WO2016061263A1 - Antisense compounds and uses thereof - Google Patents
Antisense compounds and uses thereof Download PDFInfo
- Publication number
- WO2016061263A1 WO2016061263A1 PCT/US2015/055582 US2015055582W WO2016061263A1 WO 2016061263 A1 WO2016061263 A1 WO 2016061263A1 US 2015055582 W US2015055582 W US 2015055582W WO 2016061263 A1 WO2016061263 A1 WO 2016061263A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- modified
- compound
- sugar moiety
- nucleosides
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/0104—Pyruvate kinase (2.7.1.40)
Definitions
- the pyruvate kinase M (PK-M) gene has 12 exons. Exon 9 and exon 10 are alternatively spliced in a mutually exclusive fashion to give rise to the Ml and M2 isoforms of the PK-M gene. Inclusion of exon 9 and exclusion of exon 10 yields the PK-Ml isoform. Exclusion of exon 9 and inclusion of exon 10 yields the PK-M2 isoform. Exons 9 and 10 each encode a 56 amino acid segment that confers distinctive properties to the respective PK-Ml and PK-M2 isoforms. The PK-M2 isoform is expressed in a broad range of cancer cells, whereas PK-Ml is predominantly expressed in terminally differentiated tissues.
- Antisense compounds have been used to modulate target nucleic acids. Antisense compounds comprising a variety of chemical modifications and motifs have been reported. In certain instances, such compounds are useful as research tools, diagnostic reagents, and as therapeutic agents. In certain instances antisense compounds have been shown to modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein. In certain instances, such binding of an antisense compound to its target mRNA results in cleavage of the mRNA. Antisense compounds that modulate processing of a pre-mRNA have also been reported. Such antisense compounds alter splicing, interfere with polyadenlyation or prevent formation of the 5 '-cap of a pre-mRNA.
- mRNA target messenger RNA
- the present invention provides compounds comprising oligonucleotides.
- such oligonucleotides are complementary to a pyruvate kinase M (PK-M) transcript.
- PK-M pyruvate kinase M
- oligonucleotides are complementary to a target region of the PK-M transcript comprising intron 9 or the junction between intron 9 and exon 10.
- oligonucleotides are complementary to a target region of the PK-M transcript comprising an intron adjacent to exon 10, for example, intron 9.
- oligonucleotides are complementary to a target region of the PK-M transcript comprising intron 9.
- the PK-M transcript comprises an intronic splice silencer for exon 10. In certain embodiments, the PK-M transcript comprises an intronic splice enhancer for exon 9. In certain embodiments, oligonucleotides inhibit inclusion of exon 10. In certain embodiments, oligonucleotides promote skipping of exon 10. In certain embodiments, oligonucleotides promote selection of exon 9. In certain embodiments, oligonucleotides promote skipping of exon 10 and promote inclusion of exon 9. In certain such embodiments, PK-M mRNA with exon 9 mRNA is increased. In certain such embodiments, PK-M mRNA with exon 10 mRNA is decreased. In certain embodiments, the PK-M2 isoform of the PK-M protein is decreased. In certain embodiments, the PK-M1 isoform of the PK-M protein is decreased.
- contacting a cell with an oligonucleotide described herein results in a decrease in PK-M mRNA with exon 10. In certain embodiments, contacting a cell with an oligonucleotide described herein results in a decrease in the expression of the PK-M2 isoform. In certain such embodiments, contacting a cell with an oligonucleotide described herein results in an increase in the PK-M1 isoform of the PK-M protein and a decrease in the PK-M2 isoform of the PK-M protein.
- contacting a cell with an oligonucleotide complementary to a target region of the PK-M transcript comprising intron 9 and contacting a cell with a second oligonucleotide complementary to a target region of the PK-M transcript comprising exon 10 results in a decrease in the expression of the PK-M2 isoform
- PK-M transcript is in a human. In certain embodiments, including, but not limited to any of the below numbered embodiments, the PK-M transcript is in a mouse.
- splicing of PK-M pre-mRNA is altered by contacting a cell with more than one modified oligonucleotide. In certain embodiments, splicing of PK-M pre- mRNA is altered by contacting a cell with a modified oligonucleotide that targets exon 10 and a second modified oligonucleotide that targets intron 9. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and ISIS 461378.
- splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84
- splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, and 113.
- Embodiment 1 A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-
- Embodiment 2 A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729- 28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731- 28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741- 28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, or 28773- 28787 of SEQ ID NO: 1 , wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
- Embodiment 3 A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
- Embodiment 4 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 119, 120, 121 , 122, 123,
- Embodiment 5 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 119, 120, 121 , 122, 123,
- Embodiment 6 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20,
- Embodiment 7 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
- Embodiment 8 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126,
- Embodiment 9 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131
- Embodiment 10 A compound comprising a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 8 contiguous nucleobases and is complementary to an equal- length portion of a target region of a P -M transcript.
- Embodiment 11 The compound of embodiment 10, wherein the target region of the PK-M transcript comprises at least a portion of intron 9 of the PK-M transcript.
- Embodiment 12 The compound of any of embodiments 10 to 11, wherein the target region of the PK-
- M transcript comprises at least a portion of exon 10 of the PK-M transcript.
- Embodiment 13 The compound of embodiment 11 or 12, wherein the complementary region of the modified oligonucleotide is 100% complementary to the target region.
- Embodiment 14 The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 10 contiguous nucleobases.
- Embodiment 15 The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 15 contiguous nucleobases.
- Embodiment 16 The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 18 contiguous nucleobases.
- Embodiment 17 The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 80% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
- Embodiment 18 The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 90% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
- Embodiment 19 The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is 100% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
- Embodiment 20 The compound of any of embodiments 11-19, wherein the target region is within intron 9 of the PK-M transcript.
- Embodiment 21 The compound of any of embodiments 1-10, wherein the target region is within nucleobase 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729- 28753, 28730-28744, 28730- 28747 28730- 28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767 28758-28772, 28768-28782, 28773-28787 28726-28743, 28727-28743, 28728-28743, 28729-28743 28746, 28729-28749, 28729-28753, 28730-28744,
- Embodiment 22 The compound of any of embodiments 1-10, wherein the target region is within nucleobase 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, or 28773-28787 of SEQ ID NO. 1.
- Embodiment 23 The compound of any of embodiments 1-23, wherein the modified oligonucleotide comprises at least one modified nucleoside.
- Embodiment 24 The compound of embodiment 23, wherein at least one modified nucleoside comprises a modified sugar moiety.
- Embodiment 25 The compound of embodiment 24, wherein at least one modified sugar moiety is a 2'-substituted sugar moiety.
- Embodiment 26 The compound of embodiment 25, wherein the 2'-substitutent of at least one 2'- substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
- Embodiment 27 The compound of any of embodiments 25-26, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
- Embodiment 28 The compound of any of embodiments 1-23, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
- Embodiment 29 The compound of embodiment 28, wherein at least one bicyclic sugar moiety is cEt.
- Embodiment 30 The compound of embodiment 28, wherein at least one bicyclic sugar moiety is
- Embodiment 31 The compound of embodiment 25, wherein at least one sugar moiety is a sugar surrogate.
- Embodiment 32 The compound of embodiment 31, wherein at least one sugar surrogate is a
- Embodiment 33 The compound of embodiment 31, wherein at least one sugar surrogate is a modified morpholino.
- Embodiment 34 The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 35 The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 36 The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 37 The compound of any of embodiment 1-33, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
- Embodiment 38 The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
- Embodiment 39 The compound of any of embodiments 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
- Embodiment 40 The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
- Embodiment 41 The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
- Embodiment 42 The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
- Embodiment 43 The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
- Embodiment 44 The compound of any of embodiments37-43, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'- MOE, cEt, LNA, morpholino, and modified morpholino.
- Embodiment 45 The compound of any of embodiments 40-43, wherein the modified nucleosides of the modified region each comprise the same modification as one another.
- Embodiment 46 The compound of any of embodiments 40-43, wherein the modified nucleosides of the modified region each comprise the same 2'-substituted sugar moiety.
- Embodiment 47 The compound of embodiment 46, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 48 The compound of embodiment 46, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
- Embodiment 49 The compound of embodiment 44, wherein the modified nucleosides of the region of modified nucleosides each comprise the same bicyclic sugar moiety.
- Embodiment 50 The compound of embodiment 49, wherein the bicyclic sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
- Embodiment 51 The compound of embodiment 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a morpholino.
- Embodiment 52 The compound of embodiment 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a modified morpholino.
- Embodiment 53 The compound of any of embodiments 1-35, wherein the modified oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
- Embodiment 54 The compound of any of embodiments 1-52, wherein each nucleoside of the
- modified oligonucleotide is a modified nucleoside.
- Embodiment 55 The compound of embodiment 54 wherein each modified nucleoside comprises a modified sugar moiety.
- Embodiment 56 The compound of embodiment 55, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
- Embodiment 57 The compound of embodiment 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2'-substituted sugar moiety.
- Embodiment 58 The compound of embodiment 57, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 59 The compound of embodiment 58, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is 2'-MOE.
- Embodiment 60 The compound of embodiment 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety.
- Embodiment 61 The compound of embodiment 60, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
- Embodiment 62 The compound of embodiment 55, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
- Embodiment 63 The compound of embodiment 62, wherein the sugar surrogate of the modified oligonucleotide is a morpholino.
- Embodiment 64 The compound of embodiment 62, wherein the sugar surrogate of the modified oligonucleotide is a modified morpholino.
- Embodiment 65 The compound of any of embodiments 1-34 wherein each nucleobase of the
- modified oligonucleotide is a modified sugar moiety or an unmodified nucleobase.
- Embodiment 66 The compound of embodiment 65, wherein each unmodified nucleobase is DNA.
- Embodiment 67 The compound of embodiment 65 or 66, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 68 The compound of embodiment 67, wherein the modified sugar moiety is cEt.
- Embodiment 69 The compound of embodiment 67, wherein the modified sugar moiety is LNA.
- Embodiment 70 The compound of embodiment 67, wherein the modified sugar moiety is 2'F.
- Embodiment 71 The compound of embodiment 67, wherein the modified sugar moiety is 2'-OMe.
- Embodiment 72 The compound of embodiment 67, wherein the modified sugar moiety is 2'-MOE.
- Embodiment 73 The compound of any of embodiments 65 to 72, wherein the modified
- oligonucleotide has a aaddaddaddaddaa motif, wherein each "a” represents a modified sugar moiety and wherein each "d” represents DNA.
- Embodiment 74 The compound of any of embodiments 1-73, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
- Embodiment 75 The compound of embodiment 74, wherein each internucleoside linkage is a
- Embodiment 76 The compound of embodiment 74 or 75, comprising at least one phosphorothioate internucleoside linkage.
- Embodiment 77 The compound of embodiment 75, wherein each internucleoside linkage is a
- Embodiment 78 The compound of embodiment 77, wherein each internucleoside linkage is a
- Embodiment 79 The compound of any of embodiments 1-74, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
- Embodiment 80 The compound of any of embodiments 1-79 comprising at least one conjugate.
- Embodiment 81 The compound of any of embodiments 1 -79 consisting of the modified
- Embodiment 82 The compound of any of embodiments 1-81, wherein the compound modulates splicing of the PK-M transcript.
- Embodiment 83 The compound of any of embodiments 10-82, having a nucleobase sequence
- Embodiment 84 A pharmaceutical composition comprising a compound according to any of
- embodiments 1-83 and a pharmaceutically acceptable carrier or diluent.
- Embodiment 85 The pharmaceutical composition of embodiment 84, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
- Embodiment 86 A method of modulating splicing of a P -M transcript in a cell comprising
- Embodiment 87 The method of embodiment 86, wherein the cell is in vitro.
- Embodiment 88 The method of embodiment 86, wherein the cell is in an animal.
- Embodiment 89 The method of any of embodiments 86-88, wherein inclusion of exon 9 is increased.
- Embodiment 90 The method of any of embodiments 86-89, wherein exclusion of exon 10 is
- Embodiment 91 The method of any of embodiments 86-89, wherein inclusion of exon 10 is
- Embodiment 92 The method of any of embodiments 86-91, wherein PK-M1 mR A expression is increased.
- Embodiment 93 The method of any of embodiments 86-92, wherein PK-M2 mRNA expression is decreased.
- Embodiment 94 A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of embodiments 1-85.
- Embodiment 95 The method of embodiment 94, wherein PK-M1 expression is increased.
- Embodiment 96 The method of embodiments 94 or 95, wherein PK-M2 expression is decreased.
- Embodiment 97 The method of embodiment 94, wherein the cell is in vitro.
- Embodiment 98 The method of embodiment 94, wherein the cell is in an animal.
- Embodiment 99 A method of inducing apoptosis in a cell, comprising contacting the cell with a compound according to any of embodiments 1-85.
- Embodiment 100 The method of embodiment 99, wherein the cell is a glial cell.
- Embodiment 101 The method of embodiment 99 or 100, wherein the cell is in vitro.
- Embodiment 102 The method of embodiment 99 or 100, wherein the cell is in an animal.
- Embodiment 103 A method comprising administering the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 to an animal.
- Embodiment 104 The method of embodiment 103, wherein the administration is
- Embodiment 105 The method of embodiment 103, wherein the administration is into the central nervous sysem.
- Embodiment 106 The method of any of embodiments 103-105, wherein the animal has one or more symptoms associated with cancer.
- Embodiment 107 The method embodiment 106, wherein the cancer is glioblastoma.
- Embodiment 108 The method of embodiment 107, wherein the administration results in amelioration of at least one symptom of cancer.
- Embodiment 109 The method of any of embodiments 101-108, wherein the animal is a mouse.
- Embodiment 110 The method of any of embodiments 101-108, wherein the animal is a human.
- Embodiment 111 A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 to an animal in need thereof.
- Embodiment 112 The method of embodiment 111, wherein the animal is a mouse.
- Embodiment 113 The method of embodiment 111, wherein the animal is a human.
- Embodiment 114 The method of embodiment 111 to 113, wherein the cancerous tumor comprises glioblastoma.
- Embodiment 115 The method of any of embodiments 86 to 102, further comprising contacting a cell with a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 1-83.
- Embodiment 116 The method of any of embodiments 103 to 114, further comprising administering a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 1-83.
- Embodiment 117 The method of embodiment 115 or 116, wherein the second modified
- oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
- Embodiment 118 Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the preparation of a medicament for use in the treatment of cancer.
- Embodiment 119 Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
- Embodiment 120 The use of embodiment 118 or 119, wherein the cancer is glioblastoma.
- Embodiment 121 Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the treatment of cancer.
- Embodiment 122 Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the treatment of glioblastoma.
- Embodiment 123 The method of any of embodiments 115-117, wherein the first modified
- oligonucleotide has the nucleobase sequence of Isis No. 461378.
- Embodiment 124 A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28709-28726, 28710-28727, 28711-28728, 28712- 28729, 28713-28730, 28714-28731, 28715-28732, 28716-28733, 28717-28734, 28718-28735, 28719- 28736, 28720-28737, 28721-28738, 28722-28739, 28723-28740, 28724-28741, 28725-28742 of SEQ ID
- modified oligonucleotide is at least 85%, 90%>, 95%, or 100%) complementary to SEQ ID NO: 1.
- Embodiment 125 A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 1 1 1, 112, or 113.
- Embodiment 126 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
- Embodiment 127 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
- Embodiment 128 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
- Embodiment 129 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 1 1 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
- Embodiment 130 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113.
- Embodiment 131 A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113.
- Embodiment 132 The compound of any of embodiments 124-131, wherein the complementary region of the modified oligonucleotide is 90% complementary to the target region.
- Embodiment 133 The compound of any of embodiments 124-131, wherein the complementary region of the modified oligonucleotide is 100% complementary to the target region.
- Embodiment 134 The compound of any of embodiments 124-133, wherein the modified
- oligonucleotide comprises at least one modified nucleoside.
- Embodiment 135 The compound of embodiment 134, wherein at least one modified nucleoside
- Embodiment 136 The compound of embodiment 135, wherein at least one modified sugar moiety is a 2'-substituted sugar moiety.
- Embodiment 137 The compound of embodiment 136, wherein the 2'-substitutent of at least one 2'- substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
- Embodiment 138 The compound of any of embodiments 136-137, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
- Embodiment 139 The compound of any of embodiments 124-135, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
- Embodiment 140 The compound of embodiment 139, wherein at least one bicyclic sugar moiety is cEt.
- Embodiment 141 The compound of embodiment 139, wherein at least one bicyclic sugar moiety is LNA.
- Embodiment 142 The compound of embodiment 135, wherein at least one sugar moiety is a sugar surrogate.
- Embodiment 143 The compound of embodiment 142, wherein at least one sugar surrogate is a
- Embodiment 144 The compound of embodiment 142, wherein at least one sugar surrogate is a
- Embodiment 145 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 146 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 147 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety.
- Embodiment 148 The compound of any of embodiment 124-144, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
- Embodiment 149 The compound of any of embodiment 124-144, wherein the modified
- oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
- Embodiment 150 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
- Embodiment 151 The compound of any of embodiments 124-150, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
- Embodiment 152 The compound of any of embodiments 124-150, wherein the modified
- oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
- Embodiment 153 The compound of any of embodiments 124-150, wherein the modified
- oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
- Embodiment 154 The compound of any of embodiments 124-150, wherein the modified
- oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
- Embodiment 155 The compound of any of embodiments 151-154, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'-MOE, cEt, LNA, morpholino, and modified morpholino.
- Embodiment 156 The compound of any of embodiments 151-154, wherein the modified nucleosides of the modified region each comprise the same modification as one another.
- Embodiment 157 The compound of any of embodiments 151-154, wherein the modified nucleosides of the modified region each comprise the same 2'-substituted sugar moiety.
- Embodiment 158 The compound of embodiment 157, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 159 The compound of embodiment 157, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
- Embodiment 160 The compound of embodiment 155, wherein the modified nucleosides of the region of modified nucleosides each comprise the same bicyclic sugar moiety.
- Embodiment 161 The compound of embodiment 160, wherein the bicyclic sugar moiety of the
- modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
- Embodiment 162 The compound of embodiment 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a morpholino.
- Embodiment 163 The compound of embodiment 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a modified morpholino.
- Embodiment 164 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
- Embodiment 165 The compound of any of embodiments 124-144, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside.
- Embodiment 166 The compound of embodiment 165 wherein each modified nucleoside comprises a modified sugar moiety.
- Embodiment 167 The compound of embodiment 166, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
- Embodiment 168 The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2'-substituted sugar moiety.
- Embodiment 169 The compound of embodiment 168, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 170 The compound of embodiment 168, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is 2'-MOE.
- Embodiment 171 The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety.
- Embodiment 172 The compound of embodiment 171, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
- Embodiment 173 The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
- Embodiment 174 The compound of embodiment 173, wherein the sugar surrogate of the modified oligonucleotide is a morpholino.
- Embodiment 175 The compound of embodiment 173, wherein the sugar surrogate of the modified oligonucleotide is a modified morpholino.
- Embodiment 176 The compound of any of embodiments 124-144 wherein each sugar moiety of the modified oligonucleotide is a modified sugar moiety or an unmodified sugar moiety.
- Embodiment 177 The compound of embodiment 176, wherein each unmodified sugar moiety is a 2'- deoxyfuranose sugar moiety.
- Embodiment 178 The compound of embodiment 176 or 177, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE.
- Embodiment 179 The compound of embodiment 178, wherein the modified sugar moiety is cEt.
- Embodiment 180 The compound of embodiment 178, wherein the modified sugar moiety is LNA.
- Embodiment 181 The compound of embodiment 178, wherein the modified sugar moiety is 2'F.
- Embodiment 182 The compound of embodiment 178, wherein the modified sugar moiety is 2'-OMe.
- Embodiment 183 The compound of embodiment 178, wherein the modified sugar moiety is 2'-MOE.
- Embodiment 184 The compound of any of embodiments 177-183, wherein the modified
- oligonucleotide has a aaddaddaddaddaa motif, wherein each "a” represents a modified sugar moiety and wherein each "d” represents a 2'-deoxyfuranose moiety.
- Embodiment 185 The compound of any of embodiments 177-183, wherein the modified
- oligonucleotide has a addaddaddadda motif, wherein each "a” represents a modified sugar moiety and wherein each "d” represents a 2'-deoxyfuranose moiety.
- Embodiment 186 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide has a aeeaeeaeeaeeaeea motif, wherein each "a” represents a bicyclic modified sugar moiety and wherein each "e” represents a 2 '-substituted sugar moiety.
- Embodiment 187 The compound of any of embodiments 124-144, wherein the modified
- oligonucleotide has a aaeeaeeaeeaeeeeea motif, wherein each "a” represents a bicyclic modified sugar moiety and wherein each "e” represents a 2 '-substituted sugar moiety.
- Embodiment 188 The compound of any of embodiments 184-187, wherein each "a” independently represents either a cEt modified sugar moiety or an LNA modified sugar moiety.
- Embodiment 189 The compound of embodiment 188, wherein each "a” represents a cEt modified sugar moiety.
- Embodiment 190 The compound of any of embodiments 124-189, wherein the modified
- oligonucleotide comprises at least one modified internucleoside linkage.
- Embodiment 191 The compound of embodiment 190, wherein each internucleoside linkage is a
- Embodiment 192 The compound of embodiment 190 or 191, comprising at least one phosphorothioate internucleoside linkage.
- Embodiment 193 The compound of embodiment 190, wherein each internucleoside linkage is a
- each internucleoside linkage comprises the same modification.
- Embodiment 194 The compound of embodiment 190, wherein each internucleoside linkage is a
- Embodiment 195 The compound of any of embodiments 124-190, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
- Embodiment 196 The compound of any of embodiments 124-195 comprising at least one conjugate.
- Embodiment 197 The compound of any of embodiments 124-195 consisting of the modified
- Embodiment 198 The compound of any of embodiments 124-197, wherein the compound modulates splicing of the PK-M transcript.
- Embodiment 199 A pharmaceutical composition comprising a compound according to any of
- Embodiment 200 The pharmaceutical composition of embodiment 199, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
- Embodiment 201 A method of modulating splicing of a PK-M transcript in a cell comprising
- Embodiment 202 The method of embodiment 201, wherein the cell is in vitro.
- Embodiment 203 The method of embodiment 201, wherein the cell is in an animal.
- Embodiment 204 The method of any of embodiments 201-203, wherein inclusion of exon 9 is
- Embodiment 205 The method of any of embodiments 201-204, wherein exclusion of exon 10 is
- Embodiment 206 The method of any of embodiments 201-204, wherein inclusion of exon 10 is
- Embodiment 207 The method of any of embodiments 201-206, wherein PK-Ml mRNA expression is increased.
