WO2016106391A1 - Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms - Google Patents
Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms Download PDFInfo
- Publication number
- WO2016106391A1 WO2016106391A1 PCT/US2015/067524 US2015067524W WO2016106391A1 WO 2016106391 A1 WO2016106391 A1 WO 2016106391A1 US 2015067524 W US2015067524 W US 2015067524W WO 2016106391 A1 WO2016106391 A1 WO 2016106391A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- acid sequence
- paragraph
- lna
- aspect provides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/107—Modifications characterised by incorporating a peptide nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2531/00—Reactions of nucleic acids characterised by
- C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
- C12Q2531/113—PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2545/00—Reactions characterised by their quantitative nature
- C12Q2545/10—Reactions characterised by their quantitative nature the purpose being quantitative analysis
- C12Q2545/114—Reactions characterised by their quantitative nature the purpose being quantitative analysis involving a quantitation step
Definitions
- the present disclosure relates to the field of rapid, simultaneous, and quantitative detection of genomic mutations. More specifically, the disclosure relates to the detection of single nucleotide variants in genomic sequences which may have low complexity and/or high GC content, and to the diagnosis, staging and treatment of cancers and conditions associated with the single nucleotide variants.
- Dehydrogenase 1 (II)Hl) is detected in 75% of grade II and III astrocytomas and two separate mutations in the promoter region of Telomerase Reverse Transcriptase (TERT) are detected in 83% of primary glioblastoma (GBM, grade IV astrocytoma) (P. J. Killela et al., Proc, Natl. Acad. Sci. U. S. A. 110, 6021-6026 (2013), C. Koelsche et al. , Acta Nenropathol, (BerL). 126, 907-915 (2013), N. Nonoguchi et al, Acta Nenropathol. (Bed.). 126, 93 1-937 (2013).
- Oligodendrogliomas are highly chemotherapy-sensitive gliomas characterized by loss of heterozygosity of chromosome lp and 19q, but recent studies have found that 80% of these are also defined by concurrent mutations in //>/-/ / and TERT promoter (P. J. Killela et al , Proc. Natl, Acad. Sci. U. S. A. 110, 6021-6026 (2013), N. Sabha et al , Neuro-Oncol. (2014), doi: 10.1093/neuonc/not299., H. Arita et al . Acta Nenropathol. (BerL). 126, 267-276 (2013)).
- World Health Organization (WHO) grade II diffuse gliomas are a group of slow- growing primary central nervous system tumors, including oligodendrogliomas, astrocytomas and oligoastrocytomas.
- Grade II diffuse gliomas are clinically indolent lesions for which progression free and overall patient survival positively correlates with maximal upfront resection (Smith .I S, et al., J Clin Oncol Off J Am Soc Clin Oncol 2008;26(8): 1338-45;
- the initial surgical procedure can therefore be both diagnostic and therapeutic, but accurate intraoperative diagnosis is essential in determining whether to continue with more aggressive surgical resection.
- An intraoperative assay that could rapidly and accurately identify these recurrent molecular features could augment "frozen section" histopathologic analysis, improve intraoperative diagnosis and accelerate real-time decision-making in the management of grade II diffuse gliomas.
- Melanoma is a highly prevalent neoplasm that is also characterized by recurrent missense sSNVs leading to activating mutations in either B-Raf or NRAS (E. Hodis et al.. Cell. 150, 251 -263 (2012)). Benign nevi have also been found to harbor BRAF V600E, which reduces the specificity of the alteration for distinguishing these nevi from malignant pathologies (J. M. Taube, S. Begum, C. Shi, J. R. Eshleman, W. H. Westra, Am. J. Surg. Pathol. 33, 568- 571 (2009)).
- Somatic single nucleotide variants targeting the Q61 codon of NRAS occurs in 10-25% of cutaneous melanoma (Tsao, H., et al. (2012); Genes Dev., 26: 1131-1 155). Patients undergoing therapies targeting mutant BRAF have been found to develop resistance through mechanisms that result in mutations to NRAS Q61 codon (Van Allen E, et al . (2014); Can Disc. ,4:94). Furthermore, patients with NRAS-mutant melanoma hav e a better response to immunotherapy than those with mutant BRAF (Johnson, DB, et al. (2015); Cancer Immunol Res., 3(3):288-295) therefore monitoring the blood for evidence of these alterations can have great prognostic value.
- DI G Diffuse intrinsic pontine gliomas
- CSF Cerebrospinal Fluid
- Uveal melanomas are malignancies originating within the melanocytes of the eye involving the iris, ciliary body or choroid. Patients with uveal melanoma have an approximately 50% likelihood of developing metastases and of those, the median survival rate is 2 to 15 months (Augsburger J., et al . (2009); Am J. Opthalmol, 148: 1 1 - 127, and van den Bosch, T., et al. (2010); Dermatol Res Pract, 2010:360136).
- Timely and accurate diagnosi s of cancer subtypes is critical for appropriately stratifying patients for real-time intraoperative decision-making. For instance, a "frozen section " during neurosurgical resection of malignant gliomas can facilitate intraoperative decision-making, however, the concordance between frozen and permanent histopathology has been reported to be -90% (A. Regragui, et al., Neurology. 49, 67-72 (2003)) due to secondary to small or unrepresentative sample size, low tumor purity and di sruption of histologic architecture (M. J. Glantz et al. , Neurology. 41, 1 74 1 - 1 744 (1991), R. J. Jackson et al., Neuro-Oncol.
- the specimens are cancer patient biopsies with low tumor density, e.g., infiltrating gliomas.
- the single nucleotide van ant i s a somatic alteration in a chromosomal sequence compared to wild type.
- the somatic nucleotide alteration is associated w ith a cancerous alteration in a cell .
- the somatic nucleotide alteration is present in at least one cell in a tumor sample. In some aspects, the somatic nucleotide alteration is present in only a subset of cancer cells in a tumor sample.
- the disclosed aspects are distinguished from current less sensitive techniques for detecting low abundance sequences in a complex mixture by including the following features: (1 ) optimization to overcome the low complexity and high GC content of a target site, (2) inclusion of modified oligonucleotides with peptide nucleic acid (PNA) backbones to block logarithmic amplification of wi ld-type alleles, (3) incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity, and (4) designed so that multiple assays can be used to profile multiple genes at the same time under the same cycling parameters.
- the target site comprising low sequence complexity and/or high GC content i at least one region of the TERT promoter.
- the disclosed aspects provide a quantitative polymerase chain reaction (qPCR) based assay, able to perform rapid amplification-based gen oty ping of cells from a subject.
- the genotyping compri ses determination of the presence or absence of at least one somatic alteration in a target sequence in at least one cell from a patient sample.
- the somatic gene alteration is present in the IDH1 coding region.
- the somatic gene alteration is present in the TERT promoter.
- somatic gene alterations are present in both the H3H1 coding region and TERT promoter.
- the somatic gene alterations compri se recurrent mutations.
- the methods provided herein are used to identify these recurrent mutations w ithin 45 minutes of obtaining a biopsy specimen, a time frame that parallels frozen section analysis.
- the methods prov ided herein have a sensitivity of 0.1% allelic fraction of tumor sSNVs ("single nucleotide variants") in a complex mixture comprising wild type and mutant sequences in a target site.
- the sSNVs comprise one or more somatic gene alterations in one or both of a TERT promoter and an IDH I coding region.
- the presence or absence of one or more specific sSNVs predicts final pathology in 90% of archiv ed gliomas.
- the described techniques optionally provide means of intraoperative molecular characterization, whereby the methods could supplement, replace or assist pathologic analysis of low eel hilarity diffuse gliomas, distinguishing them from nonneoplastic processes by providing cancer-specific genomic information, and could help both accelerate and solidify the decision to pursue resection within the time frame of the current operative procedure, thus eliminating the potential risks and costs associated with re-operation, and ultimately improving the approach to patients w ith diffuse gliomas.
- the methods provided herein could be used for real-time intraoperative diagnosis.
- the intraoperative diagnosis can be used to confirm a diagnosis.
- intraoperative diagnosis allows for intraoperative therapy.
- the intraoperative therapy may comprise resection, thermal ablation therapy, laser microsurgery, or targeted therapy at the ti me of operation.
- the disclosed platform can be extended to detect mutant TERT promoter alleles in blood of patients with progressive di sease.
- the mutant TERT promoter allele is in the cell -free component of a patient blood sample.
- the mutant TERT promoter allele is in a circulating cancer cell obtained from a patient blood sample.
- the sensitive and specific molecular di agnostic techniques described herein could significantly aid the discri mination of tumor pathology at the time of diagnosis, and could furthermore be useful for non-invasively monitoring of disease
- the ability to sensitively detect tumor alleles in the blood by this rapid method opens a new avenue for non-invasively monitoring tumor progression and treatment response. This would be especially useful for cancers, like melanoma, that have longer lengths of time for progression from localized to systemic disease, which is often noted when the patient has a symptomatic metastasis, and for gliomas that would otherwise require at least an initial intraoperative procedure in order to obtain a biopsy.
- a system for detection or amplification of one or more single nucleotide polymorphi sms or somatic nucleotide variants in one or more target nuclei c acids that may have high GC content and/or low sequence complexity in a sample.
- the system includes a forward primer that hybridizes to a first region on a sense strand of the target nucleic acid, a rev erse primer that hybridizes to a second region on an anti sense strand of the target nucleic acid, a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele sequence of the target nucleic acid and located within the region amplified by the forward primer and the reverse primer, a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the target nucleic acid, the PNA blocker comprising an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i.e., inhibit or cause a relative decrease in) amplification of the wild-type allele, and does not block amplification of the mutant allele
- kits that includes components that compose the system of the disclosed invention herein.
- the kit comprises the forward primer, reverse primer, LNA probe and PNA blocker for at least one target sequence.
- the target sequence is a region of the telomerase reverse transcriptase (TERT) promoter.
- the TERT promoter comprises one or both somatic variants C228T and C250T, as further described herein.
- the LNA probe hybridizes to a nucleotide region comprising a T at position 228 of the mutated allele of the TERT promoter and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wi ld type allele.
- the LNA probe hybridizes to a nucleotide region comprising a T at position 250 of the mutated al lele of the i ocitrate dehydrogenase 1 ( IDH 1 ) coding region and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wild type al lele.
- the target sequence is a region of the IDH I gene.
- the IDH I gene region comprises the nucleotide sequence encoding a somatic mutation at position 132 of the polypeptide.
- the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding an amino acid selected from one or more of a hi stidine (“H"), cysteine (“C”), glycine (“G”), serine (“S”) and leucine (“L”) at position 132 of the mutated IDH I protein, and the PNA blocker hybridizes to a nucleotide region comprising a wi ld type codon encoding an arginine ("R”) at the corresponding position in a wild type allele.
- H hi stidine
- C cysteine
- G glycine
- S serine
- L leucine
- the LNA probe hybridizes to a nucleotide region comprising an A of the mutated allele of the proto-oncogene B-raf ( BRAF) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a T at the corresponding position in a wild type allele.
- the target sequence is a region of the BRAF gene.
- the LNA probe hybridizes to a nucl eotide region comprising a mutated codon encoding a glutamic acid ("E") at position 600 of the mutated BRAF protein
- the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a valine (“V”) at the corresponding position in a wild type allele.
- the LNA probe hybridizes to a nucleotide region comprising a G of the mutated al lele of the neuroblastomas RAS viral oncogene homolog (NRAS) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele.
- the LNA probe hybridizes to a nucleotide region comprising an A of the mutated allele of the neuroblastomas RAS viral oncogene homolog (NRAS) coding region and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wi ld type allele.
- the target sequence is a region of the NRAS gene.
- the LN A probe hybridizes to a nucleotide region compri sing a mutated codon encoding an amino acid selected from one or more of an arginine ("R") and a lysine ("K”) at position 61 of the mutated allele of the NRAS and the PN A blocker hybridi es to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at the corresponding position in a wild type allel e.
- the LN A probe hybridizes to a nucleotide region compri sing a A of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PN A blocker hybridizes to a nucleotide region comprising a G at the corresponding position in a wild type allele.
- the LNA probe hybridizes to a nucleotide region compri sing a T of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a A at the corresponding position in a wild type allele.
- the LNA probe hybridizes to a nucleotide region comprising a C of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele.
- the target sequence is a region of the GN AQ gene.
- the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding a glutamine ("Q") at position 183 of the mutated allele of the GN AQ
- the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding an arginine ("R") at position 183 in a wild type allele.
- the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding a leucine ("L") or a proline (“P”) at position 209 of the mutated allele of the GNAQ
- the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at position 209 in a wild type allele.
- the LNA probe hybridizes to a nucleotide region comprising a T of the mutated allele of the guanine nucleotide-binding protein subunit a- 1 1 (GNAl 1) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele.
- the target sequence is a region of the GNA 1 1 gene.
- the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding an amino acid selected from one or more of a leucine ("L”) at position 209 of the mutated allele of the GNA 1 1 and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at the corresponding position in a wi ld type allele.
- L leucine
- Q glutamine
- the LNA probe hybridizes to a nucleotide region compri sing a T of the mutated allele of the 113 hi stone, family 3 A ( H3F3A ) coding region and the PNA blocker hybridizes to a nucleotide region comprising a A at the corresponding position in a wild type al lele.
- the LN A probe hybridizes to a nucleotide region comprising an A of the mutated allele of the H3 hi stone, family 3 A ( H3F3A) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a G at the
- the target sequence is a region of the H3 F3A gene.
- the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding a methionine ("M") at position 27 of the mutated allele of the 1I3F3A and the PNA blocker hybridizes to a nucleotide region compri sing a wild type codon encoding a lysine ("K”) at position 27 in a wi ld type allele.
- the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding an arginine ("R") at position 34 of the mutated allele of the H3F3 A and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a glycine ("G”) at position 34 in a wild type allele.
- R arginine
- G glycine
- a method is provided of using the system to detect or amplify one or more single nucleotide polymorphisms or somatic variants in at least one target nucleic acid including but not limited to, e.g., a target sequence with low sequence complexity and/or high GC content, in a sample from a subject, where the method includes isolating DNA from the sample; denaturing the isolated DN A; annealing the forward primer, the reverse primer, the LNA probe, and the PNA blocker to the DNA at the same temperature conditions; and amplifying and detecting a DNA am pi icon comprising the one or more sin le nucleotide polymorphisms, thereby detecting or amplifying one or more single nucleotide polymorphisms.
- a target nucleic acid including but not limited to, e.g., a target sequence with low sequence complexity and/or high GC content
- a method for establishing a molecular diagnosis in at least one cancer in a subj ect, where the method includes isolating DNA from a sample from the subject; denaturing the DNA isolated from the sample and a control DNA template; annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a reverse primer that hybridizes to a second region on an antisense strand of the first target nucleic acid, a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker comprising an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i.e., inhibit or cause
- amplicon comprising the mutant allele in the first target nucleic acid; detecting the mutant allele in the first target nucleic acid in the sample; and quantifying the amount of the mutant allele in the first target nucleic acid in the sample relative to the amount in a control, wherein a higher prevalence of the amount of the mutant allele in the sample relative to the control indicates presence and/or stage of the cancer in the subject.
- the assay is an intraoperative single nucleotide variant detection assay wherein the assay is performed and results are obtained concurrent with a surgical procedure for obtaining the sample from a patient.
- a method i s provided for diagnosi s of melanoma in a subject, where the method includes isolating DNA from a sample acquired from a patient, e.g., such as a skin biopsy or a metastatic lesion; denaturing the DNA isolated from the sample and a control DNA template; annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a rev erse primer that hybridizes to a second region on an antisense strand of the first target nucleic acid, a locked nucleic acid (LNA) probe compri sing an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe compri ses a nucleic acid sequence that is complementary to a mutant allele sequence of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker comprising an oligonucleotide
- LNA locked nucle
- the target nucleic acid has low sequence complexity. In some embodiments, the target nucleic acid has high GC content. In some embodiments, the target nucleic acid has a GC content of greater than 60%.
- the mutant allele comprises a single nucleotide polymorphism. In some embodiments, the mutant allele comprises a somatic variant. In some embodiments, the mutant allele comprises at least one single nucleotide polymorphism or somatic variant.
- the L A probe comprises a first end and a second end, wherein the first end comprises a label and wherein the second end comprises a quencher.
- the target nucleic acid compri ses a portion of the nucleic acid sequence of a telomerase reverse transcriptase (TERT) gene.
- the TERT gene comprises a portion of the nucleic acid sequence of the regulatory region of the TERT gene promoter.
- the mutant allele comprises variant C228T (hgl9,
- the mutant allele comprises variant C250T (hgl9, chromosome 5 : 1,295,250) of the TERT gene promoter.
- the mutant allele comprises a variant comprising the sequence CCTTC (SEQ ID NO: 1) at about nucleotide positions 1,295,226-1,295,230 of human chromosome 5, as compared to the wild-type allele at the corresponding positions comprising the sequence CCCTC (SEQ ID NO: 2).
- the mutant allele comprises a variant comprising the sequence CCCAGCCCCTTCCGGGCCC (SEQ ID NO: 3), as compared to the wild-type allele comprising the sequence CCCAGCCCCCTCCGGGCCC (SEQ ID NO: 4).
- the mutant allele comprises a variant comprising T, or Thymine, at about nucleotide position 1,295,228 of human chromosome 5, as compared to the wild-type allele at the corresponding position comprising C, or Cytosine.
- the mutant allele comprises a variant comprising the sequence CTTCC (SEQ ID NO: 5) at about nucleotide positions 1 ,295,248- 1 ,295,252 of human chromosome 5, as compared to the wild-type allele at the corresponding positions comprising the sequence CTCCC ( SEQ ID NO: 6). In some embodiments, the mutant allele comprises a variant comprising the sequence
- the mutant allele comprises a variant comprising T, or Thymine, at about nucleotide position 1,295,250 of human chromosome 5, as compared to the wild-type allele at the corresponding position comprising C, or Cytosine.
- the forward primer comprises the nucleic acid sequence of 5'- CACGTGCGCAGCAGGACGCAG-3' (SEQ ID NO: 9).
- the reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3' (SEQ ID NO: 10).
- the PNA blocker comprises the nucleic acid sequence of 5'- CCCAGCCCCCTCCGGGCCC-3' (SEQ ID NO: 1 1).
- the PNA blocker comprises the nucleic acid sequence of S'-CCGACCCCTCCCGGGTCCC-S' (SEQ ID NO: 12).
- the LNA probe comprises the nucleic acid sequence of 5'- CCCAGCCCC+T+TCCGGGCCC-3' (SEQ ID NO: 13), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- CCGACCCC+T+TCCGGGTCCC-3' (SEQ ID NO: 14), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3'(SEQ ID NO: 15), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- Fy M-CCGACCCC+T+TCCGGGTCCC-Dab-3 ' (SEQ ID NO: 16), wherein nucl eotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the target nucleic acid comprises a portion of the nucleic sequence of an isocitrate dehydrogenase 1 (IDII1) gene.
- the mutant allele comprises a variant that encodes an IDH 1 protein of variant R 132H.
- the mutant allele comprises the variant described as COSM28746 in the
- the mutant allele comprises a variant comprising the sequence GTCAT (SEQ ID NO: 17) at about nucleotide positions 392-396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 18). In some embodiments, the mutant allele comprises a variant comprising the sequence
- the mutant allele comprises a variant comprising A, or Adenine, at about nucleotide position 395 from the start of the cDNA, as compared to the wild-type al lele at the corresponding position comprising G, or Guanine.
- the mutant allele comprises a variant that encodes an IDH1 protein of variant R 1 32C.
- the mutant allele comprises the variant described as COSM28747 in COSMIC.
- the mutant al lele comprises a variant comprising the sequence GTTGT (SEQ ID NO: 2 1 ) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT ( SEQ ID NO: 1 8).
- the mutant allele comprises a variant comprising the sequence A GGTTGTC A TGC (SEQ ID NO: 22), as compared to the wi ld-type allele compri sing the sequence AGGTCGTCATGC (SEQ ID NO: 20).
- the mutant allele comprises a variant compri sing T, or Thymine, at about nucleotide position 394 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
- the mutant allele comprises a variant that encodes an IDI 1 1 protein of variant R I 32G.
- the mutant allele comprises the variant described as CO SM 28749 in COSMIC.
- the mutant allele comprises a variant comprising the sequence GTGGT ( SEQ ID NO: 23 ) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 1 8).
- the mutant allele comprises a variant compri sing the sequence AGGTGGTC A TGC ( SEQ ID NO: 24), as compared to the wild-type allele comprising the sequence AGGTCGTCATGC (SEQ ID NO: 20).
- the mutant allele comprises a variant comprising G, or Guanine, at about nucleotide position 394 from the start of the cDN A, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
- the mutant allele comprises a variant that encodes an IDH I protein of variant R132S.
- the mutant al lele compri ses the variant described as COSM28748 in COSMIC.
- the mutant allele comprises a variant comprising the sequence GTAGT ( SEQ ID NO: 25) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions compri sing the sequence GTCGT ( SEQ ID NO: 1 8).
- the mutant allele comprises a variant comprising the sequence AGGTAGTC ATGC (SEQ ID NO: 26), as compared to the wi ld-type allele compri sing the sequence AGGTCGTCAT GC (SEQ ID NO: 20).
- the mutant allele comprises a variant comprising A, or Adenine, at about nucleotide position 394 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
- the mutant allele comprises a variant that encodes an IDH I protein of variant R132L.
- the mutant allele comprises the variant described as COSM28750 in COSMIC.
- the mutant allele comprises a variant comprising the sequence GTCTT (SEQ ID NO: 27) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 18).
- the mutant allele comprises a variant comprising the sequence AGGTC TT A TGC (SEQ ID NO: 28), as compared to the wild-type allele comprising the sequence AGGTC GTCATGC (SEQ ID NO: 20).
- the mutant allele comprises a variant comprising T, or Thymine, at about nucleotide position 395 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising G, or Guanine.
- the forward primer comprises the nucleic acid sequence of 5'- CCGGCTTGTGAGTGGATGGGTAAAACCT-3' (SEQ ID NO: 29).
- the reverse primer comprises the nucleic acid sequence of 5'- CATTATTGCCAACATGACTTACTTGATCCCC-3' (SEQ ID NO: 30).
- the PNA blocker comprises the nucleic acid sequence of 5 " - AGGTCGTC ATGC- 3' (SEQ ID NO: 20).
- the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+A+T+CAT+GC-3' (SEQ ID NO: 31), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+T+G+T+C+ATGC-3' (SEQ ID NO: 32), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGGT+G+G+T+CAT+GC-3' (SEQ ID NO: 33), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGGT+A+G+T+CA+T+GC-3 ' (SEQ ID NO: 34) wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+CAT+GC-3' (SEQ ID NO: 35) wherein nucleotides preceded by a "+” are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- F AM- AGG+T+C+A+T+C AT+GC-Dab-3' (SEQ ID NO: 36), wherein nucleotides preceded by a "+” are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGG+T+T+G+T+C + ATGC -D ab -3 ' (SEQ ID NO: 37), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGGT+G+G+T+C AT+GC-Dab-3 ' (SEQ ID NO: 38), wherein nucleotides preceded by a "+'' are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGGT+ A+G+T+C A+T+GC - Dab -3 ' (SEQ ID NO: 39), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGG+T+C+T+T+C AT+GC-Dab-3' (SEQ ID NO: 40) wherein nucleotides preceded by a "+" are LNA modified nucleotides, M AXN is fluorescent moiety, and Dab is
- the mutant allele comprises a variant that encodes a BRAF protein of variant V600E.
- the mutant allele comprises the variant described as COSM1131 in COSMIC.
- the wild-type allele comprises the sequence TCACT (SEQ ID NO: 41), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence TCTCT (SEQ ID NO: 42).
- the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising T, or Thymine.
- the forward primer comprises the nucleic acid sequence of 5'- ACAGGGC ATGGAGAGTGGGTC-3 ' (SEQ ID NO: 43).
- the reverse primer comprises the nucleic acid sequence of 5'- CAAACTGATGGGACCCACTCCAT -3' (SEQ ID NO: 44).
- the PNA blocker comprises the nucleic acid sequence of 5'- CATCGAGATTTCACTGTAGCTAGA-3' (SEQ ID NO: 45).
- the LNA probe comprises the nucleic acid sequence of 5'- AGA+TT+T+C+T+CT+GT+AG+C-3' (SEQ ID NO: 46), wherein nucleotides preceded by a "+” are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- F AM- AGA+TT+T+C+T+C T+GT+ AG+C - D ab -3 ' (SEQ ID NO: 47), wherein nucleotides preceded by a "+” are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGA+TT+T+C+T+CT-i-GT-i-AG-i-C-Dab-3 ' (SEQ ID NO: 48), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the mutant allele comprises a variant that encodes an NRAS protein of variant Q6 1 R
- the mutant allele comprises the variant described as COSM584 in COSMIC.
- the wild-type allele comprises the sequence ACAAG (SEQ ID NO: 49) as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence ACGAG (SEQ ID NO: 50).
- the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant comprising A, or Adenine.
- the mutant allele comprises a variant that encodes an NRAS protein of variant Q61K.
- the mutant all ele comprises the variant described as COS M 580 in COS IC.
- the wild-type allele comprises the sequence ACAAG ( SEQ ID NO: 49), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence AAA AG ( SEQ ID NO: 51).
- the wild-type allele comprises C, or Cytosine, as compared to the mutant allele compri sing a variant compri sing A, or Adenine.
- the forward primer compri ses the nucleic acid sequence of 5'- AGTGGTTATAGATGGTGAAACCTG-3 ' (SEQ ID NO: 52).
- the reverse primer comprises the nucleic acid sequence of 5'- A C A G A GG A A G C C TTC GC C TG -3 ' (SEQ ID NO: 53 ).
- the PNA blocker compri ses the nucleic acid sequence of 5 " -C AGCTGG AC A AG A AG AGT AC-K K-3 " (SEQ ID NO: 54).
- the LNA probe comprises the nucleic acid sequence of 5 ' -CTGG+ AC+G+ AG+ A A+GAGT A-3 ' (SEQ ID NO: 55 ), wherein nucleotides preceded by a "+" are LN A modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- CAG+CTGGA+A+A+AGAA+GA+GTA-3 ' ( SEQ ID NO: 56), wherein nucleotides preceded by a "+” are LNA modified nucleotides.
- the LNA probe compri ses the nucleic acid sequence of 5' -FA M- CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' (SEQ ID NO: 57), wherein nucleotides preceded by a "+” are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- FAM-CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3 ' (SEQ ID NO: 58), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' (SEQ ID NO: 59), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3 ' (SEQ ID NO: 60), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the mutant allele comprises a variant that encodes a GNAQ protein of variant R183Q.
- the mutant allele comprises the variant described as COS M 52975 in COSMIC.
- the wild-type allele comprises the sequence TCGAG (SEQ ID NO: 61), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence TCAAG (SEQ ID NO: 62).
- the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant compri sing A, or Adenine.
- the mutant allele comprises a variant that encodes a GNAQ protein of variant Q209L.
- the mutant allele comprises the variant described as COSM33719 in COSMIC.
- the wild-type allele comprises the sequence CCAAA (SEQ ID NO: 63), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CCTAA (SEQ ID NO: 64).
- the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising T, or Thymine.
- the mutant allele comprises a variant that encodes a GNAQ protein of variant Q209P.
- the mutant allele comprises the variant described as COSM33718 in C SMIC.
- the wild-type allele comprises the sequence CCAAA (SEQ ID NO: 63), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CCCAA ( SEQ ID NO: 65).
- the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising C, or Cytosine.
- the forward primer comprises the nucleic acid sequence of 5'- TTGGACCGCGTAGCTGACCCT-3' (SEQ ID NO: 66). In other embodiments, the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3' (SEQ ID NO: 67). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- GC TG GG A A A T A GGTTTC A TGG A C -3' (SEQ ID NO: 68). In still another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- TCACTAAGCGCTACTAGAAACATG-3' (SEQ ID NO: 69).
- the PNA blocker comprises the nucleic acid sequence of 5 -TTAGAGTTCGAGTCCCC A-.V (SEQ ID NO: 70). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5 -GGGGC C A A AGGTC A G A G A -3 ' (SEQ ID NO: 71 ).
- the LNA probe comprises the nucleic acid sequence of 5'- AGAGT+TC+A+AGT+CCCCAC-3' (SEQ ID NO: 72), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGGGGCC+T+AAGGTCAGAG -3' (SEQ ID NO: 73), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- GGGCC+C+A AGGTC AGAGA -3 ' (SEQ ID NO: 74), wherein nucleotides preceded by a "+" are LNA modi ied nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- FAM-AGAGT+TC+A+AGT+CCCCAC-Dab-3' (SEQ ID NO: 75), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 -FAM- AGGGGCC+T+ A AGGTC AGAG-Dab-3 ' (SEQ ID NO: 76), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5' -FA M- GGGC C +C + A A GG TC A G A G A -D ab -3 ' (SEQ ID NO: 77), wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3' (SEQ ID NO: 78), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGGGGCC+T+AAGGTCAGAG-Dab-3 ' (SEQ ID NO: 79), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN GGGCC+C+AAGGTCAGAGA-Dab-3 ' (SEQ ID NO: 80), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the mutant allele comprises a variant that encodes a GNA1 1 protein of variant Q209L.
- the mutant allele compri ses the variant described as COSM 1 1 0736 in COSMIC.
- the wild-type allele comprises the sequence CCAGC ( SEQ ID NO: 81), as compared to the mutant allele at the corresponding positions compri sing a variant comprising the sequence CCTGC (SEQ ID NO: 82).
- the wild-type allele comprises A, or Adenine, as compared to the mutant allele compri sing a variant compri sing T, or Thymine.
- the forward primer compri ses the nucleic acid sequence of 5 '- GCAGATTGGGCCTTGGGGCG-3 ' (SEQ ID NO: 83 ).
- the reverse primer comprises the nucleic acid sequence of 5'-TCGCTGAGGGCGACGAGAAAC-3 ' (SEQ ID NO: 84).
- the PNA blocker comprises the nucleic acid sequence of 5'- GGGCC AGCGGTCGGAGC-3 ' (SEQ ID NO: 85).
- the LNA probe comprises the nucleic acid sequence of 5'- GGG+CC+T+GCGGTCGG-3 ' (SEQ ID NO: 86), herein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5 '- FAM-GGG+CC+T+GCGGTCGG-Dab-3 ' (SEQ ID NO: 87), wherein nucleotides preceded by a "+" are LN A modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5' -MAX N- GGG+CC+T+GCGGTCGG-Dab-3 ' ( SEQ ID NO: 88), wherein nucleotides preceded by a "+" are LN A modified nucleotides, MAXN i s fluorescent moiety, and Dab i s diaminobenzidine.
- the mutant allele comprises a variant that encodes an H3F3A protein of variant K27M.
- the mutant allele comprises the variant described as COSM327928 in COSMIC.
- the wild-type allele comprises the sequence CAAGA (SEQ ID NO: 89), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CATGA (SEQ ID NO: 90).
- the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant compri sing T, or Thymine.
- the mutant allele comprises a variant that encodes an H3F3 A protein of variant G34R.
- the mutant allele comprises the variant described as COSM957499 in COSMIC.
- the wild-type allele comprises the sequence AGGGG (SEQ ID NO: 91), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence AAGGG ( SEQ ID NO: 92).
- the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant comprising A, or Adenine.
- the forward primer comprises the nucleic acid sequence of 5'- C TGC C C GC A A A TC G A C C GGT-3 ' (SEQ ID NO: 93).
- the reverse primer comprises the nucleic acid sequence of 5'-GGATACATACAAGAGAGACTTTGTC-3' (SEQ ID NO: 94).
- the PNA blocker comprises the nucleic acid sequence of 5'- GCCGCTCGCAAGAGTGCGCC-3 ' (SEQ ID NO: 95).
- the PNA blocker comprises the nucleic acid sequence of 5'- TTCTTCACCCCTCCAGTAG-3' (SEQ ID NO: 96).
- the LNA probe comprises the nucleic acid sequence of 5' ⁇ CGCTCGC+A+T+GAGTG-3' (SEQ ID NO: 97), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- TACT+GGA+A+GG+GTGAAGA-3 ' (SEQ ID NO: 98), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM- CGCTCGC+A+T+GAGTG-Dab-3 ' (SEQ ID NO: 99), wherein nucleotides preceded by a "+" are LNA modified nucleotides, L AM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- FAM-TACT+GGA+A+GG+GTGAAGA-Dab-3' (SEQ ID NO: 100), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CGCTCGC+A+T+GAGTG-Dab-3' (SEQ ID NO: 101), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
- the LNA probe comprises the nucleic acid sequence of 5'- MAXN-TACT+GGA+A+GG+GTGAAGA-Dab-3 ' (SEQ ID NO: 102), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- two or more mutant alleles of TERT and/or IDH are detected simultaneously. In some embodiments, the two or more mutant alleles of TERT and/or IDH are detected simultaneously in the same well .
- a positive control genomic DNA is included, compri sing DNA which is homozygous, hemizygous or heterozygous for the mutant allele.
- a negative control genomic DNA is included, wherein the negative control contains only wild type sequence for the target al lele.
- control genomic DNA is derived from glioma cell line LN428, which is heterozygous for TERT C228T. In some embodiments, the control genomic DNA is derived from glioma cell line LN443, which is homozygous for TERT C250T.
- control genomic DNA is derived from primary glioma cell line BT 142, which is homozygous for IDH 1 R132H.
- the control genomic DNA template is derived from a melanoma cel l or a melanoma cell li ne.
- the positive control genomic DNA is synthetic.
- the negative control genomic DNA template i s derived from I ICC 1 143 cell line, which is homozygous wild-type for TERT C228T, TERT C250T, and IDH l R 1 32.
- the negative control genomic DNA template is derived from B L I 954 cell line, which is homozygous wild-type for TERT C228T, TERT C250T, and IDHl R 132.
- the negative control genomic DNA template is synthetic.
- the system or method includes a high-speed DNA polymerase. In some embodiments, the system or method includes a high-speed DNA polymerase has an elongation rate of about l kb/second. In some embodiments, the system or method includes a high-speed DN A polymerase that is Kapa 2G FAST DN A Polymerase.
- the system includes one or more multi-well plates.
- the system includes DNA extraction reagents. In some embodiments, the DNA extraction reagents are able to be used to extract DNA in 1 5 minutes or less. [00103] In some embodiments, the system includes a cell lysis buffer. In some embodiments, the system includes Proteinase K. In some embodiments, the system includes deoxynucleotide triphosphates (dNTPs). In some embodiments, the system includes MgCS 2 .
