WO2016061073A1 - Composition and method for in vivo engineering of chromosomal rearrangements - Google Patents

Composition and method for in vivo engineering of chromosomal rearrangements Download PDF

Info

Publication number
WO2016061073A1
WO2016061073A1 PCT/US2015/055286 US2015055286W WO2016061073A1 WO 2016061073 A1 WO2016061073 A1 WO 2016061073A1 US 2015055286 W US2015055286 W US 2015055286W WO 2016061073 A1 WO2016061073 A1 WO 2016061073A1
Authority
WO
WIPO (PCT)
Prior art keywords
alk
sgrnas
expression vector
vivo
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/055286
Other languages
French (fr)
Inventor
Andrea Ventura
Danilo Maddalo
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Memorial Sloan Kettering Cancer Center
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of WO2016061073A1 publication Critical patent/WO2016061073A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0331Animal model for proliferative diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C12N2015/8527Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic for producing animal models, e.g. for tests or diseases
    • C12N2015/8572Animal models for proliferative diseases, e.g. comprising an oncogene
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present application relates generally to the field of genetic engineering and in particular to compositions and methods for inducing chromosomal rearrangements in vivo.
  • One aspect of the present application relates to a method for inducing chromosomal rearrangements in vivo.
  • the method comprises administering into a subject an effective amount of an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs), wherein the expression vector expresses the Cas gene and the two or more sgRNAs in vivo and causes chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs.
  • sgRNAs single guide RNAs
  • Another aspect of the present application relates to a mouse produced by the method described above, wherein the mouse has non-small cell lung cancer (NSCLC) cells harboring an Eml4-Alk inversion and expressing an Eml4-Alk fusion gene.
  • NSCLC non-small cell lung cancer
  • compositions for inducing specific chromosomal rearrangements in vivo comprises an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs); wherein the expression vector is capable of expressing the Cas gene and the two or more sgRNAs in vivo and causing chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs.
  • sgRNAs single guide RNAs
  • kits for inducing specific chromosomal rearrangements in vivo comprises the composition described above and a reagent for introducing the expression vector into a cell in vivo.
  • Fig. 1 is a composite showing induction of Eml4-Alk rearrangement in murine cells using the CRISPR-Cas9 system.
  • Panel (a) Schematic of the In(17) involving the Eml4 and Alk loci. The smaller arrows indicate the sites recognized by the sgRNAs.
  • Panel (b) A schematic of the loci before and after the inversion with the location of the primers used (top). PCRs were performed on genomic DNA extracted from NIH/3T3 cells transfected with the indicated pX330 constructs (middle).
  • PCR bands were sub-cloned and the sequences of four independent clones and a representative chromatogram are shown (EmU- Alk Predicted, GGGTCTACTATGTAAGGCTA (SEQ ID NO. 23); Alk-EmU Predicted, ATGTCTATCTGGAAGGAGCC (SEQ ID NO. 24); EmU-Alk Clone 1,
  • GGGTCTACTATGTAAGGCTA (SEQ ID NO. 27); Alk-EmU Clone 2, ATGTCTA— GGAAGGAGCC (SEQ ID NO. 28); EmU-Alk Clone 3, GGGTCTACT--GTAAGGCTA (SEQ ID NO. 29); Alk-EmU Clone 3, ATGTCTA— GGAAGGAGCC (SEQ ID NO. 30); EmU-Alk Clone 4, GGGTCTACT--GTAAGGCTA (SEQ ID NO. 31); Alk-EmU Clone 4,
  • Fig. 2 is a schematic of the break-apart interphase FISH strategy.
  • the 5 'Alk and 3 'Alk probes become separated, and the 3 'Alk and 5 ' EmU probes become juxtaposed.
  • Fig. 3 shows induction of the Npml- ⁇ 4/ translocation in NIH/3T3 cells.
  • AATGTGTTTTGTAAGGCTA (SEQ ID NO. 41); Alk-Npml Clone 3,
  • AATGTGTTTTGTAAGGCTA (SEQ ID NO. 43); Alk-Npml Clone 4,
  • FIG. 4 shows comparison of dual and single sgRNA-expressing plasmids.
  • RNAs were analysed by northern blotting with probes against the Alk (left) or Eml4 (right) sgRNAs.
  • Fig. 5 shows induction of the Eml4-Alk inversion in primary MEFs using an adenoviral vector expressing FLAG-Cas and tandem sgRNAs.
  • Panel (a) Schematic of the Adenoviral vectors.
  • Panel (d) PCR-mediated detection of the Eml4-Alk inversion in MEFs infected with Ad- Cas9 or Ad-EA for the indicated number of days.
  • Panel (e) Standard curve generated performing quantitative PCR analysis on genomic DNA containing a known fraction of Eml4-Alk alleles. Average of two independent experiments.
  • Panel (f) Quantification of the fraction of MEFs harbouring the Eml4-Alk inversion at the indicated time points after infection with Ad-EA or Ad-Cas9. Values are mean of three independent infections ⁇ s.d.
  • Fig. 6 is a composite showing that lung tumors induced by Ad-EA infection harbor the Eml4-Alk inversion.
  • Panel (a) Detection of the wild type Eml4 locus and Eml4- Alk inversion in micro-dissected tumors from Ad-EA-infected mice using a three-primer PCR strategy.
  • Panel (b) RNAs extracted from the same tumors shown in Panel (a) were reverse- transcribed and amplified using a three-primer strategy to detect the Eml4 and Eml4-Alk transcripts.
  • Fig. 7 is a composite showing Ad-EA-induced lung tumors respond to crizotinib treatment.
  • Panel (a) Schematic of the experiment.
  • Panel (b) Representative ⁇ CT of the lungs of mice treated with crizotinib or vehicle at day 0 and after 2 weeks of treatment. Lung tumors are indicated by arrows. Asterisks mark the hearts.
  • Panel (c) Macroscopic appearance of the lungs after 2 weeks of treatment.
  • Panel (e) Higher magnification of representative haematoxylin and eosin stained lung sections from crizotinib-treated mice showing residual atrofic foci of tumor cells (left) or necrotic-inflammatory debris (right).
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats, which can also be known as SPIDRs (Spacer Interspersed Direct Repeats.
  • SPIDRs Spacer Interspersed Direct Repeats.
  • CRISPR are a family of DNA loci that are normally associated with a particular bacterial species.
  • the CRISPR locus represents a particular class of interspersed short sequence repeats (SSRs) that were recognized in E. coli. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and
  • the CRISPR loci usually differs from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs).
  • SRSRs short regularly spaced repeats
  • the repeats are short elements that appear in regularly spaced clusters with unique intervening sequences of a substantially constant length.
  • the repeat sequences are highly conserved between strains, but the number of interspersed repeats and the sequences of the spacer regions usually differs from strain to strain.
  • CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas") genes, including sequences encoding a Cas gene, a guide sequence (also referred to as a "spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
  • CRISPR-associated genes including sequences encoding a Cas gene, a guide sequence (also referred to as a "spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
  • one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system.
  • one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.
  • a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system).
  • target sequence refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
  • a target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides.
  • a target sequence is located in the nucleus or cytoplasm of a cell.
  • the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.
  • sgRNA As used herein, the terms "sgRNA”, “guide RNA”, “single guide RNA” and “synthetic guide RNA” are interchangeable and refer to the polynucleotide sequence comprising the guide sequence.
  • guide sequence refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms “guide” or "spacer.”
  • polynucleotide As used herein, the terms “polynucleotide”, “nucleotide”, “nucleotide sequence”, “nucleic acid” and “oligonucleotide” are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown.
  • polynucleotides coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • loci locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched poly
  • a polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non-traditional types.
  • a percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme.
  • a sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.
  • the terms "subject,” “individual,” and “animal” are used interchangeably herein to refer to a vertebrate, preferably a mammal.
  • the term “mammal” or “mammalian” includes, but is not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
  • administered includes delivery by viral or non-viral techniques.
  • Viral delivery mechanisms include but are not limited to adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, etc as described above.
  • Non-viral delivery mechanisms include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
  • compositions for inducing specific chromosomal rearrangements in vivo comprises an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs).
  • the expression vector when introduced into a mammalian cell, is capable of expressing the Cas gene and the two or more distinct single guide RNAs (sgRNAs) in vivo and causing chromosomal rearrangement of a DNA sequence between two chromosomal loci targeted by the two or more sgRNAs (target loci).
  • the two target loci are separated by a genomic sequence of greater than lOkb, 30kb, lOOkb, 300kb, 1Mb, 3 Mb or 10 Mb. In some embodiment, the two target loci are separated by a genomic sequence of 10kb-30kb, lOkb-lOOkb, 10kb-300kb, lOkb-IMb, 10kb-3 Mb, lOkb-10 Mb, 10kb-30 Mb, lOkb-lOOMb, 30kb-100kb, 30kb-300kb, 30kb-lMb, 30kb-3 Mb, 30kb-10 Mb, 30kb-30 Mb, 30kb-100Mb, 100kb-300kb, lOOkb-IMb, 100kb-3 Mb, lOOkb-lO Mb, 100kb-30 Mb, lOOkb- 100Mb, 300kb-lMb, 300kb-3 Mb,
  • the two or more distinct sgRNAs comprise sgRNAs targeting Eml4 and Alk sites. In other embodiments, the two or more distinct sgRNAs comprise sgRNAs targeting Npml and Alk sites.
  • chromosomal rearrangement refers to all possible allele combination of the sequences between two target loci on a chromosome, including but are not limited to, indels, inversions and deletions.
  • the Cas gene encodes a RNA-guided DNA endonuclease enzyme that forms a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins), which results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence.
  • a CRISPR complex comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins
  • Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf , homo logs thereof, or modified versions thereof.
  • the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9.
  • the CRISPR enzyme is Cas9, and may be Cas9 from S.
  • the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. Guide Sequences
  • a guide sequence is any polynucleotide sequence with sufficient
  • the degree of complementarity, when optimally aligned using a suitable alignment algorithm, between a guide sequence and its corresponding target sequence is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
  • Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, such as known to those of skill in the art.
  • a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.
  • a guide sequence may be selected to target any target sequence.
  • the target sequence is a sequence within a genome of a cell.
  • Exemplary target sequences include those that are unique in the target genome.
  • the expression vector can be a viral vector (such as a recombinant adenovirus) or a non- viral vector (such as a plasmid).
  • the expression vector comprises a Cas expression cassette comprising a regulatory element operationally linked to the Cas gene, and a sgRNA expression cassette comprising a regulatory element
  • the expression vector comprises a Cas expression cassette comprising a regulatory element operationally linked to the Cas gene, and sgRNA expression cassettes for each of the two or more sgRNAs.
  • Each sgRNA expression cassette comprises regulatory element operationally linked to a DNA sequence encoding a sgRNA.
  • the regulatory element may comprise a promoter, an enhancer or both.
  • the promoter can be a constitutive promoter, a tissue specific promoter or an inducible promoter.
  • the Cas gene and the sgRNA in the expression vector are under the control of a regulatable expression system.
  • the term "operationally linked to” refers to the joining of an encoding nucleic acid sequence to a regulatory element which results in the biological production of the desired polynucleotide or polypeptide.
  • constitutive promoters include, but are not limited to, CMV promoter, SV40 promoter, CBh (Chicken Beta Action Short), Pgk promoter, HI promoter, promoter and U6 promoter.
  • tissue specific promoters include, but are not limited to, promoters that direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes).
  • Examples of regulatable expression system include, but are not limited to Tet- on/off system, Ecdysone system, progesterone system and rapamycin system.
  • the Tet-on/off system is based on two regulatory elements derived from the tetracycline-resistance operon of the E. coli TnlO transposon: the tet repressor protein (TetR) and the Tet operator DNA sequence (tetO) to which TetR binds.
  • TetR tet repressor protein
  • tetO Tet operator DNA sequence
  • the "regulator” plasmid encodes a hybrid protein containing a mutated Tet repressor (rtetR) fused to the VP 16 activation domain of herpes simplex virus.
  • the "reporter” plasmid contains a tet-responsive element (TRE), which controls the
  • reporter gene of choice.
  • the rtetR-VP16 fusion protein can only bind to the TRE, therefore activates the transcription of the "reporter” gene, in the presence of tetracycline.
  • the ecdysone system is based on the molting induction system found in Drosophila, but modified for inducible expression in mammalian cells.
  • the system uses an analog of the drosophila steroid hormone ecdysone, muristerone A, to activate expression of the gene of interest via a heterodimeric nuclear receptor. Expression levels have been reported to exceed 200-fold over basal levels with no effect on mammalian cell physiology.
  • the progesterone receptor is normally stimulated to bind to a specific DNA sequence and to activate transcription through an interaction with its hormone ligand.
  • the progesterone antagonist mifepristone (RU486) is able to block hormone- induced nuclear transport and subsequent DNA binding.
  • a mutant form of the progesterone receptor that can be stimulated to bind through an interaction with RU486 has been generated.
  • the RU486-binding domain of the progesterone receptor has been fused to the DNA-binding domain of the yeast transcription factor GAL4 and the transactivation domain of the HSV protein VP 16.
  • the chimeric factor is inactive in the absence of RU486.
  • the addition of hormone induces a conformational change in the chimeric protein, and this change allows binding to a GAL4-binding site and the activation of transcription from promoters containing the GAL4- binding site.
  • the rapamycin system uses an immunosuppressive agent an inducer.
  • FKBP FK506-binding protein
  • FRAP rapamycin binding protein
  • the ability to bring two proteins together by addition of a drug potentiates the regulation of a number of biological processes, including transcription.
  • a chimeric DNA-binding domain has been fused to the FKBP, which enables binding of the fusion protein to a specific DNA- binding sequence.
  • a transcriptional activation domain also has been fused to FRAP.
  • a fully functional transcription factor can be formed by heterodimerization mediated by addition of rapamycin.
  • the dimerized chimeric transcription factor can then bind to a synthetic promoter sequence containing copies of the synthetic DNA-binding sequence.
  • the expression vector comprises three expression cassettes: a Cas expression cassette comprising a Cas9 gene under the control of a CBh promote and two sgRNA expression cassettes, each comprising a U6 promoter and the coding sequences of a distinct sgRNA.
  • the two sgRNA expression cassettes comprise coding sequences for sgRNAs targeting the Alk and Eml4 gene.
  • the two sgRNA expression cassettes comprise coding sequences for sgRNAs targeting the Alk and Npml gene.
  • the expression vector also comprises an enhancer element, such as WPRE; CMV enhancers and the R-U5' segment in LTR of HTLV-I.
  • an enhancer element such as WPRE; CMV enhancers and the R-U5' segment in LTR of HTLV-I.
  • the expression vector of the present application is a viral vector.
  • Viruses are logical tools for gene delivery. They replicate inside cells and therefore have evolved mechanisms to enter the cells and use the cellular machinery to express their genes. The concept of virus-based gene delivery is to engineer the virus so that it can express the gene of interest. Depending on the specific application and the type of virus, most viral vectors contain mutations that hamper their ability to replicate freely as wild-type viruses in the host.
  • viruses from several different families have been modified to generate viral vectors for gene delivery. These viruses include retroviruses, lentivirus, adenoviruses, adeno- associated viruses, herpes simplex viruses, picornaviruses, and alphaviruses.
  • RNA or DNA viral based systems targeting a virus to specific cells in the body can be used for the delivery of nucleic acids and trafficking the viral payload to the nucleus.
  • Viral vectors can be administered directly to subjects (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to subjects (ex vivo).
  • Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods.
