WO2016082055A1 - Smart label with static and dynamic information fields - Google Patents
Smart label with static and dynamic information fields Download PDFInfo
- Publication number
- WO2016082055A1 WO2016082055A1 PCT/CL2015/050047 CL2015050047W WO2016082055A1 WO 2016082055 A1 WO2016082055 A1 WO 2016082055A1 CL 2015050047 W CL2015050047 W CL 2015050047W WO 2016082055 A1 WO2016082055 A1 WO 2016082055A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- information
- label
- units
- dynamic
- tag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G06—COMPUTING OR CALCULATING; COUNTING
- G06K—GRAPHICAL DATA READING; PRESENTATION OF DATA; RECORD CARRIERS; HANDLING RECORD CARRIERS
- G06K19/00—Record carriers for use with machines and with at least a part designed to carry digital markings
- G06K19/06—Record carriers for use with machines and with at least a part designed to carry digital markings characterised by the kind of the digital marking, e.g. shape, nature, code
- G06K19/08—Record carriers for use with machines and with at least a part designed to carry digital markings characterised by the kind of the digital marking, e.g. shape, nature, code using markings of different kinds or more than one marking of the same kind in the same record carrier, e.g. one marking being sensed by optical and the other by magnetic means
Definitions
- the present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith.
- the label corresponds to the visual representation of a two-dimensional data matrix, containing information units (smaller unit that makes up the two-dimensional data matrix) that have different states.
- Such information units may have both static and dynamic behaviors.
- a dynamic behavior refers, in the present invention, to the ability of an information unit to vary its state or mutate with respect to another variable, while a static behavior refers to an immutable state in time.
- the information units that have dynamic behavior can be interpreted as sensors according to what is indicated in the method of reading information of the present invention, in order to gather information of environmental variables and / or of interest : temperature, UV radiation, pressure, etc., presenting dynamic information.
- the dynamic information units can be used in conjunction with the information units that have static behavior (static information units) to encode static information on the label.
- the dynamic information, as well as the static information, can be read from the label by a recognition system (SR) according to the reading method of the present invention. Part or all of the dynamic information can be read visually by the user without the need for an SR.
- SR recognition system
- the static information is printed on the label and commonly corresponds to information associated with the manufacture, price, origin or destination of the product in which it will be incorporated.
- the dynamic information varies over time as some sensor element changes state according to the condition to be measured.
- the label modifies its appearance by changing the color of an icon, figure, bar, etc., and this change may be reversible or irreversible.
- the document label US2013 / 0048736 is composed of two independent labels, located on the same base, because the upper part containing the bar code and the variable lower part can be separated, maintaining each one full functionality.
- JP200181356 describes a price tag that is provided with a first barcode that shows data of the non-variable type in which no alteration occurs after it is issued, and a second barcode that shows a set of data of variable type in which an alteration factor occurs after its emission, as seen in Figure 1 (c). Also in this case the label consists of two or more labels incorporated in the same base, under the same argument that the dynamic part and the static part separately maintain full functionality.
- the state of the art does not describe a label that incorporates static and dynamic information in a single unit, where part or all of the dynamic information can be read with the naked eye.
- the state of the art does not describe a label that contains static as well as dynamic elements, where dynamic elements can be interpreted as sensors, and whose method of reading / writing information considers elements that exist in more than two states.
- the present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith.
- the label corresponds to the visual representation of a two-dimensional data matrix, containing units of information (unit smaller than it forms the matrix of two-dimensional data) that present different states.
- Such information units may have both static and dynamic behaviors.
- a dynamic behavior refers, in the present invention, to the ability of an information unit to vary its state or mutate with respect to another variable, while a static behavior refers to an immutable state in time.
- the information units that have dynamic behavior can be interpreted as sensors according to what is indicated in the method of reading information of the present invention, in order to gather information of environmental variables and / or of interest : temperature, UV radiation, pressure, etc., presenting dynamic information.
- the dynamic information units can be used in conjunction with the information units that have static behavior (static information units) to encode static information on the label.
- the dynamic information, as well as the static information, can be read from the label by a recognition system (SR) according to the reading method of the present invention. Part or all of the dynamic information can be read visually by the user without the need for an SR.
- SR recognition system
- Both the units of information that exhibit dynamic behavior and those that exhibit static behavior can have more than 2 usable states by the present invention, allowing to store more information per unit of space (for example in comparison to binary codes).
- Static information corresponds to invariable information. Part of its uses are: container of an identification number or part of a mechanism that allows implement different levels of access to information (both static and dynamic) for the different users of the label.
- the coding of the static information may include redundancy information as an error correction method, according to the method of writing the information of the present invention.
- the dynamic information units of the label, used to gather dynamic information are added to the label under a predefined structure for each configuration (for example: product, product type, family of products or variables of interest to be measured).
- the combination of static and dynamic information allows information about the origin, history and current state of the product to be stored.
- an electronic system for storing and transmitting information, which acts as a backup for the analog part of the label.
- the electronic system can use wireless (RFID, NFC, WIFI, BLUETOOTH, etc.) or contact technology for sending / receiving information, which would allow the device to be integrated into automatic tracking and / or logistics systems that they consider electronic and automation components.
- the analog information (both static and dynamic) contained in the label can be read from an image of it obtained from a capture device (scanner, digital camera, etc.), using a recognition system (SR) of according to the reading method of the present invention.
- the information read from the label can be used to update an external database, and can be incorporated into a logistic and / or quality assurance system, from its manufacture to the end user.
- Figure 1 Examples of prior art.
- Figure 2 Label design according to the present invention.
- Figure 3 Label barcode.
- Figure 4 Coding used in the elaboration of the bar code.
- Figure 5 Example of distorted quadrilateral.
- Figure 10 Example 3: Coding of compressed information.
- Figure 1 1 Example 4: Coding of encrypted and compressed information
- Figure 12 Example 5: Label with a visually interpretable sensor.
- Figure 15 Example 6: Label with visually interpretable sensors.
- Figure 16 Example 6: Possible states and sensor arrangements.
- Figure 17 Example 6: Example instructions for visual label reading.
- Figure 18 Example 7: Label including colorimetric temperature sensor.
- Figure 19 Example 7: Photograph of the label to be analyzed by the image processing system.
- Example 7 Subsectors of the image to be analyzed by means of the corner detector algorithm.
- FIG. 23 Example 7: Image after spatial transformation and transformation to black and white.
- Example 7 Examples of regions of adjacent pixels and their respective bounding box.
- FIG. 25 Example 7: Zone of adjacent pixels with the highest height among those detected.
- FIG. 27 Example 7: Regions with lower value in the size pattern detection function.
- Figure 28 Example 8: Integration of the label into the logistics and product quality assurance system.
- Figure 29 Types of information contained in the label.
- Figure 30 Coding scheme.
- Figure 31 Decoding scheme.
- Figure 33 Color space color diagram xyY.
- Figure 36 Cluster projections in the CIELAB color space.
- Figure 37 Groups in the xyY color space.
- Figure 38 Groups 1 to 8 xyY color space.
- Figure 39 Groups 9 to 16 xyY color space.
- Figure 40 Evolution of the xyY color space solutions.
- Figure 42 Measured temperature versus estimated temperature.
- UV Ultraviolet electromagnetic spectrum
- RFID Radio frequency identification, of the English Radio Frecuency Identification.
- NFC Near Field Communication, from Near Field Communication.
- QR Quick Response Code Two-Dimensional Code.
- ASCII American Standard Code for Information Exchange, from the American Standard Code for Information Interchange.
- UPC Universal Product Code
- English Universal Product Code English Universal Product Code.
- GF Galois Field.
- LZW Lempel-Ziv-Welch.
- TLC Thermochromic Liquid Crystal, from English Thermochromic Liquid Crystal.
- the present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith.
- the tag has information units (elements) that have static behavior and information units (elements) that have dynamic behavior.
- the static information is that included at the beginning of the product tracking, according to the coding (writing) method of the present invention.
- Other uses are as a container of an identification number, or part of a mechanism that would allow different levels of access to information (both static and dynamic) to be implemented for the different users of the label.
- the dynamic information corresponds to that presented by the dynamic information units included in the label, which are interpreted as sensors by the SR, in order to obtain information on variables such as temperature, UV radiation, time (useful life), etc.
- the tag can integrate wireless technology for the transmission and reception of data and / or together with an electronic information storage unit that is updated based on the information retrieved from the analog part (in particular the dynamic part) of the tag .
- the information units present in the device do not require energy from the same label for their state changes.
- the label allows different levels and alternatives of access to information: simple reading by the user based on a manual or indications attached to the product, reading by an SR, according to the method of reading of the present invention, from the image obtained by means of an image capture device (scanner, digital camera, etc.) or through wireless communication means (RFID, NFC, WIFI, BLUETOOTH or others).
- Another way to implement levels of access to information is by encrypting all or part of the information, to which only a fraction of the users would have access.
- the label considers the incorporation, if necessary for the proper functioning of the SR, of information units intended for state calibration (which in its preferred execution corresponds to a metric colorimetric calibration) and spatial, which allow the recovery of information in a multitude of situations or reading conditions.
- the device allows the device to be incorporated into a management and logistics system, managing to track the entire production process and distribution of a product.
- the monitoring does not require electrical energy for its operation (since it does not require the energy information units coming from the same label), being able to recover the information stored in analogue way using the SR at any point of the path or process and record the information of the moment at the time that said information was read by the system, either in an internal memory or in an external database for later access.
- the invention has the following characteristics: Device tag: a.
- the tag has static and dynamic information, corresponding to the static and dynamic information units of a two-dimensional data matrix. b. Part or all of the dynamic information can be read by the user with the naked eye without the need for an SR.
- the analog information contained in the tag (both static and dynamic), can be read using a recognition system, according to the reading method of the present invention.
- the information units of the label can present more than two states, according to the amount of information to be included in the label and to the states that the SR is able to recognize in practice. and.
- the shape of the label is configurable, its preferred execution being square or rectangular.
- the means of transmitting the information stored electronically on the label may be of the wireless type.
- the dynamic information units correspond to one or a set of materials that in the case of experiencing changes recognizable by the SR or Visually, depending on one or more environmental or interest variables, they can be interpreted as sensors.
- the coding method can use units of static, dynamic or joint information (depending on the configuration). j. Part or all of the dynamic information can be configured to be interpreted visually. k. Some or all of the information can be configured to be interpreted only by the recognition system.
- Static label information may include redundancy information as an error correction method, according to the writing method and information reading method of the present invention, allowing the correct information to be retrieved, even though a fraction of She is read incorrectly.
- the static information may be subjected to a compression process before being added to the label, according to the methods of the present invention.
- the static information can be subjected to an encryption process before being added to the label, according to the methods of the present invention.
- decoding method (reading): or. It can be automatic, using a recognition system that delivers information as a result of the interpretation of a label image. p. It can be manual (visual) using an instruction attached to the label or intuitively to interpret part or all of the dynamic information units configured for such purposes. q. You can recognize and interpret the levels of information present on the label. r. Can recognize and interpret the existence of information compression. s. You can recognize and interpret the existence of information encryption. t. Some or all of the information read by the recognition system or by visual interpretation can be sent to a remote or local storage system manually or automatically.
- the logistics and / or product quality assurance system may have different configurations.
- the static information of the label is included in it by a particular arrangement of the static information units therein, in some cases also using dynamic information units.
- the interpretation of these elements is done through the SR.
- a particular type of information corresponds to the recognition and calibration patterns, described below.
- the SR At the time of decoding the label, it is necessary that the SR be able to determine its size, orientation and configuration, which is why a set of recognition patterns is included in it.
- Figure 2 shows pattern 201, which allows, during the analysis of an image of the label by the SR, to determine the total size of the data matrix in units of pixels, since it covers the entire first column of the label.
- pattern 201 contains additional information in the form of a barcode, constituting a double use thereof.
- the barcode used corresponds to an adaptation of the UPC code, where the digits are coded as a set of four bars of variable width, with alternating color between black and white ( Figure 4).
- said pattern can be encoded with two or more states.
- Pattern 201 includes a starting pattern corresponding to three bars (black-white-black) (301), a two-bar term pattern (white-black) (302) and a check digit dependent on The coded digits. Unlike the UPC code, here the code "L" is used in all the digits.
- the pattern 205 is of a known size in units of information, allowing to determine the size of the image of the data matrix in units of information by comparison with the size of the pattern 201 in pixels.
- the size of pattern 205 may vary, depending on aspects such as the size of the data matrix in units of information or the expected resolution in the image of the label to be analyzed by the SR.
- the size of the pattern 205 is such that errors and normal distortions in the determination of its size in pixels from the image analyzed by the SR do not result in errors in the determination of the size of the data matrix in units of information.
- Pattern 204 is used in the spatial transformation stage (3. DECODING METHOD Section A Decoding by means of the recognition system), as it is indicative of the upper right corner of the data matrix.
- Another type of pattern corresponds to the state calibration patterns, 202 and 203, respectively, according to the nature of the dynamic information units of the device and the configuration of the states of the static information units (indicated in sections B Dynamic device information and C Configuration of the device information units). Depending on the situation, these zones can be merged into a single zone or eliminated, depending on the method of reading to be used. Static information contained in the recognition patterns
- pattern 201 is used to store information relative to the size of the data matrix, together with a unique identification number for each product. For this, 4 digits corresponding to the identification number of the label are concatenated, together with two digits corresponding to the size of the same in information units (in the rectangular case 4 digits are included), in addition a verifying digit is calculated according to: where:
- This set of 7 digits is transformed into an image according to the coding shown in Figure 4, also incorporating the start and end pattern, together with an outline that facilitates recognition according to the reading method of the present invention. . It should be noted that any set of digits can be encoded in this way, being able to incorporate different and / or additional information to the size of the matrix and / or the identification number of the label.
- Pattern 205 is used in a complementary method of determining the size of the data matrix, which is based on the fact that it is of a size known in information units, its preferred execution being the size of 3x3 information units. Because the pattern 205 is required to be isolated from the rest of the figure, a white safety edge is incorporated, which constitutes a use of space of 4x4 information units. As indicated above, as the size of the data matrix increases, it may be necessary to change the size of this pattern.
- the dynamic information units of the label once interpreted visually or through the SR, allow measuring and / or quantifying environmental and / or interest variables. These information units are generated using materials that have thermodynamic, optical, chemical, pressure dependent properties, etc., variables with the magnitude to be quantified, and that do not require energy from the label itself as a power source for its operation.
- the type of material to use depends on the variable you want to measure.
- the material is required to undergo a detectable change due to changes in the value, presence or absence of the measured variable.
- the variable is temperature
- thermochromic or thermosensitive materials can be used.
- the variable of interest is UV radiation
- the required compound should be photosensitive or sensitive to light, so it must undergo a detectable change by varying the lighting to which it is subjected.
- those of colorimetric type stand out, which undergo a visible change to the human eye due to changes in some specific variable.
- Polychromatic materials can have a range of colors or phase changes associated with a certain level of excitation of some variable on which their phase change depends.
- the complexity of the analysis for this case is greater than for materials Monochromatic, this is due to the complexity of analyzing n phases and (n-1) transitions.
- This method relates the behavior of the material with a variable of interest allowing its use as a sensor.
- the first step is to identify the behavior of the material within the range of use. This is achieved by acquiring images or frames of the material associated with different values of the variable to be measured.
- Color correction is intended to normalize colors / image in different situations of light and shadow.
- the colorimetric transformation methodology is used, which is detailed in section 3.
- Figure 41 shows the curves of a TLC material with respect to temperature, in addition the curve obtained after applying a second order colorimetric transformation is included.
- the method of estimation of the variable of interest is chosen based on the information related to the material.
- methods for estimating variables such as: least squares, soft computing methods such as neural networks, fuzzy logic, among others. Since there is no single solution to relate response or change of phases for all materials with respect to a variable, several solutions can be evaluated and determine which one is best suited for each material.
- Pattern selection is a process that helps decrease the amount of data to be processed and increase the response speed of the method of estimating the variable of interest.
- Pattern is understood as the characteristics or properties of a data set.
- the number of patterns is not only limited to the values obtained from the RGB model, but to all possible color transformations to models and color spaces, statistical values, texture, invariant moments, etc.
- the objective is to choose from all the possible patterns are those that contribute the most to the estimated model according to the material and variable selected.
- the decrease in the dimensionality of the characteristics eliminates the redundancy data and increases the performance of the system.
- Each device information unit may have more than one state, with the requirement that each state be distinguishable by the SR at the time of reading.
- the states of these units must also be distinguishable by the user.
- the number of available states is directly linked to the amount of information stored within a unit of information. For the binary case, the representation of two states is called bit: one and zero; These states can be represented (in print) as the existence or absence of a color, usually black is usually used on a white background, and can be any other.
- the vEbit unit In order not to confuse the concept of bit (two states), or qdits (D-dimensions in Hilbert space) in quantum computing, the vEbit unit is defined in this invention.
- the vEbit unit aims to explicitly define that the number of states can be variable and the letter E represents the number of states used, with a v2bit being the equivalent of one bit.
- Each unit of information on the device can be configured in more than one state, with the requirement that each state be distinguishable by the SR at the time of reading.
- the states of these units must also be visible. In this way any type of measurable property can be used, with different levels representing different states, for example: colors, textures, magnetic properties, etc.
- the combination of states of different origins, such as color / texture or other selection of states may also be included, being a mixture of two or more, as the case may be.
- color has been used in the case of coding information in two-dimensional codes, using two states, with the black indicating a state and white the complementary state.
- solid colors as a representation of two or more states, is one of the possible options in increasing the density of information stored in the data matrix.
- the increase in information density is generally associated with a decrease in the identification capacity of each state.
- the amount of colors to use depends on the vEbits in which the coding is performed, but the choice of colors (states) will directly influence the ability to identify each state, associated with an error by state identification. Due to physical and technological limitations, the colors chosen may not necessarily be achieved or reproduced by printing, optical and display devices, such as printers, cameras, scanners, and monitors. In addition to this, the error produced from propagation from one device to another should be considered, for example: a given color is reproduced by means of a monitor, then this digital color is reproduced analogically with a printer, then scanned by a scanner returning again analog to digital information, to finally display it again with the same monitor. Comparing each result shows the existence of an error in the gamut or color gamut.
- the preferred execution begins by finding the common area between the color reproduction devices in the xyY color space, for this purpose the chromatic diagram of the xyY color space is used as indicated in Figure 33.
- the selected region can be found by restriction equations that form the boundary of the resulting polygon, or by evaluating membership in the region.
- a clustering algorithm is used, in this case K-means, using a distance relative to color as a distance metric, implementing the color distance CIEDE2000 ( ⁇ 00 ). It should be mentioned that the color distance ⁇ 00 , has a better response in the differentiation of colors than the typical distances used in the K-means algorithm, for example Euclidean distance.
- the objective function is to maximize all distances ⁇ 00 between the K colors chosen.
- the clustering algorithm manages to determine the set of data closest to a given initial solution ⁇ (0) , updating the value of the iteration to iteration solution until its convergence (if it exists) or up to a predefined number of iterations.
- the distances are calculated in the CIELAB color model, the set of data belonging to the selected region ⁇ (see Figure 33) in CIELAB coordinates is referred to as x, and C ⁇ (z) corresponds to the elements belonging to ax which they are closer to the element ⁇ (z) , of the solution in iteration z, with respect to the distance ⁇ 00 .
- N being the number of points belonging to the selected region ⁇ .
- the values a (j, ⁇ , m) (z) which correspond to the distance ⁇ 00 between the jth element between the and c ⁇ (z) belonging, are first calculated to the group C ⁇ (z) , and ().
- the value j * that maximizes b ⁇ (z) (j) is determined, where b ⁇ (z) (j) corresponds to the geometric mean of the values for grouping i divided by the standard deviation of the values for the grouping i.
- a learning rate w is included, ranging from zero to one.
- the size of the data matrix in information units depends on the volume of static information to be included, which could be compressed, on the dynamic elements and on the number of states in which each information unit can be configured.
- the choice of the proportion of the smart tag (high width ratio) can be arbitrary, adjusting to the number of units of information required, and the space in the place where the smart tag adheres.
- Preferred shapes are square and / or rectangular.
- the size of the data matrix is calculated, both in the square and rectangular format, as the smallest size that is capable of containing both static and dynamic information units. In the case of the square format this corresponds to determining the minimum such that:
- the information units required to encode the information depend on the coding scheme selected, as explained in section C Configuration of the information units of the device. In the case of using a rectangular format on the label, the proportion between the sides may also be subject to an aspect ratio for practical and / or aesthetic reasons.
- the label can optionally include an electronic system for storing and transmitting information.
- the information stored in the electronic system can be used as a backup for the dynamic information collected by the analog part of the label.
- a wireless or contact type data transmission system may also be included.
- the information units of the label may have static, dynamic behavior or be information units that cannot be interpreted by the SR.
- the static information is encoded on the label by assigning a defined status to each static element (see 1. LABEL DEVICE: C Configuration of the device information units), or using dynamic dual type elements (according to Figure 29) .
- the dynamic information units used in this way must meet the condition of being recognized as static information units by the SR.
- a set of positions in it can be indicated as reserved spaces, which means that during the assignment of values these positions will be omitted.
- the reserved spaces can be used to include in the label dynamic elements that due to their shape, operation, size, etc. Do not use to encode static information (simple dynamic elements), recognition / calibration patterns or others. Additional elements such as logos, perforations, fasteners, dynamic elements not interpretable by the SR, etc. They can also be located in a reserved space of the label.
- the static information is written in the data matrix (in its preferred execution) vertically, from top to bottom, covering the columns from left to right, ignoring, as explained above, the reserved spaces.
- An error correction mechanism is included in the information coding, whose objective is to detect and correct the errors that occur in the reading of the information on the smart tag, due to damage to it, or due to the performance of the SR .
- An implementation of the error correction method uses the Reed-Solomon algorithm, this algorithm has the peculiarity that it uses elements belonging to a Galois Field of order p (GF (p)) and also an extension of the Galois Field of order p ⁇ m (GFip ⁇ m)), sets that are characterized by being closed for addition and multiplication, thus avoiding the problem of overflow (that some operation generates a value that the system is not able to represent) .