- the sample is from a patient or human subject. In some embodiments, the sample is from a tumor or metastatic lesion. In certain embodiments, the sample comprises tissue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated ceil obtained from blood obtained from a subject, or a circulating cancer cell. In some embodiments, the sample comprises a cancer cell . In other embodiments, the sample comprises the sample comprises a tissue biopsy, blood, plasma, serum, cerebrospinal fluid, or one or more circulating cancer cells from the subject. In another embodiment, the sample comprises ti ssue from the subject, or one or more cancer cells from the subject. In some embodiments, the sample is from a skin biopsy. In another embodiment, the sample compri ses at least one component obtained from a body fluid. In yet another
- the body fluid is selected from blood, serum, plasma, cerebrospinal fluid, saliva, urine, semen, stool , lymph, and peritoneal fluid.
- the sample compri es at least one component obtained from blood from a patient or human subject.
- the sample compri ses a circulating cancer cell .
- the sample compri ses at least one component obtained from a body ti ssue.
- the body tissue is an endobronchial brushing or an endotracheal brushing.
- the sample comprises ti ssue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated cell obtained from blood obtained from a subject, or a circulating cancer cell .
- the sample comprises blood from the subject.
- the blood from the subject comprises one or more circulating cancer cells.
- the blood from a subject comprises serum.
- the sample comprises tissue from the subject.
- the tissue from the subject comprises one or more cancer cell s.
- the cancer is selected from the group consisting of: glioma, glioblastoma multiforme, melanoma, small cell lung cancer, non-smal l cell lung cancer, breast cancer, ovarian cancer, melanoma, uveal melanoma, bladder cancer, colon cancer, and lung cancer.
- the cancer is a glioma.
- the glioma i selected from the group consisting of: high grade glioma, diffuse astrocytoma,
- the cancer is a melanoma.
- the cancer is a glioma. high grade glioma, diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, secondary glioblastoma, primary gli oblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
- the sample comprises archival tissue.
- the archival tissue is formalin-fixed paraffin embedded.
- the sample from the subject i s taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and results of the method are avai lable to the surgeon to guide further treatment of the subject during the surgical procedure.
- the method includes subsequent resection of a glioma tumor in the subject.
- the method includes inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
- the method includes calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant al lele detected. In some embodiments, the method includes calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected relative to a standard curve generated from serial dilutions of control DNA.
- the mutant allele has an al lelic frequency of 0.1% of the nucleic acid extracted from the sample.
- the method includes validation of genome editing in cell culture or in an animal model .
- the denaturing is initially done in about 1 round of incubation at about 95 °C for 2-5 minutes, and the annealing and amplifying are done in about 45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds. In some embodiments, the annealing and amplifying are done in about 40-50 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
- the annealing and amplifying are done in about 35-45 rounds of incubation at 95 °C for 1 - 1 2 seconds fol lowed by about 62.5 °C to about 64.5°C for about 10-25 seconds. In some embodiments, the annealing and amplifying are done in about 40-45 rounds of incubation at 95 °C for 1 - 1 2 seconds followed by about 62.5 °C to about 64.5°C for about 1 0-25 seconds.
- the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 62.5 °C to about 64.5°C. In some embodiments, the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 63.5°C.
- the am pi icon is less than 70-300 nt in length.
- the denaturing, annealing and amplifying steps are performed in a therm ocycler with a ramping rate of at least 1.6-3. 1 °C per second.
- FIG. 1 A graphically depicts the sensitive detection of 1DH 1 R 132H in a previously inconclusive brain biopsy.
- FIG. 1 A shows the clinical course of patient with temporal lobe abnormality eventually diagnosed as oligoastrocytoma eight years after initial presentation.
- Thi s 16-year-old patient presented with headaches and Mill revealed a non-enhancing lesion in the left medial temporal lobe (red arrowhead).
- Biopsy was obtained, but was pathologically inconclusive.
- Intraoperative MRI confirmed that the stereotactic needle was centered in the lesion (yel low arrowhead). She was subsequently followed for five years w ith minimal radiographic change. She re-presented with generalized seizures and radiographic progression three years later. At that time she underwent subtotal resection revealing WHO II
- FIG. I B shows results of the method disclosed herein performed on 600 pg of n on -diagnostic biopsy revealing the presence of IDH 1 R 1 3211 mutation with estimated tumor purity of 1 1% (FIG. 10), consistent with the clinical diagnosis of diffuse glioma.
- FIG. 1 shows retrospective Imm unohi stochem i stry ( IHC) performed against IDH 1 R 1 3211 revealed rare tumor cells in initial biopsy (left panel ) compared to specimen obtained eight years later (right panel ). Scale bar i s 20 ⁇ .
- FIG. 2 A shows a plot depicting assessment of mutations in IDH l , and TERT in 80 archived glioma cases. Glioma characterization according to the method di closed herein is based on the presence, absence or co-occurrence of IDH I and TERT.
- Second row represents final conventional neuropathologic diagnosis of each case demonstrating concordance with the method disclosed herein.
- Third row represents clinical assessment of chromosome lp/19p deletion by FISH or aCGH and is demonstrated in black if tested positive and brown if untested.
- FIG. 2B depicts the validation of the method disclosed herein on archived frozen WHO grade II oligodendrogliomas, oiigoastrocytomas, and astrocytomas revealed presence of IDHl R132H or TERT promoter mutations in 39/44 specimens. The samples were validated by targeted high depth sequencing of these genes.
- FIG. 2C depicts assessment of false positive rate in third cohort representing 50 frozen GBM specimens. Two samples were noted by the method disclosed hereinto have IDHl R132H and 39 samples were noted to have either TERT C22ST or TERT C250T. The prevalence of non-scoring specimens in this cohort is the similar to the ratio of non-scoring GBM specimens in FIG. 2 A (p > 0.05 by Fisher' s exact test).
- FIG. 3 graphically depicts intraoperative molecular characterization of glioma.
- FIG. 3 A entitled Case 1 demonstrates the detection of TERT promoter mutation from a specimen that was diagnosed as high grade glioma on frozen section analysis (single arrowhead indicating microvascular proliferation and double arrowhead indicating necrosis) and GBM on permanent section analysis.
- FIG. 3B entitled Case 2 represents an instance of intraoperative detection of IDHl R132 mutation, which was in disagreement with frozen specimen analysis of GBM, but in agreement with permanent section analysis of IDHl mutant anaplastic oligoastrocvtoma.
- Single black arrowhead represents microvascular proliferation
- double arrowhead represents thrombosed vessel within necrotic focus
- green arrowhead represents mitotic figure.
- Scale bars represent 10 urn.
- Figure 4 graphically depicts modified oligonucleotides selectively block exponential
- PNA Peptide nucleic acid
- FIG. 5 graphically depicts locked nucleic acid (LNA) probes are specific for detection of mutant alleles.
- Locked nucleic acid probes were designed for targeting lDH I R132H (FIG. 5 A), 77 ⁇ 7 C228T (FIG. 5B), or 77 ⁇ 7 C250T (FIG. 5C).
- LNA probes selectively detect mutant alleles, but not wild-type (wt) alleles.
- FIG. 6 graphically depicts Sanger sequencing validation of positive and negative control genomic extracts. //>/-/ 7 (FIG. 6A) and TERT promoter (FIG. 6B) amplicons were confirmed by Sanger sequencing. Wild-type controls were obtained from cell extracts from HCC l 143 lymphocytes. 1DH 1 R132H mutant genomic extract was obtained from BT 142 neurospheres. lER J C22ST and TERT C250T controls were obtained from the LN428 and
- Figure 7 graphical ly depicts highly sensitive and specific detection of tumor alleles by the methods disclosed herein. Combination of allele-specific Taqman probes and wild-type allele blockers with modified oligonucleotides allows for sensitive detection of IDH l R132H (FIG. 7A), TERT C22ST (FIG. 7B), and TERT C250T (FIG. 7C) to 0.1% tumor allele fraction.
- Genomic DNA from BT142, LN428, or LN443 was diluted serially in wild-type genomic extracts from HCCl 143 lymphocytes.
- Figure 8 graphically depicts quantitative analysis allows for gross estimation of tumor purity. The method disclosed herein performed in the presence of modified PNA
- oligonucleotides allows for gross estimation of tumor purity hen tumor genomic extract is serially diluted in wild-type genomic extract (red diamonds, wild-type).
- Figure 9 graphically depicts previously inconclusive biopsy specimen with estimated tumor purity of 1 1% by the method disclosed herein. Standard curve was generated by serial dilution of genomic extract containing IDHl R 1 2H mutant alleles with wild-type genomic extract. The /7 ) 7/ 7 R132H detection signal crossed threshold at 42.5 cycles (red dot) which corresponds with -64 pg starting mutant genomic extract (1 1% of the starting material of 600
- FIG. 10 graphically depicts TERT promoter am pi icon characterization by deep sequencing in non-scoring and discordant samples noted in FIG. 2 A reveals accurate targeted genotyping by the method disclosed herein.
- PGR amplicons of the TERT promoter were generated in the samples that were discordant between molecular characterization and clinical pathologic diagnosis and subjected to high depth sequencing (mean depth 250,000x).
- Positive controls for TERT C228T and TERT C250T were also run in parallel . Fraction of mutant alleles detected by high depth sequencing is displayed in white text within respective TERT mutations.
- the TERT C250T mutation was observed at an allelic fraction of -10% by Mi Seq in the one sample that was characterized as diffuse astrocytoma, but noted to have a co-mutation of // ) /// and TERT C250T by the method disclosed herein.
- the other seven samples in which no TERT promoter mutations were observed were also wild-type by high depth sequencing of the amplicon.
- FIG. 1 1 A Expanded heatmap from FIG. 2 A demonstrating individual IDH 1 R132H, TERT C22&T and TERT C250T mutations for each glioma specimen. Glioma diagnoses were predicted as primary glioblastoma if //Ji? 7 mutant and E3H1 R 1 2 wild- type (FIG. 1 IB), oligodendroglioma if TERT and IDH 1 R132H mutant (FIG.
- Figure 12 graphically depicts a proposed workflow of intraoperati ve analysis of biopsy specimen. Specimen is immediately placed in lysis buffer and incubated at 55 C en route to pathology lab. DNA extraction is completed with magnetic beads. This sample is applied to a plate already containing the optimized mastermix to detect IDH 1 R132H, TERT ' C228T or TERT C250T with respective positive controls. The rapid qPCR protocol allows for detection of these mutant alleles within 30 minutes.
- Figure 13 graphically depicts a list of primers, detection probes and modified oligonucleotide blockers. Modified locked nucleic acids are indicated by a preceding "+”.
- Figure 14 A graphically depicts the rapid detection of TERT promoter mutant alleles to discriminate malignant skin pathology and detection of cell free alleles in serum correlates with systemic disease burden.
- Figure 14B graphically depicts the rapid detection of TERT promoter mutant alleles showing cell free DNA from serum of patient with newly diagnosed metastatic melanoma was positive for TERT C22%T. Similarly purified cell free DNA from a patient with non-small cell lung cancer (NSCLC) was negative for TERT promoter allele mutants.
- NSCLC non-small cell lung cancer
- Figure 15 graphically depicts a proposed workflow of the application of the method disclosed herein to detection of cell free mutant alleles in serum .
- Blood is collected in an EDTA-containing tube. Serum isolated by serial centrifugation. Cell free DNA extraction is completed by kit. This sample is analyzed and quantified. Normalized sample is applied to a plate already containing the optimized mastermix to detect IDHl R132H, TERT C228T or TERT C250T with respective positive controls, and analyzed by the method disclosed herein.
- Figure 16 graphically depicts the detection of cell free circulating mutant TERT promoter allele C228T DNA in a sample from a patient with glioblastoma multiforme recurrence, not responding to concurrent chemoradiation.
- Cell free DNA was purified from serum of patient obtained at time of clinical and radiographic progression of GBM in middle of postoperative concurrent chemoradiation.
- the method disclosed herein detected presence of TERT C22ST .
- 100% genomic extract from LN428 and 1% LN428 extract diluted in wild-type HCC1 143 lymphocytes is overlayed.
- Figure 17 graphically depicts a table of cell free circulating DNA samples.
- Figure 18 graphically depicts the detection of cell free circulating TERT C228T in a patient with metastatic melanoma.
- FIG. 19 graphical ly depicts the detection of decreased cell free circulating TERT
- Figure 20 graphically depicts the detection of cell free circulating TERT C228T to define the primary contribution to systemic disease.
- Figure 21 graphically depicts the detection of cell free circulating TERT C228T in a patient with lung carcinoid.
- Figure 22 graphically depicts the rapid and sensitive detection of BRAF promoter mutant alleles.
- the present disclosure provides sensitive methods that detect cancer-speci ic mutations in specimens, by including the following features: (1) forward and rev erse primers to a target sequence, (2) inclusion of modified oligonucleotides with peptide nucleic acid (PNA) backbones to block logarithmic amplification of wild-type alleles, and (3) incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity.
- PNA peptide nucleic acid
- LNA locked nucleic acids
- wild-type allele means an allele of a gene which has the highest gene frequency in a given population.
- this population is a population of humans in a certain geographical area. This area can be a continent, country, state, province or municipality. In certain embodiments, the population can be a human population separated by gender, race, national origin or age.
- wild-type allele refers to an allele that is not associated with higher prevalence of occurrence of a disease state relative to a "mutant allele” that is associated with a higher prevalence of occurrence of a disease state.
- that disease state is cancer.
- the cancer is melanoma or glioma.
- genetic information and “gene” as used herein include various components associated with the chromosomal locus that encodes a functional sequence. In most
- a "gene” includes not only a transcriptional coding region which encodes information of niRNA, iRX. Y. rR A, snRNA, and the like, but also includes one or more regulatory regions such as a promoter or enhancer which is required for gene expression. Where appropriate, one or more of these regions may be distinguished individually, e.g., a promoter sequence or a coding sequence.
- mutant allele means an allele of a gene which is associated with one or more disease aspects. As used herein a mutant allele does not have the highest gene frequency in a given population. This mutant allele could have the second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth highest gene frequency among known alleles in a population. As explained above, in certain embodiments, this population is a population of humans in a certain geographical area. This area can be a continent, country, state, province or municipality. In certain embodiments, the population can be a human population separated by gender, race, national origin or age.
- mutant allele refers to an allele that is associated with higher prevalence of occurrence of a disease state relative to a "wild-type allele” that is not associated with a higher prevalence of occurrence of a disease state.
- that disease state is cancer.
- the cancer is melanoma or glioma.
- the cancer is a glioma, high grade glioma, diffuse astrocytoma, oligodendroglioma, ol igoastrocytoma.
- mutants as used herein means a change in the sequence of a nucleic acid such as DNA and RNA, and includes a base substitution, insertion, deletion, inversion, duplication, translocation, and the like used in genetics and the like. In certain embodiments, this mutation represents the physical genetic difference between a wild-type allele and a mutant allele.
- the region of the mutation in a mutant allele is not limited to a transcriptional region, but includes a regulatory region such as a promoter which is required for gene expression. In this regard, the mutation in a mutant allele does not require a functional change.
- variant refers to an alteration in the normal sequence of a gene.
- a variant may include a single nucleotide polymorphism, a mutation, or a gene copy numb er van ati on .
- single nucleotide polymorphism refers to a single substitution of a nucleotide base for another at a particular site that occurs in more than 1% of the general population of a species.
- a single nucleotide polymorphism can have up to four possible versions at its site: A, C, G or T.
- Single nucleotide polymorphisms occur about once in every 300 nucleotide base pairs in the human genome.
- Linked or indicative SNPs are not located within genes and do not affect function of a protein.
- Causative SNPs include coding and non- coding SNPs, and affect protein function.
- Coding SNPs are found in the coding region of a gene and change the amino acid sequence of the coded protein product. Non-coding SNPs are found in the regulatory regions of a gene, and affect expression of the gene, including amount, timing and/or location of the gene's expression.
- “somatic variant” refers to an alteration of DNA that occurs in any cell of the body other than the germ cells, and is neither inherited from a parent nor passed to offspring.
- molecular diagnosis refers to a diagnostic technique utilizing the analysis of one or more molecular and/or biological markers that define disease state, and can be used for diagnosing, monitoring or staging a disease, determining risk, or determining a therapeutic approach.
- target site means a site in which a mutated base exists or a base is deleted by a mutation in a mutant allele, and a site to be detected as a target using the methods disclosed herein, including a wild-type allele.
- the target site is a base which is substituted in both a wild-type allele and a mutant allele.
- the target site in a mutant allele is an inserted base
- the target site in a wild-type allele is a site into which the base is inserted in the mutant allele.
- the target site in a mutant allele is a site in which a base is deleted by the deletion, and the target site in a wild-type allele is the deleted base in the mutant allele.
- the sequence of a target site may be a site having a sequence which encodes genetic information (sometimes referred to as a sense site or sequence), or a site having a sequence complementary to the sense sequence (sometimes referred to as an antisense site or sequence).
- sequence as the sequence with each based changed to its complement pair e.g., G to C, C to G, A to T and T to A.
- reverse complementary of a DNA sequence, as used herein, is the sequence backwards orientation (/ ' , ⁇ ?, the reverse of a sequence as read from 5' to 3 ' would be the sequence from 3 ' to 5'), and with each based changed to its complement pair (e.g., G to C, C to G, A to T and T to A).
- ampiicon means a molecule of DNA or RNA that is the source and/or product of natural or artificial amplification or replication events. It can be formed using various methods including polymerase chain reactions (PGR), ligase chain reactions (LCR), or natural gene duplication.
- PGR polymerase chain reactions
- LCR ligase chain reactions
- ampiicon i As the product of an amplification reaction, ampiicon i s used interchangeably with common laboratory terms, such as PGR product.
- the ampiicon used in the methods disclosed herein can generally be between 70-300 nt in length.
- the ampiicon used in the methods herein can be less than 300, 200, 100, 90, 80 or 70 nt in length.
- the am pi icons used according to the disclosure are 70-80, 70-90, 70-100, 70-200, 70-300, 80-90, 80-100, 80-200, 80-300, 90-100, 90-200, 90-300, 100-200, 100-300 or 200-300 nt in length.
- forward primer refers to a short, single-stranded DNA sequence that binds to a target DNA sequence and enables addition of new deoxyribonucleotides by DNA polymerase at the 3' end, wherein the pri mer binds upstream of a target site and to the sense strand of the target nucleic acid.
- the forward primer is 18-35, 19-32 or 21-31 nt in length.
- the nucleotide sequence of the forward primer is not limited, so long as it speci ically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 °C, may be within a range of 63.3 °C to 63.7 °C, and may be 63.5°C.
- the nucleotide sequence of the forward primer may be manually designed to confirm the Tin value using a primer Tin prediction tool .
- reverse primer refers to a short, single-stranded DNA sequence that binds to a target DN A sequence and enables addition of new deoxyribonucleotides by D A polymerase at the 3' end, wherein the primer binds downstream of a target site and to the antisense strand of the target nucleic acid.
- the reverse primer is 18-35, 19-32 or 20-31 nt in length.
- the nucleotide sequence of the reverse primer is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 C, may be within a range of 6 .3 C to 63.7 °C, and may be 63.5°C.
- the nucleotide sequence of the reverse primer may be manual ly designed to confirm the Tm value using a primer Tm prediction tool .
- PNA Peptide nucleic acids
- PNA Peptide nucleic acids
- PNA is artificial, chemically synthesized nucl eic acid analogues which have a structure in which a basic backbone of a nucleic acid constituted by pentose and phosphoric acid i s replaced with a polyamide backbone having no charge including glycine as units.
- PNA binds more specifically and strongly to a nucleic acid having a complementary nucleotide sequence in comparison with DNA and RNA.
- PNA is a chemical ly synthesized substance, it has a property that nucleic acid polymerases and nucleases do not act thereon.
- PN A includes not only conventional PNA, but also a PNA derivative which is an improvement based on PNA and has properties similar to PNA, for example, gripNA provided by Active Motif.
- PNA blocker as used herein means an oligonucleotide comprising PNA which hybridizes with a target site.
- a PNA blocker comprises an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i .e., inhibit or cause a relative decrease in) amplification of the wild -type allele, and does not block ampli ication of the mutant allele.
- a PN A blocker may compri se a mixture of nucleic acids, PNA, and amino acids.
- a PN A blocker may comprise a backbone containing amide bonds, deoxyribose sugar, ribose sugar, and charged phosphate groups.
- block is intended to mean inhibit or cause a decrease in relative amplification of the targeted wild-type allele to which the PNA blocker hybridizes. Such inhibition or relative decrease in amplification of the wild-type allele allow s sensitivity of the methods disclosed herein in detecting very low copy number of the variant allele.
- the PNA blocker hybridizes to a region of the wild-type allele located within the region amplified by the forward and reverse primer.
- the PNA blocker can be composed of PNA over a portion of its length or the entire sequence. Therefore, when it hybridizes with a nucleotide sequence, it shows an extremely high sel ectivity to the nucleotide sequence due to the properties of PNA.
- the PNA blocker since PNA is not affected by nucleic acid polymerases and nucleases, the PNA blocker does not function as a primer and is resistant to nucleases.
- the nucleotide sequence of the PNA blocker is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tin value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 °C, may be within a range of 63.3 °C to 63.7 °C, and may be 63.5°C.
- the nucleotide sequence of the PNA blocker may be manually designed to confirm the Tin value using a PNA Tm prediction tool .
- the length of the PNA blocker is not limited, so long as it i s 10 to 25 nucleotides.
- the length of the PNA blocker can be 1 2 to 22 nucleotides.
- the length of the PNA blocker can be 1 2 to 19 nucleotides. Since the prevalence of a wild -type gene is larger than that of a mutated gene in a gene pool, the concentration of the PN A blocker may be 2-10 times or more that of the LNA probe in the reaction solution for gene amplification so that the PNA blocker can sufficiently hybridize with the wild-type gene. For example, when the concentration of the LNA probe is 100 nmol/L, the concentration of the PN A blocker i s approximately I umol/L, or approximately 5 ⁇ /L.
- Locked nucleic acids are artificial, chemically synthesized nucl eic acid analogues compri sing an RNA nucleoside in which the 2' oxygen and 4' carbon of the ribose moiety are chemically linked (e.g., by a methylene bond).
- LNA has high affinity for a nucleic acid having a complementary nucleotide sequence, and binds thereto more specifically and strongly in comparison with DNA and RNA.
- LNA has sensitivity against nucleases, and may also act as a primer for nucleic acid polymerases.
- LNA as used herein includes not only conventional LN A, but al so a LNA derivative which is an improvement based on LNA and has properties similar to LNA.
- LN A probe as used herein means a probe which hybridizes with a target site, and at least one nucleotide contained in the DNA sequence of which is replaced with LNA.
- Thi s embodiment is characteri zed by the fact that the nucleotide sequence of the LNA probe is a sequence complementary to that of the mutated gene.
- the LNA probe hybridizes to the target sequence at a location that i s between where the forward primer and reverse primer binds.
- the nucleotide sequence of the LNA probe is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62,5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 C, may be within a range of 63.3 C to 63.7 °C, and may be 63.5°C.
- the nucleotide sequence of the LNA probe may be manually designed to confirm the Tm value using an LNA Tm prediction tool.
- the number of nucleotides contained in the LNA probe is 10 to 50 nucleotides, and may be 15 to 25 nucleotides.
- the length of the LN A probe can be 12 to 22 nucleotides.
- the length of the LNA probe can be 12 to 19 nucleotides.
- the number of LNA present within the LN A probe is not limited, so long as it is one or more, and all the nucleotides may be replaced with LNA.
- a position at which a nucleotide is replace with LNA in the LNA probe when there are one or more bases which are not found in a target region of a wild- type gene, at least one of these bases may be replaced with LNA. For example, in the case that a mutation is an insertion of some bases, at least one of the inserted bases may be replaced with LNA.
- the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can also be about 62.5 °C to about 64.5°C, may be about 63.0 °C to about 64.0 °C, may be about 63.3 °C to about 63.7 °C, and may be 63.5°C.
- the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can be about 63.5°C to 63.7°C.
- the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can be about 63.5°C.
- the Tm values may be determined using the disclosed buffer conditions. Other primer lengths and Tm values known in the art may be used where appropriate, e.g., where different buffer systems are used, and/or where stringency requirements differ.
- PCR polymerase chain reaction
- D A denaturation, annealing and enzymatic elongation of the amplified DNA Components of PCR include primers that contain sequences which are complementary to the target region(s), and a DNA polymerase.
- the DNA generated (sometimes called the amplicon) is itself used as a template for further replication, creating a chain reaction that exponentially amplifies the DNA template.
- PCR can be extensively modified to perform a wide array of genetic manipulations.
- PCR methods generally use DNA polymerase that is heat-stable, such as Taq polymerase (originally isolated from J hem s aqiiaticus).
- the DNA polymerase generates a new strand of DNA from nucleotides, where a single-stranded DNA is used as a template and DNA oligonucleotides or primers, are used for initiation of DNA synthesi s.
- PCR methods generally use thermal cycling, which is alternate heating and cooling of the PCR reaction through a set series of temperature steps.
- the strands of the DNA are separated at a high temperature in a process called DNA melting or denaturing.
- the temperature is lowered, allowing the primers and the strands of DNA to selectively anneal, creating templates for the polymerase to amplify the target DNA .
- Use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions allows for selectivity of the reaction.
- DN A template that contains the target region of interest to be amplified
- two primers that are complementary to the 3' (three prime) ends of each of the sense and anti -sense strand of the DNA target (a forward primer and a reverse primer);
- a DNA polymerase with a temperature optimum at around 60-70 °C; deoxynucleotide triphosphates (dNTPs);
- dNTPs deoxynucleotide triphosphates
- buffer solution providing a suitable chemical environment for optimum activity, binding kinetics, and stability of the DNA polymerase
- bivalent cations such as magnesium or manganese ions
- Mg 2 is used, but Mn 2+ can be used, where higher Mn ⁇ " concentration can increase the error rate of the DNA polymerase; and monovalent cations, such as potassium ions.
- PCR can comprise a series of 20-50 repeated temperature cycles, with each cycle commonly consi sting of 2-3 discrete temperature steps. Temperatures and the duration of each step can vary depending on a number of parameters. These include the enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the reaction, and the melting temperature (Tm) of the primers. Some typical PCR steps include the following:
- Initial step This step involves heating the reaction to a temperature of about 94-96 °C which can be held for about 1-9 minutes. In the present disclosure, methods may not require or include this initial step. In some cases, this step is performed at about 5 °C for 2-5 minutes.
- Denaturing step This step involves heating the reaction to 94 -98 °C for 1 -12 seconds. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between complementary bases, yielding single-stranded DNA molecules. In the present di sclosure, denaturing may be done at about 95 °C for 1 - 12 seconds.
- Annealing step The reaction temperature is lowered to 50-65 C for 10-25 seconds which allows the primers to anneal to the single-stranded DNA template.
- the polymerase then binds to the hybridized primer and template and begins DNA polymerization.
- the annealing step may be done at about 62.5 °C to 64.5 °C for about 10-25 seconds.
- thi s step is performed at about 63.5 °C.
- Extension/elongation (or amplifying) step This step generally uses a temperature of about 60-72 °C with a DNA polymerase enzyme. At this step, the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5' to 3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand.
- the extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified.
- the amplifying step may be done at about 62.5 C to 64.5 C for about 10-25 seconds. In some cases, this step is performed at about 63.5 °C.
- extension/elongation step In other words, the annealing and amplifying steps occur at the same temperature condition and during the same amount of time. Such modification optimizes the process for shorter total reaction times, resulting in a method that is useful for applications requiring a rapid process as described herein.
- the annealing and amplifying can occur in a single step at about 62.5 °C to 64.5 °C for about 10-25 seconds. In some cases, the annealing and amplifying can occur in a single step performed at about 63.5 °C for about 10-25 seconds.
- the annealing and elongation steps occur at the same temperature conditions, allowing optimization to the method for applications where a rapid process is desired.
- Quantitative PCR measures the accumulation of DN A product after each round of PCR amplification in order to measure the quantity of a target sequence (such measurement often occuring in real-time).
- Quantitative PCR can be used to determine whether a particular sequence is present in a sample, and to determine the number of its copies in the sample.
- Quantitative PCR often methods use fluorescent dyes, such as Sybr Green, EvaGreen or tl uoropho e-contai ni ng DN A probes, such as TaqMan, to measure the amount of amplified product during the reaction in real time.
- fluorescent dyes such as Sybr Green, EvaGreen or tl uoropho e-contai ni ng DN A probes, such as TaqMan
- the system and methods herein are desi ned to generate sensitive detection of alleles with v ery low prev alence, through the inclusion of modi ied oligonucleotides with peptide nucleic acid (PNA) backbones to block logarithmic amplification of wild-type alleles, and incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity.
- PNA peptide nucleic acid
- LNA locked nucleic acids
- the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature conditions, allowing the annealing and elongation steps to occur at the same temperature conditions, thereby optimizing the method for applications where a rapid process is desired or required.
- the system and methods herein are optionally adapted to overcome the low complexity and/or high GC content of a target sequence, and/or to detect cancer-specific mutations in specimens with low tumor size, mass and/or density.
- a PNA blocker comprising PNA having a sequence complementary to a target site of a wild-type gene, and an LNA probe having a sequence complementary to a target site of a mutant allele and comprising DNA that contains LNA, are allowed to contact a forward primer, a reverse primer, and a DNA template in a buffer or reaction solution for gene amplification. Since wild-type genes are generally present in a sample DNA in large amounts, the PNA blocker is added in slight excess amount. As a result, the PNA blocker, the LNA probe, and the forward primer and reverse primer hybridize with the respective corresponding complementary sequences on the genes to be detected.
- the resulting reaction solution for gene amplification is subjected to a primer elongation reaction using a gene amplification method. Since the PNA blocker does not function as a primer, no elongation reaction occurs from it. Therefore, the amplification of the detection region comprising the target site of the wild-type gene is suppressed by the hybridization of the PNA blocker. In contrast, LNA does not exhibit an inhibitory activity to primer elongation like PNA. Since the LNA probe can function as a primer, an elongation reaction occurs, and the region comprising the target site of the mutant allele is amplified over the LN A probe site and between the forward primer and reverse primer.
- the melting temperature T m ) of the ampiicon is the temperature at which one half of the DNA duplex will dissociate and become single stranded.
- the stability of a primer-template DNA duplex can be measured by the melting temperature (T m ).
- T m melting temperature
- Low sequence complexity and/or high GC content can result in an ampiicon having a melting temperature that is relatively higher than a sequence with greater sequence complexity and/or lower GC content.
- the Tm of the ampiicon is generally about 62.5 °C to about 64.5 °C.
- the length of the extension cycle required can be affected by ampiicon size. In the methods of the present disclosure, the extension cycle is shorter (in part due to ampiicon size designed to be shorter) to allow for faster extension of the ampiicon.
- the length of extension steps can also be affected by the DNA polymerase used. DNA polymerases used in the present methods are described herein.
- the PNA blocker, the LNA probe, and the forward primer and the reverse primer are again hybridized with the corresponding complementary sequences on the genes to be detected.
- the cycles of gene amplification reaction are repeated by to selectively amplify a region comprising sequence of the mutant allele.
- the number of the cycles varies in accordance with the type of a DNA polymerase used, and is not limited, so long as it is within a range of 30 to 55 cycles. It can be 35 to 50 cycles. In particular, it can be 40 to 45 cycles.
- the denaturing, annealing and amplifying steps can be done in about 3 -50 rounds of incubation at 95 °C for l - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds.
- the quantitative PCR method comprises the following conditions. Forward and reverse primers for a target site of a gene are designed and empirically optimized for an anneal/elongation temperature of 63.5 C. 5' Nuclease probes against mutant alleles and corresponding PNA oligonucleotide blockers against wild-type alleles are designed to detect mutations in the target site of the gene. Optimal sensitivity was achieved through the use of two distinct gene wild-type PNA blocking oligonucleotides designed to these two respective sites. Similarly, 5'Nuclease probes and the PNA wild-type blockers were designed for optimal performance at 63.5 C for the respective genomic templates.
- the primers for a target site of a gene include, but are not limited to, SEQ ID NOs: 9, 43, 52, 66, 67, 83, and 93 for forward primers and SEQ ID NOs: 10, 44, 53, 68, 69, 83, and 94 for reverse primers.
- the primers for a target site of a gene were used at final concentrations of 250-750 nM.
- the LNA probes for a target site of a gene include, but are not limited to, SEQ ID NOs: 46, 50, 56, 61, 68, 75, 79 and 85
- the LNA probe comprising locked nucleic acids for detection of a mutation in the target site of the gene was 250 nM.
- the peptide nucleic acid (PNA) probe for blocking wild-type gene amplification was 150- 900 nM.
- qPCR reactions were run in 384-well plates on an ABI QuantStudio 6 instrument (Applied Biosystems) in the presence of 60 nM ROX to account for background fluorescence.
- Appropriate buffers include ABI GeneExpression 2X mastermix or KAPA 2G Fast Polymerase buffer A and enhancer to a final concentration of Ix. PGR cycling times were 95 C for 3 minutes followed by 40-60 cycles at 95° for 10 seconds and 63.5 C for 20 seconds.
- the qPCR reactions were run in 96- ell plates on an ABI 7500 instrument (Applied Biosystems).
- the region of sequence which is derived from the mutant allele and amplified by the method is detected.
- the detection method is not limited, so long as the amplification of the region of the mutant allele can be confirmed.
- the 5' terminus of the amplification primer may have been previously labeled with a fluorescent substance, and after the completion of the gene amplification reaction, fluorescent emission may be captured and detected using an appropriate detector. In these detection methods, results can be compared to the measured values with the results of an appropriate control. Further, confirmation of the presence of the target site of the mutant allele in the amplified product can be made by sequencing, or other method, including but not limited to immunohistochemistry, where available. Polymerases
- the system and methods provided herein are designed to give rapid and quantitative detection of a single nucleotide variant or polymorphism from a sample, and utilizes DNA Polymerase.
- a DNA Polymerase with a high rate of elongation can be used to optimize the amount of time needed to complete the quantification of the target site in the sample, facilitating a more rapid process.
- a polymerase such as has an elongation rate of about l kb/second.
- the DNA polymerase can be a high-speed DNA polymerase such as Kapa 2G FAST DNA Polymerase (Kapa Biosystems). Buffers
- the buffers or reaction solutions as described herein refer to a solution or solutions containing reagents and the like which are required for the gene amplification reaction in the gene amplification method.
- the formulation of the reaction solution for gene amplification may need minor modifications depending on the gene amplification method used, but the reaction solution for gene amplification basically contains 4 kinds of deoxynucleoside triphosphates (dATP, dTTP, dCTP, and dGTP: hereinafter collectively referred to as dNTPs) as substrates, a DNA polymerase as an enzyme, a magnesium ion as a cofactor for the enzyme, and
- amplification primers as primers for elongation, in a buffer.
- concentrations of dNTPs may be selected within a range of 100 nrnoi/L to 400 nmol/L as a final concentration of each.
- a DNA polymerase having properties suitable for the gene amplification method used may be used.
