WO2016115441A1 - Co-detection and association of multiple genes from the same genome in a sample - Google Patents
Co-detection and association of multiple genes from the same genome in a sample Download PDFInfo
- Publication number
- WO2016115441A1 WO2016115441A1 PCT/US2016/013562 US2016013562W WO2016115441A1 WO 2016115441 A1 WO2016115441 A1 WO 2016115441A1 US 2016013562 W US2016013562 W US 2016013562W WO 2016115441 A1 WO2016115441 A1 WO 2016115441A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- target nucleic
- pcr
- coli
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
Definitions
- the present invention relates to methods for simultaneous detection (co-detection) of multiple genes, and association of such genes as belonging to the same or multiple genomes, particularly in Gram-negative bacteria.
- Escherichia coli are a large and diverse group of Gram-negative bacteria. Although most strains of E. coli are harmless, others can lead to severe illness if accidentally ingested.
- E. coli 0157:H7 is a kind of E. coli that can cause disease by making a toxin called Shiga toxin.
- Shiga toxin-producing Escherichia coli (“STEC”) is a major foodborne pathogen that causes more than 175,000 human illnesses and 20-60 deaths in the United States each year. Most deaths and severe illnesses are caused by those that carry virulence genes eae (codes for intimin), stxl (Shiga toxin 1), and especially stx2 (Shiga toxin 2).
- STECs reside and propagate in the gastrointestinal tract of cattle and shed in the feces, which serve as a major source of food and water contamination. Monitoring and management of STEC in beef production systems has become a very important aspect to public health. USDA Food Safety and Inspection Services (FSIS) requires the industry to test non-intact beef products (mainly ground beef and materials used for ground beef production) to make sure they are free of E. coli 0157 that carries the eae gene and either one of the stx genes.
- FSIS Food Safety and Inspection Services
- target pathogens e.g., O-type E. coli
- the present invention is broadly concerned with PCR-based detection methods for the identification, differentiation and quantification of different bacterial strains, and also associate two or more PCR-positive genes to a single genome.
- methods for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram-negative bacterial strains e.g., Shiga toxin- producing E. coli
- determination of association of the target nucleic acid sequences as originating from a single genome or from two or more genomes are disclosed.
- the methods generally comprise providing at least a portion of the sample suspected of or potentially containing the target nucleic acid sequences.
- a reaction mixture is formed comprising at least a portion of the sample and PCR primers and/or probes corresponding to the two or more target nucleic acid sequences.
- the PCR primers and/or probes comprise a first PCR primer set and/or probe corresponding to a first target nucleic acid for at least one bacterial serogroup (e.g., E. coli O-type); and a second PCR primer set and/or probe corresponding to a second target nucleic acid for at least one bacterial virulence gene.
- the reaction mixture is divided into a plurality of individual reaction volumes.
- the reaction volumes are amplified (using PCR) to yield amplified reaction volumes comprising positive PCR reaction products.
- the number of the amplified reaction volumes containing positive PCR reaction products for both the first and second target nucleic acids in the same reaction volume).
- the technique might detect both positive PCR reaction products at least one E. coli O- type serogroup and positive PCR reaction products for at least one E. coli virulence gene. This information can be used to calculate the gene association rate to determine whether the sample contains toxin-producing bacteria of the concerned serotype.
- kits for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram -negative bacterial strains e.g., Shiga toxin-producing E. coli
- the kits generally comprise instructions for creation of a PCR reaction mixture with the sample, instructions for generation of PCR reaction products from the PCR reaction mixture, and instructions for calculation of a gene association rate based upon the PCR reaction products.
- kits can optionally include a variety of components for carrying out the PCR reactions, including one or more of sample collection swabs, containers, buffers, reagents, enzymes, deoxynucleoside triphosphates, primers, and/or probes.
- Figure (Fig.) 1 A shows an image from digital PCR analysis software for an E. coli strain carrying both r 3 ⁇ 4E and stx2 in a single genome mixed with an E. coli strain that does not have the two genes;
- Fig. IB shows an image from digital PCR analysis software for two E. coli stains each carrying only one of the two genes
- Fig. 2A shows an image from digital PCR analysis software cattle feces spiked with a E. coli strain carrying both r 3 ⁇ 4E and stx2 in a single genome mixed with an E. coli strain that does not have the two genes;
- Fig. 2B shows an image from digital PCR analysis software for two E. coli stains each carrying only one of the two genes;
- Fig. 3 shows an image from digital PCR analysis software for comparison of r 3 ⁇ 4E and stx2 genes carried by a single genome (upper panel), versus the same two genes carried by two separate genomes (lower panel);
- Fig. 4 shows an image from digital PCR analysis software for comparison of 045 and stxl genes carried by a single genome (upper panel), versus the same two genes carried by two separate genomes (lower panel);
- Fig. 5 shows an image from digital PCR analysis software for comparison of r 3 ⁇ 4E, stx2 and eae genes carried by a single genome (upper panel), versus the same three genes carried by two separate genomes (lower panel).
- the present invention is concerned with PCR-based detection methods and kits for the identification, differentiation, and quantification of different bacterial strains (e.g., STEC strains), and also association of two or more PCR-positive genes to a single genome.
- samples are collected from a food product, water, and/or food production system site (e.g., cattle feed yard), food processing equipment (e.g., food contacting surfaces), such as by swabbing, or other conventional techniques. Samples can also be collected from animal waste, food processing by-products, or any other potential contaminated sources in the food production chain. Regardless, the sample will be one suspected of or potentially containing nucleic acid sequences of interest (e.g., such as those associated with STEC strains).
- a reaction mixture is then created using at least a portion/aliquot of the sample.
- the sample does not have to be prepped or purified before use in the inventive methods, and preferably is not subjected to treatment, purification, nucleic acid isolation/extraction, and/or cell lysis procedures before PCR processing.
- the sample used to create the reaction mixture preferably remains undisturbed or undisrupted after sample collection, and is not pre-processed, so that potential bacterial contaminants and/or target nucleic acid sequences remain intact in the sample.
- the sample or portion can be used in the inventive methods directly from its collected state (but may also be diluted or enriched so long as such procedures do not disrupt the potential intact bacterial cells or target nucleic acid in the sample).
- PCR procedures involve initial nucleic acid extraction and/or purification of the sample, which is then used to create the reaction mixture.
- no extraction, cell lysis, purification or the like is used on the sample, to ensure adequate presence of target cells or nucleic acids in their intact collected stated.
- the reaction mixture is created by mixing the sample, for example, with appropriate buffers, reagents, enzymes (e.g., DNA polymerase), deoxynucleoside triphosphates, primers, probes, and the like for PCR.
- exemplary PCR reaction mixture components are commercially- available and include Taqman® Gene Expression Mastermix (Catalog number: 4369016) from Life Technologies/ThermoFisher (Grand Island, NY).
- the reaction mixture will comprise at least a portion of the sample and a PCR primer set and/or probe.
- the reaction mixture comprises at least a portion of the sample, a PCR primer set (e.g., a first forward primer and a first reverse primer) and a separate probe.
- the PCR primers and/or probes are designed to amplify and/or detect the target nucleic acids.
- a first PCR primer set (first forward and reverse primers) and/or first probe is included in the reaction mixture, which corresponds to a target nucleic acid (e.g., gene) for at least one E. coli O-type serogroup.
- a second PCR primer set (second forward and reverse primers) and/or second probe is further included in the reaction mixture, which corresponds to a target nucleic acid for at least one E. coli virulence gene.
- a third PCR primer set (third forward and reverse primers) and/or third probe is included in the reaction mixture, which corresponds to at least a second E. coli virulence gene.
- the virulence genes are selected from the group consisting of stxl, stx2, and eae.
- a fourth PCR primer set (fourth forward and reverse primers) and/or fourth probe is included in the reaction mixture, which corresponds to a target nucleic acid for at least a second E. coli O-type serogroup.
- a fifth PCR primer set (fifth forward and reverse primers) and/or fifth probe is included in the reaction mixture, which corresponds to a target nucleic acid for at least a third E. coli O-type serogroup.
- additional sixth, seventh, eighth, etc. primer sets and/or probes can be included in the reaction mixture, which correspond to a target nucleic acid for each of the additional E. coli O-type serogroups.
- the reaction mixture can be prepared to detect up to three E. coli O-type serotypes and at least two virulence genes (and preferably at least eae, and one of either stxl or stx2).
- primer sets or probe designs can be used, depending upon the particular PCR instrument and technique, so long as they correspond to the target nucleic acid. In the case of primers, this generally means that they are complementary to a piece (e.g., 15-25bp and/or 3' ends) of each of the sense and anti-sense strand of the target nucleic acid.
- primer and probe chemistries can be used.
- the term "correspond,” as used herein means that the primer or probe sequence is designed to be complementary to the target nucleic acid sequence, bind to the target nucleic acid for amplification (e.g., in the case of primers), and/or hybridize with the target nucleic acid (e.g., in the case of probes), but in any event associates in some way with the target nucleic acid in the reaction mixture for amplification and subsequent detection.
- primer sets and probes are listed in the working examples.
- the primers and/or probes (and preferably probes) used in the inventive methods include a detectable label, such a dye, fluorophore, or other detectable reporter molecule (and preferably optically detectable reporter molecules).
