WO2016092301A1 - Vascular targeting - Google Patents
Vascular targeting Download PDFInfo
- Publication number
- WO2016092301A1 WO2016092301A1 PCT/GB2015/053771 GB2015053771W WO2016092301A1 WO 2016092301 A1 WO2016092301 A1 WO 2016092301A1 GB 2015053771 W GB2015053771 W GB 2015053771W WO 2016092301 A1 WO2016092301 A1 WO 2016092301A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumour
- antibody
- inhibitor
- vasculature
- agent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
Definitions
- the present invention relates generally to genes and polypeptides which are differentially expressed in tumour vasculature, as compared to normal tissue vasculature, to the use of antibodies that bind these polypeptides for imaging and targeting tumour vasculature, and to the use of inhibitors of these tumour vasculature expressed genes/polypeptides for inhibiting vasculature, such as angiogenesis in solid tumours.
- the present invention relates to tumour endothelial markers (TEMs), to the use of antibodies that bind such TEMs for imaging and targeting tumour vasculature, and to the use of inhibitors of such TEMs for inhibiting vasculature such as angiogenesis in solid tumours.
- the TEM is PCDH7.
- a functional vasculature contributes to tumour progression and malignant cell metastasis. Endothelial cells lining the tumour vasculature are exposed to molecular factors and mechanical forces that are absent in healthy tissue. For example, the vasculature in solid tumours is often in a hypoxic environment (Dachs and Chaplin, 1998) and is exposed to elevated levels of hypoxically induced angiogenic factors such as vascular endothelial growth factor (Relf et al., 1997). Tumour vessels may also be leaky, tortuous, sometimes blind ended and have poor vascular smooth muscle and pericyte coverage (Baluk et al., 2005).
- tumour endothelial transcriptome is markedly different from that in healthy tissue and provides a unique source for cancer target identification.
- attempts to identify tumour endothelial marker's have included construction of SAGE libraries from freshly isolated endothelium (St Croix et al., 2000), use of microarray platforms (Ho et al., 2003), proteomic analysis of freshly isolated endothelial cell membranes (Oh et al., 2004, Ho et al., 2003) as well as bioinformatics data mining (Huminiecki and Bicknell, 2000, Herbert et al., 2008).
- the present invention relates to the identification of novel TEMs and uses/methods and products which may arise from this. Those which may find use in the present invention are identified in Table 4. However, for the sake of brevity further reference throughout this specification will be made to PCDH7, but this should not be construed as limiting in any way.
- a binding agent such as an inhibitor of PCDH7 for use in a method of inhibiting tumour vasculature.
- a method of inhibiting tumour vaculature in an individual in need thereof comprising administering a cell binding agent, such as an inhibitor of PCDH7to the individual.
- PCDH7 belongs to the protocadherin gene family, a subfamily of the cadherin superfamily.
- the gene encodes a protein with an extracellular domain containing 7 cadherin repeats.
- the gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails.
- the PCDH7 gene is found on the human chromosome 4 at position p15.1 .
- the PCDH7 entry is found in Genbank Accession No.
- the cell binding agents of the present invention may be inhibitors themselves, or may simply facilitate the action of an inhibitor which may be associated, bound or conjugated to the cell-binding agent
- inhibitor in the context of the present invention is understood to relate to anti- angiogenic agents and/or vascular disrupting agents.
- anti-angiogenic agents acts to interfere with new vessel formation, thereby preventing tumour growth and limiting metastatic potential
- vascular disrupting agents are directed against established tumour vasculature and may destroy tumours and/or halt their progression.
- the present invention is generally, although not exclusively directed to the targeting and hence inhibition of tumour vasculature, rather than targeting the neoplastic cell population present in a tumour.
- the present invention is generally concerned with targeting the blood vessel network which provides nutrition to the tumour. If it is possible to reduce or remove the blood vessels which provide nutrition to a tumour, then it is expected that the tumour will become dormant or die.
- inhibitor of TEM includes both inhibitors of the TEM polypeptide and of the TEM gene/cDNA.
- Suitable inhibitors of TEM include antibodies or antibody-drug conjugates that selectively bind to the TEM.
- Other suitable inhibitors of TEM include siRNA, antisense polynucleotides, modified snoRNA molecules and ribozyme molecules that are specific for polynucleotides encoding the TEM polypeptide, and which prevent its expression.
- inhibiting is understood to mean a reduction in the rate of development, or the level of tumour vasculature associated with a tumour.
- the reduction may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% 99%, or substantially all of the rate of development or level of tumour vasculature.
- Methods of determining such a reduction are well known to the skilled reader and include histological techniques, as well as other imaging techniques as described herein.
- the vasculature is associated with a solid tumour, such as a lung tumour.
- binding agent refers to a compound that can bind the TEM (e.g., on the cell-surface) either in a specific or non-specific manner. In certain embodiments, binding to the TEM is specific.
- The-binding agent may be of any kind presently known, or that become known and includes peptides and non-peptides. It is to be appreciated that polypeptide inhibitors of the TEM may be administered directly, or may be administered in the form of a polynucleotide that encodes the polypeptide.
- Suitable antibodies which bind toa TEM such as PCDH7, or to specified portions thereof, such as extracellular portions, can be made by the skilled person using technology long- established in the art.
- Methods of preparation of monoclonal antibodies and antibody fragments are well known in the art and include hybridoma technology (Kohler & Milstein (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256: 495-497); antibody phage display (Winter et al (1994) "Making antibodies by phage display technology.”
- antibodies and antibody fragments suitable for use in the present invention are described, for example, in the following publications: “Monoclonal Hybridoma Antibodies: Techniques and Application", Hurrell (CRC Press, 1982); “ Monoclonal Antibodies: A Manual of Techniques” , H. Zola, CRC Press, 1987, ISBN: 0-84936-476-0; “Antibodies: A Laboratory Manuar 1 ⁇ st> Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1988. ISBN 0- 87969-314-2; "Using Antibodies: A Laboratory Manuar 2 ⁇ nd> Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1999.
- Antibodies that are especially active at inhibiting tumour angiogenesis are preferred for anticancer therapeutic agents, and they can be selected for this activity using methods well known in the art and described below.
- the antibody is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, a chimeric antibody, a multispecific antibody, or an antibody fragment thereof.
- the isolated antigen binding protein is a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a diabody, or a single chain antibody molecule.
- the isolated antigen binding protein is a human antibody.
- the isolated antigen binding protein is a monoclonal antibody.
- the antibody is of the IgGI-, lgG2- lgG3- or lgG4-type. In some embodiments, the antibody is coupled to a labelling group.
- an antibody that selectively binds the TEM such as PCDHH7 polypeptide is intended to mean that the antibody molecule binds the TEM with a greater affinity than for an unrelated polypeptide, such as human serum albumin (HSA).
- HSA human serum albumin
- the antibody binds with a Kd that is smaller than 100 pM.
- the antibody binds with a Kd that is smaller than 10 pM.
- the antibody binds with a Kd that is less than 5 pM.
- Such binding may be determined by methods well known in the art, such as one of the Biacore® systems.
- Antibodies may be produced by standard techniques, for example by immunisation with the TEM polypeptide or antigenic portion(s) thereof, or by using a phage display library. If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc) is immunised with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenised to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response.
- a selected mammal e.g., mouse, rabbit, goat, horse, etc
- an immunogenic polypeptide bearing a desired epitope(s) optionally haptenised to another polypeptide.
- various adjuvants may be used to increase immunological response.
- Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminium hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.
- Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the desired epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are well known in the art.
- a mouse anti-human PCDH7 monoclonal antibody is commercially available from, for example, Abeam (Catalogue ab139274), or Santa Cruz (Catalogue sc-517042)
- Monoclonal antibodies directed against entire polypeptides or particular epitopes thereof can also be readily produced by one skilled in the art.
- the general methodology for making monoclonal antibodies by hybridomas is well known.
- Immortal antibody- producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein- Barr virus.
- Panels of monoclonal antibodies produced against the polypeptides listed above can be screened for various properties; i.e., for isotype and epitope affinity.
- Monoclonal antibodies may be prepared using any of the well-known techniques which provides for the production of antibody molecules by continuous cell lines in culture.
- the antibody is a monoclonal antibody.
- the monoclonal antibody is a human monoclonal antibody or a humanised monoclonal antibody, which are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin.
- Suitably prepared non-human antibodies can be "humanised” in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies. Humanised antibodies can be made using the techniques and approaches described in Verhoeyen et al (1988) Science, 239, 1534-1536, and in Kettleborough et al, (1991 ) Protein Engineering, 14(7), 773-783.
- Fv framework residues of the human immunoglobulin are replaced by corresponding non- human residues.
- the humanised antibody will contain variable domains in which all or most of the CDR regions correspond to those of a non- human immunoglobulin, and framework regions which are substantially or completely those of a human immunoglobulin consensus sequence.
- Completely human antibodies may be produced using recombinant technologies. Typically large libraries comprising billions of different antibodies are used. In contrast to the previous technologies employing chimerisation or humanisation of e.g. murine antibodies this technology does not rely on immunisation of animals to generate the specific antibody.
- the recombinant libraries comprise a huge number of pre- made antibody variants wherein it is likely that the library will have at least one antibody specific for any antigen.
- an existing antibody having the desired binding characteristics can be identified.
- various systems where phenotype i.e. the antibody or antibody fragment is linked to its genotype i.e. the encoding gene have been devised.
- phage display system where antibody fragments are expressed, displayed, as fusions with phage coat proteins on the surface of filamentous phage particles, while simultaneously carrying the genetic information encoding the displayed molecule
- Phage displaying antibody fragments specific for a particular antigen may be selected through binding to the antigen in question. Isolated phage may then be amplified and the gene encoding the selected antibody variable domains may optionally be transferred to other antibody formats, such as e.g. full-length immunoglobulin, and expressed in high amounts using appropriate vectors and host cells well known in the art.
- the "human” antibodies can be made by immunising transgenic mice which contain, in essence, human immunoglobulin genes (Vaughan et al (1998) Nature Biotechnol. 16, 535-539).
- the antibody when the antibody is for administration to a non-human individual, the antibody may have been specifically designed/produced for the intended recipient species.
- the format of displayed antibody specificities on phage particles may differ. The most commonly used formats are Fab (Griffiths et al, 1994. EMBO J. 13: 3245-3260) and single chain (scFv) (Hoogenboom er a/, 1992, J Mol Biol. 227: 381 -388) both comprising the variable antigen binding domains of antibodies.
- the single chain format is composed of a variable heavy domain (VH) linked to a variable light domain (Vu) via a flexible linker (US 4,946,778).
- the antibody Before use as a therapeutic agent, the antibody may be transferred to a soluble format e.g. Fab or scFv and analysed as such. In later steps the antibody fragment identified to have desirable characteristics may be transferred into yet other formats such as full-length antibodies.
- WO 98/32845 and Soderlind et al (2000) Nature BioTechnol. 18: 852-856 describe technology for the generation of variability in antibody libraries. Antibody fragments derived from this library all have the same framework regions and only differ in their CDRs. Since the framework regions are of germline sequence the immunogenicity of antibodies derived from the library, or similar libraries produced using the same technology, are expected to be particularly low (Soderlind et al, 2000).
- antibody also includes heavy-chain antibodies structurally derived from camelidae antibodies, such as Nanobodies® (Ablynx). These are antibody-derived therapeutic proteins that contain the structural and functional properties of naturally-occurring heavy- chain antibodies.
- the Nanobody® technology was developed following the discovery that camelidae (camels and llamas) possess fully functional antibodies that lack light chains.
- These heavy-chain antibodies contain a single variable domain (VHH) and two constant domains (CH2 and CH3).
- VHH domain single variable domain
- CH2 and CH3 constant domains
- the cloned and isolated VHH domain is a perfectly stable polypeptide harbouring the full antigen-binding capacity of the original heavy-chain antibody.
- RNA interference is the process of sequence- specific post- transcriptional gene silencing in animals initiated by double-stranded (dsRNA) that is homologous in sequence to the silenced gene.
- the mediators of sequence-specific imRNA degradation are typically 21 - and 22-nucleotide small interfering RNAs (siRNAs) which, in vivo, may be generated by ribonuclease III cleavage from longer dsRNAs.
- 21 -nucleotide siRNA duplexes have been shown to specifically suppress expression of both endogenous and heterologous genes (Elbashir et al (2001 ) Nature 41 1 : 494-498).
- the siRNA has to be comprised of two complementary 21 mers as described below since longer double- stranded (ds) RNAs will activate PKR (dsRNA-dependent protein kinase) and inhibit overall protein synthesis.
- ds double- stranded
- Duplex siRNA molecules such as shRNA molecules selective for a polynucleotide encoding the TEM polypeptide can readily be designed by reference to its cDNA sequence.
- the first 21 -mer sequence that begins with an AA dinucleotide which is at least 120 nucleotides downstream from the initiator methionine codon is selected.
- the RNA sequence perfectly complementary to this becomes the first RNA oligonucleotide.
- the second RNA sequence should be perfectly complementary to the first 19 residues of the first, with an additional UU dinucleotide at its 3' end.
- siRNAs may be introduced into cells in the patient using any suitable method, such as those described herein. Typically, the RNA is protected from the extracellular environment, for example by being contained within a suitable carrier or vehicle. Liposome-mediated transfer, e.g. the oligofectamine method, may be used. siRNA molecules against PCDH7 are available from Santa Cruz (Catalogue No. sc-88977)
- Antisense nucleic acid molecules selective for a polynucleotide encoding the STEAP1 polypeptide can readily be designed by reference to its cDNA or gene sequence, as is known in the art.
- Antisense nucleic acids such as oligonucleotides, are single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. These nucleic acids are often termed "antisense” because they are complementary to the sense or coding strand of the gene. Recently, formation of a triple helix has proven possible where the oligonucleotide is bound to a DNA duplex.
- oligonucleotides could recognise sequences in the major groove of the DNA double helix. A triple helix was formed thereby. This suggests that it is possible to synthesise a sequence-specific molecules which specifically bind double-stranded DNA via recognition of major groove hydrogen binding sites.
- the above oligonucleotides can inhibit the function of the target nucleic acid. This could, for example, be a result of blocking the transcription, processing, poly(A) addition, replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradations.
- Antisense oligonucleotides are prepared in the laboratory and then introduced into cells, for example by microinjection or uptake from the cell culture medium into the cells, or they are expressed in cells after transfection with plasm ids or retroviruses or other vectors carrying an antisense gene.
- Antisense oligonucleotides were first discovered to inhibit viral replication or expression in cell culture for Rous sarcoma virus, vesicular stomatitis virus, herpes simplex virus type 1 , simian virus and influenza virus. Since then, inhibition of imRNA translation by antisense oligonucleotides has been studied extensively in cell-free systems including rabbit reticulocyte lysates and wheat germ extracts.
- antisense oligonucleotides are 15 to 35 bases in length.
- 20-mer oligonucleotides have been shown to inhibit the expression of the epidermal growth factor receptor mRNA (Witters et al., Breast Cancer Res Treat 53:41 -50 (1999)) and 25- mer oligonucleotides have been shown to decrease the expression of adrenocorticotropic hormone by greater than 90% (Frankel et al., J Neurosurg 91 :261 -7 (1999)).
- Antisense polynucleotides may be administered systemically. Alternatively, and preferably, the inherent binding specificity of polynucleotides characteristic of base pairing is enhanced by limiting the availability of the polynucleotide to its intended locus in vivo, permitting lower dosages to be used and minimising systemic effects. Thus, polynucleotides may be applied locally to the tumour vasculature to achieve the desired effect. The concentration of the polynucleotides at the desired locus is much higher than if the polynucleotides were administered systemically, and the therapeutic effect can be achieved using a significantly lower total amount. The local high concentration of polynucleotides enhances penetration of the targeted cells and effectively blocks translation of the target nucleic acid sequences.
- antisense agents may also include larger molecules which bind to polynucleotides (mRNA or genes) encoding the TEM polypeptide and substantially prevent expression of the protein.
- antisense molecules which are substantially complementary to the respective mRNA are also envisaged.
- the molecules may be expressed from any suitable genetic construct and delivered to the patient.
- the genetic construct which expresses the antisense molecule comprises at least a portion of the TEM cDNA or gene operatively linked to a promoter which can express the antisense molecule in the cell.
- the genetic construct is adapted for delivery to a human cell.
- Modified snoRNA molecules are described in WO2009/037490, to which the skilled reader is directed and may comprise a portion of nucleic acid designed to specifically hybridise to TEMRNA and inhibit its expression.
- Ribozymes are RNA or RNA-protein complexes that cleave nucleic acids in a site- specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity. For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate. This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction. Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids.
- IGS internal guide sequence
- ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes.
- sequence-specific ribozyme-mediated inhibition of gene expression may be particularly suited to therapeutic applications, and ribozymes specific for a polynucleotide encoding the TEM polypeptide may be designed by reference to the TEM cDNA sequence.
- polynucleotide inhibitors such as siRNA molecules, antisense molecules, modified snoRNA molecules and ribozymes
- agents that inhibit transcription of the genes encoding any of the above listed polypeptides can also be designed, for example using an engineered transcription repressor described in Isalan et al ⁇ Nat Biotechnol, 19(7): 656-60 (2001 )) and in Urnov (Biochem Pharmacol, 64 (5-6): 919 (2002)). Additionally, they can be selected, for example using the screening methods described in later aspects of the invention.
- the methods and medicaments of the invention are used to treat humans, in which case the inhibitor of the TEM is an inhibitor of human TEM. It is appreciated, however, that when the methods and medicaments of the invention are for treatment of non-human mammals, it is preferred if the inhibitor is specific for the TEM gene/polypeptide from the other species. It is appreciated that the inhibitor of TEM will typically be formulated for administration to an individual as a pharmaceutical composition, i.e. together with a pharmaceutically acceptable carrier, diluent or excipient.
- the compounds of the invention may also be administered in conjunction with a further chemotherapeutic therapy, or a non-chemotherapeutic treatments such as radiotherapy, photodynamic therapy, gene therapy; surgery and controlled diets.