- the elements of GF can be interpreted as polynomials of order (m -1), whose coefficients can be added using addition module p.
- the construction of the elements requires the definition of a generator polynomial of order m that allows to avoid overflow.
- a generator polynomial of order m that allows to avoid overflow.
- the information to be transmitted is interpreted as the coefficients of a polynomial, to which the coefficients of the product of the operation are added with a generating polynomial as follows:
- n corresponds to the total length of the data chain to be transmitted
- k corresponds to the length of the message itself
- the rest (nk) corresponds to the redundant information added as a method of error detection and correction.
- the generating polynomial g (x) corresponds to a polynomial of order (nk), whose roots are the elements a, a 2 , .... cr (n "k) in GF (p ⁇ m). You can check the (nk) roots in the polynomial message received, the evaluation in each of these roots should give a zero result.
- n (p ⁇ m) -1 is used, where the generating polynomial corresponds to:
- a physical representation is generated, where each position in the data matrix is transformed into a square of defined size. The status of each selected from a set according to the configuration of the information units defined for the device in relation to what is explained in section 1.
- DEVICE C Configuration of the information units of the device.
- the corresponding states are assigned to the recognition and state calibration patterns.
- Pattern 201 is rescaled according to the size of the first column of the label image. Surrounding the image of the label includes a security border of white color 206, so that the label is minimally isolated from the environment. The extent of pattern 206 depends on the performance of the SR and the characteristics of the product where the label will be included. For example, in the case of a white product, it might not be necessary to include a border.
- Data compression is an optional feature that aims to reduce the size of the data, prior to coding on the smart tag.
- An important premise is the use of lossless compression algorithms, among which are those based on static models and those based on dictionaries.
- Any algorithm that meets the requirement that there is no loss of information can be used, for example the Lempel-Ziv-Welch algorithm.
- the data compression process is divided into two parts, coding and decoding.
- the compression algorithm encoder fulfills the function of developing a dynamic index dictionary, which will later be used by the compression algorithm decoder.
- the decoding stage the original information is reconstructed, previously coded, through an inverse process with the information present in the dictionary.
- Data encryption is an optional feature that aims to implement levels of information security in the code in order to protect information by user types.
- the applicable encryption methods can be any present in the state of the art provided they do not present data loss.
- An example of such methods is the AES encryption method, whose implementation is detailed in Example 4.
- a correct implementation of encryption methods considers the configuration of the label and the requirements defined for the product or element to which it will adhere, as well as also for the different user levels that are considered to be implemented.
- the reading of the information from the device by the recognition system involves a series of specific stages.
- 3.A.1 Acquisition of tag image Information can be obtained from the tag image from a variety of image capture devices (eg scanner, digital camera or other). It is possible to include previous stages of processing, such as the application of a medium filter in cases where the image presents noise, or the reduction of the image size, in order to reduce the processing time, among others, depending on the application of the label and the surface on which it will adhere.
- image capture devices eg scanner, digital camera or other.
- previous stages of processing such as the application of a medium filter in cases where the image presents noise, or the reduction of the image size, in order to reduce the processing time, among others, depending on the application of the label and the surface on which it will adhere.
- the projective distortion of the image is corrected.
- the original image is subdivided into a 4x4 grid in its preferred execution, of which only the 4 sectors containing the corners of the original image are analyzed.
- Each sector is transformed to grayscale.
- Intensity gradients (I) in x and x direction are calculated by applying filters [-1 0 1] and [-1 0 1] '.
- the objective function for corner detection is calculated, given by: Where sf is a sensitivity factor in detection. Regions containing local maximums of the objective function, corresponding to the groups of pixels having the same value, while surrounded by pixels of lower intensity, are isolated. The least significant local maximums are eliminated, as a percentage of total detections. Regions containing remaining local maximums contract to a single point.
- the point recognized as the corner closest to the corner of the original image is selected, according to the position of the sector under analysis. This set of 4 points is considered to delimit the grid that contains the image of the label.
- the transformation matrix between the coordinates of these detected corners and a rectangle of similar size is calculated, according to:
- a x is the matrix that maps the unit square to quadrilateral X and A and is the matrix that maps the unit square to quadrilateral Y, then you have:
- This transformation is subsequently applied to the entire image.
- Barcode pattern This is done by transforming the image to a black and white representation, then all areas are isolated with adjacent black pixels. For each zone the rectangle in pixels that contains it (bounding box) is determined, the major edge of all the bounding boxes corresponds to the length of the image of the information matrix in units of pixels.
- the subsector of the image that corresponds to the barcode is analyzed by extracting a line of information. Points along that line where there is a color change between black and white are detected, thereby calculating a value for the widths of the columns that make up the barcode in pixels.
- the column widths obtained in this way are normalized by the average of the widths corresponding to the starting pattern, which corresponds to a unit in the UPC coding. Once the normalized width is known, groups of four columns can be translated into whole numbers. Finally, it is verified that the information has been correctly recovered by means of the verification digit.
- Pattern of size Pattern 205 is distinguished in similar ways based on the value of the objective function that considers the proximity of the form to the lower side of the data matrix, its eccentricity, and the size ratio between the shape and the total height of the data matrix, according to:
- the above values can be readjusted depending on the specific implementation.
- the comparison between the size of the pattern 205 in pixels with the size of the pattern 201 allows to determine the size of the data matrix in units of information.
- the size determined in this way can be verified with the value obtained from reading the barcode. In the event that the barcode information cannot be retrieved reliably, the value of the data matrix size determined from the analysis of pattern 205 is used. 3.A.4 Colorimetric transformation
- the colorimetric transformation is part of the recognition of the states and of obtaining information from the information units.
- the digital values of the color to be corrected previously known design values
- the values are taken as reference representative of the measured colors (mean, median, geometric mean, effective value or RMS, or other of the sample) and then find the polynomial that adjusts the measured colors as close as possible to the theoretical values.
- the polynomial order affects the stability of the transformation in the areas related to extrapolation of data. So usually the first and second order settings get more robust results at the time of mapping. However, a higher polynomial order also increases the accuracy of the approach in areas related to interpolation.
- the colorimetric transformation can be carried out directly with the values of the RGB color model, or in the XYZ, CIELAB, CIELUV or other color space. For practical and processing speed effects, it is that the application of the least squares method can be applied to models and not to color spaces.
- r 0 , g 0 and b 0 be the values of the reference colors and r , and bi the representative values of the measured colors. It has to be that the colorimetric transformation can be expressed in matrix form as follows:
- the arrays of the second and third polynomial colorimetric transformations are generated.
- the reference colors are: second order arrangement: third order arrangement:
- second order colorimetric transformation matrix third order colorimetric transformation matrix: arrangement with the data to correct:
- the data matrix is sequentially traversed, in the same writing order, that is, from top to bottom, traveling the columns from left to right, omitting the zones that correspond to reserved spaces.
- a subimage is extracted for each unit of information, whose status is compared with the list of states used in the coding.
- the information of the states used in the coding is uploaded to the SR, for example, by means of a configuration file for a particular execution of the tag. Based on this comparison, an integer is assigned as a read value, the set of these integers corresponds to the decoded message, which may or may not contain errors.
- a reading improvement method is included that corresponds to, in addition to analyzing the aforementioned sub-image, analyzing sub-images that correspond to slight displacements of the sample window, considering the one with the lowest variance in the comparison of states to assign a reading value . 3.
- the syndrome value is defined as the error polynomial evaluated at the roots of the generating polynomial, in the event that no errors occurred during the transmission of the message, all syndrome values should be equal to zero. Because the generator polynomial has (n-k) roots, a system of (n-k) equations and (n-k) unknowns is generated:
- the difficulty that the previous system is non-linear is attacked by resolving the error positions separately and then the magnitudes of them.
- the error locator polynomial is defined as:
- the visual interpretation of all or part of the dynamic information by the user may require that you have previously received instructions. In general, these consist of the location of the interpretable elements in the label, together with a list of the states in which the element (s) can be found, together with the value / condition of the associated variable of interest. Visual interpretation can also be generated based on intuitive concepts (such as representative figures of concepts known to the collective unconscious) or by logical sequences in certain industries or applications where interpretation does not necessarily require additional instructions. As an example of the previous explanation, the use of the figure X (X) or a ticket (approval or approval symbol) can be considered using colors of the information units to generate the figures.
- the reading method will use a method according to the compression algorithm used to process the information, before or after decryption depending on the order in which the data were used. optional components.
- an optional module for reading compressed information is used, an optional module of encrypted information is also used that can be used for the implementation of information levels (as indicated in point ⁇ . Information levels "below) or for the implementation of information security levels.
- the decryption module of the SR identifies segments that indicate whether there is encryption or not in a given fragment and proceeds to use the method adequate decryption. Just as it is possible to use various compression methods it is also possible to use various data decryption methods according to the specifications and requirements of the implementation, provided that it is appropriate for the encryption method used. E. Information levels
- the system is able to recognize the existence of information levels, according to the type of implementation that was used during the coding. This can be done in a variety of ways, for example an unencrypted segment of the information can be used as an indication that the next block of information is encrypted and therefore a password is required to access the information, it is also possible to create different versions of the reading software (producer version, consumer version, etc.).
- Figure 28 shows the optional integration of the smart tag into a traceability system and the integration of the analog, digital, and recognition system information.
- a traceability system involves the interaction of the different means that compose it:
- Means for configuring the device (A) At this stage the appropriate configuration for the label is chosen based on the variables to be monitored and the user's requirements. Among the aspects to be configured are: the dynamic and static part of the two-dimensional code, encryption algorithm, protocols coding and decoding, device verification number, physical arrangement of spatial and state calibration, shape, size, etc.
- the system database consists of several fields for each product. Within the database, two major types of information stand out: the pre-tracking information (C), and the information generated during the product tracking.
- Encryption and / or compression media (D): At this optional stage, the data is encrypted and / or compressed. Then this, the two-dimensional code (E) adheres to the product, collecting information through the active elements on the label.
- Label information is retrieved from the image obtained by means of a capture device (E). Both spatial and state calibrations are used to retrieve the static and dynamic information contained in the smart tag (F). After reading the two-dimensional code, it is decoded (G), stored information in the database in the fields corresponding to the object tracking (H, I, J), and feedback of the device to through the wireless connection (optional) between the device and the data acquisition portals (K, L, M), where the information fed back to the device is stored inside the internal memory (optional), as a backup of the data processed in Data acquisition portals. At any point in the follow-up, the user can visually access the information contained in the label ( ⁇ ').
- FIG. 6 An example of coding information regarding a product, corresponding to the character string, is shown in Figure 6 and Figure 7: "MANU Soprale PROD whole milk VOL 11 CONSTEMP 8 C ELAB 12-09-14 VENC 12-11-14 ", identification number" 0019 ", considering 36% of redundancy symbols (the message can be reconstructed even if 18% of the symbols are read incorrectly), in addition in each case a set of information units that have dynamic behavior is included before changes in a variable (eg temperature).
- the result of the coding is shown considering two possible states of the information units. Representing each character using 7 units of information, a data matrix of 31x31 units of information is required.
- FIG 7 considering 4 possible states of the information units, each character is represented using 4 information units, requiring a matrix of 24x24 information units, this illustrates the increase in information density when using more than two possible states for each unit of information in the coding.
- Figure 8 shows the coding using four possible states of the information units, considering a set of information units that exhibit dynamic behavior in the face of changes in a variable (eg temperature) requiring a matrix of 24x24 information units.
- Figure 9 shows how the appearance of the label can vary to rectangular to accommodate a set of information units that exhibit dynamic behavior in the face of changes in a variable (eg pressure), in this case requiring a matrix of 21x30 information units .
- Figure 10 shows the coding of two types of information; a segment of the genetic code of the species Atlantic salmon (150 characters), followed by fields with product information constituting the message "GEN AGTGCTAGAGGAGTTCTGTATCTATAATTCTTAAAATAATTGTTATGCTTTTTGTGA ACGTTTATCGTGAGTAATTTAGTAAATTCTTAGTGAATTCGGCGGAAGTTTGCGGG GGTATGCTAGTTCTGAACGTCACATGCTAATGTAAAA ⁇ n PRODUCT INFO ⁇ n MANU Marfruit ⁇ n PROD salmonahu ⁇ n WEIGHT 500g ⁇ n CONSTEMP 0C ⁇ n ELAB 20-06 ⁇ n VENC 05-07 ⁇ n PORTION 55g ⁇ n CALORIASTOT 107 ⁇ n GRASASTOT 6g9% ⁇ n CHOLESTEROL 37mg12% ⁇ n SODIUM 32mg1% ⁇ n CARBOHIDTOT 0g0% ⁇ n PROTE
- the uncoded message consists of 378 characters, equivalent to a requirement of 3024 bits in case each character is encoded using 8 bits.
- the entire message is reduced to a 1731 bit string, which represents a compression of the information to 57% of the original size.
- adjacent 8-bit segments are used as integers in the framework of the Reed Solomon algorithm, allowing information to be encoded on a 47x46 information unit label, considering 14% redundancy symbols.
- FIG. 1 1 The result of the coding of the following message is shown in Figure 1 1; "Route 25 efficiency distribution monitoring. Departure from dispatch center X, 1 1: 48 22-07, register arrival at warehouse Y. ⁇ n PRODUCT INFO ⁇ n MANU Marfruit ⁇ n PROD salmonahu ⁇ n WEIGHT 500g ⁇ n CONSTEMP 0C ⁇ n ELAB 20-06 ⁇ n VENC 05-07 ⁇ n ", identification number:" 0318 ".
- Example 5 Figure 12 shows the label generated by encoding the following information: "MANU Soprale ⁇ n PROD whole milk ⁇ n VOL 1 l ⁇ n CONSTEMP 8C ⁇ n ELAB 12-09-14 ⁇ n VENC 12-1 1- 14 ⁇ n CALORIES TOT 158 ⁇ n FAT TOT 5g8% ⁇ n CHOLESTEROL 22mg7% ⁇ n SODIUM 150mg6% ⁇ n CARBOHID TOT 18g6% ⁇ n PROTEIN 10g20% ⁇ n ", identification number:" 01 10 ", in a matrix of 47x47 units of information, considering 20% redundancy symbols.
- the active zone "SENSOR” changes its appearance according to the environmental conditions to be monitored (eg temperature), near the active zone are calibration colors, indicative of specific conditions of the information units used ( Figure 13).
- Figure 14 shows possible states of the active zone, the calibration colors can be used to determine the environmental condition by direct comparison by the user (according to the instruction manual), or by using the SR.
- Example 6
- Figure 15 shows an example of a label that includes dynamic units of information, which can be read both with the naked eye and using the SR.
- the triangular area corresponds to a protected space and contains sensors that change irreversibly when a certain combination of time and temperature occurs. While the circular-shaped sensor that also corresponds to a reserved space contains sensors that reversibly change to certain temperature values (Figure 16).
- Figure 18 shows the image of the label obtained when encoding the information: "MANU Soprale ⁇ nPROD whole milk ⁇ nVOL 1 l ⁇ nCONSTEMP 8C ⁇ nELAB 12-09-14 ⁇ nVENC 12-11-14 ⁇ n", identification number "0515”, including a set of dynamic colorimetric information units that change state with respect to the temperature variable (S), in a matrix of 31x31 information units, considering 30% redundancy symbols.
- Figure 19 shows a photograph of the same label. The photograph is 1796x1843 pixels in size. Below is the decoding algorithm, which allows you to retrieve the tag information, through the main stages.
- the photograph associated with the tag image is broken down into a 4x4 grid.
- Sub-images containing the corners of the original image are analyzed ( Figure 20).
- Figure 21 shows the detail of the pixels detected as corners in the sub-image corresponding to the upper left corner of the photograph.
- the corners detected near the edge of the subimage are then discarded (indicated by a square in Figure 22).
- the one closest to the upper left corner of the subimage is selected (indicated by a triangle in Figure 22).
- An analogous procedure is performed with the remaining three sub-images.
- the transformation matrix is obtained according to what is described in section 3.
- DECODING METHOD A Decoding by means of the recognition system.
- the image is transformed to black and white ( Figure 23), and the properties that characterize each region of contiguous pixels (Bounding box, eccentricity and centroid) are obtained.
- the height of the data matrix corresponds to a greater height between the detected regions ( Figure 25), corresponding to 1660 pixels.
- the size pattern 205 is identified by evaluation of the detection function (see 3. DECODING METHOD: A Decoding by means of the recognition system), the values corresponding to the regions with lower scores, and in reference to the Figure 27, are shown in the following table 4:
- Table 4 It is observed that the pattern is detected correctly. This determines a provisional value for the size of the data matrix in information units (31), and the size of each information unit in pixels (54).
- the matrix is then sequentially traversed, assigning each unit of information a value, depending on its status (in this example: color).
- the median of the color values is used in the case of coding using two states.
- Table 7 shows the value assignment to some units of information in the data matrix as an example:
- the selected region ⁇ is shown in the xyY color space. This region was obtained by determining the intersection between the color ranges corresponding to ProPhoto RGB, Adobe RGB 1998, Colormatch RGB, sRGB and SWOP CMYK.
- Figure 36 shows the result obtained from the groupings in the selected region ⁇ belonging to the CIELAB color space for iteration number 200.
- Figure 37 shows the result obtained from the groupings in the selected region ⁇ belonging to the color space xyY for iteration number 200.
- Figure 38 and Figure 39 show the results obtained from the groupings in the selected region ⁇ belonging to the xyY color space, for the 200th iteration, individually.
- Figure 40 shows the variation of the color with respect to the number of iterations, in the color space xyY.
- the initial and final solution are indicated as ⁇ ⁇ (0) and ⁇ (200) , respectively.
- the range of use of the material is between 15 and 29 [° C].
- a Feed Forward Neural Network was used, with 20 neurons in the first layer, 20 neurons in the second layer, and 1 neuron in the output layer.
- YCbCr 3 channels
- LCH 3 channels
- RGB 3 channels
- YPbPr 3 channels
- YUV 3 channels
- YIQ 3 channels
- HSV 3 channels
- HSL 3 channels
- HSI 3 channels
- XYZ 3 channels
- Lab 3 channels
- Luv 3 channels
- 'JPEG- YCbCr 3 channels
- CAT02 LMS 3 channels
- YDbDr YDbDr
Landscapes
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Theoretical Computer Science (AREA)
- Image Processing (AREA)
- Warehouses Or Storage Devices (AREA)
Abstract
Description
ETIQUETA INTELIGENTE CON CAMPOS DE INFORMACIÓN ESTÁTICOS Y SMART LABEL WITH STATIC INFORMATION FIELDS AND
DINÁMICOS DYNAMICS
CAMPO DE APLICACIÓN La presente invención corresponde a un dispositivo tipo etiqueta inteligente (smart label), el método de escritura de información en la misma, el método de lectura de la información contenida en la etiqueta y un sistema asociado a la misma. FIELD OF APPLICATION The present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith.
La etiqueta corresponde a la representación visual de una matriz de datos bidimensional, conteniendo unidades de información (unidad más pequeña que conforma la matriz de datos bidimensional) que presentan distintos estados. Dichas unidades de información pueden tener comportamientos tanto estáticos como dinámicos. Un comportamiento dinámico se refiere, en la presente invención, a la capacidad de una unidad de información de variar su estado o mutar respecto a otra variable, mientras que un comportamiento estático se refiere a un estado inmutable en el tiempo. Las unidades de información que presentan comportamiento dinámico (unidades de información dinámicas) pueden ser interpretadas como sensores de acuerdo a lo señalado en el método de lectura de información de la presente invención, a objeto del acopio de información de variables ambientales y/o de interés: temperatura, radiación UV, presión, etc., presentando información de tipo dinámica. La totalidad o parte de las unidades de información dinámicas pueden ser utilizadas en conjunto con las unidades de información que presentan comportamiento estático (unidades de información estáticas) para codificar información estática en la etiqueta. La información dinámica, así como la estática, puede ser leída desde la etiqueta por un sistema de reconocimiento (SR) de acuerdo al método de lectura de la presente invención. Parte o la totalidad de la información dinámica puede ser leída visualmente por el usuario sin la necesidad de un SR. ANTECEDENTES The label corresponds to the visual representation of a two-dimensional data matrix, containing information units (smaller unit that makes up the two-dimensional data matrix) that have different states. Such information units may have both static and dynamic behaviors. A dynamic behavior refers, in the present invention, to the ability of an information unit to vary its state or mutate with respect to another variable, while a static behavior refers to an immutable state in time. The information units that have dynamic behavior (dynamic information units) can be interpreted as sensors according to what is indicated in the method of reading information of the present invention, in order to gather information of environmental variables and / or of interest : temperature, UV radiation, pressure, etc., presenting dynamic information. All or part of the dynamic information units can be used in conjunction with the information units that have static behavior (static information units) to encode static information on the label. The dynamic information, as well as the static information, can be read from the label by a recognition system (SR) according to the reading method of the present invention. Part or all of the dynamic information can be read visually by the user without the need for an SR. BACKGROUND
DESCRIPCIÓN DEL ESTADO DE LA TÉCNICA DESCRIPTION OF THE STATE OF THE TECHNIQUE
En el estado de la técnica existen múltiples tipos de etiquetas con información codificada utilizando puntos, códigos de barra, códigos QR, figuras, etc. Esta información puede ser estática o dinámica dependiendo de la aplicación y uso de la etiqueta. In the state of the art there are multiple types of labels with information encoded using points, bar codes, QR codes, figures, etc. This information can be static or dynamic depending on the application and use of the label.
La información estática es impresa en la etiqueta y comúnmente corresponde a información asociada a la fabricación, precio, origen o destino del producto en el cual será incorporada. The static information is printed on the label and commonly corresponds to information associated with the manufacture, price, origin or destination of the product in which it will be incorporated.
