WO2016077079A1 - Dna encryption technologies - Google Patents
Dna encryption technologies Download PDFInfo
- Publication number
- WO2016077079A1 WO2016077079A1 PCT/US2015/058120 US2015058120W WO2016077079A1 WO 2016077079 A1 WO2016077079 A1 WO 2016077079A1 US 2015058120 W US2015058120 W US 2015058120W WO 2016077079 A1 WO2016077079 A1 WO 2016077079A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- codons
- dna
- sequencing
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
- H04L9/06—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols the encryption apparatus using shift registers or memories for block-wise or stream coding, e.g. DES systems or RC4; Hash functions; Pseudorandom sequence generators
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G09—EDUCATION; CRYPTOGRAPHY; DISPLAY; ADVERTISING; SEALS
- G09C—CIPHERING OR DECIPHERING APPARATUS FOR CRYPTOGRAPHIC OR OTHER PURPOSES INVOLVING THE NEED FOR SECRECY
- G09C1/00—Apparatus or methods whereby a given sequence of signs, e.g. an intelligible text, is transformed into an unintelligible sequence of signs by transposing the signs or groups of signs or by replacing them by others according to a predetermined system
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
- H04L9/06—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols the encryption apparatus using shift registers or memories for block-wise or stream coding, e.g. DES systems or RC4; Hash functions; Pseudorandom sequence generators
- H04L9/065—Encryption by serially and continuously modifying data stream elements, e.g. stream cipher systems, RC4, SEAL or A5/3
- H04L9/0656—Pseudorandom key sequence combined element-for-element with data sequence, e.g. one-time-pad [OTP] or Vernam's cipher
-
- H—ELECTRICITY
- H04—ELECTRIC COMMUNICATION TECHNIQUE
- H04L—TRANSMISSION OF DIGITAL INFORMATION, e.g. TELEGRAPHIC COMMUNICATION
- H04L9/00—Cryptographic mechanisms or cryptographic arrangements for secret or secure communications; Network security protocols
- H04L9/08—Key distribution or management, e.g. generation, sharing or updating, of cryptographic keys or passwords
- H04L9/0861—Generation of secret information including derivation or calculation of cryptographic keys or passwords
- H04L9/0866—Generation of secret information including derivation or calculation of cryptographic keys or passwords involving user or device identifiers, e.g. serial number, physical or biometrical information, DNA, hand-signature or measurable physical characteristics
Definitions
- DNA has been used for hiding messages and storing large texts, however these methods require advanced
- the instant disclosure relates to a method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising (a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence; (b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and, (c) obtaining an at least one nucleic acid molecule, each molecule comprising: (i) the complete or a portion of the nucleic acid message sequence, and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information.
- the nucleic acid molecules are naturally-occurring. In some embodiments, the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the sequences of the nucleic acids are naturally-occurring. In some embodiments, the sequences of the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the modified keyboard comprises codons. In some embodiments, the codons are designed to normalize frequency of character usage.
- the instant disclosure relates to a method of secure communication of information contained on a single nucleic acid molecule, the method comprising (a) obtaining a nucleic acid molecule of known sequence; (b) obtaining a modified keyboard comprising a personalized platform for translating nucleic acid sequence into text; and, (b) generating a quantum of information translated from the nucleic acid sequence using the modified keyboard of (a).
- the modified keyboard comprises codons.
- the codons are designed to normalize frequency of character usage.
- the method further comprises co-sequencing the set of nucleic acid molecules using one or more common primers. In some embodiments, the co-sequencing produces patterns in a chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of high intensity peaks on the chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of low intensity peaks on the chromatogram. In some embodiments, co-sequencing produces no chromatogram pattern. In some embodiments, the method further comprises identifying nucleic acid sequence using sequence alignments generated by bioinformatics software. In some embodiments, the method further comprises extracting the quantum of information contained within the set of nucleic acid molecules by using the modified keyboard to translate the nucleic acid sequence from the one or more nucleic acid molecules.
- the modified keyboard comprises homopolymer codons. In some embodiments, the keyboard comprises homopolymer codons located on functional keys. In some embodiments, the codons are greater than 3 nucleotides in length. In some embodiments, the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons are of mixed lengths. In some embodiments, the variable nucleic acid sequence comprises contiguous homopolymer codons.
- the instant disclosure relates to methods of extracting a quantum of encrypted information from a plurality of nucleic acid molecules.
- the encrypted information is extracted by nucleic acid sequencing.
- the nucleic acid sequencing is co-sequencing.
- the co-sequencing is DNA co- sequencing.
- the DNA co-sequencing is performed by Sanger
- the plurality of nucleic acid molecules are sequenced with at least one common primer.
- data produced from nucleic acid sequencing is analyzed by sequence alignment.
- the nucleic acid molecule(s) are in silico.
- the instant disclosure relates to a method of producing an individualized keyboard for the conversion of plaintext into nucleic acid encodable language, the method comprising: (a) producing a library of codons; (b) assigning each member of the library to a different symbol; and, (c) arranging the symbols into an array, thereby producing an
- the codons of the library are greater than three nucleotide bases in length. In some embodiments, the codons of the library are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons of the library are of mixed lengths. In some embodiments, the symbol is selected from the group consisting of letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages.
- Figures 1A-1C depict one embodiment of the iKey platform.
- Figure 1A depicts a graphical representation of one embodiment of an iKey-64, used to convert plaintext to codons for DNA transcription. Messages begin with 'start', finish with 'end', 'forward' and 'reverse' provide information on the strand containing the desired message, and 'spacel' and 'space2' can be used to produce troughs in chromatograms. Codons can be randomized to produce one-time iKeys.
- Figure IB shows that in this embodiment, iKey-64 buttons and codons were numbered to transcribe the keyboard on to a single strand of DNA (SEQ ID NO: 24).
- Figure 1C depicts this embodiment of iKey-64 transcribed on DNA (SEQ ID NO: 1). Codons were flanked by 10 Ts (SEQ ID NO: 1) to separate the start and end of the keyboard from surrounding DNA for identification.
- Figure 2A depicts a schematic for chromatogram patterning. When two DNA strands are co- sequenced, different overlapping nucleotides produce small peaks while identical ones produce large peaks. Peaks are kept in alignment via iKey-64.
- SEQ ID NOs: 48 through 50 appear from top to bottom, respectively.
- Figure 2B depicts a schematic demonstrating
- FIG. 2C depicts the sequence of 'Massachusetts Institute Technology used in Figure 2B.
- SEQ ID NOs: 51 and 52 appear from top to bottom, respectively.
- Figure 2D shows DNA-1+2 are co-sequenced at equal concentrations with a common primer (arrows), chromatogram patterning is achieved during reverse (Primer Extem aiRv) but not forward (Primer Extem aiFw) sequencing due to the flanking variable DNA regions.
- Figure 2E shows that chromatogram patterning can be tuned by varying the ratios of DNA- 1 (light shading) and DNA-2 (dark shading).
- Figures 3 A-C show that chromatogram patterning requires the alignment of base calls to be maintained during co-sequencing of DNA strands.
- Figure 3A shows a close-up of the chromatograms for forward; the consensus sequence listed below the alignment is represented by SEQ ID NO: 25.
- Figure 3B shows a close-up of the chromatograms for reverse sequencing of DNA-1+2 encoding the MIT cipher shown in Figure 2D; the consensus sequence listed below the alignment is represented by SEQ ID NO: 26. Samples were co-sequenced at equal concentrations and the arrow depicts the sequencing primer.
- Figure 3C shows the sequence of upstream (SEQ ID NOs: 14-15) and downstream (SEQ ID NOs: 16-17) variable DNA regions from Figure 2B.
- FIG 4 shows that MuSE can be tuned to discreetly encode messages in a mixed DNA population.
- the degree of chromatogram patterning can be tuned (Figure 2E).
- Figure 2E shows that MuSE can be tuned to discreetly encode messages in a mixed DNA population.
- the ratios of DNA- 1 (light shading) and DNA-2 (dark shading) the degree of chromatogram patterning can be tuned ( Figure 2E).
- Figure 2E shows that messages may be discreetly encoded between multiple DNA strands and revealed in chromatograms, but not identified by sequence alignments.
- Left alignment of chromatograms from Figure 2E with DNA-1.
- Right alignment of chromatograms from Figure 2E with DNA-2.
- Figure 5 shows discreetly embedded messages in chromatograms.
- Message encoding regions contain single peaks while variable DNA regions (unshaded box) contain two overlapping peaks whose heights can be adjusted by varying the ratios of DNA-1 (SEQ ID NO: 2) and DNA-2 (SEQ ID NO: 3).
- the portions of DNA- 1 and DNA-2 that are shown in the alignment are represented by SEQ ID NO: 53 and SEQ ID NO: 54.
- Figures 6A-6B show a combinatorial cipher depicting a century communication.
- Figure 6A shows that one embodiment of iKey-64 was used to transcribe watermarks, a key, a cipher, and a decoy message between 6 DNA strands. If the strands are sequenced according to the key
- Figure 6B shows the chromatograms of an nl x n6 matrix of strands tuned and co- sequenced with Primerci ph e r - Chromatogram patterning is not achieved when incorrect pairs are co-sequenced.
- Figure 7 shows combinatorial cipher readouts from the Halloween communication of Figures 6A-6B. Tuning and co-sequencing of multiple DNA strands reveals a variety of messages depending on the primers used and the order of strands co-sequenced.
- Figure 8 shows that the combinatorial cipher of Figures 6A-6B does not produce chromatogram patterning if non-specific primers are used for co- sequencing. Co-sequencing of cipher and decoy message containing pairs at equal concentrations with non-specific primers that are common to all strands (PrimerExtem iFw Rv) that bind outside of the information containing 525-bp region ( Figure 6A) does not produce chromatogram patterning.
- Figures 9A-9G show an examination of the peaks produced during co-sequencing of the combinatorial tradition cipher of Figures 6A-6B.
- Figure 9A shows DNA sequencing information (SEQ ID NOs: 27-29) and close-up chromatogram for the Key.
- Figures 9B-9D show DNA sequencing information (SEQ ID NOs: 30-38) and close-up chromatogram for the Cipher.
- Figures 9E-9G show DNA sequencing information (SEQ ID NOs: 39-47) and close-up chromatogram for the Decoy message.
- Figure 10 shows a 256 button iKey for introducing redundancies for transcribing plaintext in to a DNA encodable format. This is a theoretical design for an iKey-256 based on a four-nucleotide codon. While it is not designed to produce chromatogram patterning, iKey-256 would introduce redundancies in the transcription of plaintext on to DNA by equaling the frequencies of buttons for the letters used in English (Table 2). Increased number of 'start' , 'end' , 'shift', and 'space' buttons were implemented to reduce the overuse of any individual codon.
- Figures 1 1 A- 1 IB show DNA-based communication.
- Figure 11 A provides an example of NDA communication in which for Alice to send a message (m) to Bob, she must first write the data into DNA and then physically send the DNA to Bob, who can read the DNA and extract the data.
- Eve who is eavesdropping, can physically intercept and read m, making the
- Figure 1 IB provides an example of improved DNA communication.
- Data encoding m can be mixed with decoy (d) data and fragmented, then written into DNA with one-time pad encryption, where the key (k) can itself be written in DNA.
- Data transfer DNA encoded k and fragmented m+d components can be transmitted between Alice and Bob using multiple different channels based on a secret- sharing system. Interception of an incomplete set of DNA communications by Eve will not provide the data in m.
