WO2016026933A1 - Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy - Google Patents
Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy Download PDFInfo
- Publication number
- WO2016026933A1 WO2016026933A1 PCT/EP2015/069159 EP2015069159W WO2016026933A1 WO 2016026933 A1 WO2016026933 A1 WO 2016026933A1 EP 2015069159 W EP2015069159 W EP 2015069159W WO 2016026933 A1 WO2016026933 A1 WO 2016026933A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pxr
- cancer
- expression
- cells
- compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7028—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages
- A61K31/7034—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin
- A61K31/704—Compounds having saccharide radicals attached to non-saccharide compounds by glycosidic linkages attached to a carbocyclic compound, e.g. phloridzin attached to a condensed carbocyclic ring system, e.g. sennosides, thiocolchicosides, escin, daunorubicin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to new strategies for improving the efficiency of conventional chemotherapy and counteracting the emergence of chemoresistance, while maintaining limited side effects.
- cancer stem cells CSCs
- CSCs cancer stem cells
- Their enhanced resistance leads to the enrichment of cells displaying functional CSCs characteristics in residual tumor tissue following treatment, and the self -renewal abilities of this surviving cell reservoir allow the initiation of tumor relapse. Therefore, as well as targeting highly proliferative cancer cells an effective therapy also requires to efficiently and specifically target CSCs or at least to sensitize them to current therapies.
- PXR Pregnane X Receptor
- NR1I2 a key regulator of xenobiotic metabolism and disposition in the liver
- PXR knockdown significantly decreased the capacity of these cells to resist chemotoxic agents and improved recurrence-free survival following chemotherapy in a preclinical mouse xenograft model.
- the inventors have further shown that the developed adjuvant strategy is useful for the treatment of various cancers such as ovarian cancer, pancreas cancer and breast cancer.
- the invention relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy in a subject, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity, and subject suffers from a cancer comprising PXR- expressing cancer stem cells.
- said compound sensitizes cancer stem cells to chemotherapy.
- the invention relates to compound for use for preventing cancer recurrences wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity.
- said cancer responds correctly to chemotherapy.
- said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy.
- the invention in a third aspect, relates to a method for sorting out patients suffering from a cancer who might benefit from an adjuvant or a neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject, wherein patients who show an expression or an overexpression of PXR are good candidates for said adjuvant or neoadjuvant therapy.
- the invention in a fourth aspect, relates to a method for monitoring the response to a treatment of a patient going through chemotherapy comprising measuring the level of expression of PXR in a biological sample of said subject.
- the invention in a fifth aspect, relates to a method for assessing the prognosis of a patient suffering from a cancer, preferably a colorectal cancer, said method comprising the step of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
- the invention relates to a composition
- a composition comprising: at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
- At least one chemotherapeutic agent at least one chemotherapeutic agent.
- the inventors have shown that Knockdown of Pregnane X Receptor (PXR) altered the self -renewal and increased the chemo- sensitivity of cancer stem cells (CSCs), significantly delaying post-chemotherapy tumor relapse and secondary xenograft growth in mice.
- PXR Pregnane X Receptor
- CSCs cancer stem cells
- the inventors have developed a new highly promising strategy for sensitizing cancer stem cells (CSCs) to chemotherapy. Said method is thus highly efficient for treating patients who cannot benefit from appropriate treatment because of the onset of chemoresistance and/or the development of tumour recurrences.
- the invention relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy in a subject,
- said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity;
- the chemotherapy targets a cancer comprising PXR-expressing cancer stem cells.
- PXR Pregnane X Receptor
- NR1I2 Orphan nuclear receptor
- the amino acid sequence of the human PXR is available online under the accession number UniProtKB/Swiss-Prot: 075469.1.
- the gene encoding PXR it is disclosed online under the Gene ID : 8856.
- PXR belongs to the nuclear receptor superfamily, members of which are transcription factors characterized by a ligand-binding domain and a DNA-binding domain.
- the encoded protein is a transcriptional regulator of the cytochrome P450 gene CYP3A4, binding to the response element (PXRE) of the CYP3A4 promoter as a heterodimer with the 9-cis retinoic acid receptor RXR. It is activated by a range of compounds that induce CYP3A4, including dexamethasone and rifampicin.
- PXRE response element
- primary treatment refers to the main treatment used to reduce or eliminate the cancer.
- said primary treatment is based on the administration of chemotherapeutic agent.
- adjuvant therapy refers to an additional treatment to the primary treatment in a patient affected with a cancer and who is at risk of:
- the adjuvant therapy is carried out during or after the primary treatment.
- the compound of the invention is administered during and/or after the chemotherapy to the patient in need thereof.
- nuclear body damage as used herein, also refers to an additional treatment to the primary treatment in a patient affected with a cancer and who is at risk of:
- the neoadjuvant therapy according to the invention is carried out before the primary treatment.
- the compound of the invention is administered before the chemotherapy to the patient in need thereof.
- the aim of such an adjuvant or neoadjuvant treatment is thus to improve the prognosis of the patient.
- the adjuvant or neoadjuvant therapy according to the invention is a treatment which sensitizes the cancer stem cells to chemotherapy.
- the compound of the invention is useful in the context of sensitizing cancer stem cells, especially drug-resistant cancer stem cells.
- the compound of the invention is an antagonist of PXR.
- antagonist or “receptor antagonist” is meant a natural or synthetic compound that has a biological effect opposite to that of an agonist.
- An antagonist binds the receptor and blocks the action of a receptor agonist.
- An antagonist is defined by its ability to block the actions of an agonist.
- agonist or “receptor agonist” is meant a natural or synthetic compound which binds the receptor to form a receptor-agonist complex by activating said receptor and receptor-agonist complex, respectively, initiating a pathway signaling and further biological processes.
- the term "antagonist of PXR” denotes a substance that inhibits the activity of PXR such as the induction of transcription caused by PXR. More specifically, it is a substance that inhibits the binding of PXR and a coactivator of the receptor. As for the term “agonist of PXR”, it denotes a substance that binds PXR and activates its functions such as induction of transcription of genes under the dependence of PXR response elements in their promoters.
- a “receptor” or “receptor molecule” is a soluble or membrane bound/associated protein or glycoprotein comprising one or more domains to which a ligand binds to form a receptor-ligand complex.
- the receptor By binding the ligand, which may be an agonist or an antagonist the receptor is activated or inactivated and may initiate or block pathway signaling.
- ligand or "receptor ligand” is meant a natural or synthetic compound which binds a receptor molecule to form a receptor-ligand complex.
- the term ligand includes agonists, antagonists, and compounds with partial agonist/antagonist action.
- a method for the in vitro screening of antagonists of PXR may comprise the use of reporter gene assays.
- the PXR-reporter gene (such as luciferase, GFP, RFT, ect.) is placed under the control of PXR target promoter (PXRE) and the reporter gene product's activity is quantitatively measured. The results will be reported relative to the activity under a "mutated PXRE" promoter where the binding sites of PXR were destroyed.
- the steps consisting in (a) contacting cells with a ligand known to bind specifically to PXR; (b) contacting the cells of step (a) with a candidate compound; (c) comparing the reporters activities (PXRE and mutated PXRE reporters) of the ligand known to bind to PXR in the presence of said candidate compound, to the activities of ligand known to bind to PXR in the absence of said candidate compound, and (d) selecting positively the candidate compound that specifically reduces the PXRE signal of the ligand known to bind to PXR.
- suitable in vitro screening method according to the invention can be carried out using labeled candidate compounds which are then incubated with a polypeptide that has a PXR ligand binding domain.
