WO2016065349A2 - Short non-coding protein regulatory rnas (sprrnas) and methods of use - Google Patents
Short non-coding protein regulatory rnas (sprrnas) and methods of use Download PDFInfo
- Publication number
- WO2016065349A2 WO2016065349A2 PCT/US2015/057259 US2015057259W WO2016065349A2 WO 2016065349 A2 WO2016065349 A2 WO 2016065349A2 US 2015057259 W US2015057259 W US 2015057259W WO 2016065349 A2 WO2016065349 A2 WO 2016065349A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- sprrna
- nucleic acid
- cancer
- pir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
- A61K48/0016—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the nucleic acid is delivered as a 'naked' nucleic acid, i.e. not combined with an entity such as a cationic lipid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/5752—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the lungs
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/96—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood or serum control standard
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Definitions
- sprRNAs Short Non-Coding Protein Regulatory RNAs
- the present invention generally relates at least to the fields of medicine, molecular biology and cancer therapeutics.
- RNA World referring to a period of time in primitive earth' s history when the primary living substance was RNA or something chemically similar, is gaining support by research data (Higgs PG, Lehman N. The RNA World: molecular cooperation at the origins of life. Nat Rev Genet. 6(1):7-17, 2015. PMID: 25385129). These molecules are believed to carry out most of the information processing and metabolic transformations necessary for life, supporting the functional importance of RNA molecules without translation. New discoveries have expanded roles of non-coding RNAs (ncRNAs) in physiological and disease processes in organisms including humans, which improved our understanding of the molecular basis of life and redefined rules for RNAs (Cech TR, Steitz JA.
- ncRNAs non-coding RNAs
- ncRNAs don't translate into proteins or peptides, they are functional RNA molecules. Many ncRNAs are highly abundant in mammalian cells and functionally important, such as tRNAs, rRNAs, snoRNAs, and more recently characterized long ncRNAs (IncRNAs) and short ncRNAs (sncRNAs) which include microRNAs, siRNAs and piRNAs (Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 157:77-94, 2014.).
- ncRNAs are very broad from enzymatic activities of rRNAs and snRNAs, to mRNA expression targeting of siRNAs, to mRNA translation targeting of miRNAs, to transposon suppression of piRNAs in both physiological and pathological conditions (Gomes AQ, Nolasco S, Soares H. Non-coding RNAs: multi-tasking molecules in the cell. Int J Mol Sci. 14(8): 16010-39, 2013.).
- the biological functions of most newly identified ncRNAs have not been tested or validated. Therefore, the roles of these ncRNAs in cellular biology require further investigation.
- miRNAs and siRNAs are under tight temporal and spatial control and have been well established.
- both miRNAs and siRNAs are processed similarly by two RNase III proteins (Drosha and Dicer) in the nucleus and cytoplasm, respectively, followed by modifications through RNA editing, Argonaute loading and RNA decay, although the differences of the origin and precursors (Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature 431 :343-349, 2004; Ha M, Kim N. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol 15(8):509-24, 2014; Carthew RW, Sonttheimer EJ. Origins and mechanisms of miRNAs and siRNAs.
- Mature piRNA sequences are surprisingly diverse between different organisms, even between closely related species. piRNA biogenesis pathways in different organisms also appear to be diverse, and are distinct from those of miRNAs or siRNAs (Das PP, Bagijn MP, Goldstein LD, Woolford JR, Lehrbach NJ, Sapetschnig A, Buhecha HR, Gilchrist MJ, Howe KL, Stark R et al. Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the Caenorhabditis elegans germline.
- piRNAs are predominantly expressed in germline cells or tissues but recent studies have shown their expression in somatic cells or tissues, suggesting unrecognized functionalities of these molecules in adult tissues. While the biogenesis of human piRNAs is poorly understood, its complexity is expected based on studies of other species. The mouse genome encodes 3 piwi proteins whereas 4 are found in human (Carmell MA, Girard A, van de Kant HJG, Bourc'his D, Bestor TH, de Rooij DG, Hannon GJ. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12:503-514, 2007; Deng W, Lin H.
- miwi a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis.
- RNAs bind to mammalian Piwi proteins. Nature 442: 199-202, 2006) and may participate in different biogenesis.
- pachytene piRNAs originate from distinct intergenic loci and associate with MILI and MrWI, transcription factor A- MYB, POL II and PLD6 (19.
- a piRNA pathway primed by individual transposons is linked to de novo DNA methylation in Mice, Mol Cell 31 :785-799, 2008; Li XZ, Roy CK, Dong X, Bolcun-Filas E, Wang J, Han BW, Xu J, Moore MJ, Schimenti JC, Weng Z et al.
- An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes. Mol Cell 50:67-81, 2013).
- the mouse MIWI- and MILI-associated sequence tags showed an association with 3' end extended sequences (Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z.
- Tudor domain protein, TDRKH which interacts with di-methylated MrWI and MrWI2 in mitochondria, has also been implicated in the final 3' precursor maturation step (Saxe JP, Chen M, Zhao H, Lin H. Tdrkh is essential for spermatogenesis and participates in primary piRNA biogenesis in the germline. EMBO J 32: 1869-1885, 2013).
- ncRNAs have been shown to exhibit abnormal expression patterns in pathological conditions such as cancerous tissues where specific changes of miRNAs and IncRNAs have been documented to play critical functional roles in the disease processes (Mraz, M.; Pospisilova, S., "MicroRNAs in chronic lymphocytic leukemia: From causality to associations and back," Expert Review of Hematology 5 (6): 579-581, 2012; Pibouin L, Villaudy J, Ferbus D, Muleris M, Prosperi MT, Remvikos Y, Goubin G., "Cloning of the mRNA of overexpression in colon carcinoma- 1 : a sequence overexpressed in a subset of colon carcinomas," Cancer Genet Cytogenet 133 (1): 55-60, 2002; Fu X, Ravindranath L, Tran N, Petrovics G, Srivastava S.
- the number of deaths caused by lung cancer is more than the deaths from prostate, breast and colorectal cancers combined.
- the 5-year survival rate for patients diagnosed with lung cancer currently stands at a dismal 17% in the United States but much lower in other parts of the world such as ⁇ 10% in the United Kingdom.
- Lung cancer can be classified morphologically into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) subtypes with approximately 85% as NSCLC.
- Most NSCLC are either squamous cell carcinoma (SCC) or adenocarcinoma (ADC) and less common forms such as large cell and bronchial alveolar carcinoma based on histology.
- SCC squamous cell carcinoma
- ADC adenocarcinoma
- the histological classification reflects certain degrees of biologic features of the tumors and is clinically valuable in selecting treatment options.
- each histological subtype consists of a number of distinct subclasses with different underlying biological features which cannot be distinguished morphologically.
- tumors with different histology may have similar underlying molecular features which may classify them biologically to benefit from molecular-based therapies. Therefore, molecular-based classification systems based on underlying biological features of the tumors will certainly provide more accurate and clinically powerful guide for treatment selections.
- lung patients can be classified into four stages based on conditions of the primary tumors, regional nodal involvement and the presence of distant metastasis.
- surgery sometimes radiation
- these patients if successfully treated with surgery or radiation, can expect 50% chance of 5-year survival.
- less than 50% of the patients with NSCLC are diagnosed at these earlier stages.
- many of the patients at these earlier stages may not be suitable for surgery due to locations of the tumors or poor pulmonary/cardiovascular functions.
- Patients diagnosed at later stages of the disease are rarely curable and have extremely poor survival expectations. Strategies to identify the disease early may improve cure rate and survival.
- the invention relates to short non-coding protein regulatory RNAs (sprRNAs), variants, fragments and inhibitors thereof and their uses as markers in certain disease states such as cancer, in particular lung cancer.
- sprRNAs short non-coding protein regulatory RNAs
- the sprRNAs, variants, fragments and inhibitors thereof are useful as therapeutic molecules in the treatment of diseases or conditions in subjects.
- the present invention provides an isolated nucleic acid molecule comprising an sprRNA, variants, fragments and inhibitors thereof.
- the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486.
- the sprRNA is piR-L- 163 (SEQ ID NO:282).
- the sprRNA is piR-L-138 (SEQ ID NO:268).
- the sprRNA is SEQ ID NO:489.
- the sprRNA comprises an sprRNA selected from the group consisting of:
- the invention provides an isolated nucleic acid molecule comprising cDNA of sprRNA, variants, and fragments thereof.
- the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486,
- the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802.
- the cDNA encodes the sprRNA sequence comprising piR-L-163 (SEQ ID NO:282). In some embodiments, the cDNA encodes the sprRNA sequence comprising piR-L-138 (SEQ ID NO:268). In some embodiments, the cDNA encodes the sprRNA sequence comprising SEQ ID NO:489. In some embodiments, the cDNA encodes an sprRNA sequence selected from the group consisting of:
- the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to the sprRNAs or cDNAs of the invention.
- the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802.
- the invention provides a nucleic acid molecule comprising a sequence that is antisense to an sprRNA of the invention.
- the invention provides a nucleic acid molecule comprising a sequence that is antisense to a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the invention provides a nucleic acid molecule comprising a sequence that is antisense to a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802.
- the nucleic acid molecule comprises Ant-138 (SEQ ID NO:556).
- the nucleic acid molecule comprises Ant-163 (SEQ ID NO:496). In some embodiments, the nucleic acid molecule comprises AntiC (SEQ ID NO:558). In another aspect, the invention provides a pharmaceutical composition comprising an sprRNA, variant, fragment or inhibitor thereof and a pharmaceutically acceptable carrier.
- the invention provides a method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA, variant, fragment or inhibitor thereof.
- the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the sprRNA is piR-L-138 (SEQ ID NO:268).
- the sprRNA is piR-L-163 (SEQ ID NO:282).
- the sprRNA comprises SEQ ID NO:489.
- the sprRNA is selected from the group consisting of: i) sprRNA12600 (SEQ ID NO:490); ⁇ ) sprRNA11568 (SEQ ID NO:491); iii) sprRNA7410 (SEQ ID NO:492);
- the disease is cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, and uterine cancer.
- the sprRNA or an inhibitor thereof is administered in combination with one or more additional therapies.
- the inhibitor is Ant-138 (SEQ ID NO:556) and the one or more additional therapies are selected from the group consisting of cisplatin, gemcitabine (GEM), docetaxel and combinations thereof.
- the inhibitor is AntiC (SEQ ID NO:558).
- the condition to be treated is wound healing or tissue degeneration and the inhibitor administered is Ant- 163 (SEQ ID NO:496).
- the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802 in a subject's sample and comparing it to a control sample.
- the invention provides a method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 489-494, or 560-2802 in a sample from a patient comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to one or more of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the invention provides a method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 489- 494, or 560-2802 in a sample from a patient comprising isolating the sprRNAs from the patient, making complementary DNA from the sprRNAs, and detecting the complementary DNA.
- the invention provides a method of detecting sprRNA, comprising
- the antibody binds phosphor-serine, phosphor-threonine or phosphor-tyrosine proteins.
- the sprRNA is any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the invention provides a method of preventing the binding of a sprRNA to a protein target, comprising contacting the sprRNA and protein target with an inhibitor whereby the inhibitor prevents binding of the sprRNA and protein target.
- the sprRNA corresponds to one or more of SEQ ID NO: 1
- the sprRNA is piR-L-163
- the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ ID NO:282), the inhibitor is an ERM protein and the inhibitor is Ant- 16
- the sprRNA is piR-L-138 (SEQ ID NO:268), the protein is an MDM2 protein and the inhibitor is Ant-138 (SEQ ID NO:556).
- the sprRNA is selected from the group consisting of: SEQ ID NO:489; sprRNA12600 (SEQ ID NO:490); sprRNA11568 (SEQ ID NO:491); sprRNA7410 (SEQ ID NO:492); sprRNA9378 (SEQ ID NO:493); and sprRNA10698 (SEQ ID NO:494), the protein is a nucleolin protein and the inhibitor is AntiC (SEQ ID NO:558).
- the invention provides a method for identifying agonists or inhibitors that modulate binding of sprRNA to a protein target or modulate the biological activity of the sprRNA-protein interaction, comprising contacting the sprRNA and protein with the inhibitor or agonist and detecting whether the inhibitor or agonist affect binding and/or activity of the sprRNA and protein.
- the sprRNA corresponds to one or more of SEQ ID NOS: 1-486, 489- 494, or 560-2802.
- the inhibitor is an antisense nucleic acid to the sprRNA, variant or fragment thereof.
- the present invention relates to a method for diagnosing cancer or tumorigenesis in a patient comprising measuring the levels of piRNA-L- 163 in a patient sample such as blood plasma, serum saliva, sputum or urine compared to a matched sample from a noncancerous patient.
- the present invention relates to a method for diagnosing lung cancer or metastasis in a patient comprising measuring the upregulated levels of piRNA-L-163 in a patient sample such as blood plasma, serum saliva, sputum or urine compared to a matched sample from a noncancerous patient.
- the present invention relates to a method of detecting the presence or absence of one or more piRNA-L-163 sequences in a sample from the genome of a patient or subject with cancer comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
- the present invention relates to a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
- the present invention relates to a method of detecting the presence or absence of one or more piRNA-L-163 sequences in a sample from the genome of a patient or subject with lung cancer comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
- the present invention relates to a screening method for identifying inhibitors of cell proliferation in human bronchial epithelial cells comprising identifying molecule(s) which bind piRNA-L-163 and inhibit their function.
- the present invention relates to a method for treating cancer or tumorigenesis in a patient comprising introducing into the patients cells an inhibitor molecule which prevents binding of piRNA-L-163 to ERM proteins.
- the present invention relates to a kit for diagnosing lung cancer in a human subject comprising a probe comprising a polynucleotide that hybridizes to piRNA-163.
- FIG. 1 Flowchart of the protocol used to prepare sncRNAs from the cell lines for RNA-seq.
- FIG. 2 Genome distribution and clustering analysis of piRNAs and piRNA- Ls expressed in HBE and NSCLC cells, (a) Distribution of piRNAs and piRNA-Ls in chromosomes, (b) Distribution of piRNAs and piRNA-Ls in mitochondria genome. Clustering based on piRNA and piRNA-L expression patterns in HBE2-4, ADC (SKMES-1, H157, H226 and H1437) and SCC (H596, H522, H194 and H1792); (c) entire piRNA and piRNA-L expressed, (d) piRNAs only, (e) piRNA-Ls only.
- FIG. 4. piR-L-163 binds to p-ERM.
- FIG. 5 piR-L-163 motif and ERM element critical for binding and p-ERM 's interaction with EBP50 and F-actin.
- Lat A served as an internal control for background, (e) Gap closure of HBE4 cells treated with either Ant-163 or Scr. (f) Gap closure of HI 792 cells treated with Ant-163, piR- L-163, piR-L-163Ml and Scr. All values are averages of three independent replicates, the error bars reflect mean s.d., and * indicate p ⁇ 0.01 by Student's t-test.
- FIG. 7 Lengths of reads obtained in RNA-seq and human genome distributions of the reads, (a) Length distribution of all the reads, (b) Numbers of genomic loci mapped for the reads observed in each cell line (percentages of the reads).
- FIG. 8 Chromosomes and mitochondria genome distributions of the reads, (a) Distribution of all the reads. (b)Percentages of the reads mapped to exonic, intronic, and intergentic regions, respectively for each cell line.
- FIG. 9 Heat map of expression of piRNAs and piRNA-Ls identified in the 11 cell lines.
- FIG. 10 Expression levels of piRNAs (known) and piRNA-Ls (novel), (a) Density plot of all the reads separated by known and novel, (b) Histogram of average read counts covering the known and novel piRNAs (piRNA/piRNA-L).
- FIG. 11 Expression of piR-L-163 in NSCLC and HBE cell lines measured by real time RT-PCR.
- piR-L-163 expression levels in individual cell lines (b) piR-L-163 express ion levels in HBE, ADC and SCC as groups. All the values are averages of four independent replicates, error bars represent mean s .d., and * indicates p ⁇ 0.01 by Student's t-test.
- LAMC2 express ion levels in HBE4 cells measured by real time RT-PCR in the conditions as labeled. Values are averages of three independent replicates, error bars represent mean s.d., and ** indicates p ⁇ 0.05 by Student's t-test.
- FIG. 12 Regions in moesin potentially critical for piR-L-163 and p-ERM interaction, (a) Predicted RNA binding element in human and drosophila moesin. (b) Alignment of human and drosophila moesin.
- FIG. 13 Uncropped scans of critical Western blots presented in Figure 5.
- (a- c) Protein levels in lysates obtained from H1792 cells transfected with different oligos.
- FIG. 14 piR-L-138 3'-end 2'-0-methylation and expression patterns in NSCLC cell lines, (a) Expression levels of selected piRNA-Ls in SCC cell lines 24 h after treated with cisplatin treatment, (b) Average levels of piR-L-138 in ADC and SCC cell lines in comparison with the levels in HBE lines based analyzed using RNA- seq (left) and quantitative RT-PCR (right), (c) 2'-0-methylation at the 3'-end of piR- L-138 is indicated by periodate treatment followed by ⁇ -elimination. The untreated and treated synthetic oligo RNAs separated in PAGE and stained with ethidium bromide (left).
- RNAs were detected using northern blot (right). Red arrows indicate piR-L-138.
- FIG. 15. piR-L-138 impacts MDM2 cleavage and apoptosis in SCC cells, (a) Numbers of SCC cells 24 h after CDDP treatment with either Scr or Ant- 138 transfection measured by MTT assay, (b) Cell cycle distributions of HI 57 cells collected 24 h after CDDP treatment, with no treatment or treated with Scr or Ant- 138 6 h after CDDP.
- Red arrows indicate the sub-Gl fraction
- Values are averages of three independent replicates; error bars represent mean s.d.; * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001.
- FIG. 16 piR-L-138 interacts with MDM2.
- FISH fluorescence in situ hybridization
- FIG. 17 Ant-138 enhances CDDP-mediated apoptosis in xenograft tumor model
- FIG. 18 Responses of NSCLC cell lines to CDDP and the impact of CDDP to expression level of selected piRNA-Ls in ADC cell lines, (a) Response curves of SCC cell lines to different concentrations of CDDP. (b) Response curves of ADC cell lines to different concentrations of CDDP. (c) Morphological changes of H157 and SKEMS-1 (SK) cells after treatment with different chemotherapeutic agents (IC25 doses), (d) Changes of piRNA-L expression (selected piRNA-Ls) in ADC cells after CDDP treatment. Values are averages of three independent replicates, error bars represent mean s.d. FIG. 19.
- FIG. 20 Impact of Ant-138 in apoptosis of SCC cells following CDDP treatment, (a) Sub-Gl fractions of SCC cells transfected with either Scr or Ant-138 6 h after CDDP treatment, (b) Untreated controls of SCC cells in FITC annexin V experiments for Figure 15c.
- FIG. 21 Amplified bands of RNAs extracted from IP products of pooled HBE and SCC cell lines.
- FIG. 22 Size distribution of identified unique phosphor-protein binding sncRNAs.
- FIG. 23 Inhibiting proliferation (a) and altering levels of certain phosphor proteins (b) 24 h after the complementary DNA oligo treatment in lung SCC cells.
- FIG. 24 Primers designed to amplify presumable pri- and pre-sprRNAs (piR- L-163 and piR-L-138) as colored (a). RNAs extracted from each subcellular components and the purity are verified by the presence or absence of HSP90 and Histone 3A (b). RT-PCR results of the pri- and pre-sprRNAs in each subcellular component (c).
- FIG. 25 Secondary structure prediction of piR-L-163.
- FIG. 26 piRNA Levels are highly Modulated in NSCLC Cells Following Chemotherapy (piRNA138 as an example).
- FIG. 27 Secondary structure prediction of piR-L-138.
- FIG. 28 Profile of phosphorylation related sprRNAs in HBE and SCC.
- a Mitochondrial and chromosomal genomes distribution of sprRNAs.
- b-f Venn diagrams showing the specific numbers and relative proportions of sprRNAs pulled down by antibodies targeting p-Tyr, -Ser and -Thr in HBE and SCC, respectively.
- FIG. 29 Function of sprRNAs.
- a Clustering on the bases of expression patterns of sprRNAs in HBE and SCC.
- b Relative cell viability of SCC cells after treatment with control or AntiC.
- c Cells stained with Annexin V and PI were analyzed by Flow Cyto after treatment with control and AntiC.
- d Cleaved PARP and Caspase3 were detected by W.B. in cells treated with control and AntiC.
- e Relative cell viability of NHBE cells treated with control or ectopic expression of core sequence.
- FIG. 30 Interaction of necleolin and core sequence
- FIG. 31 Flowchart of the protocol used to prepare sncRNAs library from cell lines for RNA sequencing, a, Specific cell lines for sncRNAs library preparation, b-c, Cells were lysed and proteins were quantified, d-e, Lysed buffer was processed for IP using p-Ser, p-Tyr and p-Thr. f, RNAs were extracted from IP products, g-h, Adaptors were ligated. i-j, Extracted RNAs were processed for reverser transcription and polymerase chain reaction (PCR) using unique index sequence, k, PCR products were run in one nucleotide resolution gel. i-m, Targets bands were purified and sent for illumine Midseq. FIG.
- Pipeline for analyzing reads and reads statistics a, Pipeline for reads processing, b, Total and aligned reads of p-Ser, p-Thr and p-Tyr in HBE and SCC cell lines, c, Percentage of the mapped reads distributed in different hit (s) of loci in the human genome sequences.
- the present invention is based at least in part on the surprising discovery of a novel class of short non-coding RNAs (sncRNAs) referred to herein as sprRNAs (short non-coding protein regulatory RNAs) which are proposed to be integral components for the function of certain proteins in regulating cellular processes. It is also provided herein that abnormal expression of sprRNAs can contribute to cancer development and progression. Therefore, sprRNAs essential for maintaining cancer phenotypes are novel therapeutic targets and/or biomarkers for patients with cancers.
- sncRNAs short non-coding protein regulatory RNAs
- piwi- interacting RNA-Like sncRNAs are expressed in somatic epithelial cells (although the total numbers of piRNA-Ls are substantially smaller than piRNAs expressed in germ line cells);
- piRNA-Ls are differentially expressed between normal bronchial epithelial cells (HBEs) and non-small cell lung cancer (NSCLC) cells as well as between different NSCLC histology subtypes;
- HBEs normal bronchial epithelial cells
- NSCLC non-small cell lung cancer
- sncRNAs can bind directly to proteins and regulate protein functions, a mechanism never before suspected for sncRNAs.
- piRNA-L-163, a novel sprRNA described herein binds to phosphorylated ERM proteins (p-ERMs), a key cell cortex organizer, and regulates the protein functions
- piRNA-L-138, a novel sprRNA described herein binds and stabilizes MDM2 oncogene upon treatment with chemotherapeutic agents
- sncRNAs can be co-precipitated with phosphor-proteins, including 30-60% of the piRNA-Ls identified in HBE and NSCLC cells, with distinct patterns in the samples from proteins with different phosphorylated residuals as well as proteins from different types of cell lines.
- the invention relates to short non-coding protein regulatory RNAs (sprRNAs), variants, fragments and inhibitors thereof including piRNA-like molecules and their uses as markers in certain disease states such as cancer, in particular lung cancer.
- sprRNAs short non-coding protein regulatory RNAs
- variants, fragments and inhibitors thereof including piRNA-like molecules and their uses as markers in certain disease states such as cancer, in particular lung cancer.
- the sprRNAs, variants, fragments and inhibitors thereof are useful as therapeutic molecules in the treatment of diseases or conditions in subjects.
- sprRNAs are short non-coding RNAs. sprRNAs are believed to represent a new class of noncoding RNAs and are not believed to function directly to mediate silencing of gene expression or suppress transposon mobility, unlike many other non-coding RNAs such as piRNAs, siRNAs and miRNAs. sprRNAs also do not include other noncoding tRNAs and ribosomal RNAs, although sprRNAs might compose sequences identical to partial sequences of tRNAs or ribosomal RNAs. In contrast, it has been discovered that sprRNAs interact with proteins, and through these interactions, affect one or more cellular processes mediated by the proteins.
- the sprRNA ranges in size from about 24-55 nucleotides in length. In some embodiments, the sprRNA ranges in size from about 25-50 nucleotides in length or about 26-32 nucleotides in length. In some embodiments, the sprRNA comprise modifications of the RNA, including 3' end 2'- O-methylation. In some embodiments, the sprRNAs bind to phosphorylated proteins. RNA-Like sncRNAs (piRNA-Ls) referred to herein are encompassed by sprRNAs.
- the present invention provides an isolated nucleic acid molecule comprising a short non-coding protein regulatory RNA (sprRNA), variants, fragments, and inhibitors thereof.
- sprRNA short non-coding protein regulatory RNA
- the invention provides isolated nucleic acid molecules having the nucleic acid sequence set out in SEQ ID NOS: 1-486, 489-494, or 560-2802, variants, fragments, or inhibitors thereof.
- the invention further provides nucleic acid molecules that are antisense nucleic acid molecules to the nucleic acid sequences set forth in SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the present invention provides cDNA of the sprRNAs of the invention.
- the sprRNA inhibitor is an antisense nucleic acid molecule.
- the inhibitor comprises an antisense nucleic acid molecule comprising SEQ ID NOS:496, 497, or 556-559.
- the antisense molecules are selected from DNA and RNA molecules.
- a particular nucleotide sequence comprising an sprRNA, variant, fragment or inhibitor may be identical over its entire length, for example, of SEQ ID NOS: 1-486, 489-494, 496, 497, 556-559 or 560-2802.
- the nucleic acids of the invention contain a nucleotide sequence that is highly identical, e.g., at least 90% identical, with a nucleotide sequence of an sprRNA, variant, fragment or inhibitor as set forth in SEQ ID NOS: 1-486, 489-494, 496, 497, 556-2802.
- the nucleic acid comprises variants of sprRNAs.
- variants can include sequences with insertions, deletions, point mutations and modifications of the nucleotide bases.
- antisense inhibitors include sequences with insertions, deletions, point mutations, and modifications of the nucleotide bases relative to the native sprRNA sequence.
- the nucleic acids of the invention e.g., SEQ ID NOS:l- 486, 489-494, 496, 497, or 556-2802, variants, fragments or inhibitors thereof, can also include additional or modified sequences of the above mentioned sequences which can aid in their purification or stability, for example.
- one or more adaptor sequences can be attached to either the 3' and/or 5' ends of the molecule to facilitate amplification, purification and/or cloning.
- the adaptor sequence comprises SEQ ID NO:499.
- the sprRNAs, variants, fragments and inhibitors thereof can be modified to include a phosphorothioate (PS) backbone.
- PS phosphorothioate
- the modification to the backbone can be throughout the molecule or at one or more defined sites.
- the sprRNAs, variants, fragments and inhibitors thereof can be modified at one or more sites to include 2'-0-methyl (20Me) and/or 2'-0-methoxy-ethyl (MOE) groups.
- the sprRNAs, variants, fragments and inhibitors thereof can be modified to encompass peptide nucleic acids (PNA).
- the sprRNAs, variants, fragments and inhibitors thereof can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
- Embodiments of the invention further include isolated nucleic acid molecules comprising a nucleotide sequence at least 90% identical, and more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% or 100% identical to (a) SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802; or (b) a nucleotide sequence complementary to the nucleotide sequences in (a).
- the invention provides a nucleic acid comprising an sprRNA, fragment or inhibitor of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556- 2802 in which several, 1, 1-2, 1-3, or 1-5, 1-10, or 1-20 nucleotide residues are substituted, deleted or added, in any combination.
- the variants maintain the desired activity, have abrogated activity, or enhanced activity.
- the nucleic acid are at least 90% identical over their entire length to a nucleic acid having the sequence set out in SEQ ID NOS: 1-486, 489- 494, 496, 497, or 556-2802, and nucleic acids which are complementary to such nucleic acids. In some embodiments, the nucleic acids are at least 95% identical over their entire length, at least 97% identical, at least 98% identical, or at least 99% identical.
- the present invention is further directed to fragments of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802 and sequences complementary thereto.
- a fragment can be defined to be at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, and at least about 40 nt in length.
- Such fragments are useful as therapeutic agents, screening agents, diagnostic probes and primers as discussed herein and can be incorporated into detection kits to detect the nucleic acids in biological samples.
- the fragments can include truncations at the 5' or 3' ends, and can also include internal fragments with both 5' and 3' truncations.
- the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the probe or primer further comprises a detectable label. Methods of modifying probes or primers with detectable labels are well known in the art, and can include, e.g., fluorescent labels, enzymatic labels, and radiolabels.
- the probe or primer is DNA.
- the probe or primer is RNA.
- the invention provides a probe for detecting piR-L-163 (SEQ ID NO:498).
- the present invention further relates to nucleic acids that hybridize to the above-described sequences.
- the present invention especially relates to nucleic acids that hybridize under stringent conditions to the above-described nucleic acids.
- stringent conditions means hybridization will occur only if there is at least 90% and preferably at least 95% identity and more preferably at least 97%, 98%, 99% and 100% identity between the sequences.
- a major consideration associated with hybridization analysis of DNA or RNA sequences is the degree of relatedness the probe has with the sequences present in the specimen under study. This is important with a blotting technique (e.g., Southern or Northern Blot), since a moderate degree of sequence homology under nonstringent conditions of hybridization can yield a strong signal even though the probe and sequences in the sample represent non-homologous genes.
- a blotting technique e.g., Southern or Northern Blot
- hybridization can be carried out in a solution containing 6xSSC (lOxSSC: 1.5 M sodium chloride, 0.15 M sodium citrate, pH 7.0), 5x Denhardt's (1. times. Denhardt's: 0.2% bovine serum albumin, 0.2% polyvinylpyrrolidone, 0.02% Ficoll 400), 10 mM EDTA, 0.5% SDS and about 10 7 cpm of nick- translated DNA for 16 hours at 65 °C.
- 6xSSC lOxSSC: 1.5 M sodium chloride, 0.15 M sodium citrate, pH 7.0
- Denhardt's (1. times. Denhardt's: 0.2% bovine serum albumin, 0.2% polyvinylpyrrolidone, 0.02% Ficoll 400
- 10 mM EDTA 0.5% SDS
- about 10 7 cpm of nick- translated DNA for 16 hours at 65 °C.
- a washing step may be utilized wherein probe binding to nucleic acids of low homology, or nonspecific binding of the probe, may be removed.
- a stringent wash step may involve a buffer of 0.2xSSC and 0.5% SDS at a temperature of 65 °C.
- Nucleic acids of the invention which are sufficiently identical to a nucleotide sequence contained in 1-486, 489-494, 496, 497, or 556-2802 or sequences complementary thereto can be used as hybridization probes, to isolate full-length sequences, interacting proteins or protein complexes, and/or genomic clones comprising the sequences and clones of other nucleic acids that have a high sequence similarity.
- hybridization techniques are known to those of skill in the art.
- these nucleotide sequences are at least about 90% identical, preferably at least about 95% identical, more preferably at least about 97%, 98% or 99% identical to that of the reference.
- the probes generally will comprise at least 15 nucleotides. In some embodiments, such probes will have at least 20 nucleotides and can have at least 50 nucleotides or greater.
- the invention provides an isolated nucleic acid molecule that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In some embodiments, the invention provides an isolated nucleic acid comprising a sequence that is at least 95% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In some embodiments, the nucleic acid molecule comprises a sequence that is at least 99% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In another embodiment, the nucleic acid molecule comprises a sequence that is identical to any one of SEQ ID NOS: 1- 486, 489-494, 496, 497, or 556-2802.
- the nucleic acid comprises the sprRNA piR-L-163 (SEQ ID NO:282).
- the nucleic acid comprises the sprRNA is piR-L-138 (SEQ ID NO:268).
- the nucleic acid comprises SEQ ID NO:489.
- the nucleic acid comprises an sprRNA selected from the group consisting of:
- the nucleic acid comprises Ant-138 (SEQ ID NO:556) which is DNA sequence that is antisense to piR-L-138 (SEQ ID NO:268).
- the RNA antisense sequence is set forth in SEQ ID NO: 557.
- the nucleic acid comprises Ant-163 (SEQ ID NO:496), which is DNA sequence that is antisense to piR-L-163 (SEQ ID NO:282).
- the RNA antisense sequence is set forth in SEQ ID NO: 497.
- the nucleic acid comprises AntiC (SEQ ID NO:558), which is a DNA sequence that is antisense to SEQ ID NO:489.
- the RNA antisense sequence is set forth in SEQ ID NO: 559.
- the present invention also relates to vectors that comprise nucleic acids of the present invention, host cells which are genetically engineered with vectors of the invention and the production of nucleic acids of the invention by recombinant techniques.
- bacterial cells such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
- fungal cells such as yeast cells and Aspergillus cells
- insect cells such as Drosophila S2 and Spodoptera Sf9 cells
- animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells
- plant cells A great variety of systems can be used, including DNA or RNA vectors and viral vectors.
- the invention provides a vector comprising any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802.
- the invention comprises a host cell comprising a vector comprising any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802.
- the invention provides a method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA, variant, fragment or inhibitor thereof of the invention.
- the invention provides a method of preventing the binding of a sprRNA, variant, or fragment thereof to a protein target, comprising contacting a nucleic acid comprising an sprRNA, variant, or fragment thereof and protein target with an inhibitor whereby the inhibitor prevents binding of the sprRNA, variant, or fragment thereof and protein target.
- the sprRNA is not limiting and in some embodiments, the sprRNA is any one of SEQ ID NOS:l-486, 489-494 or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS:l-486, 489-494 or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-191. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486, 489-494 or 560-2802. In some embodiments, the sprRNA is piR-L-138 (SEQ ID NO:268). In some embodiments, the sprRNA is piR-L-163 (SEQ ID NO:282). In some embodiments the nucleic acid administered comprises SEQ ID NO:489. In some embodiments, the sprRNA selected from the group consisting of::
- the inhibitor that is administered is an antisense nucleic acid molecule of the nucleic acid comprising the sprRNA, variant or fragment thereof of the invention.
- Antisense therapy is the administration of exogenous oligonucleotides which bind to a target nucleic acid.
- the antisense molecules can be antisense over the entire length of the sprRNA (i.e., 100% complementary). In some embodiments the antisense molecules can be complementary over only a portion of the sprRNA.
- the antisense RNA is complementary over at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nucleotides, which can be contiguous and noncontiguous nucleotides.
- the antisense nucleic acid molecule is complementary to the sprRNA over contiguous nucleotides, while in other embodiments, one or more mismatches can occur between regions that are fully complementary in sequence.
- the antisense nucleotides herein are capable of disrupting the sprRNA-protein interaction and/or modulating the function of the sprRNA-protein interaction.
- the antisense nucleic acid molecules of the invention can be modified and can include derivatives such as S -oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra).
- S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
- the S-oligos of the present invention may be prepared by treatment of the corresponding O-oligos with 3H-l,2-benzodithiol-3-one- 1 ,1-dioxide which is a sulfur transfer reagent. See Iyer et al., /. Org. Chem. 55:4693- 4698 (1990); and Iyer et al., /. Am. Chem. Soc. 112: 1253-1254 (1990), the disclosures of which are fully incorporated by reference herein.
- the antisense nucleic acids can be modified at one or more sites to include 2'-0-methyl (20Me) and/or 2'-0-methoxy-ethyl (MOE) groups.
- the antisense nucleic acids can be modified to encompass peptide nucleic acids (PNA). In some embodiments, the antisense nucleic acids can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
- PNA peptide nucleic acids
- PMO phosphorodiamidate morpholino oligomers
- the antisense oligonucleotides of the present invention can be RNA or DNA that is complementary to sequences within SEQ ID NOS: 1-486, 489-494, or 560-2802 and stably hybridize with such sequences. Use of an oligonucleotide complementary to such regions allows for selective hybridization to the sprRNA.
- the antisense oligonucleotides of the present invention are at least 15 to 30-mer fragments of the antisense DNA molecule. Other criteria that are known in the art may be used to select the antisense oligonucleotides, varying the length or the annealing position in the targeted sequence.
- subject refers to animals, such as mammals.
- mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like.
- subject and patient refers to animals, such as mammals.
- mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like.
- treat and all its forms and tenses (including, for example, treating, treated, and treatment) can refer to therapeutic or prophylactic treatment.
- those in need thereof of treatment include those already with a pathological condition of the invention (including, for example, a cancer), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention.
- the improvement may be any observable or measurable improvement.
- a treatment may improve the patient's condition, but may not be a complete cure of the pathological condition.
- those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition such as cancer.
- the disease or condition to be treated is not limiting.
- the disease or condition to be treated is selected from the group consisting of cancer, abnormal cell proliferation, tissue degeneration and wound healing.
- cancer includes but is not limited to, carcinomas and sarcomas, such as, for example, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical cancer, AIDS-related cancers, AIDS-related lymphoma, anal cancer, astrocytoma (including, for example, cerebellar and cerebral), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor (including, for example, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal, visual pathway and hypothalamic glioma), cerebral astrocytoma/malignant glioma, breast cancer, bronchial adenomas/carcinoids, Burkitt's lymphoma, carcinoid tumor (including, for example, gastrointestinal), carcinoma of unknown primary site, central nervous system lymphoma, cervical cancer, chronic lymphocytic leukemia
- the disease is cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, and uterine cancer.
- the sprRNA, variant, fragment or inhibitor thereof is administered in combination with one or more additional therapies.
- the administration can be together in the same composition or in separate compositions.
- the sprRNA, variant, fragment or inhibitor thereof can be administered at substantially the same time with one or more additional therapies or at different times, and the spacing of time between the various treatments is not limiting.