- Embodiment 208 The method of any of embodiments 201-207, wherein PK-M2 mRNA expression is decreased.
- Embodiment 209 A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of embodiments 124-198.
- Embodiment 210 The method of embodiment 209, wherein PK-Ml expression is increased.
- Embodiment 211 The method of embodiments 209 or 210, wherein PK-M2 expression is decreased.
- Embodiment 212 The method of embodiment 209, wherein the cell is in vitro.
- Embodiment 213 The method of embodiment 209, wherein the cell is in an animal.
- Embodiment 214 A method of inducing apoptosis in a cell, comprising contacting the cell with a compound according to any of embodiments 124-198.
- Embodiment 215 The method of embodiment 214, wherein the cell is a glial cell.
- Embodiment 216 The method of embodiment 214 or 215, wherein the cell is in vitro.
- Embodiment 217 The method of embodiment 214 or 215, wherein the cell is in an animal.
- Embodiment 218 A method comprising administering the compound according to any of embodiments 124-196 or the pharmaceutical composition of embodiments 199 or 200 to an animal.
- Embodiment 219 The method of embodiment 218, wherein the administration is
- Embodiment 220 The method of embodiment 218, wherein the administration is into the central nervous sysem.
- Embodiment 221 The method of any of embodiments 218-220, wherein the animal has one or more symptoms associated with cancer.
- Embodiment 222 The method embodiment 221, wherein the cancer is glioblastoma.
- Embodiment 223 The method of embodiment 221, wherein the administration results in amelioration of at least one symptom of cancer.
- Embodiment 224 The method of any of embodiments 218-223, wherein the animal is a mouse.
- Embodiment 225 The method of any of embodiments 218-223, wherein the animal is a human.
- Embodiment 226 A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of embodiments 124-198 or the pharmaceutical composition of embodiments 199 or 200 to an animal in need thereof.
- Embodiment 227 The method of embodiment 226, wherein the animal is a mouse.
- Embodiment 228 The method of embodiment 226, wherein the animal is a human.
- Embodiment 229 The method of embodiment 226 to 228, wherein the cancerous tumor comprises glioblastoma.
- Embodiment 230 The method of any of embodiments 201 to 229, further comprising contacting a cell with a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 124-198.
- Embodiment 231 The method of embodiment 230, wherein the second modified oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
- Embodiment 232 Use of the compound according to any of embodiments 124-198 or the
- compositions 199 or 200 for the preparation of a medicament for use in the treatment of cancer.
- Embodiment 233 Use of the compound according to any of embodiments 124-198 or the
- compositions 199 or 200 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
- Embodiment 234 The use of embodiment 232 or 233, wherein the cancer is glioblastoma.
- Embodiment 235 Use of the compound according to any of embodiments 124-198 or the
- Embodiment 236 Use of the compound according to any of embodiments 124-198 or the
- nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
- chemical modification means a chemical difference in a compound when compared to a naturally occurring counterpart.
- chemical modification does not include differences only in nucleobase sequence.
- Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
- furanosyl means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
- naturally occurring sugar moiety means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
- sugar moiety means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
- modified sugar moiety means a substituted sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar surrogate.
- substituted sugar moiety means a furanosyl comprising at least one substituent group that differs from that of a naturally occurring sugar moiety.
- Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'-position, the 3 '-position, the 5'-position and/or the 4'-position.
- 2 '-substituted sugar moiety means a furanosyl comprising a substituent at the 2'- position other than H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
- MOE means -OCH 2 CH 2 OCH 3 .
- bicyclic sugar moiety means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure.
- the 4 to 7 membered ring is a sugar ring.
- the 4 to 7 membered ring is a furanosyl.
- the bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.
- sugar surrogate means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside.
- Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen.
- Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents).
- Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid).
- Sugar surrogates include without limitation morpholino, modified morpholinos, cyclohexenyls and cyclohexitols.
- nucleotide means a nucleoside further comprising a phosphate linking group.
- linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.”
- linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
- nucleobase means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
- heterocyclic base or “heterocyclic nucleobase” means a nucleobase comprising a heterocyclic structure.
- unmodified nucleobase or “naturally occurring nucleobase” means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
- modified nucleobase means any nucleobase that is not a naturally occurring nucleobase.
- modified nucleoside means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
- bicyclic nucleoside or "BNA” means a nucleoside comprising a bicyclic sugar moiety.
- constrained ethyl nucleoside or “cEt” means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-0-2'bridge.
- locked nucleic acid nucleoside or "LNA” means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH 2 -0-2'bridge.
- 2 '-substituted nucleoside means a nucleoside comprising a substituent at the 2'- position other than H or OH. Unless otherwise indicated, a 2'-substituted nucleoside is not a bicyclic nucleoside.
- 2'-deoxynucleoside means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA).
- a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
- oligonucleotide means a compound comprising a plurality of linked nucleosides.
- an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
- oligonucleoside means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom.
- oligonucleotides include oligonucleosides.
- modified oligonucleotide means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
- nucleoside linkage means a covalent linkage between adjacent nucleosides in an oligonucleotide.
- naturally occurring internucleoside linkage means a 3' to 5' phosphodiester linkage.
- modified internucleoside linkage means any internucleoside linkage other than a naturally occurring internucleoside linkage.
- oligomeric compound means a polymeric structure comprising two or more substructures.
- an oligomeric compound comprises an oligonucleotide.
- an oligomeric compound comprises one or more conjugate groups and/or terminal groups.
- an oligomeric compound consists of an oligonucleotide.
- terminal group means one or more atom attached to either, or both, the 3 ' end or the 5' end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
- conjugate means an atom or group of atoms bound to an oligonucleotide or oligomeric compound.
- conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
- conjugate linking group means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
- antisense compound means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
- antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
- detecting or “measuring” means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
- detecttable and/or measureable activity means a statistically significant activity that is not zero.
- essentially unchanged means little or no change in a particular parameter, particularly relative to another parameter which changes much more.
- a parameter is essentially unchanged when it changes less than 5%.
- a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold.
- an antisense activity is a change in the amount of a target nucleic acid.
- the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
- expression means the process by which a gene ultimately results in a protein.
- Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5 '-cap), and translation.
- target nucleic acid means a nucleic acid molecule to which an antisense compound hybridizes.
- mRNA means an RNA molecule that encodes a protein.
- pre-mRNA means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.
- transcript means an RNA molecule transcribed from DNA.
- Transcripts include, but are not limitied to mRNA, pre-mRNA, and partially processed RNA.
- PK-M transcript means a transcript transcribed from a PK-M gene.
- a PK-M transcript comprises SEQ ID NO: 1 : the complement of GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to 43314403.
- PK-M gene means a gene that encodes a pyruvate kinase M protein and any pyruvate kinase M protein isoforms.
- pyruvate kinase M protein isoforms include pyruvate kinase Ml and pyruvate kinase M2.
- a pyruvate kinase M gene is represented by GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to
- a pyruvate kinase M gene is at least 95% identical to GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to 43314403. In certain embodiments, a pyruvate kinase M gene is at least 90% identical to GENBAN Accession No.
- NT 010194.16 truncated from nucleotides 43281289 to 43314403.
- PK-M1 means a pyruvate kinase M transcript that includes exon 9 but does not include exon 10.
- PK-M1 isoform means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 9 but does not include amino acids encoded from exon 10.
- PK-M2 means a pyruvate kinase M transcript that includes exon 10 but does not include exon 9.
- PK-M2 isoform means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 10 but does not include amino acids encoded from exon 9.
- targeting means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule.
- An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
- nucleobase complementarity or “complementarity” when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase.
- adenine (A) is complementary to thymine (T).
- adenine (A) is complementary to uracil (U).
- complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the
- oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
- Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
- non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
- complementary in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions.
- Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
- complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary).
- complementary oligomeric compounds or regions are 80% complementary.
- complementary oligomeric compounds or regions are 90% complementary.
- complementary oligomeric compounds or regions are 95% complementary.
- complementary oligomeric compounds or regions are 100% complementary.
- hybridization means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- oligomeric compound specifically hybridizes to more than one target site.
- percent complementarity means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent
- complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
- percent identity means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
- modulation means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation.
- modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression.
- modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
- motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
- nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof.
- the linkages of such an oligomeric compound may be modified or unmodified.
- motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
- sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof.
- linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof.
- the nucleosides of such an oligomeric compound may be modified or unmodified.
- motifs herein describing only linkages are intended to be linkage motifs.
- the nucleosides are not limited.
- nucleobase modification motif means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
- sequence motif means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
- nucleoside having a modification of a first type may be an unmodified nucleoside.
- telomeres As used herein, “differently modified” mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally- occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified.
- nucleoside comprising a 2'-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
- the same type of modifications refers to modifications that are the same as one another, including absence of modifications.
- two unmodified DNA nucleoside have “the same type of modification,” even though the DNA nucleoside is unmodified.
- Such nucleosides having the same type modification may comprise different nucleobases.
- pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an animal.
- a pharmaceutically acceptable carrier or diluent is sterile saline.
- such sterile saline is pharmaceutical grade saline.
- substituted nucleoside and “substituent group,” means an atom or group that replaces the atom or group of a named parent compound.
- a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'- substuent is any atom or group at the 2'-position of a nucleoside other than H or OH).
- Substituent groups can be protected or unprotected.
- compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
- substituted in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group.
- a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group).
- each R aa , R bb and R cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
- alkyl means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms.
- alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like.
- Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (CrC 1 alkyl) with from 1 to about 6 carbon atoms being more preferred.
- alkenyl means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond.
- alkenyl groups include without limitation, ethenyl, propenyl, butenyl, l-methyl-2-buten-l-yl, dienes such as 1,3-butadiene and the like.
- Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred.
- Alkenyl groups as used herein may optionally include one or more further substituent groups.
- alkynyl means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond.
- alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like.
- Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred.
- Alkynyl groups as used herein may optionally include one or more further substituent groups.
- acyl means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula -C(0)-X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
- alicyclic means a cyclic ring system wherein the ring is aliphatic.
- the ring system can comprise one or more rings wherein at least one ring is aliphatic.
- Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring.
- Alicyclic as used herein may optionally include further substituent groups.
- aliphatic means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond.
- An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred.
- the straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus.
- Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
- alkoxy means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule.
- alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n- pentoxy, neopentoxy, n-hexoxy and the like.
- Alkoxy groups as used herein may optionally include further substituent groups.
- aminoalkyl means an amino substituted C1-C12 alkyl radical.
- the alkyl portion of the radical forms a covalent bond with a parent molecule.
- the amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
- aralkyl and arylalkyl mean an aromatic group that is covalently linked to a C 1-C12 alkyl radical.
- the alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like.
- Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
- aryl and aromatic mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings.
- aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
- Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings.
- Aryl groups as used herein may optionally include further substituent groups.
- halo and halogen mean an atom selected from fluorine, chlorine, bromine and iodine.
- heteroaryl and “heteroaromatic,” mean a radical comprising a mono- or poly- cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen.
- heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like.
- Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom.
- Heteroaryl groups as used herein may optionally include further substituent groups.
- the present invention provides oligomeric compounds.
- such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups.
- an oligomeric compound consists of an oligonucleotide.
- oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage.
- oligomeric compounds of the invention comprise one or more modifed nucleosides comprising a modifed sugar moiety.
- Such oligomeric compounds comprising one or more sugar- modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties.
- modified sugar moieties are substitued sugar moieties.
- modified sugar moieties are bicyclic or tricyclic sugar moieties.
- modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
- modified sugar moieties are substituted sugar moieties comprising one or more substituent, including but not limited to substituents at the 2' and/or 5' positions.
- sugar substituents suitable for the 2'-position include, but are not limited to: 2'-F, 2'-OCH 3 ("OMe” or "O- methyl"), and 2'-0(CH 2 ) 2 0CH 3 (“MOE").
- sugar substituents at the 5'-position include, but are not limited to:, 5'-methyl (R or S); 5'-vinyl, and 5'-methoxy.
- substituted sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5', 2'-bis substituted sugar moieties and nucleosides).
- Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'-substituted nucleosides.
- a 2'- substituted nucleoside comprises a 2'-substituent group selected from halo, allyl, amino, azido, O- C r C 10 alkoxy; O- C r C 10 substituted alkoxy, SH, CN, OCN, CF 3 , OCF 3 , O-alkyl, S-alkyl, N(R m )-alkyl; O- alkenyl, S- alkenyl, or N(R m )-alkenyl; O- alkynyl, S- alkynyl, N(R m )-alkynyl; O-alkylenyl- O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH 2
- These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N0 2 ), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
- a 2'- substituted nucleoside comprises a sugar moiety comprising a 2'- substituent group selected from F, 0-CH 3 , and OCH 2 CH 2 OCH 3 .
- Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety.
- the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms.
- Examples of such 4' to 2' sugar substituents include, but are not limited to: -[C(R a )(R b )] n -, -[C(R a )(R b )] n -0-, -C(R a R b )-N(R)-0- or, -C(R a R b )-0-N(R)-; 4'-CH 2 -2', 4'-(CH 2 ) 2 -2 ⁇ 4'-(CH 2 ) 3 -2',.
- Patent 7,427,672 issued on September 23, 2008
- 4'-CH 2 - C(H)(CH 3 )-2' see, e.g., Chattopadhyaya, et al, J. Org. Chem.,2009, 74, 118-134
- x 0, 1, or 2;
- n 1, 2, 3, or 4;
- Bicyclic nucleosides include, but are not limited to, (A) a-L-Methyleneoxy (4'-CH 2 -0-2') BNA , (B) ⁇ -D- Methyleneoxy (4'-CH 2 -0-2') BNA (also referred to as locked nucleic acid or LNA) , (C) Ethyleneoxy (4'-
- Bx is a nucleobase moiety and R is, inde endently, H, a protecting group, or C1-C12 alkyl.
- bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
- a nucleoside comprising a 4'-2' methylene-oxy bridge may be in the a-L configuration or in the ⁇ -D configuration.
- a-L- methyleneoxy (4'-CH 2 -0-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).
- substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4 '-2' bridged sugars), ⁇ see, PCT International Application WO 2007/134181, published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).
- bridging sugar substituent e.g., 5 '-substituted and 4 '-2' bridged sugars
- modified sugar moieties are sugar surrogates.
- the oxygen atom of the naturally occuring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom.
- such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above.
- certain sugar surogates comprise a 4'-sulfer atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US2005/0130923, published on June 16, 2005) and/or the 5' position.
- carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
- sugar surrogates comprise rings having other than 5-atoms.
- a sugar surrogate comprises a six-membered tetrahydropyran.
- Such tetrahydropyrans may be further modified or substituted.
- Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (UNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula
- Bx is a nucleobase moiety
- T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
- qi, q 2 , q3, q 4 , qs, q6 and q 7 are each, independently, H, Ci-Ce alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
- each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJJ 2 , SJ b N 3 , and CN, wherein X is O, S or NJi, and each Ji, J 2 , and J3 is, independently, H or Ci-Ce alkyl.
- the modified THP nucleosides of Formula VII are provided wherein qi, q 2 , q3, q 4 , q 5 , q6 and q 7 are each H. In certain embodiments, at least one of qi, q 2 , q3, q 4 , qs, q6 3 ⁇ 4nd q 7 is other than H. In certain embodiments, at least one of qi, q 2 , q3, q 4 , qs, q6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R 2 is F. In certain embodiments, Ri is fluoro and R 2 is H, Ri is methoxy and R 2 is H, and Ri is methoxyethoxy and R2 is H.
- sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
- nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506).
- morpholino means a sugar llowing structure:
- morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure.
- sugar surrogates are refered to herein as "modifed morpholinos.”
- nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modifed nucleobases.
- modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein.
- nucleobases include tricyclic pyrimidines such as phenoxazine cytidine( [5,4-b][l,4]benzoxazin- 2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
- nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone.
- nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
- the present invention provides oligomeric compounds comprising linked nucleosides.
- nucleosides may be linked together using any internucleoside linkage.
- the two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom.
- Non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH 2 -N(CH 3 )-0-CH 2 -), thiodiester (-O-C(O)-S-), thionocarbamate (-0- C(0)(NH)-S-); siloxane (-0-Si(H) 2 -0-); and ,N'-dimethylhydrazine (-CH 2 -N(CH 3 )-N(CH 3 )-).
- Modified linkages compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound.
- internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers.
- Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
- oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or ⁇ such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
- Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
- the present invention provides oligomeric compounds comprising oligonucleotides.
- such oligonucleotides comprise one or more chemical modification.
- chemically modified oligonucleotides comprise one or more modified nucleosides.
- chemically modified oligonucleotides comprise one or more modified nucleosides comprising modified sugars.
- chemically modified oligonucleotides comprise one or more modified nucleosides comprising one or more modified nucleobases.
- chemically modified oligonucleotides comprise one or more modified internucleoside linkages.
- the chemically modifications define a pattern or motif.
- the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another.
- an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
- oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif.
- Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
- the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or "wings" and an internal region or "gap.”
- the three regions of a gapmer motif (the 5 '-wing, the gap, and the 3 '-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
- the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap.
- the sugar moieties within the gap are the same as one another.
- the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
- the sugar modification motifs of the two wings are the same as one another (symmetric gapmer).
- the sugar modification motifs of the 5'-wing differs from the sugar modification motif of the 3'-wing (asymmetric gapmer).
- oligonucleotides comprise 2'-MOE modified nucleosides in the wings and 2'-F modified nucleosides in the gap.
- oligonucleotides are fully modified. In certain such embodiments, oligonucleotides are uniformly modified. In certain embodiments, oligonucleotides are uniform 2'-MOE. In certain embodiments, oligonucleotides are uniform 2'-F. In certain embodiments, oligonucleotides are uniform morpholino. In certain embodiments, oligonucleotides are uniform BNA. In certain embodiments, oligonucleotides are uniform LNA. In certain embodiments, oligonucleotides are uniform cEt.
- oligonucleotides comprise a uniformly modified region and additional nucleosides that are unmodified or differently modified.
- the uniformly modified region is at least 5, 10, 15, or 20 nucleosides in length.
- the uniform region is a 2'- MOE region.
- the uniform region is a 2'-F region.
- the uniform region is a morpholino region.
- the uniform region is a BNA region.
- the uniform region is a LNA region.
- the uniform region is a cEt region.
- the oligonucleotide does not comprise more than 4 contiguous unmodified 2'-deoxynucleosides.
- antisesense oligonucleotides comprising more than 4 contiguous 2'-deoxynucleosides activate RNase H, resulting in cleavage of the target RNA.
- such cleavage is avoided by not having more than 4 contiguous 2'-deoxynucleosides, for example, where alteration of splicing and not cleavage of a target RNA is desired.
- oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif.
- internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif.
- the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region.
- the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate.
- the sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
- oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain
- each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
- the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages.
- the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3 ' end of the oligonucleotide.
- oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif.
- nucleobase modifications are arranged in a gapped motif.
- nucleobase modifications are arranged in an alternating motif.
- each nucleobase is modified.
- none of the nucleobases is chemically modified.
- oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 3'-end of the oligonucleotide. In certain such embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5'-end of the oligonucleotide.
- nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide.
- each purine or each pyrimidine in an oligonucleotide is modified.
- each adenine is modified.
- each guanine is modified.
- each thymine is modified.
- each cytosine is modified.
- each uracil is modified.
- cytosine moieties in an oligonucleotide are 5- methyl cytosine moieties.
- 5-methyl cytosine is not a "modified nucleobase.”
- unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl.
- the methylation state of all or some cytosine nucleobases is specified.
- the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths.
- the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range.
- X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X ⁇ Y.
- the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 15, 11 to 16, 11 to
- nucleosides of an oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents.
- an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents.
- a gapmer oligonucleotide has any of the above lengths.
- a gapmer having a 5'-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3 '-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides.
- the lower length limit is 13 and that the limit of 10 in "10-20" has no effect in that embodiment.
- an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range.
- Such additional nucleosides may be 5' of the 5 '-wing and/or 3 ' of the 3 ' wing.
- oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region.
- sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications.
- modified nucleobase independent of the gapmer pattern of the sugar modifications.
- a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited.
- an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
- oligomeric compounds are modified by attachment of one or more conjugate groups.
- conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance.
- Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide.
- Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes.
- Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci.
- Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 36 1 -3654), a palmityl moiety (Mishra et al., Biochim.
- a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
- active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyls
- conjugate groups are directly attached to oligonucleotides in oligomeric compounds.
- conjugate groups are attached to oligonucleotides by a conjugate linking group.
- conjugate linking groups including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein.
- Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound.
- a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups.
- One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group.
- the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units.
- functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
- bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
- conjugate linking moieties include pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l -carboxylate (SMCC) and 6- aminohexanoic acid (AHEX or AHA).
- ADO 8-amino-3,6- dioxaoctanoic acid
- SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane-l -carboxylate
- AHEX or AHA 6- aminohexanoic acid
- linking groups include, but are not limited to, substituted Ci- Cio alkyl, substituted or unsubstituted C 2 -Ci 0 alkenyl or substituted or unsubstituted C 2 -Ci 0 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
- Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
- conjugate groups are at the 3 '-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3'-end. In certain embodiments, conjugates are attached at the 3 'end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.
- oligomeric compounds comprise an oligonucleotide.
- an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups.
- conjugate and/or terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above.
- an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group.
- oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow
- hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
- the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
- such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
- antisense compounds and antisense oligonucleotides comprise single-strand compounds. In certain embodiments antisense compounds and antisense oligonucleotides comprise double- strand compounds.
- PK-M2 mediates the Warburg effect.
- expression of PK-M2 is crucial for tumor cell growth and proliferation.
- reducing expression of PK-M2 inhibits cancer growth. In certain embodiments, reducing expression of PK-M2 induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell.
- increasing inclusion of exon 9 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing inclusion of exon 9 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain cancer cells. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain glioblastoma cell lines.
- PK-M2 also functions as a co-activator of HIF-1 and/ or ⁇ -catenin. In certain embodiments, reducing expression of PK-M2, as opposed to inhibiting its kinase function, interferes with anti-apoptotic and pro-proliferative functions associated with cancer or tumor cells. In certain embodiments, one or more antisense compounds may be used to target a PK-M2.
- the administration of a modified oligonucleotide causes a switch in the alternative splicing of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes increased inclusion of exon 9 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes an increase in the exclusion of exon 10 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell and inhibits cancer growth. In certain embodiments, the
- the cell is a cancer cell.
- the cell is a tumor cell.
- the cell is a glioblastoma cell.
- compounds comprise or consist of a modified oligonucleotide comprising a region that is complementary to a target nucleic acid.
- the target nucleic acid is an endogenous RNA molecule.
- the target nucleic acid is a pre-mRNA.