- Labels include radioisotopes, immunochemicals, fluorophores, and the like.
- the person skilled in the art will recognize a variety of ways of separating the bound labeled candidate therapeutic agent from the free labeled candidate therapeutic agent.
- the affinity of the labeled candidate therapeutic agent for a PXR polypeptide can be calculated using standard ligand binding methods.
- Another type of a screening method according to the invention may consist in testing the ability of a test compound to modulate binding of PXR to a ligand for PXR such as rifampincin, SR12813, hyperforin.
- the assays involve placing the test compound into an assay mixture that includes at least a ligand-binding domain of a PXR polypeptide and a ligand for PXR. The effect on binding of the PXR ligand to PXR is determined.
- Ligands that are suitable for use in the in vitro screening methods of the invention include, but are not limited to, bile acids and related compounds such as CDCA (chenodeoxycholic acid), GCDCA (glycochenodeoxycholic acid), TCDCA (taurochenodeoxycholic acid), GCA (glycocholic acid), TCA (taurocholic acid), DCA (deoxycholic acid), LCA (lithocholic acid), DHCA (dehydrocholic acid), UDCA (ursodeoxycholic acid) and CA (cholic acid).
- CDCA chenodeoxycholic acid
- GCDCA glycochenodeoxycholic acid
- TCDCA taurochenodeoxycholic acid
- GCA glycocholic acid
- TCA taurocholic acid
- DCA deoxycholic acid
- LCA lithocholic acid
- DHCA dehydrocholic acid
- UDCA ursodeoxycholic acid
- CA cholic acid
- the compound of the invention is an inhibitor of PXR.
- inhibitor of PXR should be understood broadly as it encompasses inhibitors of PXR activity, as well as inhibitors of PXR expression.
- said expression refers to compounds useful for gene silencing, more preferably of :
- said inhibitor is an inhibitor of PXR expression.
- An "inhibitor of PXR expression” refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of the gene encoding for the PXR gene. Said inhibitors are thus useful for down-regulating PXR. More preferably, said inhibitor is a selective inhibitor.
- the term "selective inhibitor of PXR” refers to an inhibitor that is selective for PXR. By “selective” it is meant that Ki of the inhibitor for PXR is at least 5-fold, preferably 10-fold, more preferably 25-fold, still preferably 100-fold lower than the Ki for other protein. The Ki of an inhibitor of PXR may be determined using various methods well known in the art.
- small organic molecule refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals.
- Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
- Inhibitors of PXR expression for use in the present invention may be microRNAs (miRNAs).
- MicroRNAs are a class of short non-coding regulatory RNA, which act as post-transcriptional regulators of gene expression.
- said Inhibitors of PXR expression is miR-148-3p. The sequence is available under the accession number MI0000253.
- Inhibitors of PXR expression for use in the present invention may be based on anti-sense oligonucleotide constructs.
- Anti-sense oligonucleotides including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of PXR mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of PXRs, and thus activity, in a cell.
- antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding PXR can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion.
- Small inhibitory RNAs can also function as inhibitors of PXR expression for use in the present invention.
- PXR expression can be reduced by contacting a subject or cell to a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that PXR expression is specifically inhibited (i.e. RNA interference or RNAi).
- dsRNA small double stranded RNA
- RNAi RNA interference
- Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT.
- the compound of the invention is an inhibitor of PXR expression selected from the group consisting of the following siRNA :
- shRNAs short hairpin RNA
- shRNAs can also function as inhibitors of PXR expression for use in the present invention.
- Ribozymes can also function as inhibitors of PXR expression for use in the present invention.
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
- the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.
- Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of PXR mRNA sequences are thereby useful within the scope of the present invention.
- ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable.
- antisense oligonucleotides and ribozymes useful as inhibitors of PXR expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis.
- anti- sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
- suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
- Antisense oligonucleotides, siRNAs, shRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector.
- a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid to the cells and preferably cells expressing PXR.
- said inhibitor is an inhibitor of the activity of PXR.
- An "inhibitor of the activity” refers to a compound that alters the activity of PXR, i.e. the transcriptional activity of PXR.
- Examples of inhibitors of PXR activity include, but are not limited to, L-sulphoraphane, sesamin, ketokonazole, A-792611, silybin, metformin, phorbol 12-myristate 13-acetate and okadaic acid.
- said inhibitors of PXR activity is selected from the group consisting of L-sulphoraphane, sesamin, ketokonazole, A-792611, silybin, phorbol 12-myristate 13-acetate , okadaic acid, and FLB-12.
- A-792611 is (S)-l-[(lS,3S,4S)-4-[(S)-2-(3-benzyl-2-oxo- imidazolidin-l-yl)-3,3-dimethyl-butyrylamino]-3-hydroxy-5-phenyl-l-(4-pyridin-2-yl- benzyl)-pentylcarbamoyl]-2,2-dimethyl-propyl-carbamic acid methyl ester.
- FLB- 12 is l-(4-(4-(((2R,4S)-2-(2,4-difluorophenyl)-2-methyl- l,3-dioxolan-4-yl)methoxy)phenyl)piperazin-l-yl)ethanone.
- This specific azole analog is disclosed in the publication Venkatesh M et al., "In vivo and in vitro characterization of a first-in-class novel azole analog that targets pregnane X receptor activation", Mol Pharmacol. 2011 Jul;80(l): 124-35.
- said inhibitors of PXR modify the phosphorylation of the PXR, hereby modifying its inherent activity.
- a method for the in vitro screening of inhibitors of PXR may comprise the use of reporter gene assays.
- the PXR-reporter gene (such as luciferase, GFP, RFT, etc.) is placed under the control of PXR target promoter (PXRE) and the reporter gene product's activity is quantitatively measured. The results will be reported relative to the activity under a "mutated PXRE" promoter where the binding sites of PXR were destroyed.
- the steps consisting in (a) contacting cells with a ligand known to bind specifically to PXR; (b) contacting the cells of step (a) with a candidate compound; (c) comparing the reporters activities (PXRE and mutated PXRE reporters) of the ligand known to bind to PXR in the presence of said candidate compound, to the activities of ligand known to bind to PXR in the absence of said candidate compound, and (d) selecting positively the candidate compound that specifically reduces the PXRE signal of the ligand known to bind to PXR.
- chemotherapy refers to a strategy of treatment useful in treating cancer, based on the administration of a "chemotherapeutic agent”.
- “Chemotherapeutic agents' or “anticancer drugs” include, but are not limited to, fludarabine, gemcitabine, capecitabine, methotrexate, taxol, taxotere, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, platinum complexes such as cisplatin, carboplatin and oxaliplatin, mitomycin, dacarbazine, procarbizine, etoposide, teniposide, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, L- asparaginas
- said chemotherapeutic agent is selected from the groups consisting of
- campathecins such as SN-38 which is the active metabolite of irinotecan, cisplatin, taxanes, vincristine, and gemcitabine.
- the anticancer drug can be a monoclonal antibody.
- Monoclonal antibodies include, but are not limited to, bevacizumab (avastin), cetuximab (ertibux), panitumumab (vectibix).
- the compound of the invention sensitizes cancer stem cells to chemotherapy.
- the expression 'sensitization of cancer stem cells to chemotherapy refers to a process by which chemotherapy resistant cancer stem cells are efficiently targeted and become sensitive to chemotherapy, i.e. the anti-cancer drug shows its therapeutic effects.
- the precise mechanism underlying CSC drug resistance remains partly unclear, but may involve multiple parameters such as slow proliferation, increased resistance to DNA damage, activation of anti-apoptosis mechanisms, but also expression of multidrug transporters such as ATP-binding cassette G2 (ABCG2) and of drug metabolizing enzymes such as aldehyde dehydrogenase 1A1 (ALDH1A1).