- the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination to a cell or a subject before, during, or after another treatment, such as a chemotherapeutic agent (e.g. alkylating agents, antimetabolites, anthracyclines, alkaloids, topoisomerase inhibitors, select monoclonal antibodies, kinase inhibitors, tyrosine kinase inhibitors, select cytotoxic antibiotics, taxanes, actinomycin, bleomycin, plicamycin, mitomycin, targeted cancer therapies), anthracycline, doxorubicin, an alkylating agent, an antimetabolite, a vinca alkaloid, a taxane, a topoisomerase inhibitor, actinomycin, an anthracycline, bleomycin, plicamycin, mitomycin.
- a chemotherapeutic agent e.g. alkylating agents, antimetabolites, anthracyclines, alkal
- the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination with radiation therapy, hormonal therapy, an aromatase inhibitor, tamoxifen, gonadotropin-releasing hormone analog, a selective estrogen receptor modulator, an antiandrogen, and a progestin.
- the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination with one or more of the following additional therapies: Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE- PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afatinib Dimaleate, Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Am
- the drug is selected from the group consisting of Paclitaxel, Curcumin, Docetaxel, Ixabepilone, Vinblastine, Colchicine, Y-27632 Fasudil, SU6656 Dasatinib, HDAC inhibitors, ROCK inhibitors, Parthenolide, Costunolide and ML-7 Jazplakinolide.
- the nucleic acid comprising the sprRNA, variant, fragment or inhibitor thereof prevents resistance to one or more additional therapies, such as the therapies described above.
- inhibitor is an inhibitor to piR-L-138 (SEQ ID NO:268), such as Ant-138 (SEQ ID NO:556), and the one or more additional therapies are referred to above.
- the one or more additional therapies to which the inhibitor of piR-L-138 prevents resistance is selected from the group consisting of cisplatin, gemcitabine (GEM), docetaxel and combinations thereof.
- the condition to be treated is cancer, such as lung cancer and an inhibitor of any of SEQ ID NOS: 489-494 is administered.
- the inhibitor is AntiC (SEQ ID NO:558).
- the invention provides a method of treating cancer comprising administering an effective amount of piRNA-L-163 (SEQ ID NO:282), a variant, or fragment thereof.
- the condition to be treated is selected from wound healing and tissue degeneration.
- an inhibitor of sprRNA piR- L-163 (SEQ ID NO:282) is administered, such as Ant- 163 (SEQ ID NO:496).
- the frequency of administration is not limiting.
- the the sprRNA, variant, fragment or inhibitor thereof of the invention administered to the subject or cell can vary from about once every 2, 3, 4, 5, or 6 months to about 1, 2, 3, 4, or 5 times a month, to about 1 , 2, 3, 4, or 5 times a week, to about once per day, to about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times a day.
- the invention provides a method for treating cancer or tumorigenesis in a patient comprising introducing into the patients cells an inhibitor molecule which prevents binding of piRNA-L-163 to ERM proteins. In some embodiments, the invention provides a method of treating cancer comprising administering an effective amount of piRNA-L-163, a variant, or fragment thereof. Diagnostic Assays
- This invention also relates to the use of nucleic acids, antibodies or other binding reagents reactive specifically against the sprRNAs as diagnostic reagents.
- Detection of altered sprRNA can provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from altered expression of the sprRNA.
- the detection of normal or altered levels of the sprRNA can direct the medical practitioner to set an appropriate course of treatment for the patient.
- neoplastic disorders such as lung cancer
- differences in the levels of sprRNA (or cDNA generated therefrom) between affected and unaffected individuals, or between normal and cancerous tissues can be determined.
- Nucleic acids for diagnosis may be obtained, for example, from a biopsy of cells from the tissue.
- bodily fluids e.g., urine
- RNA may be used directly for detection or may be converted to cDNA and amplified enzymatically by using PCR or other amplification techniques prior to analysis.
- the diagnostic assays offer a process for diagnosing or determining a susceptibility to a disease or condition, such as a neoplastic disorder, through detection of altered levels of one or more sprRNA by the methods described.
- RNA level can be measured at the RNA level using any of the methods well known in the art for the quantitation of nucleic acids; for example, RT- PCR, RNase protection, Northern blotting, array analysis, and other hybridization methods may be utilized.
- the sprRNAs can be assayed individually or in combination, e.g., as a panel of biomarkers to indicate the presence or absence of the disease or condition. Other known markers, can also be simultaneously assayed, in accordance with the methods of the present invention.
- the invention provides a method of detecting the presence or absence of one or more sprRNAs in a sample, comprising contacting the sample with a probe comprising a nucleic acid that hybridizes to one or more of the sprRNAs.
- the sprRNAs comprise any one of SEQ ID NOS:l- 486, 489-494 or 560-2802.
- the method comprises contacting a sample from a subject with a probe comprising a nucleic acid that hybridizes to one or more of SEQ ID NOS: 1-486, 489-494 or 560-2802.
- the invention provides a method of detecting the presence or absence of one or more sprRNA sequences according to SEQ ID NOS:l- 486, 489-494 or 560-2802 in a sample from a patient comprising isolating the sprRNAs from the patient, optionally making cDNA from the sprRNAs, and detecting the sprRNAs or complementary DNA.
- Methods of making cDNA from RNA templates are well known in the art and is not limiting.
- the invention provides a method of detecting sprRNA, comprising
- IP assays can be performed using antibodies specifically generated for phosphor-serine, phosphor-threonine and/or phosphor-tyrosine, and total RNA can be extracted from the IP products of the cell lysate mixture followed by attaching adaptors as described herein to one or both 3' and 5' ends of the RNAs.
- RT-PCR can be performed to amplify the phosphor-protein binding RNAs.
- the sprRNAs capable of binding phosphoproteins include any one of SEQ ID NOS: 1-486, 489-494 or 560-2802.
- the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS: 1-486, 489-494 or 560-2802 in a subject's sample and comparing it to a control sample.
- the cancer is lung cancer.
- the levels of sprRNAs can be measured in any number of ways, including using techniques well known to persons skilled in the art.
- the levels are measured using intracellular probes to assay cells directly for the presence or absence of the sprRNAs as described herein in the Examples.
- the levels of the sprRNA are detected using an fluorescence in situ hybridization (FISH) assay using, e.g., a digoxin (DIG) -labelled DNA or RNA probe complementary to the sprRNA.
- FISH fluorescence in situ hybridization
- DIG digoxin
- the levels of the sprRNA can be measured by the fluorescence intensity using standard techniques and methods.
- the sprRNA is isolated from the cell.
- the sprRNAs can be separated from total RNA using one-nucleotide-resolution PAGE gels and processed using the True® Small RNA kit.
- the sprRNA can isolated by co-immunoprecipitation using antibodies to binding proteins.
- Adaptors can also be ligated to the sprRNA to facilitate purification or amplification.
- the sprRNA can be subjected to semi-quantitative RT-PCR, quantitative RT-PCR, or realtime qRT-PCR to determine the levels of the sprRNA in the cells and compare the levels to control samples.
- the control sample is from a noncancerous patient.
- the sample is selected from the group consisting of cells, blood, plasma, serum saliva, sputum or urine.
- the cancer to be detected or diagnosed is not limiting, and can include a cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, uterine cancer or any other cancer as described herein.
- the cancer detected or diagnosed is lung cancer.
- one or more sprRNAs are measured and compared to control samples.
- one or more sprRNAs are assayed from Table 1, below, and compared to control samples.
- one or more or a panel of markers shown below can be used to distinguish between normal and cancer tissue, including distinguishing between squamous cell versus adenocarcinoma since there are differences in the markers between such cell types.
- HBE normal human bronchial epithelial
- ACD lung cancer adenocarcinoma
- SCC squamous cell carcinoma
- piRNA-L-232 (SEQ ID NO:322) piRNA-L-232 (SEQ ID NO:322) piRNA-L-409 (SEQ ID NO:417) piRNA-L-409 (SEQ ID NO:417) piRNA-L-37 (SEQ ID NO:210) piRNA-L-495 (SEQ ID NO:475) piRNA-L-101 (SEQ ID NO:248) piRNA-L-488 (SEQ ID NO:470) piRNA-L-490 (SEQ ID NO:472) piRNA-L-138 (SEQ ID NO:268) piRNA-L-124 (SEQ ID NO:260) piRNA-L-276 (SEQ ID NO: 344) piRNA-L-50 (SEQ ID NO:220) piRNA-L-334 (SEQ ID NO: 372) piRNA-L-505 (SEQ ID NO:483) piRNA-L-408 (SEQ ID NO:416) piRNA-L-369 (SEQ ID NO:393) piRNA-L-127 (SEQ ID NO:261) piRNA
- piRNA-L-420 (SEQ ID NO:423) piRNA-L-196 (SEQ ID NO: 301) piRNA-L-142 (SEQ ID NO:271) piRNA-L-2 (SEQ ID NO: 192) piRNA-L-13 (SEQ ID NO: 197) piRNA-L-85 (SEQ ID NO:236) piRNA-L-146 (SEQ ID NO:275) piRNA-L-245 (SEQ ID NO:328) piRNA-L-350 (SEQ ID NO:379) piRNA-L-9 (SEQ ID NO: 196) piRNA-L-97 (SEQ ID NO:244) piRNA-L-404 (SEQ ID NO:414) piRNA-L-257 (SEQ ID NO:333) piRNA-L-230 (SEQ ID NO:321) piRNA-L-432 (SEQ ID NO:432) piRNA-L-18 (SEQ ID NO: 199) piRNA-L-188 (SEQ ID NO:294)
- the measured sprRNA comprises piRNA-L-163 (SEQ ID NO:282). In some embodiments, the measured sprRNA comprises piRNA-L-138 (SEQ ID NO:268). In some embodiments, the measured sprRNA comprises any one of SEQ ID NOS:490-494.
- the subject is administered an effective amount of one or more therapeutic agents.
- the therapeutic agent comprises an sprRNA, variant, fragment, or inhibitor thereof, such as an antisense nucleic acid.
- the therapeutic agent comprises a nucleic acid comprising any one of SEQ ID NOS: l- 486, 489-494, or 560-2802, variants, fragments, or inhibitors thereof, such as an antisense nucleic acid.
- the therapeutic agent comprises a nucleic acid comprising any one of SEQ ID NOS:282, 268 or 489-494, variants, fragments, or inhibitors thereof.
- the therapeutic agent comprises SEQ ID NOS:496, 497, or 556-559, variants or fragments thereof.
- the present invention relates to a kit for diagnosing cancer in a human subject comprising one or more detection reagents capable of detecting any one or more of the sprRNAs of SEQ ID NOS: 1-486, 489-494, or 560- 2802.
- the sprRNAs are one or more of the sprRNAs of Table 1.
- the detection reagent comprises one or more probes comprising a nucleic acid that hybridizes to any one or more of the sprRNAs of Table 1.
- the ability of antagonists (inhibitors) and agonists of sprRNAs to interfere or enhance the activity of the sprRNA can be evaluated.
- the assay can be conducted in vitro to determine whether the inhibitors or agonist reduces or enhances the interaction between the sprRNA and its protein binding partner.
- an assay for sprRNA activity in cells can be used to determine the functionality of the sprRNA in the presence of an agent which may act as an inhibitor or agonist, and thus, agents that interfere or enhance the activity of sprRNA can be identified.
- the sprRNAs include any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
- the sprRNAs of the present invention are employed in a screening process for compounds which bind one of the sprRNAs or one of its binding proteins or both and which enhances or inhibits the biological activity of the sprRNA-protein interaction.
- the nucleic acids of the invention may also be used to assess the binding of molecular substrates and ligands in, for example, cells, cell- free preparations, chemical libraries, and natural product mixtures. These substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics.
- Inhibitors of sprRNAs are particularly advantageous and can be used in methods as therapeutic agents in the treatment of cancer, for example, lung cancer, particularly in instances where the sprRNA is upregulated in the cancer cell.
- the inhibitors are antisense nucleic acids to the sprRNA.
- the antisense nucleic acids are DNA.
- agonist is intended naturally occurring and/or synthetic compounds capable of enhancing the biological activity that results from the sprRNA-protein interaction and/or enhancing the interaction of the sprRNA and protein to which it binds.
- antagonist or “inhibitor” is intended naturally occurring and/or synthetic compounds capable of inhibiting the sprRNA-protein interaction and/or the biological activity that results from the sprRNA-protein interaction.
- the screening procedures involve producing appropriate cells which harbor the nucleic acids of the present invention.
- Such cells can include cells from mammals, yeast, Drosophila or E. coli.
- the cells express the nucleic acid endogenously.
- the cells have been transfected or engineered to express the nucleic acid.
- cells expressing the nucleic acid or extracts or purified preparations from cells are contacted with a test compound to observe stimulation or inhibition of a functional response.
- assays can test binding of a candidate compound to the sprRNA or assays can involve competition with a competitor compound, such as a labeled competitor.
- inhibitors can be assayed in the presence of a labeled antisense nucleic acid, and displacement of the labeled antisense nucleic acid can be measured.
- Potential agonists or antagonists are not limiting and examples include antibodies, peptides, carbohydrates, or small molecules which bind to the sprRNA and/or protein to which it binds. These agents can be selected and screened 1) at random, 2) by a rational selection or 3) by design using for example, ligand modeling techniques (e.g., computer modeling).
- agents such as antibodies, peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to or stimulate/block the interaction of the sprRNA and protein or the biological activity.
- agents may be rationally selected or designed.
- an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the sprRNA and/or binding protein.
- the invention provides a method of screening for an agent which modulates the activity of an sprRNA, e.g., an agonist or antagonist, comprising: (a) contacting a sprRNA and/or protein to which the sprRNA binds with the agent to be tested; and (b) assaying the agent's effect on the sprRNAs activity.
- the activity to be tested is sprRNA-protein binding, and/or biological activity that results from the sprRNA-protein interaction.
- the present invention relates to a screening method for identifying inhibitors of cell proliferation in human bronchial epithelial cells comprising identifying molecule(s) which bind piRNA-L-163 and inhibit their function.
- the invention provides a method for identifying inhibitors that prevent binding of sprRNA to a protein target, comprising contacting the sprRNA and protein with the inhibitor and detecting whether the inhibitor prevents binding of the sprRNA and protein.
- the sprRNA corresponds to one or more of SEQ ID NOS: 1-486, or 489-494.
- the inhibitor is an antisense nucleic acid to the sprRNA.
- the invention provides a pharmaceutical composition comprising one or more therapeutic agents and a pharmaceutically acceptable carrier.
- the therapeutic agents can include sprRNAs including the specific sprRNAs described herein, as well as variants, fragments and inhibitors thereof.
- the sprRNAs include any one of SEQ ID NOS: 1-486, 489-494, or 560- 2802.
- the therapeutic agents affect one or more cellular processes mediated by the protein and sprRNA interaction.
- the compositions can also include one or more additional therapeutic agents that is useful to treat a disease or condition in combination with the sprRNAs, derivatives, analogs and inhibitors thereof.
- compositions comprising one or more therapeutic agents, and methods of administering a therapeutically effective amount of one or more therapeutic agents, which are capable of prophylactic and/or therapeutic treatment of one or more conditions or diseases, such as cancer.
- therapeutic agent refers to any pharmaceutically acceptable acid, salt, ester, derivative, a stereoisomer, pro-drug or mixtures of stereoisomers of a therapeutic agent or to the therapeutic agent itself.
- Pharmaceutically acceptable acids, salts, esters, derivatives, stereoisomers, pro-drugs, and mixtures of therapeutic agents may also be used in the methods and compositions of the present invention.
- compositions can be formulated according to known methods for preparing pharmaceutically acceptable useful compositions, and can include a pharmaceutically acceptable carrier.
- the carrier may be liquid, solid, or semi-solid for example. Formulations are described in a number of sources which are well known to those of skill in the art.
- the physical and/or chemical characteristics of compositions of the inventions may be modified or optimized according to skill in the art, depending on the mode of administration and the particular disease or condition to be treated.
- the compositions may be in any suitable form, depending on the desired method of administration, and may be provided in unit dosage form, a sealed container, or as part of a kit, which may include instructions for use and/or a plurality of unit dosage forms.
- exemplary pharmaceutically acceptable salts administrable by means of the compositions of this invention include chloride, bromide, iodide, hydrochloride, acetate, nitrate, stearate, palmoate, phosphate, and sulfate salts.
- exemplary techniques for producing pharmaceutically acceptable derivatives include for example, methylation, halogenation, acetylation, esterification and hydroxylation.
- terapéuticaally effective amount means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show meaningful patient benefits, e.g, a decrease in tumor size or metastatic potential of the tumor, an increase in patient survival time, sensitization of patients to other therapeutic agents including but not limited to chemotherapy.
- the pharmaceutical composition may be adapted for administration by any appropriate route, for example by the oral, rectal, nasal, topical, vaginal or parenteral routes. Other routes, e.g., intra- articular, may also be used.
- Such compositions may be prepared by any known method, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.
- compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; as powders or granules, as solutions, syrups or suspensions.
- Suitable excipients for tablets or hard gelatin capsules include lactose, maize starch, or derivative thereof, stearic acids or salts thereof.
- Suitable excipients for use with soft gelatin capsules include for example vegetable oils, waxes, fats, semi-solid, or liquid polyols etc.
- excipients which may be used include for example water, polyols, and sugars.
- oils e.g., vegetable oils
- delayed release or enteric-coated preparations may be advantageous, for example to decrease gastric residence time and thereby reduce degradation of the pharmaceutical composition en route to the lower GI tract.
- compositions adapted for rectal administration may be presented as suppositories or enemas.
- Pharmaceutical compositions adapted for nasal administration wherein the carrier is a solid can include a coarse powder having a particle size ranging from about 20 to about 500 microns.
- Suitable compositions wherein the carrier is a liquid for administration as a nasal spray or as nasal drops include aqueous or oil solution of the active ingredient.
- Pharmaceutical compositions adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurized aerosols, nebulizer or insufflators.
- compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils.
- the therapeutic agent When formulated in an ointment, the therapeutic agent may be employed with either a parafinninic or a water-miscible ointment base.
- Pharmaceutical compositions adapted from topical administration to the eye include eye drops wherein the therapeutic agent is dissolved or suspended in a suitable carrier, especially an aqueous solvent.
- Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes.
- compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time.
- Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations.
- compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation substantially isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
- Excipients which may be used for injectable solutions include water, alcohols, polyols, glycerin and vegetable oils, for example.
- the compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in freeze-dried conditions requiring only the addition of a sterile liquid immediately prior to use.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
- the pharmaceutical compositions may contain preserving agents, solubilizing agents, stabilizing agents, wetting agents, emulsifiers, sweeteners, colorants, salts, buffers, antioxidants, etc.
- compositions of the present invention may be for a "prophylactic" or “therapeutic” purpose, or alternatively can be used for diagnostic purposes.
- the compositions of the present invention are said to be administered for a "therapeutic” purpose if the amount administered is physiologically significant to provide a therapy for an actual manifestation of the disease or condition.
- the therapeutic agent is preferably provided at (or shortly after) the identification of a symptom of actual disease.
- the therapeutic administration of the agent serves to attenuate the severity of such disease or to reverse its progress.
- the compositions of the present invention are said to be administered to provide a therapy for a potential disease or condition.
- the therapeutic agent is preferably provided in advance of any symptom thereof.
- the prophylactic administration of the therapeutic agent serves to prevent or attenuate any subsequent advance of the disease.
- the therapeutic agents of the invention are nucleic acids, such as sprRNAs, analogs, derivatives, and antisense inhibitors thereof.
- the nucleic acids of the invention can be administered to a subject by any suitable means including parenteral or oral administration.
- the nucleic acids of the invention may be administered parenterally by intraarterial, intravenous, intraperitoneal, intraocular, subcutaneous or intramuscular injection either continuously or by bolus injection, depending on the route of administration.
- the administration may also be transmembrane or transmucosal using suppositories and, optionally, agents to aid penetration of membranes or mucosal membranes. Topical administration and direct administration to a target area may also be performed.
- the administration is about 0.01-1 mg/kg, 0.0005-5 mg/kg, 0.001-0.35 mg/kg or, for example, 0.25 mg (40 pmol) nucleic acid/kg of the subject may be desirable.
- the nucleic acids of the invention can be administered to a subject or a cell with a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
- the carrier comprises at least one of: a glucose solution, a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, a ligand functionalized-hydrophilic polymer grafted polymer, and a ligand functionalized liposome.
- the polymers comprise a biodegradable histidine-lysine polymer, a biodegradable polyester, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), a polyamidoamine (PAMAM) dendrimer, a cationic lipid (such as DOTAP), or a PEGylated PEL
- a ligand can be adapted to the composition to target the composition to particular cell types.
- the ligand is specific for one or more particular cell surface markers.
- ligands can include small molecules, proteins, antibodies, and the like.
- the ligand binds a cancer cell surface marker.
- the pharmaceutically acceptable carrier is a nanoparticle.
- nanoparticles can be formulated to include high concentrations or amounts of the nucleic acids of the invention.
- nanoparticles can be formulated to include up to 15 ⁇ g, 20 ⁇ g, 25 ⁇ g, 30 ⁇ g, 40 ⁇ g, 50 ⁇ g, or more nucleic acids of the invention per lxlO 9 particles.
- concentration or amounts included can be lowered if needed, e.g., 1-12 ⁇ g nucleic acid or less per lxlO 9 particles.
- Exemplary amounts or concentrations of nucleic acids of the invention can include 10-1000 pmol/5xl0 7 particles, e.g., 20, 40, 100, 200 of 500 pmol nucleic acid/5xl0 7 particles.
- the nanoparticle is a histidine-lysine copolymer that forms a nanoparticle with the nucleic acids of the invention, wherein the diameter of the nanoparticle is about 50 nm to about 500 nm.
- the nanoparticle encapsulates the nucleic acids of the invention for topical transcutaneous or transdermal delivery or targeted epidermal delivery via nanoparticle projectile bombardment or other transcutaneous/transdermal means.
- the nanoparticles comprise at least one positively charged shell substrate and at least one negatively charged core substrate, wherein the core substrate is selected from the group consisting of heparin, heparin analogs, low molecular weight heparin, glycosaminoglycans, and alginate.
- the nucleic acids of the invention are conjugated with the core substrate.
- the nanoparticles can have a mean particle size between about 50 and 500 nanometers, between about 100 and 300 nanometers, or between about 150 and 250 nanometers.
- the pharmaceutically acceptable carrier may be a lipid nanoparticle.
- the lipid nanoparticle may be engineered to penetrate mucus and may include surface altering agents such as, but not limited to, anionic protein, surfactants, sugars or sugar derivatives, nucleic acids, polymers, mucolytic agents and various DNases including rhDNase.
- the mucus penetrating lipid nanoparticles can comprise at least one nucleic acid of the invention.
- the nucleic acids of the invention can be encapsulated in the lipid nanoparticle and/or disposed on the surface of the particle.
- the nucleic acid of the invention may be covalently coupled to the lipid nanoparticle.
- Formulations of mucus penetrating lipid nanoparticles may comprise a plurality of nanoparticles. Further, the formulations may contain particles which may interact with the mucus and alter the structural and/or adhesive properties of the surrounding mucus to decrease mucoadhesion which may increase the delivery of the mucus penetrating lipid nanoparticles to the mucosal tissue.
- a nucleic acid of the invention is formulated as a solid lipid nanoparticle.
- the solid lipid nanoparticle may be spherical with an average diameter between 10 to 1000 nm.
- SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and may be stabilized with surfactants and/or emulsifiers.
- the lipid nanoparticle may be a self-assembly lipid-polymer nanoparticle.
- the nucleic acids of the invention can be administered to a subject or a cell via liposomes as a pharmaceutically acceptable composition.
- liposomes can be manufactured by sonicating lipids in an aqueous solution. Low shear rates create multilamellar vesicles, which have many lipid layers. Continued high-shear sonication tends to form smaller unilamellar liposomes.
- liposomes can be constructed using polyethylene glycol (PEG) as a coating. The liposomes can have a ligand attached to the surface of the liposome for binding to a target cell via a cell surface receptor or other surface molecule.
- PEG polyethylene glycol
- the liposome as a pharmaceutically acceptable carrier can include opsonins or ligands in enhance the attachment of liposomes to unhealthy tissue or to activate events such as endocytosis.
- Liposomes can contain a low or a high pH to enhance the delivery of the nucleic acids of the invention.
- the pharmaceutically acceptable carrier may include liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2- dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2- dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), and MC3 (US Appl. Pub. No. 2010/0324120).
- DODMA dioleyloxy-N,N-dimethylaminopropane
- DiLa2 liposomes from Marina Biotech (Bothell, Wash.)
- DLin-DMA 1,2- dilinoleyloxy-3-dimethylaminopropane
- DLin-KC2-DMA 2,2-dilinoleyl-4-
- the pharmaceutically acceptable carrier can include liposomes such as those formed from the synthesis of stabilized plasmid- lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described for delivery to cells or subjects (see Wheeler et al., Gene Therapy. 1999 6:271-281 ; Zhang et al. Gene Therapy. 1999 6: 1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2: 1002-1007; Zimmermann et al., Nature. 2006 441 : 111-114; Heyes et al. J Contr Rel.
- SPLP stabilized plasmid- lipid particles
- SNALP stabilized nucleic acid lipid particle
- the nucleic acids of the invention may be formulated in a lipid-polycation complex.
- the formation of the lipid-polycation complex may be accomplished by methods known in the art and/or as described in U.S. Pub. No. 20120178702.
- the polycation may include a cationic peptide or a polypeptide such as polylysine, polyornithine and/or polyarginine.
- the cationic lipid pharmaceutically acceptable carrier may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2012040184, WO2011153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, WO2010080724 and WO201021865.
- the pharmaceutically acceptable carrier may include at least one of the PEGylated lipids described in International Publication No. 2012099755, herein incorporated by reference.
- the concentration of the nucleic acids of the invention in the lipid pharmaceutically acceptable carrier is about 0.2 to 0.4 mg/ml, and the total lipid concentration is about 1.5 to 2.7 mg/ml.
- the ratio of lipid:nucleic acid can be about 2: 1, at least about 3: 1, at least about 4: 1, at least about 5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 10: 1 , at least about 15: 1.
- the nucleic acids can be formulated with MaxSuppr in vivo RNALancerll as described previously (Wiggins JF, et al. Development of a Lung Cancer Therapeutic Based on the Tumor Suppressor MicroRNA-34. Cancer Res. 70, 5923-30(2010)) due to the requirement of very large quantity of formulated reagents needed for systemic delivery.
- the nucleic acids of the invention can be administered to a subject through an implanted, indwelling, intrathecal or intraparenchymal catheter that provide a means for injecting fluid containing the nucleic acids of the invention directly into a desired tissue such as local nerves or local brain tissue.
- a desired tissue such as local nerves or local brain tissue.
- Embodiments of the invention include delivery of the nucleic acids of the invention via implantable delivery devices, such as an implantable pump like that taught in U.S. Pat. Nos. 5,735,814 and 6,042,579, and further using a sensor as part of the infusion system to regulate the amount of nucleic acids of the invention delivered, like that taught in U.S. Pat. No. 5,814,014.
- Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition of the nucleic acids of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
- the composition may comprise between 0.01% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5- 80%, at least 80% (w/w) active ingredient.
- a piRNA like small RNA interacts with and modulates p-ERM proteins in human somatic cells
- PrWI-interacting RNAs are thought to silence transposon and gene expression during development.
- somatic tissues are largely unknown.
- HBE human lung bronchial epithelial
- NSCLC non-small cell lung cancer
- piRNA-L-163 (piR-L-163) (SEQ ID NO:282), the top down- regulated piRNA-L in NSCLC cells, binds directly to phosphorylated ERM proteins (p-ERM), which is dependent on the central part of UUNNi/i/i/NNUU (SEQ ID NO:495) motif in piR-L-163 (SEQ ID NO:282) and the RRRKPDT (SEQ ID NO:488) element in ERM, and.
- the piR-L-163/p-ERM interaction is critical for p-ERM's binding capability to filamentous actin (F-actin) and ERM-binding phosphoprotein 50 (EBP50).
- piRNA/piRNA-L may play a regulatory role through direct interaction with proteins in physiological and pathophysiological conditions.
- Piwi-interacting RNAs are the largest class of small non-coding RNAs (sncRNAs) expressed primarily in germ line cells and thought to function with PrWI proteins to silence transposon activity and gene expression in a sequence- dependent manner during development (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014).
- PIWI- piRNA pathway has been implicated in transposon silencing and repression of gene expression through heterochromatin modification in germ line cells (Fang, W., Wang, X., Bracht, J.R., Nowacki, M. & Landweber, L.F.
- Piwi-interacting RNAs protect DNA against lost during Oxytricha genome arrangement.
- piRNA expression has been observed in human somatic cells such as cancer cells (Mei, Y., Clark, D. & Mao, L. Novel dimensions of piRNAs in cancer. Cancer Lett 336, 46-52 (2013))
- the extent of piRNA expression in mammalian somatic tissues remains an outstanding question (Ross, R.J., Weiner, M.M. & Lin, H. PrWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014), as are the functional roles of piRNAs in these tissues.
- the ERM proteins belong to a family of proteins located at cell cortex (Fehon, R.G., Mclatchey, A.I. & Bretscher, A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11, 276-287 (2010); Fievet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. 1773, 653-560 (2007); McClatchey, A.I. ERM proteins at a glance. J Cell Sci. 127:3199-204 (2014); Neisch, A.L & Fehon, R.G.
- Ezrin, Radixin and Moesin key regulators of membrane-cortex interactions and signaling. Curr Opin Cell Biol. 23, 377-82 (2011)). They are critical in connecting transmembrane proteins, such as EBP50, and the cytoskeleton to play important role in regulating signal transduction pathways (McClatchey, A.I & Fehon, R.G. Merlin and the ERM proteins— regulators of receptor distribution and signaling at the cell cortex. Trends Cell Biol. 19, 198-206 (2009); Bretscher, A., Edwards, K. & Fehon, R.G. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol. 3, 586-99 (2002); Solinet, S.
- ERM protein Moesin binds to and stabilizes microtubules at the cell cortex. J Cell Biol. 202, 251-60 (2013); Morales, F.C., Takahashi, Y., Kreimann, E.L & Georgescu, M.M. Ezrin-radixin- moesin (ERM)-binding phosphoprotein 50 organizes ERM proteins at the apical membrane of polarized epithelia. Proc Natl Acad Sci. 101, 17705-17710 (2004); Fouassier, L., Yun, C.C., Fitz, J.G.& Doctor, R.B.
- EBP50 ezrin-radixin-moesin- binding phosphoprotein 50
- Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol. 140, 647-657 (1998); Gary, R. & Bretscher, A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell. 6, 1061-75 (1995)) and expressed in a tissue-specific manner (Fehon, R.G., Mclatchey, A.I. & Bretscher, A.
- Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol. 140, 647-657 (1998); Gary, R. & Bretscher, A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell. 6, 1061-75 (1995)).
- ERM proteins Upon phosphorylation at a particular C-terminus site (Thr558 for moesin or Thr576 and Thr564 for ezrin and radixin, respectively), ERM proteins become activated by unfolding to expose the masked binding sites and allowing the proteins bind to EBP50 and F-actin (Fievet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. 1773, 653-560 (2007); McClatchey, A.I. ERM proteins at a glance. J Cell Sci. 127:3199-204 (2014); Neisch, A.L & Fehon, R.G.
- Ezrin, Radixin and Moesin key regulators of membrane-cortex interactions and signaling. Curr Opin Cell Biol. 23, 377-82 (2011); Solinet, S. et al. The actin-binding ERM protein Moesin binds to and stabilizes microtubules at the cell cortex. J Cell Biol. 202, 251-60 (2013); Morales, F.C., Takahashi, Y., Kreimann, E.L & Georgescu, M.M. Ezrin-radixin-moesin (ERM)-binding phosphoprotein 50 organizes ERM proteins at the apical membrane of polarized epithelia. Proc Natl Acad Sci.
- piRNAs are expressed in somatic human bronchial epithelial cells and the expression patterns are distinctive between normal bronchial epithelial cells and lung cancer cells.
- piRNA-Like-163 piR-L-163 (SEQ ID NO:282)
- p-ERM phosphorylated ERM
- RNAs ranging approximately from 25 to 33 bases were used for library construction (Fig. la-c and Table 2) based on previous reports (Aravin, A. et al. A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442, 203-207 (2006); Grivna, S.T., Beyret, E., Wang, Z. & Lin, H. A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20, 1709-1714 (2006); Watanabe, T. et al.
- RNA-seq was performed and resulted in approximately 4.5 million reads with >99 of the reads between 26 and 32 bases (Fig. 7a), and approximately 50% of the reads mapped to >2 loci in the human genome sequences (Fig. 7b), indicating that the piRNA reads captured a nontrivial portion of piRNA diversity (Ruby, J.G. et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193-1207 (2006)).
- a total of 555 piRNAs between 26 and 32 bases were called based on >20 reads of individual piRNA in any of the cell lines. These piRNAs are distributed among chromosomal and mitochondrial genomes with bias in chromosomes 1 and 6 (Fig. 2a and 2b; Fig. 8a). Consistent with previous reports, 99% of the piRNAs are mapped to intergenic regions (64%) or introns (35%) and 1 % to exons (Gan, H. et al. piRNA profiling during specific stages of mouse spermatogenesis. RNA 17, 1191— 1203 (2011); Robine, N. et al. A broadly conserved pathway generates 3'UTR- directed primary piRNAs. Curr. Biol.
- piRNA and piRNA- L expression patterns were firstly used in an unsupervised hierarchy clustering analysis for the 11 cell lines. NSCLC lines and HBE lines can be clearly clustered together based on the expression patterns of the entire piRNAs and piRNA-Ls (Fig. 2c) as well as piRNAs or piRNA-Ls individually (Fig. 2d, e).
- piRNA-L-163_igs (in brief as piR-L-163 (SEQ ID NO:282)) is a piRNA-L aligned to intron 10 of LAMC2 gene on Chromosome 1 and the top commonly down-regulated piRNA-L in NSCLC cell lines (Fig. 3a; Fig. 11a, b).
- piR-L-163 (SEQ ID NO:282) carries a 3 terminal 2'-0-methylation, a characteristic feature of piRNA (Luteijn, M.J. & Ketting, R.F. PIWI- interacting RNAs: from generation to transgenerational epigenetics. Nat Rev Genet. 14, 523-534 (2013); Houwing, S., et al. A Role for Piwi and piRNAs in Germ Cell Maintenance and Transposon Silencing in Zebrafish. Cell 129, 69-82 (2007); Kirino, Y. & Mourelatos, Z. Mouse Piwi-interacting RNAs are 2[prime]-0- methylated at their 3[prime] termini.
- piR-L-163 (SEQ ID NO:282) plays a functional role in human bronchial epithelial cells.
- HBE4 cells as well as primary normal human bronchial epithelial (NHBE) cells with piR-L-163 complementary DNA oligonucleotides (Ant- 163) (SEQ ID NO:496) or RNA oligonucleotides (Ant-163R) (SEQ ID NO:497) in the experiment.
- the RNA oligonucleotides triggered a siRNA like response as expected (Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.
- piR-L-163 was not localized in the nucleus as expected for piRNAs (Siomi, M.C., Sato, K., Pezic, D. & Aravin, A.A. PrWI-interacting RNAs: the vanguard of genome defence. Nature 12: 246-258 (2011)), but predominantly located in cytoplasm during interphase, moved into the cell cortex in metaphase, and concentrated on junctions of cell division in anaphase (Fig. 3g).
- piRNAs are believed to function as a PlWI-binding and sequence-dependent epigenetic regulator (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014)).
- piR-L-163 binds to p-ERM and regulates p-ERM activity
- piR-L-163 plays a biological role through interaction with proteins.
- biotin- conjugated piR-L- 163 RNA oligonucleotides were used as a bait to pull down cellular binding proteins in HBE4 cells.
- Scr control RNA we revealed two protein bands predominantly presented in the piR-L-163 pull down product (Fig. 4a).
- IP immune -precipitation
- piR-L-163 only binds to functionally activated p-ERM proteins but not the inactive form of ERM.
- Drosophila wild type (Moe-WT-GFP) moesin which shares an identical C-terminal motif with human moesin containing the p-Thr site (Polesello, C, Delon, I., Valenti, P., Ferrer, P. & Payer, F. Dmoesin controls actin-based cell shape and polarity during Drosophila melanogaster oogenesis. Nat Cell Biol.
- the HBE4 cells expressing these transgenes were treated with dsRNA specifically targeting the 3' untranslated region (UTR) of the endogenous moesin RNA to reduce the endogenous moesin level (Fig. 4e). Because all the proteins generated from transfected Drosophila moesins contained GFP, an anti-GFP antibody was used to pull down the fusion proteins and to determine whether the IP products containing piR-L-163, an indication of their binding with piR-L-163.
- piR-L-163 was only detected in the IP products from Moe-WT-GFP and Moe- TD-GFP transfected cells but not Moe-TA-GFP transfected cells (Fig. 4f), supporting the notion that the threonine phosphorylation is critical for the binding between piR- L-163 and moesin.
- the amount of Moe-TA-GFP pull downed in the IP product was much lower than that of Moe-WT-GFP (Fig. 4f). It is likely due to difference in the protein conformation of Moe-TA-GFP because the mutation prevented the specific amino acid from phosphorylated, which resulted in a weakened binding affinity between the fusion protein and the anti-GFP antibody.
- H1792 cells were transfected with Scr (control), Ant- 163, piR-L-163 (WT), or Mutant 1 (Ml) to Mutant 5 (M5) RNA oligonucletides, respectively.
- An anti-p-ERM antibody was used for IP followed by RT-PCR using primers specific for Scr, Ant- 163, piR-L-163, or M1-M5 (Table 6) to detect the corresponding oligonucleotides.
- H522 cells expressed extremely low level of endogenous p-ERM (Fig. 5c) and very low level of piR-L-163 (Fig. 11a).