  • the expression vector of the present application is an adenoviral vector.
  • the adenovirus is a double-stranded, linear DNA virus that does not go through an R A intermediate.
  • Human adenovirus group C serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections in the young.
  • Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division.
  • the adenoviruses/adenoviral vectors in aspects of the present application may be of human or animal origin.
  • preferred adenoviruses are those classified in group C, in particular the adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2). More preferably, it is an Ad2 or Ad5 adenovirus.
  • canine adenovirus mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al, 1993, J Virol 67:3777-3785) may be used.
  • avian adenovirus such as CELO virus
  • animal adenoviruses it is preferred to use adenoviruses of canine origin, and especially the strains of the CAV2 adenoviruses [manhattan strain or A26/61 (ATCC VR-800) for example].
  • the organization of the adenovirus genome is similar in all of the adenovirus groups and specific functions are generally positioned at identical locations for each serotype studied.
  • the genome of adenoviruses comprises an inverted terminal repeat (ITR) at each end, an encapsidation sequence (Psi), early genes and late genes.
  • ITR inverted terminal repeat
  • Psi encapsidation sequence
  • the main early genes have been classified into an array of intermediate early (Ela), delayed early (Elb, E2a, E2b, E3 and E4), and intermediate regions.
  • the adenoviral vector comprises a deletion in the El, E2, E3 and/or E4 region in the viral genome.
  • a heat-sensitive point mutation has been introduced into the tsl25 mutant, making it possible to inactivate the 72 kDa DNA-binding protein (DBP).
  • the adenoviral vector comprises a deletion in the El region of its genome. In some embodiments, the adenoviral vector comprises a deletion in the Ela and Elb regions.
  • the adenoviral vector comprise a deletion in the E4 region.
  • the E4 region is involved in the regulation of the expression of the late genes, in the stability of the late nuclear RNAs, in decreasing host cell protein expression and in the efficiency of the replication of the viral DNA.
  • the adenoviral vector comprise deletions in both the El and the E4 region. Adenoviral vectors in which the El and E4 regions are deleted therefore possess very reduced viral gene expression and transcriptional background noise.
  • the adenoviral vector is a "gutless" adenoviral vector in which all the viral genes are deleted.
  • the adenoviral vectors of the present application may possess other alterations in their genome.
  • other regions may be deleted to increase the capacity of the virus and reduce its side effects linked to the expression of viral genes.
  • all or part of the E3 or IVa2 region in particular may be deleted.
  • the E3 region it may however be particularly preferred to conserve the part encoding the gpl9K protein. This protein indeed makes it possible to prevent the adenoviral vector from becoming the subject of an immune reaction which (i) would limit its action and (ii) could have undesirable side effects.
  • the E3 region is deleted and the sequence encoding the gpl9K protein is reintroduced under the control of a heterologous promoter.
  • the cas gene and the coding sequences for sgR As can be inserted into various sites of the recombinant viral genome. It can be inserted into the El, E3 or E4 region, as a replacement for the deleted or surplus sequences. It can also be inserted into any other site, outside the sequences necessary in cis for the production of the viruses (ITR sequences and encapsidation sequence).
  • the adenoviral vector is replication deficient. In other embodiments, the adenoviral vector is a replication-competent adenoviral vector.
  • the expression vector is a retroviral vector.
  • Retroviruses are RNA viruses that replicate through an integrated DNA intermediate.
  • Retroviral particles encapsidate two copies of the full-length viral RNA, each copy containing the complete genetic information needed for virus replication.
  • Retroviruses possess a lipid envelope and use interactions between the virally encoded envelope protein that is embedded in the membrane and a cellular receptor to enter the host cells.
  • virally encoded enzyme reverse transcriptase which is present in the virion, viral RNA is reverse transcribed into a DNA copy.
  • This DNA copy is integrated into the host genome by integrase, another virally encoded enzyme.
  • the integrated viral DNA is referred to as a provirus and becomes a permanent part of the host genome.
  • the cellular transcriptional and translational machinery carries out expression of the viral genes.
  • the host RNA polymerase II transcribes the provirus to generate RNA, and other cellular processes modify and transport the RNA out of the nucleus.
  • a fraction of viral RNAs are spliced to allow expression of some genes whereas other viral RNAs remain full-length.
  • the host translational machinery synthesizes and modifies the viral proteins.
  • the newly synthesized viral proteins and the newly synthesized full-length viral RNAs are assembled together to form new viruses that bud out of the host cells.
  • Retroviruses can also be classified into oncoviruses, lentiviruses, and spumaviruses. Most oncoviruses are simple retroviruses. Lentiviruses, spumaviruses, and some oncoviruses are complex retroviruses.
  • Murine leukemia virus (MLV) is example of an oncovirus
  • human immunodeficiency virus 1 (HIV-1) is an example of a lentivirus
  • human foamy virus is an example of a spumavirus.
  • the viral vector is a lentiviral vector.
  • Retroviral vectors are comprised of czs-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum czs-acting LTRs are sufficient for replication and packaging of the vectors. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof.
  • MiLV murine leukemia virus
  • GaLV gibbon ape leukemia virus
  • SIV Simian Immunodeficiency virus
  • HAV human immunodeficiency virus
  • the retroviral vector is a self-inactivating retroviral vector. After gene delivery, the vector will delete some of the cis-acting elements needed to complete another round of replication. Therefore, even in the presence of a replication- competent virus, these vectors cannot be transferred to other target cells efficiently.
  • HSV Herpes Simplex Virus
  • AAV adeno-associated virus
  • vesicular stomatitis virus vectors vaccinia virus vectors
  • SV-40-based viral vectors SV-40-based viral vectors.
  • Non-viral vectors include Herpes Simplex Virus (HSV) vector, adeno-associated virus (AAV) vectors, vesicular stomatitis virus vectors, vaccinia virus vectors and SV-40-based viral vectors.
  • the expression vector of the present application is a non- viral expression vector, such as a plasmid comprising one or more expression cassettes.
  • the non- viral expression vector may be administered using a delivery agent/method such as lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes,
  • Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
  • kits for inducing specific chromosomal rearrangements in vivo comprises: an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs); and one or more reagents for delivering the expression vector into a mammalian cell, wherein the expression vector is capable of expressing the Cas gene and the two or more sgRNAs inside the cell and causing chromosomal rearrangement between two chromosomal loci targeted by the two or more sgRNAs.
  • the expression vector is an adenoviral viral vector.
  • the kit further comprises instructions for how to use the kit.
  • Another aspect of the present application relates to a method for inducing specific chromosomal rearrangements in vivo.
  • the method comprises the steps of administering into a subject an effective amount of an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs), wherein the expression vector expresses the Cas gene and the two or more sgRNAs inside a target cell and causes chromosomal rearrangement between two chromosomal loci targeted by the two or more sgRNAs.
  • sgRNAs single guide RNAs
  • the two or more distinct sgRNAs consist of sgRNAs targeting Eml4 and Alk sites. In other embodiments, the two or more distinct sgRNAs consist of sgRNAs targeting Npml and Alk sites.
  • the expression vector is a viral vector. In a particular embodiment, the viral vector is an adenoviral vector. In some embodiments, the expression vector is a non-viral vector.
  • the method is utilized to correct a genomic deficiency in certain somatic or germ line cells. In other embodiments, the method is used to create animal models with conditions resulting from chromosomal rearrangement.
  • the present application relates to a method for inducing specific chromosomal rearrangements in vivo to create an animal model of human non-small cell lung cancer (NSCLC).
  • the method comprises infecting somatic cells in a subject with a viral vector capable of expressing the Cas9 gene and sgR As targeting Eml4 and Alk sites, wherein the infection results in development of tumors harboring the Eml4-Alk inversion in the subject.
  • the CRISPR-based strategy described herein offers several advantages over germline engineering via transgenesis or homologous recombination. By inducing the rearrangement in only a subset of somatic cells, the resulting lesions more closely recapitulate the stochastic nature of tumor formation in humans. In addition, by modifying the endogenous loci, expression of the resulting fusion genes is subjected to physiologic transcriptional and post-transcriptional regulation, accurately modelling the reduced dosage of the wild-type alleles and the expression of the reciprocal product of the
  • the method requires only the generation of an appropriate viral vector and no germline manipulations, it can be readily adapted to model chromosomal rearrangements in other species, including non-human primates, and as such will facilitate the study of species-specific differences in tumor progression and therapy response in vivo.
  • Another aspect of the present application relates to an animal produced by the methods of inducing an in vivo chromosomal rearrangement described herein, wherein the animal has NSCLCs that harbor the Eml4-Alk inversion, express the Eml4-Alk fusion gene, display histopathologic and molecular features typical of Alk+ human NSCLCs, and respond to treatment with A / ⁇ -inhibitors.
  • the animal is a mouse, a rat, a chimpanzee, a monkey, a sheep, a rabbit, a guinea pig, a frog, a zebrafish or any laboratory test animal as would be known to one of ordinary skill in the art.
  • the animal produced by the methods of inducing an in vivo chromosomal rearrangement described herein provides unique opportunities to dissect the molecular mechanisms of diseases related to the chromosomal rearrangement, to test the efficacy of targeted therapies, and to investigate the mechanisms of drug resistance in vivo.
  • one or more expression vectors described herein are used to produce a non-human transgenic animal.
  • the animal is a mammal, such as a mouse, rat, or rabbit.
  • Methods for producing transgenic animals are known in the art, and generally begin with a method of cell transfection, such as is known in the art.
  • the animal may be useful in applications outside of providing a disease model.
  • transgenic animals especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
  • Eml4 and Alk are located on chromosome 17, approximately 11 megabases (Mb) apart, in a region that is syntenic to human chromosome 2(p2 l-p23) (Fig. 1 , panel (a)).
  • the most common EML4-ALK variant in human NSCLCs is modeled by introducing concomitant double-strand DNA breaks at intron 14 of Eml4 (which corresponds to intron 13 of EML4) and at intron 19 of Alk (Fig. 1, panels (a) and (b) and Fig. 2).
  • To induce the DNA breaks the CRISPR system was chosen because it only requires co- expression of Cas9 and an appropriately designed single guide RNA molecule (sgRNA).
  • the second U6-sgRNA cassette was amplified using primers containing the Xbal and Kpnl sites and cloned into the pX330 construct containing the appropriate sgRNA.
  • pX33Q-Alk-Eml4 vector was modified by adding an Xhol site upstream the first U6 promoter.
  • An EcoRI/XhoI fragment containing the double U6-sgRNA cassette and the Flag-tagged Cas9 was then ligated the EcoRI/XhoI-digested pacAd5 shuttle vector.
  • NIH/3T3 cells were transfected in 6- well plates with 3 ⁇ g of total plasmid DNA per well using lipofectamine 2000 (Invitrogen) following the manufacturer's instructions.
  • transfections included 1 ⁇ g of a plasmid expressing the Puro-resistance gene (pSico) and cells were incubated with 2 ⁇ g ml-1 puromycin for 2 days.
  • Recombinant adenoviruses were generated by Viraquest (Ad-EA and Ad-Cas9) or purchased from the University of Iowa (Ad-Cre).
  • MEFs infections were performed by adding adenovirus (3 x 10 6 p.f.u.) to each well of a 6- well plate.
  • NIH/3T3 subclone was first isolated carrying a mono-allelic Eml4-Alk inversion validated by interphase FISH. Genomic DNA extracted from this clone was mixed with increasing amounts of genomic DNA from parental NIH/3T3 cells to generate a series of standards containing known percentage of Eml4-Alk alleles.
  • the standards and the test samples were then subjected to quantitative PCR (Applied Biosystem) using primers amplifying the Eml4-Alk junction (Eml4-for and Alk-rev, see Table 1) or a control gene (miR-17 ⁇ 92-gDNA-for and miR-17 ⁇ 92-gDNA-rev) and the fraction ofEml4-Alk alleles in the test was calculated by plotting the AACt values on the standard curve. qPCR analysis was performed using SYBR Green (Life Technology).
  • MEFs were generated from E14.5 wild-type embryos following standard procedures.
  • NIH/3T3 were purchased from ATCC.
  • EXAMPLE 2 DELIVERY OF sgRNA/Cas9 USING ADENOVIRAL VECTORS
  • plasmids were engineered to simultaneously express Cas9 and two distinct sgRNAs from tandem U6 promoters (Fig. 4, panel (a)). Their transfection in NIH/3T3 cells resulted in comparable levels of the two sgRNAs, efficient cleavage at the targeted sites, and accumulation of the Eml4-Alk inversion (Fig. 4, panels (b)-(d)).
  • Adenoviral vectors are ideal because they efficiently infect the lung epithelium of adult mice and do not integrate into the host genome.
  • Infection of mouse embryo fibroblasts (MEFs) with Ad-EA led to the expression of Cas9 and both sgRNAs, and to the rapid generation of the desired Eml4-Alk inversion (Fig. 5, panels (b) and (c)).
  • the Eml4-Alk inversion was estimated to occur in approximately 3-4% of infected MEFs (Fig. 5, panels (d)-(e)).
  • mice were purchased from The Jackson Laboratory (C57BL/6J) or from Charles River (CD1) and housed in the SPF Memorial Sloan-Kettering Cancer Center Institutional Animal Care and Use Committee, where the health status of the colony is constantly monitored by the veterinary staff and by a sentinel program.
  • ketamine 80 mg per kg
  • xylazine 10 mg per kg
  • intratracheal instillation of 1.5 x 10 8 PFU adenovirus/mouse as previously described (DuPage et al, Nature Protocols, 2009, 4: 1064-1072).
  • Investigators were not blinded with respect to which adenovirus was injected. All studies and procedures were approved by the MSKCC Institutional Animal Care and Use Committee.
  • the genomic region flanking the CRISPR/Cas9 target site was first amplified by PCR. After a cycle of melting and re-annealing to allow heteroduplex formation, the amplicon was digested with the surveyor nuclease (Transgenomic) for 1 h at 42 °C according to the manufacturer's directions and the digestion products were separated on a 2% agarose gel.
  • the surveyor nuclease Transgenomic
  • Interphase FISH experiments were performed and interpreted by the MSKCC cytogenetic core using a 3 -colour probe mix designed to detect and discriminate between Alk-Eml4 fusion and other rearrangements of Alk.
  • the probe mix comprised mouse BAC clones mapping to: 3' Alk (17qE1.3, RP23-306H20, RP23-397M18 labelled with Green dUTP), 5' Alk (17qE1.3, RP23-12H17, RP23-403F20 labelled with Red dUTP), and 5' Eml4 (17qE4, RP23-193B15 labelled with Orange dUTP). Probe labelling, hybridization, washing, and fluorescence detection were done according to standard procedures.
  • Ad-EA-induced lung tumors was examined, a dual ALK/MET inhibitor used in the clinic to treat patients affected by ALK+ NSCLCs.
  • Lungs were inflated by intratracheal injection of 4% paraformaldehyde (PFA), incubated for 18-24 h in 4% PFA, and then transferred to 70% ethanol for at least 24 h before further processing.
  • the following antibodies were used: phospho-Stat3 (Tyr705, Cell Signaling Technology #9135, 0.1 ⁇ g mf 1 ); phospho-Erkl/2 (Thr202/Tyr204, Cell Signaling Technology #4370 1 ⁇ g ml l ); phospho-Akt (Ser473, Cell Signaling Technology #4060 1 ⁇ g mf 1 ); Nkx-2.1 (Epitomics, EP1584Y 1 : 1,200); FLAG (Sigma, M2 1 : 1,000); P63 (Santa Cruz (H-137) sc8343, 1 : 1,000); Sox2 (Cell Signaling Technology, C70B1 #3728, 1 : 1,000);
  • CC10/CCSP (Millipore, 07-623, 1 :2,000); SpC (Millipore, AB3786, 1 : 1,000).
  • ⁇ CT Scans were performed on the Mediso Nano SPECT/CT System covering only the lung fields of each mouse. Each scan averaged approximately 5 min using 240 projections with an exposure time of 1,000 ms set at a pitch of 1 degree. The tube energy of the X-ray was 55 kVp and 145 ⁇ . The in-plane voxel sizes chosen were small and thin creating a voxel size of 73 x 73 x 73 ⁇ . The final reconstructed image consisted of 368 x 368 x 1,897 voxels. Scans were analysed with the Osirix software.
  • mice were randomized to receive either control vehicle (water) or crizotinib at 100 mg/kg p.o. daily for at least 14 consecutive days. Mice were monitored daily for weight loss and clinical signs. Investigators were not blind with respect to treatment.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