- PXR-expressing cancer stem cells or “PXR-overexpressing cancer stem cell” refer to a population of cancer stem cells which express PXR or overexpress PXR in comparison with other tumor cells.
- the expression of PXR in said cancer stem cells is higher than the expression of PXR of the rest of the tumor cells, i.e. tumor cells other than cancer stem cells.
- said chemotherapy targets a cancer comprising PXR-expressing cancer stem cells.
- cancer or “tumor”, as used herein, refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features.
- cancer comprising PXR-expressing cancer stem cells include colorectal cancer, ovarian cancer, pancreas cancer and breast cancer, melanoma, adrenal gland cancer, biliary tract cancer, bladder cancer, brain or central nervous system cancer, bronchus cancer, blastoma, carcinoma, a chondrosarcoma, cancer of the oral cavity or pharynx, cervical cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, hepatic carcinoma, hepatoma, hepatocellular carcinoma, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, non-small cell lung cancer, osteosarcoma, peripheral nervous system cancer, prostate cancer, sarcoma, salivary gland cancer, small bowel or appendix cancer, small-cell lung cancer, squamous cell cancer, stomach cancer, testis cancer, thyroid cancer, urinary bladder cancer, uterine or endometrial cancer, and
- said cancer comprising PXR-expressing cancer stem cells is selected from the group consisting of colorectal cancer, hepatocellular carcinoma, endometrial cancer, prostate cancer, ovarian cancer, pancreas cancer, breast cancer, melanoma and lung cancer.
- said cancer is selected from the group consisting of ovarian cancer, pancreas cancer and breast cancer.
- the compound of the invention sensitizes cancer stems cells of respectfully ovarian, pancreatic and breast origins.
- the invention further relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy,
- said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity;
- said chemotherapy targets a cancer selected from the group consisting of ovarian cancer, pancreas cancer and breast cancer.
- the invention relates to a compound for use for treating cancer in a patient going through chemotherapy, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; and wherein said cancer comprises PXR-expressing cancer stem cells. All the previously disclosed are applicable here.
- Cancer stem cells may generate new tumors through the stem cell processes of self-renewal and differentiation into multiple cell types. Such cells are proposed to persist in tumors as a distinct population and cause relapse and metastasis by giving rise to new tumors.
- a tumor comprises three types of cells: including cancer stem cells, progenitor cells, and differentiated cells.
- Progenitor cells have limited proliferative potential.
- chemotherapeutic agents target progenitor cells.
- the progenitor cells then mature into differentiated cells, which do not proliferate.
- Standard treatments in cancer therapy merely target the progenitor cells.
- Unfortunately what looks like a successful treatment is often only the reduction of tumor mass (including for example progenitor cells and differentiated cells) without killing the cancer stem cells that, after the treatment is terminated, may induce new tumors or metastases.
- cancer stem cells survive and the cancer can relapse.
- Cancer stem cells are thus known to be responsible for a cancer recurrence.
- cancer recurrence or “cancer relapse” refers to the return of a cancer that occurs after treatment of such cancer and after a period of time during which the cancer is considered as non-detectable.
- the cancer recurrence may be a local recurrence or a distal recurrence.
- Local recurrence refers to cancers that recur in tissues or organs adjacent to or proximate to the initial cancer tissue or organ, whereas distal recurrence refers to cancers that recur distant from the cancerous tissue or organ.
- the cancer recurrence is a local recurrence.
- recurrence may occur after the removal of the initial tumor.
- local recurrence may occur from metastatic cells.
- a chemotherapeutic agent targets a cancer tissue or organ, it may destroy cancerous cells without affecting a group of chemo-resistant cancer cells within said tissue or organ.
- a cancer tissue or organ may globally react positively to cancer therapy, even though a small population of the cells constituting the cancer tissue or organ are resistant to the treatment.
- these resistant cells are cancer stem cells. While cancer stem cells are not necessarily derived from normal stem cells, defining characteristics of CSCs include the ability to self-renew as well as differentiate into cancer cells.
- the expression "globally well responsive cancer” or “responsive cancer” refers to a cancer that responds correctly to cancer therapy, i.e. which is sensitive to cancer therapy, preferably chemotherapy.
- a responsive cancer appears to be entirely destroyed by such therapy.
- said cancer comprises a subpopulation of cancer cells which is resistant to cancer therapy, preferably a subpopulation of cells consisting of CSC.
- the inventors have discovered a promising strategy to specifically target these cells. The results of the inventors indeed indicate that the compound of the invention is extremely useful for specifically targeting the chemoresistant cancer stem cells within an otherwise sensitive cancerous tissue.
- the invention relates to a compound for use for preventing cancer recurrence, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity.
- said cancer is globally well-responsive to chemotherapy, i.e. said cancer responds correctly to chemotherapy.
- said cancer is selected from the group consisting of drug resistant cancer, a refractory cancer, a recurrent cancer or a non-resectable tumor.
- said cancer is a metastatic cancer, more preferably a metastatic cancer from a primary colorectal cancer.
- said compound acts specifically in a chemoresistant subpopulation of cells of globally well responsive cancer, preferably the cancerous stem cells.
- said compound acts specifically on cancerous stem cells, typically chemoresistant cancerous stem cells.
- the compound sensitizes cancer stem cells to chemotherapy.
- the invention in a third aspect, relates to a method of screening patients suffering from a cancer who might benefit from an adjuvant or a neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said patient, wherein patients who show an expression or an overexpression of PXR are good candidates for said adjuvant or neoadjuvant therapy.
- the invention is drawn to a compound for use for preventing cancer recurrence wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; said cancer responds correctly to chemotherapy; said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy, and
- the patient is identified by a method comprising :
- the term "gene expression level” or “the expression level of a gene” refers to an amount or a concentration of a transcription product, for instance mRNA, or of a translation product, for instance a protein or polypeptide.
- a level of mRNA expression can be expressed in units such as transcripts per cell or nanograms per microgram of tissue.
- a level of a polypeptide can be expressed as nanograms per microgram of tissue or nanograms per milliliter of a culture medium, for example. Alternatively, relative units can be employed to describe an expression level.
- the expression “mRNA transcript” refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence without introns and that can be translated into polypeptides by the cell.
- biological sample refers to any biological sample obtained for the purpose of evaluation in vitro.
- said biological sample can be obtained from solid tissues and tumor tissues.
- further biological samples include blood, serum, plasma, nipple aspirate fluid, urine, saliva, synovial fluid and cephalorachidian liquid (CRL).
- the tissue sample may be obtained from a biopsy procedure in the subject or from a surgical procedure to remove a tumor mass from the subject, preferably a primary tumor and not a metastasis.
- said biological sample is blood, which may comprise tumor derived material such as tumor cells, tumor relapsed proteins and/or nucleic acids or tumor released material such as exosomes,
- the expression of "measuring the expression level of a gene” encompasses the step of measuring the quantity of a transcription product, preferably mRNA obtained through transcription of said gene, and/or the step of measuring the quantity of translation product, preferably the protein obtained through translation of said gene.
- the step of measuring the expression of a gene refers to the step of measuring the quantity of mRNA obtained through transcription of said gene.
- the step a) of measuring the level of gene expression of said gene(s) may be performed according to the routine techniques, well known of the person skilled in the art.
- step a) of measuring the level of expression of PXR is a step of measuring the expression level of translation products, preferably PXR proteins.