La información dinámica varía en el tiempo a medida que algún elemento sensor cambia de estado de acuerdo a la condición a medir. Como resultado de este cambio en el sensor, la etiqueta modifica su apariencia mediante el cambio de color de un icono, figura, barra, etc., pudiendo este cambio ser reversible o irreversible. The dynamic information varies over time as some sensor element changes state according to the condition to be measured. As a result of this change in the sensor, the label modifies its appearance by changing the color of an icon, figure, bar, etc., and this change may be reversible or irreversible.
Actualmente existen etiquetas que cumplen con la condición de contener información estática y dinámica. El documento US2013/0048736 describe una etiqueta consistente en dos componentes. El primer componente corresponde a una superficie que contiene información que es invariable en el tiempo (información estática) y el segundo componente corresponde a una porción de la etiqueta que contiene información que varía en el tiempo. Por ejemplo, se aprecia en la Figura 1 (a), un primer componente de la etiqueta consistente en un código de barras y un segundo componente que es una cinta que cambia de color a medida que transcurre el tiempo, lo cual puede ser asociado al tiempo de expiración del producto en el cual está inserta la etiqueta. Del mismo modo la Figura 1 (b) muestra una etiqueta en que el código de barras contiene información estática y la parte inferior de la etiqueta es variable en el tiempo. There are currently labels that meet the condition of containing static and dynamic information. Document US2013 / 0048736 describes a label consisting of two components. The first component corresponds to a surface that contains information that is invariable over time (static information) and the second component corresponds to a portion of the label that contains information that It varies over time. For example, it can be seen in Figure 1 (a), a first component of the label consisting of a barcode and a second component that is a tape that changes color as time passes, which can be associated with the expiration time of the product in which the label is inserted. Similarly, Figure 1 (b) shows a label in which the barcode contains static information and the bottom of the label is variable in time.
La etiqueta del documento US2013/0048736 está compuesta por dos etiquetas independientes, ubicadas sobre una misma base, debido a que la parte superior que contiene el código de barras y la parte inferior variable pueden ser separadas, manteniendo cada una plena funcionalidad. The document label US2013 / 0048736 is composed of two independent labels, located on the same base, because the upper part containing the bar code and the variable lower part can be separated, maintaining each one full functionality.
El documento JP200181356 describe una etiqueta de precios que está provista de un primer código de barras que muestra datos del tipo no variable en los cuales ninguna alteración se produce después de emitida, y un segundo código de barras que muestra un conjunto de datos de tipo variable en el que se produce un factor de alteración después de su emisión, como se observa en la Figura 1 (c). También en este caso la etiqueta consta de dos o más etiquetas incorporadas en una misma base, bajo el mismo argumento de que la parte dinámica y la parte estática por separado mantienen plena funcionalidad. JP200181356 describes a price tag that is provided with a first barcode that shows data of the non-variable type in which no alteration occurs after it is issued, and a second barcode that shows a set of data of variable type in which an alteration factor occurs after its emission, as seen in Figure 1 (c). Also in this case the label consists of two or more labels incorporated in the same base, under the same argument that the dynamic part and the static part separately maintain full functionality.
Los señores Shimizu, Isami y otros [Referencia 2], investigaron el uso de colores distintos de blanco y negro en la construcción de códigos bidimensionales. Propusieron un método para mejorar la eficiencia en la clasificación por parte del sistema de reconocimiento, con respecto a los colores usados en la codificación. Su método consiste en incluir un conjunto de colores (seed colors) en el código bidimensional, que no necesariamente son iguales a los colores usados en la codificación. Como entrada del sistema de clasificación (features) usaron los valores RGB del color a clasificar, junto a los valores RGB correspondientes a los seed colors. En concreto realizaron experimentos considerando como colores de codificación los 64 colores generados con las combinaciones de valores RGB [0,85, 170,255], y como seed colors utilizaron los 8 colores generados con las combinaciones de valores RGB [0,255]. Ellos no consideraron la incorporación de elementos dinámicos en la etiqueta utilizada ni tampoco la utilización de estados diferentes a color. El estado de la técnica no describe una etiqueta que incorpore información estática y dinámica en una sola unidad, en donde parte o la totalidad de la información dinámica pueda ser leída a simple vista. El estado de la técnica no describe una etiqueta que contenga elementos estáticos a la vez que dinámicos, en donde los elementos dinámicos puedan ser interpretados como sensores, y cuyo método de lectura/escritura de información considere elementos que existan en más de dos estados. Messrs. Shimizu, Isami and others [Reference 2], investigated the use of colors other than black and white in the construction of two-dimensional codes. They proposed a method to improve the efficiency in the classification by the recognition system, with respect to the colors used in the coding. its The method consists of including a set of colors (seed colors) in the two-dimensional code, which are not necessarily equal to the colors used in the coding. As input of the classification system (features) they used the RGB values of the color to be classified, together with the RGB values corresponding to the seed colors. Specifically, they carried out experiments considering as coding colors the 64 colors generated with the combinations of RGB values [0.85, 170,255], and as seed colors they used the 8 colors generated with the combinations of RGB values [0,255]. They did not consider the incorporation of dynamic elements in the label used nor the use of different color states. The state of the art does not describe a label that incorporates static and dynamic information in a single unit, where part or all of the dynamic information can be read with the naked eye. The state of the art does not describe a label that contains static as well as dynamic elements, where dynamic elements can be interpreted as sensors, and whose method of reading / writing information considers elements that exist in more than two states.
RESUMEN SUMMARY
La presente invención corresponde a un dispositivo tipo etiqueta inteligente (smart label), el método de escritura de información en la misma, el método de lectura de la información contenida en la etiqueta y un sistema asociado a la misma. The present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith.
La etiqueta corresponde a la representación visual de una matriz de datos bidimensional, conteniendo unidades de información (unidad más pequeña que conforma la matriz de datos bidimensional) que presentan distintos estados. Dichas unidades de información pueden tener comportamientos tanto estáticos como dinámicos. Un comportamiento dinámico se refiere, en la presente invención, a la capacidad de una unidad de información de variar su estado o mutar respecto a otra variable, mientras que un comportamiento estático se refiere a un estado inmutable en el tiempo. Las unidades de información que presentan comportamiento dinámico (unidades de información dinámicas) pueden ser interpretadas como sensores de acuerdo a lo señalado en el método de lectura de información de la presente invención, a objeto del acopio de información de variables ambientales y/o de interés: temperatura, radiación UV, presión, etc., presentando información de tipo dinámica. La totalidad o parte de las unidades de información dinámicas pueden ser utilizadas en conjunto con las unidades de información que presentan comportamiento estático (unidades de información estáticas) para codificar información estática en la etiqueta. La información dinámica, así como la estática, puede ser leída desde la etiqueta por un sistema de reconocimiento (SR) de acuerdo al método de lectura de la presente invención. Parte o la totalidad de la información dinámica puede ser leída visualmente por el usuario sin la necesidad de un SR. The label corresponds to the visual representation of a two-dimensional data matrix, containing units of information (unit smaller than it forms the matrix of two-dimensional data) that present different states. Such information units may have both static and dynamic behaviors. A dynamic behavior refers, in the present invention, to the ability of an information unit to vary its state or mutate with respect to another variable, while a static behavior refers to an immutable state in time. The information units that have dynamic behavior (dynamic information units) can be interpreted as sensors according to what is indicated in the method of reading information of the present invention, in order to gather information of environmental variables and / or of interest : temperature, UV radiation, pressure, etc., presenting dynamic information. All or part of the dynamic information units can be used in conjunction with the information units that have static behavior (static information units) to encode static information on the label. The dynamic information, as well as the static information, can be read from the label by a recognition system (SR) according to the reading method of the present invention. Part or all of the dynamic information can be read visually by the user without the need for an SR.
Tanto las unidades de información que presentan comportamiento dinámico como las que presentan comportamiento estático pueden presentar más de 2 estados utilizables por la presente invención, permitiendo almacenar mayor cantidad de información por unidad de espacio (por ejemplo en comparación a códigos binarios). Both the units of information that exhibit dynamic behavior and those that exhibit static behavior can have more than 2 usable states by the present invention, allowing to store more information per unit of space (for example in comparison to binary codes).
La información estática corresponde a información invariable. Parte de sus usos son: contenedor de un número de identificación o parte de un mecanismo que permita implementar distintos niveles de acceso a la información (tanto estática como dinámica) para los distintos usuarios de la etiqueta. La codificación de la información estática puede incluir información de redundancia como método de corrección de errores, de acuerdo al método de escritura de la información de la presente invención. Las unidades de información dinámicas de la etiqueta, utilizadas para reunir información dinámica, se agregan a la etiqueta bajo una estructura predefinida para cada configuración (por ejemplo: producto, tipo de producto, familia de productos o variables de interés a medir). Static information corresponds to invariable information. Part of its uses are: container of an identification number or part of a mechanism that allows implement different levels of access to information (both static and dynamic) for the different users of the label. The coding of the static information may include redundancy information as an error correction method, according to the method of writing the information of the present invention. The dynamic information units of the label, used to gather dynamic information, are added to the label under a predefined structure for each configuration (for example: product, product type, family of products or variables of interest to be measured).
La combinación de información estática y dinámica permite almacenar información relativa al origen, historia y estado actual del producto. The combination of static and dynamic information allows information about the origin, history and current state of the product to be stored.
Además de la información contenida en las unidades de información estáticas y dinámicas, opcionalmente es posible incluir un sistema electrónico de almacenamiento y transmisión de información, que actúa como respaldo de la parte analógica de la etiqueta. El sistema electrónico puede usar tecnología inalámbrica (RFID, NFC, WIFI, BLUETOOTH, etc.) o de contacto para el envío/recepción de la información, lo cual permitiría que el dispositivo sea integrado a sistemas automáticos de seguimiento y/o logística que consideren componentes electrónicos y de automatización. In addition to the information contained in the static and dynamic information units, it is optionally possible to include an electronic system for storing and transmitting information, which acts as a backup for the analog part of the label. The electronic system can use wireless (RFID, NFC, WIFI, BLUETOOTH, etc.) or contact technology for sending / receiving information, which would allow the device to be integrated into automatic tracking and / or logistics systems that they consider electronic and automation components.
La información analógica (tanto estática como dinámica) contenida en la etiqueta puede ser leída a partir de una imagen de la misma obtenida desde un dispositivo de captura (escáner, cámara digital, etc.), utilizando un sistema de reconocimiento (SR), de acuerdo al método de lectura de la presente invención. La información leída de la etiqueta puede ser utilizada para actualizar una base de datos externa, pudiendo ser incorporada en un sistema logístico y/o de aseguramiento de la calidad del producto, desde su fabricación hasta el usuario final. The analog information (both static and dynamic) contained in the label can be read from an image of it obtained from a capture device (scanner, digital camera, etc.), using a recognition system (SR) of according to the reading method of the present invention. The information read from the label can be used to update an external database, and can be incorporated into a logistic and / or quality assurance system, from its manufacture to the end user.
BREVE DESCRIPCIÓN DE LAS FIGURAS BRIEF DESCRIPTION OF THE FIGURES
Figura 1 : Ejemplos de estado de la técnica. Figure 1: Examples of prior art.
Figura 2: Diseño de la etiqueta según la presente invención. Figure 2: Label design according to the present invention.
Figura 3: Código de barras de la etiqueta. Figure 3: Label barcode.
Figura 4: Codificación usada en la elaboración del código de barras. Figure 4: Coding used in the elaboration of the bar code.
Figura 5: Ejemplo de cuadrilátero distorsionado. Figure 5: Example of distorted quadrilateral.
Figura 6: Ejemplo 1 : Codificación usando dos estados posibles para las unidades de información. Figure 6: Example 1: Coding using two possible states for the information units.
Figura 7: Ejemplo 1 : Codificación usando cuatro estados posibles para las unidades de información. Figure 7: Example 1: Coding using four possible states for the information units.
Figura 8: Ejemplo 2: Caso base. Figure 8: Example 2: Base case.
Figura 9: Ejemplo 2: Adaptación de forma de la etiqueta a objeto de acomodar sensor adicional. Figure 9: Example 2: Adaptation of the shape of the label in order to accommodate additional sensor.
Figura 10: Ejemplo 3: Codificación de información comprimida. Figure 10: Example 3: Coding of compressed information.
Figura 1 1 : Ejemplo 4: Codificación de información encriptada y comprimida Figura 12: Ejemplo 5: Etiqueta con un sensor interpretable visualmente. Figure 1 1: Example 4: Coding of encrypted and compressed information Figure 12: Example 5: Label with a visually interpretable sensor.
Figura 13: Ejemplo 5: Detalle del sensor. Figure 13: Example 5: Sensor detail.
Figura 14: Ejemplo 5: Estados del sensor. Figure 14: Example 5: Sensor states.
Figura 15: Ejemplo 6: Etiqueta con sensores interpretables visualmente. Figura 16: Ejemplo 6: Posibles estados y arreglos de los sensores. Figure 15: Example 6: Label with visually interpretable sensors. Figure 16: Example 6: Possible states and sensor arrangements.
Figura 17: Ejemplo 6: Ejemplo de instrucciones para la lectura visual de la etiqueta. Figure 17: Example 6: Example instructions for visual label reading.
Figura 18: Ejemplo 7: Etiqueta incluyendo sensor colorimétrico de temperatura. Figura 19: Ejemplo 7: Fotografía de la etiqueta a ser analizada por el sistema de procesamiento de imágenes. Figure 18: Example 7: Label including colorimetric temperature sensor. Figure 19: Example 7: Photograph of the label to be analyzed by the image processing system.
Figura 20: Ejemplo 7: Subsectores de la imagen a analizar por medio del algoritmo detector de esquinas. Figure 20: Example 7: Subsectors of the image to be analyzed by means of the corner detector algorithm.
Figura 21 : Ejemplo 7: Resultados de algoritmo detector de esquinas. Figure 21: Example 7: Results of corner detector algorithm.
Figura 22: Ejemplo 7: Clasificación de esquinas. Figure 22: Example 7: Corner classification.
Figura 23: Ejemplo 7: Imagen luego de transformación espacial y transformación a blanco y negro. Figure 23: Example 7: Image after spatial transformation and transformation to black and white.
Figura 24: Ejemplo 7: Ejemplos de regiones de pixeles contiguos y sus respectivos bounding box. Figure 24: Example 7: Examples of regions of adjacent pixels and their respective bounding box.
Figura 25: Ejemplo 7: Zona de pixeles contiguos con la mayor altura entre las detectadas. Figure 25: Example 7: Zone of adjacent pixels with the highest height among those detected.
Figura 26: Ejemplo 7: Código de barras. Figure 26: Example 7: Barcode.
Figura 27: Ejemplo 7: Regiones con menor valor en la función de detección del patrón de tamaño. Figure 27: Example 7: Regions with lower value in the size pattern detection function.
Figura 28: Ejemplo 8: Integración de la etiqueta al sistema logístico y de aseguramiento de la calidad del producto. Figure 28: Example 8: Integration of the label into the logistics and product quality assurance system.
Figura 29: Tipos de información contenida en la etiqueta. Figure 29: Types of information contained in the label.
Figura 30: Esquema de codificación. Figura 31 : Esquema de decodificación. Figure 30: Coding scheme. Figure 31: Decoding scheme.
Figura 32: Esquema de sistema Figure 32: System scheme
Figura 33: Diagrama cromático espacio de color xyY. Figure 33: Color space color diagram xyY.
Figura 34: Densidad de distribución de datos del indicador a. Figure 34: Density of indicator data distribution a.
Figura 35: Densidad de distribución de datos del indicador b. Figure 35: Density of indicator data distribution b.
Figura 36: Proyecciones de agrupamientos en el espacio de color CIELAB. Figure 36: Cluster projections in the CIELAB color space.
Figura 37: Agrupamientos en el espacio de color xyY. Figure 37: Groups in the xyY color space.
Figura 38: Agrupamientos 1 al 8 espacio de color xyY. Figure 38: Groups 1 to 8 xyY color space.
Figura 39: Agrupamientos 9 al 16 espacio de color xyY. Figure 39: Groups 9 to 16 xyY color space.
Figura 40: Evolución de las soluciones espacio de color xyY. Figure 40: Evolution of the xyY color space solutions.
Figura 41 : Transformación colorimétrica para los canales rojo, verde y azul Figure 41: Colorimetric transformation for the red, green and blue channels
Figura 42: Temperatura medida versus temperatura estimada. Figure 42: Measured temperature versus estimated temperature.
Figura 43: Distribución acumulada del error absoluto. Figure 43: Cumulative distribution of the absolute error.
LISTADO DE SIGLAS Y ACRÓNIMOS LIST OF ACRONYMS AND ACRONYMS
A continuación se listan las siglas y/o acrónimos utilizados en este documento: UV: Espectro electromagnético ultravioleta. Listed below are the acronyms and / or acronyms used in this document: UV: Ultraviolet electromagnetic spectrum.
RFID: Identificación por radio frecuencia, del inglés Radio Frecuency Identification. NFC: Comunicación por campos cercanos, del inglés Near Field Communication. QR: Código Bidimensional de respuesta rápida, del inglés Quick Response Code. ASCII: Código Estándar Estadounidense para el Intercambio de Información, del inglés American Standard Code for Information Interchange. RFID: Radio frequency identification, of the English Radio Frecuency Identification. NFC: Near Field Communication, from Near Field Communication. QR: Quick Response Code Two-Dimensional Code. ASCII: American Standard Code for Information Exchange, from the American Standard Code for Information Interchange.
UPC: Código universal de producto, del inglés Universal Product Code. GF: Galois Field. UPC: Universal Product Code, English Universal Product Code. GF: Galois Field.
RS: Reed-Solomon. RS: Reed-Solomon.
LZW: Lempel-Ziv-Welch. LZW: Lempel-Ziv-Welch.
TLC: Cristal líquido termocromáticos, del inglés Thermochromic Liquid Crystal. TLC: Thermochromic Liquid Crystal, from English Thermochromic Liquid Crystal.
SR: Sistema de reconocimiento. SR: Recognition system.
REFERENCIAS REFERENCES
[1] Reed, Irving S.; Solomon, Gustave (1960), "Polynomial Codes over Certain Finite Fields", Journal of the Society for Industrial and Applied Mathematics (SIAM) 8 (2): 300-304. [2] Color Recognition by Extended Color Space Method for 64-color 2-D Barcode. Takuma Shimizu, Mariko Isami y otros, MVA2011 IAPR Conference on Machine Vision Applications, June 13-15, 201 1 Nara, Japan. [1] Reed, Irving S .; Solomon, Gustave (1960), "Polynomial Codes over Certain Finite Fields", Journal of the Society for Industrial and Applied Mathematics (SIAM) 8 (2): 300-304. [2] Color Recognition by Extended Color Space Method for 64-color 2-D Barcode. Takuma Shimizu, Mariko Isami and others, MVA2011 IAPR Conference on Machine Vision Applications, June 13-15, 201 1 Nara, Japan.
[3] ISO/IEC 15420:2009 Information technology - Automatic Identification and data capture techniques ~ EAN/UPC bar code symbology specification. [4] High speed data compression and decompression apparatus and method, Welch, T.A., US4558302, 1985/12/10/. [3] ISO / IEC 15420: 2009 Information technology - Automatic Identification and data capture techniques ~ EAN / UPC bar code symbology specification. [4] High speed data compression and decompression apparatus and method, Welch, T.A., US4558302, 1985/12/10 /.
[5] A method for the construction of minimum-redundancy codes. David A. Huffmann. Preceedings of the I.R.E. DESCRIPCIÓN DETALLADA DE LA INVENCIÓN [5] A method for the construction of minimum-redundancy codes. David A. Huffmann. Preceedings of the IRE DETAILED DESCRIPTION OF THE INVENTION
La presente invención corresponde a un dispositivo tipo etiqueta inteligente (smart label), el método de escritura de información en la misma, el método de lectura de la información contenida en la etiqueta y un sistema asociado a la misma. La etiqueta posee unidades de información (elementos) que presentan comportamiento de tipo estático y unidades de información (elementos) que presentan comportamiento de tipo dinámico. The present invention corresponds to a smart tag type device, the method of writing information therein, the method of reading the information contained in the tag and a system associated therewith. The tag has information units (elements) that have static behavior and information units (elements) that have dynamic behavior.
La información estática es aquella incluida al inicio del seguimiento del producto, de acuerdo al método de codificación (escritura) de la presente invención. Otros usos son como contenedor de un número de identificación, o parte de un mecanismo que permitiría implementar distintos niveles de acceso a la información (tanto estática como dinámica) para los distintos usuarios de la etiqueta. The static information is that included at the beginning of the product tracking, according to the coding (writing) method of the present invention. Other uses are as a container of an identification number, or part of a mechanism that would allow different levels of access to information (both static and dynamic) to be implemented for the different users of the label.
La información dinámica corresponde a la presentada por las unidades de información dinámicas incluidas en la etiqueta, las que son interpretadas como sensores por el SR, a objeto de obtener información de variables como temperatura, radiación UV, tiempo (vida útil), etc. The dynamic information corresponds to that presented by the dynamic information units included in the label, which are interpreted as sensors by the SR, in order to obtain information on variables such as temperature, UV radiation, time (useful life), etc.
Adicionalmente, la etiqueta puede integrar tecnología inalámbrica para la transmisión y recepción de datos y/o junto a una unidad electrónica de almacenamiento de información que se actualiza en base a la información recuperada de la parte analógica (en particular la parte dinámica) de la etiqueta. Las unidades de información presentes en el dispositivo no requieren de energía proveniente de la misma etiqueta para sus cambios de estado. La etiqueta permite distintos niveles y alternativas de acceso a la información: simple lectura por parte del usuario basado en un manual o indicaciones adjuntas en el producto, lectura por un SR, de acuerdo al método de lectura de la presente invención, a partir de la imagen obtenida mediante un dispositivo de captura de imágenes (escáner, cámara digital, etc.) o a través de medios de comunicación inalámbrica (RFID, NFC, WIFI, BLUETOOTH u otros). Otra forma de implementar niveles de acceso a la información es mediante la encriptación de toda o parte de la información, a la que sólo tendría acceso una fracción de los usuarios. Additionally, the tag can integrate wireless technology for the transmission and reception of data and / or together with an electronic information storage unit that is updated based on the information retrieved from the analog part (in particular the dynamic part) of the tag . The information units present in the device do not require energy from the same label for their state changes. The label allows different levels and alternatives of access to information: simple reading by the user based on a manual or indications attached to the product, reading by an SR, according to the method of reading of the present invention, from the image obtained by means of an image capture device (scanner, digital camera, etc.) or through wireless communication means (RFID, NFC, WIFI, BLUETOOTH or others). Another way to implement levels of access to information is by encrypting all or part of the information, to which only a fraction of the users would have access.
