WO2016087625A1 - Method for the identification of gene regulation targets - Google Patents
Method for the identification of gene regulation targets Download PDFInfo
- Publication number
- WO2016087625A1 WO2016087625A1 PCT/EP2015/078603 EP2015078603W WO2016087625A1 WO 2016087625 A1 WO2016087625 A1 WO 2016087625A1 EP 2015078603 W EP2015078603 W EP 2015078603W WO 2016087625 A1 WO2016087625 A1 WO 2016087625A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- splicing
- network
- factors
- alternative splicing
- exon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B5/00—ICT specially adapted for modelling or simulations in systems biology, e.g. gene-regulatory networks, protein interaction networks or metabolic networks
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
Definitions
- the present invention relates to a method for identifying functional associations between regulators of alternative splicing (AS), or between a particular splicing regulator involved in a disease and a compound that will become a candidate to drug against said disease, from a network of functional interactions among factors involved in intron removal itself and/or in the regulation of either the activity of the splicing machinery or the selection among alternative patterns of intron removal (alternative splicing), which method is based on the previous construction of the network by applying a combination of algorithms to a collection of data related to alternative splicing.
- introns from mRNA precursors is an essential step for the generation of functional mRNAs in eukaryotes.
- Alternative patterns of intron removal expand the coding potential of the genome and allow versatile regulation of gene expression in multicellular organisms.
- Most human transcripts undergo AS, thus representing an important mechanism for the generation of proteome diversity (Nilsen and Graveley, 2010). The process is tightly regulated to set up specific AS programs across different tissues or during development (Barbosa-Morais et al., 2012; Merkin et al., 2012).
- Pre-mRNA splicing is carried out by the spliceosome, one of the most complex molecular machineries of the cell, composed of 5 small nuclear ribonucleoprotein particles (U1 , U2, U4/5/6 snRNP) and about 150 additional polypeptides (reviewed by Wahl et al., 2009).
- U1 snRNP recognizes the 5' splice site
- U2AF -a heterodimer of 35 and 65KDa subunits- recognizes sequences at the 3' end of introns.
- U2AF binding helps to recruit U2 snRNP to the upstream branch point sequence, forming complex A.
- U2 snRNP binding involves interactions of pre-mRNA sequences with U2 snRNA as well as with U2 proteins (e.g. SF3B1 ). Subsequent binding of pre-assembled U4/5/6 tri-snRNP forms complex B, which after a series of conformational changes forms complexes Bact and C, concomitant with the activation of the two catalytic steps that generate splicing intermediates and products.
- RNA structures contributed by base pairing interactions between U2 and U6 snRNAs serve to coordinate metal ions critical for splicing catalysis (Fica et al., 2013), implying that the spliceosome is an RNA enzyme whose catalytic center is only established upon assembly of its individual components.
- the major splicing apparatus (spliceosome), as summarized by Cooper et al. (Cooper et al., 2009), is composed of a core with 5 small nuclear ribonucleinprotein complexes (snRNPs), each containing one or two snRNAs (U1 , U2, U4/U6, and U5), and numerous protein factors.
- snRNPs small nuclear ribonucleinprotein complexes
- U1 , U2, U4/U6, and U5 small nuclear ribonucleinprotein complexes
- These splicing factors include RNA-binding proteins (e.g., U2AF, SF1 and SRF) and different enzymes (helicases/RN Pases, kinases, phosphastases, etc.).
- Each snRNP except U6 and U6atac, have in common a stable seven-membered ring of Sm proteins (the Sm core), as well as several snRNA-specific proteins.
- RNA-binding proteins which are some of the factors involved in the splicing process which are not part of the spliceosome itself.
- RNA-binding proteins have either positive (primarily SR proteins: serine arginine-rich domain containing proteins) or negative (primarily hnRNP proteins) effects on spliceosome assembly in their vicinity to maintain appropriate constitutive splicing or to regulate alternative splicing.
- SR proteins serine arginine-rich domain containing proteins
- hnRNP proteins primarily hnRNP proteins
- EJC exon junction complex
- AS alternative splicing
- these regulatory factors include members of the hnRNP and SR protein families, which often display cooperative or antagonistic functions depending on the position of their binding sites relative to the regulated splice sites.
- the combinatorial nature of these contributions complicates the formulation of integrative models for AS regulation and its relation with physiological regulation, with the activity of other cellular pathways and, particularly, with the etiology and development of some diseases.
- genes encoding splicing factors including the drug target splicing factor 3B subunit 1 (SF3B1 ), are among the most highly mutated in various haematological malignancies such as chronic lymphocytic leukaemia and myelodysplastic syndromes, highlighting the role of splicing factors in cancers. Consequently, alteration of the alternative splicing pattern of different pre-mRNAs has been often associated with different cancer diseases and seems to be even an important factor in the stimulation of tumor growth.
- SF3B1 drug target splicing factor 3B subunit 1
- Fas/CD95 exon 6 encodes a trans-membrane domain, and skipping of this exon leads to an mRNA encoding a soluble form of the receptor that can act as a decoy and prevent cell death (Cheng et al., 1994; Cascino et al., 1995; Liu et al., 1995; Papoff et al., 1996:).
- a switch in isoforms from soluble to membrane-bound occurs during T lymphocyte activation and miss-regulation of this switch is associated with Autoimmune Lymphoproliferative syndrome (Roesler et al., 2005).
- RNAs The discovery of disease-causing mutations in RNAs is yielding a range of therapeutic targets. But developing therapeutics requires a deeper understanding of RNA biology and chemistry and, particularly, a better understanding of the factors involved in the regulation of splicing and their contribution to alternative splicing, as well as the development of appropriate tools for handling the intricate network of interactions among them.
- Genome-wide and high-throughput content screenings have emerged as powerful tools for the identification of novel regulators of a variety of cellular processes, including cell cycle progression or cell death. Few genome-scale screens for the identification of novel splicing regulators in mammalian cells have been reported. Using a luciferase-based reporter minigene and a cDNA expression screen, Warzecha et al. (2009) identified ESRP1 and ESRP2 as epithelial-specific splicing regulators governing the splicing of the FGFR2 receptor. Using dual fluorescent reporters, a gain-of-function cDNA screen identified novel regulators of post-synaptic density protein 95 (Psd-95) AS (Zheng et al., 2013).
- Psd-95 post-synaptic density protein 95
- Moore et al. (2010) employed fluorescent reporters to carry out a genome- scale siRNA screen to identify novel regulators of AS of two apoptotic genes, BCL- X and MCL-1 .They proposed a network of regulatorsthat modulate the mentioned two splicing events based upon previous knowledge of physical interactions involving these proteins, which allowed the authors to propose mutual influences between the processes of splicing and cell cycle control.
- the mentioned network does not allow deriving from it any statistically meaningful functional relationships between a high number of factors such as the complete set of components of the spliceosome.
- splicing regulators specifically, RNA binding proteins
- exons or exon modules groups of co-regulated exons
- the present invention provides a solution to such problems.
- the present invention refers to a method for identifying targets for the modulation of alternative splicing, which comprises the steps of:
- the impact is assessed for at least 35 alternative splicing events.
- a possible of embodiment of the method of the invention of particular interest is that one wherein an additional step for identifying general and secondary functional interactions among splicing factors is carried out, which step comprises the substeps of:
- step a) of the method i. repeating substeps i) to iv) of step a) of the method with different subsamples of data, each subsample consisting of different combinations of at least one half of the alternative splicing events initially analyzed, wherein the number of subsamples is preferably at least one order of magnitude higher than the number of inhibited genes or the total number of perturbing stimuli applied,
- An additional possible embodiment of the present invention is that one wherein, once applied steps a) and b) of the method, those nodes that appear clustered in a same region of a network with connections among them are identified as corresponding to splicing factors forming part of a same splicing subcomplex.
- the splicing perturbing stimulus whose effect on the set of alternative splicing events is analyzed consist of submitting the corresponding cell or cells to the action of an added compound.
- the added compound can be a drug known to have a therapeutic effect on a disease associated with altered alternative splicing, so that any splicing regulatory factor whose corresponding network node has a direct connection with the node corresponding to the drug is identified as a target for directing to it other compounds intended to be candidates to alternative drugs against said disease.
- a particular example of such embodiments can be those wherein the drug is spliceostatin A or meayamicin and any direct connection with it is identified as a target for directing to it other compounds intended to be candidates to alternative drugs against cancer.
- Another possible embodiment, closely related to the previous one, is that wherein an added compound is identified as a candidate to drug for the treatment of a disease associated with altered alternative splicing when it has at least a direct connection in common with a second compound, also having added as a perturbing stimulus for carrying out the method or whose functional associations have been previously identified by the method of claim 1 or by any other means, which second compound is a drug known to have an therapeutic effect on a disease associated with altered alternative splicing.
- the added compound is known to modulate a physiological process in the cell and any splicing regulatory factor whose corresponding network node has a direct connection with the node corresponding to the drug is identified as a target for directing to it other compounds intended to be candidates to the modulation of the same process.
- Additional embodiment derive from carrying out the method both with cells removed from a patient suffering from a disease or malfunction and with a different kind of cells deriving from and individual not suffering that disease or malfunction and those factors showing different connection in the two generated networks could be identified as targets for directing to them compounds intended to be candidates to drugs against said disease or malfunction.
- the approaches related to identification of drug targets and candidate to drugs can also be set forth as a method for identifying candidates to drugs against a disease which comprises the steps of carrying out the above discussed method and identifying the compound as candidate to drug against such disease when it shows at least a direct connection in common with another compound previously known to have a therapeutic effect on that disease or with a splicing regulatory factor that is previously known to be a target of at least a drug known to have a therapeutic effect on that disease.
- This can be considered also an aspect of the present invention.
- Fig. 1 Genome-wide screening for regulators of Fas/CD5 receptor AS: Methodology and result analysis.
- - Panel A Scheme of the screening procedure.
- an automatized method for siRNA transfection, RNA isolation and reverse transcription that generates cDNA transcriptomes corresponding to the individual knock down of every human gene.
- This collection is interrogated, in this specific example, by PCR to amplify a region of Fas gene comprising exons 5 and 7, which is alternatively spliced to generate products that include or skip exon 6.
- cDNAs from each knock down condition are amplified using a particular combination of barcoded primers (see below) and the collection of amplification products from every knock down condition analyzed by paired-ended Solexa sequencing.
- Deep sequencing reads were filtered based upon the barcode sequence combination (each knock down condition is characterized by a particular combination of forward (F1 -Fn) and reverse (R1 -Rn) barcoded primers) and the presence or absence of Fas/CD95 exon 6 sequences.
- the percentage of exon inclusion isoforms was calculated for each knockdown condition by simply counting the number of exon 6-containing and exon 6-lacking deep sequencing reads corresponding to molecules containing the particular combination of forward and reverse primers characteristic of that condition.
- - Panel C Correlation between Percentage Spliced In (PSI) values obtained by deep sequencing data and by HTCE (High-Throughput Capillary Electrophoresis) for 500 control knockdown conditions. The results validate the deep sequencing approach to quantify alternative splicing changes.
- PSI Percentage Spliced In
- Panel E Distribution of robust Z-scores across the 26880 siRNA conditions analyzed.
- - Panel F Flowchart of hit validation along the screening procedure.
- MAD indicates scaled median absolute deviation.
- the 1505 hits from the initial screen were tested in triplicate by High-Throughput Capillary Electrophoresis (HTCE), and the validated 427 hits were tested using a second siRNA library in biological triplicates by HTCE, generating a final list of 200 hits validated by two siRNA libraries and two different technologies (deep sequencing and HTCE).
- HTCE High-Throughput Capillary Electrophoresis
- Panel H Pie chart showing the functional classification of genome-wide screen hits. Classes (functions) are indicated below the chart, beginning with that the highest percentage of hits ("Splicing factors", 28%, occupying the top right- handed quarter and a little portion of the bottom right-handed quarter), and indicating the function of the remaining portions clockwise.
- Fig. 2 Comprehensive mapping of functional interactions between SFs (splicing factors) in ASEs (alternative splicing events) implicated in cell proliferation and apoptosis.
- Panel A Flow-chart of the pipeline for network generation. Changes in 36 alternative splicing events are measured upon knock down of each of the individual genes encoding components of the splicing machinery as well as chromatin remodeling factors.