- Data extraction chromatogram patterning can be used by Bob to rapidly extract data via multiplexed sequencing reactions.
- Figures 12A- 12C show naive co-sequencing of multiple DNA strands.
- Figure 12A shows DNA- 1 (top), nl (second from top), and iKey-64 (third from top) strands have different sequences but they all share a common upstream region and sequencing primer (PrimerEx te m a i w)- Individual sequencing of each strand produces high quality reads, but the resulting reads are of poor quality when two (e.g. , DNA- 1 and nl) or three (e.g. , DNA- 1, nl , and iKey64) strands are co- sequenced.
- Figure 1 IB depicts a close-up of the chromatogram of DNA- 1 (SEQ ID NO: 2) and nl (SEQ ID NO: 4) co-sequencing.
- Figure 11C depicts a close-up of the chromatogram of DNA-1, nl, and iKey64 co-sequencing (SEQ ID NOs: 2, 4 and 1, respectively).
- Figure 13 shows an example of a workflow of extracting the correct message from a DNA communication that incorporates the iKey, MuSE, and chromatogram patterning techniques.
- Workflow steps 1, 2, and 3 can be viewed in detail in Figures 6A-6B and Figure 14.
- Data containing strands are pooled and sequenced with Primer Key to reveal the combination key. Deciphering and unlocking of the combination key will reveal the correct strand pairs to analyze with PrimerMessage to reveal the message. Analysis of incorrect strand pairs will reveal a decoy communication.
- Figure 14 shows an example of a combinatorial message depicting a military communication.
- iKey-64 Encryption Key
- iKey-64 Encryption Key
- Figure 15 shows an example of DNA camouflage.
- the 525 bp information-encoding regions of DNA were flipped between the forward and reverse strands to provide a camouflage effect against sequencing with random primer (Primer Ext ernaiFw/Rv)- While the external DNA regions surrounding the information containing regions were identical, strands nl/n3/n5 were encoded in the forward direction and strands n2/n4/n6 in the reverse direction, with watermarks used for orientation.
- Figures 16A-16C show an example of next-generation sequencing of a communication disseminated across six DNA strands.
- Figure 16A shows plasmids containing nl, n2, n3, n4, n5, and n6 sequences (Figure 15) were grown and purified in dH 2 0, mixed at equal concentrations of 30 ng/pL, and submitted to an outside party for NGS sequencing and assembly under blind experimental conditions.
- Figure 15B shows 300 ng of plasmids containing nl, n2, n3, n4, n5, and n6 sequences run on a 1% agarose gel to demonstrate purity.
- Figure 16C shows the outside party was provided with the number of plasmids, vector sequences, and the size of messages inserted into the vectors and asked to assemble the messages encoded in the plasmids. They assembled 6 sequences (Table 5) that represent the messages nl, n2, n3, n4, n5, and n6. Here the alignment of the 6 assembled sequences with nl, n2, n3, n4, n5, and n6 are shown. Shown below the alignment is a legend for the color-coding of the templates. Boxes highlight assembled sequences with near perfect alignment to corresponding templates.
- the instant disclosure relates to a method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising (a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence; (b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and, (c) obtaining at least one nucleic acid molecule, each molecule comprising: (i) the complete or a portion of the nucleic acid message sequence, and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information.
- the nucleic acid molecules are naturally-occurring. In some embodiments, the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the sequences of the nucleic acids are naturally-occurring. In some embodiments, the sequences of the nucleic acid molecules are synthesized or non-naturally occurring.
- the instant disclosure relates to a method of secure communication of information contained on a single nucleic acid molecule, the method comprising (a) obtaining a nucleic acid molecule of known sequence; (b) obtaining a modified keyboard comprising a personalized platform for translating nucleic acid sequence into text; and, (b) generating a quantum of information translated from the nucleic acid sequence using the modified keyboard of (a).
- the instant disclosure relates to the use of a keyboard to encrypt text information into nucleic acid sequence.
- the keyboard can be a modified keyboard, in which the keys are modified relative to a standard "QWERTY" keyboard such that each key corresponds to specific combination of nucleotides.
- the modified keyboard is used as a "one-time pad".
- a "one-time pad” refers to a device for the encryption of information, wherein each character of a plaintext (e.g., information) is encrypted by combining it with the corresponding bit or character of a single-use, random, secret pad or key (e.g. , a modified keyboard) using modular addition.
- the keyboard disclosed herein is a physical keyboard comprising a set of keys, wherein each key is associated with a particular codon.
- the modified keyboard comprises homopolymer codons.
- the keyboard comprises homopolymer codons located on functional keys.
- homopolymer codons are associated only with functional keys.
- a "functional key" refers to a key that does not translate a letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages.
- the keyboard is a virtual keyboard comprising a set of keys, wherein each key is associated with a particular codon.
- a "virtual keyboard” is a keyboard appearing on a computer screen, the keys of which may be activated by a user clicking a mouse or contacting a touch screen.
- the instant disclosure relates to a method of producing an individualized keyboard for the conversion of plaintext into nucleic acid encodable language, the method comprising: (a) producing a library of codons; (b) assigning each member of the library to a different symbol; and, (c) arranging the symbols into an array, thereby producing an individualized keyboard.
- the codons of the library are three nucleotide bases in length, such as those depicted in Figure 1A.
- the codons of the library are greater than three nucleotide bases in length. In some embodiments, the codons of the library are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 1 1 , or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons of the library are of mixed lengths. In some embodiments, the symbol is selected from the group consisting of letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages.
- nucleic acid refers to a DNA or RNA molecule.
- Nucleic acids are polymeric macromolecules comprising a plurality of nucleotides.
- the nucleotides are deoxyribonucleotides or ribonucleotides.
- the nucleotides comprising the nucleic acid are selected from the group consisting of adenine, guanine, cytosine, thymine, uracil and inosine.
- the nucleotides comprising the nucleic acid are modified nucleotides. Methods of modifying nucleotides are generally known in the art.
- nucleotide modifications include phosphorothioate backbone modifications, 2'-0-mefhyl group sugar modifications and the substitution of non-naturally occurring nucleotide bases (for example, nucleotides derivatized at the 5-, 6-, 7- or 8-position).
- nucleotide modification is fusion of DNA terminal ends with at least one protein.
- nucleic acids of the instant disclosure are natural.
- natural nucleic acids include genomic DNA, and plasmid DNA.
- the nucleic acids of the instant disclosure are synthetic.
- nucleic acid refers to a nucleic acid molecule that is constructed via the joining nucleotides by a synthetic or non-natural method.
- a synthetic method is solid-phase oligonucleotide synthesis.
- the nucleic acids of the instant disclosure are isolated.
- nucleic acid sequence may be measured as a quantum.
- quantum of information refers to a pre-determined amount of information that is expressed in the appropriate unit. Non-limiting examples of appropriate units include characters, letters, words, phrases, sentences, numbers and symbols.
- nucleic acid sequence that comprises translated information is referred to herein as "nucleic acid message sequence”.
- information may be translated into nucleic acid sequence using codons.
- codon refers to a group of consecutive nucleotides that form a single unit of genetic code.
- Naturally-occurring codons are three nucleotides in length and represent the 20 common amino acids used to build proteins.
- the codons used to translate information into DNA sequence are naturally- occurring codons that comprise three nucleotides.
- the codons used to translate information into DNA sequence are greater than 3 nucleotides in length.
- the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length.
- the codons are of mixed lengths. Also contemplated herein is the use of homopolymer codons. The term
- homopolymer describes a codon consisting essentially of a homogenous population of nucleotides.
- homopolymer codons may be represented by the formulae including but not limited to [A] n ,[C] n , [G] n , [T] n , [U] n and [I] n , wherein n is an integer representing the length of the codon.
- Further non-limiting examples of homopolymer codons include AAA, GGG, CCC, TTT, GGG, UUU, III, AAAA, GGGG, TTTT, CCCC, UUUU, and IIII.
- the modified keyboards disclosed herein comprises homopolymer codons.
- the homopolymer codons are located on the functional keys of a modified keyboard.
- the instant disclosure relates to methods of secure communication of information by translation of said information into nucleic acid sequence.
- the nucleic acid sequence is natural or naturally-occurring. In some embodiments, the nucleic acid sequence is natural or naturally-occurring.
- the nucleic acid sequence is synthetic or synthesized. In order to further obscure the identity of translated information, the translated information may be camouflaged within larger fragments of natural genomic or plasmid nucleic acid sequence, or variable nucleic acid sequence, to produce an encrypted nucleic acid molecule.
- the synthesized nucleic acid molecules comprise nucleic acid message sequence and at least one contiguous stretch of randomized variable nucleic acid sequence. In some embodiments, the synthesized nucleic acid molecules comprise nucleic acid message sequence and no randomized variable nucleic acid sequence. As used herein "variable” refers to randomized nucleic acid sequence that does not comprise nucleic acid message sequence.
- variable DNA sequence camouflages information translated into nucleic acid sequence by disrupting the fidelity of base calling during nucleic acid sequencing.
- the variable nucleic acid sequence of the instant disclosure comprises one or more homopolymer codons.
- the presence of homopolymer codons in variable nucleic acid sequence causes an intentional misalignment of nucleic acid sequences during sequence analysis. Such misalignment may be useful in disguising the location of the encrypted information.
- the instant disclosure relates to methods of extracting a quantum of encrypted information from a one or more of nucleic acid molecules.
- the encrypted information is extracted by nucleic acid sequencing.
- the nucleic acid sequencing is co-sequencing.
- the co-sequencing is DNA co- sequencing.
- the DNA co-sequencing is performed by Sanger sequencing.
- Other non-limiting methods of DNA co-sequencing include Maxam-Gilbert sequencing, bridge PCR, nanopore sequencing and Next Generation Sequencing (e.g. , Single- molecule real-time sequencing, Ion Torrent sequencing, pyrosequencing, Illumina sequencing, sequencing by ligation (SOLiD)).
- the plurality of nucleic acid molecules are sequenced with at least one common primer.
- the plurality of nucleic acid molecules are sequenced with 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 common primers.
- the method further comprises co-sequencing the set of nucleic acid molecules using one or more common primers to produce a chromatogram.
- chromatogram refers to a visual representation of a DNA sample produced by a sequencing machine. Chromatograms depict a sequence of nucleic acid base calls as a series of peaks along a histogram.
- the method described herein further comprises identifying information translated into nucleic acid sequence corresponding to areas of high intensity peaks on the chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of low intensity peaks on the chromatogram. In some embodiments, nucleic acid sequencing produces no chromatogram pattern. In some
- the method further comprises identifying nucleic acid sequence using sequence alignments generated by bioinformatics software. In some embodiments, the method further comprises extracting the information contained within a single nucleic acid molecule or the set of nucleic acid molecules by using the modified keyboard to translate the nucleic acid sequence from the at least one nucleic acid molecule.
- the nucleic acid sequences and molecules described herein are in silico.
- the term "in silico” refers to nucleic acid sequences or molecules produced by means of computer modeling or computer simulation. Without being bound by any particular theory, the instant disclosure contemplates the utility of in silico nucleic acid sequences and molecules for the nucleic acid encryption methods described herein.
- in silico nucleic acid molecules or sequences may be encrypted using the methods described herein.
- encrypted in silico nucleic acid molecules or sequences are useful for the archiving and protection of digital data.