- concentration of the magnesium ion may be selected within a range of I mmol L to 6 mmol/L as a final concentration.
- the buffer has an optimum pH and an optimum salt concentration capable of obtaining the activity of the DNA polymerase.
- Various types of reaction solutions for gene amplification are commercially available for each gene amplification method, and one attached to such a commercially available kit may be used.
- the system disclosed herein can be part of a kit, optionally including further components for use in the methods disclosed herein, or for other uses.
- the kit can include DNA extraction reagents, in particular DN A extraction reagents which are suitable and/or designed for rapid extraction of DNA from a sample.
- Kits can provide primers and LNA and PNA components that are specific for at least one target nucleic acid.
- a kit generally comprises the forward primer, reverse primer, LNA probe and PNA blocker for at least one target nucleic acid.
- the target nucleic acid can be a region of the TERT promoter, such as one or both somatic variants C228T and C250T, as further described herein.
- the LNA probe can hybridize to a nucleotide region comprising a T at position 228 or 250, respectively, of the mutated allele of the TERT promoter and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wild type allele.
- the target nucleic acid is a region of the IDH1 gene, such as the nucleotide sequence encoding a somatic mutation at position 132 of the polypeptide.
- the LNA probe can hybridize to a nucleotide region comprising a mutated codon encoding an amino acid selected from one or more of a histidine (“H"), cysteine (“C”), glycine (“G”), serine (“S”) and leucine (“L”) at position 132 of the mutated IDH 1 protein and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding an arginine ("R”) at the corresponding position in a wild type allele.
- H histidine
- C cysteine
- G glycine
- S serine
- L leucine
- kits can compri se primers, probes and blockers for more than one target nucleic acid, such as a kit comprising primers, probes and blockers for a variant of the TERT promoter, and primers, probes and blockers for one or more variants of the IDH1 gene.
- Intraoperative histopathology can be technically challenging in the setting of low eel hilarity lesions and smal l biopsy specimens, and these difficulties may hamper surgical decision-making.
- Cancer genome sequencing has revealed that many tumors can now be positively identified by recurrent genomic features. For instance, greater than 80% of gliomas can be identified and clustered by IDH 1 and TERT promoter mutations, within groups that correspond closely to existing hi stopathologic classification.
- research techniques have applied real-time PCR detection of IDH I mutation or mass spectrometry to the
- the method disclosed herein is designed to simultaneously detect the di stinguishing genomic features in both the TERT promoter and // ) /// in an intraoperative timeframe to sensitively detect diffuse glioma and guide neurosurgical resection.
- the methods prov ided herein could be used for real-time intraoperative diagnosis.
- the intraoperative diagnosis can be used to confirm a diagnosi s.
- intraoperative diagnosi s allows for intraoperative therapy.
- the intraoperative therapy may comprise resection, thermal ablation therapy, laser microsurgery, or targeted therapy at the time of operation
- the methods of the present disclosure are designed to be done in a very rapid fashion, in order to enable intraoperative decision making and guidance of subsequent operative steps, including resection of the detected or graded tumor or lesion. These methods are capable of being performed within 30 minutes of the completion of DNA extraction. With rapid extraction techniques allowing extraction of sample DN A within 1 5 minutes, the result is a method which i s capable of providing sensitiv e results to the surgeon within 45 minutes, thus allowing the surgeon to act on the results within an intraoperative timeframe.
- the methods of the present disclosure are also very sensitive at detection of single nucleotide polymorphisms and somatic variants. Through the use of optimized probes and wild- type blocking oligonucleotides, we show detection as low as 0.1% mutant allele fraction in an intraoperative timeframe.
- a further application of the methods described herein takes advantage of their high sensitivity to detect single nucleotide polymorphisms or somatic variants in cell free circulating DNA, such as detection of cell free circulating tumor DNA, which may be present in blood or serum are very low levels not detectable by other means.
- the method can include calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected.
- Rapid and sensitive molecular characterization by this assay could guide the decision to pursue a maximal upfront resection of gliomas, obv iating the need for a staged craniotomy pending final pathologic confirmation.
- the ability to obtain intraoperative molecular information allows for the future possibility of administering direct intratumoral therapy.
- Another direct application of this assay would be to quantify the extent of residual di sease at the surgical margin and incorporate that information into postoperative oncologic treatment planning.
- targeted analysis of IDH1 and TERT promoter mutations with minimal tissue requirement could accurately characterize and stratify glioma subtypes, with potential implications for prognosis and clinical trial design .
- the sample from the subject is taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and results of the method are available to the surgeon to guide further treatment of the subject during the surgical procedure.
- the method can include subsequent resection of a glioma tumor in the subject.
- the method can include inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
- a second challenge is the low abundance of tumor- specific alleles circulating as cell free DNA fragments, which is addressed by the abi lity of the present methods to detect in cell free DNA fragments variants such as TERT C22ST or TERT C250T,
- the methods can be used with as little as 25 pg starting genomic material to detect circulating cell free DNA variant in a patient at any stage in the patient' s disease.
- the present methods can be used to detect circulating cell free DNA variant at a later timepoint post- treatment, supporting determination of disease progression and/or clinical treatment response.
- the diagnosis, prognosis and assessment of therapeutic treatment of diseases or disorders can be facilitated by the sensitive detection of single nucleotide polymorphisms or somatic variants using the systems and methods described herein.
- the methods and systems can be used to detect a mutant allele or alleles in one or more target nucleic acids. By quantifying the amount of the mutant allele( s) in a sample relative to a control, the likelihood of the presence of the di sease or disorder can be determined for a subject.
- Prognosis can be determined by detecting a mutant allele or alleles in one or more target nucleic acids, and. quantifying the amount of the mutant allele(s) in a sample relative to a control. In thi s way, the prognosis of a disease or disorder can be determined for a subject. In addition, the assessment of a targeted therapeutic approach can be facilitated by detecting a mutant allele or alleles in one or more target nucleic acids, and quantifying the amount of the mutant allele( s) in a sample relative to a control . In thi s way, the effectiveness of the targeted treatment on the di sease or disorder can be determined.
- the methods and systems described herein are used to detect or diagnose melanoma. In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of melanoma. In certain embodiments, mutations in BRAF, NRAS and/or TERT are used to detect, diagnose or detect an increased risk of the presence of melanoma. In some embodiments, mutations in BRAF, NR AS and/or TERT are detected in cell free DNA. This cell free DNA can be isolated from blood, serum or plasma.
- Mutations in BRAF, NR AS and/or TERT can also be detected in tissue samples.
- the detection of mutation in these genes can be used prognostic indicators for melanoma.
- mutations in these genes can be used for assessing a therapeutic response to melanoma.
- the mutation in NRAS is one that leads to a Q6IR or Q61K mutation in the protein encoded by this gene.
- the mutation in TERT to the promoter of this gene.
- the method s and systems can take ad vantage of the occurrence of somatic single nucleotide variants targeting the Q61 codon of NRAS occurs in 10-25% of cutaneous melanoma (Tsao, H., et al. (2012); Genes Dev., 26: 1 131-1 155), and thereby facilitate the detection of Q61 variants for the diagnosis of melanoma. Because patients undergoing therapies targeting mutant BRAF have been found to develop resistance through mechanisms that result in mutations to the NRAS Q61 codon (Van Allen E, et al . (2014); Can Disc.
- the methods and systems described herein are used to detect or diagnose uveal melanoma. In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of uveal melanoma. In certain embodiments, mutations in BRAF, GNAQ, GNA 1 1 and/or TERT are used to detect, diagnose or detect an increased risk of the presence of uveal melanoma. In some embodiments, mutations in BRAF, GNAQ, GNAl 1 and/or TERT are detected in cell free DNA. This cel l free DNA can be i solated from blood, serum or plasma. Mutations in BRAF, GNAQ, GNA 1 1 and/or TERT can al so be detected in tissue samples.
- the detection of mutation in these genes can be used prognostic indicators for uveal melanoma. In other embodiments, mutations in these genes can be used for assessing a therapeutic response to uveal melanoma. In certain embodiments,
- the mutation in G AQ is one that leads to a R 1 83Q, Q209L or Q209P mutation in the protein encoded by this gene.
- the mutation in GNAl 1 i s one that leads to a Q209L mutation in the protein encoded by thi s gene.
- the methods and systems described herein are used to detect or diffuse intrinsic pontine glioma (DIPG), In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of DIPG. In certain embodi m ents, mutati ons i n H3F3 A are used to detect, diagnose or detect an increased risk of the presence of DIPG. In some embodiments, mutations in H3F3A are detected in cell free DMA. This cell free DNA can be isolated from blood, serum, plasma, or cerebrospinal fluid.
- Mutations in H3F3 A can al so be detected in tissue samples.
- the detection of mutation in these genes can be used prognostic indicators for DIPG.
- mutations in these genes can be used for assessing a therapeutic response to DIPG.
- the mutation in H3F3A is one that leads to a K27M or G34R mutation in the protein encoded by thi s gene.
- Diffuse intrinsic pontine gliomas are diffusely infiltrative malignant glial neoplasms that arise in the brainstem during childhood ( Panditharatna E., et al . (2015); Cancer Genet. 208, 367-373 ). These tumors are highly aggressive and ultimately fatal . More than 70% of diffuse intrinsic pontine glioma, one-third of pediatric glioblastoma and nearly 20% of pediatric anaplastic astrocytoma have recently been found to harbor recurrent mutations in H3F3A (Schwartzentruber, J. et al. (20 1 2); Nature 482, 226-23 1, Wu, G. et al. (20 12); Nat. Genet.
- the methods herein can also include the experimental validation of genome editing in cel l culture or in an animal model .
- applications of these methods can be used with archival tissue.
- the archival tissue is in a formalin-fixed paraffin embedded sample.
- Optimal sensitivity was achieved through the use of two distinct TERT w ild-type PNA blocking oligonucleotides designed to these two respective sites. Similarly, 5 ' Nuclease probes and the PNA wild-type blockers were designed for optimal performance at 63.5 C for the respective genomic templates.
- the primers for IDH 1 were 5'-CCGGCTTGTGAGTGGATGGGTAAAACCT-3 '
- the TaqMan probe for detection of the IDH I R132H mutation was 250 nM 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3 ' (with the locked nucleic acid being denoted by a preceding +; SEQ ID NO: 36) (Exiqon).
- the peptide nucleic acid (PNA) probe for blocking wild-type IDH I amplification was 900 iiM 5'- AGGTCGTC ATGC-3 ' (SEQ ID NO: 20) (PNA Bio).
- the primers for TERT were 5 ' -C ACGTGCGC AGC AGGACGC AG-3 ' (SEQ ID NO: 9) and 5'-CTTCACCTTCCAGCTCCGCCTC-3 ' (SEQ ID NO: 10) used at 500 nM.
- the TaqMan probe for detecting TERT C228T was 250 nM 5 ' -FAM-
- TERT C250T is 250 nM 5'- FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3 ' (SEQ ID NO: 16).
- the PNA probes for blocking amplification of TERT C22S and TERT C250 were 150 nM 5'- CCCAGCCCCCTCCGGGCCC-3 ' (SEQ ID NO: 1 1) and 500 nM 5'- CCGACCCCTCCCGGGTCCC-3 ' (SEQ ID NO: 12), respectively.
- TERT promoter and IDH 1 control templates were validated by Sanger sequencing (FIG. 6).
- the method design allowed for simultaneous parallel detection of IDH 1 and TERT promoter mutations.
- the IDH I R132H detection probe was labeled with a FAM moiety while the lower frequency R132 detection probes were labeled with a MAX moiety to allow for simultaneous detection of canonical and non-canonical IDH I alterations.
- IDH 1 R132H, R 132S, R 132C, R 132G, R 132L, TERT C228T, or TERT C250T could be detected in samples harboring as low as 0.1% mutant allele fraction (FIG. 7).
- ol i odendrogl i om a by hi stological examination also had been analyzed for deletion of chromosome I p and 19q by fluorescence in situ hybridization (FISH ) or array comparative genomic hybridization (aCGH).
- FISH fluorescence in situ hybridization
- aCGH array comparative genomic hybridization
- FFPE specimens were extracted using Qiagen QIAamp FFPE kit using manufacturer's recommended protocol. Intraoperative or fresh tissue specimens were extracted using
- Circulating cell free DNA was i solated from 5ml of fresh peripheral blood using the Qiagen Circulating Nucleic Acid Isolation kit following manufacturer's protocol and quantified by PicoGreen and visualized by Agilent BioAnalyzer.
- BT 142 cell line (ATCC), which is hemizygous for the 1DH I R 132H mutation
- TERT promoter mutations without an 11) I mutation were detected in 17/22 GBM, a frequency consistent with prior reports (Killela PJ, et al., Proc Natl Acad Sci U S A 2013; 110(15):6021-6; Nonoguchi N, et al., Acta Neuropathoi (Berl) 2013; 126(6):931-7; Koelsche C, et al, Acta Neuropathoi (Berl) 2013; 126(6):907-15). To confirm mutation status in the eight discordant cases, these tumors were additionally analyzed at the TERT promoter by high depth next generation sequencing to a mean of 250,Q00x coverage (FIG. 10).
- FIG. 2A Retrospective central neuropathology review confirmed that seven of these frozen section preparations were inconclusive. This underscores the potential value of molecular characterization to assist in establishing an intraoperative diagnosis, and led us to evaluate the method disclosed herein in a second validation cohort of 44 archived frozen WHO grade II diffuse gliomas. We were able to detect either IDH1 R132H or TER T promoter mutations C228T or C250T in 39/44 frozen diffuse glioma specimens ( FIG. 2B). Four of the five cases that did not score by the method disclosed herein were found to have alternative IDH 1/2 mutations by targeted high-depth sequencing. To further explore the possible false positive rate associated with the method disclosed herein, we analyzed 50 frozen GBM specimens (FIG.
- TERT promoter mutations are found in diverse cancer types, many of which are biopsied in the outpatient setting. Given that over 70% of melanoma harbor a mutation in the TERT promoter (F. W. Huang et al., Science. 339, 957 -959 (2013), S. Horn et al, Science. 339, 959 -961 (2013), J. Vinagre et al , Nat. ommim. 4, 2 1 85 (2013)), we tested whether the method disclosed herein could be used for discriminating benign from malignant skin lesions.
- the BT 142 cell line (ATCC), which is hemizygous for the IDH1 R132H mutation (H. A. Luchman et al. , Nearo-Oncol. 14, 1 84- 19 1 (20 1 2); H. A. Luchman, et al ., Neuro-Oncol. 15, 979 -980 (2013)) was grown under standard conditions.
- the TERT C22ST and TERT C250T control templates were generated from primary glioma cell lines LN428 and LN443, respectively. Neurospheres were harvested and the cell pellet was extracted using the QiaAMP kit (Qiagen). DNA extracts were quantified by PicoGreen dye ( Inv itrogen) and normalized to 25 ng/ ⁇ iL in Tris-EDTA. Quantitative PCR primers and conditions
- the primers for TERT are 5 ' -CACGTGCGC AGC AGGACGC AG-3 ' (SEQ ID NO: 9) and 5'-CTTCACCTTCCAGCTCCGCCTC-3' (SEQ ID NO: 10) used at 500 nM.
- the TaqMan probe for detecting TERT C22ST is 250 nM 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3' (SEQ ID NO: 15) and TERT C250T is 250 nM 5'-FAM-CCGACCCC+T+TCCGGGTCCC-
- the PNA probes for blocking amplification of TERT C22S and TERT C250 are 150 nM 5'-CCCAGCCCCCTCCGGGCCC-3' (SEQ ID NO: 11) and 500 nM 5'- CCGACCCCTCCCGGGTCCC-3' (SEQ ID NO: 12), respectively.
- TERT promoter mutations were detected using 5X buffer with enhancer and F AST 2G Taq polymerase (Kapa Biosy stems).
- a second challenge is the low abundance of tumor-specific alleles circulating as cell free DNA fragments, which was addressed by the ability to detect TERT C22ST or TERT C250T with as little as 25 pg starting genomic material (FIG. 9).
- the method disclosed herein detected circulating cell free TERT C22ST in a patient with clinically and radiographically progressive GBM while undergoing concurrent chemoradiation (FIG. 16).
- the disease is radiographicallv stable; however, this may be secondary to impaired uptake of contrast agent following VEGF inhibition leading to uncertainty regarding true disease progression.
- Analysis of the ctDNA by the method disclosed herein was unable to detect cell free TERT C22ST at this later timepoint, supporting clinical treatment response.
- One aspect provides a system for detection or amplification of one or more single nucleotide polymorphi sms or somatic variants in one or more target nucleic acids that may have high GC content and/or low sequence complexity in a sample, the system comprising:
- a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modi ication on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele sequence of the target nucleic acid and located within the region amplified by the forward primer and the reverse primer,
- a peptide nucleic acid (PNA) blocker that hybridizes to a wi ld-type allele of the target nucleic acid, the blocker compri sing peptide nucleic acid oligonucleotides that block
- the PNA blocker hybridizes to a region located within the region amplified by the forward and reverse primer, and
- the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature conditions.
- One aspect provides the system of paragraph [00243], wherein the target nucleic acid has high GC content.
- One aspect prov ides the system of paragraph [00245], wherein the target nucleic acid has a GC content of greater than 60%.
- One aspect provides the system of paragraph [00243], wherein the mutant allele comprises a single nucleotide polymorphism or somatic variant. [00248] One aspect provides the system of paragraph [00243], wherein the sample is from a model organi sm or a subject.
- One aspect provides the system of paragraph [00243], wherein the sample is from a tumor or metastatic lesion.
- One aspect provides the system of paragraph [00243], wherein the sample comprises a cancer cell.
- One aspect provides the system of paragraph [00243], wherein the sample comprises blood from a patient or human subject.
- the sample comprises tissue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated cell obtained from blood obtained from a subject, or a circulating cancer cel l .
- One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a telomerase reverse transcriptase (TERT) gene.
- TERT telomerase reverse transcriptase
- TERT gene comprises a portion of the nucleic acid sequence of the regulatory region of the TERT gene promoter.
- mutant allele comprises variant C228T (hgl9, chromosome 5 : 1,295,228) of the TERT gene promoter.
- mutant allele comprises variant C250T (hgl9, chromosome 5 : 1 ,295,250) of the TERT gene promoter.
- One aspect prov ides the system of paragraph [00243], further comprising a control genomic DNA, comprising DNA which is homozygous, hemizygous or heterozygous for the mutant allele.
- the target nucleic acid comprises a portion of the nucleic acid sequence of an isocitrate dehydrogenase 1 ( IDH 1 ) gene.
- mutant allele comprises a variant that encodes an IDH l protein of variant R 1 32H.
- mutant allele comprises a variant that encodes an IDH l protein of variant R I 32C.
- mutant allele comprises a variant that encodes an IDH 1 protein of variant R132G.
- mutant allele comprises a variant that encodes an IDH I protein of variant R1 32S.
- mutant allele comprises a variant that encodes an IDH1 protein of variant R132L.
- One aspect provides the system of paragraph [00243], further comprising a control genomic DNA, comprising DNA which is homozygous, hemizygous or heterozygous for the mutant allele.
- control genomic DNA is derived from primary glioma cell line BT142.
- One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a proto-oncogene B-raf (BRAF) gene.
- BRAF proto-oncogene B-raf
- mutant allele comprises a variant that encodes a BRAF protein of variant V600E.
- One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a neuroblastomas RAS viral oncogene homolog (NRAS) gene.
- NRAS neuroblastomas RAS viral oncogene homolog
- mutant allele comprises a variant that encodes an NRAS protein of variant Q61 R.
- mutant allele comprises a variant that encodes an NRAS protein of variant Q61K.
- the target nucleic acid comprises a portion of the nucleic acid sequence of a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) gene.
- mutant allele compri ses a variant that encodes an GNAQ protein of variant R l 83Q.
- mutant allele comprises a variant that encodes an GNAQ protein of variant Q209L.
- mutant allele compri ses a variant that encodes an GNAQ protein of variant Q209P.
- the target nucleic acid comprises a portion of the nucleic acid sequence of a guanine nucleoti de-binding protein subunit a-1 1 (GNA1 1) gene.
- the mutant allele comprises a variant that encodes an G A I 1 protein of van ant Q209L.
- the target nucleic acid comprises a portion of the nucleic acid sequence of a 113 hi stone, fami ly 3 A (H3F3A) gene.
- mutant allele comprises a variant that encodes an H3 F3A protein of variant K27M.
- mutant allele compri ses a variant that encodes an H3 F3A protein of variant G34R,
- One aspect provides the system of paragraph [00243], further comprising a high-speed DNA polymerase.
- One aspect prov ides the system of paragraph [00243], further compri sing one or more multi-well plates.
- One aspect provides the system of paragraph [00243], further comprising DN A extraction reagents.
- One aspect provides the system of paragraph [00243], further comprising a cell lysis buffer.
- dNTPs deoxynucleotide triphosphates
- the forward primer comprises the nucleic acid sequence of 5'-CACGTGCGCAGCAGGACGCAG-3 ' .
- the reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3 ' .
- the PNA blocker comprises the nucleic acid sequence of 5'-CCCAGCCCCCTCCGGGCCC-3 ' .
- the LNA probe comprises a first end and a second end, wherein the first end comprises a label and wherein the second end comprises a quencher.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3 ⁇ wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5 '-CCGGCTTGTGAGTGGATGGGT A AA ACCT-3 ' .
- the reverse primer comprises the nucleic acid sequence of 5'C ATTATTGCC AAC TGACTTACTTGATCCCC-3 ' .
- PNA blocker comprises the nucleic acid sequence of 5'-AGGTCGTCATGC-3' .
- LN A probe comprises the nucleic acid sequence of 5'-AGG+T+C+A+T+CAT+GC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+T+G+T+C+ATGC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of ' - AGGT+G+G+T+C AT+GC- ' , herein nucleotides preceded by a "+" are LNA modified nucleotides.
- LN A probe comprises the nucleic acid sequence of 5'-AGGT+A+G+T+CA+T+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+C AT+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGG+T+T+G+T+C+ATGC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+G+G+T+CAT+GC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+A+G+T+CA+T+GC-Dab-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 -M AXN- AGG+T+C+T+CAT+GC-Dab-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5 '-ACAGGGC ATGGAGAGTGGGTC-3 ' .
- the reverse primer comprises the nucleic acid sequence of 5'-C A A AC T G ATGGG ACCC ACTCC AT-3 ' .
- PNA blocker comprises the nucleic acid sequence of 5 -C ATCGAGAT T TC ACTGT AGC T AGA-3 ' .
- the LNA probe comprises the nucleic acid sequence of 5'-AGA+TT+T+C+T+CT+GT+AG+C-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LN A probe comprises the nucleic acid sequence of 5 '-MAXN- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-AGTGGTTATAGATGGTGAAACCTG-3'.
- reverse primer comprises the nucleic acid sequence of 5'-ACAGAGGAAGCCTTCGCCTG-3 ⁇
- PNA blocker comprises the nucleic acid sequence of 5'-CAGCTGGACAAGAAGAGTAC-KK-3' .
- the LN A probe comprises the nucleic acid sequence of 5'-CTGG+AC+G+AG+AA+GAGTA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-CAG+CTGGA+A+A+AGAA+GA+GTA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 -FAM- CAG+CTGGA+A+A+AGAA+GA+GTA- Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LN A probe comprises the nucleic acid sequence of 5'-MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LN A probe comprises the nucleic acid sequence of 5' -MAXN- CAG+CTGGA+A+A+AGAA+GA+GTA- Dab-3', herein nucleotides preceded by a "+” are LNA modified nucleotides, M AXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-TTGGACCGCGTAGCTGACCCT-3 ⁇
- the LNA probe comprises the nucleic acid sequence of 5'-AGAGT+TC+A+AGT+CCCCAC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGAGT+TC+A+AGT+CCCCAC-Dab-3 ⁇ wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3'.
- reverse primer comprises the nucleic acid sequence of 5'-TCACTAAGCGCTACTAGAAACATG-3' .
- PN A blocker comprises the nucleic acid sequence of 5 ' -GGGGCC A A A GGTC AG AG A-3 ' .
- LNA probe comprises the nucleic acid sequence of 5 -AGGGGCC+T+ AAGGTCAGAG-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- LN A probe comprises the nucleic acid sequence of 5'-GGGCC+C+AAGGTCAGA-3', wherein nucleotides preceded by a "+" are LNA modi ied nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGGGGCC+T+AAGGTCAGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGGGCC+T+AAGGTCAGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- LN A probe comprises the nucleic acid sequence of 5'-MAXN-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-GCAGATTGGGCCTTGGGGCG-3'.
- PNA blocker comprises the nucleic acid sequence of 5'-GGGCCAGCGGTCGGAGC-3' .
- the LNA probe comprises the nucleic acid sequence of 5'-GGG+CC+T+GCGGTCGG-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- LN A probe comprises the nucleic acid sequence of 5'-FAM-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- LN A probe comprises the nucleic acid sequence of 5'-MAXN-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-CTGCCCGCAAATCGACCGGT-3' .
- the reverse primer comprises the nucleic acid sequence of 5 ' -G G A T A C A T A C A A G A G A C TTTGTC - 3 ' .
- PNA blocker comprises the nucleic acid sequence of 5'-GCCGCTCGCAAGAGTGCGCC-3' .
- One aspect provides the system of paragraph [00279], wherein the PNA blocker comprises the nucleic acid sequence of 5'-TTCTTCACCCCTCCAGTAG-3'.
- the LNA probe comprises the nucleic acid sequence of 5'-CGCTCGC+A+T+GAGTG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-TACT+GGA+A+GG+GTGAAGA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-T ACT+GGA+ A+GG+GTGAAGA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-TACT+GGA+ A+GG+GTGAAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- One aspect provides a kit comprising the system of any one or more of paragraphs [00243] through [00356].
- One aspect provides a method of using the system of any one or more of paragraphs [00243] through [00356] to detect or amplify one or more single nucleotide pol morphisms or somatic variants in a target nucleic acid with low sequence complexity and/or high GC content, in a sample from a subject comprising:
- amplifying and detecting a DNA am pi icon comprising the one or more single nucleotide polymorphisms, thereby detecting or amplifying one or more single nucleotide polymorphisms.
- One aspect provides a method for establishing a molecular diagnosis in at least one cancer in a subject, the method comprising:
- a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid
- a reverse primer that hybridizes to a second region on an anti sense strand of the first target nucleic acid
- a locked nucleic acid ( LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the first target nucleic acid
- sample comprises a tissue biopsy, blood, plasma, serum or cerebrospinal fluid from the subject.
- One aspect provides a method of paragraph [00360], wherein the blood, plasma, serum or cerebrospinal fluid from the subject comprises one or more circulating cancer cells.
- One aspect provides a method of paragraph [00359], wherein the sample comprises tissue from the subject.
- tissue from the subject comprises one or more cancer cell s.
- One aspect provides a method of paragraph [00359], wherein the amplifying is performed in the presence of a DN A polymerase.
- One aspect provides a method of paragraph [00364], wherein the DN A polymerase is a high-speed D A polymerase. [00366] One aspect provides a method of paragraph [00365], wherein the high-speed DNA polymerase has an elongation rate of about I kb/second.
- One aspect provides a method of paragraph [00365], wherein the high-speed DNA polymerase is Kapa 2G F AST DNA Polymerase.
- One aspect provides a method of paragraph [00359], wherein the cancer is a glioma.
- glioma is selected from the group consisting of: high grade glioma, diffuse astrocytoma, oligodendroglioma, ol i goastrocy torn a, secondary glioblastoma, prim ary gliobl astom a and diffuse intrinsic pontine glioma.
- One aspect provides a method of paragraph [00359], wherein the cancer is a melanoma.
- Another aspect provides a method of paragraph [00359], wherein the cancer is a glioma, high grade glioma, diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, secondary
- glioblastoma primary glioblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
- One aspect provides a method of paragraph [00370], wherein the cancer is uveal melanoma.
- One aspect provides a method of paragraph [00359], wherein the sample is from a skin biopsy or metastatic lesion.
- control DNA template is derived from a melanoma cell or a melanoma cel l line.
- One aspect provides a method of paragraph [00359], herein the first target nucleic acid compri ses the nucleic sequence of a telom erase reverse transcriptase (TERT) gene promoter.
- TERT telom erase reverse transcriptase
- mutant allele comprises variant C228T (hgl9, chromosome 5 : 1 ,295,228) of the TERT gene promoter.
- mutant allele compri ses variant C250T (hgl9, chromosome 5 : 1 ,295,250) of the TERT gene promoter.
- control DNA template is derived from glioma cell line LN428.
- One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nuclei c acid sequence of an isocitrate dehydrogenase 1 ( IDH I ) gene.
- the mutant allele comprises a variant that encodes an IDH 1 protein of variant R132H.
- mutant allele comprises a variant that encodes an IDH I protein of variant R132C.
- mutant allele comprises a variant that encodes an IDH1 protein of variant R132G.
- mutant allele comprises a variant that encodes an IDH I protein of variant R132S.
- mutant allele comprises a variant that encodes an IDH 1 protein of variant R132L.
- One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a proto-oncogene B-raf (BRAF) gene.
- BRAF proto-oncogene B-raf
- mutant allele comprises a variant that encodes a BRAF protein of variant V600E.
- the first target nucleic acid comprises the nucleic acid sequence of a neuroblastomas RAS viral oncogene homolog
- mutant allele comprises a variant that encodes an NRAS protein of variant Q61R.
- mutant allele comprises a variant that encodes an NRAS protein of variant Q61K.
- the first target nucleic acid comprises the nucleic acid sequence of a guanine nucleotide-binding protein G(q) subunit a (GNAQ) gene.
- mutant allele comprises a variant that encodes an GNAQ protein of variant R 183Q.
- mutant allele comprises a variant that encodes an GN AQ protein of variant Q209L.
- mutant allele comprises a variant that encodes an G AQ protein of variant Q209P.
- the first target nucleic acid comprises the nucleic acid sequence of a guanine nucleotide-binding protein subunit a- 1 1
- mutant allele comprises a variant that encodes an G A 1 1 protein of van ant Q209L.
- the first target nucleic acid comprises the nucleic acid sequence of a H3 hi stone, family 3 A (H3F3A) gene.
- mutant allele comprises a variant that encodes an H3F3 A protein of variant K27M.
- mutant allele comprises a variant that encodes an H3F3A protein of variant G34R.
- template is derived from primary glioma cell line BT 142.
- the forward primer comprises the nucleic acid sequence of 5'-CACGTGCGCAGCAGGACGCAG-3 ' .
- reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3 ⁇
- PNA. blocker comprises the nucleic acid sequence of 5'-CCCAGCCCCCTCCGGGCCC-3 ' .
- One aspect provides a method of paragraph [00374], wherein the PNA blocker compri ses the nucleic acid sequence of 5'-CCGACCCCTCCCGGGTCCC-3 ' .
- LNA probe comprises the nucleic acid sequence of 5'-CCCAGCCCC+T+TCCGGGCCC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-CCGACCCC+T+TCCGGGTCCC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LN A probe comprises the nucleic acid sequence of 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3 ⁇ wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- One aspect prov ides a method of paragraph [00374], wherein the LN A probe compri ses the nucleic acid sequence of 5'-FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- One aspect provides a method of paragraph [00379], wherein the forward primer comprises the nucleic acid sequence of 5 '-CCGGCTTGTGAGTGGATGGGTAAAACCT-3 ' .
- the reverse primer comprises the nucleic acid sequence of 5 ' -C A TT A TTGC C A A C A TG A C ⁇ A C I T G A TC C C C -
- PNA blocker comprises the nucleic acid sequence of 5'-AGGTCGTCATGC-3' .
- the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+C+A+T+CAT+GC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+T+G+T+C+ATGC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-AGGT+G+G+T+CAT+GC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-AGGT+A+G+T+CA+T+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+CAT+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- LN A probe comprises the nucleic acid sequence of 5'-MAXN-AGG+T+T+G+T+C+ATGC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- nucleotides preceded by a "+” are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+A+G+T+CA+T+GC-Dab-3',wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 '-MAXN- AGG+T+C+T+CAT+GC-Dab-3 ' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- One aspect provides a method of paragraph [00385], herein the forward primer compri ses the nucleic aci d sequence of 5'-ACAGGGCATGGAGAGTGGGTC-3 ' .
- the reverse primer comprises the nucleic acid sequence of 5'-C A A ACTGATGGGACCC ACTCC AT-3 '
- PNA blocker comprises the nucleic acid sequence of 5'-CATCGAGATTTCACTGTAGCTAGA-3 ' .
- the LNA probe comprises the nucleic acid sequence of 5'-AGA+TT+T+C+T+CT+GT+AG+C-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- LN A probe comprises the nucleic acid sequence of 5'-FAM- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+" are LN A modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- One aspect provides a method of paragraph [00385], wherein the LN A probe compri ses the nucleic acid sequence of 5 -MAXN- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+” are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- One aspect prov ides a method of paragraph [00387], wherein the forward primer comprises the nucleic acid sequence of 5 -AG ' l GGTTATAGATGGTGA A ACCTG-3 ' .
- PNA blocker comprises the nucleic acid sequence of 5 - AGCTGGA A AGA AG AGT AC-KK-3 " .
- the LN A probe comprises the nucleic acid sequence of 5 -CTGG+AC+G+AG+AA f GAGTA-3 " , wherein nucleotides preceded by a "+” are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-CAG+CTGGA+A+A+AGAA+GA+GTA-3 ', wherein nucleotides preceded by a "+” are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM- CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LN A probe comprises the nucleic acid sequence of 5' -MAXN- CAG+CTGGA+A+A+AGAA+ GA+GTA-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-TTGGACCGCGTAGCTGACCCT-3' .
- the reverse primer comprises the nucleic acid sequence of 5 ' -GC TG GG A A A T A GGTTTC A TGG A C -3 ⁇
- PNA blocker comprises the nucleic acid sequence of 5'-TTAGAGTTCGAGTCCCCA-3' .
- the LNA probe comprises the nucleic acid sequence of 5'-AGAGT+TC+A+AGT+CCCCAC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- One aspect provides a method of paragraph [00390], wherein the LN A probe compri ses the nucleic acid sequence of 5 ' -F AM- AGAGT+TC+A+AGT+CCCC AC-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3 ⁇ wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3'.
- reverse primer comprises the nucleic acid sequence of 5'-TCACTAAGCGCTACTAGAAACATG-3' .
- the PNA blocker comprises the nucleic acid sequence of 5'-GGGGCCAAAGGTCAGAGA-3' .
- the LNA probe comprises the nucleic acid sequence of 5'-AGGGGCC+T+AAGGTCAGAG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-GGGCC+C+AAGGTCAGA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5 ' -F AM- AGGGGCC+T+AAGGTC AGAG-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5' -M AXN-AGGGGCC+T+ A AGGTC AGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 -MAXN-GGGCC ; C+AAGGTCAGAGA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5 ' - GC A G A TTGGGC C TTGGG GC G -3 ' .