- Methods for measuring the quantity of protein in a biological sample may be measured by using standard immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays.
- immunoassays such as competition, direct reaction, or sandwich type assays.
- cancer cells are purified from the isolated biological sample.
- assays include, but are not limited to, agglutination tests; enzyme-labelled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; immunoelectrophoresis; immunoprecipitation.
- the reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted therewith. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the target protein of the invention. The cancer cells of the biological sample that are suspected of containing a target protein of the invention are then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labelled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
- an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the target protein
- the methods of the invention comprise contacting the cancer cells of the biological sample with a binding partner capable of selectively interacting with at least one of the target proteins of the invention (i.e. a protein coded by one of the genes of interest of the invention) present in the biological sample.
- the binding partner may be an antibody that may be polyclonal or monoclonal, preferably monoclonal. In another embodiment, the binding partner may be an aptamer.
- Polyclonal antibodies of the invention or a fragment thereof can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others.
- a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others.
- Various adjuvants known in the art can be used to enhance antibody production.
- antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred.
- Monoclonal antibodies of the invention or a fragment thereof can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture.
- Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV- hybridoma technique (Cole et al. 1985).
- Antibodies useful in practicing the present invention also include fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
- F(ab')2 fragments which can be generated by pepsin digestion of an intact antibody molecule
- Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
- Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to the target protein of the invention. For example, phage display of antibodies may be used.
- single-chain Fv (scFv) or Fab fragments are expressed on the surface of a suitable bacteriophage, e. g., M13.
- a suitable host e. g., mouse
- the coding regions of the VL and VH chains are obtained from those cells that are producing the desired antibody against the protein. These coding regions are then fused to a terminus of a phage sequence.
- a suitable carrier e.g. bacteria
- the phage displays the antibody fragment.
- Phage display of antibodies may also be provided by combinatorial methods known to those skilled in the art. Antibody fragments displayed by a phage may then be used as part of an immunoassay.
- the binding partner may be an aptamer.
- Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition.
- Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity.
- Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. 1997.
- the random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence.
- Peptide aptamers consist of conformationally constrained antibody variable regions displayed by a platform protein, such as E. coli Thioredoxin A, that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
- binding partners of the invention such as antibodies or aptamers, may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art.
- a detectable molecule or substance such as a fluorescent molecule, a radioactive molecule or any others labels known in the art.
- Labels are known in the art that generally provide (either directly or indirectly) a signal.
- the term "labelled", with regard to the antibody is intended to encompass direct labelling of the antibody or aptamer by coupling (i.e., physically linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)) to the antibody or aptamer, as well as indirect labelling of the probe or antibody by reactivity with a detectable substance.
- a detectable substance such as a radioactive agent or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5))
- FITC fluorescein isothiocyanate
- PE phycoerythrin
- Indocyanine Indocyanine
- An antibody or aptamer of the invention may be labelled with a radioactive molecule by any method known in the art.
- the aforementioned assays generally involve the binding of the binding partner (i.e. antibody or aptamer) to a solid support.
- Solid supports that can be used in the practice of the invention include substrates such as nitrocellulose (e. g., in membrane or microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.
- said step a) of measuring the level of expression of PXR is a step of measuring the expression level of transcription products, preferably mRNA.
- the nucleic acid contained in the biological sample may be extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions.
- the extracted mRNA may be then detected by hybridization (e. g., Northern blot analysis).
- the extracted mRNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that enable amplification of a region in said genes.
- RT-PCR polymerase chain reaction
- Extracted mRNA may be reverse-transcribed and amplified, after which amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art.
- Other methods of amplification include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).
- Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to the mRNA of interest, herein find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90- 95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, enzymatic or other ligands (e. g. avidin/biotin).
- Probes typically comprise single- stranded nucleic acids of between 10 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500.
- Primers typically are shorter single- stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified.
- the probes and primers are "specific" to the nucleic acids they hybridize to, i.e. they preferably hybridize under high stringency hybridization conditions (corresponding to the highest melting temperature Tm, e.g., 50 % formamide, 5x or 6x SCC.
- Tm melting temperature
- SCC is a 0.15 M NaCl, 0.015 M Na-citrate).
- the nucleic acid primers or probes used in the above amplification and detection method may be assembled as a kit.
- a kit includes consensus primers and molecular probes.
- a preferred kit also includes the components necessary to determine if amplification has occurred.
- the kit may also include, for example, PCR buffers and enzymes; positive control sequences, reaction control primers; and instructions for amplifying and detecting the specific sequences.
- the method of the invention further comprises a step b) of comparing the level of expression of PXR obtained in step a) to a threshold value.
- a threshold value can be determined experimentally, empirically, or theoretically.
- a threshold value can also be arbitrarily selected based upon the existing experimental and/or clinical conditions, as would be recognized by person skilled in the art. It is noteworthy that the expression of PXR may be seen as a higher level in comparison with a reference level. Similarly, an absence of expression of PXR may be seen as a lower level in comparison with a reference level.
- step a) is a step of measuring the activity of PXR in a biological sample of said subject.
- said step performed by quantification of PXR target gene expression.
- target genes of PXR are cancer stem cell-specific target genes such as ALDH1A1, LGR5, CD26, CD24, TERT, ABCG2, CXCR4, OLFM4, EphB2 or target genes involved in treatment resistance and tumour recurrence such as respectively UGT1A1, S100A10 and ABCC6, BLVRA, and BCL11A.
- the quantification of PXR target gene expression is performed by DNA microarray.
- the person skilled in the art is able to design or identify appropriate probes for carrying out such microarray.
- ADH1A1 refers to the gene of "aldehyde dehydrogenase 1 family, member Al”. The sequence is available under the accession number Gene ID: 216.
- LGR5 refers to the gene of "leucine-rich repeat containing G protein-coupled receptor 5". The sequence is available under the accession number Gene ID: 8549.
- CD26 refers to the gene of "dipeptidyl-peptidase 4". The sequence is available under the accession number Gene ID: 1803.
- CD24 refers to the gene of "CD24 molecule”. The sequence is available under the accession number Gene ID: 100133941.
- TERT refers to the gene of "telomerase reverse transcriptase”. The sequence is available under the accession number Gene ID: 7015.
- ABCG2 refers to the gene of "ATP-binding cassette, sub-family G (WHITE), member 2". The sequence is available under the accession number Gene ID: 9429.
- CXCR4 refers to the gene of "chemokine (C-X-C motif) receptor 4". The sequence is available under the accession number Gene ID: 7852.
- OFM4 refers to the gene of "olfactomedin 4". The sequence is available under the accession number Gene ID: 105620.
- EphB2 refers to the gene of "EPH receptor B2". The sequence is available under the accession number Gene IS: 2048.
- UGT1A1 refers to the gene of "UDP glucuronosyltransferase 1 family, polypeptide Al”. The sequence is available under the accession number Gene ID: 54658.
- S100A10 refers to S100 calcium binding protein A100.
- the sequence is available under the accession number Gene ID: 6281.
- ABSCC6 refers to the gene of "ATP-binding cassette, sub-family C (CFTR/MRP), member 6". The sequence is available under the accession Gene ID: 368.
- BLVRA refers to the gene of "biliverdin reductase A”. The sequence is available under the accession number Gene ID: 644
- BCLllA refers to the gene of "B-cell CLL/lymphoma 11A (zinc finger protein)". The sequence is available under the accession number Gene ID: 53335.
- the person skilled in the art may refer to the sequences of primer set forth in SEQ ID No. 3 to SEQ ID No. 36 for measuring gene expression of the above mentioned gene, for example by real-time PCR.