La etiqueta considera la incorporación, de ser necesario para el correcto funcionamiento del SR, de unidades de información destinadas para la calibración de estados (que en su ejecución preferida corresponde a una calibración colorí métrica) y espacial, que permiten la recuperación de la información en una multitud de situaciones o condiciones de lectura. The label considers the incorporation, if necessary for the proper functioning of the SR, of information units intended for state calibration (which in its preferred execution corresponds to a metric colorimetric calibration) and spatial, which allow the recovery of information in a multitude of situations or reading conditions.
Todo lo anterior permite que el dispositivo pueda ser incorporado a un sistema de gestión y logística, logrando hacer un seguimiento de todo el proceso productivo y de distribución de un producto. El seguimiento no requiere de energía eléctrica para su funcionamiento (al no requerir las unidades de información energía proveniente de la misma etiqueta), pudiendo recuperar la información guardada de manera analógica utilizando el SR en cualquier punto del trayecto o proceso y registrar la información del momento en el tiempo en que fue leída dicha información por el sistema, ya sea en una memoria interna o en una base de datos externa para su posterior acceso. All of the above allows the device to be incorporated into a management and logistics system, managing to track the entire production process and distribution of a product. The monitoring does not require electrical energy for its operation (since it does not require the energy information units coming from the same label), being able to recover the information stored in analogue way using the SR at any point of the path or process and record the information of the moment at the time that said information was read by the system, either in an internal memory or in an external database for later access.
La invención posee las siguientes características: Dispositivo etiqueta: a. La etiqueta posee información estática y dinámica, correspondiente a las unidades de información estáticas y dinámicas de una matriz de datos bidimensional. b. Parte o la totalidad de la información dinámica puede ser leída por el usuario a simple vista sin la necesidad de un SR. c. La información analógica contenida en la etiqueta (tanto estática como dinámica), puede ser leída usando un sistema reconocimiento, de acuerdo al método de lectura de la presente invención. d. Las unidades de información de la etiqueta pueden presentar más de dos estados, de acuerdo a la cantidad de información a incluir en la etiqueta y a los estados que el SR es capaz de reconocer en la práctica. e. La forma de la etiqueta es configurable, siendo su ejecución preferida forma cuadrada o rectangular. f. Permite incluir un medio electrónico de almacenamiento/transmisión de información. g. El medio de transmisión de la información almacenada de forma electrónica en la etiqueta puede ser de tipo inalámbrico. h. Las unidades de información dinámica corresponden a uno o un conjunto de materiales que en el caso de experimentar cambios reconocibles por el SR o visualmente, dependientes de una o más variables ambientales o de interés, pueden ser interpretados como sensores. The invention has the following characteristics: Device tag: a. The tag has static and dynamic information, corresponding to the static and dynamic information units of a two-dimensional data matrix. b. Part or all of the dynamic information can be read by the user with the naked eye without the need for an SR. C. The analog information contained in the tag (both static and dynamic), can be read using a recognition system, according to the reading method of the present invention. d. The information units of the label can present more than two states, according to the amount of information to be included in the label and to the states that the SR is able to recognize in practice. and. The shape of the label is configurable, its preferred execution being square or rectangular. F. It allows to include an electronic means of storage / transmission of information. g. The means of transmitting the information stored electronically on the label may be of the wireless type. h. The dynamic information units correspond to one or a set of materials that in the case of experiencing changes recognizable by the SR or Visually, depending on one or more environmental or interest variables, they can be interpreted as sensors.
Respecto al método de codificación (escritura): i. El método de codificación puede utilizar unidades de información estática, dinámica o en conjunto (dependiendo de la configuración). j. Parte o la totalidad de la información dinámica puede ser configurada para ser interpretada visualmente. k. Parte o toda la información puede ser configurada para ser interpretada sólo por el sistema de reconocimiento. I. La información estática de la etiqueta puede incluir información de redundancia como método de corrección de errores, de acuerdo al método de escritura y método de lectura de información de la presente invención, permitiendo recuperar la información correcta, a pesar de que una fracción de ella sea leída de forma incorrecta. m. La información estática puede ser sometida a un proceso de compresión antes de ser añadida a la etiqueta, de acuerdo a los métodos de la presente invención. n. La información estática puede ser sometida a un proceso de encriptación antes de ser añadida a la etiqueta, de acuerdo a los métodos de la presente invención. Regarding the coding method (writing): i. The coding method can use units of static, dynamic or joint information (depending on the configuration). j. Part or all of the dynamic information can be configured to be interpreted visually. k. Some or all of the information can be configured to be interpreted only by the recognition system. I. Static label information may include redundancy information as an error correction method, according to the writing method and information reading method of the present invention, allowing the correct information to be retrieved, even though a fraction of She is read incorrectly. m. The static information may be subjected to a compression process before being added to the label, according to the methods of the present invention. n. The static information can be subjected to an encryption process before being added to the label, according to the methods of the present invention.
Respecto a método de decodificación (lectura): o. Puede ser automático, utilizando un sistema de reconocimiento que entrega información como resultado de la interpretación de una imagen de la etiqueta. p. Puede ser manual (visual) utilizando un instructivo adjunto a la etiqueta o intuitivamente para interpretar parte o la totalidad de las unidades de información dinámicas configuradas para tales efectos. q. Puede reconocer e interpretar los niveles de información presentes en la etiqueta. r. Puede reconocer e interpretar la existencia de compresión de información. s. Puede reconocer e interpretar la existencia de encriptación de información. t. Parte o toda la información leída por el sistema de reconocimiento o mediante interpretación visual puede ser enviada a un sistema de almacenamiento remoto o local de manera manual o automática. Regarding decoding method (reading): or. It can be automatic, using a recognition system that delivers information as a result of the interpretation of a label image. p. It can be manual (visual) using an instruction attached to the label or intuitively to interpret part or all of the dynamic information units configured for such purposes. q. You can recognize and interpret the levels of information present on the label. r. Can recognize and interpret the existence of information compression. s. You can recognize and interpret the existence of information encryption. t. Some or all of the information read by the recognition system or by visual interpretation can be sent to a remote or local storage system manually or automatically.
Respecto al sistema: u. El sistema de logística y/o de aseguramiento de calidad del producto, consecuencia de la utilización de la etiqueta, puede poseer distintas configuraciones. Regarding the system: u. The logistics and / or product quality assurance system, as a result of the use of the label, may have different configurations.
1. DISPOSITIVO ETIQUETA 1. LABEL DEVICE
A continuación se describen las tecnologías y métodos que sustentan las características de la etiqueta antes descritas. A. Información estática del dispositivo The technologies and methods that support the characteristics of the label described above are described below. A. Static device information
La información estática de la etiqueta se incluye en ella mediante un arreglo particular de las unidades de información estáticas en la misma, en algunos casos utilizando además unidades de información dinámicas. La interpretación de estos elementos se realiza por medio del SR. The static information of the label is included in it by a particular arrangement of the static information units therein, in some cases also using dynamic information units. The interpretation of these elements is done through the SR.
Un tipo particular de información corresponde a los patrones de reconocimiento y calibración, descritos a continuación. A particular type of information corresponds to the recognition and calibration patterns, described below.
Patrones de reconocimiento y calibración Recognition and calibration patterns
Al momento de la decodificación de la etiqueta, es necesario que el SR sea capaz de determinar su tamaño, orientación y configuración, es por esto que se incluye en la misma un conjunto de patrones de reconocimiento. At the time of decoding the label, it is necessary that the SR be able to determine its size, orientation and configuration, which is why a set of recognition patterns is included in it.
La Figura 2 muestra el patrón 201 , el cual permite, durante el análisis de una imagen de la etiqueta por parte del SR, determinar el tamaño total de la matriz de datos en unidades de pixeles, ya que cubre la totalidad de la primera columna de la etiqueta. Además el patrón 201 contiene información adicional en la forma de un código de barras, constituyendo un doble uso del mismo. El código de barras utilizado corresponde a una adaptación del código UPC, donde los dígitos se codifican como un conjunto de cuatro barras de ancho variable, con color alternado entre blanco y negro (Figura 4). En la presente invención, dicho patrón puede codificarse con con dos o más estados. El patrón 201 , del cual se muestra un ejemplo en la Figura 3, incluye un patrón de inicio correspondiente a tres barras (negro-blanco-negro) (301), un patrón de término de dos barras (blanco-negro) (302) y un dígito de verificación dependiente de los dígitos codificados. A diferencia del código UPC, acá se utiliza la codificación "L" en la totalidad de los dígitos. Figure 2 shows pattern 201, which allows, during the analysis of an image of the label by the SR, to determine the total size of the data matrix in units of pixels, since it covers the entire first column of the label. In addition, pattern 201 contains additional information in the form of a barcode, constituting a double use thereof. The barcode used corresponds to an adaptation of the UPC code, where the digits are coded as a set of four bars of variable width, with alternating color between black and white (Figure 4). In the present invention, said pattern can be encoded with two or more states. Pattern 201, of which an example is shown in Figure 3, includes a starting pattern corresponding to three bars (black-white-black) (301), a two-bar term pattern (white-black) (302) and a check digit dependent on The coded digits. Unlike the UPC code, here the code "L" is used in all the digits.
El patrón 205 es de un tamaño conocido en unidades de información, permitiendo determinar el tamaño de la imagén de la matriz de datos en unidades de información por comparación con el tamaño del patrón 201 en pixeles. El tamaño del patrón 205 puede variar, dependiendo de aspectos como el tamaño de la matriz de datos en unidades de información o la resolución esperada en la imagen de la etiqueta a analizar por el SR. El tamaño del patrón 205 es tal que errores y distorsiones normales en la determinación de su tamaño en pixeles a partir de la imagen analizada por el SR no derivan en errores en la determinación del tamaño de la matriz de datos en unidades de información. The pattern 205 is of a known size in units of information, allowing to determine the size of the image of the data matrix in units of information by comparison with the size of the pattern 201 in pixels. The size of pattern 205 may vary, depending on aspects such as the size of the data matrix in units of information or the expected resolution in the image of the label to be analyzed by the SR. The size of the pattern 205 is such that errors and normal distortions in the determination of its size in pixels from the image analyzed by the SR do not result in errors in the determination of the size of the data matrix in units of information.
El patrón 204 es usado en la etapa de transformación espacial (3. METODO DE DECODIFICACIÓN Sección A Decodificación por medio del sistema de reconocimiento), ya que es indicativo de la esquina superior derecha de la matriz de datos. Pattern 204 is used in the spatial transformation stage (3. DECODING METHOD Section A Decoding by means of the recognition system), as it is indicative of the upper right corner of the data matrix.
Otro tipo de patrones corresponde a los patrones de calibración de estados, 202 y 203, respectivamente, de acuerdo a la naturaleza de las unidades de información dinámica del dispositivo y a la configuración de los estados de las unidades de información estática (indicado en las secciones B Información dinámica del dispositivo y C Configuración de las unidades de información del dispositivo). Dependiendo de la situación, estas zonas se pueden fusionar en una zona única o ser eliminadas, dependiendo del método del lectura a utilizar. Información estática contenida en los patrones de reconocimiento Another type of pattern corresponds to the state calibration patterns, 202 and 203, respectively, according to the nature of the dynamic information units of the device and the configuration of the states of the static information units (indicated in sections B Dynamic device information and C Configuration of the device information units). Depending on the situation, these zones can be merged into a single zone or eliminated, depending on the method of reading to be used. Static information contained in the recognition patterns
La adaptación de la codificación UPC utilizada en la generación del patrón 201 permite incluir una cantidad de dígitos arbitraria. En una implementación de la invención, se utiliza el patrón 201 para almacenar información relativa al tamaño de la matriz de datos, junto con un número de identificación único por cada producto. Para esto se concatenan 4 dígitos correspondientes al número de identificación de la etiqueta, junto con dos dígitos correspondientes al tamaño de la misma en unidades de información (en el caso rectangular se incluyen 4 dígitos), además se calcula un dígito verificador de acuerdo a: donde: The adaptation of the UPC coding used in the generation of pattern 201 allows an arbitrary number of digits to be included. In an implementation of the invention, pattern 201 is used to store information relative to the size of the data matrix, together with a unique identification number for each product. For this, 4 digits corresponding to the identification number of the label are concatenated, together with two digits corresponding to the size of the same in information units (in the rectangular case 4 digits are included), in addition a verifying digit is calculated according to: where:
Este conjunto de 7 dígitos se transforma en una imagen de acuerdo a la codificación mostrada en la Figura 4, incorporando además el patrón de inicio y el de término, junto con un contorno que facilita el reconocimiento de acuerdo al método de lectura de la presente invención. Se debe notar que cualquier conjunto de dígitos puede ser codificado de esta forma, pudiéndose incorporar información distinta y/o adicional al tamaño de la matriz y/o al número de identificación de la etiqueta. This set of 7 digits is transformed into an image according to the coding shown in Figure 4, also incorporating the start and end pattern, together with an outline that facilitates recognition according to the reading method of the present invention. . It should be noted that any set of digits can be encoded in this way, being able to incorporate different and / or additional information to the size of the matrix and / or the identification number of the label.
El patrón 205 se utiliza en un método complementario de determinación del tamaño de la matriz de datos, que se basa en que el mismo es de un tamaño conocido en unidades de información, siendo su ejecución preferida el tamaño de 3x3 unidades de información. Debido a que se requiere que el patrón 205 se encuentre aislado del resto de la figura, se incorpora un borde de seguridad de color blanco, lo que constituye un uso de espacio de 4x4 unidades de información. Como se indicó antes, al aumentar el tamaño de la matriz de datos, puede ser necesario modificar el tamaño de este patrón. Pattern 205 is used in a complementary method of determining the size of the data matrix, which is based on the fact that it is of a size known in information units, its preferred execution being the size of 3x3 information units. Because the pattern 205 is required to be isolated from the rest of the figure, a white safety edge is incorporated, which constitutes a use of space of 4x4 information units. As indicated above, as the size of the data matrix increases, it may be necessary to change the size of this pattern.
B. Información dinámica del dispositivo B. Dynamic device information
Las unidades de información dinámicas de la etiqueta, una vez interpretadas visualmente o mediante el SR, permiten medir y/o cuantificar variables ambientales y/o de interés. Estas unidades de información se generan utilizando materiales que tengan propiedades termodinámicas, ópticas, químicas, dependientes de la presión, etc., variables con la magnitud a cuantificar, y que no requieran energía de la propia etiqueta como fuente de alimentación para su funcionamiento. The dynamic information units of the label, once interpreted visually or through the SR, allow measuring and / or quantifying environmental and / or interest variables. These information units are generated using materials that have thermodynamic, optical, chemical, pressure dependent properties, etc., variables with the magnitude to be quantified, and that do not require energy from the label itself as a power source for its operation.
El tipo de material a utilizar depende de la variable que se desee medir. Se requiere que el material experimente un cambio detectable debido a cambios en el valor, presencia o ausencia de la variable medida. Por ejemplo, si la variable es temperatura, se pueden utilizar materiales termocrómicos o termosensibles. Por otra parte, si la variable de interés es radiación UV el compuesto requerido debiese ser fotosensible o sensible a la luz, por lo que debe experimentar un cambio detectable al variar la iluminación a la que está sometido. Dentro de la variedad de materiales con potencial de utilización existentes, destacan los de tipo colorimétrico, que experimentan un cambio visible al ojo humano debido a cambios en alguna variable específica. Estos cambios pueden presentarse como la variación de una gama de colores, por ejemplo en los TLC, o materiales que experimenten una decoloración o coloración ante ciertos valores umbrales (materiales fotosensibles), debido a cambios de fase en el material de tipo reversible (histéresis) o irreversible. Dentro de los materiales considerados destacan aquellos que presentan cambios colorimétricos, los cuales serán utilizados en la ejecución preferida de la presente invención, pudiendo clasificarse como monocromáticos o policromáticos. The type of material to use depends on the variable you want to measure. The material is required to undergo a detectable change due to changes in the value, presence or absence of the measured variable. For example, if the variable is temperature, thermochromic or thermosensitive materials can be used. On the other hand, if the variable of interest is UV radiation, the required compound should be photosensitive or sensitive to light, so it must undergo a detectable change by varying the lighting to which it is subjected. Within the variety of materials with potential for use, those of colorimetric type stand out, which undergo a visible change to the human eye due to changes in some specific variable. These changes may occur as the variation of a range of colors, for example in the TLC, or materials that undergo discoloration or coloration before certain threshold values (photosensitive materials), due to phase changes in the reversible (hysteresis) or irreversible material. Among the materials considered are those that have colorimetric changes, which will be used in the preferred embodiment of the present invention, and can be classified as monochromatic or polychromatic.
Materiales monocromáticos Monochromatic materials
Estos materiales tienen la particularidad de experimentar un cambio de color reversible o irreversible, según sea el caso, ante la presencia y/o ausencia de cierta variable que provoca un cambio de fase. Por ejemplo, se podría tomar la referencia de materiales sensibles en el rango del espectro ultravioleta, en dónde si se alcanza cierto valor umbral el material mostrará un cambio que puede ser desde la disminución de tonalidad hasta llegar a ser translúcido, o desde una fase translúcida hasta llegar a un color determinado en estado estacionario. Por lo tanto, una calibración colorimétrica, necesaria para la interpretación del estado del material como un sensor, en este caso se centra en la cantidad de color más que en las diferencias de color. These materials have the particularity of experiencing a reversible or irreversible color change, as the case may be, in the presence and / or absence of a certain variable that causes a phase change. For example, the reference of sensitive materials in the range of the ultraviolet spectrum could be taken, where if a certain threshold value is reached the material will show a change that can be from the decrease in hue to becoming translucent, or from a translucent phase until you reach a certain color in steady state. Therefore, a colorimetric calibration, necessary for the interpretation of the state of the material as a sensor, in this case focuses on the amount of color rather than the differences in color.
Materiales policromáticos Polychromatic materials
Los materiales policromáticos pueden tener una gama de colores o cambios de fase asociados a cierto nivel de excitación de alguna variable de la cual dependa su cambio de fase. La complejidad del análisis para este caso es mayor que para materiales monocromáticos, esto se debe a la complejidad propia de analizar n fases y (n-1) transiciones. Polychromatic materials can have a range of colors or phase changes associated with a certain level of excitation of some variable on which their phase change depends. The complexity of the analysis for this case is greater than for materials Monochromatic, this is due to the complexity of analyzing n phases and (n-1) transitions.
Metodología general que relaciona el comportamiento de un material y una variable de interés. General methodology that relates the behavior of a material and a variable of interest.
Para transformar el comportamiento de los materiales en estados reconocibles por el SR de las unidades de información se propone el siguiente método. Dicho método relaciona el comportamiento del material con una variable de interés permitiendo su utilización como sensor. To transform the behavior of the materials into recognizable states by the SR of the information units, the following method is proposed. This method relates the behavior of the material with a variable of interest allowing its use as a sensor.
Aplicación de metodología para el uso de colores de calibración en conjunto con materiales monocromáticos y policromáticos Application of methodology for the use of calibration colors in conjunction with monochromatic and polychromatic materials
1. Análisis del comportamiento del material 1. Analysis of the behavior of the material
El análisis del comportamiento de un material que presente cambios de fase reversible o irreversible, dependerá de si este pertenece al tipo monocromático o policromático y a las variables a las que que se asociarán los cambios de fase. The analysis of the behavior of a material that presents reversible or irreversible phase changes will depend on whether it belongs to the monochromatic or polychromatic type and the variables to which the phase changes will be associated.
El primer paso es identificar el comportamiento del material dentro del rango de utilización. Esto se consigue mediante la adquisición de imágenes o fotogramas del material asociadas a diferentes valores de la variable a medir. The first step is to identify the behavior of the material within the range of use. This is achieved by acquiring images or frames of the material associated with different values of the variable to be measured.
Si la variable fuese temperatura y el rango de utilización de temperaturas entre T0 y Τ1, donde Τ1 > T0, se debe establecer un muestreo adecuado para obtener una mayor precisión en el análisis de su comportamiento. Por ejemplo la adquisición de una imagen cada ( Τ1 - T0)/N; siendo N la cantidad de muestras, o también podría ser un video del material con un paso igual un fotograma {framé). Es importante que exista una coherencia entre la información obtenida de la variable medida y la imagen equivalente. Cabe mencionar que para mejorar el proceso de adquisición de datos se incorporan colores de referencia para la posterior corrección de colores. 2. Corrección de color If the variable were temperature and the temperature utilization range between T 0 and Τ 1 , where Τ 1 > T 0 , adequate sampling should be established to obtain greater precision in the analysis of its behavior. For example the acquisition of an image every (Τ 1 - T 0 ) / N; N being the quantity of samples, or it could also be a video of the material with an equal step a frame {framé). It is important that there is a coherence between the information obtained from the measured variable and the equivalent image. It is worth mentioning that to improve the data acquisition process, reference colors are incorporated for subsequent color correction. 2. Color correction
La corrección del color tiene como finalidad la normalización de los colores/imagen en distintas situaciones de luz y sombra. Para ello se utiliza la metodología de transformación colorimétrica que se detalla en la sección 3. A.4. En la Figura 41 se muestran las curvas de un material TLC con respecto a la temperatura, además se incluye la curva obtenida luego de aplicar una transformación colorimétrica de segundo orden. Color correction is intended to normalize colors / image in different situations of light and shadow. For this, the colorimetric transformation methodology is used, which is detailed in section 3. A.4. Figure 41 shows the curves of a TLC material with respect to temperature, in addition the curve obtained after applying a second order colorimetric transformation is included.