- One aspect provides a method of paragraph [00394], wherein the reverse primer comprises the nucleic acid sequence of 5 ' - T C G C T G A G G G C G A C G A G A A A C - 3 ' .
- the PNA blocker comprises the nucleic acid sequence of 5'-GGGCCAGCGGTCGGAGC-3' .
- the LNA probe comprises the nucleic acid sequence of S'-GGG* CC+T+GCGGTCGG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGG+CC+T+GCGGTCGG-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5'-MAXN-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- the forward primer comprises the nucleic acid sequence of 5'- CTGCCCGCAAATCGACCGGT -3' .
- reverse primer comprises the nucleic acid sequence of 5'- GGATACATACAAGAGAGACTTTGTC-3' .
- PNA blocker comprises the nucleic acid sequence of 5'-GCCGCTCGCAAGAGTGCGCC-3' .
- the LNA probe comprises the nucleic acid sequence of 5'-CGCTCGC+A+T+GAGTG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5'-FAM-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5 -MAXN-CGCTCGC+A+T ; GAGTG-Dab-3 " , wherein nucleotides preceded by a "+” are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
- One aspect provides a method of paragraph [00396], wherein the PNA blocker comprises the nucleic acid sequence of TTCTTCACCCCTCCAGTAG [00464]
- One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of TACT+GGA+A+GG+GTGAAGA, wherein nucleotides preceded by a "+" are LNA modified nucleotides.
- the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-T AC T+GGA+ A+GG+GTGAAGA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- the LNA probe comprises the nucleic acid sequence of 5' -MAXN-TACT+GGA+ A+GG+GTGAAGA-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
- One aspect provides a method of any one or more of paragraphs [00374], [00379], [00385], [00387], [00390], [00394] or [00396] wherein two or more mutant alleles of TERT, IDH BRAF, NBAS, GNAQ, GNA 1 1 and/or H3F3A are detected simultaneously.
- One aspect provides a method of paragraph [00359], further comprising calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected.
- One aspect provides a method of paragraph [00468], wherein the calculating of tumor burden or tumor purity of the sample is based on the quantitative amount of mutant allele detected relative to a standard curve generated from serial dilutions of control DM A.
- One aspect provides a method of paragraph [00359], wherein sample from the subject is taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and wherein results of the method are available to the surgeon to guide further treatment of the subject during the surgical procedure.
- One aspect provides a method of paragraph [00359], further comprising subsequent resection of a glioma tumor in the subject.
- One aspect provides a method of paragraph [00359], further comprising inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
- One aspect provides a method of paragraph [00359], wherein the denaturing is initially done in about 1 round of incubation at about 95 °C for 2-5 minutes, and the annealing and ampli y ing are done in about 45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds.
- One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 40-50 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
- One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 35-45 rounds of incubation at 95 °C for 1-12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
- One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 40-45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
- One aspect provides a method of paragraph [00359], wherein the melting temperatures of the forward primer, reverse primer, LNA probe and P A blocker are about 62,5 °C to about 64.5°C.
- One aspect provides a method of paragraph [00359], wherein the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 63.5°C.
- One aspect provides a method of paragraph [00359], wherein the am pi icon is less than 70-300 nt in length.
- One aspect provides a method of paragraph [00359], wherein the denaturing, annealing and amplifying steps are performed in a therm ocycler with a ramping rate of at least 1.6-3.1 °C per second.
- One aspect prov ides a method of any one or more of paragraphs [ 00358] through
- mutant allele has an allelic frequency of 0.1% of the nucleic acid extracted from the sample.
- One aspect provides a method of any one or more of paragraphs [00358] through
- sample comprises archival tissue
- One aspect provides a method of paragraph [00482], wherein the archival tissue is formalin-fixed paraffin embedded.
- One aspect provides a method of any one or more of paragraphs [00358] through
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Provided are systems, kits, and methods for the quantitative detection of single nucleotide polymorphisms or variants to identify malignant neoplasms. The methods include use of modified oligonucleotide blockers with peptide nucleic acid backbones that hybridize to and block logarithmic amplification of the wild-type alleles of a target, and incorporation of locked nucleic acids into probes that are complementary to a mutant allele of the target sequence to increase specificity. The methods include detection of variants in sequences with high GC content and/or low complexity, such as the TERT promoter, IDH1, BRAF, NRAS, GNAQ, GNA11 and H3F3 A gene variants. The methods include sensitive detection and staging of cancers with low cellularity, and can be used intraoperatively such as for glioma, or to detect cell -free circulating tumor DNA, such as for melanoma.
Description
RAPID QUANTITATIVE DETECTION OF SINGLE NUCLEOTIDE
POLYMORPHISMS OR SOMATIC V ARIANTS AND METHODS TO IDENTIFY
MALIGNANT NEOPLASMS
RELATED APPLICATION
[0001] This application claims priority from U.S. Provisional Patent Application No.
62/095,386, filed on December 22, 2014 and incorporated herein by reference in its entirety. FIELD
[0002] The present disclosure relates to the field of rapid, simultaneous, and quantitative detection of genomic mutations. More specifically, the disclosure relates to the detection of single nucleotide variants in genomic sequences which may have low complexity and/or high GC content, and to the diagnosis, staging and treatment of cancers and conditions associated with the single nucleotide variants.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with Government support under Grant No. TCGA and Grant No. CA 143867 awarded by the National institutes of Health. The Government has certain rights in this invention.
SEQUENCE LISTING
[0004] The instant application contains a Sequence Listing, which has been submitted electronically, in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on December 22, 2015, is named "576597__BDC-
and is 32,768 bytes in size.
BACKGROUND
[0005] Recent large-scale genomic analyses have revealed highly recurrent somatic single nucleotide variants (sSNV s) occurring within the majority of the common cancer subtypes. Incorporating molecular-based classifications with conventional tissue-based pathologic diagnosis will continue to guide decision-making for treatment.
[0008] For example, in glioma the recurrent somatic R132H mutation in Isocitrate
Dehydrogenase 1 (II)Hl) is detected in 75% of grade II and III astrocytomas and two separate
mutations in the promoter region of Telomerase Reverse Transcriptase (TERT) are detected in 83% of primary glioblastoma (GBM, grade IV astrocytoma) (P. J. Killela et al., Proc, Natl. Acad. Sci. U. S. A. 110, 6021-6026 (2013), C. Koelsche et al. , Acta Nenropathol, (BerL). 126, 907-915 (2013), N. Nonoguchi et al, Acta Nenropathol. (Bed.). 126, 93 1-937 (2013).
Oligodendrogliomas are highly chemotherapy-sensitive gliomas characterized by loss of heterozygosity of chromosome lp and 19q, but recent studies have found that 80% of these are also defined by concurrent mutations in //>/-/ / and TERT promoter (P. J. Killela et al , Proc. Natl, Acad. Sci. U. S. A. 110, 6021-6026 (2013), N. Sabha et al , Neuro-Oncol. (2014), doi: 10.1093/neuonc/not299., H. Arita et al . Acta Nenropathol. (BerL). 126, 267-276 (2013)). The classification of glioma by these recurrent mutations in IDH1 and TERT promoter closely mirrors conventional histopathology, but serves as a stronger predictor of response to adjuvant therapy and overall survival than conventional pathology (P. J. Killela et al,, Oncotarget (2014), A. K.-Y. Chan et al , Mod. Pathol. Off J. U. S. Can. Acad. Pathol. Inc (2014),
doi : 10. 1038/modpathol .20 14.94). This latter point is critical for appropriate clinical trial design and patient stratification.
[0007] World Health Organization (WHO) grade II diffuse gliomas are a group of slow- growing primary central nervous system tumors, including oligodendrogliomas, astrocytomas and oligoastrocytomas. Grade II diffuse gliomas are clinically indolent lesions for which progression free and overall patient survival positively correlates with maximal upfront resection (Smith .I S, et al., J Clin Oncol Off J Am Soc Clin Oncol 2008;26(8): 1338-45;
Yordanova YN, et al., J Neurosurg 201 1 ; 1 15(2):232-9; Jakola AS, et al., JAM A 2012;
308(18): 1881-8; Potts MB, et al, J Neurosurg 2012; 1 16(2):365-72; Beiko J, et al, Neuro- Oncol 20 14; 16( 1 ):8 1 -9 1 ). The initial surgical procedure can therefore be both diagnostic and therapeutic, but accurate intraoperative diagnosis is essential in determining whether to continue with more aggressive surgical resection. However, as a consequence of the tumor location, infiltrative growth, low cellularity and often small stereotactic biopsy specimens, frozen intraoperative pathological assessment of low-cell ularity diffuse gliomas can be challenging (Glantz MJ, et al., Neurology 199 1 ;4 1 ( 1 1): 1741-4; Jackson RJ, Fuller GN, Abi-Said D, et al.; 3(3): 193 -200; Regragui A, et al . , Neurochirurgie 2003;49(2-3 Pt i ):67 72 ). This diagnostic dilemma often requires clarification by final pathologic analysis several days after the diagnostic biopsy, including immunohistochemistry ( IHC ) for Ki67, TP53, IDH1 R132H or even targeted sequencing. Once the diagnosis is firmly established, patients may then require a second neurosurgical procedure for definitive resection.
[0008] Recent studies have demonstrated that diffuse gliomas harbor characteristic recurrent somatic mutations in IDH1 (present in >80% of diffuse astrocytomas, oligodendrogliomas, oligoastrocytomas and secondary glioblastoma (GBM); Yan H, et al., N Engl J Med
2009;360(8):765-73) and the TERT promoter (similarly present in up to 80% of
oligodendrogliomas and primary GBM; Arita H, et al., Acta Neuropathol (Berl)
2013; 126(2):267-76; Killela PJ, et al, Proc Natl Acad Sci U S A 2013; 1 10(15):6021-6;
Nonoguchi N, et al., Acta Neuropathol (Berl) 2013; 126(6):931-7). An intraoperative assay that could rapidly and accurately identify these recurrent molecular features could augment "frozen section" histopathologic analysis, improve intraoperative diagnosis and accelerate real-time decision-making in the management of grade II diffuse gliomas.
[0009] Melanoma is a highly prevalent neoplasm that is also characterized by recurrent missense sSNVs leading to activating mutations in either B-Raf or NRAS (E. Hodis et al.. Cell. 150, 251 -263 (2012)). Benign nevi have also been found to harbor BRAF V600E, which reduces the specificity of the alteration for distinguishing these nevi from malignant pathologies (J. M. Taube, S. Begum, C. Shi, J. R. Eshleman, W. H. Westra, Am. J. Surg. Pathol. 33, 568- 571 (2009)). However, recent whole genome analyses have revealed that primary melanoma and basal cell cancer are uniquely characterized by recurrent mutations in the promoter region of TERT(¥. W. Huang et al, Science. 339, 957-959 (2013), S. Horn et al, Science. 339, 959-961 (2013), J. Vinagre et al, Nat. Commun. 4, 2185 (2013)), and, thus, more specifically
discriminates true neoplastic pathology from benign lesions.
[0010] Somatic single nucleotide variants targeting the Q61 codon of NRAS occurs in 10-25% of cutaneous melanoma (Tsao, H., et al. (2012); Genes Dev., 26: 1131-1 155). Patients undergoing therapies targeting mutant BRAF have been found to develop resistance through mechanisms that result in mutations to NRAS Q61 codon (Van Allen E, et al . (2014); Can Disc. ,4:94). Furthermore, patients with NRAS-mutant melanoma hav e a better response to immunotherapy than those with mutant BRAF (Johnson, DB, et al. (2015); Cancer Immunol Res., 3(3):288-295) therefore monitoring the blood for evidence of these alterations can have great prognostic value.
[0011] Diffuse intrinsic pontine gliomas (DI G ) are diffusely infiltrative malignant glial neoplasms that arise in the brainstem during childhood (Panditharatna E., et al. (2015); Cancer Genet. 208, 367-373). These tumors are highly aggressive and ultimately fatal. Though there is a growing consensus toward obtaining biopsies of patients with suspected DIPG ( Walker, D A. et al. (2013); Neuro-oncology 4, 462-468), concerns remain regarding the risks of routine brainstem biopsies in children. A large percentage of pediatric high-grade gliomas hav e
recently been found to harbor recurrent mutations in H3F3 A, including more than 70% of diffuse intrinsic pontine glioma, one-third of pediatric glioblastoma and nearly 20% of pediatric anaplastic astrocytoma ( Sch vvartzentruber, J. et al. (2012); Nature 482, 226-23 1 , Wu, G. et al. (2012); Nat. Genet. 44, 251-253). Improving the diagnostic success rate for diffuse gliomas while decreasing the risks associated with biopsy of critical brain structures, as in cases of suspected DIPG, could significantly improve the management of diffuse gliomas in adults and children. The detection of genomic alterations that define diffuse gliomas, including DIPGs, from small volumes of Cerebrospinal Fluid (CSF), would allow for minimally invasive diagnosis and monitoring of response to cancer-directed therapies using CSF specimens obtained by lumbar punctures.
[0012] Uveal melanomas are malignancies originating within the melanocytes of the eye involving the iris, ciliary body or choroid. Patients with uveal melanoma have an approximately 50% likelihood of developing metastases and of those, the median survival rate is 2 to 15 months (Augsburger J., et al . (2009); Am J. Opthalmol, 148: 1 1 - 127, and van den Bosch, T., et al. (2010); Dermatol Res Pract, 2010:360136). In upwards of 80% of uveal melanomas, somatic single nucleotide variants in GNAQ or GNA1 1 are found to occur and have been shown to lead to the activation of the MAPK pathway (Chen X., et al ., (2014); Oncogene, 33 :4724-4734, Van Raamsdonk CD, et al (2010); N Engl J Med, 363 :2 1 9 1 -2 199, Van Raamsdonk CD, et al . (2009); Nature 457:599-602 ). Inhibition of the MAP pathway shows promise in leading to improved progression free survival (Carvajal RD, et al. (2014); Jama 31 1 :2397-2405, however predicting response is hindered by the location of the tumor. Improved diagnostic success would be achieved through monitoring the blood of patients with uveal melanoma by the detection of alterations to GNAQ and GNA 1 1 .
[0013] Timely and accurate diagnosi s of cancer subtypes is critical for appropriately stratifying patients for real-time intraoperative decision-making. For instance, a "frozen section" during neurosurgical resection of malignant gliomas can facilitate intraoperative decision-making, however, the concordance between frozen and permanent histopathology has been reported to be -90% (A. Regragui, et al., Neurochirurgie. 49, 67-72 (2003)) due to secondary to small or unrepresentative sample size, low tumor purity and di sruption of histologic architecture (M. J. Glantz et al. , Neurology. 41, 1 74 1 - 1 744 (1991), R. J. Jackson et al., Neuro-Oncol. 3, 193-200 (2001), T. P. Plesec, R A. Prayson, Arch. Pathol, Lab. Med. 131 , 1 532- 1 540 (2007), B. Y. S. Kim et al , J. Neurooncol. (2014), doi : 10. 1007/s l 1060-0 14- 145 1 - 0). Molecular based cancer diagnostic assays are al so important for clustering patients of
similar prognoses for clinical trial design (I. K. Mellinghoff el al, N. Engl J. Med. 353, 2012- 2024 (2005)) and can guide targeted therapies in the management of malignant neoplasms.
[0014] There is a need for translation of this genomic knowledge to provide sensitive and rapid molecular-based pathologic determinations in a timeframe that can impact surgical decision-making and to facilitate non-invasive monitoring of disease progression and treatment response.
SUMMARY
[0015] Here, we report the development of compositions and methods that detect cancer- specific mutations in specimens. In some aspects, the specimens are cancer patient biopsies with low tumor density, e.g., infiltrating gliomas. In some aspects the single nucleotide van ant i s a somatic alteration in a chromosomal sequence compared to wild type. In some aspects, the somatic nucleotide alteration is associated w ith a cancerous alteration in a cell . In some aspects, the somatic nucleotide alteration is present in at least one cell in a tumor sample. In some aspects, the somatic nucleotide alteration is present in only a subset of cancer cells in a tumor sample. In some aspects, the disclosed aspects are distinguished from current less sensitive techniques for detecting low abundance sequences in a complex mixture by including the following features: (1 ) optimization to overcome the low complexity and high GC content of a target site, (2) inclusion of modified oligonucleotides with peptide nucleic acid (PNA) backbones to block logarithmic amplification of wi ld-type alleles, (3) incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity, and (4) designed so that multiple assays can be used to profile multiple genes at the same time under the same cycling parameters. In some aspects, the target site comprising low sequence complexity and/or high GC content i at least one region of the TERT promoter. In one aspect, the disclosed aspects provide a quantitative polymerase chain reaction (qPCR) based assay, able to perform rapid amplification-based gen oty ping of cells from a subject. In one aspect, the genotyping compri ses determination of the presence or absence of at least one somatic alteration in a target sequence in at least one cell from a patient sample. In one aspect, the somatic gene alteration is present in the IDH1 coding region. In one aspect, the somatic gene alteration is present in the TERT promoter. In one aspect, somatic gene alterations are present in both the H3H1 coding region and TERT promoter. In one aspect, the somatic gene alterations compri se recurrent mutations. In one aspect, the methods provided herein are used to identify these recurrent mutations w ithin 45 minutes of obtaining a biopsy specimen, a time frame that parallels frozen section analysis. In one aspect, the methods prov ided herein have a sensitivity of 0.1% allelic
fraction of tumor sSNVs ("single nucleotide variants") in a complex mixture comprising wild type and mutant sequences in a target site. In one aspect, the sSNVs comprise one or more somatic gene alterations in one or both of a TERT promoter and an IDH I coding region. In one aspect, the presence or absence of one or more specific sSNVs predicts final pathology in 90% of archiv ed gliomas. As disclosed herein, the described techniques optionally provide means of intraoperative molecular characterization, whereby the methods could supplement, replace or assist pathologic analysis of low eel hilarity diffuse gliomas, distinguishing them from nonneoplastic processes by providing cancer-specific genomic information, and could help both accelerate and solidify the decision to pursue resection within the time frame of the current operative procedure, thus eliminating the potential risks and costs associated with re-operation, and ultimately improving the approach to patients w ith diffuse gliomas. The methods provided herein could be used for real-time intraoperative diagnosis. In some embodiments, the intraoperative diagnosis can be used to confirm a diagnosis. In another embodiment, intraoperative diagnosis allows for intraoperative therapy. In yet another embodiment, the intraoperative therapy may comprise resection, thermal ablation therapy, laser microsurgery, or targeted therapy at the ti me of operation.
[0016] Given the sensitivity of these methods, the disclosed platform can be extended to detect mutant TERT promoter alleles in blood of patients with progressive di sease. In one aspect the mutant TERT promoter allele is in the cell -free component of a patient blood sample. In one aspect the mutant TERT promoter allele is in a circulating cancer cell obtained from a patient blood sample. In one aspect, the sensitive and specific molecular di agnostic techniques described herein could significantly aid the discri mination of tumor pathology at the time of diagnosis, and could furthermore be useful for non-invasively monitoring of disease
progression. In addition, the ability to sensitively detect tumor alleles in the blood by this rapid method opens a new avenue for non-invasively monitoring tumor progression and treatment response. This would be especially useful for cancers, like melanoma, that have longer lengths of time for progression from localized to systemic disease, which is often noted when the patient has a symptomatic metastasis, and for gliomas that would otherwise require at least an initial intraoperative procedure in order to obtain a biopsy.
[0017] In one aspect, a system is provided for detection or amplification of one or more single nucleotide polymorphi sms or somatic nucleotide variants in one or more target nuclei c acids that may have high GC content and/or low sequence complexity in a sample. In one aspect, the system includes a forward primer that hybridizes to a first region on a sense strand of the target nucleic acid, a rev erse primer that hybridizes to a second region on an anti sense strand of the
target nucleic acid, a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele sequence of the target nucleic acid and located within the region amplified by the forward primer and the reverse primer, a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the target nucleic acid, the PNA blocker comprising an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i.e., inhibit or cause a relative decrease in) amplification of the wild-type allele, and does not block amplification of the mutant allele, wherein the PNA bl ocker hybridizes to a region of the wild-type allele located within the region amplified by the forward and reverse primer, and a reaction buffer, wherein the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature conditions.
[0018] In one aspect, a kit is provided that includes components that compose the system of the disclosed invention herein. In one aspect, the kit comprises the forward primer, reverse primer, LNA probe and PNA blocker for at least one target sequence. In one aspect, the target sequence is a region of the telomerase reverse transcriptase (TERT) promoter. In one aspect, the TERT promoter comprises one or both somatic variants C228T and C250T, as further described herein. In one aspect, the LNA probe hybridizes to a nucleotide region comprising a T at position 228 of the mutated allele of the TERT promoter and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wi ld type allele.
[0019] In one aspect, the LNA probe hybridizes to a nucleotide region comprising a T at position 250 of the mutated al lele of the i ocitrate dehydrogenase 1 ( IDH 1 ) coding region and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wild type al lele. In one aspect, the target sequence is a region of the IDH I gene. In one aspect, the IDH I gene region comprises the nucleotide sequence encoding a somatic mutation at position 132 of the polypeptide. In one aspect, the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding an amino acid selected from one or more of a hi stidine ("H"), cysteine ("C"), glycine ("G"), serine ("S") and leucine ("L") at position 132 of the mutated IDH I protein, and the PNA blocker hybridizes to a nucleotide region comprising a wi ld type codon encoding an arginine ("R") at the corresponding position in a wild type allele.
[0020] In some embodiments, the LNA probe hybridizes to a nucleotide region comprising an A of the mutated allele of the proto-oncogene B-raf ( BRAF) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a T at the corresponding position in a wild type allele. In another embodiment, the target sequence is a region of the BRAF gene. In certain
embodiments, the LNA probe hybridizes to a nucl eotide region comprising a mutated codon encoding a glutamic acid ("E") at position 600 of the mutated BRAF protein, and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a valine ("V") at the corresponding position in a wild type allele.
[0021] In yet another embodiment, the LNA probe hybridizes to a nucleotide region comprising a G of the mutated al lele of the neuroblastomas RAS viral oncogene homolog (NRAS) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele. In still another embodiment, the LNA probe hybridizes to a nucleotide region comprising an A of the mutated allele of the neuroblastomas RAS viral oncogene homolog (NRAS) coding region and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wi ld type allele. In certain embodiments, the target sequence is a region of the NRAS gene. In still another embodiment, the LN A probe hybridizes to a nucleotide region compri sing a mutated codon encoding an amino acid selected from one or more of an arginine ("R") and a lysine ("K") at position 61 of the mutated allele of the NRAS and the PN A blocker hybridi es to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at the corresponding position in a wild type allel e.
[0022] In a further embodiment, the LN A probe hybridizes to a nucleotide region compri sing a A of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PN A blocker hybridizes to a nucleotide region comprising a G at the corresponding position in a wild type allele. In another embodiment, the LNA probe hybridizes to a nucleotide region compri sing a T of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a A at the corresponding position in a wild type allele. In vet another embodiment, the LNA probe hybridizes to a nucleotide region comprising a C of the mutated allele of the a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele. In certain embodiments, the target sequence is a region of the GN AQ gene.
[0023] In another embodiment, the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding a glutamine ("Q") at position 183 of the mutated allele of the GN AQ, and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding an arginine ("R") at position 183 in a wild type allele. In another embodiment, the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding a leucine ("L") or a proline ("P") at position 209 of the mutated allele of the GNAQ, and the PNA blocker
hybridizes to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at position 209 in a wild type allele.
[0024] In another embodiment, the LNA probe hybridizes to a nucleotide region comprising a T of the mutated allele of the guanine nucleotide-binding protein subunit a- 1 1 (GNAl 1) coding region and the PNA blocker hybridizes to a nucleotide region comprising an A at the corresponding position in a wild type allele. In some embodiments, the target sequence is a region of the GNA 1 1 gene. In another embodiment, the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding an amino acid selected from one or more of a leucine ("L") at position 209 of the mutated allele of the GNA 1 1 and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a glutamine ("Q") at the corresponding position in a wi ld type allele.
[0025] In still another embodiment, the LNA probe hybridizes to a nucleotide region compri sing a T of the mutated allele of the 113 hi stone, family 3 A ( H3F3A ) coding region and the PNA blocker hybridizes to a nucleotide region comprising a A at the corresponding position in a wild type al lele. In still another embodiment, the LN A probe hybridizes to a nucleotide region comprising an A of the mutated allele of the H3 hi stone, family 3 A ( H3F3A) coding region and the PNA blocker hybridizes to a nucleotide region compri sing a G at the
corresponding position in a wild type allele. In certain embodiments, the target sequence is a region of the H3 F3A gene. In another embodiment, the LNA probe hybridizes to a nucleotide region compri sing a mutated codon encoding a methionine ("M") at position 27 of the mutated allele of the 1I3F3A and the PNA blocker hybridizes to a nucleotide region compri sing a wild type codon encoding a lysine ("K") at position 27 in a wi ld type allele. In another embodiment, the LNA probe hybridizes to a nucleotide region comprising a mutated codon encoding an arginine ("R") at position 34 of the mutated allele of the H3F3 A and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding a glycine ("G") at position 34 in a wild type allele.
[0026] In one aspect, a method is provided of using the system to detect or amplify one or more single nucleotide polymorphisms or somatic variants in at least one target nucleic acid including but not limited to, e.g., a target sequence with low sequence complexity and/or high GC content, in a sample from a subject, where the method includes isolating DNA from the sample; denaturing the isolated DN A; annealing the forward primer, the reverse primer, the LNA probe, and the PNA blocker to the DNA at the same temperature conditions; and amplifying and detecting a DNA am pi icon comprising the one or more sin le nucleotide polymorphisms, thereby detecting or amplifying one or more single nucleotide polymorphisms.
[0027] In one aspect, a method is provided for establishing a molecular diagnosis in at least one cancer in a subj ect, where the method includes isolating DNA from a sample from the subject; denaturing the DNA isolated from the sample and a control DNA template; annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a reverse primer that hybridizes to a second region on an antisense strand of the first target nucleic acid, a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker comprising an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i.e., inhibit or cause a relative decrease in) amplification of a wild-type allele of the first target nucleic acid, and does not block amplification of a mutant allele of the first target nucleic acid, wherein the PNA blocker hybridizes to a region of the wild-type allele located within a region ampli ied by the forward and reverse primer; amplifying a DNA
amplicon comprising the mutant allele in the first target nucleic acid; detecting the mutant allele in the first target nucleic acid in the sample; and quantifying the amount of the mutant allele in the first target nucleic acid in the sample relative to the amount in a control, wherein a higher prevalence of the amount of the mutant allele in the sample relative to the control indicates presence and/or stage of the cancer in the subject.
[0028] In one aspect of the disclosure, the assay is an intraoperative single nucleotide variant detection assay wherein the assay is performed and results are obtained concurrent with a surgical procedure for obtaining the sample from a patient.
[0029] In one aspect, a method i s provided for diagnosi s of melanoma in a subject, where the method includes isolating DNA from a sample acquired from a patient, e.g., such as a skin biopsy or a metastatic lesion; denaturing the DNA isolated from the sample and a control DNA template; annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a rev erse primer that hybridizes to a second region on an antisense strand of the first target nucleic acid, a locked nucleic acid (LNA) probe compri sing an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe compri ses a nucleic acid sequence that is complementary to a mutant allele sequence of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker comprising an oligonucleotide compri sing one or more peptide nucleic acids that acts to block (i .e., inhibit or cause a relative decrease in) the amplification of a wild-type allele of the first target nucleic acid, and does not block amplification of a mutant allele of the first target nucleic acid, wherein the PNA blocker hybridizes to a region of the wild-type allele located within a region amplified by the forward
and reverse primer; amplifying a DNA amplicon comprising the mutant allele in the first target nucleic acid; and detecting the amount of the mutant al lele present from the first target nucleic acid in the sample, wherein increased prevalence of the mutant allele the first target nucleic acid in the sample relative to the control indicates presence of a melanoma in the subject.
[0030] In some embodiments, the target nucleic acid has low sequence complexity. In some embodiments, the target nucleic acid has high GC content. In some embodiments, the target nucleic acid has a GC content of greater than 60%.
[0031] In some embodiments, the mutant allele comprises a single nucleotide polymorphism. In some embodiments, the mutant allele comprises a somatic variant. In some embodiments, the mutant allele comprises at least one single nucleotide polymorphism or somatic variant.
[0032] In some embodiments, the L A probe comprises a first end and a second end, wherein the first end comprises a label and wherein the second end comprises a quencher.
In some embodiments, the target nucleic acid compri ses a portion of the nucleic acid sequence of a telomerase reverse transcriptase (TERT) gene. In some embodiments, the TERT gene comprises a portion of the nucleic acid sequence of the regulatory region of the TERT gene promoter. In some embodiments, the mutant allele comprises variant C228T (hgl9,
chromosome 5 : 1,295,228) of the TERT gene promoter. In some embodiments, the mutant allele comprises variant C250T (hgl9, chromosome 5 : 1,295,250) of the TERT gene promoter. In some embodiments, the mutant allele comprises a variant comprising the sequence CCTTC (SEQ ID NO: 1) at about nucleotide positions 1,295,226-1,295,230 of human chromosome 5, as compared to the wild-type allele at the corresponding positions comprising the sequence CCCTC (SEQ ID NO: 2). In some embodiments, the mutant allele comprises a variant comprising the sequence CCCAGCCCCTTCCGGGCCC (SEQ ID NO: 3), as compared to the wild-type allele comprising the sequence CCCAGCCCCCTCCGGGCCC (SEQ ID NO: 4). In some embodiments, the mutant allele comprises a variant comprising T, or Thymine, at about nucleotide position 1,295,228 of human chromosome 5, as compared to the wild-type allele at the corresponding position comprising C, or Cytosine. In some embodiments, the mutant allele comprises a variant comprising the sequence CTTCC (SEQ ID NO: 5) at about nucleotide positions 1 ,295,248- 1 ,295,252 of human chromosome 5, as compared to the wild-type allele at the corresponding positions comprising the sequence CTCCC ( SEQ ID NO: 6). In some embodiments, the mutant allele comprises a variant comprising the sequence
CCGACCCCTTCCGGGTCCC (SEQ ID NO: 7), as compared to the wild-type allele comprising the sequence CCGACCCCTCCCGGGTCCC (SEQ ID NO: 8). In some embodiments, the mutant allele comprises a variant comprising T, or Thymine, at about
nucleotide position 1,295,250 of human chromosome 5, as compared to the wild-type allele at the corresponding position comprising C, or Cytosine.
[0033] In some embodiments, the forward primer comprises the nucleic acid sequence of 5'- CACGTGCGCAGCAGGACGCAG-3' (SEQ ID NO: 9). In some embodiments, the reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3' (SEQ ID NO: 10). In some embodiments, the PNA blocker comprises the nucleic acid sequence of 5'- CCCAGCCCCCTCCGGGCCC-3' (SEQ ID NO: 1 1). In some embodiments, the PNA blocker comprises the nucleic acid sequence of S'-CCGACCCCTCCCGGGTCCC-S' (SEQ ID NO: 12).
[0034] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- CCCAGCCCC+T+TCCGGGCCC-3' (SEQ ID NO: 13), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0035] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- CCGACCCC+T+TCCGGGTCCC-3' (SEQ ID NO: 14), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0036] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3'(SEQ ID NO: 15), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0037] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- Fy M-CCGACCCC+T+TCCGGGTCCC-Dab-3 ' (SEQ ID NO: 16), wherein nucl eotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0038] In some embodiments, the target nucleic acid comprises a portion of the nucleic sequence of an isocitrate dehydrogenase 1 (IDII1) gene. In some embodiments, the mutant allele comprises a variant that encodes an IDH 1 protein of variant R 132H. In some
embodiments, the mutant allele comprises the variant described as COSM28746 in the
Catalogue of Somatic Mutations In Cancer (COSMIC) of the Wel lcome Trust Sanger Institute; see, Forbes et al., 2014, Nucl. Acids Res., doi: 10.1093/nar/gkul075. In some embodiments, the mutant allele comprises a variant comprising the sequence GTCAT (SEQ ID NO: 17) at about nucleotide positions 392-396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 18). In some embodiments, the mutant allele comprises a variant comprising the sequence
AGGTCATC ATGC (SEQ ID NO: 19), as compared to the wild-type allele comprising the sequence AGGTCGTCATGC (SEQ ID NO: 20). In some embodiments, the mutant allele
comprises a variant comprising A, or Adenine, at about nucleotide position 395 from the start of the cDNA, as compared to the wild-type al lele at the corresponding position comprising G, or Guanine.
[0039] In some embodiments, the mutant allele comprises a variant that encodes an IDH1 protein of variant R 1 32C. In some embodiments, the mutant allele comprises the variant described as COSM28747 in COSMIC. In some embodiments, the mutant al lele comprises a variant comprising the sequence GTTGT (SEQ ID NO: 2 1 ) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT ( SEQ ID NO: 1 8). In some embodiments, the mutant allele comprises a variant comprising the sequence A GGTTGTC A TGC (SEQ ID NO: 22), as compared to the wi ld-type allele compri sing the sequence AGGTCGTCATGC (SEQ ID NO: 20). In some embodiments, the mutant allele comprises a variant compri sing T, or Thymine, at about nucleotide position 394 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
[0040] In some embodiments, the mutant allele comprises a variant that encodes an IDI 1 1 protein of variant R I 32G. In some embodiments, the mutant allele comprises the variant described as CO SM 28749 in COSMIC. In some embodiments, the mutant allele comprises a variant comprising the sequence GTGGT ( SEQ ID NO: 23 ) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 1 8). In some embodiments, the mutant allele comprises a variant compri sing the sequence AGGTGGTC A TGC ( SEQ ID NO: 24), as compared to the wild-type allele comprising the sequence AGGTCGTCATGC (SEQ ID NO: 20). In some embodiments, the mutant allele comprises a variant comprising G, or Guanine, at about nucleotide position 394 from the start of the cDN A, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
[0041] In some embodiments, the mutant allele comprises a variant that encodes an IDH I protein of variant R132S. In some embodiments, the mutant al lele compri ses the variant described as COSM28748 in COSMIC. In some embodiments, the mutant allele comprises a variant comprising the sequence GTAGT ( SEQ ID NO: 25) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions compri sing the sequence GTCGT ( SEQ ID NO: 1 8). In some embodiments, the mutant allele comprises a variant comprising the sequence AGGTAGTC ATGC (SEQ ID NO: 26), as compared to the wi ld-type allele compri sing the sequence AGGTCGTCAT GC (SEQ ID NO: 20). In some embodiments, the mutant allele comprises a variant comprising A, or
Adenine, at about nucleotide position 394 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising C, or Cytosine.