- a further chemotherapeutic therapy or a non-chemotherapeutic treatments such as radiotherapy, photodynamic therapy, gene therapy; surgery and controlled diets.
- an immunogenic formulation such as in the form of a vaccine, comprising a TEM, such as PCDH7or an immunogenic fragment thereof, such as an extracellular portion thereof for use in a method of preventing the development of tumour vasculature.
- the vaccine/immunogenic formulation may be administered prior to or after the detection of a tumour.
- the vaccine/immunogenic formulation may induce a cellular or humoral immune reaction against the TEM polypeptide or fragment thereof. Preferably, both humoral and cellular immune reactions are induced.
- the present invention extends to nucleotide vaccines in which case a nucleotide which encodes a TEM or immunogenic fragment thereof, may be administered to a subject, as is well known in the art
- the vaccine/immunogenic formulation may be administered to a subject to be treated, one or more, such as two or three, times.
- the compounds or physiologically acceptable salt, solvate, ester or other physiologically functional derivative thereof described herein may be presented as a pharmaceutical formulation, comprising the compound or physiologically acceptable salt, ester or other physiologically functional derivative thereof, together with one or more pharmaceutically acceptable carriers therefore and optionally other therapeutic and/or prophylactic ingredients.
- the carrier(s) must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
- compositions include those suitable for oral, topical (including dermal, buccal and sublingual), rectal or parenteral (including subcutaneous, intradermal, intramuscular and intravenous), nasal and pulmonary administration e.g., by inhalation.
- the formulation may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association an active compound with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
- compositions suitable for oral administration wherein the carrier is a solid are most preferably presented as unit dose formulations such as boluses, capsules or tablets each containing a predetermined amount of active compound.
- a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine an active compound in a free-flowing form such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, lubricating agent, surface-active agent or dispersing agent.
- Moulded tablets may be made by moulding an active compound with an inert liquid diluent. Tablets may be optionally coated and, if uncoated, may optionally be scored.
- Capsules may be prepared by filling an active compound, either alone or in admixture with one or more accessory ingredients, into the capsule shells and then sealing them in the usual manner.
- Cachets are analogous to capsules wherein an active compound together with any accessory ingredient(s) is sealed in a rice paper envelope.
- An active compound may also be formulated as dispersible granules, which may for example be suspended in water before administration, or sprinkled on food. The granules may be packaged, e.g., in a sachet.
- Formulations suitable for oral administration wherein the carrier is a liquid may be presented as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water liquid emulsion.
- Formulations for oral administration include controlled release dosage forms, e.g., tablets wherein an active compound is formulated in an appropriate release - controlling matrix, or is coated with a suitable release - controlling film. Such formulations may be particularly convenient for prophylactic use.
- Pharmaceutical formulations suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by admixture of an active compound with the softened or melted carrier(s) followed by chilling and shaping in moulds.
- compositions suitable for parenteral administration include sterile solutions or suspensions of an active compound in aqueous or oleaginous vehicles.
- Injectable preparations may be adapted for bolus injection or continuous infusion. Such preparations are conveniently presented in unit dose or multi-dose containers which are sealed after introduction of the formulation until required for use.
- an active compound may be in powder form which is constituted with a suitable vehicle, such as sterile, pyrogen-free water, before use.
- An active compound may also be formulated as long-acting depot preparations, which may be administered by intramuscular injection or by implantation, e.g., subcutaneously or intramuscularly. Depot preparations may include, for example, suitable polymeric or hydrophobic materials, or ion-exchange resins. Such long-acting formulations are particularly convenient for prophylactic use.
- Formulations suitable for pulmonary administration via the buccal cavity are presented such that particles containing an active compound and desirably having a diameter in the range of 0.5 to 7 microns are delivered in the bronchial tree of the recipient.
- such formulations are in the form of finely comminuted powders which may conveniently be presented either in a pierceable capsule, suitably of, for example, gelatin, for use in an inhalation device, or alternatively as a self-propelling formulation comprising an active compound, a suitable liquid or gaseous propellant and optionally other ingredients such as a surfactant and/or a solid diluent.
- suitable liquid propellants include propane and the chlorofluorocarbons
- suitable gaseous propellants include carbon dioxide.
- Self-propelling formulations may also be employed wherein an active compound is dispensed in the form of droplets of solution or suspension.
- Such self-propelling formulations are analogous to those known in the art and may be prepared by established procedures. Suitably they are presented in a container provided with either a manually-operable or automatically functioning valve having the desired spray characteristics; advantageously the valve is of a metered type delivering a fixed volume, for example, 25 to 100 microlitres, upon each operation thereof.
- an active compound may be in the form of a solution or suspension for use in an atomizer or nebuliser whereby an accelerated airstream or ultrasonic agitation is employed to produce a fine droplet mist for inhalation.
- Formulations suitable for nasal administration include preparations generally similar to those described above for pulmonary administration. When dispensed such formulations should desirably have a particle diameter in the range 10 to 200 microns to enable retention in the nasal cavity; this may be achieved by, as appropriate, use of a powder of a suitable particle size or choice of an appropriate valve. Other suitable formulations include coarse powders having a particle diameter in the range 20 to 500 microns, for administration by rapid inhalation through the nasal passage from a container held close up to the nose, and nasal drops comprising 0.2 to 5% w/v of an active compound in aqueous or oily solution or suspension.
- the pharmaceutical formulations described above may include, an appropriate one or more additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the formulation isotonic with the blood of the intended recipient.
- additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the formulation isotonic with the blood of the intended recipient.
- Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.1 M and preferably 0.05 M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.
- Formulations suitable for topical formulation may be provided for example as gels, creams or ointments. Such preparations may be applied e.g. to a wound or ulcer either directly spread upon the surface of the wound or ulcer or carried on a suitable support such as a bandage, gauze, mesh or the like which may be applied to and over the area to be treated.
- a suitable support such as a bandage, gauze, mesh or the like which may be applied to and over the area to be treated.
- Liquid or powder formulations may also be provided which can be sprayed or sprinkled directly onto the site to be treated, e.g. a wound or ulcer.
- a carrier such as a bandage, gauze, mesh or the like can be sprayed or sprinkle with the formulation and then applied to the site to be treated.
- Therapeutic formulations for veterinary use may conveniently be in either powder or liquid concentrate form.
- conventional water soluble excipients such as lactose or sucrose, may be incorporated in the powders to improve their physical properties.
- suitable powders of this invention comprise 50 to 100% w/w and preferably 60 to 80% w/w of the active ingredient(s) and 0 to 50% w/w and preferably 20 to 40% w/w of conventional veterinary excipients.
- These powders may either be added to animal feedstuffs, for example by way of an intermediate premix, or diluted in animal drinking water.
- Liquid concentrates of this invention suitably contain the compound or a derivative or salt thereof and may optionally include a veterinarily acceptable water-miscible solvent, for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol.
- a veterinarily acceptable water-miscible solvent for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol.
- the liquid concentrates may be administered to the drinking water of animals.
- the antibody can be administered by a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours.
- a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours.
- ReGel injectable system An alternative method for delivery of polypeptide inhibitors, such as antibodies, is the ReGel injectable system that is thermo-sensitive. Below body temperature, ReGel is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve. Polypeptide pharmaceuticals such as antibodies can also be delivered orally.
- the process employs a natural process for oral uptake of vitamin B12 in the body to co-deliver proteins and peptides. By riding the vitamin B 2 uptake system, the protein or peptide can move through the intestinal wall. Complexes are synthesised between vitamin B12 analogues and the drug that retain both significant affinity for intrinsic factor (IF) in the vitamin B12 portion of the complex and significant bioactivity of the drug portion of the complex.
- IF intrinsic factor
- Polynucleotides may be administered by any effective method, for example, parenterally (e.g. intravenously, subcutaneously, intramuscularly) or by oral, nasal or other means which permit the polynucleotides to access and circulate in the patient's bloodstream.
- Polynucleotides administered systemically preferably are given in addition to locally administered polynucleotides, but also have utility in the absence of local administration.
- a dosage in the range of from about 0.1 to about 10 grams per administration to an adult human generally will be effective for this purpose.
- the polynucleotide may be administered as a suitable genetic construct.
- the polynucleotide in the genetic construct is operatively linked to a promoter which can express the compound in the cell.
- the genetic constructs of the invention can be prepared using methods well known in the art, for example in Sambrook et al (2001 ).
- genetic constructs for delivery of polynucleotides can be DNA or RNA, it is preferred if they are DNA.
- the genetic construct is adapted for delivery to a human or animal cell. Means and methods of introducing a genetic construct into a cell in an animal body are known in the art.
- the constructs of the invention may be introduced into cells by any convenient method, for example methods involving retroviruses, so that the construct is inserted into the genome of the cell.
- methods involving retroviruses for example, in Kuriyama et al (1991 , Cell Struc. and Func. 16, 503-510) purified retroviruses are administered.
- Retroviral DNA constructs comprising a polynucleotide as described above may be made using methods well known in the art.
- To produce active retrovirus from such a construct it is usual to use an ecotropic psi2 packaging cell line grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% foetal calf serum (FCS).
- DMEM Dulbecco's modified Eagle's medium
- FCS foetal calf serum
- Transfection of the cell line is conveniently by calcium phosphate co-precipitation, and stable transformants are selected by addition of G418 to a final concentration of 1 mg/ml (assuming the retroviral construct contains a neo® gene). Independent colonies are isolated and expanded and the culture supernatant removed, filtered through a 0.45 pm pore-size filter and stored at -70C.
- the retrovirus for example, it is convenient to inject directly retroviral supernatant to which 10 pg/ml Polybrene has been added.
- tumours exceeding 10 mm in diameter it is appropriate to inject between 0.1 ml and 1 ml of retroviral supernatant; preferably 0.5 ml.
- cells which produce retroviruses may be injected.
- the retrovirus-producing cells so introduced are engineered to actively produce retroviral vector particles so that continuous productions of the vector occurred within the tumour mass in situ.
- Targeted retroviruses are also available for use in the invention; for example, sequences conferring specific binding affinities may be engineered into pre-existing viral env genes (see Miller & Vile (1995) Faseb J. 9, 190-199, for a review of this and other targeted vectors for gene therapy).
- a polycation-antibody complex is formed with the DNA construct or other genetic construct of the invention, wherein the antibody is specific for either wild-type adenovirus or a variant adenovirus in which a new epitope has been introduced which binds the antibody.
- the polycation moiety binds the DNA via electrostatic interactions with the phosphate backbone.
- the adenovirus because it contains unaltered fibre and penton proteins, is internalised into the cell and carries into the cell with it the DNA construct of the invention. It is preferred if the polycation is polylysine.
- a high-efficiency nucleic acid delivery system that uses receptor- mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids. Human transferrin, or the chicken homologue conalbumin, or combinations thereof is covalently linked to the small DNA-binding protein protamine or to polylysines of various sizes through a disulphide linkage. These modified transferrin molecules maintain their ability to bind their cognate receptor and to mediate efficient iron transport into the cell.
- the transferrin-polycation molecules form electrophoretically stable complexes with DNA constructs or other genetic constructs of the invention independent of nucleic acid size (from short oligonucleotides to DNA of 21 kilobase pairs).
- complexes of transferrin- polycation and the DNA constructs or other genetic constructs of the invention are supplied to the tumour cells, a high level of expression from the construct in the cells is expected.
- USA 89, 6094-6098 may also be used.
- This approach appears to rely on the fact that adenoviruses are adapted to allow release of their DNA from an endosome without passage through the lysosome, and in the presence of, for example transferrin linked to the DNA construct or other genetic construct of the invention, the construct is taken up by the cell by the same route as the adenovirus particle.
- This approach has the advantages that there is no need to use complex retroviral constructs; there is no permanent modification of the genome as occurs with retroviral infection; and the targeted expression system is coupled with a targeted delivery system, thus reducing toxicity to other cell types.
- naked DNA and DNA complexed with cationic and neutral lipids may also be useful in introducing the DNA of the invention into cells of the individual to be treated.
- Non-viral approaches to gene therapy are described in Ledley (1995, Human Gene Therapy 6, 1 129-1 144).
- tissue-specific promoters in the vectors encoding a polynucleotide inhibitor, this is not essential. This is because the targeted genes are only expressed, or selectively expressed, in the tumour endothelium. Accordingly, expression of TEM, such as PCDH7-specific inhibitors such as siRNA, antisense molecules, modified snoRNA and ribozymes in the body at locations other than the solid tumour would be expected to have little or no effect since the TEMs of the invention, such as PCDH7 are not expressed or are expressed at a comparatively low level. Moreover, the risk of inappropriate expression of these inhibitors, in a cell that may express the target polypeptide at a low level, is miniscule compared to the therapeutic benefit to a patient suffering from a solid tumour.
- TEM such as PCDH7-specific inhibitors such as siRNA, antisense molecules, modified snoRNA and ribozymes
- Targeted delivery systems are also known, such as the modified adenovirus system described in WO 94/10323, wherein, typically, the DNA is carried within the adenovirus, or adenovirus-like, particle.
- Michael ef al (1995) Gene Therapy 2: 660-668 describes modification of adenovirus to add a cell-selective moiety into a fibre protein.
- Mutant adenoviruses which replicate selectively in p53-deficient human tumour cells such as those described in Bischoff er a/ (1996) Science 274: 373-376 are also useful for delivering genetic constructs to a cell.
- Other suitable viruses, viral vectors or virus-like particles include lentivirus and lentiviral vectors, HSV, adeno-assisted virus (AAV) and AAV-based vectors, vaccinia and parvovirus.
- therapeutic agents including vectors can be distributed throughout a wide region of the CNS by injection into the cerebrospinal fluid, e.g., by lumbar puncture (See e.g., Kapadia et al (1996) Neurosurg 10: 585-587).
- precise delivery of the therapeutic agent into specific sites of the brain can be conducted using stereotactic microinjection techniques.
- the therapeutic agent is delivered using other delivery methods suitable for localised delivery, such as localised permeation of the blood-brain barrier.
- US 2005/0025746 describes delivery systems for localised delivery of an adeno-associated virus vector (AAV) vector encoding a therapeutic agent to a specific region of the brain.
- AAV adeno-associated virus vector
- a therapeutic agent for the treatment of a solid tumour of, for example, the brain is encoded by a polynucleotide
- Central nervous system (CNS) specific promoters such as, neuron-specific promoters (e.g., the neurofilament promoter (Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477) and glial specific promoters (Morii et al (1991 ) Biochem. Biophys Res. Commun.
- the promoter is tissue specific and is essentially not active outside the central nervous system, or the activity of the promoter is higher in the central nervous system than in other cells or tissues
- Suitable neuronal specific promoters include, but are not limited to, neuron specific enolase (NSE; Arlington et al (1991 ) Genomics 10: 157-165); GenBank Accession No: X51956), and human neurofilament light chain promoter (NEFL; Rogaev er al (1992) Hum. Mol. Genet. 1 : 781 ); GenBank Accession No: L04147).
- Glial specific promoters include, but are not limited to, glial fibrillary acidic protein (GFAP) promoter (Morii er al (1991 ); GenBank Accession No: M65210), S100 promoter (Morii et al (1991 ); GenBank Accession No: M65210) and glutamine synthase promoter (Van den ef al (1991 ) Biochem. Biophys. Acta. 2: 249-251 ); GenBank Accession No: X59834).
- the gene is flanked upstream (i.e., 5') by the neuron specific enolase (NSE) promoter.
- NSE neuron specific enolase
- the gene of interest is flanked upstream (i.e., 5') by the elongation factor 1 alpha (EF) promoter.
- EF elongation factor 1 alpha
- a hippocampus specific promoter that might be used is the hippocampus specific glucocorticoid receptor (GR) gene promoter.
- Svensson et al (1999) describes the delivery of recombinant genes to cardiomyocytes by intramyocardial injection or intracoronary infusion of cardiotropic vectors, such as recombinant adeno-associated virus vectors, resulting in transgene expression in murine cardiomyocytes in vivo (Svensson et al (1999) "Efficient and stable transduction of cardiomyocytes after intramyocardial injection or intracoronary perfusion with recombinant adeno-associated virus vectors.” Circulation. 99: 201 -5).
- elo et al review gene and cell-based therapies for heart disease Melo er al (2004) "Gene and cell- based therapies for heart disease.” FASEB J. 18(6): 648-63).
- An alternative preferred route of administration is via a catheter or stent.
- Stents represent an attractive alternative for localized gene delivery, as they provide a platform for prolonged gene elution and efficient transduction of opposed arterial walls. This gene delivery strategy has the potential to decrease the systemic spread of the viral vectors and hence a reduced host immune response. Both synthetic and naturally occurring stent coatings have shown potential to allow prolonged gene elution with no significant adverse reaction (Sharif ef al (2004) "Current status of catheter- and stent-based gene therapy.” Cardiovasc Res. 64(2): 208-16).
- polynucleotide inhibitor may be operatively linked to a regulatable promoter.
- regulatable promoters include those referred to in the following papers: Rivera et al (1999) Proc Natl Acad Sci USA 96(15), 8657-62 (control by rapamycin, an orally bioavailable drug, using two separate adenovirus or adeno- associated virus (AAV) vectors, one encoding an inducible human growth hormone (hGH) target gene, and the other a bipartite rapamycin- regulated transcription factor); Magari er al (1997) J Clin Invest 100(1 1 ), 2865-72 (control by rapamycin); Bueler (1999) Biol Chem 380(6), 613-22 (review of adeno-associated viral vectors); Bohl et al (1998) Blood 92(5), 1512-7 (control by doxycycline in adeno-associated vector); Abruzzese et al (1996) J Mol Med 74(7), 379-92 (review of induction factors, e.g.. hormones, growth hormone
- the inhibitor is typically administered as a suitably acceptable formulation in accordance with normal veterinary practice and the veterinary surgeon will determine the dosing regimen and route of administration which will be most appropriate for a particular animal.
- the method may also comprising administering to the individual at least one further anticancer agent.