- a different reporter molecule is used for each respective target nucleic acid.
- a first reporter molecule is used for the target nucleic acid for the at least one E. coli O-type serogroup.
- a second reporter molecule is used for the target nucleic acid for the first E. coli virulence gene.
- a third reporter molecule is used for the target nucleic acid for the second E.
- the same reporter molecule is used for each of the virulence genes stxl and stxl (and a different reporter molecule is used for virulence gene eae). It will be appreciated that additional (fourth, fifth, sixth, seventh, eighth, etc.) reporter molecules can be used for each of the E. coli O-type serogroups. Specific techniques will depend upon the PCR equipment utilized, including the number of optical channels available in the case of dPCR equipment.
- Exemplary reporter molecules include FAM (excitation wavelength [EX] 495 nm, emission wavelength [EM] 520 nm), VIC or MAX (EX 538 nm, EM 554 nm), TexasRed (EX 590 nm, EM 610 nm), Cy5 (EX 647 nm, EM 667 nm), and Cy5.5 (EX 690 nm, EM 705 nm).
- FAM excitation wavelength [EX] 495 nm, emission wavelength [EM] 520 nm
- VIC or MAX EX 538 nm, EM 554 nm
- TexasRed EX 590 nm, EM 610 nm
- Cy5 EX 647 nm, EM 667 nm
- Cy5.5 EX 690 nm, EM 705 nm
- the reaction mixture is then divided into a plurality of individual reaction volumes for performing PCR reactions.
- the reaction volume is small enough that it can hold only approximately a single nucleic acid molecule (e.g., of a target nucleic acid) or none of the target nucleic acid (if the target nucleic acid is absent from the sample).
- the reaction volume comprises a single nucleic acid molecule, preferably substantially intact, and even more preferably, the volume comprises a single intact bacterial cell containing the target nucleic acid sequence preferably as a substantially intact genome. It will be appreciated that the reaction volume may also comprise none of the nucleic acids or cells in the case of PCR negative reaction volumes.
- the reaction volume would be less than about 1 nl, and preferably from about 0.5 nl to about 0.9 nl.
- the individual reaction volumes are subsequently thermally cycled in a PCR protocol or procedure, the samples containing the target nucleic acid are amplified and produce a positive detection signal, while the samples containing no target nucleic acid are not amplified and produce no detection signal, as applicable.
- each positive detection signal is attributable to a single nucleic acid molecule (which may contain one or more of the target nucleic acid sequences).
- the reaction mixture is distributed/sub -divided into a plurality of individual reaction wells or chambers (e.g., on a multi-well plate).
- the reaction mixture instead of being distributed into wells, can be subdivided into individual droplets. The overall approach is same to carrying out the reactions in wells.
- PCR is performed to endpoint within each droplet using primers and probes, and a suitable dPCR instrument interrogates each droplet for probe signal, identifying whether the target nucleic acids are present.
- each reaction volume will theoretically contain zero or one molecule (cell), corresponding to a negative or positive PCR reaction result once PCR end- products are generated via amplification.
- the number of PCR amplification cycles is proportional to the starting copy number. dPCR, however, is not dependent on the number of amplification cycles to determine the initial sample amount, eliminating the reliance on uncertain exponential data to quantify target nucleic acids and therefore can provide accurate quantification.
- the target nucleic acids in the reaction volumes are amplified according to the selected PCR protocol, followed by detection of the presence of absence of the target nucleic acid in each reaction volume (e.g., well or droplet).
- amplification involves an initial denaturation at about 95°C for about 10 minutes followed by about 40 cycles at about 95°C for about 15 seconds, and about 60°C for about 60 seconds.
- the sample in the reaction mixture preferably comprises intact bacteria cells (when present), which in turn contain intact nucleic acids (genomes). The initial denaturation at about 95°C for about 10 minutes will lyse the cells (if present) and release the target nucleic acids (DNA) for PCR.
- signal detection is carried out optically. In one or more embodiments, signal detection is carried out by capturing the signal emitted by each reporter molecule in each cycle of amplification, for example, with a digital camera embedded in the digital PCR system.
- the gene association rate is then calculated.
- the "gene association rate” is calculated by first counting the number of individual reaction volumes that are each positive for at least two of the target nucleic acids, and more preferably are positive for at least one O-serotype and at least one virulence gene. For example, in the case of a two-gene test, one would first count the number of reaction volumes with positive PCR reaction products for both target nucleic acid sequences. Likewise, in the case of a three-gene test, one would first count the number of reaction volumes with positive PCR reaction products for all three target nucleic acid sequences.
- a reaction volume would be counted if primer and/or probe signals (as applicable) for at least one O-type serotype nucleic acid sequence is detected in the reaction volume, along with a primer and/or probe signals (as applicable) for a virulence gene nucleic acid sequence for eae, and preferably at least one virulence gene nucleic acid sequence for either of stxl or stx2.
- the presence of two or three signals in the same reaction volume indicates a high likelihood that the target nucleic acid sequences of interest originate from the same genome.
- the number of reaction volumes that are positive for both: 1) at least one O-serotype nucleic acid sequence, and 2) at least one virulence gene nucleic acid sequence is divided by the total number of reaction volumes that generate any signal at all (e.g., reaction volumes that have one and two signals for two-gene, and one, two and three signals for three-gene associations). In other words, only reaction volumes with positive PCR end products are counted. Reaction volumes negative for PCR reaction products (i.e., reaction volumes containing no detectable signal) are not counted.
- the foregoing calculation yields the gene association rate.
- the calculated gene association rate is greater than 50, this indicates that the target nucleic acid sequences originate from the same (a single) genome.
- the resulting data indicate that the sample contains O-serotype E. coli carrying one or more virulence genes.
- the calculated gene association rate is less than 40, this indicates that the target nucleic acid sequences are carried by different genomes.
- the resulting data may indicate that the sample: 1) does not contain O- serotype E. coli 2) contains O-serotype E. coli that does not carry virulence genes; and/or 3) contains non-0 serotype E. coli that carries virulence genes.
- the current USDA regulation is to test for E. coli strains that carry one of the two stx genes and the eae gene. Regulation of testing for the other six O-groups (026, 045, O103, Ol l l, 0121 and 0145) that carry the stx and eae genes will be in place soon.
- the current USDA protocol takes at least a week.
- the foregoing method, implemented using dPCR yields results in 2 days. Many dPCR machines only have two optical detection channels and a reference channel. In this work, we have been able to adapt the machine to use the reference channel for detection, so that three optical detection channels can be used. USDA guidelines do not dictate which stx gene is present.
- each O-type is tested individually with the virulence genes as a PCR reaction. Accordingly, in some embodiments, seven PCR reactions will be carried out for the seven O-types for each sample. In a given O-type-stx-eae combination, they are labeled with different reporter molecules, but multiple O-types are labeled with the same reporter molecule, and run in different reactions.
- Major advantages of using digital PCR to detect and to associate STEC O-type with the major virulence genes are to: 1) speed up the entire process from the current one week+ to two days using the inventive approach; and 2) streamline the sample preparation and digital PCR detection processes into a high throughput setting.
- Co-detection of two or three genes from the same genome out of a diagnostic sample as described here may have broader reaching impact in the field of molecular detection.
- the inventive co-detection method could be used as a pre-screening method for the existing USDA-FSIS method of Shiga-toxigenic 0157 identification. More importantly, it can potentially replace the existing method as well if the method is approved by USDA-FSIS.
- Kits for carrying out the various embodiments of the invention are also described herein.
- Such kits comprise one or more of the following: sample collection swabs, containers (e.g., tubes, vials, flasks), buffers, reagents, enzymes (e.g., DNA polymerase), deoxynucleoside triphosphates, primers, probes, instructions for creation of the PCR reaction mixture, along with instructions for generation of PCR reaction products, and calculation of the gene association rate from the resulting data.
- the components of the kits will typically be packaged in suitable, respective containers, individually or in pre-mixed forms, and can be provided in aqueous media, in anhydrous buffer, or in lyophilized form.
- the phrase "and/or," when used in a list of two or more items, means that any one of the listed items can be employed by itself or any combination of two or more of the listed items can be employed.
- the composition can contain or exclude A alone; B alone; C alone; A and B in combination; A and C in combination; B and C in combination; or A, B, and C in combination.
- the present description also uses numerical ranges to quantify certain parameters relating to various embodiments of the invention. It should be understood that when numerical ranges are provided, such ranges are to be construed as providing literal support for claim limitations that only recite the lower value of the range as well as claim limitations that only recite the upper value of the range. For example, a disclosed numerical range of about 10 to about 100 provides literal support for a claim reciting "greater than about 10" (with no upper bounds) and a claim reciting "less than about 100" (with no lower bounds).
- Some digital PCR systems distribute a PCR reaction into many tiny reactions to allow absolute quantification of target genes.
- the Life Technologies/Thermo Fisher QuantStudio 3D system (US 2015/0278437, incorporated by reference herein) to perform a pilot study to see if we can co-detect two genes as a proof of concept study.
- the system is a two-channel (can detect two genes) digital PCR system that aliquots a regular real-time PCR reaction into -20,000 individual reactions.