3. Elección del método de estimación de la variable de interés 3. Choice of the method of estimation of the variable of interest
Una vez conocidas las curvas experimentales del comportamiento del material con respecto a la variable de interés, se procede a la elección del método de estimación de la variable de interés en función de la información relacionada al material. Existe una gran variedad de métodos para la estimación de variables, tales como: mínimos cuadrados, métodos de soft computing como redes neuronales, lógica difusa, entre otros. Dado a que no existe una solución única para relacionar respuesta o cambio de fases para todos los materiales respecto a una variable, se pueden evaluar varias soluciones y determinar cual es la que mejor se adapta para cada material. Once the experimental curves of the behavior of the material with respect to the variable of interest are known, the method of estimation of the variable of interest is chosen based on the information related to the material. There is a wide variety of methods for estimating variables, such as: least squares, soft computing methods such as neural networks, fuzzy logic, among others. Since there is no single solution to relate response or change of phases for all materials with respect to a variable, several solutions can be evaluated and determine which one is best suited for each material.
4. Selección y extracción de patrones La selección de patrones es un proceso que ayuda a disminuir la cantidad de datos a procesar y aumentar la velocidad de respuesta del método de estimación de la variable de interés. Se entiende por patrón las características o propiedades de un conjunto de datos. La cantidad de patrones no sólo se limita a los valores obtenidos del modelo RGB, sino que a todas las posibles transformaciones de color a modelos y espacios de color, valores estadísticos, de textura, momentos invariantes, etc.. El objetivo es escoger de todos los posibles patrones los que más aportan al modelo estimativo de acuerdo al material y variable seleccionados. Existen varios métodos de selección de patrones: basados en filtrado de características independientemente del estimador (filtering); basados en el desempeño del estimador (wrapping); y basados en el entrenamiento del estimador (embedding), pudiendo haber algunos mixtos y otras familias de métodos no mencionados. La disminución de la dimensionalidad de las características elimina los datos de redundancia y aumenta el desempeño del sistema. 4. Selection and extraction of patterns Pattern selection is a process that helps decrease the amount of data to be processed and increase the response speed of the method of estimating the variable of interest. Pattern is understood as the characteristics or properties of a data set. The number of patterns is not only limited to the values obtained from the RGB model, but to all possible color transformations to models and color spaces, statistical values, texture, invariant moments, etc. The objective is to choose from all the possible patterns are those that contribute the most to the estimated model according to the material and variable selected. There are several methods of pattern selection: based on feature filtering regardless of the estimator (filtering); based on estimator performance (wrapping); and based on estimator training (embedding), there may be some mixed and other families of methods not mentioned. The decrease in the dimensionality of the characteristics eliminates the redundancy data and increases the performance of the system.
5. Entrenamiento, error y evaluación del método. 5. Training, error and evaluation of the method.
El entrenamiento, el error y la evaluación del método dependerán del método estimativo a implementar. Una implementación del método se expone en el Ejemplo 9. Training, error and evaluation of the method will depend on the estimation method to be implemented. An implementation of the method is set forth in Example 9.
C. Configuración de las unidades de información del dispositivo Cada unidad de información del dispositivo puede presentar más de un estado, con el requisito de que cada estado sea distinguible por el SR al momento de la lectura. En el caso de configurar unidades de información para su interpretación visual, los estados de esas unidades deben además ser distinguibles a la vista por el usuario. La cantidad de estados disponibles está directamente ligada con la cantidad de información almacenable dentro de una unidad de información. Para el caso binario, se llama bit la representación de dos estados: uno y cero; estos estados pueden ser representados (de manera impresa) como la existencia o la ausencia de un color, normalmente se suele usar el negro sobre un fondo blanco, pudiendo ser cualquier otro. C. Configuration of the device information units Each device information unit may have more than one state, with the requirement that each state be distinguishable by the SR at the time of reading. In the case of configuring information units for visual interpretation, the states of these units must also be distinguishable by the user. The number of available states is directly linked to the amount of information stored within a unit of information. For the binary case, the representation of two states is called bit: one and zero; These states can be represented (in print) as the existence or absence of a color, usually black is usually used on a white background, and can be any other.
Para aumentar la densidad de información se incorpora una mayor cantidad de estados posibles para cada unidad de información. Al aumentar la cantidad de estados ya no se puede hacer referencia al bit binario, dado que la base del sistema ya no sería dos. Si la codificación solamente fuese la tabla ASCI 1(256) se tiene que para almacenar los 256 caracteres son necesarios 8 bits (28 = 256), por otra parte si se quisiese almacenar la tabla ASCII(128) el requerimiento sería de 7 bits (27 = 128). Ahora bien, para el almacenamiento de la tabla ASCII(256) para una base mayor a dos, al utilizar las bases 4, 16 y 256 se tiene que la cantidad de unidades de información requeridas para representar un carácter disminuyen a la vez que aumenta la densidad de información en la etiqueta. Para no confundir el concepto de bit (dos estados), o de qdits (D-dimensiones en el espacio de Hilbert) en computación cuántica, se define en esta invención la unidad vEbit. La unidad vEbit tiene como objetivo definir explícitamente que la cantidad de estados puede ser variable y la letra E representa la cantidad de estados utilizados, siendo un v2bit el equivalente a un bit. To increase the density of information, a greater number of possible states is incorporated for each unit of information. By increasing the number of states, the binary bit can no longer be referred to, since the base of the system would no longer be two. If the encoding were only the ASCI 1 table (256), it is necessary to store the 256 characters 8 bits (2 8 = 256), on the other hand if you wanted to store the ASCII table (128) the requirement would be 7 bits (2 7 = 128). However, for the storage of the ASCII table (256) for a base greater than two, when using bases 4, 16 and 256, the amount of information units required to represent a character has to be reduced while increasing the density of information on the label. In order not to confuse the concept of bit (two states), or qdits (D-dimensions in Hilbert space) in quantum computing, the vEbit unit is defined in this invention. The vEbit unit aims to explicitly define that the number of states can be variable and the letter E represents the number of states used, with a v2bit being the equivalent of one bit.
Ya definida la unidad del información mayor a dos estados, se tiene que para codificar la tabla ASCII(256) se requieren de 8 v2bits (28 = 256), 4 v4bits (44 = 256), 2 v16bits (162 = 256), o 1 v256bit (2561 = 256); para 2, 4, 16 y 256 estados, respectivamente. Esta metodología, que consiste en la utilización de un mayor número de estados de forma de aumentar la densidad de información, puede ser utilizada no solamente para el código ASCII(256), sino que para cualquier tabla de símbolos. Siendo la cantidad de estados dependiente de la factibilidad tecnológica y de la sensibilidad del SR. Representación de Estados: Once the unit of information greater than two states is defined, it is necessary to encode the ASCII table (256) of 8 v2bits (2 8 = 256), 4 v4bits (4 4 = 256), 2 v16bits (16 2 = 256 ), or 1 v256bit (256 1 = 256); for 2, 4, 16 and 256 states, respectively. This methodology, which consists in the use of a greater number of states in order to increase the density of information, can be used not only for the ASCII code (256), but for any symbol table. Being the amount of states dependent on the technological feasibility and sensitivity of the SR. Representation of States:
Cada unidad de información del dispositivo se puede configurar en más de un estado, con el requisito de que cada estado sea distinguible por el SR al momento de la lectura. En el caso de configurar unidades de información para su interpretación visual, los estados de esas unidades deben además ser distinguibles a la vista. De esta forma cualquier tipo de propiedad medible puede ser usada, con distintos niveles representando distintos estados, por ejemplo: colores, texturas, propiedades magnéticas, etc. Cabe destacar, que también pueden ser incluida la combinación de estados de diferentes orígenes, tales como color/textura u otra selección de estados, pudiendo ser una mezcla de dos o más, según sea el caso. En el estado de la técnica se ha utilizado color en el caso de la codificación de información en códigos bidimensionales, utilizando dos estados, con el negro indicando un estado y el blanco el estado complementario. Each unit of information on the device can be configured in more than one state, with the requirement that each state be distinguishable by the SR at the time of reading. In the case of configuring information units for visual interpretation, the states of these units must also be visible. In this way any type of measurable property can be used, with different levels representing different states, for example: colors, textures, magnetic properties, etc. It should be noted that the combination of states of different origins, such as color / texture or other selection of states, may also be included, being a mixture of two or more, as the case may be. In the state of the art, color has been used in the case of coding information in two-dimensional codes, using two states, with the black indicating a state and white the complementary state.
La utilización de más de dos estados por unidad de información tiene como objeto el aumento de la densidad de información dentro del mismo espacio físico. Por otra parte, la selección de estados se obtiene mediante el cálculo de distancias percibidas para una tolerancia dada. Utilización de colores The use of more than two states per unit of information is aimed at increasing the density of information within the same physical space. On the other hand, the selection of states is obtained by calculating perceived distances for a given tolerance. Use of colors
La utilización de colores sólidos, como representación de dos o más estados, es una de las posibles opciones en el aumento de la densidad de información almacenable en la matriz de datos. El aumento de la densidad de información generalmente se asocia a una disminución de la capacidad de identificación de cada estado. The use of solid colors, as a representation of two or more states, is one of the possible options in increasing the density of information stored in the data matrix. The increase in information density is generally associated with a decrease in the identification capacity of each state.
La cantidad de colores a utilizar depende de los vEbits en los que se realice la codificación, pero la elección de los colores (estados) influirá directamente en la capacidad de identificación de cada estado, asociados a un error por identificación de estados. Debido a limitaciones físicas y tecnológicas no necesariamente los colores elegidos pueden ser logrados o reproducidos por dispositivos de impresión, ópticos y de visualización, tales como: impresoras, cámaras, escáners, y monitores. Sumado a esto, se debe considerar el error producido de propagación desde un dispositivo a otro, por ejemplo: un color dado se reproduce mediante un monitor, luego este color digital se reproduce analógicamente con una impresora, a continuación se escanea mediante un escáner volviendo nuevamente la información analógica a digital, para finalmente volverla a visualizar con el mismo monitor. Al comparar cada resultado se desprende la existencia de un error en la gama de colores o gamut. The amount of colors to use depends on the vEbits in which the coding is performed, but the choice of colors (states) will directly influence the ability to identify each state, associated with an error by state identification. Due to physical and technological limitations, the colors chosen may not necessarily be achieved or reproduced by printing, optical and display devices, such as printers, cameras, scanners, and monitors. In addition to this, the error produced from propagation from one device to another should be considered, for example: a given color is reproduced by means of a monitor, then this digital color is reproduced analogically with a printer, then scanned by a scanner returning again analog to digital information, to finally display it again with the same monitor. Comparing each result shows the existence of an error in the gamut or color gamut.
Por otra parte, sumado a los errores referentes a la reproducción de color, cabe destacar que los colores elegidos deben satisfacer la condición de máxima diferencia de color entre los mismos. Además de cumplir con las condiciones de contorno según sea el caso, tal como lo indica la línea segmentada de la región seleccionada Ω en la Figura 33. On the other hand, in addition to the errors related to color reproduction, it should be noted that the colors chosen must satisfy the condition of maximum color difference between them. In addition to meeting the boundary conditions according to be the case, as indicated by the segmented line of the selected region Ω in Figure 33.
La ejecución preferida comienza por encontrar el área común entre los dispositivos de reproducción de color en el espacio de color xyY, para ello se utiliza el diagrama cromático del espacio de color xyY como se indica en la Figura 33. La región seleccionada se puede encontrar mediante ecuaciones de restricción que forman la frontera del polígono resultante, o mediante la evaluación de pertenencia a la región. The preferred execution begins by finding the common area between the color reproduction devices in the xyY color space, for this purpose the chromatic diagram of the xyY color space is used as indicated in Figure 33. The selected region can be found by restriction equations that form the boundary of the resulting polygon, or by evaluating membership in the region.
Para evaluar la pertenencia de los colores a la región seleccionada, se genera un arreglo que contenga todos los colores pertenecientes a un modelo de color finito. Si se utiliza el modelo de color RGB, se tiene que la cantidad máxima de colores es 2563 = 16.777.216, a continuación se hace una transformación al espacio de color XYZ, para luego obtener las coordenadas en el espacio de color xyY, las ecuaciones de transformación del espacio de color XYZ a xyY se muestran a continuación: To evaluate the membership of the colors to the selected region, an array is generated that contains all the colors belonging to a finite color model. If the RGB color model is used, the maximum number of colors is 256 3 = 16,777,216, then a transformation is made to the XYZ color space, to then obtain the coordinates in the xyY color space, the XYZ to xyY color space transformation equations are shown below:
Una vez definida la pertenencia de los puntos a la región seleccionada, se utiliza un algoritmo de agrupamiento (clustering), en este caso K-means, utilizando una distancia relativa al color como métrica de distancia, implementándose la distancia de color CIEDE2000 ( ΔΕ00). Cabe mencionar que la distancia de color ΔΕ00, tiene una mejor respuesta en la diferenciación de colores que las típicas distancias utilizadas en el algoritmo de K-means, por ejemplo distancia euclidiana. Once defined the membership of the points to the selected region, a clustering algorithm is used, in this case K-means, using a distance relative to color as a distance metric, implementing the color distance CIEDE2000 (ΔΕ 00 ). It should be mentioned that the color distance ΔΕ 00 , has a better response in the differentiation of colors than the typical distances used in the K-means algorithm, for example Euclidean distance.
La función objetivo es maximizar todas las distancias ΔΕ00 entre los K colores escogidos. El algoritmo de agrupamiento logra determinar el conjunto de datos más cercanos a una solución inicial determinada μ(0), actualizando el valor de la solución iteración a iteración hasta su convergencia (si existe) o hasta un número predefinido de iteraciones. El cálculo de las distancias se realiza en el modelo de color CIELAB, el conjunto de datos pertenecientes a la región seleccionada Ω (ver Figura 33) en coordenadas CIELAB se denomina como x, y C¡(z) corresponde a los elementos pertenecientes a x que se encuentran más cercanos al elemento μ ¡(z), de la solución en la iteración z, con respecto a la distancia ΔΕ00. Siendo N la cantidad de puntos pertenecientes a la región seleccionada Ω. The objective function is to maximize all distances ΔΕ 00 between the K colors chosen. The clustering algorithm manages to determine the set of data closest to a given initial solution μ (0) , updating the value of the iteration to iteration solution until its convergence (if it exists) or up to a predefined number of iterations. The distances are calculated in the CIELAB color model, the set of data belonging to the selected region Ω (see Figure 33) in CIELAB coordinates is referred to as x, and C¡ (z) corresponds to the elements belonging to ax which they are closer to the element μ¡ (z) , of the solution in iteration z, with respect to the distance ΔΕ 00 . N being the number of points belonging to the selected region Ω.
Para mejorar el resultado de la agrupación de datos, primero se calculan los valores a (j, ¡, m) (z) , que corresponden a la distancia ΔΕ00 entre el j-ésimo elemento de entre los yc¡(z) pertenecientes al agrupamiento C¡(z), y ( ). La suma de la cantidad de datos pertenecientes a cada agrupamiento nc¡ se mantiene constante para cada iteración. To improve the result of the data grouping, the values a (j, ¡ , m) (z) , which correspond to the distance ΔΕ 00 between the jth element between the and c ¡ (z) belonging, are first calculated to the group C¡ (z) , and (). The sum of the amount of Data pertaining to each cluster n c ¡remains constant for each iteration.
Luego para cada agrupamiento i, se determina el valor j* que maximiza b¡(z) (j), donde b¡(z) (j) corresponde a la media geométrica de los valores para el agrupamiento i divididos por la desviación estándar de los valores para el agrupamiento i. Then for each grouping i, the value j * that maximizes b¡ (z) (j) is determined, where b¡ (z) (j) corresponds to the geometric mean of the values for grouping i divided by the standard deviation of the values for the grouping i.
donde, where,
Una vez encontrado el valor de j¡(z)* se obtiene el valor de las soluciones que maximizan las distancias de color entre las K soluciones. Once the value of j¡ (z) * is found, the value of the solutions that maximize the color distances between the K solutions is obtained.
Finalmente, se incluye una tasa de aprendizaje w, que va desde cero a uno. Finally, a learning rate w is included, ranging from zero to one.
D. Forma y tamaño del dispositivo D. Shape and size of the device
El tamaño de la matriz de datos en unidades de información, depende del volumen de información estática a incluir, la cual podría estar comprimida, de los elementos dinámicos y de la cantidad de estados en que se puede configurar cada unidad de información. La elección de la proporción de la etiqueta inteligente (razón alto ancho) puede ser arbitraria, ajustándose al número de unidades de información requeridas, y al espacio en el lugar en que se adhiere la etiqueta inteligente. Las formas preferidas son del tipo cuadrada y/o rectangular. El tamaño de la matriz de datos se calcula, tanto en el formato cuadrado como en el rectangular, como el menor tamaño que es capaz de contener tanto las unidades de información estáticas como dinámicas. En el caso del formato cuadrado esto corresponde a determinar el mínimo tal que: The size of the data matrix in information units depends on the volume of static information to be included, which could be compressed, on the dynamic elements and on the number of states in which each information unit can be configured. The choice of the proportion of the smart tag (high width ratio) can be arbitrary, adjusting to the number of units of information required, and the space in the place where the smart tag adheres. Preferred shapes are square and / or rectangular. The size of the data matrix is calculated, both in the square and rectangular format, as the smallest size that is capable of containing both static and dynamic information units. In the case of the square format this corresponds to determining the minimum such that:
Donde corresponde a las unidades de información utilizadas por los elementos estáticos y dinámicosT Las unidades de información requeridas para codificar la información dependen del esquema de codificación seleccionado, de acuerdo a lo explicado en la sección C Configuración de las unidades de información del dispositivo. En el caso de usar un formato rectangular en la etiqueta, la proporción entre los lados puede estar además sujeta a una razón de aspecto por motivos prácticos y/o estéticos. Where it corresponds to the information units used by the static and dynamic elements T The information units required to encode the information depend on the coding scheme selected, as explained in section C Configuration of the information units of the device. In the case of using a rectangular format on the label, the proportion between the sides may also be subject to an aspect ratio for practical and / or aesthetic reasons.
E. Opcional: Elementos electrónicos del dispositivo La etiqueta, opcionalmente, puede incluir un sistema electrónico para el almacenamiento y transmisión de información. La información almacenada en el sistema electrónico puede usarse como respaldo de la información dinámica recopilada por la parte análoga de la etiqueta. Se puede incluir además un sistema de transmisión de datos de tipo inalámbrico o de contacto. 2. MÉTODO DE CODIFICACIÓN E. Optional: Electronic device elements The label can optionally include an electronic system for storing and transmitting information. The information stored in the electronic system can be used as a backup for the dynamic information collected by the analog part of the label. A wireless or contact type data transmission system may also be included. 2. CODING METHOD
A continuación se describen las tecnologías/métodos que sustentan las características del método de codificación antes descritas. The technologies / methods that support the characteristics of the coding method described above are described below.
A. Configuración de la información dentro del dispositivo A. Information settings inside the device
Como se observa en el diagrama de la Figura 29, las unidades de información de la etiqueta pueden presentar comportamiento estático, dinámico o ser unidades de información no interpretables por el SR. La información estática se codifica en la etiqueta asignando a cada elemento estático un estado definido (ver 1. DISPOSITIVO ETIQUETA: C Configuración de las unidades de información del dispositivo), o bien utilizando elementos dinámicos de tipo dual (de acuerdo a la Figura 29). Las unidades de información dinámicas utilizadas de esta forma deben cumplir la condición de ser reconocidas como unidades de información estáticas por el SR. As can be seen in the diagram in Figure 29, the information units of the label may have static, dynamic behavior or be information units that cannot be interpreted by the SR. The static information is encoded on the label by assigning a defined status to each static element (see 1. LABEL DEVICE: C Configuration of the device information units), or using dynamic dual type elements (according to Figure 29) . The dynamic information units used in this way must meet the condition of being recognized as static information units by the SR.
Antes de la asignación de los valores que corresponden a información estática a la matriz de datos, un conjunto de posiciones en la misma se pueden indicar como espacios reservados, lo que quiere decir que durante la asignación de valores estas posiciones serán omitidas. Los espacios reservados se pueden utilizar para incluir en la etiqueta elementos dinámicos que por su forma, funcionamiento, tamaño, etc. no se utilicen para codificar información estática (elementos dinámicos simples), patrones de reconocimiento/calibración u otros. Elementos adicionales como logos, perforaciones, elementos de sujeción, elementos dinámicos no interpretables por el SR, etc. pueden también ser ubicados en un espacio reservado de la etiqueta. Before assigning the values that correspond to static information to the data matrix, a set of positions in it can be indicated as reserved spaces, which means that during the assignment of values these positions will be omitted. The reserved spaces can be used to include in the label dynamic elements that due to their shape, operation, size, etc. Do not use to encode static information (simple dynamic elements), recognition / calibration patterns or others. Additional elements such as logos, perforations, fasteners, dynamic elements not interpretable by the SR, etc. They can also be located in a reserved space of the label.
La información estática se escribe en la matriz de datos (en su ejecución preferida) en forma vertical, de arriba hacia abajo, cubriendo las columnas de izquierda a derecha, ignorando, como ya se explicó antes, los espacios reservados. The static information is written in the data matrix (in its preferred execution) vertically, from top to bottom, covering the columns from left to right, ignoring, as explained above, the reserved spaces.
Una posible situación en la cual parte de las unidades de información dinámicas no pueden utilizarse para codificar información estática, es cuando se requiere que estos tengan una organización particular, por ejemplo, con el objeto de generar un patrón que facilite la interpretación visual de los mismos, formar un logotipo, etc. B. Método de corrección de errores A possible situation in which part of the dynamic information units cannot be used to encode static information is when they are required to have a particular organization, for example, in order to generate a pattern that facilitates their visual interpretation. , form a logo, etc. B. Error correction method
Se incluye en la codificación de la información un mecanismo de corrección de errores, cuyo objetivo es detectar y corregir los errores que se producen en la lectura de la información de la etiqueta inteligente, debido a daño en la misma, o debido al desempeño del SR. An error correction mechanism is included in the information coding, whose objective is to detect and correct the errors that occur in the reading of the information on the smart tag, due to damage to it, or due to the performance of the SR .