- the method may comprise administering to the individual a pharmaceutical composition containing the inhibitor of a TEM, such as PCDH7and the further anticancer agent.
- the inhibitor of the TEM and the further anticancer agent may be administered separately, for instance by separate routes of administration.
- the inhibitor of the TEM and the at least one further anticancer agent can be administered sequentially or (substantially) simultaneously.
- the further anticancer agent may be directed to target neoplastic cells rather than the tumour vasculature. In another embodiment the further anticancer agent may also be directed to target the tumour vasculature rather than the neoplastic cells of the tumour.
- the medicament containing the inhibitor of a TEM such as PCDH7may also comprise at least one further anticancer agent.
- the individual to be treated may be one who is administered at least one further anticancer agent. It is appreciated that the individual may be administered the further anticancer agent at the same time as the medicament containing the inhibitor of the TEM, although the individual may have been (or will be) administered the further anticancer agent before (or after) receiving the medicament containing the inhibitor of the TEM.
- the further anticancer agent may be selected from alkylating agents including nitrogen mustards such as mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan (L- sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine, thiotepa; alkyl sulphonates such as busulphan; nitrosoureas such as carmustine (BCNU), lomustine (CCNU), semustine (methyl-CCNU) and streptozocin (streptozotocin); and triazenes such as decarbazine (DTIC; dimethyltriazenoimidazole- carboxamide); antimetabolites including folic acid analogues such as methotrexate (amethopterin); pyrimidine analogues such as fluorouracil (5-fluorouracil; 5-FU), floxuridine (fluoro
- the clinically used anticancer agents are typically grouped by mechanism of action: Alkylating agents, Topoisomerase I inhibitors, Topoisomerase II inhibitors, RNA/DNA antimetabolites, DNA antimetabolites and Antimitotic agents.
- Alkylating agents include Alkylating agents, Topoisomerase I inhibitors, Topoisomerase II inhibitors, RNA/DNA antimetabolites, DNA antimetabolites and Antimitotic agents.
- the US NIH/National Cancer Institute website lists 122 compounds (http://dtp.nci.nih.gov/docs/cancer/ searches/standard_mechanism.html), all of which may be used in conjunction with an inhibitor of STEAP1 .
- Alkylating agents including Asaley, A2Q, BCNU, Busulfan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, c/s-platinum, clomesone, cyanomorpholino-doxorubicin, cyclodisone, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, teroxirone, tetraplatin, picoplatin (SP-4-3) (cis- aminedichloro(2- methylpyridine)Pt(ll)), thio-tepa, triethylenemelamine, uracil nitrogen mustard, Yoshi-864; anitmitotic agents including allo
- the at least one further anticancer agent is selected from cisplatin; carboplatin; picoplatin; 5-flurouracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin.
- the inhibitor of the TEM is used in combination with that further anticancer agent to treat that specific tumour type.
- tumour endothelial markers are specific for tumour endothelial markers. Due to their accessibility and to the therapeutic options that they allow (for example, intraluminal blood coagulation or recruitment of immune cells), vascular markers selectively expressed on tumour blood vessels are ideally suited for ligand-based tumour-targeting strategies, allowing for the imaging of tumour neovasculature and for targeting cytotoxic agents to the tumour neovasculature.
- the invention provides an antibody-drug conjugate for use in a method of inhibiting tumour vasculature, wherein the antibody-drug conjugate comprises: (i) an antibody that selectively binds the TEM, such as PCDH7polypeptide, or fragment thereof and (ii) an anti-tumour vasculature cell moiety
- Such an antibody-drug conjugate may also be used in a method of treatment as discussed herein.
- the present invention further provides an antibody-drug conjugate as defined for use in the preparation of a medicament for use in treating/inhibiting tumour vasculature.
- conjugate refers to an anti-tumour vasculature cell moiety or a derivative thereof that is linked to an antibody as defined herein directly or by way of a linker.
- linker is any chemical moiety that is capable of linking the anti-tumour vasculature cell moiety to an antibody or a fragment thereof in a stable, covalent manner.
- Linkers can be susceptible to or be substantially resistant to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage, at conditions under which the anti-tumour vasculature cell moiety and/or the antibody remains active.
- Suitable linkers are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups.
- Linkers also include charged linkers, and hydrophilic forms thereof as described herein and know in the art.
- the anti-tumour vasculature moiety may be a cytotoxic moiety.
- the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide or a radioactive atom.
- cytotoxic moieties, as well as methods of making the conjugates comprising the antibody and the cytotoxic moiety are provided in earlier publications WO 02/36771 and WO 2004/046191 , incorporated herein by reference.
- the cytotoxic moiety may be directly or indirectly toxic to cells in neovasculature or cells which are in close proximity to and associated with neovasculature.
- directly cytotoxic we include the meaning that the moiety is one which on its own is cytotoxic.
- indirectly cytotoxic we include the meaning that the moiety is one which, although is not itself cytotoxic, can induce cytotoxicity, for example by its action on a further molecule or by further action on it.
- the cytotoxic moiety is a cytotoxic chemotherapeutic agent.
- Cytotoxic chemotherapeutic agents are well known in the art. Cytotoxic chemo- therapeutic agents, such as anticancer agents, include those listed herein.
- cytotoxic moieties such as cytotoxic chemotherapeutic agents, have previously been attached to antibodies and other targeting agents, and so compounds of the invention comprising these agents may readily be made by the person skilled in the art.
- carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151 -159) may be used to conjugate a variety of agents, including doxorubicin, to antibodies.
- cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety by which we include any moiety which leads to cell death.
- Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the like. Methods for linking them to targeting moieties such as antibodies are also known in the art.
- ricin as a cytotoxic agent is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci. USA 90, 8996-9000, and the use of tissue factor, which leads to localised blood clotting and infarction of a tumour, has been described by Ran et al (1998) Cancer Res. 58, 4646-4653 and Huang et al (1997) Science 275, 547-550.
- Tsai et al (1995) Dis. Colon Rectum 38, 1067-1074 describes the abrin A chain conjugated to a monoclonal antibody.
- Other ribosome inactivating proteins are described as cytotoxic agents in WO 96/06641 .
- Pseudomonas exotoxin may also be used as the cytotoxic polypeptide moiety (Aiello et al (1995) Proc. Natl. Acad. Sci. USA 92, 0457-10461 ).
- Certain cytokines, such as TNFa, INFy and IL-2 may also be useful as cytotoxic agents.
- Certain radioactive atoms may also be cytotoxic if delivered in sufficient doses.
- the cytotoxic moiety may comprise a radioactive atom which, in use, delivers a sufficient quantity of radioactivity to the target site so as to be cytotoxic.
- Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131 , indium-1 1 1 , rhenium-186, rhenium-188 or yttrium- 90, or any other isotope which emits enough energy to destroy neighbouring cells, organelles or nucleic acid.
- the isotopes and density of radioactive atoms in the compound of the invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000 cGy) is delivered to the target site and, preferably, to the cells at the target site and their organelles, particularly the nucleus.
- the radioactive atom may be attached to the antibody in known ways. For example EDTA or another chelating agent may be attached to the antibody and used to attach 11 In or 90 Y. Tyrosine residues may be labelled with 125 l or 131 1.
- the cytotoxic moiety may be a radiosensitizer.
- Radiosensitizers include fluoropyrimidines, thymidine analogues, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole, pimonidazole and misonidazole (see, for example, McGinn et al (1996) J. Natl. Cancer Inst. 88, 1 193-1 1203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol.
- the cytotoxic moiety may be a procoagulant factor, such as the extracellular domain of tissue factor (Rippmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen- specific coagulation-promoting molecule.” Biochem J. 349: 805-12; Huang er al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature.” Science. 275(5299): 547-550.
- the cytotoxic moiety may be an indirectly cytotoxic polypeptide.
- the indirectly cytotoxic polypeptide is a polypeptide which has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug.
- the targeting moiety is an antibody this type of system is often referred to as ADEPT (Antibody- Directed Enzyme Prodrug Therapy).
- ADEPT Antibody- Directed Enzyme Prodrug Therapy
- the system requires that the targeting moiety locates the enzymatic portion to the desired site in the body of the patient (e.g. the site of new vascular tissue associated with a tumour) and after allowing time for the enzyme to localise at the site, administering a prodrug which is a substrate for the enzyme, the end product of the catalysis being a cytotoxic compound.
- the object of the approach is to maximise the concentration of drug at the desired site and to minimise the concentration of drug in normal tissues (Senter et al (1988) "Anti-tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J. Cancer 56, 531 -2; and Bagshawe, et al (1988) "A cytotoxic agent can be generated selectively at cancer sites” Br. J. Cancer. 58, 700-703); Bagshawe (1995) Drug Dev. Res. 34, 220-230 and WO 2004/046191 , describe various enzyme/prodrug combinations which may be suitable in the context of this invention.
- the prodrug is relatively non-toxic compared to the cytotoxic drug. Typically, it has less than 10% of the toxicity, preferably less than 1 % of the toxicity as measured in a suitable in vitro cytotoxicity test.
- the further moiety may be one which becomes cytotoxic, or releases a cytotoxic moiety, upon irradiation.
- the boron-10 isotope when appropriately irradiated, releases particles which are cytotoxic (US 4,348,376; Primus et al (1996) Bioconjug. Chem. 7: 532- 535).
- the cytotoxic moiety may be one which is useful in photodynamic therapy such as photofrin (see, for example, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
- Preferences for the individual to be treated, the types of solid tumour, the routes of administration, the antibody, and so on, are as defined above with respect to the first aspect of the invention.
- Antibodies that selectively bind to the STEAP1 polypeptide, when attached to a detectable moiety may be useful in imaging, for example vascular imaging of tumours. Methods and compounds useful in vascular imaging of tumours are described in earlier publication WO 02/36771 , incorporated herein by reference.
- a compound comprising an anti-TEM antibody as defined above and a detectable moiety can be used, in combination with an appropriate detection method, to detect the location of the compound in the individual, and hence to identify the sites and extent of tumour angiogenesis in the individual.
- a further aspect of the invention provides a method of imaging tumour neovasculature in the body of an individual the method comprising administering to the individual a compound comprising (i) an antibody that selectively binds the TEM, such as PCDH7polypeptide and (ii) a detectable moiety, and imaging the detectable moiety in the body.
- the method may further comprise the step of detecting the location of the compound in the individual.
- the detectable moiety is one which, when located at the target site following administration of the compound of the invention into a patient, may be detected, typically non-invasively from outside the body, and the site of the target located.
- the compounds of this aspect of the invention are useful in imaging and diagnosis, especially in the imaging and diagnosis of neovasculature of solid tumours.
- the detectable moiety is or comprises a magnetic nano-particle, a radionuclide or a fluorophore.
- the detectable moiety may be a radioactive atom which is useful in imaging. Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies.
- MRI magnetic resonance imaging
- iodine-123 again, iodine-131 , indium-1 1 1 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
- a further aspect of the invention provides an ex vivo method of inhibiting tumour vasculature, the method comprising administering an inhibitor of a TEM, such as PCDH7to tissue or cells ex vivo.
- a TEM such as PCDH7to tissue or cells
- this ex vivo method of inhibiting tumour vasculature is carried out in the context of a tumour vasculature assay or in a model of tumour vasculature, such as those described below.
- the cells may be established tumour cell lines or tumour cells that have been removed from an individual.
- the tissue or cells are preferably mammalian tissue or cells, and most preferably are human tissue or cells.
- the tissue or cells comprise tumour endothelium, or are a model of tumour endothelium.
- tumour vasculature assays include assays for endothelial cell proliferation, migration and invasion, and include the BD BioCoat(TM) Angiogenesis System for Endothelial Cell Invasion which is available as Catalogue Nos. 354141 and 354142 from BD Biosciences, Bedford, MA, USA.
- Suitable models of tumour angiogenesis include assays for migration of tumour endothelial cells, including bFGF- and VEGF-induced migration, proliferation of tumour endothelial cells, and invasion of tumour endothelial cells and aortic ring assays.
- a further aspect of the invention provides a method of identifying an agent that may be useful in the treatment of tumour vasculature, or a lead compound for the identification of an agent that may be useful in the treatment of tumour vasculature, the method comprising: providing a candidate compound that binds the TEM, such as PCDH7 polypeptide, or a fragment thereof; and testing the candidate compound in a tumour vasculature assay, wherein a candidate compound that inhibits tumour vasculature in the assay may be an agent that is useful in the treatment/inhibition of tumour vasculature, or may be a lead compound for the identification of an agent that is useful in the treatment of tumour vasculature.
- the method further comprises the preceding step of determining whether the candidate compound selectively binds to the TEM polypeptide, or a fragment thereof.
- Suitable candidate agents include polypeptides, polynucleotides, antibodies, carbohydrates, aptamers, small molecules (typically less than 500 Daltons) and the like.
- Figure 1 A Ulex coated magnetic bead isolation achieved substantial endothelial enrichment and gave good quality RNA.
- Figure 2 PCA plot of microarray of 4 pairs of healthy and tumor lung endothelial isolates
- Quantitative real-time PCR validation of tumor vascular target candidates in endothelial cells isolated from healthy and tumor lung tissue Flotillin 2 was used as the house keeping gene to which the data was normalized.
- the double delta Ct method was used to compare expression levels in tumor relative to healthy endothelial isolates.
- RNA-seq data confirmed a panel of elevated angiogenesis associated genes, matrix-metalloprotease genes and lung cancer vascular target candidates identified through microarray analysis.
- Identified putative lung TEMs were validated by immunohistochemistry. Representative immunohistochemistry for lung vascular target candidates on healthy and tumor lung tissue.
- FIG. 7 Functional analysis of STEAP1 in endothelial cells
- Table 1 Clinical-pathological data of lung cancer patients used in the genomic analysis.
- RNA-seq gene pools generated a list comprising 122 genes with a transmembrane or a signal peptide.
- the listed genes were ranked in ascending order of P values generated through microarray data analysis. Materials and methods Ulex-bead isolation
- RNA extracted from Ulex-bead isolated samples was converted to cRNA, then subjected to amplification and labeling. Labeled cRNA samples were then hybridized to an Agilent 4 x 44k whole human gene expression microarray (Agilent, UK).
- the Bioconductor packages preprocess Core and Limma were used to subtract background and Quantile normalize probe signal intensities prior to performing differential gene expression analyses.
- Principal component analysis (PCA) was performed in R. RNA-seq
- Tophat output bam files were sorted using samtools (Version: 0.1 .8, (Li et al., 2009)), and 'HTSeq-count' version 0.4.7p4 (Anders, 2010) was used, in conjunction with the Human transcriptome GTF Refseq version 19, to assign gene counts and produce a tab delimited file of transcript/gene counts.
- Differential gene expression analysis and p-value generation on the count data was carried out using the R Bioconductor package DESeq v1 .5 (Anders and Huber, 2010).
- RNA extraction, complementary DNA preparation and quantitative real-time PCR were performed using LightCycler real time quantitative PCR (Roche, UK) following previously described methods (Armstrong et al., 2008). Primer sequences were provided in Table 6. The double delta Ct method was used to compare expression levels in tumor relative to healthy endothelial isolates.
- D1 sense: CUAUAUUCAGAGCAAGCUATT; antisense: UAGCUUGCUCUGAAUAUAGTG; D2: sense: GAAUAAGUGGAUAGAUAUATT; anti-sense: UAUAUCUAUCCACUUAUUCCA (Ambion, UK).
- the open area of the wound was quantified using a cell intelligence quotient analyzer or Image J software (Image J website, rsbweb.nih.gov).
- the effect of STEAP1 knockdown on Matrigel assays was analysed by Angiogenesis Analyzer for ImageJ. All images were acquired using a Leica DM IL microscope (Leica, Milton Keynes, UK) and USB 2.0 2M Xli camera (XL Imaging LLC, Carrollton, TX, USA).
- the tumor tissue was resected from the viable region of the tumor core and the patient matched healthy tissue resected > 10 cm away from the tumor core.
- Endothelial cells were positively isolated using magnetic beads coupled to Ulex lectin (workflow illustrated in Figure 1a).
- expression of the universal endothelial marker CD31 was examined by qPCR in the endothelial isolates and compared to that in the bulk tissue.
- a 15- fold enrichment of endothelium was achieved in the bead isolated samples when compared to whole tumor extracts.
- A4-fold enrichment was seen in endothelial cells isolated from healthy lung ( Figure 1 b).
- RNA integrity analysis of a typical RNA isolate is shown in Figure 1c. The data confirm that the Ulex-bead isolation approach can effectively isolate the endothelial population from lung. Microarray of endothelial isolates from lung cancer patients
- RNA-seq using deep sequencing technology provides an in-depth resolution of RNA snapshots by generating millions of reads that can be assembled and mapped to a known transcriptome, allowing the measurement of differential gene expression.
- RNA-seq has the advantage of querying novel transcripts and does not rely on prior knowledge and annotation.
- RNA-seq to verify the genes that had been identified through the microarray analysis.
- a lower yield of RNA was obtained from healthy lung tissue compared to that from tumor. This was possibly due to the endothelial cells in healthy lung tissue being in a quiescent state compared to the active endothelium in tumors.
- RNA-seq data was performed using the DESeq v1 .5 package (Anders and Huber, 2010). The analysis confirmed most of the unregulated angiogenesis associated genes, MMPs and putative targets identified through the microarray analysis (Figure 4). Analysis of the RNA- seq data alone generated a list of 477 genes with the same criterion used in the microarray analysis for target identification.
- RNA-seq gene pools comprises a list of 122 genes, which provides a rich source for target identification (Table 7). The discrepancy between the two analyses is likely due to cancer type (squamous vs. adeno) and individual patient variability.
- ROS1 and STEAP1 also showed positive expression on some tumor cells or macrophages and this may be beneficial for developing drugs targeting the tumor and its vasculature simultaneously. It is also worth mentioning that other target candidates should not be completely eliminated for further investigation simply due to the lack of antibody reactivity in immunochemistry. Expression of STEAP1 in lung cancer
- STEAP1 is differentially expressed in the endothelium within healthy and tumor lung tissue.