- the target nucleic acid is a PK-M transcript.
- the target RNA is a PK- M pre-mRNA.
- a modified oligonucleotide is complementary to a region of PK-M pre- mRNA. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre- mRNA comprising an exon encoding PK-M2. In certain embodiments, a modified oligonucleotide is complementary to a region of PK-M pre-mRNA comprising an intron-exon splice junction. In certain embodiments, a modified oligonucleotide is complementary to a region of P -M pre-mRNA comprising the intron-exon splice junction adjacent to exon 10.
- a modified oligonucleotide is complementary within a region of PK-M pre- mRNA consisting of exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre- mRNA consisting of intron 9. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within intron 9.
- a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within exon 9. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 9.
- a modified oligonucleotide comprises a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length of a PK-M transcript.
- the target region is within nucleobase 28726 and nucleobase 29137 of SEQ ID NO.: 1.
- the target region is within nucleobase 28726 and nucleobase 28787 of SEQ ID NO. : 1.
- the target region is within nucleobase 28714 and nucleobase 29257 of SEQ ID NO.: 1.
- the target region is within nucleobase 29128 and nucleobase 29162 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29159 and nucleobase 29193 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29164 and nucleobase 29183 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 28826 and nucleobase 29183 of SEQ ID NO.: 1.
- a modified oligonucleotide modulates splicing of a pre-mRNA. In certain embodiments, a modified oligonucleotide modulates splicing a PK-M pre-mRNA. In certain embodiments, a modified oligonucleotide increases the amount of PK-M mRNA. In certain embodiments, a modified oligonucleotide increases the inclusion of exon 9 in PK-M mRNA. In certain embodiments, a modified oligonucleotide decreases the inclusion of exon 10 in PK-M mRNA. In certain embodiments, a modified oligonucleotide increases the amount of PK-Ml mRNA. In certain embodiments, a modified oligonucleotide decreases the amount of PK-M2 mRNA.
- PK-M pre-mRNA it is desirable to alter the splicing of PK-M pre-mRNA to include exon 9 and exclude exon 10.
- expression of PK-Ml will increase and expression of PK-M2 will decrease.
- splicing of PK-M pre-mRNA is altered by contacting a cell with more than one modified oligonucleotide. In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with a modified oligonucleotide that targets ex on 10 and a second modified oligonucleotide that targets intron 9.
- modified oligonucleotides targeted to exon 10 are described in PCT Publication No. WO 2014/071078, which is hereby incorporated by reference in its entirety. In certain embodiments, modified oligonucleotides that target exon 10 are described in Table A below.
- modified oligonucleotides in Table A below were designed as uniform oligonucleotides, 15 nucleotides in length, with every nucleoside having a 2'-0-methoxyethyl ribose sugar residue and a fully phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- splicing of PK-M pre-mRNA is altered by contacting a cell with more than one modified oligonucleotide. In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with a modified oligonucleotide that targets exon 10 and a second modified oligonucleotide that targets intron 9. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and ISIS 461378.
- splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81,
- the present invention provides pharmaceutical compositions comprising one or more antisense compound.
- such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier.
- a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound.
- such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound.
- the sterile saline is pharmaceutical grade saline.
- a pharmaceutical composition comprises one or more antisense compound and sterile water.
- a pharmaceutical composition consists of one or more antisense compound and sterile water.
- the sterile saline is pharmaceutical grade water.
- a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
- antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
- compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
- compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters.
- pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
- the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
- Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
- a prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
- Lipid moieties have been used in nucleic acid therapies in a variety of methods.
- the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
- DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
- a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
- compositions provided herein comprise one or more modified oligonucleotides and one or more excipients.
- excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
- a pharmaceutical composition provided herein comprises a delivery system.
- delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
- a pharmaceutical composition provided herein comprises one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
- pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
- a pharmaceutical composition provided herein comprises a co-solvent system.
- co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
- co-solvent systems are used for hydrophobic compounds.
- VPD co-solvent system is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
- co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
- identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
- a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
- a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.).
- a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
- other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
- injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like.
- compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
- Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
- a pharmaceutical composition is prepared for transmucosal administration.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount.
- the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
- one or more modified oligonucleotide provided herein is formulated as a prodrug.
- a prodrug upon in vivo administration, is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide.
- prodrugs are useful because they are easier to administer than the corresponding active form.
- a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form.
- a prodrug may have improved solubility compared to the corresponding active form.
- prodrugs are less water soluble than the
- a prodrug is an ester.
- the ester is metabolically hydrolyzed to carboxylic acid upon administration.
- the carboxylic acid containing compound is the corresponding active form.
- a prodrug comprises a short peptide (polyaminoacid) bound to an acid group.
- the peptide is cleaved upon administration to form the corresponding active form.
- the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell.
- the cell is in an animal.
- the animal is a mammal.
- the animal is a rodent.
- the animal is a primate.
- the animal is a non-human primate.
- the animal is a human.
- the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal.
- Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous).
- parenteral e.g., intravenous, intramuscular, intramedullary, and subcutaneous.
- pharmaceutical intrathecals are administered to achieve local rather than systemic exposures.
- pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the eyes, ears).
- a pharmaceutical composition is administered to an animal having at least one cancer cell. In certain embodiments, such administration results in apoptosis of at least cancer cell. In certain embodiments, a pharmaceutical composition is administered to an animal having at least one symptom associated with cancer. In certain embodiments, such administration results in amelioration of at least one symptom. In certain embodiments, administration of a pharmaceutical composition to an animal results in a decrease of PK-M2 mRNA in a cell of the animal. In certain embodiments, such administration results in an increase in PK-M1 mRNA. In certain embodiments, such administration results in a decrease in PK-M2 protein and an increase PK-M1 protein.
- a PK-M1 protein is preferred over a PK-M2 protein.
- the administration of certain antisense oligonucleotides delays the onset of cancer. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of cancer cells. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of tumor cells. In certain embodiments, the administration of certain antisense oligonucleotides prevents the growth of cancer. In certain embodiments, the administration of certain antisense oligonucleotides prevents the formation of tumors. In certain embodiments, the administration of certain antisense oligonucleotides causes tumor mass to decrease. In certain embodiments, the administration of certain antisense oligonucleotides rescues cellular phenotype.
- RNA nucleoside comprising a 2' -OH sugar moiety and a thymine base
- RNA having a modified sugar 2'-OH for the natural 2'-H of DNA
- RNA having a modified base thymine (methylated uracil) for natural uracil of RNA
- nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence is intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- an oligomeric compound having the nucleobase sequence is intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
- ATCGATCG encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG” and those having some DNA bases and some RNA bases such as
- AUCGATCG and oligomeric compounds having other modified or naturally occurring bases, such as "AT me CGAUCG,” wherein me C indicates a cytosine base comprising a methyl group at the 5-position.
- Example 1 Effect of antisense oligonucleotides targeting pyruvate kinase M
- the antisense oligonucleotides (ASOs) in the table below were designed to target intron 9 or the junction between intron 9 and exon 10 of human pyruvate kinase M (P -M).
- the ASOs comprise uniform
- NT 010194.16 truncated from nucleotides 43281289 to 43314403 (designated herein as SEQ ID NO: 1), and the start and stop sites of each ASO on that sequence are shown in the table below.
- HEK-293 cells were transfected with each ASO at a final concentration of 60 nM.
- HEK-293 cells were obtained from ATCC and grown at a density of 4 x 10 5 cells in 6-cm dishes in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37°C and 5% CO 2 .
- Transfections were performed using an ASO: LipofectAMINE2000® ratio of 20 pmoles: 1 ⁇ ,.
- hPKMF 5'- AGAAACAGCCAAAGGGGACT-3 ' (designated herein as SEQ ID NO: 117)
- hPKMR 5'- CATTCATGGCAAAGTTCACC-3 ' (designated herein as SEQ ID NO: 118).
- the products were analyzed on a 5% native polyacrylamide gel, visualized by autoradiography, and quantified on a Typhoon 9410 phosphorimager (GE Healthcare) using Multi Gauge software Version 2.3.
- the results are presented in Table 1.
- the % Ml mRNA in endogenous transcripts was calculated using the GC -content-normalized intensities of the top undigested band (Ml), the bottom two digested bands of M2 in the PstI -digested samples, and the double-skipped species (D), if detectable.
- Ml top undigested band
- D double-skipped species
- Each product was quantified as a percentage of the total of Ml, M2, and double-skipped species.
- %M1 and %M2 are presented in the Table 1 below.
- the background negative-control levels are ⁇ 4% Ml and 96% M2; " ⁇ " indicates a visually estimated value.
- Table 1 does not include a column for the double-skipped species (
- Example 2 Design of antisense oligonucleotides targeting pyruvate kinase M
- ASOs antisense oligonucleotides
- the ASOs presented in Table 2 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs presented in Table 3 comprise 18-mer oligonucleotides with deoxy and cEt modifications.
- the Chemistry column denotes the position of the sugar modifications: 'k' is a cEt modification; 'd' is a deoxyribose sugar.
- the ASOs comprise a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- the ASOs presented in Table 4 are 18-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- the ASOs presented in Table 5 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- the ASOs presented in Table 6 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs target the exon 8/intron 9 junction or intron 9 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- the ASOs presented in Table 7 are oligonucleotides with deoxy ("d"), cEt modifications ("k”), and or 2'-0-methoxyethyl (“e") modifications.
- the Chemistry column denotes the position of the sugar modifications.
- the ASOs comprise a uniform phosphorothioate backbone. All the cytosine nucleobases are 5- methylcytosines.
- the ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- the ASOs presented in Table 8 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
- the ASOs target the exon 10/intron 10 junction or intron 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
- Example 3 Effect of antisense oligonucleotides targeting pyruvate kinase M
- Antisense oligonucleotides described in Example 2 in the table below were tested for their effects on endogenous PK-M transcripts, as described in Example 1. The results are presented in Table 9 below. Table 9 does not include a column for the double-skipped species (D), because it was not detected in this experiment.
- Antisense oligonucleotides targeting intron 9b/exon 10 of PK-M were tested for their effects on endogenous PK-M transcripts.
- U87-MG were obtained from ATCC and grown in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37°C and 5% C0 2 .
- ASO transfections were conducted as described in Example 1. Splicing of the PK-M transcripts by radioactive RT-PCR was analyzed 48 hrs after transfection, as described in Example 1. The results are presented in Table 10, below.
- Example 5 Effect combination treatment of antisense oligonucleotides targeting pyruvate kinase M
- Isis No. 461378 see Table 1
- Isis No. 549197 see Table A
- both were transfected into A172 cells at a final, total concentration of 120 nM, and compared to a control ASO that is not complementary to PK-M transcript (ISIS No. 439273).
- A172 cells were obtained from ATCC and cultured at a density of 4 x 10 5 cells in 6 cm dishes in DMEM media, supplemented with 1% (v/v) FBS, penicillin and streptomycin, at 37°C and 5% C0 2 . Transfections were performed using 7ul of Lipofectamine® RNAiMAX.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention provides compounds comprising oligonucleotides complementary to a pyruvate kinase M transcript. Certain such compounds are useful for hybridizing to a pyruvate kinase M transcript, including but not limited to a pyruvate kinase M transcript in a cell. In certain embodiments, such hybridization results in modulation of splicing of the pyruvate kinase M transcript. In certain embodiments, such compounds are used to treat one or more symptoms associated with cancer.
Description
ANTISENSE COMPOUNDS AND USES THEREOF
SEQUENCE LISTING
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0259WOSEQ_ST25.txt, created October 14, 2015, which is 80 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
BACKGROUND
The pyruvate kinase M (PK-M) gene has 12 exons. Exon 9 and exon 10 are alternatively spliced in a mutually exclusive fashion to give rise to the Ml and M2 isoforms of the PK-M gene. Inclusion of exon 9 and exclusion of exon 10 yields the PK-Ml isoform. Exclusion of exon 9 and inclusion of exon 10 yields the PK-M2 isoform. Exons 9 and 10 each encode a 56 amino acid segment that confers distinctive properties to the respective PK-Ml and PK-M2 isoforms. The PK-M2 isoform is expressed in a broad range of cancer cells, whereas PK-Ml is predominantly expressed in terminally differentiated tissues.
Antisense compounds have been used to modulate target nucleic acids. Antisense compounds comprising a variety of chemical modifications and motifs have been reported. In certain instances, such compounds are useful as research tools, diagnostic reagents, and as therapeutic agents. In certain instances antisense compounds have been shown to modulate protein expression by binding to a target messenger RNA (mRNA) encoding the protein. In certain instances, such binding of an antisense compound to its target mRNA results in cleavage of the mRNA. Antisense compounds that modulate processing of a pre-mRNA have also been reported. Such antisense compounds alter splicing, interfere with polyadenlyation or prevent formation of the 5 '-cap of a pre-mRNA.
Certain antisense compounds have been described previously. See for example United States Patent No. 7,399,845 and published International Patent Application No. WO 2008/049085, which are hereby incorporated by reference herein in their entirety.
SUMMARY
In certain embodiments, the present invention provides compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides are complementary to a pyruvate kinase M (PK-M) transcript. In certain such embodiments, oligonucleotides are complementary to a target region of the PK-M transcript comprising intron 9 or the junction between intron 9 and exon 10. In certain such embodiments, oligonucleotides are complementary to a target region of the PK-M transcript comprising an intron adjacent to exon 10, for example, intron 9. In certain such embodiments, oligonucleotides are complementary to a target region of the PK-M transcript comprising intron 9. In certain embodiments, the PK-M transcript comprises an intronic splice silencer for exon 10. In certain embodiments, the PK-M transcript comprises an
intronic splice enhancer for exon 9. In certain embodiments, oligonucleotides inhibit inclusion of exon 10. In certain embodiments, oligonucleotides promote skipping of exon 10. In certain embodiments, oligonucleotides promote selection of exon 9. In certain embodiments, oligonucleotides promote skipping of exon 10 and promote inclusion of exon 9. In certain such embodiments, PK-M mRNA with exon 9 mRNA is increased. In certain such embodiments, PK-M mRNA with exon 10 mRNA is decreased. In certain embodiments, the PK-M2 isoform of the PK-M protein is decreased. In certain embodiments, the PK-M1 isoform of the PK-M protein is decreased.
In certain embodiments, contacting a cell with an oligonucleotide described herein results in a decrease in PK-M mRNA with exon 10. In certain embodiments, contacting a cell with an oligonucleotide described herein results in a decrease in the expression of the PK-M2 isoform. In certain such embodiments, contacting a cell with an oligonucleotide described herein results in an increase in the PK-M1 isoform of the PK-M protein and a decrease in the PK-M2 isoform of the PK-M protein.
In certain embodiments, contacting a cell with an oligonucleotide complementary to a target region of the PK-M transcript comprising intron 9 and contacting a cell with a second oligonucleotide
complementary to a target region of the PK-M transcript comprising exon 10 results in a decrease in the expression of the PK-M2 isoform. In certain embodiments, contacting a cell with an oligonucleotide complementary to a target region of the PK-M transcript comprising intron 9 and contacting a cell with a second oligonucleotide complementary to a target region of the PK-M transcript comprising exon 10 results in a decrease in the expression of the PK-M2 isoform
In certain embodiments, including, but not limited to any of the below numbered embodiments, the
PK-M transcript is in a human. In certain embodiments, including, but not limited to any of the below numbered embodiments, the PK-M transcript is in a mouse.
In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with more than one modified oligonucleotide. In certain embodiments, splicing of PK-M pre- mRNA is altered by contacting a cell with a modified oligonucleotide that targets exon 10 and a second modified oligonucleotide that targets intron 9. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and ISIS 461378. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS
549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, and 113.
The present disclosure provides the following non- limiting numbered embodiments:
Embodiment 1 : A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-
28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731-
28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-
28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, 28773- 28787 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-
28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732-
28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-
28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, 28773-28787, 28778-28792, 28788-
28802, 28793-28807, 28798-28812, 28803-28817, 28808-28822, 28813-28827, 28818-28832, 28823- 28837, 28828-28842, 28833-28847, 28838-28852, 28843-28857, 28848-28862, 28853-28867, 28858-
28872, 28863-28877, 28873-28887, 28878-28892, 28883-28897, 28888-28902, 28893-28907, 28898-
28912, 28903-28917, 28908-28922, 28913-28927, 28918-28932, 28923-28937, 28928-28942, 28933-
28947, 28938-28952, 28943-28957, 28948-28962, 28953-28967, 28958-28972, 28963-28977, 28968-
28982, 28973-28987, 28978-28992, 28983-28997, 28988-29002, 28993-29007, 28998-29012, 29003- 29017, 29008-29022, 29013-29027, 29018-29032, 29023-29037, 29028-29042, 29053-29067, 29058-
29072, 29063-29077, 29068-29082, 29073-29087, 29093-29107, 29098-29112, 29103-29117, 29123-
29137, 28826-28840, 28827-28841, 28829-28843, 28830-28844, 28831-28845, 28832-28846, 28834-
28848, 28835-28849, 28836-28850, 28837-28851, 28839-28853, 28840-28854, 28841-28855, 28842-
28856, 28844-28858, 28845-28859, 28846-28860, 28847-28861, 28849-28863, 28850-28864, 29164- 29181, 29165-29182, 29166-29183, 29159-29176, 29160-29177, 29161-29178, 29162-29179, 29163-
29180, 29164-29181, 29165-29182, 29166-29183, 29167-29184, 29168-29185, 29169-29186, 29170-
29187, 29171-29188, 29172-29189, 29173-29190, 29174-29191, 29175-29192, 29176-29193, 29128-
29142, 29133-29147, 29138-29152, 29143-29157, 29148-29162, 28714-28728, 28719-28733, 28724-
28738, 29128-29142, 29133-29147, 29138-29152, 29143-29157, 29148-29162, 29208-29222, 29213- 29227, 29218-29232, 29223-29237, 29228-29242, 29233-29247, 29238-29252, or 29243-29257 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
Embodiment 2: A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-
28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731- 28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741- 28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, or 28773- 28787 of SEQ ID NO: 1 , wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
Embodiment 3 : A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78,
79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, and 156. Embodiment 4: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133,
134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 5: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 119, 120, 121 , 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154,
155, and 156.
Embodiment 6: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 7: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 8: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 9: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 10: A compound comprising a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 8 contiguous nucleobases and is complementary to an equal- length portion of a target region of a P -M transcript.
Embodiment 11 : The compound of embodiment 10, wherein the target region of the PK-M transcript comprises at least a portion of intron 9 of the PK-M transcript.
Embodiment 12: The compound of any of embodiments 10 to 11, wherein the target region of the PK-
M transcript comprises at least a portion of exon 10 of the PK-M transcript.
Embodiment 13: The compound of embodiment 11 or 12, wherein the complementary region of the modified oligonucleotide is 100% complementary to the target region.
Embodiment 14: The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 10 contiguous nucleobases.
Embodiment 15: The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 15 contiguous nucleobases.
Embodiment 16: The compound of any of embodiments 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 18 contiguous nucleobases.
Embodiment 17: The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 80% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
Embodiment 18 : The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 90% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
Embodiment 19: The compound of any of embodiments 11-16, wherein the nucleobase sequence of the oligonucleotide is 100% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
Embodiment 20: The compound of any of embodiments 11-19, wherein the target region is within intron 9 of the PK-M transcript.
Embodiment 21 : The compound of any of embodiments 1-10, wherein the target region is within nucleobase 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749,
28729- 28753, 28730-28744, 28730- 28747 28730- 28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767 28758-28772, 28768-28782, 28773-28787 28726-28743, 28727-28743, 28728-28743, 28729-28743 28729-28746, 28729-28749, 28729-28753, 28730-28744,
28730- 28747, 28730-28754, 28731- 28745 28731- 28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782 28773-28787, 28778-28792, 28788-28802, 28793-28807, 28798-28812, 28803-28817, 28808-28822 28813-28827, 28818-28832, 28823-28837, 28828-28842, 28833-28847, 28838-28852, 28843-28857 28848- 28862, 28853-28867, 28858-28872, 28863-28877, 28873-28887, 28878-28892, 28883-28897 28888-28902, 28893-28907, 28898-28912, 28903-28917, 28908-28922, 28913-28927, 28918-28932 28923-28937, 28928-28942, 28933-28947, 28938-28952, 28943-28957, 28948-28962, 28953-28967 28958-28972, 28963-28977, 28968-28982, 28973-28987, 28978-28992, 28983-28997, 28988-29002 28993-29007, 28998-29012, 29003-29017, 29008-29022, 29013-29027, 29018-29032, 29023-29037 29028-29042, 29053-29067, 29058-29072, 29063-29077, 29068-29082, 29073-29087, 29093-29107 29098-29112, 29103-29117, 29123-29137, 28826-28840, 28827-28841, 28829-28843, 28830-28844 28831-28845, 28832-28846, 28834-28848, 28835-28849, 28836-28850, 28837-28851, 28839-28853 28840-28854, 28841-28855, 28842-28856, 28844-28858, 28845-28859, 28846-28860, 28847-28861 28849- 28863, 28850-28864, 29164-29181, 29165-29182, 29166-29183, 29159-29176, 29160-29177 29161-29178, 29162-29179, 29163-29180, 29164-29181, 29165-29182, 29166-29183, 29167-29184 29168-29185, 29169-29186, 29170-29187, 29171-29188, 29172-29189, 29173-29190, 29174-29191 29175-29192, 29176-29193, 29128-29142, 29133-29147, 29138-29152, 29143-29157, 29148-29162 28714-28728, 28719-28733, 28724-28738, 29128-29142, 29133-29147, 29138-29152, 29143-29157 29148-29162, 29208-29222, 29213-29227, 29218-29232, 29223-29237, 29228-29242, 29233-29247 29238-29252, or 29243-29257 of SEQ ID NO: 1.
Embodiment 22: The compound of any of embodiments 1-10, wherein the target region is within nucleobase 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, or 28773-28787 of SEQ ID NO. 1.
Embodiment 23: The compound of any of embodiments 1-23, wherein the modified oligonucleotide comprises at least one modified nucleoside.
Embodiment 24: The compound of embodiment 23, wherein at least one modified nucleoside comprises a modified sugar moiety.
Embodiment 25: The compound of embodiment 24, wherein at least one modified sugar moiety is a 2'-substituted sugar moiety.
Embodiment 26: The compound of embodiment 25, wherein the 2'-substitutent of at least one 2'- substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE. Embodiment 27: The compound of any of embodiments 25-26, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
Embodiment 28: The compound of any of embodiments 1-23, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
Embodiment 29: The compound of embodiment 28, wherein at least one bicyclic sugar moiety is cEt.
Embodiment 30: The compound of embodiment 28, wherein at least one bicyclic sugar moiety is
LNA.