- VWR Start DNA Polymerase
- Figure 1 1A To illustrate, if Alice sends a message (m) to Bob, she would first write— encode and synthesize— the information in DNA molecules and send it to Bob who would then read— sequence and decode— the message (m). However, during the transfer of m between Alice and Bob, Eve could intercept the communication and read m. To protect m, DNA-specific cryptography and steganography methods may be implemented, however many of these methods are experimentally unproven and do not make accommodations for challenges in DNA synthesis and sequencing, such as minimizing homopolymeric stretches.
- FIG. 1 IB Here a new framework for the facile and secure communication of short messages in DNA is presented (Figure 1 IB).
- an encryption key (k)— that functions as a one-time pad— and decoys (d), where k is required to decode the message (m) and a combination key is required to discern m from d was implemented.
- a secret- sharing system was established, where m can be dispersed throughout a mixture of different DNA molecules, requiring Eve to physically intercept and interrogate multiple separate data transmission lines to gain access to m.
- chromatogram patterning a method that allows the bypassing of sequence alignments and instead permits information to be extracted from multiple DNA molecules in a single sequencing reaction was developed.
- iKey individualized keyboard
- MoSE secret- sharing Multiplexed Sequence Encryption
- the natural genetic code employs three-letter DNA words (codons) to represent the 20 common amino acids used to build proteins.
- These 64 codons were mapped onto a modified QWERTY keyboard to produce a personalized platform - iKey-64 - for translating text on to DNA (Figure 1A).
- the codons in iKey-64 can be randomized to produce a unique iKey for every message to provide additional security for communications, akin to a one-time pad 11 .
- Any specific version of iKey-64 can itself be encoded in DNA and provided as an additional component of a communication, where it can serve as a unique dictionary for each message ( Figures 1B-1C).
- the homopolymer codons AAA, CCC, GGG, and TTT are assigned to four function keys, ensuring that in normal text no homopolymer longer than four bases is possible. Even letter combinations yielding four identical bases (such as GTT-TTC representing V-K on the keyboard) are kept quite rare. Therefore, the codon assignment of iKey-64 was based on the frequency of use of letters in the English language 18 to minimize the occurrence of homopolymers and achieve chromatogram patterning.
- buttons of this embodiment of the iKey-64 were separated in to 3 categories based on the frequency of use as judged by qualitative measures.
- Category 1 is for the most frequently used buttons and is encoded by codons that contain three different nucleotides.
- Category 2 is for less frequently used buttons and is encoded by codons that contain the same nucleotide in the first and third position.
- Category 3 is for the least frequently used buttons and is encoded by codons that contain two or more homopolymers. Since iKey-64 is similar in design to a one-time pad, many possible versions exist and the last column provides the number of potential permutations that exist for randomly shuffling the codons between the buttons. The frequency of letters in the English alphabet were based on Table 2. If
- buttons in iKey-64 can be randomly shuffled for transcription of plaintext on to DNA.
- MuSE can be tuned to embed data in chromatograms discreetly so that sequence alignments derived from chromatograms cannot be used to identify embedded information. Adjusting the ratio of DNA- l/DNA-2 allows the degree of contrast achieved in the
- MuSE can be used to disseminate information across many DNA strands, where multiplexed sequencing of different strand combinations will provide different readouts (Figure 13).
- watermarks, a key, a cipher, and a decoy message were encoded across six strands in a 525 bp region of DNA to recreate a World War II communication made during the establishment of Bletchley Park ( Figure 6A and Figure 14) 19 .
- the functions of the elements are: (i) watermarks - an identification tag for each strand, (ii) key
- next- generation sequencing might also be attempted for extracting messages.
- NGS next- generation sequencing
- a purified mixture of DNA samples nl+n2+n3+n4+n5+n6 was prepared and submitted for NGS analysis to an outside party under blind experimental conditions, with a request to provide the assembled contents of the sample ( Figure 16A-16B). While sequencing of the mixture produced ⁇ 2 million reads, the blind assembly of the reads to reconstruct the contents proved difficult and inconclusive (Table 4). However, after the initial analysis the outside party was informed that there were 6 plasmids in the sample, each containing 525 bp messages as inserts.
- nl 2,346 bp/47.4% GC
- n2 2,346 bp/47.3% GC
- n3 2,346 bp/47.5% GC
- n4 2,346 bp/47.6% GC
- n5 2,346 bp/47.4% GC
- n6 2,346 bp/47.3% GC.
- Table 5 Identified sequences from NGS analysis.
- iKey-64 data encoded using iKey-64 would still not be truly random due to the frequency of use for each button, but additional measures may be implemented to increase security: (i) Cryptography - plaintext information may first be subject to advanced cryptographic algorithms, (ii) Linguistics - principles of linguistics may be applied to the layout of iKeys to modify alphabets for DNA communication, introduce new grammar rules or create iKeys in different languages, and (iii) Codons - increasing the number of nucleotides per codon can introduce redundancies in the buttons to adjust for character usage frequency. To illustrate, four nucleotides codons can be used to create a 256 button keyboards such as iKey-256 ( Figure 10).
- buttons for E When the number of buttons for each letter is adjusted to reflect its frequency in English text, then the probability of using a button for E would equal Q. Similar redundancies may also be introduced for buttons representing numerals, grammar, and other user-defined functions. For instance, the frequency of numerals may be adjusted according to Benford' s Law 20.
- codons can be used to represent words or phrases in addition to characters. It is estimated that the vocabulary of an educated native English speaking adult consists of -17,000 lemmas, while only 10 lemmas constitute 25% of the words used in English 21 ' 22 . Using 8-nucleotide codons could generate iKeys with 65,536 buttons, sufficient to include all of the commonly used words in English as well as accommodate individual letters, numerals, grammatical characters, functional characters, and high frequency words.
- the iKey platform may be designed to incorporate the entire English language.
- the Oxford English Dictionary (OED) the most comprehensive record of the English language, contains 291,500 entries and a total of 615,100 word forms 23.
- OED Oxford English Dictionary
- To encode all of the entries of the OED on an iKey would require 10-nucleotide codons to generate a 1,048,576 button keyboard.
- the dictionary is composed of 59 million words containing 350 million characters resulting in 5.9 characters/word. This would require 18 nucleotides to encode with an iKey-64 but only 10 nucleotides for an iKey- 1,048,576, representing a 44% reduction in DNA requirements.
Landscapes
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Computer Security & Cryptography (AREA)
- Computer Networks & Wireless Communication (AREA)
- Signal Processing (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Theoretical Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
In some aspects, the instant disclosure relates to the multiplexed encryption of information on nucleic acid molecules. In some aspects, the instant disclosure relates to a method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising (a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence; (b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and, (c) obtaining an at least one nucleic acid molecule, each molecule comprising: (i) the complete or a portion of the nucleic acid message sequence, and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information.
Description
DNA ENCRYPTION TECHNOLOGIES
RELATED APPLICATIONS
This application claims the benefit of U.S. provisional application serial number USSN 62/069,994, filed on October 29, 2014, and entitled "DNA Encryption Technologies", the entire content of which is incorporated herein by reference.
FEDERALLY SPONSORED RESEARCH
This invention was made with government support under Contract No. N66001-12-C- 4016 awarded by the Space and Naval Warfare Systems Center. The government has certain rights in the invention.
BACKGROUND OF INVENTION
As the costs and time constraints of DNA synthesis and sequencing are rapidly declining, DNA is emerging as a viable medium for information storage. Previously, DNA has been used for hiding messages and storing large texts, however these methods require advanced
laboratories with trained scientists to extract information. Simpler writing and reading methods are required for DNA communication to become more adopted.
SUMMARY OF INVENTION
In some aspects, the instant disclosure relates to a method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising (a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence; (b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and, (c) obtaining an at least one nucleic acid molecule, each molecule comprising: (i) the complete or a portion of the nucleic acid message sequence, and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information. In some embodiments, the nucleic acid molecules are naturally-occurring. In some embodiments, the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the sequences of the nucleic acids are naturally-occurring. In some embodiments, the sequences of the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the
modified keyboard comprises codons. In some embodiments, the codons are designed to normalize frequency of character usage.
In some aspects, the instant disclosure relates to a method of secure communication of information contained on a single nucleic acid molecule, the method comprising (a) obtaining a nucleic acid molecule of known sequence; (b) obtaining a modified keyboard comprising a personalized platform for translating nucleic acid sequence into text; and, (b) generating a quantum of information translated from the nucleic acid sequence using the modified keyboard of (a). In some embodiments, the modified keyboard comprises codons. In some embodiments, the codons are designed to normalize frequency of character usage.
In some embodiments, the method further comprises co-sequencing the set of nucleic acid molecules using one or more common primers. In some embodiments, the co-sequencing produces patterns in a chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of high intensity peaks on the chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of low intensity peaks on the chromatogram. In some embodiments, co-sequencing produces no chromatogram pattern. In some embodiments, the method further comprises identifying nucleic acid sequence using sequence alignments generated by bioinformatics software. In some embodiments, the method further comprises extracting the quantum of information contained within the set of nucleic acid molecules by using the modified keyboard to translate the nucleic acid sequence from the one or more nucleic acid molecules.
In some embodiments, the modified keyboard comprises homopolymer codons. In some embodiments, the keyboard comprises homopolymer codons located on functional keys. In some embodiments, the codons are greater than 3 nucleotides in length. In some embodiments, the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons are of mixed lengths. In some embodiments, the variable nucleic acid sequence comprises contiguous homopolymer codons.
In some embodiments, the instant disclosure relates to methods of extracting a quantum of encrypted information from a plurality of nucleic acid molecules. In some embodiments, the encrypted information is extracted by nucleic acid sequencing. In some embodiments, the nucleic acid sequencing is co-sequencing. In some embodiments, the co-sequencing is DNA co-
sequencing. In some embodiments, the DNA co-sequencing is performed by Sanger
sequencing. In some embodiments, the plurality of nucleic acid molecules are sequenced with at least one common primer. In some embodiments, data produced from nucleic acid sequencing is analyzed by sequence alignment. In certain embodiments, the nucleic acid molecule(s) are in silico.
In some aspects, the instant disclosure relates to a method of producing an individualized keyboard for the conversion of plaintext into nucleic acid encodable language, the method comprising: (a) producing a library of codons; (b) assigning each member of the library to a different symbol; and, (c) arranging the symbols into an array, thereby producing an
individualized keyboard. In some embodiments, the codons of the library are greater than three nucleotide bases in length. In some embodiments, the codons of the library are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons of the library are of mixed lengths. In some embodiments, the symbol is selected from the group consisting of letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages.
BRIEF DESCRIPTION OF DRAWINGS
Figures 1A-1C depict one embodiment of the iKey platform. Figure 1A depicts a graphical representation of one embodiment of an iKey-64, used to convert plaintext to codons for DNA transcription. Messages begin with 'start', finish with 'end', 'forward' and 'reverse' provide information on the strand containing the desired message, and 'spacel' and 'space2' can be used to produce troughs in chromatograms. Codons can be randomized to produce one-time iKeys. Figure IB shows that in this embodiment, iKey-64 buttons and codons were numbered to transcribe the keyboard on to a single strand of DNA (SEQ ID NO: 24). Figure 1C depicts this embodiment of iKey-64 transcribed on DNA (SEQ ID NO: 1). Codons were flanked by 10 Ts (SEQ ID NO: 1) to separate the start and end of the keyboard from surrounding DNA for identification. Figures 2A-2E depict chromatogram patterning with Multiplexed Sequence Encryption (MuSE). Figure 2A depicts a schematic for chromatogram patterning. When two DNA strands are co-
sequenced, different overlapping nucleotides produce small peaks while identical ones produce large peaks. Peaks are kept in alignment via iKey-64. In Figure 2A, SEQ ID NOs: 48 through 50 appear from top to bottom, respectively. Figure 2B depicts a schematic demonstrating
'Massachusetts Institute Technology' being patterned with MuSE and iKey-64. Figure 2C depicts the sequence of 'Massachusetts Institute Technology used in Figure 2B. In Figure 2C, SEQ ID NOs: 51 and 52 appear from top to bottom, respectively. Figure 2D shows DNA-1+2 are co-sequenced at equal concentrations with a common primer (arrows), chromatogram patterning is achieved during reverse (PrimerExtemaiRv) but not forward (PrimerExtemaiFw) sequencing due to the flanking variable DNA regions. Figure 2E shows that chromatogram patterning can be tuned by varying the ratios of DNA- 1 (light shading) and DNA-2 (dark shading).