- an expression profiling was carried out on human lung cancer tissues by immunohistochemistry. 82 Patients were examined (Table 5). The intensity of the signal was classified as absent, low, medium or high. Representative images of STEAP1 staining in lung cancer are shown in Figure 6a. From the 82 cases examined, a clear overexpression of STEAP1 in tumor vessels was observed: for example 46% of the vessels highly expressed STEAP1 in lung cancer versus only 5% in matching healthy lung.
- ECSM2 an endothelial specific filamin a binding protein that mediates chemotaxis. Arterioscler Thromb Vase Biol, 28, 1640-6.
- DACHS G. U. & CHAPLIN, D. J. 1998. Microenvironmental control of gene expression: implications for tumor angiogenesis, progression, and metastasis. Semin Radiat Oncol, 8, 208-16. HERBERT, J. M., STEKEL, D., SANDERSON, S., HEATH, V. L. & BICKNELL, R. 2008. A novel method of differential gene expression analysis using multiple cDNA libraries applied to the identification of tumour endothelial genes. BMC Genomics, 9, 153.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates generally to genes and polypeptides which are differentially expressed in tumour vasculature, as compared to normal tissue vasculature, to the use of antibodies that bind these polypeptides for imaging and targeting tumour vasculature, and to the use of inhibitors of these tumour vasculature expressed genes/polypeptides for inhibiting vasculature, such as angiogenesis in solid tumours. In particular, the present invention relates to tumour endothelial markers (TEMs), to the use of antibodies that bind such TEMs for imaging and targeting tumour vasculature, and to the use of inhibitors of such TEMs for inhibiting vasculature such as angiogenesis in solid tumours. In a preferred embodiment the TEM is PCDH7.
Description
Vasculature Targeting
Field of the invention
The present invention relates generally to genes and polypeptides which are differentially expressed in tumour vasculature, as compared to normal tissue vasculature, to the use of antibodies that bind these polypeptides for imaging and targeting tumour vasculature, and to the use of inhibitors of these tumour vasculature expressed genes/polypeptides for inhibiting vasculature, such as angiogenesis in solid tumours. In particular, the present invention relates to tumour endothelial markers (TEMs), to the use of antibodies that bind such TEMs for imaging and targeting tumour vasculature, and to the use of inhibitors of such TEMs for inhibiting vasculature such as angiogenesis in solid tumours. In a preferred embodiment the TEM is PCDH7.
Background to the invention A functional vasculature contributes to tumour progression and malignant cell metastasis. Endothelial cells lining the tumour vasculature are exposed to molecular factors and mechanical forces that are absent in healthy tissue. For example, the vasculature in solid tumours is often in a hypoxic environment (Dachs and Chaplin, 1998) and is exposed to elevated levels of hypoxically induced angiogenic factors such as vascular endothelial growth factor (Relf et al., 1997). Tumour vessels may also be leaky, tortuous, sometimes blind ended and have poor vascular smooth muscle and pericyte coverage (Baluk et al., 2005). As a result, the tumour endothelial transcriptome is markedly different from that in healthy tissue and provides a unique source for cancer target identification. In the last decade, attempts to identify tumour endothelial marker's (TEM's) have included construction of SAGE libraries from freshly isolated endothelium (St Croix et al., 2000), use of microarray platforms (Ho et al., 2003), proteomic analysis of freshly isolated endothelial cell membranes (Oh et al., 2004, Ho et al., 2003) as well as bioinformatics data mining (Huminiecki and Bicknell, 2000, Herbert et al., 2008). These efforts identified several targets including the EDB domain of fibronectin, a series of numbered TEM's, annexin A and CLEC14A reviewed in Meyer, 2010 (Meyer, 2010). However, there is a requirement for further TEMs which may be of use as targets for inhibitors of tumour vasculature.
Summary of the Invention
The present invention relates to the identification of novel TEMs and uses/methods and products which may arise from this. Those which may find use in the present invention are identified in Table 4. However, for the sake of brevity further reference throughout this specification will be made to PCDH7, but this should not be construed as limiting in any way.
In a first aspect there is provided a binding agent, such as an inhibitor of PCDH7 for use in a method of inhibiting tumour vasculature.
In a further aspect there is provided a method of inhibiting tumour vaculature in an individual in need thereof comprising administering a cell binding agent, such as an inhibitor of PCDH7to the individual.
PCDH7 belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. The PCDH7 gene is found on the human chromosome 4 at position p15.1 . The PCDH7 entry is found in Genbank Accession No. AB006755 The cell binding agents of the present invention may be inhibitors themselves, or may simply facilitate the action of an inhibitor which may be associated, bound or conjugated to the cell-binding agent The term inhibitor in the context of the present invention is understood to relate to anti- angiogenic agents and/or vascular disrupting agents. Generally speaking, anti-angiogenic agents acts to interfere with new vessel formation, thereby preventing tumour growth and limiting metastatic potential, whereas vascular disrupting agents are directed against established tumour vasculature and may destroy tumours and/or halt their progression. It is to be appreciated that the present invention is generally, although not exclusively directed to the targeting and hence inhibition of tumour vasculature, rather than targeting the neoplastic cell population present in a tumour. Thus, the present invention is generally concerned with targeting the blood vessel network which provides nutrition to the tumour. If it is possible to reduce or remove the blood vessels which provide nutrition to a tumour, then it is expected that the tumour will become dormant or die.
The term inhibitor of TEM includes both inhibitors of the TEM polypeptide and of the TEM gene/cDNA. Suitable inhibitors of TEM include antibodies or antibody-drug conjugates that selectively bind to the TEM. Other suitable inhibitors of TEM include siRNA, antisense
polynucleotides, modified snoRNA molecules and ribozyme molecules that are specific for polynucleotides encoding the TEM polypeptide, and which prevent its expression.
The term "inhibiting" is understood to mean a reduction in the rate of development, or the level of tumour vasculature associated with a tumour. The reduction may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% 99%, or substantially all of the rate of development or level of tumour vasculature. Methods of determining such a reduction are well known to the skilled reader and include histological techniques, as well as other imaging techniques as described herein.
In a specific embodiment, the vasculature is associated with a solid tumour, such as a lung tumour.
The term "binding agent" as used herein refers to a compound that can bind the TEM (e.g., on the cell-surface) either in a specific or non-specific manner. In certain embodiments, binding to the TEM is specific. The-binding agent may be of any kind presently known, or that become known and includes peptides and non-peptides. It is to be appreciated that polypeptide inhibitors of the TEM may be administered directly, or may be administered in the form of a polynucleotide that encodes the polypeptide. Thus, as used herein, unless the context demands otherwise, by administering to the individual an inhibitor of TEM which is a polypeptide, we include the meanings of administering the polypeptide inhibitor directly, or administering a polynucleotide that encodes the inhibitor, typically in the form of a vector. Similarly, as used herein, unless the context demands otherwise, by a medicament or a composition comprising an inhibitor of a TEM which is a polypeptide, we include the meanings that the medicament or composition comprises the inhibitor itself, or comprises a polynucleotide that encodes the inhibitor.
Suitable antibodies which bind toa TEM such as PCDH7, or to specified portions thereof, such as extracellular portions, can be made by the skilled person using technology long- established in the art. Methods of preparation of monoclonal antibodies and antibody fragments are well known in the art and include hybridoma technology (Kohler & Milstein (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256: 495-497); antibody phage display (Winter et al (1994) "Making antibodies by phage display technology." Annu. Rev. Immunol. 12: 433-455); ribosome display (Schaffitzel et al (1999) "Ribosome display: an in vitro method for selection and evolution of antibodies from libraries." J. Immunol. Methods 231 : 1 19-135); and iterative colony filter screening (Giovannoni et al (2001 ) "Isolation of anti-angiogenesis antibodies from a large combinatorial repertoire by colony filter screening." Nucleic Acids Res. 29: E27). Further,
antibodies and antibody fragments suitable for use in the present invention are described, for example, in the following publications: "Monoclonal Hybridoma Antibodies: Techniques and Application", Hurrell (CRC Press, 1982); " Monoclonal Antibodies: A Manual of Techniques" , H. Zola, CRC Press, 1987, ISBN: 0-84936-476-0; "Antibodies: A Laboratory Manuar 1 <st> Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1988. ISBN 0- 87969-314-2; "Using Antibodies: A Laboratory Manuar 2<nd> Edition, Harlow & Lane, Eds, Cold Spring Harbor Laboratory Press, New York, 1999. ISBN 0-87969-543-9; and "Handbook of Therapeutic Antibodies" Stefan Dubel, Ed., 1 <st> Edition, - Wiley- VCH, Weinheim, 2007. ISBN: 3-527-31453-9. Antibodies that are especially active at inhibiting tumour angiogenesis are preferred for anticancer therapeutic agents, and they can be selected for this activity using methods well known in the art and described below.
In some embodiments, the antibody is a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, a chimeric antibody, a multispecific antibody, or an antibody fragment thereof. In some embodiments, the isolated antigen binding protein is a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a Fv fragment, a diabody, or a single chain antibody molecule. In some embodiments, the isolated antigen binding protein is a human antibody. In some embodiments, the isolated antigen binding protein is a monoclonal antibody. In some embodiments, the antibody is of the IgGI-, lgG2- lgG3- or lgG4-type. In some embodiments, the antibody is coupled to a labelling group.
An antibody that selectively binds the TEM, such as PCDHH7 polypeptide is intended to mean that the antibody molecule binds the TEM with a greater affinity than for an unrelated polypeptide, such as human serum albumin (HSA). In some embodiments, the antibody binds with a Kd that is smaller than 100 pM. In some embodiments, the antibody binds with a Kd that is smaller than 10 pM. In some embodiments, the antibody binds with a Kd that is less than 5 pM. Such binding may be determined by methods well known in the art, such as one of the Biacore® systems.
Antibodies may be produced by standard techniques, for example by immunisation with the TEM polypeptide or antigenic portion(s) thereof, or by using a phage display library. If polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc) is immunised with an immunogenic polypeptide bearing a desired epitope(s), optionally haptenised to another polypeptide. Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminium hydroxide, and surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the desired epitope contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are well known in the art.
A mouse anti-human PCDH7 monoclonal antibody is commercially available from, for example, Abeam (Catalogue ab139274), or Santa Cruz (Catalogue sc-517042)
Monoclonal antibodies directed against entire polypeptides or particular epitopes thereof can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody- producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein- Barr virus. Panels of monoclonal antibodies produced against the polypeptides listed above can be screened for various properties; i.e., for isotype and epitope affinity. Monoclonal antibodies may be prepared using any of the well-known techniques which provides for the production of antibody molecules by continuous cell lines in culture.
It is preferred if the antibody is a monoclonal antibody. In some circumstance, particularly if the antibody is to be administered repeatedly to a human patient, it is preferred if the monoclonal antibody is a human monoclonal antibody or a humanised monoclonal antibody, which are suitable for administration to humans without engendering an immune response by the human against the administered immunoglobulin. Suitably prepared non-human antibodies can be "humanised" in known ways, for example by inserting the CDR regions of mouse antibodies into the framework of human antibodies. Humanised antibodies can be made using the techniques and approaches described in Verhoeyen et al (1988) Science, 239, 1534-1536, and in Kettleborough et al, (1991 ) Protein Engineering, 14(7), 773-783. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non- human residues. In general, the humanised antibody will contain variable domains in which all or most of the CDR regions correspond to those of a non- human immunoglobulin, and framework regions which are substantially or completely those of a human immunoglobulin consensus sequence. Completely human antibodies may be produced using recombinant technologies. Typically large libraries comprising billions of different antibodies are used. In contrast to the previous technologies employing chimerisation or humanisation of e.g. murine antibodies this technology does not rely on immunisation of animals to generate the specific antibody. Instead the recombinant libraries
comprise a huge number of pre- made antibody variants wherein it is likely that the library will have at least one antibody specific for any antigen. Thus, using such libraries, an existing antibody having the desired binding characteristics can be identified. In order to find the good binder in a library in an efficient manner, various systems where phenotype i.e. the antibody or antibody fragment is linked to its genotype i.e. the encoding gene have been devised. The most commonly used such system is the so called phage display system where antibody fragments are expressed, displayed, as fusions with phage coat proteins on the surface of filamentous phage particles, while simultaneously carrying the genetic information encoding the displayed molecule (McCafferty et al, 1990, Nature 348: 552- 554). Phage displaying antibody fragments specific for a particular antigen may be selected through binding to the antigen in question. Isolated phage may then be amplified and the gene encoding the selected antibody variable domains may optionally be transferred to other antibody formats, such as e.g. full-length immunoglobulin, and expressed in high amounts using appropriate vectors and host cells well known in the art. Alternatively, the "human" antibodies can be made by immunising transgenic mice which contain, in essence, human immunoglobulin genes (Vaughan et al (1998) Nature Biotechnol. 16, 535-539).
It is appreciated that when the antibody is for administration to a non-human individual, the antibody may have been specifically designed/produced for the intended recipient species. The format of displayed antibody specificities on phage particles may differ. The most commonly used formats are Fab (Griffiths et al, 1994. EMBO J. 13: 3245-3260) and single chain (scFv) (Hoogenboom er a/, 1992, J Mol Biol. 227: 381 -388) both comprising the variable antigen binding domains of antibodies. The single chain format is composed of a variable heavy domain (VH) linked to a variable light domain (Vu) via a flexible linker (US 4,946,778). Before use as a therapeutic agent, the antibody may be transferred to a soluble format e.g. Fab or scFv and analysed as such. In later steps the antibody fragment identified to have desirable characteristics may be transferred into yet other formats such as full-length antibodies. WO 98/32845 and Soderlind et al (2000) Nature BioTechnol. 18: 852-856 describe technology for the generation of variability in antibody libraries. Antibody fragments derived from this library all have the same framework regions and only differ in their CDRs. Since the framework regions are of germline sequence the immunogenicity of antibodies derived from the library, or similar libraries produced using the same technology, are expected to be particularly low (Soderlind et al, 2000). This property is of great value for therapeutic antibodies, reducing the risk that the patient forms antibodies to the administered antibody, thereby reducing risks for allergic reactions, the occurrence of blocking antibodies, and allowing a long plasma half-life of the antibody. Thus, when developing therapeutic antibodies to be used in humans, modern recombinant library technology (Soderlind et al,
2001 , Comb. Chem. & High Throughput Screen. 4: 409-416) is now used in preference to the earlier hybridoma technology.
The term antibody also includes heavy-chain antibodies structurally derived from camelidae antibodies, such as Nanobodies® (Ablynx). These are antibody-derived therapeutic proteins that contain the structural and functional properties of naturally-occurring heavy- chain antibodies. The Nanobody® technology was developed following the discovery that camelidae (camels and llamas) possess fully functional antibodies that lack light chains. These heavy-chain antibodies contain a single variable domain (VHH) and two constant domains (CH2 and CH3). The cloned and isolated VHH domain is a perfectly stable polypeptide harbouring the full antigen-binding capacity of the original heavy-chain antibody. These VHH domains with their unique structural and functional properties form the basis of Nanobodies®. They combine the advantages of conventional antibodies (high target specificity, high target affinity and low inherent toxicity) with important features of small molecule drugs (the ability to inhibit enzymes and access receptor clefts). Furthermore, they are stable, have the potential to be administered by means other than injection, are easier to manufacture, and can be humanised. (See, for example US 5,840,526; US 5,874,541 ; US 6,005,079, US 6.765,087; EP 1 589 107; WO 97/34103; WO97/49805; US 5,800,988; US 5,874, 541 and US 6,015,695).
Small interfering RNAs are described by Hannon et al. Nature, 418 (6894): 244-51 (2002); Brummelkamp et al., Science 21 , 21 (2002); and Sui et al., Proc. Natl Acad. Sci. USA 99, 5515-5520 (2002). RNA interference (RNAi) is the process of sequence- specific post- transcriptional gene silencing in animals initiated by double-stranded (dsRNA) that is homologous in sequence to the silenced gene. The mediators of sequence-specific imRNA degradation are typically 21 - and 22-nucleotide small interfering RNAs (siRNAs) which, in vivo, may be generated by ribonuclease III cleavage from longer dsRNAs. 21 -nucleotide siRNA duplexes have been shown to specifically suppress expression of both endogenous and heterologous genes (Elbashir et al (2001 ) Nature 41 1 : 494-498). In mammalian cells it is considered that the siRNA has to be comprised of two complementary 21 mers as described below since longer double- stranded (ds) RNAs will activate PKR (dsRNA-dependent protein kinase) and inhibit overall protein synthesis.
Duplex siRNA molecules , such as shRNA molecules selective for a polynucleotide encoding the TEM polypeptide can readily be designed by reference to its cDNA sequence. Typically, the first 21 -mer sequence that begins with an AA dinucleotide which is at least 120 nucleotides downstream from the initiator methionine codon is selected. The RNA sequence perfectly complementary to this becomes the first RNA oligonucleotide. The second RNA
sequence should be perfectly complementary to the first 19 residues of the first, with an additional UU dinucleotide at its 3' end. Once designed, the synthetic RNA molecules can be synthesised using methods well known in the art. siRNAs may be introduced into cells in the patient using any suitable method, such as those described herein. Typically, the RNA is protected from the extracellular environment, for example by being contained within a suitable carrier or vehicle. Liposome-mediated transfer, e.g. the oligofectamine method, may be used. siRNA molecules against PCDH7 are available from Santa Cruz (Catalogue No. sc-88977)
Antisense nucleic acid molecules selective for a polynucleotide encoding the STEAP1 polypeptide can readily be designed by reference to its cDNA or gene sequence, as is known in the art. Antisense nucleic acids, such as oligonucleotides, are single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence. By binding to the appropriate target sequence, an RNA-RNA, a DNA-DNA, or RNA-DNA duplex is formed. These nucleic acids are often termed "antisense" because they are complementary to the sense or coding strand of the gene. Recently, formation of a triple helix has proven possible where the oligonucleotide is bound to a DNA duplex. It was found that oligonucleotides could recognise sequences in the major groove of the DNA double helix. A triple helix was formed thereby. This suggests that it is possible to synthesise a sequence-specific molecules which specifically bind double-stranded DNA via recognition of major groove hydrogen binding sites. By binding to the target nucleic acid, the above oligonucleotides can inhibit the function of the target nucleic acid. This could, for example, be a result of blocking the transcription, processing, poly(A) addition, replication, translation, or promoting inhibitory mechanisms of the cells, such as promoting RNA degradations.