Embodiment 31 : The compound of embodiment 25, wherein at least one sugar moiety is a sugar surrogate.
Embodiment 32: The compound of embodiment 31, wherein at least one sugar surrogate is a
morpholino.
Embodiment 33: The compound of embodiment 31, wherein at least one sugar surrogate is a modified morpholino. Embodiment 34: The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
Embodiment 35: The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
Embodiment 36: The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety.
Embodiment 37: The compound of any of embodiment 1-33, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
Embodiment 38: The compound of any of embodiment 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
Embodiment 39: The compound of any of embodiments 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
Embodiment 40: The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
Embodiment 41 : The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
Embodiment 42: The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
Embodiment 43: The compound of any of embodiments 1-39, wherein the modified oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
Embodiment 44: The compound of any of embodiments37-43, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'- MOE, cEt, LNA, morpholino, and modified morpholino.
Embodiment 45: The compound of any of embodiments 40-43, wherein the modified nucleosides of the modified region each comprise the same modification as one another.
Embodiment 46: The compound of any of embodiments 40-43, wherein the modified nucleosides of the modified region each comprise the same 2'-substituted sugar moiety.
Embodiment 47: The compound of embodiment 46, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE. Embodiment 48: The compound of embodiment 46, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
Embodiment 49: The compound of embodiment 44, wherein the modified nucleosides of the region of modified nucleosides each comprise the same bicyclic sugar moiety.
Embodiment 50: The compound of embodiment 49, wherein the bicyclic sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
Embodiment 51 : The compound of embodiment 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a morpholino.
Embodiment 52: The compound of embodiment 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a modified morpholino. Embodiment 53: The compound of any of embodiments 1-35, wherein the modified oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
Embodiment 54: The compound of any of embodiments 1-52, wherein each nucleoside of the
modified oligonucleotide is a modified nucleoside.
Embodiment 55: The compound of embodiment 54 wherein each modified nucleoside comprises a modified sugar moiety.
Embodiment 56: The compound of embodiment 55, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
Embodiment 57: The compound of embodiment 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2'-substituted sugar moiety.
Embodiment 58: The compound of embodiment 57, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
Embodiment 59: The compound of embodiment 58, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is 2'-MOE.
Embodiment 60: The compound of embodiment 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety. Embodiment 61 : The compound of embodiment 60, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
Embodiment 62: The compound of embodiment 55, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
Embodiment 63: The compound of embodiment 62, wherein the sugar surrogate of the modified oligonucleotide is a morpholino.
Embodiment 64: The compound of embodiment 62, wherein the sugar surrogate of the modified oligonucleotide is a modified morpholino.
Embodiment 65: The compound of any of embodiments 1-34 wherein each nucleobase of the
modified oligonucleotide is a modified sugar moiety or an unmodified nucleobase. Embodiment 66: The compound of embodiment 65, wherein each unmodified nucleobase is DNA.
Embodiment 67: The compound of embodiment 65 or 66, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE. Embodiment 68: The compound of embodiment 67, wherein the modified sugar moiety is cEt.
Embodiment 69: The compound of embodiment 67, wherein the modified sugar moiety is LNA.
Embodiment 70: The compound of embodiment 67, wherein the modified sugar moiety is 2'F.
Embodiment 71 : The compound of embodiment 67, wherein the modified sugar moiety is 2'-OMe.
Embodiment 72: The compound of embodiment 67, wherein the modified sugar moiety is 2'-MOE.
Embodiment 73 : The compound of any of embodiments 65 to 72, wherein the modified
oligonucleotide has a aaddaddaddaddaddaa motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents DNA.
Embodiment 74: The compound of any of embodiments 1-73, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage. Embodiment 75: The compound of embodiment 74, wherein each internucleoside linkage is a
modified internucleoside linkage.
Embodiment 76: The compound of embodiment 74 or 75, comprising at least one phosphorothioate internucleoside linkage.
Embodiment 77: The compound of embodiment 75, wherein each internucleoside linkage is a
modified internucleoside linkage and wherein each internucleoside linkage comprises the same modification. Embodiment 78: The compound of embodiment 77, wherein each internucleoside linkage is a
phosphorothioate internucleoside linkage.
Embodiment 79: The compound of any of embodiments 1-74, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
Embodiment 80: The compound of any of embodiments 1-79 comprising at least one conjugate.
Embodiment 81 : The compound of any of embodiments 1 -79 consisting of the modified
oligonucleotide.
Embodiment 82: The compound of any of embodiments 1-81, wherein the compound modulates splicing of the PK-M transcript.
Embodiment 83: The compound of any of embodiments 10-82, having a nucleobase sequence
comprising any of the sequences as set forth in SEQ ID NOs. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
Embodiment 84: A pharmaceutical composition comprising a compound according to any of
embodiments 1-83 and a pharmaceutically acceptable carrier or diluent.
Embodiment 85: The pharmaceutical composition of embodiment 84, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
Embodiment 86: A method of modulating splicing of a P -M transcript in a cell comprising
contacting the cell with a compound according to any of embodiments 1-85. Embodiment 87: The method of embodiment 86, wherein the cell is in vitro.
Embodiment 88: The method of embodiment 86, wherein the cell is in an animal.
Embodiment 89: The method of any of embodiments 86-88, wherein inclusion of exon 9 is increased.
Embodiment 90: The method of any of embodiments 86-89, wherein exclusion of exon 10 is
increased.
Embodiment 91 : The method of any of embodiments 86-89, wherein inclusion of exon 10 is
decreased.
Embodiment 92: The method of any of embodiments 86-91, wherein PK-M1 mR A expression is increased. Embodiment 93: The method of any of embodiments 86-92, wherein PK-M2 mRNA expression is decreased.
Embodiment 94: A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of embodiments 1-85.
Embodiment 95: The method of embodiment 94, wherein PK-M1 expression is increased.
Embodiment 96: The method of embodiments 94 or 95, wherein PK-M2 expression is decreased.
Embodiment 97: The method of embodiment 94, wherein the cell is in vitro.
Embodiment 98: The method of embodiment 94, wherein the cell is in an animal.
Embodiment 99: A method of inducing apoptosis in a cell, comprising contacting the cell with a compound according to any of embodiments 1-85.
Embodiment 100: The method of embodiment 99, wherein the cell is a glial cell. Embodiment 101 : The method of embodiment 99 or 100, wherein the cell is in vitro.
Embodiment 102: The method of embodiment 99 or 100, wherein the cell is in an animal.
Embodiment 103: A method comprising administering the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 to an animal.
Embodiment 104: The method of embodiment 103, wherein the administration is
intracerebroventricular.
Embodiment 105: The method of embodiment 103, wherein the administration is into the central nervous sysem.
Embodiment 106: The method of any of embodiments 103-105, wherein the animal has one or more symptoms associated with cancer.
Embodiment 107: The method embodiment 106, wherein the cancer is glioblastoma.
Embodiment 108: The method of embodiment 107, wherein the administration results in amelioration of at least one symptom of cancer.
Embodiment 109: The method of any of embodiments 101-108, wherein the animal is a mouse.
Embodiment 110: The method of any of embodiments 101-108, wherein the animal is a human.
Embodiment 111 : A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 to an animal in need thereof.
Embodiment 112: The method of embodiment 111, wherein the animal is a mouse.
Embodiment 113: The method of embodiment 111, wherein the animal is a human.
Embodiment 114: The method of embodiment 111 to 113, wherein the cancerous tumor comprises glioblastoma.
Embodiment 115: The method of any of embodiments 86 to 102, further comprising contacting a cell with a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 1-83.
Embodiment 116: The method of any of embodiments 103 to 114, further comprising administering a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 1-83.
Embodiment 117: The method of embodiment 115 or 116, wherein the second modified
oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
Embodiment 118: Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the preparation of a medicament for use in the treatment of cancer.
Embodiment 119: Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
Embodiment 120: The use of embodiment 118 or 119, wherein the cancer is glioblastoma.
Embodiment 121 : Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the treatment of cancer.
Embodiment 122: Use of the compound according to any of embodiments 1-83 or the pharmaceutical composition of embodiments 84 or 85 for the treatment of glioblastoma.
Embodiment 123: The method of any of embodiments 115-117, wherein the first modified
oligonucleotide has the nucleobase sequence of Isis No. 461378.
Embodiment 124: A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28709-28726, 28710-28727, 28711-28728, 28712- 28729, 28713-28730, 28714-28731, 28715-28732, 28716-28733, 28717-28734, 28718-28735, 28719- 28736, 28720-28737, 28721-28738, 28722-28739, 28723-28740, 28724-28741, 28725-28742 of SEQ ID
NO: 1 , wherein said modified oligonucleotide is at least 85%, 90%>, 95%, or 100%) complementary to SEQ ID NO: 1.
Embodiment 125: A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 1 1 1, 112, or 113.
Embodiment 126: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
Embodiment 127: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
Embodiment 128: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
Embodiment 129: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 1 1 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 11 1, 1 12, or 113.
Embodiment 130: A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113.
Embodiment 131 : A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, or 113.
Embodiment 132: The compound of any of embodiments 124-131, wherein the complementary region of the modified oligonucleotide is 90% complementary to the target region.
Embodiment 133: The compound of any of embodiments 124-131, wherein the complementary region of the modified oligonucleotide is 100% complementary to the target region.
Embodiment 134: The compound of any of embodiments 124-133, wherein the modified
oligonucleotide comprises at least one modified nucleoside.
Embodiment 135: The compound of embodiment 134, wherein at least one modified nucleoside
comprises a modified sugar moiety.
Embodiment 136: The compound of embodiment 135, wherein at least one modified sugar moiety is a 2'-substituted sugar moiety.
Embodiment 137: The compound of embodiment 136, wherein the 2'-substitutent of at least one 2'- substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
Embodiment 138: The compound of any of embodiments 136-137, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
Embodiment 139: The compound of any of embodiments 124-135, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
Embodiment 140: The compound of embodiment 139, wherein at least one bicyclic sugar moiety is cEt.
Embodiment 141 : The compound of embodiment 139, wherein at least one bicyclic sugar moiety is LNA.
Embodiment 142: The compound of embodiment 135, wherein at least one sugar moiety is a sugar surrogate.
Embodiment 143: The compound of embodiment 142, wherein at least one sugar surrogate is a
morpholino. Embodiment 144: The compound of embodiment 142, wherein at least one sugar surrogate is a
modified morpholino.
Embodiment 145: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
Embodiment 146: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
Embodiment 147: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety. Embodiment 148: The compound of any of embodiment 124-144, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
Embodiment 149: The compound of any of embodiment 124-144, wherein the modified
oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
Embodiment 150: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
Embodiment 151 : The compound of any of embodiments 124-150, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
Embodiment 152: The compound of any of embodiments 124-150, wherein the modified
oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
Embodiment 153: The compound of any of embodiments 124-150, wherein the modified
oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
Embodiment 154: The compound of any of embodiments 124-150, wherein the modified
oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
Embodiment 155: The compound of any of embodiments 151-154, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'-MOE, cEt, LNA, morpholino, and modified morpholino.
Embodiment 156: The compound of any of embodiments 151-154, wherein the modified nucleosides of the modified region each comprise the same modification as one another.
Embodiment 157: The compound of any of embodiments 151-154, wherein the modified nucleosides of the modified region each comprise the same 2'-substituted sugar moiety.
Embodiment 158: The compound of embodiment 157, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE.
Embodiment 159: The compound of embodiment 157, wherein the 2'-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
Embodiment 160: The compound of embodiment 155, wherein the modified nucleosides of the region of modified nucleosides each comprise the same bicyclic sugar moiety.
Embodiment 161 : The compound of embodiment 160, wherein the bicyclic sugar moiety of the
modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
Embodiment 162: The compound of embodiment 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a morpholino.
Embodiment 163: The compound of embodiment 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a modified morpholino.
Embodiment 164: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
Embodiment 165: The compound of any of embodiments 124-144, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside.
Embodiment 166: The compound of embodiment 165 wherein each modified nucleoside comprises a modified sugar moiety.
Embodiment 167: The compound of embodiment 166, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
Embodiment 168: The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2'-substituted sugar moiety.
Embodiment 169: The compound of embodiment 168, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
Embodiment 170: The compound of embodiment 168, wherein the 2'-substituted sugar moiety of the modified oligonucleotide is 2'-MOE.
Embodiment 171 : The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety.
Embodiment 172: The compound of embodiment 171, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
Embodiment 173: The compound of embodiment 167, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
Embodiment 174: The compound of embodiment 173, wherein the sugar surrogate of the modified oligonucleotide is a morpholino. Embodiment 175: The compound of embodiment 173, wherein the sugar surrogate of the modified oligonucleotide is a modified morpholino.
Embodiment 176: The compound of any of embodiments 124-144 wherein each sugar moiety of the modified oligonucleotide is a modified sugar moiety or an unmodified sugar moiety.
Embodiment 177: The compound of embodiment 176, wherein each unmodified sugar moiety is a 2'- deoxyfuranose sugar moiety.
Embodiment 178: The compound of embodiment 176 or 177, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE.
Embodiment 179: The compound of embodiment 178, wherein the modified sugar moiety is cEt.
Embodiment 180: The compound of embodiment 178, wherein the modified sugar moiety is LNA.
Embodiment 181 : The compound of embodiment 178, wherein the modified sugar moiety is 2'F.
Embodiment 182: The compound of embodiment 178, wherein the modified sugar moiety is 2'-OMe. Embodiment 183: The compound of embodiment 178, wherein the modified sugar moiety is 2'-MOE.
Embodiment 184: The compound of any of embodiments 177-183, wherein the modified
oligonucleotide has a aaddaddaddaddaddaa motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents a 2'-deoxyfuranose moiety.
Embodiment 185: The compound of any of embodiments 177-183, wherein the modified
oligonucleotide has a addaddaddaddadda motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents a 2'-deoxyfuranose moiety. Embodiment 186: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide has a aeeaeeaeeaeeaeea motif, wherein each "a" represents a bicyclic modified sugar moiety and wherein each "e" represents a 2 '-substituted sugar moiety.
Embodiment 187: The compound of any of embodiments 124-144, wherein the modified
oligonucleotide has a aaeeaeeaeeaeeaeeea motif, wherein each "a" represents a bicyclic modified sugar moiety and wherein each "e" represents a 2 '-substituted sugar moiety.
Embodiment 188: The compound of any of embodiments 184-187, wherein each "a" independently represents either a cEt modified sugar moiety or an LNA modified sugar moiety.
Embodiment 189: The compound of embodiment 188, wherein each "a" represents a cEt modified sugar moiety.
Embodiment 190: The compound of any of embodiments 124-189, wherein the modified
oligonucleotide comprises at least one modified internucleoside linkage.
Embodiment 191 : The compound of embodiment 190, wherein each internucleoside linkage is a
modified internucleoside linkage.
Embodiment 192: The compound of embodiment 190 or 191, comprising at least one phosphorothioate internucleoside linkage.
Embodiment 193: The compound of embodiment 190, wherein each internucleoside linkage is a
modified internucleoside linkage and wherein each internucleoside linkage comprises the same modification.
Embodiment 194: The compound of embodiment 190, wherein each internucleoside linkage is a
phosphorothioate internucleoside linkage.
Embodiment 195: The compound of any of embodiments 124-190, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
Embodiment 196: The compound of any of embodiments 124-195 comprising at least one conjugate.
Embodiment 197: The compound of any of embodiments 124-195 consisting of the modified
oligonucleotide.
Embodiment 198: The compound of any of embodiments 124-197, wherein the compound modulates splicing of the PK-M transcript.
Embodiment 199: A pharmaceutical composition comprising a compound according to any of
embodiments 124-198 and a pharmaceutically acceptable carrier or diluent.
Embodiment 200: The pharmaceutical composition of embodiment 199, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
Embodiment 201 : A method of modulating splicing of a PK-M transcript in a cell comprising
contacting the cell with a compound according to any of embodiments 124-198.
Embodiment 202: The method of embodiment 201, wherein the cell is in vitro.
Embodiment 203: The method of embodiment 201, wherein the cell is in an animal.
Embodiment 204: The method of any of embodiments 201-203, wherein inclusion of exon 9 is
increased.
Embodiment 205: The method of any of embodiments 201-204, wherein exclusion of exon 10 is
increased.
Embodiment 206: The method of any of embodiments 201-204, wherein inclusion of exon 10 is
decreased. Embodiment 207: The method of any of embodiments 201-206, wherein PK-Ml mRNA expression is increased.
Embodiment 208: The method of any of embodiments 201-207, wherein PK-M2 mRNA expression is decreased.
Embodiment 209: A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of embodiments 124-198.
Embodiment 210: The method of embodiment 209, wherein PK-Ml expression is increased.
Embodiment 211 : The method of embodiments 209 or 210, wherein PK-M2 expression is decreased.
Embodiment 212: The method of embodiment 209, wherein the cell is in vitro. Embodiment 213: The method of embodiment 209, wherein the cell is in an animal.
Embodiment 214: A method of inducing apoptosis in a cell, comprising contacting the cell with a compound according to any of embodiments 124-198. Embodiment 215: The method of embodiment 214, wherein the cell is a glial cell.
Embodiment 216: The method of embodiment 214 or 215, wherein the cell is in vitro.
Embodiment 217: The method of embodiment 214 or 215, wherein the cell is in an animal.
Embodiment 218: A method comprising administering the compound according to any of embodiments 124-196 or the pharmaceutical composition of embodiments 199 or 200 to an animal.
Embodiment 219: The method of embodiment 218, wherein the administration is
intracerebroventricular.
Embodiment 220: The method of embodiment 218, wherein the administration is into the central nervous sysem. Embodiment 221 : The method of any of embodiments 218-220, wherein the animal has one or more symptoms associated with cancer.
Embodiment 222: The method embodiment 221, wherein the cancer is glioblastoma. Embodiment 223: The method of embodiment 221, wherein the administration results in amelioration of at least one symptom of cancer.
Embodiment 224: The method of any of embodiments 218-223, wherein the animal is a mouse. Embodiment 225: The method of any of embodiments 218-223, wherein the animal is a human.
Embodiment 226: A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of embodiments 124-198 or the pharmaceutical composition of embodiments 199 or 200 to an animal in need thereof.
Embodiment 227: The method of embodiment 226, wherein the animal is a mouse.
Embodiment 228: The method of embodiment 226, wherein the animal is a human.
Embodiment 229: The method of embodiment 226 to 228, wherein the cancerous tumor comprises glioblastoma.
Embodiment 230: The method of any of embodiments 201 to 229, further comprising contacting a cell with a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of embodiments 124-198.
Embodiment 231 : The method of embodiment 230, wherein the second modified oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
Embodiment 232: Use of the compound according to any of embodiments 124-198 or the
pharmaceutical composition of embodiments 199 or 200 for the preparation of a medicament for use in the treatment of cancer.
Embodiment 233: Use of the compound according to any of embodiments 124-198 or the
pharmaceutical composition of embodiments 199 or 200 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
Embodiment 234: The use of embodiment 232 or 233, wherein the cancer is glioblastoma.
Embodiment 235: Use of the compound according to any of embodiments 124-198 or the
pharmaceutical composition of embodiments 199 or 200 for the treatment of cancer.
Embodiment 236: Use of the compound according to any of embodiments 124-198 or the
pharmaceutical composition of embodiments 199 or 200 for the treatment of glioblastoma. DETAILED DESCRIPTION
Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society , Washington D.C., 1994; "Remington's Pharmaceutical
Sciences," Mack Publishing Co., Easton, Pa., 2 edition, 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications" Edited by Stanley T. Crooke, C C Press, Boca Raton, Florida; and Sambrook et al., "Molecular Cloning, A laboratory Manual," 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, which are hereby incorporated by reference for any purpose. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout in the disclosure are incorporated by reference herein in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
As used herein, "nucleoside" means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
As used herein, "chemical modification" means a chemical difference in a compound when compared to a naturally occurring counterpart. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications.
As used herein, "furanosyl" means a structure comprising a 5-membered ring comprising four carbon atoms and one oxygen atom.
As used herein, "naturally occurring sugar moiety" means a ribofuranosyl as found in naturally occurring RNA or a deoxyribofuranosyl as found in naturally occurring DNA.
As used herein, "sugar moiety" means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
As used herein, "modified sugar moiety" means a substituted sugar moiety, a bicyclic or tricyclic sugar moiety, or a sugar surrogate.
As used herein, "substituted sugar moiety" means a furanosyl comprising at least one substituent group that differs from that of a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'-position, the 3 '-position, the 5'-position and/or the 4'-position.
As used herein, "2 '-substituted sugar moiety" means a furanosyl comprising a substituent at the 2'- position other than H or OH. Unless otherwise indicated, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of a 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring.
As used herein, "MOE" means -OCH2CH2OCH3.
As used herein, "bicyclic sugar moiety" means a modified sugar moiety comprising a 4 to 7 membered ring (including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7
membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2'-carbon and the 4'-carbon of the furanosyl.
As used herein the term "sugar surrogate" means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside is capable of (1) incorporation into an oligonucleotide and (2) hybridization to a complementary nucleoside. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholino, modified morpholinos, cyclohexenyls and cyclohexitols.
As used herein, "nucleotide" means a nucleoside further comprising a phosphate linking group. As used herein, "linked nucleosides" may or may not be linked by phosphate linkages and thus includes, but is not limited to "linked nucleotides." As used herein, "linked nucleosides" are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
As used herein, "heterocyclic base" or "heterocyclic nucleobase" means a nucleobase comprising a heterocyclic structure.
As used herein the terms, "unmodified nucleobase" or "naturally occurring nucleobase" means the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C), and uracil (U).
As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase.
As used herein, "modified nucleoside" means a nucleoside comprising at least one chemical modification compared to naturally occurring RNA or DNA nucleosides. Modified nucleosides comprise a modified sugar moiety and/or a modified nucleobase.
As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside comprising a bicyclic sugar moiety.
As used herein, "constrained ethyl nucleoside" or "cEt" means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2'bridge.
As used herein, "locked nucleic acid nucleoside" or "LNA" means a nucleoside comprising a bicyclic
sugar moiety comprising a 4'-CH2-0-2'bridge.
As used herein, "2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2'- position other than H or OH. Unless otherwise indicated, a 2'-substituted nucleoside is not a bicyclic nucleoside.
As used herein, "2'-deoxynucleoside" means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).
As used herein, "oligonucleotide" means a compound comprising a plurality of linked nucleosides. In certain embodiments, an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
As used herein "oligonucleoside" means an oligonucleotide in which none of the internucleoside linkages contains a phosphorus atom. As used herein, oligonucleotides include oligonucleosides.
As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one modified nucleoside and/or at least one modified internucleoside linkage.
As used herein "internucleoside linkage" means a covalent linkage between adjacent nucleosides in an oligonucleotide.