A method for inducing specific chromosomal rearrangements in vivo using the CRISPR/Cas system is disclosed. The method may be used to introduce chromosomal rearrangement in vivo and to generate animal models of human diseases, such as a mouse model of Eml4-Alk-driven non- small cell lung cancer.

Description

COMPOSITION AND METHOD FOR IN VIVO ENGINEERING OF
CHROMOSOMAL REARRANGEMENTS
[0001] This application claims priority from U.S. Provisional Application No.
62/063,728, filed October 14, 2014. The entirety of the aforementioned application is incorporated by reference.
FIELD
[0002] The present application relates generally to the field of genetic engineering and in particular to compositions and methods for inducing chromosomal rearrangements in vivo.
BACKGROUND
[0003] Chromosomal rearrangements have a central role in the pathogenesis of human cancers and often result in the expression of therapeutically actionable gene fusions. A recently discovered example is a fusion between the genes echinoderm microtubule- associated protein like 4 (Eml4) and anaplastic lymphoma kinase (Alk), generated by an inversion on the short arm of chromosome 2: inv(2)(p21p23). The Eml4-Alk oncogene is detected in a subset of human non-small cell lung cancers (NSCLC) and is clinically relevant because it confers sensitivity to Alk inhibitors. Despite their importance, modelling such genetic events in mice has proven challenging and requires complex manipulation of the germline.
SUMMARY
[0004] One aspect of the present application relates to a method for inducing chromosomal rearrangements in vivo. The method comprises administering into a subject an effective amount of an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs), wherein the expression vector expresses the Cas gene and the two or more sgRNAs in vivo and causes chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs.
[0005] Another aspect of the present application relates to a mouse produced by the method described above, wherein the mouse has non-small cell lung cancer (NSCLC) cells harboring an Eml4-Alk inversion and expressing an Eml4-Alk fusion gene.
[0006] Another aspect of the present application relates to a composition for inducing specific chromosomal rearrangements in vivo. The composition comprises an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs); wherein the expression vector is capable of expressing the Cas gene and the two or more sgRNAs in vivo and causing chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs.
[0007] Another aspect of the present application relates to a kit for inducing specific chromosomal rearrangements in vivo. The kit comprises the composition described above and a reagent for introducing the expression vector into a cell in vivo.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The above and other objects and advantages of the application will be apparent upon consideration of the following detailed description, taken in conjunction with the accompanying figures.
[0009] Fig. 1 is a composite showing induction of Eml4-Alk rearrangement in murine cells using the CRISPR-Cas9 system. Panel (a): Schematic of the In(17) involving the Eml4 and Alk loci. The smaller arrows indicate the sites recognized by the sgRNAs. Panel (b): A schematic of the loci before and after the inversion with the location of the primers used (top). PCRs were performed on genomic DNA extracted from NIH/3T3 cells transfected with the indicated pX330 constructs (middle). The PCR bands were sub-cloned and the sequences of four independent clones and a representative chromatogram are shown (EmU- Alk Predicted, GGGTCTACTATGTAAGGCTA (SEQ ID NO. 23); Alk-EmU Predicted, ATGTCTATCTGGAAGGAGCC (SEQ ID NO. 24); EmU-Alk Clone 1,
GGGTCTACTATGTAAGGCTA (SEQ ID NO. 25); Alk-EmU Clone 1,
ATGTCTATCTGGAAGGAGCC (SEQ ID NO. 26); EmU-Alk Clone 2,
GGGTCTACTATGTAAGGCTA (SEQ ID NO. 27); Alk-EmU Clone 2, ATGTCTA— GGAAGGAGCC (SEQ ID NO. 28); EmU-Alk Clone 3, GGGTCTACT--GTAAGGCTA (SEQ ID NO. 29); Alk-EmU Clone 3, ATGTCTA— GGAAGGAGCC (SEQ ID NO. 30); EmU-Alk Clone 4, GGGTCTACT--GTAAGGCTA (SEQ ID NO. 31); Alk-EmU Clone 4,
ATG GAGCC (SEQ ID NO. 32)) (bottom). Panel (c): Schematic of the EmU-Alk fusion transcript (top). Detection of the EmU-Alk fusion transcript by RT-PCR on total RNAs extracted from NIH/3T3 cells transfected with the indicated pX330 constructs (bottom left). Sequence of the PCR product showing the correct EmU-Alk junction is shown {EmU- Alk Predicted, GGACCTAAAGTGTACCGTCG (SEQ ID NO. 33); EmU-Alk Observed, GGACCTAAAGTGTACCGTCG (SEQ ID NO. 34); (bottom right).
[0010] Fig. 2 is a schematic of the break-apart interphase FISH strategy. In cells with the EmU-Alk inversion, the 5 'Alk and 3 'Alk probes become separated, and the 3 'Alk and 5 ' EmU probes become juxtaposed. . [0011] Fig. 3 shows induction of the Npml-^4/ translocation in NIH/3T3 cells.
Panel (a): Schematic of the Npml-^4/ translocation. Smaller arrows indicate the sites recognized by the sgRNAs. Panel (b): Sequences recognized by the sgRNAs and location of primers used to detect the Npml-^4/ and ^4/ -Npml rearrangement (top). PCR on genomic DNA extracted from NIH/3T3 co-transfected with pX330 constructs expressing the indicated sgRNAs (middle). Sequences of four independent subclones obtained from the PCR products and representative chromatogram are shown {Npml-Alk Predicted,
AATGTGTTTTGTAAGGCTA (SEQ ID NO. 35); Alk-Npml Predicted,
CATGTCTATCTGGTTGGGTT (SEQ ID NO. 36); Npml-Alk Clone 1,
AATGTGTTTTGTAAGGCTA (SEQ ID NO. 37); Alk-Npml Clone 1,
CATGTCTATCTGGTTGGGTT (SEQ ID NO. 38); Npml-Alk Clone 2,
AATGTGTTTTGTAAGGCTA (SEQ ID NO. 39); Alk-Npml Clone 2,
CATGTCTATCTGGTTGGGTT (SEQ ID NO. 40); Npml-Alk Clone 3,
AATGTGTTTTGTAAGGCTA (SEQ ID NO. 41); Alk-Npml Clone 3,
CATGTCTATCTGGTTGGGTT (SEQ ID NO. 42); Npml-Alk Clone 4,
AATGTGTTTTGTAAGGCTA (SEQ ID NO. 43); Alk-Npml Clone 4,
CATGTCTATCTGGTTGGGTT (SEQ ID NO. 44)) (bottom). Panel (c): Detection of the Npml-^4/ fusion transcript by RT-PCR on total RNAs extracted from NIH/3T3 cells co- transfected with the indicated pX330 constructs (left). The PCR band was extracted and sequenced to confirm the presence of the correct Npml-^4/ junction (bottom-right).
Representative results from two independent experiments are shown {Npml-Alk Predicted, CATCTAGTAGTGTACCGTCG (SEQ ID NO. 45); Npml-Alk Observed,
CATCTAGTAGTGTACCGTCG (SEQ ID NO. 46).
[0012] Fig. 4 shows comparison of dual and single sgRNA-expressing plasmids. Panel (a): Schematic of pX330 (A) and its derivatives (B-E) used in these experiments.
NIH/3T3 were transfected with these constructs and lysed to extract total RNA and genomic DNA. Panel (b): RNAs were analysed by northern blotting with probes against the Alk (left) or Eml4 (right) sgRNAs. Panels (c) and (d): The DNA samples were subjected to surveyor assays (Panel (c)), or amplified by PCR to detect the Eml4-Alk inversion (Panel (d)).
[0013] Fig. 5 shows induction of the Eml4-Alk inversion in primary MEFs using an adenoviral vector expressing FLAG-Cas and tandem sgRNAs. Panel (a): Schematic of the Adenoviral vectors. Panel (b): Immunoblot using an anti-FLAG antibody on lysates from MEFs infected with the indicated adenoviruses. Panel (c): Small-RNA northerns using probes against sgEml4 and sgAlk on total RNAs from cells infected with Ad-Cas9 or Ad-EA. Panel (d): PCR-mediated detection of the Eml4-Alk inversion in MEFs infected with Ad- Cas9 or Ad-EA for the indicated number of days. Panel (e): Standard curve generated performing quantitative PCR analysis on genomic DNA containing a known fraction of Eml4-Alk alleles. Average of two independent experiments. Panel (f): Quantification of the fraction of MEFs harbouring the Eml4-Alk inversion at the indicated time points after infection with Ad-EA or Ad-Cas9. Values are mean of three independent infections ± s.d.
[0014] Fig. 6 is a composite showing that lung tumors induced by Ad-EA infection harbor the Eml4-Alk inversion. Panel (a): Detection of the wild type Eml4 locus and Eml4- Alk inversion in micro-dissected tumors from Ad-EA-infected mice using a three-primer PCR strategy. Panel (b): RNAs extracted from the same tumors shown in Panel (a) were reverse- transcribed and amplified using a three-primer strategy to detect the Eml4 and Eml4-Alk transcripts. Panel (c): RT-PCR detection (left) of the full length EmU-Alk cDNA (-3.2 Kb) in the tumors shown in Panel (a). The full-length PCR products were sequenced on both strands. A chromatogram of the EmU-Alk junction is shown (right). Observed sequence: GGACCTAAAGTGTACCGTCG (SEQ ID NO. 47); Predicted sequences
GGACCTAAAGTGTACCGTCG (SEQ ID NO. 48). Panel (d): Representative
immunohistochemistry of Ad-EA-induced lung tumors decorated with antibodies against the indicated phospho-proteins. A bar-plot of staining intensity for the indicated phospho- proteins is also shown. Tumors from two mice for each group were scored.
[0015] Fig. 7 is a composite showing Ad-EA-induced lung tumors respond to crizotinib treatment. Panel (a): Schematic of the experiment. Panel (b): Representative μCT of the lungs of mice treated with crizotinib or vehicle at day 0 and after 2 weeks of treatment. Lung tumors are indicated by arrows. Asterisks mark the hearts. Panel (c): Macroscopic appearance of the lungs after 2 weeks of treatment. Panel (d): Low magnification of lung sections from two crizotinib-treated and 2 vehicle-treated mice (haematoxylin and eosin). Panel (e): Higher magnification of representative haematoxylin and eosin stained lung sections from crizotinib-treated mice showing residual atrofic foci of tumor cells (left) or necrotic-inflammatory debris (right).
DETAILED DESCRIPTION
[0016] Some modes for carrying out the present invention are presented in terms of its exemplary embodiments, herein discussed below. However, the present invention is not limited to the described embodiment and a person skilled in the art will appreciate that many other embodiments of the present invention are possible without deviating from the basic concept of the present invention, and that any such work around will also fall under scope of this application. It is envisioned that other styles and configurations of the present invention can be easily incorporated into the teachings of the present invention, and only one particular configuration shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope.
[0017] Headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description or the claims. As used throughout this application, the word "may" is used in a permissive sense (i.e., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). The terms "a" and "an" herein do not denote a limitation of quantity, but rather denote the presence of at least one of the referenced items.
Definitions
[0018] The term "CRISPR" as used herein, refers to Clustered Regularly Interspaced Short Palindromic Repeats, which can also be known as SPIDRs (Spacer Interspersed Direct Repeats. CRISPR are a family of DNA loci that are normally associated with a particular bacterial species. The CRISPR locus represents a particular class of interspersed short sequence repeats (SSRs) that were recognized in E. coli. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and
Mycobacterium tuberculosis. The CRISPR loci usually differs from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs). Generally, the repeats are short elements that appear in regularly spaced clusters with unique intervening sequences of a substantially constant length. The repeat sequences are highly conserved between strains, but the number of interspersed repeats and the sequences of the spacer regions usually differs from strain to strain.
[0019] As used herein, "CRISPR system" refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding a Cas gene, a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast.
[0020] As used herein, the terms "sgRNA", "guide RNA", "single guide RNA" and "synthetic guide RNA" are interchangeable and refer to the polynucleotide sequence comprising the guide sequence. The term "guide sequence" refers to the about 20 bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms "guide" or "spacer."
[0021] As used herein, the terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
[0022] As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). [0023] As used herein, "hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.
[0024] As used herein, the terms "engineering" or "engineered" are used
interchangeably and indicate the involvement of the hand of man.
[0025] As used herein, the terms "subject," "individual," and "animal" are used interchangeably herein to refer to a vertebrate, preferably a mammal. The term "mammal" or "mammalian" includes, but is not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.
[0026] As used herein, "administered" includes delivery by viral or non-viral techniques. Viral delivery mechanisms include but are not limited to adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors, retroviral vectors, lentiviral vectors, etc as described above. Non-viral delivery mechanisms include lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
Composition for inducing in vivo chromosomal rearrangements