Antisense oligonucleotides are prepared in the laboratory and then introduced into cells, for example by microinjection or uptake from the cell culture medium into the cells, or they are expressed in cells after transfection with plasm ids or retroviruses or other vectors carrying an antisense gene. Antisense oligonucleotides were first discovered to inhibit viral replication or expression in cell culture for Rous sarcoma virus, vesicular stomatitis virus, herpes simplex virus type 1 , simian virus and influenza virus. Since then, inhibition of imRNA translation by antisense oligonucleotides has been studied extensively in cell-free systems including rabbit reticulocyte lysates and wheat germ extracts. Inhibition of viral function by antisense oligonucleotides has been demonstrated ex vivo using oligonucleotides which were complementary to the AIDS HIV retrovirus RNA (Goodchild, J. 1988 "Inhibition of Human Immunodeficiency Virus Replication by Antisense Oligodeoxynucleotides", Proc. Natl. Acad. Sci. (USA) 85(15): 5507-1 1 ). The Goodchild study showed that oligonucleotides
that were most effective were complementary to the poly(A) signal; also effective were those targeted at the 5' end of the RNA, particularly the cap and 5N untranslated region, next to the primer binding site and at the primer binding site. The cap, 5' untranslated region, and poly(A) signal lie within the sequence repeated at the ends of retrovirus RNA (R region) and the oligonucleotides complementary to these may bind twice to the RNA.
Typically, antisense oligonucleotides are 15 to 35 bases in length. For example, 20-mer oligonucleotides have been shown to inhibit the expression of the epidermal growth factor receptor mRNA (Witters et al., Breast Cancer Res Treat 53:41 -50 (1999)) and 25- mer oligonucleotides have been shown to decrease the expression of adrenocorticotropic hormone by greater than 90% (Frankel et al., J Neurosurg 91 :261 -7 (1999)). However, it is appreciated that it may be desirable to use oligonucleotides with lengths outside this range, for example 10, 1 1 , 12, 13, or 14 bases, or 36, 37, 38, 39 or 40 bases.
Antisense polynucleotides may be administered systemically. Alternatively, and preferably, the inherent binding specificity of polynucleotides characteristic of base pairing is enhanced by limiting the availability of the polynucleotide to its intended locus in vivo, permitting lower dosages to be used and minimising systemic effects. Thus, polynucleotides may be applied locally to the tumour vasculature to achieve the desired effect. The concentration of the polynucleotides at the desired locus is much higher than if the polynucleotides were administered systemically, and the therapeutic effect can be achieved using a significantly lower total amount. The local high concentration of polynucleotides enhances penetration of the targeted cells and effectively blocks translation of the target nucleic acid sequences. It will be appreciated that antisense agents may also include larger molecules which bind to polynucleotides (mRNA or genes) encoding the TEM polypeptide and substantially prevent expression of the protein. Thus, antisense molecules which are substantially complementary to the respective mRNA are also envisaged. The molecules may be expressed from any suitable genetic construct and delivered to the patient. Typically, the genetic construct which expresses the antisense molecule comprises at least a portion of the TEM cDNA or gene operatively linked to a promoter which can express the antisense molecule in the cell. Preferably, the genetic construct is adapted for delivery to a human cell. Modified snoRNA molecules are described in WO2009/037490, to which the skilled reader is directed and may comprise a portion of nucleic acid designed to specifically hybridise to TEMRNA and inhibit its expression.
Ribozymes are RNA or RNA-protein complexes that cleave nucleic acids in a site- specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity. For example, a large number of ribozymes accelerate phosphoester transfer reactions with a
high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate. This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction. Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids. For example, US 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of gene expression may be particularly suited to therapeutic applications, and ribozymes specific for a polynucleotide encoding the TEM polypeptide may be designed by reference to the TEM cDNA sequence.
Methods and routes of administering polynucleotide inhibitors, such as siRNA molecules, antisense molecules, modified snoRNA molecules and ribozymes, to a patient, are described in more detail below. Further agents that inhibit transcription of the genes encoding any of the above listed polypeptides can also be designed, for example using an engineered transcription repressor described in Isalan et al {Nat Biotechnol, 19(7): 656-60 (2001 )) and in Urnov (Biochem Pharmacol, 64 (5-6): 919 (2002)). Additionally, they can be selected, for example using the screening methods described in later aspects of the invention. Preferably, the methods and medicaments of the invention are used to treat humans, in which case the inhibitor of the TEM is an inhibitor of human TEM. It is appreciated, however, that when the methods and medicaments of the invention are for treatment of non-human mammals, it is preferred if the inhibitor is specific for the TEM gene/polypeptide from the other species. It is appreciated that the inhibitor of TEM will typically be formulated for administration to an individual as a pharmaceutical composition, i.e. together with a pharmaceutically acceptable carrier, diluent or excipient.
The compounds of the invention may also be administered in conjunction with a further chemotherapeutic therapy, or a non-chemotherapeutic treatments such as radiotherapy, photodynamic therapy, gene therapy; surgery and controlled diets.
In a further aspect there is provided an immunogenic formulation, such as in the form of a vaccine, comprising a TEM, such as PCDH7or an immunogenic fragment thereof, such as an extracellular portion thereof for use in a method of preventing the development of tumour vasculature.
In one embodiment, the vaccine/immunogenic formulation may be administered prior to or after the detection of a tumour.
The vaccine/immunogenic formulation may induce a cellular or humoral immune reaction against the TEM polypeptide or fragment thereof. Preferably, both humoral and cellular immune reactions are induced.
The present invention extends to nucleotide vaccines in which case a nucleotide which encodes a TEM or immunogenic fragment thereof, may be administered to a subject, as is well known in the art
The vaccine/immunogenic formulation may be administered to a subject to be treated, one or more, such as two or three, times. For use according to the present invention, the compounds or physiologically acceptable salt, solvate, ester or other physiologically functional derivative thereof described herein may be presented as a pharmaceutical formulation, comprising the compound or physiologically acceptable salt, ester or other physiologically functional derivative thereof, together with one or more pharmaceutically acceptable carriers therefore and optionally other therapeutic and/or prophylactic ingredients. The carrier(s) must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof.
Pharmaceutical formulations include those suitable for oral, topical (including dermal, buccal and sublingual), rectal or parenteral (including subcutaneous, intradermal, intramuscular and intravenous), nasal and pulmonary administration e.g., by inhalation. The formulation may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing into association an active compound with liquid carriers or finely divided solid carriers or both and then, if necessary, shaping the product into the desired formulation.
Pharmaceutical formulations suitable for oral administration wherein the carrier is a solid are most preferably presented as unit dose formulations such as boluses, capsules or tablets each containing a predetermined amount of active compound. A tablet may be made by compression or moulding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine an active compound in a
free-flowing form such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, lubricating agent, surface-active agent or dispersing agent. Moulded tablets may be made by moulding an active compound with an inert liquid diluent. Tablets may be optionally coated and, if uncoated, may optionally be scored. Capsules may be prepared by filling an active compound, either alone or in admixture with one or more accessory ingredients, into the capsule shells and then sealing them in the usual manner. Cachets are analogous to capsules wherein an active compound together with any accessory ingredient(s) is sealed in a rice paper envelope. An active compound may also be formulated as dispersible granules, which may for example be suspended in water before administration, or sprinkled on food. The granules may be packaged, e.g., in a sachet. Formulations suitable for oral administration wherein the carrier is a liquid may be presented as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water liquid emulsion. Formulations for oral administration include controlled release dosage forms, e.g., tablets wherein an active compound is formulated in an appropriate release - controlling matrix, or is coated with a suitable release - controlling film. Such formulations may be particularly convenient for prophylactic use. Pharmaceutical formulations suitable for rectal administration wherein the carrier is a solid are most preferably presented as unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by admixture of an active compound with the softened or melted carrier(s) followed by chilling and shaping in moulds.
Pharmaceutical formulations suitable for parenteral administration include sterile solutions or suspensions of an active compound in aqueous or oleaginous vehicles.
Injectable preparations may be adapted for bolus injection or continuous infusion. Such preparations are conveniently presented in unit dose or multi-dose containers which are sealed after introduction of the formulation until required for use. Alternatively, an active compound may be in powder form which is constituted with a suitable vehicle, such as sterile, pyrogen-free water, before use. An active compound may also be formulated as long-acting depot preparations, which may be administered by intramuscular injection or by implantation, e.g., subcutaneously or intramuscularly. Depot preparations may include, for example, suitable polymeric or
hydrophobic materials, or ion-exchange resins. Such long-acting formulations are particularly convenient for prophylactic use.
Formulations suitable for pulmonary administration via the buccal cavity are presented such that particles containing an active compound and desirably having a diameter in the range of 0.5 to 7 microns are delivered in the bronchial tree of the recipient.
As one possibility such formulations are in the form of finely comminuted powders which may conveniently be presented either in a pierceable capsule, suitably of, for example, gelatin, for use in an inhalation device, or alternatively as a self-propelling formulation comprising an active compound, a suitable liquid or gaseous propellant and optionally other ingredients such as a surfactant and/or a solid diluent. Suitable liquid propellants include propane and the chlorofluorocarbons, and suitable gaseous propellants include carbon dioxide. Self-propelling formulations may also be employed wherein an active compound is dispensed in the form of droplets of solution or suspension.
Such self-propelling formulations are analogous to those known in the art and may be prepared by established procedures. Suitably they are presented in a container provided with either a manually-operable or automatically functioning valve having the desired spray characteristics; advantageously the valve is of a metered type delivering a fixed volume, for example, 25 to 100 microlitres, upon each operation thereof.
As a further possibility an active compound may be in the form of a solution or suspension for use in an atomizer or nebuliser whereby an accelerated airstream or ultrasonic agitation is employed to produce a fine droplet mist for inhalation.
Formulations suitable for nasal administration include preparations generally similar to those described above for pulmonary administration. When dispensed such formulations should desirably have a particle diameter in the range 10 to 200 microns to enable retention in the nasal cavity; this may be achieved by, as appropriate, use of a powder of a suitable particle size or choice of an appropriate valve. Other suitable formulations include coarse powders having a particle diameter in the range 20 to 500 microns, for administration by rapid inhalation through the nasal passage from a container held close up to the nose, and nasal drops comprising 0.2 to 5% w/v of an active compound in aqueous or oily solution or suspension.
It should be understood that in addition to the aforementioned carrier ingredients the pharmaceutical formulations described above may include, an appropriate one or more additional carrier ingredients such as diluents, buffers, flavouring agents, binders, surface active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like, and substances included for the purpose of rendering the formulation isotonic with the blood of the intended recipient.
Pharmaceutically acceptable carriers are well known to those skilled in the art and include, but are not limited to, 0.1 M and preferably 0.05 M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents, inert gases and the like.
Formulations suitable for topical formulation may be provided for example as gels, creams or ointments. Such preparations may be applied e.g. to a wound or ulcer either directly spread upon the surface of the wound or ulcer or carried on a suitable support such as a bandage, gauze, mesh or the like which may be applied to and over the area to be treated.
Liquid or powder formulations may also be provided which can be sprayed or sprinkled directly onto the site to be treated, e.g. a wound or ulcer. Alternatively, a carrier such as a bandage, gauze, mesh or the like can be sprayed or sprinkle with the formulation and then applied to the site to be treated.
Therapeutic formulations for veterinary use may conveniently be in either powder or liquid concentrate form. In accordance with standard veterinary formulation practice, conventional water soluble excipients, such as lactose or sucrose, may be incorporated in the powders to improve their physical properties. Thus particularly suitable powders of this invention comprise 50 to 100% w/w and preferably 60 to 80% w/w of the active ingredient(s) and 0 to 50% w/w and preferably 20 to 40% w/w of conventional veterinary excipients. These powders may either be added to animal feedstuffs, for example by way of an intermediate premix, or diluted in animal drinking water.
Liquid concentrates of this invention suitably contain the compound or a derivative or salt thereof and may optionally include a veterinarily acceptable water-miscible solvent, for example polyethylene glycol, propylene glycol, glycerol, glycerol formal or such a solvent mixed with up to 30% v/v of ethanol. The liquid concentrates may be administered to the drinking water of animals.
The antibody can be administered by a surgically implanted device that releases the drug directly to the required site, for example, into the eye to treat ocular tumours. Such direct application to the site of disease achieves effective therapy without significant systemic side- effects.
An alternative method for delivery of polypeptide inhibitors, such as antibodies, is the ReGel injectable system that is thermo-sensitive. Below body temperature, ReGel is an injectable liquid while at body temperature it immediately forms a gel reservoir that slowly erodes and dissolves into known, safe, biodegradable polymers. The active drug is delivered over time as the biopolymers dissolve. Polypeptide pharmaceuticals such as antibodies can also be delivered orally. The process employs a natural process for oral uptake of vitamin B12 in the body to co-deliver proteins and peptides. By riding the vitamin B 2 uptake system, the protein or peptide can move through the intestinal wall. Complexes are synthesised between vitamin B12 analogues and the drug that retain both significant affinity for intrinsic factor (IF) in the vitamin B12 portion of the complex and significant bioactivity of the drug portion of the complex.
Polynucleotides may be administered by any effective method, for example, parenterally (e.g. intravenously, subcutaneously, intramuscularly) or by oral, nasal or other means which permit the polynucleotides to access and circulate in the patient's bloodstream. Polynucleotides administered systemically preferably are given in addition to locally administered polynucleotides, but also have utility in the absence of local administration. A dosage in the range of from about 0.1 to about 10 grams per administration to an adult human generally will be effective for this purpose.
The polynucleotide may be administered as a suitable genetic construct.. Typically, the polynucleotide in the genetic construct is operatively linked to a promoter which can express the compound in the cell. The genetic constructs of the invention can be prepared using methods well known in the art, for example in Sambrook et al (2001 ). Although genetic constructs for delivery of polynucleotides can be DNA or RNA, it is preferred if they are DNA.
Preferably, the genetic construct is adapted for delivery to a human or animal cell. Means and methods of introducing a genetic construct into a cell in an animal body are known in the art. For example, the constructs of the invention may be introduced into cells by any convenient method, for example methods involving retroviruses, so that the construct is inserted into the genome of the cell. For example, in Kuriyama et al (1991 , Cell Struc. and Func. 16, 503-510) purified retroviruses are administered. Retroviral DNA constructs comprising a polynucleotide as described above may be made using methods well known in the art. To produce active retrovirus from such a construct it is usual to use an ecotropic psi2 packaging cell line grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% foetal calf serum (FCS). Transfection of the cell line is conveniently by calcium phosphate co-precipitation, and stable transformants are selected by addition of G418 to a final concentration of 1 mg/ml (assuming the retroviral construct contains a neo® gene). Independent colonies are isolated and expanded and the culture supernatant removed, filtered through a 0.45 pm pore-size filter and stored at -70C. For the introduction of the retrovirus into tumour cells, for example, it is convenient to inject directly retroviral supernatant to which 10 pg/ml Polybrene has been added. For tumours exceeding 10 mm in diameter it is appropriate to inject between 0.1 ml and 1 ml of retroviral supernatant; preferably 0.5 ml. Alternatively, as described in Culver et al (1992, Science 256, 1550-1552), cells which produce retroviruses may be injected. The retrovirus-producing cells so introduced are engineered to actively produce retroviral vector particles so that continuous productions of the vector occurred within the tumour mass in situ.
Targeted retroviruses are also available for use in the invention; for example, sequences conferring specific binding affinities may be engineered into pre-existing viral env genes (see Miller & Vile (1995) Faseb J. 9, 190-199, for a review of this and other targeted vectors for gene therapy).
Other methods involve simple delivery of the construct into the cell for expression therein either for a limited time or, following integration into the genome, for a longer time. An example of the latter approach includes liposomes (Nassander et al (1992) Cancer Res. 52, 646-653).
Other methods of delivery include adenoviruses carrying external DNA via an antibody- polylysine bridge (see Curiel (1993) Prog. Med. Virol. 40, 1 -18) and transferrin-polycation conjugates as carriers (Wagner ef al (1990) Proc. Natl. Acad. Sci. USA 87, 3410-3414). In the first of these methods a polycation-antibody complex is formed with the DNA construct or other genetic construct of the invention, wherein the antibody is specific for either wild-type adenovirus or a variant adenovirus in which a new epitope has been introduced which binds the antibody. The polycation moiety binds the DNA via electrostatic interactions with the phosphate backbone. The adenovirus, because it contains unaltered fibre and penton proteins, is internalised into the cell and carries into the cell with it the DNA construct of the invention. It is preferred if the polycation is polylysine.
In an alternative method, a high-efficiency nucleic acid delivery system that uses receptor- mediated endocytosis to carry DNA macromolecules into cells is employed. This is accomplished by conjugating the iron-transport protein transferrin to polycations that bind nucleic acids. Human transferrin, or the chicken homologue conalbumin, or combinations thereof is covalently linked to the small DNA-binding protein protamine or to polylysines of various sizes through a disulphide linkage. These modified transferrin molecules maintain their ability to bind their cognate receptor and to mediate efficient iron transport into the cell. The transferrin-polycation molecules form electrophoretically stable complexes with DNA constructs or other genetic constructs of the invention independent of nucleic acid size (from short oligonucleotides to DNA of 21 kilobase pairs). When complexes of transferrin- polycation and the DNA constructs or other genetic constructs of the invention are supplied to the tumour cells, a high level of expression from the construct in the cells is expected. High-efficiency receptor-mediated delivery of the DNA constructs or other genetic constructs of the invention using the endosome-disruption activity of defective or chemically inactivated adenovirus particles produced by the methods of Cotten ef al (1992) Proc. Natl. Acad. Sci. USA 89, 6094-6098 may also be used. This approach appears to rely on the fact that adenoviruses are adapted to allow release of their DNA from an endosome without passage through the lysosome, and in the presence of, for example transferrin linked to the DNA construct or other genetic construct of the invention, the construct is taken up by the cell by the same route as the adenovirus particle. This approach has the advantages that there is no need to use complex retroviral constructs; there is no permanent modification of the genome as occurs with retroviral infection; and the targeted expression system is coupled with a targeted delivery system, thus reducing toxicity to other cell types.