Figures 3 A-C show that chromatogram patterning requires the alignment of base calls to be maintained during co-sequencing of DNA strands. Figure 3A shows a close-up of the chromatograms for forward; the consensus sequence listed below the alignment is represented by SEQ ID NO: 25. Figure 3B shows a close-up of the chromatograms for reverse sequencing of DNA-1+2 encoding the MIT cipher shown in Figure 2D; the consensus sequence listed below the alignment is represented by SEQ ID NO: 26. Samples were co-sequenced at equal concentrations and the arrow depicts the sequencing primer. Figure 3C shows the sequence of upstream (SEQ ID NOs: 14-15) and downstream (SEQ ID NOs: 16-17) variable DNA regions from Figure 2B.
Figure 4 shows that MuSE can be tuned to discreetly encode messages in a mixed DNA population. By varying the ratios of DNA- 1 (light shading) and DNA-2 (dark shading), the degree of chromatogram patterning can be tuned (Figure 2E). When one partner is present at a lower concentration chromatogram patterning is still achieved, however the resulting chromatogram would align perfectly with the more concentrated partner. Therefore, messages may be discreetly encoded between multiple DNA strands and revealed in chromatograms, but not identified by sequence alignments. Left: alignment of chromatograms from Figure 2E with DNA-1. Right: alignment of chromatograms from Figure 2E with DNA-2.
Figure 5 shows discreetly embedded messages in chromatograms. A close-up of chromatogram patterns formed with MuSE tuning (Figure 2E). Message encoding regions (shaded box) contain single peaks while variable DNA regions (unshaded box) contain two overlapping peaks whose heights can be adjusted by varying the ratios of DNA-1 (SEQ ID NO: 2) and DNA-2 (SEQ ID NO: 3). The portions of DNA- 1 and DNA-2 that are shown in the alignment are represented by SEQ ID NO: 53 and SEQ ID NO: 54.
Figures 6A-6B show a combinatorial cipher depicting a WWII communication. Figure 6A shows that one embodiment of iKey-64 was used to transcribe watermarks, a key, a cipher, and a decoy message between 6 DNA strands. If the strands are sequenced according to the key
(Pascal's triangle on left) with the appropriate primers, then the correct communication would be revealed. Figure 6B shows the chromatograms of an nl x n6 matrix of strands tuned and co- sequenced with Primercipher- Chromatogram patterning is not achieved when incorrect pairs are co-sequenced.
Figure 7 shows combinatorial cipher readouts from the WWII communication of Figures 6A-6B. Tuning and co-sequencing of multiple DNA strands reveals a variety of messages depending on the primers used and the order of strands co-sequenced. Figure 8 shows that the combinatorial cipher of Figures 6A-6B does not produce chromatogram patterning if non-specific primers are used for co- sequencing. Co-sequencing of cipher and decoy message containing pairs at equal concentrations with non-specific primers that are common to all strands (PrimerExtem iFw Rv) that bind outside of the information containing 525-bp region (Figure 6A) does not produce chromatogram patterning.
Figures 9A-9G show an examination of the peaks produced during co-sequencing of the combinatorial WWII cipher of Figures 6A-6B. Figure 9A shows DNA sequencing information (SEQ ID NOs: 27-29) and close-up chromatogram for the Key. Figures 9B-9D show DNA sequencing information (SEQ ID NOs: 30-38) and close-up chromatogram for the Cipher.
Figures 9E-9G show DNA sequencing information (SEQ ID NOs: 39-47) and close-up chromatogram for the Decoy message.
Figure 10 shows a 256 button iKey for introducing redundancies for transcribing plaintext in to a DNA encodable format. This is a theoretical design for an iKey-256 based on a four-nucleotide codon. While it is not designed to produce chromatogram patterning, iKey-256 would introduce redundancies in the transcription of plaintext on to DNA by equaling the frequencies of buttons for the letters used in English (Table 2). Increased number of 'start' , 'end' , 'shift', and 'space' buttons were implemented to reduce the overuse of any individual codon. To highlight the start and end of any message from the surrounding DNA, all 5 'start' and 'end' codons may be used together to identify messages written within even a genome. Furthermore, a T button was introduced to replace all punctuation characters as offline communication by DNA need not abide by grammatical rules.
Figures 1 1 A- 1 IB show DNA-based communication. Figure 11 A provides an example of NDA communication in which for Alice to send a message (m) to Bob, she must first write the data into DNA and then physically send the DNA to Bob, who can read the DNA and extract the data. Eve, who is eavesdropping, can physically intercept and read m, making the
communication channel unsecure. Three areas that can improve communication between Alice and Bob include data encoding, data transfer, and data extraction. Figure 1 IB provides an example of improved DNA communication. Data encoding: m can be mixed with decoy (d) data and fragmented, then written into DNA with one-time pad encryption, where the key (k) can itself be written in DNA. Data transfer: DNA encoded k and fragmented m+d components can be transmitted between Alice and Bob using multiple different channels based on a secret- sharing system. Interception of an incomplete set of DNA communications by Eve will not provide the data in m. Data extraction: chromatogram patterning can be used by Bob to rapidly extract data via multiplexed sequencing reactions.
Figures 12A- 12C show naive co-sequencing of multiple DNA strands. Figure 12A shows DNA- 1 (top), nl (second from top), and iKey-64 (third from top) strands have different sequences but they all share a common upstream region and sequencing primer (PrimerExtemai w)- Individual sequencing of each strand produces high quality reads, but the resulting reads are of poor quality when two (e.g. , DNA- 1 and nl) or three (e.g. , DNA- 1, nl , and iKey64) strands are co- sequenced. Figure 1 IB depicts a close-up of the chromatogram of DNA- 1 (SEQ ID NO: 2) and
nl (SEQ ID NO: 4) co-sequencing. Figure 11C depicts a close-up of the chromatogram of DNA-1, nl, and iKey64 co-sequencing (SEQ ID NOs: 2, 4 and 1, respectively).
Figure 13 shows an example of a workflow of extracting the correct message from a DNA communication that incorporates the iKey, MuSE, and chromatogram patterning techniques. Workflow steps 1, 2, and 3 can be viewed in detail in Figures 6A-6B and Figure 14. Data containing strands are pooled and sequenced with PrimerKey to reveal the combination key. Deciphering and unlocking of the combination key will reveal the correct strand pairs to analyze with PrimerMessage to reveal the message. Analysis of incorrect strand pairs will reveal a decoy communication.
Figure 14 shows an example of a combinatorial message depicting a WWII communication. iKey-64 (Encryption Key) was used to write watermarks, a key, a message, and a decoy between six DNA strands (Secret-Sharing System). If strands are sequenced according to the
Combination Key— obtained from Pascal's triangle— with the appropriate primers, then the correct communication is revealed.
Figure 15 shows an example of DNA camouflage. The 525 bp information-encoding regions of DNA were flipped between the forward and reverse strands to provide a camouflage effect against sequencing with random primer (PrimerExternaiFw/Rv)- While the external DNA regions surrounding the information containing regions were identical, strands nl/n3/n5 were encoded in the forward direction and strands n2/n4/n6 in the reverse direction, with watermarks used for orientation.
Figures 16A-16C show an example of next-generation sequencing of a communication disseminated across six DNA strands. Figure 16A shows plasmids containing nl, n2, n3, n4, n5, and n6 sequences (Figure 15) were grown and purified in dH20, mixed at equal concentrations of 30 ng/pL, and submitted to an outside party for NGS sequencing and assembly under blind experimental conditions. Figure 15B shows 300 ng of plasmids containing nl, n2, n3, n4, n5, and n6 sequences run on a 1% agarose gel to demonstrate purity. Figure 16C shows the outside party was provided with the number of plasmids, vector sequences, and the size of messages inserted into the vectors and asked to assemble the messages encoded in the plasmids. They
assembled 6 sequences (Table 5) that represent the messages nl, n2, n3, n4, n5, and n6. Here the alignment of the 6 assembled sequences with nl, n2, n3, n4, n5, and n6 are shown. Shown below the alignment is a legend for the color-coding of the templates. Boxes highlight assembled sequences with near perfect alignment to corresponding templates.
DETAILED DESCRIPTION OF INVENTION
In some embodiments, methods are provided herein for the storage, transfer and retrieval of encrypted information within at least one nucleic acid molecule In some aspects, the instant disclosure relates to a method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising (a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence; (b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and, (c) obtaining at least one nucleic acid molecule, each molecule comprising: (i) the complete or a portion of the nucleic acid message sequence, and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information. In some embodiments, the nucleic acid molecules are naturally-occurring. In some embodiments, the nucleic acid molecules are synthesized or non-naturally occurring. In some embodiments, the sequences of the nucleic acids are naturally-occurring. In some embodiments, the sequences of the nucleic acid molecules are synthesized or non-naturally occurring.
In some aspects, the instant disclosure relates to a method of secure communication of information contained on a single nucleic acid molecule, the method comprising (a) obtaining a nucleic acid molecule of known sequence; (b) obtaining a modified keyboard comprising a personalized platform for translating nucleic acid sequence into text; and, (b) generating a quantum of information translated from the nucleic acid sequence using the modified keyboard of (a).
In certain aspects, the instant disclosure relates to the use of a keyboard to encrypt text information into nucleic acid sequence. For example, the keyboard can be a modified keyboard, in which the keys are modified relative to a standard "QWERTY" keyboard such that each key
corresponds to specific combination of nucleotides. In some embodiments, the modified keyboard is used as a "one-time pad". As used herein, a "one-time pad" refers to a device for the encryption of information, wherein each character of a plaintext (e.g., information) is encrypted by combining it with the corresponding bit or character of a single-use, random, secret pad or key (e.g. , a modified keyboard) using modular addition. In some embodiments, the keyboard disclosed herein is a physical keyboard comprising a set of keys, wherein each key is associated with a particular codon. In some embodiments, the modified keyboard comprises homopolymer codons. In some embodiments, the keyboard comprises homopolymer codons located on functional keys. In some embodiments, homopolymer codons are associated only with functional keys. As used herein, a "functional key" refers to a key that does not translate a letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages. In some embodiments, the keyboard is a virtual keyboard comprising a set of keys, wherein each key is associated with a particular codon. As used herein, a "virtual keyboard" is a keyboard appearing on a computer screen, the keys of which may be activated by a user clicking a mouse or contacting a touch screen. In some aspects, the instant disclosure relates to a method of producing an individualized keyboard for the conversion of plaintext into nucleic acid encodable language, the method comprising: (a) producing a library of codons; (b) assigning each member of the library to a different symbol; and, (c) arranging the symbols into an array, thereby producing an individualized keyboard. In some embodiments, the codons of the library are three nucleotide bases in length, such as those depicted in Figure 1A. In some embodiments, the codons of the library are greater than three nucleotide bases in length. In some embodiments, the codons of the library are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 1 1 , or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons of the library are of mixed lengths. In some embodiments, the symbol is selected from the group consisting of letter, number, word, punctuation mark or pictogram, logogram and/or any other relevant references to linguistic principles of different languages.