[0042] In some embodiments, the mutant allele comprises a variant that encodes an IDH I protein of variant R132L. In some embodiments, the mutant allele comprises the variant described as COSM28750 in COSMIC. In some embodiments, the mutant allele comprises a variant comprising the sequence GTCTT (SEQ ID NO: 27) at about nucleotide positions 392- 396 from the start of the cDNA, as compared to the wild-type allele at the corresponding positions comprising the sequence GTCGT (SEQ ID NO: 18). In some embodiments, the mutant allele comprises a variant comprising the sequence AGGTC TT A TGC (SEQ ID NO: 28), as compared to the wild-type allele comprising the sequence AGGTC GTCATGC (SEQ ID NO: 20). In some embodiments, the mutant allele comprises a variant comprising T, or Thymine, at about nucleotide position 395 from the start of the cDNA, as compared to the wild- type allele at the corresponding position comprising G, or Guanine.
[0043] In some embodiments, the forward primer comprises the nucleic acid sequence of 5'- CCGGCTTGTGAGTGGATGGGTAAAACCT-3' (SEQ ID NO: 29). In some embodiments, the reverse primer comprises the nucleic acid sequence of 5'- CATTATTGCCAACATGACTTACTTGATCCCC-3' (SEQ ID NO: 30). In some
embodiments, the PNA blocker comprises the nucleic acid sequence of 5 " - AGGTCGTC ATGC- 3' (SEQ ID NO: 20).
[0044] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+A+T+CAT+GC-3' (SEQ ID NO: 31), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0045] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+T+G+T+C+ATGC-3' (SEQ ID NO: 32), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0046] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGGT+G+G+T+CAT+GC-3' (SEQ ID NO: 33), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0047] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGGT+A+G+T+CA+T+GC-3 ' (SEQ ID NO: 34) wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0048] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+CAT+GC-3' (SEQ ID NO: 35) wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0049] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- F AM- AGG+T+C+A+T+C AT+GC-Dab-3' (SEQ ID NO: 36), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0050] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGG+T+T+G+T+C + ATGC -D ab -3 ' (SEQ ID NO: 37), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
diaminobenzidine.
[0051] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGGT+G+G+T+C AT+GC-Dab-3 ' (SEQ ID NO: 38), wherein nucleotides preceded by a "+'' are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
di ami nob enzi di ne .
[0052] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGGT+ A+G+T+C A+T+GC - Dab -3 ' (SEQ ID NO: 39), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is
diaminobenzidine.
[0053] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN- AGG+T+C+T+T+C AT+GC-Dab-3' (SEQ ID NO: 40) wherein nucleotides preceded by a "+" are LNA modified nucleotides, M AXN is fluorescent moiety, and Dab is
diaminobenzidine
[0054] In some embodiments, the mutant allele comprises a variant that encodes a BRAF protein of variant V600E. In another embodiment, the mutant allele comprises the variant described as COSM1131 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence TCACT (SEQ ID NO: 41), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence TCTCT (SEQ ID NO: 42). In still another embodiment, the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising T, or Thymine.
[0055] In some embodiments, the forward primer comprises the nucleic acid sequence of 5'- ACAGGGC ATGGAGAGTGGGTC-3 ' (SEQ ID NO: 43). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- CAAACTGATGGGACCCACTCCAT -3' (SEQ ID NO: 44). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5'- CATCGAGATTTCACTGTAGCTAGA-3' (SEQ ID NO: 45).
[0056] In still another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- AGA+TT+T+C+T+CT+GT+AG+C-3' (SEQ ID NO: 46), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0057] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- F AM- AGA+TT+T+C+T+C T+GT+ AG+C - D ab -3 ' (SEQ ID NO: 47), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0058] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGA+TT+T+C+T+CT-i-GT-i-AG-i-C-Dab-3 ' (SEQ ID NO: 48), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[0059] In some embodiments, the mutant allele comprises a variant that encodes an NRAS protein of variant Q6 1 R In another embodiment, the mutant allele comprises the variant described as COSM584 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence ACAAG (SEQ ID NO: 49) as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence ACGAG (SEQ ID NO: 50). In still another embodiment, the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant comprising A, or Adenine.
[0060] In some embodiments, the mutant allele comprises a variant that encodes an NRAS protein of variant Q61K. In another embodiment, the mutant all ele comprises the variant described as COS M 580 in COS IC. In yet another embodiment, the wild-type allele comprises the sequence ACAAG ( SEQ ID NO: 49), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence AAA AG ( SEQ ID NO: 51). In still another embodiment, the wild-type allele comprises C, or Cytosine, as compared to the mutant allele compri sing a variant compri sing A, or Adenine.
[0061] In some embodiments, the forward primer compri ses the nucleic acid sequence of 5'- AGTGGTTATAGATGGTGAAACCTG-3 ' (SEQ ID NO: 52). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- A C A G A GG A A G C C TTC GC C TG -3 ' (SEQ ID NO: 53 ). In yet another embodiment, the PNA blocker compri ses the nucleic acid sequence of 5 " -C AGCTGG AC A AG A AG AGT AC-K K-3 " (SEQ ID NO: 54).
[0062] In still another embodiment, the LNA probe comprises the nucleic acid sequence of 5 ' -CTGG+ AC+G+ AG+ A A+GAGT A-3 ' (SEQ ID NO: 55 ), wherein nucleotides preceded by a "+" are LN A modified nucleotides.
[0063] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- CAG+CTGGA+A+A+AGAA+GA+GTA-3 ' ( SEQ ID NO: 56), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0064] In another embodiment, the LNA probe compri ses the nucleic acid sequence of 5' -FA M- CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' (SEQ ID NO: 57), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0065] In still another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- FAM-CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3 ' (SEQ ID NO: 58), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0066] In a further embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' (SEQ ID NO: 59), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
[0067] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3 ' (SEQ ID NO: 60), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[0068] In some embodiments, the mutant allele comprises a variant that encodes a GNAQ protein of variant R183Q. In another embodiment, the mutant allele comprises the variant described as COS M 52975 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence TCGAG (SEQ ID NO: 61), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence TCAAG (SEQ ID NO: 62). In still another embodiment, the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant compri sing A, or Adenine.
[0069] In some embodiments, the mutant allele comprises a variant that encodes a GNAQ protein of variant Q209L. In another embodiment, the mutant allele comprises the variant described as COSM33719 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence CCAAA (SEQ ID NO: 63), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CCTAA (SEQ ID NO: 64). In still another embodiment, the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising T, or Thymine.
[0070] In some embodiments, the mutant allele comprises a variant that encodes a GNAQ protein of variant Q209P. In another embodiment, the mutant allele comprises the variant described as COSM33718 in C SMIC. In yet another embodiment, the wild-type allele comprises the sequence CCAAA (SEQ ID NO: 63), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CCCAA ( SEQ ID NO:
65). In still another embodiment, the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant comprising C, or Cytosine.
[0071] In some embodiments, the forward primer comprises the nucleic acid sequence of 5'- TTGGACCGCGTAGCTGACCCT-3' (SEQ ID NO: 66). In other embodiments, the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3' (SEQ ID NO: 67). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- GC TG GG A A A T A GGTTTC A TGG A C -3' (SEQ ID NO: 68). In still another embodiment, the reverse primer comprises the nucleic acid sequence of 5'- TCACTAAGCGCTACTAGAAACATG-3' (SEQ ID NO: 69). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5 -TTAGAGTTCGAGTCCCC A-.V (SEQ ID NO: 70). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5 -GGGGC C A A AGGTC A G A G A -3 ' (SEQ ID NO: 71 ).
[0072] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- AGAGT+TC+A+AGT+CCCCAC-3' (SEQ ID NO: 72), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0073] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- AGGGGCC+T+AAGGTCAGAG -3' (SEQ ID NO: 73), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0074] In certain embodiments, the LNA probe comprises the nucleic acid sequence of 5'- GGGCC+C+A AGGTC AGAGA -3 ' (SEQ ID NO: 74), wherein nucleotides preceded by a "+" are LNA modi ied nucleotides.
[0075] In still another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- FAM-AGAGT+TC+A+AGT+CCCCAC-Dab-3' (SEQ ID NO: 75), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0076] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5 -FAM- AGGGGCC+T+ A AGGTC AGAG-Dab-3 ' (SEQ ID NO: 76), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0077] In other embodiments, the LNA probe comprises the nucleic acid sequence of 5' -FA M- GGGC C +C + A A GG TC A G A G A -D ab -3 ' (SEQ ID NO: 77), wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0078] In yet another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3' (SEQ ID NO: 78), wherein nucleotides
preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
[0079] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-AGGGGCC+T+AAGGTCAGAG-Dab-3 ' (SEQ ID NO: 79), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[0080] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN GGGCC+C+AAGGTCAGAGA-Dab-3 ' (SEQ ID NO: 80), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[0081] In some embodiments, the mutant allele comprises a variant that encodes a GNA1 1 protein of variant Q209L. In another embodiment, the mutant allele compri ses the variant described as COSM 1 1 0736 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence CCAGC ( SEQ ID NO: 81), as compared to the mutant allele at the corresponding positions compri sing a variant comprising the sequence CCTGC (SEQ ID NO: 82). In still another embodiment, the wild-type allele comprises A, or Adenine, as compared to the mutant allele compri sing a variant compri sing T, or Thymine.
[0082] In some embodiments, the forward primer compri ses the nucleic acid sequence of 5 '- GCAGATTGGGCCTTGGGGCG-3 ' (SEQ ID NO: 83 ). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'-TCGCTGAGGGCGACGAGAAAC-3 ' (SEQ ID NO: 84). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5'- GGGCC AGCGGTCGGAGC-3 ' (SEQ ID NO: 85).
[0083] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'- GGG+CC+T+GCGGTCGG-3 ' (SEQ ID NO: 86), herein nucleotides preceded by a "+" are LNA modified nucleotides.
[0084] In yet another embodiment, the LNA probe comprises the nucleic acid sequence of 5 '- FAM-GGG+CC+T+GCGGTCGG-Dab-3 ' (SEQ ID NO: 87), wherein nucleotides preceded by a "+" are LN A modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0085] the LNA probe comprises the nucleic acid sequence of 5' -MAX N- GGG+CC+T+GCGGTCGG-Dab-3 ' ( SEQ ID NO: 88), wherein nucleotides preceded by a "+" are LN A modified nucleotides, MAXN i s fluorescent moiety, and Dab i s diaminobenzidine.
[0086] In some embodiments, the mutant allele comprises a variant that encodes an H3F3A protein of variant K27M. In another embodiment, the mutant allele comprises the variant described as COSM327928 in COSMIC. In yet another embodiment, the wild-type allele
comprises the sequence CAAGA (SEQ ID NO: 89), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence CATGA (SEQ ID NO: 90). In still another embodiment, the wild-type allele comprises A, or Adenine, as compared to the mutant allele comprising a variant compri sing T, or Thymine.
[0087] In some embodiments, the mutant allele comprises a variant that encodes an H3F3 A protein of variant G34R. In another embodiment, the mutant allele comprises the variant described as COSM957499 in COSMIC. In yet another embodiment, the wild-type allele comprises the sequence AGGGG (SEQ ID NO: 91), as compared to the mutant allele at the corresponding positions comprising a variant comprising the sequence AAGGG ( SEQ ID NO: 92). In still another embodiment, the wild-type allele comprises G, or Guanine, as compared to the mutant allele comprising a variant comprising A, or Adenine.
[0088] In some embodiments, the forward primer comprises the nucleic acid sequence of 5'- C TGC C C GC A A A TC G A C C GGT-3 ' (SEQ ID NO: 93). In another embodiment, the reverse primer comprises the nucleic acid sequence of 5'-GGATACATACAAGAGAGACTTTGTC-3' (SEQ ID NO: 94). In yet another embodiment, the PNA blocker comprises the nucleic acid sequence of 5'- GCCGCTCGCAAGAGTGCGCC-3 ' (SEQ ID NO: 95). In another
embodiment, the PNA blocker comprises the nucleic acid sequence of 5'- TTCTTCACCCCTCCAGTAG-3' (SEQ ID NO: 96).
[0089] In some embodiments, the LNA probe comprises the nucleic acid sequence of 5'~ CGCTCGC+A+T+GAGTG-3' (SEQ ID NO: 97), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0090] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- TACT+GGA+A+GG+GTGAAGA-3 ' (SEQ ID NO: 98), wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[0091] In other embodiments, the LNA probe comprises the nucleic acid sequence of 5'-FAM- CGCTCGC+A+T+GAGTG-Dab-3 ' (SEQ ID NO: 99), wherein nucleotides preceded by a "+" are LNA modified nucleotides, L AM is fluorescein moiety, and Dab is diaminobenzidine.
[0092] In yet another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- FAM-TACT+GGA+A+GG+GTGAAGA-Dab-3' (SEQ ID NO: 100), wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[0093] In another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-CGCTCGC+A+T+GAGTG-Dab-3' (SEQ ID NO: 101), wherein nucleotides preceded
by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is di ami nob enzi di ne .
[0094] In still another embodiment, the LNA probe comprises the nucleic acid sequence of 5'- MAXN-TACT+GGA+A+GG+GTGAAGA-Dab-3 ' (SEQ ID NO: 102), wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[0095] In some embodiments, two or more mutant alleles of TERT and/or IDH are detected simultaneously. In some embodiments, the two or more mutant alleles of TERT and/or IDH are detected simultaneously in the same well .
[0096] In some embodiments, a positive control genomic DNA is included, compri sing DNA which is homozygous, hemizygous or heterozygous for the mutant allele. In some aspects, a negative control genomic DNA is included, wherein the negative control contains only wild type sequence for the target al lele.
[0097] In some embodiments, the control genomic DNA is derived from glioma cell line LN428, which is heterozygous for TERT C228T. In some embodiments, the control genomic DNA is derived from glioma cell line LN443, which is homozygous for TERT C250T.
[0098] In some embodiments, the control genomic DNA is derived from primary glioma cell line BT 142, which is homozygous for IDH 1 R132H.
[0099] In some embodiments, the control genomic DNA template is derived from a melanoma cel l or a melanoma cell li ne. In some embodiments, the positive control genomic DNA is synthetic. In some embodiments, the negative control genomic DNA template i s derived from I ICC 1 143 cell line, which is homozygous wild-type for TERT C228T, TERT C250T, and IDH l R 1 32. In some embodiments, the negative control genomic DNA template is derived from B L I 954 cell line, which is homozygous wild-type for TERT C228T, TERT C250T, and IDHl R 132. In some embodiments, the negative control genomic DNA template is synthetic.
[00100] In some embodiments, the system or method includes a high-speed DNA polymerase. In some embodiments, the system or method includes a high-speed DNA polymerase has an elongation rate of about l kb/second. In some embodiments, the system or method includes a high-speed DN A polymerase that is Kapa 2G FAST DN A Polymerase.
[00101] In some embodiments, the system includes one or more multi-well plates.
[00102] In some embodiments, the system includes DNA extraction reagents. In some embodiments, the DNA extraction reagents are able to be used to extract DNA in 1 5 minutes or less.
[00103] In some embodiments, the system includes a cell lysis buffer. In some embodiments, the system includes Proteinase K. In some embodiments, the system includes deoxynucleotide triphosphates (dNTPs). In some embodiments, the system includes MgCS2.
[00104] In some embodiments, the sample is from a patient or human subject. In some embodiments, the sample is from a tumor or metastatic lesion. In certain embodiments, the sample comprises tissue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated ceil obtained from blood obtained from a subject, or a circulating cancer cell. In some embodiments, the sample comprises a cancer cell . In other embodiments, the sample comprises the sample comprises a tissue biopsy, blood, plasma, serum, cerebrospinal fluid, or one or more circulating cancer cells from the subject. In another embodiment, the sample comprises ti ssue from the subject, or one or more cancer cells from the subject. In some embodiments, the sample is from a skin biopsy. In another embodiment, the sample compri ses at least one component obtained from a body fluid. In yet another
embodiment, the body fluid is selected from blood, serum, plasma, cerebrospinal fluid, saliva, urine, semen, stool , lymph, and peritoneal fluid. In some embodiments, the sample compri es at least one component obtained from blood from a patient or human subject. In some
embodiments, the sample compri ses a circulating cancer cell . In stil l another embodiment, the sample compri ses at least one component obtained from a body ti ssue. In a further embodiment, the body tissue is an endobronchial brushing or an endotracheal brushing. In another embodiment, the sample comprises ti ssue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated cell obtained from blood obtained from a subject, or a circulating cancer cell .
[00105] In some embodiments, the sample comprises blood from the subject. In some embodiments, the blood from the subject comprises one or more circulating cancer cells. In some aspects the blood from a subject comprises serum. In some embodiments, the sample comprises tissue from the subject. In some embodiments, the tissue from the subject comprises one or more cancer cell s.
[00106] In some embodiments, the cancer is selected from the group consisting of: glioma, glioblastoma multiforme, melanoma, small cell lung cancer, non-smal l cell lung cancer, breast cancer, ovarian cancer, melanoma, uveal melanoma, bladder cancer, colon cancer, and lung cancer. In some embodiments, the cancer is a glioma. In some embodiments, the glioma i s selected from the group consisting of: high grade glioma, diffuse astrocytoma,
ol igodendrogl i oma, oligoastrocytoma, secondary glioblastoma, and primary glioblastoma. In some embodiments, the cancer is a melanoma. In another embodiment, the cancer is a glioma.
high grade glioma, diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, secondary glioblastoma, primary gli oblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
[00107] In some embodiments, the sample comprises archival tissue. In some embodiments, the archival tissue is formalin-fixed paraffin embedded.
[00108] In some embodiments, the sample from the subject i s taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and results of the method are avai lable to the surgeon to guide further treatment of the subject during the surgical procedure. In some embodiments, the method includes subsequent resection of a glioma tumor in the subject. In some embodiments, the method includes inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
[00109] In some embodiments, the method includes calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant al lele detected. In some embodiments, the method includes calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected relative to a standard curve generated from serial dilutions of control DNA.
[001 10] In some embodiments, the mutant allele has an al lelic frequency of 0.1% of the nucleic acid extracted from the sample.
[001 11] In some embodiments, the method includes validation of genome editing in cell culture or in an animal model .
[001 12] In some embodiments, the denaturing is initially done in about 1 round of incubation at about 95 °C for 2-5 minutes, and the annealing and amplifying are done in about 45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds. In some embodiments, the annealing and amplifying are done in about 40-50 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds. In some embodiments, the annealing and amplifying are done in about 35-45 rounds of incubation at 95 °C for 1 - 1 2 seconds fol lowed by about 62.5 °C to about 64.5°C for about 10-25 seconds. In some embodiments, the annealing and amplifying are done in about 40-45 rounds of incubation at 95 °C for 1 - 1 2 seconds followed by about 62.5 °C to about 64.5°C for about 1 0-25 seconds.
[001 13] In some embodiments, the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 62.5 °C to about 64.5°C. In some embodiments, the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 63.5°C.
[001 14] In some embodiments, the am pi icon is less than 70-300 nt in length.
[001 15] In some embodiments, the denaturing, annealing and amplifying steps are performed in a therm ocycler with a ramping rate of at least 1.6-3. 1 °C per second.
[001 16] Other embodiments will become apparent from a review of the ensuing detailed description, drawings, tables and accompanying claims.
BRIEF DESCRIPTION OF THE FIGURES
[001 17] The foregoing and other features and advantages of the system and methods disclosed herein will be more fully understood from the following detailed description of illustrative embodiments taken in conjunction with the accompanying drawings. The file of this patent contains at least one drawi ng/photograph executed in color. Copies of thi s patent w ith color drawi ng( s)/photograph( s ) will be provided by the Office upon request and payment of the necessary fee.
[001 18] Figure 1 graphically depicts the sensitive detection of 1DH 1 R 132H in a previously inconclusive brain biopsy. FIG. 1 A shows the clinical course of patient with temporal lobe abnormality eventually diagnosed as oligoastrocytoma eight years after initial presentation. Thi s 16-year-old patient presented with headaches and Mill revealed a non-enhancing lesion in the left medial temporal lobe (red arrowhead). Biopsy was obtained, but was pathologically inconclusive. Intraoperative MRI confirmed that the stereotactic needle was centered in the lesion (yel low arrowhead). She was subsequently followed for five years w ith minimal radiographic change. She re-presented with generalized seizures and radiographic progression three years later. At that time she underwent subtotal resection revealing WHO II
oligoastrocytoma. FIG. I B shows results of the method disclosed herein performed on 600 pg of n on -diagnostic biopsy revealing the presence of IDH 1 R 1 3211 mutation with estimated tumor purity of 1 1% (FIG. 10), consistent with the clinical diagnosis of diffuse glioma. FIG. 1 shows retrospective Imm unohi stochem i stry ( IHC) performed against IDH 1 R 1 3211 revealed rare tumor cells in initial biopsy (left panel ) compared to specimen obtained eight years later (right panel ). Scale bar i s 20 μιη.
[001 19] Figure 2 graphically depicts rapidly segregation of low and high grade gliomas by the method disclosed herein. FIG. 2 A shows a plot depicting assessment of mutations in IDH l , and TERT in 80 archived glioma cases. Glioma characterization according to the method di closed herein is based on the presence, absence or co-occurrence of IDH I and TERT. Second row represents final conventional neuropathologic diagnosis of each case demonstrating concordance with the method disclosed herein. Third row represents clinical assessment of chromosome
lp/19p deletion by FISH or aCGH and is demonstrated in black if tested positive and brown if untested. Bottom row illustrates that intraoperative frozen section analysis was diagnostic (purple) in 22/22 GBM, but inconclusive (pink) in 10/58 diffuse gliomas. The five specimens for which TER T promoter mutations and IDHl R132H were not detected (ND) by the method disclosed herein were all diagnosed histopathologically as GBM. FIG. 2B depicts the validation of the method disclosed herein on archived frozen WHO grade II oligodendrogliomas, oiigoastrocytomas, and astrocytomas revealed presence of IDHl R132H or TERT promoter mutations in 39/44 specimens. The samples were validated by targeted high depth sequencing of these genes. All but one of those cases that did not score by the method disclosed herein were found to have alternative IDHl and IDII2 mutations. FIG. 2C depicts assessment of false positive rate in third cohort representing 50 frozen GBM specimens. Two samples were noted by the method disclosed hereinto have IDHl R132H and 39 samples were noted to have either TERT C22ST or TERT C250T. The prevalence of non-scoring specimens in this cohort is the similar to the ratio of non-scoring GBM specimens in FIG. 2 A (p > 0.05 by Fisher' s exact test).
[00120] Figure 3 graphically depicts intraoperative molecular characterization of glioma. FIG. 3 A, entitled Case 1 demonstrates the detection of TERT promoter mutation from a specimen that was diagnosed as high grade glioma on frozen section analysis (single arrowhead indicating microvascular proliferation and double arrowhead indicating necrosis) and GBM on permanent section analysis. FIG. 3B, entitled Case 2 represents an instance of intraoperative detection of IDHl R132 mutation, which was in disagreement with frozen specimen analysis of GBM, but in agreement with permanent section analysis of IDHl mutant anaplastic oligoastrocvtoma. Single black arrowhead represents microvascular proliferation, double arrowhead represents thrombosed vessel within necrotic focus, green arrowhead represents mitotic figure. Scale bars represent 10 urn.
[00121] Figure 4 graphically depicts modified oligonucleotides selectively block exponential
PCR amplification of wild-type alleles. Peptide nucleic acid (PNA) oligonucleotides were designed to target wild-type alleles of IDHl R132 (FIG. 4A), //•7 /' C228 and TERT C250 (FIG. 4B). Genomic extracts were obtained from HCC 1 143 lymphocytes (wt), wild-type HCC 1954 lymphocytes (1954), BT142 primary glioma cell line with hemizygous IDHl R132H mutation, primary glioma cell line LN428 with JERJ' 22 T mutation and primary glioma cell line LN443 with TERT C250T mutation. PNA oligonucleotides have dose-dependent effects in selectively blocking wild-type allele amplification, while allowing for PCR amplification of mutant alleles.
[00122] Figure 5 graphically depicts locked nucleic acid (LNA) probes are specific for detection of mutant alleles. Locked nucleic acid probes were designed for targeting lDH I R132H (FIG. 5 A), 77^7 C228T (FIG. 5B), or 77^7 C250T (FIG. 5C). LNA probes selectively detect mutant alleles, but not wild-type (wt) alleles. These experiments were performed in the absence of modified PNA oligonucleotides.
[00123] Figure 6 graphically depicts Sanger sequencing validation of positive and negative control genomic extracts. //>/-/ 7 (FIG. 6A) and TERT promoter (FIG. 6B) amplicons were confirmed by Sanger sequencing. Wild-type controls were obtained from cell extracts from HCC l 143 lymphocytes. 1DH 1 R132H mutant genomic extract was obtained from BT 142 neurospheres. lER J C22ST and TERT C250T controls were obtained from the LN428 and
LN443 primary glioma cell lines, respectively. PGR products were generated in the absence of PNA oligonucleotide blockers.
[00124] Figure 7 graphical ly depicts highly sensitive and specific detection of tumor alleles by the methods disclosed herein. Combination of allele-specific Taqman probes and wild-type allele blockers with modified oligonucleotides allows for sensitive detection of IDH l R132H (FIG. 7A), TERT C22ST (FIG. 7B), and TERT C250T (FIG. 7C) to 0.1% tumor allele fraction. Genomic DNA from BT142, LN428, or LN443 was diluted serially in wild-type genomic extracts from HCCl 143 lymphocytes.
[00125] Figure 8 graphically depicts quantitative analysis allows for gross estimation of tumor purity. The method disclosed herein performed in the presence of modified PNA
oligonucleotides allows for gross estimation of tumor purity hen tumor genomic extract is serially diluted in wild-type genomic extract (red diamonds, wild-type).
[00126] Figure 9 graphically depicts previously inconclusive biopsy specimen with estimated tumor purity of 1 1% by the method disclosed herein. Standard curve was generated by serial dilution of genomic extract containing IDHl R 1 2H mutant alleles with wild-type genomic extract. The /7)7/ 7 R132H detection signal crossed threshold at 42.5 cycles (red dot) which corresponds with -64 pg starting mutant genomic extract (1 1% of the starting material of 600
Pg)-
[00127] Figure 10 graphically depicts TERT promoter am pi icon characterization by deep sequencing in non-scoring and discordant samples noted in FIG. 2 A reveals accurate targeted genotyping by the method disclosed herein. PGR amplicons of the TERT promoter were generated in the samples that were discordant between molecular characterization and clinical pathologic diagnosis and subjected to high depth sequencing (mean depth 250,000x). Positive controls for TERT C228T and TERT C250T were also run in parallel . Fraction of mutant alleles
detected by high depth sequencing is displayed in white text within respective TERT mutations. The TERT C250T mutation was observed at an allelic fraction of -10% by Mi Seq in the one sample that was characterized as diffuse astrocytoma, but noted to have a co-mutation of //)/// and TERT C250T by the method disclosed herein. The other seven samples in which no TERT promoter mutations were observed were also wild-type by high depth sequencing of the amplicon.
[00128] Figure 11 graphically depicts sensitivity and specificity analysis of results compared to final pathologic diagnosis. FIG. 1 1 A: Expanded heatmap from FIG. 2 A demonstrating individual IDH 1 R132H, TERT C22&T and TERT C250T mutations for each glioma specimen. Glioma diagnoses were predicted as primary glioblastoma if //Ji? 7 mutant and E3H1 R 1 2 wild- type (FIG. 1 IB), oligodendroglioma if TERT and IDH 1 R132H mutant (FIG. 1 1 C), or diffuse glioma, oligoastrocytoma, or secondary glioblastoma if IDH 1 R132H mutant and TERT wild- type (FIG. 1 I D). Combining the analysi s for panels (c) and (d) yields the results for non- primary glioblastoma diagnoses (FIG. 1 IE). Listed in parentheses are 95% confidence interv als.
[00129] Figure 12 graphically depicts a proposed workflow of intraoperati ve analysis of biopsy specimen. Specimen is immediately placed in lysis buffer and incubated at 55 C en route to pathology lab. DNA extraction is completed with magnetic beads. This sample is applied to a plate already containing the optimized mastermix to detect IDH 1 R132H, TERT ' C228T or TERT C250T with respective positive controls. The rapid qPCR protocol allows for detection of these mutant alleles within 30 minutes.
[00130] Figure 13 graphically depicts a list of primers, detection probes and modified oligonucleotide blockers. Modified locked nucleic acids are indicated by a preceding "+".
[00131] Figure 14 A graphically depicts the rapid detection of TERT promoter mutant alleles to discriminate malignant skin pathology and detection of cell free alleles in serum correlates with systemic disease burden.
[00132] Figure 14B graphically depicts the rapid detection of TERT promoter mutant alleles showing cell free DNA from serum of patient with newly diagnosed metastatic melanoma was positive for TERT C22%T. Similarly purified cell free DNA from a patient with non-small cell lung cancer (NSCLC) was negative for TERT promoter allele mutants.
[00133] Figure 15 graphically depicts a proposed workflow of the application of the method disclosed herein to detection of cell free mutant alleles in serum . Blood is collected in an EDTA-containing tube. Serum isolated by serial centrifugation. Cell free DNA extraction is completed by kit. This sample is analyzed and quantified. Normalized sample is applied to a
plate already containing the optimized mastermix to detect IDHl R132H, TERT C228T or TERT C250T with respective positive controls, and analyzed by the method disclosed herein.
[00134] Figure 16 graphically depicts the detection of cell free circulating mutant TERT promoter allele C228T DNA in a sample from a patient with glioblastoma multiforme recurrence, not responding to concurrent chemoradiation. Cell free DNA was purified from serum of patient obtained at time of clinical and radiographic progression of GBM in middle of postoperative concurrent chemoradiation. The method disclosed herein detected presence of TERT C22ST . For comparison, 100% genomic extract from LN428 and 1% LN428 extract diluted in wild-type HCC1 143 lymphocytes is overlayed.
[00135] Figure 17 graphically depicts a table of cell free circulating DNA samples.
[00138] Figure 18 graphically depicts the detection of cell free circulating TERT C228T in a patient with metastatic melanoma.
[00137] Figure 19 graphical ly depicts the detection of decreased cell free circulating TERT
C228T in a patient with metastatic melanoma in response to treatment.
[00138] Figure 20 graphically depicts the detection of cell free circulating TERT C228T to define the primary contribution to systemic disease.
[00139] Figure 21 graphically depicts the detection of cell free circulating TERT C228T in a patient with lung carcinoid.
[00140] Figure 22 graphically depicts the rapid and sensitive detection of BRAF promoter mutant alleles.
DETAILED DESCRIPTION
[00141] Before the invention is described, it is to be understood that this invention is not limited to particular methods and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, because the scope of the invention wi ll be limited only by the appended claims.
[00142] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which thi s invention belongs.
[00143] The present disclosure provides sensitive methods that detect cancer-speci ic mutations in specimens, by including the following features: (1) forward and rev erse primers to a target sequence, (2) inclusion of modified oligonucleotides with peptide nucleic acid (PNA) backbones
to block logarithmic amplification of wild-type alleles, and (3) incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity.
[00144] In certain embodiments, the term "wild-type allele" as used herein means an allele of a gene which has the highest gene frequency in a given population. In certain embodiments, this population is a population of humans in a certain geographical area. This area can be a continent, country, state, province or municipality. In certain embodiments, the population can be a human population separated by gender, race, national origin or age.
[00145] In other embodiments, "wild-type allele" refers to an allele that is not associated with higher prevalence of occurrence of a disease state relative to a "mutant allele" that is associated with a higher prevalence of occurrence of a disease state. In certain embodiments, that disease state is cancer. In other embodiments, the cancer is melanoma or glioma.
[00148] The terms "genetic information" and "gene" as used herein include various components associated with the chromosomal locus that encodes a functional sequence. In most
embodiments a "gene" includes not only a transcriptional coding region which encodes information of niRNA, iRX. Y. rR A, snRNA, and the like, but also includes one or more regulatory regions such as a promoter or enhancer which is required for gene expression. Where appropriate, one or more of these regions may be distinguished individually, e.g., a promoter sequence or a coding sequence.
[00147] In certain embodiments, the term "mutant allele" as used herein means an allele of a gene which is associated with one or more disease aspects. As used herein a mutant allele does not have the highest gene frequency in a given population. This mutant allele could have the second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth highest gene frequency among known alleles in a population. As explained above, in certain embodiments, this population is a population of humans in a certain geographical area. This area can be a continent, country, state, province or municipality. In certain embodiments, the population can be a human population separated by gender, race, national origin or age.
[00148] In other embodiments, "mutant allele" refers to an allele that is associated with higher prevalence of occurrence of a disease state relative to a "wild-type allele" that is not associated with a higher prevalence of occurrence of a disease state. In certain embodiments, that disease state is cancer. In other embodiments, the cancer is melanoma or glioma. In another embodiment, the cancer is a glioma, high grade glioma, diffuse astrocytoma, oligodendroglioma, ol igoastrocytoma. secondary glioblastoma, primary glioblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
[00149] The term "mutation" as used herein means a change in the sequence of a nucleic acid such as DNA and RNA, and includes a base substitution, insertion, deletion, inversion, duplication, translocation, and the like used in genetics and the like. In certain embodiments, this mutation represents the physical genetic difference between a wild-type allele and a mutant allele. The region of the mutation in a mutant allele is not limited to a transcriptional region, but includes a regulatory region such as a promoter which is required for gene expression. In this regard, the mutation in a mutant allele does not require a functional change.
[00150] In certain embodiments, "variant" refers to an alteration in the normal sequence of a gene. A variant may include a single nucleotide polymorphism, a mutation, or a gene copy numb er van ati on .
[00151] In certain embodiments, "single nucleotide polymorphism" (S P ) refers to a single substitution of a nucleotide base for another at a particular site that occurs in more than 1% of the general population of a species. A single nucleotide polymorphism can have up to four possible versions at its site: A, C, G or T. Single nucleotide polymorphisms occur about once in every 300 nucleotide base pairs in the human genome. Linked or indicative SNPs are not located within genes and do not affect function of a protein. Causative SNPs include coding and non- coding SNPs, and affect protein function. Coding SNPs are found in the coding region of a gene and change the amino acid sequence of the coded protein product. Non-coding SNPs are found in the regulatory regions of a gene, and affect expression of the gene, including amount, timing and/or location of the gene's expression.
[00152] In certain embodiments, "somatic variant" refers to an alteration of DNA that occurs in any cell of the body other than the germ cells, and is neither inherited from a parent nor passed to offspring.
[00153] In certain embodiments, "molecular diagnosis" refers to a diagnostic technique utilizing the analysis of one or more molecular and/or biological markers that define disease state, and can be used for diagnosing, monitoring or staging a disease, determining risk, or determining a therapeutic approach.