It will be appreciated that "naked DNA" and DNA complexed with cationic and neutral lipids may also be useful in introducing the DNA of the invention into cells of the individual to be treated. Non-viral approaches to gene therapy are described in Ledley (1995, Human Gene Therapy 6, 1 129-1 144).
Although for solid tumours of specific tissues it may be useful to use tissue-specific promoters in the vectors encoding a polynucleotide inhibitor, this is not essential. This is because the targeted genes are only expressed, or selectively expressed, in the tumour endothelium. Accordingly, expression of TEM, such as PCDH7-specific inhibitors such as siRNA, antisense molecules, modified snoRNA and ribozymes in the body at locations other than the solid tumour would be expected to have little or no effect since the TEMs of the invention, such as PCDH7 are not expressed or are expressed at a comparatively low level. Moreover, the risk of inappropriate expression of these inhibitors, in a cell that may express the target polypeptide at a low level, is miniscule compared to the therapeutic benefit to a patient suffering from a solid tumour.
Targeted delivery systems are also known, such as the modified adenovirus system described in WO 94/10323, wherein, typically, the DNA is carried within the adenovirus, or adenovirus-like, particle. Michael ef al (1995) Gene Therapy 2: 660-668, describes modification of adenovirus to add a cell-selective moiety into a fibre protein. Mutant adenoviruses which replicate selectively in p53-deficient human tumour cells, such as those described in Bischoff er a/ (1996) Science 274: 373-376 are also useful for delivering genetic constructs to a cell. Other suitable viruses, viral vectors or virus-like particles include lentivirus and lentiviral vectors, HSV, adeno-assisted virus (AAV) and AAV-based vectors, vaccinia and parvovirus.
In one embodiment, therapeutic agents including vectors can be distributed throughout a wide region of the CNS by injection into the cerebrospinal fluid, e.g., by lumbar puncture (See e.g., Kapadia et al (1996) Neurosurg 10: 585-587). Alternatively, precise delivery of the therapeutic agent into specific sites of the brain can be conducted using stereotactic microinjection techniques. In another embodiment, the therapeutic agent is delivered using other delivery methods suitable for localised delivery, such as localised permeation of the blood-brain barrier. US 2005/0025746 describes delivery systems for localised delivery of an adeno-associated virus vector (AAV) vector encoding a therapeutic agent to a specific region of the brain. When a therapeutic agent for the treatment of a solid tumour of, for example, the brain, is encoded by a polynucleotide, it may be preferable for its expression to be under
the control of a suitable tissue-specific promoter. Central nervous system (CNS) specific promoters such as, neuron-specific promoters (e.g., the neurofilament promoter (Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86: 5473-5477) and glial specific promoters (Morii et al (1991 ) Biochem. Biophys Res. Commun. 175: 185-191 ) are preferably used for directing expression of a polynucleotide preferentially in cells of the CNS. Preferably, the promoter is tissue specific and is essentially not active outside the central nervous system, or the activity of the promoter is higher in the central nervous system than in other cells or tissues Suitable neuronal specific promoters include, but are not limited to, neuron specific enolase (NSE; Olivia et al (1991 ) Genomics 10: 157-165); GenBank Accession No: X51956), and human neurofilament light chain promoter (NEFL; Rogaev er al (1992) Hum. Mol. Genet. 1 : 781 ); GenBank Accession No: L04147). Glial specific promoters include, but are not limited to, glial fibrillary acidic protein (GFAP) promoter (Morii er al (1991 ); GenBank Accession No: M65210), S100 promoter (Morii et al (1991 ); GenBank Accession No: M65210) and glutamine synthase promoter (Van den ef al (1991 ) Biochem. Biophys. Acta. 2: 249-251 ); GenBank Accession No: X59834). In a preferred embodiment, the gene is flanked upstream (i.e., 5') by the neuron specific enolase (NSE) promoter. In another preferred embodiment, the gene of interest is flanked upstream (i.e., 5') by the elongation factor 1 alpha (EF) promoter. A hippocampus specific promoter that might be used is the hippocampus specific glucocorticoid receptor (GR) gene promoter. Alternatively, for treatment of solid tumours of the heart, Svensson et al (1999) describes the delivery of recombinant genes to cardiomyocytes by intramyocardial injection or intracoronary infusion of cardiotropic vectors, such as recombinant adeno-associated virus vectors, resulting in transgene expression in murine cardiomyocytes in vivo (Svensson et al (1999) "Efficient and stable transduction of cardiomyocytes after intramyocardial injection or intracoronary perfusion with recombinant adeno-associated virus vectors." Circulation. 99: 201 -5). elo et al review gene and cell-based therapies for heart disease Melo er al (2004) "Gene and cell- based therapies for heart disease." FASEB J. 18(6): 648-63). An alternative preferred route of administration is via a catheter or stent. Stents represent an attractive alternative for localized gene delivery, as they provide a platform for prolonged gene elution and efficient transduction of opposed arterial walls. This gene delivery strategy has the potential to decrease the systemic spread of the viral vectors and hence a reduced host immune response. Both synthetic and naturally occurring stent coatings have shown potential to allow prolonged gene elution with no significant adverse reaction (Sharif ef al (2004) "Current status of catheter- and stent-based gene therapy." Cardiovasc Res. 64(2): 208-16).
It may be desirable in some embodiments to be able to temporally regulate expression of the
polynucleotide inhibitor in the cell, although this is not essential for the reasons given above. Thus the polynucleotide may be operatively linked to a regulatable promoter. Examples of regulatable promoters include those referred to in the following papers: Rivera et al (1999) Proc Natl Acad Sci USA 96(15), 8657-62 (control by rapamycin, an orally bioavailable drug, using two separate adenovirus or adeno- associated virus (AAV) vectors, one encoding an inducible human growth hormone (hGH) target gene, and the other a bipartite rapamycin- regulated transcription factor); Magari er al (1997) J Clin Invest 100(1 1 ), 2865-72 (control by rapamycin); Bueler (1999) Biol Chem 380(6), 613-22 (review of adeno-associated viral vectors); Bohl et al (1998) Blood 92(5), 1512-7 (control by doxycycline in adeno-associated vector); Abruzzese et al (1996) J Mol Med 74(7), 379-92 (review of induction factors, e.g.. hormones, growth factors, cytokines, cytostatics, irradiation, heat shock and associated responsive elements).
For veterinary use, the inhibitor is typically administered as a suitably acceptable formulation in accordance with normal veterinary practice and the veterinary surgeon will determine the dosing regimen and route of administration which will be most appropriate for a particular animal.
It is to be appreciated that although the inhibitors of TEMs described above may be clinically effective in the absence of any other anti-cancer compound, it may be advantageous to administer these inhibitors in conjunction with a further anticancer agent. Accordingly, in an embodiment, the method may also comprising administering to the individual at least one further anticancer agent. The method may comprise administering to the individual a pharmaceutical composition containing the inhibitor of a TEM, such as PCDH7and the further anticancer agent. However, it is appreciated that the inhibitor of the TEM and the further anticancer agent may be administered separately, for instance by separate routes of administration. Thus it is appreciated that the inhibitor of the TEM and the at least one further anticancer agent can be administered sequentially or (substantially) simultaneously. They may be administered within the same pharmaceutical formulation or medicament or they may be formulated and administered separately. In a further embodiment, the further anticancer agent may be directed to target neoplastic cells rather than the tumour vasculature. In another embodiment the further anticancer agent may also be directed to target the tumour vasculature rather than the neoplastic cells of the tumour.
In an embodiment of the medical uses, the medicament containing the inhibitor of a TEM, such as PCDH7may also comprise at least one further anticancer agent. In another
embodiment of the medical uses, the individual to be treated may be one who is administered at least one further anticancer agent. It is appreciated that the individual may be administered the further anticancer agent at the same time as the medicament containing the inhibitor of the TEM, although the individual may have been (or will be) administered the further anticancer agent before (or after) receiving the medicament containing the inhibitor of the TEM.
The further anticancer agent may be selected from alkylating agents including nitrogen mustards such as mechlorethamine (HN2), cyclophosphamide, ifosfamide, melphalan (L- sarcolysin) and chlorambucil; ethylenimines and methylmelamines such as hexamethylmelamine, thiotepa; alkyl sulphonates such as busulphan; nitrosoureas such as carmustine (BCNU), lomustine (CCNU), semustine (methyl-CCNU) and streptozocin (streptozotocin); and triazenes such as decarbazine (DTIC; dimethyltriazenoimidazole- carboxamide); antimetabolites including folic acid analogues such as methotrexate (amethopterin); pyrimidine analogues such as fluorouracil (5-fluorouracil; 5-FU), floxuridine (fluorodeoxyuridine; FUdR) and cytarabine (cytosine arabinoside); and purine analogues and related inhibitors such as mercaptopurine (6-mercaptopurine; 6-MP), thioguanine (6- thioguanine; TG) and pentostatin (2'-deoxycoformycin); natural products including vinca alkaloids such as vinblastine (VLB) and vincristine; epipodophyllotoxins such as etoposide and teniposide; antibiotics such as dactinomycin (actinomycin D), daunorubicin (daunomycin; rubidomycin), doxorubicin, bleomycin, plicamycin (mithramycin) and mitomycin (mitomycin C); enzymes such as L-asparaginase; and biological response modifiers such as interferon alphenomes; miscellaneous agents including platinum coordination complexes such as cisplatin (c/s-DDP) and carboplatin; anthracenedione such as mitoxantrone and anthracycline; substituted urea such as hydroxyurea; methyl hydrazine derivative such as procarbazine (N-methylhydrazine, MIH); and adrenocortical suppressant such as mitotane ([omicron],[rho]'-DDD) and aminoglutethimide; taxol and analogues/derivatives; cell cycle inhibitors; proteosome inhibitors such as Bortezomib (Velcade®); signal transductase (e.g. tyrosine kinase) inhibitors such as Imatinib (Glivec®), COX-2 inhibitors, and hormone agonists/antagonists such as flutamide and tamoxifen.
The clinically used anticancer agents are typically grouped by mechanism of action: Alkylating agents, Topoisomerase I inhibitors, Topoisomerase II inhibitors, RNA/DNA antimetabolites, DNA antimetabolites and Antimitotic agents. The US NIH/National Cancer Institute website lists 122 compounds (http://dtp.nci.nih.gov/docs/cancer/
searches/standard_mechanism.html), all of which may be used in conjunction with an inhibitor of STEAP1 . They include Alkylating agents including Asaley, A2Q, BCNU, Busulfan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, c/s-platinum, clomesone, cyanomorpholino-doxorubicin, cyclodisone, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, teroxirone, tetraplatin, picoplatin (SP-4-3) (cis- aminedichloro(2- methylpyridine)Pt(ll)), thio-tepa, triethylenemelamine, uracil nitrogen mustard, Yoshi-864; anitmitotic agents including allocolchicine, Halichondrin B, colchicine, colchicine derivative, dolastatin 10, maytansine, rhizoxin, taxol, taxol derivative, thiocolchicine, trityl cysteine, vinblastine sulphate, vincristine sulphate; Topoisomerase I Inhibitors including camptothecin, camptothecin, Na salt, aminocamptothecin, 20 camptothecin derivatives, morpholinodoxorubicin; Topoisomerase II Inhibitors including doxorubicin, amonafide, m- AMSA, anthrapyrazole derivative, pyrazoloacridine, bisantrene HCL, daunorubicin, deoxydoxorubicin, mitoxantrone, menogaril, [Nu],[Nu]-dibenzyl daunomycin, oxanthrazole, rubidazone, VM-26, VP-16; RNA/DNA antimetabolites including L-alanosine, 5-azacytidine, 5-fluorouracil, acivicin, 3 aminopterin derivatives, an antifol, Baker's soluble antifol, dichlorallyl lawsone, brequinar, ftorafur (pro-drug), 5,6-dihydro-5-azacytidine, methotrexate, methotrexate derivative, N-(phosphonoacetyl)-L-aspartate (PALA), pyrazofurin, trimetrexate; DNA antimetabolites including, 3-HP, 2'-deoxy-5-fluorouridine, 5-HP, alpha-TGDR, aphidicolin glycinate, ara-C, 5-aza-2'-deoxycytidine, beta-TGDR, cyclocytidine, guanazole, hydroxyurea, inosine glycodialdehyde, macbecin II, pyrazoloimidazole, thioguanine and thiopurine. It is, however, preferred that the at least one further anticancer agent is selected from cisplatin; carboplatin; picoplatin; 5-flurouracil; paclitaxel; mitomycin C; doxorubicin; gemcitabine; tomudex; pemetrexed; methotrexate; irinotecan, fluorouracil and leucovorin; oxaliplatin, 5-fluorouracil and leucovorin; and paclitaxel and carboplatin. When the further anticancer agent has been shown to be particularly effective for a specific tumour type, it may be preferred that the inhibitor of the TEM is used in combination with that further anticancer agent to treat that specific tumour type.
One avenue towards the development of more selective, and thus better, anticancer drugs is the targeted delivery of bioactive molecules to the tumour environment by means of binding molecules (for example, human antibodies) that are specific for tumour endothelial markers. Due to their accessibility and to the therapeutic options that they allow (for example, intraluminal blood coagulation or recruitment of immune cells), vascular markers selectively expressed on tumour blood vessels are ideally suited for ligand-based tumour-targeting
strategies, allowing for the imaging of tumour neovasculature and for targeting cytotoxic agents to the tumour neovasculature.
In a further aspect, the invention provides an antibody-drug conjugate for use in a method of inhibiting tumour vasculature, wherein the antibody-drug conjugate comprises: (i) an antibody that selectively binds the TEM, such as PCDH7polypeptide, or fragment thereof and (ii) an anti-tumour vasculature cell moiety
Such an antibody-drug conjugate may also be used in a method of treatment as discussed herein. The present invention further provides an antibody-drug conjugate as defined for use in the preparation of a medicament for use in treating/inhibiting tumour vasculature.
The term "conjugate" as used herein refers to an anti-tumour vasculature cell moiety or a derivative thereof that is linked to an antibody as defined herein directly or by way of a linker.
A "linker" is any chemical moiety that is capable of linking the anti-tumour vasculature cell moiety to an antibody or a fragment thereof in a stable, covalent manner. Linkers can be susceptible to or be substantially resistant to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage, at conditions under which the anti-tumour vasculature cell moiety and/or the antibody remains active. Suitable linkers are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups. Linkers also include charged linkers, and hydrophilic forms thereof as described herein and know in the art.
The anti-tumour vasculature moiety may be a cytotoxic moiety. Typically the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety which is able to convert a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule that encodes a directly or indirectly cytotoxic polypeptide or a radioactive atom. Examples of such cytotoxic moieties, as well as methods of making the conjugates comprising the antibody and the cytotoxic moiety, are provided in earlier publications WO 02/36771 and WO 2004/046191 , incorporated herein by reference.
The cytotoxic moiety may be directly or indirectly toxic to cells in neovasculature or cells which are in close proximity to and associated with neovasculature. By "directly cytotoxic" we include the meaning that the moiety is one which on its own is cytotoxic. By "indirectly cytotoxic" we include the meaning that the moiety is one which, although is not itself cytotoxic, can induce cytotoxicity, for example by its action on a further molecule or by further action on it.
In one embodiment the cytotoxic moiety is a cytotoxic chemotherapeutic agent. Cytotoxic chemotherapeutic agents are well known in the art. Cytotoxic chemo- therapeutic agents, such as anticancer agents, include those listed herein. Various of these cytotoxic moieties, such as cytotoxic chemotherapeutic agents, have previously been attached to antibodies and other targeting agents, and so compounds of the invention comprising these agents may readily be made by the person skilled in the art. For example, carbodiimide conjugation (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151 -159) may be used to conjugate a variety of agents, including doxorubicin, to antibodies. Other methods for conjugating a cytotoxic moiety to an antibody can also be used. For example, sodium periodate oxidation followed by reductive alkylation of appropriate reactants can be used, as can glutaraldehyde cross- linking. Methods of cross-linking polypeptides are known in the art and described in WO 2004/046191 . However, it is recognised that, regardless of which method of producing a compound of the invention is selected, a determination must be made that the antibody maintains its targeting ability and that the attached moiety maintains its relevant function. In a further embodiment of the invention, the cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety by which we include any moiety which leads to cell death. Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor and the like. Methods for linking them to targeting moieties such as antibodies are also known in the art. The use of ricin as a cytotoxic agent is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci. USA 90, 8996-9000, and the use of tissue factor, which leads to localised blood clotting and infarction of a tumour, has been described by Ran et al (1998) Cancer Res. 58, 4646-4653 and Huang et al (1997) Science 275, 547-550. Tsai et al (1995) Dis. Colon Rectum 38, 1067-1074 describes the abrin A chain conjugated to a monoclonal antibody. Other ribosome inactivating proteins are described as cytotoxic agents in WO 96/06641 . Pseudomonas exotoxin may also be used as the cytotoxic polypeptide moiety (Aiello et al (1995) Proc. Natl. Acad. Sci. USA 92, 0457-10461 ).
Certain cytokines, such as TNFa, INFy and IL-2, may also be useful as cytotoxic agents. Certain radioactive atoms may also be cytotoxic if delivered in sufficient doses. Thus, the cytotoxic moiety may comprise a radioactive atom which, in use, delivers a sufficient quantity of radioactivity to the target site so as to be cytotoxic. Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131 , indium-1 1 1 , rhenium-186, rhenium-188 or yttrium- 90, or any other isotope which emits enough energy to destroy neighbouring cells, organelles or nucleic acid. Preferably, the isotopes and density of radioactive atoms in the compound of the invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000 or 10000 cGy) is delivered to the target site and, preferably, to the cells at the target site and their organelles, particularly the nucleus. The radioactive atom may be attached to the antibody in known ways. For example EDTA or another chelating agent may be attached to the antibody and used to attach 11 In or 90Y. Tyrosine residues may be labelled with 125l or 1311.