As used herein "naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage. As used herein, "modified internucleoside linkage" means any internucleoside linkage other than a naturally occurring internucleoside linkage.
As used herein, "oligomeric compound" means a polymeric structure comprising two or more substructures. In certain embodiments, an oligomeric compound comprises an oligonucleotide. In certain embodiments, an oligomeric compound comprises one or more conjugate groups and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide.
As used herein, "terminal group" means one or more atom attached to either, or both, the 3 ' end or the 5' end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
As used herein, "conjugate" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and/or clearance properties.
As used herein, "conjugate linking group" means any atom or group of atoms used to attach a conjugate to an oligonucleotide or oligomeric compound.
As used herein, "antisense compound" means a compound comprising or consisting of an oligonucleotide at least a portion of which is complementary to a target nucleic acid to which it is capable of hybridizing, resulting in at least one antisense activity.
As used herein, "antisense activity" means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
As used herein, "detecting" or "measuring" means that a test or assay for detecting or measuring is performed. Such detection and/or measuring may result in a value of zero. Thus, if a test for detection or measuring results in a finding of no activity (activity of zero), the step of detecting or measuring the activity has nevertheless been performed.
As used herein, "detectable and/or measureable activity" means a statistically significant activity that is not zero.
As used herein, "essentially unchanged" means little or no change in a particular parameter, particularly relative to another parameter which changes much more. In certain embodiments, a parameter is essentially unchanged when it changes less than 5%. In certain embodiments, a parameter is essentially unchanged if it changes less than two-fold while another parameter changes at least ten-fold. For example, in certain embodiments, an antisense activity is a change in the amount of a target nucleic acid. In certain such embodiments, the amount of a non-target nucleic acid is essentially unchanged if it changes much less than the target nucleic acid does, but the change need not be zero.
As used herein, "expression" means the process by which a gene ultimately results in a protein. Expression includes, but is not limited to, transcription, post-transcriptional modification (e.g., splicing, polyadenlyation, addition of 5 '-cap), and translation.
As used herein, "target nucleic acid" means a nucleic acid molecule to which an antisense compound hybridizes.
As used herein, "mRNA" means an RNA molecule that encodes a protein.
As used herein, "pre-mRNA" means an RNA transcript that has not been fully processed into mRNA. Pre-RNA includes one or more intron.
As used herein, "transcript" means an RNA molecule transcribed from DNA. Transcripts include, but are not limitied to mRNA, pre-mRNA, and partially processed RNA.
As used herein, "PK-M transcript" means a transcript transcribed from a PK-M gene. In certain embodiments, a PK-M transcript comprises SEQ ID NO: 1 : the complement of GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to 43314403.
As used herein, "PK-M gene" means a gene that encodes a pyruvate kinase M protein and any pyruvate kinase M protein isoforms. In certain embodiments, pyruvate kinase M protein isoforms include pyruvate kinase Ml and pyruvate kinase M2. In certain embodiments, a pyruvate kinase M gene is represented by GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to
43314403, or a variant thereof. In certain embodiments, a pyruvate kinase M gene is at least 95% identical to GENBANK Accession No. NT 010194.16 truncated from nucleotides 43281289 to 43314403. In certain
embodiments, a pyruvate kinase M gene is at least 90% identical to GENBAN Accession No.
NT 010194.16 truncated from nucleotides 43281289 to 43314403.
As used herein, "PK-M1" means a pyruvate kinase M transcript that includes exon 9 but does not include exon 10.
As used herein, "PK-M1 isoform" means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 9 but does not include amino acids encoded from exon 10.
As used herein, "PK-M2" means a pyruvate kinase M transcript that includes exon 10 but does not include exon 9.
As used herein, "PK-M2 isoform" means a pyruvate kinase M protein isoform that includes amino acids encoded from exon 10 but does not include amino acids encoded from exon 9.
As used herein, "targeting" or "targeted to" means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule. An antisense compound targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
As used herein, "nucleobase complementarity" or "complementarity" when in reference to nucleobases means a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase means a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the
oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
Nucleobases comprising certain modifications may maintain the ability to pair with a counterpart nucleobase and thus, are still capable of nucleobase complementarity.
As used herein, "non-complementary" in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
As used herein, "complementary" in reference to oligomeric compounds (e.g., linked nucleosides, oligonucleotides, or nucleic acids) means the capacity of such oligomeric compounds or regions thereof to hybridize to another oligomeric compound or region thereof through nucleobase complementarity under stringent conditions. Complementary oligomeric compounds need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. In certain embodiments, complementary oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, complementary oligomeric compounds or regions are 80% complementary. In certain embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. In certain
embodiments, complementary oligomeric compounds or regions are 100% complementary.
As used herein, "hybridization" means the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
As used herein, "specifically hybridizes" means the ability of an oligomeric compound to hybridize to one nucleic acid site with greater affinity than it hybridizes to another nucleic acid site. In certain embodiments, an antisense oligonucleotide specifically hybridizes to more than one target site.
As used herein, "percent complementarity" means the percentage of nucleobases of an oligomeric compound that are complementary to an equal-length portion of a target nucleic acid. Percent
complementarity is calculated by dividing the number of nucleobases of the oligomeric compound that are complementary to nucleobases at corresponding positions in the target nucleic acid by the total length of the oligomeric compound.
As used herein, "percent identity" means the number of nucleobases in a first nucleic acid that are the same type (independent of chemical modification) as nucleobases at corresponding positions in a second nucleic acid, divided by the total number of nucleobases in the first nucleic acid.
As used herein, "modulation" means a change of amount or quality of a molecule, function, or activity when compared to the amount or quality of a molecule, function, or activity prior to modulation. For example, modulation includes the change, either an increase (stimulation or induction) or a decrease (inhibition or reduction) in gene expression. As a further example, modulation of expression can include a change in splice site selection of pre-mRNA processing, resulting in a change in the absolute or relative amount of a particular splice-variant compared to the amount in the absence of modulation.
As used herein, "motif means a pattern of chemical modifications in an oligomeric compound or a region thereof. Motifs may be defined by modifications at certain nucleosides and/or at certain linking groups of an oligomeric compound.
As used herein, "nucleoside motif means a pattern of nucleoside modifications in an oligomeric compound or a region thereof. The linkages of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
As used herein, "sugar motif means a pattern of sugar modifications in an oligomeric compound or a region thereof.
As used herein, "linkage motif means a pattern of linkage modifications in an oligomeric compound or region thereof. The nucleosides of such an oligomeric compound may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
As used herein, "nucleobase modification motif means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
As used herein, "sequence motif means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
As used herein, "type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.
As used herein, "differently modified" mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are "differently modified," even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are "differently modified," even though both are naturally- occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2'-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2'-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.
As used herein, "the same type of modifications" refers to modifications that are the same as one another, including absence of modifications. Thus, for example, two unmodified DNA nucleoside have "the same type of modification," even though the DNA nucleoside is unmodified. Such nucleosides having the same type modification may comprise different nucleobases.
As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administering to an animal. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile saline. In certain embodiments, such sterile saline is pharmaceutical grade saline.
As used herein, "substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'- substuent is any atom or group at the 2'-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present invention have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
Likewise, as used herein, "substituent" in reference to a chemical functional group means an atom or group of atoms differs from the atom or a group of atoms normally present in the named functional group. In
certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (- C(O)Raa), carboxyl (-C(0)0-Raa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (-O-Raa), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (-N(R b)(Rco)), imino(=NRbb), amido (-C(0)N(Rbb)(Roo) or -N(Rbb)C(0)Raa), azido (-N3), nitro (-N02), cyano (-CN), carbamido
(-OC(0)N(Rbb)(Rcc) or -N(Rbb)C(0)ORaa), ureido (-N(Rbb)C(0)N(Rbb)(Rcc)), thioureido (-N(Rbb)C(S)N(Rbb)- (Rcc)), guanidinyl (-N(Rbb)C(=NRbb)N(Rbb)(Rcc)), amidinyl
thiol (-SRbb), sulfmyl (-S(0)Rbb), sulfonyl (-S(0)2Rbb) and sulfonamidyl (-S(0)2N(Rbb)(Rcc) or -N(Rbb)S-
(0)2Rbb). Wherein each Raa, Rbb and Rccis, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
As used herein, "alkyl," as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (CrC1 alkyl) with from 1 to about 6 carbon atoms being more preferred.
As used herein, "alkenyl," means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, l-methyl-2-buten-l-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
As used herein, "alkynyl," means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
As used herein, "acyl," means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula -C(0)-X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic
phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
As used herein, "alicyclic" means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
As used herein, "aliphatic" means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
As used herein, "alkoxy" means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n- pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
As used herein, "aminoalkyl" means an amino substituted C1-C12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and/or amino portions.
As used herein, "aralkyl" and "arylalkyl" mean an aromatic group that is covalently linked to a C 1-C12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
As used herein, "aryl" and "aromatic" mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
As used herein, "halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.
As used herein, "heteroaryl," and "heteroaromatic," mean a radical comprising a mono- or poly- cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
Oligomeric Compounds
In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, such oligomeric compounds comprise oligonucleotides optionally comprising one or more conjugate and/or terminal groups. In certain embodiments, an oligomeric compound consists of an oligonucleotide. In certain embodiments, oligonucleotides comprise one or more chemical modifications. Such chemical modifications include modifications one or more nucleoside (including modifications to the sugar moiety and/or the nucleobase) and/or modifications to one or more internucleoside linkage. Certain Sugar Moieties
In certain embodiments, oligomeric compounds of the invention comprise one or more modifed nucleosides comprising a modifed sugar moiety. Such oligomeric compounds comprising one or more sugar- modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to oligomeric compounds comprising only nucleosides comprising naturally occurring sugar moieties. In certain embodiments, modified sugar moieties are substitued sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surogates may comprise one or more substitutions corresponding to those of substituted sugar moieties.
In certain embodiments, modified sugar moieties are substituted sugar moieties comprising one or more substituent, including but not limited to substituents at the 2' and/or 5' positions. Examples of sugar substituents suitable for the 2'-position, include, but are not limited to: 2'-F, 2'-OCH3 ("OMe" or "O- methyl"), and 2'-0(CH2)20CH3 ("MOE"). In certain embodiments, sugar substituents at the 2' position is selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl; O- Ci-Cio alkoxy; O- Ci-Cio substituted alkoxy, OCF3, 0(CH2)2SCH3, 0(CH2)2-0-N(Rm)( n), and 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted Ci-Cio alkyl. Examples of sugar
substituents at the 5'-position, include, but are not limited to:, 5'-methyl (R or S); 5'-vinyl, and 5'-methoxy. In certain embodiments, substituted sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 5', 2'-bis substituted sugar moieties and nucleosides).
Nucleosides comprising 2'-substituted sugar moieties are referred to as 2'-substituted nucleosides. In certain embodiments, a 2'- substituted nucleoside comprises a 2'-substituent group selected from halo, allyl, amino, azido, O- CrC10 alkoxy; O- CrC10 substituted alkoxy, SH, CN, OCN, CF3, OCF3, O-alkyl, S-alkyl, N(Rm)-alkyl; O- alkenyl, S- alkenyl, or N(Rm)-alkenyl; O- alkynyl, S- alkynyl, N(Rm)-alkynyl; O-alkylenyl- O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn) or 0-CH2- C(=0)-N(Rm)(Rn), where each Rm and Rn is, inde endently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl. These 2'-substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N02), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl.
In certain embodiments, a 2'- substituted nucleoside comprises a 2 '-substituent group selected from F, NH2, N3, OCF3, 0-CH3, 0(CH2)3NH2, CH2-CH=CH2, 0-CH2-CH=CH2, OCH2CH2OCH3, 0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), 0(CH2)20(CH2)2N(CH3)2, and N-substituted acetamide (0-CH2-C(=0)-N(Rm)(Rn) where each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted CrCio alkyl.
In certain embodiments, a 2'- substituted nucleoside comprises a sugar moiety comprising a 2'- substituent group selected from F, OCF3j 0-CH3, OCH2CH2OCH3, 0(CH2)2SCH3, 0-(CH2)2-0- N(CH3)2, -0(CH2)20(CH2)2N(CH3)2, and 0-CH2-C(=0)-N(H)CH3.
In certain embodiments, a 2'- substituted nucleoside comprises a sugar moiety comprising a 2'- substituent group selected from F, 0-CH3, and OCH2CH2OCH3.
Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4' to 2' sugar substituents, include, but are not limited to: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-0-, -C(RaRb)-N(R)-0- or, -C(RaRb)-0-N(R)-; 4'-CH2-2', 4'-(CH2)2-2\ 4'-(CH2)3-2',. 4'-(CH2)-0-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-0-2' (ENA); 4'-CH(CH3)-0-2' (cEt) and 4'-CH(CH2OCH3)-0-2',and analogs thereof (see, e.g., U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH3)(CH3)-0-2'and analogs thereof, (see, e.g., WO2009/006478, published January 8, 2009); 4'- CH2-N(OCH3)-2' and analogs thereof (see, e.g., WO2008/150729, published December 11, 2008); 4'-CH2-0- N(CH3)-2' (see, e.g., US2004/0171570, published September 2, 2004 ); 4'-CH2-0-N(R)-2', and 4'-CH2-N(R)- 0-2'-, wherein each R is, independently, H, a protecting group, or Ci-C12 alkyl; 4'-CH2-N(R)-0-2', wherein R is H, C1-C12 alkyl, or a protecting group (see, U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH2- C(H)(CH3)-2' (see, e.g., Chattopadhyaya, et al, J. Org. Chem.,2009, 74, 118-134); and 4'-CH2-C(=CH2)-2'
and analogs thereof (see, published PCT International Application WO 2008/154401, published on December 8, 2008).
In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=0)-, -C(=S)-, -0-, - Si(Ra)r, -S(=0)x-, and -N(Ra)-;
wherein:
x is 0, 1, or 2;
n is 1, 2, 3, or 4;
each Ra and Rb is, independently, H, a protecting group, hydroxyl, C 1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJJ2, SJi, N3, COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl
and
each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
Nucleosides comprising bicyclic sugar moieties are referred to as bicyclic nucleosides or BNAs. Bicyclic nucleosides include, but are not limited to, (A) a-L-Methyleneoxy (4'-CH2-0-2') BNA , (B) β-D- Methyleneoxy (4'-CH2-0-2') BNA (also referred to as locked nucleic acid or LNA) , (C) Ethyleneoxy (4'-
(CH2)2-0-2') BNA , (D) Aminooxy (4'-CH2-0-N(R)-2') BNA, (E) Oxyamino (4'-CH2-N(R)-0-2') BNA, (F) Methyl(methyleneoxy) (4'-CH(CH3)-0-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH2-S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, and (J) propylene carbocyclic (4'-(CH2)3-2') BNA as depicted below.
(A) (B) (C)
Additional bicyclic sugar moieties are known in the art, for example: Singh et al., Chem. Commun., 1998, 4, 455-456; oshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. , 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc, 129(26) 8362-8379 (Jul. 4, 2007); Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Oram et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 7,053,207, 6,268,490, 6,770,748, 6,794,499, 7,034,133, 6,525,191, 6,670,461, and 7,399,845; WO 2004/106356, WO 1994/14226, WO
2005/021570, and WO 2007/134181 ; U.S. Patent Publication Nos. US2004/0171570, US2007/0287831, and US2008/0039618; U.S. Patent Serial Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844; and PCT International Applications Nos. PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922.
In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the a-L configuration or in the β-D configuration. Previously, a-L- methyleneoxy (4'-CH2-0-2') bicyclic nucleosides have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365-6372).
In certain embodiments, substituted sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 '-substituted and 4 '-2' bridged sugars), {see, PCT International Application WO 2007/134181, published on 11/22/07, wherein LNA is substituted with, for example, a 5'-methyl or a 5'-vinyl group).
In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the naturally occuring sugar is substituted, e.g., with a sulfer, carbon or nitrogen atom. In certain such embodiments, such modified sugar moiety also comprises bridging and/or non-bridging substituents as described above. For example, certain sugar surogates comprise a 4'-sulfer atom and a substitution at the 2'-position (see, e.g., published U.S. Patent Application US2005/0130923, published on
June 16, 2005) and/or the 5' position. By way of additional example, carbocyclic bicyclic nucleosides having a 4'-2' bridge have been described (see, e.g., Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740).
In certain embodiments, sugar surrogates comprise rings having other than 5-atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran. Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (UNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, CJ. Bioorg. & Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), and those compounds having Formula
VII
wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:
Bx is a nucleobase moiety;
T3 and T4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T3 and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group;
qi, q2, q3, q4, qs, q6 and q7 are each, independently, H, Ci-Ce alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and
each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJJ2, SJb N3,
and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or Ci-Ce alkyl.
In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein qi, q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, q6 ¾nd q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, q6 and q7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is fluoro and R2 is H, Ri is methoxy and R2 is H, and Ri is methoxyethoxy and R2 is H.
Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used to modify nucleosides (see, e.g., review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841-854).
In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term "morpholino" means a sugar llowing structure:
In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as "modifed morpholinos."
Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH2-0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379). Certain Nucleobases
In certain embodiments, nucleosides of the present invention comprise one or more unmodified nucleobases. In certain embodiments, nucleosides of the present invention comprise one or more modifed nucleobases.
In certain embodiments, modified nucleobases are selected from: universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. 5-substituted pyrimidines, 6-azapyrimidines and -2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil; 5-propynylcytosine; 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6- methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C- CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted
uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine( [5,4-b][l,4]benzoxazin- 2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- dJpyrimidin-2-one). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.I., Ed., John Wiley & Sons, 1990, 858-859; those disclosed by Englisch et al, Angewandte Chemie, International Edition, 1991, 30, 613; and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288.
Representative United States patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, U.S. 3,687,808; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177;
5,525,711; 5,552,540; 5,587,469; 5,594,121 ; 5,596,091; 5,614,617; 5,645,985; 5,681,941 ; 5,750,692;
5,763,588; 5,830,653 and 6,005,096, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.
Certain Internucleoside Linkages
In certain embodiments, the present invention provides oligomeric compounds comprising linked nucleosides. In such embodiments, nucleosides may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters (P=0), phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (P=S). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester (-O-C(O)-S-), thionocarbamate (-0- C(0)(NH)-S-); siloxane (-0-Si(H)2-0-); and ,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligomeric compound. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods of preparation of
phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art.
The oligonucleotides described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), a or β such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.
Neutral internucleoside linkages include without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), and thioformacetal (3'-S-CH2-0-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
Certain Motifs
In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleosides comprising one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).
Certain sugar motifs
In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.
In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or "wings" and an internal region or "gap." The three regions of a gapmer motif (the 5 '-wing, the gap, and the 3 '-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3 '-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5'-wing differs from the sugar modification motif of the 3'-wing (asymmetric gapmer). In certain embodiments, oligonucleotides comprise 2'-MOE modified nucleosides in the wings and 2'-F modified nucleosides in the gap.
In certain embodiments, oligonucleotides are fully modified. In certain such embodiments, oligonucleotides are uniformly modified. In certain embodiments, oligonucleotides are uniform 2'-MOE. In certain embodiments, oligonucleotides are uniform 2'-F. In certain embodiments, oligonucleotides are uniform morpholino. In certain embodiments, oligonucleotides are uniform BNA. In certain embodiments, oligonucleotides are uniform LNA. In certain embodiments, oligonucleotides are uniform cEt.
In certain embodiments, oligonucleotides comprise a uniformly modified region and additional nucleosides that are unmodified or differently modified. In certain embodiments, the uniformly modified region is at least 5, 10, 15, or 20 nucleosides in length. In certain embodiments, the uniform region is a 2'- MOE region. In certain embodiments, the uniform region is a 2'-F region. In certain embodiments, the uniform region is a morpholino region. In certain embodiments, the uniform region is a BNA region. In certain embodiments, the uniform region is a LNA region. In certain embodiments, the uniform region is a cEt region.
In certain embodiments, the oligonucleotide does not comprise more than 4 contiguous unmodified 2'-deoxynucleosides. In certain circumstances, antisesense oligonucleotides comprising more than 4 contiguous 2'-deoxynucleosides activate RNase H, resulting in cleavage of the target RNA. In certain embodiments, such cleavage is avoided by not having more than 4 contiguous 2'-deoxynucleosides, for example, where alteration of splicing and not cleavage of a target RNA is desired.
Certain Internucleoside Linkage Motifs
In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In
certain embodiments, internucleoside linkages are arranged in a gapped motif, as described above for sugar modification motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The sugar modification motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped sugar modification motif and if it does have a gapped sugar motif, the wing and gap lengths may or may not be the same.
In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides of the present invention comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain
embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3 ' end of the oligonucleotide.
Certain Nucleobase Modification Motifs
In certain embodiments, oligonucleotides comprise chemical modifications to nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or nucleobases modification motif. In certain such embodiments, nucleobase modifications are arranged in a gapped motif. In certain embodiments, nucleobase modifications are arranged in an alternating motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is chemically modified.
In certain embodiments, oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 '-end of the oligonucleotide. In certain embodiments the block is within 3
nucleotides of the 3'-end of the oligonucleotide. In certain such embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments the block is within 3 nucleotides of the 5'-end of the oligonucleotide.
In certain embodiments, nucleobase modifications are a function of the natural base at a particular position of an oligonucleotide. For example, in certain embodiments each purine or each pyrimidine in an oligonucleotide is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, each uracil is modified.