[00154] The term "target site" as used herein means a site in which a mutated base exists or a base is deleted by a mutation in a mutant allele, and a site to be detected as a target using the methods disclosed herein, including a wild-type allele. For example, in the case of a base substitution, the target site is a base which is substituted in both a wild-type allele and a mutant allele. In the case of an insertion, the target site in a mutant allele is an inserted base, and the target site in a wild-type allele is a site into which the base is inserted in the mutant allele. In the case of a deletion, the target site in a mutant allele is a site in which a base is deleted by the
deletion, and the target site in a wild-type allele is the deleted base in the mutant allele. The sequence of a target site may be a site having a sequence which encodes genetic information (sometimes referred to as a sense site or sequence), or a site having a sequence complementary to the sense sequence (sometimes referred to as an antisense site or sequence).
[00155] As used herein, the term "complementary" refers to the complement of a DNA
sequence as the sequence with each based changed to its complement pair (e.g., G to C, C to G, A to T and T to A).
[00156] The term, "reverse complementary" of a DNA sequence, as used herein, is the sequence backwards orientation (/',<?, the reverse of a sequence as read from 5' to 3 ' would be the sequence from 3 ' to 5'), and with each based changed to its complement pair (e.g., G to C, C to G, A to T and T to A).
[00157] The term "ampiicon" as used herein means a molecule of DNA or RNA that is the source and/or product of natural or artificial amplification or replication events. It can be formed using various methods including polymerase chain reactions (PGR), ligase chain reactions (LCR), or natural gene duplication. In this context, "amplification" or "amplifying" refers to the production of one or more copies of a genetic fragment or target sequence, specifically the ampiicon. As the product of an amplification reaction, ampiicon i s used interchangeably with common laboratory terms, such as PGR product. The ampiicon used in the methods disclosed herein can generally be between 70-300 nt in length. The ampiicon used in the methods herein can be less than 300, 200, 100, 90, 80 or 70 nt in length. In certain embodiments, the am pi icons used according to the disclosure are 70-80, 70-90, 70-100, 70-200, 70-300, 80-90, 80-100, 80-200, 80-300, 90-100, 90-200, 90-300, 100-200, 100-300 or 200-300 nt in length. Primers and Probes
[00158] The term "forward primer" as used herein refers to a short, single-stranded DNA sequence that binds to a target DNA sequence and enables addition of new deoxyribonucleotides by DNA polymerase at the 3' end, wherein the pri mer binds upstream of a target site and to the sense strand of the target nucleic acid. According to certain embodiments, the forward primer is 18-35, 19-32 or 21-31 nt in length. The nucleotide sequence of the forward primer is not limited, so long as it speci ically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 °C, may be within a range of 63.3 °C to 63.7
°C, and may be 63.5°C. The nucleotide sequence of the forward primer may be manually designed to confirm the Tin value using a primer Tin prediction tool .
[00159] The term "reverse primer" as sued herein refers to a short, single-stranded DNA sequence that binds to a target DN A sequence and enables addition of new deoxyribonucleotides by D A polymerase at the 3' end, wherein the primer binds downstream of a target site and to the antisense strand of the target nucleic acid. According to certain embodiments, the reverse primer is 18-35, 19-32 or 20-31 nt in length. The nucleotide sequence of the reverse primer is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 C, may be within a range of 6 .3 C to 63.7 °C, and may be 63.5°C. The nucleotide sequence of the reverse primer may be manual ly designed to confirm the Tm value using a primer Tm prediction tool .
[00160] Peptide nucleic acids (PNA) are artificial, chemically synthesized nucl eic acid analogues which have a structure in which a basic backbone of a nucleic acid constituted by pentose and phosphoric acid i s replaced with a polyamide backbone having no charge including glycine as units. PNA binds more specifically and strongly to a nucleic acid having a complementary nucleotide sequence in comparison with DNA and RNA. In contrast, since PNA is a chemical ly synthesized substance, it has a property that nucleic acid polymerases and nucleases do not act thereon. By utilizing such a property, a method for selectively amplifying only a mutated gene by suppressing a w ild-type gene by performing a PGR method using a PNA oligomer that i s specific to a wild-type gene is known.
[00161] The term "PN A" as used herein includes not only conventional PNA, but also a PNA derivative which is an improvement based on PNA and has properties similar to PNA, for example, gripNA provided by Active Motif.
[00162] The term "PNA blocker" as used herein means an oligonucleotide comprising PNA which hybridizes with a target site. A PNA blocker comprises an oligonucleotide comprising one or more peptide nucleic acids that acts to block (i .e., inhibit or cause a relative decrease in) amplification of the wild -type allele, and does not block ampli ication of the mutant allele. A PN A blocker may compri se a mixture of nucleic acids, PNA, and amino acids. A PN A blocker may comprise a backbone containing amide bonds, deoxyribose sugar, ribose sugar, and charged phosphate groups. In this context, "block" is intended to mean inhibit or cause a decrease in relative amplification of the targeted wild-type allele to which the PNA blocker hybridizes. Such inhibition or relative decrease in amplification of the wild-type allele allow s sensitivity of the methods disclosed herein in detecting very low copy number of the variant allele. The PNA
blocker hybridizes to a region of the wild-type allele located within the region amplified by the forward and reverse primer. The PNA blocker can be composed of PNA over a portion of its length or the entire sequence. Therefore, when it hybridizes with a nucleotide sequence, it shows an extremely high sel ectivity to the nucleotide sequence due to the properties of PNA. Further, since PNA is not affected by nucleic acid polymerases and nucleases, the PNA blocker does not function as a primer and is resistant to nucleases. The nucleotide sequence of the PNA blocker is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tin value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62.5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 °C, may be within a range of 63.3 °C to 63.7 °C, and may be 63.5°C. The nucleotide sequence of the PNA blocker may be manually designed to confirm the Tin value using a PNA Tm prediction tool . The length of the PNA blocker is not limited, so long as it i s 10 to 25 nucleotides. The length of the PNA blocker can be 1 2 to 22 nucleotides. The length of the PNA blocker can be 1 2 to 19 nucleotides. Since the prevalence of a wild -type gene is larger than that of a mutated gene in a gene pool, the concentration of the PN A blocker may be 2-10 times or more that of the LNA probe in the reaction solution for gene amplification so that the PNA blocker can sufficiently hybridize with the wild-type gene. For example, when the concentration of the LNA probe is 100 nmol/L, the concentration of the PN A blocker i s approximately I umol/L, or approximately 5 μιηοΙ/L.
[00163] Locked nucleic acids (LNA) are artificial, chemically synthesized nucl eic acid analogues compri sing an RNA nucleoside in which the 2' oxygen and 4' carbon of the ribose moiety are chemically linked (e.g., by a methylene bond). Similarly to PNA, LNA has high affinity for a nucleic acid having a complementary nucleotide sequence, and binds thereto more specifically and strongly in comparison with DNA and RNA. In contrast, unlike PNA, LNA has sensitivity against nucleases, and may also act as a primer for nucleic acid polymerases. By utilizing such properties, a method for detecting and using a PGR method with an LNA probe was developed.
[00164] The term "LNA" as used herein includes not only conventional LN A, but al so a LNA derivative which is an improvement based on LNA and has properties similar to LNA.
[00165] The term "LN A probe" as used herein means a probe which hybridizes with a target site, and at least one nucleotide contained in the DNA sequence of which is replaced with LNA. Thi s embodiment is characteri zed by the fact that the nucleotide sequence of the LNA probe is a sequence complementary to that of the mutated gene. The LNA probe hybridizes to the target sequence at a location that i s between where the forward primer and reverse primer binds. The nucleotide sequence of the LNA probe is not limited, so long as it specifically hybridizes with
part of or an entire target site, and its Tm value may be within a range of 50 °C to 65 °C, and in particular may be within a range of 62,5 °C to 64.5 °C, may be within a range of 63.0 °C to 64.0 C, may be within a range of 63.3 C to 63.7 °C, and may be 63.5°C. The nucleotide sequence of the LNA probe may be manually designed to confirm the Tm value using an LNA Tm prediction tool. The number of nucleotides contained in the LNA probe is 10 to 50 nucleotides, and may be 15 to 25 nucleotides. The length of the LN A probe can be 12 to 22 nucleotides. The length of the LNA probe can be 12 to 19 nucleotides. The number of LNA present within the LN A probe is not limited, so long as it is one or more, and all the nucleotides may be replaced with LNA. With respect to a position at which a nucleotide is replace with LNA in the LNA probe, when there are one or more bases which are not found in a target region of a wild- type gene, at least one of these bases may be replaced with LNA. For example, in the case that a mutation is an insertion of some bases, at least one of the inserted bases may be replaced with LNA.
[00166] The melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can also be about 62.5 °C to about 64.5°C, may be about 63.0 °C to about 64.0 °C, may be about 63.3 °C to about 63.7 °C, and may be 63.5°C. In particular, the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can be about 63.5°C to 63.7°C. In particular, the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker can be about 63.5°C. The Tm values may be determined using the disclosed buffer conditions. Other primer lengths and Tm values known in the art may be used where appropriate, e.g., where different buffer systems are used, and/or where stringency requirements differ.
Systems and methods for detecting single nucleotide polymorphisms
[00167] The system and methods of use described herein include or make use of the polymerase chain reaction (PCR) PGR relies on thermal cycling, which consists of cycles of repeated heating and cooling of the reaction for D A denaturation, annealing and enzymatic elongation of the amplified DNA. Components of PCR include primers that contain sequences which are complementary to the target region(s), and a DNA polymerase. In the PCR reaction, the DNA generated (sometimes called the amplicon) is itself used as a template for further replication, creating a chain reaction that exponentially amplifies the DNA template. PCR can be extensively modified to perform a wide array of genetic manipulations.
[00168] Most applications of PCR applications utilize DNA polymerase that is heat-stable, such as Taq polymerase (originally isolated from J hem s aqiiaticus). The DNA polymerase
generates a new strand of DNA from nucleotides, where a single-stranded DNA is used as a template and DNA oligonucleotides or primers, are used for initiation of DNA synthesi s. PCR methods generally use thermal cycling, which is alternate heating and cooling of the PCR reaction through a set series of temperature steps.
[00169] First, the strands of the DNA are separated at a high temperature in a process called DNA melting or denaturing. Next, the temperature is lowered, allowing the primers and the strands of DNA to selectively anneal, creating templates for the polymerase to amplify the target DNA . Use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions allows for selectivity of the reaction.
[00170] In general, a typical PCR process requires a number of components and reagents.
These include: a DN A template that contains the target region of interest to be amplified; two primers that are complementary to the 3' (three prime) ends of each of the sense and anti -sense strand of the DNA target (a forward primer and a reverse primer); a DNA polymerase with a temperature optimum at around 60-70 °C; deoxynucleotide triphosphates ( dNTPs); a buffer solution, providing a suitable chemical environment for optimum activity, binding kinetics, and stability of the DNA polymerase; bivalent cations such as magnesium or manganese ions;
generally Mg2 is used, but Mn2+ can be used, where higher Mn~ " concentration can increase the error rate of the DNA polymerase; and monovalent cations, such as potassium ions.
[00171] PCR can comprise a series of 20-50 repeated temperature cycles, with each cycle commonly consi sting of 2-3 discrete temperature steps. Temperatures and the duration of each step can vary depending on a number of parameters. These include the enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the reaction, and the melting temperature (Tm) of the primers. Some typical PCR steps include the following:
[00172] Initial step: This step involves heating the reaction to a temperature of about 94-96 °C which can be held for about 1-9 minutes. In the present disclosure, methods may not require or include this initial step. In some cases, this step is performed at about 5 °C for 2-5 minutes.
[00173] Denaturing step: This step involves heating the reaction to 94 -98 °C for 1 -12 seconds. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between complementary bases, yielding single-stranded DNA molecules. In the present di sclosure, denaturing may be done at about 95 °C for 1 - 12 seconds.
[00174] Annealing step: The reaction temperature is lowered to 50-65 C for 10-25 seconds which allows the primers to anneal to the single-stranded DNA template. The polymerase then binds to the hybridized primer and template and begins DNA polymerization. In the present
disclosure, the annealing step may be done at about 62.5 °C to 64.5 °C for about 10-25 seconds. In some cases, thi s step is performed at about 63.5 °C.
[00175] Extension/elongation (or amplifying) step: This step generally uses a temperature of about 60-72 °C with a DNA polymerase enzyme. At this step, the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5' to 3' direction, condensing the 5'-phosphate group of the dNTPs with the 3'-hydroxyl group at the end of the nascent (extending) DNA strand. The extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified. In the present disclosure, the amplifying step may be done at about 62.5 C to 64.5 C for about 10-25 seconds. In some cases, this step is performed at about 63.5 °C.
[00176] The methods of the present disclosure use a combi ned annealing and
extension/elongation step. In other words, the annealing and amplifying steps occur at the same temperature condition and during the same amount of time. Such modification optimizes the process for shorter total reaction times, resulting in a method that is useful for applications requiring a rapid process as described herein.
[00177] For example, in the present methods, the annealing and amplifying can occur in a single step at about 62.5 °C to 64.5 °C for about 10-25 seconds. In some cases, the annealing and amplifying can occur in a single step performed at about 63.5 °C for about 10-25 seconds.
[00178] In the case of the methods disclosed herein, the annealing and elongation steps occur at the same temperature conditions, allowing optimization to the method for applications where a rapid process is desired.
[00179] The system and methods provided herein make use of a variation of PCR called Quantitative PCR (qPCR), which measures the accumulation of DN A product after each round of PCR amplification in order to measure the quantity of a target sequence (such measurement often occuring in real-time). Quantitative PCR can be used to determine whether a particular sequence is present in a sample, and to determine the number of its copies in the sample.
Quantitative PCR often methods use fluorescent dyes, such as Sybr Green, EvaGreen or tl uoropho e-contai ni ng DN A probes, such as TaqMan, to measure the amount of amplified product during the reaction in real time.
Features of the System and Methods
[00180] The system and methods herein are desi ned to generate sensitive detection of alleles with v ery low prev alence, through the inclusion of modi ied oligonucleotides with peptide
nucleic acid (PNA) backbones to block logarithmic amplification of wild-type alleles, and incorporation of locked nucleic acids (LNA) into mutant allele detection probes to increase specificity. In the case of the present methods disclosed herein, the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature conditions, allowing the annealing and elongation steps to occur at the same temperature conditions, thereby optimizing the method for applications where a rapid process is desired or required. The system and methods herein are optionally adapted to overcome the low complexity and/or high GC content of a target sequence, and/or to detect cancer-specific mutations in specimens with low tumor size, mass and/or density.
[00181] First, a PNA blocker comprising PNA having a sequence complementary to a target site of a wild-type gene, and an LNA probe having a sequence complementary to a target site of a mutant allele and comprising DNA that contains LNA, are allowed to contact a forward primer, a reverse primer, and a DNA template in a buffer or reaction solution for gene amplification. Since wild-type genes are generally present in a sample DNA in large amounts, the PNA blocker is added in slight excess amount. As a result, the PNA blocker, the LNA probe, and the forward primer and reverse primer hybridize with the respective corresponding complementary sequences on the genes to be detected. Most or parts of the nucleotide sequences of the PNA blocker and the LNA probe accord with each other, because their target sites are the same. Therefore, both the hybridizations to the target sites essentially compete with each other. However, since PNA and LNA exhibit a high specificity to each complementary nucleotide sequence, even if the mutation is a difference in only one nucleotide, almost all the PNA blocker hybridizes with the target site on the wild-type gene, and almost all the LNA probe hybridizes with the target site on the mutant allele.
[00182] Next, the resulting reaction solution for gene amplification is subjected to a primer elongation reaction using a gene amplification method. Since the PNA blocker does not function as a primer, no elongation reaction occurs from it. Therefore, the amplification of the detection region comprising the target site of the wild-type gene is suppressed by the hybridization of the PNA blocker. In contrast, LNA does not exhibit an inhibitory activity to primer elongation like PNA. Since the LNA probe can function as a primer, an elongation reaction occurs, and the region comprising the target site of the mutant allele is amplified over the LN A probe site and between the forward primer and reverse primer.
[00183] The amplicon length is typically dictated by experimental goals. In the methods of the present disclosure, which utilize quantitative PGR, goal for amplicon length should be 70 to 300 bases for optimal PGR efficiency and to allow for shorter annealing and elongation times. For
many cases, the ampiicon length is closer to 100 bp or less. Given the known positions of the forward primer and the reverse primer with respect to the template, the length of the product is calculated as: Product length = (Position of antisense primer) - (Position of sense primer) + 1.
[00184] The melting temperature Tm) of the ampiicon is the temperature at which one half of the DNA duplex will dissociate and become single stranded. The stability of a primer-template DNA duplex can be measured by the melting temperature (Tm). Low sequence complexity and/or high GC content can result in an ampiicon having a melting temperature that is relatively higher than a sequence with greater sequence complexity and/or lower GC content. In the methods disclosed herein, the Tm of the ampiicon is generally about 62.5 °C to about 64.5 °C.
[00185] The length of the extension cycle required can be affected by ampiicon size. In the methods of the present disclosure, the extension cycle is shorter (in part due to ampiicon size designed to be shorter) to allow for faster extension of the ampiicon. The length of extension steps can also be affected by the DNA polymerase used. DNA polymerases used in the present methods are described herein.
[00186] After the completion of the elongation reaction, the PNA blocker, the LNA probe, and the forward primer and the reverse primer are again hybridized with the corresponding complementary sequences on the genes to be detected. The cycles of gene amplification reaction are repeated by to selectively amplify a region comprising sequence of the mutant allele. The number of the cycles varies in accordance with the type of a DNA polymerase used, and is not limited, so long as it is within a range of 30 to 55 cycles. It can be 35 to 50 cycles. In particular, it can be 40 to 45 cycles.
[00187] In the present methods, the denaturing, annealing and amplifying steps can be done in about 3 -50 rounds of incubation at 95 °C for l - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds.
[00188] In some embodiments of the present methods, the quantitative PCR method comprises the following conditions. Forward and reverse primers for a target site of a gene are designed and empirically optimized for an anneal/elongation temperature of 63.5 C. 5' Nuclease probes against mutant alleles and corresponding PNA oligonucleotide blockers against wild-type alleles are designed to detect mutations in the target site of the gene. Optimal sensitivity was achieved through the use of two distinct gene wild-type PNA blocking oligonucleotides designed to these two respective sites. Similarly, 5'Nuclease probes and the PNA wild-type blockers were designed for optimal performance at 63.5 C for the respective genomic templates.
[00189] For example, the primers for a target site of a gene include, but are not limited to, SEQ ID NOs: 9, 43, 52, 66, 67, 83, and 93 for forward primers and SEQ ID NOs: 10, 44, 53, 68, 69,
83, and 94 for reverse primers. The primers for a target site of a gene were used at final concentrations of 250-750 nM. For example, the LNA probes for a target site of a gene include, but are not limited to, SEQ ID NOs: 46, 50, 56, 61, 68, 75, 79 and 85 The LNA probe comprising locked nucleic acids for detection of a mutation in the target site of the gene was 250 nM. The peptide nucleic acid (PNA) probe for blocking wild-type gene amplification was 150- 900 nM.
[00190] The qPCR reactions were run in 384-well plates on an ABI QuantStudio 6 instrument (Applied Biosystems) in the presence of 60 nM ROX to account for background fluorescence. Appropriate buffers include ABI GeneExpression 2X mastermix or KAPA 2G Fast Polymerase buffer A and enhancer to a final concentration of Ix. PGR cycling times were 95 C for 3 minutes followed by 40-60 cycles at 95° for 10 seconds and 63.5 C for 20 seconds.
[00191] In other embodiments, the qPCR reactions were run in 96- ell plates on an ABI 7500 instrument (Applied Biosystems).
Detection of Amplified Product
[00192] The region of sequence which is derived from the mutant allele and amplified by the method is detected. The detection method is not limited, so long as the amplification of the region of the mutant allele can be confirmed. For example, the 5' terminus of the amplification primer may have been previously labeled with a fluorescent substance, and after the completion of the gene amplification reaction, fluorescent emission may be captured and detected using an appropriate detector. In these detection methods, results can be compared to the measured values with the results of an appropriate control. Further, confirmation of the presence of the target site of the mutant allele in the amplified product can be made by sequencing, or other method, including but not limited to immunohistochemistry, where available. Polymerases
[00193] The system and methods provided herein are designed to give rapid and quantitative detection of a single nucleotide variant or polymorphism from a sample, and utilizes DNA Polymerase. In particular, a DNA Polymerase with a high rate of elongation can be used to optimize the amount of time needed to complete the quantification of the target site in the sample, facilitating a more rapid process. For example, such a polymerase such as has an elongation rate of about l kb/second. The DNA polymerase can be a high-speed DNA polymerase such as Kapa 2G FAST DNA Polymerase (Kapa Biosystems).
Buffers
[00194] The buffers or reaction solutions as described herein refer to a solution or solutions containing reagents and the like which are required for the gene amplification reaction in the gene amplification method. The formulation of the reaction solution for gene amplification may need minor modifications depending on the gene amplification method used, but the reaction solution for gene amplification basically contains 4 kinds of deoxynucleoside triphosphates (dATP, dTTP, dCTP, and dGTP: hereinafter collectively referred to as dNTPs) as substrates, a DNA polymerase as an enzyme, a magnesium ion as a cofactor for the enzyme, and
amplification primers as primers for elongation, in a buffer. The concentrations of dNTPs may be selected within a range of 100 nrnoi/L to 400 nmol/L as a final concentration of each. A DNA polymerase having properties suitable for the gene amplification method used may be used. The concentration of the magnesium ion may be selected within a range of I mmol L to 6 mmol/L as a final concentration.
[00195] The buffer has an optimum pH and an optimum salt concentration capable of obtaining the activity of the DNA polymerase. Various types of reaction solutions for gene amplification are commercially available for each gene amplification method, and one attached to such a commercially available kit may be used.
Kits
[00198] The system disclosed herein can be part of a kit, optionally including further components for use in the methods disclosed herein, or for other uses. In some cases, the kit can include DNA extraction reagents, in particular DN A extraction reagents which are suitable and/or designed for rapid extraction of DNA from a sample.
[00197] Kits can provide primers and LNA and PNA components that are specific for at least one target nucleic acid. A kit generally comprises the forward primer, reverse primer, LNA probe and PNA blocker for at least one target nucleic acid. The target nucleic acid can be a region of the TERT promoter, such as one or both somatic variants C228T and C250T, as further described herein. In such cases, the LNA probe can hybridize to a nucleotide region comprising a T at position 228 or 250, respectively, of the mutated allele of the TERT promoter and the PNA blocker hybridizes to a nucleotide region comprising a C at the corresponding position in a wild type allele. In some cases, the target nucleic acid is a region of the IDH1 gene, such as the nucleotide sequence encoding a somatic mutation at position 132 of the polypeptide.
In such cases, the LNA probe can hybridize to a nucleotide region comprising a mutated codon encoding an amino acid selected from one or more of a histidine ("H"), cysteine ("C"), glycine
("G"), serine ("S") and leucine ("L") at position 132 of the mutated IDH 1 protein and the PNA blocker hybridizes to a nucleotide region comprising a wild type codon encoding an arginine ("R") at the corresponding position in a wild type allele.
[00198] In some aspects, the kits can compri se primers, probes and blockers for more than one target nucleic acid, such as a kit comprising primers, probes and blockers for a variant of the TERT promoter, and primers, probes and blockers for one or more variants of the IDH1 gene.
Other Uses of the System and Methods
Intraoperative Uses
[00199] Intraoperative histopathology can be technically challenging in the setting of low eel hilarity lesions and smal l biopsy specimens, and these difficulties may hamper surgical decision-making. Cancer genome sequencing has revealed that many tumors can now be positively identified by recurrent genomic features. For instance, greater than 80% of gliomas can be identified and clustered by IDH 1 and TERT promoter mutations, within groups that correspond closely to existing hi stopathologic classification. In accord, research techniques have applied real-time PCR detection of IDH I mutation or mass spectrometry to the
intraoperative detection of 2-hydroxyglutarate, the metabolite of mutant IDH 1 . In one aspect, the method disclosed herein is designed to simultaneously detect the di stinguishing genomic features in both the TERT promoter and //)/// in an intraoperative timeframe to sensitively detect diffuse glioma and guide neurosurgical resection. The methods prov ided herein could be used for real-time intraoperative diagnosis. In some embodiments, the intraoperative diagnosis can be used to confirm a diagnosi s. In another embodiment, intraoperative diagnosi s allows for intraoperative therapy. In yet another embodiment, the intraoperative therapy may comprise resection, thermal ablation therapy, laser microsurgery, or targeted therapy at the time of operation
[00200] The methods of the present disclosure are designed to be done in a very rapid fashion, in order to enable intraoperative decision making and guidance of subsequent operative steps, including resection of the detected or graded tumor or lesion. These methods are capable of being performed within 30 minutes of the completion of DNA extraction. With rapid extraction techniques allowing extraction of sample DN A within 1 5 minutes, the result is a method which i s capable of providing sensitiv e results to the surgeon within 45 minutes, thus allowing the surgeon to act on the results within an intraoperative timeframe.
[00201] The methods of the present disclosure are also very sensitive at detection of single nucleotide polymorphisms and somatic variants. Through the use of optimized probes and wild-
type blocking oligonucleotides, we show detection as low as 0.1% mutant allele fraction in an intraoperative timeframe.
[00202] A further application of the methods described herein takes advantage of their high sensitivity to detect single nucleotide polymorphisms or somatic variants in cell free circulating DNA, such as detection of cell free circulating tumor DNA, which may be present in blood or serum are very low levels not detectable by other means.
[00203] In many applications of the methods described herein, the method can include calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected.
[00204] In many cases, it is based on quantitative amount of mutant allele detected relative to standard curve generated from serial dilutions of control DN A
[00205] Rapid and sensitive molecular characterization by this assay could guide the decision to pursue a maximal upfront resection of gliomas, obv iating the need for a staged craniotomy pending final pathologic confirmation. Furthermore, the ability to obtain intraoperative molecular information allows for the future possibility of administering direct intratumoral therapy. Another direct application of this assay would be to quantify the extent of residual di sease at the surgical margin and incorporate that information into postoperative oncologic treatment planning. In addition, targeted analysis of IDH1 and TERT promoter mutations with minimal tissue requirement could accurately characterize and stratify glioma subtypes, with potential implications for prognosis and clinical trial design .
[00206] In some applications of the methods described herein, the sample from the subject is taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and results of the method are available to the surgeon to guide further treatment of the subject during the surgical procedure.
[00207] In some cases, the method can include subsequent resection of a glioma tumor in the subject.
[00208] In some cases, the method can include inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
These methods for detecting single nucleotide somatic variants can be applied as non-invasive biomarker detection methods for monitoring disease progression and treatment response.
Identification of circulating cell free tumor DNA w ith digital PCR has been a widely applied to a variety of tumor subtypes (C. Bettegovvda et a I., Set Transl, Med, 6, 224ra24 ( 2014); S.-J. Dawson et a I., N, Engl J, Med. 368, 1199 1209 (2013) ) . One challenge of detecting cell free mutant alleles is the fragmented nature of circulating tumor DNA, necessitating short PCR
am pi icons to capture these fragments. A second challenge is the low abundance of tumor- specific alleles circulating as cell free DNA fragments, which is addressed by the abi lity of the present methods to detect in cell free DNA fragments variants such as TERT C22ST or TERT C250T, The methods can be used with as little as 25 pg starting genomic material to detect circulating cell free DNA variant in a patient at any stage in the patient' s disease. The present methods can be used to detect circulating cell free DNA variant at a later timepoint post- treatment, supporting determination of disease progression and/or clinical treatment response.
Other Uses
[00209] The diagnosis, prognosis and assessment of therapeutic treatment of diseases or disorders can be facilitated by the sensitive detection of single nucleotide polymorphisms or somatic variants using the systems and methods described herein. For diagnostic purposes, the methods and systems can be used to detect a mutant allele or alleles in one or more target nucleic acids. By quantifying the amount of the mutant allele( s) in a sample relative to a control, the likelihood of the presence of the di sease or disorder can be determined for a subject.
Prognosis can be determined by detecting a mutant allele or alleles in one or more target nucleic acids, and. quantifying the amount of the mutant allele(s) in a sample relative to a control. In thi s way, the prognosis of a disease or disorder can be determined for a subject. In addition, the assessment of a targeted therapeutic approach can be facilitated by detecting a mutant allele or alleles in one or more target nucleic acids, and quantifying the amount of the mutant allele( s) in a sample relative to a control . In thi s way, the effectiveness of the targeted treatment on the di sease or disorder can be determined.
Melanoma
[00210] In certain embodiments, the methods and systems described herein are used to detect or diagnose melanoma. In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of melanoma. In certain embodiments, mutations in BRAF, NRAS and/or TERT are used to detect, diagnose or detect an increased risk of the presence of melanoma. In some embodiments, mutations in BRAF, NR AS and/or TERT are detected in cell free DNA. This cell free DNA can be isolated from blood, serum or plasma.
Mutations in BRAF, NR AS and/or TERT can also be detected in tissue samples. In certain embodiments, the detection of mutation in these genes can be used prognostic indicators for melanoma. In other embodiments, mutations in these genes can be used for assessing a therapeutic response to melanoma. In certain embodiments, the mutation in NRAS is one that
leads to a Q6IR or Q61K mutation in the protein encoded by this gene. In certain embodiments, the mutation in TERT to the promoter of this gene.
[00211] In certain embodiments, the method s and systems can take ad vantage of the occurrence of somatic single nucleotide variants targeting the Q61 codon of NRAS occurs in 10-25% of cutaneous melanoma (Tsao, H., et al. (2012); Genes Dev., 26: 1 131-1 155), and thereby facilitate the detection of Q61 variants for the diagnosis of melanoma. Because patients undergoing therapies targeting mutant BRAF have been found to develop resistance through mechanisms that result in mutations to the NRAS Q61 codon (Van Allen E, et al . (2014); Can Disc. ,4:94), their prognosis can be facilitated by applying the methods and systems herein to detection of NRAS 06 1 variation. Furthermore, since patients with NRAS-mutant melanoma have a better response to immunotherapy than those with mutant BRAF (Johnson, DB, et al. (2015); Cancer Immunol Res., 3(3):288-295), the detection of single nucleotide or somatic variants in NRAS and BRAF using the methods and systems herein can facilitate the prognosis and monitoring of efficacy of targeted treatment in melanoma patients.
[00212] In certain embodiments, the methods and systems described herein are used to detect or diagnose uveal melanoma. In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of uveal melanoma. In certain embodiments, mutations in BRAF, GNAQ, GNA 1 1 and/or TERT are used to detect, diagnose or detect an increased risk of the presence of uveal melanoma. In some embodiments, mutations in BRAF, GNAQ, GNAl 1 and/or TERT are detected in cell free DNA. This cel l free DNA can be i solated from blood, serum or plasma. Mutations in BRAF, GNAQ, GNA 1 1 and/or TERT can al so be detected in tissue samples. In certain embodiments, the detection of mutation in these genes can be used prognostic indicators for uveal melanoma. In other embodiments, mutations in these genes can be used for assessing a therapeutic response to uveal melanoma. In certain
embodiments, the mutation in G AQ is one that leads to a R 1 83Q, Q209L or Q209P mutation in the protein encoded by this gene. In certain embodiments, the mutation in GNAl 1 i s one that leads to a Q209L mutation in the protein encoded by thi s gene.
[00213] Somatic single nucleotide variants in GNAQ or GNA 1 1 are found in over 80% of uveal melanomas. These variants lead to activation of the MAPK pathway (Chen X., et al ., (2014); Oncogene, 33 :4724-4734, Van Raamsdonk CD, et al (2010); N Engl J Med, 363 :2191-2199,
Van Raamsdonk CD, et al. (2009); Nature 457:599-602). Inhibition of the MAPK pathway can lead to improved progression free surv ival (Carvajal RD, et al . (2014); Jama 3 1 1 :2397-2405 ). Predicting response i s hindered, however, by the location of the tumor. Diagnosis of uveal melanoma could thus be improved by monitoring, for example, the blood of patients with uveal
melanoma by the detection of alterations to GNAQ and/or GNA 1 1 according to the methods herein.
Diffuse intrinsic pontine glioma and H3F3A
[00214] In certain embodiments, the methods and systems described herein are used to detect or diffuse intrinsic pontine glioma (DIPG), In certain embodiments, the methods and systems described herein are used to detect an increased risk of the presence of DIPG. In certain embodi m ents, mutati ons i n H3F3 A are used to detect, diagnose or detect an increased risk of the presence of DIPG. In some embodiments, mutations in H3F3A are detected in cell free DMA. This cell free DNA can be isolated from blood, serum, plasma, or cerebrospinal fluid.
Mutations in H3F3 A can al so be detected in tissue samples. In certain embodiments, the detection of mutation in these genes can be used prognostic indicators for DIPG. In other embodiments, mutations in these genes can be used for assessing a therapeutic response to DIPG. In certain embodiments, the mutation in H3F3A is one that leads to a K27M or G34R mutation in the protein encoded by thi s gene.
[00215] Diffuse intrinsic pontine gliomas (DIPG) are diffusely infiltrative malignant glial neoplasms that arise in the brainstem during childhood ( Panditharatna E., et al . (2015); Cancer Genet. 208, 367-373 ). These tumors are highly aggressive and ultimately fatal . More than 70% of diffuse intrinsic pontine glioma, one-third of pediatric glioblastoma and nearly 20% of pediatric anaplastic astrocytoma have recently been found to harbor recurrent mutations in H3F3A (Schwartzentruber, J. et al. (20 1 2); Nature 482, 226-23 1, Wu, G. et al. (20 12); Nat. Genet. 44, 25 1 -253 ). Though there i s a growing consensus toward obtaining biopsies of patients with suspected DIPG (Walker, D A. et.al . (20 1 3 ); euro-oncology 4, 462-468 ), The risks of routine brainstem biopsies in children remains concerning. The systems and methods herein, when applied to the sensitive detection of variants of H3F3A, can improve the diagnosis success rate for diffuse gl iomas, including DIPGs, especially given that the disease could be diagnosed and monitored in response to targeted therapeutic approaches using small volumes of Cerebrospinal Fluid (CSF). Such a minimally-invasive approach to diagnosis, prognosis and monitoring therapeutic response could significantly improve the management of diffuse gliomas in adults and children.
Research Applications
[00216] The skilled artisan will be aware of the many useful further applications of these methods to enable sensitive detection of single nucleotide polymorphisms or somatic variants
for research uses. In some cases, the methods herein can also include the experimental validation of genome editing in cel l culture or in an animal model .
[00217] In further examples, applications of these methods can be used with archival tissue. In some cases, the archival tissue is in a formalin-fixed paraffin embedded sample.