The cytotoxic moiety may be a radiosensitizer. Radiosensitizers include fluoropyrimidines, thymidine analogues, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamide, 3-aminobenzodiamide, etanixadole, pimonidazole and misonidazole (see, for example, McGinn et al (1996) J. Natl. Cancer Inst. 88, 1 193-1 1203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol. 34, 571 -587; Shenoy & Singh (1992) Clin. Invest. 10, 533-551 ; Mitchell et al (1989) Int. J. Radial Biol. 56, 827-836; lliakis & Kurtzman (1989) Int. J. Radial Oncol. Biol. Phys. 16, 1235- 1241 ; Brown (1989) Int. J. Radial Oncol. Biol. Phys. 16, 987-993; Brown (1985) Cancer 55, 2222-2228).
The cytotoxic moiety may be a procoagulant factor, such as the extracellular domain of tissue factor (Rippmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumour stroma specific single-chain fragment variable antibody results in an antigen- specific coagulation-promoting molecule." Biochem J. 349: 805-12; Huang er al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature." Science. 275(5299): 547-550.
The cytotoxic moiety may be an indirectly cytotoxic polypeptide. In a particularly preferred embodiment, the indirectly cytotoxic polypeptide is a polypeptide which has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug. When the targeting moiety is an antibody this type of system is often referred to as ADEPT (Antibody- Directed Enzyme Prodrug Therapy). The system requires that the targeting moiety locates the enzymatic portion to the desired site in the body of the patient (e.g. the site of new vascular tissue associated with a tumour) and after allowing time for the enzyme to localise at the site, administering a prodrug which is a substrate for the enzyme, the end product of the catalysis being a cytotoxic compound. The object of the approach is to maximise the concentration of drug at the desired site and to minimise the concentration of drug in normal tissues (Senter et al (1988) "Anti-tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J. Cancer 56, 531 -2; and Bagshawe, et al (1988) "A cytotoxic agent can be generated selectively at cancer sites" Br. J. Cancer. 58, 700-703); Bagshawe (1995) Drug Dev. Res. 34, 220-230 and WO 2004/046191 , describe various enzyme/prodrug combinations which may be suitable in the context of this invention.
Typically, the prodrug is relatively non-toxic compared to the cytotoxic drug. Typically, it has less than 10% of the toxicity, preferably less than 1 % of the toxicity as measured in a suitable in vitro cytotoxicity test.
It is likely that the moiety which is able to convert a prodrug to a cytotoxic drug will be active in isolation from the rest of the compound but it is necessary only for it to be active when (a) it is in combination with the rest of the compound and (b) the compound is attached to, adjacent to or internalised in target cells.
The further moiety may be one which becomes cytotoxic, or releases a cytotoxic moiety, upon irradiation. For example, the boron-10 isotope, when appropriately irradiated, releases particles which are cytotoxic (US 4,348,376; Primus et al (1996) Bioconjug. Chem. 7: 532- 535).
Similarly, the cytotoxic moiety may be one which is useful in photodynamic therapy such as photofrin (see, for example, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).
Preferences for the individual to be treated, the types of solid tumour, the routes of administration, the antibody, and so on, are as defined above with respect to the first aspect of the invention. Antibodies that selectively bind to the STEAP1 polypeptide, when attached to a detectable moiety, may be useful in imaging, for example vascular imaging of tumours. Methods and compounds useful in vascular imaging of tumours are described in earlier publication WO 02/36771 , incorporated herein by reference. A compound comprising an anti-TEM antibody as defined above and a detectable moiety can be used, in combination with an appropriate detection method, to detect the location of the compound in the individual, and hence to identify the sites and extent of tumour angiogenesis in the individual. Accordingly, a further aspect of the invention provides a method of imaging tumour neovasculature in the body of an individual the method comprising administering to the individual a compound comprising (i) an antibody that selectively binds the TEM, such as PCDH7polypeptide and (ii) a detectable moiety, and imaging the detectable moiety in the body. In an embodiment, the method may further comprise the step of detecting the location of the compound in the individual.
By a "detectable moiety" we include the meaning that the moiety is one which, when located at the target site following administration of the compound of the invention into a patient, may be detected, typically non-invasively from outside the body, and the site of the target located. Thus, the compounds of this aspect of the invention are useful in imaging and diagnosis, especially in the imaging and diagnosis of neovasculature of solid tumours. Typically, the detectable moiety is or comprises a magnetic nano-particle, a radionuclide or a fluorophore. Thus, in an embodiment, the detectable moiety may be a radioactive atom which is useful in imaging. Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies. Other readily detectable moieties include, for example, spin labels for magnetic
resonance imaging (MRI) such as iodine-123 again, iodine-131 , indium-1 1 1 , fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.
Many suitable fluorophores and detection methods are well known in the art and are described, for example by Stefan Andersson-Engels et al (1997) "In vivo fluorescence imaging for tissue diagnostics. Phys. Med. Biol. 42: 815-824; Altinoglu et al (2008) "Near- Infrared Emitting Fluorophore-Doped Calcium Phosphate Nanoparticles for In Vivo Imaging of Human Breast Cancer" ACS Nano 2(10): 2075-84; and Chin et al (2009) "In- vivo optical detection of cancer using chlorin e6 - polyvinylpyrrolidone induced fluorescence imaging and spectroscopy" BMC Medical Imaging 9:1 (doi: 10.1 186/1471 - 2342-9-1 ).
A further aspect of the invention provides an ex vivo method of inhibiting tumour vasculature, the method comprising administering an inhibitor of a TEM, such as PCDH7to tissue or cells ex vivo. Typically, this ex vivo method of inhibiting tumour vasculature is carried out in the context of a tumour vasculature assay or in a model of tumour vasculature, such as those described below. Thus the cells may be established tumour cell lines or tumour cells that have been removed from an individual. The tissue or cells are preferably mammalian tissue or cells, and most preferably are human tissue or cells. Preferably, the tissue or cells comprise tumour endothelium, or are a model of tumour endothelium. Preferences for the inhibitor of the TEM are as described herein. Suitable tumour vasculature assays include assays for endothelial cell proliferation, migration and invasion, and include the BD BioCoat(TM) Angiogenesis System for Endothelial Cell Invasion which is available as Catalogue Nos. 354141 and 354142 from BD Biosciences, Bedford, MA, USA. Suitable models of tumour angiogenesis include assays for migration of tumour endothelial cells, including bFGF- and VEGF-induced migration, proliferation of tumour endothelial cells, and invasion of tumour endothelial cells and aortic ring assays.
A further aspect of the invention provides a method of identifying an agent that may be useful in the treatment of tumour vasculature, or a lead compound for the identification of an agent that may be useful in the treatment of tumour vasculature, the method comprising: providing a candidate compound that binds the TEM, such as PCDH7 polypeptide, or a fragment thereof; and testing the candidate compound in a tumour vasculature assay, wherein a candidate compound that inhibits tumour vasculature in the assay may be an agent that is useful in the treatment/inhibition of tumour vasculature, or may be a lead compound for the identification of an agent that is useful in the treatment of tumour vasculature. In an embodiment, the method further comprises the preceding step of determining whether the candidate compound selectively binds to the TEM polypeptide, or a fragment thereof.
It is appreciated that these methods can be used to identify an anti- tumour vasculature factor, which may be an anti-cancer agent.
Suitable candidate agents include polypeptides, polynucleotides, antibodies, carbohydrates, aptamers, small molecules (typically less than 500 Daltons) and the like.
All of the documents referred to herein are incorporated herein, in their entirety, by reference. The listing or discussion of an apparently prior-published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge
Detailed Description
The present invention will now be further described by way of example and with reference to the figures which show:
Figure 1 A Ulex coated magnetic bead isolation achieved substantial endothelial enrichment and gave good quality RNA.
(a) The workflow of the main steps in Ulex-bead isolation of endothelial cells from healthy/tumor lung tissue, (b) Confirmation of endothelial enrichment using the Ulex-beads approach. Real-time PCR using a primer set for the endothelial marker CD31 was performed on the bead isolated endothelial cells and bulk tissue. Expression of CD31 in the bead isolated sample was normalized to that in the bulk tissue (n = 3). (c) Good quality RNA (RIN
> 7) was obtained from Ulex-bead isolated endothelial cells from healthy and tumor lung tissue. ECs = Endothelial cells
Figure 2 PCA plot of microarray of 4 pairs of healthy and tumor lung endothelial isolates
A PCA plot showing that the endothelial transcriptomes of healthy and tumor lung show a clear difference. The separation between healthy and tumor lung endothelium was highlighted by dotted lines.
Figure 3 Validation of putative lung vascular targets by qPCR
Quantitative real-time PCR validation of tumor vascular target candidates in endothelial cells isolated from healthy and tumor lung tissue. Flotillin 2 was used as the house keeping gene to which the data was normalized. The double delta Ct method was used to compare expression levels in tumor relative to healthy endothelial isolates.
Figure 4 Confirmation of upregulated angiogenesis associated genes, matrix metal loproteases and putative vascular targets in lung cancer by RNA-seq
Differential gene expression analysis of RNA-seq data confirmed a panel of elevated angiogenesis associated genes, matrix-metalloprotease genes and lung cancer vascular target candidates identified through microarray analysis.
Figure 5 Validation of putative lung vascular targets by immunohistochemistry.
Identified putative lung TEMs were validated by immunohistochemistry. Representative immunohistochemistry for lung vascular target candidates on healthy and tumor lung tissue.
Figure 6 Expression profiling of STEAP1 expression in clinical lung cancer samples.
(a) Representative images of STEAP1 in healthy (i - ii) and tumor (iii - vi) lung tissue; expression level classified as no expression (i), low (ii - iii), medium (iv) and high (v - vi).
Images were acquired using an optical microscope at a magnification of 20x. (b) Expression profiling of STEAP1 in clinical samples by immunohistochemistry (n = 82).
Figure 7 Functional analysis of STEAP1 in endothelial cells (a) Western blot showing that two independent siRNA duplexes efficiently knockdown STEAP1 protein in HUVEC. Tubulin was used as a loading control. STEAP1 appears as two bands, the 65 kDa glycosylated mature protein and the 30 kDa unglycosylated precursor, (b-c) Scratch wound assay and (d-e) Matrigel tube forming assay in HUVEC transfected with mock, negative control or STEAP1 siRNA duplexes (± SEM.).
Figure 8 Validation of putative lung vascular targets by immunohistochemistry.
Representative images of immunohistochemistry for lung vascular target candidates on placental tissue
Tables
Table 1 Clinical-pathological data of lung cancer patients used in the genomic analysis.
Table 2 Upregulated angiogenesis associated genes in lung cancer
Differential expression analysis of microarray data for the identification of elevated known angiogenesis associated genes. Listed genes were ranked by LogFC in descending order. LogFC = Log2 Fold Change.
Table 3 Upregulated matrix metallopeptidases in lung cancer
Differential expression analysis of microarray data for the identification of elevated matrix metallopeptidases. Listed genes were ranked by LogFC in descending order.
Table 4 Putative vascular targets in lung cancer
Differential expression analysis of microarray data for the identification of putative vascular targets for lung cancer. Listed genes were ranked by LogFC in descending order.
Table 5 Clinical characteristics of lung cancer patients for STEAP1 profiling
Table 6 Quantitative Real-time PCR primer sets for target validation
Table 7 Potential vascular targets identified through combined analysis of microarray and RNA-seq data
The intersection of the microarray and RNA-seq gene pools generated a list comprising 122 genes with a transmembrane or a signal peptide. The listed genes were ranked in ascending order of P values generated through microarray data analysis. Materials and methods Ulex-bead isolation
Healthy and tumor lung tissue was obtained immediately following surgery with full patient consent and ethics approval (Heartlands Hospital, REC. 07/MRE08/42). Minced tissue was digested in DMEM containing 2 mg/ml collagenase type V (Sigma, UK), 7.4 mg/ml of actinomycin (Sigma, UK) and 30 kU/ml of DNAse I (Qiagen, UK) at 37°C. Endothelial cells were isolated from the digested cell suspension by positive selection using Ulex lectin coated magnetic beads (Invitrogen, UK).
Microarray RNA extracted from Ulex-bead isolated samples was converted to cRNA, then subjected to amplification and labeling. Labeled cRNA samples were then hybridized to an Agilent 4 x 44k whole human gene expression microarray (Agilent, UK). The Bioconductor packages preprocess Core and Limma were used to subtract background and Quantile normalize probe signal intensities prior to performing differential gene expression analyses. Principle component analysis (PCA) was performed in R.
RNA-seq
79 and 84 million paired end reads (50bp + 35bp) were sequenced on the SOLiD4 2nd generation sequencer for endothelium from fresh tumor and healthy tissue respectively. Reads were mapped to the Human genome (University California Santa Cruz, version hg19) with Tophat 1 .3.3 (Trapnell et al., 2009). Default parameters for color space mapping were used with the exception of the following; 1 . -g/-max-multihits was set to 1 to identify the single best mapped read; 2. -library-type was set to fr-secondstrand to reflect the sequencing library preparation; 3. -G provided Tophat with a model set of gene annotation genome positions from the Refseq hg19 transcnptome. The Tophat output bam files were sorted using samtools (Version: 0.1 .8, (Li et al., 2009)), and 'HTSeq-count' version 0.4.7p4 (Anders, 2010) was used, in conjunction with the Human transcriptome GTF Refseq version 19, to assign gene counts and produce a tab delimited file of transcript/gene counts. Differential gene expression analysis and p-value generation on the count data was carried out using the R Bioconductor package DESeq v1 .5 (Anders and Huber, 2010).
Quantitative Real-time PCR
RNA extraction, complementary DNA preparation and quantitative real-time PCR (qPCR) were performed using LightCycler real time quantitative PCR (Roche, UK) following previously described methods (Armstrong et al., 2008). Primer sequences were provided in Table 6. The double delta Ct method was used to compare expression levels in tumor relative to healthy endothelial isolates.
Immunohistochemistry
Immunohistochemistry of placental tissue or lung tumor sections were immunostained with antisera to the targets (all antisera from Abeam, UK). Sections were then visualized using ImmPRESS universal antibody kit and NovaRed chromagen (Vector labs, USA). Finally sections were counterstained with Mayers hematoxylin, dehydrated, and mounted in distyrene-plasticizer-xylene resin.
Functional assay with siRNA knockdown
Transfection with siRNA and functional assays were performed as previously described (Armstrong et al., 2008). STEAP1 siRNA duplexes were:
D1 : sense: CUAUAUUCAGAGCAAGCUATT; antisense: UAGCUUGCUCUGAAUAUAGTG; D2: sense: GAAUAAGUGGAUAGAUAUATT; anti-sense: UAUAUCUAUCCACUUAUUCCA (Ambion, UK). The open area of the wound was quantified using a cell intelligence quotient analyzer or Image J software (Image J website, rsbweb.nih.gov). The effect of STEAP1 knockdown on Matrigel assays was analysed by Angiogenesis Analyzer for ImageJ. All images were acquired using a Leica DM IL microscope (Leica, Milton Keynes, UK) and USB 2.0 2M Xli camera (XL Imaging LLC, Carrollton, TX, USA).
Results
Isolation of lung endothelium from fresh tissue
Previous studies have shown a high purity of endothelial isolates can be achieved using L//ex-conjugated beads (Jackson et al., 1990) but has not yet been applied to human lung tissue. Ulex europaeus agglutinin I is a lectin that specifically binds to L-fucose residues present in glycoproteins on the human endothelial surface (Holthofer et al., 1982). Here, we examine this approach for the isolation of endothelium from fresh lung specimens. 1 ~ 3 g of fresh healthy or tumor lung tissue samples were processed within 3 hours post-surgery. The tumor tissue was resected from the viable region of the tumor core and the patient matched healthy tissue resected > 10 cm away from the tumor core. Endothelial cells were positively isolated using magnetic beads coupled to Ulex lectin (workflow illustrated in Figure 1a). To verify endothelial enrichment, expression of the universal endothelial marker CD31 was examined by qPCR in the endothelial isolates and compared to that in the bulk tissue. A 15- fold enrichment of endothelium was achieved in the bead isolated samples when compared to whole tumor extracts. A4-fold enrichment was seen in endothelial cells isolated from healthy lung (Figure 1 b). The differing fold increase in CD31 seen in healthy and tumor samples is likely due to the proportion of endothelial cells being higher in healthy lung (30%) than in tumors (3-5%). RNA integrity analysis of a typical RNA isolate is shown in Figure 1c. The data confirm that the Ulex-bead isolation approach can effectively isolate the endothelial population from lung.
Microarray of endothelial isolates from lung cancer patients
For expression profiling, a microarray analysis was performed on 4 pairs of NSCLC patient matched healthy and tumor lung endothelial isolates. Clinical and pathologic data was obtained from Birmingham Heartland's Hospital (Table 1 , patient 1 -4). A PCA plot shows variation in both tumor and healthy lung samples and between samples of each group. This was to be expected as samples were collected and extracted from different patients and statistically significant genes are those that are consistent across replicate samples. Despite this the tumor and healthy isolates fall into two discrete groups (Figure 2).
To better understand the role of known angiogenesis associated genes in NSCLC, a differential expression analysis was performed using the program Limma. The analysis revealed a panel of known angiogenesis associated genes including COL1 A1 , VEGF-A, TEM7, TNC, EPHB2, IL8, FGF1 , ANGPTL2 and TEM8 elevated in lung tumor endothelium (Table 2). As tumor angiogenesis proceeds by proteolysis of the extracellular matrix (Sottile, 2004), elevated matrix metalloprotease (MMPs) activity is associated with active angiogenesis and tumor progression. The analysis also identified a number of MMPs up- regulated in lung tumor compared to healthy lung endothelium (Table 3).