- H522 cells transfected with piR-L-163 were simultaneously transfected with either Moesin-WT or Moesin-DM to determine the potential binding ability of the introduced moesin proteins with piR-L-163.
- piR-L-163 is critical for ERM' s functional activities
- EBP50 EBP50
- C-ERMAD and FERM domain Fouassier, L., Yun, C.C., Fitz, J.G.& Doctor, R.B. Evidence for ezrin-radixin- moesin-binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions. J Biol Chem. 275, 25039-25045 (2000); Turunen, O., Wahlstrom, T. & Vaheri, A. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J Cell Biol.
- HBE4 cells treated with Ant- 163 showed a significantly increased invasion capability compared to cells treated with Scr control, even after 15% downward adjustment for the cells treated with Ant- 163 to compensate the possible increase of the cell number after 12 hrs (Fig. 6a).
- H1792 cells transfected with piR-L-163 exhibited a significantly decreased invasion capability compared to the cells treated with a control RNA oligonucleotides (Fig. 6b).
- the cells transfected with either Ant- 163 or a mutant piR-L-163 showed no impact to the cells' invasion capability (Fig. 6b).
- HBE4 cells treated with Ant- 163 exhibited significantly increased cell migration compared to the cells treated with Scr control (Fig. 6c).
- H1792 cells transfected with piR-L- 163 showed significantly decreased cell migration compared with the cells treatment with Scr or Ant- 163 (Fig. 6d).
- HBE4 cells treated with Ant- 163 showed a faster gap closure than the cells treated with Scr control (Fig. 6e).
- H1792 cells transfected with piR-L-163 showed a slower gap closure compared to cells transfected with Scr control, Ant- 163 or a mutant piR-L-163 (Fig. 6f).
- piRNAs/piRNA-Ls play certain biological roles and are involved in lung tumorigenesis because the expression patterns are distinctive between normal bronchial epithelial cells (HBEs) and lung cancer cells. Furthermore, different expression patterns were also observed between adenocarcinomas and squamous cell carcinomas. Although this study did not focus on potential applications of piRNAs/piRNA-Ls for patients with lung cancer, our data suggest that piRNAs/piRNA-Ls may be a new class of molecules potentially useful as biomarkers for cancer classification as well as therapeutic targets.
- piR-L-163 binds directly to p-ERM and regulates ERM functional activities is unexpected and mechanistically important.
- Our data demonstrate a dynamic interaction between piR-L-163 and p-ERM in subsequent functional activities reflected to cell proliferation, migration and invasion. It should be noted, however, that other factors might also be involved in addition to ERM for piR-L-163 mediated impact in cell proliferation, migration and invasion. Further studies will be necessary to address these issues. Nevertheless, this is the first time that a sncRNA is revealed to participate in a protein functional regulation through a direct interaction with the protein in mammalian cells, in this case, through piR-L-163 binding to p-ERM.
- Human NSCLC cell lines H157, H226, H596, SK-MES-1 , H522, H1437, H1792 and H1944 were obtained from ATCC (Manassas, VA, USA) and cultured in RPMI 1640 with 10% FBS (Sigma- Aldrich).
- Human HBE cell lines (HBE2, HBE3 and HBE4) were provided by Dr. John D. Minna (University of Texas Scontaminated Medical Cancer, Dallas, Texas) and cultured in Keratinocyte-SFM with L-Glutamine, prequalified human recombinant Epidermal Growth Factor and Bovine Pituitary Extract (BPE) (Life Technology). All the cell lines were genotyped for their authentication (the test was done on October 24, 2014). Mycoplasma contaminations were regularly tested and the cells were routinely treated to prevent mycoplasma growth.
- sncRNAs ( ⁇ 200 nt) were firstly separated from total RNA, and then piRNAs were purified from sncRNA in one nucleotide resolution gel. The entire process consisted of total RNA extraction, sncRNA separation, piRNA separation and piRNA enrichment. For total RNA extraction, mirVanaTM miRNA isolation kit (Ambion) was used according to the manufacturer's instructions. For sncRNA separation, extracted total RNAs were separated using Craig C. Mello Lab's sncRNA cloning protocols (Gu W and Conte D.
- piRNAs were separated on 15% denaturing acrylamide gel with following specific steps: Prepared gel by mixing the following reagents in 50mL tube: 6.3g Urea (Fish Scientific), 1.5mL ⁇ (Life technology), 5.6mL 40% Acrylamide (Bio-Rad), and 3mL Nuclease-free water (Quality Biological); Stirred at RT until urea is completely dissolved, then added 75ul of 10% AP (Sigma-Aldrich) and 15 ⁇ 1 of TEMED (Bio-Rad), mixed well and loaded into the electrophoresis shelf to form gel; Pre-run gel in lxTBE for 20 min at 300V; Heated samples and markers at 75 °C for 5 min, and put them immediately on ice; Run the samples at 300V for 35 min; Stained the gel with 0 ⁇ g/ml Ethidium Bromide (EB, Sigma-Aldrich) in a clean container for 2-3 min, carefully cut out the target band with a scalpel using UV light for visual
- piRNAs were pelleted using a modified protocol of True ® Small RNA for sequence preparation (Illumina): Punctured the bottom of a sterile, Nuclease-free, 0.5mL micro centrifuge tube 3-4 times with a 21 -gauge needle; Placed the target band into punctured tube, and put the tube into a new 1.5mL EP tube; Centrifuged the stacked tubes in 20,000 x g in a micro centrifuge for 2 min at RT to move the gel through the holes into the 1.5 ml tube, and ensured that the gel was completely moved into the bottom tube; Added 300 ⁇ 1 of Nuclease-free water to the gel debris, and eluted the DNA by shaking the tube overnight at RT followed by transfering to the top of a 5 ⁇ filter, and centrifuged the filter for 10 sec in 600 x g; Added the following reagents to the collected fluid: 2 ⁇ 1 Glycogen (Invitrogen), 30 ⁇ 1 3M NaAc (In
- RNA-seq was performed using Illumina sequencer in the University of Maryland Institute for Genome Sciences.
- sncRNAs from HBE4 cells or synthetic RNA was dissolved in 25 ⁇ of lOmM NaI0 4 , kept at 4°C for 40 min in dark room; RNAs were precipitated and the pellet was dissolved in 60 ⁇ 1 of 1M L-Lysine (PH8.5, Sigma-Alrich), and kept the tube at 45°C for 90 min; RNAs were precipitated and dissolved in Nuclease-free water; Separated the RNAs on 15% denaturing acrylamide gel; For positive control, stained the gel with EB in a clean container for 2-3 min, then took photos (UVP, BioSpectrum ® AC imaging system); For sncRNAs extracted from HBE4 cells, transferred the gel to Zeta-Probe ® Membrane (Bio-RAD) in 0.5xTBE for 60 min at 80V for Northern blot after UV cross-linking (UV Stratalinker 2400, Stratagene).
- GGTCAGAGAATCAAAGTAACATCATGATAT-3' (SEQ ID NO:498) (Synthesized by IDT).
- Chemically synthesized oligonucleotides were labelled with ⁇ - 32 P-ATP with T4 polynucleotide Kinase (Thermo Scientific). Briefly, separated labeled oligonucleotides from unincorporated label by gel filtration on NucAwayTM Spin Columns (Ambion), and 10k cpm of 32 P labeled oligonucleotides was used for each reaction; Pre-wash the membrane in O.
- RNA oligonucleotides (5'Biosg/AUAUCAUGAUGUUACUUUGAUUCUCUGACC-3') (SEQ ID NO: 502) was used and scrambled RNA
- Protein extracts from lxlO 7 cells using HKMG lysis buffer (lOmM HEPES pH 7.9, lOOmM KCL, 5mM MgC12, 10% glycerol, ImM dithiothreitol, 0.1 % NP40) with protease and phosphatase inhibitors (Roche) were incubated with ⁇ g biotin- labeled RNA for 16 hr at 4°C with rotation after pre-clearing with streptavidin beads, then coupled to ⁇ 50% of streptavidin agarose beads (Sigma- Aldrich).
- biotin-labeled oligonucleotide-coupled streptavidin beads were washed four times with HKMG lysis buffer. Samples were denatured in SDS protein loading buffer before running on a SDS-acrylamide gel.
- anti-Moesin Clone Q480, Catalog No. 3150, Cell Signaling
- anti-p-ERM Clone 41A3, Catalog No. 3149, Cell Signaling
- GFP antibody (Clone GSN149, Catalog No. G1546, Sigma- Aldrich)
- Moesin mutants of Drosophila were used to test piR-L-163 binding ability.
- Protein extracts were prepared from cells at 48 hrs after plasmids transfection.
- GFP saturated protein G agarose beads were added to the pre-cleared extracts; RNA precipitation, adaptor ligation, reverse transcription and PCR were performed as described above.
- the target band for mass spectrometry was performed.
- the specific protocol is as follows: Selected gel bands were excised from the one-dimensional SDS- polyacrylamide gel electrophoresis gel, cut into lXlmm cubes and destained in 50% acetonitrile in lOOmM NH4HC03. Gel pieces were reduced with lOmM tris (2- carboxyethyl) phosphine hydrochloride Q22 (Thermo Scientific) in lOOmM NH4HC03 for 60min at 56 °C, and were alkylated with 55mM iodoacetamide (Sigma) in lOOmM NH4HC03 for 1 h at room temperature in the dark.
- the gel pieces were dehydrated with 100% acetonitrile and dried using a speed vacuum of Q23 1.5 mg of trypsin (Promega), and a volume of 50mM NH4HC03 was added to each gel piece and the gel pieces were allowed to swell for 30 min on ice. Excess trypsin was removed and replaced with 50mM NH4HC03 and samples were incubated at 37 1C overnight. The resulting peptides were extracted using 2.5% formic acid, 50% acetonitrile in 50mM NH4HC03.
- the processed samples were analyzed using a nanoscale reverse-phase liquid chromatography using an Xtreme Simple nanoLC system (CVC/Q24 MicroTech).
- the analytical column was prepared by packing into a laser-pulled fused silica capillary, and peptides were injected into the sample loop using an Endurance auto sampler.
- a 120-min liquid chromatography-gradient method with a post-split flow rate of 0.6 ml/min was used to elute Q25 the peptides into the LTQ mass spectrometer with a nanospray ionization source.
- Dynamic exclusion was enabled with repeat count 2, repeat duration 30 s and exclusion duration 120 s.
- Mass spectrometry and tandem Q26 mass spectrometry data were searched against the UniProtKB human protein database using Bioworks 3.3.1 SP1 with the SEQUEST algorithm. Search parameters included 1.5 Da peptide mass tolerance, 1.0 Da fragment tolerance, static Cys + 57.02510 (carbamidomethylation) modification and differential modification Met-i- 15.99492. Fully tryptic peptides with up to two missed cleavages and charge- state-dependent cross-correlation scores >2.5, 3.0 and 3.5 for 2+, 3+ and 4+ peptides, respectively.
- RNA targeting untranslated region (UTR) of human Moesin (5'-CCGUUAGCAGGAAGCCUAA-3') (SEQ ID NO:504) with scrambled sequence as a control (5- GAUACCAAGGGACAUACGCUU-3 ') (SEQ ID NO:505).
- Sense and anti-sense oligo RNAs of Moesin and scrambled control were annealed, respectively.
- Transfection is performed using Lipofectamine TM RNAiMAX (Invitrogen) according to its manual, and the final concentration of annealed oligo RNAs is 400nM. Transfection and knockdown efficiency were tested at both RNA and protein levels.
- piR-L-163 expression To avoid triggering uncertain siRNA (Lamb, R.F. et al. The TSCl tumour suppressor hamartin regulates cell adhesion through ERM proteins and the GTPase Rho. Nat Cell Biol. 2, 281-287(2000)), complementary DNA was used as antagonism targeting piR- 163 (5 ' -GGTCAGAGAATCAAAGTAAC ATC ATGATAT-3 ') (SEQ ID NO:496) with scrambled DNA (5 ' -GATACC AGGGAC ATACGCTTGATCCTAGC-3 ') (SEQ ID NO: 506) as a control.
- Cell cycle distribution was analyzed by Flow Cytometry (Becton-Dickinson). Cells were synchronized in growth factor-free Keratinocyte-SFM with 2mM Thymidine (Catalog No.T1895, Sigma- Aldrich) for 24 hrs. Transfection is performed using Lipofectamine TM RNAiMAX (Invitrogen) according to its manual, and the final concentration of annealed oligo RNAs is 400nM. Four hour after transfection, culture medium was replaced by complete Keratinocyte-SFM supplemented with L- Glutamine, prequalified human recombinant EOF 1-53 and BPE.
- MTT MTT
- trypan blue exclusion assay cells were washed in PBS for three times, and dyed in 0.4% tyrpan blue solution. Unstained viable cells were counted in hemocytometer chamber under microscope. Each experiment was performed three times independently.
- 6xl0 4 cells were placed in the upper chamber of Matrigel Invasion Chambers (BD Bioscience) with growth factor-free Keratinocyte-SFM and the bottom chamber were exposed to Keratinocyte-SFM medium supplemented with L-Glutamine, prequalified human recombinant EOF 1-53 and BPE.
- Invading cells were evaluated after 12 hrs according to the manufacturer's instruction. The numbers of invading cells were adjusted 15% downwards for Ant- 163 treated cells or 15% upwards for piR-L-163 treated cells to compensate the differences for the proliferation rates.
- InnocytoTM Cell migration Assay kit (EMD Millipore) was used. Briefly, 24 hrs after treatment, lxlO 5 cells (10% less for Ant- 163 treated cells or 10% more for piR-L-163 treated cells) were loaded to the upper chamber with growth factor-free Keratinocyte-SFM for (HBE4 cells) or serum-free DMEM (for HI 792 cells) with the bottom chamber exposed to completed culture medium. Negative controls were used with 3 ⁇ Latrunculin A. After 12 hrs incubation, fluorescence was measured using a fluorescence plate reader 485nm (excitation) and 520nm (emission) according to the manufacturer's instruction.
- the sequencing reads from each of the 11 samples were individually processed and aligned to the human reference (build hgl9) using Bowtie 0.12.9 (Langmead, B., Trapnell, C, Pop, M. & Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009)).
- In-house Perl scripts were used to detect piRNAs expression based on genomic coverage after using a cut-off of 30x across a minimum length of 26bp regions.
- a piRNA prediction tool (Zhang, Y., Wang, X. & Kang, L. A k-mer scheme to predict piRNAs and characterize locust piRNAs.
- HTSeq (Anders, S., Pyl, P.T. & Huber, W. HTSeq - A Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166-169 (2015)) was used to compute read counts across each piRNA in each of the 11 samples which in turn were used as input to the R package DESeq (Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010)). DESeq was used to normalize the read counts for library size and dispersion followed by tests for differential piRNA expression between the Immortalized and Adenocarcinoma cell line and the Immortalized and Squamous cell line. The significant differentially expressed piRNA (the unknown piRNAs are referred as piRNA-Ls in the text) were determined using an FDR cut-off ⁇ 0.05 and at least two-fold change between conditions.
- RNA-seq analysis was added to RNAs of individual cell lines to allow identify the origins of the RNAs for RNA-seq analysis.
- piR163-L-Bio (SEQ ID NO: 502) for IP m is 2-0- methyl
- ControlBio (SEQ ID NO: 503) IP control Bio is Biotin Antl63 GGTCAGAGAATCAAAGTAACATCATGATAT (SEQ ID NO:496) for blocking piR-L-163
- piRcon GATACCAGGGACATACGCTTGATCCTAGC SEQ ID NO: 506
- m is 2-0- methyl rArUrUrUrCrArUrGrArUrGrUrUrArCrUrUrUrGrArUrUrCrUrGrArCrUrCrUrGrArCmC (SEQ ID NO:522) interaction study m is 2-0- methyl rArUrUrUrCrArUrGrArUrGrUrUrArCrUrUrUrGrArUrUrCrUrGrArCmC (SEQ
- CpiR163-L- DigN / 5 DigN/ GGTC AG AGA ATC A AAGT A AC ATC ATG ATAT (SEQ ID NO:525) for FISH DigN is Digoxin piR163-L-F ATATCATGATGTTACTTTGATTCTCT (SEQ ID NO:526) for PCR or QPCR
- piR163-L- M2F ATATCATGATGTTACGAC (SEQ ID NO: 530) for piR-L-163M2 amplification
- MoesinVF2 (SEQ ID NO:536) for human Moesin plasmid constraction
- MoesinVR2 (SEQ ID NO : 537) for human Moesin plasmid constraction
- GAPDHF TGCACCACCACCAACTGCTTAGC (SEQ ID NO: 538) inner control for coding gene QPCR
- GAPDHR GGCATGGACTGTGGTCATGAG (SEQ ID NO:539) inner control for coding gene QPCR moesinFl GGGAAGCAGCTATTTGACCA (SEQ ID NO:540) for QPCR
- LAMC2F1 CTACTTCGGGGACCCATTG (SEQ ID NO:554) for QPCR
- Cisplatin upregulates piRNA-L-138 which confers cisplatin-resistance by inhibiting apoptosis in lung squamous cell carcinoma
- piRNAs PlWI-interacting RNAs
- sncRNAs short non-coding RNAs
- sncRNAs short non-coding RNAs
- piRNA-Ls piRNA-Like sncRNAs
- NSCLC non-small cell lung cancer
- piRNA-L-138 a piRNA-L down-regulated in NSCLC cells
- CDDP cisplatin
- Blocking piR-L-138 by an antisense oligo (Ant-138) (SEQ ID NO:556) resulted in an increased apoptosis and a reduced cleavage of MDM2 in CDDP-treated SCC cells.
- exogenously transfecting piR-L-138 into SCC cells accelerated MDM2 cleavage.
- piR-L-138 was found in the same complex with cleaved 60kD MDM2 isoform in CDDP-treated SCC cells.
- the interaction between piR-L-138 and the MDM2 isoform was further confirmed visually by co-localization of the two molecules within individual cells.
- PDX patient- derived xenograft
- CDDP-based chemotherapy resulted in an increased piR-L-138 expression.
- a significantly increased apoptosis was observed in tumor regions locally delivered Ant- 138.
- upregulating piR-L-138 as a novel mechanism of CDDP resistance in lung SCC and potentially targetable to overcome the resistance.
- piRNAs are primarily investigated for their functions in renewal of germ line cells and development (Lin, H. & Spradling, A. C. A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124, 2463-2476 (1997); Cox DN, et al. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev. 12, 3715-3727 (1998); Girard, A., et al. A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442, 199-202 (2006); Brennecke J, et al.
- RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128, 1089-1103 (2007); Shirayama M. et al. piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell 150, 65-77 (2012); Lee H. C. et al. C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts. Cell 150, 78-87 (2012); Ashe A. et al. piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell 150, 88-99 (2012)).
- Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl-XL pathway.
- piRNA-Ls sncRNAs
- piRNA-Ls play a role in chemo-sensitivity
- 11 piRNA-Ls differentially expressed between NSCLC and HBE cells (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)) and analyzed the relationship between the expression levels and the sensitivities to chemotherapeutic agents commonly used clinically for patients with NSCLC.
- Mdm2 affects genome stability independent of p53. Cancer Res. 69, 1697-701 (2009); Zhang, Z., Li, M., Wang, H., Agrawal, S., and Zhang, R. Antisense therapy targeting MDM2 oncogene in prostate cancer: Effects on proliferation, apoptosis, multiple gene expression, and chemotherapy. Proc. Natl. Acad. Sci. 100, 11636-11641 (2003); Zhang Z, Wang H, Li M, Agrawal S, Chen X, Zhang R. MDM2 Is a Negative Regulator of p21WAFl/CIPl , Independent of p53. /. Biol. Chem.
- FISH fluorescence in situ hybridization
- tumors treated with CDDP and Ant-138 exhibited higher expression of cleaved caspase 3 (Fig. 17c), an indication of enhanced apoptotic process by inhibiting piR-L-138 induced by CDDP treatment.
- Further analysis using due-immunofluorescence staining showed a significantly concentrated caspase 3 positive tumor cells in areas with high levels of Ant-138 (Fig. 17d and 17e).
- piR-L-138 a short non-coding RNA, up-regulated upon CDDP administration interacts with MDM2 onco-protein to increase its degradation and contributes to inhibition of apoptosis.
- Targeting piR-L-138 can improve the sensitivity of lung SCC to CDDP treatment in both in vitro and in vivo, which warrants further testing to determine its clinical utility for patients with lung SCC.
- sncRNAs were separated from total RNA using one-nucleotide-resolution PAGE gels and processed using the True® Small RNA kit. sncRNAs purification, adaptor ligation and reverse transcription for PCR or RT-PCR are described in the Methods. Mass spectrometry, oligonucleotide precipitation assay, IP, FISH, Western blot, apoptosis and cell cycle distribution assay, DNA or RNA transfection, animal model establishment etc., were performed as described in the Methods.
- RT-PCR was performed to amplify the phosphor-protein binding RNAs. RT-PCR of the IP products showed two clusters of bands with approximately 300 and 150 nt respectively (Fig.
- the average copy numbers were 400-600 per unique sncRNA but 83 sncRNAs >5,000 copies for individual libraries. While the same amount of cellular proteins were used for each IP experiment, the total reads were twice as much in the libraries from HBE cells compared with those detected in libraries from lung SCC cells in all three IP pull-downs with antibodies against different phosphor amino acids, suggesting the presence of more and abundant sprRNAs in HBE cells than the cancerous SCC cells. After normalization using equal number of reads for each library, 1,825 unique sncRNAs were found in the library of HBE cells when an anti-phosphor- Tyr antibody was used for IP compared to 1,669 unique sncRNAs detected in the library of lung SCC cells.
- a piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun. 6:7316, 2015) were among the unique sncRNAs identified in HBE cells and 50% of the piRNA-Ls identified in lung SCC cells. The higher number of sncRNAs identified in the later experiment is probably due to the enrichment by the protein binding and the expanded range of size beyond 35 nt. In a distribution analysis, the unique sncRNAs (candidate sprRNAs) were peaked around 32 nt and 50 nt (Fig. 22). Another interesting finding is that about 70% of the unique sncRNAs were mapped to exons (30%) or introns (40%) with less than one third mapped to intergenic regions.
- RNAs were extracted from cytoplasm and nucleus of HBE2 and HBE4 cells respectively (Fig. 24b) and used for cDNA synthesis.
- the primer sets were used to amplify the pri- and pre-sprRNAs in each of the samples.
- the pri- and pre-sprRNAs could only be detected in RNAs extracted from nucleus (Fig. 24c), suggesting the early biogenesis likely occurs in nucleus.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Cell Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides isolated nucleic acid molecules comprising short non-coding protein regulatory RNAs (sprRNA), variants, fragments and inhibitors thereof and compositions and methods of using the same.
Description
Short Non-Coding Protein Regulatory RNAs (sprRNAs) and Methods of Use
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Appl. No.: 62/068,106, filed October 24, 2014. The content of the aforementioned application is relied upon and is incorporated by reference in its entirety.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
Incorporated by reference in its entirety herein is a computer-readable sequence listing submitted concurrently herewith and identified as follows: One 428,242 Byte ASCII (Text) file named "Sequence_listing.txt," created on October 24, 2015.
FIELD OF THE INVENTION
The present invention generally relates at least to the fields of medicine, molecular biology and cancer therapeutics.
BACKGROUND OF THE INVENTION
The concept of the "RNA World," referring to a period of time in primitive earth' s history when the primary living substance was RNA or something chemically similar, is gaining support by research data (Higgs PG, Lehman N. The RNA World: molecular cooperation at the origins of life. Nat Rev Genet. 6(1):7-17, 2015. PMID: 25385129). These molecules are believed to carry out most of the information processing and metabolic transformations necessary for life, supporting the functional importance of RNA molecules without translation. New discoveries have expanded roles of non-coding RNAs (ncRNAs) in physiological and disease processes in organisms including humans, which improved our understanding of the molecular basis of life and redefined rules for RNAs (Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 157:77-94, 2014.). With tens of thousands functionally uncharacterized ncRNAs expressed in mammalian cells, it is not unreasonable to anticipate that new functions or rules of RNAs may further
emerge to better understand RNA biology in addition to the basic DNA-RNA-proteins rule in today's life.
While ncRNAs don't translate into proteins or peptides, they are functional RNA molecules. Many ncRNAs are highly abundant in mammalian cells and functionally important, such as tRNAs, rRNAs, snoRNAs, and more recently characterized long ncRNAs (IncRNAs) and short ncRNAs (sncRNAs) which include microRNAs, siRNAs and piRNAs (Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge new ones. Cell. 157:77-94, 2014.). The functions of ncRNAs are very broad from enzymatic activities of rRNAs and snRNAs, to mRNA expression targeting of siRNAs, to mRNA translation targeting of miRNAs, to transposon suppression of piRNAs in both physiological and pathological conditions (Gomes AQ, Nolasco S, Soares H. Non-coding RNAs: multi-tasking molecules in the cell. Int J Mol Sci. 14(8): 16010-39, 2013.). However, the biological functions of most newly identified ncRNAs have not been tested or validated. Therefore, the roles of these ncRNAs in cellular biology require further investigation.
The biogenesis processes of miRNAs and siRNAs are under tight temporal and spatial control and have been well established. In mammals, both miRNAs and siRNAs are processed similarly by two RNase III proteins (Drosha and Dicer) in the nucleus and cytoplasm, respectively, followed by modifications through RNA editing, Argonaute loading and RNA decay, although the differences of the origin and precursors (Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature 431 :343-349, 2004; Ha M, Kim N. Regulation of microRNA biogenesis. Nat Rev Mol Cell Biol 15(8):509-24, 2014; Carthew RW, Sonttheimer EJ. Origins and mechanisms of miRNAs and siRNAs. Cell 136:642-655, 2009). Mature piRNA sequences are surprisingly diverse between different organisms, even between closely related species. piRNA biogenesis pathways in different organisms also appear to be diverse, and are distinct from those of miRNAs or siRNAs (Das PP, Bagijn MP, Goldstein LD, Woolford JR, Lehrbach NJ, Sapetschnig A, Buhecha HR, Gilchrist MJ, Howe KL, Stark R et al. Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the Caenorhabditis elegans germline. Mol Cell 31 :79-90, 2008; Houwing S, Kamminga
LM, Berezikov E, Cronembold D, Girard A, van den Elst H, Filippov DV, Blaser H, Raz E, Moens CB et al. A role for piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell 129:69-82, 2007; Vagin VV, Sigova A, Li C, Seitz H, Gvozdev V, Zamore PD. A distinct small RNA pathway silences selfish genetic elements in the germline. Science 313:320-324, 2006.). piRNAs are predominantly expressed in germline cells or tissues but recent studies have shown their expression in somatic cells or tissues, suggesting unrecognized functionalities of these molecules in adult tissues. While the biogenesis of human piRNAs is poorly understood, its complexity is expected based on studies of other species. The mouse genome encodes 3 piwi proteins whereas 4 are found in human (Carmell MA, Girard A, van de Kant HJG, Bourc'his D, Bestor TH, de Rooij DG, Hannon GJ. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell 12:503-514, 2007; Deng W, Lin H. miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell 2:819- 830, 2002; Kuramochi-Miyagawa S, Kimura T, Ijiri TW, Isobe T, Asada N, Fujita Y, Ikawa M, Iwai N, Okabe M, Deng W et al. Mili, a mammalian member of piwi family gene, is essential for spermatogenesis. Development 131 :839-849, 2004.). These proteins express at different stages in development and associate with distinguishable subsets of piRNAs (Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in Mice Mol Cell 31 :785-799, 2008; Aravin A, Gaidatzis D, Pfeffer S, Lagos-Quintana M, Landgraf P, Iovino N, Morris P, Brownstein MJ, Kuramochi-Miyagawa S, Nakano T et al. A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442:203-207, 2006; Girard A, Sachidanandam R, Hannon GJ, Carmell MA. A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442: 199-202, 2006) and may participate in different biogenesis. For example, pachytene piRNAs originate from distinct intergenic loci and associate with MILI and MrWI, transcription factor A- MYB, POL II and PLD6 (19. Aravin AA, Sachidanandam R, Bourc'his D, Schaefer C, Pezic D, Toth KF, Bestor T, Hannon GJ. A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in Mice, Mol Cell 31 :785-799, 2008; Li XZ, Roy CK, Dong X, Bolcun-Filas E, Wang J, Han BW, Xu J, Moore MJ,
Schimenti JC, Weng Z et al. An ancient transcription factor initiates the burst of piRNA production during early meiosis in mouse testes. Mol Cell 50:67-81, 2013). The mouse MIWI- and MILI-associated sequence tags showed an association with 3' end extended sequences (Vourekas A, Zheng Q, Alexiou P, Maragkakis M, Kirino Y, Gregory BD, Mourelatos Z. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nat Struct Mol Biol 19:773-781 , 2012), indicating that 5' end processing and incorporation of the 5' U into the MID domain of the Piwi protein occur first. This is likely followed by 3 ' end trimming by an unidentified exonuclease, by 3' end 2'-0-methylation of the piRNA by the mouse homolog of HENl and, finally, by binding of the 3' end by the PAZ domain of the Piwi protein (Kirino Y, Mourelatos Z. The mouse homolog of HENl is a potential methylase for Piwi-interacting RNAs. RNA 13: 1397-1401 , 2007; Kirino Y, Mourelatos Z. Mouse Piwi-interacting RNAs are 2"-Omethylated at their 3" termini. Nat Struct Mol Biol 14:347-348, 2007). Tudor domain protein, TDRKH, which interacts with di-methylated MrWI and MrWI2 in mitochondria, has also been implicated in the final 3' precursor maturation step (Saxe JP, Chen M, Zhao H, Lin H. Tdrkh is essential for spermatogenesis and participates in primary piRNA biogenesis in the germline. EMBO J 32: 1869-1885, 2013).
A number of ncRNAs have been shown to exhibit abnormal expression patterns in pathological conditions such as cancerous tissues where specific changes of miRNAs and IncRNAs have been documented to play critical functional roles in the disease processes (Mraz, M.; Pospisilova, S., "MicroRNAs in chronic lymphocytic leukemia: From causality to associations and back," Expert Review of Hematology 5 (6): 579-581, 2012; Pibouin L, Villaudy J, Ferbus D, Muleris M, Prosperi MT, Remvikos Y, Goubin G., "Cloning of the mRNA of overexpression in colon carcinoma- 1 : a sequence overexpressed in a subset of colon carcinomas," Cancer Genet Cytogenet 133 (1): 55-60, 2002; Fu X, Ravindranath L, Tran N, Petrovics G, Srivastava S. "Regulation of apoptosis by a prostate- specific and prostate cancer- associated noncoding gene, PCGEM1 ," DNA Cell Biol 25 (3): 135-41, 2006). For example, miRNAs involved in the large scale regulation of protein-coding genes and are extensively studied in recent years for their potential implications in human diseases such as cancer (Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim
LP, Burge CB, Bartel DP. "The widespread impact of mammalian MicroRNAs on mRNA repression and evolution," Science 310 (5755): 1817-21, 2005; Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. "Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs," Nature 433 (7027): 769-73, 2005). Recently, an increased attention has been devoted to IncRNAs. Although the biological functions and mechanisms of IncRNAs are less clear in part due to their length, IncRNAs likely possess multiple functions within a cell or in different cell types. Given the presence of tens of thousands ncRNAs in the human genome alone, it would not be surprising that ncRNAs have many not yet recognized biological functions. If RNAs possess various unrecognized chemical and biological functions in early life, it is also possible that cells might hijack these mechanisms to bypass limits of canonical pathways to achieve survival in physiological and pathological conditions.
Human cancer is a highly diverse disease with more than 100 different forms and is the second leading cause of death in the United States with 576,691 cancer- related deaths in 2011. Lung cancer is the leading cause of cancer-related death both in men and women. Although the national efforts in tobacco control has resulted in a reduced overall lung cancer incidence, the 42 million current smokers and 45 million former smokers in the United States make lung cancer a major healthcare challenge in the decades to come. Genetic and other molecular alterations caused by chronic exposure to tobacco smoke can last for years after smoking cessation. In the United States alone, it is estimated that 224,210 lung cancer patients will be diagnosed with 50% coming from former smokers and 159,260 will die from the disease this year. The number of deaths caused by lung cancer is more than the deaths from prostate, breast and colorectal cancers combined. The 5-year survival rate for patients diagnosed with lung cancer currently stands at a dismal 17% in the United States but much lower in other parts of the world such as < 10% in the United Kingdom.
Lung cancer can be classified morphologically into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) subtypes with approximately 85% as NSCLC. Most NSCLC are either squamous cell carcinoma (SCC) or adenocarcinoma (ADC) and less common forms such as large cell and bronchial
alveolar carcinoma based on histology. The histological classification reflects certain degrees of biologic features of the tumors and is clinically valuable in selecting treatment options. However, each histological subtype consists of a number of distinct subclasses with different underlying biological features which cannot be distinguished morphologically. Conversely, tumors with different histology may have similar underlying molecular features which may classify them biologically to benefit from molecular-based therapies. Therefore, molecular-based classification systems based on underlying biological features of the tumors will certainly provide more accurate and clinically powerful guide for treatment selections.
Clinically, lung patients can be classified into four stages based on conditions of the primary tumors, regional nodal involvement and the presence of distant metastasis. For NSCLC, if patients are diagnosed at earlier stages of the disease, surgery (sometimes radiation) may be effective treatment option. These patients, if successfully treated with surgery or radiation, can expect 50% chance of 5-year survival. Unfortunately, less than 50% of the patients with NSCLC are diagnosed at these earlier stages. Furthermore, many of the patients at these earlier stages may not be suitable for surgery due to locations of the tumors or poor pulmonary/cardiovascular functions. Patients diagnosed at later stages of the disease are rarely curable and have extremely poor survival expectations. Strategies to identify the disease early may improve cure rate and survival. Unfortunately, many of these patients remain vulnerable to develop recurrent or metastatic disease which will require systemic treatment. Current systemic treatment for patients with advanced stage NSCLC or recurrences consists of combinational chemotherapy, radiotherapy (for locally advanced or symptom controls) and molecular targeted therapy.
The benefits of conventional chemotherapy and chemo-radiotherapy therapies have reached a plateau for the patient population. Substantial advances have been made to develop novel strategies targeting key abnormalities in lung cancer based on new knowledge obtained in the past decades. Unfortunately, survival rates of the patients with advanced stage NSCLC have improved only marginally.
Accordingly, what is needed are new therapeutic approaches in the treatment of cancer to improve patient survival, particularly for lung cancer.
This background information is provided for informational purposes only. No admission is necessarily intended, nor should it be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
It is to be understood that both the foregoing general description of the embodiments and the following detailed description are exemplary, and thus do not restrict the scope of the embodiments.
In some aspects, the invention relates to short non-coding protein regulatory RNAs (sprRNAs), variants, fragments and inhibitors thereof and their uses as markers in certain disease states such as cancer, in particular lung cancer. In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof are useful as therapeutic molecules in the treatment of diseases or conditions in subjects.
In one aspect, the present invention provides an isolated nucleic acid molecule comprising an sprRNA, variants, fragments and inhibitors thereof. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486. In some embodiments, the sprRNA is piR-L- 163 (SEQ ID NO:282). In some embodiments, the sprRNA is piR-L-138 (SEQ ID NO:268). In some embodiments, the sprRNA is SEQ ID NO:489. In some embodiments, the sprRNA comprises an sprRNA selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
In another aspect, the invention provides an isolated nucleic acid molecule comprising cDNA of sprRNA, variants, and fragments thereof. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486,
489-494, or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802. In some embodiments, the cDNA
encodes the sprRNA sequence comprising piR-L-163 (SEQ ID NO:282). In some embodiments, the cDNA encodes the sprRNA sequence comprising piR-L-138 (SEQ ID NO:268). In some embodiments, the cDNA encodes the sprRNA sequence comprising SEQ ID NO:489. In some embodiments, the cDNA encodes an sprRNA sequence selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
In another aspect, the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to the sprRNAs or cDNAs of the invention. In one embodiment, the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802. In one embodiment, the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802.
In another aspect, the invention provides a nucleic acid molecule comprising a sequence that is antisense to an sprRNA of the invention. In some embodiments, the invention provides a nucleic acid molecule comprising a sequence that is antisense to a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802. In some embodiments, the invention provides a nucleic acid molecule comprising a sequence that is antisense to a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802. In some embodiments, the nucleic acid molecule comprises Ant-138 (SEQ ID NO:556). In some embodiments, the nucleic acid molecule comprises Ant-163 (SEQ ID NO:496). In some embodiments, the nucleic acid molecule comprises AntiC (SEQ ID NO:558).
In another aspect, the invention provides a pharmaceutical composition comprising an sprRNA, variant, fragment or inhibitor thereof and a pharmaceutically acceptable carrier.
In another aspect, the invention provides a method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA, variant, fragment or inhibitor thereof. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802. In some embodiments, the sprRNA is piR-L-138 (SEQ ID NO:268). In some embodiments, the sprRNA is piR-L-163 (SEQ ID NO:282). In some embodiments, the sprRNA comprises SEQ ID NO:489. In some embodiments, the sprRNA is selected from the group consisting of: i) sprRNA12600 (SEQ ID NO:490); ϋ) sprRNA11568 (SEQ ID NO:491); iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
In some embodiments, the disease is cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, and uterine cancer. In some embodiments, the sprRNA or an inhibitor thereof is administered in combination with one or more additional therapies. In some embodiments, the inhibitor is Ant-138 (SEQ ID NO:556) and the one or more additional therapies are selected from the group consisting of cisplatin, gemcitabine (GEM), docetaxel and combinations thereof. In some embodiments, the inhibitor is AntiC (SEQ ID NO:558). In some embodiments, the condition to be treated is wound healing or tissue degeneration and the inhibitor administered is Ant- 163 (SEQ ID NO:496).