[00218] Furthermore, in accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g. , Green &
Sambrook, Molecular Cloning: A Laboratory Manual, Fourth Edition (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; DNA Cloning: A Practical Approach, Volumes I and II (D.N. Glover ed. 1985); Oligonucleotide Synthesis (M.J . Gait ed. 1984); Nucleic Acid Hybridization [B.D. Hames & S.J. Higgins eds. ( 1985 )]; Transcription And Translation [B.D. Hames & S.J. Higgins, eds. ( 1 984)]; Animal Cell Culture [R.I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular ( lotting ( 1984); F.M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
[00219] The present invention is further illustrated by the following examples which should not be construed as further limiting. The contents of the figures and all references, patents and published patent applications cited throughout thi s application are expressly incorporated herein by reference for all purposes.
EXAMPLES
[00220] The following examples are included to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the methods and compositions featured in the invention, and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric. Example 1. Rapid Quantitation of Single Nucleotide Polymorphisms to Identify Glioma
C ASE REPORT
[00221] In 2006, a 16-year-old woman presenting with progressive headaches was found to have a non-enhancing left medial temporal lobe lesion on T2-wei ghted MRI. She had a normal neurologic exam. She underwent an MRI-guided stereotactic biopsy to obtain diagnostic tissue,
but four separate frozen section specimens were inconclusive (FIG. 1 A). Final neuropathology analysis noted a mild increase in eel hilarity, scattered atypical cells, and low Ki-67 proliferation index (less than 1% of cells). These findings were suggestive, but not diagnostic, of an infiltrative diffuse glioma. Given the lack of a definitive diagnosis, she was followed clinically with annual serial imaging and neurologic examination for the following five years without evidence of radiographic changes and was subsequently lost to follow-up. In 2014, she presented with a generalized seizure. An MRI revealed an increase in the extent of the non- enhancing lesion with progression along the medial temporal lobe, extending into the ipsi lateral thalamus and crossing the splenium of the corpus callosum. Due to the extent of disease, she underwent a partial resection, with pathology revealing a WHO Grade II oligoastrocytoma with cytological atypia, rare mitoses and an elev ated Ki -67 proliferation index of (6.3%). Analysis of the tumor revealed retention of chromosome arms l p and 19q, MGMT methvlation, and IDH 1 R132H detected by mutant-specific i m m unoh i stochem i stry . Based on thi s new diagnostic information, the patient went on to receive temozolomide chemotherapy.
METHODS
[00222] To address the challenge of non-diagnostic intraoperative biopsies, we developed a rapid molecular diagnostic method to detect TERT promoter and IDH 1 R132H mutations, sensitively and specifically.
Quantitative PGR methods
[00223] Forward and reverse primers for regions of interest in IDH 1 and TERT promoter were designed and empirically optimi zed for an anneal/elongation temperature of 63.5 C. 5" Nuclease probes against mutant alleles and corresponding PNA oligonucleotide blockers against wild- type alleles were designed to detect IDH 1 R 1 32 mutations and TERT promoter mutations on chromosome 5 at positions 1,295,228 and 1 ,295,250 based on human genome reference version 19 (referred to hereafter as TERT C228T or TERT C250T) (FIG. 13). Optimal sensitivity was achieved through the use of two distinct TERT w ild-type PNA blocking oligonucleotides designed to these two respective sites. Similarly, 5 ' Nuclease probes and the PNA wild-type blockers were designed for optimal performance at 63.5 C for the respective genomic templates.
[00224] The primers for IDH 1 were 5'-CCGGCTTGTGAGTGGATGGGTAAAACCT-3 '
(SEQ ID NO: 29) and 5'-CATTATTGCCAACATGACTTACTTGATCCCC-3 ' (SEQ ID NO: 30) both used at final concentrations of 750 nM. The TaqMan probe for detection of the IDH I R132H mutation was 250 nM 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3 ' (with the locked nucleic acid being denoted by a preceding +; SEQ ID NO: 36) (Exiqon). The peptide nucleic
acid (PNA) probe for blocking wild-type IDH I amplification was 900 iiM 5'- AGGTCGTC ATGC-3 ' (SEQ ID NO: 20) (PNA Bio).
[00225] The primers for TERT were 5 ' -C ACGTGCGC AGC AGGACGC AG-3 ' (SEQ ID NO: 9) and 5'-CTTCACCTTCCAGCTCCGCCTC-3 ' (SEQ ID NO: 10) used at 500 nM. The TaqMan probe for detecting TERT C228T was 250 nM 5 ' -FAM-
CCCAGCCCC+T+TCCGGGCCC-Dab-3 ' (SEQ ID NO: 15) and TERT C250T is 250 nM 5'- FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3 ' (SEQ ID NO: 16). The PNA probes for blocking amplification of TERT C22S and TERT C250 were 150 nM 5'- CCCAGCCCCCTCCGGGCCC-3 ' (SEQ ID NO: 1 1) and 500 nM 5'- CCGACCCCTCCCGGGTCCC-3 ' (SEQ ID NO: 12), respectively.
[00228] The qPCR reactions were run in 384-vvell plates on an ABI QuantStudio 6 instrument (Applied Biosystems) in the presence of 60nM ROX to account for background fluorescence. IDH 1 reactions were carried in using ABI GeneExpression 2X mastermix and TERT were carried out in the presence of K A PA. 2G Fast Polymerase buffer A and enhancer to a final concentration of Ix. PCR cycling times were 95 C for 3 minutes followed by 40-60 cycles at 95° for 10 seconds and 63.5 C for 20 seconds.
Development and optimization of rapid genotyping methods
[00227] One challenge of detecting mutant alleles in brain biopsies with infrequent tumor cells is competition for PCR reagents by wild-type alleles from surrounding normal cells. To address this, PNA oligonucleotides, which cannot be digested by 5' exonuclease activity or used as a primer for extension by DNA polymerase, were used to block the amplification of wild-type alleles (FIG. 4). At the same time, high mutant allele specificity was achieved through the use of LNAs, where a chemically synthesized ribose moiety stabilized by an additional covalent bond is incorporated into the detection probe in order to optimize hybridization characteristics and minimize non- specific binding to wild-type alleles (FIG. 5). TERT promoter and IDH 1 control templates were validated by Sanger sequencing (FIG. 6). The method design allowed for simultaneous parallel detection of IDH 1 and TERT promoter mutations. The IDH I R132H detection probe was labeled with a FAM moiety while the lower frequency R132 detection probes were labeled with a MAX moiety to allow for simultaneous detection of canonical and non-canonical IDH I alterations. In these optimized methods, IDH 1 R132H, R 132S, R 132C, R 132G, R 132L, TERT C228T, or TERT C250T could be detected in samples harboring as low as 0.1% mutant allele fraction (FIG. 7). Reactions contained on average 25ng of genomic input, however signal was detected from as low as 60pg of input
material as quantified by PicoGreen (Invitrogen). Estimation of tumor purity was extrapolated from standard curves generated from serial dilutions of mutant specific control DNAs (FIG. 8). For validation by next generation sequencing, PCR am pi icons were generated for these regions and subjected to high depth sequencing by MiSeq ( Il lumina). Sequences were aligned by standard methods and were manually reviewed by Integrated Genome Viewer with allelic fraction threshold of 5%.
Tumor specimens
[00228] Archived glioma specimens and intraoperative specimens were obtained under approval of the Institutional Review Board s at Dana-Farber Cancer Institute and Massachusetts General Hospital, respectively. Archived FFPE cases that were suggestive of
ol i odendrogl i om a by hi stological examination also had been analyzed for deletion of chromosome I p and 19q by fluorescence in situ hybridization (FISH ) or array comparative genomic hybridization (aCGH).
[00229] FFPE specimens were extracted using Qiagen QIAamp FFPE kit using manufacturer's recommended protocol. Intraoperative or fresh tissue specimens were extracted using
Invitrogen ChargeSwitch magnetic bead isolation system following manufacturer' s protocol using the following modifications: increased proteinase K concentrations, shortened incubation at 55°C, and elution in lower buffer volumes.
[00230] Circulating cell free DNA was i solated from 5ml of fresh peripheral blood using the Qiagen Circulating Nucleic Acid Isolation kit following manufacturer's protocol and quantified by PicoGreen and visualized by Agilent BioAnalyzer.
Control genomic templates
[00231] The BT 142 cell line (ATCC), which is hemizygous for the 1DH I R 132H mutation
(Luchman HA, et al., Neuro-Oncol 2013; 15(8):979-80) was grown under standard conditions. The 7/·7ν C228T and TERT 250T control templates were generated from established glioma cell lines LN428 and LN443, respectively. Wild-type DNA was isolated from the normal lymphoblastic cell line HCC1954 (ATCC ).
Detection of glioma in previously inconclusive biopsy
[00232] To determine whether we could detect glioma-defining mutations in a non-diagnostic biopsy, we obtained a small FFPE fragment of the above-described patient' s 2006 inconclusive specimen. Despite a DNA concentration of 600 pg/uL, using the method disclosed herein we
were able to detect IDHl R132H but no TERT promoter mutation, consistent with the patient's ultimate diagnosis of ol igoastrocy toma (FIG. I B). Using serial dilution curves, we estimate that this specimen contained only 11% tumor cells (FIG. 9). Consistent with result of the method discl osed herein, retrospective IHC analysis of the 2006 biopsy confirmed that rare infi ltrative tumor cells were positive for IDHl R 132H (FIG. 1 C). Of course current neuropathology protocols, including IHC for IDHl R132H, could have similarly established the diagnosis of grade II diffuse glioma post-operatively (Camelo-Piragua S, et al., Acta Neuropathoi (Berl) 2010; 119(4):509-11; Anderson MD, et al, Neuro-Oncol 2013; 15(7):811-3). However, definitive resection following final pathology would require a second craniotomy. As this case highlights the hesitation to resect lesions that cannot be definitively diagnosed as infiltrative glioma, we asked whether sensitive and rapid molecular characterization of both IDHl and the .7 7 ' promoter could provide intraoperative clarification of non-diagnostic neurosurgical biopsies. Application of the method to intraoperative glioma characterization
[00233] We first sought to validate these methods' ability to detect II )H I and TERT promoter mutations simultaneously across a range of clinically annotated gliomas (Arita H, et al, Acta Neuropathoi (Berl) 2013; 126(2):267 76; Killela PJ, et al., Proc Natl Acad Sci U S A
2013 ; 110(15) :6021-6; Nonoguchi N, et al., Acta Neuropathoi (Berl ) 2013; 126(6):931-7). We therefore performed a blinded comparison between molecular characterization based on the method disclosed herein, pathologic diagnoses and DNA sequencing analyses from 80 FFPE archival glioma samples (Cryan JB, , et al., Oncotarget 2014). In order to allow for subsequent validation using IHC for IDHl R 132H mutation, tumors with IDH2 or non-R132H IDHl mutations were excluded from this analysis. Across this group of gliomas, the method disclosed herein was able to detect every tumor with an IDHl mutation (58/58 samples), as confirmed by IDHl R132H IHC. Though there is no clinical test to confirm mutations in the TERT promoter, concurrent IDHl and TERT promoter mutations detected by the method disclosed herein accurately predicted oligodendrogliomas in 38/40 cases with known lp/19q co-deletion (Killela PJ, et al., Proc Natl Acad Sci U S A 2013; 1 10(15):6021-6; Chan AK-Y, et al., Mod Pathol Off J U S Can Acad Pathol Inc 2014). In addition, TERT promoter mutations without an 11) I mutation were detected in 17/22 GBM, a frequency consistent with prior reports (Killela PJ, et al., Proc Natl Acad Sci U S A 2013; 110(15):6021-6; Nonoguchi N, et al., Acta Neuropathoi (Berl) 2013; 126(6):931-7; Koelsche C, et al, Acta Neuropathoi (Berl) 2013; 126(6):907-15). To confirm mutation status in the eight discordant cases, these tumors were additionally
analyzed at the TERT promoter by high depth next generation sequencing to a mean of 250,Q00x coverage (FIG. 10). In each case, high depth sequencing was concordant with the method disclosed herein, demonstrating the accuracy of these methods. The correlation between molecular characterization based on the method disclosed herein and final pathologic diagnosis of oligodendrogliomas, diffuse astrocytomas, oligoastrocytomas and secondary glioblastomas in this series of 80 cases revealed 100% sensitivity (94-100%, 95% confidence interval) and 100% specificity (84-100%, confidence interval ) (FIG. 2 A, FIG. 11).
[00234] Of note, review of the frozen section diagnoses in the FFPE cohort revealed that whil e an intraoperative diagnosis had been made in 22/22 high grade gliomas, 10/58 di fuse gliomas were not diagnosed definitively at the time of intraoperative histologic examination.
Retrospective central neuropathology review confirmed that seven of these frozen section preparations were inconclusive (FIG. 2A). This underscores the potential value of molecular characterization to assist in establishing an intraoperative diagnosis, and led us to evaluate the method disclosed herein in a second validation cohort of 44 archived frozen WHO grade II diffuse gliomas. We were able to detect either IDH1 R132H or TER T promoter mutations C228T or C250T in 39/44 frozen diffuse glioma specimens ( FIG. 2B). Four of the five cases that did not score by the method disclosed herein were found to have alternative IDH 1/2 mutations by targeted high-depth sequencing. To further explore the possible false positive rate associated with the method disclosed herein, we analyzed 50 frozen GBM specimens (FIG. 2C). Similar to the frequency noted in the FFPE cohort, 39 GBM specimens were positive for TERT C228T or TERT C250T and only 2 were found to have an IDH 1 R132H mutation by the method disclosed herein. Furthermore, these 50 GBM cases were subjected to targeted high-depth sequencing which confirmed the presence of the two IDH 1 mutations detected by the method disclosed herein, consistent with a zero false positive rate in this cohort.
[00235] Having validated the method disclosed herein on a range of archived glioma specimens, we next tested whether these methods could be used in an intraoperative timeframe to detect mutant alleles during glioma surgery. Using intraoperative tissue specimens from five different procedures, the method disclosed herein was able to detect glioma-specific somatic single nucleotide variants (sSNV) in IDH I or the TERT promoter within 45 minutes of tissue acquisition (FIG. 12 ). To illustrate how this workflow could ultimately be applied in a clinical setting, we present two additional cases in which this method could have provided intraoperative molecular characterization (FIG. 3A-B). The first case illustrates the ability to detect TERT C228T in a GBM (FIG. 3 A) within an intraoperative timeframe. The second patient had a frozen section diagnosis of GBM; however, the method disclosed herein detected an IDH 1
R132H mutation and no TERT promoter mutation, which would also be consistent with WHO Grade 11 111 glioma (FIG. 3B). indeed, the pathologic assessment from the permanent specimen agreed with the analysi s by the method disclosed herein and ultimately concluded that the tumor was an anaplastic oligoastrocytoma. These cases demonstrate that the method disclosed herein can provide molecular characterization, accurately facilitating pathologic diagnosis in an intraoperative timeframe.
Example 2. Quantitation of Single Nucleotide Polymorphisms to Identify Melanoma : Application of the method disclosed herein to melanoma
[00236] While malignant gliomas represent an ideal usage scenario, TERT promoter mutations are found in diverse cancer types, many of which are biopsied in the outpatient setting. Given that over 70% of melanoma harbor a mutation in the TERT promoter (F. W. Huang et al., Science. 339, 957 -959 (2013), S. Horn et al, Science. 339, 959 -961 (2013), J. Vinagre et al , Nat. ommim. 4, 2 1 85 (2013)), we tested whether the method disclosed herein could be used for discriminating benign from malignant skin lesions. An analysi s of 20 archiv ed skin biopsies by the method disclosed herein rev ealed TERT ' C228T in zero and TERT ' C250T in 4/5 cases (FIG. 14 A). Accordingly, identi ication of these two somatic SNPs by the method di sclosed herein predicted malignant skin neoplasm in 4/5 cases, which captured 80% of malignant melanoma lesions in this cohort. Of note, the TERT promoter mutations were not identified in benign lesions. We al so used the method disclosed herein to detect circulating eel 1 free mutant TERT promoter alleles in a patient with metastatic melanoma. Serum from thi s patient was found to have circulating cell free TERT C22&T and this diminished after initiation of ipilimumab (FIG. 14B). Example 3. Sensitive detection of TERT alterations in circulating tumor DNA
Control genomic templates
[00237] The BT 142 cell line (ATCC), which is hemizygous for the IDH1 R132H mutation (H. A. Luchman et al. , Nearo-Oncol. 14, 1 84- 19 1 (20 1 2); H. A. Luchman, et al ., Neuro-Oncol. 15, 979 -980 (2013)) was grown under standard conditions. The TERT C22ST and TERT C250T control templates were generated from primary glioma cell lines LN428 and LN443, respectively. Neurospheres were harvested and the cell pellet was extracted using the QiaAMP kit (Qiagen). DNA extracts were quantified by PicoGreen dye ( Inv itrogen) and normalized to 25 ng/^iL in Tris-EDTA.
Quantitative PCR primers and conditions
[00238] The primers for TERT are 5 ' -CACGTGCGC AGC AGGACGC AG-3 ' (SEQ ID NO: 9) and 5'-CTTCACCTTCCAGCTCCGCCTC-3' (SEQ ID NO: 10) used at 500 nM. The TaqMan probe for detecting TERT C22ST is 250 nM 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3' (SEQ ID NO: 15) and TERT C250T is 250 nM 5'-FAM-CCGACCCC+T+TCCGGGTCCC-
Dab-3' (SEQ ID NO: 16). The PNA probes for blocking amplification of TERT C22S and TERT C250 are 150 nM 5'-CCCAGCCCCCTCCGGGCCC-3' (SEQ ID NO: 11) and 500 nM 5'- CCGACCCCTCCCGGGTCCC-3' (SEQ ID NO: 12), respectively.
[00239] The TERT promoter mutations were detected using 5X buffer with enhancer and F AST 2G Taq polymerase (Kapa Biosy stems).
[00240] The qPCR reaction were prepared in a final volume of 15 μΕ and run on an ABI
7900HT instrument (Applied Biosystems). PCR cycling times were 95 C for 3 :00 followed by 40-50 cycles at 95° for 10 seconds and 63.5 C for 20 seconds. Cell free tumor DNA analysis from blood
[00241] Patient blood samples were obtained under IRB approval from Massachusetts General Hospital and Dana Father Cancer Institute. Samples were obtained in EDT A containing tubes and were centrifuged within 1 hour to separate plasma. Cell free DNA was purified from 3 m L plasma using the QiaAmp Circulating nucleic acid isolation kits following manufacturers protocol (Qiagen). Samples were eluted with 25 μΐ. buffer AVE and 3μΕ of this elute was used for each reaction for the method disclosed herein. Samples were also analyzed for overall DNA fragmentation state by Bioanalyzer (Agilent).
[00242] We next tested whether this approach for detecting these pathognomonic sSNVs could be applied as non-invasive biomarker detection methods for monitoring disease progression and treatment response. Identification of circulating cell free tumor DNA with digital PCR has been a widely applied to a variety of tumor subtypes (C. Bettegowda et a!., Sci. Transl. Med. 6, 224ra24 (2014); S.-J. Dawson et al„ N. Engl, J. Med, 368, 1199-1209 (2013)). One challenge of detecting cell free mutant alleles is the fragmented nature of circulating tumor DNA, necessitating short PCR amplicons to capture these fragments. A second challenge is the low abundance of tumor-specific alleles circulating as cell free DNA fragments, which was addressed by the ability to detect TERT C22ST or TERT C250T with as little as 25 pg starting genomic material (FIG. 9). In this study we report that the method disclosed herein detected circulating cell free TERT C22ST in a patient with clinically and radiographically progressive GBM while undergoing concurrent chemoradiation (FIG. 16). One year after transitioning the
patient to bevacizumab, the disease is radiographicallv stable; however, this may be secondary to impaired uptake of contrast agent following VEGF inhibition leading to uncertainty regarding true disease progression. Analysis of the ctDNA by the method disclosed herein was unable to detect cell free TERT C22ST at this later timepoint, supporting clinical treatment response.
Exemplary Embodiments
[00243] One aspect provides a system for detection or amplification of one or more single nucleotide polymorphi sms or somatic variants in one or more target nucleic acids that may have high GC content and/or low sequence complexity in a sample, the system comprising:
(a) a forward primer that hybridizes to a first region on a sense strand of the target nucleic acid,
(b) a reverse primer that hybridizes to a second region on an anti sense strand of the target nucleic acid,
(c) a locked nucleic acid ( LNA) probe comprising an oligonucleotide with at least one LNA modi ication on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele sequence of the target nucleic acid and located within the region amplified by the forward primer and the reverse primer,
(d) a peptide nucleic acid (PNA) blocker that hybridizes to a wi ld-type allele of the target nucleic acid, the blocker compri sing peptide nucleic acid oligonucleotides that block
amplification of the wild-type allele, and does not block amplification of the mutant allele, wherein the PNA blocker hybridizes to a region located within the region amplified by the forward and reverse primer, and
(f) a reaction buffer,
wherein the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature conditions.
[00244] One aspect prov ides the system of paragraph [ 00243 ], w herein the target nucleic acid has low sequence complexity.
[00245] One aspect provides the system of paragraph [00243], wherein the target nucleic acid has high GC content.
[00246] One aspect prov ides the system of paragraph [00245], wherein the target nucleic acid has a GC content of greater than 60%.
[00247] One aspect provides the system of paragraph [00243], wherein the mutant allele comprises a single nucleotide polymorphism or somatic variant.
[00248] One aspect provides the system of paragraph [00243], wherein the sample is from a model organi sm or a subject.
[00249] One aspect provides the system of paragraph [00243], wherein the sample is from a tumor or metastatic lesion.
[00250] One aspect provides the system of paragraph [00243], wherein the sample comprises a cancer cell.
[00251] One aspect provides the system of paragraph [00243], wherein the sample comprises blood from a patient or human subject.
[00252] One aspect provides the system of paragraph [00243], herein the sample comprises tissue from a model organism, a cell from a tissue biopsy obtained from a subject, a cancer cell, nucleated cell obtained from blood obtained from a subject, or a circulating cancer cel l .
[00253] One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a telomerase reverse transcriptase (TERT) gene.
[00254] One aspect provides the system of paragraph [00253], wherein the TERT gene comprises a portion of the nucleic acid sequence of the regulatory region of the TERT gene promoter.
[00255] One aspect provides the system of paragraph [00254], wherein the mutant allele comprises variant C228T (hgl9, chromosome 5 : 1,295,228) of the TERT gene promoter.
[00256] One aspect provides the system of paragraph [00254], wherein the mutant allele comprises variant C250T (hgl9, chromosome 5 : 1 ,295,250) of the TERT gene promoter.
[00257] One aspect prov ides the system of paragraph [00243], further comprising a control genomic DNA, comprising DNA which is homozygous, hemizygous or heterozygous for the mutant allele.
[00258] One aspect prov ides the system of paragraph [00257], wherein the control genomic DNA i s derived from glioma cell line LN428.
[00259] One aspect prov ides the system of paragraph [00257], wherein the control genomic DNA is deriv ed from glioma cell line LN443.
[00260] One aspect prov ides the system of paragraph [ 00243 ], w herein the target nucleic acid comprises a portion of the nucleic acid sequence of an isocitrate dehydrogenase 1 ( IDH 1 ) gene.
[00261] One aspect prov ides the system of paragraph [00260], wherein the mutant allele comprises a variant that encodes an IDH l protein of variant R 1 32H.
[00262] One aspect provides the system of paragraph [00260], wherein the mutant allele comprises a variant that encodes an IDH l protein of variant R I 32C.
[00263] One aspect provides the system of paragraph [00260], wherein the mutant allele comprises a variant that encodes an IDH 1 protein of variant R132G.
[00264] One aspect provides the system of paragraph [00260], wherein the mutant allele comprises a variant that encodes an IDH I protein of variant R1 32S.
[00265] One aspect provides the system of paragraph [00260], wherein the mutant allele comprises a variant that encodes an IDH1 protein of variant R132L.
[00266] One aspect provides the system of paragraph [00243], further comprising a control genomic DNA, comprising DNA which is homozygous, hemizygous or heterozygous for the mutant allele.
[00267] One aspect provides the system of paragraph [00266], wherein the control genomic DNA is derived from primary glioma cell line BT142.
[00268] One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a proto-oncogene B-raf (BRAF) gene.
[00269] One aspect provides the system of paragraph [00268], wherein the mutant allele comprises a variant that encodes a BRAF protein of variant V600E.
[00270] One aspect provides the system of paragraph [00243], wherein the target nucleic acid compri ses a portion of the nucleic acid sequence of a neuroblastomas RAS viral oncogene homolog (NRAS) gene.
[00271] One aspect provides the system of paragraph [00270], herein the mutant allele comprises a variant that encodes an NRAS protein of variant Q61 R.
[00272] One aspect provides the system of paragraph [00270], wherein the mutant allele comprises a variant that encodes an NRAS protein of variant Q61K.
[00273] One aspect provides the system of paragraph [00243], herein the target nucleic acid comprises a portion of the nucleic acid sequence of a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) gene.
[00274] One aspect provides the system of paragraph [00273], wherein the mutant allele compri ses a variant that encodes an GNAQ protein of variant R l 83Q.
[00275] One aspect provides the system of paragraph [00273], wherein the mutant allele comprises a variant that encodes an GNAQ protein of variant Q209L.
[00276] One aspect provides the system of paragraph [00273], wherein the mutant allele compri ses a variant that encodes an GNAQ protein of variant Q209P.
[00277] One aspect provides the system of paragraph [00243], wherein the target nucleic acid comprises a portion of the nucleic acid sequence of a guanine nucleoti de-binding protein subunit a-1 1 (GNA1 1) gene.
[00278] One aspect provides the system of paragraph [00277], wherein the mutant allele comprises a variant that encodes an G A I 1 protein of van ant Q209L.
[00279] One aspect provides the system of paragraph [00243], wherein the target nucleic acid comprises a portion of the nucleic acid sequence of a 113 hi stone, fami ly 3 A (H3F3A) gene.
[00280] One aspect provides the system of paragraph [00279], wherein the mutant allele comprises a variant that encodes an H3 F3A protein of variant K27M.
[00281] One aspect provides the system of paragraph [00279], wherein the mutant allele compri ses a variant that encodes an H3 F3A protein of variant G34R,
[00282] One aspect provides the system of paragraph [00243], further comprising a high-speed DNA polymerase.
[00283] One aspect prov ides the system of paragraph [ 00282 ], wherein the high-speed DN A polymerase has an elongation rate of about l kb/second.
[00284] One aspect provides the system of paragraph [00282], wherein the high-speed DN A polymerase is Kapa 2G FAST DNA Polymerase.
[00285] One aspect prov ides the system of paragraph [00243], further compri sing one or more multi-well plates.
[00286] One aspect provides the system of paragraph [00243], further comprising DN A extraction reagents.
[00287] One aspect prov ides the system of paragraph [00286], wherein the DNA extraction reagents are able to be used to extract DNA in 1 5 minutes or less.
[00288] One aspect provides the system of paragraph [00243], further comprising a cell lysis buffer.
[00289] One aspect provides the system of paragraph [00243], further comprising Proteinase K.
[00290] One aspect prov ides the system of paragraph [00243], further compri sing
deoxynucleotide triphosphates ( dNTPs).
[00291] One aspect provides the system of paragraph [00243], further comprising MgC12.
[00292] One aspect provides the system of paragraph [00253], wherein the forward primer comprises the nucleic acid sequence of 5'-CACGTGCGCAGCAGGACGCAG-3 ' .
[00293] One aspect prov ides the system of paragraph [ 00253 ], w herein the reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3 ' .
[00294] One aspect provides the system of paragraph [00253], wherein the PNA blocker comprises the nucleic acid sequence of 5'-CCCAGCCCCCTCCGGGCCC-3 ' .
[00295] One aspect provides the system of paragraph [00243], wherein the LNA probe comprises a first end and a second end, wherein the first end comprises a label and wherein the second end comprises a quencher.
[00296] One aspect provides the system of paragraph [00253], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3\ wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00297] One aspect provides the system of paragraph [00253], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00298] One aspect provides the system of paragraph [00260], wherein the forward primer comprises the nucleic acid sequence of 5 '-CCGGCTTGTGAGTGGATGGGT A AA ACCT-3 ' .
[00299] One aspect provides the system of paragraph [00260], wherein the reverse primer comprises the nucleic acid sequence of 5'C ATTATTGCC AAC TGACTTACTTGATCCCC-3 ' .
[00300] One aspect provides the system of paragraph [00260], wherein the PNA blocker comprises the nucleic acid sequence of 5'-AGGTCGTCATGC-3' .
[00301] One aspect provides the system of paragraph [00260], wherein the LN A probe comprises the nucleic acid sequence of 5'-AGG+T+C+A+T+CAT+GC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00302] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+T+G+T+C+ATGC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00303] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of ' - AGGT+G+G+T+C AT+GC- ' , herein nucleotides preceded by a "+" are LNA modified nucleotides.
[00304] One aspect provides the system of paragraph [00260], wherein the LN A probe comprises the nucleic acid sequence of 5'-AGGT+A+G+T+CA+T+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00305] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+C AT+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00308] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3', wherein
nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
[00307] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGG+T+T+G+T+C+ATGC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00308] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+G+G+T+CAT+GC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00309] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+A+G+T+CA+T+GC-Dab-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00310] One aspect provides the system of paragraph [00260], wherein the LNA probe comprises the nucleic acid sequence of 5 -M AXN- AGG+T+C+T+T+CAT+GC-Dab-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00311] One aspect provides the system of paragraph [00268], wherein the forward primer comprises the nucleic acid sequence of 5 '-ACAGGGC ATGGAGAGTGGGTC-3 ' .
[00312] One aspect provides the system of paragraph [00268], wherein the reverse primer comprises the nucleic acid sequence of 5'-C A A AC T G ATGGG ACCC ACTCC AT-3 ' .
[00313] One aspect provides the system of paragraph [00268], wherein the PNA blocker comprises the nucleic acid sequence of 5 -C ATCGAGAT T TC ACTGT AGC T AGA-3 ' .
[00314] One aspect provides the system of paragraph [00268], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGA+TT+T+C+T+CT+GT+AG+C-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00315] One aspect provides the system of paragraph [00268], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00316] One aspect provides the system of paragraph [00268], wherein the LN A probe comprises the nucleic acid sequence of 5 '-MAXN- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3',
wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00317] One aspect provides the system of paragraph [00270], wherein the forward primer comprises the nucleic acid sequence of 5'-AGTGGTTATAGATGGTGAAACCTG-3'.
[00318] One aspect provides the system of paragraph [00270], wherein the reverse primer comprises the nucleic acid sequence of 5'-ACAGAGGAAGCCTTCGCCTG-3\
[00319] One aspect provides the system of paragraph [00270], wherein the PNA blocker comprises the nucleic acid sequence of 5'-CAGCTGGACAAGAAGAGTAC-KK-3' .
[00320] One aspect provides the system of paragraph [00270], herein the LN A probe comprises the nucleic acid sequence of 5'-CTGG+AC+G+AG+AA+GAGTA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00321] One aspect provides the system of paragraph [00270], wherein the LNA probe comprises the nucleic acid sequence of 5'-CAG+CTGGA+A+A+AGAA+GA+GTA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00322] One aspect provides the system of paragraph [00270], wherein the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-CTGG+AC+G+AG+AA+GAGTA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00323] One aspect provides the system of paragraph [00270], wherein the LNA probe comprises the nucleic acid sequence of 5 -FAM- CAG+CTGGA+A+A+AGAA+GA+GTA- Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00324] One aspect provides the system of paragraph [00270], herein the LN A probe comprises the nucleic acid sequence of 5'-MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00325] One aspect provides the system of paragraph [00270], wherein the LN A probe comprises the nucleic acid sequence of 5' -MAXN- CAG+CTGGA+A+A+AGAA+GA+GTA- Dab-3', herein nucleotides preceded by a "+" are LNA modified nucleotides, M AXN is fluorescent moiety, and Dab is diaminobenzidine.
[00326] One aspect provides the system of paragraph [00273], wherein the forward primer comprises the nucleic acid sequence of 5'-TTGGACCGCGTAGCTGACCCT-3\
[00327] One aspect provides the system of paragraph [00273], wherein the reverse primer comprises the nucleic acid sequence of 5'-GCTGGGAAATAGGTTTC ATGGAC-3 ' .
[00328] One aspect provides the system of paragraph [00273], wherein the PNA blocker comprises the nucleic acid sequence of 5'-TT AGAGTTCGAGTCCCCA-3' .
[00329] One aspect provides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGAGT+TC+A+AGT+CCCCAC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00330] One aspect provides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGAGT+TC+A+AGT+CCCCAC-Dab-3\ wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00331] One aspect provides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00332] One aspect provides the system of paragraph [00273], wherein the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3'.
[00333] One aspect provides the system of paragraph [00273], wherein the reverse primer comprises the nucleic acid sequence of 5'-TCACTAAGCGCTACTAGAAACATG-3' .
[00334] One aspect provides the system of paragraph [00273], wherein the PN A blocker comprises the nucleic acid sequence of 5 ' -GGGGCC A A A GGTC AG AG A-3 ' .
[00335] One aspect prov ides the system of paragraph [ 00273 ], wherein the LNA probe comprises the nucleic acid sequence of 5 -AGGGGCC+T+ AAGGTCAGAG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00336] One aspect prov ides the system of paragraph [00273], wherein the LN A probe comprises the nucleic acid sequence of 5'-GGGCC+C+AAGGTCAGAGA-3', wherein nucleotides preceded by a "+" are LNA modi ied nucleotides.
[00337] One aspect prov ides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGGGGCC+T+AAGGTCAGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00338] One aspect prov ides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00339] One aspect provides the system of paragraph [00273], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGGGCC+T+AAGGTCAGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00340] One aspect provides the system of paragraph [00273], wherein the LN A probe comprises the nucleic acid sequence of 5'-MAXN-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00341] One aspect provides the system of paragraph [00277], wherein the forward primer comprises the nucleic acid sequence of 5'-GCAGATTGGGCCTTGGGGCG-3'.
[00342] One aspect prov ides the system of paragraph [00277], wherein the reverse primer comprises the nucleic acid sequence of 5'-TCGCTGAGGGCGACGAGAAAC-3'.
[00343] One aspect provides the system of paragraph [00277], wherein the PNA blocker comprises the nucleic acid sequence of 5'-GGGCCAGCGGTCGGAGC-3' .
[00344] One aspect provides the system of paragraph [00277], wherein the LNA probe comprises the nucleic acid sequence of 5'-GGG+CC+T+GCGGTCGG-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00345] One aspect prov ides the system of paragraph [00277], wherein the LN A probe comprises the nucleic acid sequence of 5'-FAM-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00346] One aspect prov ides the system of paragraph [00277], wherein the LN A probe comprises the nucleic acid sequence of 5'-MAXN-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00347] One aspect provides the system of paragraph [00279], wherein the forward primer comprises the nucleic acid sequence of 5'-CTGCCCGCAAATCGACCGGT-3' .
[00348] One aspect provides the system of paragraph [00279], wherein the reverse primer comprises the nucleic acid sequence of 5 ' -G G A T A C A T A C A A G A G A G A C TTTGTC - 3 ' .