Identification and validation of putative tumor vascular targets in NSCLC For target identification, differentially expressed genes from the microarray data were filtered through several selection criteria: Log2 fold change magnitude > 1 , a p-value < 0.5 and containing a transmembrane or signal peptide domain, which generated a list comprised of 584 genes. Twelve target candidates were chosen for further validation based on additional criteria including the level of association with endothelial cells, previously published work, sites of expression and relation to known genes with interesting functional properties (Table 4). To validate putative targets, a qPCR was performed on the four pairs of endothelial isolates used in the microarray. Figure 3 shows that all candidates had elevated expression in tumor compared to that in healthy endothelium ranging from a 3 to 35 fold increase in expression.
Expression profiling of lung endothelial isolates by RNA-seq
RNA-seq using deep sequencing technology provides an in-depth resolution of RNA snapshots by generating millions of reads that can be assembled and mapped to a known transcriptome, allowing the measurement of differential gene expression. RNA-seq has the advantage of querying novel transcripts and does not rely on prior knowledge and annotation. Here we used RNA-seq to verify the genes that had been identified through the microarray analysis. We note that a lower yield of RNA was obtained from healthy lung tissue compared to that from tumor. This was possibly due to the endothelial cells in healthy lung tissue being in a quiescent state compared to the active endothelium in tumors. For this reason, endothelial RNA isolated from three healthy lung samples (pooled) (Table 1 , patient 5 -7) and one tumor lung tissue (Table 1 , patient 6) were sequenced as 1 healthy and 1 tumor sample on a SOLiD4 sequencer. The differential gene expression analysis of the RNA-seq data was performed using the DESeq v1 .5 package (Anders and Huber, 2010). The analysis confirmed most of the unregulated angiogenesis associated genes, MMPs and putative targets identified through the microarray analysis (Figure 4). Analysis of the RNA- seq data alone generated a list of 477 genes with the same criterion used in the microarray analysis for target identification. The intersection of the microarray and RNA-seq gene pools comprises a list of 122 genes, which provides a rich source for target identification (Table 7). The discrepancy between the two analyses is likely due to cancer type (squamous vs. adeno) and individual patient variability.
Expression of TEM candidates in angiogenic tissue and lung cancer
To further validate the candidate targets, we investigated protein expression by immunohistochemistry. We have previously shown that placental vasculature is a rich source of endothelial gene expression. Thus, immunohistochemical staining was performed first on human placental tissue using antibodies to the lung TEM targets. Amongst the twelve targets, six genes: ROS1 , PCDH7, BI RC5, STEAP1 , GJB2 and PROM2 showed expression in human placental vessels (Figure 8). Tumor and healthy lung tissue was then immunostained and these six candidates are indeed overexpressed on the lung tumor vessels while absent or at a low level in healthy lung tissue (Figure 5). Some of the targets were not restricted to the tumor endothelium, for example, ROS1 and STEAP1 also showed positive expression on some tumor cells or macrophages and this may be beneficial for developing drugs targeting the tumor and its vasculature simultaneously. It is also worth mentioning that other target candidates should not be completely eliminated for further investigation simply due to the lack of antibody reactivity in immunochemistry.
Expression of STEAP1 in lung cancer
We then focused on the top-ranked target STEAP1 . To confirm whether STEAP1 is differentially expressed in the endothelium within healthy and tumor lung tissue, an expression profiling was carried out on human lung cancer tissues by immunohistochemistry. 82 Patients were examined (Table 5). The intensity of the signal was classified as absent, low, medium or high. Representative images of STEAP1 staining in lung cancer are shown in Figure 6a. From the 82 cases examined, a clear overexpression of STEAP1 in tumor vessels was observed: for example 46% of the vessels highly expressed STEAP1 in lung cancer versus only 5% in matching healthy lung. The proportion of vessels that are 'low' and 'no expression' of STEAP1 was 86% in healthy lung, but only 14% in lung tumors (Figure 6b). These data confirm that STEAP1 is differentially expressed between the tumor and healthy lung vasculature and presents a possible vascular target for lung cancers.
Function of STEAP1 in endothelial cells
We next used siRNA knockdown to seek a function of STEAP1 in endothelial cells. STEAP1 protein expression was efficiently knocked down by two independent siRNA duplexes (Figure 7a). Migration of HUVEC after STEAP1 knockdown was compared with that of mock and negative siRNA transfected controls in a scratch-wound assay. At 24 h, control wounds showed 60% closure, whereas in STEAP1 knockdown cells, the wound had only closed by 35% - 40% (Figures 7b and c). STEAP1 knockdown also compromised tube formation on Matrigel. Tubes showed a significant decrease in mesh size compared with controls (Figures 7d and e).
Discussion To date, expression of STEAP1 and other TEMs identified herein in endothelium has not been described. The present data have shown for the first time that STEAP1 and other identified TEMs expression is upregulated in endothelial cells, such as in the vessels of human lung tumors.
Like the previously described tumor endothelial markers CLEC14A and Robo4, STEAP1 , PCDH7 and BIRC5 are all upregulated on endothelium exposed to reduced shear stress (Bicknell et al, unpublished data). Reduced blood flow and shear stress may account for their expression on tumor vessels.
References
ANDERS, S. 2010. HTSeq: Analysing high-throughput sequencing data with Python [Online].
Available: Httj3;//
[Accessed].
ANDERS, S. & HUBER, W. 2010. Differential expression analysis for sequence count data. Genome Biol, 11, R106.
ARMSTRONG, L. J., HEATH, V. L, SANDERSON, S., KAUR, S., BEESLEY, J. F., HERBERT, J. M., LEGG, J.
A., POULSOM, R. & BICKNELL, R. 2008. ECSM2, an endothelial specific filamin a binding protein that mediates chemotaxis. Arterioscler Thromb Vase Biol, 28, 1640-6.
BALUK, P., HASHIZUME, H. & MCDONALD, D. M. 2005. Cellular abnormalities of blood vessels as targets in cancer. Curr Opin Genet Dev, 15, 102-11.
DACHS, G. U. & CHAPLIN, D. J. 1998. Microenvironmental control of gene expression: implications for tumor angiogenesis, progression, and metastasis. Semin Radiat Oncol, 8, 208-16. HERBERT, J. M., STEKEL, D., SANDERSON, S., HEATH, V. L. & BICKNELL, R. 2008. A novel method of differential gene expression analysis using multiple cDNA libraries applied to the identification of tumour endothelial genes. BMC Genomics, 9, 153.
HO, M., YANG, E., MATCUK, G., DENG, D., SAMPAS, N., TSALENKO, A., TABIBIAZAR, R., ZHANG, Y.,
CHEN, M., TALBI, S., HO, Y. D., WANG, J., TSAO, P. S., BEN-DOR, A., YAKHINI, Z., BRUHN, L. & QUERTERMOUS, T. 2003. Identification of endothelial cell genes by combined database mining and microarray analysis. Physiol Genomics, 13, 249-62.
HOLTHOFER, H., VIRTANEN, I., KARINIEMI, A. L, HORMIA, M., UNDER, E. & MIETTINEN, A. 1982.
Ulex europaeus I lectin as a marker for vascular endothelium in human tissues. Lab Invest,
47, 60-6.
HUMINIECKI, L. & BICKNELL, R. 2000. In silico cloning of novel endothelial-specific genes. Genome Res, 10, 1796-806.
JACKSON, C. J., GARBETT, P. K., NISSEN, B. & SCHRIEBER, L. 1990. Binding of human endothelium to Ulex europaeus l-coated Dynabeads: application to the isolation of microvascular endothelium. J Cell Sci, 96 ( Pt 2), 257-62.
LI, H., HANDSAKER, B., WYSOKER, A., FENNELL, T., RUAN, J., HOMER, N., MARTH, G., ABECASIS, G.
& DURBIN, R. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics, 25, 2078-9.
MEYER, T. 2010. Vascular Disruptive Agents for the Treatment of Cancer. Springer.
OH, P., LI, Y., YU, J., DURR, E., KRASINSKA, K. M., CARVER, L. A., TESTA, J. E. & SCHNITZER, J. E.
2004. Subtractive proteomic mapping of the endothelial surface in lung and solid tumours for tissue-specific therapy. Nature, 429, 629-35.
RELF, M., LEJEUNE, S., SCOTT, P. A., FOX, S., SMITH, K., LEEK, R., MOGHADDAM, A., WHITEHOUSE,
R., BICKNELL, R. & HARRIS, A. L. 1997. Expression of the angiogenic factors vascular endothelial cell growth factor, acidic and basic fibroblast growth factor, tumor growth factor beta-1, platelet-derived endothelial cell growth factor, placenta growth factor, and pleiotrophin in human primary breast cancer and its relation to angiogenesis. Cancer Res,
57, 963-9.
SOTTILE, J. 2004. Regulation of angiogenesis by extracellular matrix. Biochim Biophys Acta, 1654, 13-22.
ST CROIX, B., RAGO, C, VELCULESCU, V., TRAVERSO, G., ROMANS, K. E., MONTGOMERY, E., LAL, A., RIGGINS, G. J., LENGAUER, C, VOGELSTEIN, B. & KINZLER, K. W. 2000. Genes expressed in human tumor endothelium. Science, 289, 1197-202.
TRAPNELL, C, PACHTER, L. & SALZBERG, S. L. 2009. TopHat: discovering splice junctions with RNA- Seq. Bioinformatics, 25, 1105-11.
Claims
An inhibitor of PCDH7 for use in a method of inhibiting tumour vasculature.
The inhibitor for use in a method according to claim 1 wherein the inhibitor is anti- angiogenic agent and/or vascular disrupting agent
The inhibitor for use in a method according to either of claims 1 or 2 wherein the inhibitor does not substantially inhibit neoplastic tumour cells.
The inhibitor for use in a method according to any preceding claim, wherein the inhibitor is an antibody, or antibody-drug conjugate that selectively binds to PCDH7, or an siRNA, antisense polynucleotide, modified snoRNA molecule or ribozyme molecules that are specific for polynucleotides encoding the PCDH7 polypeptide, and which prevent its expression.
The inhibitor for use in a method according to any preceding claim wherein the tumour vasculature is associated with a solid tumour, such as a lung tumour.
The inhibitor for use in a method according to any preceding claim wherein the method further comprises the administration of at least one additional anti-cancer therapy, such as a chemotherapeutic agent, or a non-chemotherapeutic treatments such as radiotherapy, photodynamic therapy, gene therapy; surgery or a controlled diet.
The inhibitor for use in a method according to claim 6 wherein said at least one additional anticancer agent is directed to target neoplastic cells rather than the tumour vasculature, or is directed to target the tumour vasculature rather than the neoplastic cells of the tumour.
An antibody-drug conjugate for use in a method of inhibiting tumour vasculature, wherein the antibody-drug conjugate comprises: (i) an antibody that selectively binds a PCDH7 polypeptide, or fragment thereof and (ii) an anti-tumour vasculature cell moiety.
9. An antibody-drug conjugate according to claim 8 wherein the anti-tumour vasculature cell moiety is a cytotoxic or anti-angiogenic agent.
A method of identifying an agent for use in the inhibition of tumour vasculature , or a lead compound for the identification of an agent that may be useful in the inhibition of tumour vasculature, the method comprising: providing a candidate compound that binds a PCDH7 polypeptide, or a fragment thereof; and testing the candidate compound in a tumour vasculature assay, wherein a candidate compound that inhibits tumour vasculature in the assay may be an agent that is useful in the inhibition of tumour vasculature, or may be a lead compound for the identification of an agent that is useful in the inhibition of tumour vasculature.
The method of identifying an agent for use in the inhibition of tumour vasculature, or a lead compound for the identification of an agent that may be useful in the inhibition of tumour vasculature according to claim 10, the method further comprising the preceding step of determining whether the candidate or lead compound selectively binds to the PCDH7 polypeptide, or a fragment thereof.
A pharmaceutical formulation comprising an inhibitor or antibody according to any of claims 1 - 5, or 8 - 9, together with at least one additional anti-cancer therapy, such as a chemotherapeutic agent; and a pharmaceutically acceptable excipient.
The pharmaceutical formulation according to claim 12 wherein said at least one additional anticancer agent is directed to target neoplastic cells rather than the tumour vasculature, or is directed to target the tumour vasculature rather than the neoplastic cells of the tumour.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB1421900.0 | 2014-12-09 | ||
| GBGB1421900.0A GB201421900D0 (en) | 2014-12-09 | 2014-12-09 | Vasculature Targeting |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016092301A1 true WO2016092301A1 (en) | 2016-06-16 |
Family
ID=52425706
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2015/053771 Ceased WO2016092301A1 (en) | 2014-12-09 | 2015-12-09 | Vascular targeting |
Country Status (2)
| Country | Link |
|---|---|
| GB (1) | GB201421900D0 (en) |
| WO (1) | WO2016092301A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113862218A (en) * | 2021-10-12 | 2021-12-31 | 广州医科大学附属第一医院(广州呼吸中心) | A kind of tumor-related vascular pericyte subgroup and preparation method and application |
| WO2025024284A1 (en) * | 2023-07-21 | 2025-01-30 | The Board Of Regents Of The University Of Texas System | Monoclonal antibodies against pcdh7 for lung cancer therapy |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006009915A2 (en) * | 2004-06-17 | 2006-01-26 | The Trustees Of Columbia University In The City Of New York | Use of genetically- and epigenetically-altered protocadherins in methods of diagnosing, prognosing, and treating cancer |
| WO2011124669A1 (en) * | 2010-04-08 | 2011-10-13 | Institut Gustave Roussy | Methods for predicting or monitoring whether a patient affected by a cancer is responsive to a treatment with a molecule of the taxoid family |
-
2014
- 2014-12-09 GB GBGB1421900.0A patent/GB201421900D0/en not_active Ceased
-
2015
- 2015-12-09 WO PCT/GB2015/053771 patent/WO2016092301A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006009915A2 (en) * | 2004-06-17 | 2006-01-26 | The Trustees Of Columbia University In The City Of New York | Use of genetically- and epigenetically-altered protocadherins in methods of diagnosing, prognosing, and treating cancer |
| WO2011124669A1 (en) * | 2010-04-08 | 2011-10-13 | Institut Gustave Roussy | Methods for predicting or monitoring whether a patient affected by a cancer is responsive to a treatment with a molecule of the taxoid family |
Non-Patent Citations (3)
| Title |
|---|
| LI AI-MIN ET AL: "Protocadherin-7 induces bone metastasis of breast cancer", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 436, no. 3, 2013, pages 486 - 490, XP028672824, ISSN: 0006-291X, DOI: 10.1016/J.BBRC.2013.05.131 * |
| N. OZLU ET AL: "Quantitative comparison of a human cancer cell surface proteome between interphase and mitosis", EMBO JOURNAL., vol. 34, no. 2, 4 December 2014 (2014-12-04) - 13 January 2015 (2015-01-13), GB, pages 251 - 265, XP055246875, ISSN: 0261-4189, DOI: 10.15252/embj.201385162 * |
| NAKAMURA HARUHIKO ET AL: "Global epigenomic analysis indicates protocadherin-7 activates osteoclastogenesis by promoting cell-cell fusion", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, ACADEMIC PRESS INC. ORLANDO, FL, US, vol. 455, no. 3, 13 November 2014 (2014-11-13), pages 305 - 311, XP029108960, ISSN: 0006-291X, DOI: 10.1016/J.BBRC.2014.11.009 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113862218A (en) * | 2021-10-12 | 2021-12-31 | 广州医科大学附属第一医院(广州呼吸中心) | A kind of tumor-related vascular pericyte subgroup and preparation method and application |
| WO2025024284A1 (en) * | 2023-07-21 | 2025-01-30 | The Board Of Regents Of The University Of Texas System | Monoclonal antibodies against pcdh7 for lung cancer therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| GB201421900D0 (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2513146B1 (en) | Antibodies against ror1 capable of inducing cell death of cll | |
| US9266952B2 (en) | Antibodies against ROR1 and uses thereof | |
| JP7098648B2 (en) | Modified NK-92 haNK003 cells for clinical use | |
| US20180010132A1 (en) | Inhibition of prmt5 to treat mtap-deficiency-related diseases | |
| UA128387C2 (en) | Anti-lag3 antibodies | |
| JP6649941B2 (en) | Anticancer / metastasis inhibitor using FSTL1 and combination thereof | |
| EP2473529B1 (en) | Clec14a inhibitors | |
| JP2024515189A (en) | Chimeric costimulatory receptors, chemokine receptors, and their uses in cellular immunotherapy - Patents.com | |
| WO2021044039A1 (en) | Ssea-4 binding members | |
| US11215618B2 (en) | Articles and methods directed to personalized therapy of cancer | |
| WO2016092301A1 (en) | Vascular targeting | |
| WO2012074842A2 (en) | Compositions and methods for treating neoplasia | |
| WO2011004379A1 (en) | Compositions and methods for treating cancer | |
| WO2024030758A1 (en) | Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies | |
| CN116350756A (en) | Novel application of B4GALT1 gene/protein, a kind of isolated immune cell and its application | |
| US20230303712A1 (en) | Methods of treating glioblastoma | |
| US12111319B2 (en) | Articles and methods directed to personalized therapy of cancer | |
| CA3218832A1 (en) | Combined therapy using anti-cd300c antibody | |
| HK40095411A (en) | Modified nk-92 hank003 cells for clinical use | |
| EP4619509A1 (en) | T cell-nk cell interaction inhibitors for use in disease treatment | |
| KR101753457B1 (en) | GPR50 as biomarker for detecting cancer stem like cell and use thereof | |
| HK40028190A (en) | Methods for modulating regulatory t cells and immune responses using cdk4/6 inhibitors | |
| Srinivasan et al. | Advances in Cancer Stem Cell Therapy: Targets and Treatments | |
| WO2012125554A2 (en) | Compositions and methods for the treatment of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15816206 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15816206 Country of ref document: EP Kind code of ref document: A1 |