In another aspect, the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs
according to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802 in a subject's sample and comparing it to a control sample.
In another aspect, the invention provides a method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 489-494, or 560-2802 in a sample from a patient comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to one or more of SEQ ID NOS: 1-486, 489-494, or 560-2802.
In another embodiment, the invention provides a method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 489- 494, or 560-2802 in a sample from a patient comprising isolating the sprRNAs from the patient, making complementary DNA from the sprRNAs, and detecting the complementary DNA.
In another embodiment, the invention provides a method of detecting sprRNA, comprising
i) contacting a cell lysate with an antibody that binds one or more proteins;
ii) isolating the components from the cell lysate that bind the antibody; and
iii) detecting the sprRNA from the isolated components.
In some embodiments, the antibody binds phosphor-serine, phosphor-threonine or phosphor-tyrosine proteins. In some embodiments, the sprRNA is any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
In another aspect, the invention provides a method of preventing the binding of a sprRNA to a protein target, comprising contacting the sprRNA and protein target with an inhibitor whereby the inhibitor prevents binding of the sprRNA and protein target. In some embodiments the sprRNA corresponds to one or more of SEQ ID
NOS: 1-486, 489-494, or 560-2802. In some embodiments, the sprRNA is piR-L-163
(SEQ ID NO:282), the protein is an ERM protein and the inhibitor is Ant- 163 (SEQ
ID NO:496). In some embodiments, the sprRNA is piR-L-138 (SEQ ID NO:268), the protein is an MDM2 protein and the inhibitor is Ant-138 (SEQ ID NO:556). In some
embodiments, the sprRNA is selected from the group consisting of: SEQ ID NO:489; sprRNA12600 (SEQ ID NO:490); sprRNA11568 (SEQ ID NO:491); sprRNA7410 (SEQ ID NO:492); sprRNA9378 (SEQ ID NO:493); and sprRNA10698 (SEQ ID NO:494), the protein is a nucleolin protein and the inhibitor is AntiC (SEQ ID NO:558).
In another aspect, the invention provides a method for identifying agonists or inhibitors that modulate binding of sprRNA to a protein target or modulate the biological activity of the sprRNA-protein interaction, comprising contacting the sprRNA and protein with the inhibitor or agonist and detecting whether the inhibitor or agonist affect binding and/or activity of the sprRNA and protein. In some embodiments, the sprRNA corresponds to one or more of SEQ ID NOS: 1-486, 489- 494, or 560-2802. In some embodiments, the inhibitor is an antisense nucleic acid to the sprRNA, variant or fragment thereof.
In another embodiment the present invention relates to a method for diagnosing cancer or tumorigenesis in a patient comprising measuring the levels of piRNA-L- 163 in a patient sample such as blood plasma, serum saliva, sputum or urine compared to a matched sample from a noncancerous patient.
In another embodiment the present invention relates to a method for diagnosing lung cancer or metastasis in a patient comprising measuring the upregulated levels of piRNA-L-163 in a patient sample such as blood plasma, serum saliva, sputum or urine compared to a matched sample from a noncancerous patient.
In another embodiment the present invention relates to a method of detecting the presence or absence of one or more piRNA-L-163 sequences in a sample from the genome of a patient or subject with cancer comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
In another embodiment the present invention relates to a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
In another embodiment the present invention relates to a method of detecting the presence or absence of one or more piRNA-L-163 sequences in a sample from the genome of a patient or subject with lung cancer comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to piRNA-L-163.
In another embodiment the present invention relates to a screening method for identifying inhibitors of cell proliferation in human bronchial epithelial cells comprising identifying molecule(s) which bind piRNA-L-163 and inhibit their function.
In another embodiment the present invention relates to a method for treating cancer or tumorigenesis in a patient comprising introducing into the patients cells an inhibitor molecule which prevents binding of piRNA-L-163 to ERM proteins.
In another embodiment the present invention relates to a kit for diagnosing lung cancer in a human subject comprising a probe comprising a polynucleotide that hybridizes to piRNA-163.
Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
FIG. 1. Flowchart of the protocol used to prepare sncRNAs from the cell lines for RNA-seq. (a) Outlined steps of the preparation, (b) Size-guided sncRNA extraction at one-nucleotide resolution, (c) Secondary sncRNA purification after library construction based on sizes for RNA-seq. The smaller sized products (low band) are likely microRNAs.
FIG. 2. Genome distribution and clustering analysis of piRNAs and piRNA- Ls expressed in HBE and NSCLC cells, (a) Distribution of piRNAs and piRNA-Ls in chromosomes, (b) Distribution of piRNAs and piRNA-Ls in mitochondria genome. Clustering based on piRNA and piRNA-L expression patterns in HBE2-4, ADC (SKMES-1, H157, H226 and H1437) and SCC (H596, H522, H194 and H1792); (c) entire piRNA and piRNA-L expressed, (d) piRNAs only, (e) piRNA-Ls only.
FIG. 3. Characteristics of piR-L-163 and its impact in cell cycle, (a) Expression levels of piR-L-163 in HBE and NSCLC (ADC and SCC) cells based on RNA-seq data, (b) 2' -O-methylation at the 3-termimal of piR-L-163 measured using periodate treatment followed by β-elimination. Synthetic RNAs separated and stained with ethidium bromide (left). Total RNAs separated and detected by Northern blot using a probe specific for piR-L-163 (right). Arrows indicate piR-L-163 bands, (c) The 2' -O-methylation of piR-L-163 determined by RTL-P. (d) Cell survivals after Ant- 163 or Scr treatment (48 hrs). (e) Growth of cells treated with Ant- 163 or Scr. (f) Cell cycle distributions at different time points for HBE4 cells treated with Ant- 163 or Scr. (g) piR-L-163 distribution at cell cycle phases as merged images of FISH and DAPI. All values are averages of three independent replicates, the error bars reflect mean s.d., and * indicate p<0.01 by Student's t-test.
FIG. 4. piR-L-163 binds to p-ERM. (a) Pull downed proteins from HBE4 cell lysates with biotinylated scrambled RNA or piR-L- 163. Arrows indicate differentially presented bands and detected peptides of ezrin and moesin. (b) piR-L-163 detected in RNA purified from various IP products, (c) Endogenous p-ERM levels in HBE4 cells, (d) Threonine residue in C-terminal of human ERM and Drosophila moesin. (e) Endogenous moesin was effectively down-regulated in HBE4 cells, (f) and (g) piR- L-163 detected in RNAs purified from various IP products in conditions as indicated. All values are averages of three independent replicates, the error bars reflect mean s.d., and * indicate p<0.01 by Student's t-test.
FIG. 5. piR-L-163 motif and ERM element critical for binding and p-ERM 's interaction with EBP50 and F-actin. (a) Predicted protein binding motif NNUUNNUUUNN (SEQ ID NO:487) in piR-L-163. (b) Sequences of the mutant piR-L-163s. (c) Endogenous p-ERM levels in 4 NSCLC cell lines, (d) Moesin levels in H522 cells transfected with pCDNA3 (empty vector), pCDNA3 -Moesin WT (wild type moesin) and pCDNA3-Moesin DM (RRRKPDT (SEQ ID NO:488) element deleted), (e) piR-L-163 and its mutant forms detected in RNAs purified from the IP products and the correlated binding capabilities between p-ERM and EBP50 or F- actin in H1792 cells, (f) piR-L-163 or piR-L-163Ml detected in RNAs purified from IP products of H522 cells (left) or HBE4 cells (right) transfected with p-Moesin in
conditions as indicated and the correlated binding capabilities between p-ERM and EBP50 or F-actin.
FIG. 6. piR-L-163 impacted migration and invasion, (a) Trans-well assay showed increased invading cells after treating HBE4 cells with Ant- 163 compared with cells treated with Ant-163. (b) In H1792 cells (extremely low endogenous piR- L-163 expression), piR-L-163 significantly reduced the number of invading cells but no impact of Ant-163 or piR-L-163Ml treatment, (c) Migration capability of HBE4 cells treated with either Ant-163 or Scr measured by a quantitative assay, (d) Migration capability of HI 792 cells treated with piR-L-163, Ant-163 or Scr. Lat A served as an internal control for background, (e) Gap closure of HBE4 cells treated with either Ant-163 or Scr. (f) Gap closure of HI 792 cells treated with Ant-163, piR- L-163, piR-L-163Ml and Scr. All values are averages of three independent replicates, the error bars reflect mean s.d., and * indicate p<0.01 by Student's t-test.
FIG. 7. Lengths of reads obtained in RNA-seq and human genome distributions of the reads, (a) Length distribution of all the reads, (b) Numbers of genomic loci mapped for the reads observed in each cell line (percentages of the reads).
FIG. 8. Chromosomes and mitochondria genome distributions of the reads, (a) Distribution of all the reads. (b)Percentages of the reads mapped to exonic, intronic, and intergentic regions, respectively for each cell line.
FIG. 9. Heat map of expression of piRNAs and piRNA-Ls identified in the 11 cell lines.
FIG. 10. Expression levels of piRNAs (known) and piRNA-Ls (novel), (a) Density plot of all the reads separated by known and novel, (b) Histogram of average read counts covering the known and novel piRNAs (piRNA/piRNA-L).
FIG. 11. Expression of piR-L-163 in NSCLC and HBE cell lines measured by real time RT-PCR. (a) piR-L-163 expression levels in individual cell lines, (b) piR-L-163 express ion levels in HBE, ADC and SCC as groups. All the values are averages of four independent replicates, error bars represent mean s .d., and * indicates p<0.01 by Student's t-test. (c) LAMC2 express ion levels in HBE4 cells measured by real time RT-PCR in the conditions as labeled. Values are averages of three
independent replicates, error bars represent mean s.d., and ** indicates p<0.05 by Student's t-test.
FIG. 12. Regions in moesin potentially critical for piR-L-163 and p-ERM interaction, (a) Predicted RNA binding element in human and drosophila moesin. (b) Alignment of human and drosophila moesin.
FIG. 13. Uncropped scans of critical Western blots presented in Figure 5. (a- c) Protein levels in lysates obtained from H1792 cells transfected with different oligos. (d-f) p-ERM, F-actin and EBP50 levels in proteins pulled down by p-ERM. (g-h) EBP50 and F-actin levels in lysates of HBE4 and H522 cells with various treatment conditions, (i-1) F-actin, EBP50 and Moesin levels in proteins pulled down by p- ERM.
FIG. 14. piR-L-138 3'-end 2'-0-methylation and expression patterns in NSCLC cell lines, (a) Expression levels of selected piRNA-Ls in SCC cell lines 24 h after treated with cisplatin treatment, (b) Average levels of piR-L-138 in ADC and SCC cell lines in comparison with the levels in HBE lines based analyzed using RNA- seq (left) and quantitative RT-PCR (right), (c) 2'-0-methylation at the 3'-end of piR- L-138 is indicated by periodate treatment followed by β-elimination. The untreated and treated synthetic oligo RNAs separated in PAGE and stained with ethidium bromide (left). The untreated or treated total RNAs were detected using northern blot (right). Red arrows indicate piR-L-138. (d) Relative piR-L-138 levels detected in tumors from 4 PDX NSCLC models treated with cisplatin-based chemotherapy. Values are averages of three independent replicates; error bars represent mean s.d.; * p<0.05, ** p<0.01, *** p<0.001.
FIG. 15. piR-L-138 impacts MDM2 cleavage and apoptosis in SCC cells, (a) Numbers of SCC cells 24 h after CDDP treatment with either Scr or Ant- 138 transfection measured by MTT assay, (b) Cell cycle distributions of HI 57 cells collected 24 h after CDDP treatment, with no treatment or treated with Scr or Ant- 138 6 h after CDDP. Red arrows indicate the sub-Gl fraction, (c) Apoptotic and pre- apoptotic SCC cells transfected with either Scr or Ant-138 after CDDP treatment measured by FITC annexin V assay, (d) Western blot analysis of levels of full length MDM2, cleaved 60kD MDM2 (total and phosphorylated form) and cleaved PARP in SCC cells transfected with either Scr or Ant-138 after CDDP treatment, (e) Western
blot analysis of levels of full length and cleaved 60kD MDM2 (total and phosphorylated form) in SCC cells transfected with either Scr RNA or piR-L-138. Values are averages of three independent replicates; error bars represent mean s.d.; * p<0.05, ** p<0.01, *** p<0.001.
FIG. 16. piR-L-138 interacts with MDM2. (a) Pull-down experiment using immobilized Scr RNA or piR-L- 138 followed by Western blot to detect cleaved 60kD MDM2 in CDDP treated SCC cells, (b) Immunoprecipitation experiment using either IgG or an anti-MDM2 antibody followed by RT-PCR using piR-L-138 specific primers in CDDP treated SCC cells, (c) piR-L-138 and MDM2 co-localization analyzed in HBE4 cells with or without the antibody or oligos probe, HI 57 and SKMES-1 cells untreated or treated with CDDP as indicated by fluorescence in situ hybridization (FISH) analysis.
FIG. 17. Ant-138 enhances CDDP-mediated apoptosis in xenograft tumor model, (a) Representative animals and hematoxylin and eosin (H&E) stained tumor sections 16 days after treatment as indicated HE staining morphology were presented, (b) Tumor growth curves in animals of each treatment group as indicated (relative tumor volumes compared to volumes before treatment), (c) The presence of Ant-138 and cleaved caspase 3 in tumor sections from treatment groups as indicated, (d) Immunofluorescence stained cleaved caspase 3 (Red) and Ant-138 (Green) in tumor sections of animals treated with CDDP and plus Ant-138 (left panel is the 10 times magnified images of right panel), (e) Intensities of cleaved caspase 3 signal in tumor regions with high (>20,000 pixels) and low (<20,000 pixels) Ant-138 signals (20 regions for each category). Error bars represent mean s.d., *** p<0.001.
FIG. 18. Responses of NSCLC cell lines to CDDP and the impact of CDDP to expression level of selected piRNA-Ls in ADC cell lines, (a) Response curves of SCC cell lines to different concentrations of CDDP. (b) Response curves of ADC cell lines to different concentrations of CDDP. (c) Morphological changes of H157 and SKEMS-1 (SK) cells after treatment with different chemotherapeutic agents (IC25 doses), (d) Changes of piRNA-L expression (selected piRNA-Ls) in ADC cells after CDDP treatment. Values are averages of three independent replicates, error bars represent mean s.d.
FIG. 19. Impact of chemotherapeutic agents to piR-L-138 expression in NSCLC cells and the effect of Ant- 138 on SCC cell growth, (a) Impact of drug concentrations (H, LC25 doses; L, LC10 doses) to piR-L-138 expression levels in H157. (b) Viability of H157 and SKEMS-1 (SK) cells treated with gemcitabine (GEM) or docetaxel (DOC) and the impact of Ant-138 (compared to control Scr). (c) Changes of piR-L-138 expression level in SCC cell lines after treatment with different chemotherapeutic agents, (d) Changes of piR-L-138 expression level in ADC cell lines after treatment with different chemotherapeutic agents. Values are averages of three independent replicates; error bars represent mean s.d.; * p<0.05, ** p<0.01, *** p<0.001.
FIG. 20. Impact of Ant-138 in apoptosis of SCC cells following CDDP treatment, (a) Sub-Gl fractions of SCC cells transfected with either Scr or Ant-138 6 h after CDDP treatment, (b) Untreated controls of SCC cells in FITC annexin V experiments for Figure 15c.
FIG. 21. Amplified bands of RNAs extracted from IP products of pooled HBE and SCC cell lines.
FIG. 22. Size distribution of identified unique phosphor-protein binding sncRNAs.
FIG. 23. Inhibiting proliferation (a) and altering levels of certain phosphor proteins (b) 24 h after the complementary DNA oligo treatment in lung SCC cells.
FIG. 24. Primers designed to amplify presumable pri- and pre-sprRNAs (piR- L-163 and piR-L-138) as colored (a). RNAs extracted from each subcellular components and the purity are verified by the presence or absence of HSP90 and Histone 3A (b). RT-PCR results of the pri- and pre-sprRNAs in each subcellular component (c).
FIG. 25. Secondary structure prediction of piR-L-163.
FIG. 26. piRNA Levels are highly Modulated in NSCLC Cells Following Chemotherapy (piRNA138 as an example).
FIG. 27. Secondary structure prediction of piR-L-138.
FIG. 28. Profile of phosphorylation related sprRNAs in HBE and SCC. a, Mitochondrial and chromosomal genomes distribution of sprRNAs. b-f, Venn
diagrams showing the specific numbers and relative proportions of sprRNAs pulled down by antibodies targeting p-Tyr, -Ser and -Thr in HBE and SCC, respectively.
FIG. 29. Function of sprRNAs. a, Clustering on the bases of expression patterns of sprRNAs in HBE and SCC. b, Relative cell viability of SCC cells after treatment with control or AntiC. c, Cells stained with Annexin V and PI were analyzed by Flow Cyto after treatment with control and AntiC. d, Cleaved PARP and Caspase3 were detected by W.B. in cells treated with control and AntiC. e, Relative cell viability of NHBE cells treated with control or ectopic expression of core sequence.
FIG. 30. Interaction of necleolin and core sequence
(5'- CUCUCACCGCCGCGGCCCGGGUUCG-3') (SEQ ID NO:489) of sprRNA 12600 (5'- CUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGGAACC
-3') (SEQ ID NO:490), sprRNA11568 (5'-
CUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGGAAC-3') (SEQ ID NO:491), sprRNA7410 (5'-
CUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGGAACCA-3') (SEQ ID NO:492), sprRNA9378 (5'-
CUCUCACCGCCGCGGCCCGGGUUCGUUUCCCGGUCAGGGAACC-3') (SEQ ID NO:493) and sprRNA10698 (5'-
CUCUCACCGCCGCGGCCCGGGUUCGUUUCCCGGUCAGGGAACCA-3') (SEQ ID NO:494). a, Pulled-down proteins from H157 and H226 cell lysates with biotinylated scrambled RNA or core sequence. Arrows indicate differentially presented bands and detected peptides nucleolin. b, Nuleolin could override the effects of AntiC.
FIG. 31. Flowchart of the protocol used to prepare sncRNAs library from cell lines for RNA sequencing, a, Specific cell lines for sncRNAs library preparation, b-c, Cells were lysed and proteins were quantified, d-e, Lysed buffer was processed for IP using p-Ser, p-Tyr and p-Thr. f, RNAs were extracted from IP products, g-h, Adaptors were ligated. i-j, Extracted RNAs were processed for reverser transcription and polymerase chain reaction (PCR) using unique index sequence, k, PCR products were run in one nucleotide resolution gel. i-m, Targets bands were purified and sent for illumine Midseq.
FIG. 32. Pipeline for analyzing reads and reads statistics, a, Pipeline for reads processing, b, Total and aligned reads of p-Ser, p-Thr and p-Tyr in HBE and SCC cell lines, c, Percentage of the mapped reads distributed in different hit (s) of loci in the human genome sequences.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is based at least in part on the surprising discovery of a novel class of short non-coding RNAs (sncRNAs) referred to herein as sprRNAs (short non-coding protein regulatory RNAs) which are proposed to be integral components for the function of certain proteins in regulating cellular processes. It is also provided herein that abnormal expression of sprRNAs can contribute to cancer development and progression. Therefore, sprRNAs essential for maintaining cancer phenotypes are novel therapeutic targets and/or biomarkers for patients with cancers. These findings are based on the following observations: first, it is shown that piwi- interacting RNA-Like sncRNAs (piRNA-Ls) are expressed in somatic epithelial cells (although the total numbers of piRNA-Ls are substantially smaller than piRNAs expressed in germ line cells); second, piRNA-Ls are differentially expressed between normal bronchial epithelial cells (HBEs) and non-small cell lung cancer (NSCLC) cells as well as between different NSCLC histology subtypes; third, sncRNAs can bind directly to proteins and regulate protein functions, a mechanism never before suspected for sncRNAs. Provided herein are three lines of evidence to support the last claim: 1) piRNA-L-163, a novel sprRNA described herein, binds to phosphorylated ERM proteins (p-ERMs), a key cell cortex organizer, and regulates the protein functions; 2) piRNA-L-138, a novel sprRNA described herein, binds and stabilizes MDM2 oncogene upon treatment with chemotherapeutic agents; and 3) a considerable number of sncRNAs can be co-precipitated with phosphor-proteins, including 30-60% of the piRNA-Ls identified in HBE and NSCLC cells, with distinct patterns in the samples from proteins with different phosphorylated residuals as well as proteins from different types of cell lines. The present results are shown on lung cancer cells, the lead cause of cancer-related death in the United States. The present findings are significant paradigm shifting discoveries and pave the way for a new class of cancer therapeutic targets and beyond.
Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and other similar technical references. As used herein, the word "about" means + 10% of the numerical value.
For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of "or" means "and/or" unless stated otherwise. The use of "a" herein means "one or more" unless stated otherwise or where the use of "one or more" is clearly inappropriate. The use of "comprise," "comprises," "comprising," "include," "includes," and "including" are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term "comprising," those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language "consisting essentially of and/or "consisting of."
In some aspects, the invention relates to short non-coding protein regulatory RNAs (sprRNAs), variants, fragments and inhibitors thereof including piRNA-like molecules and their uses as markers in certain disease states such as cancer, in particular lung cancer. In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof are useful as therapeutic molecules in the treatment of diseases or conditions in subjects.
As described herein, sprRNAs are short non-coding RNAs. sprRNAs are believed to represent a new class of noncoding RNAs and are not believed to function
directly to mediate silencing of gene expression or suppress transposon mobility, unlike many other non-coding RNAs such as piRNAs, siRNAs and miRNAs. sprRNAs also do not include other noncoding tRNAs and ribosomal RNAs, although sprRNAs might compose sequences identical to partial sequences of tRNAs or ribosomal RNAs. In contrast, it has been discovered that sprRNAs interact with proteins, and through these interactions, affect one or more cellular processes mediated by the proteins. In some embodiments, the sprRNA ranges in size from about 24-55 nucleotides in length. In some embodiments, the sprRNA ranges in size from about 25-50 nucleotides in length or about 26-32 nucleotides in length. In some embodiments, the sprRNA comprise modifications of the RNA, including 3' end 2'- O-methylation. In some embodiments, the sprRNAs bind to phosphorylated proteins. RNA-Like sncRNAs (piRNA-Ls) referred to herein are encompassed by sprRNAs.
Nucleic Acids of the Invention
In one aspect, the present invention provides an isolated nucleic acid molecule comprising a short non-coding protein regulatory RNA (sprRNA), variants, fragments, and inhibitors thereof. In some embodiments, the invention provides isolated nucleic acid molecules having the nucleic acid sequence set out in SEQ ID NOS: 1-486, 489-494, or 560-2802, variants, fragments, or inhibitors thereof. In some embodiments, the invention further provides nucleic acid molecules that are antisense nucleic acid molecules to the nucleic acid sequences set forth in SEQ ID NOS: 1-486, 489-494, or 560-2802. In some embodiments, the present invention provides cDNA of the sprRNAs of the invention. In some embodiments, the sprRNA inhibitor is an antisense nucleic acid molecule. In some embodiments, the inhibitor comprises an antisense nucleic acid molecule comprising SEQ ID NOS:496, 497, or 556-559. In some embodiments the antisense molecules are selected from DNA and RNA molecules.
A particular nucleotide sequence comprising an sprRNA, variant, fragment or inhibitor may be identical over its entire length, for example, of SEQ ID NOS: 1-486, 489-494, 496, 497, 556-559 or 560-2802. In some embodiments, the nucleic acids of the invention contain a nucleotide sequence that is highly identical, e.g., at least 90%
identical, with a nucleotide sequence of an sprRNA, variant, fragment or inhibitor as set forth in SEQ ID NOS: 1-486, 489-494, 496, 497, 556-2802.
In some embodiments the nucleic acid comprises variants of sprRNAs. In some embodiments, variants can include sequences with insertions, deletions, point mutations and modifications of the nucleotide bases. In some embodiments, antisense inhibitors include sequences with insertions, deletions, point mutations, and modifications of the nucleotide bases relative to the native sprRNA sequence.
In some embodiments, the nucleic acids of the invention, e.g., SEQ ID NOS:l- 486, 489-494, 496, 497, or 556-2802, variants, fragments or inhibitors thereof, can also include additional or modified sequences of the above mentioned sequences which can aid in their purification or stability, for example. In some embodiments, one or more adaptor sequences can be attached to either the 3' and/or 5' ends of the molecule to facilitate amplification, purification and/or cloning. In some embodiments, the adaptor sequence comprises SEQ ID NO:499. In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof (such as antisense nucleic acids as described herein) can be modified to include a phosphorothioate (PS) backbone. The modification to the backbone can be throughout the molecule or at one or more defined sites. In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof can be modified at one or more sites to include 2'-0-methyl (20Me) and/or 2'-0-methoxy-ethyl (MOE) groups. In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof can be modified to encompass peptide nucleic acids (PNA). In some embodiments, the sprRNAs, variants, fragments and inhibitors thereof can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
Embodiments of the invention further include isolated nucleic acid molecules comprising a nucleotide sequence at least 90% identical, and more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 99% or 100% identical to (a) SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802; or (b) a nucleotide sequence complementary to the nucleotide sequences in (a).
Conventional means utilizing known computer programs such as the BestFit program (Wisconsin Sequence Analysis Package, Version 10 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis.
53711) may be utilized to determine if a particular nucleic acid molecule is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to any one of the nucleotide sequences shown in SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802.
In some embodiments, the invention provides a nucleic acid comprising an sprRNA, fragment or inhibitor of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556- 2802 in which several, 1, 1-2, 1-3, or 1-5, 1-10, or 1-20 nucleotide residues are substituted, deleted or added, in any combination. In some embodiments, the variants maintain the desired activity, have abrogated activity, or enhanced activity.
In some embodiments, the nucleic acid are at least 90% identical over their entire length to a nucleic acid having the sequence set out in SEQ ID NOS: 1-486, 489- 494, 496, 497, or 556-2802, and nucleic acids which are complementary to such nucleic acids. In some embodiments, the nucleic acids are at least 95% identical over their entire length, at least 97% identical, at least 98% identical, or at least 99% identical.
The present invention is further directed to fragments of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802 and sequences complementary thereto. A fragment can be defined to be at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, and at least about 40 nt in length. Such fragments are useful as therapeutic agents, screening agents, diagnostic probes and primers as discussed herein and can be incorporated into detection kits to detect the nucleic acids in biological samples. The fragments can include truncations at the 5' or 3' ends, and can also include internal fragments with both 5' and 3' truncations.
In some embodiments, the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, or 560-2802. In some embodiments, the probe or primer further comprises a detectable label. Methods of modifying probes or primers with detectable labels are well known in the art, and can include, e.g., fluorescent labels, enzymatic labels, and radiolabels. In some embodiments the probe or primer is DNA. In some embodiments, the probe or primer is RNA. In some embodiments, the invention provides a probe for detecting piR-L-163 (SEQ ID NO:498).
The present invention further relates to nucleic acids that hybridize to the above-described sequences. In this regard, the present invention especially relates to nucleic acids that hybridize under stringent conditions to the above-described nucleic acids. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 90% and preferably at least 95% identity and more preferably at least 97%, 98%, 99% and 100% identity between the sequences.
Furthermore, a major consideration associated with hybridization analysis of DNA or RNA sequences is the degree of relatedness the probe has with the sequences present in the specimen under study. This is important with a blotting technique (e.g., Southern or Northern Blot), since a moderate degree of sequence homology under nonstringent conditions of hybridization can yield a strong signal even though the probe and sequences in the sample represent non-homologous genes.
The particular hybridization technique is not essential to the invention, any technique commonly used in the art is within the scope of the present invention. Typical probe technology is described in U.S. Pat. No. 4,358,535 to Falkow et al., incorporated by reference herein. For example, hybridization can be carried out in a solution containing 6xSSC (lOxSSC: 1.5 M sodium chloride, 0.15 M sodium citrate, pH 7.0), 5x Denhardt's (1. times. Denhardt's: 0.2% bovine serum albumin, 0.2% polyvinylpyrrolidone, 0.02% Ficoll 400), 10 mM EDTA, 0.5% SDS and about 107 cpm of nick- translated DNA for 16 hours at 65 °C. Additionally, if hybridization is to an immobilized nucleic acid, a washing step may be utilized wherein probe binding to nucleic acids of low homology, or nonspecific binding of the probe, may be removed. For example, a stringent wash step may involve a buffer of 0.2xSSC and 0.5% SDS at a temperature of 65 °C.
Additional information related to hybridization technology and, more particularly, the stringency of hybridization and washing conditions may be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989), which is incorporated herein by reference.
Nucleic acids of the invention which are sufficiently identical to a nucleotide sequence contained in 1-486, 489-494, 496, 497, or 556-2802 or sequences complementary thereto can be used as hybridization probes, to isolate full-length
sequences, interacting proteins or protein complexes, and/or genomic clones comprising the sequences and clones of other nucleic acids that have a high sequence similarity. Such hybridization techniques are known to those of skill in the art. Typically, these nucleotide sequences are at least about 90% identical, preferably at least about 95% identical, more preferably at least about 97%, 98% or 99% identical to that of the reference. In some embodiments, the probes generally will comprise at least 15 nucleotides. In some embodiments, such probes will have at least 20 nucleotides and can have at least 50 nucleotides or greater.
In some embodiments, the invention provides an isolated nucleic acid molecule that is at least 90% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In some embodiments, the invention provides an isolated nucleic acid comprising a sequence that is at least 95% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In some embodiments, the nucleic acid molecule comprises a sequence that is at least 99% identical to any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In another embodiment, the nucleic acid molecule comprises a sequence that is identical to any one of SEQ ID NOS: 1- 486, 489-494, 496, 497, or 556-2802.
In some embodiments, the nucleic acid comprises the sprRNA piR-L-163 (SEQ ID NO:282).
In some embodiments, the nucleic acid comprises the sprRNA is piR-L-138 (SEQ ID NO:268).
In some embodiments, the nucleic acid comprises SEQ ID NO:489.
In some embodiments, the nucleic acid comprises an sprRNA selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
In some embodiments, the nucleic acid comprises Ant-138 (SEQ ID NO:556) which is DNA sequence that is antisense to piR-L-138 (SEQ ID NO:268). The RNA antisense sequence is set forth in SEQ ID NO: 557.
In some embodiments, the nucleic acid comprises Ant-163 (SEQ ID NO:496), which is DNA sequence that is antisense to piR-L-163 (SEQ ID NO:282). The RNA antisense sequence is set forth in SEQ ID NO: 497.
In some embodiments, the nucleic acid comprises AntiC (SEQ ID NO:558), which is a DNA sequence that is antisense to SEQ ID NO:489. The RNA antisense sequence is set forth in SEQ ID NO: 559.
Vectors and Host Cells
The present invention also relates to vectors that comprise nucleic acids of the present invention, host cells which are genetically engineered with vectors of the invention and the production of nucleic acids of the invention by recombinant techniques.
Representative examples of appropriate hosts include bacterial cells, such as streptococci, staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells. A great variety of systems can be used, including DNA or RNA vectors and viral vectors.
In some embodiments, the invention provides a vector comprising any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802. In another embodiment, the invention comprises a host cell comprising a vector comprising any one of SEQ ID NOS: 1-486, 489-494, 496, 497, or 556-2802.
Methods of Treatment
In another embodiment, the invention provides a method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA, variant, fragment or inhibitor thereof of the invention.
In another embodiment, the invention provides a method of preventing the binding of a sprRNA, variant, or fragment thereof to a protein target, comprising
contacting a nucleic acid comprising an sprRNA, variant, or fragment thereof and protein target with an inhibitor whereby the inhibitor prevents binding of the sprRNA, variant, or fragment thereof and protein target.
The sprRNA is not limiting and in some embodiments, the sprRNA is any one of SEQ ID NOS:l-486, 489-494 or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS:l-486, 489-494 or 560-2802. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 1-191. In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS: 192-486, 489-494 or 560-2802. In some embodiments, the sprRNA is piR-L-138 (SEQ ID NO:268). In some embodiments, the sprRNA is piR-L-163 (SEQ ID NO:282). In some embodiments the nucleic acid administered comprises SEQ ID NO:489. In some embodiments, the sprRNA selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
In some embodiments, the inhibitor that is administered is an antisense nucleic acid molecule of the nucleic acid comprising the sprRNA, variant or fragment thereof of the invention. Antisense therapy is the administration of exogenous oligonucleotides which bind to a target nucleic acid. In some embodiments the antisense molecules can be antisense over the entire length of the sprRNA (i.e., 100% complementary). In some embodiments the antisense molecules can be complementary over only a portion of the sprRNA. In some embodiments, the antisense RNA is complementary over at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50 nucleotides, which can be contiguous and noncontiguous nucleotides. In some embodiments, the antisense nucleic acid molecule is complementary to the sprRNA over contiguous nucleotides, while in other embodiments, one or more mismatches can occur between regions that are fully complementary in sequence. The antisense nucleotides herein in some embodiments
are capable of disrupting the sprRNA-protein interaction and/or modulating the function of the sprRNA-protein interaction. In some embodiments, the antisense nucleic acid molecules of the invention can be modified and can include derivatives such as S -oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra). S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention may be prepared by treatment of the corresponding O-oligos with 3H-l,2-benzodithiol-3-one- 1 ,1-dioxide which is a sulfur transfer reagent. See Iyer et al., /. Org. Chem. 55:4693- 4698 (1990); and Iyer et al., /. Am. Chem. Soc. 112: 1253-1254 (1990), the disclosures of which are fully incorporated by reference herein. In some embodiments, the antisense nucleic acids can be modified at one or more sites to include 2'-0-methyl (20Me) and/or 2'-0-methoxy-ethyl (MOE) groups. In some embodiments, the antisense nucleic acids can be modified to encompass peptide nucleic acids (PNA). In some embodiments, the antisense nucleic acids can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
In some embodiments, the antisense oligonucleotides of the present invention can be RNA or DNA that is complementary to sequences within SEQ ID NOS: 1-486, 489-494, or 560-2802 and stably hybridize with such sequences. Use of an oligonucleotide complementary to such regions allows for selective hybridization to the sprRNA. In some embodiments, the antisense oligonucleotides of the present invention are at least 15 to 30-mer fragments of the antisense DNA molecule. Other criteria that are known in the art may be used to select the antisense oligonucleotides, varying the length or the annealing position in the targeted sequence.
The term "subject" as used herein is not limiting and is used interchangeably with patient. In some embodiments, the subject refers to animals, such as mammals. For example, mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like. The terms "subject" and "patient."
As used herein, "treat" and all its forms and tenses (including, for example, treating, treated, and treatment) can refer to therapeutic or prophylactic treatment. In certain aspects of the invention, those in need thereof of treatment include those
already with a pathological condition of the invention (including, for example, a cancer), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention. The improvement may be any observable or measurable improvement. Thus, one of skill in the art realizes that a treatment may improve the patient's condition, but may not be a complete cure of the pathological condition. In other certain aspects of the invention, those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition such as cancer.
The disease or condition to be treated is not limiting. In some embodiments, the disease or condition to be treated is selected from the group consisting of cancer, abnormal cell proliferation, tissue degeneration and wound healing.
As used herein, cancer includes but is not limited to, carcinomas and sarcomas, such as, for example, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical cancer, AIDS-related cancers, AIDS-related lymphoma, anal cancer, astrocytoma (including, for example, cerebellar and cerebral), basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor (including, for example, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal, visual pathway and hypothalamic glioma), cerebral astrocytoma/malignant glioma, breast cancer, bronchial adenomas/carcinoids, Burkitt's lymphoma, carcinoid tumor (including, for example, gastrointestinal), carcinoma of unknown primary site, central nervous system lymphoma, cervical cancer, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, cutaneous T-Cell lymphoma, endometrial cancer, ependymoma, esophageal cancer, Ewing's Family of tumors, extrahepatic bile duct cancer, eye cancer (including, for example, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor (including, for example, extracranial, extragonadal, ovarian), gestational trophoblastic tumor,
glioma, hairy cell leukemia, head and neck cancer, squamous cell head and neck cancer, hepatocellular cancer, Hodgkin's lymphoma, hypopharyngeal cancer, islet cell carcinoma (including, for example, endocrine pancreas), Kaposi's sarcoma, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer (including, for example, non-small cell), lymphoma, macroglobulinemia, malignant fibrous histiocytoma of bone/osteosarcoma, medulloblastoma, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myeloma, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, oral cancer, oral cavity cancer, osteosarcoma, oropharyngeal cancer, ovarian cancer (including, for example, ovarian epithelial cancer, germ cell tumor), ovarian low malignant potential tumor, pancreatic cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, pregnancy and breast cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, soft tissue sarcoma, uterine sarcoma, Sezary syndrome, skin cancer (including, for example, non- melanoma or melanoma), small intestine cancer, supratentorial primitive neuroectodermal tumors, T-Cell lymphoma, testicular cancer, throat cancer, thymoma, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor (including, for example, gestational), unusual cancers of childhood and adulthood, urethral cancer, endometrial uterine cancer, uterine sarcoma, vaginal cancer, viral induced cancers (including, for example, HPV induced cancer), vulvar cancer, Waldenstrom's macroglobulinemia, Wilms' Tumor, and women's cancers.
In some embodiments, the disease is cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, and uterine cancer.