- the invention in a fourth aspect, pertains to a method for monitoring the response to a treatment of a patient going through a chemotherapy comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
- High level of expression of PXR is associated with a negative prognosis and said patient can therefore be construed as a bad responder to chemotherapy.
- a patient having a negative vital prognosis would have high risk of treatment failure to drug therapies, a cancer recurrence, and/or metastasis.
- the term "negative prognosis" indicates a decreased patient survival and/or an early disease progression and/or an increase disease recurrence and/or an increase metastasis formation. The physician would thus have to adapt the treatment.
- positive prognosis refers to an increased patient survival and/or a late disease progression and/or a decreased disease recurrence and/or a decreased metastasis formation.
- the physician would thus be able to adapt the treatment and provide the best therapeutic strategy for each patient.
- the monitoring of a patient undergoing chemotherapy by quantifying PXR expression or activity of PXR provide predictive information as to whether the patient is likely :
- the step of measuring the gene expression level is performed by the following method:
- a biological sample in case of monitoring the response to a treatment of a patient going through chemotherapy, may be a sample of the cancerous tissue or cells obtained from the patient according to methods known in the art.
- Said biological sample is for example a biopsy.
- the sample comes from complete surgical resection of the primary tumour.
- said biological sample is composed of tumor cells circulating in the blood of cancer patients or of a metastatic sample biopsy.
- the step of measuring the gene expression level may be performed according to the routine techniques, well known of the person skilled in the art. More preferably, the measurement comprises contacting the cancer cells of the biological sample with selective reagents such as probes, primers, ligands or antibodies, and thereby detecting the presence of nucleic acids or proteins of interest originally in the sample.
- selective reagents such as probes, primers, ligands or antibodies
- the method of the invention may involve the following steps: - determining at a first time point the level of expression or activity of PXR in a biological sample of said subject at said first time point; and
- An “increased level” or “level higher” or a “decreased level” or a “lower level” than a comparative level, or a “change” or “deviation” or from said comparative level is statistically significant.
- an increased level or a decreased level from, or change or deviation from a comparative level can be considered to exist if the level differs from the comparative level by about 5% or more, by about 10% or more, by about 20% or more, or by about 50% or more compared to the comparative level.
- the "comparative level” preferably refers to the level of expression or activity of PXR obtained at the first time point.
- Statistically significant may alternatively be calculated as P ⁇ 0.05 when using any relevant statistical assay familiar to the man of the art.
- the invention thus provides a biomarker by which a practitioner may predict the reaction of a patient subjected to a treatment.
- the treatment is considered to be effective when the level of expression or activity of PXR between the first and the second time point decreases of at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, still even more preferably at least 80%. This generally indicates a good prognosis.
- the treatment is considered to be ineffective when the level PXR are detected in the second time point whereas they were not at the first point time.
- the treatment is also considered to be ineffective when the level of expression or activity of PXR between the first and the second time point increases by at least 5%, preferably at least 10%, more preferably at least 20%, even more preferably at least 30%, still even more preferably at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, still even more preferably at least 80% or more.
- the invention provides a mean for monitoring the responsiveness of a patient to chemotherapy.
- the invention relates to a method for assessing the prognosis of a patient suffering from a cancer, preferably a colorectal cancer, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
- the method of the invention further comprises a step b) of comparing the level of expression of PXR obtained in step a) to a threshold value.
- a decrease in the level of expression or activity of PXR is indicative of a good prognosis.
- an increase in the level of expression or activity of PXR is indicative of a poor prognosis.
- a “poor prognosis” preferably refers to a high chance of cancer recurrence whereas "a good prognosis” refers to a diminished chance of cancer recurrence.
- the method of the invention provides the physician with highly valuable information regarding the risk of a patient to relapse. Consequently, the method allows the screening and identification of patients who would benefit from a therapy based on the administration of a compound selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity.
- compositions comprising:
- At least one chemotherapeutic agent at least one chemotherapeutic agent.
- compositions are highly promising for treating cancer. Indeed, they address the need for treating cancer as well as for sensitizing cancer stem cells.
- the invention relates to:
- cancer as a combined preparation for simultaneous, separate or sequential use in the treatment of cancer, , or a recurrence of said cancer, said cancer being selected from the group consisting of colorectal cancer, ovarian cancer, pancreas cancer and breast cancer.
- Another object of the invention is a pharmaceutical composition
- a pharmaceutical composition comprising: i) at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
- said cancer for use for preventing and/or treating a cancer, or a recurrence of said cancer, said cancer being preferably selected from the group consisting of colorectal cancer, ovarian cancer, pancreas cancer and breast cancer.
- said cancers are cancer comprising PXR-expressing cancer stem cells. All the previously mentioned technical features are applicable here.
- the pharmaceutical composition of the invention may comprise, in addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
- a pharmaceutically acceptable excipient e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal or patch routes.
- Prescription of treatment is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners.
- the compounds of the invention and the chemotherapeutic agents are embodied in pharmaceutical compositions intended for administration by any effective means, including parenteral, topical, oral, pulmonary (e.g. by inhalation) or local administration.
- the pharmaceutical compositions are administered parenterally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly, or intranasally.
- the pharmaceutical composition of the invention is administrated by intranasal route.
- the pharmaceutical composition of the invention is administrated intravenously.
- the invention provides compositions for parenteral administration that comprise a solution of the compounds of the invention, as described above, dissolved or suspended in an acceptable carrier, preferably an aqueous carrier.
- an acceptable carrier preferably an aqueous carrier.
- aqueous carriers may be used including, for example, water, buffered water, 0.4% saline, 0.3% glycine, hyaluronic acid and the like.
- These compositions may be sterilized by conventional, well-known sterilization techniques or, they may be sterile filtered.
- the resulting aqueous solutions may be packaged for use as is or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration.
- compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions including pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, such as, for example, sodium acetate, sodium lactate, sodium chloride potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
- auxiliary substances such as, for example, sodium acetate, sodium lactate, sodium chloride potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
- nontoxic solid carriers may be used that include, for, example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
- a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient and more preferably at a concentration of 25%-75%.
- the NAP or ADNF polypeptides are preferably supplied in finely divided from along with a surfactant and propellant.
- the surfactant must, of course, be nontoxic, and preferably soluble in the propellant.
- Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
- Mixed esters, such as mixed or natural glycerides may be employed.
- a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery.
- An example includes a solution in which each milliliter included 7.5 mg NaCl, 1.7 mg citric acid monohydrate, 3 mg disodium phosphate dihydrate and 0.2 mg benzalkonium chloride solution (50%)
- Another object of the invention is a method for preventing and/or treating cancer in a subject in need thereof, said method comprising administering a therapeutically effective amount of at least one compound of the invention as described here above, and a chemotherapeutic agent or a therapeutically effective amount of a pharmaceutical composition as described here above.
- the compound of the invention and the chemotherapeutic agent are administered to a patient in an amount sufficient to prevent and/or treat cancer.
- Amounts effective for this use will depend on, for example, the particular compound employed, the type of cancer to be prevented, the route of administration, the weight and general state of health of the patient, and the judgement of the prescribing physician.
- an amount of the compound of the invention falling within the range of a 100 ng to 10 mg dose given intra-nasally once a day (e.g., in the evening) would be a therapeutically effective amount.
- dosages may be outside of this range, or on a different schedule.
- dosages may range from 0.0001 mg kg to 10,000 mg/kg, and will preferably be about 0.001 mg kg, 0.1 mg/kg, 1 mg/kg
- Doses may be administered hourly, every 4,
- the duration of dosing may be single (acute) dosing, or over the course of days, weeks, months, or years, depending on the condition to be treated.