As used herein "nucleic acid" refers to a DNA or RNA molecule. Nucleic acids are polymeric macromolecules comprising a plurality of nucleotides. In some embodiments, the nucleotides are deoxyribonucleotides or ribonucleotides. In some embodiments, the nucleotides comprising the nucleic acid are selected from the group consisting of adenine, guanine, cytosine, thymine, uracil and inosine. In some embodiments, the nucleotides comprising the nucleic acid
are modified nucleotides. Methods of modifying nucleotides are generally known in the art. Non-limiting examples of nucleotide modifications include phosphorothioate backbone modifications, 2'-0-mefhyl group sugar modifications and the substitution of non-naturally occurring nucleotide bases (for example, nucleotides derivatized at the 5-, 6-, 7- or 8-position). In some embodiments, the nucleotide modification is fusion of DNA terminal ends with at least one protein. In some embodiments, the nucleic acids of the instant disclosure are natural. Non- limiting examples of natural nucleic acids include genomic DNA, and plasmid DNA. In some embodiments, the nucleic acids of the instant disclosure are synthetic. As used herein, the term "synthetic nucleic acid" refers to a nucleic acid molecule that is constructed via the joining nucleotides by a synthetic or non-natural method. One non-limiting example of a synthetic method is solid-phase oligonucleotide synthesis. In some embodiments, the nucleic acids of the instant disclosure are isolated.
Aspects of the instant disclosure relate to the translation of information into nucleic acid sequence. In some embodiments, the amount of information to be translated into nucleic acid sequence may be measured as a quantum. As used herein, a "quantum of information" refers to a pre-determined amount of information that is expressed in the appropriate unit. Non-limiting examples of appropriate units include characters, letters, words, phrases, sentences, numbers and symbols. In some embodiments, nucleic acid sequence that comprises translated information is referred to herein as "nucleic acid message sequence". In some embodiments, information may be translated into nucleic acid sequence using codons. As used herein, "codon" refers to a group of consecutive nucleotides that form a single unit of genetic code. Naturally-occurring codons are three nucleotides in length and represent the 20 common amino acids used to build proteins. In some embodiments, the codons used to translate information into DNA sequence are naturally- occurring codons that comprise three nucleotides. In some embodiments, the codons used to translate information into DNA sequence are greater than 3 nucleotides in length. In some embodiments, the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length. In some embodiments, the codons are of mixed lengths. Also contemplated herein is the use of homopolymer codons. The term
"homopolymer" describes a codon consisting essentially of a homogenous population of nucleotides. In some embodiments, homopolymer codons may be represented by the formulae including but not limited to [A]n,[C]n, [G]n, [T]n, [U]n and [I]n, wherein n is an integer representing the length of the codon. Further non-limiting examples of homopolymer codons
include AAA, GGG, CCC, TTT, GGG, UUU, III, AAAA, GGGG, TTTT, CCCC, UUUU, and IIII. In some embodiments, the modified keyboards disclosed herein comprises homopolymer codons. In some embodiments, the homopolymer codons are located on the functional keys of a modified keyboard.
In some aspects, the instant disclosure relates to methods of secure communication of information by translation of said information into nucleic acid sequence. In some
embodiments, the nucleic acid sequence is natural or naturally-occurring. In some
embodiments, the nucleic acid sequence is synthetic or synthesized. In order to further obscure the identity of translated information, the translated information may be camouflaged within larger fragments of natural genomic or plasmid nucleic acid sequence, or variable nucleic acid sequence, to produce an encrypted nucleic acid molecule. In some embodiments, the synthesized nucleic acid molecules comprise nucleic acid message sequence and at least one contiguous stretch of randomized variable nucleic acid sequence. In some embodiments, the synthesized nucleic acid molecules comprise nucleic acid message sequence and no randomized variable nucleic acid sequence. As used herein "variable" refers to randomized nucleic acid sequence that does not comprise nucleic acid message sequence. In some embodiments, variable DNA sequence camouflages information translated into nucleic acid sequence by disrupting the fidelity of base calling during nucleic acid sequencing. In some embodiments, the variable nucleic acid sequence of the instant disclosure comprises one or more homopolymer codons. In some aspects, the presence of homopolymer codons in variable nucleic acid sequence causes an intentional misalignment of nucleic acid sequences during sequence analysis. Such misalignment may be useful in disguising the location of the encrypted information.
In some embodiments, the instant disclosure relates to methods of extracting a quantum of encrypted information from a one or more of nucleic acid molecules. In some embodiments, the encrypted information is extracted by nucleic acid sequencing. In some embodiments, the nucleic acid sequencing is co-sequencing. In some embodiments, the co-sequencing is DNA co- sequencing. In some embodiments, the DNA co-sequencing is performed by Sanger sequencing. Other non-limiting methods of DNA co-sequencing include Maxam-Gilbert sequencing, bridge PCR, nanopore sequencing and Next Generation Sequencing (e.g. , Single- molecule real-time sequencing, Ion Torrent sequencing, pyrosequencing, Illumina sequencing, sequencing by ligation (SOLiD)). In some embodiments, the plurality of nucleic acid molecules
are sequenced with at least one common primer. In some embodiments, the plurality of nucleic acid molecules are sequenced with 2, or 3, or 4, or 5, or 6, or 7, or 8, or 9, or 10 common primers.
In some embodiments, the method further comprises co-sequencing the set of nucleic acid molecules using one or more common primers to produce a chromatogram. A
"chromatogram" refers to a visual representation of a DNA sample produced by a sequencing machine. Chromatograms depict a sequence of nucleic acid base calls as a series of peaks along a histogram. In some embodiments, the method described herein further comprises identifying information translated into nucleic acid sequence corresponding to areas of high intensity peaks on the chromatogram. In some embodiments, the method further comprises identifying nucleic acid sequence corresponding to areas of low intensity peaks on the chromatogram. In some embodiments, nucleic acid sequencing produces no chromatogram pattern. In some
embodiments, the method further comprises identifying nucleic acid sequence using sequence alignments generated by bioinformatics software. In some embodiments, the method further comprises extracting the information contained within a single nucleic acid molecule or the set of nucleic acid molecules by using the modified keyboard to translate the nucleic acid sequence from the at least one nucleic acid molecule.
In some embodiments, the nucleic acid sequences and molecules described herein are in silico. As used herein, the term "in silico" refers to nucleic acid sequences or molecules produced by means of computer modeling or computer simulation. Without being bound by any particular theory, the instant disclosure contemplates the utility of in silico nucleic acid sequences and molecules for the nucleic acid encryption methods described herein. In some embodiments, in silico nucleic acid molecules or sequences may be encrypted using the methods described herein. In some embodiments, encrypted in silico nucleic acid molecules or sequences are useful for the archiving and protection of digital data.
EXAMPLES
Example 1 : Materials and Methods
Plasmids
Constructs were cloned using standard molecular biology techniques, where KOD Hot
Start DNA Polymerase (VWR) was used for all PCRs with primers from IDT. Synthetic DNA sequences were purchased as gBlocks from IDT (Table 1) and assembled with PCR amplified
pl5A origin and chloramphenicol resistance gene fusions using Gibson assembly with 25 bp
24
sequence overlaps, either with a commercial kit (NEB) or homemade mixture , and transformed in to E. coli DH5aPRO (F" cp80/acZAM15 A(/acZYA-argF)U169 deoR recAX endAX hsdRll(rk~, mk+) phoA supEA thi- 1 gyr A96 relA\ λ", PN25/tetR, Placiq/lacl, Spr). Random DNA sequences were generated at http://www.bioinformatics.org/sms2/random_dna.html. All constructs were sequence verified by Genewiz Inc. (Cambridge, MA).
Sequencing
All constructs (Table 1) were purified using Qiagen kits and stored in cell culture grade water (Cellgro). Constructs were diluted to a final concentration of 30 ng/μί and sent for sequencing at indicated concentrations. PrimerExtemaiFw (GACATTAACCTATAAAAATAGGC) (SEQ ID NO: 10), PrimerExtemaiRv (GCATCTTCCAGGAAATCTC) (SEQ ID NO: 11), PrimerKey (TAATACGACTCACTATAGGG) (SEQ ID NO: 12), and PrimerCipher
(GCTAGTTATTGCTCAGCGG) (SEQ ID NO: 13) were used for all sequencing reactions as indicated. Sequencing reactions were all performed by Genewiz Inc. (Cambridge, MA) under 'Difficult Template' settings to ensure stringent sequencing conditions were employed. All sequencing reactions were performed in triplicate. Genewiz Inc. was not consulted prior, during, or after this study and all Sager sequencing reactions were performed under blind conditions by Genewiz Inc. to ensure bias was not introduced in the results. Geneious Pro 5.5.8 was used to analyze chromatograms, perform ClustalW alignments, and produce figures.
Table 1: DNA Constructs
Co struct Se uence Seq !D HQ: iKey-64 pBZ38 1
DMA1 pBZ27 2
DMA2 pBZ28 3
4 n1 pBZ2S n2 pBZ30 5 n3 pBZ31 6 n4 pBZ32 7 n5 pBZ33 8 n6 pBZ37
Example 2: Secure Offline Communication via DNA Linguistics
Introduction
The Internet has revolutionized communication with its great speed and volume but remains vulnerable to security breaches. For certain applications where security supersedes speed, the offline transfer of data remains vital. Moving beyond pen and paper, DNA is increasing being used as a medium for information storage and communication1"6, and DNA cryptography and steganography have emerged as platforms for securing embedded information
7-10
against unauthorized individuals " .
Three important points of a communication have been investigated— data encoding, data transfer & data extraction— to develop new innovations specifically for DNA-based
communications (Figure 1 1A). To illustrate, if Alice sends a message (m) to Bob, she would first write— encode and synthesize— the information in DNA molecules and send it to Bob who would then read— sequence and decode— the message (m). However, during the transfer of m between Alice and Bob, Eve could intercept the communication and read m. To protect m, DNA-specific cryptography and steganography methods may be implemented, however many of these methods are experimentally unproven and do not make accommodations for challenges in DNA synthesis and sequencing, such as minimizing homopolymeric stretches.
Here a new framework for the facile and secure communication of short messages in DNA is presented (Figure 1 IB). To securely encode data, an encryption key (k)— that functions as a one-time pad— and decoys (d), where k is required to decode the message (m) and a combination key is required to discern m from d was implemented. To securely transfer data, a secret- sharing system was established, where m can be dispersed throughout a mixture of different DNA molecules, requiring Eve to physically intercept and interrogate multiple separate data transmission lines to gain access to m. To facilitate data extraction, chromatogram patterning, a method that allows the bypassing of sequence alignments and instead permits information to be extracted from multiple DNA molecules in a single sequencing reaction was developed.
Taking inspiration from one-time pads, considered to be an unbreakable form of encryption11"15, described herein is a rationally designed individualized keyboard (iKey) that is amenable to randomization, serves as a facile platform to transfer plaintext on to DNA, and can achieve chromatogram patterning through co-sequencing of multiple DNA strands. Using an iKey, the secret- sharing Multiplexed Sequence Encryption (MuSE) system was developed for
the secure offline communication of information that is disseminated across multiple DNA strands but can be extracted in one step. By recreating a World War II communication from Bletchley Park, it is demonstrated herein that watermarks, a key, a cipher, and a decoy can be written on DNA and the correct information is revealed only if specific strands are co- sequenced.