- An automatized procedure for siRNA transfection, mRNA isolation and splicing event-specific PCRs, analyzed by High Throughput Capillary electrophoresis generates splicing perturbation profiles that represent changes in alternative splicing induced by knock down of a particular factor. Comparison between perturbation profiles of pairs of factors us used to build a functional splicing network.
- Panel B Genes with ASEs relevant for the regulation of cell proliferation and/or apoptosis used in the network generation assays; the area common to both circles corresponds to the genes involved in both kinds of events.
- Electrophoresis Electrophoresis profiles for FAS/CD95 and CHEK2 ASEs under conditions of knockdown of the core splicing factor SF3B1 .
- Upper panels show the HTCE profiles, lower panels represent the relative intensities of the inclusion and skipping isoforms.
- PSI percentage of inclusion
- Panel D Spread of PSI changes observed for each of the events analyzed in this study upon the different knockdowns.
- Panel E Examples of splicing perturbation profiles for different knockdowns.
- the profiles represent change towards inclusion (>0) or skipping ( ⁇ 0) for each ASE upon knockdown of the indicated factors, quantified as a robust Z- score.
- Panel F Robust correlation regression of the perturbation profiles of strongly correlated (PLRG1 versus CDC5L, upper panel) or anti-correlated (DDX52 versus SNRPG, lower panel) factors.
- Fig. 3 Coordinated regulation of splicing events by coherent subsets of SFs.
- ASEs Information about ASEs, a) type ( ce - cassette exon; 5ss - alternative 5' splice site; me - mutually exclusive exon; complex - multi-exonic rearrangement; 3ss - alternative 3' splice site ; ir - intron retention) and b) involvement in apoptosis (dark-coloroured boxes) or cell proliferation (non-coloured boxes) or in both process (grey coloured boxes) regulation is indicated in the second level of boxed located over each vertical lane of the heatmap.
- each short bar located before each horizontal lane of the heatmap indicates the category of the genes knocked down, the palest tones corresponding to other RNA processing factors or miscellaneous factors (abbreviated "Other RNApr./Misc”) and the darkest ones to chromatine remodeling factors ("Chrom. Factors").
- Panel E Box-plot representation of the mean z-score of AS changes induced by the knockdown of particular classes of factors, classified as in panel C.
- Fig. 5 Core network involved in AS regulation.
- Fig. 6 Variable functional interactions extracted from networks generated from subsets of ASEs.
- Fig. 7 Mapping the effects of pharmacological treatments to the splicing network.
- Iron homeostasis modulates Fas/CD95 alternative splicing.
- - Panel B Analysis of intracellular iron levels by Phen-green SK fluorescence flow cytometry of facs-sorted HeLa cells (left panels) transfected with siRNAs against AC01 or FTL, or treated with Hemin, Desferal or cyclopirox olamine, as indicated in the right panels, where the geometric median of Phen- green SK fluorescence intensity for a representative experiment is shown.
- the X axis represents fluorescence intensity and the Y axis represents cell numbers.
- CN PGSK indicates autofluorescence in the absence of Phen-green SK treatment. CN corresponds to control cells transfected with scrambled siRNAs and incubated with DMSO instead of Hemin or Desferal. AC01 and FTL knockdown treatments were also incubated with DMSO prior to experimental measurements.
- RNA processing factors and alterations of iron levels derived from a Splicing network analysis. Lines connecting RNA processing factors and treatments leading to changes in iron levels indicate similar (green in the original) or opposite (red in the original) effects on the profile of AS changes of 36 genes induced by splicing factor or AC01 / FTL knockdown or by treatment with 100 ⁇ Hemin or Desferal (DFOA in the Figure). Line widths are proportional to the strength of the correlations observed.
- SRSF7 overexpression and iron overload have antagonistic effects on Fas/CD95 AS.
- HeLa cells were transfected with a reporter minigene corresponding to Fas/CD95 exons 5-7 and either an empty vector or a SRSF7 expression vector, and treated either with DMSO (control) or with 100 ⁇ Hemin; RNAs were isolated and the patterns of Fas/CD95 AS analyzed by capillary electrophoresis. PSI indexes, s.d and p-values for three independent experiments are shown.
- Panel D Effects of iron levels perturbation and SRSF7 knockdown on AS of the apoptosis regulatory gene DIABLO.
- Fig. 10 Iron regulates SRSF7 RNA binding.
- Binding values represent mean and s.d. of fold-increase over control IgG for three independent experiments, after normalization by input levels of each amplicon and condition. The positions of exons and predicted SRSF7 binding sites are indicated.
- Panel H Model of iron mediated Fas AS regulation. SRSF7 binding to Fas pre-mRNA under low iron conditions promotes exon 6 skipping, while iron overload compromises the Zn knuckle domain-mediated RNA binding of SRSF7, leading to higher levels of exon 6 inclusion
- the present invention relates to a method for identifying alternative splicing regulation targets from the identification of functional associations among factors, internal or external, involved in the splicing process and its regulation.
- the method is based on the generation of a network of connections among factors involved in performing the splicing process itself and in its regulation, which can be used as a model of functional associations among alternative splicing (AS) factors and/or among AS regulatory factors and stimulate perturbing AS in a cell.
- the network represents a unique compendium of functional interactions among gene products involved in splicing regulation (splicing factors, SF), a discovery tool for coupling cell-perturbing stimuli to splicing regulation and an expansive view of the splicing regulatory landscape and its organization.
- the network and the method for applying it to the identification of alternative splicing regulation targets are powerful tools for studying the splicing process and its regulation, identifying targets for modulating specific alternative splicing events and even finding common patterns of behaviour among some splicing factors that can be used as starting points for finding common features among them, broading the knowledge about their functions and/or finding common targets for their regulations or activities previously unknown.
- the identification of new targets for modulating specific alternative events can be a crucial point for having new targets for developing drugs against malfunctions or diseases associated to alterations of alternative splicings, including drugs or even for identifying the alternative splicing events connected with a disease.
- the method of the present invention can be of use for identifying candidates to drugs against the same disease among the compounds with the same target, which compounds can be more effective against the disease to treat.
- the network also gives an idea of the intensity of the interaction among two factors, the network can also be of use to assess whether a candidate to drug against a disease has a stronger effect over a target than a previous known drug, giving an initial assessment of the possible activity of the compound.
- the method can also be of use for identifying the biological targets of compounds with a known activity but with an unknown target or, even, without a previous known connection with alternative splicing, and knowing the target can be of use to find other compounds with similar activities but, for instance, with less collateral effects.
- the construction of the network that is a basic pillar for carrying out the method of the present invention is based on two fundamental parts:
- a high-throughput screen to evaluate the effects of knocking down a multiplicity of genes (271 genes in the assays prepared for the construction of the network), which genes were selected trying to have a representative of each individual splicing component or regulator of a plurality of functionally important AS Events (ASEs).
- the screen is designed to assess the individual effect of knocking down each individual gene of the multiplicity of genes on each one of a plurality of selected alternative splicing events.
- the particular ASEs studied in the assays shown in the present application have been selected due to being significant in the regulation of cell proliferation and/or apoptosis.
- the distinct profiles of splicing changes caused by perturbation of regulatory factors depend on the functional bearings of those factors and can, therefore, be used as proxies for inferring functional relationships.
- the perturbation profiles of alternative splicing generated for each perturbation stimulus can be regarded as representing the influence of such stimulus on each one of the analyzed ASE, so that the comparative analysis of each possible pair of profiles can be used to infer functional relations among the corresponding gene or perturbation factor.
- the present inventors derived a network that recapitulates the topology of known splicing complexes and provides an extensive map of >500 functional associations among -200 splicing factors (SFs).
- the network accurately captures known physical and functional associations and identifies new ones, revealing remarkable regulatory potential of core spliceosomal components, related to the order and duration of their recruitment during Spliceosome assembly.
- such network can be used to identify general and particular mechanisms of AS regulation and to identify key SFs that mediate the effects on cell perturbations that affect AS, such as those induced by iron or by drugs targeting components of the splicing machinery, such as the anti-cancer drugs spliceostatine and meayamicine.
- Such splicing factors represent targets for finding or improving compounds aimed to modulate the process where they are involved, such as iron metabolism, or conditions, disorders and disease where AS is altered, such as some cancer types.
- the first step is perturbing the alternative splicing conditions in a cell by submitting it to one or more splicing perturbing stimuli.
- a splicing perturbing stimulus is any change in the situation / status / condition of a cell that affect the splicing process in said cell.
- the term is analogous, in certain cases, to other terms used throughout the present application such as factor involved in splicing regulation or splicing regulation factor or, simply, splicing factor (SF).
- a splicing regulation factor can be any compound exogenous to the cell, such as a drug or any other compound as to provoke a change in at least a cellular process, or biological compounds naturally involved in the regulation of splicing in cells, such as gene products like proteins or different RNA molecules (included snRNAs and siRNAs) or any other biological compound involved, for instance, in signaling or trafficking that might have an effect in the splicing process.
- gene products like proteins or different RNA molecules (included snRNAs and siRNAs) or any other biological compound involved, for instance, in signaling or trafficking that might have an effect in the splicing process.
- a particular case of a splicing perturbing stimulus is the inhibition of the expression of a gene whose product is involved (or suspected to be involved) in splicing regulation.
- Such group of perturbing stimuli have been the ones used in Example 1 for building the splicing network that has been the basis of the additional assays described in Example 2, the examples where the network is applied for inferring practical conclusions.
- the multiplicity of genes to be inhibited are selected from one or more of the following groups:
- components of the spliceosome core that is, components of the core spliceosome compounds composed of U1 , U2, U4/5/6 snRNPs and factors associated with A, B, Bact and C complexes (Wahl et al., 2009).
- auxiliary factors which are part of the splicing machinery and that are not components of the spliceosome core
- factors involved in mRNA processing that are not part of the splicing machinery, such as those having roles in mRNA translation, polyadenylation, stability and localization in the cytoplasm, included molecules such as microRNAs
- siRNAs small interference RNAs
- siRNA libraries commercially available suitable for the purpose of the present invention, such as ON TARGET PLUS (Dharmacon), where siRNAs for inhibiting genes of the three first categories can be found, or siGENOME (Dharmacon).
- ON TARGET PLUS Dharmacon
- siRNAs for inhibiting genes of the three first categories can be found
- siGENOME siGENOME
- mRNA is isolated and processed.
- assays set forth in Example 1 of the present application which have been the basis for the network modeling, mRNA was purified 72 hours posttransfection. As commented at the end of section 1 .2. a of Example 1 , mRNA isolation 48 hours posttransfection does not mean any significant change in the results obtained. Moreover, as set forth in section 1 .2.
- Example 1 cell viability is not generally compromised after 72 h of knockdown of 13 individual core splicing factors, which indicate that the changes in AS are not due to the induction of cell death upon depletion of essential SF even 72 hours posttransfection, so that the time points of 48 hours and 72 hours posttransfection and any other time point comprised between said points can be considered suitable for mRNA isolation, particularly when the assays are performed with HeLa cells.
- an automatized system for mRNA isolation and cDNA amplification can be used, as in Example 1 of the present application. Subsequently, it is necessary to determine the impact that knocking down each of the genes has had in the use of any one of the set of alternative splicing sites selected for carrying out the method of the present invention. For determining such impact, the percentage of mRNAs samples where the exon has been excluded must be determined and compared with that of a control sample where no inhibition of the same gene has been induced and/or no perturbation stimulus has been provoked.
- each one of the possible forms of the mRNA corresponding to a gene can be used, such as amplifying by PCR the cDNA obtained by retrotranscribing the isolated total mRNA.
- Total mRNA can be isolated by different known techniques, such as binding to oligo-dTs, which might be linked to a plate surface or to any material suitable for filling affinity columns.
- the primers can be oligonucleotides complementary to the exon-flanking regions.
- the levels of each mRNA form can be measured by an appropriate technique, such as high throughput capillary electrophoresis.
- ASE alternative splicing events analysed in the assays shown in section 1 .2 of Example 1 were initially 47, as can be seen in Table 5a, and were chosen because they are all events relevant for the regulation of cell proliferation and/or apoptosis. Detailed information about all of them can be found on https://s3.amazonaws.com/SplicinqNet/ASEs.zip.
- Fig. 2B shows a classification of the corresponding genes, sorted out in accordance with the cellular process (apoptosis or cell proliferation) where they are involved.