- the invention also relates to a theragnosis method.
- the term "theragnosis” refers to the identification, for example by diagnostic methods, of patients who might benefit from a particular therapy.
- the invention thus relates to a method for preventing a patient suffering from a cancer from developing a cancer recurrence, said method comprising the steps of :
- step 1) shows an expression or an overexpression of PXR
- step 2) if step 1) shows an expression or an overexpression of PXR, then the method comprises a step 3) of administering a compound selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity to said patient.
- a compound selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity to said patient.
- mice Evolution of tumor volume over time after subcutaneous injection of 15.000 shLuc or shPXR CRC1 colon cancer cells isolated from colonospheres (18mice/group). Once tumors reached a 100 mm3 volume, mice were randomized (day 20). Three days after randomization, one group (6 mice/group) was treated twice weekly for 4 weeks with vehicle or with Folfiri (90mg kg leucovorin, 50mg/kg 5-FU and 30mg/kg irinotecan, twice a week during 4 weeks, 12mice/group). At day 48, three days after the end of treatment, 6 mice/group were sacrificed and the remaining ones from Folfiri- treated groups (6 mice/group) were kept for 7 weeks without treatment to further monitor tumor growth.
- Folfiri 90mg kg leucovorin, 50mg/kg 5-FU and 30mg/kg irinotecan
- ALDH1A a-huALDHlA
- human mitochondria a-huMitoch
- Figure 7 Down-regulation of PXR mRNA suppressed tumor growth and prolonged survival in patient-derived colon cancer xenografts.
- FIG. 8 PXR depletion in CRC cell lines impairs chemotherapy-induced enrichment of PXR and CSC markers in vitro.
- OCT4 and LGR5 mRNA expression were quantified by RT-qPCR on CRC1 cells maintained as colonospheres for multiple passages (SI to S8).
- RT-qPCR data are expressed as the mean+SEM of >3 experiments and are reported as fold change compared to cells grown under adherent conditions ('2D'). *, p ⁇ 0.05 compared to 2D conditions (student's t-test).
- PXR transcriptional activity was measured with PXR-promoter luciferase reporters assay , i.e. the synthetic PXRE response element (CYP2B6 NRlx3TKpGL3b, PXREx3TK) or the [-7600/-7200] pCYP3A4- 163/+l lpGL2b construct (XREM CYP3A4), in ALDH 10 and ALDH br T84 cells. Data in are expressed as the mean+SEM of >3 experiments and are compared to ALDH 10 cells. *, P ⁇ 0.05 compared to ALDH br cells (student's t-test).
- Figure 11 PXR drives the expression of a large number of genes that protect CSCs against genotoxic death stimuli and promote self-renewal.
- Figure 13 PXR transcriptional activity marks chemoresistant CSCs in lung cell cancer cells.
- Example 1 Pregnane X-receptor drives post-treatment tumor recurrence in colon cancer by regulating a cancer stem cell genes signature network
- LS174T stable PXR transfectants (LS-PXR2 and LS-PXR6) were previously described.
- CRC cell lines (T84, LS174T, HT29, DLD1, SW620) and SKOV3, MIA- PACA2 and MDA-MB237 were obtained from ATCC and maintained in DMEM (Gibco) with 10% FBS or as spheroids in defined Mil media in ultra-low attachment flasks (Corning).
- Mil is DMEM/F12 (1: 1) medium (Gibco), supplemented with N2, Glutamine 3 mM, Glucose 0.6%, insulin 4 ⁇ g/ml (Sigma-Aldrich), Penicilin G lOOU/ml, Streptomycin lOOug/ml, hBasic-FGF 10 ng/ml (R&D Systems), hEGF 20 ng/ml (R&D Systems).
- Patient-derived cell cultures (CRC1, 19, 24, 25) of colon cancer cells were obtained from CRC biopsies provided by CHU-Caremeau (Nimes, France, ClinicalTrial.gov Identifier#NCT01577511) within an approved protocol.
- Tumors were washed, minced into fragments ( ⁇ 2mm 3 ) and digested with liberase H (0.26U/mL, Roche) resuspended in Accumax (Sigma-Aldrich). After 2 hours at 37°C, cell suspension was filtered through a 40 ⁇ mesh to obtain a single cell suspension and plated in DMEM medium, supplemented with FBS, glutamine, antibiotics and non-essential aminoacids.
- Liver metastasis samples obtained from patients with metastatic colorectal disease were obtained according to French government regulations and with ethical committee approval (CHUvier, agreement #CT 094173). Patients diagnosed with stage II or III colon cancer and treated at the Colorectal Cancer Unit of the Hospital Clinic of Barcelona between 1998 and 2005 were previously described. The study was approved by the institutional Ethics Committee of the Hospital Clinic of Barcelona.
- FFPE paraffin embedded
- DNAse-1 The first strand cDNA was synthetized using Superscript II (Invitrogen) and random hexamers, and gene expression was measured by real-time PCR. Primer sequences are detailed in the following table:
- RNA expression profiling of LS 174T overexpressing PXR were performed on 44K Agilent Human Genome, Agilent Technologies with competitive hybridization of each LS174T transfectants (LS-CTRL, LS-PXR2 and LS-PXR6) versus a pool of equal amounts of total RNA from all samples. Five microgram aliquots of total RNA from each sample and from the reference pool were used to generate labeled antisense cRNAs with T7 RNA polymerase. Reverse transcription, linear amplification, cRNA labeling, and purification were performed with the Agilent Linear Amplification kit.
- the arrays were then washed with 0.6x and O.Olx SSC buffers containing Triton, and were dried with a nitrogen gun before scanning with an Agilent DNA microarray scanner.
- the fluorescence images thus obtained were quantified with Feature Extraction software (Agilent Technologies).
- RNA expression profiling of CRC1 ALDHbr transfected with PXR siRNA cells were performed using Affymetrix Human gene ST 2.0 DNA microarrays.
- ALDH high cell-derived CRC 1 colonospheres were collected after transfection with control (si ⁇ Gal) siRNA or siPXR and were analysed in biological triplicates.
- Preparation of cRNA was done with the "GeneChip® WT PLUS Reagent Kit (Affymetrix)" as recommended by the supplier. Hybridizations, washes, detection and quantification were then done as previously described and expression data were normalised by the Robust Multichip Average method using the Affymetrix "Expression Console" software. Then, analyses were done in R and associated packages.
- GSEA Gene set enrichment analysis
- the CYP3A4-XREMpGL3Luc, the PXR responsive (NRl)3TKluc, the control pGL3TK luciferase (TKluc) plasmids and ⁇ -galactosidase expressing plasmid, pSV- GAL have been described previously.
- the EIFlaeGFP plasmid was from addgene (#39196).
- DNA fragment corresponding to the [-7600/-7200]/(-1100/+ll) CYP3A4 promoter was cloned in the lentiviral expression vector pLV-GFP upstream from the GFP reporter gene (from Anne Corlu, INSERM UMR991, Rennes, France). siRNA duplexes cells transfection
- the aldefluor assay (Stem Cell Technologies) was performed according to the manufacturer's instructions (Stem Cell Technologies). ALDH bright cells (ALDH br ) and ALDH low cells (ALDH 10 ) were identified by comparing the same sample with and without the ALDH inhibitor diethylaminobenzaidehyde (DEAB). FACS gating of ALDH activity was set at 0.1% in presence of DEAB. Cells were analyzed and sorted using (BD) FACSAria II and Summit 6.0 or Cyflogic softwares. Dead cells were excluded based on light scatter characteristics.