Development of iKey and MuSE
Here, the familiarity of text-based communication, the QWERTY keyboard, and the genetic code were combined to develop an iKey that serves as a facile platform for DNA communication.
The natural genetic code employs three-letter DNA words (codons) to represent the 20 common amino acids used to build proteins. The four-letter DNA alphabet of adenine (A), cytosine (C), guanine (G) and thymine (T) thus yields 43 = 64 codons. These 64 codons were mapped onto a modified QWERTY keyboard to produce a personalized platform - iKey-64 - for translating text on to DNA (Figure 1A). The codons in iKey-64 can be randomized to produce a unique iKey for every message to provide additional security for communications, akin to a one-time pad11. Any specific version of iKey-64 can itself be encoded in DNA and provided as an additional component of a communication, where it can serve as a unique dictionary for each message (Figures 1B-1C).
To increase the security of encoded messages in addition to the substitution cipher of iKey-64, texts were disseminated between multiple DNA strands so that the desired message would be revealed only if the correct strand combinations were analyzed. This multiplexing is at the heart of the MuSE strategy, which is a secret- sharing system where a message can be stored securely by being fragmented and distributed between multiple parties16. Analyzing only a single strand would yield either nonsense or incorrect messages designed to mislead unauthorized individuals.
Conventionally, to extract information embedded on multiple DNA strands, one would first have to sequence each strand separately and then perform sequence alignments. In designing MuSE, it was expected that when multiple DNA strands are analyzed together by Sanger sequencing using a common primer, at chromatogram positions where two bases are identical a large peak would be observed and where two bases differ a small peak would be observed, thereby producing a pattern (Figure 2A). However, the simultaneous sequencing of
multiple DNA strands with a common primer cannot be used, as it leads to poor chromatograms and non-specific reads (Figures 12A-12C). Chromatogram patterning is based on the rational design of iKey-64 (Tables 2-3), where the aim was to reduce the incidence of homopolymers in
DNA messages as long stretches of homopolymers lead to sequencing inaccuracies 17. The homopolymer codons AAA, CCC, GGG, and TTT are assigned to four function keys, ensuring that in normal text no homopolymer longer than four bases is possible. Even letter combinations yielding four identical bases (such as GTT-TTC representing V-K on the keyboard) are kept quite rare. Therefore, the codon assignment of iKey-64 was based on the frequency of use of letters in the English language 18 to minimize the occurrence of homopolymers and achieve chromatogram patterning.
As shown in Table 3, the buttons of this embodiment of the iKey-64 were separated in to 3 categories based on the frequency of use as judged by qualitative measures. Category 1 is for the most frequently used buttons and is encoded by codons that contain three different nucleotides. Category 2 is for less frequently used buttons and is encoded by codons that contain the same nucleotide in the first and third position. Category 3 is for the least frequently used buttons and is encoded by codons that contain two or more homopolymers. Since iKey-64 is similar in design to a one-time pad, many possible versions exist and the last column provides the number of potential permutations that exist for randomly shuffling the codons between the buttons. The frequency of letters in the English alphabet were based on Table 2. If
chromatogram patterning is not desired, then all 64 buttons in iKey-64 can be randomly shuffled for transcription of plaintext on to DNA.
Table 2: Rational Design of iKey-64: Letter Frequency
Letter Fre e cy Letter Frequency
E 11 .1607% 3.0129%
A 8.4986% H 3.0034%
R 7.5809% G 2.4705%
! 7.5448% B 2.0720%
0 7.1635% F 1.8121%
T 6.9509% Y 1.7779%
N 6.6544% w 1.2899%
S 5.7351 % K 1.1016%
L 5.4893% V 1.0074%
C 4.5388% X 0.2902% u 3.6308% z 0.2722%
D 3.3844% J 0.1965%
P 3.1671 % Q 0.1962%
able 3: Rational Design of iKey64: Examples of iKey Permutations
iKey-64 was tested for MuSE by writing the cipher 'Massachusetts Institute Technology' on two DNA strands, where "spacel" (AGT) was used in DNA- 1 and "space2" (CTA) with DNA-2 to demarcate individual words in the sequences (Figures 2B-2C). Co-sequencing both DNA samples together would introduce troughs around words in the chromatogram. Individual sequencing of DNA-1 and DNA-2 produced high quality reads, however in a DNA- 1+2 mixture forward sequencing with a common primer did not produce chromatogram patterning, but rather camouflaged the cipher (Figure 2D). This was due to the variable DNA sequences placed upstream of the ciphers, where stretches of C and A homopolymers at the 5' ends interfered with base determination during Sanger sequencing causing intentional misalignment of the recognized bases in the chromatogram (Figures 3A-3C). On the other hand, reverse sequencing of DNA- 1+2 with a common primer produced a distinct pattern on the chromatogram. Since there were no interfering stretches of homopolymers in the variable DNA regions, there were no
shifts in the base identities during sequencing leading to predictable chromatogram patterning and a single-step extraction of information from the two strands (Figures 3B-3C).
MuSE can be tuned to embed data in chromatograms discreetly so that sequence alignments derived from chromatograms cannot be used to identify embedded information. Adjusting the ratio of DNA- l/DNA-2 allows the degree of contrast achieved in the
chromatogram patterns to be varied (Figure 2E). When DNA-1 or DNA-2 is present at 10-30%, chromatogram patterning is still achieved upon close examination of individual peaks, but the resulting sequence produced is only that of the more concentrated partner (Figures 4-5).
Therefore, an unauthorized user would be unable to see embedded messages directly in the sequence output or in alignments.
Multiplexed Sequencing of Strand Combinations
For additional security, MuSE can be used to disseminate information across many DNA strands, where multiplexed sequencing of different strand combinations will provide different readouts (Figure 13). To demonstrate this, watermarks, a key, a cipher, and a decoy message were encoded across six strands in a 525 bp region of DNA to recreate a World War II communication made during the establishment of Bletchley Park (Figure 6A and Figure 14)19. The functions of the elements are: (i) watermarks - an identification tag for each strand, (ii) key
- a riddle whose solution would provide the correct strand combinations required for co- sequencing to reveal the cipher in the secret- sharing system, (iii) cipher - the desired message to be communicated, and (iv) decoy - a false message to be revealed if improper strand
combinations were used for co-sequencing.
To extract the information via co-sequencing, two different primers - PrimerKey and Primercipher - that are common to all six strands are required. As a demonstration for this exercise a simple key was chosen, where co-sequencing of all of the strands with PrimerKey revealed the message: Pascal's triangle: d2r6-reverse (Figure 6A). This serves as a combination key and means the cipher is revealed from pairs as ordered is Pascal's triangle diagonal 2 down until row 6 on the reverse strand. If strand pairs nl+2, n3+4, and n5+6 were to be co-sequenced using Primercipher, then the embedded message 'Bletchley Park: GC&CS Codebreakers' would be revealed. However, if one were to for example misinterpret the key, then a decoy message could be revealed. Here, one decoy message was embedded - 'Captain Ridley's Shooting Party'
- that would be revealed if one were to co-sequence pairs n2+3, n4+5, and n6+l, a circular
permutation of the key. Of course, more than one decoy message could be embedded to further introduce complexity in communications. Alternatively, an unauthorized user may use random primers - PrimerExtemaiFw/Rv - instead of PrimerKey and Primercipher to extract messages if they were embedded in large DNA regions. To obfuscate this approach, the embedded information was alternated between the forward and reverse strands to provide a camouflage effect (Figure 15. Since any secure communication would have a limited quantity of DNA (enough to extract the desired message once), an unauthorized user would be unable to exhaustively explore primer sequences to extract information without advanced scientific protocols.
As expected, co- sequencing with PrimerExtemaiFw/Rv did not produce chromatogram patterning, whether cipher/decoy pairs or all six strands were co-sequenced (Figures 7-8).
However, co-sequencing of all six strands with PrimerKey produced the readout 'Pascal's triangle: d2r6-reverse', while the cipher/decoy containing regions did not produce
chromatogram patterning. Similarly, chromatogram patterning was not observed in the cipher/decoy containing regions when Primercipher was used for co-sequencing all six strands. On the other hand, sequencing of pairs with Primercipher as per the order in Pascal's triangle - nl+2, n3+4, and n5+6 - revealed the cipher via chromatogram patterning (Figures 9A-9G). Similarly, co-sequencing of the incorrect pairs - n2+3, n4+5, and n6+l - led to a decoy message to be revealed. Expectedly, co- sequencing of other pair combinations did not lead to any patterning (Figure 6B). This demonstrated that in addition to the security afforded by iKey-64 and MuSE, one must also decipher the key accurately to unlock embedded messages.
If unauthorized individuals were to gain access to a DNA communication, next- generation sequencing (NGS) might also be attempted for extracting messages. To recreate such a scenario, the difficulty associated with NGS analysis of unknown DNA samples was tested. A purified mixture of DNA samples nl+n2+n3+n4+n5+n6 was prepared and submitted for NGS analysis to an outside party under blind experimental conditions, with a request to provide the assembled contents of the sample (Figure 16A-16B). While sequencing of the mixture produced ~2 million reads, the blind assembly of the reads to reconstruct the contents proved difficult and inconclusive (Table 4). However, after the initial analysis the outside party was informed that there were 6 plasmids in the sample, each containing 525 bp messages as inserts. The vector sequence was then provided and the outside party asked for the exact sequences of the messages in the sample. A second round of analysis identified 6 assembled sequences that represented our messages (Table 5). Alignment of the 6 identified sequences with nl, n2, n3, n4, n5, and n6
templates provided most of the information in the six messages, with nl, n2, n3, and n5 providing almost perfect alignments (Figure 16C). This demonstrated the difficulty associated with blind sequencing of a MuSE communication without any prior knowledge of DNA contents. Even if the sequences of a DNA communication were identified after considerable time and expense, the contents of a communication would still likely be protected by the iKey, combination key, and decoy/non-coding sequences.
Table 4: Next- generation sequencing statistics of assembled reads under blind experimental conditions. n1 +n 2+rt 3+n4+n5+n6
Sequence size 1 ,407,94?
Number of scaffolds 2,851
% GC 51 ,1
Shortest conttig size 300
Median sequence size 423
ean sequence size 493.8
Longest cooiso; size 4,825
Number of subsystems 22
Number of coding sequences 984
Number of As 0
*NGS sequencing of a mixture of samples nl+n2+n3+n4+n5+n6 (Fig S10) produced 1,997,179 reads at 300 bp with 47% GC content. Shown are the statistics of the assembled scaffolds by the MIT BioMicro Center under blind experimental conditions. While the DNA samples produced high quality reads, under blind experimental conditions assembly of the reads in to the original constructs proved challenging and the results were inconclusive, nl = 2,346 bp/47.4% GC, n2 = 2,346 bp/47.3% GC, n3 = 2,346 bp/47.5% GC, n4 = 2,346 bp/47.6% GC, n5 = 2,346 bp/47.4% GC, n6 = 2,346 bp/47.3% GC.
Table 5: Identified sequences from NGS analysis.