- the system has the largest number of individual reactions for each sample on the market, and thus was selected for initial testing.
- the size of the reaction well only allows one or a few DNA template molecules to enter, providing the opportunity to associate two genes in a single bacterial cell.
- E. coli strains were used to generate the preliminary data on the QuantStudio 3D system.
- Strain 1 an 0157 (r 3 ⁇ 4E) strain that carries stx2 (rfl>E+/stx2+) strain 2: a non-0157 strain that does not carry stx2 (rfl>E-/stx2-) strain 3 : an 0157 strain that does not carry stx2 (rfl)E+/stx2-); and strain 4: a non-0157 strain that carries stx2 (rfbE-/stx2+).
- strain 1 an 0157 (r 3 ⁇ 4E) strain that carries stx2 (rfl>E+/stx2+) strain 2: a non-0157 strain that does not carry stx2 (rfl>E-/stx2-) strain 3 : an 0157 strain that does not carry stx2 (rfl)E+/stx2-); and strain
- coli strains stored in -80°C freezer was streaked on Luria-Bertani (LB) agar plates, and incubated at 37°C for 16 h to obtain single colonies.
- a single colony from each strain was inoculated separately into 5 ml LB broth and incubated at 37°C with shaking for 16 h. The resulting fresh culture is used in the following experiments.
- Inoculated feces was added into a 5 ml of EC broth tube, and mixed by low speed vortexing. Five hundred microliter (0.5 ml) of such mixture was inoculated into 4.5 ml EC broth, and incubated at 37°C for 16 h with shaking. The resulting feces-inoculated culture was diluted to 50 times with sterile distilled water, and used as template for digital PCR.
- the number of the green dots in Fig. 1A is greater than that from Fig. IB indicating that the presence of the two-target genes on a single genome can be differentiated from two genes carried by two different genomes.
- Figs. 2A and 2B show digital PCR images for the cattle feces spiked with pure E. coli culture. The results of the feces spiked with the mixture of strain 1 and strain 2 are shown in Fig.
- Example 1 High throughput dPCR detection and association of multiple genes
- the protocol used in Example 1 was tested using a high throughput dPCR machine, the Fluidigm Biomark digital PCR platform that can do similar testing but with higher throughput capabilities.
- the Biomark 48.770 chip is capable of handling 48 samples, each has 770 cells (reactions). Fluidigm kindly provided a demo Biomark machine for this particular study.
- strain 1 an 0157 strain that carries stx2 (rfl>E+/stxl+)
- strain 2 a non-0157 strain that does not carry stx2 (rfbE-/stxl-);
- strain 3 an 0157 strain that does not carry stx2 (rfbE+/stxl-);
- strain 4 a non-0157 strain that carries stx2 (rfbE-/stxl+).
- Fig. 3 shows that the comparison of above-mentioned culture mixtures inoculated into a negative fecal sample.
- Upper panel is with mixture of strains 1 & 2 (r 3 ⁇ 4E and stx2 genes carried by a single genome); lower panel is mixture of strains 3 & 4 (r 3 ⁇ 4E and stx2 genes carried by separate genomes). Number of grids that have two-gene signals (grids have two vertical bars) is significantly higher than those in the lower panel.
- the top row in Table 1 shows the pure culture and culture-inoculated 0157 data involving r 3 ⁇ 4E and stxl genes.
- the gene association rate is calculated by number of grids that have two signals, divided by the total number of grids that have one or two signals (percentage of dual positives). The validity of this approach is confirmed by the data.
- the two genes carried by the same genome had the rate of 77.6 and 78.6 for culture and fecal samples, respectively. Whereas the rate for the two genes carried by separate genomes were 28.7 and 34.5 for culture and fecal samples. These are statistically distinct from the associated rates.
- This association ratio is significantly higher in mixture of strains 1 & 2, than mixture of strains 3 & 4 for both pure culture and feces inoculated with culture.
- Serogroups 026, 045 and 0103 were tested with both pure culture and culture- inoculated feces.
- Serogroups 0111, 0121 and 0145 were tested with culture-inoculated feces.
- the gene association rates for each serogroup are shown in Table 1.
- the rates for associated genes in non-0157 strains are between 56.1 and 93.3 with average of 77.8; the rates for unassociated genes are between 9.6 and 38.8 averaged at 21.4.
- the gene association rates were distinctly different, and easy to differentiate, indicating using this rate we can easily identify those serogroups that carries the virulence genes.
- Figure 4 shows 045 antigen and six 1 carried by the same genome (upper panel) and these same genes on two separate genomes (lower panel) using culture-inoculated cattle feces. Similar to the 0157 data, the number of cells that have two vertical bars in upper panel is obviously larger than the number in the lower panel.
- E. coli 0157 strain (rZ&E-positive) that carries both stx2 and eae genes (rft>E+leae+lstx2+) was mixed with a strain negative to all three genes (rft>E-leae-lstx2-). This was compared with a mixture of two strains: a) an 0157 strain carrying the eae gene (rfbE+/eae+/stx2-); and b) a non-0157 strain carrying only the stx2 gene (rft>E-leae-lstx2+).
- Upper panel in Fig. 5 is the strain that carries all three genes; the lower panel is the three genes carried by two separate strains.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention is concerned with PCR-based detection methods and kits for the identification, differentiation, and quantification of different bacterial strains (e.g., Gram-negative bacterial strains), and also association of two or more PCR-positive genes to a single genome. The methods generally comprise carrying out PCR reactions using at least a first PCR primer set and/or probe for at least one target nucleic acid; and a second PCR primer set and/or probe for at least a second target nucleic acid. Positive PCR reaction products are then detected to determine test samples containing positive PCR reaction products for both the first and second target nucleic acids. This information can be used to calculate the gene association rate to determine whether the sample contains, for example, Shiga toxin-producing E. coli of the O-type serogroup.
Description
CO-DETECTION AND ASSOCIATION OF MULTIPLE GENES FROM THE SAME
GENOME IN A SAMPLE
CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims the priority benefit of U.S. Provisional Patent Application
Serial No. 62/104,346, filed January 16, 2015, entitled Co-detection and association of multiple genes from the same Escherichia coli genome using digital PCR technology, incorporated by reference in its entirety herein. SEQUENCE LISTING
The following application contains a sequence listing in computer readable format (CRF), submitted as a text file in ASCII format entitled "47068-PCTSequenceListing," created on January 14, 2016, as 5 KB. The content of the CRF is hereby incorporated by reference. BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to methods for simultaneous detection (co-detection) of multiple genes, and association of such genes as belonging to the same or multiple genomes, particularly in Gram-negative bacteria.
Description of Related Art
Escherichia coli (E. coli) are a large and diverse group of Gram-negative bacteria. Although most strains of E. coli are harmless, others can lead to severe illness if accidentally ingested. E. coli 0157:H7 is a kind of E. coli that can cause disease by making a toxin called Shiga toxin. Shiga toxin-producing Escherichia coli ("STEC") is a major foodborne pathogen that causes more than 175,000 human illnesses and 20-60 deaths in the United States each year. Most deaths and severe illnesses are caused by those that carry virulence genes eae (codes for intimin), stxl (Shiga toxin 1), and especially stx2 (Shiga toxin 2). Only certain serogroups of STEC, such as 0157 and non-0157 serogroups: 026, 045, O103, Ol l l, 0121, 0145, are of concern for public health. O-groups that carry one or more virulence genes are of particular concern. STECs reside and propagate in the gastrointestinal tract of cattle and shed in the feces,
which serve as a major source of food and water contamination. Monitoring and management of STEC in beef production systems has become a very important aspect to public health. USDA Food Safety and Inspection Services (FSIS) requires the industry to test non-intact beef products (mainly ground beef and materials used for ground beef production) to make sure they are free of E. coli 0157 that carries the eae gene and either one of the stx genes. Regulations for testing six other serogroups (non-0157 STEC) will be in place soon. The current FSIS testing protocols involve a conformational culture isolation procedure that normally takes a week to get a result. The main reason that culture-isolation is required and primarily used is because PCR-based detection methods are not able to associate the virulence genes with the STEC O-groups. Virulence genes can be carried by different bacterial strains in the sample, and normally only E. coli O-groups mentioned above that also carry certain virulence genes are considered of concern for public health.
Thus, there remains a significant need in the art to screen food products, and particularly beef and associated processing equipment for target pathogens (e.g., O-type E. coli), and likewise determine if the target pathogen carries a virulence gene of concern for public health.
SUMMARY OF THE INVENTION
The present invention is broadly concerned with PCR-based detection methods for the identification, differentiation and quantification of different bacterial strains, and also associate two or more PCR-positive genes to a single genome.