- ASE analysed in the Examples shown in the present application can be considered cancer-relevant, because the identification of new targets for the developing of anticancer drugs has been considered to be one of the important embodiments and practical applications, with clear industrial interest, of the method of the present invention, but the selection of other or additional subsets of ASE might be advisable when further insight in the mechanism of alternative splicing of other processes is desired or when targets for the modulation of other different processes, particularly those involved in disease where AS is altered, are sought.
- Fig. 4B that plots the number of deduced edges (y-axis) as a function of the number of assayed events (x-axis), supports the validity of the chosen approach: it is a key result that bears weight to the methodologies and results of the present approach.
- the plot compares the curve derived from actual-data based networks to the curve derived from shuffled data that should contain no meaningful associations (the technical, statistical term for this process is generation of data that preserve the marginal distributions parameters while expunging the correlation structure of the joint distribution). In the range of 1 -10 assayed events the two curves are almost linear and have a similar slope (steepness or gradient).
- edges inferred based on small number of events are completely unreliable and close to pure noise.
- the slope of the curve representing the random data remains constant while the slope of the curve representing the actual data gradually decreases and the as a result the two curves begin to diverge. This means that the rate at which edges as pruned as more events are assayed is lower for the actual than for the random data. Consequently, as the number of events increase, a lesser fraction of the obtained edges is expected to represent false associations.
- This fraction (also known as False Discovery Rate, FDR) can be in fact estimated by calculating the ratio of random to actual edges at any specific number of events. As the two curves diverge to a greater degree for larger numbers of assayed events, the FDR also decreases meaning that our edges become more reliable.
- a near-zero slope means that the rate at which edges are pruned as more events are assayed is also close to zero. Therefore, the number of inferred edges when more than 30 events are assayed is approximately constant (around 500 edges) suggesting that this number of edges is a lower-bound on the number of true functional associations.
- the processing of the data and the design of a framework for analysing such data and modelling a network from them is another important pillar of the method of the present invention.
- the generation of perturbation profiles and their covariance analysis, as well as the processing of the results of such analysis for modelling the network are key for the invention.
- the covariance analysis performed and the careful selection of the statistical- computerized tools applied, as well as the specific parameters and conditions chosen for their implementation for the purposes of the present invention have been relevant for developing it, as previously commented.
- each data corresponding to the percentage of mRNA isoforms with the exon included is preferably transformed in its corresponding Z-score (http://en.wikipedia.org/wiki/Standard score; see below the methodological section of the Examples for details about the calculations applied for the assays of the present application).
- the perturbation profiles of alternative splicing events are the lines which connect Z-score values obtained for a particular perturbing stimulus for each one the alternative splicing events analyzed in the study.
- the perturbation profile represents its impact along the alternative splicing events analyzed with regard to its magnitude and change direction.
- Fig. 2E shows the perturbation profiles obtained in Example 1 upon knocking down four different genes, the first two with similar profiles, whereas the other two have opposed profiles, that is, for most ASEs analyzed, the effect of knocking down one of them is opposed to the effect of knocking down the other one.
- the construction of the interaction network is based on quantifying the similarity between two perturbation profiles for each pair of factors (inhibited genes or perturbation stimulus in general) included in the study. That quantification has been referred above as covariance analysis.
- Another important step before comparing the data corresponding to different perturbation profiles is preprocessing and reducing the obtained data of the impact of each perturbation in each selected alternative splicing event. It comprises removing sparse variables and imputing missing values, removing uninformative events and scaling data by standardization.
- the specific approaches carried out for the assays of the Examples of the present application are described in the methodological section located immediately before the Examples, under the subheading "Network construction. Data preprocessing and reduction".
- the scaling of each knocking down is important, because it has as effect that only the relative magnitude (i.e. the shape, not the scale) of the perturbation profiles is important for inferring associations between different factors.
- the estimation of covariance of perturbation profiles of alternative splicing events carried out for the assays of the present Examples was performed by quantifying the correlation between each pair of perturbation profile basing it on an iterative weighting algorithm, so that the estimated correlation for two pairs of genes or perturbing stimuli X a and X b is the weighted Pearson's correlation
- w is a vector whose length is equal to the number n of alternative splicing events that is processed after data preprocessing, which vector contains the reliability values FF a,b corresponding to each Z-score for the estimation of the correlation between two perturbation profiles, wherein the values Ff a b are calculated with the formula
- D u (X ai X b ) ⁇ p(X ai X b ) - p_ u iX ai X b ) ⁇ wherein p(X a , X b ) and p- u (X a ,X b ) are the Pearson's correlation estimates before or after removing the observations M au , M bu coming from an splicing event u, and using iteratively said algorithm until estimations converge.
- any alternative methodology selected for estimating the correlation among profiles should be also based on an algorithm that discriminates among outliers arising from technical reason and those corresponding to reliable measures.
- a regularization parameter which can be seen as a penalty that can be tuned to control the number of inferred connections together with the false discovery rate (FDR) of the final model.
- FDR false discovery rate
- both the number of inferred connections and the FDR are inversely correlated with the number of assayed ASEs.
- Example 2 indicates that the network reconstruction converges to -500 connections with FDR ⁇ 5% and approximately 35 ASEs, which is an indication that, at least for the particular network constructed, including additional ASEs in the first steps of the method might have little effect in the accuracy of the network.
- Fig. 4A The network of functional interactions depicted in Fig. 4A. It comprises 196 nodes, which represent the regulatory factors (knocked down genes maintained after preprocessing and reduction of data) and 541 connections (edges), 518 corresponding to positive functional associations (green connecting lines in the original) and 23 corresponding to negative associations (red connecting lines in the original). Line thickness is proportional to the strength of the functional interaction and node size is proportional to the overall impact (median Z-score) of a given knockdown in regulation of AS.
- Known physical interactions, as reported in the STRING database, are represented adding a black dotted line over the line connecting two nodes (factors).
- the topology of the network recapitulates the topology of the known splicing complexes and provides an extended map of more than 500 functional associations. It can be easily identified a "central" grouping of densely connected factors where the components of the spliceosome core are comprised, where the factors physically associated to U2 snRNP and factors functionally related with its function can be found, as well as an adjacent grouping, corresponding to the factors physically associated to snRNP U5 or U4/U5/U6 snRNP. In the periphery there are factors with a lower connectivity with some connections towards the central core, where the classical splicing regulatory factors can be found, as well as several factors involved in modelling chromatin structure. An intermediate category, with a lower density of connections with regard to the central core, corresponds to RNA dependent DEAD/X box helicases. Persistent factors of the spliceosome core are particularly well connected ones to the others.
- the obtained network provides comprehensive information about SFs (and some additional chromatin factors) relevant to understand the regulation of 35 AS events important for cell proliferation and apoptosis. But not all connections correspond to previously known associations, which demonstrates the utility of the network as a tool for getting further insight in the mechanism of alternative splicing, so that the method of the present invention, based on the combined experimental and statistical approach described in detail in the Examples of the present application, provides a powerful toolset for studying the splicing process and its regulation. It can be useful to systematically capture information about other aspects of transcriptional or post-transcriptional gene regulation by analysing the functional connections of factors known to be involved in such process, also providing new targets for transcriptional or post-transcriptional regulation of particular genes
- the network analysis also reveals functional links between SFs, which in some cases are based upon physical interactions.
- the reconstruction of the known topology of some complexes by the network suggests that the approach captures important aspects of the operation of these particles and therefore, the method of the present invention has the potential to provide novel insights into the composition and intricate workings of multiple Spliceosomal sub-complexes.
- the method can be used for identifying splicing factors forming part of a same splicing subcomplex, as those splicing factors that correspond to nodes that appear clustered in a same region of a network and with connections among them.
- said nodes will be highly connected among them to identify them as corresponding to factors belonging to the same splicing subcomplex.
- the method of the invention can be used to identify, for instance, functional connections that persist in all kinds of alternative splicing events and that can be considered to correspond to general interactions among splicing factors, essential for the process being carried out irrespective of the alternative splicing event considered, and those corresponding to associations of factors that are specific for certain ASEs or groups of ASEs.
- Such possible embodiments of the method of the invention are exemplified in sections 2.1 . a and 2.1 .b of Example 2 and can even be considered an additional aspect of the present invention, due to the utility to identify the specific splicing regulatory factors implied in certain conditions, such as particular disease conditions.
- the method of the present invention can serve as a resource for exploring mechanisms of AS regulation induced by perturbations of the system, including genetic manipulations, internal or external stimuli or exposure to drugs.
- the network can be used to identify a link between AS changes and variations in the cellular condition or status (in the case of section 2.3. a, variations in intracellular iron).
- section 2.3. a variations in intracellular iron.
- Other examples include a) the identification of the extensive regulatory overlap between the interacting proteins IK/RED and SMU1 , relevant for the control of programmed cell death; b) evidence for a general role of uridine-rich hnRNP C binding sequences (some associated with transposable elements, Zarnack et al., 2013) in the regulation of nearby alternative exons via antagonism with U2AF; and c) delineation of U2 snRNP components and other factors, including PPIH, that are functionally linked to the effects of anti-tumor drugs on AS.
- the assays set forth in the present application reveal changes of AS regulation mediated either by core splicing components or by classical regulatory factors like proteins of the SR and hnRNP families. While the central core of functional links is likely to operate globally, alternative configurations (particularly in the periphery of the network) are likely to emerge if similar approaches are applied to other cell types, genes or biological contexts, what makes advisable, as previously commented, to select the cell types wherein the assays are carried out, the set of inhibited genes and/or additional perturbing stimulus for submitting cells to them, and the set of alternative splicing events specially for purpose which is sought when the method of the present invention is applied, keeping in mind that all possible embodiments arisen from differences in the selection of said features are encompassed by the scope of the present invention.
- the results of the genome-wide si RNA screen for regulators of Fas AS set forth in section 1 .1 . of Example 1 of the present application provide unbiased evidence that an extensive number of core SFs have the potential to contribute to the regulation of splice site selection. This is in fact the most populated category of screen hits. Similarly, the results inferred form the network highlight coherent effects on alternative splice site choice of multiple core components, revealing also that the extent of their effects on alternative splice site selection can be largely attributed to the duration and order of their recruitment in the splicing reaction.
- the regulatory plasticity revealed by the present network analysis may be contributed, at least in part, by the emerging realization that a substantial number of SFs contain disordered regions when analyzed in isolation. Such regions may be flexible to adopt different conformations in the presence of other spliceosomal components, allowing alternative routes for spliceosome assembly on different introns, with some pathways being more sensitive than others to the depletion of a general factor.
- SF3B1 a component of U2 snRNP involved in branch point recognition
- myelodysplastic syndromes Yoshida et al., 201 1
- chronic lymphocytic leukemia Quesada et al., 201 1
- other cancers correlating with different disease outcomes.
- SF3B1 is the physical target of anti-tumor drugs like Spliceostatin A and -likely- Meayamycin, as captured by the assays set forth in Example 2 of the present application.
- SF3B1 participates in the stabilization and proofreading of U2 snRNP binding to the branch point region and it is therefore possible that variations in the activity of this protein result in switches between alternative 3' splice sites harboring branch sites with different strengths and/or flanking decoy binding sites. Similar concepts may apply to explain the effects of mutations in other SFs linked to disease, including for example mutations in PRP8 leading to Retinitis Pigmentosa.
- the applicability of the method of the present invention as a piece in the development of applications with more direct industrial interest can be seen more clearly when it is considered the potentiality of the method when the set of perturbing stimuli selected for subjecting cell to them is not only restricted to the inhibition / knocking down of specific genes that are (at least potentially) splicing regulatory factors, but at least a different perturbing stimulus is included, such as submitting the corresponding cell or cells to the action of an added compound.
- the drug can be, for example, a drug known to have a therapeutic effect on a disease associated with altered alternative splicing, as it has been done in section 2.2 of Example 2 of the present application, where the known anti-cancer drug spliceostatin A, and a structurally similar drug, meayamycin, have been added to cells.
- Applying the method of the invention including such perturbing stimuli gives rise to finding that both drugs have direct connections with SF3B1 , which is a known physical target of spliceostatin, which confirms said factor as a target of interest for the identification and developing of other anti-cancer drugs.
- Example 2 shows a method for the identification of new potential anti-cancer drugs from the previous identification of the targets where they can be directed.
- an added compound can be identified as a drug for the treatment of a disease associated with altered alternative splicing when it has at least a direct connection in common with a second compound, which second compound is a drug known to have a therapeutic effect on a disease associated with altered alternative splicing.