[0027] One aspect of the present application is a composition for inducing specific chromosomal rearrangements in vivo. The composition comprises an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs). The expression vector, when introduced into a mammalian cell, is capable of expressing the Cas gene and the two or more distinct single guide RNAs (sgRNAs) in vivo and causing chromosomal rearrangement of a DNA sequence between two chromosomal loci targeted by the two or more sgRNAs (target loci). In some embodiment, the two target loci are separated by a genomic sequence of greater than lOkb, 30kb, lOOkb, 300kb, 1Mb, 3 Mb or 10 Mb. In some embodiment, the two target loci are separated by a genomic sequence of 10kb-30kb, lOkb-lOOkb, 10kb-300kb, lOkb-IMb, 10kb-3 Mb, lOkb-10 Mb, 10kb-30 Mb, lOkb-lOOMb, 30kb-100kb, 30kb-300kb, 30kb-lMb, 30kb-3 Mb, 30kb-10 Mb, 30kb-30 Mb, 30kb-100Mb, 100kb-300kb, lOOkb-IMb, 100kb-3 Mb, lOOkb-lO Mb, 100kb-30 Mb, lOOkb- 100Mb, 300kb-lMb, 300kb-3 Mb, 300kb-10 Mb, 300kb-30 Mb, 300kb-100Mb, lMb-3 Mb, 3Mb -10 Mb, 10Mb -30 Mb, lOMb-lOOMb or 30Mb-100Mb.
[0028] In some embodiments, the two or more distinct sgRNAs comprise sgRNAs targeting Eml4 and Alk sites. In other embodiments, the two or more distinct sgRNAs comprise sgRNAs targeting Npml and Alk sites.
[0029] As used herein, the term "chromosomal rearrangement" refers to all possible allele combination of the sequences between two target loci on a chromosome, including but are not limited to, indels, inversions and deletions.
The Cas gene
[0030] The Cas gene encodes a RNA-guided DNA endonuclease enzyme that forms a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins), which results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf , homo logs thereof, or modified versions thereof. These enzymes are known in the art, and may be found in publicly available databases of protein sequences. In some embodiments, the unmodified CRISPR enzyme has DNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S.
pyogenes or S. pneumoniae. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. Guide Sequences
[0031] A guide sequence is any polynucleotide sequence with sufficient
complementarity to a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity, when optimally aligned using a suitable alignment algorithm, between a guide sequence and its corresponding target sequence is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, such as known to those of skill in the art. In some embodiments, a guide sequence is about or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length.
[0032] Any appropriate assay as known to those of skill in the art may be used to assess the ability of a guide sequence to direct sequence-specific binding of a CRISPR complex to a target sequence. A guide sequence may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within a genome of a cell. Exemplary target sequences include those that are unique in the target genome.
Expression Vectors
[0033] The expression vector can be a viral vector (such as a recombinant adenovirus) or a non- viral vector (such as a plasmid). In some embodiments, the expression vector comprises a Cas expression cassette comprising a regulatory element operationally linked to the Cas gene, and a sgRNA expression cassette comprising a regulatory element
operationally linked to the DNA sequences encoding the two or more sgRNAs. In some embodiments, the expression vector comprises a Cas expression cassette comprising a regulatory element operationally linked to the Cas gene, and sgRNA expression cassettes for each of the two or more sgRNAs. Each sgRNA expression cassette comprises regulatory element operationally linked to a DNA sequence encoding a sgRNA. The regulatory element may comprise a promoter, an enhancer or both. The promoter can be a constitutive promoter, a tissue specific promoter or an inducible promoter. In some embodiments, the Cas gene and the sgRNA in the expression vector are under the control of a regulatable expression system.
[0034] As used herein, the term "operationally linked to" refers to the joining of an encoding nucleic acid sequence to a regulatory element which results in the biological production of the desired polynucleotide or polypeptide.
[0035] Examples of constitutive promoters include, but are not limited to, CMV promoter, SV40 promoter, CBh (Chicken Beta Action Short), Pgk promoter, HI promoter, promoter and U6 promoter.
[0036] Examples of tissue specific promoters include, but are not limited to, promoters that direct expression primarily in a desired tissue of interest, such as muscle, neuron, bone, skin, blood, specific organs (e.g. liver, pancreas), or particular cell types (e.g. lymphocytes).
[0037] Examples of regulatable expression system include, but are not limited to Tet- on/off system, Ecdysone system, progesterone system and rapamycin system. The Tet-on/off system is based on two regulatory elements derived from the tetracycline-resistance operon of the E. coli TnlO transposon: the tet repressor protein (TetR) and the Tet operator DNA sequence (tetO) to which TetR binds. The system consists of two components, a "regulator" and a "reporter" plasmid. The "regulator" plasmid encodes a hybrid protein containing a mutated Tet repressor (rtetR) fused to the VP 16 activation domain of herpes simplex virus. The "reporter" plasmid contains a tet-responsive element (TRE), which controls the
"reporter" gene of choice. The rtetR-VP16 fusion protein can only bind to the TRE, therefore activates the transcription of the "reporter" gene, in the presence of tetracycline.
[0038] The ecdysone system is based on the molting induction system found in Drosophila, but modified for inducible expression in mammalian cells. The system uses an analog of the drosophila steroid hormone ecdysone, muristerone A, to activate expression of the gene of interest via a heterodimeric nuclear receptor. Expression levels have been reported to exceed 200-fold over basal levels with no effect on mammalian cell physiology.
[0039] The progesterone receptor is normally stimulated to bind to a specific DNA sequence and to activate transcription through an interaction with its hormone ligand.
Conversely, the progesterone antagonist mifepristone (RU486) is able to block hormone- induced nuclear transport and subsequent DNA binding. A mutant form of the progesterone receptor that can be stimulated to bind through an interaction with RU486 has been generated. To generate a specific, regulatable transcription factor, the RU486-binding domain of the progesterone receptor has been fused to the DNA-binding domain of the yeast transcription factor GAL4 and the transactivation domain of the HSV protein VP 16. The chimeric factor is inactive in the absence of RU486. The addition of hormone, however, induces a conformational change in the chimeric protein, and this change allows binding to a GAL4-binding site and the activation of transcription from promoters containing the GAL4- binding site.
[0040] The rapamycin system uses an immunosuppressive agent an inducer. The binding of rapamycin to FK506-binding protein (FKBP) results in its heterodimerization with another rapamycin binding protein FRAP, which can be reversed by removal of the drug. The ability to bring two proteins together by addition of a drug potentiates the regulation of a number of biological processes, including transcription. A chimeric DNA-binding domain has been fused to the FKBP, which enables binding of the fusion protein to a specific DNA- binding sequence. A transcriptional activation domain also has been fused to FRAP. When these two fusion proteins are co-expressed in the same cell, a fully functional transcription factor can be formed by heterodimerization mediated by addition of rapamycin. The dimerized chimeric transcription factor can then bind to a synthetic promoter sequence containing copies of the synthetic DNA-binding sequence.
[0041] In some embodiments, the expression vector comprises three expression cassettes: a Cas expression cassette comprising a Cas9 gene under the control of a CBh promote and two sgRNA expression cassettes, each comprising a U6 promoter and the coding sequences of a distinct sgRNA. In some embodiments, the two sgRNA expression cassettes comprise coding sequences for sgRNAs targeting the Alk and Eml4 gene. In other
embodiments, the two sgRNA expression cassettes comprise coding sequences for sgRNAs targeting the Alk and Npml gene.
[0042] In some embodiments, the expression vector also comprises an enhancer element, such as WPRE; CMV enhancers and the R-U5' segment in LTR of HTLV-I.
Viral Vectors
[0043] In some embodiments, the expression vector of the present application is a viral vector. Viruses are logical tools for gene delivery. They replicate inside cells and therefore have evolved mechanisms to enter the cells and use the cellular machinery to express their genes. The concept of virus-based gene delivery is to engineer the virus so that it can express the gene of interest. Depending on the specific application and the type of virus, most viral vectors contain mutations that hamper their ability to replicate freely as wild-type viruses in the host.
[0044] Viruses from several different families have been modified to generate viral vectors for gene delivery. These viruses include retroviruses, lentivirus, adenoviruses, adeno- associated viruses, herpes simplex viruses, picornaviruses, and alphaviruses.
[0045] RNA or DNA viral based systems targeting a virus to specific cells in the body as known to one of skill in the art can be used for the delivery of nucleic acids and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to subjects (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to subjects (ex vivo). Conventional viral based systems could include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods. [0046] In some embodiments, the expression vector of the present application is an adenoviral vector. The adenovirus is a double-stranded, linear DNA virus that does not go through an R A intermediate. There are over 50 different human serotypes of adenovirus divided into 6 subgroups based on the genetic sequence homology all of which exhibit comparable genetic organization. Human adenovirus group C serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections in the young.
[0047] Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. The adenoviruses/adenoviral vectors in aspects of the present application may be of human or animal origin. As regards the adenoviruses of human origin, preferred adenoviruses are those classified in group C, in particular the adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2). More preferably, it is an Ad2 or Ad5 adenovirus. Among the various adenoviruses of animal origin, canine adenovirus, mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al, 1993, J Virol 67:3777-3785) may be used. With respect to animal adenoviruses it is preferred to use adenoviruses of canine origin, and especially the strains of the CAV2 adenoviruses [manhattan strain or A26/61 (ATCC VR-800) for example].
[0048] The organization of the adenovirus genome is similar in all of the adenovirus groups and specific functions are generally positioned at identical locations for each serotype studied. The genome of adenoviruses comprises an inverted terminal repeat (ITR) at each end, an encapsidation sequence (Psi), early genes and late genes. The main early genes have been classified into an array of intermediate early (Ela), delayed early (Elb, E2a, E2b, E3 and E4), and intermediate regions. In some embodiments, the adenoviral vector comprises a deletion in the El, E2, E3 and/or E4 region in the viral genome.
[0049] In some embodiments, a heat-sensitive point mutation has been introduced into the tsl25 mutant, making it possible to inactivate the 72 kDa DNA-binding protein (DBP). In some embodiments, the adenoviral vector comprises a deletion in the El region of its genome. In some embodiments, the adenoviral vector comprises a deletion in the Ela and Elb regions.
[0050] In some embodiments, the adenoviral vector comprise a deletion in the E4 region. The E4 region is involved in the regulation of the expression of the late genes, in the stability of the late nuclear RNAs, in decreasing host cell protein expression and in the efficiency of the replication of the viral DNA. In some embodiments, the adenoviral vector comprise deletions in both the El and the E4 region. Adenoviral vectors in which the El and E4 regions are deleted therefore possess very reduced viral gene expression and transcriptional background noise. In some embodiments, the adenoviral vector is a "gutless" adenoviral vector in which all the viral genes are deleted.
[0051] The adenoviral vectors of the present application may possess other alterations in their genome. In particular, other regions may be deleted to increase the capacity of the virus and reduce its side effects linked to the expression of viral genes. Thus, all or part of the E3 or IVa2 region in particular may be deleted. As regards the E3 region, it may however be particularly preferred to conserve the part encoding the gpl9K protein. This protein indeed makes it possible to prevent the adenoviral vector from becoming the subject of an immune reaction which (i) would limit its action and (ii) could have undesirable side effects. According to a specific mode, the E3 region is deleted and the sequence encoding the gpl9K protein is reintroduced under the control of a heterologous promoter.