Una implementación del método de corrección de errores utiliza el algoritmo de Reed- Solomon, este algoritmo tiene la particularidad de que utiliza elementos pertenecientes a un Campo de Galois de orden p (GF(p)) y también una extensión del Campo de Galois de orden p^m (GFip^m)), conjuntos que se caracterizan por ser cerrados para la adición y para la multiplicación, por lo que se evita el problema del desbordamiento (que alguna operación genere un valor que el sistema no es capaz de representar). En GF(p) las operaciones de adición y multiplicación se realizan modulo p, lo que quiere decir que el resultado se corrige reemplazándolo por el módulo de la división por p, en la práctica sólo se usan números primos como base, debido a que de otra forma no todos los elementos poseen inverso multiplicativo, y en algunos casos el elemento neutro no es único limitando los posibles conjuntos de valores a usar. An implementation of the error correction method uses the Reed-Solomon algorithm, this algorithm has the peculiarity that it uses elements belonging to a Galois Field of order p (GF (p)) and also an extension of the Galois Field of order p ^ m (GFip ^ m)), sets that are characterized by being closed for addition and multiplication, thus avoiding the problem of overflow (that some operation generates a value that the system is not able to represent) . In GF (p) the operations of addition and multiplication are carried out module p, which means that the result is corrected by replacing it with the module of division by p, in practice only prime numbers are used as a base, because of otherwise, not all elements have a multiplicative inverse, and in some cases the neutral element is not unique limiting the possible sets of values to use.
Por otra parte los elementos de GF(p^m) se pueden interpretar como polinomios de orden (m -1), cuyos coeficientes pueden ser sumados utilizando adición módulo p. La construcción de los elementos requiere la definición de un polinomio generador de orden m que permite evitar el desbordamiento. Como ejemplo, en la siguiente tabla 1 , se muestra la construcción de los elementos del conjunto GF(2^2), utilizando el polinomio generador (a2 + a + 1 = 0), además de la comparación con los valores mayores a (pAm)- 1 transformando al elemento equivalente tanto en GF(2^2) como en GF(4). Se debe notar que existen pm elementos diferentes en cada caso. On the other hand the elements of GF (p ^ m) can be interpreted as polynomials of order (m -1), whose coefficients can be added using addition module p. The construction of the elements requires the definition of a generator polynomial of order m that allows to avoid overflow. As an example, in the following table 1, the construction of the elements of the GF set (2 ^ 2) is shown, using the generating polynomial (a 2 + a + 1 = 0), in addition to the comparison with the values greater than (p A m) - 1 transforming the equivalent element into both GF (2 ^ 2) and GF (4). It should be noted that there are p m different elements in each case.
Tabla 1. Elementos del conjunto GF(2^2), utilizando el polinomio generador (a2 + a + 1 = 0) Table 1. Elements of the GF set (2 ^ 2), using the generator polynomial (a 2 + a + 1 = 0)
En el marco del algoritmo de Reed Solomon la información a transmitir se interpreta como los coeficientes de un polinomio, al que se le añaden los coeficientes del producto de la operación con un polinomio generador de la siguiente forma: Within the framework of the Reed Solomon algorithm, the information to be transmitted is interpreted as the coefficients of a polynomial, to which the coefficients of the product of the operation are added with a generating polynomial as follows:
En esta construcción, n corresponde al largo total de la cadena de datos a ser transmitida, mientras que k corresponde al largo del mensaje propiamente tal, el resto (n-k) corresponde a la información redundante añadida como método de detección y corrección de errores. In this construction, n corresponds to the total length of the data chain to be transmitted, while k corresponds to the length of the message itself, the rest (nk) corresponds to the redundant information added as a method of error detection and correction.
El polinomio generador g(x), corresponde a un polinomio de orden (n-k), cuyas raíces son los elementos a, a2,.... cr(n"k) en GF(p^m). De esta forma se pueden comprobar las (n-k) raíces en el polinomio mensaje recibido, la evaluación en cada una de estas raíces debería dar un resultado cero. The generating polynomial g (x) corresponds to a polynomial of order (nk), whose roots are the elements a, a 2 , .... cr (n "k) in GF (p ^ m). You can check the (nk) roots in the polynomial message received, the evaluation in each of these roots should give a zero result.
La información de los ceros del polinomio recibido permite detectar y corregir errores hasta un máximo de (n-k)/2, debido al hecho de que se requiere la información de una evaluación para detectar el error y una adicional para corregirlo. En la implementación típica se utiliza n = (p^m)-1, donde el polinomio generador corresponde a: The zeros information of the received polynomial allows to detect and correct errors up to a maximum of (nk) / 2, due to the fact that the information of an evaluation is required to detect the error and an additional one to correct it. In the typical implementation, n = (p ^ m) -1 is used, where the generating polynomial corresponds to:
C. Generación de etiqueta en formato impreso C. Generation of label in printed format
Se genera una representación física, dónde cada posición en la matriz de datos se transforma en un cuadrado de tamaño definido. El estado de cada uno seleccionado de entre un conjunto de acuerdo a la configuración de las unidades de información definidas para el dispositivo en relación a lo explicado en la sección 1. DISPOSITIVO: C Configuración de las unidades de información del dispositivo. Además se asignan los estados correspondientes a los patrones de reconocimiento y de calibración de estados. Se re-escala el patrón 201 de acuerdo al tamaño de la primera columna de la imagen de la etiqueta. Rodeando a la imagen de la etiqueta se incluye un borde de seguridad de color blanco 206, con el objeto de que la etiqueta se encuentre mínimamente aislada del entorno. La extensión del patrón 206 depende del desempeño del SR y de las características del producto en donde se incluirá la etiqueta. Por ejemplo, en el caso de un producto de color blanco, podría no ser necesario incluir un borde. A physical representation is generated, where each position in the data matrix is transformed into a square of defined size. The status of each selected from a set according to the configuration of the information units defined for the device in relation to what is explained in section 1. DEVICE: C Configuration of the information units of the device. In addition, the corresponding states are assigned to the recognition and state calibration patterns. Pattern 201 is rescaled according to the size of the first column of the label image. Surrounding the image of the label includes a security border of white color 206, so that the label is minimally isolated from the environment. The extent of pattern 206 depends on the performance of the SR and the characteristics of the product where the label will be included. For example, in the case of a white product, it might not be necessary to include a border.
Luego, la imagen de la etiqueta pasa a la etapa de impresión. Dependiendo de la naturaleza de los materiales usados en las unidades de información dinámicas de la etiqueta, estas pueden incorporarse en el mismo equipo de impresión o en una etapa posterior. D. Opcional: Compresión de información Then, the image of the label goes to the printing stage. Depending on the nature of the materials used in the dynamic information units of the label, these can be incorporated in the same printing equipment or at a later stage. D. Optional: Compression of information
La compresión de datos es una característica opcional que tiene por objetivo la disminución del tamaño de los mismos, previo a la codificación en la etiqueta inteligente. Una premisa importante es la utilización de algoritmos de compresión sin pérdidas, dentro de los cuales destacan los basados en modelos estáticos y los basados en diccionarios. Data compression is an optional feature that aims to reduce the size of the data, prior to coding on the smart tag. An important premise is the use of lossless compression algorithms, among which are those based on static models and those based on dictionaries.
Se puede utilizar cualquier algoritmo que cumpla con el requerimiento de que no exista pérdida de información, por ejemplo el algoritmo Lempel-Ziv-Welch. Any algorithm that meets the requirement that there is no loss of information can be used, for example the Lempel-Ziv-Welch algorithm.
El proceso de compresión de datos se divide en dos partes, codificación y decodificación. En el caso del algoritmo de Lempel-Ziv-Welch el codificador del algoritmo de compresión cumple la función de desarrollar un diccionario de índices dinámicos, que a posterior será utilizado por el decodificador del algoritmo de compresión. En la etapa de decodificación se reconstruye la información original, previamente codificada, mediante un proceso inverso con la información presente en el diccionario. The data compression process is divided into two parts, coding and decoding. In the case of the Lempel-Ziv-Welch algorithm, the compression algorithm encoder fulfills the function of developing a dynamic index dictionary, which will later be used by the compression algorithm decoder. In the decoding stage the original information is reconstructed, previously coded, through an inverse process with the information present in the dictionary.
E. Opcional: Encriptación de información E. Optional: Information encryption
La encriptación de datos es una característica opcional que tiene por objetivo implementar niveles de seguridad de información en el código a modo de proteger información por tipos de usuario. Los métodos de encriptación aplicables puede ser cualquiera presente en el estado de la técnica siempre que no presenten pérdida de datos. Un ejemplo de dichos métodos es el método de encriptación AES, cuya implementación se detalla en el Ejemplo 4. Una correcta implementación de métodos de encriptación considera la configuración de la etiqueta y los requerimientos definidos para el producto o elemento al que se adherirá, así como también para los distintos niveles de usuario que se considere implementar. Data encryption is an optional feature that aims to implement levels of information security in the code in order to protect information by user types. The applicable encryption methods can be any present in the state of the art provided they do not present data loss. An example of such methods is the AES encryption method, whose implementation is detailed in Example 4. A correct implementation of encryption methods considers the configuration of the label and the requirements defined for the product or element to which it will adhere, as well as also for the different user levels that are considered to be implemented.
Es importante mencionar que es posible la implementación de distintos métodos de encriptación de información en la misma etiqueta en caso de querer definir, para cada usuario, un nivel de seguridad diferente. It is important to mention that it is possible to implement different methods of encryption of information on the same label in case you want to define, for each user, a different level of security.
3. MÉTODO DE DECODIFICACIÓN 3. DECODING METHOD
A continuación se describen las tecnologías/métodos que sustentan las características del método de decodificación antes descritas. A. Decodificación por medio del sistema de reconocimiento The following describes the technologies / methods that support the characteristics of the decoding method described above. A. Decoding through the recognition system
La lectura de la información desde el dispositivo por parte del sistema de reconocimiento involucra una serie de etapas específicas. The reading of the information from the device by the recognition system involves a series of specific stages.
3.A.1 Adquisición de imagen de la etiqueta La información puede ser obtenida de la imagen de la etiqueta proveniente de una variedad de dispositivos de captura de imágenes (ej. escáner, cámara digital u otro). Es posible incluir etapas previas de procesamiento, como la aplicación de un filtro mediana en los casos en que la imagen presente ruido, o la reducción del tamaño de la imagen, de forma de disminuir el tiempo de procesamiento, entre otros, dependiendo de la aplicación de la etiqueta y la superficie en la que se adherirá. 3.A.1 Acquisition of tag image Information can be obtained from the tag image from a variety of image capture devices (eg scanner, digital camera or other). It is possible to include previous stages of processing, such as the application of a medium filter in cases where the image presents noise, or the reduction of the image size, in order to reduce the processing time, among others, depending on the application of the label and the surface on which it will adhere.
3. A.2 Transformación espacial 3. A.2 Spatial transformation
En la etapa de transformación espacial se corrige la distorsión proyectiva de la imagen. En un primer paso la imagen original se subdivide en una cuadrícula de 4x4 en su ejecución preferida, de las que se analizan sólo los 4 sectores que contienen las esquinas de la imagen original. In the stage of spatial transformation, the projective distortion of the image is corrected. In a first step, the original image is subdivided into a 4x4 grid in its preferred execution, of which only the 4 sectors containing the corners of the original image are analyzed.
Cada sector se transforma a escala de grises. Se calculan los gradientes de intensidad (I) en dirección x e y aplicando los filtros [-1 0 1] y [-1 0 1]'. Se calcula la función objetivo para la detección de esquinas, dada por: Donde sf es un factor de sensibilidad en la detección. Se aislan las regiones que contienen máximos locales de la función objetivo, correspondientes a los grupos de pixeles que tienen el mismo valor, a la vez que están rodeados de pixeles de menor intensidad. Se eliminan los máximos locales menos significativos, como un porcentaje del total de detecciones. Las regiones que contienen máximos locales restantes se contraen a un único punto. A continuación para cada uno de los 4 sectores analizados se selecciona el punto reconocido como esquina más cercano a la esquina de la imagen original, de acuerdo a la posición del sector bajo análisis. Este conjunto de 4 puntos se considera que delimita la cuadrícula que contiene la imagen de la etiqueta. Se calcula la matriz de transformación entre las coordenadas de estas esquinas detectadas y un rectángulo de tamaño similar, de acuerdo a: Each sector is transformed to grayscale. Intensity gradients (I) in x and x direction are calculated by applying filters [-1 0 1] and [-1 0 1] '. The objective function for corner detection is calculated, given by: Where sf is a sensitivity factor in detection. Regions containing local maximums of the objective function, corresponding to the groups of pixels having the same value, while surrounded by pixels of lower intensity, are isolated. The least significant local maximums are eliminated, as a percentage of total detections. Regions containing remaining local maximums contract to a single point. Next, for each of the 4 sectors analyzed, the point recognized as the corner closest to the corner of the original image is selected, according to the position of the sector under analysis. This set of 4 points is considered to delimit the grid that contains the image of the label. The transformation matrix between the coordinates of these detected corners and a rectangle of similar size is calculated, according to:
Con X los puntos de referencia en coordenadas de la imagen original e Y los puntos de referencia en las coordenadas de la imagen corregida. Esta transformación se puede calcular en dos etapas. En referencia a la Figura 5, la matriz que mapea el cuadrado unitario a las coordenadas del paralelogramo está dada por: With X the reference points in coordinates of the original image and Y the reference points in the coordinates of the corrected image. This transformation can be calculated in two stages. Referring to Figure 5, the matrix that maps the unit square to the coordinates of the parallelogram is given by:
Si Ax es la matriz que mapea el cuadrado unitario al cuadrilátero X y Ay es la matriz que mapea el cuadrado unitario al cuadrilátero Y, entonces se tiene: If A x is the matrix that maps the unit square to quadrilateral X and A and is the matrix that maps the unit square to quadrilateral Y, then you have:
Esta transformación es posteriormente aplicada a toda la imagen. This transformation is subsequently applied to the entire image.
3.A.3 Reconocimiento de patrones 3.A.3 Pattern recognition
Patrón código de barras Esto se realiza transformando la imagen a una representación en blanco y negro, luego se aislan todas las zonas con pixeles de color negro contiguos. Para cada zona se determina el rectángulo en pixeles que la contiene (bounding box), la arista mayor de entre todos los bounding box corresponde a la longitud de la imagen de la matriz de información en unidades de pixeles. El subsector de la imagen que corresponde al código de barras, se analiza extrayendo una línea de información. Se detectan los puntos a lo largo de esa línea donde existe un cambio de color entre blanco y negro, con lo que se calcula un valor para los anchos de las columnas que conforman el código de barras en pixeles. Los anchos de columna obtenidos de esta forma se normalizan por el promedio de los anchos correspondientes al patrón de inicio, que corresponde a una unidad en la codificación UPC. Una vez conocido el ancho normalizado, los grupos de cuatro columnas se pueden traducir a números enteros. Por último se verifica que la información se haya recuperado correctamente por medio del dígito verificador. Barcode pattern This is done by transforming the image to a black and white representation, then all areas are isolated with adjacent black pixels. For each zone the rectangle in pixels that contains it (bounding box) is determined, the major edge of all the bounding boxes corresponds to the length of the image of the information matrix in units of pixels. The subsector of the image that corresponds to the barcode is analyzed by extracting a line of information. Points along that line where there is a color change between black and white are detected, thereby calculating a value for the widths of the columns that make up the barcode in pixels. The column widths obtained in this way are normalized by the average of the widths corresponding to the starting pattern, which corresponds to a unit in the UPC coding. Once the normalized width is known, groups of four columns can be translated into whole numbers. Finally, it is verified that the information has been correctly recovered by means of the verification digit.
Patrón de tamaño Se distingue el patrón 205 de formas similares basado en el valor de la función objetivo que considera la cercanía de la forma al lado inferior de la matriz de datos, su excentricidad, y la razón de tamaño entre la forma y la altura total de la matriz de datos, de acuerdo a: Pattern of size Pattern 205 is distinguished in similar ways based on the value of the objective function that considers the proximity of the form to the lower side of the data matrix, its eccentricity, and the size ratio between the shape and the total height of the data matrix, according to:
Con los valores de las constantes ajustados en base a un set de imágenes de etiquetas: With the values of the constants adjusted based on a set of label images:
Los valores anteriores se pueden reajustar dependiendo de la implementación específica. La comparación entre el tamaño del patrón 205 en pixeles con el tamaño del patrón 201 , permite determinar el tamaño de la matriz de datos en unidades de información. El tamaño determinado de esta forma puede ser verificado con el valor obtenido a partir de la lectura del código de barras. En el caso de que la información del código de barras no pueda ser recuperada de forma confiable se utiliza el valor del tamaño de la matriz de datos determinado a partir del análisis del patrón 205. 3.A.4 Transformación colorimétrica The above values can be readjusted depending on the specific implementation. The comparison between the size of the pattern 205 in pixels with the size of the pattern 201, allows to determine the size of the data matrix in units of information. The size determined in this way can be verified with the value obtained from reading the barcode. In the event that the barcode information cannot be retrieved reliably, the value of the data matrix size determined from the analysis of pattern 205 is used. 3.A.4 Colorimetric transformation
La transformación colorimétrica forma parte del reconocimiento de los estados y de la obtención de información a partir de las unidades de información. Dentro de las posibles transformaciones colorimétricas se toma como referencia los valores digitales del color a corregir (valores de diseño previamente conocidos), y los valores representativos de los colores medidos (media, mediana, media geométrica, valor eficaz o RMS, u otro de la muestra) para luego encontrar el polinomio que ajuste los colores medidos acercándolos lo más posible a los valores teóricos. The colorimetric transformation is part of the recognition of the states and of obtaining information from the information units. Within the possible colorimetric transformations, the digital values of the color to be corrected (previously known design values), and the values are taken as reference representative of the measured colors (mean, median, geometric mean, effective value or RMS, or other of the sample) and then find the polynomial that adjusts the measured colors as close as possible to the theoretical values.
Una forma de encontrar los polinomios de ajuste es mediante la aproximación ajuste de mínimos cuadrados, minimizando así el error cuadrático. A continuación se presenta el ajuste polinomial en notación matricial: donde y corresponde a los colores sin distorsión, X corresponde a los valores representativos de los colores experimentales, y corresponde a la matriz de transformación. La ecuación anterior puede ser resuelta mediante la premultiplicación por la transpuesta: One way to find the adjustment polynomials is through the least squares adjustment approximation, thus minimizing the quadratic error. The polynomial adjustment in matrix notation is presented below: where y corresponds to colors without distortion, X corresponds to the representative values of the experimental colors, and corresponds to the transformation matrix. The above equation can be solved by premultiplying by the transpose:
La solución numérica de la ecuación matricial se puede encontrar al despejar como sigue: The numerical solution of the matrix equation can be found by clearing as follows:
El orden polinomial afecta la estabilidad de la transformación en las zonas referentes a extrapolación de datos. Por lo que normalmente los ajustes de primer y segundo orden consiguen resultados más robustos al momento del mapeo. No obstante, a mayor orden polinomial también aumenta la exactitud de la aproximación en zonas referentes a la interpolación. La transformación colorimétrica puede ser efectuada directamente con los valores del modelo de color RGB, o en el espacio de color XYZ, CIELAB, CIELUV u otro. Para efectos prácticos y de velocidad de procesamiento, es que la aplicación del método de mínimos cuadrados se puede aplicar a modelos y no a espacios de color. The polynomial order affects the stability of the transformation in the areas related to extrapolation of data. So usually the first and second order settings get more robust results at the time of mapping. However, a higher polynomial order also increases the accuracy of the approach in areas related to interpolation. The colorimetric transformation can be carried out directly with the values of the RGB color model, or in the XYZ, CIELAB, CIELUV or other color space. For practical and processing speed effects, it is that the application of the least squares method can be applied to models and not to color spaces.
A continuación se describen algunos polinomios utilizados para la transformación colorimétrica, pudiéndose utilizar polinomios de orden mayor a los que se detallan a continuación. Some polynomials used for colorimetric transformation are described below, and polynomials of greater order than those detailed below can be used.
Polinomio transformación de primer orden First order transformation polynomial
Sean r0, g0 y b0 los valores de los colores de referencia y r,, y bi los valores representativos de los colores medidos. Se tiene que la transformación colorimétrica puede ser expresada de forma matricial como sigue: Let r 0 , g 0 and b 0 be the values of the reference colors and r ,, and bi the representative values of the measured colors. It has to be that the colorimetric transformation can be expressed in matrix form as follows:
Luego que se obtiene la transformación colorimétrica, se procede a corregir los colores de toda la imagen, donde r2, g2 y b2 representan los vectores columna de la imagen. Entonces: Luego se procede a llevar la información contenida en el arreglo a otro de dimensiones (O x P x 3), donde (M = 0 x P) After the colorimetric transformation is obtained, the colors of the entire image are corrected, where r 2 , g 2 and b 2 represent the column vectors of the image. So: Then we proceed to take the information contained in the arrangement to another dimension (O x P x 3), where (M = 0 x P)
Polinomio transformación de segundo y tercer orden Second and third order transformation polynomial
Al igual que la transformación colorimétrica de primer orden, se procede a generar los arreglos de las transformaciones colorimétricas de segundo y tercer orden polinomial. Para simplificar la notación se tiene que los colores referenciales son: arreglo de segundo orden: arreglo de tercer orden: Like the first order colorimetric transformation, the arrays of the second and third polynomial colorimetric transformations are generated. To simplify the notation, the reference colors are: second order arrangement: third order arrangement:
matriz de transformación colorimétrica de segundo orden: matriz de transformación colorimétrica de tercer orden: arreglo con los datos a corregir: second order colorimetric transformation matrix: third order colorimetric transformation matrix: arrangement with the data to correct:
Luego se tiene que las imágenes corregidas para la transformaciones de segundo y tercer orden son: Then you have that the corrected images for the second and third order transformations are:
Luego se procede a llevar la información contenida en el arreglo a otro de dimensiones (O x P x 3), donde (M = 0 x P). Then we proceed to take the information contained in the array to another dimension (O x P x 3), where (M = 0 x P).