- the second compound can also have been added as a perturbing stimulus for carrying out the method of the invention or their functional associations can have been previously identified, either by the method of the present invention or by any other method.
- the method of the present invention can be of help for finding additional targets for the developing of drugs or even for finding drugs against diseases so important as cancer, Duchenne muscular dystrophy, spinal muscular atrophy, or other neuromuscular or neurological disease that are associated to altered alternative splicing.
- the method of the invention can be also of use for identifying new targets for the development of modulators of physical process where an added compound is known to act as a modulator or new candidates to modulators of said process.
- the network modelled for carrying out the method of the present invention also shows which connections correspond to positive or negative functional associations among the splicing factors represented in the nodes and, even, the width of the connecting lines is proportional to the strength of association, the method of the invention and its network can be used for selecting candidates to compounds having a different modulating direction that the compound whose target is already known.
- the case of hemin and desferal can illustrate this potentiality: the fact that their connection is negative indicates that they have opposite effects regarding intracellular iron, information which could be of use when the activity of one of them is not known and a compound when the opposed activity is sought.
- the method can even be carried out both with cells removed from a patient suffering from a disease or malfunction and with a different kind of cells deriving from and individual not suffering that disease or malfunction and those factors showing different connection in the two generated networks could be identified as targets for directing to them compounds intended to be candidates to drugs against said disease or malfunction.
- HeLa CCL-2 cells and HEK293 cells were purchased from the American Type Culture Collection (ATCC). Cells were cultured in Glutamax Dulbecco's modified Eagle's medium (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (Gibco, Life Technologies) and penicillin/streptomycin antibiotics (penicillin 500 u/ml; streptomycin 0.5 mg/ml, Life Technologies). Cell culture was performed in cell culture dishes in a humidified incubator at 37°C under 5% C0 2 .
- HeLa cells were forward-transfected with siRNAs targeting IK, SMU1 or both genes by plating 2500 cells over a mixture containing siRNA-RNAiMAX lipofectamine complexes, as previously described. Indirect estimations of cell proliferation were obtained 24, 48 and 72 hours post transfection by treating the cells for 4h with resazurin (5 ⁇ ,) prior to the fluorescence measurements (544 nm excitation and 590 nm emission wavelengths). Plate values were obtained with an Infinite 200 PRO series multiplate reader (TECAN).
- HeLa cells were transfected with siRNAs against IK, SMU1 or both genes, as described above. Cells were trypsinized and collected for analysis 72 hours post transfection. Pellets were washed once with complete DMEM medium (10% serum plus antibiotics), and three times with PBS 1 X. Cells were then resuspended in 200 ⁇ Binding buffer provided by the Annexin V-FITC Apoptosis Detection Kit (eBiosciences), resulting in a final density of 4x10 5 cells/ml. 5 ⁇ of Annexin V-FITC was added to each sample followed by 10 min incubation at room temperature in dark conditions.
- PBMCs cells were supplemented over a total period of 48 hours with PHA (10 ⁇ 9 ⁇ , Sigma Aldrich) or vehicle. 24 hours after initial stimulation, cells were treated for a period of 12 hours with either mock, hemin or desferal conditions (100 ⁇ ) and cells were washed twice with PBS 1 X before apoptosis induction. Fas mediated apoptosis was induced by incubating treated cells with anti-Fas antibody (1 ⁇ g/ml, Human activating clone CH1 1 , Millipore) or isotype control IgG over a period of 16 hours.
- PHA 10 ⁇ 9 ⁇ , Sigma Aldrich
- vehicle 24 hours after initial stimulation, cells were treated for a period of 12 hours with either mock, hemin or desferal conditions (100 ⁇ ) and cells were washed twice with PBS 1 X before apoptosis induction. Fas mediated apoptosis was induced by incubating treated cells with anti-Fas
- Genosplice Technology was performed by Genosplice Technology and the date (gene expression, alternative splicing changes and gene ontologies upon IK, SMU1 knockdown conditions) is available at: https://s3.amazonaws.com/SplicinqNet HJAY arravs.zip and at GEO database with the accession number GSE56605.
- HeLa cells were forward transfected in triplicate in 96 well plates with a siRNA library against known and predicted protein-coding human genes, comprising >21000siRNAs (genome wide screen, SMARTpools siGENOME, Thermo- Scientific) or 250 spliceosome related siRNAs (Pilot screen, SMARTpools ON TARGET PLUS, Thermo-Scientific) using an automatized robotic procedure (Sciclone Liquid Handling workstation, Perkin Elmer).
- a siRNA library against known and predicted protein-coding human genes comprising >21000siRNAs (genome wide screen, SMARTpools siGENOME, Thermo- Scientific) or 250 spliceosome related siRNAs (Pilot screen, SMARTpools ON TARGET PLUS, Thermo-Scientific) using an automatized robotic procedure (Sciclone Liquid Handling workstation, Perkin Elmer).
- HeLa cells were transfected in biological triplicates with siRNAs pools (ON TARGET plus smartpool, Dharmacon, Thermo Scientific) against 270 splicing and chromatin remodeling factors (see Table 1 ).
- RNA samples corresponding to treatments with splicing arresting drug were isolated with the Maxwell 16 LEV simplyRNA kit (Promega).
- Spl. Factors Splicing factors
- SR proteins Splicing-site recognition proteins
- Core Spl. Factors of the spliceosome core
- Isolated cellular mRNAs were reverse-transcribed in 96 well plates with superscript I II retro transcriptase (Invitrogen, Life Technologies) in the presence of oligo-dT (Sigma-Aldrich, Cat No. 0487) and random primers (Life Technologies) following the manufacturer's instructions.
- the list of barcoded primers used in the pilot screening is the following one:
- SEQ ID NO:423 Reverse primers: Head: barcode; to 539)
- Forward primers -SEQ ID NO: 660: reverse primers
- tails are common in all reverse primers (gaaccttggtttttcctttctgtg) (SEQ ID NO: 660) and in all forward primers (gaacatggaatcatcaaggaatg) (SEQ ID NO:661 ).
- SEQ I D NO:423 to SEQ ID NO:539 represent the barcode part of each of these primers, ordered as in Table 2.
- Forward and reverse Fas barcoded primers were designed by combining sequences in Fas exons 5 or 7 with a list of barcodes previously reported by Hamady et al. (Hamady et al., 2008). Amplicon length provided enough coverage to measure Fas inclusion and skipping isoforms in the deep sequencing assay. Primers for quantitative analysis of other genes were designed using Primer 3 Plus (https://www.bioinformatics.nl/cai-bin/primer3Dlus/primer3plus.cgi) using the reference sequence and / or Refseq accession numbers.
- First strand cDNA synthesis was set up with 500 ng of RNA, 50 pmol of oligo-dT (Sigma-Aldrich), 75 ng of random primers (Life Technologies), and superscript I II reverse transcriptase (Life Technologies) in 20 ⁇ final volume, following the manufacturer's instructions.
- Quantitative PCR amplification was carried out using 1 ⁇ of 1 :2 to 1 :4 diluted cDNA with 5 ⁇ of 2X SYBR Green Master Mix (Roche) and 4 pmol of specific primer pairs in a final volume of 10 ⁇ in 384 well-white microtiter plates, Roche).
- qPCR mixes were analyzed in triplicates in a Light Cycler 480 system (Roche) and fold change ratios were calculated according to the Pfaffl method (Pfaffl, 2001 ).
- the primers used for real time qPCR analysis of a variety of genes with important alternative splicing events were the following:
- FAS intron 2 R AAGCTGTTGGTTTCTGCCTG 548
- RNAs were reverse-transcribed using superscript I II retro transcriptase (Invitrogen, Life Technologies) following the manufacturer's recommendations. PCR reactions for every individual splicing event analyzed were carried out using forward and reverse primers in exonic sequences flanking the alternatively spliced region of interest and further reagents provided in the GOTaq DNA polymerase kit (GoTaq, Promega). Primers used in this study are listed in Table 5b.
- Hemin, Deferoxamine (Desferal) and Ciclopirox olamine were purchased from Sigma Aldrich. HeLa or HepG2 cells were treated with these reagents at 100 ⁇ for 18-24h to modulate intracellular iron levels.
- RNA was isolated using the RNeasy minikit (Quiagen) following manufacturer's recommendations and RNA quality was assessed by Agilent Bioanalyzer nano assay and nanodrop spectrophotometry (Thermo- Scientific). 24h after treatment with iron-modulating drugs, cells were washed twice with 1 X PBS and then stained with 5 ⁇ of PhenGreen SK diacetate (Life Technologies) in PBS for 15 min at 37°C.
- Robust correlation estimation is based on an iterative weighting algorithm, implemented in R code, that discriminates between technical outliers and reliable measurements with high leverage.
- the weighting for measurements relies on calculation of a reliability index that takes into account their cumulative influence on correlation estimates of the complete dataset.
- a measure of the reliability of these measurements for the estimation of p(X a , X b ) given all the observed data is then based on their cumulative influence on high correlates of X a and X b .
- T being a minimum correlation threshold for considering a pair of variables.
- the algorithm can be used iteratively, however in the author's experience the estimates converge within 1 to 2 iterations.
- ⁇ is an estimate for the inverse covariance matrix ⁇ 1
- S is the empirical covariance matrix of the data
- ⁇ is the L 1 norm i.e. the sum of the absolute values of all elements in ⁇ ⁇ 1
- r is a regularization parameter (in this case selected based on estimates of the FDR, see below).
- the solution to the glasso optimization is convex and can be obtained using coordinate descent.
- the glasso process for network reconstruction was implemented using the glasso R package by Jerome Friedman, Trevor Hastie and Rob Tibshirani (http://statweb.stanford.edu/ ⁇ tibs/qlasso/).
- Network modules or communities can be defined loosely as sets of nodes with a more dense connection pattern among their members than between their members and the remainder of them. Module detection in real-world graphs is a problem of considerable practical interest as they often capture meaningful functional groupings.
- the network modularity M(p) is defined as: where m is the number of modules in p, l k is the number of connections within module k, L is the total number of network connections and d k is the sum of the degrees of the nodes in module k.
- R- mode PCA Principal Component Analysis for ancillary edges was performed using R- mode PCA (R function princomp).
- the input dataset is the scaled 95x35 matrix containing the absolute average correlation for each of the 95 edges over the subsets of the 10,000 samples that included each of the 35 events.
- the coordinates for projecting the 95 edges are directly derived from their scores on the first two principal components.
- the arrows representing the top 10 discriminatory events were drawn from the origin to the coordinate defined by the first two PC loadings scaled by a constant factor for display purposes.
- PWMs position weight matrices
- the matrices were built using a set of human splice sites from constitutive, internal exons compiled from the hg19 UCSC annotation database (Karolchik et al., 2014). Background nucleotide frequencies were estimated from a set of strictly intronic regions. Threshold was set based on a FDR of 0.5/kbp of random intronic sequences generated using a 2nd order Markov chain of actual intronic regions.
- Annotation of ALU elements was based on the RepeatMasker track developed by Arian Smit (http://www.repeatmasker.org) and the Repbase library (Jurka et al., 2005).
- samples were treated with proteinase K in PK buffer (100 mM Tris-HCI pH 7.4, 50 mM NaCI, 10 mM EDTA) for 20 min at 37 S C and then incubated in PK buffer supplemented with 7M urea for further 20 min at 37 S C.
- PK buffer 100 mM Tris-HCI pH 7.4, 50 mM NaCI, 10 mM EDTA
- RNA was extracted by phenol-chloroform extraction followed by ethanol precipitation and samples were reverse transcribed and analyzed by real-time qPCR.
- siRNAs targeting all known and predicted human protein-coding genes was transfected in HeLa cells using a robotized procedure. 72 hours after transfection, mRNAs were isolated in oligodT plates using an automated protocol ( Figure 1 A) and cDNA libraries of the 22000 transcriptomes were then generated by automatized reverse transcription using oligodT and random hexamers. To interrogate the ratio of Fas/CD95 exon 6 inclusion/skipping in these libraries, PCR reactions were set up using barcoded primers corresponding to sequences in the flanking exons 5 and 7.
- each individual siRNA condition is identified by a particular combination of two barcodes, one in each of the PCR primers (Fig. 1 A).