In certain embodiments, some, all, or none of the cytosine moieties in an oligonucleotide are 5- methyl cytosine moieties. Herein, 5-methyl cytosine is not a "modified nucleobase." Accordingly, unless otherwise indicated, unmodified nucleobases include both cytosine residues having a 5-methyl and those lacking a 5 methyl. In certain embodiments, the methylation state of all or some cytosine nucleobases is specified. Certain Overall Lengths
In certain embodiments, the present invention provides oligomeric compounds including oligonucleotides of any of a variety of ranges of lengths. In certain embodiments, the invention provides oligomeric compounds or oligonucleotides consisting of X to Y linked nucleosides, where X represents the fewest number of nucleosides in the range and Y represents the largest number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; provided that X<Y. For example, in certain embodiments, the invention provides oligomeric compounds which comprise oligonucleotides consisting of 8 to 9, 8 to 10, 8 to 11, 8 to 12, 8 to 13, 8 to 14, 8 to 15, 8 to 16, 8 to 17, 8 to 18, 8 to 19, 8 to 20, 8 to 21, 8 to 22, 8 to 23, 8 to 24, 8 to 25, 8 to 26, 8 to 27, 8 to 28, 8 to 29, 8 to 30, 9 to 10, 9 to 11, 9 to 12, 9 to 13, 9 to 14, 9 to 15, 9 to 16, 9 to 17, 9 to 18, 9 to 19, 9 to 20, 9 to 21, 9 to 22, 9 to 23, 9 to 24, 9 to 25, 9 to 26, 9 to 27, 9 to 28, 9 to 29, 9 to 30, 10 to 11, 10 to 12, 10 to 13, 10 to 14, 10 to 15, 10 to 16, 10 to 17, 10 to 18, 10 to 19, 10 to 20, 10 to 21, 10 to 22, 10 to 23, 10 to 24, 10 to 25, 10 to 26, 10 to 27, 10 to 28, 10 to 29, 10 to 30, 11 to 12, 11 to 13, 11 to 14, 11 to 15, 11 to 16, 11 to 17, 11 to 18, 11 to 19, 11 to 20, 11 to 21, 11 to 22, 11 to 23, 11 to 24, 11 to 25, 11 to 26, 11 to 27, 11 to 28, 11 to 29, 11 to 30, 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15,
13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22,
14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30,
16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26,
17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21 , 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to
26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to
27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. In embodiments where the number of nucleosides of an oligomeric compound or oligonucleotide is limited, whether to a range or to a specific number, the oligomeric compound or oligonucleotide may, nonetheless further comprise additional other substituents. For example, an oligonucleotide comprising 8-30 nucleosides excludes oligonucleotides having 31 nucleosides, but, unless otherwise indicated, such an oligonucleotide may further comprise, for example one or more conjugates, terminal groups, or other substituents. In certain embodiments, a gapmer oligonucleotide has any of the above lengths.
One of skill in the art will appreciate that certain lengths may not be possible for certain motifs. For example: a gapmer having a 5'-wing region consisting of four nucleotides, a gap consisting of at least six nucleotides, and a 3 '-wing region consisting of three nucleotides cannot have an overall length less than 13 nucleotides. Thus, one would understand that the lower length limit is 13 and that the limit of 10 in "10-20" has no effect in that embodiment.
Further, where an oligonucleotide is described by an overall length range and by regions having specified lengths, and where the sum of specified lengths of the regions is less than the upper limit of the overall length range, the oligonucleotide may have additional nucleosides, beyond those of the specified regions, provided that the total number of nucleosides does not exceed the upper limit of the overall length range. For example, an oligonucleotide consisting of 20-25 linked nucleosides comprising a 5 '-wing consisting of 5 linked nucleosides; a 3 '-wing consisting of 5 linked nucleosides and a central gap consisting of 10 linked nucleosides (5+5+10=20) may have up to 5 nucleosides that are not part of the 5'-wing, the 3'- wing, or the gap (before reaching the overall length limitation of 25). Such additional nucleosides may be 5' of the 5 '-wing and/or 3 ' of the 3 ' wing.
Certain Oligonucleotides
In certain embodiments, oligonucleotides of the present invention are characterized by their sugar motif, internucleoside linkage motif, nucleobase modification motif and overall length. In certain embodiments, such parameters are each independent of one another. Thus, each internucleoside linkage of an
oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. Thus, the internucleoside linkages within the wing regions of a sugar-gapmer may be the same or different from one another and may be the same or different from the internucleoside linkages of the gap region. Likewise, such sugar-gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Herein if a description of an oligonucleotide or oligomeric compound is silent with respect to one or more parameter, such parameter is not limited. Thus, an oligomeric compound described only as having a gapmer sugar motif without further description may have any length, internucleoside linkage motif, and nucleobase modification motif. Unless otherwise indicated, all chemical modifications are independent of nucleobase sequence.
Certain Conjugate Groups
In certain embodiments, oligomeric compounds are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligomeric compound, such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let, 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 11 1 1 -1 118; Kabanov et al., FEBS Lett, 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l ,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651 -3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 36 1 -3654), a palmityl moiety (Mishra et al., Biochim.
Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
In certain embodiments, a conjugate group comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
In certain embodiments, conjugate groups are directly attached to oligonucleotides in oligomeric compounds. In certain embodiments, conjugate groups are attached to oligonucleotides by a conjugate linking group. In certain such embodiments, conjugate linking groups, including, but not limited to, bifunctional linking moieties such as those known in the art are amenable to the compounds provided herein. Conjugate linking groups are useful for attachment of conjugate groups, such as chemical stabilizing groups, functional groups, reporter groups and other groups to selective sites in a parent compound such as for example an oligomeric compound. In general a bifunctional linking moiety comprises a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as chemical functional group or a conjugate group. In some embodiments, the conjugate linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups that are routinely used in a bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g., double or triple bonds), and the like.
Some nonlimiting examples of conjugate linking moieties include pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-l -carboxylate (SMCC) and 6- aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted Ci- Cio alkyl, substituted or unsubstituted C2-Ci0 alkenyl or substituted or unsubstituted C2-Ci0 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
Conjugate groups may be attached to either or both ends of an oligonucleotide (terminal conjugate groups) and/or at any internal position.
In certain embodiments, conjugate groups are at the 3 '-end of an oligonucleotide of an oligomeric compound. In certain embodiments, conjugate groups are near the 3'-end. In certain embodiments, conjugates are attached at the 3 'end of an oligomeric compound, but before one or more terminal group nucleosides. In certain embodiments, conjugate groups are placed within a terminal group.
In certain embodiments, the present invention provides oligomeric compounds. In certain embodiments, oligomeric compounds comprise an oligonucleotide. In certain embodiments, an oligomeric compound comprises an oligonucleotide and one or more conjugate and/or terminal groups. Such conjugate and/or
terminal groups may be added to oligonucleotides having any of the chemical motifs discussed above. Thus, for example, an oligomeric compound comprising an oligonucleotide having region of alternating nucleosides may comprise a terminal group. Antisense Compounds
In certain embodiments, oligomeric compounds of the present invention are antisense compounds. Such antisense compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acid. In certain embodiments, a specifically hybridizing antisense compound has a nucleobase sequence comprising a region having sufficient complementarity to a target nucleic acid to allow
hybridization and result in antisense activity and insufficient complementarity to any non-target so as to avoid non-specific hybridization to any non-target nucleic acid sequences under conditions in which specific hybridization is desired (e.g., under physiological conditions for in vivo or therapeutic uses, and under conditions in which assays are performed in the case of in vitro assays).
In certain embodiments, the present invention provides antisense compounds comprising oligonucleotides that are fully complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are 95% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 90% complementary to the target nucleic acid.
In certain embodiments, such oligonucleotides are 85% complementary to the target nucleic acid. In certain embodiments, such oligonucleotides are 80% complementary to the target nucleic acid. In certain embodiments, an antisense compound comprises a region that is fully complementary to a target nucleic acid and is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain such embodiments, the region of full complementarity is from 6 to 14 nucleobases in length.
In certain embodiments antisense compounds and antisense oligonucleotides comprise single-strand compounds. In certain embodiments antisense compounds and antisense oligonucleotides comprise double- strand compounds.
Certain Pathways and Mechanisms Associated With Cancer
Many cancer cells preferentially use the glycolytic pathway with lactate generation to produce energy, even under normal oxygen conditions. This metabolic feature of cancer is termed the Warburg effect. In certain embodiments, PK-M2 mediates the Warburg effect. In certain embodiments, expression of PK-M2 is crucial for tumor cell growth and proliferation.
In certain embodiments, reducing expression of PK-M2 inhibits cancer growth. In certain embodiments, reducing expression of PK-M2 induces apoptosis in a cell. In certain embodiments, the cell is
a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell.
In certain embodiments, increasing inclusion of exon 9 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript inhibits cancer growth. In certain embodiments, increasing inclusion of exon 9 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, increasing exclusion of exon 10 of a PK-M transcript induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain cancer cells. In certain embodiments, the downregulation of PK-M2 leads to apoptosis in certain glioblastoma cell lines.
In certain embodiments, PK-M2 also functions as a co-activator of HIF-1 and/ or β-catenin. In certain embodiments, reducing expression of PK-M2, as opposed to inhibiting its kinase function, interferes with anti-apoptotic and pro-proliferative functions associated with cancer or tumor cells. In certain embodiments, one or more antisense compounds may be used to target a PK-M2.
In certain embodiments, the administration of a modified oligonucleotide causes a switch in the alternative splicing of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes increased inclusion of exon 9 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide causes an increase in the exclusion of exon 10 mRNA of the PK-M transcript. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell. In certain embodiments, the administration of a modified oligonucleotide reduces expression of PK-M2 in a cell and inhibits cancer growth. In certain embodiments, the
administration of a modified oligonucleotide reduces expression of PK-M2 and induces apoptosis in a cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a tumor cell. In certain imbodiments, the cell is a glioblastoma cell.
Certain Target Nucleic Acids and Mechanisms
In certain embodiments, compounds comprise or consist of a modified oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target nucleic acid is a PK-M transcript. In certain embodiments, the target RNA is a PK- M pre-mRNA.
In certain embodiments, a modified oligonucleotide is complementary to a region of PK-M pre- mRNA. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre- mRNA comprising an exon encoding PK-M2. In certain embodiments, a modified oligonucleotide is complementary to a region of PK-M pre-mRNA comprising an intron-exon splice junction. In certain
embodiments, a modified oligonucleotide is complementary to a region of P -M pre-mRNA comprising the intron-exon splice junction adjacent to exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre- mRNA consisting of exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre- mRNA consisting of intron 9. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within intron 9. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 10. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing silencer within exon 9. In certain embodiments, a modified oligonucleotide is complementary within a region of PK-M pre-mRNA comprising an exonic splicing enhancer within exon 9.
In certain embodiments, a modified oligonucleotide comprises a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length of a PK-M transcript. In certain embodiments, the target region is within nucleobase 28726 and nucleobase 29137 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 28726 and nucleobase 28787 of SEQ ID NO. : 1. In certain embodiments, the target region is within nucleobase 28714 and nucleobase 29257 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29128 and nucleobase 29162 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29159 and nucleobase 29193 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 29164 and nucleobase 29183 of SEQ ID NO.: 1. In certain embodiments, the target region is within nucleobase 28826 and nucleobase 29183 of SEQ ID NO.: 1.
In certain embodiments, a modified oligonucleotide modulates splicing of a pre-mRNA. In certain embodiments, a modified oligonucleotide modulates splicing a PK-M pre-mRNA. In certain embodiments, a modified oligonucleotide increases the amount of PK-M mRNA. In certain embodiments, a modified oligonucleotide increases the inclusion of exon 9 in PK-M mRNA. In certain embodiments, a modified oligonucleotide decreases the inclusion of exon 10 in PK-M mRNA. In certain embodiments, a modified oligonucleotide increases the amount of PK-Ml mRNA. In certain embodiments, a modified oligonucleotide decreases the amount of PK-M2 mRNA.
In certain embodiments it is desirable to alter the splicing of PK-M pre-mRNA to include exon 9 and exclude exon 10. By altering the splicing of PK-M pre-mRNA to include exon 9 and exclude exon 10, expression of PK-Ml will increase and expression of PK-M2 will decrease. In certain embodiments it is desirable to alter the splicing of PK-M pre-mRNA to decrease expression of PK-M2.
In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with more than
one modified oligonucleotide. In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with a modified oligonucleotide that targets ex on 10 and a second modified oligonucleotide that targets intron 9. In certain embodiments, modified oligonucleotides targeted to exon 10 are described in PCT Publication No. WO 2014/071078, which is hereby incorporated by reference in its entirety. In certain embodiments, modified oligonucleotides that target exon 10 are described in Table A below. The modified oligonucleotides in Table A below were designed as uniform oligonucleotides, 15 nucleotides in length, with every nucleoside having a 2'-0-methoxyethyl ribose sugar residue and a fully phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines.
Table A
In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with more than one modified oligonucleotide. In certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell with a modified oligonucleotide that targets exon 10 and a second modified oligonucleotide that targets intron 9. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and ISIS 461378. For example, in certain embodiments, splicing of PK-M pre-mRNA is altered by contacting a cell both ISIS 549197 and a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 1 19, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141 , 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, and 156.
Certain Pharmaceutical Compositions
In certain embodiments, the present invention provides pharmaceutical compositions comprising one or more antisense compound. In certain embodiments, such pharmaceutical composition comprises a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises a sterile saline solution and one or more antisense compound. In certain embodiments, such pharmaceutical composition consists of a sterile saline solution and one or more antisense compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile water. In certain embodiments, the sterile saline is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more antisense compound and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one or more antisense compound and sterile phosphate-buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.
In certain embodiments, antisense compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising antisense compounds comprise one or more oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
A prodrug can include the incorporation of additional nucleosides at one or both ends of an oligomeric compound which are cleaved by endogenous nucleases within the body, to form the active antisense oligomeric compound.
Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly-cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is
selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
In certain embodiments, pharmaceutical compositions provided herein comprise one or more modified oligonucleotides and one or more excipients. In certain such embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.
In certain embodiments, a pharmaceutical composition provided herein comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, a pharmaceutical composition provided herein comprises one or more tissue- specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, a pharmaceutical composition provided herein comprises a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non- limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, a pharmaceutical composition provided herein is prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration.
In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g.,
in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, such suspensions may also contain suitable stabilizers or agents that increase the solubility of the pharmaceutical agents to allow for the preparation of highly concentrated solutions.
In certain embodiments, a pharmaceutical composition is prepared for transmucosal administration. In certain of such embodiments penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
In certain embodiments, a pharmaceutical composition provided herein comprises an oligonucleotide in a therapeutically effective amount. In certain embodiments, the therapeutically effective amount is sufficient to prevent, alleviate or ameliorate symptoms of a disease or to prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
In certain embodiments, one or more modified oligonucleotide provided herein is formulated as a prodrug. In certain embodiments, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically more active form of an oligonucleotide. In certain embodiments, prodrugs are useful because they are easier to administer than the corresponding active form. For example, in certain instances, a prodrug may be more bioavailable (e.g., through oral administration) than is the corresponding active form. In certain instances, a prodrug may have improved solubility compared to the corresponding active form. In certain embodiments, prodrugs are less water soluble than the
corresponding active form. In certain instances, such prodrugs possess superior transmittal across cell membranes, where water solubility is detrimental to mobility. In certain embodiments, a prodrug is an ester. In certain such embodiments, the ester is metabolically hydrolyzed to carboxylic acid upon administration. In certain instances the carboxylic acid containing compound is the corresponding active form. In certain embodiments, a prodrug comprises a short peptide (polyaminoacid) bound to an acid group. In certain of such embodiments, the peptide is cleaved upon administration to form the corresponding active form.
In certain embodiments, the present invention provides compositions and methods for reducing the amount or activity of a target nucleic acid in a cell. In certain embodiments, the cell is in an animal. In certain embodiments, the animal is a mammal. In certain embodiments, the animal is a rodent. In certain embodiments, the animal is a primate. In certain embodiments, the animal is a non-human primate. In certain embodiments, the animal is a human.
In certain embodiments, the present invention provides methods of administering a pharmaceutical composition comprising an oligomeric compound of the present invention to an animal. Suitable administration routes include, but are not limited to, oral, rectal, transmucosal, intestinal, enteral, topical, suppository, through inhalation, intrathecal, intracerebroventricular, intraperitoneal, intranasal, intraocular, intratumoral, and parenteral (e.g., intravenous, intramuscular, intramedullary, and subcutaneous). In certain embodiments, pharmaceutical intrathecals are administered to achieve local rather than systemic exposures. For example, pharmaceutical compositions may be injected directly in the area of desired effect (e.g., into the eyes, ears).
In certain embodiments, a pharmaceutical composition is administered to an animal having at least one cancer cell. In certain embodiments, such administration results in apoptosis of at least cancer cell. In certain embodiments, a pharmaceutical composition is administered to an animal having at least one symptom associated with cancer. In certain embodiments, such administration results in amelioration of at least one symptom. In certain embodiments, administration of a pharmaceutical composition to an animal results in a decrease of PK-M2 mRNA in a cell of the animal. In certain embodiments, such administration results in an increase in PK-M1 mRNA. In certain embodiments, such administration results in a decrease in PK-M2 protein and an increase PK-M1 protein. In certain embodiments, a PK-M1 protein is preferred over a PK-M2 protein. In certain embodiments, the administration of certain antisense oligonucleotides delays the onset of cancer. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of cancer cells. In certain embodiments, the administration of certain antisense oligonucleotides slows the proliferation of tumor cells. In certain embodiments, the administration of certain antisense oligonucleotides prevents the growth of cancer. In certain embodiments, the administration of certain antisense oligonucleotides prevents the formation of tumors. In certain embodiments, the administration of certain antisense oligonucleotides causes tumor mass to decrease. In certain embodiments, the administration of certain antisense oligonucleotides rescues cellular phenotype.
Nonlimiting disclosure and incorporation by reference
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.
Although the sequence listing accompanying this filing identifies each sequence as either "RNA" or "DNA" as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide
comprising a nucleoside comprising a 2' -OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2'-OH for the natural 2'-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).
Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence
"ATCGATCG" encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence "AUCGAUCG" and those having some DNA bases and some RNA bases such as
"AUCGATCG" and oligomeric compounds having other modified or naturally occurring bases, such as "ATmeCGAUCG," wherein meC indicates a cytosine base comprising a methyl group at the 5-position.
Examples
The following examples illustrate certain embodiments of the present invention and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.
Example 1: Effect of antisense oligonucleotides targeting pyruvate kinase M
The antisense oligonucleotides (ASOs) in the table below were designed to target intron 9 or the junction between intron 9 and exon 10 of human pyruvate kinase M (P -M). The ASOs comprise uniform
2'-0-methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target the complement of GENBANK Accession No.
NT 010194.16 truncated from nucleotides 43281289 to 43314403 (designated herein as SEQ ID NO: 1), and the start and stop sites of each ASO on that sequence are shown in the table below.
To examine the effects of antisense oligonucleotide treatment of the cells on endogenous PK-M transcripts, HEK-293 cells were transfected with each ASO at a final concentration of 60 nM. HEK-293 cells were obtained from ATCC and grown at a density of 4 x 105 cells in 6-cm dishes in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37°C and 5% CO2. Transfections were performed using an ASO: LipofectAMINE2000® ratio of 20 pmoles: 1 μΐ,.
Splicing of the PK-M transcripts by radioactive RT-PCR was analyzed 48 hrs after transfection. Two micrograms of total RNA was extracted from the cells using Trizol reagent (Life Technologies, Carlsbad,
CA). Contaminating DNA was removed with DNase I (Promega). Reverse transcription was carried out using
ImPromp-II reverse transcriptase (Promega). Semiquantitative PCR using Amp litaq polymerase (Applied Biosystems) was performed by including [a-32P]-dCTP in the reactions. The human-specific primer sets used to amplify endogenous transcripts anneal to PK-M exons 8 and 1 1 , and their sequences are: hPKMF: 5'- AGAAACAGCCAAAGGGGACT-3 ' (designated herein as SEQ ID NO: 117) and hPKMR: 5'- CATTCATGGCAAAGTTCACC-3 ' (designated herein as SEQ ID NO: 118). After 26 amplification cycles for endogenous transcripts, the reactions were divided into two aliquots for digestion with PstI (New England Biolabs) or no digestion. PstI digestion was carried out to distinguish between Ml and M2; only M2 has a PstI site, resulting in two cleavage products, Bl (213 nucleotides) and B2 (185 nucleotides) which are the 3 ' and 5' ends of M2 respectively.
The products were analyzed on a 5% native polyacrylamide gel, visualized by autoradiography, and quantified on a Typhoon 9410 phosphorimager (GE Healthcare) using Multi Gauge software Version 2.3. The results are presented in Table 1. The % Ml mRNA in endogenous transcripts was calculated using the GC -content-normalized intensities of the top undigested band (Ml), the bottom two digested bands of M2 in the PstI -digested samples, and the double-skipped species (D), if detectable. Each product was quantified as a percentage of the total of Ml, M2, and double-skipped species. %M1 and %M2 are presented in the Table 1 below. The background negative-control levels are ~4% Ml and 96% M2; "~" indicates a visually estimated value. Table 1 does not include a column for the double-skipped species (D), because it was not detected in this experiment.
Table 1
ASOs targeted to human PK-M
SE
Isis Target % %
Sequence Start Q
Stop
No. Region Ml M2 ID
NO.