In one aspect, methods for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram-negative bacterial strains (e.g., Shiga toxin- producing E. coli), and determination of association of the target nucleic acid sequences as originating from a single genome or from two or more genomes are disclosed. The methods generally comprise providing at least a portion of the sample suspected of or potentially containing the target nucleic acid sequences. A reaction mixture is formed comprising at least a portion of the sample and PCR primers and/or probes corresponding to the two or more target nucleic acid sequences. In one or more embodiments, the PCR primers and/or probes comprise a first PCR primer set and/or probe corresponding to a first target nucleic acid for at least one bacterial serogroup (e.g., E. coli O-type); and a second PCR primer set and/or probe corresponding to a second target nucleic acid for at least one bacterial virulence gene. The
reaction mixture is divided into a plurality of individual reaction volumes. The reaction volumes are amplified (using PCR) to yield amplified reaction volumes comprising positive PCR reaction products. The number of the amplified reaction volumes containing positive PCR reaction products for both the first and second target nucleic acids (in the same reaction volume). For example, the technique might detect both positive PCR reaction products at least one E. coli O- type serogroup and positive PCR reaction products for at least one E. coli virulence gene. This information can be used to calculate the gene association rate to determine whether the sample contains toxin-producing bacteria of the concerned serotype.
Also described herein, are kits for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram -negative bacterial strains (e.g., Shiga toxin-producing E. coli), and determination of association of the target nucleic acid sequences as originating from a single genome or from two or more genomes. The kits generally comprise instructions for creation of a PCR reaction mixture with the sample, instructions for generation of PCR reaction products from the PCR reaction mixture, and instructions for calculation of a gene association rate based upon the PCR reaction products. The kits can optionally include a variety of components for carrying out the PCR reactions, including one or more of sample collection swabs, containers, buffers, reagents, enzymes, deoxynucleoside triphosphates, primers, and/or probes. BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Figure (Fig.) 1 A shows an image from digital PCR analysis software for an E. coli strain carrying both r ¾E and stx2 in a single genome mixed with an E. coli strain that does not have the two genes;
Fig. IB shows an image from digital PCR analysis software for two E. coli stains each carrying only one of the two genes;
Fig. 2A shows an image from digital PCR analysis software cattle feces spiked with a E. coli strain carrying both r ¾E and stx2 in a single genome mixed with an E. coli strain that does not have the two genes;
Fig. 2B shows an image from digital PCR analysis software for two E. coli stains each carrying only one of the two genes;
Fig. 3 shows an image from digital PCR analysis software for comparison of r ¾E and stx2 genes carried by a single genome (upper panel), versus the same two genes carried by two separate genomes (lower panel);
Fig. 4 shows an image from digital PCR analysis software for comparison of 045 and stxl genes carried by a single genome (upper panel), versus the same two genes carried by two separate genomes (lower panel); and
Fig. 5 shows an image from digital PCR analysis software for comparison of r ¾E, stx2 and eae genes carried by a single genome (upper panel), versus the same three genes carried by two separate genomes (lower panel).
DETAILED DESCRIPTION
The present invention is concerned with PCR-based detection methods and kits for the identification, differentiation, and quantification of different bacterial strains (e.g., STEC strains), and also association of two or more PCR-positive genes to a single genome. In the methods, samples are collected from a food product, water, and/or food production system site (e.g., cattle feed yard), food processing equipment (e.g., food contacting surfaces), such as by swabbing, or other conventional techniques. Samples can also be collected from animal waste, food processing by-products, or any other potential contaminated sources in the food production chain. Regardless, the sample will be one suspected of or potentially containing nucleic acid sequences of interest (e.g., such as those associated with STEC strains).
A reaction mixture is then created using at least a portion/aliquot of the sample. Advantageously, the sample does not have to be prepped or purified before use in the inventive methods, and preferably is not subjected to treatment, purification, nucleic acid isolation/extraction, and/or cell lysis procedures before PCR processing. In other words, the sample used to create the reaction mixture preferably remains undisturbed or undisrupted after sample collection, and is not pre-processed, so that potential bacterial contaminants and/or target nucleic acid sequences remain intact in the sample. Accordingly, the sample or portion can be used in the inventive methods directly from its collected state (but may also be diluted or enriched so long as such procedures do not disrupt the potential intact bacterial cells or target
nucleic acid in the sample). That is, it will be appreciated most PCR procedures involve initial nucleic acid extraction and/or purification of the sample, which is then used to create the reaction mixture. In this application, no extraction, cell lysis, purification or the like is used on the sample, to ensure adequate presence of target cells or nucleic acids in their intact collected stated.
The reaction mixture is created by mixing the sample, for example, with appropriate buffers, reagents, enzymes (e.g., DNA polymerase), deoxynucleoside triphosphates, primers, probes, and the like for PCR. Exemplary PCR reaction mixture components are commercially- available and include Taqman® Gene Expression Mastermix (Catalog number: 4369016) from Life Technologies/ThermoFisher (Grand Island, NY). In one or more embodiments, the reaction mixture will comprise at least a portion of the sample and a PCR primer set and/or probe. Preferably, the reaction mixture comprises at least a portion of the sample, a PCR primer set (e.g., a first forward primer and a first reverse primer) and a separate probe. The PCR primers and/or probes are designed to amplify and/or detect the target nucleic acids. In one or more embodiments, a first PCR primer set (first forward and reverse primers) and/or first probe is included in the reaction mixture, which corresponds to a target nucleic acid (e.g., gene) for at least one E. coli O-type serogroup. In one or more embodiments, a second PCR primer set (second forward and reverse primers) and/or second probe is further included in the reaction mixture, which corresponds to a target nucleic acid for at least one E. coli virulence gene. In one or more embodiments, a third PCR primer set (third forward and reverse primers) and/or third probe is included in the reaction mixture, which corresponds to at least a second E. coli virulence gene. In one or more embodiments, the virulence genes are selected from the group consisting of stxl, stx2, and eae. In one or more embodiments, a fourth PCR primer set (fourth forward and reverse primers) and/or fourth probe is included in the reaction mixture, which corresponds to a target nucleic acid for at least a second E. coli O-type serogroup. In one or more embodiments, a fifth PCR primer set (fifth forward and reverse primers) and/or fifth probe is included in the reaction mixture, which corresponds to a target nucleic acid for at least a third E. coli O-type serogroup. Depending upon the multiplexing abilities of the particular PCR instrument, it will be appreciated that additional sixth, seventh, eighth, etc. primer sets and/or probes can be included in the reaction mixture, which correspond to a target nucleic acid for each of the additional E. coli O-type serogroups. In one or more embodiments, the reaction mixture can be prepared to
detect up to three E. coli O-type serotypes and at least two virulence genes (and preferably at least eae, and one of either stxl or stx2).
Various primer sets or probe designs can be used, depending upon the particular PCR instrument and technique, so long as they correspond to the target nucleic acid. In the case of primers, this generally means that they are complementary to a piece (e.g., 15-25bp and/or 3' ends) of each of the sense and anti-sense strand of the target nucleic acid. Various primer and probe chemistries can be used. Accordingly, the term "correspond," as used herein means that the primer or probe sequence is designed to be complementary to the target nucleic acid sequence, bind to the target nucleic acid for amplification (e.g., in the case of primers), and/or hybridize with the target nucleic acid (e.g., in the case of probes), but in any event associates in some way with the target nucleic acid in the reaction mixture for amplification and subsequent detection. Exemplary primer sets and probes are listed in the working examples.
In one or more embodiments, the primers and/or probes (and preferably probes) used in the inventive methods include a detectable label, such a dye, fluorophore, or other detectable reporter molecule (and preferably optically detectable reporter molecules). In one or more embodiments, a different reporter molecule is used for each respective target nucleic acid. In one or more embodiments, a first reporter molecule is used for the target nucleic acid for the at least one E. coli O-type serogroup. In one or more embodiments, a second reporter molecule is used for the target nucleic acid for the first E. coli virulence gene. In one or more embodiments, a third reporter molecule is used for the target nucleic acid for the second E. coli virulence gene. In one or more embodiments, the same reporter molecule is used for each of the virulence genes stxl and stxl (and a different reporter molecule is used for virulence gene eae). It will be appreciated that additional (fourth, fifth, sixth, seventh, eighth, etc.) reporter molecules can be used for each of the E. coli O-type serogroups. Specific techniques will depend upon the PCR equipment utilized, including the number of optical channels available in the case of dPCR equipment. Exemplary reporter molecules include FAM (excitation wavelength [EX] 495 nm, emission wavelength [EM] 520 nm), VIC or MAX (EX 538 nm, EM 554 nm), TexasRed (EX 590 nm, EM 610 nm), Cy5 (EX 647 nm, EM 667 nm), and Cy5.5 (EX 690 nm, EM 705 nm).
The reaction mixture is then divided into a plurality of individual reaction volumes for performing PCR reactions. Preferably, the reaction volume is small enough that it can hold only approximately a single nucleic acid molecule (e.g., of a target nucleic acid) or none of the target
nucleic acid (if the target nucleic acid is absent from the sample). More particularly, the reaction volume comprises a single nucleic acid molecule, preferably substantially intact, and even more preferably, the volume comprises a single intact bacterial cell containing the target nucleic acid sequence preferably as a substantially intact genome. It will be appreciated that the reaction volume may also comprise none of the nucleic acids or cells in the case of PCR negative reaction volumes. In general, the reaction volume would be less than about 1 nl, and preferably from about 0.5 nl to about 0.9 nl. When the individual reaction volumes are subsequently thermally cycled in a PCR protocol or procedure, the samples containing the target nucleic acid are amplified and produce a positive detection signal, while the samples containing no target nucleic acid are not amplified and produce no detection signal, as applicable. Thus, each positive detection signal is attributable to a single nucleic acid molecule (which may contain one or more of the target nucleic acid sequences).