- the PCR products were pooled together (>26000 different conditions including controls) and the sequences of individual molecules determined by paired-ended lllumina HiSeq sequencing (532 million reads in total, 100 nucleotide length, obtained either from pooled or technical replicate samples, see Supplementary Methods). This provides on average more than 4.000 reads per technical replicate or 20.000 reads per knockdown condition, which allows a robust determination of isoform ratios.
- a first category contains proteins involved in DNA metabolism, including transcription factors (e.g. MYC, MYBL1 ), proteins with dual roles in transcription and splicing that have been previously linked to DNA damage response (e.g. SKI I P or ZNF830), topoisomerase-associated factors (e.g. TOP2A and TOPB1 ) and chromatin remodeling factors (e.g. components of the SWI/SNF complex or the histone methyl-transferase SETD2). These factors may affect Fas/CD95 AS through mechanisms involving the coupling between transcription and RNA processing.
- transcription factors e.g. MYC, MYBL1
- proteins with dual roles in transcription and splicing that have been previously linked to DNA damage response e.g. SKI I P or ZNF830
- topoisomerase-associated factors e.g. TOP2A and TOPB1
- chromatin remodeling factors e.g. components of the SWI/SNF complex or the histone methyl-transferase SETD
- Fas/CD95 AS Factors involved in other aspects of RNA metabolism include components of the THO complex, which are deposited after capping and splicing of pre-mRNAs and promote RNA transport, suggesting that differential export of transcript isoforms contributes to the observed ratios between alternatively spliced mRNAs.
- a third category of regulators of Fas/CD95 AS includes various factors acting outside of the nucleus to activate particular signaling pathways, including Fibroblast Growth Factor Receptor 1 and several members of the Ras- and Rho- families of small GTPases. The data also indicate a link between Fas/CD95 splicing and several genes encoding mitochondrial proteins involved in the regulation of energy metabolism, including enzymes implicated in sugar and fatty acid catabolism and oxidative phosphorylation.
- core SFs defined as proteins identified in highly purified spliceosomal complexes assembled on model, single intron pre-mRNAs, Wahl et al, 2009
- ASEs were selected due to their clear impact on protein function and their documented biological relevance. As represented in Fig. 2B, they can be grouped in apoptosis related events, cell proliferation related events and events having features of the first two groups. They can be found listed below in Table 5a, wherein the common abbreviated gene symbol, the gene identification number in HUGO database (http://www.qenenames.org/) ("Gene ID”), the sequence of the alternatively spliced exon ("Exon sequence”) and its size, the strand where said sequence can be found, the number of the human chromosome where the gene can be found ("Chr name”), the chromosome size (“chr size”), and the chromosome positions where the exon starts ("start”) and ends (“end”) are indicated.
- Table 5a wherein the common abbreviated gene symbol, the gene identification number in HUGO database (http://www.qenenames.org/) ("Gene ID”), the sequence of the alternatively spliced exon ("Ex
- sequences of the spliced exons can be found in the sequence listing (SEQ I D NO:1 to SEQ ID NO:46).
- the forward and reverse primers used for identifying the events are also indicated (see Table 5b), together with the length of the expected products upon inclusion or skipping of the alternative exon. In some cases exon inclusion or skipping leads to two distinct products (because of the use of alternative 5' or 3' splice sites) and the sizes of the alternative products are indicated in these cases.
- PLM2 In one instance (PKM2), two alternative mutually exclusive exons are used, which generate products of the same size, which can be distinguished by the use of restriction endonucleases that cut one product and not the other: In this case the sizes of the products of restriction digestion corresponding to one of the alternatively spliced products are indicated.
- a library of 270 siRNA pools was used, corresponding to genes encoding core spliceosomal components as well as auxiliary regulatory SFs and factors involved in other RNA-processing steps, including RNA stability, export or polyadenylation.
- 40 genes involved in chromatin structure modulation were included, to probe for possible functional links between chromatin and splicing regulation, particularly taking into account that some of the genes identified as FAS AS regulators in the assays described in section 1 .1 were genes related to chromatin remodeling and histone modification (SMARCA4, SMARCC2, SMARCD1 , SAP18, SETD2).
- SMARCA4, SMARCC2, SMARCD1 , SAP18, SETD2 genes related to chromatin remodeling and histone modification
- siRNA pools were individually transfected in biological triplicates in HeLa cells using a robotized procedure. 72 hours post-transfection RNA was isolated, cDNA libraries generated using oligo-dT and random primers and the patterns of splicing probed by PCR using primers flanking each of the alternatively spliced regions (see summary of the procedure in Fig. 2A). PCR products were resolved by high throughput capillary electrophoresis (HTCE) and the ratio between isoforms calculated as the Percent Spliced In (PSI) index (Katz et al., 201 1 ), which represents the percentage of exon inclusion/alternative splice site usage.
- PSI Percent Spliced In
- Knockdowns of factors affecting one ASE were also validated with siRNA pools from a second library and by a second independent technique, High Throughput Capillary Electrophoresis. Conversely, the effects of knocking down core SFs (P14, SNRPG, SF3B1 ) on the ASEs were robust when different siRNAs and RNA purification methods were used.
- Fig. 2D shows the spread of the effects of knockdown for all the factors in the screen for the ASEs analyzed. Three events (VEGFA, SYK and CCND1 ) were excluded from further analysis, because they were not affected in the majority of the knockdowns (median absolute APSkl , Fig. 2D).
- Fig. 2E show examples of such profiles and the relationships between them:
- knockdown of CDC5L or PLRG1 generates very similar perturbation profiles (upper diagrams in Figs. 2E and 2F), consistent with their well-known physical interactions within the PRP19 complex (Makarova et al., 2004).
- the profiles associated with the knockdown of SNRPG and DDX52 are to a large extent opposite to each other (lower diagrams in Figs. 2E and 2F), suggesting antagonistic functions.
- Perturbation profiles and relationships between factors were not significantly changed when knockdown of a subset of factors was carried out for 48 hours, arguing against AS changes being the consequence of secondary effects of SF knockdown in these cases.
- ASEs relevant for the control of programmed cell death cluster together and are similarly regulated by a common set of core spliceosome components. This observation suggests coordinated regulation of apoptosis by core factors, although the functional effects of these AS changes appear to be complex.
- Another example are two distinct ASEs in the fibronectin gene (cassette exons EDA and EDB, of paramount importance to control aspects of development and cancer progression, Muro et al., 2007) which cluster close together, suggesting common mechanisms of regulation of the ASEs in this locus.
- knockdowns of factors that persist during spliceosome assembly cause AS changes of higher magnitude than those caused by knockdowns of transient factors involved in early spliceosomal complexes, which in turn are stronger and more disperse than those caused by factors involved in middle complexes and in complex C formation or catalytic activation (Fig. 3C).
- knockdown of persistent factors tends to favor skipping, while the effects of knockdown of more transient factors are more split between inclusion and skipping (Fig. 3D and Fig. 3E).
- EJC EJC
- Fig. 3C transient early or mid splicing complexes
- Glasso seeks a parsimonious network model for the observed correlations. This is achieved by specifying a regularization parameter, which serves as a penalty that can be tuned in order to control the number of inferred connections (network sparsity) and therefore the false discovery rate (FDR) of the final model. For a given regularization parameter, both the number of inferred connections and the FDR are a decreasing function of the number of ASEs assayed (Fig. 4B).
- Random sampling with different subsets of the real or reshuffled versions of the data indicates that network reconstruction converges to -500 connections with a FDR ⁇ 5% near 35 events (Fig. 4B) implying that analysis of additional ASEs in the screening would have only small effects on network sparsity and accuracy.
- the complete network of functional interactions among the screened factors is shown in Figure 4A. It is comprised of 196 nodes representing screened factors and 541 connections (average degree 5.5), of which 518 correspond to positive and 23 to negative functional associations.
- the topology of the resulting network has several key features.
- the first class encompasses factors that form densely connected clusters comprised of core spliceosomal components (Fig. 4A). Factors physically linked within U2 snRNP and factors functionally related with U2 snRNP function, and with the transition from complex A to B, form a tight cluster (group of dark-shaded circles in the upper right part of the inset of Fig. 4A, in red in the original).
- An adjacent but distinct highly linked cluster corresponds mainly to factors physically associated within U5 snRNP or the U4/5/6 tri-snRNP (group of dark-shaded circles in the bottom left part of the inset of Fig. 4A, shaded in blue in the original). Factors in these clusters and their mutual links encompass 23% of the network nodes but 63% of the total inferred functional associations (average degree 14.5).
- a second category includes factors that form a periphery of lower connectivity that occasionally projects to the core. This category includes many of the classical splicing regulators (e.g. SR proteins, hnRNPs) as well as several chromatin factors.
- An intermediate category -more densely interconnected but not reaching the density of interactions of the central modules- includes multiple members of the RNA-dependent DEAD/X box helicase family.
- Factors that belong to consecutive complexes are significantly more linked to each other than factors that belong to early and late complexes, and factors that transiently assemble towards the final stages of spliceosome assembly display the least number of connections (Fig. 4D and Fig. 4E).
- core SFs particularly those that persist during assembly, display highly related functions in splice site recognition and fluctuations in their levels or activities have related consequences on the modulation of splice site choice.
- 20% can be attributed to known physical interactions and 82% of these are among core components (Fig. 4A). Examples include tight links between the two subunits of U2AF, between the interacting partners PLRG1 and CDC5L, or IK and SMU1 .
- the retrieved set of connections are shown in Fig. 5A and they can be considered to represent a "basal" or indispensable splicing circuitry that captures close similarities in function between SFs regardless of the subset of splicing substrates considered.
- the majority of these connections correspond to links between core components, with modules corresponding to major spliceosomal complexes.
- the majority of components of U2 snRNP constitute the most prominent of the core modules (Fig. 5A).
- the module is topological ⁇ subdivided in two sub-modules, one corresponding to components of the SF3a and SF3b complexes and the second corresponding to proteins in the Sm complex.
- U2 snRNP components remarkably recapitulates known topological features of U2 snRNP organization, including the assembly of SF3a/b complexes in stem loops I and I I and the assembly of the Sm ring in a different region of the U2 snRNA (Behrens et al., 1993).
- a second prominent "core” module (that corresponding to the group of nodes located on the right side of Fig. 5A) corresponds to factors known to play roles in conformational changes previous to / concomitant with catalysis in spliceosomes from yeast to human, including PRP8, PRP31 or U5-200.
- PRP8 with PRP31 or U5-1 16K or PRP31 with C20ORF14.
- Affymetrix genome-wide splicing-sensitive microarrays
- the overlap was much more limited with RBM6, a splicing regulator (Bechara et al., 2013) located elsewhere in the network.
- Fig. 6A shows the set of such identified interactions, which therefore represents specific functional links that only emerge when particular subsets of AS events are considered.
- the inset represents graphically the results of Principal Component Analysis (PCA) showing the variability in the strength of these interactions depending on the presence or absence of different ASEs across the subsamples. The most discriminatory set of ASEs for separating these interactions is also shown. While this analysis may be constrained by the limited number of events analyzed and higher FDR due to multiple testing, it can provide a valuable tool for discovering regulatory mechanisms underlying specific classes of ASEs as illustrated by the example below.
- PCA Principal Component Analysis
- Another application of the present network analysis is to identify possible targets within the splicing machinery of physiological or external (e.g. pharmacological) perturbations that produce changes in AS that can be measured using the same experimental setting.
- physiological or external perturbations e.g. pharmacological
- the similarity between profiles of AS changes induced by such perturbations and the knockdown of particular factors can help to uncover SFs that mediate their effects.
- HeLa cells were treated with drugs known to affect AS decisions and the patterns of changes in the 35 ASEs induced by these treatments were assessed by the same robotized procedure for RNA isolation and RT-PCR analysis and used to locate their position within the network.
- ACO1 encodes a moonlighting protein that functions, under conditions of iron-abundance, as an enzyme that converts citrate to isocitrate and, upon iron-depletion, displays an RNA binding activity that modulates the stability / translation of target mRNAs encoding genes (like FTL) that control iron storage or uptake. Under conditions of iron depletion, AC01 represses FTL (ferritin L chain) translation, leading to the release of iron from ferritin storage sites.