[00349] One aspect prov ides the system of paragraph [00279], wherein the PNA blocker comprises the nucleic acid sequence of 5'-GCCGCTCGCAAGAGTGCGCC-3' .
[00350] One aspect prov ides the system of paragraph [00279], wherein the PNA blocker comprises the nucleic acid sequence of 5'-TTCTTCACCCCTCCAGTAG-3'.
[00351] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5'-CGCTCGC+A+T+GAGTG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00352] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00353] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00354] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5'-TACT+GGA+A+GG+GTGAAGA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00355] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-T ACT+GGA+ A+GG+GTGAAGA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00356] One aspect provides the system of paragraph [00279], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-TACT+GGA+ A+GG+GTGAAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00357] One aspect provides a kit comprising the system of any one or more of paragraphs [00243] through [00356].
[00358] One aspect provides a method of using the system of any one or more of paragraphs [00243] through [00356] to detect or amplify one or more single nucleotide pol morphisms or somatic variants in a target nucleic acid with low sequence complexity and/or high GC content, in a sample from a subject comprising:
(a) isolating DNA from the sample;
(b) denaturing the isolated DNA;
annealing the forward primer, the reverse primer, the LNA probe, and the PNA blocker to the DNA at the same temperature conditions; and
amplifying and detecting a DNA am pi icon comprising the one or more single nucleotide polymorphisms,
thereby detecting or amplifying one or more single nucleotide polymorphisms.
[00359] One aspect provides a method for establishing a molecular diagnosis in at least one cancer in a subject, the method comprising:
(a) isolating DNA from a sample from the subject;
(b) denaturing the DNA isolated from the sample and a control DNA template;
(c) annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a reverse primer that hybridizes to a second region on an anti sense strand of the first target nucleic acid, a locked nucleic acid ( LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the first target nucleic acid;
(d) amplifying a DNA amplicon comprising the mutant allele in the first target nucleic acid;
(e) detecting the mutant al lele in the first target nucleic acid in the sample; and
(f) quantifying the amount of the mutant allele in the first target nucleic acid in the sample relative to the amount in a control, wherein a higher prevalence of the amount of mutant allele in the sample relative to the control indicates presence and/or stage of the cancer in the subject.
[00360] One aspect provides a method of paragraph [00359], wherein the sample comprises a tissue biopsy, blood, plasma, serum or cerebrospinal fluid from the subject.
[00361] One aspect provides a method of paragraph [00360], wherein the blood, plasma, serum or cerebrospinal fluid from the subject comprises one or more circulating cancer cells.
[00362] One aspect provides a method of paragraph [00359], wherein the sample comprises tissue from the subject.
[00363] One aspect provides a method of paragraph [00362], wherein the tissue from the subject comprises one or more cancer cell s.
[00364] One aspect provides a method of paragraph [00359], wherein the amplifying is performed in the presence of a DN A polymerase.
[00365] One aspect provides a method of paragraph [00364], wherein the DN A polymerase is a high-speed D A polymerase.
[00366] One aspect provides a method of paragraph [00365], wherein the high-speed DNA polymerase has an elongation rate of about I kb/second.
[00367] One aspect provides a method of paragraph [00365], wherein the high-speed DNA polymerase is Kapa 2G F AST DNA Polymerase.
[00368] One aspect provides a method of paragraph [00359], wherein the cancer is a glioma.
[00369] One aspect provides a method of paragraph [00368], wherein the glioma is selected from the group consisting of: high grade glioma, diffuse astrocytoma, oligodendroglioma, ol i goastrocy torn a, secondary glioblastoma, prim ary gliobl astom a and diffuse intrinsic pontine glioma.
[00370] One aspect provides a method of paragraph [00359], wherein the cancer is a melanoma. Another aspect provides a method of paragraph [00359], wherein the cancer is a glioma, high grade glioma, diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, secondary
glioblastoma, primary glioblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
[00371] One aspect provides a method of paragraph [00370], wherein the cancer is uveal melanoma.
[00372] One aspect provides a method of paragraph [00359], wherein the sample is from a skin biopsy or metastatic lesion.
[00373] One aspect provides a method of paragraph [00370], wherein the control DNA template is derived from a melanoma cell or a melanoma cel l line.
[00374] One aspect provides a method of paragraph [00359], herein the first target nucleic acid compri ses the nucleic sequence of a telom erase reverse transcriptase (TERT) gene promoter.
[00375] One aspect provides a method of paragraph [00374], wherein the mutant allele comprises variant C228T (hgl9, chromosome 5 : 1 ,295,228) of the TERT gene promoter.
[00376] One aspect provides a method of paragraph [00374], herein the mutant allele compri ses variant C250T (hgl9, chromosome 5 : 1 ,295,250) of the TERT gene promoter.
[00377] One aspect provides a method of paragraph [00359], wherein the control DNA template is derived from glioma cell line LN428.
[00378] One aspect provides a method of paragraph [00359], wherein the control DN A template i s derived from glioma cell line LN443.
[00379] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nuclei c acid sequence of an isocitrate dehydrogenase 1 ( IDH I ) gene.
[00380] One aspect provides a method of paragraph [00379], wherein the mutant allele comprises a variant that encodes an IDH 1 protein of variant R132H.
[00381] One aspect provides a method of paragraph [00379], wherein the mutant allele comprises a variant that encodes an IDH I protein of variant R132C.
[00382] One aspect provides a method of paragraph [00379], wherein the mutant allele comprises a variant that encodes an IDH1 protein of variant R132G.
[00383] One aspect provides a method of paragraph [00379], wherein the mutant allele comprises a variant that encodes an IDH I protein of variant R132S.
[00384] One aspect provides a method of paragraph [00379], wherein the mutant allele comprises a variant that encodes an IDH 1 protein of variant R132L.
[00385] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a proto-oncogene B-raf (BRAF) gene.
[00386] One aspect provides a method of paragraph [00385], wherein the mutant allele comprises a variant that encodes a BRAF protein of variant V600E.
[00387] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a neuroblastomas RAS viral oncogene homolog
(NRAS) gene.
[00388] One aspect provides a method of paragraph [00387], wherein the mutant allele comprises a variant that encodes an NRAS protein of variant Q61R.
[00389] One aspect provides a method of paragraph [00387], wherein the mutant allele comprises a variant that encodes an NRAS protein of variant Q61K.
[00390] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a guanine nucleotide-binding protein G(q) subunit a (GNAQ) gene.
[00391] One aspect provides a method of paragraph [00387], wherein the mutant allele comprises a variant that encodes an GNAQ protein of variant R 183Q.
[00392] One aspect provides a method of paragraph [00390], herein the mutant allele comprises a variant that encodes an GN AQ protein of variant Q209L.
[00393] One aspect provides a method of paragraph [00390], wherein the mutant allele comprises a variant that encodes an G AQ protein of variant Q209P.
[00394] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a guanine nucleotide-binding protein subunit a- 1 1
(GNAl l) gene.
[00395] One aspect provides a method of paragraph [00394], wherein the mutant allele comprises a variant that encodes an G A 1 1 protein of van ant Q209L.
[00396] One aspect provides a method of paragraph [00359], wherein the first target nucleic acid comprises the nucleic acid sequence of a H3 hi stone, family 3 A (H3F3A) gene.
[00397] One aspect provides a method of paragraph [00396], wherein the mutant allele comprises a variant that encodes an H3F3 A protein of variant K27M.
[00398] One aspect provides a method of paragraph [00396], wherein the mutant allele comprises a variant that encodes an H3F3A protein of variant G34R.
[00399] One aspect provides a method of paragraph [00359],, wherein the control DNA
template is derived from primary glioma cell line BT 142.
[00400] One aspect provides a method of paragraph [00374], wherein the forward primer comprises the nucleic acid sequence of 5'-CACGTGCGCAGCAGGACGCAG-3 ' .
[00401] One aspect provides a method of paragraph [00374], wherein the reverse primer comprises the nucleic acid sequence of 5'-CTTCACCTTCCAGCTCCGCCTC-3 \
[00402] One aspect prov ides a method of paragraph [00374], wherein the PNA. blocker comprises the nucleic acid sequence of 5'-CCCAGCCCCCTCCGGGCCC-3 ' .
[00403] One aspect provides a method of paragraph [00374], wherein the PNA blocker compri ses the nucleic acid sequence of 5'-CCGACCCCTCCCGGGTCCC-3 ' .
[00404] One aspect prov ides a method of paragraph [00374], wherein the LNA probe comprises the nucleic acid sequence of 5'-CCCAGCCCC+T+TCCGGGCCC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00405] One aspect provides a method of paragraph [00374], wherein the LNA probe comprises the nucleic acid sequence of 5'-CCGACCCC+T+TCCGGGTCCC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00406] One aspect provides a method of paragraph [00374], wherein the LN A probe comprises the nucleic acid sequence of 5'-FAM-CCCAGCCCC+T+TCCGGGCCC-Dab-3 \ wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00407] One aspect prov ides a method of paragraph [00374], wherein the LN A probe compri ses the nucleic acid sequence of 5'-FAM-CCGACCCC+T+TCCGGGTCCC-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modi ied nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00408] One aspect prov ides a method of paragraph [00379], wherein the forward primer comprises the nucleic acid sequence of 5 '-CCGGCTTGTGAGTGGATGGGTAAAACCT-3 ' .
[00409] One aspect provides a method of paragraph [00379], wherein the reverse primer comprises the nucleic acid sequence of 5 ' -C A TT A TTGC C A A C A TG A C Ί A C I T G A TC C C C -
3'.
[00410] One aspect provides a method of paragraph [00379], wherein the PNA blocker comprises the nucleic acid sequence of 5'-AGGTCGTCATGC-3' .
[00411] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+C+A+T+CAT+GC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00412] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGG+T+T+G+T+C+ATGC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00413] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGGT+G+G+T+CAT+GC-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00414] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGGT+A+G+T+CA+T+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00415] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'- AGG+T+C+T+T+CAT+GC-3' wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00416] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-AGG+T+C+A+T+CAT+GC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00417] One aspect provides a method of paragraph [00379], wherein the LN A probe comprises the nucleic acid sequence of 5'-MAXN-AGG+T+T+G+T+C+ATGC-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00418] One aspect provides a method of paragraph [00379], wherein the LN A probe compri ses the nucleic acid sequence of 5 ' -MAXN-AGGT+G+G+T+C AT+GC-Dab-3 ' , wherein
nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00419] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGGT+A+G+T+CA+T+GC-Dab-3',wherein
nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00420] One aspect provides a method of paragraph [00379], wherein the LNA probe comprises the nucleic acid sequence of 5 '-MAXN- AGG+T+C+T+T+CAT+GC-Dab-3 ' wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00421] One aspect provides a method of paragraph [00385], herein the forward primer compri ses the nucleic aci d sequence of 5'-ACAGGGCATGGAGAGTGGGTC-3 ' .
[00422] One aspect provides a method of paragraph [00385], wherein the reverse primer comprises the nucleic acid sequence of 5'-C A A ACTGATGGGACCC ACTCC AT-3 '
[00423] One aspect provides a method of paragraph [00385], wherein the PNA blocker comprises the nucleic acid sequence of 5'-CATCGAGATTTCACTGTAGCTAGA-3 ' .
[00424] One aspect provides a method of paragraph [00385 ], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGA+TT+T+C+T+CT+GT+AG+C-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00425] One aspect provides a method of paragraph [00385], wherein the LN A probe comprises the nucleic acid sequence of 5'-FAM- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+" are LN A modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00426] One aspect provides a method of paragraph [00385], wherein the LN A probe compri ses the nucleic acid sequence of 5 -MAXN- AGA+TT+T+C+T+CT+GT+AG+C-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00427] One aspect prov ides a method of paragraph [00387], wherein the forward primer comprises the nucleic acid sequence of 5 -AG'l GGTTATAGATGGTGA A ACCTG-3 ' .
[00428] One aspect provides a method of paragraph [00387], wherein the rev erse primer compri ses the nucleic acid sequence of 5 '- A C A G A GG A A GC CTT GCC TG-3 ' .
[00429] One aspect prov ides a method of paragraph [00387], wherein the PNA blocker comprises the nucleic acid sequence of 5 - AGCTGGA A AGA AG AGT AC-KK-3 " .
[00430] One aspect provides a method of paragraph [00387], wherein the LN A probe comprises the nucleic acid sequence of 5 -CTGG+AC+G+AG+AA f GAGTA-3 ", wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00431] One aspect provides a method of paragraph [00387], wherein the LNA probe comprises the nucleic acid sequence of 5'-CAG+CTGGA+A+A+AGAA+GA+GTA-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00432] One aspect provides a method of paragraph [00387], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00433] One aspect provides a method of paragraph [00387], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM- CAG+CTGGA+A+A+AGAA+GA+GTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00434] One aspect provides a method of paragraph [00387], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-CTGG+AC+G+AG+AA+GAGTA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00435] One aspect provides a method of paragraph [00387], herein the LN A probe comprises the nucleic acid sequence of 5' -MAXN- CAG+CTGGA+A+A+AGAA+ GA+GTA-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00436] One aspect provides a method of paragraph [00390], wherein the forward primer comprises the nucleic acid sequence of 5'-TTGGACCGCGTAGCTGACCCT-3' .
[00437] One aspect provides a method of paragraph [00390], wherein the reverse primer comprises the nucleic acid sequence of 5 ' -GC TG GG A A A T A GGTTTC A TGG A C -3 \
[00438] One aspect provides a method of paragraph [00390], wherein the PNA blocker comprises the nucleic acid sequence of 5'-TTAGAGTTCGAGTCCCCA-3' .
[00439] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGAGT+TC+A+AGT+CCCCAC-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00440] One aspect provides a method of paragraph [00390], wherein the LN A probe compri ses the nucleic acid sequence of 5 ' -F AM- AGAGT+TC+A+AGT+CCCC AC-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00441] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-AGAGT+TC+A+AGT+CCCCAC-Dab-3\ wherein
nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00442] One aspect provides a method of paragraph [00390], wherein the forward primer comprises the nucleic acid sequence of 5'-CCCTAAGTTTGTAAGTAGTGCTATA-3'.
[00443] One aspect provides a method of paragraph [00390], wherein the reverse primer comprises the nucleic acid sequence of 5'-TCACTAAGCGCTACTAGAAACATG-3' .
[00444] One aspect provides a method of paragraph [00390], herein the PNA blocker comprises the nucleic acid sequence of 5'-GGGGCCAAAGGTCAGAGA-3' .
[00445] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5'-AGGGGCC+T+AAGGTCAGAG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00446] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5'-GGGCC+C+AAGGTCAGAGA-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00447] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5 ' -F AM- AGGGGCC+T+AAGGTC AGAG-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
[00448] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGGCC+C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00449] One aspect provides a method of paragraph [00390], wherein the LNA probe comprises the nucleic acid sequence of 5' -M AXN-AGGGGCC+T+ A AGGTC AGAG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00450] One aspect provides a method of paragraph [00390], herein the LNA probe comprises the nucleic acid sequence of 5 -MAXN-GGGCC ; C+AAGGTCAGAGA-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00451] One aspect provides a method of paragraph [00394], wherein the forward primer comprises the nucleic acid sequence of 5 ' - GC A G A TTGGGC C TTGGG GC G -3 ' .
[00452] One aspect provides a method of paragraph [00394], wherein the reverse primer comprises the nucleic acid sequence of 5 ' - T C G C T G A G G G C G A C G A G A A A C - 3 ' .
[00453] One aspect provides a method of paragraph [00394], wherein the PNA blocker comprises the nucleic acid sequence of 5'-GGGCCAGCGGTCGGAGC-3' .
[00454] One aspect provides a method of paragraph [00394], wherein the LNA probe comprises the nucleic acid sequence of S'-GGG* CC+T+GCGGTCGG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00455] One aspect provides a method of paragraph [00394], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-GGG+CC+T+GCGGTCGG-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, RAM is fluorescein moiety, and Dab is diaminobenzidine.
[00456] One aspect provides a method of paragraph [00394], wherein the LNA probe comprises the nucleic acid sequence of 5'-MAXN-GGG+CC+T+GCGGTCGG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00457] One aspect provides a method of paragraph [00396], wherein the forward primer comprises the nucleic acid sequence of 5'- CTGCCCGCAAATCGACCGGT -3' .
[00458] One aspect provides a method of paragraph [00396], wherein the reverse primer comprises the nucleic acid sequence of 5'- GGATACATACAAGAGAGACTTTGTC-3' .
[00459] One aspect provides a method of paragraph [00396], wherein the PNA blocker comprises the nucleic acid sequence of 5'-GCCGCTCGCAAGAGTGCGCC-3' .
[00460] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of 5'-CGCTCGC+A+T+GAGTG-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00461] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of 5'-FAM-CGCTCGC+A+T+GAGTG-Dab-3', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00462] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of 5 -MAXN-CGCTCGC+A+T ; GAGTG-Dab-3", wherein nucleotides preceded by a "+" are LNA modified nucleotides, MAXN is fluorescent moiety, and Dab is diaminobenzidine.
[00463] One aspect provides a method of paragraph [00396], wherein the PNA blocker comprises the nucleic acid sequence of TTCTTCACCCCTCCAGTAG
[00464] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of TACT+GGA+A+GG+GTGAAGA, wherein nucleotides preceded by a "+" are LNA modified nucleotides.
[00465] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of 5 ' -F AM-T AC T+GGA+ A+GG+GTGAAGA-Dab-3 ' , wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00466] One aspect provides a method of paragraph [00396], wherein the LNA probe comprises the nucleic acid sequence of 5' -MAXN-TACT+GGA+ A+GG+GTGAAGA-Dab-3 ', wherein nucleotides preceded by a "+" are LNA modified nucleotides, FAM is fluorescein moiety, and Dab is diaminobenzidine.
[00467] One aspect provides a method of any one or more of paragraphs [00374], [00379], [00385], [00387], [00390], [00394] or [00396] wherein two or more mutant alleles of TERT, IDH BRAF, NBAS, GNAQ, GNA 1 1 and/or H3F3A are detected simultaneously.
[00468] One aspect provides a method of paragraph [00359], further comprising calculating tumor burden or tumor purity in the sample, based on quantitative amount of mutant allele detected.
[00469] One aspect provides a method of paragraph [00468], wherein the calculating of tumor burden or tumor purity of the sample is based on the quantitative amount of mutant allele detected relative to a standard curve generated from serial dilutions of control DM A.
[00470] One aspect provides a method of paragraph [00359], wherein sample from the subject is taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and wherein results of the method are available to the surgeon to guide further treatment of the subject during the surgical procedure.
[00471] One aspect provides a method of paragraph [00359], further comprising subsequent resection of a glioma tumor in the subject.
[00472] One aspect provides a method of paragraph [00359], further comprising inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
[00473] One aspect provides a method of paragraph [00359], wherein the denaturing is initially done in about 1 round of incubation at about 95 °C for 2-5 minutes, and the annealing and ampli y ing are done in about 45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to 64.5 °C for about 10-25 seconds.
[00474] One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 40-50 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
[00475] One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 35-45 rounds of incubation at 95 °C for 1-12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
[00476] One aspect provides a method of paragraph [00359], wherein the annealing and amplifying are done in about 40-45 rounds of incubation at 95 °C for 1 - 12 seconds followed by about 62.5 °C to about 64.5°C for about 10-25 seconds.
[00477] One aspect provides a method of paragraph [00359], wherein the melting temperatures of the forward primer, reverse primer, LNA probe and P A blocker are about 62,5 °C to about 64.5°C.
[00478] One aspect provides a method of paragraph [00359], wherein the melting temperatures of the forward primer, reverse primer, LNA probe and PNA blocker are about 63.5°C.
[00479] One aspect provides a method of paragraph [00359], wherein the am pi icon is less than 70-300 nt in length.
[00480] One aspect provides a method of paragraph [00359], wherein the denaturing, annealing and amplifying steps are performed in a therm ocycler with a ramping rate of at least 1.6-3.1 °C per second.
[00481] One aspect prov ides a method of any one or more of paragraphs [ 00358] through
[00480], wherein the mutant allele has an allelic frequency of 0.1% of the nucleic acid extracted from the sample.
[00482] One aspect provides a method of any one or more of paragraphs [00358] through
[00480], wherein the sample comprises archival tissue.
[00483] One aspect provides a method of paragraph [00482], wherein the archival tissue is formalin-fixed paraffin embedded.
[00484] One aspect provides a method of any one or more of paragraphs [00358] through
[00480], further comprising validation of genome editing in cell culture or in an animal model.
[00485] The present inv ention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
Claims
What is claimed is:
1. A system for detection or ampli ication of one or more single nucleotide polymorphi sms or somatic variants in one or more target nucleic acids that may have high GC content and/or low sequence complexity in a sample, the system comprising:
(a) a forward primer that hy bridizes to a first region on a sense strand of the target nucleic acid,
(b) a reverse primer that hybridizes to a second region on an anti sense strand of the target nucleic acid,
(c) a locked nucleic acid (L A) probe comprising an oligonucleotide with at least one
LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that i s complementary to a mutant allele sequence of the target nucleic acid and located within the region amplified by the forward primer and the reverse primer,
(d) a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the target nucleic acid, the blocker comprising peptide nucleic acid oligonucleotides that block
amplification of the wild-type allele, and does not block amplification of the mutant allele, wherein the PNA blocker hybridizes to a region located within the region amplified by the forward and reverse primer, and
(f) a reaction buffer,
wherein the forward primer, the reverse primer, the LNA probe, and the PNA blocker are capable of recognizing their target sequences under same temperature condi tions.
2. The system of claim 1, wherein the mutant allele comprises a single nucleotide polymorphism or somatic variant.
3. The system of claim 1, wherein the sample comprises tissue from a model organism, a cell from a ti sue biopsy obtained from a subject, a cancer cell , nucleated cel l obtained from blood obtained from a subject, or a circulating cancer cell .
4. A kit comprising the system of any one of claims 1-3.
5. A method of using the system of any one of claims 1 -3 to detect or amplify one or more single nucleotide polymorphisms or somatic variants in a target nucleic acid w ith low sequence complexity and/or high GC content, in a sample from a subject comprising:
(e) isolating DNA from the sample,
(f) denaturing the isolated DNA;
(g) annealing the forward primer, the reverse primer, the LNA probe, and the PNA blocker to the DNA at the same temperature conditions; and
(h) amplifying and detecting a DNA am pi icon comprising the one or more single nucleotide polymorphisms,
thereby detecting or amplifying one or more single nucleotide polymorphisms.
6. A method for establishing a molecular diagnosis in at least one cancer in a subject, the method comprising:
(g) isolating DNA from a sample from the subject;
(h) denaturing the DNA isolated from the sample and a control DNA template;
(i) annealing a forward primer that hybridizes to a first region on a sense strand of a first target nucleic acid, a reverse primer that hybridizes to a second region on an antisense strand of the first target nucleic acid, a locked nucleic acid (LNA) probe comprising an oligonucleotide with at least one LNA modification on at least one nucleotide, wherein the probe comprises a nucleic acid sequence that is complementary to a mutant allele of the first target nucleic acid, and a peptide nucleic acid (PNA) blocker that hybridizes to a wild-type allele of the first target nucleic acid;
(j) amplifying a DNA amplicon comprising the mutant allele in the first target nucleic acid;
(k) detecting the mutant allele in the first target nucleic acid in the sample; and (1) quantifying the amount of the mutant allele in the first target nucleic acid in the sample relative to the amount in a control, wherein a higher prevalence of the amount of mutant allele in the sample relative to the control indicates presence and/or stage of the cancer in the subject.
7. The method of claim 6, wherein the sample comprises a tissue biopsy, blood, plasma, serum, cerebrospinal fluid, or one or more circulating cancer cell s from the subject.
8. The method of claim 6, herein the sample comprises ti ssue from the subject, or one or more cancer cells from the subject.
9. The method of claim 6, wherein the cancer is a glioma, high grade glioma, diffuse astrocytoma, oligodendroglioma, oligoastrocytoma, secondary glioblastoma, primary glioblastoma, diffuse intrinsic pontine glioma, a melanoma, or uveal melanoma.
10. The method of claim 6, wherein the sample is from a skin biopsy or metastatic lesion. 1 1 . The method of claim 6, wherein the first target nucleic acid comprises the nucleic sequence of a telom erase reverse transcriptase (TERT) gene promoter.
1 2. The method of claim 6, wherein the first target nucleic acid comprises the nucleic acid sequence of an isocitrate dehydrogenase 1 ( IDH 1 ) gene.
13. The method of claim 6, wherein the first target nucleic acid comprises the nucleic acid sequence of a proto-oncogene B-raf (BRAF) gene.
14. The method of claim 6, wherein the first target nucleic acid comprises the nucleic acid sequence of a neuroblastomas RAS viral oncogene homolog (NRAS) gene.
15. The method of claim 6, wherein the first target nucleic acid compri ses the nucleic acid sequence of a guanine nucleoti de-binding protein G(q) subunit a (GNAQ) gene. 16. The method of claim 6, wherein the first target nucleic acid comprises the nucleic acid sequence of a guanine nucleotide-binding protein subunit u- l 1 (GNA1 1) gene.
I 7. The method of claim 6, wherein the first target nucleic acid comprises the nucleic acid sequence of a H3 hi stone, family 3 A (H3F3A) gene.
1 8. The method of claim 6, wherein sample from the subject i s taken from a concurrent surgical procedure involving the subject and a surgeon, wherein the sample from the subject is obtained in rapid fashion, and wherein results of the method are available to the surgeon to guide further treatment of the subject during the surgical procedure.
19. The method of claim 6, further comprising subsequent resection of a glioma tumor in the subject. 20. The method of claim 6, further comprising inserting a therapeutic drug-coated wafer into a central cavity of a tumor in the subject.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/538,382 US10590473B2 (en) | 2014-12-22 | 2015-12-22 | Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462095386P | 2014-12-22 | 2014-12-22 | |
| US62/095,386 | 2014-12-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016106391A1 true WO2016106391A1 (en) | 2016-06-30 |
Family
ID=56151544
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/067524 Ceased WO2016106391A1 (en) | 2014-12-22 | 2015-12-22 | Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10590473B2 (en) |
| WO (1) | WO2016106391A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2674338C1 (en) * | 2017-10-09 | 2018-12-07 | Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) | Method for analysis of somatic mutations in braf, nras and kit genes using lna-blocking multiplex pcr and subsequent hybridization with oligonucleotide biological microchip (biochip) |
| RU2674687C1 (en) * | 2017-10-09 | 2018-12-12 | Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) | Method for analysis of somatic mutations in gnaq and gna11 genes using lna-blocking multiplex pcr and subsequent hybridization with oligonucleotide biological microchip (biochip) |
| WO2019055234A1 (en) | 2017-09-13 | 2019-03-21 | Massachusetts Institute Of Technology | Genotype-directed local delivery of targeted therapeutics |
| CN112930228A (en) * | 2018-09-03 | 2021-06-08 | 维斯比医学公司 | Apparatus and method for antibiotic susceptibility testing |
| WO2023031485A1 (en) | 2021-09-06 | 2023-03-09 | Christian-Albrechts-Universität Zu Kiel | Method for the diagnosis and/or classification of a disease in a subject |
| US11952636B2 (en) | 2020-01-03 | 2024-04-09 | Visby Medical, Inc. | Devices and methods for antibiotic susceptibility testing |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019157339A1 (en) * | 2018-02-09 | 2019-08-15 | Children's Medical Center Corporation | Compositions and methods for identifying a single-nucleotide variant |
| CN111383713B (en) * | 2018-12-29 | 2023-08-01 | 北京安诺优达医学检验实验室有限公司 | ctDNA detection and analysis device and method |
| CN111850117A (en) * | 2019-07-19 | 2020-10-30 | 上海睿昂基因科技股份有限公司 | Primer, probe, kit and device for detecting mutation of human TERT promoter |
| AU2020364234A1 (en) * | 2019-10-11 | 2022-04-07 | Bioventures, Llc | Use of simultaneous marker detection for assessing difuse glioma and responsiveness to treatment |
| JP7470787B2 (en) | 2019-11-05 | 2024-04-18 | パーソナリス,インコーポレイティド | Estimation of tumor purity from a single sample |
| CN112522369A (en) * | 2020-12-08 | 2021-03-19 | 合肥欧创基因生物科技有限公司 | Method for designing Blocker double chain of ARMS-TaqMan Blocker system |
| CN115807098A (en) * | 2021-01-14 | 2023-03-17 | 润安医学科技(苏州)有限公司 | A primer combination and kit for detecting gene mutations in differentiated thyroid cancer |
| CN115261463B (en) * | 2021-04-30 | 2024-06-07 | 北京泛生子基因科技有限公司 | Kit, primer probe combination, and primer combination for detecting human IDH gene and TERT gene promoter mutation |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070178445A1 (en) * | 2004-03-22 | 2007-08-02 | Eshleman James R | Methods for the detection of nucleic acid differences |
| US20120202207A1 (en) * | 2008-09-03 | 2012-08-09 | Duke University | Genetic alterations in isocitrate dehydrogenase and other genes in malignant glioma |
| US20130102653A1 (en) * | 2010-04-16 | 2013-04-25 | The Univeristy Of British Columbia | Gna11 and gnaq exon 4 mutations in melanoma |
| WO2014029669A1 (en) * | 2012-08-21 | 2014-02-27 | Universidad De Murcia | Combinations (catechins and methotrexate) for use in the treatment of melanomas |
-
2015
- 2015-12-22 US US15/538,382 patent/US10590473B2/en active Active
- 2015-12-22 WO PCT/US2015/067524 patent/WO2016106391A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070178445A1 (en) * | 2004-03-22 | 2007-08-02 | Eshleman James R | Methods for the detection of nucleic acid differences |
| US20120202207A1 (en) * | 2008-09-03 | 2012-08-09 | Duke University | Genetic alterations in isocitrate dehydrogenase and other genes in malignant glioma |
| US20130102653A1 (en) * | 2010-04-16 | 2013-04-25 | The Univeristy Of British Columbia | Gna11 and gnaq exon 4 mutations in melanoma |
| WO2014029669A1 (en) * | 2012-08-21 | 2014-02-27 | Universidad De Murcia | Combinations (catechins and methotrexate) for use in the treatment of melanomas |
Non-Patent Citations (2)
| Title |
|---|
| RACHAKONDA ET AL.: "TERT promoter mutations in bladder cancer affect patient survival and disease recurrence through modification by a common polymorphism.", PROC NATL ACAD SCI U S A, vol. 110, no. 43, 22 October 2013 (2013-10-22), pages 17426 - 17431 * |
| YUEN ET AL.: "Histone H3.3 mutations: a variant path to cancer.", CANCER CELL, vol. 24, no. 5, 11 November 2013 (2013-11-11), pages 567 - 574, XP028771727, DOI: doi:10.1016/j.ccr.2013.09.015 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019055234A1 (en) | 2017-09-13 | 2019-03-21 | Massachusetts Institute Of Technology | Genotype-directed local delivery of targeted therapeutics |
| US20210322507A1 (en) * | 2017-09-13 | 2021-10-21 | Massachusetts Institute Of Technology | Genotype-directed local delivery of targeted therapeutics |
| RU2674338C1 (en) * | 2017-10-09 | 2018-12-07 | Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) | Method for analysis of somatic mutations in braf, nras and kit genes using lna-blocking multiplex pcr and subsequent hybridization with oligonucleotide biological microchip (biochip) |
| RU2674687C1 (en) * | 2017-10-09 | 2018-12-12 | Федеральное Государственное Бюджетное Учреждение Науки Институт Молекулярной Биологии Им. В.А. Энгельгардта Российской Академии Наук (Имб Ран) | Method for analysis of somatic mutations in gnaq and gna11 genes using lna-blocking multiplex pcr and subsequent hybridization with oligonucleotide biological microchip (biochip) |
| CN112930228A (en) * | 2018-09-03 | 2021-06-08 | 维斯比医学公司 | Apparatus and method for antibiotic susceptibility testing |
| US12239993B2 (en) | 2018-09-03 | 2025-03-04 | Visby Medical, Inc. | Devices and methods for antibiotic susceptibility testing |
| US11952636B2 (en) | 2020-01-03 | 2024-04-09 | Visby Medical, Inc. | Devices and methods for antibiotic susceptibility testing |
| WO2023031485A1 (en) | 2021-09-06 | 2023-03-09 | Christian-Albrechts-Universität Zu Kiel | Method for the diagnosis and/or classification of a disease in a subject |
Also Published As
| Publication number | Publication date |
|---|---|
| US20170369939A1 (en) | 2017-12-28 |
| US10590473B2 (en) | 2020-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10590473B2 (en) | Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms | |
| RU2491289C2 (en) | Polynucleotide primers | |
| EP2447378B1 (en) | Probe for detection of polymorphism in EGFR gene, amplification primer, and use thereof | |
| CN1596314B (en) | Method for determining chemotherapy regimen based on expression of ERCC1 and TS | |
| JP7389551B2 (en) | Detection of MET exon 14 deletion and related treatments | |
| EP1409723B1 (en) | Method of determining dihydropyrimidine dehydrogenase gene expression | |
| US20140272956A1 (en) | Method for amplification and assay of rna fusion gene variants, method of distinguishing same and related primers, probes, and kits | |
| AU2015306907C9 (en) | Methods for rapid and sensitive detection of hotspot mutations | |
| EP3055422B1 (en) | Methods and compositions for detecting a mutation in the human ezh2 gene | |
| JP5769952B2 (en) | Highly sensitive detection method for EML4-ALK fusion gene | |
| JP2014500028A (en) | Methods and compositions for detecting mutations in the human epidermal growth factor receptor gene | |
| JP6453781B2 (en) | Methods and compositions for detecting human PI3KCA (PIK3CA) gene mutations | |
| TWI780315B (en) | Method of quantifying mutant allele burden of target gene | |
| JP6153758B2 (en) | Polymorph detection probe, polymorph detection method, drug efficacy determination method, and polymorph detection kit | |
| CN110964833B (en) | A kit for detecting KRAS and BRAF gene mutations in plasma cell-free DNA in one tube | |
| CN111607646A (en) | A nucleotide sequence set for detecting BRAF gene mutation and its application | |
| JP2013017395A (en) | Probe for detecting genetic mutation relating to myeloproliferative disease, and method for detecting genetic mutation using the probe | |
| CN108753961B (en) | BRAF V600E gene mutation detection primer, method and kit | |
| KR101930818B1 (en) | Non-Invasive Diagnosis of Bladder Cancer | |
| CN111378751A (en) | Nucleotide sequence group for detecting KRAS gene mutation and application thereof | |
| CN115961039A (en) | Oligonucleotide combination detection method for EGFR gene L858R mutation | |
| WO2011046871A1 (en) | Quantification of ir-a and ir-b for tumor classification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15874354 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15874354 Country of ref document: EP Kind code of ref document: A1 |