Assembled Sequence SEQ ID NO: Sequence
1 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 18
GTCTCATGAGTGTAGGATGCATGAGATCAACGCTAGCATCGCACTG
TCGTCATGCAGCTGACTCCGATCTGACTATCGTCTGAGATCAGAGC
GTAACGTAGTCAGTGCTAGCATGCGAACTCGATGATCGAGTCGTAT
CCACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTC
GAGAGATCATCCCTATCTTGACGTTAGTTACAAGATCCCACCAATA
CTGCCAATAGACGGTCCTCCTTTCCCGTTGCTGTAAAACAGTCATGA
TCGTCATCAGATCATGCCGGCGTGATCTAGATACACGGTGGATTCA
GCTACTAGTCGAATCATGACGTGAGAAGCATGAACGATATGAAGAA
GTTATGTGGATAGCTGTCGACGTGATCGTATCGATGCAGTCCTCAG
GTCATATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCC
GCTGAGCAATAACTAGC
2 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 19
GTCTCATGAGTGTAGGATGCATGATCATGATTCTGATCTAGTCCAGC
AGTAGAGTCGTCTCGATCGATCTGTGCATCGTCAGCGATATTCGAC
GTAGTCGCTCGACCTGACTCGTGAGTGCAGCTACGTGTCAGTCATCC
ACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTCGA
GAGATCATCCAGTTCTTGACGTTAGTTACAAGATTGGCCACGATCC
ATGCTAACGTCTCTTCCACCTTTCCCAAAAAGTAACACACCATGACG
TATCGACTACGCACATACAGCATATGTGGATGATCACTGACTGACT
GAACTACGATCATGGTGTATGTGAGCGTGTATGTGCTCGTGACTGG
AGAAACGGCAACAGTGGATGATTGACGTACGACTGCTAGCTCAGGT
CATATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCCGC
TGAGCAATAACTAGC
3 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 20
GTCTCATGAGTGTAGGATGCATGATCATGATTCTGATCTAGTCCAGC
AGTAGAGTCGTCTCGATCGATCTGTGCATCGTCAGCGATATTCGAC
GTAGTCGCTCGACCTGACTCGTGAGTGCAGCTACGTGTCAGTCATCC
ACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTCGA
GAGATCATCCAGTTCTTGACGTTAGTTACAAGATTGGCCACGATCC
ATGCTAACGTCTCTTCCACCTTTCCCAAAAAGTAACACCGACTGATC
GCGCATACGGCAACAGTGACTCTCGACTACCATAGTAGTGAGATGG
TGGATTACGATCGCGTGATCTGAGTATCATTGATCTATAGTGGATTG
ACTGATGATCGTACTGTCGTACTGACTCTGACGTCGATCTCAGGTCA
TATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCCGCTG
AGCAATAACTAGC
4 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 21
GTCTCATGAGTGTAGGATGCATGATCATGATTCTGATCTAGTCCAGC
AGTAGAGTCGTCTCGATCGATCTGTGCATCGTCAGCGATATTCGAC
GTAGTCGCTCGACCTGACTCGTGAGTGCAGCTACGTGTCAGTCATCC
ACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTCGA
GAGATCATCCAGTTCTTGACGTTAGTTACAAGATTGGCCACGATCC
ATGCTAACGTCTCTTCCACCTTTCCCAAAAAGTAACACTGACTGCAT
TCGTGATCATCATGCCGGCGTGATCTAGATACACGGTGGATTCAGC
TACTAGTCGAATCATGACGTGAGAAGCATGAACGATATGAAGAAGT
TATGTGGATAGCTGTCGACGTGATCGTATCGATGCAGTCCTCAGGTC
ATATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCCGCT
GAGCAATAACTAGC
5 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 22
GTCTCATGAGTGTAGGATGCATGAGATCAACGCTAGCATCGCACTG TCGTCATGCAGCTGACTCCGATCTGACTATCGTCTGAGATCAGAGC
GTAACGTAGTCAGTGCTAGCATGCGAACTCGATGATCGAGTCGTAT
CCACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTC
GAGAGATCATCCCTATCTTGACGTTAGTTACAAGATCCCACCAATA
CTGCCAATAGACGGTCCTCCTTTCCCGTTGCTGTAAAACATAGTCAT
GACATCGACTACGCACATACAGCATATGTGGATCTAGCTTGACTAG
TCAACGTCGATATCGCGTGATCTGAGTATCATTGATCTATAGTGGAT
TGACTGATGATCGTACTGTCGTACTGACTCTGACGTCGATCTCAGGT
CATATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCCGC
TGAGCAATAACTAGC
6 TAATACGACTCACTATAGGGACAGTCTAGTGCAGCAGTCAGTACGA 23
GTCTCATGAGTGTAGGATGCATGAGATCAACGCTAGCATCGCACTG
TCGTCATGCAGCTGACTCCGATCTGACTATCGTCTGAGATCAGAGC
GTAACGTAGTCAGTGCTAGCATGCGAACTCGATGATCGAGTCGTAT
CCACTGTTGCCATATATGCAGACGGCATAGTATGCGTGTATGCGTC
GAGAGATCATCCCTATCTTGACGTTAGTTACAAGATCCCACCAATA
CTGCCAATAGACGGTCCTCCTTTCCCGTTGCTGTAAAACATAGTCAT
GACATCGACTACGCACATACAGCATATGTGGATCTAGCTTGACTAG
TCAACGTCGATATCGCGTGATCTGAGTATCATTGATCTATAGTGGAT
CATGACGTGCATGCAAGCTTAGCTAGTCAGATCAGTAGCTCTCAGG
TCATATTACTCGACAGTTGCTAAGTCAGTCATCGTCATACGATGCCG
CTGAGCAATAACTAGC
* After blind analysis by the MIT BioMicro Center did not provide the contents of the unknown sample submitted for analysis, further information about the plasmids and vector sequences was provided. Shown here are the 6 assembled and identified sequences each 525 bp, representing the messages encoded in nl, n2, n3, n4, n5, and n6 generated by the MIT BioMicro Center after a second round of analysis. Alignments to nl, n2, n3, n4, n5, and n6 are in Figure 16C. iKey-64 is designed to convert plaintext in to a DNA encodable language. If chromatogram patterning is desired, the codons may potentially be shuffled to enable 9.1 x 1061 variants (Table 3). However, if chromatogram patterning is not desired then a maximum of 1.3 x 1089 variants exist, significantly increasing the security of encoded information. As a communication medium, knowledge of the appropriate primers, combination key, and incorporation of decoy messages would also provide additional data security. Nevertheless, data encoded using iKey-64 would still not be truly random due to the frequency of use for each button, but additional measures may be implemented to increase security: (i) Cryptography - plaintext information may first be subject to advanced cryptographic algorithms, (ii) Linguistics - principles of linguistics may be applied to the layout of iKeys to modify alphabets for DNA communication, introduce new grammar rules or create iKeys in different languages, and (iii) Codons - increasing the number of nucleotides per codon can introduce redundancies in the buttons to adjust for character usage frequency. To illustrate, four nucleotides codons can be
used to create a 256 button keyboards such as iKey-256 (Figure 10). When the number of buttons for each letter is adjusted to reflect its frequency in English text, then the probability of using a button for E would equal Q. Similar redundancies may also be introduced for buttons representing numerals, grammar, and other user-defined functions. For instance, the frequency of numerals may be adjusted according to Benford' s Law 20.
To further extend the iKey system, codons can be used to represent words or phrases in addition to characters. It is estimated that the vocabulary of an educated native English speaking adult consists of -17,000 lemmas, while only 10 lemmas constitute 25% of the words used in English21' 22. Using 8-nucleotide codons could generate iKeys with 65,536 buttons, sufficient to include all of the commonly used words in English as well as accommodate individual letters, numerals, grammatical characters, functional characters, and high frequency words.
Theoretically, the iKey platform may be designed to incorporate the entire English language. The Oxford English Dictionary (OED), the most comprehensive record of the English language, contains 291,500 entries and a total of 615,100 word forms 23. To encode all of the entries of the OED on an iKey would require 10-nucleotide codons to generate a 1,048,576 button keyboard. Additionally, the dictionary is composed of 59 million words containing 350 million characters resulting in 5.9 characters/word. This would require 18 nucleotides to encode with an iKey-64 but only 10 nucleotides for an iKey- 1,048,576, representing a 44% reduction in DNA requirements.
References
1. Bancroft, C, Bowler, T., Bloom, B. & Clelland, C. T. Long-term storage of information in DNA. Science 293, 1763-1765 (2001).
2. Clelland, C. T., Risca, V. & Bancroft, C. Hiding messages in DNA microdots. Nature 399, 533-534 (1999).
3. Church, G. M., Gao, Y. & Kosuri, S. Next-generation digital information storage in DNA. Science 337, 1628 (2012).
4. Liss, M. et al. Embedding permanent watermarks in synthetic genes. PLoS One 7, e42465 (2012).
5. Cox, J. P. Long-term data storage in DNA. Trends Biotechnol. 19, 247-250 (2001).
6. Sennels, L. & Bentin, T. To DNA, all information is equal. Artif. DNA PNA XNA 3, 109-111 (2012).
7. Haughton, D. & Balado, F. BioCode: two biologically compatible Algorithms for embedding data in non-coding and coding regions of DNA. BMC Bioinformatics 14, 121-2105-14-121 (2013).
8. Heider, D. & Barnekow, A. DNA-based watermarks using the DNA-Crypt algorithm. BMC Bioinformatics 8, 176 (2007).
9. Tulpan, D., Regoui, C, Durand, G., Belliveau, L. & Leger, S. HyDEn: a hybrid
steganocryptographic approach for data encryption using randomized error-correcting DNA codes. Biomed. Res. Int. 2013, 634832 (2013).
10. awano, T. Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system. Commun. Integr. Biol. 6, e23478 (2013).
11. Ekert, A. & Renner, R. The ultimate physical limits of privacy. Nature 507, 443-447 (2014).
12. Gehani, A., LaBean, T. & Reif, J. DNA-based Cryptography. DNA Based Computers V: Dimacs Workshop DNA Based Computers V June 14-15, 1999 Massachusetts Institute of Technology 54, 233 (2000).
13. Mao, C, LaBean, T. FL, Relf, J. H. & Seeman, N. C. Logical computation using algorithmic self-assembly of DNA triple-crossover molecules. Nature 407, 493-496 (2000).
14. Hirabayashi, M., Kojima, H. & Oiwa, K. in (eds Peper, F., Umeo, H., Matsui, N. & Isokawa, T.) 174-183 (Springer Japan, 2010).
15. Hirabayashi, M., Kojima, H. & Oiwa, K. Effective algorithm to encrypt information based on self-assembly of DNA tiles. Nucleic Acids Symp. Ser. (Oxf) (53):79-80. doi, 79-80 (2009).
16. Voelkerding, K. V., Dames, S. A. & Durtschi, J. D. Next-generation sequencing: from basic research to diagnostics. Clin. Chem. 55, 641-658 (2009).
17. http://www.oxforddictionaries.com/us/words/what-is-the-frequency-of-the-letters-of-the- alphabet-in-english.
18. Ferguson, N., Schneier, B. & Kohno, T. in Cryptography engineering: design principles and practical applications (Wiley Publishing, Inc., Indianapolis, 2010).
19. http ://www.bletchleyp ark.or .uk/.
20. Alves, A. D., Yanasse, H. H. & Soma, N. Y. Benford's Law and articles of scientific journals: comparison of JCR and Scopus data. Scientometrics 98, 173-184 (2014).
21. http ://www . oxf orddictionaries . com/us/words/the- oec-f acts- about- the-language .