[0052] The cas gene and the coding sequences for sgR As can be inserted into various sites of the recombinant viral genome. It can be inserted into the El, E3 or E4 region, as a replacement for the deleted or surplus sequences. It can also be inserted into any other site, outside the sequences necessary in cis for the production of the viruses (ITR sequences and encapsidation sequence).
[0053] In some embodiments, the adenoviral vector is replication deficient. In other embodiments, the adenoviral vector is a replication-competent adenoviral vector.
[0054] In other embodiments, the expression vector is a retroviral vector.
Retroviruses are RNA viruses that replicate through an integrated DNA intermediate.
Retroviral particles encapsidate two copies of the full-length viral RNA, each copy containing the complete genetic information needed for virus replication. Retroviruses possess a lipid envelope and use interactions between the virally encoded envelope protein that is embedded in the membrane and a cellular receptor to enter the host cells. Using the virally encoded enzyme reverse transcriptase, which is present in the virion, viral RNA is reverse transcribed into a DNA copy. This DNA copy is integrated into the host genome by integrase, another virally encoded enzyme. The integrated viral DNA is referred to as a provirus and becomes a permanent part of the host genome. The cellular transcriptional and translational machinery carries out expression of the viral genes. The host RNA polymerase II transcribes the provirus to generate RNA, and other cellular processes modify and transport the RNA out of the nucleus. A fraction of viral RNAs are spliced to allow expression of some genes whereas other viral RNAs remain full-length. The host translational machinery synthesizes and modifies the viral proteins. The newly synthesized viral proteins and the newly synthesized full-length viral RNAs are assembled together to form new viruses that bud out of the host cells.
[0055] Retroviruses can also be classified into oncoviruses, lentiviruses, and spumaviruses. Most oncoviruses are simple retroviruses. Lentiviruses, spumaviruses, and some oncoviruses are complex retroviruses. Murine leukemia virus (MLV) is example of an oncovirus, human immunodeficiency virus 1 (HIV-1) is an example of a lentivirus, and human foamy virus is an example of a spumavirus. In some embodiments, the viral vector is a lentiviral vector.
[0056] A retrovirus can be altered by incorporating foreign envelope proteins, which can expand the potential target population of cells in a subject. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors are comprised of czs-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum czs-acting LTRs are sufficient for replication and packaging of the vectors. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof.
[0057] In some embodiments, the retroviral vector is a self-inactivating retroviral vector. After gene delivery, the vector will delete some of the cis-acting elements needed to complete another round of replication. Therefore, even in the presence of a replication- competent virus, these vectors cannot be transferred to other target cells efficiently.
[0100] Other viral vectors which may be used in aspects of the present application include Herpes Simplex Virus (HSV) vector, adeno-associated virus (AAV) vectors, vesicular stomatitis virus vectors, vaccinia virus vectors and SV-40-based viral vectors. Non-viral vectors
[0101] In some embodiments, the expression vector of the present application is a non- viral expression vector, such as a plasmid comprising one or more expression cassettes. The non- viral expression vector may be administered using a delivery agent/method such as lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes,
immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos.
5,049,386, 4,946,787; and 4,897,355) and lipofection reagents are sold commercially {e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91/17424; WO 91/16024. Delivery can be to cells (e.g. in vitro or ex vivo administration) or target tissues (e.g. in vivo administration).
[0102] The practice of aspects of the present application employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A
LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN
MOLECULAR BIOLOGY (F. M. Ausubel, et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M. J.
MacPherson, B. D. Hames and G. R. Taylor eds. (1995)), Harlow and Lane, eds. (1988) ANTIBODIES, A LABORATORY MANUAL, and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).
Kit for inducing in vivo chromosomal rearrangements
[0103] Another aspect of the present application is a kit for inducing specific chromosomal rearrangements in vivo. The kit comprises: an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs); and one or more reagents for delivering the expression vector into a mammalian cell, wherein the expression vector is capable of expressing the Cas gene and the two or more sgRNAs inside the cell and causing chromosomal rearrangement between two chromosomal loci targeted by the two or more sgRNAs. In some embodiments, the expression vector is an adenoviral viral vector. In some embodiments, the kit further comprises instructions for how to use the kit.
Methods for inducing in vivo chromosomal rearrangements
[0104] Another aspect of the present application relates to a method for inducing specific chromosomal rearrangements in vivo. The method comprises the steps of administering into a subject an effective amount of an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs), wherein the expression vector expresses the Cas gene and the two or more sgRNAs inside a target cell and causes chromosomal rearrangement between two chromosomal loci targeted by the two or more sgRNAs.
[0105] In some embodiments, the two or more distinct sgRNAs consist of sgRNAs targeting Eml4 and Alk sites. In other embodiments, the two or more distinct sgRNAs consist of sgRNAs targeting Npml and Alk sites. [0106] In certain embodiments, the expression vector is a viral vector. In a particular embodiment, the viral vector is an adenoviral vector. In some embodiments, the expression vector is a non-viral vector.
[0107] In some embodiments, the method is utilized to correct a genomic deficiency in certain somatic or germ line cells. In other embodiments, the method is used to create animal models with conditions resulting from chromosomal rearrangement.
[0108] In some embodiments, the present application relates to a method for inducing specific chromosomal rearrangements in vivo to create an animal model of human non-small cell lung cancer (NSCLC). The method comprises infecting somatic cells in a subject with a viral vector capable of expressing the Cas9 gene and sgR As targeting Eml4 and Alk sites, wherein the infection results in development of tumors harboring the Eml4-Alk inversion in the subject.
[0109] The CRISPR-based strategy described herein offers several advantages over germline engineering via transgenesis or homologous recombination. By inducing the rearrangement in only a subset of somatic cells, the resulting lesions more closely recapitulate the stochastic nature of tumor formation in humans. In addition, by modifying the endogenous loci, expression of the resulting fusion genes is subjected to physiologic transcriptional and post-transcriptional regulation, accurately modelling the reduced dosage of the wild-type alleles and the expression of the reciprocal product of the
translocation/inversion. Finally, because the method requires only the generation of an appropriate viral vector and no germline manipulations, it can be readily adapted to model chromosomal rearrangements in other species, including non-human primates, and as such will facilitate the study of species-specific differences in tumor progression and therapy response in vivo.
Animal models
[0110] Another aspect of the present application relates to an animal produced by the methods of inducing an in vivo chromosomal rearrangement described herein, wherein the animal has NSCLCs that harbor the Eml4-Alk inversion, express the Eml4-Alk fusion gene, display histopathologic and molecular features typical of Alk+ human NSCLCs, and respond to treatment with A /^-inhibitors. In some embodiments, the animal is a mouse, a rat, a chimpanzee, a monkey, a sheep, a rabbit, a guinea pig, a frog, a zebrafish or any laboratory test animal as would be known to one of ordinary skill in the art.
[0111] The animal produced by the methods of inducing an in vivo chromosomal rearrangement described herein provides unique opportunities to dissect the molecular mechanisms of diseases related to the chromosomal rearrangement, to test the efficacy of targeted therapies, and to investigate the mechanisms of drug resistance in vivo.
[0112] In some embodiments, one or more expression vectors described herein are used to produce a non-human transgenic animal. In some embodiments, the animal is a mammal, such as a mouse, rat, or rabbit. Methods for producing transgenic animals are known in the art, and generally begin with a method of cell transfection, such as is known in the art. The animal may be useful in applications outside of providing a disease model. In this regard, transgenic animals, especially mammals such as livestock (cows, sheep, goats and pigs), but also poultry and edible insects, are preferred.
[0113] Below are disclosed methods, devices, and systems for targeting the delivery of agents to specific cell types in mammals, in particular the lungs. Further aspects and advantages of the application will appear from the following description taken together with the accompanying drawings.
EXAMPLES
EXAMPLE 1: ADAPTING THE CRISPR SYSTEM TO ENGINEER
CHROMOSOMAL REARRANGEMENTS IN EUKARYOTIC CELLS
[0114] In the mouse genome, Eml4 and Alk are located on chromosome 17, approximately 11 megabases (Mb) apart, in a region that is syntenic to human chromosome 2(p2 l-p23) (Fig. 1 , panel (a)). The most common EML4-ALK variant in human NSCLCs is modeled by introducing concomitant double-strand DNA breaks at intron 14 of Eml4 (which corresponds to intron 13 of EML4) and at intron 19 of Alk (Fig. 1, panels (a) and (b) and Fig. 2). To induce the DNA breaks the CRISPR system was chosen because it only requires co- expression of Cas9 and an appropriately designed single guide RNA molecule (sgRNA).
[0115] The sgRNA sequences targeting the Eml4 and Alk sites are cloned into the Cas9-expressing plasmid pX330 and the resulting constructs are-cotransfected in NIH/3T3. PCR analysis demonstrated the induction of the Eml4-Alk inversion and of a large deletion of the region between the two cut sites in the transfected cell population (Fig. 1, panel (b)). The presence of the desired Eml4-Alk inversion was confirmed by sequencing the corresponding Eml4-Alk fusion transcript (Fig. 1, panel (c)) and directly visualized by interphase FISH (Fig. 1, panels (d) and (e)). Using a similar strategy, this also modelled the Npml-Alk
rearrangement, a reciprocal chromosomal translocation commonly observed in anaplastic large cell lymphomas (Fig. 3). These results confirm that the CRISPR system can be adapted to engineer large deletions, inversions, and chromosomal translocations in eukaryotic cells. [0116] The pX330 vector expressing Cas9 (Addgene plasmid 42230) was digested with Bbsl and ligated to annealed and phosphorylated sgRNA oligos targeting Eml4, Alk, and Npml . For cloning of tandem U6-sgRNA-Cas9 constructs, the second U6-sgRNA cassette was amplified using primers containing the Xbal and Kpnl sites and cloned into the pX330 construct containing the appropriate sgRNA. For AdQno-Eml4-Alk cloning, pX33Q-Alk-Eml4 vector was modified by adding an Xhol site upstream the first U6 promoter. An EcoRI/XhoI fragment containing the double U6-sgRNA cassette and the Flag-tagged Cas9 was then ligated the EcoRI/XhoI-digested pacAd5 shuttle vector. NIH/3T3 cells were transfected in 6- well plates with 3 μg of total plasmid DNA per well using lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. To enrich for transfected cells, transfections included 1 μg of a plasmid expressing the Puro-resistance gene (pSico) and cells were incubated with 2 μg ml-1 puromycin for 2 days. Recombinant adenoviruses were generated by Viraquest (Ad-EA and Ad-Cas9) or purchased from the University of Iowa (Ad-Cre). MEFs infections were performed by adding adenovirus (3 x 106 p.f.u.) to each well of a 6- well plate.
PCR and RT-PCR analysis