- Knockdown experiments were carried out in HeLa (firstly) or HepG2 (secondly) cell lines transfected with siRNA pools against the following genes: AC01 , FTL, TIA1 , the pools corresponding to siGENOME and ON TARGET PLUS, purchased from Thermo Scientific, using Lipofectamine RNAiMAX according to the manufacturer's recommendations. Under such conditions, the levels of ACO1 and FTL proteins themselves, the intracellular iron levels (phen-green SK fluorescence intensity) and the effect on Fas/CD95 exon 6 alternative splicing were measured. The results are represented in Fig. 8, together with the results obtained after the treatment with other compounds related with iron overload or depletion, as described below.
- Hemin intracellular iron overload
- Desferal iron depletion
- Fig. 8E the effects of pharmacological treatments that lead to intracellular iron overload (Hemin) or iron depletion (Desferal, Ciclopirox) were explored.
- HeLa cells were treated with 100 ⁇ Hemin or 100 ⁇ Desferal or cyclopirox olamine
- Hemin treatment led to higher ferritin mRNA and protein levels and lower transferrin mRNA levels, and an overall increase of intracellular iron (measured as a decrease in Phen-green SK fluorescence) in different cell lines (see Fig. 8B).
- Treatment with Desferal had opposite effects (Fig. 8E).
- PBMCs Peripheral Blood Mononuclear Cells
- PHA phyto-haemagglutinin
- APS Autoimmune Lymphoproliferative Syndrome
- Fas/CD95 protein isoform levels While it was technically difficult to evaluate Fas/CD95 protein isoform levels in these cells, the results suggest that the splice site switches induced in Fas/CD95 by regulation of iron levels are biologically relevant.
- SRSF7 is a classical member of the SR protein family of splicing regulators and the only one containing a Zinc-knuckle motif, which is known to be important for SRSF7 binding specificity.
- CLI P crosslinking immunoprecipitation experiments
- HeLa cells transfected with epitope-tagged SRSF7 were UV light irradiated, lysed and, after RNA isolation, the association of SRSF7 with different regions of Fas/CD95 alternatively spliced region was tested by qPCR using consecutive 80 nucleotide amplicons covering the alternatively spliced genomic sequences of Fas/CD95 from exon 5 to exon 7, both in control (CN) cells or cells treated with 100 ⁇ Hemin for 24 hours.
- CN control
- SRSF7 recombinant SRSF7 protein expressed in and purified from E. coli was partially denatured and refolded in the presence of Fe2+ or Zn2+ and binding to previously described SRSF7 SELEX RNA motifs tested in filter binding assays. Refolding of SRSF7 in the presence of Zn2+ enhanced RNA binding, while refolding in the presence of Fe2+ decreased binding to this RNA. These differences were negligible when a SRSF7 variant lacking the Zinc-knuckle domain or when the binding of another SR protein, SRSF1 ( Figure 6E), were tested.
- Such information might be not only very valuable for scientific knowledge by itself, but it also may be useful for the identification of factors involved in certain disorders and diseases and the selection of targets for finding candidates to drugs for controlling or ameliorating such disorders and diseases.
- the method of the invention can be used, in turn, in the process of identification or assessment of the candidates to drugs and, thus, being a very valuable tool both for basic research and for finding and developing industrial applications to research such as identification and development of new drugs targeting factors involved in the regulation of alternative splicing or, particularly, in the regulation of certain splicing events that are associated to certain diseases or malignancies.
- the exon junction complex controls the splicing of MAPK and other long intron-containing transcripts in Drosophila. Cell. 143 ⁇ 2) :251 -62.
- RNP Small nuclear ribonucleoprotein
- RNA active site residues suggest a function for Prp8 at the catalytic core of the spliceosome.
- Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45. Cell. 709(3):285-96.
- Muraki M., Ohkawara, B., Hosoya, T., Onogi, H., Koizumi, J., Koizumi, T., Sumi, K., Yomoda, J., Murray, M.V., Kimura, H., et al. (2004). Manipulation of alternative splicing by a newly developed inhibitor of Clks. J. Biol. Chem. 279(23) :24246-54.
- Muro A.F., Chauhan, A.K., Gajovic, S., laconcig, A., Porro, F., Stanta, G., Baralle, F.E.
- Pena V., Liu, S., Bujnicki, J.M., Luhrmann, R., Wahl, M.C. (2007). Structure of a multipartite protein-protein interaction domain in splicing factor prp8 and its link to retinitis pigmentosa. Mol. Cell. 25(4) :615-24.
- Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia. Nat. Genet. 44(1 ):47-52.
- the 20kD protein of human [U4/U6.U5] tri- snRNPs is a novel cyclophilin that forms a complex with the U4/U6-specific 60kD and 90kD proteins.
- ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Theoretical Computer Science (AREA)
- Bioinformatics & Computational Biology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Medical Informatics (AREA)
- Genetics & Genomics (AREA)
- Evolutionary Biology (AREA)
- Pathology (AREA)
- Physiology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2015357028A AU2015357028A1 (en) | 2014-12-03 | 2015-12-03 | Method for the identification of gene regulation targets |
| CA2969179A CA2969179A1 (en) | 2014-12-03 | 2015-12-03 | Method for the identification of gene regulation targets |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14196170.6 | 2014-12-03 | ||
| EP14196170.6A EP3029149B1 (en) | 2014-12-03 | 2014-12-03 | Method of the identification of targets for alternative splicing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016087625A1 true WO2016087625A1 (en) | 2016-06-09 |
Family
ID=52002824
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2015/078603 Ceased WO2016087625A1 (en) | 2014-12-03 | 2015-12-03 | Method for the identification of gene regulation targets |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP3029149B1 (en) |
| AU (1) | AU2015357028A1 (en) |
| CA (1) | CA2969179A1 (en) |
| WO (1) | WO2016087625A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265053A (en) * | 2017-10-26 | 2018-07-10 | 武汉大学 | A kind of screening technique for the antisense oligonucleotides that extron shearing is inhibited to inhibit subfunction |
| CN115083511A (en) * | 2022-06-24 | 2022-09-20 | 西安电子科技大学 | Peripheral gene regulation and control feature extraction method based on graph representation learning and attention |
| CN116286911A (en) * | 2022-10-21 | 2023-06-23 | 上海鑫湾生物科技有限公司 | A spliceable system for regulating viral replication in response to anoxic environment and its use |
| US11752197B2 (en) | 2019-08-12 | 2023-09-12 | Regeneron Pharmaceuticals, Inc. | Macrophage stimulating 1 receptor (MST1R) variants and uses thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3543340A1 (en) | 2018-03-19 | 2019-09-25 | Fundació Centre de Regulació Genòmica | Antisense oligonucleotides and uses thereof |
| CN110414713A (en) * | 2019-06-27 | 2019-11-05 | 电子科技大学 | A real-time runoff prediction method based on synchronous data stream compression |
-
2014
- 2014-12-03 EP EP14196170.6A patent/EP3029149B1/en active Active
-
2015
- 2015-12-03 WO PCT/EP2015/078603 patent/WO2016087625A1/en not_active Ceased
- 2015-12-03 AU AU2015357028A patent/AU2015357028A1/en not_active Abandoned
- 2015-12-03 CA CA2969179A patent/CA2969179A1/en not_active Abandoned
Non-Patent Citations (84)
| Title |
|---|
| "Computational and Functional Analysis of Splicing Regulations", THE PHD THESIS OF PANAGIOTIS PAPASAIKAS, 2010, pages 1 - 143 |
| "PhD-Thesis", 1 January 2010, Dept. of Biol. Sci.; Carnegie Mellon University, Pittsburgh 2010, article PANAGIOTIS PAPASAIKAS: "COMPUTATIONAL AND FUNCTIONAL ANALYSES OF SPLICING REGULATION", pages: 1 - 143, XP055189506 * |
| ABELSON, J.; BLANCO, M.; DITZLER, M.A.; FULLER, F.; ARAVAMUDHAN, P.; WOOD, M.; VILLA, T.; RYAN, D.E.; PLEISS, J.A.; MAEDER, C. ET: "Conformational dynamics of single pre-mRNA molecules during in vitro splicing", NAT. STRUCT. MOL. BIOL., vol. 17, no. 4, 2010, pages 504 - 12 |
| ALBULESCU, L.O.; SABET, N.; GUDIPATI, M.; STEPANKIW, N.; BERGMAN, Z.J.; HUFFAKER, T.C.; PLEISS, J.A.: "A quantitative, high-throughput reverse genetic screen reveals novel connections between Pre-mRNA splicing and 5' and 3' end transcript determinants", PLOS GENET., vol. 8, no. 3, 2012, pages E1002530 |
| ASHTON-BEAUCAGE, D.; UDELL, C.M.; LAVOIE, H.; BARIL, C.; LEFRANGOIS, M.; CHAGNON, P.; GENDRON, P.; CARON-LIZOTTE, O.; BONNEIL, E.;: "The exon junction complex controls the splicing of MAPK and other long intron-containing transcripts in Drosophila", CELL, vol. 143, no. 2, 2010, pages 251 - 62 |
| BARASH, Y.; CALARCO, J.A.; GAO, W.; PAN, Q.; WANG, X.; SHAI, O.; BLENCOWE, B.J.; FREY, B.J.: "Deciphering the splicing code", NATURE, vol. 465, no. 7294, 2010, pages 53 - 9 |
| BARBOSA-MORAIS, N.L.; IRIMIA, M.; PAN, Q.; XIONG, H.Y.; GUEROUSSOV, S.; LEE, L.J.; SLOBODENIUC, V.; KUTTER, C.; WATT, S.; COLAK, R: "The evolutionary landscape of alternative splicing in vertebrate species", SCIENCE, vol. 338, no. 6114, 2012, pages 1587 - 93 |
| BECHARA, E.G.; SEBESTYEN, E.; BERNARDIS, I.; EYRAS, E.; VALCARCEL, J.: "RBM5, 6, and 10 differentially regulate NUMB alternative splicing to control cancer cell proliferation", MOL. CELL, vol. 52, no. 5, 2013, pages 720 - 33 |
| BEHRENS, S.E.; TYC, K.; KASTNER, B.; REICHELT, J.; LUHRMANN, R.: "Small nuclear ribonucleoprotein (RNP) U2 contains numerous additional proteins and has a bipartite RNP structure under splicing conditions", MOL. CELL. BIOL., vol. 13, no. 1, 1993, pages 307 - 19 |
| BERRIZ GF; KING OD; BRYANT B; SANDER C; ROTH FP: "Characterizing gene sets with FuncAssociate", BIOINFORMATICS, vol. 19, no. 18, 2003, pages 2502 - 4 |
| BESSONOV, S.; ANOKHINA, M.; WILL, C.L.; URLAUB, H.; LUHRMANN, R.: "Isolation of an active step I spliceosome and composition of its RNP core", NATURE, vol. 452, no. 7189, 2008, pages 846 - 50 |