In one or more embodiments, the reaction mixture is distributed/sub -divided into a plurality of individual reaction wells or chambers (e.g., on a multi-well plate). In one or more embodiments, instead of being distributed into wells, the reaction mixture can be subdivided into individual droplets. The overall approach is same to carrying out the reactions in wells. Thus, PCR is performed to endpoint within each droplet using primers and probes, and a suitable dPCR instrument interrogates each droplet for probe signal, identifying whether the target nucleic acids are present.
Distributing the sample into a plurality of subdivided reaction volumes allows one to estimate the number of different molecules by assuming that the molecule population follows the Poisson distribution. As a result, each reaction volume will theoretically contain zero or one molecule (cell), corresponding to a negative or positive PCR reaction result once PCR end- products are generated via amplification. In conventional PCR, the number of PCR amplification cycles is proportional to the starting copy number. dPCR, however, is not dependent on the number of amplification cycles to determine the initial sample amount, eliminating the reliance on uncertain exponential data to quantify target nucleic acids and therefore can provide accurate quantification.
Regardless, the target nucleic acids in the reaction volumes are amplified according to the selected PCR protocol, followed by detection of the presence of absence of the target nucleic acid in each reaction volume (e.g., well or droplet). In one or more embodiments, amplification
involves an initial denaturation at about 95°C for about 10 minutes followed by about 40 cycles at about 95°C for about 15 seconds, and about 60°C for about 60 seconds. As mentioned, the sample in the reaction mixture preferably comprises intact bacteria cells (when present), which in turn contain intact nucleic acids (genomes). The initial denaturation at about 95°C for about 10 minutes will lyse the cells (if present) and release the target nucleic acids (DNA) for PCR. It will be appreciated that this novel approach not only facilitates determination of whether target nucleic acids originate/reside from the same genome, but also saves time in the overall method, as the samples do not need to be subjected to various pre-processing (e.g., extraction) procedures used in conventional PCR approaches.
In one or more embodiments, signal detection is carried out optically. In one or more embodiments, signal detection is carried out by capturing the signal emitted by each reporter molecule in each cycle of amplification, for example, with a digital camera embedded in the digital PCR system.
The gene association rate is then calculated. The "gene association rate" is calculated by first counting the number of individual reaction volumes that are each positive for at least two of the target nucleic acids, and more preferably are positive for at least one O-serotype and at least one virulence gene. For example, in the case of a two-gene test, one would first count the number of reaction volumes with positive PCR reaction products for both target nucleic acid sequences. Likewise, in the case of a three-gene test, one would first count the number of reaction volumes with positive PCR reaction products for all three target nucleic acid sequences. More particularly, one would count the number of reaction volumes with positive PCR reaction products for at least one O-type serotype nucleic acid sequence and at least one virulence gene nucleic acid sequence (and preferably at least two virulence genes/nucleic acid sequences). In one or more embodiments, a reaction volume would be counted if primer and/or probe signals (as applicable) for at least one O-type serotype nucleic acid sequence is detected in the reaction volume, along with a primer and/or probe signals (as applicable) for a virulence gene nucleic acid sequence for eae, and preferably at least one virulence gene nucleic acid sequence for either of stxl or stx2. Advantageously, due to the restricted reaction volumes, the presence of two or three signals in the same reaction volume indicates a high likelihood that the target nucleic acid sequences of interest originate from the same genome. Next, the number of reaction volumes that are positive for both: 1) at least one O-serotype nucleic acid sequence, and 2) at least one
virulence gene nucleic acid sequence, is divided by the total number of reaction volumes that generate any signal at all (e.g., reaction volumes that have one and two signals for two-gene, and one, two and three signals for three-gene associations). In other words, only reaction volumes with positive PCR end products are counted. Reaction volumes negative for PCR reaction products (i.e., reaction volumes containing no detectable signal) are not counted.
The foregoing calculation yields the gene association rate. When the calculated gene association rate is greater than 50, this indicates that the target nucleic acid sequences originate from the same (a single) genome. As such, the resulting data indicate that the sample contains O-serotype E. coli carrying one or more virulence genes. When the calculated gene association rate is less than 40, this indicates that the target nucleic acid sequences are carried by different genomes. As such, the resulting data may indicate that the sample: 1) does not contain O- serotype E. coli 2) contains O-serotype E. coli that does not carry virulence genes; and/or 3) contains non-0 serotype E. coli that carries virulence genes. In any event, such a result indicates that the sample is free of E. coli O-serotypes that carry the eae gene and either one of the stx genes, and as such generally confirms the safety of the sample insofar as STEC contamination is concerned. A gene association rate of between 40 and 50 is considered inconclusive and requires further testing and analysis of the sample, including for example, culture isolation of the bacteria.
The current USDA regulation is to test for E. coli strains that carry one of the two stx genes and the eae gene. Regulation of testing for the other six O-groups (026, 045, O103, Ol l l, 0121 and 0145) that carry the stx and eae genes will be in place soon. The current USDA protocol takes at least a week. The foregoing method, implemented using dPCR yields results in 2 days. Many dPCR machines only have two optical detection channels and a reference channel. In this work, we have been able to adapt the machine to use the reference channel for detection, so that three optical detection channels can be used. USDA guidelines do not dictate which stx gene is present. In certain practically applied embodiments, one could put both stxl and stx2 in one channel, O-group in a channel, then eae in the 3rd channel. Next generation dPCR machines are advancing towards five channels for detection, which will further expand the possibilities for gene association. Regardless, the present methods permit the association of one of the O-group of E. coli carrying stxllstxl and eae as being present or absent in the sample. In one or more embodiments, each O-type is tested individually with the virulence genes as a PCR reaction. Accordingly, in some embodiments, seven PCR reactions
will be carried out for the seven O-types for each sample. In a given O-type-stx-eae combination, they are labeled with different reporter molecules, but multiple O-types are labeled with the same reporter molecule, and run in different reactions.
This novel method of detection and association of STEC O-type with major virulence genes has broad applications for the beef industry, particularly in regard to meeting current and future USDA food safety regulations. When USDA FSIS requires testing for non-0157 STEC in beef production systems in the near future, this method should have a significant impact and an even larger application for cattle producers, regulatory agencies and consumers.
Major advantages of using digital PCR to detect and to associate STEC O-type with the major virulence genes are to: 1) speed up the entire process from the current one week+ to two days using the inventive approach; and 2) streamline the sample preparation and digital PCR detection processes into a high throughput setting. Co-detection of two or three genes from the same genome out of a diagnostic sample as described here may have broader reaching impact in the field of molecular detection. At a minimum, the inventive co-detection method could be used as a pre-screening method for the existing USDA-FSIS method of Shiga-toxigenic 0157 identification. More importantly, it can potentially replace the existing method as well if the method is approved by USDA-FSIS.
Kits for carrying out the various embodiments of the invention are also described herein. Such kits comprise one or more of the following: sample collection swabs, containers (e.g., tubes, vials, flasks), buffers, reagents, enzymes (e.g., DNA polymerase), deoxynucleoside triphosphates, primers, probes, instructions for creation of the PCR reaction mixture, along with instructions for generation of PCR reaction products, and calculation of the gene association rate from the resulting data. The components of the kits will typically be packaged in suitable, respective containers, individually or in pre-mixed forms, and can be provided in aqueous media, in anhydrous buffer, or in lyophilized form.
Additional advantages of the various embodiments of the invention will be apparent to those skilled in the art upon review of the disclosure herein and the working examples below. It will be appreciated that the various embodiments described herein are not necessarily mutually exclusive unless otherwise indicated herein. For example, a feature described or depicted in one embodiment may also be included in other embodiments, but is not necessarily included. Thus, the present invention encompasses a variety of combinations and/or integrations of the specific
embodiments described herein.
As used herein, the phrase "and/or," when used in a list of two or more items, means that any one of the listed items can be employed by itself or any combination of two or more of the listed items can be employed. For example, if a composition is described as containing or excluding components A, B, and/or C, the composition can contain or exclude A alone; B alone; C alone; A and B in combination; A and C in combination; B and C in combination; or A, B, and C in combination.
The present description also uses numerical ranges to quantify certain parameters relating to various embodiments of the invention. It should be understood that when numerical ranges are provided, such ranges are to be construed as providing literal support for claim limitations that only recite the lower value of the range as well as claim limitations that only recite the upper value of the range. For example, a disclosed numerical range of about 10 to about 100 provides literal support for a claim reciting "greater than about 10" (with no upper bounds) and a claim reciting "less than about 100" (with no lower bounds).
EXAMPLES
The following examples set forth methods in accordance with the invention. It is to be understood, however, that these examples are provided by way of illustration and nothing therein should be taken as a limitation upon the overall scope of the invention.