[0117] For PCR analysis of genomic DNA, cells were collected in lysis buffer (100 nM Tris-HCl pH 8.5, 5 mM EDTA, 0.2% SDS, 200 mM NaCl supplemented with fresh proteinase K at final concentration of 100 ng ml-1). Genomic DNA was extracted with phenol-chloroform-isoamylic alcohol and precipitated in ethanol. The DNA pellet was dried and resuspended in double-distilled water. For RT-PCR, total RNAs were extracted with TRIzol (Life Technologies) following manufacturer's instructions. cDNAs were prepared using the Superscript III kit, following the manufacturer's instructions. The primers and the primer pairs used in the various PCR reactions are provided in Table 1 (which lists the name and sequence of each DNA oligonucleotide used in this study).
TABLE 1
Figure imgf000020_0001
Quantification of inversion efficiency in MEFs
[0118] An NIH/3T3 subclone was first isolated carrying a mono-allelic Eml4-Alk inversion validated by interphase FISH. Genomic DNA extracted from this clone was mixed with increasing amounts of genomic DNA from parental NIH/3T3 cells to generate a series of standards containing known percentage of Eml4-Alk alleles. The standards and the test samples were then subjected to quantitative PCR (Applied Biosystem) using primers amplifying the Eml4-Alk junction (Eml4-for and Alk-rev, see Table 1) or a control gene (miR-17~92-gDNA-for and miR-17~92-gDNA-rev) and the fraction ofEml4-Alk alleles in the test was calculated by plotting the AACt values on the standard curve. qPCR analysis was performed using SYBR Green (Life Technology).
Cell lines
[0119] MEFs were generated from E14.5 wild-type embryos following standard procedures. NIH/3T3 were purchased from ATCC.
EXAMPLE 2: DELIVERY OF sgRNA/Cas9 USING ADENOVIRAL VECTORS
[0120] Although appropriate for cell-based experiments, expression of two sgRNAs from separate constructs would be impractical in vivo. Therefore, plasmids were engineered to simultaneously express Cas9 and two distinct sgRNAs from tandem U6 promoters (Fig. 4, panel (a)). Their transfection in NIH/3T3 cells resulted in comparable levels of the two sgRNAs, efficient cleavage at the targeted sites, and accumulation of the Eml4-Alk inversion (Fig. 4, panels (b)-(d)).
[0121] To deliver Cas9 and sgRNAs targeting the Alk and Eml4 loci to the lungs of adult mice, next the dual sgRNA/Cas9 cassette was transferred into an adenoviral shuttle vector (Fig. 5, panel (a)), which was then used to produce recombinant adenoviruses
(hereafter referred to as 'Ad-EA'). Adenoviral vectors are ideal because they efficiently infect the lung epithelium of adult mice and do not integrate into the host genome. Infection of mouse embryo fibroblasts (MEFs) with Ad-EA led to the expression of Cas9 and both sgRNAs, and to the rapid generation of the desired Eml4-Alk inversion (Fig. 5, panels (b) and (c)). The Eml4-Alk inversion was estimated to occur in approximately 3-4% of infected MEFs (Fig. 5, panels (d)-(e)).
Mouse husbandry and adenoviral infection
[0122] Mice were purchased from The Jackson Laboratory (C57BL/6J) or from Charles River (CD1) and housed in the SPF Memorial Sloan-Kettering Cancer Center Institutional Animal Care and Use Committee, where the health status of the colony is constantly monitored by the veterinary staff and by a sentinel program. For adenoviral infection, 6-10-week-old mice were anaesthetized by intra peritoneal injection of ketamine (80 mg per kg) and xylazine (10 mg per kg) and treated by intratracheal instillation of 1.5 x 108 PFU adenovirus/mouse, as previously described (DuPage et al, Nature Protocols, 2009, 4: 1064-1072). Investigators were not blinded with respect to which adenovirus was injected. All studies and procedures were approved by the MSKCC Institutional Animal Care and Use Committee.
Surveyor assay [0123] The genomic region flanking the CRISPR/Cas9 target site was first amplified by PCR. After a cycle of melting and re-annealing to allow heteroduplex formation, the amplicon was digested with the surveyor nuclease (Transgenomic) for 1 h at 42 °C according to the manufacturer's directions and the digestion products were separated on a 2% agarose gel.
Northern blot analysis
[0124] 10 μg of R A previously extracted with TRIzol (Life Technologies) were run on a 15% denaturing polyacrylamide gel and blotted on a nitrocellulose membrane for 1 h at 100 V at room temperature. The membranes were then hybridized to radiolabeled oligonucleotides complementary to the Alk (5 '-TAC AGATAGACATGCCAGGAC) (SEQ ID NO: 20), EmU (5'-TCCTAGTAGACCCCGACAAAC) (SEQ ID NO: 21) sgRNAs, or mU6 (5'-GCAGGGGCCATGCTAATCTTCTCTGTATCG) (SEQ ID NO: 22) dissolved in
ExpressHyb (Clontech) at 42 °C overnight. Washes were performed at room temperature in 2X SSC and 0.2 SSC.
EXAMPLE 3: INDUCING CHROMOSOMAL REARRANGEMENTS IN MICE
[0125] To induce the Eml4-Alk rearrangement in vivo a cohort of adult CD1 and C57BL/6J (B6) mice were next infected by intratracheal instillation of Ad-EA (n = 52: 22 B6, 30 CD1) or control adenoviruses expressing either the Cre recombinase (Ad-Cre, n = 15: 6 B6, 9 CD 1) or Cas9 alone (Ad-Cas9, n = 19: 9 B6, 10 CD1).
[0126] At two days, and at one week post-infection the lungs appeared histologically normal with no obvious signs of cytoxicity except for the presence of occasional
inflammatory infiltrates (data not shown). However, one month after Ad-EA infection, the lungs of mice of both strains presented multiple small lesions that, upon histopatho logical examination, appeared to be papillary intrabronchiolar epithelial hyperplasia, atypical adenomatous hyperplasia (AAH) or early well-differentiated adenocarcinomas. By 6-8 weeks post-infection, larger tumors were easily detectable by micro-computed tomography ^CT) and macroscopically visible at necropsy. At 12-14 weeks post-infection, the lungs of Ad-EA-infected mice invariably contained multiple large lesions histologically classified as lung adenocarcinomas.
[0127] In Ad-EA-infected animals, multiple bilateral lung tumors were frequently detected by 4-7 weeks post-infection (n = 23/26 mice), and invariably after 8 weeks postinfection (n = 34). In contrast, Ad-Cre-infected mice remained tumor-free at all time points examined (n = 14 mice, range 4-18 weeks), with the exception of two CD1 mice in each of which was observed a single small adenoma. Analogously, even at the latest time point examined (9 weeks post-infection), none of the Ad-Cas9 infected mice presented lung tumors (n = 8 mice), whereas at same time point all Ad-EA infected mice had developed multiple tumors (P value < 0.0001, Fisher's exact test). These results indicate that intra-tracheal delivery of Ad-EA can initiate lung tumorigenesis with high penetrance and low latency, and that this effect cannot be attributed to adenoviral infection or Cas9 expression alone.
[0128] All tumors examined were positive for the pneumocyte marker Nkx-2.1/TTFl and negative for p63 and Sox2, in agreement with the diagnosis of lung adenocarcinoma. The tumors were also strongly positive for the alveolar type II marker surfactant protein C (SpC), whereas the Clara cell marker CCSP/CC10 was undetectable. The adenocarcinomas had a papillary or, less frequently, acinar architecture. Most of these tumors were in close proximity to bronchi and bronchioles showing papillary epithelial hyperplasia, and areas of AAH were frequently observed, especially at earlier time points. The majority of tumor cells appeared low-grade, with occasional instances of intermediate nuclear atypia with enlarged nuclei and prominent nucleoli. Approximately 20% of tumors contained cells with a large cytoplasmic vacuole and a peripherally located nucleus. These cells are reminiscent of signet ring cells, which are commonly observed in human ALK+ NSCLC. Approximately 30% of adenocarcinomas displayed areas of intense positivity at the periodic acid-Schiff (PAS) staining.
EXAMPLE 4: DEMONSTRATION OF IN VIVO CHROMOSOMAL
REARRANGEMENTS
[0129] Interphase FISH analysis demonstrated the presence of a mono- or bi-allelic Eml4-Alk inversion in every Ad-EA-induced tumor examined (n = 4 animals), but not in control K-RasG12D-driven tumors (data not shown). The presence of the inversion and expression of the full-length Eml4-Alk transcript by PCR and PCR with reverse transcription (RT-PCR) analysis of micro-dissected tumors followed by sequencing (Fig. 6, panels (a)-(c)) was further confirmed.
[0130] Activation of the human ALK oncogene via deregulation, translocation or amplification has been shown to lead to constitutive phosphorylation of ER , STAT3, and AKT. At 12-14 weeks post-infection, all lung tumors derived from Ad-EA-injected mice showed phosphorylation and nuclear localization of Stat3. Phosphorylation of Akt and Erkl/2 were also frequently, but not invariably, observed (Fig. 6, panel (d)).
Interphase fluorescent in situ hybridization
[0131] Interphase FISH experiments were performed and interpreted by the MSKCC cytogenetic core using a 3 -colour probe mix designed to detect and discriminate between Alk-Eml4 fusion and other rearrangements of Alk. The probe mix comprised mouse BAC clones mapping to: 3' Alk (17qE1.3, RP23-306H20, RP23-397M18 labelled with Green dUTP), 5' Alk (17qE1.3, RP23-12H17, RP23-403F20 labelled with Red dUTP), and 5' Eml4 (17qE4, RP23-193B15 labelled with Orange dUTP). Probe labelling, hybridization, washing, and fluorescence detection were done according to standard procedures. Cell line harvest and metaphase spreads were prepared according to standard cytogenetics procedures. For NIH/3T3, FISH signals were enumerated in a minimum of 20 metaphases to determine locus specificity, and 100 interphase cells to determine Alk-Eml4 fusion status. Each paraffin section was first scanned under χ 100 objective to assess signal pattern and select
representative regions for analysis. At least three images per representative region were captured (each image was a compressed stack of 12 z-sections at 0.5 micron intervals).
Signal counts were performed on the captured images and a minimum of 50 interphase nuclei was analysed to determine the Alk-Eml4 fusion status. Based on the observed distance between the green (3' Alk), red (5' Alk), and orange (5' Eml4) signal in the negative controls (parental cell line and Ad-Cre-infected cells), interphase cells were classified as normal, Eml4-Alk positive, or other.
EXAMPLE 5: SENSITIVITY OF TUMORS INDUCED BY IN VIVO
CHROMOSOMAL REARRANGEMENTS TO CRIZOTINIB
[0132] Finally, the sensitivity of Ad-EA-induced lung tumors to crizotinib was examined, a dual ALK/MET inhibitor used in the clinic to treat patients affected by ALK+ NSCLCs. Ten Ad-EA infected CD1 mice were monitored by μCT scans starting at 9 weeks post-infection until the appearance of multiple large lung tumors, at which point the animals were randomly assigned to receive a daily dose of crizotinib (lOOmg/kg; n = 7) or vehicle (n = 3) (Fig. 7, panel (a)). After two weeks of treatment the animals in the crizotinib group displayed complete (6/7) or partial (1/7) tumor regression, as indicated by μCT scans and confirmed at necropsy, whereas all control animals showed signs of disease progression (Fig. 7, panels (b) and (c)). Histological analysis showed that in the crizotinib group the tumors had undergone marked atrophy or were replaced by areas of intense inflammatory necrosis (Fig. 7, panels (d) and (e)).
Lung processing and antibodies for immunohistochemistry
[0133] Lungs were inflated by intratracheal injection of 4% paraformaldehyde (PFA), incubated for 18-24 h in 4% PFA, and then transferred to 70% ethanol for at least 24 h before further processing. The following antibodies were used: phospho-Stat3 (Tyr705, Cell Signaling Technology #9135, 0.1 μg mf1); phospho-Erkl/2 (Thr202/Tyr204, Cell Signaling Technology #4370 1 μg ml l); phospho-Akt (Ser473, Cell Signaling Technology #4060 1 μg mf1); Nkx-2.1 (Epitomics, EP1584Y 1 : 1,200); FLAG (Sigma, M2 1 : 1,000); P63 (Santa Cruz (H-137) sc8343, 1 : 1,000); Sox2 (Cell Signaling Technology, C70B1 #3728, 1 : 1,000);
CC10/CCSP (Millipore, 07-623, 1 :2,000); SpC (Millipore, AB3786, 1 : 1,000).
μ€Τ imaging
[0134] μCT Scans were performed on the Mediso Nano SPECT/CT System covering only the lung fields of each mouse. Each scan averaged approximately 5 min using 240 projections with an exposure time of 1,000 ms set at a pitch of 1 degree. The tube energy of the X-ray was 55 kVp and 145 μΑ. The in-plane voxel sizes chosen were small and thin creating a voxel size of 73 x 73 x 73 μιη. The final reconstructed image consisted of 368 x 368 x 1,897 voxels. Scans were analysed with the Osirix software.
Crizotinib treatment
[0135] Mice were randomized to receive either control vehicle (water) or crizotinib at 100 mg/kg p.o. daily for at least 14 consecutive days. Mice were monitored daily for weight loss and clinical signs. Investigators were not blind with respect to treatment.
[0136] The foregoing descriptions of specific embodiments of the present application have been presented for purposes of illustration and description. They are not intended to be exhaustive or to limit the application and method of use to the precise forms disclosed.
Obviously many modifications and variations are possible in light of the above teaching. It is understood that various omissions or substitutions of equivalents are contemplated as circumstance may suggest or render expedient, but is intended to cover the application or implementation without departing from the spirit or scope of the claims of the present application.