| BIRMINGHAM, A.; SELFORS, L.M.; FORSTER, T.; WROBEL, D.; KENNEDY, C.J.; SHANKS, E.; SANTOYO-LOPEZ, J.; DUNICAN, D.J.; LONG, A.; KEL: "Statistical methods for analysis of high-throughput RNA interference screens", NAT. METHODS, vol. 6, no. 8, 2010, pages 569 - 75 |
| BONNAL, S.; MARTINEZ, C.; FORCH, P.; BACHI, A.; WILM, M.; VALCARCEL, J.: "RBM5/Luca-15/H37 regulates Fas alternative splice site pairing after exon definition", MOL. CELL, vol. 32, no. 1, 2008, pages 81 - 95 |
| BONNAL, S.; VIGEVANI, L.; VALCARCEL, J.: "The spliceosome as a target of novel antitumour drugs", NAT. REV. DRUG. DISCOV., vol. 11, no. 11, 2012, pages 847 - 59 |
| BOTTNER, C.A.; SCHMIDT, H.; VOGEL, S.; MICHELE, M.; KAUFER, N.F.: "Multiple genetic and biochemical interactions of Brr2, Prp8, Prp31, Prp1 and Prp4 kinase suggest a function in the control of the activation of spliceosomes in Schizosaccharomyces pombe", CURR. GENET., vol. 48, no. 3, 2005, pages 151 - 61 |
| CASCINO, I.; FIUCCI, G.; PAPOFF, G.; RUBERTI, G.: "Three functional soluble forms of the human apoptosis-inducing Fas molecule are produced by alternative splicing", J. IMMUNOL., vol. 154, no. 6, 15 December 1994 (1994-12-15), pages 2706 - 13 |
| CHATR-ARYAMONTRI, A.; BREITKREUTZ, B.J.; HEINICKE, S.; BOUCHER, L.; WINTER, A.; STARK, C.; NIXON, J.; RAMAGE, L.; KOLAS, N.; O'DON: "The BioGRID interaction database: 2013 update", NUCLEIC ACIDS RES., vol. 41, 2013, pages D816 - 23 |
| CHEN, W.; MOORE, M.J.: "The spliceosome: disorder and dynamics defined", CURR. OPIN. STRUCT. BIOL., vol. 24C, 2014, pages 141 - 149 |
| CLARK, T.A.; SUGNET, C.W.; ARES, M. JR.: "Genomewide analysis of mRNA processing in yeast using splicing-specific microarrays", SCIENCE, vol. 296, no. 5569, 2002, pages 907 - 10 |
| CLAUSET A; NEWMAN ME; MOORE C: "Finding community structure in very large networks", PHYS REV E STAT NONLIN SOFT MATTER PHYS., vol. 70, 2004, pages 066111 |
| COLLINS, C.A.; GUTHRIE, C.: "Allele-specific genetic interactions between Prp8 and RNA active site residues suggest a function for Prp8 at the catalytic core of the spliceosome", GENES DEV., vol. 13, no. 15, 1999, pages 1970 - 82 |
| COOPER, T.A.; WAN, L.; DREYFUSS, G.: "RNA and disease", CELL, vol. 136, no. 4, 2009, pages 777 - 93 |
| CORRIONERO, A.; MINANA, B.; VALCARCEL, J.: "Reduced fidelity of branch point recognition and alternative splicing induced by the anti-tumor drug spliceostatin A", GENES DEV., vol. 25, no. 5, 2011, pages 445 - 59 |
| CSARDI, G.; NEPUSZ, T.: "The igraph software package for complex network research", INTERJOURNAL. COMPLEX SYSTEMS, 2006, pages 1695 |
| FICA, S.M.; TUTTLE, N.; NOVAK, T.; LI, N.S.; LU, J.; KOODATHINGAL, P.; DAI, Q.; STALEY, J.P; PICCIRILLI, J.A.: "RNA catalyses nuclear pre-mRNA splicing", NATURE, vol. 503, no. 7475, 2013, pages 229 - 34 |
| FRANCESCHINI, A.; SZKLARCZYK, D.; FRANKILD, S.; KUHN, M.; SIMONOVIC, M.; ROTH, A.; LIN, J.; MINGUEZ, P.; BORK, P.; VON MERING, C.: "STRING v9.1: protein-protein interaction networks, with increased coverage and integration", NUCLEIC ACIDS RES., vol. 41, 2013, pages D808 - 15 |
| FRIEDMAN, J.; HASTIE, T.; TIBSHIRANI, R.: "Sparse inverse covariance estimation with the graphical lasso", BIOSTATISTICS, vol. 9, no. 3, 2008, pages 432 - 41 |
| FU, X.D.; ARES, M.: "Context-dependent control of alternative splicing by RNA-binding proteins", NAT. REV. GENET., vol. 15, 2014, pages 689 - 701 |
| GAO, Y.; VOGT, A.; FORSYTH, C.J.; KOIDE, K.: "Comparison of splicing factor 3b inhibitors in human cells", CHEMBIOCHEM., vol. 14, no. 1, 2013, pages 49 - 52 |
| GERSTEIN MB; KUNDAJE A; HARIHARAN M; LANDT SG; YAN KK; CHENG C; MU XJ; KHURANA E; ROZOWSKY J; ALEXANDER R: "Architecture of the human regulatory network derived from ENCODE data", NATURE, vol. 489, no. 7414, 2012, pages 91 - 100 |
| HACKER, I.; SANDER, B.; GOLAS, M.M.; WOLF, E.; KARAGOZ, E.; KASTNER, B.; STARK, H.; FABRIZIO, P.; LUHRMANN, R.: "Localization of Prp8, Brr2, Snu114 and U4/U6 proteins in the yeast tri-snRNP by electron microscopy", NAT. STRUCT. MOL. BIOL., vol. 15, no. 11, 2008, pages 1206 - 12 |
| HAMADY M; WALKER JJ; HARRIS JK; GOLD NJ; KNIGHT R: "Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex", NAT METHODS, vol. 5, no. 3, 2008, pages 235 - 7 |
| HASEGAWA, M.; MIURA, T.; KUZUYA, K.; INOUE, A.; WON KI, S.; HORINOUCHI, S.; YOSHIDA, T.; KUNOH, T.; KOSEKI, K.; MINO, K. ET AL.: "Identification of SAP155 as the target of GEX1 A (Herboxidiene), an antitumor natural product", ACS CHEM. BIOL., vol. 6, no. 3, 2011, pages 229 - 33 |
| HASTIE T; TIBSHIRANI R; SHERLOCK G; EISEN M; BROWN P; BOTSTEI D: "Imputing Missing Data for Gene Expression Arrays", TECHNICAL REPORT STANFORD STATISTICS DEPARTMENT, 1999 |
| HOROWITZ, D.S.; KOBAYASHI, R.; KRAINER, A.R.: "A new cyclophilin and the human homologues of yeast Prp3 and Prp4 form a complex associated with U4/U6 snRNPs", RNA, vol. 3, no. 12, 1997, pages 1374 - 87 |
| HOSKINS, A.A.; FRIEDMAN, L.J.; GALLAGHER, S.S.; CRAWFORD, D.J.; ANDERSON, E.G.; WOMBACHER, R.; RAMIREZ, N.; CORNISH, V.W.; GELLES,: "Ordered and dynamic assembly of single spliceosomes", SCIENCE, vol. 331, no. 6022, 2011, pages 1289 - 95 |
| HOSKINS, A.A.; MOORE, M.J.: "The spliceosome: a flexible, reversible macromolecular machine", TRENDS BIOCHEM. SCI., vol. 37, no. 5, 2012, pages 179 - 88 |
| HOUSE, A.E.; LYNCH, K.W.: "An exonic splicing silencer represses spliceosome assembly after ATP-dependent exon recognition", NAT. STRUCT. MOL. BIOL., vol. 13, no. 10, 2006, pages 937 - 44 |
| JURKA, J.; KAPITONOV, V.V.; PAVLICEK, A.; KLONOWSKI, P.; KOHANY, O.; WALICHIEWICZ, J.: "Repbase Update, a database of eukaryotic repetitive elements", CYTOGENET GENOME RES., vol. 110, no. 1-4, 2005, pages 462 - 7 |
| KAIDA, D.; MOTOYOSHI, H.; TASHIRO, E.; NOJIMA, T.; HAGIWARA, M.; ISHIGAMI, K.; WATANABE, H.; KITAHARA, T.; YOSHIDA, T.; NAKAJIMA,: "Spliceostatin A targets SF3b and inhibits both splicing and nuclear retention of pre-mRNA", NAT. CHEM. BIOL., vol. 3, no. 9, 2007, pages 576 - 83 |
| KAROLCHIK, D.; BARBER, G.P.; CASPER, J.; CLAWSON, H.; CLINE, M.S.; DIEKHANS, M.; DRESZER, T.R.; FUJITA, P.A.; GURUVADOO, L.; HAEUS: "The UCSC Genome Browser database: 2014 update", NUCLEIC ACIDS RES., vol. 42, 2014, pages D764 - 70 |
| KATZ, Y.; WANG, E.T.; AIROLDI, E.M.; BURGE, C.B.: "Analysis and design of RNA sequencing experiments for identifying isoform regulation", NAT. METHODS, vol. 7, no. 12, 2010, pages 1009 - 15 |
| KIM, D.; KIM, M.S.; CHO, K.H.: "The core regulation module of stress-responsive regulatory networks in yeast", NUCLEIC ACIDS RES., vol. 40, no. 18, 2012, pages 8793 - 802 |
| KONIG J; ZARNACK K; ROT G; CURK T; KAYIKCI M; ZUPAN B; TURNER DJ; LUSCOMBE NM; ULE J.: "iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution", J VIS EXP., vol. 30, no. 50, 2011 |
| KORNETA, I.; BUJNICKI, J.M.: "Intrinsic disorder in the human spliceosomal proteome", PLOS COMPUT. BIOL., vol. S, no. 8, 2012, pages E1002641 |
| LALLENA, M.J.; CHALMERS, K.J.; LLAMAZARES, S.; LAMOND, A.I.; VALCARCEL, J.: "Splicing regulation at the second catalytic step by Sex-lethal involves 3' splice site recognition by SPF45", CELL, vol. 109, no. 3, 2002, pages 285 - 96 |
| LIU, C.; CHENG, J.; MOUNTZ, J.D.: "Differential expression of human Fas mRNA species upon peripheral blood mononuclear cell activation", BIOCHEM. J., vol. 310, 1995, pages 957 - 63 |
| LUCO, R.F.; ALLO, M.; SCHOR, I.E.; KORNBLIHTT, A.R.; MISTELI, T.: "Epigenetics in alternative pre-mRNA splicing", CELL, vol. 144, no. 1, 2011, pages 16 - 26 |
| MAKAROVA, O.V.; MAKAROV, E.M.; URLAUB, H.; WILL, C.L.; GENTZEL, M.; WILM, M.; LUHRMANN, R.: "A subset of human 35S U5 proteins, including Prp19, function prior to catalytic step 1 of splicing", EMBO J., vol. 23, no. 12, 2004, pages 2381 - 91 |
| MARIA PAOLA PARONETTO ET AL: "Regulation of FAS Exon Definition and Apoptosis by the Ewing Sarcoma Protein", CELL REPORTS, vol. 7, no. 4, 1 May 2014 (2014-05-01), pages 1211 - 1226, XP055189515, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2014.03.077 * |
| MARIAPAOLA PARONETTO ET AL: "The Ewing Sarcoma Protein Regulates DNA Damage-Induced Alternative Splicing", MOLECULAR CELL, CELL PRESS, CAMBRIDGE, MA, US, vol. 43, no. 3, 25 May 2011 (2011-05-25), pages 353 - 368, XP028276490, ISSN: 1097-2765, [retrieved on 20110629], DOI: 10.1016/J.MOLCEL.2011.05.035 * |
| MERKIN, J.; RUSSELL, C.; CHEN, P.; BURGE, C.B.: "Evolutionary dynamics of gene and isoform regulation in Mammalian tissues", SCIENCE, vol. 338, no. 6114, 2012, pages 1593 - 9 |
| MOORE MICHAEL J ET AL: "An Alternative Splicing Network Links Cell-Cycle Control to Apoptosis", CELL, vol. 142, no. 4, 20 August 2010 (2010-08-20), pages 625 - 636, XP028931170, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2010.07.019 * |
| MOORE, M.J.; WANG, Q.; KENNEDY, C.J.; SILVER, P.A.: "An alternative splicing network links cell-cycle control to apoptosis", CELL, vol. 142, no. 4, 2010, pages 625 - 36 |
| MOZAFFARI-JOVIN, S.; SANTOS, K.F.; HSIAO, H.H.; WILL, C.L.; URLAUB, H.; WAHL, M.C.; LUHRMANN, R.: "The Prp8 RNase H-like domain inhibits Brr2-mediated U4/U6 snRNA unwinding by blocking Brr2 loading onto the U4 snRNA", GENES DEV., vol. 26, no. 21, 2012, pages 2422 - 34 |
| MUCKENTHALER, M.; RICHTER, A.; GUNKEL, N.; RIEDEL, D.; POLYCARPOU-SCHWARZ, M.; HENTZE, S.; FALKENHAHN, M.; STREMMEL, W.; ANSORGE,: "Relationships and distinctions in iron-regulatory networks responding to interrelated signals", BLOOD, vol. 101, no. 9, 2003, pages 3690 - 8 |
| MURAKI, M.; OHKAWARA, B.; HOSOYA, T.; ONOGI, H.; KOIZUMI, J.; KOIZUMI, T.; SUMI, K.; YOMODA, J.; MURRAY, M.V.; KIMURA, H. ET AL.: "Manipulation of alternative splicing by a newly developed inhibitor of Clks", J. BIOL. CHEM., vol. 279, no. 23, 2004, pages 24246 - 54 |
| MURO, A.F.; CHAUHAN, A.K.; GAJOVIC, S.; LACONCIG, A.; PORRO, F.; STANTA, G.; BARALLE, F.E.: "Regulated splicing of the fibronectin EDA exon is essential for proper skin wound healing and normal lifespan", J. CELL. BIOL., vol. 162, no. 1, 2003, pages 149 - 60 |
| NEWMAN, M.E.: "Modularity and community structure in networks", PROC. NATL. ACAD. SCI. U.S.A., vol. 103, no. 23, 2006, pages 8577 - 82 |
| NILSEN, T.W.; GRAVELEY, B.R.: "Expansion of the eukaryotic proteome by alternative splicing", NATURE, vol. 463, 2010, pages 457 - 463 |