In some embodiments, the sprRNA, variant, fragment or inhibitor thereof is administered in combination with one or more additional therapies. The administration can be together in the same composition or in separate compositions. The sprRNA, variant, fragment or inhibitor thereof can be administered at substantially the same time with one or more additional therapies or at different times, and the spacing of time between the various treatments is not limiting. In some embodiments, the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination to a cell or a subject before, during, or after another treatment, such as a chemotherapeutic agent (e.g. alkylating agents, antimetabolites, anthracyclines, alkaloids, topoisomerase inhibitors, select monoclonal antibodies, kinase inhibitors, tyrosine kinase inhibitors, select cytotoxic antibiotics, taxanes, actinomycin, bleomycin, plicamycin, mitomycin, targeted cancer therapies), anthracycline, doxorubicin, an alkylating agent, an antimetabolite, a vinca alkaloid, a taxane, a topoisomerase inhibitor, actinomycin, an anthracycline, bleomycin, plicamycin, mitomycin. In some embodiments, the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination with radiation therapy, hormonal therapy, an aromatase inhibitor, tamoxifen, gonadotropin-releasing hormone analog, a selective estrogen receptor modulator, an antiandrogen, and a progestin.
In some embodiments, the sprRNA, variant, fragment or inhibitor thereof of the invention is administered in combination with one or more of the following additional therapies: Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE- PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afatinib Dimaleate, Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Avastin (Bevacizumab), Axitinib, Azacitidine, BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine
Hydrochloride, BEP, Bevacizumab, Bexarotene, Bexxar (Tositumomab and I 131 Iodine Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cabozantinib-S-Malate, CAF, Campath (Alemtuzumab), Camptosar (Irinotecan Hydrochloride), Capecitabine, CAPOX, Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmubris (Carmustine), Carmustine, Carmustine Implant, Casodex (Bicalutamide), CeeNU (Lomustine) Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar (Clofarabine), CMF, Cometriq (Cabozantinib-S-Malate), COPP, COPP-ABV, Cosmegen (Dactinomycin), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine, Liposomal, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Dasatinib, Daunorubicin Hydrochloride, Decitabine, Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane Hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC- Dome (Dacarbazine), Efudex (Fluorouracil), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Exemestane, Fareston (Toremifene), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil), Fluorouracil, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI- CETUXIMAB , FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9
(Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE- OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), Imatinib Mesylate, Imbruvica (Ibrutinib), Imiquimod, Inlyta (Axitinib), Intron A (Recombinant Interferon Alfa- 2b), Iodine 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Istodax (Romidepsin), Ixabepilone, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Liposomal Cytarabine, Lomustine, Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lupron Depot-3 Month (Leuprolide Acetate), Lupron Depot-4 Month (Leuprolide Acetate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megace (Megestrol Acetate), Megestrol Acetate, Mekinist (Trametinib), Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Mexate (Methotrexate), Mexate-AQ (Methotrexate), Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride), Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel
(Paclitaxel Albumin- stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Nelarabine, Neosar (Cyclophosphamide), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilotinib, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, OEPA, Ofatumumab, OFF, Olaparib, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Oxaliplatin, Paclitaxel, Paclitaxel Albumin- stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Pamidronate Disodium, Panitumumab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, Pegaspargase, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R- CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Rituximab, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Ruxolitinib Phosphate, Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synovir (Thalidomide), Synribo (Omacetaxine Mepesuccinate), TAC, Tafinlar (Dabrafenib), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel),Taxotere (Docetaxel), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thiotepa, Toposar (Etoposide), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and 1 131 Iodine Tositumomab,
Totect (Dexrazoxane Hydrochloride), TPF, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vandetanib, VAMP, Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, VePesid (Etoposide), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Zaltrap (Ziv-Aflibercept), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and Zytiga (Abiraterone Acetate). In some embodiments, the drug is selected from the group consisting of Paclitaxel, Curcumin, Docetaxel, Ixabepilone, Vinblastine, Colchicine, Y-27632 Fasudil, SU6656 Dasatinib, HDAC inhibitors, ROCK inhibitors, Parthenolide, Costunolide and ML-7 Jazplakinolide.
In some embodiments, the nucleic acid comprising the sprRNA, variant, fragment or inhibitor thereof prevents resistance to one or more additional therapies, such as the therapies described above. In some embodiments, inhibitor is an inhibitor to piR-L-138 (SEQ ID NO:268), such as Ant-138 (SEQ ID NO:556), and the one or more additional therapies are referred to above. In some embodiments, the one or more additional therapies to which the inhibitor of piR-L-138 prevents resistance is selected from the group consisting of cisplatin, gemcitabine (GEM), docetaxel and combinations thereof.
In one embodiment, the condition to be treated is cancer, such as lung cancer and an inhibitor of any of SEQ ID NOS: 489-494 is administered. In some embodiments, the inhibitor is AntiC (SEQ ID NO:558). In some embodiments, the invention provides a method of treating cancer comprising administering an effective amount of piRNA-L-163 (SEQ ID NO:282), a variant, or fragment thereof.
In some embodiments, the condition to be treated is selected from wound healing and tissue degeneration. In some embodiments, an inhibitor of sprRNA piR- L-163 (SEQ ID NO:282) is administered, such as Ant- 163 (SEQ ID NO:496).
The frequency of administration is not limiting. In some embodiments, the the sprRNA, variant, fragment or inhibitor thereof of the invention administered to the subject or cell can vary from about once every 2, 3, 4, 5, or 6 months to about 1, 2, 3, 4, or 5 times a month, to about 1 , 2, 3, 4, or 5 times a week, to about once per day, to about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times a day.
In some embodiments, the invention provides a method for treating cancer or tumorigenesis in a patient comprising introducing into the patients cells an inhibitor molecule which prevents binding of piRNA-L-163 to ERM proteins. In some embodiments, the invention provides a method of treating cancer comprising administering an effective amount of piRNA-L-163, a variant, or fragment thereof. Diagnostic Assays
This invention also relates to the use of nucleic acids, antibodies or other binding reagents reactive specifically against the sprRNAs as diagnostic reagents. Detection of altered sprRNA (or cDNA) can provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from altered expression of the sprRNA. The detection of normal or altered levels of the sprRNA can direct the medical practitioner to set an appropriate course of treatment for the patient.
As a means to detect or diagnose neoplastic disorders, such as lung cancer, differences in the levels of sprRNA (or cDNA generated therefrom) between affected and unaffected individuals, or between normal and cancerous tissues can be determined.
Nucleic acids for diagnosis may be obtained, for example, from a biopsy of cells from the tissue. In some embodiments, bodily fluids, e.g., urine, are obtained from the patient are used to detect elevated or reduced levels. Alterations in levels can be assayed by comparison to a standard or control level of sprRNA. RNA may be used directly for detection or may be converted to cDNA and amplified enzymatically by using PCR or other amplification techniques prior to analysis.
The diagnostic assays offer a process for diagnosing or determining a susceptibility to a disease or condition, such as a neoplastic disorder, through detection of altered levels of one or more sprRNA by the methods described. Decreased or increased levels can be measured at the RNA level using any of the methods well known in the art for the quantitation of nucleic acids; for example, RT- PCR, RNase protection, Northern blotting, array analysis, and other hybridization methods may be utilized.
The sprRNAs can be assayed individually or in combination, e.g., as a panel of biomarkers to indicate the presence or absence of the disease or condition. Other known markers, can also be simultaneously assayed, in accordance with the methods of the present invention.
In some embodiments, the invention provides a method of detecting the presence or absence of one or more sprRNAs in a sample, comprising contacting the sample with a probe comprising a nucleic acid that hybridizes to one or more of the sprRNAs. In some embodiments, the sprRNAs comprise any one of SEQ ID NOS:l- 486, 489-494 or 560-2802. In some embodiments, the method comprises contacting a sample from a subject with a probe comprising a nucleic acid that hybridizes to one or more of SEQ ID NOS: 1-486, 489-494 or 560-2802.
In another embodiment, the invention provides a method of detecting the presence or absence of one or more sprRNA sequences according to SEQ ID NOS:l- 486, 489-494 or 560-2802 in a sample from a patient comprising isolating the sprRNAs from the patient, optionally making cDNA from the sprRNAs, and detecting the sprRNAs or complementary DNA. Methods of making cDNA from RNA templates are well known in the art and is not limiting.
In another embodiment, the invention provides a method of detecting sprRNA, comprising
i) contacting a cell lysate with an antibody that binds one or more proteins;
ii) isolating the components from the cell lysate that bind the antibody; and
iii) detecting the sprRNA from the isolated components.
An exemplary approach is described in FIG. 31 and Example 3 herein. For example, immunoprecipitation (IP) assays can be performed using antibodies specifically generated for phosphor-serine, phosphor-threonine and/or phosphor-tyrosine, and total RNA can be extracted from the IP products of the cell lysate mixture followed by attaching adaptors as described herein to one or both 3' and 5' ends of the RNAs. RT-PCR can be performed to amplify the phosphor-protein binding RNAs. In some embodiments, the sprRNAs capable of binding phosphoproteins include any one of SEQ ID NOS: 1-486, 489-494 or 560-2802.
In another embodiment, the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS: 1-486, 489-494 or 560-2802 in a subject's sample and comparing it to a control sample. In some embodiments, the cancer is lung cancer.
The levels of sprRNAs can be measured in any number of ways, including using techniques well known to persons skilled in the art. In some embodiments, the levels are measured using intracellular probes to assay cells directly for the presence or absence of the sprRNAs as described herein in the Examples. For example, in some embodiments, the levels of the sprRNA are detected using an fluorescence in situ hybridization (FISH) assay using, e.g., a digoxin (DIG) -labelled DNA or RNA probe complementary to the sprRNA. In some embodiments, the levels of the sprRNA can be measured by the fluorescence intensity using standard techniques and methods. In some embodiments, the sprRNA is isolated from the cell. For example, the sprRNAs can be separated from total RNA using one-nucleotide-resolution PAGE gels and processed using the True® Small RNA kit. In other embodiments, the sprRNA can isolated by co-immunoprecipitation using antibodies to binding proteins. Adaptors can also be ligated to the sprRNA to facilitate purification or amplification. The sprRNA can be subjected to semi-quantitative RT-PCR, quantitative RT-PCR, or realtime qRT-PCR to determine the levels of the sprRNA in the cells and compare the levels to control samples. In some embodiments, the control sample is from a
noncancerous patient. In some embodiments, the sample is selected from the group consisting of cells, blood, plasma, serum saliva, sputum or urine.
The cancer to be detected or diagnosed is not limiting, and can include a cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, uterine cancer or any other cancer as described herein.
In one embodiment, the cancer detected or diagnosed is lung cancer. In some embodiments, one or more sprRNAs are measured and compared to control samples. In some embodiments, one or more sprRNAs are assayed from Table 1, below, and compared to control samples. In some embodiments, one or more or a panel of markers shown below can be used to distinguish between normal and cancer tissue, including distinguishing between squamous cell versus adenocarcinoma since there are differences in the markers between such cell types.
Table 1. Differentially expressed sprRNAs between normal human bronchial epithelial (HBE) cells and lung cancer adenocarcinoma (ACD) cells and squamous cell carcinoma (SCC) cells
piRNA-L-232 (SEQ ID NO:322) piRNA-L-232 (SEQ ID NO:322) piRNA-L-409 (SEQ ID NO:417) piRNA-L-409 (SEQ ID NO:417) piRNA-L-37 (SEQ ID NO:210) piRNA-L-495 (SEQ ID NO:475) piRNA-L-101 (SEQ ID NO:248) piRNA-L-488 (SEQ ID NO:470) piRNA-L-490 (SEQ ID NO:472) piRNA-L-138 (SEQ ID NO:268) piRNA-L-124 (SEQ ID NO:260) piRNA-L-276 (SEQ ID NO: 344) piRNA-L-50 (SEQ ID NO:220) piRNA-L-334 (SEQ ID NO: 372) piRNA-L-505 (SEQ ID NO:483) piRNA-L-408 (SEQ ID NO:416) piRNA-L-369 (SEQ ID NO:393) piRNA-L-127 (SEQ ID NO:261) piRNA-L-381 (SEQ ID NO:400) piRNA-L-450 (SEQ ID NO:442) piRNA-L-130 (SEQ ID NO:264)
piRNA-L-87 (SEQ ID NO:237)
piRNA-L-40 (SEQ ID N0:211)
piRNA-L-181 (SEQ ID NO:290)
piRNA-L-212 (SEQ ID NO:312)
piRNA-L-89 (SEQ ID NO:239)
piRNA-L-112 (SEQ ID NO:254)
piRNA-L-246 (SEQ ID NO:329)
piRNA-L-290 (SEQ ID NO:352)
piRNA-L-143 (SEQ ID NO:272)
piRNA-L-420 (SEQ ID NO:423)
piRNA-L-196 (SEQ ID NO: 301) piRNA-L-142 (SEQ ID NO:271) piRNA-L-2 (SEQ ID NO: 192) piRNA-L-13 (SEQ ID NO: 197) piRNA-L-85 (SEQ ID NO:236) piRNA-L-146 (SEQ ID NO:275) piRNA-L-245 (SEQ ID NO:328) piRNA-L-350 (SEQ ID NO:379) piRNA-L-9 (SEQ ID NO: 196) piRNA-L-97 (SEQ ID NO:244) piRNA-L-404 (SEQ ID NO:414) piRNA-L-257 (SEQ ID NO:333) piRNA-L-230 (SEQ ID NO:321) piRNA-L-432 (SEQ ID NO:432) piRNA-L-18 (SEQ ID NO: 199) piRNA-L-188 (SEQ ID NO:294)
In some embodiments, the measured sprRNA comprises piRNA-L-163 (SEQ ID NO:282). In some embodiments, the measured sprRNA comprises piRNA-L-138 (SEQ ID NO:268). In some embodiments, the measured sprRNA comprises any one of SEQ ID NOS:490-494.
In some embodiments, following detection and/or diagnosis, the subject is administered an effective amount of one or more therapeutic agents. In some embodiments, the therapeutic agent comprises an sprRNA, variant, fragment, or
inhibitor thereof, such as an antisense nucleic acid. In some embodiments, the therapeutic agent comprises a nucleic acid comprising any one of SEQ ID NOS: l- 486, 489-494, or 560-2802, variants, fragments, or inhibitors thereof, such as an antisense nucleic acid. In some embodiments, the therapeutic agent comprises a nucleic acid comprising any one of SEQ ID NOS:282, 268 or 489-494, variants, fragments, or inhibitors thereof. In some embodiments, the therapeutic agent comprises SEQ ID NOS:496, 497, or 556-559, variants or fragments thereof.
In another embodiment the present invention relates to a kit for diagnosing cancer in a human subject comprising one or more detection reagents capable of detecting any one or more of the sprRNAs of SEQ ID NOS: 1-486, 489-494, or 560- 2802. In some embodiments, the sprRNAs are one or more of the sprRNAs of Table 1. In some embodiments, the detection reagent comprises one or more probes comprising a nucleic acid that hybridizes to any one or more of the sprRNAs of Table 1.
Agonist and Antagonist Screening
In some embodiments, the ability of antagonists (inhibitors) and agonists of sprRNAs to interfere or enhance the activity of the sprRNA can be evaluated. In some embodiments, the assay can be conducted in vitro to determine whether the inhibitors or agonist reduces or enhances the interaction between the sprRNA and its protein binding partner. In some embodiments of the invention, an assay for sprRNA activity in cells can be used to determine the functionality of the sprRNA in the presence of an agent which may act as an inhibitor or agonist, and thus, agents that interfere or enhance the activity of sprRNA can be identified. In some embodiments, the sprRNAs include any one of SEQ ID NOS: 1-486, 489-494, or 560-2802.
In some embodiments, the sprRNAs of the present invention are employed in a screening process for compounds which bind one of the sprRNAs or one of its binding proteins or both and which enhances or inhibits the biological activity of the sprRNA-protein interaction. Thus, the nucleic acids of the invention may also be used to assess the binding of molecular substrates and ligands in, for example, cells, cell- free preparations, chemical libraries, and natural product mixtures. These substrates
and ligands may be natural substrates and ligands or may be structural or functional mimetics. Inhibitors of sprRNAs are particularly advantageous and can be used in methods as therapeutic agents in the treatment of cancer, for example, lung cancer, particularly in instances where the sprRNA is upregulated in the cancer cell. In some embodiments, the inhibitors are antisense nucleic acids to the sprRNA. In some embodiments, the antisense nucleic acids are DNA.
By "agonist" is intended naturally occurring and/or synthetic compounds capable of enhancing the biological activity that results from the sprRNA-protein interaction and/or enhancing the interaction of the sprRNA and protein to which it binds. By "antagonist" or "inhibitor" is intended naturally occurring and/or synthetic compounds capable of inhibiting the sprRNA-protein interaction and/or the biological activity that results from the sprRNA-protein interaction.
In some embodiments, the screening procedures involve producing appropriate cells which harbor the nucleic acids of the present invention. Such cells can include cells from mammals, yeast, Drosophila or E. coli. In some embodiments, the cells express the nucleic acid endogenously. In other embodiments, the cells have been transfected or engineered to express the nucleic acid. In some embodiments, cells expressing the nucleic acid (or extracts or purified preparations from cells) are contacted with a test compound to observe stimulation or inhibition of a functional response.
In some embodiments, assays can test binding of a candidate compound to the sprRNA or assays can involve competition with a competitor compound, such as a labeled competitor. In some embodiments, inhibitors can be assayed in the presence of a labeled antisense nucleic acid, and displacement of the labeled antisense nucleic acid can be measured.
Potential agonists or antagonists are not limiting and examples include antibodies, peptides, carbohydrates, or small molecules which bind to the sprRNA and/or protein to which it binds. These agents can be selected and screened 1) at random, 2) by a rational selection or 3) by design using for example, ligand modeling techniques (e.g., computer modeling).
For random screening, agents such as antibodies, peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their
ability to bind to or stimulate/block the interaction of the sprRNA and protein or the biological activity.
Alternatively, agents may be rationally selected or designed. As used herein, an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the sprRNA and/or binding protein.
In one aspect, the invention provides a method of screening for an agent which modulates the activity of an sprRNA, e.g., an agonist or antagonist, comprising: (a) contacting a sprRNA and/or protein to which the sprRNA binds with the agent to be tested; and (b) assaying the agent's effect on the sprRNAs activity. In some embodiments, the activity to be tested is sprRNA-protein binding, and/or biological activity that results from the sprRNA-protein interaction.
In another embodiment the present invention relates to a screening method for identifying inhibitors of cell proliferation in human bronchial epithelial cells comprising identifying molecule(s) which bind piRNA-L-163 and inhibit their function.
In another aspect, the invention provides a method for identifying inhibitors that prevent binding of sprRNA to a protein target, comprising contacting the sprRNA and protein with the inhibitor and detecting whether the inhibitor prevents binding of the sprRNA and protein. In some embodiments, the sprRNA corresponds to one or more of SEQ ID NOS: 1-486, or 489-494. In some embodiments, the inhibitor is an antisense nucleic acid to the sprRNA.
Pharmaceutical Compositions
In some embodiments, the invention provides a pharmaceutical composition comprising one or more therapeutic agents and a pharmaceutically acceptable carrier.
The therapeutic agents can include sprRNAs including the specific sprRNAs described herein, as well as variants, fragments and inhibitors thereof. In some embodiments, the sprRNAs include any one of SEQ ID NOS: 1-486, 489-494, or 560- 2802.
The therapeutic agents affect one or more cellular processes mediated by the protein and sprRNA interaction. The compositions can also include one or more
additional therapeutic agents that is useful to treat a disease or condition in combination with the sprRNAs, derivatives, analogs and inhibitors thereof.
Certain embodiments of the present invention relate to pharmaceutical compositions comprising one or more therapeutic agents, and methods of administering a therapeutically effective amount of one or more therapeutic agents, which are capable of prophylactic and/or therapeutic treatment of one or more conditions or diseases, such as cancer. The term "therapeutic agent" refers to any pharmaceutically acceptable acid, salt, ester, derivative, a stereoisomer, pro-drug or mixtures of stereoisomers of a therapeutic agent or to the therapeutic agent itself. Pharmaceutically acceptable acids, salts, esters, derivatives, stereoisomers, pro-drugs, and mixtures of therapeutic agents may also be used in the methods and compositions of the present invention.
The pharmaceutical compositions can be formulated according to known methods for preparing pharmaceutically acceptable useful compositions, and can include a pharmaceutically acceptable carrier. The carrier may be liquid, solid, or semi-solid for example. Formulations are described in a number of sources which are well known to those of skill in the art. The physical and/or chemical characteristics of compositions of the inventions may be modified or optimized according to skill in the art, depending on the mode of administration and the particular disease or condition to be treated. The compositions may be in any suitable form, depending on the desired method of administration, and may be provided in unit dosage form, a sealed container, or as part of a kit, which may include instructions for use and/or a plurality of unit dosage forms.
The term "pharmaceutically acceptable" with reference to the therapeutic agent used herein refers to those modifications of the parent compound (acids, salts, ester, etc.) that do not significantly or adversely affect the pharmaceutical properties of the parent therapeutic agent. For example, exemplary pharmaceutically acceptable salts administrable by means of the compositions of this invention include chloride, bromide, iodide, hydrochloride, acetate, nitrate, stearate, palmoate, phosphate, and sulfate salts. Exemplary techniques for producing pharmaceutically acceptable derivatives include for example, methylation, halogenation, acetylation, esterification and hydroxylation.
The term "therapeutically effective amount" means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show meaningful patient benefits, e.g, a decrease in tumor size or metastatic potential of the tumor, an increase in patient survival time, sensitization of patients to other therapeutic agents including but not limited to chemotherapy.
The pharmaceutical composition may be adapted for administration by any appropriate route, for example by the oral, rectal, nasal, topical, vaginal or parenteral routes. Other routes, e.g., intra- articular, may also be used. Such compositions may be prepared by any known method, for example by admixing the active ingredient with the carrier(s) or excipient(s) under sterile conditions.
Pharmaceutical compositions adapted for oral administration may be presented as discrete units such as capsules or tablets; as powders or granules, as solutions, syrups or suspensions. Suitable excipients for tablets or hard gelatin capsules include lactose, maize starch, or derivative thereof, stearic acids or salts thereof. Suitable excipients for use with soft gelatin capsules include for example vegetable oils, waxes, fats, semi-solid, or liquid polyols etc. For the preparation of solutions and syrups, excipients which may be used include for example water, polyols, and sugars. For the preparation of suspension, oils (e.g., vegetable oils) may be used to provide oil-in-water or water-in-oil suspensions. In certain situations, delayed release or enteric-coated preparations may be advantageous, for example to decrease gastric residence time and thereby reduce degradation of the pharmaceutical composition en route to the lower GI tract.
Pharmaceutical compositions adapted for rectal administration may be presented as suppositories or enemas. Pharmaceutical compositions adapted for nasal administration wherein the carrier is a solid can include a coarse powder having a particle size ranging from about 20 to about 500 microns. Suitable compositions wherein the carrier is a liquid for administration as a nasal spray or as nasal drops, include aqueous or oil solution of the active ingredient. Pharmaceutical compositions adapted for administration by inhalation include fine particle dusts or mists which may be generated by means of various types of metered dose pressurized aerosols, nebulizer or insufflators.
Pharmaceutical compositions adapted for topical administration may be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. When formulated in an ointment, the therapeutic agent may be employed with either a parafinninic or a water-miscible ointment base. Pharmaceutical compositions adapted from topical administration to the eye include eye drops wherein the therapeutic agent is dissolved or suspended in a suitable carrier, especially an aqueous solvent. Pharmaceutical compositions adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes. Pharmaceutical compositions adapted for transdermal administration may be presented as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Pharmaceutical compositions adapted for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations.
Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation substantially isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Excipients which may be used for injectable solutions include water, alcohols, polyols, glycerin and vegetable oils, for example. The compositions may be presented in unit-dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in freeze-dried conditions requiring only the addition of a sterile liquid immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. The pharmaceutical compositions may contain preserving agents, solubilizing agents, stabilizing agents, wetting agents, emulsifiers, sweeteners, colorants, salts, buffers, antioxidants, etc.
The administration of the compositions of the present invention may be for a "prophylactic" or "therapeutic" purpose, or alternatively can be used for diagnostic purposes. The compositions of the present invention are said to be administered for a "therapeutic" purpose if the amount administered is physiologically significant to provide a therapy for an actual manifestation of the disease or condition. When provided therapeutically, the therapeutic agent is preferably provided at (or shortly
after) the identification of a symptom of actual disease. The therapeutic administration of the agent serves to attenuate the severity of such disease or to reverse its progress. The compositions of the present invention are said to be administered to provide a therapy for a potential disease or condition. When provided prophylactically, the therapeutic agent is preferably provided in advance of any symptom thereof. The prophylactic administration of the therapeutic agent serves to prevent or attenuate any subsequent advance of the disease.
In some embodiments the therapeutic agents of the invention are nucleic acids, such as sprRNAs, analogs, derivatives, and antisense inhibitors thereof. The nucleic acids of the invention can be administered to a subject by any suitable means including parenteral or oral administration. The nucleic acids of the invention may be administered parenterally by intraarterial, intravenous, intraperitoneal, intraocular, subcutaneous or intramuscular injection either continuously or by bolus injection, depending on the route of administration. The administration may also be transmembrane or transmucosal using suppositories and, optionally, agents to aid penetration of membranes or mucosal membranes. Topical administration and direct administration to a target area may also be performed. In some embodiments, the administration is about 0.01-1 mg/kg, 0.0005-5 mg/kg, 0.001-0.35 mg/kg or, for example, 0.25 mg (40 pmol) nucleic acid/kg of the subject may be desirable.
In some embodiments, the nucleic acids of the invention can be administered to a subject or a cell with a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
Pharmaceutically acceptable carriers are generally known to those skilled in the art and include saline, sugars, polypeptides, polymers, lipids, creams, gels, micelle materials, and nanoparticles. In some embodiments, the carrier comprises at least one of: a glucose solution, a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, a ligand functionalized-hydrophilic polymer grafted
polymer, and a ligand functionalized liposome. In other embodiments, the polymers comprise a biodegradable histidine-lysine polymer, a biodegradable polyester, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), a polyamidoamine (PAMAM) dendrimer, a cationic lipid (such as DOTAP), or a PEGylated PEL A ligand can be adapted to the composition to target the composition to particular cell types. In some embodiments, the ligand is specific for one or more particular cell surface markers. In some embodiments, ligands can include small molecules, proteins, antibodies, and the like. In some embodiments, the ligand binds a cancer cell surface marker.
In some embodiments, the pharmaceutically acceptable carrier is a nanoparticle. In some embodiments, nanoparticles can be formulated to include high concentrations or amounts of the nucleic acids of the invention. For example, in some embodiments, nanoparticles can be formulated to include up to 15 μg, 20 μg, 25 μg, 30 μg, 40 μg, 50 μg, or more nucleic acids of the invention per lxlO9 particles. However, concentration or amounts included can be lowered if needed, e.g., 1-12 μg nucleic acid or less per lxlO9 particles. Exemplary amounts or concentrations of nucleic acids of the invention can include 10-1000 pmol/5xl07 particles, e.g., 20, 40, 100, 200 of 500 pmol nucleic acid/5xl07 particles.
In some embodiments, the nanoparticle is a histidine-lysine copolymer that forms a nanoparticle with the nucleic acids of the invention, wherein the diameter of the nanoparticle is about 50 nm to about 500 nm. Some embodiments of the invention, the nanoparticle encapsulates the nucleic acids of the invention for topical transcutaneous or transdermal delivery or targeted epidermal delivery via nanoparticle projectile bombardment or other transcutaneous/transdermal means.
In some embodiments, the nanoparticles comprise at least one positively charged shell substrate and at least one negatively charged core substrate, wherein the core substrate is selected from the group consisting of heparin, heparin analogs, low molecular weight heparin, glycosaminoglycans, and alginate. In one embodiment, the nucleic acids of the invention are conjugated with the core substrate.
In a further embodiment, the nanoparticles can have a mean particle size between about 50 and 500 nanometers, between about 100 and 300 nanometers, or between about 150 and 250 nanometers.
In some embodiments, the pharmaceutically acceptable carrier may be a lipid nanoparticle. The lipid nanoparticle may be engineered to penetrate mucus and may include surface altering agents such as, but not limited to, anionic protein, surfactants, sugars or sugar derivatives, nucleic acids, polymers, mucolytic agents and various DNases including rhDNase.
The mucus penetrating lipid nanoparticles can comprise at least one nucleic acid of the invention. The nucleic acids of the invention can be encapsulated in the lipid nanoparticle and/or disposed on the surface of the particle. The nucleic acid of the invention may be covalently coupled to the lipid nanoparticle. Formulations of mucus penetrating lipid nanoparticles may comprise a plurality of nanoparticles. Further, the formulations may contain particles which may interact with the mucus and alter the structural and/or adhesive properties of the surrounding mucus to decrease mucoadhesion which may increase the delivery of the mucus penetrating lipid nanoparticles to the mucosal tissue.
In one embodiment, a nucleic acid of the invention is formulated as a solid lipid nanoparticle. The solid lipid nanoparticle (SLN) may be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and may be stabilized with surfactants and/or emulsifiers. The lipid nanoparticle may be a self-assembly lipid-polymer nanoparticle.
In some embodiments, the nucleic acids of the invention can be administered to a subject or a cell via liposomes as a pharmaceutically acceptable composition. In some embodiments, liposomes can be manufactured by sonicating lipids in an aqueous solution. Low shear rates create multilamellar vesicles, which have many lipid layers. Continued high-shear sonication tends to form smaller unilamellar liposomes. In some embodiments, liposomes can be constructed using polyethylene glycol (PEG) as a coating. The liposomes can have a ligand attached to the surface of the liposome for binding to a target cell via a cell surface receptor or other surface molecule.
In some embodiments, the liposome as a pharmaceutically acceptable carrier can include opsonins or ligands in enhance the attachment of liposomes to unhealthy tissue or to activate events such as endocytosis. Liposomes can contain a low or a high pH to enhance the delivery of the nucleic acids of the invention.
In some embodiments, the pharmaceutically acceptable carrier may include liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), 1,2- dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2- dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), and MC3 (US Appl. Pub. No. 2010/0324120).
In some embodiments, the pharmaceutically acceptable carrier can include liposomes such as those formed from the synthesis of stabilized plasmid- lipid particles (SPLP) or stabilized nucleic acid lipid particle (SNALP) that have been previously described for delivery to cells or subjects (see Wheeler et al., Gene Therapy. 1999 6:271-281 ; Zhang et al. Gene Therapy. 1999 6: 1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2: 1002-1007; Zimmermann et al., Nature. 2006 441 : 111-114; Heyes et al. J Contr Rel. 2005 107:276-287; Semple et al. Nature Biotech. 2010 28: 172-176; Judge et al. J Clin Invest. 2009 119:661-673; deFougerolles Hum Gene Ther. 2008 19: 125-132).
In some embodiments, the nucleic acids of the invention may be formulated in a lipid-polycation complex. The formation of the lipid-polycation complex may be accomplished by methods known in the art and/or as described in U.S. Pub. No. 20120178702. The polycation may include a cationic peptide or a polypeptide such as polylysine, polyornithine and/or polyarginine.
In some embodiments, the cationic lipid pharmaceutically acceptable carrier may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2012040184, WO2011153120, WO2011149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, WO2010080724 and WO201021865.
In some embodiments, the pharmaceutically acceptable carrier may include at least one of the PEGylated lipids described in International Publication No. 2012099755, herein incorporated by reference.
In some embodiments, the concentration of the nucleic acids of the invention in the lipid pharmaceutically acceptable carrier is about 0.2 to 0.4 mg/ml, and the total lipid concentration is about 1.5 to 2.7 mg/ml. In some embodiments, the ratio of lipid:nucleic acid can be about 2: 1, at least about 3: 1, at least about 4: 1, at least about
5: 1, at least about 6: 1, at least about 7: 1, at least about 8: 1, at least about 10: 1 , at least about 15: 1.
In some embodiments, the nucleic acids can be formulated with MaxSuppr in vivo RNALancerll as described previously (Wiggins JF, et al. Development of a Lung Cancer Therapeutic Based on the Tumor Suppressor MicroRNA-34. Cancer Res. 70, 5923-30(2010)) due to the requirement of very large quantity of formulated reagents needed for systemic delivery.
In some embodiments, the nucleic acids of the invention can be administered to a subject through an implanted, indwelling, intrathecal or intraparenchymal catheter that provide a means for injecting fluid containing the nucleic acids of the invention directly into a desired tissue such as local nerves or local brain tissue. Embodiments of the invention include delivery of the nucleic acids of the invention via implantable delivery devices, such as an implantable pump like that taught in U.S. Pat. Nos. 5,735,814 and 6,042,579, and further using a sensor as part of the infusion system to regulate the amount of nucleic acids of the invention delivered, like that taught in U.S. Pat. No. 5,814,014.
Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition of the nucleic acids of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.01% and 100%, e.g., between 0.5 and 50%, between 1-30%, between 5- 80%, at least 80% (w/w) active ingredient.
While the invention has been described with reference to certain particular examples and embodiments herein, those skilled in the art will appreciate that various examples and embodiments can be combined for the purpose of complying with all relevant patent laws {e.g. , methods described in specific examples can be used to describe particular aspects of the invention and its operation even though such are not explicitly set forth in reference thereto).
EXAMPLES
EXAMPLE 1
A piRNA like small RNA interacts with and modulates p-ERM proteins in human somatic cells
PrWI-interacting RNAs (piRNAs) are thought to silence transposon and gene expression during development. However, the roles of piRNAs in somatic tissues are largely unknown. Here we report the identification of 555 piRNAs in human lung bronchial epithelial (HBE) and non-small cell lung cancer (NSCLC) cell lines, including 295 that don't exist in databases termed as piRNA-Like sncRNAs or piRNA-Ls. Distinctive piRNA/piRNA-L expression patterns are observed between HBE and NSCLC cells. piRNA-L-163 (piR-L-163) (SEQ ID NO:282), the top down- regulated piRNA-L in NSCLC cells, binds directly to phosphorylated ERM proteins (p-ERM), which is dependent on the central part of UUNNi/i/i/NNUU (SEQ ID NO:495) motif in piR-L-163 (SEQ ID NO:282) and the RRRKPDT (SEQ ID NO:488) element in ERM, and. The piR-L-163/p-ERM interaction is critical for p-ERM's binding capability to filamentous actin (F-actin) and ERM-binding phosphoprotein 50 (EBP50). Thus, piRNA/piRNA-L may play a regulatory role through direct interaction with proteins in physiological and pathophysiological conditions.
Piwi-interacting RNAs (piRNAs) are the largest class of small non-coding RNAs (sncRNAs) expressed primarily in germ line cells and thought to function with PrWI proteins to silence transposon activity and gene expression in a sequence- dependent manner during development (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014). PIWI- piRNA pathway has been implicated in transposon silencing and repression of gene expression through heterochromatin modification in germ line cells (Fang, W., Wang, X., Bracht, J.R., Nowacki, M. & Landweber, L.F. Piwi-interacting RNAs protect DNA against lost during Oxytricha genome arrangement. Cell 151, 1243-1255 (2012); Brennecke, J. et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128, 1089-1103 (2007); Batista, P.J. et al. PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Mol. Cell 31, 67-78 (2008); Das, P.P. et al. Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the
Caenorhabditis elegans germline. Mol. Cell 31, 79-90 (2008); Rajasethupathy, P. et al. A role for neuronal piRNAs in the epigenetic control of memory-related synaptic plasticity. Cell 149: 693-707 (2012); Shirayama, M. et al. piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell 150, 65-77 (2012); Lee, H.C. et al. C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts. Cell 150, 78-87 (2012); Ashe, A. et al. piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell 150, 88-99 (2012)). Although piRNA expression has been observed in human somatic cells such as cancer cells (Mei, Y., Clark, D. & Mao, L. Novel dimensions of piRNAs in cancer. Cancer Lett 336, 46-52 (2013)), the extent of piRNA expression in mammalian somatic tissues remains an outstanding question (Ross, R.J., Weiner, M.M. & Lin, H. PrWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014), as are the functional roles of piRNAs in these tissues.