605232 TACCTGCCCTTAGGGCCC Intron 9 28726 28743 5 95 2
605231 TACCTGCCCTTAGGGCC Intron 9 28727 28743 6 94 3
605230 TACCTGCCCTTAGGGC Intron 9 28728 28743 9 91 4
461378 TACCTGCCCTTAGGG Intron 9 28729 28743 23 77 5
605227 TGTTACCTGCCCTTAGGG Intron 9 28729 28746 16 84 6
605228 CAGTGTTACCTGCCCTTAGGG Intron 9 28729 28749 16 84 7
605229 CTAACAGTGTTACCTGCCCTTAGGG Intron 9 28729 28753 16 84 8
672461 TTACCTGCCCTTAGG Intron 9 28730 28744 6 94 9
672463 GTGTTACCTGCCCTTAGG Intron 9 28730 28747 11 89 10
672466 CCTAACAGTGTTACCTGCCCTTAGG Intron 9 28730 28754 13 87 1 1
672462 GTTACCTGCCCTTAG Intron 9 28731 28745 5 95 12
672464 AGTGTTACCTGCCCTTAG Intron 9 28731 28748 10 90 13
672467 TCCTAACAGTGTTACCTGCCCTTAG Intron 9 28731 28755 9 91 14
461379 TGTTACCTGCCCTTA Intron 9 28732 28746 12 88 15
672465 CAGTGTTACCTGCCCTTA Intron 9 28732 28749 6 94 16
672468 ATCCTAACAGTGTTACCTGCCCTTA Intron 9 28732 28756 4 96 17
461380 CAGTGTTACCTGCCC Intron 9 28735 28749 15 85 18
461381 TAACAGTGTTACCTG Intron 9 28738 28752 19 81 19
461382 TCCTAACAGTGTTAC Intron 9 28741 28755 19 81 20
461383 TTATCCTAACAGTGT Intron 9 28744 28758 15 85 21
461384 TGGTTATCCTAACAG Intron 9 28747 28761 18 82 22
461385 GGCTGGTTATCCTAA Intron 9 28750 28764 21 79 23
461386 AGAGGCTGGTTATCC Intron 9 28753 28767 19 81 24
461387 GAGCAAGAGGCTGGT Intron 9 28758 28772 14 86 25
461388 AGAGCAGGTGGAGCA Intron 9 28768 28782 10 90 26
461389 CTCCTAGAGCAGGTG Intron 9 28773 28787 10 90 27
461390 GTCTTCTCCTAGAGC Intron 9 28778 28792 4 -96 28
461391 GGGCCTGGCTGTCTT Intron 9 28788 28802 4 -96 29
461392 AGGTTGGGCCTGGCT Intron 9 28793 28807 4 -96 30
461393 ATGCCAGGTTGGGCC Intron 9 28798 28812 4 -96 31
461394 CCCAGATGCCAGGTT Intron 9 28803 28817 4 -96 32
461395 CTGTGCCCAGATGCC Intron 9 28808 28822 4 -96 33
461396 AGGCTCTGTGCCCAG Intron 9 28813 28827 4 -96 34
461397 AGAAGAGGCTCTGTG Intron 9 28818 28832 4 -96 35
461398 AGACGAGAAGAGGCT Intron 9 28823 28837 4 -96 36
461399 CCTACAGACGAGAAG Intron 9 28828 28842 4 -96 37
461400 GTGTTCCTACAGACG Intron 9 28833 28847 4 -96 38
461401 TGGCGGTGTTCCTAC Intron 9 28838 28852 4 -96 39
461402 CTCCCTGGCGGTGTT Intron 9 28843 28857 ~4 -96 40
461403 ATGACCTCCCTGGCG Intron 9 28848 28862 4 -96 41
461404 CTGCCATGACCTCCC Intron 9 28853 28867 4 -96 42
461405 CTGCCCTGCCATGAC Intron 9 28858 28872 4 -96 43
461406 TGGTCCTGCCCTGCC Intron 9 28863 28877 ~4 -96 44
461407 CAGGACCCTTTGGTC Intron 9 28873 28887 4 -96 45
461408 AGCCACAGGACCCTT Intron 9 28878 28892 4 -96 46
461409 TACTGAGCCACAGGA Intron 9 28883 28897 4 -96 47
461410 GTGCCTACTGAGCCA Intron 9 28888 28902 ~4 -96 48
461411 CTACTGTGCCTACTG Intron 9 28893 28907 4 -96 49
461412 GACATCTACTGTGCC Intron 9 28898 28912 4 -96 50
461413 CCTGTGACATCTACT Intron 9 28903 28917 4 -96 51
461414 AAGTGCCTGTGACAT Intron 9 28908 28922 ~4 -96 52
461415 TCACCAAGTGCCTGT Intron 9 28913 28927 4 -96 53
461416 GTCCTTCACCAAGTG Intron 9 28918 28932 4 -96 54
461417 AACCAGTCCTTCACC Intron 9 28923 28937 4 -96 55
461418 ACAGAAACCAGTCCT Intron 9 28928 28942 4 -96 56
461419 ACTCCACAGAAACCA Intron 9 28933 28947 4 -96 57
461420 TCAAGACTCCACAGA Intron 9 28938 28952 4 -96 58
461421 CAAGATCAAGACTCC Intron 9 28943 28957 4 -96 59
461422 TGAGCCAAGATCAAG Intron 9 28948 28962 4 -96 60
461423 TGAGCTGAGCCAAGA Intron 9 28953 28967 4 -96 61
461424 GATTCTGAGCTGAGC Intron 9 28958 28972 ~4 -96 62
461425 CTGGAGATTCTGAGC Intron 9 28963 28977 4 -96 63
461426 AATCACTGGAGATTC Intron 9 28968 28982 4 -96 64
461427 AGCCCAATCACTGGA Intron 9 28973 28987 4 -96 65
461428 AGAGGAGCCCAATCA Intron 9 28978 28992 ~4 -96 66
461429 GGCCAAGAGGAGCCC Intron 9 28983 28997 4 -96 67
461430 ACAAAGGCCAAGAGG Intron 9 28988 29002 4 -96 68
461431 TGGGAACAAAGGCCA Intron 9 28993 29007 4 -96 69
461432 GTTCCTGGGAACAAA Intron 9 28998 29012 ~4 -96 70
461433 AACATGTTCCTGGGA Intron 9 29003 29017 4 -96 71
461434 TGAGGAACATGTTCC Intron 9 29008 29022 4 -96 72
461435 GCTGGTGAGGAACAT Intron 9 29013 29027 4 -96 73
461436 GGACAGCTGGTGAGG Intron 9 29018 29032 4 -96 74
461437 TCACCGGACAGCTGG Intron 9 29023 29037 4 -96 75
461438 AAGAGTCACCGGACA Intron 9 29028 29042 4 -96 76
461439 TTTGTCACAAAAGGA Intron 9 29053 29067 4 -96 77
461440 AGAGCTTTGTCACAA Intron 9 29058 29072 4 -96 78
461441 TTGTCAGAGCTTTGT Intron 9 29063 29077 4 -96 79
461442 GAGCTTTGTCAGAGC Intron 9 29068 29082 4 -96 80
461443 GGACAGAGCTTTGTC Intron 9 29073 29087 4 -96 81
461444 CGTCCAGAGGGACGA Intron 9 29093 29107 4 -96 82
461445 ACATCCGTCCAGAGG Intron 9 29098 29112 ~4 -96 83
461446 GAGCAACATCCGTCC Intron 9 29103 29117 4 -96 84
Intron 9
/ Exon
461447 GCCTCACGGGCAATC 10 29123 29137 4 -96 85
Junctio
n
Example 2: Design of antisense oligonucleotides targeting pyruvate kinase M
Additional antisense oligonucleotides (ASOs) were designed to target intron 9 or intron 9-exon junctions of human pyruvate kinase M (PK-M).
The ASOs presented in Table 2 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target intron 9 of the pyruvate kinase M genomic sequence (designated herein as SEQ ID NO: 1), and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 3 comprise 18-mer oligonucleotides with deoxy and cEt modifications. The Chemistry column denotes the position of the sugar modifications: 'k' is a cEt modification; 'd' is a deoxyribose sugar. The ASOs comprise a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 4 are 18-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 5 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 6 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target the exon 8/intron 9 junction or intron 9 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 7 are oligonucleotides with deoxy ("d"), cEt modifications ("k"), and or 2'-0-methoxyethyl ("e") modifications. The Chemistry column denotes the position of the sugar modifications. The ASOs comprise a uniform phosphorothioate backbone. All the cytosine nucleobases are 5- methylcytosines. The ASOs target intron 9b/exon 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
The ASOs presented in Table 8 are 15-mer oligonucleotides and comprise uniform 2'-0- methoxyethyl ribose sugar modifications and a uniform phosphorothioate backbone. All the cytosine nucleobases are 5-methylcytosines. The ASOs target the exon 10/intron 10 junction or intron 10 of SEQ ID NO: 1, and the start and stop sites of each ASO on that sequence are shown in the table below.
Table 2
ASOs targeted to intron 9 of the human PK-M genomic sequence
SEQ ID
Isis No. Sequence Start Stop
NO.
549167 TACAGACGAGAAGAG 28826 28840 119
549168 CTACAGACGAGAAGA 28827 28841 120
549169 TCCTACAGACGAGAA 28829 28843 121
549170 TTCCTACAGACGAGA 28830 28844 122
549171 GTTCCTACAGACGAG 28831 28845 123
549172 TGTTCCTACAGACGA 28832 28846 124
549173 GGTGTTCCTACAGAC 28834 28848 125
549174 CGGTGTTCCTACAGA 28835 28849 126
549175 GCGGTGTTCCTACAG 28836 28850 127
549176 GGCGGTGTTCCTACA 28837 28851 128
549177 CTGGCGGTGTTCCTA 28839 28853 129
549178 CCTGGCGGTGTTCCT 28840 28854 130
549179 CCCTGGCGGTGTTCC 28841 28855 131
549180 TCCCTGGCGGTGTTC 28842 28856 132
549181 CCTCCCTGGCGGTGT 28844 28858 133
549182 ACCTCCCTGGCGGTG 28845 28859 134
549183 GACCTCCCTGGCGGT 28846 28860 135
549184 TGACCTCCCTGGCGG 28847 28861 136
549185 CATGACCTCCCTGGC 28849 28863 137
549186 CCATGACCTCCCTGG 28850 28864 138
Table 3
ASOs targeted to intron 9b/exon 10 of the human PK-M genomic sequence
Table 4
ASOs targeted to intron 9b/exon 10 of the human PK-M genomic sequence
ASOs targeted to intron 9b/exon 10 of the human PK-M genomic sequence
ASOs targeted to exon 9/intron 9 junction, intron 9, or intron 9b/exon 10 of human PK-M genomic sequence
Table 7
ASOs targeted to exon 9/intron 9 junction or intron 9 of human PK-M genomic sequence
Isis SEQ ID
Sequence Target Region Chemistry Start Stop
No. NO.
Exon 9/intron
487463 CCTGCCAGACTCCGT 28709 28723 102
9 junction
597242 TGTCAGAGCTTTGTC Intron 9 e2o 29062 29076 103
597243 GCTTTGTCAGAGCTT Intron 9 e2o 29066 29080 104
597247 GTCCAGAGGGACGAG Intron 9 e2o 29092 29106 105
597248 ATCCGTCCAGAGGGA Intron 9 e2o 29096 29110 106
597249 CAACATCCGTCCAGA Intron 9 e2o 29100 29114 107
597250 GGAGCAACATCCGTC Intron 9 e2o 29104 29118 108
606583 GGGAGCAACATCCGTCCA Intron 9 e2o 29102 29119 109
606981 GAGCAACATCCGTCCA Intron 9 (kdd)5k 29102 29117 110
607022 GGGAGCAACATCCGTCCA Intron 9 k(kdd)5kk 29102 29119 111
607062 GAGCAACATCCGTCCA Intron 9 (kee)5k 29102 29117 112
607102 GGGAGCAACATCCGTCCA Intron 9 k(kee)5ke 29102 29119 113
Table 8
ASOs targeted to ex on 10/intron 10 junction or intron 10 of human PK-M genomic sequence
Example 3: Effect of antisense oligonucleotides targeting pyruvate kinase M
Antisense oligonucleotides described in Example 2 in the table below were tested for their effects on endogenous PK-M transcripts, as described in Example 1. The results are presented in Table 9 below. Table 9 does not include a column for the double-skipped species (D), because it was not detected in this experiment.
Table 9
ASOs targeted to human PK-M
Isis No. Target Region % M1 % M2
487463 Exon 9/Intron 9 junction - 4% ~ 96%
487464 Exon 9/Intron 9 junction - 4% ~ 96%
487465 Exon 9/Intron 9 junction - 4% ~ 96%
487466 Intron 9 - 4% ~ 96%
549167 Intron 9 - 4% ~ 96%
549168 Intron 9 - 4% ~ 96%
549169 Intron 9 - 4% ~ 96%
549170 Intron 9 - 4% ~ 96%
549171 Intron 9 - 4% ~ 96%
549172 Intron 9 - 4% ~ 96%
549173 Intron 9 - 4% ~ 96%
549174 Intron 9 -4% ~ 96%
549175 Intron 9 -4% ~ 96%
549176 Intron 9 -4% ~ 96%
549177 Intron 9 -4% ~ 96%
549178 Intron 9 -4% ~ 96%
549179 Intron 9 -4% ~ 96%
549180 Intron 9 -4% ~ 96%
549181 Intron 9 -4% ~ 96%
549182 Intron 9 -4% ~ 96%
549183 Intron 9 -4% ~ 96%
549184 Intron 9 -4% ~ 96%
549185 Intron 9 -4% ~ 96%
549186 Intron 9 -4% ~ 96%
597242 Intron 9 -4% ~ 96%
597243 Intron 9 -4% ~ 96%
597247 Intron 9 -4% ~ 96%
597248 Intron 9 -4% ~ 96%
597249 Intron 9 -4% ~ 96%
597250 Intron 9 -4% ~ 96%
606583 Intron 9 -4% ~ 96%
606981 Intron 9 -4% ~ 96%
607022 Intron 9 -4% ~ 96%
607062 Intron 9 -4% ~ 96%
607102 Intron 9 -4% ~ 96%
461448 Exon 10 -4% ~ 96%
461449 Exon 10 -4% ~ 96%
461450 Exon 10 -4% ~ 96%
461451 Exon 10 -4% ~ 96%
461452 Exon 10 -4% ~ 96%
461461 Exon 10 -4% ~ 96%
461462 Exon 10 -4% ~ 96%
461463 Exon 10 -4% ~ 96%
461464 Exon 10 -4% ~ 96%
461465 Exon 10 -4% ~ 96%
461466 Exon 10 -4% ~ 96%
461467 Exon 10 -4% ~ 96%
461468 Exon 10 -4% ~ 96%
Example 4: Effect of antisense oligonucleotides targeting pyruvate kinase M
Antisense oligonucleotides targeting intron 9b/exon 10 of PK-M, described in Example 2, were tested for their effects on endogenous PK-M transcripts.
U87-MG were obtained from ATCC and grown in DMEM supplemented with 10% (v/v) FBS, penicillin, and streptomycin, at 37°C and 5% C02. ASO transfections were conducted as described in Example 1. Splicing of the PK-M transcripts by radioactive RT-PCR was analyzed 48 hrs after transfection, as described in Example 1. The results are presented in Table 10, below.
Table 10
ASOs targeted to human PK-M
Example 5: Effect combination treatment of antisense oligonucleotides targeting pyruvate kinase M
To test combinations of two antisense oligonucleotides on endogenous PK-M transcript, Isis No. 461378 (see Table 1), Isis No. 549197 (see Table A), or both were transfected into A172 cells at a final, total concentration of 120 nM, and compared to a control ASO that is not complementary to PK-M transcript (ISIS No. 439273). A172 cells were obtained from ATCC and cultured at a density of 4 x 105 cells in 6 cm dishes in DMEM media, supplemented with 1% (v/v) FBS, penicillin and streptomycin, at 37°C and 5% C02. Transfections were performed using 7ul of Lipofectamine® RNAiMAX. Splicing of the PK-M transcripts by radioactive RT-PCR was analyzed 48 hrs after transfection, as described in Example 1. The results are presented in Table 11. The percentages of the M2 and double-skipped (D) isoforms were combined in the table below.
Table 11
Claims
Claims:
1. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731- 28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758- 28772, 28768-28782, 28773-28787 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731- 28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758- 28772, 28768-28782, 28773-28787, 28778-28792, 28788-28802, 28793-28807, 28798-28812, 28803-28817, 28808-28822, 28813-28827, 28818-28832, 28823-28837, 28828-28842, 28833- 28847, 28838-28852, 28843-28857, 28848-28862, 28853-28867, 28858-28872, 28863-28877, 28873-28887, 28878-28892, 28883-28897, 28888-28902, 28893-28907, 28898-28912, 28903- 28917, 28908-28922, 28913-28927, 28918-28932, 28923-28937, 28928-28942, 28933-28947, 28938-28952, 28943-28957, 28948-28962, 28953-28967, 28958-28972, 28963-28977, 28968- 28982, 28973-28987, 28978-28992, 28983-28997, 28988-29002, 28993-29007, 28998-29012, 29003-29017, 29008-29022, 29013-29027, 29018-29032, 29023-29037, 29028-29042, 29053- 29067, 29058-29072, 29063-29077, 29068-29082, 29073-29087, 29093-29107, 29098-29112, 29103-29117, 29123-29137, 28826-28840, 28827-28841, 28829-28843, 28830-28844, 28831- 28845, 28832-28846, 28834-28848, 28835-28849, 28836-28850, 28837-28851, 28839-28853, 28840-28854, 28841-28855, 28842-28856, 28844-28858, 28845-28859, 28846-28860, 28847- 28861, 28849-28863, 28850-28864, 29164-29181, 29165-29182, 29166-29183, 29159-29176, 29160-29177, 29161-29178, 29162-29179, 29163-29180, 29164-29181, 29165-29182, 29166- 29183, 29167-29184, 29168-29185, 29169-29186, 29170-29187, 29171-29188, 29172-29189, 29173-29190, 29174-29191, 29175-29192, 29176-29193, 29128-29142, 29133-29147, 29138- 29152, 29143-29157, 29148-29162, 28714-28728, 28719-28733, 28724-28738, 29128-29142, 29133-29147, 29138-29152, 29143-29157, 29148-29162, 29208-29222, 29213-29227, 29218- 29232, 29223-29237, 29228-29242, 29233-29247, 29238-29252, or 29243-29257 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731- 28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758- 28772, 28768-28782, or 28773-28787 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
6. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
7. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
8. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
9. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136,
137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
10. A compound comprising a modified oligonucleotide consisting of 8 to 30 linked nucleosides and having a nucleobase sequence comprising a complementary region, wherein the complementary region comprises at least 8 contiguous nucleobases and is complementary to an equal-length portion of a target region of a PK-M transcript.
11. The compound of claim 10, wherein the target region of the PK-M transcript comprises at least a portion of intron 9 of the PK-M transcript.
12. The compound of any of claims 10 to 11, wherein the target region of the PK-M transcript
comprises at least a portion of ex on 10 of the PK-M transcript.
13. The compound of claim 11 or 12, wherein the complementary region of the modified
oligonucleotide is 100% complementary to the target region.
14. The compound of any of claims 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 10 contiguous nucleobases.
15. The compound of any of claims 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 15 contiguous nucleobases.
16. The compound of any of claims 11 to 13, wherein the complementary region of the modified oligonucleotide comprises at least 18 contiguous nucleobases.
17. The compound of any of claims 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 80% complementary to an equal- length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
18. The compound of any of claims 11-16, wherein the nucleobase sequence of the oligonucleotide is at least 90%> complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
19. The compound of any of claims 11-16, wherein the nucleobase sequence of the oligonucleotide is 100% complementary to an equal-length region of the PK-M transcript, as measured over the entire length of the oligonucleotide.
20. The compound of any of claims 11-19, wherein the target region is within intron 9 of the PK-M transcript.
21. The compound of any of claims 1-10, wherein the target region is within nucleobase 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730- 28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747- 28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, 28773-28787 28726-28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730- 28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732-28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747- 28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, 28773-28787, 28778-28792, 28788-28802, 28793-28807, 28798-28812, 28803-28817, 28808-28822, 28813-28827, 28818- 28832, 28823-28837, 28828-28842, 28833-28847, 28838-28852, 28843-28857, 28848-28862, 28853-28867, 28858-28872, 28863-28877, 28873-28887, 28878-28892, 28883-28897, 28888- 28902, 28893-28907, 28898-28912, 28903-28917, 28908-28922, 28913-28927, 28918-28932, 28923-28937, 28928-28942, 28933-28947, 28938-28952, 28943-28957, 28948-28962, 28953- 28967, 28958-28972, 28963-28977, 28968-28982, 28973-28987, 28978-28992, 28983-28997, 28988-29002, 28993-29007, 28998-29012, 29003-29017, 29008-29022, 29013-29027, 29018- 29032, 29023-29037, 29028-29042, 29053-29067, 29058-29072, 29063-29077, 29068-29082, 29073-29087, 29093-29107, 29098-29112, 29103-29117, 29123-29137, 28826-28840, 28827- 28841, 28829-28843, 28830-28844, 28831-28845, 28832-28846, 28834-28848, 28835-28849, 28836-28850, 28837-28851, 28839-28853, 28840-28854, 28841-28855, 28842-28856, 28844- 28858, 28845-28859, 28846-28860, 28847-28861, 28849-28863, 28850-28864, 29164-29181, 29165-29182, 29166-29183, 29159-29176, 29160-29177, 29161-29178, 29162-29179, 29163- 29180, 29164-29181, 29165-29182, 29166-29183, 29167-29184, 29168-29185, 29169-29186, 29170-29187, 29171-29188, 29172-29189, 29173-29190, 29174-29191, 29175-29192, 29176- 29193, 29128-29142, 29133-29147, 29138-29152, 29143-29157, 29148-29162, 28714-28728, 28719-28733, 28724-28738, 29128-29142, 29133-29147, 29138-29152, 29143-29157, 29148-
29162, 29208-29222, 29213-29227, 29218-29232, 29223-29237, 29228-29242, 29233-29247, 29238-29252, or 29243-29257 of SEQ ID NO: 1.
22. The compound of any of claims 1-10, wherein the target region is within nucleobase 28726- 28743, 28727-28743, 28728-28743, 28729-28743, 28729-28746, 28729-28749, 28729-28753, 28730-28744, 28730-28747, 28730-28754, 28731-28745, 28731-28748, 28731-28755, 28732- 28746, 28732-28749, 28732-28756, 28735-28749, 28738-28752, 28741-28755, 28744-28758, 28747-28761, 28750-28764, 28753-28767, 28758-28772, 28768-28782, or 28773-28787 of SEQ ID NO. 1.
23. The compound of any of claims 1-23, wherein the modified oligonucleotide comprises at least one modified nucleoside.
24. The compound of claim 23, wherein at least one modified nucleoside comprises a modified sugar moiety.
25. The compound of claim 24, wherein at least one modified sugar moiety is a 2 '-substituted sugar moiety.
26. The compound of claim 25, wherein the 2'-substitutent of at least one 2 '-substituted sugar moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
27. The compound of any of claims 25-26, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
28. The compound of any of claims 1-23, wherein at least one modified sugar moiety is a bicyclic sugar moiety.
29. The compound of claim 28, wherein at least one bicyclic sugar moiety is cEt.
30. The compound of claim 28, wherein at least one bicyclic sugar moiety is LNA.
31. The compound of claim 25, wherein at least one sugar moiety is a sugar surrogate.
32. The compound of claim 31, wherein at least one sugar surrogate is a morpholino.
33. The compound of claim 31, wherein at least one sugar surrogate is a modified morpholino.
34. The compound of any of claim 1-33, wherein the modified oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
35. The compound of any of claim 1-33, wherein the modified oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
36. The compound of any of claim 1-33, wherein the modified oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety.
37. The compound of any of claim 1-33, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
38. The compound of any of claim 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
39. The compound of any of claims 1-33, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
40. The compound of any of claims 1-39, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
41. The compound of any of claims 1-39, wherein the modified oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
42. The compound of any of claims 1-39, wherein the modified oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
43. The compound of any of claims 1-39, wherein the modified oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
44. The compound of any of claims37-43, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'-MOE, cEt, LNA, morpholino, and modified morpholino.
45. The compound of any of claims 40-43, wherein the modified nucleosides of the modified region each comprise the same modification as one another.
46. The compound of any of claims 40-43, wherein the modified nucleosides of the modified region each comprise the same 2 '-substituted sugar moiety.
47. The compound of claim 46, wherein the 2 '-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE.
48. The compound of claim 46, wherein the 2 '-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
49. The compound of claim 44, wherein the modified nucleosides of the region of modified
nucleosides each comprise the same bicyclic sugar moiety.
50. The compound of claim 49, wherein the bicyclic sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
51. The compound of claim 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a morpholino.
52. The compound of claim 44, wherein the sugar surrogate of the modified nucleosides of the region of modified nucleosides is a modified morpholino.