22. Goulden, R., Nation, I. S. P. & Read, J. How large can a receptive vocabulary be? Applied Linguistics 11, 341-363 (1990).
23. http://public.oed.com/history-of-the-oed/dictionary-facts/.
24. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
What is claimed is:
Claims
1. A method of secure communication of information contained on a single nucleic acid molecule, the method comprising:
(a) obtaining a nucleic acid molecule of known sequence;
(b) obtaining a modified keyboard comprising a personalized platform for translating nucleic acid sequence into text; and,
(b) generating a quantum of information translated from the nucleic acid sequence using the modified keyboard of (a).
2. A method of secure communication of information disseminated across at least one nucleic acid molecule, the method comprising:
(a) obtaining a modified keyboard comprising a personalized platform for translating text into a nucleic acid sequence;
(b) translating a quantum of information into a nucleic acid message sequence using the modified keyboard of (a); and,
(c) obtaining a at least one nucleic acid molecules, each molecule comprising (i) the complete or a portion of the nucleic acid message sequence and (ii) at least one contiguous stretch of randomized variable nucleic acid sequence flanking and/or inserted into the message sequence, thereby producing a nucleic acid molecule or a set of nucleic acid molecules containing the entire quantum of information.
3. The method of claim 1 or claim 2, wherein the modified keyboard comprises codons.
4. The method of claim 3, wherein the codons are designed to normalize frequency of character usage.
5. The method of any one of claims 1 to 4, further comprising sequencing the nucleic acid molecule or set of nucleic acid molecules using one or more common primers.
6. The method of claim 5, wherein the sequencing produces a chromatogram.
7. The method of claim 5, wherein the sequencing produces data that is analyzed by sequence alignment or bioinformatics methods.
8. The method of claim 6, further comprising identifying nucleic acid sequence corresponding to areas of high intensity peaks on the chromatogram.
9. The method of claim 6, further comprising identifying nucleic acid sequence corresponding to areas of low intensity peaks on the chromatogram.
10. The method of any one of claims 6-9, further comprising extracting the quantum of information contained within the set of nucleic acid molecules by using the modified keyboard to translate the nucleic acid sequence identified in any one of claims 6-9.
11. The method of any one of claims 1-10, wherein the modified keyboard comprises homopolymer codons located on functional keys.
12. The method of any one of claims 1-11, wherein the codons are greater than 3 nucleotides in length.
13. The method of claim 12, wherein the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length.
14. The method of any one of claims 1-13, wherein the codons are of mixed lengths.
15. The method of any one of claims 1-14, wherein the variable nucleic acid sequence comprises contiguous homopolymer codons.
16. The method of any one of claims 6-15, wherein the sequencing is performed by Sanger sequencing, bridge PCR, nanopore sequencing, or Next Generation Sequencing.
17. The method of any one of claims 1-16, wherein the at least one nucleic acid molecule is sequenced with at least one common primer.
18. The method of any one of claims 1-17, wherein the nucleic acid molecule(s) are in silico.
19. A method of producing an individualized keyboard for the conversion of plaintext into nucleic acid encodable language, the method comprising:
(a) producing a library of codons;
(b) assigning each member of the library to a different symbol; and
(c) arranging the symbols into an array, thereby producing an individualized keyboard.
20. The method of claim 19, wherein the codons are greater than three nucleotide bases in length.
21. The method of claim 19 or claim 20, wherein the codons are 4, or 5, or 6, or 7, or 8, or 9, or 10, or 11, or 12, or 13, or 14, or 15, or 16, or 17, or 18 nucleotide bases in length.
22. The method of any one of claims 19-21, wherein the codons are of mixed lengths.
23. The method of any one of claims 19-22, wherein the symbol is selected from the group consisting of letter, number, word, punctuation mark, pictogram or logogram.
24. The method of any one of claims 2-18, wherein the variable sequence comprises at least one contiguous stretch of homopolymer codons.
25. The method of any one of claims 19-23, wherein the individualized keyboard comprises homopolymer codons associated only with functional keys.
26. The method of any one of claims 19-23, wherein the codons are designed to normalize frequency of character usage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/521,956 US20170338943A1 (en) | 2014-10-29 | 2015-10-29 | Dna encryption technologies |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462069994P | 2014-10-29 | 2014-10-29 | |
| US62/069,994 | 2014-10-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016077079A1 true WO2016077079A1 (en) | 2016-05-19 |
Family
ID=55954857
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/058120 Ceased WO2016077079A1 (en) | 2014-10-29 | 2015-10-29 | Dna encryption technologies |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20170338943A1 (en) |
| WO (1) | WO2016077079A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021130187A1 (en) * | 2019-12-24 | 2021-07-01 | Technische Universiteit Delft | Secure communication using crispr-cas |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6834771B2 (en) * | 2017-05-19 | 2021-02-24 | 富士通株式会社 | Communication device and communication method |
| TW201919361A (en) * | 2017-11-09 | 2019-05-16 | 張英輝 | Method for block cipher enhanced by nonce text protection and decryption thereof |
| KR102138864B1 (en) | 2018-04-11 | 2020-07-28 | 경희대학교 산학협력단 | Dna digital data storage device and method, and decoding method of dna digital data storage device |
| US11017170B2 (en) | 2018-09-27 | 2021-05-25 | At&T Intellectual Property I, L.P. | Encoding and storing text using DNA sequences |
| CN113380322B (en) * | 2021-06-25 | 2023-10-24 | 倍生生物科技(深圳)有限公司 | Artificial nucleic acid sequence watermark coding system, watermark character string and coding and decoding method |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003019159A1 (en) * | 2001-08-24 | 2003-03-06 | First Genetic Trust, Inc. | Methods for indexing and storing genetic data |
| WO2011053868A1 (en) * | 2009-10-30 | 2011-05-05 | Synthetic Genomics, Inc. | Encoding text into nucleic acid sequences |
| US20120230326A1 (en) * | 2011-03-09 | 2012-09-13 | Annai Systems, Inc. | Biological data networks and methods therefor |
| US20130046994A1 (en) * | 2011-08-17 | 2013-02-21 | Harry C. Shaw | Integrated genomic and proteomic security protocol |
Family Cites Families (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1240954A (en) * | 1998-06-25 | 2000-01-12 | 阎道原 | I/O method based on 8-colour biological genetic code and its keyboard |
| US7761715B1 (en) * | 1999-12-10 | 2010-07-20 | International Business Machines Corporation | Semiotic system and method with privacy protection |
| CN101918590B (en) * | 2007-12-10 | 2013-03-27 | 高晓莲 | Sequencing of nucleic acids |
| US20090198519A1 (en) * | 2008-01-31 | 2009-08-06 | Mcnamar Richard Timothy | System for gene testing and gene research while ensuring privacy |
| AU2009273465A1 (en) * | 2008-07-24 | 2010-01-28 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. | Fluorescently or spin-labeled kinases for rapid screening and identification of novel kinase inhibitor scaffolds |
| US20100311821A1 (en) * | 2009-04-15 | 2010-12-09 | Yan Geng | Synthetic vector |
| US20120070862A1 (en) * | 2009-12-31 | 2012-03-22 | Ventana Medical Systems, Inc. | Methods for producing uniquely distinct nucleic acid tags |
| WO2011154807A1 (en) * | 2010-06-08 | 2011-12-15 | Stellenbosch University | Modification of xylan |
| US8865404B2 (en) * | 2010-11-05 | 2014-10-21 | President And Fellows Of Harvard College | Methods for sequencing nucleic acid molecules |
| US8349587B2 (en) * | 2011-10-31 | 2013-01-08 | Ginkgo Bioworks, Inc. | Methods and systems for chemoautotrophic production of organic compounds |
| CN202443419U (en) * | 2012-02-10 | 2012-09-19 | 刘军发 | DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) input keypad |
| US20150254912A1 (en) * | 2014-03-04 | 2015-09-10 | Adamov Ben-Zvi Technologies LTD. | DNA based security |
-
2015
- 2015-10-29 US US15/521,956 patent/US20170338943A1/en not_active Abandoned
- 2015-10-29 WO PCT/US2015/058120 patent/WO2016077079A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003019159A1 (en) * | 2001-08-24 | 2003-03-06 | First Genetic Trust, Inc. | Methods for indexing and storing genetic data |
| WO2011053868A1 (en) * | 2009-10-30 | 2011-05-05 | Synthetic Genomics, Inc. | Encoding text into nucleic acid sequences |
| US20120230326A1 (en) * | 2011-03-09 | 2012-09-13 | Annai Systems, Inc. | Biological data networks and methods therefor |
| US20130046994A1 (en) * | 2011-08-17 | 2013-02-21 | Harry C. Shaw | Integrated genomic and proteomic security protocol |
Non-Patent Citations (1)
| Title |
|---|
| SHAW ET AL.: "Genomics -based Security Protocols: From Plaintext to Cipherprotein", INTERNATIONAL JOURNAL ON ADVANCES IN SECURITY, vol. 4, 2 January 2011 (2011-01-02), pages 106 - 117 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021130187A1 (en) * | 2019-12-24 | 2021-07-01 | Technische Universiteit Delft | Secure communication using crispr-cas |
| NL2024572B1 (en) * | 2019-12-24 | 2021-09-06 | Univ Delft Tech | Secure communication using crispr-cas |
Also Published As
| Publication number | Publication date |
|---|---|
| US20170338943A1 (en) | 2017-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20170338943A1 (en) | Dna encryption technologies | |
| CN102025482B (en) | A Construction Method of Cryptography System (VGC) Based on Virtual Genome | |
| Grass et al. | Genomic encryption of digital data stored in synthetic DNA | |
| Wang et al. | Hiding messages based on DNA sequence and recombinant DNA technique | |
| Jacob | DNA based cryptography: An overview and analysis | |
| Mahjabin et al. | A survey on DNA-based cryptography and steganography | |
| US20130046994A1 (en) | Integrated genomic and proteomic security protocol | |
| Mondal et al. | Review on DNA cryptography | |
| Khalifa et al. | Secure blind data hiding into pseudo DNA sequences using playfair ciphering and generic complementary substitution | |
| Hamad | Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data. | |
| Tulpan et al. | HyDEn: A Hybrid Steganocryptographic Approach for Data Encryption Using Randomized Error‐Correcting DNA Codes | |
| Sabry et al. | A DNA and amino acids-based implementation of playfair cipher | |
| Vinodhini et al. | A survey on DNA and image steganography | |
| Zakeri et al. | Multiplexed sequence encoding: a framework for DNA communication | |
| Aggarwal et al. | Secure data transmission using DNA encryption | |
| Zhang et al. | A DNA‐Based Encryption Method Based on Two Biological Axioms of DNA Chip and Polymerase Chain Reaction (PCR) Amplification Techniques | |
| Karimi et al. | Cryptography using DNA nucleotides | |
| Cao et al. | Achieving handle-level random access in an encrypted DNA archival storage system via frequency dictionary mapping coding | |
| Hamed et al. | Hybrid, randomized and high capacity conservative mutations DNA-based steganography for large sized data | |
| JP6175453B2 (en) | Encryption and decryption method using nucleic acid | |
| Beck et al. | Finding data in DNA: computer forensic investigations of living organisms | |
| Rafat et al. | Secure digital steganography for ASCII text documents | |
| Risca | DNA-based steganography | |
| Bazli et al. | Data encryption using bio-molecular information | |
| Taj et al. | A multi-level random key cryptosystem based on DNA encoding and state-changing mealy machine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15858364 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15858364 Country of ref document: EP Kind code of ref document: A1 |