The ERM proteins (ezrin, radixin and moesin) belong to a family of proteins located at cell cortex (Fehon, R.G., Mclatchey, A.I. & Bretscher, A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11, 276-287 (2010); Fievet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. 1773, 653-560 (2007); McClatchey, A.I. ERM proteins at a glance. J Cell Sci. 127:3199-204 (2014); Neisch, A.L & Fehon, R.G. Ezrin, Radixin and Moesin: key regulators of membrane-cortex interactions and signaling. Curr Opin Cell Biol. 23, 377-82 (2011)). They are critical in connecting transmembrane proteins, such as EBP50, and the cytoskeleton to play important role in regulating signal transduction pathways (McClatchey, A.I & Fehon, R.G. Merlin and the ERM proteins— regulators of receptor distribution and signaling at the cell cortex. Trends Cell Biol. 19, 198-206 (2009); Bretscher, A., Edwards, K. & Fehon, R.G. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol. 3, 586-99 (2002); Solinet, S. et al. The actin-binding ERM protein Moesin binds to and stabilizes microtubules at the cell cortex. J Cell Biol. 202, 251-60 (2013); Morales, F.C., Takahashi, Y., Kreimann, E.L & Georgescu, M.M. Ezrin-radixin- moesin (ERM)-binding phosphoprotein 50 organizes ERM proteins at the apical membrane of polarized epithelia. Proc Natl Acad Sci. 101, 17705-17710 (2004); Fouassier, L., Yun, C.C., Fitz, J.G.& Doctor, R.B. Evidence for ezrin-radixin-moesin-
binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions. J Biol Chem. 275, 25039-25045 (2000); Lamb, R.F. et al. The TSC1 tumor suppressor hamartin regulates cell adhesion through ERM proteins and the GTPase Rho. Nat Cell Biol. 2, 281-287(2000)). These proteins are highly conserved throughout evolution, particularly at their N-terminus and C-terminus regions (Turunen, O., Wahlstrom, T. & Vaheri, A. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J Cell Biol. 126, 1445-1453 (1994); Matsui, T. et al. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol. 140, 647-657 (1998); Gary, R. & Bretscher, A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell. 6, 1061-75 (1995)) and expressed in a tissue-specific manner (Fehon, R.G., Mclatchey, A.I. & Bretscher, A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11 , 276-287 (2010); Doi, Y. et al. Normal development of mice and unimpaired cell adhesion/cell motility/actin-based cytoskeleton without compensatory up-regulation of ezrin or radixin in moesin gene knockout. J Biol Chem. 21 A, 2315-2321 (1999)). It is believed that ERM function is regulated through changing the folding of the protein (Fie vet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. Π73, 653-560 (2007); McClatchey, A.I. ERM proteins at a glance. J Cell Sci. 127:3199- 204 (2014); Neisch, A.L & Fehon, R.G. Ezrin, Radixin and Moesin: key regulators of membrane-cortex interactions and signaling. Curr Opin Cell Biol. 23, 377-82 (2011); Matsui, T. et al. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol. 140, 647-657 (1998). In the inactive form, the proteins are folded and the binding sites to EBP50 and F-actin are masked (Matsui, T. et al. Rho-kinase phosphorylates COOH-terminal threonines of ezrin/radixin/moesin (ERM) proteins and regulates their head-to-tail association. J Cell Biol. 140, 647-657 (1998); Gary, R. & Bretscher, A. Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell. 6, 1061-75 (1995)). Upon phosphorylation at a particular C-terminus site (Thr558 for moesin or Thr576 and Thr564 for ezrin and radixin, respectively), ERM
proteins become activated by unfolding to expose the masked binding sites and allowing the proteins bind to EBP50 and F-actin (Fievet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. 1773, 653-560 (2007); McClatchey, A.I. ERM proteins at a glance. J Cell Sci. 127:3199-204 (2014); Neisch, A.L & Fehon, R.G. Ezrin, Radixin and Moesin: key regulators of membrane-cortex interactions and signaling. Curr Opin Cell Biol. 23, 377-82 (2011); Solinet, S. et al. The actin-binding ERM protein Moesin binds to and stabilizes microtubules at the cell cortex. J Cell Biol. 202, 251-60 (2013); Morales, F.C., Takahashi, Y., Kreimann, E.L & Georgescu, M.M. Ezrin-radixin-moesin (ERM)-binding phosphoprotein 50 organizes ERM proteins at the apical membrane of polarized epithelia. Proc Natl Acad Sci. 101, 17705-17710 (2004); Fouassier, L., Yun, C.C., Fitz, J.G. & Doctor, R.B. Evidence for ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions. J Biol Chem. 275, 25039-25045 (2000)).
Here, we demonstrated that piRNAs are expressed in somatic human bronchial epithelial cells and the expression patterns are distinctive between normal bronchial epithelial cells and lung cancer cells. Importantly, we further demonstrated that piRNA-Like-163 (piR-L-163 (SEQ ID NO:282)), the top down-regulated piRNAs in lung cancer cells, directly binds to phosphorylated ERM (p-ERM) and play a critical role in ERM activation.
RESULTS
Expression of piRNAs/piRNA-Like sncRNAs in somatic cells
To explore potential implications of piRNA in lung cancer, we firstly analyzed global piRNA expression profiles in 8 NSCLC and 3 HBE cell lines. Small RNAs ranging approximately from 25 to 33 bases were used for library construction (Fig. la-c and Table 2) based on previous reports (Aravin, A. et al. A novel class of small RNAs bind to MILI protein in mouse testes. Nature 442, 203-207 (2006); Grivna, S.T., Beyret, E., Wang, Z. & Lin, H. A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 20, 1709-1714 (2006); Watanabe, T. et al. Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in
testes. Genes Dev 20, 1732-1743 (2006); Girard, A., Sachidanandam, R., Hannon, G.J. & Carmell, M.A. A germline-specific class of small RNAs binds mammalian Piwi proteins. Nature 442, 199-202 (2006); Samji, T. PIWI, piRNAs, and germline stem cells: what's the link? Yale J Biol Med. 82, 121-124 (2009); Peng, H. et al. A novel class of tRNA-derived small RNAs extremely enriched in mature mouse sperm. Cell Res. 22, 1609-1612 (2012)). RNA-seq was performed and resulted in approximately 4.5 million reads with >99 of the reads between 26 and 32 bases (Fig. 7a), and approximately 50% of the reads mapped to >2 loci in the human genome sequences (Fig. 7b), indicating that the piRNA reads captured a nontrivial portion of piRNA diversity (Ruby, J.G. et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193-1207 (2006)). The original sequence data is deposited in GEO database and accessible through the following link: http://www.ncbi.nlm. nih.gov/geo/query /acc.cgi?token=ini'otwauavbsztsr&acc=(jSE 57681.
A total of 555 piRNAs between 26 and 32 bases were called based on >20 reads of individual piRNA in any of the cell lines. These piRNAs are distributed among chromosomal and mitochondrial genomes with bias in chromosomes 1 and 6 (Fig. 2a and 2b; Fig. 8a). Consistent with previous reports, 99% of the piRNAs are mapped to intergenic regions (64%) or introns (35%) and 1 % to exons (Gan, H. et al. piRNA profiling during specific stages of mouse spermatogenesis. RNA 17, 1191— 1203 (2011); Robine, N. et al. A broadly conserved pathway generates 3'UTR- directed primary piRNAs. Curr. Biol. 19, 2066-2076 (2009)). (Fig. 8b and Table 2). Of the 555 piRNAs, 191 (47%) are matched in the NCBI (SEQ ID NO: l-191) and 295 (53%) are novel (Fig. 9 (SEQ ID NOS: 192-486)). A majority of the novel piRNAs had >100 reads in the samples (Fig. 10). Because many of these piRNAs are new, identified in adult tissues and not yet fully characterized, we refer to these sncRNAs as piRNA-Like sncRNAs or piRNA-Ls in this report.
Expression patterns of piRNAs and piRNA-Ls
To determine potential biological roles of these sncRNAs, piRNA and piRNA- L expression patterns were firstly used in an unsupervised hierarchy clustering
analysis for the 11 cell lines. NSCLC lines and HBE lines can be clearly clustered together based on the expression patterns of the entire piRNAs and piRNA-Ls (Fig. 2c) as well as piRNAs or piRNA-Ls individually (Fig. 2d, e). Because among the 8 NSCLC cell lines, 4 (H157, H226, H596 and SK-MES-1) derived from patients with lung squamous cell carcinoma (SCC) and 4 (H522, H1437, H1792 and H1944) from patients with adenocarcinoma (ADC), we could also examine the patterns between these two major NSCLC subtypes. The expression patterns were in fact able to separate ADC subtype from SCC subtype of NSCLC (Table 1 and Fig. Id, e). These results suggest that these sncRNAs may play a biological role in lung tumorigenesis and NSCLC differentiation.
We then analyzed differentially expressed piRNAs and piRNA-Ls between NSCLC (ADC or SCC) and HBE cell lines. Using filtered log fold change (LFC) =1 and false discovery rate (FDR) <0.05 as criteria, we observed 51 differentially expressed piRNAs or piRNA-Ls between ADC cells and HBE cells, 18 between SCC cells and HBE cells, including 9 differentially expressed piRNA-Ls common for both ADC and SCC (Table 5). Of these, piRNA-L-163_igs (in brief as piR-L-163 (SEQ ID NO:282)) is a piRNA-L aligned to intron 10 of LAMC2 gene on Chromosome 1 and the top commonly down-regulated piRNA-L in NSCLC cell lines (Fig. 3a; Fig. 11a, b).
piR-L-163 and its biological impact in cell cycle regulation
First, we analyzed whether piR-L-163 (SEQ ID NO:282) carries a 3 terminal 2'-0-methylation, a characteristic feature of piRNA (Luteijn, M.J. & Ketting, R.F. PIWI- interacting RNAs: from generation to transgenerational epigenetics. Nat Rev Genet. 14, 523-534 (2013); Houwing, S., et al. A Role for Piwi and piRNAs in Germ Cell Maintenance and Transposon Silencing in Zebrafish. Cell 129, 69-82 (2007); Kirino, Y. & Mourelatos, Z. Mouse Piwi-interacting RNAs are 2[prime]-0- methylated at their 3[prime] termini. Nat Struct Mol Biol. 14, 347-348 (2007); Faehnle, C.R. & Joshua-Tor, L., Argonautes confront new small RNAs. Curr Opin Chem Biol. 11, 569-577 (2007)).
We used both synthesized oligo RNA and RNA isolated from HBE4 cells and treated these RNAs with periodate (I04) followed by beta elimination and analyzed them. As expected, the synthesized oligo RNA without 3 prime 2'-0-methylation was
sensitive to the Ι04 treatment and resulted in a 2 bases reduction (Fig. 3b, left) whereas no reduction was observed for piR-L-163 (SEQ ID NO:282) (Fig. 3b, right), indicating that iR-L-163 (SEQ ID NO:282) carried a 3 prime 2'-0-methylation. We then performed RTL-P (Reverse Transcription at Low dNTP concentrations followed by PCR) and showed that the signal intensities of RT-PCR products produced with an unanchored primer was only 20% of the products with an anchored primer when 0.4μΜ dNTPs were used (Fig. 3c), further supporting that piR-L-163 (SEQ ID NO:282) had RNA 2'-0-methylation consistent with a mature piRNA.
We then wanted to determine whether piR-L-163 (SEQ ID NO:282) plays a functional role in human bronchial epithelial cells. We treated HBE4 cells as well as primary normal human bronchial epithelial (NHBE) cells with piR-L-163 complementary DNA oligonucleotides (Ant- 163) (SEQ ID NO:496) or RNA oligonucleotides (Ant-163R) (SEQ ID NO:497) in the experiment. The RNA oligonucleotides triggered a siRNA like response as expected (Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-811 (1998) and resulted in reduced expression levels of LAMC2 but not the DNA oligonucleotides (Fig. 11c). We, therefore, used the DNA oligonucleotides in all subsequent experiments as the piR-L-163 blocking agent. Compared with HBE or NHBE cells treated with scrambled DNA oligonucleotides (Scr), the cells treated with Ant- 163 showed enhanced cell viability and proliferation (Fig. 3d-e). We next performed cell cycle analysis using HBE4 cells synchronized at S phase followed by treatment with either Ant- 163 or Scr. Cell cycle distributions were measured every 2 hrs. We showed an accelerated DNA synthesis and G2-M accumulation for the cells treated with Ant- 163 compared to the cells treated with Scr (Fig. 3f), suggesting a functional role of piR-L-163 in the cell cycle regulation.
We next wanted to know the cellular localization of piR-L-163 in HBE cells. Using a fluorescence in situ hybridization (FISH) method with a digoxin (DIG)- labelled probe complimentary to piR-L-163, we surprisingly observed that piR-L-163 was not localized in the nucleus as expected for piRNAs (Siomi, M.C., Sato, K., Pezic, D. & Aravin, A.A. PrWI-interacting RNAs: the vanguard of genome defence. Nature 12: 246-258 (2011)), but predominantly located in cytoplasm during interphase, moved into the cell cortex in metaphase, and concentrated on junctions of cell division
in anaphase (Fig. 3g). The finding is intriguing because piRNAs are believed to function as a PlWI-binding and sequence-dependent epigenetic regulator (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PlWI-interacting RNAs in the soma. Nature 505, 353-359 (2014)).
piR-L-163 binds to p-ERM and regulates p-ERM activity
Because of the unexpected cellular localizations of piR-L-163 during cell cycle progression, we suspected that piR-L-163 plays a biological role through interaction with proteins. To identify potential piR-L-163 interacting proteins, biotin- conjugated piR-L- 163 RNA oligonucleotides were used as a bait to pull down cellular binding proteins in HBE4 cells. Compared to proteins pulled down using Scr control RNA, we revealed two protein bands predominantly presented in the piR-L-163 pull down product (Fig. 4a). Liquid chromatography-tandem mass spectrometry (LC-MS- MS) analysis of the bands revealed ERM proteins as the major protein components, including 7 peptides of ezrin, 5 peptides of radixin and 15 peptides of moesin (Fig. 4a), suggesting that piR-L-163 binds to ERM proteins in HBE4 cells.
To confirm the binding between piR-L-163 and ERM proteins, we performed immune -precipitation (IP) assays using anti-Moesin antibodies followed by RT-PCR using primers specific for piR-L-163. While piR-L-163 was not detectable in the IP products using either a control IgG antibody or an antibody for non-phosphorylated moesin (Fig. 4b), piR-L-163 was readily detected in the IP product using an antibody specific for ERM proteins with phosphorylated threonine (p-Thr) in the C termini of the proteins (p-ERM), which is the functionally active form of ERM proteins (Roubinet, C. et al. Molecular networks linked by Moesin drive remodeling of the cell cortex during mitosis. /. Cell Biol. 195, 99-112 (2011); Kunda, P., Pelling, A.E., Liu, T. & Baum, B. Moesin controls cortical rigidity, cell rounding, and spindle morphogenesis during mitosis. Curr. Biol. 18, 91-101 (2008)) (Fig. 4b). It should be noted that p-Moesin is the predominant p-ERM protein in HBE4 cells as detected by the phosphorylation specific antibody (Fig. 4c) and the protein levels were not significantly changed following treatment with Ant- 163 (Fig. 4c). These results suggest that piR-L-163 only binds to functionally activated p-ERM proteins but not the inactive form of ERM.
To validate that piR-L-163 and ERM binding is p-ERM specific, we replaced with an exogenous Drosophila wild type (Moe-WT-GFP) moesin which shares an identical C-terminal motif with human moesin containing the p-Thr site (Polesello, C, Delon, I., Valenti, P., Ferrer, P. & Payer, F. Dmoesin controls actin-based cell shape and polarity during Drosophila melanogaster oogenesis. Nat Cell Biol. 4, 782- 789 (2002)), a constitutively active phosphor mimetic mutant (Moe-TD-GFP), or an inactivated mutant (Moe-TA-GFP) at the p-Thr site (Roubinet, C. et al. Molecular networks linked by Moesin drive remodeling of the cell cortex during mitosis. /. Cell Biol. 195, 99-112 (2011); Kunda, P., Pelling, A.E., Liu, T. & Baum, B. Moesin controls cortical rigidity, cell rounding, and spindle morphogenesis during mitosis. Curr. Biol. 18, 91-101 (2008)) (Fig. 4d) in HBE4 cells. To be effective, the HBE4 cells expressing these transgenes were treated with dsRNA specifically targeting the 3' untranslated region (UTR) of the endogenous moesin RNA to reduce the endogenous moesin level (Fig. 4e). Because all the proteins generated from transfected Drosophila moesins contained GFP, an anti-GFP antibody was used to pull down the fusion proteins and to determine whether the IP products containing piR-L-163, an indication of their binding with piR-L-163.
piR-L-163 was only detected in the IP products from Moe-WT-GFP and Moe- TD-GFP transfected cells but not Moe-TA-GFP transfected cells (Fig. 4f), supporting the notion that the threonine phosphorylation is critical for the binding between piR- L-163 and moesin. However, we noticed that the amount of Moe-TA-GFP pull downed in the IP product was much lower than that of Moe-WT-GFP (Fig. 4f). It is likely due to difference in the protein conformation of Moe-TA-GFP because the mutation prevented the specific amino acid from phosphorylated, which resulted in a weakened binding affinity between the fusion protein and the anti-GFP antibody. It is also possible that the lack of detectable piR-L-163 in the PI product from Moe-TA- GFP transfected cells was simply due to the lower amount of Moe-TA-GFP in the IP product. To rule out the later possibility, we used 4-fold input of the PI product from Moe-TA-GFP transfected cells and repeated the experiment. With a comparable amount of pull downed Moe-TA-GFP compared to Moe-WT-GFP (Fig. 4g), piR-L- 163 remained undetectable in the PI product from Moe-TA-GFP transfected cells
(Fig. 4g), confirming that the lack of detectable piR-L-163 was not due to the amount of Moe-TA-GFP in the IP product.
Motif and element critical for piR-L-163 and ERM interaction
We next wanted to determine the site critical for piR-L-163's binding to p- ERM. We first analyzed the piR-L-163 sequence and identified a candidate motif "UUNNUUUNNUU" (SEQ ID NO:495) with potentially critical for the binding (Fig. 5a). We then generated 5 mutant forms of piR-L-163 named as M1-M5 (Fig. 5b and Table 3) to test their potential impact on the p-ERM binding. For this experiment, we used H1792 cells because these cells expressed extremely low level of endogenous piR-L-163 but considerable amount of p-ERM (Fig. 5c and Fig. 11a). H1792 cells were transfected with Scr (control), Ant- 163, piR-L-163 (WT), or Mutant 1 (Ml) to Mutant 5 (M5) RNA oligonucletides, respectively. An anti-p-ERM antibody was used for IP followed by RT-PCR using primers specific for Scr, Ant- 163, piR-L-163, or M1-M5 (Table 6) to detect the corresponding oligonucleotides. As shown in Figure 5e, while strong RT-PCR band was detected in the cells transfected with piR-L-163, no RT-PCR band could be detected in the IP products from the cells transfected with Scr, Ant-163, Ml or M2, indicating these oligonucleotides do not bind p-ERM. Conversely, RT-PCR bands with expected sizes were detected in the IP products from cells transfected with M3, M4 or M5, although the band from the M3 transfected cells was substantially weaker than those from M4 and M5 transfected cells (Fig. 5e). These results indicate that the central 3 nucleotides of the UUNNE/i/i/NNUU (SEQ ID NO:495) motif (Fig. 5b) are critical for piR-L-163 to bind p-ERM.
To determine potential element of ERM proteins critical for their binding with piR-L-163, we analyzed human and Drosophila moesin sequences using BindN (http:/ bioinfo.ggc.org/bindn/) and identified RRRKPDT (SEQ ID NO:488) at position 293-299 as a candidate RNA binding element (Fig. 12a, b). We then constructed plasmids containing either wild-type human moesin (Moesin- WT) or a mutant form of moesin with RRRKPDT (SEQ ID NO:488) deletion (Moesin-DM). Both plasmids produce high levels of moesin proteins in the transfected cells (Fig. 5d). We used two cell lines (H522 and HBE4) to test if this element contributes to the binding between moesin and piR-L-163. H522 cells expressed extremely low level of endogenous p-ERM (Fig. 5c) and very low level of piR-L-163 (Fig. 11a). H522 cells
transfected with piR-L-163 were simultaneously transfected with either Moesin-WT or Moesin-DM to determine the potential binding ability of the introduced moesin proteins with piR-L-163. We also used the non-functional piR-L-163Ml mutant to replace piR-L-163 in the experiment as a negative control. While Moesin-WT bound to piR-L-163 but not piR-L-163Ml as expected (Fig. 5f, left panel), Moesin-DM failed to bind piR-L-163 (Fig. 5f, left panel), indicating that the RRRKPDT (SEQ ID NO:488) element is critical for moesin's interaction with piR-L-163. We next transfected HBE4 cells which expressed both p-ERM and piR-L-163 (Fig. 4e and Fig. 11a) with either Moesin-WT or Moesin-DM after knocked down the endogenous moesin in the cells. We demonstrated again that only Moesin-WT but not Moesin- DM bound piR-L-163 (Fig. 5f, right panel).
piR-L-163 is critical for ERM' s functional activities
Because p-ERM functions primarily through binding to F-actin and EBP50 (ERM-binding phosphoprotein 50) through their C-ERMAD and FERM domain (Fouassier, L., Yun, C.C., Fitz, J.G.& Doctor, R.B. Evidence for ezrin-radixin- moesin-binding phosphoprotein 50 (EBP50) self-association through PDZ-PDZ interactions. J Biol Chem. 275, 25039-25045 (2000); Turunen, O., Wahlstrom, T. & Vaheri, A. Ezrin has a COOH-terminal actin-binding site that is conserved in the ezrin protein family. J Cell Biol. 126, 1445-1453 (1994); Bretscher, A. et al. ERM-Merlin and EBP50 protein families in plasma membrane organization and function. Annu Rev Cell Dev Biol. 16, 113-143 (2000)), we analyzed the binding affinities of p-ERM with both EBP50 and F-actin in IP products from H1792 cells treated with Scr, Ant-163, WT, or M1-M5. As expected, p-ERM's ability to bind F-actin and EBP50 were closely correlated with binding of piR-L-163 and p-ERM (Fig. 5e). In H522 cells, wild-type moesin (Moesin-WT) together with piR-L-163 but not the mutant piR-L- 163 (piR-L-163Ml) nor a mutant moesin (Moesin-DM) resulted in an enhanced binding with F-actin and EBP50 (Fig. 5f). These results indicate that piR-L-163 binds moesin and is critical for moesin's ability to interact with F-actin and EBP50.
We then tested the potential impact of piR-L-163 in cell migration and invasion, two of the properties involving ERM's biological functions (Fehon, R.G., Mclatchey, A.I. & Bretscher, A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11, 276-287 (2010); Hunter, K.W. Ezrin, a key component in
tumor metastasis. Trends Mol. Med. 10, 201-204 (2004); Luo, Y. et al. Recognition of CD 146 as an ERM -binding protein offers novel mechanisms for melanoma cell migration. Oncogene 31, 306-321 (2013); Clucas, J. & Valderrama, F. ERM proteins in cancer progression. J Cell Sci. 128, 1253 (2015)). In a trans-well invasion assay, HBE4 cells treated with Ant- 163 showed a significantly increased invasion capability compared to cells treated with Scr control, even after 15% downward adjustment for the cells treated with Ant- 163 to compensate the possible increase of the cell number after 12 hrs (Fig. 6a). Conversely, H1792 cells transfected with piR-L-163 exhibited a significantly decreased invasion capability compared to the cells treated with a control RNA oligonucleotides (Fig. 6b). The cells transfected with either Ant- 163 or a mutant piR-L-163 showed no impact to the cells' invasion capability (Fig. 6b).
For cell migration, we used two complementary assays. In a quantitative cell migration assay, HBE4 cells treated with Ant- 163 exhibited significantly increased cell migration compared to the cells treated with Scr control (Fig. 6c). Conversely, H1792 cells transfected with piR-L- 163 showed significantly decreased cell migration compared with the cells treatment with Scr or Ant- 163 (Fig. 6d). To compensate potential differences in the cell numbers among different treatment conditions, we seeded 10% less cells for Ant- 163 treated HBE4 cells and 10% more cells for piR-L- 163 transfected H1792 cells. In the wound healing assays, HBE4 cells treated with Ant- 163 showed a faster gap closure than the cells treated with Scr control (Fig. 6e). Conversely, H1792 cells transfected with piR-L-163 showed a slower gap closure compared to cells transfected with Scr control, Ant- 163 or a mutant piR-L-163 (Fig. 6f).
In this study, we systematically profiled the expression of piRNAs in adult human airway cells including both immortalized normal bronchial epithelial cells and lung cancer cells. Because piRNAs are predominantly expressed in germline cells to play a key role in suppressing activities of transposons, the identification of more than 550 piRNAs or piRNA-Ls in these adult cells is important, suggesting that these sncRNAs play biological roles beyond transposon regulation. Because we used a conservative calling (>20 reads in a cell line) and the relatively low total reads (4.5 million) for the 11 cell lines, the actual number of piRNAs/piRNA-Ls expressed should be higher. Further studies will be needed to determine whether these
piRNAs/piRNA-Ls are biologically important in the adult cells, particularly those expressed at very low levels.
Nevertheless, our data suggest that these piRNAs/piRNA-Ls play certain biological roles and are involved in lung tumorigenesis because the expression patterns are distinctive between normal bronchial epithelial cells (HBEs) and lung cancer cells. Furthermore, different expression patterns were also observed between adenocarcinomas and squamous cell carcinomas. Although this study did not focus on potential applications of piRNAs/piRNA-Ls for patients with lung cancer, our data suggest that piRNAs/piRNA-Ls may be a new class of molecules potentially useful as biomarkers for cancer classification as well as therapeutic targets.
The finding that piR-L-163 binds directly to p-ERM and regulates ERM functional activities is unexpected and mechanistically important. Our data demonstrate a dynamic interaction between piR-L-163 and p-ERM in subsequent functional activities reflected to cell proliferation, migration and invasion. It should be noted, however, that other factors might also be involved in addition to ERM for piR-L-163 mediated impact in cell proliferation, migration and invasion. Further studies will be necessary to address these issues. Nevertheless, this is the first time that a sncRNA is revealed to participate in a protein functional regulation through a direct interaction with the protein in mammalian cells, in this case, through piR-L-163 binding to p-ERM. We have narrowed down the critical RNA motif in piR-L-163 to the central 3 nucleotides (UUNNi/i/i/NNUU) (SEQ ID NO:495) and a small peptide element in ERM critical for the interaction. Based on current model, upon ERM proteins bind to ptdIns(4,5)P2 (PIP2), which is required for phosphorylation of the threonine in the C-terminus of ERM (Fehon, R.G., Mclatchey, A.I. & Bretscher, A. Organizing the cell cortex: the role of ERM proteins. Nat Rev Mol Cell Biol. 11, 276- 287 (2010); Fievet, B., Louvard, D. & Arpin, M. ERM proteins in epithelial cell organization and functions. Biochim Biophys Acta. 1773, 653-560 (2007); Bretscher, A., Edwards, K. & Fehon, R.G. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol. 3, 586-99 (2002); Hao, J.J. et al. Phospholipase C- mediated hydrolysis of PIP2 releases ERM proteins from lymphocyte membrane. J Cell Biol. 184, 451-462 (2009)), the bound between FREM and C-ERMAD domains weakens and the clamp formed by the two domains opens. It is therefore possible that
piR-163 binds to p-ERM at this point to stabilize the opening structure and allow the binding sites in FREM and C-ERMAD domains interacting with the cytoplasmic tail of EBP50 and F-actin.
Methods
Cell culture
Human NSCLC cell lines H157, H226, H596, SK-MES-1 , H522, H1437, H1792 and H1944 were obtained from ATCC (Manassas, VA, USA) and cultured in RPMI 1640 with 10% FBS (Sigma- Aldrich). Human HBE cell lines (HBE2, HBE3 and HBE4) were provided by Dr. John D. Minna (University of Texas Southwestern Medical Cancer, Dallas, Texas) and cultured in Keratinocyte-SFM with L-Glutamine, prequalified human recombinant Epidermal Growth Factor and Bovine Pituitary Extract (BPE) (Life Technology). All the cell lines were genotyped for their authentication (the test was done on October 24, 2014). Mycoplasma contaminations were regularly tested and the cells were routinely treated to prevent mycoplasma growth.
Total mature piRNA purification
To obtain purified mature piRNAs, sncRNAs (<200 nt) were firstly separated from total RNA, and then piRNAs were purified from sncRNA in one nucleotide resolution gel. The entire process consisted of total RNA extraction, sncRNA separation, piRNA separation and piRNA enrichment. For total RNA extraction, mirVana™ miRNA isolation kit (Ambion) was used according to the manufacturer's instructions. For sncRNA separation, extracted total RNAs were separated using Craig C. Mello Lab's sncRNA cloning protocols (Gu W and Conte D. http://www.umassmed.edu/uploadedFiles/nemo/Mello%201ab%20small%20RNA% 20cloning%20protocol.pdf) with following minor modifications: Mixed 80μ1 (<lmg) of total RNA, 400μ1 (5x volume of total RNA) of MirVana lysis/binding buffer, and 48μ1 (1/10 volume of total RNA and lysis/binding buffer) of MirVana homogenate buffer in a 1.5mL Eppendorf (EP) tube; Incubated the tube at room temperature (RT) for 5 min to denature RNA followed by adding 1/3 volume (176μ1) of 100% ethanol and mixed well; Span the tube at 2,200 x g for 4 min at RT to remove larger (>200nt) RNA, and then transferred the supernatant to a new EP tube and added isopropanol (~700μ1); Precipitated sncRNAs at -80°C until it was frozen (-30 min), and pelleted
sncRNA at 20,000 x g at 4°C for 40 min; Washed once with 70% cold ethanol (American Bioanalytic), and dissolved the pellet with Nuclease-free water.
Next, piRNAs were separated on 15% denaturing acrylamide gel with following specific steps: Prepared gel by mixing the following reagents in 50mL tube: 6.3g Urea (Fish Scientific), 1.5mL ΙΟχΤΒΕ (Life technology), 5.6mL 40% Acrylamide (Bio-Rad), and 3mL Nuclease-free water (Quality Biological); Stirred at RT until urea is completely dissolved, then added 75ul of 10% AP (Sigma-Aldrich) and 15μ1 of TEMED (Bio-Rad), mixed well and loaded into the electrophoresis shelf to form gel; Pre-run gel in lxTBE for 20 min at 300V; Heated samples and markers at 75 °C for 5 min, and put them immediately on ice; Run the samples at 300V for 35 min; Stained the gel with 0^g/ml Ethidium Bromide (EB, Sigma-Aldrich) in a clean container for 2-3 min, carefully cut out the target band with a scalpel using UV light for visualizing bands.
piRNAs were pelleted using a modified protocol of True® Small RNA for sequence preparation (Illumina): Punctured the bottom of a sterile, Nuclease-free, 0.5mL micro centrifuge tube 3-4 times with a 21 -gauge needle; Placed the target band into punctured tube, and put the tube into a new 1.5mL EP tube; Centrifuged the stacked tubes in 20,000 x g in a micro centrifuge for 2 min at RT to move the gel through the holes into the 1.5 ml tube, and ensured that the gel was completely moved into the bottom tube; Added 300μ1 of Nuclease-free water to the gel debris, and eluted the DNA by shaking the tube overnight at RT followed by transfering to the top of a 5μιη filter, and centrifuged the filter for 10 sec in 600 x g; Added the following reagents to the collected fluid: 2μ1 Glycogen (Invitrogen), 30μ1 3M NaAc (Invitrogen), and 975μ1 Pre-chilled 100% Ethanol; Precipitated at -80°C until it was frozen, and then pelleted by 20,000 x g at 4°C for 40 min; Washed once with 70% cold ethanol, and dissolved the pellet in Nuclease-free water.
Prepare piRNAs for sequencing
As described in Figure 1, 5'- and 3'- end adaptors containing barcodes were added to extracted sncRNAs. RT-PCR was performed according to the manufacturer's instructions of True® Small RNA kit. RNA-seq was performed using Illumina sequencer in the University of Maryland Institute for Genome Sciences.
Periodate treatment and Beta elimination
The method was used to determine 2-O-methylation at the 3' end (Gunawardane, L.S. et al. A slicer-mediated mechanism for repeat-associated siRNA 5' end formation in Drosophila. Science 315, 1587-1590 (2007); Kirino, Y. & Mourelatos, Z. Mouse Piwi-interacting RNAs are 2'-0-methylated at their 3' termini. Nat Struct Mol Biol. 14, 347-348 (2007)). Synthetic 30 bases RNA without modification was used as a control. Briefly, sncRNAs from HBE4 cells or synthetic RNA was dissolved in 25 μΐ of lOmM NaI04, kept at 4°C for 40 min in dark room; RNAs were precipitated and the pellet was dissolved in 60μ1 of 1M L-Lysine (PH8.5, Sigma-Alrich), and kept the tube at 45°C for 90 min; RNAs were precipitated and dissolved in Nuclease-free water; Separated the RNAs on 15% denaturing acrylamide gel; For positive control, stained the gel with EB in a clean container for 2-3 min, then took photos (UVP, BioSpectrum® AC imaging system); For sncRNAs extracted from HBE4 cells, transferred the gel to Zeta-Probe® Membrane (Bio-RAD) in 0.5xTBE for 60 min at 80V for Northern blot after UV cross-linking (UV Stratalinker 2400, Stratagene).
Northern blot
Probe for detecting piR-L-163 was 5'-
GGTCAGAGAATCAAAGTAACATCATGATAT-3' (SEQ ID NO:498) (Synthesized by IDT). Chemically synthesized oligonucleotides were labelled with γ- 32P-ATP with T4 polynucleotide Kinase (Thermo Scientific). Briefly, separated labeled oligonucleotides from unincorporated label by gel filtration on NucAway™ Spin Columns (Ambion), and 10k cpm of 32P labeled oligonucleotides was used for each reaction; Pre-wash the membrane in O. lxSSC (Quality Biological) with 0.1 % SDS (Bio-Rad) for 1 hr at 65 °C; Removed prewash solution, preheated pre- hybridization buffer (Ambion) to 40°C and then hybridized the membrane in the buffer for 2 hrs at 40 °C; Removed pre-hybridization buffer, added labeled probe to 10ml hybridization buffer (Ambion), and hybridized overnight at 37 °C; Washed blot in 6xSSC with 0.1 % SDS for 5 min at RT for three times, and pre-erased Phosphorlmager screen simultaneously for 20 min on light table; Repeated wash a fourth time for 20 min at 30°C, laid the damp blot on clean saran wrap after finishing wash, and fold wraps to seal blot; Exposed wrapped blot to Phosphorlmager screen in cassette, and imaged screen after 2 hrs.
Reverse Transcription (RT)-PCR
To amplify sncRNAs, we added an adaptor to the 3' end, a process including adaptor ligation, RT and PCR(de Vanssay, A. et al. Paramutation in Drosophila linked to emergence of a piRNA-producing locus. Nature 490, 112-115 (2012); Li, Z. et al. Characterization of viral and human RNAs smaller than canonical MicroRNAs. J Virol. 83, 12751-12758 (2009)). For adaptor ligation, the adaptor /5 'rapp/CTGTAGGC ACCATCAAT/3 ' ddc/ (SEQ ID NO:499) with both 5' and 3' modification was used. Briefly, mixed Ιμΐ (lOpmol, ~55ng) of RNA 3' adaptor and 4.2μ1 (~100ng) of purified sncRNAs in a 1.5ml EP tube; Incubated at 72°C for 2 min, then placed on ice immediately and kept it on ice for at least 1 min; Added the following reagents (New England Biolabs) to the above tube: 0.8μ1 ΙΟχ RNA ligase buffer, Ιμΐ RNase inhibitor, and Ιμΐ single strand RNA ligase; Mixed it well and incubated at 37 °C for 1 hr, then terminated the reaction at 65°C for 15 min. For RT, Superscript™ III First-Strand Synthesis System (Invitrogen) was used according to the manufacturer's instructions with gene specific primer (5'- CAAGCAGAAGACGGCATACGAATTGATGGTGCCTACAG-3') (SEQ ID NO: 500). For PCR, a common reverse primer (5'- CAAGCAGAAGACGGCATACGA -3') (SEQ ID NO:501) and primers specific for individual sncRNAs (Table 6). Amplification conditions were denaturation at 95 °C for 30 s (5 min for the first cycle), annealing at 60°C for 20 s and extension at 72°C for 20 s (2 min for the last cycle) for 25 cycles.
Immune Precipitation (IP)
For IP using piR-L-163, synthesized biotin labeled RNA oligonucleotides (/5'Biosg/AUAUCAUGAUGUUACUUUGAUUCUCUGACC-3') (SEQ ID NO: 502) was used and scrambled RNA
(/5'Biosg/GAUACCAAGGACAUACGCUUAUGCAUGCUA-3') (SEQ ID NO: 503) used as a control.
Protein extracts from lxlO7 cells using HKMG lysis buffer (lOmM HEPES pH 7.9, lOOmM KCL, 5mM MgC12, 10% glycerol, ImM dithiothreitol, 0.1 % NP40) with protease and phosphatase inhibitors (Roche) were incubated with \ g biotin- labeled RNA for 16 hr at 4°C with rotation after pre-clearing with streptavidin beads, then coupled to ΙΟμΙ 50% of streptavidin agarose beads (Sigma- Aldrich). After
incubation, the biotin-labeled oligonucleotide-coupled streptavidin beads were washed four times with HKMG lysis buffer. Samples were denatured in SDS protein loading buffer before running on a SDS-acrylamide gel.
For IP using anti-human Moesin or p-ERM antibodies, anti-Moesin (Clone Q480, Catalog No. 3150, Cell Signaling) or anti-p-ERM (Clone 41A3, Catalog No. 3149, Cell Signaling) antibodies were used and a rabbit IgG was used as a control. Briefly, Saturated protein G agarose beads (Sigma-Aldrich) with rabbit IgG, anti- Moesin or anti-p-ERM antibodies, respectively (^g antibody was used for 4μ1 agarose beads) at 4°C for 3 hrs, centrifuged at 2,200 x g for 5 min, and discarded the upper aqueous phase; (2) Protein extracts prepared from cells using lysis buffer (20mM Tris-cl, pH7.6, 150mM NaCl, 20mM KC1, 1.5mM MgCk, 0.5% NP-40, 0.5mM PMSF) were pre-cleared using protein G agarose at 4°C for 2 hrs, centrifuged at 2,200 x g for 5 min, and transferred the upper aqueous phase to above tubes with agarose beads saturated with antibodies, respectively; Kept the tubes rotating overnight at 4°C, centrifuged at 2,200 x g for 5 min, and washed the beads with lysis buffer twice; Extracted total RNAs from beads using Trizol Reagent (Life Technologies); Amplification of piR-L-163 or its mutants was performed according to the steps described in the "RT-PCR" section.
For IP using GFP antibody (Clone GSN149, Catalog No. G1546, Sigma- Aldrich), Moesin mutants of Drosophila were used to test piR-L-163 binding ability. Protein extracts were prepared from cells at 48 hrs after plasmids transfection. GFP saturated protein G agarose beads were added to the pre-cleared extracts; RNA precipitation, adaptor ligation, reverse transcription and PCR were performed as described above.