53. The compound of any of claims 1-35, wherein the modified oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
54. The compound of any of claims 1-52, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside.
55. The compound of claim 54 wherein each modified nucleoside comprises a modified sugar moiety.
56. The compound of claim 55, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
57. The compound of claim 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2 '-substituted sugar moiety.
58. The compound of claim 57, wherein the 2 '-substituted sugar moiety of the modified
oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
59. The compound of claim 58, wherein the 2 '-substituted sugar moiety of the modified
oligonucleotide is 2'-MOE.
60. The compound of claim 56, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety.
61. The compound of claim 60, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
62. The compound of claim 55, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
63. The compound of claim 62, wherein the sugar surrogate of the modified oligonucleotide is a
morpholino.
64. The compound of claim 62, wherein the sugar surrogate of the modified oligonucleotide is a
modified morpholino.
65. The compound of any of claims 1-34 wherein each nucleobase of the modified oligonucleotide is a modified sugar moiety or an unmodified nucleobase.
66. The compound of claim 65, wherein each unmodified nucleobase is DNA.
67. The compound of claim 65 or 66, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE.
68. The compound of claim 67, wherein the modified sugar moiety is cEt.
69. The compound of claim 67, wherein the modified sugar moiety is LNA.
70. The compound of claim 67, wherein the modified sugar moiety is 2'F.
71. The compound of claim 67, wherein the modified sugar moiety is 2'-OMe.
72. The compound of claim 67, wherein the modified sugar moiety is 2'-MOE.
73. The compound of any of claims 65 to 72, wherein the modified oligonucleotide has a
aaddaddaddaddaddaa motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents DNA.
74. The compound of any of claims 1-73, wherein the modified oligonucleotide comprises at least one modified mternucleoside linkage.
75. The compound of claim 74, wherein each mternucleoside linkage is a modified mternucleoside linkage.
76. The compound of claim 74 or 75, comprising at least one phosphorothioate mternucleoside
linkage.
77. The compound of claim 75, wherein each mternucleoside linkage is a modified mternucleoside linkage and wherein each mternucleoside linkage comprises the same modification.
78. The compound of claim 77, wherein each mternucleoside linkage is a phosphorothioate
mternucleoside linkage.
79. The compound of any of claims 1-74, wherein each mternucleoside linkage is either a
phosphodiester mternucleoside linkage or a phosphorothioate mternucleoside linkage.
80. The compound of any of claims 1-79 comprising at least one conjugate.
81. The compound of any of claims 1 -79 consisting of the modified oligonucleotide.
82. The compound of any of claims 1-81, wherein the compound modulates splicing of the PK-M transcript.
83. The compound of any of claims 10-82, having a nucleobase sequence comprising any of the
sequences as set forth in SEQ ID NOs. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, and 156.
84. A pharmaceutical composition comprising a compound according to any of claims 1-83 and a pharmaceutically acceptable carrier or diluent.
85. The pharmaceutical composition of claim 84, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
86. A method of modulating splicing of a PK-M transcript in a cell comprising contacting the cell with a compound according to any of claims 1-85.
87. The method of claim 86, wherein the cell is in vitro.
88. The method of claim 86, wherein the cell is in an animal.
89. The method of any of claims 86-88, wherein inclusion of exon 9 is increased.
90. The method of any of claims 86-89, wherein exclusion of exon 10 is increased.
91. The method of any of claims 86-89, wherein inclusion of exon 10 is decreased.
92. The method of any of claims 86-91, wherein PK-M1 mRNA expression is increased.
93. The method of any of claims 86-92, wherein PK-M2 mRNA expression is decreased.
94. A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of claims 1-85.
95. The method of claim 94, wherein PK-M1 expression is increased.
96. The method of claims 94 or 95, wherein PK-M2 expression is decreased.
97. The method of claim 94, wherein the cell is in vitro.
98. The method of claim 94, wherein the cell is in an animal.
99. A method of inducing apoptosis in a cell, comprising contacting the cell with a compound
according to any of claims 1-85.
100. The method of claim 99, wherein the cell is a glial cell.
101. The method of claim 99 or 100, wherein the cell is in vitro.
102. The method of claim 99 or 100, wherein the cell is in an animal.
103. A method comprising administering the compound according to any of claims 1-83 or the
pharmaceutical composition of claims 84 or 85 to an animal.
104. The method of claim 103, wherein the administration is intracerebroventricular.
105. The method of claim 103, wherein the administration is into the central nervous sysem
106. The method of any of claims 103-105, wherein the animal has one or more symptoms associated with cancer.
107. The method claim 106, wherein the cancer is glioblastoma.
108. The method of claim 107, wherein the administration results in amelioration of at least one symptom of cancer.
109. The method of any of claims 101-108, wherein the animal is a mouse.
110. The method of any of claims 101-108, wherein the animal is a human.
111. A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of claims 1-83 or the pharmaceutical composition of claims 84 or 85 to an animal in need thereof.
112. The method of claim 111, wherein the animal is a mouse.
113. The method of claim 111, wherein the animal is a human.
114. The method of claim 111 to 113, wherein the cancerous tumor comprises glioblastoma.
115. The method of any of claims 86 to 102, further comprising contacting a cell with a second
modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of claims 1-83.
116. The method of any of claims 103 to 114, further comprising administering a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of claims 1-83.
117. The method of claim 115 or 116, wherein the second modified oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
118. Use of the compound according to any of claims 1-83 or the pharmaceutical composition of claims 84 or 85 for the preparation of a medicament for use in the treatment of cancer.
119. Use of the compound according to any of claims 1-83 or the pharmaceutical composition of claims 84 or 85 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
120. The use of claim 118 or 119, wherein the cancer is glioblastoma.
121. Use of the compound according to any of claims 1-83 or the pharmaceutical composition of
claims 84 or 85 for the treatment of cancer.
122. Use of the compound according to any of claims 1-83 or the pharmaceutical composition of
claims 84 or 85 for the treatment of glioblastoma.
123. The method of any of claims 115-117, wherein the first modified oligonucleotide has the
nucleobase sequence of Isis No. 461378.
124. A compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides complementary within nucleobases 28709-28726, 28710-28727, 28711-28728, 28712-28729, 28713-28730, 28714-28731, 28715-28732, 28716-28733, 28717-28734, 28718-28735, 28719- 28736, 28720-28737, 28721-28738, 28722-28739, 28723-28740, 28724-28741, 28725-28742 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, 90%, 95%, or 100% complementary to SEQ ID NO: 1.
125. A compound comprising a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NO: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
126. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
127. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
128. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
129. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
130. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
131. A compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, or 185.
132. The compound of any of claims 124-131, wherein the complementary region of the modified oligonucleotide is 90% complementary to the target region.
133. The compound of any of claims 124-131, wherein the complementary region of the modified oligonucleotide is 100% complementary to the target region.
134. The compound of any of claims 124-133, wherein the modified oligonucleotide comprises at least one modified nucleoside.
135. The compound of claim 134, wherein at least one modified nucleoside comprises a modified sugar moiety.
136. The compound of claim 135, wherein at least one modified sugar moiety is a 2 '-substituted sugar moiety.
137. The compound of claim 136, wherein the 2'-substitutent of at least one 2 '-substituted sugar
moiety is selected from among: 2'-OMe, 2'-F, and 2'-MOE.
138. The compound of any of claims 136-137, wherein the 2'-substiuent of at least one 2 '-substituted sugar moiety is a 2'-MOE.
139. The compound of any of claims 124-135, wherein at least one modified sugar moiety is a
bicyclic sugar moiety.
140. The compound of claim 139, wherein at least one bicyclic sugar moiety is cEt.
141. The compound of claim 139, wherein at least one bicyclic sugar moiety is LNA.
142. The compound of claim 135, wherein at least one sugar moiety is a sugar surrogate.
143. The compound of claim 142, wherein at least one sugar surrogate is a morpholino.
144. The compound of claim 142, wherein at least one sugar surrogate is a modified morpholino.
145. The compound of any of claims 124-144, wherein the modified oligonucleotide comprises at least 5 modified nucleosides, each independently comprising a modified sugar moiety.
146. The compound of any of claims 124-144, wherein the modified oligonucleotide comprises at least 10 modified nucleosides, each independently comprising a modified sugar moiety.
147. The compound of any of claims 124-144, wherein the modified oligonucleotide comprises at least 15 modified nucleosides, each independently comprising a modified sugar moiety.
148. The compound of any of claim 124-144, wherein each nucleoside of the modified oligonucleotide is a modified nucleoside, each independently comprising a modified sugar moiety
149. The compound of any of claim 124-144, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are the same as one another.
150. The compound of any of claims 124-144, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising modified sugar moieties that are different from one another.
151. The compound of any of claims 124-150, wherein the modified oligonucleotide comprises a modified region of at least 5 contiguous modified nucleosides.
152. The compound of any of claims 124-150, wherein the modified oligonucleotide comprises a modified region of at least 10 contiguous modified nucleosides.
153. The compound of any of claims 124-150, wherein the modified oligonucleotide comprises a modified region of at least 15 contiguous modified nucleosides.
154. The compound of any of claims 124-150, wherein the modified oligonucleotide comprises a modified region of at least 18 contiguous modified nucleosides.
155. The compound of any of claims 151-154, wherein each modified nucleoside of the modified region has a modified sugar moiety independently selected from among: 2'-F, 2'-OMe, 2'-MOE, cEt, LNA, morpholino, and modified morpholino.
156. The compound of any of claims 151-154, wherein the modified nucleosides of the modified
region each comprise the same modification as one another.
157. The compound of any of claims 151-154, wherein the modified nucleosides of the modified
region each comprise the same 2 '-substituted sugar moiety.
158. The compound of claim 157, wherein the 2 '-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from 2'-F, 2'-OMe, and 2'-MOE.
159. The compound of claim 157, wherein the 2 '-substituted sugar moiety of the modified nucleosides of the region of modified nucleosides is 2'-MOE.
160. The compound of claim 155, wherein the modified nucleosides of the region of modified nucleosides each comprise the same bicyclic sugar moiety.
161. The compound of claim 160, wherein the bicyclic sugar moiety of the modified nucleosides of the region of modified nucleosides is selected from LNA and cEt.
162. The compound of claim 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a morpholino.
163. The compound of claim 155, wherein the modified sugar of the modified nucleosides of the region of modified nucleosides is a modified morpholino.
164. The compound of any of claims 124-144, wherein the modified oligonucleotide comprises no more than 4 contiguous naturally occurring nucleosides.
165. The compound of any of claims 124-144, wherein each nucleoside of the modified
oligonucleotide is a modified nucleoside.
166. The compound of claim 165 wherein each modified nucleoside comprises a modified sugar
moiety.
167. The compound of claim 166, wherein the modified nucleosides of the modified oligonucleotide comprise the same modification as one another.
168. The compound of claim 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same 2 '-substituted sugar moiety.
169. The compound of claim 168, wherein the 2 '-substituted sugar moiety of the modified
oligonucleotide is selected from 2'-F, 2'-OMe, and 2'-MOE.
170. The compound of claim 168, wherein the 2 '-substituted sugar moiety of the modified
oligonucleotide is 2'-MOE.
171. The compound of claim 167, wherein the modified nucleosides of the modified oligonucleotide each comprise the same bicyclic sugar moiety.
172. The compound of claim 171, wherein the bicyclic sugar moiety of the modified oligonucleotide is selected from LNA and cEt.
173. The compound of claim 167, wherein the modified nucleosides of the modified oligonucleotide each comprises a sugar surrogate.
174. The compound of claim 173, wherein the sugar surrogate of the modified oligonucleotide is a morpholino.
175. The compound of claim 173, wherein the sugar surrogate of the modified oligonucleotide is a modified morpholino.
176. The compound of any of claims 124-144 wherein each sugar moiety of the modified
oligonucleotide is a modified sugar moiety or an unmodified sugar moiety.
177. The compound of claim 176, wherein each unmodified sugar moiety is a 2'-deoxyfuranose sugar moiety.
178. The compound of claim 176 or 177, wherein each modified sugar moiety is selected from cEt, LNA, 2'-F, 2'-OMe, and 2'-MOE.
179. The compound of claim 178, wherein the modified sugar moiety is cEt.
180. The compound of claim 178, wherein the modified sugar moiety is LNA.
181. The compound of claim 178, wherein the modified sugar moiety is 2'F.
182. The compound of claim 178, wherein the modified sugar moiety is 2'-OMe.
183. The compound of claim 178, wherein the modified sugar moiety is 2'-MOE.
184. The compound of any of claims 177-183, wherein the modified oligonucleotide has a aaddaddaddaddaddaa motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents a 2'-deoxyfuranose moiety.
185. The compound of any of claims 177-183, wherein the modified oligonucleotide has a
addaddaddaddadda motif, wherein each "a" represents a modified sugar moiety and wherein each "d" represents a 2'-deoxyfuranose moiety.
186. The compound of any of claims 124-144, wherein the modified oligonucleotide has a
aeeaeeaeeaeeaeea motif, wherein each "a" represents a bicyclic modified sugar moiety and wherein each "e" represents a 2 '-substituted sugar moiety.
187. The compound of any of claims 124-144, wherein the modified oligonucleotide has a
aaeeaeeaeeaeeaeeea motif, wherein each "a" represents a bicyclic modified sugar moiety and wherein each "e" represents a 2 '-substituted sugar moiety.
188. The compound of any of claims 184-187, wherein each "a" independently represents either a cEt modified sugar moiety or an LNA modified sugar moiety.
189. The compound of claim 188, wherein each "a" represents a cEt modified sugar moiety.
190. The compound of any of claims 124-189, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.
191. The compound of claim 190, wherein each internucleoside linkage is a modified internucleoside linkage.
192. The compound of claim 190 or 191, comprising at least one phosphorothioate internucleoside linkage.
193. The compound of claim 190, wherein each internucleoside linkage is a modified internucleoside linkage and wherein each internucleoside linkage comprises the same modification.
194. The compound of claim 190, wherein each internucleoside linkage is a phosphorothioate
internucleoside linkage.
195. The compound of any of claims 124-190, wherein each internucleoside linkage is either a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.
196. The compound of any of claims 124-195 comprising at least one conjugate.
197. The compound of any of claims 124-195 consisting of the modified oligonucleotide.
198. The compound of any of claims 124-197, wherein the compound modulates splicing of the PK-M transcript.
199. A pharmaceutical composition comprising a compound according to any of claims 124-198 and a pharmaceutically acceptable carrier or diluent.
200. The pharmaceutical composition of claim 199, wherein the pharmaceutically acceptable carrier or diluent is sterile saline.
201. A method of modulating splicing of a PK-M transcript in a cell comprising contacting the cell with a compound according to any of claims 124-198.
202. The method of claim 201, wherein the cell is in vitro.
203. The method of claim 201, wherein the cell is in an animal.
204. The method of any of claims 201-203, wherein inclusion of exon 9 is increased.
205. The method of any of claims 201-204, wherein exclusion of exon 10 is increased.
206. The method of any of claims 201-204, wherein inclusion of exon 10 is decreased.
207. The method of any of claims 201-206, wherein PK-M1 mRNA expression is increased.
208. The method of any of claims 201-207, wherein PK-M2 mRNA expression is decreased.
209. A method of modulating the expression of PK-M in a cell, comprising contacting the cell with a compound according to any of claims 124-198.
210. The method of claim 209, wherein PK-M1 expression is increased.
211. The method of claims 209 or 210, wherein PK-M2 expression is decreased.
212. The method of claim 209, wherein the cell is in vitro.
213. The method of claim 209, wherein the cell is in an animal.
214. A method of inducing apoptosis in a cell, comprising contacting the cell with a compound
according to any of claims 124-198.
215. The method of claim 214, wherein the cell is a glial cell.
216. The method of claim 214 or 215, wherein the cell is in vitro.
217. The method of claim 214 or 215, wherein the cell is in an animal.
218. A method comprising administering the compound according to any of claims 124-196 or the pharmaceutical composition of claims 199 or 200 to an animal.
219. The method of claim 218, wherein the administration is intracerebroventricular.
220. The method of claim 218, wherein the administration is into the central nervous sysem
221. The method of any of claims 218-220, wherein the animal has one or more symptoms associated with cancer.
222. The method claim 221, wherein the cancer is glioblastoma.
223. The method of claim 221, wherein the administration results in amelioration of at least one symptom of cancer.
224. The method of any of claims 218-223, wherein the animal is a mouse.
225. The method of any of claims 218-223, wherein the animal is a human.
226. A method of preventing or retarding the growth of a cancerous tumor, comprising administering the compound according to any of claims 124-198 or the pharmaceutical composition of claims
199 or 200 to an animal in need thereof.
227. The method of claim 226, wherein the animal is a mouse.
228. The method of claim 226, wherein the animal is a human.
229. The method of claim 226 to 228, wherein the cancerous tumor comprises glioblastoma.
230. The method of any of claims 201 to 229, further comprising contacting a cell with a second modified oligonucleotide, wherein the second modified oligonucleotide is different from the compound according to any of claims 124-198.
231. The method of claim 230, wherein the second modified oligonucleotide has the nucleobase sequence and motif of ISIS No. 549197.
232. Use of the compound according to any of claims 124-198 or the pharmaceutical composition of claims 199 or 200 for the preparation of a medicament for use in the treatment of cancer.
233. Use of the compound according to any of claims 124-198 or the pharmaceutical composition of claims 199 or 200 for the preparation of a medicament for use in the amelioration of one or more symptoms cancer.
234. The use of claim 232 or 233, wherein the cancer is glioblastoma.
235. Use of the compound according to any of claims 124-198 or the pharmaceutical composition of claims 199 or 200 for the treatment of cancer.
236. Use of the compound according to any of claims 124-198 or the pharmaceutical composition of claims 199 or 200 for the treatment of glioblastoma.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462063892P | 2014-10-14 | 2014-10-14 | |
| US62/063,892 | 2014-10-14 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016061263A1 true WO2016061263A1 (en) | 2016-04-21 |
Family
ID=55747287
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/055582 Ceased WO2016061263A1 (en) | 2014-10-14 | 2015-10-14 | Antisense compounds and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016061263A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019138057A1 (en) * | 2018-01-12 | 2019-07-18 | Roche Innovation Center Copenhagen A/S | Alpha-synuclein antisense oligonucleotides and uses thereof |
| RU2773197C2 (en) * | 2018-01-12 | 2022-05-31 | Рош Инновейшен Сентер Копенгаген А/С | Antisense oligonucleotides to alpha-synuclein and applications thereof |
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| US20220280545A1 (en) * | 2018-09-10 | 2022-09-08 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating cln3 expression |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040192628A1 (en) * | 1999-08-19 | 2004-09-30 | Monia Brett P. | Antisense modulation of focal adhesion kinase expression |
| US20130289092A1 (en) * | 2010-06-15 | 2013-10-31 | Cold Spring Harbor Laboratory | Compounds and methods for modulating interaction between proteins and target nucleic acids |
| WO2014071078A1 (en) * | 2012-10-31 | 2014-05-08 | Isis Pharmaceuticals, Inc. | Antisense compounds and uses thereof |
-
2015
- 2015-10-14 WO PCT/US2015/055582 patent/WO2016061263A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040192628A1 (en) * | 1999-08-19 | 2004-09-30 | Monia Brett P. | Antisense modulation of focal adhesion kinase expression |
| US20130289092A1 (en) * | 2010-06-15 | 2013-10-31 | Cold Spring Harbor Laboratory | Compounds and methods for modulating interaction between proteins and target nucleic acids |
| WO2014071078A1 (en) * | 2012-10-31 | 2014-05-08 | Isis Pharmaceuticals, Inc. | Antisense compounds and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| WANG ET AL.: "Exon-centric regulation of pyruvate kinase M alternative splicing via mutually exclusive exons", JOURNAL OF MOLECULAR CELL BIOLOGY, vol. 4, 1 November 2011 (2011-11-01), pages 79 - 87, XP055274436 * |
| WANG ET AL.: "Manipulation of PK -M mutually exclusive alternative splicing by antisense oligonucleotides", OPEN BIOLOGY, vol. 2, 31 October 2012 (2012-10-31), pages 1 - 11, XP055274438 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4035659A1 (en) | 2016-11-29 | 2022-08-03 | PureTech LYT, Inc. | Exosomes for delivery of therapeutic agents |
| WO2019138057A1 (en) * | 2018-01-12 | 2019-07-18 | Roche Innovation Center Copenhagen A/S | Alpha-synuclein antisense oligonucleotides and uses thereof |
| RU2773197C2 (en) * | 2018-01-12 | 2022-05-31 | Рош Инновейшен Сентер Копенгаген А/С | Antisense oligonucleotides to alpha-synuclein and applications thereof |
| US20220280545A1 (en) * | 2018-09-10 | 2022-09-08 | Ionis Pharmaceuticals, Inc. | Compounds and methods for modulating cln3 expression |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2839006B1 (en) | Oligomeric compounds comprising bicyclic nucleotides and uses thereof | |
| US9695418B2 (en) | Oligomeric compounds comprising bicyclic nucleosides and uses thereof | |
| US9518259B2 (en) | Compounds and methods for modulating interaction between proteins and target nucleic acids | |
| EP3766974A1 (en) | Compositions and methods for modulating tau expression | |
| US10851371B2 (en) | Modulation of SMN expression | |
| WO2013033223A1 (en) | Methods and compounds useful in conditions related to repeat expansion | |
| WO2012151324A1 (en) | Antisense compounds targeting genes associated with usher syndrome | |
| WO2016138017A1 (en) | Compounds and methods for increasing antisense activity | |
| WO2012027033A1 (en) | Compounds and methods for modulating target nuclear and sub-nuclear nucleic acid molecules in cells and animals | |
| US11459564B2 (en) | Modulation of frataxin expression | |
| WO2016154096A1 (en) | Modulation of smggds expression | |
| WO2013192233A1 (en) | Compounds and method for improved cellular uptake of antisense compounds | |
| EP3471779A1 (en) | Combinations for the modulation of smn expression | |
| EP3077510B1 (en) | Antisense compounds and uses thereof | |
| US20190382760A1 (en) | Antisense compounds targeting genes associated with fibronectin | |
| WO2019169243A1 (en) | Compounds and methods for the modulation of amyloid-beta precursor protein | |
| WO2015187989A1 (en) | Antisense compounds targeting apolipoprotein e receptor 2 | |
| WO2016061263A1 (en) | Antisense compounds and uses thereof | |
| US10287584B2 (en) | Compounds and methods for the modulation of COMP | |
| WO2014071078A1 (en) | Antisense compounds and uses thereof | |
| US9487780B2 (en) | Antisense compounds targeting genes associated with fibronectin |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15850666 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15850666 Country of ref document: EP Kind code of ref document: A1 |