- tumors were harvested and fixed 2 hours with PFA 4% and were dehydrated with serial ethanol baths followed by xylene baths before being embedded in paraffin. 6 ⁇ slides were then cut using a microtome (Microm, HM335E). Embedded tumor slides were dewaxed by heating at 56°C and immersing in serial xylene and graded ethanol baths. Antigen retrieval was performed in boiling citrate buffer for 20 min and nonspecific binding sites were blocked for lh in Phosphate Buffered Saline (PBS) containing 5% milk and 0,5% triton. Slides were incubated overnight at 4°C with primary antibodies diluted in blocking buffer.
- PBS Phosphate Buffered Saline
- Anti-ALDHlAl (1/100) was from BD Biosciences (60274), anti-human mitochondria (1/100) was from Millipore (MAB 1273). Secondary antibodies used for immunohistochemistry were developed using 3 3' diammobenzidine tetrahydrochloride (DAB). Slides were counterstained with hematoxylin and coverslipped with permount. Human mitochondria- and ALDH1A1- stained areas in tumor sections were measured on an image analyzer (Image J, NIH) software. Sphere formation assays
- Percentage of Cell Forming Sphere was determined after plating 100 cells/well in Mi l medium in P96 wells in ultra-low attachment plates (Corning). Sphere size exceeding 50 ⁇ were counted.
- the inventors first validated PXR shRNA (shPXR) sequences leading to the specific down-expression of PXR expression and its target genes, and performed rescue experiment to confirm the direct involvement of PXR on these effects (Figure 6). Then, to study the relationship between PXR and CSCs chemoresistance, we established colonosphere culture isolated from freshly resected colorectal tumor after infection with lentivirus expressing small hairpin RNAs targeted against human PXR (shPXR1334, hereafter shPXR) or control (shLUC). As expected, a significant down-regulation of PXR, CYP3A4, ALDH1A1 and ABCG2 mRNAs was quantified (Figure la).
- mice were randomized to receive vehicle or a folfiri regimen (i.e. 90mg/kg Leucovorin+50mg/kg 5-fluorouracil+30mg/kg Irinotecan, twice a week during 4 weeks) designed to induce tumor regression (22).
- a folfiri regimen i.e. 90mg/kg Leucovorin+50mg/kg 5-fluorouracil+30mg/kg Irinotecan, twice a week during 4 weeks
- the tumor volume was calculated at various time points and represented as tumor volume changes from day 20.
- the inventors then asked whether the importance of PXR on the ability of CSCs to resist and survive chemotherapy could reflect a preferential expression of PXR in the CSC population. To do so, the inventors compared PXR expression in CSCs versus non- CSCs by using enrichment of self-renewing cells via spheroids passaging or Aldefluor- based cell sorting.
- Western blot and RT-qPCR analysis showed the selective expression of PXR in CRC cells maintained as colonospheres (Sphe) compared to cells maintained in adherent conditions and exposed to serum-containing medium (2D) (Figure 3a). Similar results were obtained with HT29, SW620, T84 and SW480 CRC cell lines ( Figure 9a).
- the inventors quantified PXR expression in CSC population isolated according to their strong ALDH1A activity level via Aldefluor- mediated flow cytometry.
- luciferase reporter genes for PXR transcriptional activity were specifically increased in ALDHbr cells (p ⁇ 0.001; Figure 3d and lOe).
- the inventors infected T84 cells with a GFP-tagged PXR-driven promoter (CYP3A4eGFP) to monitor PXR activity.
- This composite construct contains both the proximal part of the CYP3A4 promoter (-163/+11 region, that contains a proximal PXRE ER6 element) fused a PXR- driven enhancer (-7600/-7200 regions, also named XREM for Xenobiotic Response Element module that contain 3 PXRE elements).
- CYP3A4eGFP GFP-tagged PXR-driven promoter
- CYP3A4br showed higher resistance towards Firi treatment than CYP3A41o cells ( Figure 4a), in agreement with an enhanced expression of PXR and its target genes ( Figure 4b), confirming the correlation between the endogenous expression and activity of PXR and the CYP3A4 promoter-driven eGFP expression.
- LS 174T CRC cells were stably transfected with PXR cDNA (clones PXR6 and PXR2) or infected with lentivirus expressing shPXR. Since ALDHlAl activity has been described as colon CSC marker and a regulator of cellular chemoresistance and cell renewal, we focused our attention on its putative regulation by PXR. Indeed, it has already been shown that PXR activators induce both liver Aldhlal mRNA expression and PXR binding to the aldhlAl gene in mice as measured by chromatin immunoprecipitation.
- ALDHbr cells were transfected with control ( ⁇ ) or PXR siRNAs, maintained for 72h under colonosphere conditions, then subjected to mRNA expression profiling.
- PXR mRNA expression and downstream genes network are poor prognosis factors in colon cancer patients treated with chemotherapy
- Example 2 Low miR-148-3p expression drives the preferential expression of PXR in colon CSCs
- the inventors then attempted to determine why PXR expression was specifically enhanced in colorectal cancer cells displaying CSC characteristics. Because of the emerging role of micro RNA (miRNA) in the regulation of CSCs, they screened 4 independent miRNA databases (DIANAmT, miRanda, miRWalk, Targetscan) to identify miRNAs predicted to, or experimentally validated as targeting PXR. Among the selected miRNAs three stood out as strongly implicated in recurrence or chemoresistance: i.e. Let-7a, miR-130a, and miR148-3p.
- miRNA micro RNA
- RT-qPCR demonstrated that of miR-148-3p expression in CRCl and T84 cells was reduced under conditions that enrich CSCs, such as in colonospheres or in ALDH cells, while this was not the case for Let-7a and miR-130a. In addition, they observed an inverse correlation between miR-148-3p and PXR or PXR target genes expression in these conditions. The inventors then investigated whether an up-regulation of miR-148-3p would have a negative impact on both PXR expression and CSC phenotype by transfecting CRC cell lines (T84 and LS174T) with miR-148-3p. RT-qPCR confirmed increased miR-148-3p levels 48 hours post transfection.
- RNA.l Compared with a control sequence (RNA.l), ectopic expression of miR-148-3p mimic resulted in significantly reduced expression of miR- 148a target genes PXR and DNMT1, which encodes DNA methyltransferase 1.
- PXR and DNMT1 encodes DNA methyltransferase 1.
- the inventors observed a decreased ALDH1A1 mRNA level, sphere-forming potential and percentage of ALDH br cells in miR-148-3p transfected cells.
- overexpression of a PXR cDNA depleted in the 3'UTR miR-148-3p binding site i.e. LSPXR-2 specifically abrogated the ability of miR-148-3p to decrease the percentage of ALDH br cells, while it had no effect on miR-148-3p-driven DNMT1 repression.
- Example 3 Assessment of PXR expression following chemotherapy in various cancer cell models.
- chemotherapeutic agent such as doxorubicin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a compound for use for preventing cancer recurrences wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; said cancer responds correctly to chemotherapy; and said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy.
Description
Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to
chemotherapy
FIELD OF THE INVENTION
The present invention relates to new strategies for improving the efficiency of conventional chemotherapy and counteracting the emergence of chemoresistance, while maintaining limited side effects.
BACKGROUND OF THE INVENTION
In recent years, patterns of therapeutic failure seen in patients suffering from cancer became consistent with the accumulation of highly tumorigenic subpopulations of cancer cells named cancer stem cells (CSCs). Several studies confirmed that CSCc are implicated in drug resistance as well as in tumor recurrence. Their enhanced resistance leads to the enrichment of cells displaying functional CSCs characteristics in residual tumor tissue following treatment, and the self -renewal abilities of this surviving cell reservoir allow the initiation of tumor relapse. Therefore, as well as targeting highly proliferative cancer cells an effective therapy also requires to efficiently and specifically target CSCs or at least to sensitize them to current therapies.