EXAMPLE 1
Pilot study for dPCR detection and association of multiple genes We have developed various PCR-based detection methods for the identification, differentiation and quantification of different STEC strains. A major limitation of these PCR assays is that they are not able to associate two PCR-positive genes to a single genome. For example, a sample testing positive to both rfbE (coding for 0157 antigen) and stx2 genes does not necessarily confirm whether the stx2 gene is actually carried by the E. coli 0157 strain, as other strains in the sample can also carry the stx2 gene. An E. coli 0157 strain that does not carry stx2 may not be as problematic. The current USDA protocol for identification of STEC 0157 stains involves an E. coli 0157 isolation process through traditional culture method that is tedious, low throughput, and may take up to a week to get the results. We have been
investigating the possibility of using digital PCR to associate two or three genes to a single bacterial genome.
Some digital PCR systems distribute a PCR reaction into many tiny reactions to allow absolute quantification of target genes. In this Example, we used the Life Technologies/Thermo Fisher QuantStudio 3D system (US 2015/0278437, incorporated by reference herein) to perform a pilot study to see if we can co-detect two genes as a proof of concept study. The system is a two-channel (can detect two genes) digital PCR system that aliquots a regular real-time PCR reaction into -20,000 individual reactions. The system has the largest number of individual reactions for each sample on the market, and thus was selected for initial testing. The size of the reaction well only allows one or a few DNA template molecules to enter, providing the opportunity to associate two genes in a single bacterial cell.
Four E. coli strains were used to generate the preliminary data on the QuantStudio 3D system. Strain 1 : an 0157 (r ¾E) strain that carries stx2 (rfl>E+/stx2+) strain 2: a non-0157 strain that does not carry stx2 (rfl>E-/stx2-) strain 3 : an 0157 strain that does not carry stx2 (rfl)E+/stx2-); and strain 4: a non-0157 strain that carries stx2 (rfbE-/stx2+). Each of the four E. coli strains stored in -80°C freezer was streaked on Luria-Bertani (LB) agar plates, and incubated at 37°C for 16 h to obtain single colonies. A single colony from each strain was inoculated separately into 5 ml LB broth and incubated at 37°C with shaking for 16 h. The resulting fresh culture is used in the following experiments.
For pure culture testing, 50 μΐ of overnight culture was inoculated into 5 ml LB broth, and cultured at 37°C with shaking for 3.5-4 h, until the optical density at 600 nm measured by a spectrophotometer reaches 0.4-0.5 (-108 CFU/ml). The resulting cultures of strain 1 and strain 2 were mixed in equal volume, and strain 3 and stain 4 were mixed in equal volume. Thus, testing was carried out on an E. coli strain that carries both r ¾E and stx2 in a single genome mixed with an E. coli strain that does not have the two genes (mixture of strain 1 and 2), and a mixture of two stains each carry one of the two genes. Each mixture was diluted 150 times with sterile distilled water and used directly as template for digital PCR amplifications.
For cattle fecal spike-in experiment, multiple fecal samples were collected from a cattle feedyard. One gram of each sample was added into 9 ml Escherichia coli (EC) broth, and cultured overnight at 37°C with shaking, and screened for r ¾E and stx2 genes by real-time PCR. A fecal sample that is negative to both r ¾E and stx2 was used for culture-inoculation
experiment. Fresh cultures (-10 CFU/ml) of strain 1 and strain 2 were mixed with equal volume; and fresh cultures of strain 3 and strain 4 were mixed with equal volume. Fifty microliter of each culture mixtures was mixed with 0.1 g of feces, respectively, and mixed well.
Inoculated feces was added into a 5 ml of EC broth tube, and mixed by low speed vortexing. Five hundred microliter (0.5 ml) of such mixture was inoculated into 4.5 ml EC broth, and incubated at 37°C for 16 h with shaking. The resulting feces-inoculated culture was diluted to 50 times with sterile distilled water, and used as template for digital PCR.
Our preliminary data using QuantStudio 3D was able to separate the equal-volume mixture of strains 1 and 2 from the equal-volume mixture of strains 3 and 4. Figs. 1A and IB show digital PCR images for the pure E. coli culture results. The results for the mixture of strain
1 and strain 2 are shown in the Fig. 1 A, and the results for the mixture of strain 3 and strain 4 are shown in Fig. IB. The green clusters (encircled portion) are wells that have both genes detected.
The number of the green dots in Fig. 1A is greater than that from Fig. IB indicating that the presence of the two-target genes on a single genome can be differentiated from two genes carried by two different genomes.
Figs. 2A and 2B show digital PCR images for the cattle feces spiked with pure E. coli culture. The results of the feces spiked with the mixture of strain 1 and strain 2 are shown in Fig.
2A. The results of the feces spiked with the mixture of strain 3 and strain 4 are shown in Fig.
2B. Again, the number of the green dots in Fig. 2A is greater than that from Fig. 2B, indicating that the presence of the two target genes on a single genome can be differentiated from two genes carried by two different genomes in feces samples.
We were able to separate the two mixtures from both pure bacterial cultures (Figs.
1A&1B) and from cattle fecal samples that were inoculated with the two culture mixtures indicating that the method should work for bovine fecal samples collected in the field (Figs. 2A & 2B).
EXAMPLE 2
High throughput dPCR detection and association of multiple genes The protocol used in Example 1 was tested using a high throughput dPCR machine, the Fluidigm Biomark digital PCR platform that can do similar testing but with higher throughput capabilities. The Biomark 48.770 chip is capable of handling 48 samples, each has 770 cells
(reactions). Fluidigm kindly provided a demo Biomark machine for this particular study.
We have demonstrated three lines of data with the Biomark system: 1) repeated what we have done with the QuantStudio 3D system which is to associate E. coli 0157 antigen with stxl gene using pure culture and cattle feces inoculated with culture; 2) In addition to serotype 0157, we have also tested the six major non-0157 serogroups, namely 026, 045, O103, 0111, 0121 and 0145, and associated them with one of the two six genes (stxl or stxl, we do not have an 045 strain that carries stx2 gene in our collection, thus an 045-stxl strain is used) using pure culture and cattle feces inoculated with culture; and 3) We have tested the association of three genes, 0157 antigen, stx2 and eae on the Biomark system. Bacterial culture method and fecal inoculation procedures were the same to that were used for QuantStudio 3D system as described above.
1. Association of 0157 antigen-encoding gene r ¾E with stx2 gene.
The same four strains were used: strain 1 : an 0157 strain that carries stx2 (rfl>E+/stxl+) strain 2: a non-0157 strain that does not carry stx2 (rfbE-/stxl-); strain 3 : an 0157 strain that does not carry stx2 (rfbE+/stxl-); and strain 4: a non-0157 strain that carries stx2 (rfbE-/stxl+). Mixture of strains 1 and 2 (r δΕ and stx2 were carried by one strain) was compared with the mixture of strains 3 and 4 (r ¾E and stx2 were carried by two separate strains) for both pure culture and for culture-inoculated feces. Fig. 3 shows that the comparison of above-mentioned culture mixtures inoculated into a negative fecal sample. Upper panel is with mixture of strains 1 & 2 (r ¾E and stx2 genes carried by a single genome); lower panel is mixture of strains 3 & 4 (r ¾E and stx2 genes carried by separate genomes). Number of grids that have two-gene signals (grids have two vertical bars) is significantly higher than those in the lower panel.
Table 1. Gene association rate* of top seven E. coli serogroups with Shiga toxin genes analyzed on Biomark system with pure culture and culture inoculated cattle feces.
0111 and stxl N/A N/A 86.1 32.3
0121 and stxl N/A N/A 83.0 38.8
0145 and stxl N/A N/A 93.3 27.7
0157, stxl, and eae 61.1 16.8 55.2 27.4
*Gene association rate was calculated by number of wells that are positive for both genes (two genes tested), or for all three genes (three genes tested), divided by total wells that generate signals (wells that have one and two signals for two-gene, and one, two and three signals for three-gene associations). Pure culture data for 0111, 0121 and 0145 were not generated.
The top row in Table 1 shows the pure culture and culture-inoculated 0157 data involving r ¾E and stxl genes. The gene association rate is calculated by number of grids that have two signals, divided by the total number of grids that have one or two signals (percentage of dual positives). The validity of this approach is confirmed by the data. The two genes carried by the same genome had the rate of 77.6 and 78.6 for culture and fecal samples, respectively. Whereas the rate for the two genes carried by separate genomes were 28.7 and 34.5 for culture and fecal samples. These are statistically distinct from the associated rates. This association ratio is significantly higher in mixture of strains 1 & 2, than mixture of strains 3 & 4 for both pure culture and feces inoculated with culture.
2. Association tests of non-0157 E. coli serogroups, 026, O103, 0111, 0121 and 0145 with stxl, and 045 with stxl .
Experiment design for the association of non-0157 strains with stx genes is listed in Table 2 below.
Table 2. Genotypes and treatments for E. coli non-0157 strain testing
045 + - 045 stx 1
One genome
- - + NA NA
045
045 - - 045 NA
Two genomes
- + - NA stx 1
O103 + + O103 stx2
One genome
- - - NA NA
O103
O103 + - O103 NA
Two genomes
- - + NA stx2
0111 + + 0111 stx2
One genome
- - - NA NA
0111
0111 + - 0111 NA
Two genomes
- - + NA stx2
0121 - + 0121 stx2
One genome
- - - NA NA
0121
0121 - - 0121 NA
Two genomes
- + + NA stx2
0145 + + 0145 stx2
One genome
- - - NA NA
0145
0145 + - 0145 NA
Two genomes
- - + NA stx2
*"One genome" indicating the two targeted genes are located in a single genome; "Two genomes" indicating the two targeted genes are located on two separate genomes.