Claims

What is claimed is:
1. A method for inducing chromosomal rearrangements in vivo, comprising:
administering into a subject an effective amount of an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgR As), wherein the expression vector expresses the Cas gene and the two or more sgRNAs in vivo and causes chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs
2. The method of Claim 1, wherein the expression vector is a viral vector.
3. The method of Claim 2, wherein the viral vector is an adenoviral vector.
4. The method of Claim 1, wherein the expression vector is an non- viral vector.
5. The method of Claim 1, wherein the Cas gene is a Cas9 gene.
6. The method of Claim 1, wherein the expression vector is the only expression vector administered to the subject.
7. The method of Claim 1, wherein the Cas gene and each of the two or more distinct sgRNAs are controlled by separate regulatory element.
8. The method of Claim 1, wherein the subject is a mouse and wherein the two or more distinct sgRNAs consist of sgRNAs targeting Eml4 and Alk sites.
9. The method of Claim 1, wherein the subject is a mouse and wherein the two or more distinct sgRNAs consist of sgRNAs targeting Npml and Alk sites.
10. A mouse produced by the method of Claim 7, wherein the mouse has non-small cell lung cancer (NSCLC) cells harboring an Eml4-Alk inversion and expressing an Eml4-Alk fusion gene.
11. The mouse of Claim 10, wherein the non-small cell lung cancer (NSCLC) cells display histopathologic and molecular features typical of Alk+ human NSCLCs, and respond to treatment with A /^-inhibitors.
12. A composition for inducing specific chromosomal rearrangements in vivo, comprising an expression vector comprising a polynucleotide encoding a Cas gene and two or more distinct single guide RNAs (sgRNAs); wherein the expression vector is capable of expressing the Cas gene and the two or more sgRNAs in vivo and causing chromosomal rearrangements between two chromosomal loci targeted by the two or more sgRNAs.
13. The composition of Claim 12, wherein the expression vector is a viral vector.
14. The composition of Claim 13, wherein the viral vector is an adenoviral vector.
15. The composition of Claim 12, wherein the expression vector is an non- viral vector.
16. The composition of Claim 12, wherein the Cas gene is a Cas9 gene.
17. The method of Claim 12, wherein the Cas gene and each of the two or more distinct sgR As are controlled by separate regulatory element.
18. A kit for inducing specific chromosomal rearrangements in vivo, comprising: the composition of Claim 12; and
a reagent for introducing the expression vector into a cell in vivo.
19. The kit of Claim 18, wherein the cell is a somatic cell.
20. The kit of Claim 18, further comprising instructions for introducing the expression vector into the cell.
PCT/US2015/055286 2014-10-14 2015-10-13 Composition and method for in vivo engineering of chromosomal rearrangements Ceased WO2016061073A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462063728P 2014-10-14 2014-10-14
US62/063,728 2014-10-14