Finalmente se procede a la estandarización de los datos al igual que en la transformación de primer orden Finally, the data is standardized as in the first order transformation
3. A.5 Lectura de información 3. A.5 Reading information
Con el tamaño de la matriz de datos conocido, así como el tamaño de una unidad de información en pixeles, se recorre secuencialmente la matriz de datos, en el mismo orden de escritura, esto es, de arriba abajo, recorriendo las columnas de izquierda a derecha, omitiendo las zonas que corresponden a espacios reservados. Se extrae una subimagen por cada unidad de información, cuyo estado se compara con el listado de estados usados en la codificación. La información de los estados usados en la codificación es cargada al SR, por ejemplo, mediante un archivo de configuración para una ejecución particular de la etiqueta. Basado en esta comparación se asigna un entero como valor de lectura, el conjunto de estos enteros, corresponde al mensaje decodificado, el que puede o no contener errores. With the size of the known data matrix, as well as the size of a unit of information in pixels, the data matrix is sequentially traversed, in the same writing order, that is, from top to bottom, traveling the columns from left to right, omitting the zones that correspond to reserved spaces. A subimage is extracted for each unit of information, whose status is compared with the list of states used in the coding. The information of the states used in the coding is uploaded to the SR, for example, by means of a configuration file for a particular execution of the tag. Based on this comparison, an integer is assigned as a read value, the set of these integers corresponds to the decoded message, which may or may not contain errors.
Alternativamente se incluye un método de mejora en la lectura que corresponde a, además de analizar la subimagen antes mencionada, analizar subimágenes que corresponden a leves desplazamientos de la ventana muestral, considerando la de menor varianza en la comparación de estados para asignar un valor de lectura. 3. A.6 Verificación y corrección de errores Alternatively, a reading improvement method is included that corresponds to, in addition to analyzing the aforementioned sub-image, analyzing sub-images that correspond to slight displacements of the sample window, considering the one with the lowest variance in the comparison of states to assign a reading value . 3. A.6 Verification and correction of errors
En el marco del algoritmo de Reed Solomon, el mensaje recibido corresponde al Under the Reed Solomon algorithm, the message received corresponds to the
mensaje transmitido más una componente de error de acuerdo a:Message transmitted plus an error component according to:
Suponiendo que los errores se encuentran en las posiciones y son de magnitud , entonces el polinomio error se puede escribir como: Assuming the errors are in the positions and they are of magnitude , then the polynomial error can be written as:
Se define el valor syndrome como el polinomio error evaluado en las raíces del polinomio generador, en el caso de que no se hayan producido errores durante la transmisión del mensaje, todos los valores de syndrome deberían ser igual a cero. Debido a que el polinomio generador tiene (n-k) raíces, se genera un sistema de (n-k) ecuaciones y (n-k) incógnitas: The syndrome value is defined as the error polynomial evaluated at the roots of the generating polynomial, in the event that no errors occurred during the transmission of the message, all syndrome values should be equal to zero. Because the generator polynomial has (n-k) roots, a system of (n-k) equations and (n-k) unknowns is generated:
La notación se puede simplificar un poco reemplazandoThe notation can be simplified a little by replacing
La dificultad de que el sistema anterior es no lineal se ataca resolviendo por separado las posiciones de los errores y luego las magnitudes de los mismos. Se define el polinomio localizador de errores como: The difficulty that the previous system is non-linear is attacked by resolving the error positions separately and then the magnitudes of them. The error locator polynomial is defined as:
Las raíces del polinomio localizador corresponden a los recíprocos de Pi , así, encontrar las raíces es equivalente a determinar las posiciones de los errores en el mensaje recibido. Se tiene: La ecuación anterior aún es válida al multiplicarla por (en la ecuación siguiente se usa la notaciónThe roots of the polynomial locator correspond to the reciprocals of Pi, thus, finding the roots is equivalent to determining the positions of the errors in the received message. It has: The previous equation is still valid when multiplied by (In the following equation the notation is used
A continuación se suma sobre p desde 1 a (n-k)/2: Then add on p from 1 to (n-k) / 2:
Recordando la definición de syndrome: Remembering the definition of syndrome:
Repitiendo esto para distintos valores de m se obtiene un sistema de ecuaciones que permite obtener los coeficientes del polinomio localizador de errores, y a partir de sus raíces encontrar las posiciones con errores en el mensaje: Repeating this for different values of m, a system of equations is obtained that allows to obtain the coefficients of the error locator polynomial, and from its roots find the positions with errors in the message:
Una vez determinados los valores a partir de los recíprocos de las raíces del polinomio localizador de errores se pueden determinar las magnitudes de los mismos, y con esto corregir el mensaje. En este algoritmo el número de errores se debe resolver en forma iterativa. Once the values have been determined From the reciprocals of the roots of the error locator polynomial, the magnitudes of the same can be determined, and with this correct the message. In this algorithm the number of errors must be resolved iteratively.
B. Interpretación visual B. Visual interpretation
La interpretación visual de toda o parte de la información dinámica por parte del usuario puede requerir que previamente haya recibido instrucciones. En general estas consisten en la ubicación de los elementos interpretables en la etiqueta, junto con un listado de los estados en que se puede encontrar el/los elementos, junto con el valor/condición de la variable de interés asociada. La interpretación visual también se puede generar basándose en conceptos intuitivos (tales como figuras representativas de conceptos conocidos por el inconsciente colectivo) o por secuencias lógicas en ciertas industrias o aplicaciones en las que la interpretación no necesariamente requiere de instrucciones adicionales. Como ejemplo de la explicación anterior se puede considerar el uso de la figura equis (X) o de un ticket (visto bueno o símbolo de aprobación) utilizando colores de las unidades de información para generar las figuras. The visual interpretation of all or part of the dynamic information by the user may require that you have previously received instructions. In general, these consist of the location of the interpretable elements in the label, together with a list of the states in which the element (s) can be found, together with the value / condition of the associated variable of interest. Visual interpretation can also be generated based on intuitive concepts (such as representative figures of concepts known to the collective unconscious) or by logical sequences in certain industries or applications where interpretation does not necessarily require additional instructions. As an example of the previous explanation, the use of the figure X (X) or a ticket (approval or approval symbol) can be considered using colors of the information units to generate the figures.
C. Descompresión C. Decompression
Si se utilizó el componente opcional de compresión de datos señalado en el método de escritura, el método de lectura utilizará un método acorde al algoritmo de compresión utilizado para procesar la información, antes o después de la desencriptación dependiendo del orden en el cual fueron utilizados los componentes opcionales. If the optional data compression component indicated in the writing method was used, the reading method will use a method according to the compression algorithm used to process the information, before or after decryption depending on the order in which the data were used. optional components.
Una vez utilizado el método de descompresión adecuado se prosigue con la secuencia de lectura correspondiente. D. Desencriptación Once the appropriate decompression method has been used, the corresponding reading sequence is continued. D. Decryption
Tal como se utiliza un modulo opcional de lectura de información comprimida, se utiliza también un módulo opcional de información encriptada que puede utilizarse para la implementación de niveles de información (cómo se señala en el punto Έ. Niveles de información" siguiente) o para la implementación de niveles de seguridad de información. As an optional module for reading compressed information is used, an optional module of encrypted information is also used that can be used for the implementation of information levels (as indicated in point Έ. Information levels "below) or for the implementation of information security levels.
El módulo de desencripación del SR identifica segmentos que le indican si existe encriptación o no en un fragmento determinado y procede a utilizar el método adecuado de desencriptación. Así como es posible utilizar diversos métodos de compresión también es posible utilizar diversos métodos de desencriptación de datos de acuerdo a las especificaciones y requerimientos de la implementación, siempre que sea el adecuado para el método de encriptación utilizado. E. Niveles de información The decryption module of the SR identifies segments that indicate whether there is encryption or not in a given fragment and proceeds to use the method adequate decryption. Just as it is possible to use various compression methods it is also possible to use various data decryption methods according to the specifications and requirements of the implementation, provided that it is appropriate for the encryption method used. E. Information levels
Al momento de la decodificación, el sistema es capaz de reconocer la existencia de niveles de información, de acuerdo al tipo de implementación que se utilizó durante la codificación. Esto se puede realizar de una variedad de formas, por ejemplo un segmento no encriptado de la información puede usarse como indicativo de que el bloque siguiente de información está encriptado y por lo tanto se requiere una clave para acceder a la información, también es posible crear diferentes versiones del software de lectura (versión productor, versión consumidor, etc.). At the time of decoding, the system is able to recognize the existence of information levels, according to the type of implementation that was used during the coding. This can be done in a variety of ways, for example an unencrypted segment of the information can be used as an indication that the next block of information is encrypted and therefore a password is required to access the information, it is also possible to create different versions of the reading software (producer version, consumer version, etc.).
4. Sistema 4. System
La Figura 28 muestra la integración opcional de la etiqueta inteligente a un sistema de trazabilidad y de integración de la información de los sistemas analógico, digital, y el sistema de reconocimiento. Un sistema de este tipo involucra la interacción de los distintos medios que lo componen: Figure 28 shows the optional integration of the smart tag into a traceability system and the integration of the analog, digital, and recognition system information. Such a system involves the interaction of the different means that compose it:
1. Medios para la configuración del dispositivo (A): En esta etapa se escoge la configuración adecuada para la etiqueta en función de las variables a monitorear y los requerimientos del usuario. Entre los aspectos a configurar se encuentran: la parte dinámica y estática del código bidimensional, algoritmo de cifrado, protocolos de codificación y decodificación, número verificador del dispositivo, disposición física de la calibración espacial y de estados, forma, tamaño, etc. 1. Means for configuring the device (A): At this stage the appropriate configuration for the label is chosen based on the variables to be monitored and the user's requirements. Among the aspects to be configured are: the dynamic and static part of the two-dimensional code, encryption algorithm, protocols coding and decoding, device verification number, physical arrangement of spatial and state calibration, shape, size, etc.
2. Medio de interacción con la base de datos del sistema (B): La base de datos del sistema consta de varios campos por cada producto. Dentro de la base de datos, destacan dos grandes tipos de información: la información previa al seguimiento (C), y la información generada durante el seguimiento del producto. 2. Means of interaction with the system database (B): The system database consists of several fields for each product. Within the database, two major types of information stand out: the pre-tracking information (C), and the information generated during the product tracking.
3. Medios de encriptación y/o compresión (D): En esta etapa opcional, los datos son encriptados y/o comprimidos. Luego esto, el código bidimensional (E) se adhiere al producto, recolectando información por medio de los elementos activos en la etiqueta. 3. Encryption and / or compression media (D): At this optional stage, the data is encrypted and / or compressed. Then this, the two-dimensional code (E) adheres to the product, collecting information through the active elements on the label.
4. Medios de adquisición y realimentación de datos. Se recupera la información de la etiqueta a partir de la imagen obtenida por medio de un dispositivo de captura (E). Se utilizan tanto las calibraciones espaciales como de estados para recuperar la información estática y dinámica contenida en la etiqueta inteligente (F). A continuación de la lectura del código bidimensional, se procede a la decodificación del mismo (G), almacenamiento de la información en la base de datos en los campos respectivos al seguimiento del objeto (H, I, J), y realimentación del dispositivo a través de la conexión inalámbrica (opcional) entre el dispositivo y los portales de adquisición de datos (K, L, M), donde la información realimentada al dispositivo es almacenada dentro de la memoria interna (opcional), como respaldo de los datos procesados en los portales de adquisición de datos. En cualquier punto del seguimiento, el usuario puede acceder de manera visual a la información contenida en la etiqueta (Ε'). 4. Means of acquisition and feedback of data. Label information is retrieved from the image obtained by means of a capture device (E). Both spatial and state calibrations are used to retrieve the static and dynamic information contained in the smart tag (F). After reading the two-dimensional code, it is decoded (G), stored information in the database in the fields corresponding to the object tracking (H, I, J), and feedback of the device to through the wireless connection (optional) between the device and the data acquisition portals (K, L, M), where the information fed back to the device is stored inside the internal memory (optional), as a backup of the data processed in Data acquisition portals. At any point in the follow-up, the user can visually access the information contained in the label (Ε ').
Ejemplos Examples
Ejemplo 1 Example 1
En la Figura 6 y Figura 7 se muestra un ejemplo de codificación de información relativa a un producto, correspondiente a la cadena de caracteres: "MANU Soprale PROD leche entera VOL 11 CONSTEMP 8 C ELAB 12-09-14 VENC 12-11-14", número de identificación "0019", considerando un 36% de símbolos de redundancia (se puede reconstruir el mensaje aunque 18% de los símbolos sean leídos incorrectamente), además en cada caso se incluye un conjunto de unidades de información que presentan comportamiento dinámico ante cambios en una variable (ej. temperatura). En el caso mostrado en la Figura 6, se muestra el resultado de la codificación considerando dos posibles estados de las unidades de información. Representando cada carácter utilizando 7 unidades de información, se requiere una matriz de datos de 31x31 unidades de información. En el caso mostrado en la Figura 7, considerando 4 posibles estados de las unidades de información, cada carácter se representa usando 4 unidades de información, requiriendo de una matriz de 24x24 unidades de información, esto ilustra el aumento en la densidad de información al usar más de dos estados posibles para cada unidad de información en la codificación. An example of coding information regarding a product, corresponding to the character string, is shown in Figure 6 and Figure 7: "MANU Soprale PROD whole milk VOL 11 CONSTEMP 8 C ELAB 12-09-14 VENC 12-11-14 ", identification number" 0019 ", considering 36% of redundancy symbols (the message can be reconstructed even if 18% of the symbols are read incorrectly), in addition in each case a set of information units that have dynamic behavior is included before changes in a variable (eg temperature). In the case shown in Figure 6, the result of the coding is shown considering two possible states of the information units. Representing each character using 7 units of information, a data matrix of 31x31 units of information is required. In the case shown in Figure 7, considering 4 possible states of the information units, each character is represented using 4 information units, requiring a matrix of 24x24 information units, this illustrates the increase in information density when using more than two possible states for each unit of information in the coding.
Ejemplo 2 Example 2
En la Figura 8 y Figura 9 se muestra la codificación de la información correspondiente a la cadena de texto "MANU Marfruit PROD salmonahu PESO 500g CONSTEMP 0C ELAB 20-06 VENC 05-07", número de identificación "0120", utilizando un 36% de símbolos de redundancia. En la Figura 8 se muestra la codificación usando cuatro estados posibles de las unidades de información, considerando un conjunto de unidades de información que presentan comportamiento dinámico ante cambios en una variable (ej. temperatura) requiriendo una matriz de 24x24 unidades de información. En la Figura 9 se muestra como el aspecto de la etiqueta puede variar a rectangular para acomodar un conjunto de unidades de información que presentan comportamiento dinámico ante cambios en una variable (ej. presión), requiriendo en este caso una matriz de 21x30 unidades de información. The coding of the information corresponding to the text string "MANU Marfruit PROD salmonahu PESO 500g CONSTEMP 0C ELAB 20-06 VENC 05-07", identification number "0120", using 36% is shown in Figure 8 and Figure 9 of redundancy symbols. Figure 8 shows the coding using four possible states of the information units, considering a set of information units that exhibit dynamic behavior in the face of changes in a variable (eg temperature) requiring a matrix of 24x24 information units. Figure 9 shows how the appearance of the label can vary to rectangular to accommodate a set of information units that exhibit dynamic behavior in the face of changes in a variable (eg pressure), in this case requiring a matrix of 21x30 information units .
Ejemplo 3 Example 3
En la Figura 10 se muestra la codificación de dos tipos de información; un segmento del código genético de la especie de salmón del atlántico (150 caracteres), seguido de campos con información del producto, constituyendo el siguiente mensaje: "GEN AGTGCTAGAGGAGTTCTGTATCTATAATTCTTAAAATAATTGTTATGCTTTTTGTGA ACGTTTATCGTGAGTAATTTAGTAAATTCTTAGTGAATTCGGCGGAAGTTTGCGGG GGTATGCTAGTTCTGAACGTCACATGCTAATGTAAAA \n PRODUCT INFO\n MANU Marfruit\n PROD salmonahu\n PESO 500g\n CONSTEMP 0C\n ELAB 20-06\n VENC 05-07\n PORCION 55g\n CALORIASTOT 107\n GRASASTOT 6g9%\n COLESTEROL 37mg12%\n SODIO 32mg1 %\n CARBOHIDTOT 0g0%\n PROTEINA 13g26%\n", número de identificación "01 15". En este caso la información fue comprimida usando el algoritmo de Huffman. El algoritmo se basa en codificar los caracteres que se repiten un mayor número de veces en el mensaje usando el menor número posible de bits. Generando una tabla de equivalencias de la siguiente forma: Figure 10 shows the coding of two types of information; a segment of the genetic code of the species Atlantic salmon (150 characters), followed by fields with product information constituting the message "GEN AGTGCTAGAGGAGTTCTGTATCTATAATTCTTAAAATAATTGTTATGCTTTTTGTGA ACGTTTATCGTGAGTAATTTAGTAAATTCTTAGTGAATTCGGCGGAAGTTTGCGGG GGTATGCTAGTTCTGAACGTCACATGCTAATGTAAAA \ n PRODUCT INFO \ n MANU Marfruit \ n PROD salmonahu \ n WEIGHT 500g \ n CONSTEMP 0C \ n ELAB 20-06 \ n VENC 05-07 \ n PORTION 55g \ n CALORIASTOT 107 \ n GRASASTOT 6g9% \ n CHOLESTEROL 37mg12% \ n SODIUM 32mg1% \ n CARBOHIDTOT 0g0% \ n PROTEIN 13g26% \ n ", identification number" 01 15 ". In this case the information was compressed using Huffman's algorithm. The algorithm is based on encoding the characters that are repeated a greater number of times in the message using the least possible number of bits. Generating an equivalence table as follows:
Tabla 2. Equivalencia binarias Table 2. Binary equivalence
El mensaje sin codificar consta de 378 caracteres, que equivalen a un requerimiento de 3024 bits en caso de codificarse cada carácter usando 8 bits. Mediante el algoritmo de Huffman, el mensaje completo se reduce a una cadena de 1731 bits, lo que representa una compresión de la información a un 57% del tamaño original. Posteriormente, segmentos de 8 bits contiguos se usan como enteros en el marco del algoritmo de Reed Solomon, permitiendo codificar la información en una etiqueta de 47x46 unidades de información, considerando 14% de símbolos de redundancia. Ejemplo 4 The uncoded message consists of 378 characters, equivalent to a requirement of 3024 bits in case each character is encoded using 8 bits. Using the Huffman algorithm, the entire message is reduced to a 1731 bit string, which represents a compression of the information to 57% of the original size. Subsequently, adjacent 8-bit segments are used as integers in the framework of the Reed Solomon algorithm, allowing information to be encoded on a 47x46 information unit label, considering 14% redundancy symbols. Example 4
En la Figura 1 1 se muestra el resultado de la codificación del siguiente mensaje; "Monitoreo de eficiencia de reparto ruta 25. Salida de centro de despacho X, 1 1 :48 22- 07, registrar arribo a bodega Y.\n PRODUCT INFO\n MANU Marfruit\n PROD salmonahu\n PESO 500g\n CONSTEMP 0C\n ELAB 20-06\n VENC 05-07\n", número de identificación: "0318". En este caso se presume que no es conveniente que los repartidores conozcan que esta unidad en particular del producto está bajo un monitoreo especial, de forma de evitar un trato preferente, por lo que previo a la codificación la información se somete a un proceso de encriptación, en este caso con el algoritmo AES128Bit, usando la clave "admin_key", generando el mensaje modificado: The result of the coding of the following message is shown in Figure 1 1; "Route 25 efficiency distribution monitoring. Departure from dispatch center X, 1 1: 48 22-07, register arrival at warehouse Y. \ n PRODUCT INFO \ n MANU Marfruit \ n PROD salmonahu \ n WEIGHT 500g \ n CONSTEMP 0C \ n ELAB 20-06 \ n VENC 05-07 \ n ", identification number:" 0318 ". In this case it is presumed that it is not convenient for distributors to know that this particular unit of the product is under special monitoring, in order to avoid preferential treatment, so that prior to coding the information is subjected to an encryption process , in this case with the AES128Bit algorithm, using the "admin_key" key, generating the modified message:
"yTTBDYgpqvQ+XmnCjrqojsKR7tsBkW6/l7U2xMh/zgqvV+ov0N5ldgAPH2fqrhGtRVmX lagXbhOpr24YmQU6k84tel4j95mqgYm91322pCSanad+/YxTOzN/Ocg8mxhMYYBi/Go esqy9+PB3Gj4Fm8L7ZIAuXtBDBn6smbbnX4c=\n PRODUCT INFO\n MANU Marfruit\n PROD salmonahu\n PESO 500g\n CONSTEMP 0C\n ELAB 20-06\n VENC 05-07\n", donde la información sensible ha sido reemplazada, luego de esto la información se comprime usando el algoritmo de Huffman y se inserta en la etiqueta, en este caso utilizando 4 estados de las unidades de información y un 18% de símbolos de redundancia, en una etiqueta de 34x33 unidades de información. El mensaje original consta de 219 caracteres, el mensaje encriptado de 274 caracteres (2192 bits), y el mensaje comprimido de 1642 bits (compresión a un 75% del tamaño de la información encriptada). "YTTBDYgpqvQ + XmnCjrqojsKR7tsBkW6 / l7U2xMh / zgqvV + ov0N5ldgAPH2fqrhGtRVmX lagXbhOpr24YmQU6k84tel4j95mqgYm91322pCSanad + / YxTOzN / Ocg8mxhMYYBi / Go esqy9 + PB3Gj4Fm8L7ZIAuXtBDBn6smbbnX4c = \ n PRODUCT INFO \ n MANU Marfruit \ n PROD salmonahu \ n WEIGHT 500g \ n CONSTEMP 0C \ n ELAB 20-06 \ n VENC 05-07 \ n ", where the sensitive information has been replaced, after this the information is compressed using the Huffman algorithm and inserted into the label, in this case using 4 states of the information units and 18% of Redundancy symbols, on a 34x33 information unit label. The original message consists of 219 characters, the encrypted message of 274 characters (2192 bits), and the compressed message of 1642 bits (compression at 75% of the size of the encrypted information).