Serogroups 026, 045 and 0103 were tested with both pure culture and culture- inoculated feces. Serogroups 0111, 0121 and 0145 were tested with culture-inoculated feces. The gene association rates for each serogroup are shown in Table 1. The rates for associated genes in non-0157 strains are between 56.1 and 93.3 with average of 77.8; the rates for unassociated genes are between 9.6 and 38.8 averaged at 21.4. For each pair of comparison, the gene association rates were distinctly different, and easy to differentiate, indicating using this rate we can easily identify those serogroups that carries the virulence genes.
As an example, Figure 4 shows 045 antigen and six 1 carried by the same genome (upper panel) and these same genes on two separate genomes (lower panel) using culture-inoculated cattle feces. Similar to the 0157 data, the number of cells that have two vertical bars in upper panel is obviously larger than the number in the lower panel.
3. Association of 0157 antigen-encoding gene (rfl>E) with stx2, and eae genes
An E. coli 0157 strain (rZ&E-positive) that carries both stx2 and eae genes (rft>E+leae+lstx2+) was mixed with a strain negative to all three genes (rft>E-leae-lstx2-). This was compared with a mixture of two strains: a) an 0157 strain carrying the eae gene (rfbE+/eae+/stx2-); and b) a non-0157 strain carrying only the stx2 gene (rft>E-leae-lstx2+). Upper panel in Fig. 5 is the strain that carries all three genes; the lower panel is the three genes carried by two separate strains. The number of grids that are positive to all three genes (3 vertical bars in the same cell) in the upper panel is significantly higher than those that in the lower panel. The last row in Table 1 shows that the association rate for three genes carried by a single strain is 61.1 and 55.2 for culture and fecal samples respectively; and the rates for three genes carried by two different strains are 16.8 and 27.4. This data is similar to the two-gene association data we presented for 0157 and non-0157 strains above. It will be appreciated that although the data here relates to STEC, this approach will work in other gram-negative bacteria. Table 3. Primers and probes used in digital PCR reactions in this study.
Target genes/ Primers Sequence
O-group / Probe
Forward GTGCGAATGCCATATTTCCT (SEQ ID N0: 1)
WZX026/026 Reverse TGC T AGT AC TTC AC C A AC AGC A A (SEQ ID N0:2)
Probe* CCTTAGGGGAAAACATCTTTTCAA (SEQ ID N0:3)
Forward AAAGGCGCATTAGTGTCTGC (SEQ ID N0:4)
WZ 0103/OIO3 Reverse GAGGAGTATGTCCCACCCAGT (SEQ ID NO: 5)
Probe ATGCGGTTGCAGGTGTCTG (SEQ ID N0:6)
Forward CCGGTTGTTTCATCAATCCT (SEQ ID NO: 7) wzxoiii/0111 Reverse AAACTAAGTGAGACGCCACCA (SEQ ID NO: 8)
Probe TGAGTCAAAATGGATGTTTCTTCAA (SEQ ID NO: 9)
Forward GGTGTTGCCATATGGTGTTG (SEQ ID NO: 10)
WZX045/045 Reverse TCCGGAAATTTTACCTTCCA (SEQ ID NO: 11)
Probe TGATCATGCAACAGGTCACTATGA (SEQ ID NO: 12) wbqEoui+ Forward TGGATATGCTTCGAATGAACC (SEQ ID NO: 13)
wbqFoui Reverse CAATGCGAGTTTTGTCTCCA (SEQ ID NO: 14)
/0121 Probe TTCCTACACCTACTCGATATACTCCCA (SEQ ID NO: 15)
Forward CATTGTTTTGCTTGCTCGAC (SEQ ID NO: 16)
W 0145/0145 Reverse CAACGAAAATACCATATCCTACAGC (SEQ ID NO: 17)
Probe CCATCAACAGATTTAGGAGTGTATGG (SEQ ID NO: 18)
Forward TAGGACCGCAGAGGAAAGAG (SEQ ID NO: 19)
r ¾Eoi57/0157 Reverse AAACTGGCCTTGTTTCGATG (SEQ ID NO:20)
Probe TCTGCAAGGTGATTCCTTAATTCCT (SEQ ID NO:21)
Forward CAAGAGCGATGTTACGGTTTG (SEQ ID NO:22)
Reverse GTAAGATCAACATCTTCAGCAGTC (SEQ ID NO:23)
Probe ACATAAGAACGCCCACTGAGATCATCCA (SEQ ID NO:24)
Forward GCATCCAGAGCAGTTCTGC (SEQ ID NO:25) stxl Reverse GCGTCATCGTATACACAGGAG (SEQ ID NO:26)
Probe TGTCACTGTCACAGCAGAAGCCTTACG (SEQ ID NO:27)
Forward AAAGCGGGAGTCAATGTAACG (SEQ ID NO:28)
eae Reverse GGCGATTACGCGAAAGATAC (SEQ ID NO:29)
Probe CTCTGCAGATTAACCTCTGCCG (SEQ ID NO: 30)
*A11 probes for the O-group and stx gene pair were labeled with FAM and MAX (VIC equivalent; i.e., FAM for 0157 and MAX for stxl; MAX for O103 and FAM for stxl, etc.), except that the eae gene on the third channel was labeled with TexasRed. All quenchers were used as manufacturer suggested.
Claims
1. A method for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram-negative bacteria, and determination of association of said target nucleic acid sequences as originating from a single genome or from two or more genomes, said method comprising:
providing a sample suspected of or potentially containing said target nucleic acid sequences;
forming a reaction mixture comprising at least a portion of said sample and PCR primers and/or probes corresponding to said two or more target nucleic acid sequences, said PCR primers and/or probes comprising:
a first PCR primer set and/or probe corresponding to a first target nucleic acid; and
a second PCR primer set and/or probe corresponding to a second target nucleic acid;
dividing said reaction mixture into a plurality of individual reaction volumes;
amplifying said reaction volumes to yield amplified reaction volumes comprising positive
PCR reaction products; and
determining the number of said amplified reaction volumes containing both positive PCR reaction products for said first target nucleic acid and positive PCR reaction products for said second target nucleic acid.
2. The method of claim 1, further comprising calculating a gene association rate for said amplified reaction volumes, wherein the number of said amplified reaction volumes containing both positive PCR reaction products is divided by a total number of reaction volumes that generate at least one positive PCR reaction product.
3. The method of claim 2, wherein a gene association rate of greater than 50 indicates that the two or more target nucleic acid sequences originate from the same genome.
4. The method of claim 2, wherein a gene association rate of less than 40 indicates that the two or more target nucleic acid sequences originate from different genomes.
5. The method of claim 1, wherein said first PCR primer set and/or probe corresponds to a target nucleic acid for at least one Gram-negative bacterial serogroup; and said second PCR primer set and/or probe corresponds to a target nucleic acid for at least one virulence gene from a Gram-negative bacteria.
6. The method of claim 1, wherein said reaction mixture further comprise one or more buffers, reagents, enzymes, and/or deoxynucleoside triphosphates.
7. The method of claim 1, wherein said first and/or second primer set and/or probe comprises a detectable reporter molecule.
8. The method of claim 1, wherein said reaction volume comprises up to a single intact bacterial cell.
9. The method of claim 1, wherein said reaction volume comprises up to a single intact nucleic acid molecule.
10. The method of claim 1, wherein said reaction volume is less than about 1 nl.
11. The method of claim 1, wherein said dividing comprises distributing said reaction mixture into a plurality of individual reaction wells or chambers, each well or chamber comprising respective reaction volumes.
12. The method of claim 1, wherein said dividing comprises generation of a plurality of individual droplets of said reaction mixture, each droplet comprising respective reaction volumes.
13. The method of claim 1, wherein said Gram-negative bacteria is Shiga toxin- producing Escherichia coli.
14. The method of claim 1, wherein said first PCR primer set and/or probe
corresponds to a target nucleic acid for at least one E. coli O-type serogroup; and said second PCR primer set and/or probe corresponds to a target nucleic acid for at least one E. coli virulence gene.
15. The method of claim 14, wherein said virulence gene is selected from the group consisting of stxl, stx2, and eae.
16. The method of claim 14, wherein said positive PCR reaction products for at least one E. coli O-type serogroup is a detectable signal from a primer/probe for said O-type serotype and said and positive PCR reaction products for at least one E. coli virulence gene is a detectable signal from a primer/probe for virulence gene eae, stxl, or stxl.
17. The method of claim 14, wherein said E. coli O-type serogroup is selected from the group consisting of 0157, 026, 045, O103, 0111, 0121, and 0145.
18. The method of claim 14, wherein said reaction mixture further comprises a third PCR primer set and/or probe corresponding to at least a second E. coli virulence gene.
19. The method of claim 14, wherein said reaction mixture further comprises a fourth PCR primer set and/or probe corresponding to a target nucleic acid for at least a second E. coli
O-type serogroup.
20. The method of claim 14, wherein said first PCR primer set and/or probe corresponding to a target nucleic acid for at least one E. coli O-type serogroup is selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, and combinations thereof.