Mass spectrometry
The target band for mass spectrometry was performed. The specific protocol is as follows: Selected gel bands were excised from the one-dimensional SDS- polyacrylamide gel electrophoresis gel, cut into lXlmm cubes and destained in 50% acetonitrile in lOOmM NH4HC03. Gel pieces were reduced with lOmM tris (2- carboxyethyl) phosphine hydrochloride Q22 (Thermo Scientific) in lOOmM NH4HC03 for 60min at 56 °C, and were alkylated with 55mM iodoacetamide (Sigma) in lOOmM NH4HC03 for 1 h at room temperature in the dark. After washing,
the gel pieces were dehydrated with 100% acetonitrile and dried using a speed vacuum of Q23 1.5 mg of trypsin (Promega), and a volume of 50mM NH4HC03 was added to each gel piece and the gel pieces were allowed to swell for 30 min on ice. Excess trypsin was removed and replaced with 50mM NH4HC03 and samples were incubated at 37 1C overnight. The resulting peptides were extracted using 2.5% formic acid, 50% acetonitrile in 50mM NH4HC03.
The processed samples were analyzed using a nanoscale reverse-phase liquid chromatography using an Xtreme Simple nanoLC system (CVC/Q24 MicroTech). The analytical column was prepared by packing into a laser-pulled fused silica capillary, and peptides were injected into the sample loop using an Endurance auto sampler. A 120-min liquid chromatography-gradient method with a post-split flow rate of 0.6 ml/min was used to elute Q25 the peptides into the LTQ mass spectrometer with a nanospray ionization source. Dynamic exclusion was enabled with repeat count 2, repeat duration 30 s and exclusion duration 120 s. Mass spectrometry and tandem Q26 mass spectrometry data were searched against the UniProtKB human protein database using Bioworks 3.3.1 SP1 with the SEQUEST algorithm. Search parameters included 1.5 Da peptide mass tolerance, 1.0 Da fragment tolerance, static Cys + 57.02510 (carbamidomethylation) modification and differential modification Met-i- 15.99492. Fully tryptic peptides with up to two missed cleavages and charge- state-dependent cross-correlation scores >2.5, 3.0 and 3.5 for 2+, 3+ and 4+ peptides, respectively.
RNA interference
The small interference RNA targeting untranslated region (UTR) of human Moesin (5'-CCGUUAGCAGGAAGCCUAA-3') (SEQ ID NO:504) with scrambled sequence as a control (5- GAUACCAAGGGACAUACGCUU-3 ') (SEQ ID NO:505). Sense and anti-sense oligo RNAs of Moesin and scrambled control were annealed, respectively. Transfection is performed using Lipofectamine TM RNAiMAX (Invitrogen) according to its manual, and the final concentration of annealed oligo RNAs is 400nM. Transfection and knockdown efficiency were tested at both RNA and protein levels.
Blocking piR-L-163 expression
To avoid triggering uncertain siRNA (Lamb, R.F. et al. The TSCl tumour suppressor hamartin regulates cell adhesion through ERM proteins and the GTPase Rho. Nat Cell Biol. 2, 281-287(2000)), complementary DNA was used as antagonism targeting piR- 163 (5 ' -GGTCAGAGAATCAAAGTAAC ATC ATGATAT-3 ') (SEQ ID NO:496) with scrambled DNA (5 ' -GATACC AGGGAC ATACGCTTGATCCTAGC-3 ') (SEQ ID NO: 506) as a control.
Western blot and Antibodies
Primary antibodies used were: anti-Moesin (1 : 1 ,000, Clone Q480, Catalog No. 3150, Cell Signaling), anti-p-ERM (Clone 41A3, Catalog No. 3149, Cell Signaling), anti-Moesin (Clone 38/Moesin, Catalog No. 610401, BD Transduction Laboratories), anti-p-Moesin (Thr558, Catalog No. 12895, Sanra Cruz), anti- -actin (1 :5,000, Catalog No. A228, Sigma-Aldrich), anti-EBP50 (1 : 100, Clone 6/EBP50, Catalog No.61160, BD Transduction Laboratories), anti-F-actin (1 : 100, Clone NH3, Catalog No. MA1-80729, Thermor Fisher), anti-p-Wee 1 (Se53, 1 : 1000, Catalog No. sc- 130223, Sanra Cruz), anti-Wee 1 (C-20, 1 : 1000, Catalog No. sc-325, Sanra Cruz), anti-p-Cdc2 (Tyrl5, 1 :1000, Catalog No. 9111, Cell Signaling), anti-p-Cdk (Thrl4/Tyrl5-R, 1 : 1000, Catalog No. sc-28435-R, Sanra Cruz), anti-Cdc2 p34 (H- 297, 1 : 1000, Catalog No. sc-747, Sanra Cruz), anti-p-Cdc25C (Serl98, 1 : 1000, Catalog No. 9529, Cell Signaling), anti-CDK2 (78B2, 1 : 1000, Catalog No. 2546, Cell Signaling), anti-p-Histone H2AX (Serl39, 20E3, : 1000, Catalog No. 9718, Cell Signaling), and anti-GFP (N-terminal, 1 :4000, Catalog No. G1544, Sigma). Secondary antibodies used were: Goat anti-Mouse (1 :2,500, Catalog No. 31160, Pierce), and Goat anti-Rabbit (1 :2,500, Catalog No. 31460, Pierce). Cells were lysed in RIPA buffer (Sigma) on ice after washed in PBS twice, centrifuge at 160,000 x g for 10 min at 4°C. Protein in supernatant was qualified using BCA TM protein assay kit (Thermo Scitific) and denatured in SDS loading buffer in boiling water, run 10% SDS-PAGE gel and transferred to nitrocellulose membrane (Thermo Scitific). Membrane was incubated with primary antibody overnight at 4°C after blocking, washed in PBST and incubated corresponding secondary antibody for 1 h at RT, finally was developed using SuperSignal® west pico chemiluminescent substrate (Thermo Scitific). The full gels of the Western blots presented in Figure 5 are shown in Figure 13.
Cell cycle analysis
Cell cycle distribution was analyzed by Flow Cytometry (Becton-Dickinson). Cells were synchronized in growth factor-free Keratinocyte-SFM with 2mM Thymidine (Catalog No.T1895, Sigma- Aldrich) for 24 hrs. Transfection is performed using Lipofectamine TM RNAiMAX (Invitrogen) according to its manual, and the final concentration of annealed oligo RNAs is 400nM. Four hour after transfection, culture medium was replaced by complete Keratinocyte-SFM supplemented with L- Glutamine, prequalified human recombinant EOF 1-53 and BPE. Cells were harvested at different time points, washed in phosphate-buffer saline (PBS), fixed with ice-cold 70% ethanol, and strained in PI/RNase solution (BD Pharmigen). The samples were analyzed on a FACScan flow cytometer in combination with BD lysis software (B ecton-Dickinson) .
Cell viability and cell growth curve assay
Cell viability and cell growth curve assay were determined by MTT assay and trypan blue exclusion assay, respectively as described previously (Kirino, Y. & Mourelatos, Z. Mouse Piwi-interacting RNAs are 2'-0-methylated at their 3' termini. Nat Struct Mol Biol. 14, 347-348 (2007)). BrieflySpecifically, MTT (5mg/ml) was added into cells and incubated at culture condition for 3 hours, removed the medium carefully and dissolved formazan in DMSO, assay was used to assess the surviving cells and OD values were measured using Microplate Reader Manager (Bio Rad) at wavelengths of 570/690 nm. For trypan blue exclusion assay, cells were washed in PBS for three times, and dyed in 0.4% tyrpan blue solution. Unstained viable cells were counted in hemocytometer chamber under microscope. Each experiment was performed three times independently.
Invasion assay
Briefly, 24 hrs after transfection, 6xl04 cells were placed in the upper chamber of Matrigel Invasion Chambers (BD Bioscience) with growth factor-free Keratinocyte-SFM and the bottom chamber were exposed to Keratinocyte-SFM medium supplemented with L-Glutamine, prequalified human recombinant EOF 1-53 and BPE. Invading cells were evaluated after 12 hrs according to the manufacturer's instruction. The numbers of invading cells were adjusted 15% downwards for Ant-
163 treated cells or 15% upwards for piR-L-163 treated cells to compensate the differences for the proliferation rates.
Migration assays
Two complimentary methods were used. For quantitative fluorescent dye assay, Innocyto™ Cell migration Assay kit (EMD Millipore) was used. Briefly, 24 hrs after treatment, lxlO5 cells (10% less for Ant- 163 treated cells or 10% more for piR-L-163 treated cells) were loaded to the upper chamber with growth factor-free Keratinocyte-SFM for (HBE4 cells) or serum-free DMEM (for HI 792 cells) with the bottom chamber exposed to completed culture medium. Negative controls were used with 3μΜ Latrunculin A. After 12 hrs incubation, fluorescence was measured using a fluorescence plate reader 485nm (excitation) and 520nm (emission) according to the manufacturer's instruction. For wound-healing assay, cells (24 hrs after treatment with different DNA or RNA oligonucleotides) were grown to confluence followed by scratching with a pipette tip to create a gap. The floating cells were removed and the gaps were monitored/photographed every 12 hrs.
Statistical analysis
The results reported as mean +s.d. indicated in the data sets were analyzed using student's t-test under the assumption of equal variance for comparisons. All tests were determined by unpaired two-sided tests, and F-values O.05 were considered statistically significant.
Bioinformatics analysis
The sequencing reads from each of the 11 samples were individually processed and aligned to the human reference (build hgl9) using Bowtie 0.12.9 (Langmead, B., Trapnell, C, Pop, M. & Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009)). In-house Perl scripts were used to detect piRNAs expression based on genomic coverage after using a cut-off of 30x across a minimum length of 26bp regions. A piRNA prediction tool (Zhang, Y., Wang, X. & Kang, L. A k-mer scheme to predict piRNAs and characterize locust piRNAs. Bioinformatics 27, 771-776 (2011)) was used to filter the detected piRNAs loci from individual samples utilizing the piRNAs sequence. The piRNAs loci from all 11 samples were collated using custom Perl scripts. This merged set of piRNAs loci was further filtered to exclude piRNAs loci that overlapped known
protein coding genes and other sncRNAs. Only those piRNAs loci with lengths between 26 nucleotides to 32 nucleotides were retained as the final set of novel piRNAs loci.
Simultaneously, 32,046 piRNAs nucleotide sequences were queried and downloaded from NCBI. The Blat program (Kent, W.J. BLAT— The BLAST-Like Alignment Tool. Genome Res.\2, 656-664 (2002)) was used to align these nucleotide sequences against human reference (build hgl9) to infer the genomic coordinates for the known piRNA sequences. Blat hits showing 100% alignment against the human reference were retained as the coordinates of the known piRNAs sequences. Known piRNAs sequences that aligned to multiple locations were given separate unique IDs. The read coverage across these known piRNAs loci was calculated using custom Perl scripts. The final set of known piRNAs loci was determined by filtering out piRNAs loci with Reads per Kilobase per Million mapped reads (RPKM) < 15. Known piRNAs loci that showed partial read support across the entire length were also filtered out.
HTSeq (Anders, S., Pyl, P.T. & Huber, W. HTSeq - A Python framework to work with high-throughput sequencing data. Bioinformatics 31, 166-169 (2015)) was used to compute read counts across each piRNA in each of the 11 samples which in turn were used as input to the R package DESeq (Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010)). DESeq was used to normalize the read counts for library size and dispersion followed by tests for differential piRNA expression between the Immortalized and Adenocarcinoma cell line and the Immortalized and Squamous cell line. The significant differentially expressed piRNA (the unknown piRNAs are referred as piRNA-Ls in the text) were determined using an FDR cut-off <0.05 and at least two-fold change between conditions.
Constructing wild type and mutant moesin plasmids
We used pcDNA3.1 (+) vector for cloning moesin wild type and mutant plasmids. All plasmids were sequenced for verification.
Interaction between piR163 and Moesin
To determine specific piR-L-163 site critical for its binding to moesin, a series of piR-L-163 mutants in the NNUUNNUUUNNUU motif predicted with protein
binding capability (Ray, D. et al. A compendium of RNA-binding motifs for decoding gene regulation. Nature 499, 172-177 (2013)) were generated. To determine moesin domain critical for its interaction with piR-L-163, a construct was generated with deletion of a candidate RNA binding element (RRRKPDT) (SEQ ID NO:488) based on structures of Human and Drosophila moesin predicted using software BindN (http ://bioinfo. ggc.org/bindn/) .
Cell Line Name Index Sequence
H157 ATCACG (SEQ ID NO:507)
H226 CGATGT (SEQ ID NO: 508)
H596 TTAGGC (SEQ ID NO: 509)
SKMES1 TGACCA (SEQ ID NO:510)
H522 ACAGTG (SEQ ID NO:511)
H1437 GCCAAT (SEQ ID NO:512)
H1792 CAGATC (SEQ ID NO:513)
HI 944 ACTTGA (SEQ ID NO: 514)
HBE2 TAGCTT (SEQ ID NO:515)
HBE3 GGCTAC (SEQ ID NO:516)
HBE4 CTTGTA (SEQ ID NO:517)
Table 2. Index sequences for individual cell lines.
Specific sequence tag was added to RNAs of individual cell lines to allow identify the origins of the RNAs for RNA-seq analysis.
Table 3. Synthesized DNA and RNA oligonucleotides
name sequence (5' to 3') application
adaptor for snRNAs Adenylation-5' a
3' Adaptor /5rapp/CTGTAGGCACCATCAAT/3ddc/ (SEQ ID NO:499) PCR or QPCR dideoxy C-3' for sncRNAs reverse
Cmop7modban CAAGCAGAAGACGGCATACGAATTGATGGTGCCTACAG (SEQ ID NO: 500) transcription
Cmo RP CAAGCAGAAGACGGCATACGA (SEQ ID NO:501) reverse primer
/5Biosg/rArUrArUrCrArUrGrArUrGrUrUrArCrUrUrUrGrArUrUrCrUrCrUrGrArCmC
piR163-L-Bio (SEQ ID NO: 502) for IP m is 2-0- methyl
/5Biosg/rGrArUrArCrCrArArGrGrArCrArUrArCrGrCrUrUrArUrGrCrArUrGrCrUrA
ControlBio (SEQ ID NO: 503) IP control Bio is Biotin Antl63 GGTCAGAGAATCAAAGTAACATCATGATAT (SEQ ID NO:496) for blocking piR-L-163
control for blocking
piRcon GATACCAGGGACATACGCTTGATCCTAGC (SEQ ID NO: 506) piR163
rArUrArUrCrArUrGrArUrGrUrUrArCrUrUrUrGrArUrUrCrUrCrUrGrArCmC (SEQ
piR163-L-WT ID NO:518) interaction study m is 2-0- methyl rArUrArUrCrArUrGrArUrGrArCrArCrGrArCrGrArCrArCrUrCrUrGrArCmC (SEQ
piR163-L-Ml ID NO:519) interaction study m is 2-0- methyl rArUrArUrCrArUrGrArUrGrUrUrArCrGrArCrGrArUrUrCrUrCrUrGrArCmC (SEQ
piR163-L-M2 ID NO:520) interaction study m is 2-0- methyl
rArUrArUrCrArUrGrArUrGrUrUrArCrGrCrUrGrArUrUrCrUrCrUrGrArCmC (SEQ
piR163-L-M3 ID NO:521) interaction study m is 2-0- methyl rArUrArUrCrArUrGrArUrGrUrUrArCrUrCrUrGrArUrUrCrUrCrUrGrArCmC (SEQ
piR163-L-M4 ID NO:522) interaction study m is 2-0- methyl rArUrUrUrCrArUrGrArUrGrUrUrArCrUrUrUrGrArUrUrCrUrCrUrGrArCmC (SEQ
piR163-L-M5 ID NO:523) interaction study m is 2-0- methyl
AntipiR163-L- rGrGrUrCrArGrArGrArArUrCrArArArGrUrArArCrArUrCrArUrGrArUrArU (SEQ
RNA ID NO:497) blocking piR-L-163
Control RNA rGrArUrArCrCrArArGrGrArCrArUrArCrGrCrUrUrArUrGrCrArUrGrCrUrA (SEQ ID
oligos NO:524) sncRNAs control
CpiR163-L- DigN / 5 DigN/ GGTC AG AGA ATC A AAGT A AC ATC ATG ATAT (SEQ ID NO:525) for FISH DigN is Digoxin piR163-L-F ATATCATGATGTTACTTTGATTCTCT (SEQ ID NO:526) for PCR or QPCR
U6F ATGACACGCAAATTCGTGAA (SEQ ID NO: 527) QPCR inner control for snRNAs
Con F GATACCAGGGACATACGCTTGA (SEQ ID NO: 506) for control amplification
GGTCAGAGAATCAAAGTAACATCATGA (SEQ ID
Antl63-L-F NO:528) for Ant- 163 amplification
piR163-L-
M1F ATATCATGATGACACGACGACA (SEQ ID NO:529) for piR-L-163Ml amplification
piR163-L- M2F ATATCATGATGTTACGAC (SEQ ID NO: 530) for piR-L-163M2 amplification
piR163-L- M3F ATATCATGATGTTACGC (SEQ ID NO:531) for piR-L-163M3 amplification
piR163-L- M4F ATATCATGATGTTACTC (SEQ ID NO: 532) for piR-L-163M4 amplification
piR163-L-
M5F ATTTCATGATGTTACTTTGATT (SEQ ID NO:533) for piR-L-163M5 amplification
AGCAAGCTTATGCAAAACAACCAAAT (SEQ ID
MoesinVFl NO:534) for human Moesin plasmid constraction
ATCTCGAGTTACATAGACTCAAATTCGTCA (SEQ
MoesinVRl ID NO:535) for human Moesin plasmid constraction
AACTATACATG ATTGAGGTGCAGCAGATGAAGG
MoesinVF2 (SEQ ID NO:536) for human Moesin plasmid constraction
GCACCTCAATCATGTATAGTTCATGGTTCCCCATG
MoesinVR2 (SEQ ID NO : 537) for human Moesin plasmid constraction
GAPDHF TGCACCACCAACTGCTTAGC (SEQ ID NO: 538) inner control for coding gene QPCR GAPDHR GGCATGGACTGTGGTCATGAG (SEQ ID NO:539) inner control for coding gene QPCR moesinFl GGGAAGCAGCTATTTGACCA (SEQ ID NO:540) for QPCR
moesinRl CTTAAAGAGCAGGGGGCTTT (SEQ ID NO:541) for QPCR
rCrCrGrUrUrArGrCrArGrGrArArGrCrCrUrArArUrU
Moe3UTRsiF (SEQ ID NO:542) for Moesin knockdown
rUrUrArGrGrCrUrUrCrCrUrGrCrUrArArCrGrGrUrU
Moe3UTRsiR (SEQ ID NO:543) for Moesin knockdown
rGrArUrA rCrCrArA rGrGrGrA rCrArUrA rCrGrC rUrU
Neg S (SEQ ID NO:544) knockdown control
rGrCrG rUrArUrG rUrCrCrC rUrUrGrG rUrArUrC rUrU
Neg AS (SEQ ID NO:545) knockdown control
PIWIL1F GAGCCAGAGCCAGAGGAAG (SEQ ID NO:546) for QPCR
PIWIL1R ATAATTCCCCCTCTGCTGGT (SEQ ID NO:547) for QPCR
PIWIL2F GTGGGTTTGGTCTCCATGTT (SEQ ID NO:548) for QPCR
PIWIL2R CCTGTCCTTGCGTACCAGAT (SEQ ID NO:549) for QPCR
PIWIL3F GCAGGGAGAGCTACCAACAA (SEQ ID NO:550) for QPCR
PIWIL3R AACCACTGGGACTTCCTCCT (SEQ ID NO:551) for QPCR
PIWIL4F ACCAGAGAAAAATTGGCACA (SEQ ID NO:552) for QPCR
PIWIL4R GCCAGTCTTGGGGAAAATCT (SEQ ID NO:553) for QPCR
LAMC2F1 CTACTTCGGGGACCCATTG (SEQ ID NO:554) for QPCR
LAMC2R1 CAAACACAGGTGCCATCACT (SEQ ID NO:555) for QPCR
o
EXAMPLE 2
Cisplatin upregulates piRNA-L-138 which confers cisplatin-resistance by inhibiting apoptosis in lung squamous cell carcinoma
PlWI-interacting RNAs (piRNAs) is the largest family of short non-coding RNAs (sncRNAs) and plays an important role in suppressing transposon activities during development (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PIWI- interacting RNAs in the soma. Nature 505, 353-359 (2014)). We recently showed that piRNA-Like sncRNAs (piRNA-Ls) are aberrantly expressed and biologically functional in non-small cell lung cancer (NSCLC) cells (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)). Here, we show that piRNA-L-138 (piR-L-138), a piRNA-L down-regulated in NSCLC cells, is up-regulated upon cisplatin (CDDP) treatment particularly in lung squamous cell carcinoma (SCC) cells. Blocking piR-L-138 by an antisense oligo (Ant-138) (SEQ ID NO:556) resulted in an increased apoptosis and a reduced cleavage of MDM2 in CDDP-treated SCC cells. Conversely, exogenously transfecting piR-L-138 into SCC cells accelerated MDM2 cleavage. Interestingly, piR-L-138 was found in the same complex with cleaved 60kD MDM2 isoform in CDDP-treated SCC cells. The interaction between piR-L-138 and the MDM2 isoform was further confirmed visually by co-localization of the two molecules within individual cells. In patient- derived xenograft (PDX) lung SCC models, CDDP-based chemotherapy resulted in an increased piR-L-138 expression. In a SCC xenograft model treated with CDDP, a significantly increased apoptosis was observed in tumor regions locally delivered Ant- 138. Thus, we revealed upregulating piR-L-138 as a novel mechanism of CDDP resistance in lung SCC and potentially targetable to overcome the resistance.
piRNAs are primarily investigated for their functions in renewal of germ line cells and development (Lin, H. & Spradling, A. C. A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124, 2463-2476 (1997); Cox DN, et al. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev. 12, 3715-3727 (1998); Girard, A., et al. A germline-specific class of small RNAs
binds mammalian Piwi proteins. Nature 442, 199-202 (2006); Brennecke J, et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128, 1089-1103 (2007); Shirayama M. et al. piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell 150, 65-77 (2012); Lee H. C. et al. C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts. Cell 150, 78-87 (2012); Ashe A. et al. piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell 150, 88-99 (2012)). Their potential roles in somatic tissues, while poorly studied, have recently been recognized (Ross, R.J., Weiner, M.M. & Lin, H. PIWI proteins and PIWI- interacting RNAs in the soma. Nature 505, 353-359 (2014); Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015); Brower-Toland B, et al. Drosophila Piwi associates with chromatin and interacts directly with HP la. Genes Dev. 21, 2300-2311 (2007); Yan Z, et al. Widespread expression of piRNA-like molecules in somatic tissues. Nucleic Acids Res. 39, 6596- 6607 (2011); Qiao, D., et al. Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas. Oncogene. 21, 3988-3999 (2002)). A number of studies have shown an abnormal expression of piRNAs in various cancer types, suggesting biological roles of piRNAs in cancer development and progression (Mei, Y., Clark, D. & Mao L. Novel dimensions of piRNAs in cancer. Cancer Lett 336, 46- 52 (2013); Lee JH, et al. Stem-cell protein Piwil2 is widely expressed in tumors and inhibits apoptosis through activation of Stat3/Bcl-XL pathway. Hum. Mol. Genet. 15, 201-211 (2006); Taubert H, et al. Expression of the stem cell self-renewal gene Hiwi and risk of tumour-related death in patients with soft-tissue sarcoma. Oncogene 26, 1098-1100 (2007); Grochola L F, et al . The stem cell-associated Hiwi gene in human adenocarcinoma of the pancreas: expression and risk of tumour-related death. Br. J. Cancer 99, 1083-1088 (2008); Lee JH, et al. Pathways of proliferation and antiapoptosis driven in breast cancer stem cells by stem cell protein Piwil2. Cancer Res. 70, 4569-4579 (2010); Janic, A., et al. Ectopic expression of germline genes drives malignant brain tumor growth in Drosophila. Science 330, 1824-1827 (2010); Zhao YM, et al. HIWI is associated with prognosis in patients with hepatocellular carcinoma after curative resection. Cancer
118, 2708-2717 (2012); Lee E, et al. Landscape of somatic retrotransposition in human cancers. Science 337, 967-971 (2012)). We recent identified 555 piRNAs expressed in immortalized normal human lung bronchial epithelial (HBE) and NSCLC cell lines. Because more than half of the piRNAs are not presented in any of the existing databases and also lack of certain characteristic features, we termed these sncRNAs as piRNA-Ls (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)). Many of these piRNA-Ls were differentially expressed between HBE and NSCLC cell lines as well as between adenocarcinoma (ADC) and SCC cell types including piR-L-138. We uncovered a novel mechanism of sncRNAs where a sncRNA, piR-L-163 in this case, can directly bind to proteins and regulate functional activities of the proteins (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)).
To determine if piRNA-Ls play a role in chemo-sensitivity, we first selected 11 piRNA-Ls differentially expressed between NSCLC and HBE cells (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)) and analyzed the relationship between the expression levels and the sensitivities to chemotherapeutic agents commonly used clinically for patients with NSCLC. We established doses of 50% inhibitory concentration (IC50) for CDDP, gemcitabine, and docetaxel in 4 SCC and 4 ADC cell lines based on 3-(4, 5- dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay (Table 4). Examples of the inhibitory curves and morphological changes by these agents were presented in Figure 18 (18a - 18c). We then measured expression levels of the 11 selected piRNA-Ls using real-time RT-PCR before and 24 h after treatment with both IC50 (H) and IC25 (L) doses for each of the agents. Among these piRNA-Ls, we observed a consistent and substantial increase of piR-L-138 levels in all SCC cell lines after CDDP treatment (Fig. 14a) but no or much smaller increase of piR-L-138 expression was observed in the ADC cell lines (Fig. 18d). Impact of gemcitabine and docetaxel in piR-L-138 expression was also determined in these NSCLC cell lines
(Fig. 19). As CDDP is the backbone agent to treat patients with NSCLC, we selected CDDP as the representative agent to further determine the role of piR-L-138 in SCC cells' response to chemotherapy.
Consistent with the data obtained by using RNA-seq (Fig. 14b, left) as we reported previously (Mei Y, Wang Y, Kumari P, et al. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun 6, 7316. doi: 10.1038/ncomms8316 (2015)), expression level of piR-L-138 was down regulated in both ADC and SCC cell lines compared to that observed in HBE cell lines by RT-PCR (Fig. 14b, right). Similar to piRNAs21, piR-L138 also contains a 3 prime nucleotide 2'-0-methylation (Fig. 14c).
To determine if the CDDP-induced piR-L-138 up-regulation is a cell culture artifact, we analyzed 10 NSCLC tissues from 4 patient-derived xenograft (PDX) models (2 SCC and 2 ADC) used in our previously published study (Jun Zhao, et al. Anti-HDGF Targets Cancer and Cancer Stromal Stem Cells Resistant to Chemotherapy. Clin Cancer Res. 19, 3567-76 (2013)), including 4 tumors of unrelated patients from untreated animals, 2 tumors obtained at 8 days after treatment (CDDP plus gemcitabine) and 4 tumors obtained 28 days after the treatment. We found that piR-L-138 levels were significantly increased in the two SCC models (UMB410 and MDA2131-11) with tumors collected at both 8 or 28 days after the treatment compared with tumors from untreated controls (Fig. 14d). While one tumor (28 days after treatment) from one of two ADC models (MDA274-2) also showed an increase of piR-L-138 level, both tumors (8 and 28 days after treatment) from the other ADC model (MDA2131-1) exhibited a decrease of piR-L-138 expression (Fig. 14d). The data support the impact of CDDP on piR-L-138 expression also occurs in vivo of lung PDX SCCs.
To determine if the increased piR-L-138 plays a functional role in CDDP treated SCC cells, we used DNA antisense oligos of piR-L-138 (Ant-138) to block piR-L-138 in H157 and SKMES-1 cells. Six hours after Ant-138 treatment, we treated the cells with CDDP (IC25 dose). We observed a significantly increased cell killing compared with control cells pre-treated with scrambled oligonucleotides (Scr) measured by MTT assay (Fig. 15a). Using flow cytometry, we further observed a substantially increased proportion of the sub-Gl phase in cells treated with Ant-138
compared with cells treated with Scr before CDDP treatment (Fig. 15b; Fig. 19c and 20a), suggesting the increased cell killing was due to an enhancement of ell apoptosis. To validate the increased sub-Gl fragment represents apoptotic cells, we performed annexin V staining assay and indeed observed Ant-138 pre-treated SCC cells were more sensitive to CDDP-induced apoptosis compared to Scr pre-treated cells (Fig. 15c; Fig. 20b and 20c). These results indicate the involvement of piR-L-138 in inhibiting CDDP-induced apoptosis in lung SCC cells.
Next, we wanted to explore potential mechanism of piR-L-138-mediated apoptosis inhibition in CDDP treated lung SCC cells. We first analyzed cleaved PARP, a protein marker indicative of apoptosis, and found it was increased in the SCC cells pre-treated with Ant-138 compared with Scr pre-treated cells (Fig. 15d). As both of the SCC cell lines harbor p53 mutations, we analyzed mouse double minute 2 homolog (MDM2) which has been implicated in apoptosis including p53-independent pathway (Bohlman S, Manfredi JJ. p53-independent effects of Mdm2. Subcell Biochem. 85,235-46 (2014); Bouska A, Eischen CM. Mdm2 affects genome stability independent of p53. Cancer Res. 69, 1697-701 (2009); Zhang, Z., Li, M., Wang, H., Agrawal, S., and Zhang, R. Antisense therapy targeting MDM2 oncogene in prostate cancer: Effects on proliferation, apoptosis, multiple gene expression, and chemotherapy. Proc. Natl. Acad. Sci. 100, 11636-11641 (2003); Zhang Z, Wang H, Li M, Agrawal S, Chen X, Zhang R. MDM2 Is a Negative Regulator of p21WAFl/CIPl , Independent of p53. /. Biol. Chem. 279: 16000-16006 (2004); Zhu Y, et al. Cisplatin causes cell death via TAB1 regulation of p53/MDM2/MDMX circuitry. Genes Dev. 27, 1739-51 (2013); Yang JY, et al. ERK promotes tumorigenesis by inhibiting FOX03a via MDM2-mediated degradation. Nat Cell Biol. 10, 138-48 (2008); Yang W, Dolloff NG, El-Deiry WS. ERK and MDM2 prey on FOX03a. Nat Cell Biol. 10,125-6 (2008)). In the SCC cells pre-treated with Ant- 138, we observed a substantially reduced MDM2 cleavage upon CDDP treatment (Fig. 15d). Conversely, the SCC cells transfected with piR-L-138 enhanced MDM2 cleavage with an increased 60 kD cleaved fragment (Fig. 15d). Interestingly, a reduced MDM2 cleavage is accompanied with an increase of serine- 166 phosphorylation in the cleaved MDM2, which has been shown to stimulate p53 degradation and to block MDM2's inhibitory effects (Cheng Q, et al. Autoactivation
of the MDM2 E3 ligase by intramolecular interaction. Mol Cell Biol. 34, 2800- 10(2014); Meek DW1, Knippschild U. Posttranslational modification of MDM2. Mol Cancer Res. 1,1017-26(2003); Mayo L.D. & Donner D.B. Aphosphatidylinositol3- kinase/Aktpathway promotes translocation of Mdm2 from the cytoplasm to the nucleus. Proc. Natl. Acad. Sci. 98,11598-11603(2001); Ogawara, Y., et al. Akt enhances Mdm2-mediated ubiquitination and degradation of p53. /. Biol. Chem. 277,21843-21850(2002); Zhou,B.P., et al. HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nat. Cell Biol. 3, 973 - 982(2001)). Conversely, exogenous piR-L-138 transfection into the SCC cells enhanced MDM2 cleavage and reduced Serine- 166 phosphorylation in cleaved MDM2 (Fig. 15e).
To determine if piR-L-138 is functioning through direct interaction with MDM2, biotin-conjugated piR-L-138 was used as a bait to pull down its potential binding proteins in CDDP treated HI 57 and SKEMS-1 cells followed by Western blot analysis. The cleaved 60 kD MDM2 was detectable in the pulled down products using piR-L-138 but not in the products using Scr RNA control (Fig. 16a), indicating piR- L-138 binds to the MDM2 fragment. To confirm the binding between piR-L-138 to the MDM2 fragment, we performed immuno-precipitation (IP) assay using an anti- MDM2 antibody followed by RT-PCR using primers specific for piR-L-138. While piR-L-138 was not detectable in the IP products by using a control Rabbit IgG antibody, it was readily detected in the products pulled down by using the anti-MDM2 antibody (Fig. 16b).
To further validate the interaction between piR-L-138 and MDM2 at the individual cell level, we performed fluorescence in situ hybridization (FISH) assay using a digoxin (DIG)-labelled RNA probe complimentary to piR-L-138 and an anti- MDM2 antibody. We first tested the probes in HBE4 cells which express high levels of piR-L-138 to ensure the sensitivity and specificity of the piR-L-138 probe and MDM2 antibody (Fig. 16c). We found that both MDM2 and piR-L-138 were predominantly co-localized at a perinuclear area in SCC cells when unchallenged and showed an enhanced and polarized perinuclear pattern following CDDP treatment (Fig. 16c). This is consistent with the observed up-regulation of piR-L-138 in SCC cells upon CDDP treatment and the interaction between piR-L-138 and MDM2.
Next, we used H157 tumor xenograft model to determine if targeting piR-L-138 can enhance CDDP-mediated tumor cell apoptosis in SCC in vivo. In this proof of principle experiment, we used intra-tumor injection of Ant-138 (SEQ ID NO:556) which was formulated with MaxSuppr in vivo RNALancerll as described previously (Wiggins JF, et al. Development of a Lung Cancer Therapeutic Based on the Tumor Suppressor MicroRNA-34. Cancer Res. 70, 5923-30(2010)) due to the requirement of very large quantity of formulated reagents needed for systemic delivery. Compared to tumors formed in untreated mice and mice treated with CDDP plus Scr control, tumors in mice treated with CDDP plus Anti-138 were smaller but the difference was only border line statistically (Fig. 17a and 17b). Since we were using local injection with sub-optimal dose, such modest anti-tumor activity was expected. We were focusing on determining if Ant-138 increased apoptosis at the sites of injection by analyzing tumor tissue sections for cleaved caspase 3 as an indicator of apoptosis and Ant-138. Compared with tumors treated with CDDP and Scr control, tumors treated with CDDP and Ant-138 exhibited higher expression of cleaved caspase 3 (Fig. 17c), an indication of enhanced apoptotic process by inhibiting piR-L-138 induced by CDDP treatment. Further analysis using due-immunofluorescence staining (for cleaved caspase 3 and Ant-138) showed a significantly concentrated caspase 3 positive tumor cells in areas with high levels of Ant-138 (Fig. 17d and 17e). These results support the role of piR-L-138 in protecting SCC cells from CDDP induced apoptosis and piR-L-138 targeting as a potential strategy to enhance CDDP efficacy in treating patients with lung SCC.
In summary, we identified a novel mechanism of CDDP treatment resistance for Lung SCC, where a short non-coding RNA, piR-L-138, up-regulated upon CDDP administration interacts with MDM2 onco-protein to increase its degradation and contributes to inhibition of apoptosis. Targeting piR-L-138 can improve the sensitivity of lung SCC to CDDP treatment in both in vitro and in vivo, which warrants further testing to determine its clinical utility for patients with lung SCC.
Method Summary
sncRNAs were separated from total RNA using one-nucleotide-resolution PAGE gels and processed using the True® Small RNA kit. sncRNAs purification, adaptor
ligation and reverse transcription for PCR or RT-PCR are described in the Methods. Mass spectrometry, oligonucleotide precipitation assay, IP, FISH, Western blot, apoptosis and cell cycle distribution assay, DNA or RNA transfection, animal model establishment etc., were performed as described in the Methods.
Table 4. IC50 of CDDP in NSCLC cell lines
HI 57 80
SKMES- 10
1
H596 30
H226 40
HI 944 100
H1792 50
H1437 50
H522 45
EXAMPLE 3
Co-precipitation of large numbers of sncRNAs with phosphor-proteins
To determine the potential scale of sncRNAs with capability to bind with cellular proteins, we performed IP assays using antibodies specifically generated for phosphor-Serine, phosphor-Threonine or phosphor-tyrosine, respectively and cell lysates from pooled HBE or lung SCC cell lines (200μg from each of the 3 HBE lines and 150μg from each of the 4 lung SCC lines). Total RNA was extracted from the IP products of each lysate mixture followed by attaching adaptors to both 3' and 5' ends of the RNAs. RT-PCR was performed to amplify the phosphor-protein binding RNAs. RT-PCR of the IP products showed two clusters of bands with approximately 300 and 150 nt respectively (Fig. 21), representing 150-200 nt and 25-50 nt original single strand RNAs considering the sizes of adaptors. We focused on the cluster of sncRNAs with 150 bases bands. We purified RT-PCR products in the gels sized approximately 140-180 nt for generating individual DNA library followed by RNA-seq analysis using Illumila MiSeq (each library was uniquely barcoded). Total reads from individual library were between 700,000 and 2,830,000. A total of 2,647 unique reads (sncRNAs) were identified from these libraries ranging from 1,669 to 1,912 in individual libraries based on cutoff of >20 copies (including SEQ ID NOS: 560-2802).