| PAPOFF, G; CASCINO, I.; ERAMO, A.; STARACE, G.; LYNCH, D.H.; RUBERTI, G.: "An N-terminal domain shared by Fas/Apo-1 (CD95) soluble variants prevents cell death in vitro", J. IMMUNOL., vol. 156, no. 12, 1996, pages 4622 - 30 |
| PARK, J.W.; PARISKY, K.; CELOTTO, A.M.; REENAN, R.A.; GRAVELEY, B.R.: "Identification of alternative splicing regulators by RNA interference in Drosophila", PROC. NATL. ACAD. SCI. U.S.A., vol. 101, no. 45, 2004, pages 15974 - 9 |
| PENA, V.; LIU, S.; BUJNICKI, J.M.; LUHRMANN, R.; WAHL, M.C.: "Structure of a multipartite protein-protein interaction domain in splicing factor prp8 and its link to retinitis pigmentosa", MOL. CELL., vol. 25, no. 4, 2007, pages 615 - 24 |
| PLEISS, J.A.; WHITWORTH, G.B; BERGKESSEL, M.; GUTHRIE, C.: "Transcript specificity in yeast pre-mRNA splicing revealed by mutations in core spliceosomal components", PLOS BIOL., vol. 5, no. 4, 2007, pages E90 |
| QUESADA, V.; CONDE, L.; VILLAMOR, N.; ORDONEZ, G.R.; JARES, P.; BASSAGANYAS, L.; RAMSAY, A.J.; BEA, S.; PINYOL, M.; MARTFNEZ-TRILL: "Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia", NAT. GENET., vol. 44, no. 1, 2011, pages 47 - 52 |
| ROESLER, J.; IZQUIERDO, J.M.; RYSER, M.; ROSEN-WOLFF, A.; GAHR, M.; VALCARCEL, J.; LENARDO, M.J.; ZHENG, L.: "Haploinsufficiency, rather than the effect of an excessive production of soluble CD95 (CD95{Delta}TM), is the basis for ALPS la in a family with duplicated 3' splice site AG in CD95 intron 5 on one allele", BLOOD, vol. 106, no. 5, 2005, pages 1652 - 9 |
| SALTZMAN, A.L.; PAN, Q.; BLENCOWE, B.J.: "Regulation of alternative splicing by the core spliceosomal machinery", GENES DEV., vol. 25, no. 4, 2011, pages 373 - 84 |
| SHCHERBAKOVA, I.; HOSKINS, A.A.; FRIEDMAN, L.J.; SEREBROV, V.; CORREA, I.R. JR.; XU, M.Q.; GELLES, J.; MOORE, M.J.: "Alternative spliceosome assembly pathways revealed by single-molecule fluorescence microscopy", CELL REP., vol. 5, no. 1, 2013, pages 151 - 65 |
| SOPHIE BONNAL ET AL: "The spliceosome as a target of novel antitumour drugs", NATURE REVIEWS DRUG DISCOVERY, vol. 11, no. 11, 5 November 2012 (2012-11-05), pages 847 - 859, XP055189513, ISSN: 1474-1776, DOI: 10.1038/nrd3823 * |
| TAZI J ET AL: "Alternative splicing and disease", BIOCHIMICA ET BIOPHYSICA ACTA. MOLECULAR BASIS OF DISEASE, AMSTERDAM, NL, vol. 1792, no. 1, 1 January 2009 (2009-01-01), pages 14 - 26, XP025838034, ISSN: 0925-4439, [retrieved on 20081017], DOI: 10.1016/J.BBADIS.2008.09.017 * |
| TEIGELKAMP, S.; ACHSEL, T.; MUNDT, C.; GOTHEL, S.F.; CRONSHAGEN, U.; LANE, W.S.; MARAHIEL, M.; LUHRMANN, R.: "The 20kD protein of human [U4/U6.U5] tri-snRNPs is a novel cyclophilin that forms a complex with the U4/U6-specific 60kD and 90kD proteins", RNA, vol. 4, no. 2, 1998, pages 127 - 41 |
| TSENG, C.K.; CHENG, S.C.: "Both catalytic steps of nuclear pre-mRNA splicing are reversible", SCIENCE, vol. 320, no. 5884, 2008, pages 1782 - 4 |
| WAHL, M.C.; WILL, C.L.; LUHRMANN R.: "The spliceosome: design principles of a dynamic RNP machine", CELL, vol. 136, no. 4, 2009, pages 701 - 18 |
| WARZECHA, C.C.; SATO, T.K.; NABET, B.; HOGENESCH, J.B.; CARSTENS, R.P.: "ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing", MOL. CELL, vol. 33, no. 5, 2009, pages 591 - 601 |
| WATSON, E.; MACNEIL, L.T.; ARDA, H.E.; ZHU, L.J.; WALHOUT, A.J.: "Integration of metabolic and gene regulatory networks modulates the C. elegans dietary response", CELL, vol. 753, no. 1, 2013, pages 253 - 66 |
| WOLFGANG J. KÖSTLER ET AL: "Epidermal Growth-Factor - Induced Transcript Isoform Variation Drives Mammary Cell Migration", PLOS ONE, vol. 8, no. 12, 6 December 2013 (2013-12-06), pages e80566, XP055189571, DOI: 10.1371/journal.pone.0080566 * |
| WONG, A.K.; PARK, C.Y.; GREENE, C.S.; BONGO, L.A.; GUAN, Y.; TROYANSKAYA, O.G.: "IMP: a multi-species functional genomics portal for integration, visualization and prediction of protein functions and networks", NUCLEIC ACIDS RES., vol. 40, 2012, pages W484 - 90 |
| WONG, J.J.; RITCHIE, W.; EBNER, O.A.; SELBACH, M.; WONG, J.W.; HUANG, Y.; GAO, D.; PINELLO, N.; GONZALEZ, M.; BAIDYA, K. ET AL.: "Orchestrated intron retention regulates normal granulocyte differentiation", CELL, vol. 154, no. 3, 2013, pages 583 - 95 |
| YANG, Y.; HAN, L.; YUAN, Y.; LI, J.; HEI, N.; LIANG, H.: "Gene co-expression network analysis reveals common system-level properties of prognostic genes across cancer types", NAT. COMMUN., vol. 5, 2014, pages 3231 |
| YOSHIDA, K.; SANADA, M.; SHIRAISHI, Y.; NOWAK, D.; NAGATA, Y.; YAMAMOTO, R.; SATO, Y.; SATO-OTSUBO, A.; KON, A.; NAGASAKI, M. ET A: "Frequent pathway mutations of splicing machinery in myelodysplasia", NATURE, vol. 478, no. 7367, 2011, pages 64 - 9 |
| ZARNACK, K.; KONIG, J.; TAJNIK, M.; MARTINCORENA, I.; EUSTERMANN, S.; STEVANT, I.; REYES, A.; ANDERS, S.; LUSCOMBE, N.M.; ULE, J.: "Direct competition between hnRNP C and U2AF65 protects the transcriptome from the exonization of Alu elements", CELL, vol. 152, no. 3, 2013, pages 453 - 66 |
| ZHANG, C.; FRIAS, M.A.; MELE, A.; RUGGIU, M.; EOM, T.; MARNEY, C.B.; WANG, H.; LICATALOSI, D.D.; FAK, J.J.; DARNELL, R.B.: "Integrative modeling defines the Nova splicing-regulatory network and its combinatorial controls", SCIENCE, vol. 329, no. 5990, 2010, pages 439 - 43 |
| ZHENG, S.; DAMOISEAUX, R.; CHEN, L.; BLACK, D.L.: "A broadly applicable high-throughput screening strategy identifies new regulators of Dlg4 (Psd-95) alternative splicing", GENOME RES., vol. 23, no. 6, 2013, pages 998 - 1007 |
| ZHOU Z; LICKLIDER LJ; GYGI SO; REED R.: "Comprehensive proteomic analysis of the human spliceosome", NATURE, vol. 419, 2002, pages 182 - 5 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108265053A (en) * | 2017-10-26 | 2018-07-10 | 武汉大学 | A kind of screening technique for the antisense oligonucleotides that extron shearing is inhibited to inhibit subfunction |
| CN108265053B (en) * | 2017-10-26 | 2020-10-13 | 武汉大学 | Screening method of antisense oligonucleotide for inhibiting exon shearing inhibitor function |
| US11752197B2 (en) | 2019-08-12 | 2023-09-12 | Regeneron Pharmaceuticals, Inc. | Macrophage stimulating 1 receptor (MST1R) variants and uses thereof |
| CN115083511A (en) * | 2022-06-24 | 2022-09-20 | 西安电子科技大学 | Peripheral gene regulation and control feature extraction method based on graph representation learning and attention |
| CN116286911A (en) * | 2022-10-21 | 2023-06-23 | 上海鑫湾生物科技有限公司 | A spliceable system for regulating viral replication in response to anoxic environment and its use |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3029149A1 (en) | 2016-06-08 |
| AU2015357028A1 (en) | 2017-07-13 |
| EP3029149B1 (en) | 2020-02-12 |
| CA2969179A1 (en) | 2016-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rubin et al. | Coupled single-cell CRISPR screening and epigenomic profiling reveals causal gene regulatory networks | |
| Cheng et al. | Modeling CRISPR-Cas13d on-target and off-target effects using machine learning approaches | |
| Spiniello et al. | HyPR-MS for multiplexed discovery of MALAT1, NEAT1, and NORAD lncRNA protein interactomes | |
| Dominguez et al. | A high-resolution transcriptome map of cell cycle reveals novel connections between periodic genes and cancer | |
| Papasaikas et al. | Functional splicing network reveals extensive regulatory potential of the core spliceosomal machinery | |
| EP3029149B1 (en) | Method of the identification of targets for alternative splicing | |
| Luo et al. | Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions | |
| McFadden et al. | Biochemical methods to investigate lncRNA and the influence of lncRNA: protein complexes on chromatin | |
| Lv et al. | Identification and characterization of long non-coding RNAs related to mouse embryonic brain development from available transcriptomic data | |
| TWI831766B (en) | Systems and methods for discriminating effects on targets | |
| Donohue et al. | A cis-regulatory lexicon of DNA motif combinations mediating cell-type-specific gene regulation | |
| Carazo et al. | Upstream analysis of alternative splicing: a review of computational approaches to predict context-dependent splicing factors | |
| Han et al. | Integrating epigenomics into the understanding of biomedical insight | |
| Li et al. | Circ RNA wrap–a flexible pipeline for circ RNA identification, transcript prediction, and abundance estimation | |
| WO2020257501A1 (en) | Systems and methods for evaluating query perturbations | |
| Zhang et al. | Time to infer miRNA sponge modules | |
| Forouzmand et al. | Developmentally regulated long non-coding RNAs in Xenopus tropicalis | |
| França et al. | Drug-induced adaptation along a resistance continuum in cancer cells | |
| Suo et al. | Enhancing the predictive power of machine learning models through a chemical space complementary DEL screening strategy | |
| Shao et al. | Alternative polyadenylation in glioblastoma multiforme and changes in predicted RNA binding protein profiles | |
| Tang et al. | Cancer omics: from regulatory networks to clinical outcomes | |
| Sterne-Weiler et al. | Whippet: an efficient method for the detection and quantification of alternative splicing reveals extensive transcriptomic complexity | |
| Ding et al. | Simultaneous profiling of chromatin-associated RNA at targeted DNA loci and RNA-RNA Interactions through TaDRIM-seq | |
| Akcan et al. | Predictive model of transcriptional elongation control identifies trans regulatory factors from chromatin signatures | |
| Setti et al. | Decoding RNA–RNA Interactions: The Role of Low-Complexity Repeats and a Deep Learning Framework for Sequence-Based Prediction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15804783 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2969179 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2015357028 Country of ref document: AU Date of ref document: 20151203 Kind code of ref document: A |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15804783 Country of ref document: EP Kind code of ref document: A1 |


