21. The method of claim 14, wherein said second PCR primer set and/or probe corresponding to a target nucleic acid for at least one E. coli virulence gene is selected from the group consisting of SEQ ID NOs: 22, 23, 24, 25, 26, 27, 28, 29, 30, and combinations thereof.
22. A kit for co-detection of two or more target nucleic acid sequences in a sample suspected of or potentially containing Gram-negative bacteria, and determination of association of said target nucleic acid sequences as originating from a single genome or from two or more genomes, said kit comprising:
instructions for creation of a PCR reaction mixture with said sample;
instructions for generation of PCR reaction products from said PCR reaction mixture; instructions for calculation of a gene association rate based upon said PCR reaction products; and
optionally, one or more of sample collection swabs, containers, buffers, reagents, enzymes, deoxynucleoside triphosphates, primers, and/or probes.
23. The kit of claim 22, wherein said Gram-negative bacteria is Shiga toxin- producing Escherichia coli.
24. The kit of claim 23, said kit comprising a first PCR primer set and/or probe corresponding to a target nucleic acid for at least one E. coli O-type serogroup; and a second PCR primer set and/or probe corresponding to a target nucleic acid for at least one E. coli virulence gene.
25. The kit of claim 24, wherein said virulence gene is selected from the group consisting of stxl, stx2, and eae.
26. The kit of claim 24, wherein said E. coli O-type serogroup is selected from the group consisting of 0157, 026, 045, O103, 0111, 0121, and 0145.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/543,712 US10233505B2 (en) | 2015-01-16 | 2016-01-15 | Co-detection and association of multiple genes from the same genome in a sample |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562104346P | 2015-01-16 | 2015-01-16 | |
| US62/104,346 | 2015-01-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016115441A1 true WO2016115441A1 (en) | 2016-07-21 |
Family
ID=56406440
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/013562 Ceased WO2016115441A1 (en) | 2015-01-16 | 2016-01-15 | Co-detection and association of multiple genes from the same genome in a sample |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10233505B2 (en) |
| WO (1) | WO2016115441A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024161284A1 (en) * | 2023-01-31 | 2024-08-08 | Mobidiag Oy | Compositions and methods for detecting stx nucleic acids |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021080545A1 (en) * | 2019-10-23 | 2021-04-29 | Ankara Üniversitesi Rektörlüğü | Kit for detection of big six enterohemorrhagic escherichia coli serotypes with rt-pcr |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080014578A1 (en) * | 2003-12-26 | 2008-01-17 | Naoko Horikoshi | Method of Multiplex Microorganism Detection |
| US20080176222A9 (en) * | 2002-05-17 | 2008-07-24 | Creighton University | Multiplex PCR for the detection of AmpC beta-lactamase genes |
| US20130122505A1 (en) * | 2011-08-24 | 2013-05-16 | Life Technologies Corporation | Compositions and methods for detection of multiple microorganisms |
| US20130224751A1 (en) * | 2010-02-12 | 2013-08-29 | Jeffrey Olson | Digital analyte analysis |
| US20130236896A1 (en) * | 2009-05-15 | 2013-09-12 | Life Technologies Corporation | E. coli o157:h7 specific assay |
| WO2013186754A2 (en) * | 2012-06-14 | 2013-12-19 | Agence Nationale De Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail | Method for detecting and identifying enterohemorrhagic escherichia coli |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5766178B2 (en) * | 2009-03-24 | 2015-08-19 | ザ・ユニバーシティ・オブ・シカゴThe University Of Chicago | Slipchip apparatus and method |
-
2016
- 2016-01-15 WO PCT/US2016/013562 patent/WO2016115441A1/en not_active Ceased
- 2016-01-15 US US15/543,712 patent/US10233505B2/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080176222A9 (en) * | 2002-05-17 | 2008-07-24 | Creighton University | Multiplex PCR for the detection of AmpC beta-lactamase genes |
| US20080014578A1 (en) * | 2003-12-26 | 2008-01-17 | Naoko Horikoshi | Method of Multiplex Microorganism Detection |
| US20130236896A1 (en) * | 2009-05-15 | 2013-09-12 | Life Technologies Corporation | E. coli o157:h7 specific assay |
| US20130224751A1 (en) * | 2010-02-12 | 2013-08-29 | Jeffrey Olson | Digital analyte analysis |
| US20130122505A1 (en) * | 2011-08-24 | 2013-05-16 | Life Technologies Corporation | Compositions and methods for detection of multiple microorganisms |
| WO2013186754A2 (en) * | 2012-06-14 | 2013-12-19 | Agence Nationale De Securite Sanitaire De L'alimentation, De L'environnement Et Du Travail | Method for detecting and identifying enterohemorrhagic escherichia coli |
Non-Patent Citations (3)
| Title |
|---|
| BOTKIN ET AL.: "Development of a multiplex PCR assay for detection of Shiga toxin-producing Escherichia coli, enterohemorrhagic E. coli, and enteropathogenic E. coli strains", FRONT CELL INFECT MICROBIOL., vol. 2, no. 8, 14 February 2012 (2012-02-14), pages 1 - 10 * |
| SHARIFI ET AL.: "Mulliplex pulymerase chain reaction (PCR) assay for simultancous detection of shiga-like toxin (stx1 and stx2), intimin (eae) and invasive plasmid antigen H (ipaH) genes in diarrheagenic Escherichia coli", AFRICAN JOURNAL OF BIOTECHNOLOGY, vol. 10, 28 February 2011 (2011-02-28), pages 1522 - 1526 * |
| TADMOR ET AL.: "Probing individual environmental bacteria for viruses by using microfluidic digital PCR", SCIENCE, vol. 333, 1 July 2011 (2011-07-01), pages 58 - 62 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024161284A1 (en) * | 2023-01-31 | 2024-08-08 | Mobidiag Oy | Compositions and methods for detecting stx nucleic acids |
Also Published As
| Publication number | Publication date |
|---|---|
| US20180010170A1 (en) | 2018-01-11 |
| US10233505B2 (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jian et al. | Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling | |
| Jaroenram et al. | Xylenol orange-based loop-mediated DNA isothermal amplification for sensitive naked-eye detection of Escherichia coli | |
| Bonny et al. | Current trends in polymerase chain reaction based detection of three major human pathogenic vibrios | |
| US20120322676A1 (en) | Compositions and methods for detection of cronobacter spp. and cronobacter species and strains | |
| US8883488B2 (en) | Detection of food threat agents and food-borne pathogens | |
| Boyer et al. | Analytical opportunities of quantitative polymerase chain reaction in dairy microbiology | |
| Elizaquível et al. | Quantification of Salmonella spp., Listeria monocytogenes and Escherichia coli O157: H7 in non-spiked food products and evaluation of real-time PCR as a diagnostic tool in routine food analysis | |
| Yu et al. | Improvement and evaluation of loop-mediated isothermal amplification combined with a chromatographic flow dipstick assay and utilization in detection of Vibrio cholerae | |
| JP5835702B2 (en) | Detection method and detection kit for cryptococcosis-causing bacteria | |
| Amoako et al. | Rapid detection and identification of Bacillus anthracis in food using pyrosequencing technology | |
| Tzeling et al. | One-step, multiplex, dual-function oligonucleotide of loop-mediated isothermal amplification assay for the detection of pathogenic Burkholderia pseudomallei | |
| Xing et al. | Improvement and evaluation of loop-mediated isothermal amplification combined with chromatographic flow dipstick assays for Vibrio parahaemolyticus | |
| Modise et al. | A novel multiplex qPCR‑HRM assay for the simultaneous detection of four abortive zoonotic agents in cattle, sheep, and goats | |
| US9024002B2 (en) | Compositions and methods for detection of Salmonella species | |
| Naranitus et al. | Smartphone‐compatible, CRISPR‐based platforms for sensitive detection of acute hepatopancreatic necrosis disease in shrimp | |
| US7695941B2 (en) | Multiplexed polymerase chain reaction for genetic sequence analysis | |
| Sebastian | Evaluation of sensitivity and cost-effectiveness of molecular methods for the co-detection of waterborne pathogens in India | |
| Nadin-Davis et al. | A real-time PCR regimen for testing environmental samples for Salmonella enterica subsp. enterica serovars of concern to the poultry industry, with special focus on Salmonella Enteritidis | |
| Tamerat et al. | Application of molecular diagnostic techniques for the detection of E. coli O157: H7: a review | |
| US10233505B2 (en) | Co-detection and association of multiple genes from the same genome in a sample | |
| Li | Li j | |
| Gong et al. | Rapid and accurate detection of Salmonella enterica serovar Enteritidis using a one-step LAMP-CRISPR/Cas12b method | |
| Costa-Ribeiro et al. | Multiplex Real-Time PCR for the Detection of Shiga Toxin-Producing Escherichia coli in Foods | |
| Nour et al. | Amplification of P1 and 16S rRNA genes by nested PCR for detection of Mycoplasma pneumoniae in paediatric patients | |
| Janzen et al. | Rapid detection method for Bacillus anthracis using a combination of multiplexed real-time PCR and pyrosequencing and its application for food biodefense |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16737950 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16737950 Country of ref document: EP Kind code of ref document: A1 |