Publications (1)

Publication Number Publication Date
WO2016061073A1 true WO2016061073A1 (en) 2016-04-21

Family

ID=55747208

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/055286 Ceased WO2016061073A1 (en) 2014-10-14 2015-10-13 Composition and method for in vivo engineering of chromosomal rearrangements

Country Status (1)

Country Link
WO (1) WO2016061073A1 (en)

Cited By (39)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US9902971B2 (en) 2014-06-26 2018-02-27 Regeneron Pharmaceuticals, Inc. Methods for producing a mouse XY embryonic (ES) cell line capable of producing a fertile XY female mouse in an F0 generation
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US20220064613A1 (en) * 2018-12-21 2022-03-03 Aarhus Universitet Crispr gene therapy of fusion gene related cancers
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11326184B2 (en) 2014-12-19 2022-05-10 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification through single-step multiple targeting
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
EP4074832A4 (en) * 2019-11-06 2023-12-06 Qingdao KingAgroot Chemical Compound Co., Ltd. Method for creating new gene in organism and use thereof
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12342801B2 (en) 2016-05-20 2025-07-01 Regeneron Pharmaceuticals, Inc. Methods for producing antigen-binding proteins against foreign antigens
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014093595A1 (en) * 2012-12-12 2014-06-19 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
US20140273226A1 (en) * 2013-03-15 2014-09-18 System Biosciences, Llc Crispr/cas systems for genomic modification and gene modulation

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014093595A1 (en) * 2012-12-12 2014-06-19 The Broad Institute, Inc. Crispr-cas component systems, methods and compositions for sequence manipulation
US20140273226A1 (en) * 2013-03-15 2014-09-18 System Biosciences, Llc Crispr/cas systems for genomic modification and gene modulation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHOI, PS ET AL.: "Targeted Genomic Rearrangements Using CRISPR/Cas Technology.", NAT. COMMUN., vol. 5, 24 April 2014 (2014-04-24), pages 1 - 9 *
MAGGIO, I ET AL.: "Adenoviral Vector Delivery of RNA-guided CRISPR/Cas9 Nuclease Complexes Induces Targeted Mutagenesis In A Diverse Array Of I luman Cells.", SCI. REP., vol. 5, no. 5105, 2014, pages 1 - 11, XP002726565, DOI: doi:10.1038/SREP05105 *
MARTINELLI, P ET AL.: "The Lymphoma-Associated NPM-ALK Oncogene Elicits A p161NK4a/pRb-Dependent Tumor-Suppressive Pathway.", BLOOD., vol. 117, no. 24, 16 June 2011 (2011-06-16), pages 6617 - 6626 *
SODA, M ET AL.: "A Mouse Model for EML4-ALK-Positive Lung Cancer.", PROC. NATL. ACAD. SCI. USA., vol. 105, no. 50, 16 December 2008 (2008-12-16), pages 19893 - 7 *
XUE, W ET AL.: "CRISPR-Mediated Direct Mutation of Cancer Genes in the Mouse Liver.", NATURE, vol. 514, 16 October 2014 (2014-10-16), pages 380 - 384, XP055176815, [retrieved on 20140806], DOI: doi:10.1038/nature13589 *

Cited By (87)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10975390B2 (en) 2013-04-16 2021-04-13 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US12037596B2 (en) 2013-04-16 2024-07-16 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10385359B2 (en) 2013-04-16 2019-08-20 Regeneron Pharmaceuticals, Inc. Targeted modification of rat genome
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10227581B2 (en) 2013-08-22 2019-03-12 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US12559737B2 (en) 2013-09-06 2026-02-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US9999671B2 (en) 2013-09-06 2018-06-19 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US9737604B2 (en) 2013-09-06 2017-08-22 President And Fellows Of Harvard College Use of cationic lipids to deliver CAS9
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US12473573B2 (en) 2013-09-06 2025-11-18 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US12584118B2 (en) 2013-09-06 2026-03-24 President And Fellows Of Harvard College Cas9 variants and uses thereof
US10208317B2 (en) 2013-12-11 2019-02-19 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse embryonic stem cell genome
US9546384B2 (en) 2013-12-11 2017-01-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse genome
US10711280B2 (en) 2013-12-11 2020-07-14 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a mouse ES cell genome
US11820997B2 (en) 2013-12-11 2023-11-21 Regeneron Pharmaceuticals, Inc. Methods and compositions for the targeted modification of a genome
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US12215365B2 (en) 2013-12-12 2025-02-04 President And Fellows Of Harvard College Cas variants for gene editing
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
US10793874B2 (en) 2014-06-26 2020-10-06 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modifications and methods of use
US9902971B2 (en) 2014-06-26 2018-02-27 Regeneron Pharmaceuticals, Inc. Methods for producing a mouse XY embryonic (ES) cell line capable of producing a fertile XY female mouse in an F0 generation
US10077453B2 (en) 2014-07-30 2018-09-18 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12398406B2 (en) 2014-07-30 2025-08-26 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10457960B2 (en) 2014-11-21 2019-10-29 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US11697828B2 (en) 2014-11-21 2023-07-11 Regeneran Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification using paired guide RNAs
US11326184B2 (en) 2014-12-19 2022-05-10 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification through single-step multiple targeting
US12553064B2 (en) 2014-12-19 2026-02-17 Regeneron Pharmaceuticals, Inc. Methods and compositions for targeted genetic modification through single-step multiple targeting
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US12344869B2 (en) 2015-10-23 2025-07-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10167457B2 (en) 2015-10-23 2019-01-01 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US12342801B2 (en) 2016-05-20 2025-07-01 Regeneron Pharmaceuticals, Inc. Methods for producing antigen-binding proteins against foreign antigens
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US12390514B2 (en) 2017-03-09 2025-08-19 President And Fellows Of Harvard College Cancer vaccine
US12516308B2 (en) 2017-03-09 2026-01-06 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US12435331B2 (en) 2017-03-10 2025-10-07 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US12359218B2 (en) 2017-07-28 2025-07-15 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US12406749B2 (en) 2017-12-15 2025-09-02 The Broad Institute, Inc. Systems and methods for predicting repair outcomes in genetic engineering
US12157760B2 (en) 2018-05-23 2024-12-03 The Broad Institute, Inc. Base editors and uses thereof
US12522807B2 (en) 2018-07-09 2026-01-13 The Broad Institute, Inc. RNA programmable epigenetic RNA modifiers and uses thereof
US12281338B2 (en) 2018-10-29 2025-04-22 The Broad Institute, Inc. Nucleobase editors comprising GeoCas9 and uses thereof
US12157905B2 (en) * 2018-12-21 2024-12-03 Aarhus Universitet CRISPR gene therapy of fusion gene related cancers
US20220064613A1 (en) * 2018-12-21 2022-03-03 Aarhus Universitet Crispr gene therapy of fusion gene related cancers
US12351837B2 (en) 2019-01-23 2025-07-08 The Broad Institute, Inc. Supernegatively charged proteins and uses thereof
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12509680B2 (en) 2019-03-19 2025-12-30 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12281303B2 (en) 2019-03-19 2025-04-22 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12570972B2 (en) 2019-03-19 2026-03-10 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624353B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12624354B2 (en) 2019-03-19 2026-05-12 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US12473543B2 (en) 2019-04-17 2025-11-18 The Broad Institute, Inc. Adenine base editors with reduced off-target effects
US12435330B2 (en) 2019-10-10 2025-10-07 The Broad Institute, Inc. Methods and compositions for prime editing RNA
EP4074832A4 (en) * 2019-11-06 2023-12-06 Qingdao KingAgroot Chemical Compound Co., Ltd. Method for creating new gene in organism and use thereof
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Similar Documents

Publication Publication Date Title
US11124796B2 (en) Delivery, use and therapeutic applications of the CRISPR-Cas systems and compositions for modeling competition of multiple cancer mutations in vivo
US20260002141A1 (en) Methods and compositions for selectively eliminating cells of interest
Aida et al. Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in mice
JP2023058644A (en) Gene therapy for haploinsufficiency
US20180265890A1 (en) Efficient and safe transposon integration system and use thereof
Lagutina et al. Modeling of the human alveolar rhabdomyosarcoma Pax3-Foxo1 chromosome translocation in mouse myoblasts using CRISPR-Cas9 nuclease
AU2019226526B2 (en) Identifying and characterizing genomic safe harbors (GSH) in humans and murine genomes, and viral and non-viral vector compositions for targeted integration at an identified GSH loci
Damdindorj et al. A comparative analysis of constitutive promoters located in adeno-associated viral vectors
WO2016108926A1 (en) Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis
JP2016521994A (en) Optimized CRISPR-Cas dual nickase system, method and composition for sequence manipulation
US20220304286A1 (en) SYSTEMS AND METHODS FOR IN VIVO DUAL RECOMBINASE-MEDIATED CASSETTE EXCHANGE (dRMCE) AND DISEASE MODELS THEREOF
JP2024063065A (en) Systems and methods for in vivo dual recombinase-mediated cassette exchange (dRMCE) and disease models thereof
JP2022513368A (en) Cancer treatment based on gene editing
WO2017205832A1 (en) L-myc pathway targeting as a treatment for small cell lung cancer
Isiaku et al. Transient, flexible gene editing in zebrafish neutrophils and macrophages for determination of cell-autonomous functions
CN113544257A (en) Characterization and inactivation of endogenous retroviruses in chinese hamster ovary cells
WO2024152937A1 (en) Gene editing system targeting fgf2 and use thereof
JP2025513046A (en) Constructs, Vectors, and Systems and Their Uses
Voet et al. Controlled transgene dosage and PAC-mediated transgenesis in mice using a chromosomal vector
CN115843746B (en) USH2A gene humanized mouse model and establishment method and application thereof
Puspasari et al. Long range regulation of human FXN gene expression
CN113444722B (en) Application of single-base editing-mediated splicing repair in the preparation and treatment of spinal muscular atrophy
Rominger et al. Mutant RIT1 cooperates with YAP to drive an EMT-like lung cancer state
CN115279184A (en) Rodent models of B4GALT 1-mediated function
WO2023206088A1 (en) Rna base editor for treating dmd-associated diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15851291

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15851291

Country of ref document: EP

Kind code of ref document: A1