The average copy numbers were 400-600 per unique sncRNA but 83 sncRNAs >5,000 copies for individual libraries. While the same amount of cellular proteins were used for each IP experiment, the total reads were twice as much in the libraries from HBE cells compared with those detected in libraries from lung SCC cells in all three IP pull-downs with antibodies against different phosphor amino acids, suggesting the presence of more and abundant sprRNAs in HBE cells than the cancerous SCC cells. After normalization using equal number of reads for each library, 1,825 unique sncRNAs were found in the library of HBE cells when an anti-phosphor- Tyr antibody was used for IP compared to 1,669 unique sncRNAs detected in the library of lung SCC cells. In an unsupervised clustering analysis based on the abundancies of the unique sncRNAs detected in each library, HBE libraries and lung SCC libraries clustered together, although the differences of the sncRNA abundancies existed among different libraries from the same cell type, suggesting the cell types are more important for the sprRNA patterns or the phosphor-proteins' capable to interact with these sprRNAs due to the fundamental biological features of the cell types. Additionally, approximately one third of the piRNA-Ls (Mei Y, Wang Y, Kumari P, Shetty AC, Clark D, Gable T, MacKerell AD, Ma MZ, Weber DJ, Yang AJ, Edelman MJ, Mao L. A piRNA-like small RNA interacts with and modulates p-ERM proteins in human somatic cells. Nat Commun. 6:7316, 2015) were among the unique sncRNAs identified in HBE cells and 50% of the piRNA-Ls identified in lung SCC cells. The higher number of sncRNAs identified in the later experiment is probably due to the enrichment by the protein binding and the expanded range of size beyond 35 nt. In a distribution analysis, the unique sncRNAs (candidate sprRNAs) were peaked around 32 nt and 50 nt (Fig. 22). Another interesting finding is that about 70% of the unique sncRNAs were mapped to exons (30%) or introns (40%) with less than one third mapped to intergenic regions.
To test the potential impact of the candidate sprRNAs identified by phosphor- protein binding in the phosphorylation status of the proteins, we selected a panel of 5 sprRNAs with sizes ranging from 25-50 nt but sharing a common 25 nt sequence and used DNA oligo complementary to the common sequence (5'- CTCTCACCGCCGCGGCCCGGGTTCG-3') (SEQ ID NO:489) to block these sprRNAs. Twenty-four hours after the DNA oligo treatment, we measured the cell
viability using MTT assay and observed a significant growth inhibition in all 4 lung SCC cell lines (Fig. 23a), suggesting these sprRNAs play biological roles in these cells. We further measured levels of phosphorylated proteins using antibodies against p-Tyrosine and p-Theronin/Serine respectively on Western blots and observed changes of levels in certain phosphor-proteins in lung SCC cells treated with the DNA oligo (Fig. 23b).
Lack of expression of human Piwi genes in some of the HBE cell lines
Using RT-PCR, we measured the expression levels of PiwiLl-4 in the 3 HBE cell lines (HBE2, HBE3 and HBE4) and observed either undetectable or extremely low level of expression of these genes in HBE3 and HBE4 cells except moderate expression levels of PiwiL2 and PiwiL4 in HBE2 cells, suggesting these PiwiLs are not the primary contributors for sprRNA biogenesis in these airway epithelial cells.
Nucleus localization of sprRNA precursors
To assess the possible location of sprRNA processing, we analyzed cellular localizations of the precursors of piR-L-163 and piR-L-138 which have been shown as sprRNAs based on our preliminary studies. We designed primer sets for presumable pri- and pre-sprRNAs of the 2 candidates (Fig. 24a). RNAs were extracted from cytoplasm and nucleus of HBE2 and HBE4 cells respectively (Fig. 24b) and used for cDNA synthesis. The primer sets were used to amplify the pri- and pre-sprRNAs in each of the samples. The pri- and pre-sprRNAs could only be detected in RNAs extracted from nucleus (Fig. 24c), suggesting the early biogenesis likely occurs in nucleus.
While there have been shown and described what are presently believed to be the preferred embodiments of the present invention, those skilled in the art will realize that other and further embodiments can be made without departing from the spirit and scope of the invention described in this application, and this application includes all such modifications that are within the intended scope of the claims set forth herein. All patents and publications mentioned and/or cited herein are incorporated by reference to the same extent as if each individual publication was specifically and individually indicated as having been incorporated by reference in its entirety.
Claims
1. An isolated nucleic acid molecule comprising a short non-coding protein regulatory RNA (sprRNA) that is at least 90% identical to any one of SEQ ID NOS: 192-486 or 560-2802.
2. The nucleic acid molecule of claim 1, wherein the sprRNA is at least 95% identical to SEQ ID NOS: 192-486 or 560-2802.
3. The nucleic acid molecule of any of claims 1-2, wherein the sprRNA is at least 99% identical to SEQ ID NOS: 192-486 or 560-2802.
4. The nucleic acid molecule of any of claims 1-2, wherein the sprRNA comprises SEQ ID NOS: 192-486 or 560-2802.
5. The nucleic acid molecule of claim 4, wherein the sprRNA is piR-L-163 (SEQ ID NO:282).
6. The nucleic acid molecule of claim 4, wherein the sprRNA is piR-L-138 (SEQ ID NO:268).
7. An isolated nucleic acid molecule comprising a short non-coding protein regulatory RNA (sprRNA), wherein the sprRNA comprises SEQ ID NO:489.
8. An isolated nucleic acid molecule comprising a short non-coding protein regulatory RNA (sprRNA) that is at least 90% identical to an sprRNA selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
9. The nucleic acid molecule of any of claims 1-8, further comprising 3' and/or 5' adaptor sequence that has been attached to the noncoding ribonucleic acid sequence.
10. An isolated nucleic acid molecule comprising cDNA of sprRNA that is at least 90% identical to any one of SEQ ID NOS: 192-486, 489-494 or 560-2802.
11. The nucleic acid molecule of claim 10, comprising cDNA of sprRNA that is at least 95% identical to any one of SEQ ID NOS: 192-486, 489-494 or 560-2802.
12. The nucleic acid molecule of any one of claims 10-11, comprising cDNA of sprRNA that is at least 99% identical to any one of SEQ ID NOS: 192-486, 489- 494 or 560-2802.
13. The nucleic acid molecule of any of claims 10-12, wherein the sprRNA molecule comprises SEQ ID NOS: 192-486, 489-494 or 560-2802.
14. The nucleic acid molecule of claim 13, wherein the sprRNAis piR-L-163 (SEQ ID NO:282).
15. The nucleic acid molecule of claim 13, wherein the sprRNAis piR-L-138 (SEQ ID NO:268).
16. An isolated nucleic acid molecule comprising cDNA of sprRNA, wherein the sprRNA comprises SEQ ID NO:489.
17. The nucleic acid molecule of claim 16, wherein the sprRNA comprises an sprRNA selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
18. An isolated probe or primer comprising a nucleic acid sequence that hybridizes to the nucleic acid molecule of any of claims 1-17.
19. An isolated probe or primer comprising a nucleic acid sequence that hybridizes to an isolated nucleic acid molecule comprising a sprRNA that is at least 90% identical to any one of SEQ ID NOS:l-191, or 489-494.
20. The probe or primer according to any of claims 18-19, further comprising a detectable label.
21. The probe or primer according to claims 18-20, wherein the probe or primer is DNA.
22. The probe or primer according to claims 18-20, wherein the probe or primer is RNA.
23. A nucleic acid molecule comprising a sequence that is antisense to the sprRNA of any of claims 1 -9.
24. A nucleic acid molecule comprising a sequence that is antisense to a sprRNA that is at least 90% identical to any one of SEQ ID NOS: 1-191, or 489-494.
25. The nucleic acid molecule of claim 23-24, wherein the nucleic acid molecule is DNA.
26. The nucleic acid molecule of claim 23-24, wherein the nucleic acid molecule is RNA.
27. The nucleic acid molecule of claim 23, wherein the nucleic acid molecule comprises Ant- 138 (SEQ ID NO:556).
28. The nucleic acid molecule of claim 23, wherein the nucleic acid molecule comprises Ant-163 (SEQ ID NO:496).
29. The nucleic acid molecule of claim 23, wherein the nucleic acid molecule comprises AntiC (SEQ ID NO:558).
30. A pharmaceutical composition comprising the nucleic acid molecule or probe or primer of any of claims 1 -29, variant, fragment or inhibitor thereof and a pharmaceutically acceptable carrier.
31. A method of treating a disease or condition in a subject in need of treatment comprising administering to the subject a composition comprising an effective amount of a nucleic acid comprising an sprRNA, variant, fragment or inhibitor thereof.
32. The method of claim 31, wherein the sprRNA is at least 90% identical to any one of SEQ ID NOS:l-486 or 489-494 or 560-2802.
33. The method of any one of claims claim 31-32, wherein the inhibitor is an antisense nucleic acid molecule of the sprRNA.
34. The method of claim 31 , wherein the composition comprises the nucleic acid molecule of any of claims 1-17 or 23-29.
35. The method of claim 34, wherein the sprRNA is piR-L-138 (SEQ ID NO:268).
36. The method of claim 34, wherein the sprRNA is piR-L-163 (SEQ ID NO:282).
37. The method of claim 34, wherein the sprRNA comprises SEQ ID NO:489.
38. The method of claim 34, wherein the sprRNA is selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
39. The method of any one of claims 31-38, wherein the disease is cancer selected from the group consisting of breast cancer, prostate cancer, lung cancer, bladder cancer, pancreatic cancer, brain cancer, liver cancer, testicular cancer, skin cancer, colon cancer, ovarian cancer, cervical cancer, and uterine cancer.
40. The method of any one of claims 31-39, wherein the sprRNA or an inhibitor thereof is administered in combination with one or more additional therapies.
41. The method of claim 40, wherein the sprRNA or inhibitor thereof prevents resistance to the one or more additional therapies.
42. The method of claim 41, wherein the inhibitor is an inhibitor to piR-L-138 (SEQ ID NO:268).
43. The method of claim 42, wherein the inhibitor is Ant- 138 (SEQ ID NO:556).
44. The method of any of claims 42-43, wherein the one or more additional therapies are selected from the group consisting of cisplatin, gemcitabine (GEM), docetaxel and combinations thereof.
45. The method of any of claims 31-34 and 38-41, wherein the inhibitor is AntiC (SEQ ID NO:558).
46. The method of any of claims 31-38 and 40-41 wherein the condition is selected from wound healing and tissue degeneration.
47. The method of claim 46, wherein the inhibitor is Ant- 163 (SEQ ID NO:496).
48. A method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS: 1-486 or 490-494 in a subject's sample and comparing it to a control sample.
49. The method of claim 48, wherein the control sample is from a noncancerous patient.
50. The method of any of claims 48-49, wherein the sample is selected from the group consisting of cells, blood, plasma, serum saliva, sputum or urine.
51. The method of any of claims 48-50, wherein the cancer is lung cancer.
52. The method of any of claims 48-51, wherein the sprRNAs is piRNA-L-163 (SEQ ID NO:282).
53. The method of any of claims 48-51, wherein the sprRNAs is piRNA-L-138 (SEQ ID NO:268).
54. A method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 490-494 or 560-2802 in a sample from a patient comprising contacting the sample with a probe comprising a polynucleotide that hybridizes to one or more of SEQ ID NOS: 1-486, 490-494 or 560-2802.
55. A method of detecting the presence or absence of one or more sprRNAs according to SEQ ID NOS: 1-486, 490-494 or 560-2802 in a sample from a patient comprising isolating the sprRNAs from the patient, making
complementary DNA from the sprRNAs, and detecting the complementary DNA.
56. A method of detecting sprRNA, comprising
i) contacting a cell lysate with an antibody that binds one or more proteins;
ii) isolating the components from the cell lysate that bind the antibody; and
iii) detecting the sprRNA from the isolated components.
57. The method of claim 56, wherein the antibody binds phosphor-serine, phosphor-threonine or phosphor-tyrosine proteins.
58. The method of claim 56, wherein the sprRNA comprises one or more sprRNAs according to SEQ ID NOS:l-486, 490-494 or 560-2802.
59. The method of any of claims 54-58, wherein the sprRNA is piR-L-138 (SEQ ID NO:268).
60. The method of any of claims 54-58, wherein the sprRNA is piR-L-163 (SEQ ID NO:282).
61. The method of any of claims 54-58, wherein the sprRNA is selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
62. The method of any of claims 54-61, wherein the patient has cancer.
63. The method of claim 62, wherein the patient has lung cancer.
64. A method of preventing the binding of a sprRNA, variant, or fragment thereof to a protein target, comprising contacting the sprRNA, variant, or fragment
thereof and protein target with an inhibitor whereby the inhibitor prevents binding of the sprRNA, variant, or fragment thereof and protein target.
65. The method of claim 64, wherein the sprRNA corresponds to one or more of SEQ ID NOS: 1-486 or 489-494.
66. The method of any of claims 64-65, wherein the inhibitor is an antisense molecule.
67. The method of any of claims 64-65, wherein the inhibitor is a synthetic organic molecule.
68. The method of any of claims 64-67, wherein the sprRNA is piR-L-163 (SEQ ID NO:282).
69. The method of claim 68, wherein the protein is an ERM protein.
70. The method of any one of claims 68-69, wherein the inhibitor is Ant- 163 (SEQ ID NO:496).
71. The method of any of claims 64-67, wherein the sprRNA is piR-L-138 (SEQ ID NO:268).
72. The method of claim 71 , wherein the protein is an MDM2 protein.
73. The method of any one of claims 71-72, wherein the inhibitor is Ant- 138 (SEQ ID NO:556).
74. The method of any of claims 64-67, wherein the sprRNA is selected from the group consisting of:
i) sprRNA12600 (SEQ ID NO:490);
ii) sprRNA 11568 (SEQ ID NO:491);
iii) sprRNA7410 (SEQ ID NO:492);
iv) sprRNA9378 (SEQ ID NO:493); and
v) sprRNA10698 (SEQ ID NO:494).
75. The method of claim 74, wherein the protein is a nucleolin protein.
76. The method of any one of claims 74-75, wherein the inhibitor is AntiC (SEQ ID NO:558).
77. A method for identifying inhibitors that prevent binding of sprRNA to a protein target, comprising contacting the sprRNA and protein with the inhibitor and detecting whether the inhibitor prevents binding of the sprRNA and protein.
78. The method of claim 77, wherein the sprRNA corresponds to one or more of SEQ ID NOS: 1-486, 490-494 or 560-2802.
79. The method of any of claims 77-78, wherein the inhibitor is an antisense nucleic acid to the sprRNA.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15851885.2A EP3209780A4 (en) | 2014-10-24 | 2015-10-24 | Short non-coding protein regulatory rnas (sprrnas) and methods of use |
| US15/521,606 US10889812B2 (en) | 2014-10-24 | 2015-10-24 | Short non-coding protein regulatory RNAs (sprRNAs) and methods of use |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462068106P | 2014-10-24 | 2014-10-24 | |
| US62/068,106 | 2014-10-24 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2016065349A2 true WO2016065349A2 (en) | 2016-04-28 |
| WO2016065349A3 WO2016065349A3 (en) | 2016-07-14 |
| WO2016065349A8 WO2016065349A8 (en) | 2016-11-10 |
Family
ID=55761760
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/057259 Ceased WO2016065349A2 (en) | 2014-10-24 | 2015-10-24 | Short non-coding protein regulatory rnas (sprrnas) and methods of use |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US10889812B2 (en) |
| EP (1) | EP3209780A4 (en) |
| WO (1) | WO2016065349A2 (en) |
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486247A (en) * | 2018-02-12 | 2018-09-04 | 中山大学 | Application of piRNA-54265 in the diagnosis, treatment and prognosis evaluation of colorectal cancer |
| US10287353B2 (en) | 2016-05-11 | 2019-05-14 | Huya Bioscience International, Llc | Combination therapies of HDAC inhibitors and PD-1 inhibitors |
| US10385131B2 (en) | 2016-05-11 | 2019-08-20 | Huya Bioscience International, Llc | Combination therapies of HDAC inhibitors and PD-L1 inhibitors |
| EP3604529A4 (en) * | 2017-03-29 | 2021-01-06 | Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences | MICROARN AND USES OF IT IN THE PREVENTION AND / OR TREATMENT OF A MEDICAL SIGN AND / OR SYNDROME OF FIBROPLASIA |
| WO2022109435A1 (en) * | 2020-11-23 | 2022-05-27 | Thomas Jefferson University | Trna fragments and methods of use |
| WO2023025161A1 (en) * | 2021-08-23 | 2023-03-02 | 北京嘉树佳业科技有限公司 | Srna derived from medicinal plant and application thereof |
| CN116024211A (en) * | 2022-07-29 | 2023-04-28 | 浙江大学 | Application of tRNA Derivative tRF-His-008 in Diagnosis and Treatment of Renal Cancer |
| US20230165889A1 (en) * | 2020-02-28 | 2023-06-01 | Forsyth Dental Infirmary For Children | CHEMICALLY MODIFIED TRANSFER RNA-DERIVED SMALL RNAs (tsRNAs) TO TARGET PATHOGENIC BACTERIA |
| WO2023217735A1 (en) * | 2022-05-13 | 2023-11-16 | Hummingbird Diagnostics Gmbh | Novel rna molecule for cancer detection |
| WO2024073612A3 (en) * | 2022-09-30 | 2024-06-06 | Cedars-Sinai Medical Center | Therapeutic nucleic acids and methods of use thereof |
| WO2024113828A1 (en) * | 2022-11-29 | 2024-06-06 | 四川大学华西医院 | Use of reagent for detecting pir-hsa-790910 in preparing kit for lung cancer screening or diagnosis |
| US12146137B2 (en) | 2018-02-05 | 2024-11-19 | Cedars-Sinai Medical Center | Methods for therapeutic use of exosomes and Y-RNAS |
| JP2025081530A (en) * | 2022-05-13 | 2025-05-27 | ハミングバード ダイアグノスティクス ゲーエムベーハー | Novel rna molecule for cancer detection |
| WO2025212448A1 (en) * | 2024-04-01 | 2025-10-09 | Cedars-Sinai Medical Center | Therapeutic trna-based nucleic acids and methods of use thereof |
| WO2025217982A1 (en) * | 2024-04-16 | 2025-10-23 | 温州医科大学附属第一医院 | Plasma pirna combination for early diagnosis of gastric cancer and use thereof |
| US12544409B2 (en) | 2014-10-03 | 2026-02-10 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy |
| US12584127B2 (en) | 2012-08-13 | 2026-03-24 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20210340625A1 (en) * | 2018-10-10 | 2021-11-04 | Thomas Jefferson University | tRNA-DERIVED FRAGMENTS AS BIOMARKERS FOR PARKINSON'S DISEASE |
| CN111197070A (en) * | 2018-11-16 | 2020-05-26 | 南京迈西可生物科技有限公司 | Method for identifying 2' -O-methylation modification in RNA molecule and application thereof |
| GB201907380D0 (en) * | 2019-05-24 | 2019-07-10 | Cancer Research Tech Ltd | Mediators of gene silencing |
| GB202018570D0 (en) * | 2020-11-25 | 2021-01-06 | Cancer Research Tech Ltd | Mediators of gene silencing |
| CN113355407B (en) * | 2021-06-09 | 2023-02-28 | 南京鼓楼医院 | A tsRNA marker for diagnosing systemic lupus erythematosus and its clinical application |
| CN115537463A (en) * | 2021-06-29 | 2022-12-30 | 四川大学华西医院 | Use of the reagent for detecting piR-hsa-120522 in plasma in the preparation of lung cancer screening or diagnostic kits |
| EP4471146A1 (en) * | 2022-01-28 | 2024-12-04 | Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences | Small rna drug for inhibiting activity of cancer cells |
| CN115141883B (en) * | 2022-03-01 | 2025-04-29 | 宁波大学 | A tsRNA biomarker, a kit and its application for diagnosing depression |
| CN115851729A (en) * | 2022-11-21 | 2023-03-28 | 扬州大学附属医院 | A marker tRF-Thr-TGT-4-M2 for detecting prostate cancer through urine and its application |
| CN118291471B (en) * | 2024-01-24 | 2024-10-25 | 山东大学 | A small molecule RNA for treating diabetic wounds and its application |
| CN117752675B (en) * | 2024-02-22 | 2024-06-11 | 山东大学 | A small molecule RNA for treating osteoporosis and its application |
| CN119746069B (en) * | 2024-11-12 | 2026-02-03 | 上海大学 | Application of reagent or method for inhibiting expression of lysine-specific demethylase 6B in preparation of medicine for preventing and treating heart diseases caused by administration of anticancer medicine |
| CN119842905A (en) * | 2025-02-11 | 2025-04-18 | 南京鼓楼医院 | Biomarker related to bladder cancer and application thereof |
| CN120700128A (en) * | 2025-04-15 | 2025-09-26 | 中国人民解放军总医院第二医学中心 | tsRNA markers, kits and applications thereof for diagnosing and evaluating vascular aging |
Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4358535A (en) | 1980-12-08 | 1982-11-09 | Board Of Regents Of The University Of Washington | Specific DNA probes in diagnostic microbiology |
| EP1752536A1 (en) | 2004-05-11 | 2007-02-14 | RNAi Co., Ltd. | Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same |
| WO2010021865A1 (en) | 2008-08-18 | 2010-02-25 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| WO2010080724A1 (en) | 2009-01-12 | 2010-07-15 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| US20100324120A1 (en) | 2009-06-10 | 2010-12-23 | Jianxin Chen | Lipid formulation |
| WO2011022460A1 (en) | 2009-08-20 | 2011-02-24 | Merck Sharp & Dohme Corp. | Novel cationic lipids with various head groups for oligonucleotide delivery |
| WO2011043913A2 (en) | 2009-10-08 | 2011-04-14 | Merck Sharp & Dohme Corp. | Novel cationic lipids with short lipid chains for oligonucleotide delivery |
| WO2011090965A1 (en) | 2010-01-22 | 2011-07-28 | Merck Sharp & Dohme Corp. | Novel cationic lipids for oligonucleotide delivery |
| WO2011149733A2 (en) | 2010-05-24 | 2011-12-01 | Merck Sharp & Dohme Corp. | Novel amino alcohol cationic lipids for oligonucleotide delivery |
| WO2011153120A1 (en) | 2010-06-04 | 2011-12-08 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012040184A2 (en) | 2010-09-20 | 2012-03-29 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012044638A1 (en) | 2010-09-30 | 2012-04-05 | Merck Sharp & Dohme Corp. | Low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012054365A2 (en) | 2010-10-21 | 2012-04-26 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012061259A2 (en) | 2010-11-05 | 2012-05-10 | Merck Sharp & Dohme Corp. | Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery |
| WO2012087983A1 (en) | 2010-12-20 | 2012-06-28 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
| US20120178702A1 (en) | 1995-01-23 | 2012-07-12 | University Of Pittsburgh | Stable lipid-comprising drug delivery complexes and methods for their production |
| WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
| WO2013095132A1 (en) | 2011-12-22 | 2013-06-27 | Interna Technologies B.V. | Mirna for treating head and neck cancer |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7250496B2 (en) * | 2002-11-14 | 2007-07-31 | Rosetta Genomics Ltd. | Bioinformatically detectable group of novel regulatory genes and uses thereof |
| WO2009134443A2 (en) * | 2008-05-02 | 2009-11-05 | The Brigham And Women's Hospital, Inc. | Rna-induced translational silencing and cellular apoptosis |
| US10513737B2 (en) | 2011-12-13 | 2019-12-24 | Decipher Biosciences, Inc. | Cancer diagnostics using non-coding transcripts |
| US20160024575A1 (en) * | 2013-05-02 | 2016-01-28 | The Regents Of The University Of California | Circulating small noncoding rna markers |
-
2015
- 2015-10-24 US US15/521,606 patent/US10889812B2/en not_active Expired - Fee Related
- 2015-10-24 EP EP15851885.2A patent/EP3209780A4/en not_active Withdrawn
- 2015-10-24 WO PCT/US2015/057259 patent/WO2016065349A2/en not_active Ceased
Patent Citations (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4358535B1 (en) | 1980-12-08 | 1986-05-13 | ||
| US4358535A (en) | 1980-12-08 | 1982-11-09 | Board Of Regents Of The University Of Washington | Specific DNA probes in diagnostic microbiology |
| US20120178702A1 (en) | 1995-01-23 | 2012-07-12 | University Of Pittsburgh | Stable lipid-comprising drug delivery complexes and methods for their production |
| EP1752536A1 (en) | 2004-05-11 | 2007-02-14 | RNAi Co., Ltd. | Polynucleotide causing rna interfere and method of regulating gene expression with the use of the same |
| WO2010021865A1 (en) | 2008-08-18 | 2010-02-25 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| WO2010080724A1 (en) | 2009-01-12 | 2010-07-15 | Merck Sharp & Dohme Corp. | Novel lipid nanoparticles and novel components for delivery of nucleic acids |
| US20100324120A1 (en) | 2009-06-10 | 2010-12-23 | Jianxin Chen | Lipid formulation |
| WO2011022460A1 (en) | 2009-08-20 | 2011-02-24 | Merck Sharp & Dohme Corp. | Novel cationic lipids with various head groups for oligonucleotide delivery |
| WO2011043913A2 (en) | 2009-10-08 | 2011-04-14 | Merck Sharp & Dohme Corp. | Novel cationic lipids with short lipid chains for oligonucleotide delivery |
| WO2011090965A1 (en) | 2010-01-22 | 2011-07-28 | Merck Sharp & Dohme Corp. | Novel cationic lipids for oligonucleotide delivery |
| WO2011149733A2 (en) | 2010-05-24 | 2011-12-01 | Merck Sharp & Dohme Corp. | Novel amino alcohol cationic lipids for oligonucleotide delivery |
| WO2011153120A1 (en) | 2010-06-04 | 2011-12-08 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012040184A2 (en) | 2010-09-20 | 2012-03-29 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012044638A1 (en) | 2010-09-30 | 2012-04-05 | Merck Sharp & Dohme Corp. | Low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012054365A2 (en) | 2010-10-21 | 2012-04-26 | Merck Sharp & Dohme Corp. | Novel low molecular weight cationic lipids for oligonucleotide delivery |
| WO2012061259A2 (en) | 2010-11-05 | 2012-05-10 | Merck Sharp & Dohme Corp. | Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery |
| WO2012087983A1 (en) | 2010-12-20 | 2012-06-28 | The General Hospital Corporation | Polycomb-associated non-coding rnas |
| WO2012099755A1 (en) | 2011-01-11 | 2012-07-26 | Alnylam Pharmaceuticals, Inc. | Pegylated lipids and their use for drug delivery |
| WO2013095132A1 (en) | 2011-12-22 | 2013-06-27 | Interna Technologies B.V. | Mirna for treating head and neck cancer |
Non-Patent Citations (26)
| Title |
|---|
| "Molecular Biology and Biotechnology: a Comprehensive Desk Reference", 1995, WILEY, JOHN & SONS, INC. |
| "The Encyclopedia of Molecular Biology", 1994, BLACKWELL PUBLISHERS |
| BENJAMIN LEWIN: "Genes VII", 2000, OXFORD UNIVERSITY PRESS |
| CECH TRSTEITZ JA: "The noncoding RNA revolution-trashing old rules to forge new ones", CELL, vol. 157, 2014, pages 77 - 94, XP028601898, DOI: 10.1016/j.cell.2014.03.008 |
| DEFOUGEROLLES, HUM GENE THER, vol. 19, 2008, pages 125 - 132 |
| GERSTL ET AL., JOURNAL OF BIOTECHNOLOGY, vol. 166, 2013, pages 1 - 2,51-57 |
| GUFFANTI ET AL., BMC GENOMICS, vol. 10, no. 163, 2009, pages 1 - 17 |
| HEYES ET AL., J CONTR REL, vol. 107, 2005, pages 276 - 287 |
| HIGGS PGLEHMAN N: "The RNA World: molecular cooperation at the origins of life", NAT REV GENET., vol. 6, no. 1, 2015, pages 7 - 17 |
| IYER ET AL., J. AM. CHEM. SOC., vol. 112, 1990, pages 1253 - 1254 |
| IYER ET AL., J. ORG. CHEM., vol. 55, 1990, pages 4693 - 4698 |
| JEFFS ET AL., PHARM RES., vol. 22, 2005, pages 362 - 372 |
| JUDGE ET AL., J CLIN INVEST., vol. 119, 2009, pages 661 - 673 |
| KIM ET AL., PNAS, vol. 106, no. 20, 2009, pages 8278 - 8283 |
| KOSS ET AL., THE JOURNAL OF IMMUNOLOGY, vol. 176, no. 2, 2006, pages 1218 - 1227 |
| MEI ET AL., CANCER LETTERS, vol. 336, 2013, pages 46 - 52 |
| MEI ET AL., NATURE COMMUNICATIONS, vol. 6, no. 1, 2015, pages 1 - 12 |
| MORRISSEY ET AL., NAT BIOTECHNOL., vol. 2, 2005, pages 1002 - 1007 |
| ORTOGERO ET AL., JBC, vol. 289, no. 47, 2014, pages 32824 - 32834 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| See also references of EP3209780A4 |
| SEMPLE ET AL., NATURE BIOTECH, vol. 28, 2010, pages 172 - 176 |
| SIDDIQIMATUSHANSKY, JOURNAL OF CELLULAR BIOCHEMISTRY, vol. 113, no. 2, 2012, pages 373 - 380 |
| WHEELER ET AL., GENE THERAPY, vol. 6, 1999, pages 1438 - 1447 |
| YAN ET AL., NUCLEIC ACIDS RESEARCH, vol. 39, no. 15, 2011, pages 6596 - 6607 |
| ZIMMERMANN ET AL., NATURE, vol. 441, 2006, pages 111 - 114 |
Cited By (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12584127B2 (en) | 2012-08-13 | 2026-03-24 | Cedars-Sinai Medical Center | Exosomes and micro-ribonucleic acids for tissue regeneration |
| US12544409B2 (en) | 2014-10-03 | 2026-02-10 | Cedars-Sinai Medical Center | Cardiosphere-derived cells and exosomes secreted by such cells in the treatment of muscular dystrophy |
| US11535670B2 (en) | 2016-05-11 | 2022-12-27 | Huyabio International, Llc | Combination therapies of HDAC inhibitors and PD-L1 inhibitors |
| US10385130B2 (en) | 2016-05-11 | 2019-08-20 | Huya Bioscience International, Llc | Combination therapies of HDAC inhibitors and PD-1 inhibitors |
| US10385131B2 (en) | 2016-05-11 | 2019-08-20 | Huya Bioscience International, Llc | Combination therapies of HDAC inhibitors and PD-L1 inhibitors |
| US12122833B2 (en) | 2016-05-11 | 2024-10-22 | Huyabio International, Llc | Combination therapies of HDAC inhibitors and PD-1 inhibitors |
| US10287353B2 (en) | 2016-05-11 | 2019-05-14 | Huya Bioscience International, Llc | Combination therapies of HDAC inhibitors and PD-1 inhibitors |
| EP3604529A4 (en) * | 2017-03-29 | 2021-01-06 | Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences | MICROARN AND USES OF IT IN THE PREVENTION AND / OR TREATMENT OF A MEDICAL SIGN AND / OR SYNDROME OF FIBROPLASIA |
| US11471476B2 (en) | 2017-03-29 | 2022-10-18 | Institute Of Basic Medical Sciences, Chinese Academy Of Medical Sciences | Microrna and uses thereof in prevention and/or treatment of fibroplasia medical sign and/or syndrome |
| US12427164B2 (en) | 2017-03-29 | 2025-09-30 | Beijing Baishihekang Pharmaceutical Technology (Bsjpharma) Co., Ltd | Microrna and uses thereof in prevention and/or treatment of fibroplasia medical sign and/or syndrome |
| US12146137B2 (en) | 2018-02-05 | 2024-11-19 | Cedars-Sinai Medical Center | Methods for therapeutic use of exosomes and Y-RNAS |
| CN108486247B (en) * | 2018-02-12 | 2021-01-15 | 中山大学 | Application of piRNA-54265 in diagnosis and treatment and prognosis evaluation of colorectal cancer |
| WO2019153656A1 (en) * | 2018-02-12 | 2019-08-15 | 中山大学 | Use of pirna-54265 in diagnosis, treatment and prognostic evaluation of colorectal cancer |
| CN108486247A (en) * | 2018-02-12 | 2018-09-04 | 中山大学 | Application of piRNA-54265 in the diagnosis, treatment and prognosis evaluation of colorectal cancer |
| US20230165889A1 (en) * | 2020-02-28 | 2023-06-01 | Forsyth Dental Infirmary For Children | CHEMICALLY MODIFIED TRANSFER RNA-DERIVED SMALL RNAs (tsRNAs) TO TARGET PATHOGENIC BACTERIA |
| US20230416758A1 (en) * | 2020-11-23 | 2023-12-28 | Thomas Jefferson University | Trna fragments and methods of use |
| WO2022109435A1 (en) * | 2020-11-23 | 2022-05-27 | Thomas Jefferson University | Trna fragments and methods of use |
| WO2023025161A1 (en) * | 2021-08-23 | 2023-03-02 | 北京嘉树佳业科技有限公司 | Srna derived from medicinal plant and application thereof |
| JP2025516614A (en) * | 2022-05-13 | 2025-05-30 | ハミングバード ダイアグノスティクス ゲーエムベーハー | Novel RNA molecules for cancer detection |
| CN119278277A (en) * | 2022-05-13 | 2025-01-07 | 蜂鸟诊断有限责任公司 | New RNA molecule for cancer detection |
| EP4495268A3 (en) * | 2022-05-13 | 2025-04-30 | Hummingbird Diagnostics GmbH | Novel rna molecule for cancer detection |
| JP2025081530A (en) * | 2022-05-13 | 2025-05-27 | ハミングバード ダイアグノスティクス ゲーエムベーハー | Novel rna molecule for cancer detection |
| JP7749867B2 (en) | 2022-05-13 | 2025-10-06 | ハミングバード ダイアグノスティクス ゲーエムベーハー | Novel RNA molecules for cancer detection |
| WO2023217735A1 (en) * | 2022-05-13 | 2023-11-16 | Hummingbird Diagnostics Gmbh | Novel rna molecule for cancer detection |
| CN116024211A (en) * | 2022-07-29 | 2023-04-28 | 浙江大学 | Application of tRNA Derivative tRF-His-008 in Diagnosis and Treatment of Renal Cancer |
| CN116024211B (en) * | 2022-07-29 | 2026-04-07 | 浙江大学 | Application of tRNA derivative tRF-His-008 in the diagnosis and treatment of renal cell carcinoma |
| WO2024073612A3 (en) * | 2022-09-30 | 2024-06-06 | Cedars-Sinai Medical Center | Therapeutic nucleic acids and methods of use thereof |
| WO2024113828A1 (en) * | 2022-11-29 | 2024-06-06 | 四川大学华西医院 | Use of reagent for detecting pir-hsa-790910 in preparing kit for lung cancer screening or diagnosis |
| WO2025212448A1 (en) * | 2024-04-01 | 2025-10-09 | Cedars-Sinai Medical Center | Therapeutic trna-based nucleic acids and methods of use thereof |
| WO2025217982A1 (en) * | 2024-04-16 | 2025-10-23 | 温州医科大学附属第一医院 | Plasma pirna combination for early diagnosis of gastric cancer and use thereof |
| US12580080B2 (en) | 2024-04-16 | 2026-03-17 | The First Affiliated Hospital Of Wenzhou Medical University | Plasma piRNA combination for early diagnosis of gastric cancer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3209780A4 (en) | 2018-09-19 |
| WO2016065349A8 (en) | 2016-11-10 |
| US20180273941A1 (en) | 2018-09-27 |
| WO2016065349A3 (en) | 2016-07-14 |
| EP3209780A2 (en) | 2017-08-30 |
| US10889812B2 (en) | 2021-01-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10889812B2 (en) | Short non-coding protein regulatory RNAs (sprRNAs) and methods of use | |
| JP2009528346A (en) | Sensitization of cells to cancer therapy by modulating the activity of nucleic acid encoding RPS27L protein | |
| US12234455B2 (en) | Therapeutic oligonucleotides | |
| WO2017147594A1 (en) | COMPOSITIONS AND METHODS OF USING piRNAS IN CANCER DIAGNOSTICS AND THERAPEUTICS | |
| Blumental-Perry et al. | Retrograde signaling by a mtDNA-encoded non-coding RNA preserves mitochondrial bioenergetics | |
| US20190055563A1 (en) | Polymerase q as a target in hr-deficient cancers | |
| US20230149507A1 (en) | Treatment of alt cancers | |
| US20180148789A1 (en) | Methods for treating and assessing tumor invasion and metastasis | |
| WO2021146347A1 (en) | Inhibition of tap63 regulated oncogenic long non-coding rnas (trolls) in the treatment of cancer | |
| EP3329004A1 (en) | Therapeutic oligonucleotides | |
| US20230054860A1 (en) | Tap63 regulated oncogenic long non-coding rnas | |
| US20240141352A1 (en) | Chaperonin-containing tcp-1 inhibitors for the treatment of cancer | |
| EP4294408A1 (en) | Tap63 regulated oncogenic long non-coding rnas | |
| CA3207288A1 (en) | Ep300 degrader and uses thereof in neuroblastoma | |
| EP3889262A1 (en) | Inhibition of caspase-3 by the microrna 126-5p | |
| JP2007505825A (en) | Use of eukaryotic genes that influence cell cycle control or cell cycle progression in the diagnosis and treatment of proliferative diseases | |
| US20250066784A1 (en) | Therapeutic oligonucleotides | |
| WO2020033572A1 (en) | Parn as a biomarker and therapeutic target | |
| US20240124610A1 (en) | Methods for treating her2-negative or her2-low cancer | |
| WO2011041784A1 (en) | Methods for diagnosing and treating cancer | |
| Harold | Identifying Non-Coding and Protein Regulators of Ribosome Biogenesis | |
| JP2024543181A (en) | Minor spliceosome targeting compositions and their use in cancer treatment | |
| WO2025038613A1 (en) | Therapeutic modulation of snora13 for treatment of ribosomopathies | |
| WO2022182697A1 (en) | A novel rna-based approach to cancer treatment | |
| HK40093667A (en) | Diagnosis and treatment of chronic diabetic complications using long non-coding rnas as targets |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15851885 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15521606 Country of ref document: US |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015851885 Country of ref document: EP |