Ejemplo 5 En la Figura 12 se muestra la etiqueta generada al codificar la siguiente información: "MANU Soprale\n PROD leche entera\n VOL 1 l\n CONSTEMP 8C\n ELAB 12-09-14\n VENC 12-1 1-14\n CALORIAS TOT 158\n GRASA TOT 5g8%\n COLESTEROL 22mg7%\n SODIO 150mg6%\n CARBOHID TOT 18g6%\n PROTEINA 10g20%\n", número de identificación: "01 10", en una matriz de 47x47 unidades de información, considerando un 20% de símbolos de redundancia. La zona activa "SENSOR", cambia de apariencia de acuerdo a las condiciones ambientales a monitorear (ej. temperatura), cerca de la zona activa se encuentran colores de calibración, indicativos de condiciones específicas de las unidades de información utilizadas (Figura 13). En la Figura 14 se muestran posibles estados de la zona activa, los colores de calibración pueden ser utilizados para determinar la condición ambiental por comparación directa por parte del usuario (de acuerdo al manual de instrucciones), o utilizando el SR. Ejemplo 6 Example 5 Figure 12 shows the label generated by encoding the following information: "MANU Soprale \ n PROD whole milk \ n VOL 1 l \ n CONSTEMP 8C \ n ELAB 12-09-14 \ n VENC 12-1 1- 14 \ n CALORIES TOT 158 \ n FAT TOT 5g8% \ n CHOLESTEROL 22mg7% \ n SODIUM 150mg6% \ n CARBOHID TOT 18g6% \ n PROTEIN 10g20% \ n ", identification number:" 01 10 ", in a matrix of 47x47 units of information, considering 20% redundancy symbols. The active zone "SENSOR", changes its appearance according to the environmental conditions to be monitored (eg temperature), near the active zone are calibration colors, indicative of specific conditions of the information units used (Figure 13). Figure 14 shows possible states of the active zone, the calibration colors can be used to determine the environmental condition by direct comparison by the user (according to the instruction manual), or by using the SR. Example 6
En la Figura 15, se muestra un ejemplo de una etiqueta que incluye unidades de información dinámicas, las cuales pueden ser leídas tanto a simple vista, como utilizando el SR. El área de forma triangular corresponde a un espacio protegido y contiene sensores que cambian irreversiblemente al producirse una determinada combinación de tiempo y temperatura. Mientras que el sensor de forma circular que también corresponde a un espacio reservado contiene sensores que cambian de forma reversible a ciertos valores de temperatura (Figura 16). Figure 15 shows an example of a label that includes dynamic units of information, which can be read both with the naked eye and using the SR. The triangular area corresponds to a protected space and contains sensors that change irreversibly when a certain combination of time and temperature occurs. While the circular-shaped sensor that also corresponds to a reserved space contains sensors that reversibly change to certain temperature values (Figure 16).
Se asume que el usuario tuvo acceso previamente a un instructivo del tipo mostrado en la Figura 17. Visualmente el usuario puede decidir descartar el producto, basado en la observación del área triangular. Así mismo, observando el área circular se obtiene una idea de la temperatura del producto en relación a su temperatura de consumo recomendada (proporción del área circular). Por otra parte, haciendo uso del SR, puede, en base al sensor(es), específico (de tratarse de unidades de información compatibles con el SR) que se activó dentro del área triangular, determinar la causa del deterioro del producto. Así mismo, basado en la configuración de las zonas coloreadas en el área circular, puede obtener una recomendación específica acerca de cómo manipular el producto para que alcance su temperatura óptima. Un ejemplo de lectura de la etiqueta mostrada en la Figura 15, es: It is assumed that the user previously had access to an instruction of the type shown in Figure 17. Visually the user may decide to discard the product, based on the observation of the triangular area. Likewise, observing the circular area gives an idea of the temperature of the product in relation to its recommended consumption temperature (proportion of the circular area). On the other hand, using the SR, you can, based on the specific sensor (s) (if it is information units compatible with the SR) that was activated within the triangular area, determine the cause of the deterioration of the product. Also, based on the configuration of the colored areas in the circular area, you can get a specific recommendation on how to handle the product to reach its optimum temperature. An example of reading the label shown in Figure 15 is:
Ejemplo 7 Example 7
En la Figura 18, se muestra la imagen de la etiqueta obtenida al codificar la información: "MANU Soprale\nPROD leche entera\nVOL 1 l\nCONSTEMP 8C\nELAB 12-09-14\nVENC 12-11-14\n" , número de identificación "0515", incluyendo un conjunto de unidades de información dinámicas colorimétrico que cambian de estado respecto a la variable temperatura (S), en una matriz de 31x31 unidades de información, considerando un 30% de símbolos de redundancia. En la Figura 19 se muestra una fotografía de la misma etiqueta. La fotografía tiene un tamaño de 1796x1843 pixeles. A continuación se detalla el algoritmo de decodificación, que permite recuperar la información de la etiqueta, a través de las etapas principales. Figure 18 shows the image of the label obtained when encoding the information: "MANU Soprale \ nPROD whole milk \ nVOL 1 l \ nCONSTEMP 8C \ nELAB 12-09-14 \ nVENC 12-11-14 \ n", identification number "0515", including a set of dynamic colorimetric information units that change state with respect to the temperature variable (S), in a matrix of 31x31 information units, considering 30% redundancy symbols. Figure 19 shows a photograph of the same label. The photograph is 1796x1843 pixels in size. Below is the decoding algorithm, which allows you to retrieve the tag information, through the main stages.
Etapa de Transformación espacial Spatial Transformation Stage
La fotografía asociada a la imagen de la etiqueta se descompone en una cuadrícula de 4x4. Se analizan las subimágenes que contienen las esquinas de la imagen original (Figura 20). En la Figura 21 se muestra el detalle de los pixeles detectados como esquinas en la subimagen correspondiente a la esquina superior izquierda de la fotografía. A continuación se descartan las esquinas detectadas cerca del borde de la subimagen (indicadas por medio de un cuadrado en la Figura 22). De las esquinas restantes, se selecciona, en este caso, la más cercana a la esquina superior izquierda de la subimagen (indicada por un triángulo en la Figura 22). Un procedimiento análogo se realiza con las restantes tres subimágenes. Una vez obtenidas las coordenadas de las esquinas de la matriz de datos, se obtiene la matriz de transformación de acuerdo a lo descrito en la sección 3. MÉTODO DE DECODIFICACION: A Decodificación por medio del sistema de reconocimiento. The photograph associated with the tag image is broken down into a 4x4 grid. Sub-images containing the corners of the original image are analyzed (Figure 20). Figure 21 shows the detail of the pixels detected as corners in the sub-image corresponding to the upper left corner of the photograph. The corners detected near the edge of the subimage are then discarded (indicated by a square in Figure 22). Of the corners remaining, in this case, the one closest to the upper left corner of the subimage is selected (indicated by a triangle in Figure 22). An analogous procedure is performed with the remaining three sub-images. Once the coordinates of the corners of the data matrix are obtained, the transformation matrix is obtained according to what is described in section 3. DECODING METHOD: A Decoding by means of the recognition system.
Etapa de reconocimiento de patrones Pattern Recognition Stage
Luego de la aplicación de la transformación espacial, la imagen se transforma a blanco y negro (Figura 23), y se obtienen las propiedades que caracterizan a cada región de pixeles contiguos (Bounding box, excentricidad y centroide). After the application of the spatial transformation, the image is transformed to black and white (Figure 23), and the properties that characterize each region of contiguous pixels (Bounding box, eccentricity and centroid) are obtained.
Análisis de bounding box Bounding box analysis
Para cada una de las regiones se determina el rectángulo que la contiene, caracterizado por las coordenadas del vértice superior izquierdo, y los valores de ancho y alto. Un ejemplo de los valores obtenidos, con respecto a las regiones indicadas en la Figura 24, se muestra en la siguiente tabla 3: For each of the regions, the rectangle that contains it is determined, characterized by the coordinates of the upper left vertex, and the width and height values. An example of the values obtained, with respect to the regions indicated in Figure 24, is shown in the following table 3:
Tabla 3. Table 3.
En este caso particular se detectan 32 regiones diferentes, la altura de la matriz de datos corresponde a mayor altura de entre las regiones detectadas (Figura 25), correspondiente a 1660 pixeles. In this particular case, 32 different regions are detected, the height of the data matrix corresponds to a greater height between the detected regions (Figure 25), corresponding to 1660 pixels.
A continuación se identifica el patrón de tamaño 205 por evaluación de la función de detección (ver 3. MÉTODO DE DECODIFICACION: A Decodifiacion por medio del sistema de reconocimiento), los valores correspondientes a las regiones con menores puntajes, y en referencia a la Figura 27, se muestran en la siguiente tabla 4: Next, the size pattern 205 is identified by evaluation of the detection function (see 3. DECODING METHOD: A Decoding by means of the recognition system), the values corresponding to the regions with lower scores, and in reference to the Figure 27, are shown in the following table 4:
Tabla 4. Se observa que el patrón es detectado correctamente. Con esto se determina un valor provisional para el tamaño de la matriz de datos en unidades de información (31), y del tamaño de cada unidad de información en pixeles (54). Table 4 It is observed that the pattern is detected correctly. This determines a provisional value for the size of the data matrix in information units (31), and the size of each information unit in pixels (54).
Análisis del código de barras A continuación se analiza la parte de la imagen que corresponde al código de barras (Figura 26). A partir de esta imagen se determina el valor de la longitud de cada una de las barras, valores que posteriormente se normalizan por el promedio de la longitud detectada para las 3 barras que corresponden al patrón de inicio de la codificación. Ambos conjuntos de valores se muestran en la tabla 5, donde los 31 valores mostrados corresponden a las tres barras del patrón de inicio, junto con las 28 barras correspondientes a los 7 dígitos codificados: Bar code analysis The part of the image that corresponds to the bar code is analyzed below (Figure 26). From this image, the value of the length of each of the bars is determined, values that are subsequently normalized by the average of the detected length for the 3 bars corresponding to the coding start pattern. Both sets of values are shown in table 5, where the 31 values shown correspond to the three bars of the start pattern, along with the 28 bars corresponding to the 7 coded digits:
Tabla 5. Table 5.
Las longitudes normalizadas permiten identificar cada dígito de acuerdo a la tabla 6: Normalized lengths allow each digit to be identified according to table 6:
Tabla 6. Table 6.
Con esto se comprueba el dígito verificador: This verifies the check digit:
Dado que el dígito verificador coincide, se asume que la información recuperada del código de barras es correcta, en este caso el tamaño de la matriz determinado por ambos métodos (31) coincide. Since the check digit matches, it is assumed that the information retrieved from the barcode is correct, in this case the size of the matrix determined by both methods (31) matches.
Lectura de la información Reading the information
A continuación se recorre secuencialmente la matriz, asignando a cada unidad de información un valor, dependiendo de su estado (en este ejemplo: color). Se usa la mediana de los valores de color en el caso de la codificación utilizando dos estados. En la Tabla 7 se muestra la asignación de valor a algunas unidades de información de la matriz de datos a modo de ejemplo: The matrix is then sequentially traversed, assigning each unit of information a value, depending on its status (in this example: color). The median of the color values is used in the case of coding using two states. Table 7 shows the value assignment to some units of information in the data matrix as an example:
Tabla 7. Table 7.
Se debe notar que en algunos casos de la Tabla 7 esta asignación es más confiable que en otros. Luego de esto, los valores leídos se concatenan y se procede a verificar que no se hayan producido errores durante la lectura. En este caso particular el mensaje es recuperado sin errores. It should be noted that in some cases in Table 7 this allocation is more reliable than in others. After this, the read values are concatenated and we proceed to verify that no errors occurred during the reading. In this particular case the message is recovered without errors.
Ejemplo 8 Example 8
En la Figura 33, se muestra la región seleccionada Ω en el espacio de color xyY. Dicha región se obtuvo al determinar la intersección entre las gamas de color correspondientes a ProPhoto RGB, Adobe RGB 1998, Colormatch RGB, sRGB y SWOP CMYK. In Figure 33, the selected region Ω is shown in the xyY color space. This region was obtained by determining the intersection between the color ranges corresponding to ProPhoto RGB, Adobe RGB 1998, Colormatch RGB, sRGB and SWOP CMYK.
Se determinaron 16 agrupamientos (K = 16), utilizando 200 iteraciones (iter = 200) y una tasa de aprendizaje de 0.8 (w = 0.8). Los colores iniciales μ° se escogieron de forma aleatoria respetando las condiciones de frontera de la región Ω, la transformación al espacio de color CIELAB de los colores iniciales se muestra en la Tabla 8. 16 clusters were determined (K = 16), using 200 iterations (iter = 200) and a learning rate of 0.8 (w = 0.8). The initial colors μ ° were chosen randomly respecting the boundary conditions of the Ω region, the transformation to the CIELAB color space of the initial colors is shown in the Table 8
Tabla 8. Table 8
En la Figura 34 y Figura 35 se muestran las funciones de distribución empírica de los indicadores a(z) y b(z) (para z=200), respectivamente. En la Tabla 9 se muestran los colores obtenidos al final del cálculo. The functions of empirical distribution of the indicators a (z) and b (z) (for z = 200), respectively, are shown in Figure 34 and Figure 35. Table 9 shows the colors obtained at the end of the calculation.
Tabla 9 Table 9
En la Figura 36 se muestra el resultado obtenido de los agrupamientos en la región seleccionada Ω perteneciente al espacio de color CIELAB para la iteración número 200. Figure 36 shows the result obtained from the groupings in the selected region Ω belonging to the CIELAB color space for iteration number 200.
En la Figura 37 se muestra el resultado obtenido de los agrupamientos en la región seleccionada Ω perteneciente al espacio de color xyY para la iteración número 200. En la Figura 38 y Figura 39 se muestran los resultados obtenidos de los agrupamientos en la región seleccionada Ω perteneciente al espacio de color xyY, para la iteración número 200, de manera individual. En la Figura 40 se muestra la variación del color con respecto al número de iteraciones, en el espacio de color xyY. La solución inicial y final se indican como μι (0) y μι(200), respectivamente. Figure 37 shows the result obtained from the groupings in the selected region Ω belonging to the color space xyY for iteration number 200. Figure 38 and Figure 39 show the results obtained from the groupings in the selected region Ω belonging to the xyY color space, for the 200th iteration, individually. Figure 40 shows the variation of the color with respect to the number of iterations, in the color space xyY. The initial and final solution are indicated as μ ι (0) and μι (200) , respectively.
Ejemplo 9 Caracterización del comportamiento colorimétrico de un material policromático (TLC), con respecto a la temperatura: Example 9 Characterization of the colorimetric behavior of a polychromatic material (TLC), with respect to temperature:
El rango de utilización del material es entre 15 y 29 [°C]. The range of use of the material is between 15 and 29 [° C].
Se utilizó una transformación colorimétrica de segundo orden para la corrección de colores, la comparación de los valores para cada canal de color en RGB, corregidos y sin corregir, se muestra en la Figura 41. A second order colorimetric transformation was used for color correction, the comparison of the values for each color channel in RGB, corrected and uncorrected, is shown in Figure 41.
Como método de regresión se utilizó una Red Neuronal Feed Forward, con 20 neuronas en la primera capa, 20 neuronas en la segunda, y 1 neurona en la capa de salida. As a regression method, a Feed Forward Neural Network was used, with 20 neurons in the first layer, 20 neurons in the second layer, and 1 neuron in the output layer.
Se utilizaron 45 características correspondientes a cada uno de los canales de las siguientes transformaciones de color: YCbCr (3 canales), LCH (3 canales), RGB (3 canales), YPbPr (3 canales), YUV (3 canales), YIQ (3 canales), HSV (3 canales), HSL (3 canales), HSI (3 canales), XYZ (3 canales), Lab (3 canales), Luv (3 canales), 'JPEG- YCbCr (3 canales), CAT02 LMS (3 canales), YDbDr (3 canales). El método utilizado para la selección de características fue uno del tipo wrapping, en cada iteración se añade al modelo de regresión la característica con un mejor desempeño, mientras el desempeño aumente. Como indicador del desempeño se utilizó el error cuadrático medio (MSE), los resultados se muestran en la Tabla 10. De los resultados se seleccionaron 4 características dado que la quinta iteración empeora el desempeño. 45 characteristics corresponding to each of the channels of the following color transformations were used: YCbCr (3 channels), LCH (3 channels), RGB (3 channels), YPbPr (3 channels), YUV (3 channels), YIQ ( 3 channels), HSV (3 channels), HSL (3 channels), HSI (3 channels), XYZ (3 channels), Lab (3 channels), Luv (3 channels), 'JPEG- YCbCr (3 channels), CAT02 LMS (3 channels), YDbDr (3 channels). The method used for the selection of characteristics was one of the wrapping type, in each iteration the characteristic with a better performance is added to the regression model, while the performance increases. As an indicator of performance, the mean square error (MSE) was used, the results are shown in Table 10. From the results, 4 characteristics were selected since the fifth iteration worsens the performance.
Tabla 10 Table 10
En la Figura 42 se muestra la relación entre la temperatura ajustada y la experimental para el set de datos usados en el cálculo, coeficiente de correlación cuadrático R2=0.9969. Figure 42 shows the relationship between the adjusted and experimental temperature for the data set used in the calculation, quadratic correlation coefficient R 2 = 0.9969.
En la Figura 43 se muestra la distribución acumulada del error de ajuste. The cumulative distribution of the adjustment error is shown in Figure 43.
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CL2014003255A CL2014003255A1 (en) | 2014-11-28 | 2014-11-28 | Smart tag with static and dynamic information fields. |
| CL3255-2014 | 2014-11-28 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016082055A1 true WO2016082055A1 (en) | 2016-06-02 |
Family
ID=56073268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CL2015/050047 Ceased WO2016082055A1 (en) | 2014-11-28 | 2015-11-27 | Smart label with static and dynamic information fields |
Country Status (2)
| Country | Link |
|---|---|
| CL (1) | CL2014003255A1 (en) |
| WO (1) | WO2016082055A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090020609A1 (en) * | 2007-07-16 | 2009-01-22 | Cohen Marc H | Sensor-embedded barcodes |
| JP2009537038A (en) * | 2006-05-07 | 2009-10-22 | バーコード リミティド | System and method for improving quality control in a product logistic chain |
| US8253541B2 (en) * | 2001-04-24 | 2012-08-28 | Savi Technology, Inc. | Method and apparatus for varying signals transmitted by a tag |
| US20130105587A1 (en) * | 2010-07-09 | 2013-05-02 | Steven J. Simske | Rfid antenna and 2d barcode |
-
2014
- 2014-11-28 CL CL2014003255A patent/CL2014003255A1/en unknown
-
2015
- 2015-11-27 WO PCT/CL2015/050047 patent/WO2016082055A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8253541B2 (en) * | 2001-04-24 | 2012-08-28 | Savi Technology, Inc. | Method and apparatus for varying signals transmitted by a tag |
| JP2009537038A (en) * | 2006-05-07 | 2009-10-22 | バーコード リミティド | System and method for improving quality control in a product logistic chain |
| US20090020609A1 (en) * | 2007-07-16 | 2009-01-22 | Cohen Marc H | Sensor-embedded barcodes |
| US20130105587A1 (en) * | 2010-07-09 | 2013-05-02 | Steven J. Simske | Rfid antenna and 2d barcode |
Also Published As
| Publication number | Publication date |
|---|---|
| CL2014003255A1 (en) | 2016-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12067455B2 (en) | Two dimensional barcode with dynamic environmental data system, method, and apparatus | |
| RU2596997C2 (en) | Producing, capturing and using visual identification tags for moving objects | |
| KR102320597B1 (en) | Two-dimensional barcode, method and apparatus with dynamic environmental data system | |
| EP3278266B1 (en) | A two dimensional barcode with dynamic environmental data system, method, and apparatus | |
| US8879832B2 (en) | Color matrix code | |
| EP2178031B1 (en) | Optical code recognition apparatus, optical code and recognition method. | |
| JP7525678B2 (en) | Improved matrix symbol error correction method | |
| WO2016108221A1 (en) | Machine-readable image encoding data | |
| US9129346B2 (en) | Image fragmentation for distortion correction of color space encoded image | |
| US20160142713A1 (en) | Description Encoding/decoding of information from a graphic information unit | |
| WO2016082055A1 (en) | Smart label with static and dynamic information fields | |
| WO2021064272A1 (en) | Visual code, method for generating a visual code and method for decoding a visual code | |
| Mandal et al. | A color channel based on multiple Random Forest coupled with a computer vision technique for the detection and prediction of Sudan dye‐I adulteration in turmeric powder | |
| ES2817926B2 (en) | VISUAL CODE AND PROCEDURE TO ENCODE AND DECODE A TWO-DIMENSIONAL IMAGE | |
| CN109344937A (en) | A kind of graphics code generation, identification method and device | |
| US20200371141A1 (en) | Measurement signal device for a physical variable | |
| Benito Altamirano | Automated color correction for colorimetric applications using barcodes | |
| WO2024168355A2 (en) | Multiplex data label system | |
| HK1245458B (en) | A two dimensional barcode with dynamic environmental data system, method, and apparatus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15862535 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15862535 Country of ref document: EP Kind code of ref document: A1 |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 15/11/2018) |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15862535 Country of ref document: EP Kind code of ref document: A1 |














