Thus, given the central role that CSCs are thought to play in mediating drug resistance, it is currently of the utmost importance to identify innovative approaches to treat and improve clinical outcomes for cancer patients.
To date, most strategies aim to inhibit CSCs self-renewal or to induce their differentiation. However, these phenotypic traits are shared by healthy adult stem cells, leading to specificity concerns about such approaches. The proposed strategy thus fails to provide for an appropriate treatment.
There is thus a long-time felt unfulfilled need for an effective strategy for efficiently targeting CSCs, in the context of a promising strategy for treating cancer.
SUMMARY OF THE INVENTION
The inventors have found out that the Pregnane X Receptor (PXR or NR1I2), a key regulator of xenobiotic metabolism and disposition in the liver, is enriched in CSCs where it controls the expression of multiple genes involved in drug resistance and cancer hallmarks, driving the chemoresistance and tumorigenicity of these cells. PXR
knockdown significantly decreased the capacity of these cells to resist chemotoxic agents and improved recurrence-free survival following chemotherapy in a preclinical mouse xenograft model.
The inventors have further shown that the developed adjuvant strategy is useful for the treatment of various cancers such as ovarian cancer, pancreas cancer and breast cancer.
Thus, in a first aspect, the invention relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy in a subject, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity, and subject suffers from a cancer comprising PXR- expressing cancer stem cells. Preferably, said compound sensitizes cancer stem cells to chemotherapy.
In a second aspect, the invention relates to compound for use for preventing cancer recurrences wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity. Preferably, said cancer responds correctly to chemotherapy. Preferably, said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy. In a third aspect, the invention relates to a method for sorting out patients suffering from a cancer who might benefit from an adjuvant or a neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject, wherein patients who show an expression or an overexpression of PXR are good candidates for said adjuvant or neoadjuvant therapy.
In a fourth aspect, the invention relates to a method for monitoring the response to a treatment of a patient going through chemotherapy comprising measuring the level of expression of PXR in a biological sample of said subject.
In a fifth aspect, the invention relates to a method for assessing the prognosis of a patient suffering from a cancer, preferably a colorectal cancer, said method comprising the step of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
In a sixth aspect, the invention relates to a composition comprising:
at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
at least one chemotherapeutic agent.
DETAILED DESCRIPTION OF THE INVENTION
Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy
The inventors have shown that Knockdown of Pregnane X Receptor (PXR) altered the self -renewal and increased the chemo- sensitivity of cancer stem cells (CSCs), significantly delaying post-chemotherapy tumor relapse and secondary xenograft growth in mice. The inventors have developed a new highly promising strategy for sensitizing cancer stem cells (CSCs) to chemotherapy. Said method is thus highly efficient for treating patients who cannot benefit from appropriate treatment because of the onset of chemoresistance and/or the development of tumour recurrences.
Thus, in a first aspect, the invention relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy in a subject,
wherein:
said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity;
said subject suffers from a cancer comprising PXR-expressing cancer stem cells. Thus, in the context of the invention the chemotherapy targets a cancer comprising PXR-expressing cancer stem cells.
"Pregnane X Receptor", also referred to as "PXR" or "NR1I2" or "Orphan nuclear receptor". The amino acid sequence of the human PXR is available online under the accession number UniProtKB/Swiss-Prot: 075469.1. As for the gene encoding PXR, it is disclosed online under the Gene ID : 8856. PXR belongs to the nuclear receptor superfamily, members of which are transcription factors characterized by a ligand-binding domain and a DNA-binding domain. The encoded protein is a transcriptional regulator of the cytochrome P450 gene CYP3A4, binding to the response element (PXRE) of the CYP3A4 promoter as a heterodimer with the 9-cis retinoic acid receptor RXR. It is activated by a range of compounds that induce CYP3A4, including dexamethasone and rifampicin. Several alternatively spliced transcripts encoding
different isoforms, some of which use non-AUG (CUG) translation initiation codon, have been described for this gene.
As used herein, "primary treatment" refers to the main treatment used to reduce or eliminate the cancer. Preferably, said primary treatment is based on the administration of chemotherapeutic agent.
The term "adjuvant therapy", as used herein, refers to an additional treatment to the primary treatment in a patient affected with a cancer and who is at risk of:
not benefiting from a conventional chemotherapy,
developing metastasis; and/or
- developing recurrences.
Preferably, the adjuvant therapy is carried out during or after the primary treatment. In this specific embodiment, the compound of the invention is administered during and/or after the chemotherapy to the patient in need thereof.
The term "neoaduvant therapy" as used herein, also refers to an additional treatment to the primary treatment in a patient affected with a cancer and who is at risk of:
not benefiting from a conventional chemotherapy,
developing metastasis; and/or
developing recurrences.
Preferably, the neoadjuvant therapy according to the invention is carried out before the primary treatment. In this specific embodiment, the compound of the invention is administered before the chemotherapy to the patient in need thereof.
The aim of such an adjuvant or neoadjuvant treatment is thus to improve the prognosis of the patient. The adjuvant or neoadjuvant therapy according to the invention is a treatment which sensitizes the cancer stem cells to chemotherapy.
As used herein, the expression "compound(s) of the invention" refers to :
an antagonist of PXR;
an inhibitor of PXR expression; or
an inhibitor of PXR activity.
The compound of the invention is useful in the context of sensitizing cancer stem cells, especially drug-resistant cancer stem cells.
In one embodiment, the compound of the invention is an antagonist of PXR.
As used herein, "antagonist" or "receptor antagonist" is meant a natural or synthetic compound that has a biological effect opposite to that of an agonist. An antagonist binds the receptor and blocks the action of a receptor agonist. An antagonist is defined by its ability to block the actions of an agonist. By "agonist" or "receptor agonist" is meant a natural or synthetic compound which binds the receptor to form a receptor-agonist complex by activating said receptor and receptor-agonist complex, respectively, initiating a pathway signaling and further biological processes.
Therefore, the term "antagonist of PXR" denotes a substance that inhibits the activity of PXR such as the induction of transcription caused by PXR. More specifically, it is a substance that inhibits the binding of PXR and a coactivator of the receptor. As for the term "agonist of PXR", it denotes a substance that binds PXR and activates its functions such as induction of transcription of genes under the dependence of PXR response elements in their promoters.
A "receptor" or "receptor molecule" is a soluble or membrane bound/associated protein or glycoprotein comprising one or more domains to which a ligand binds to form a receptor-ligand complex. By binding the ligand, which may be an agonist or an antagonist the receptor is activated or inactivated and may initiate or block pathway signaling. By "ligand" or "receptor ligand" is meant a natural or synthetic compound which binds a receptor molecule to form a receptor-ligand complex. The term ligand includes agonists, antagonists, and compounds with partial agonist/antagonist action.
The person skilled in the art is able to screen product which falls within the definition of antagonist. These techniques may be readily carried out by the person skilled in the art, in the light of his general knowledge.
As an example, a method for the in vitro screening of antagonists of PXR may comprise the use of reporter gene assays. The PXR-reporter gene (such as luciferase, GFP, RFT, ect.) is placed under the control of PXR target promoter (PXRE) and the reporter gene product's activity is quantitatively measured. The results will be reported relative to the activity under a "mutated PXRE" promoter where the binding sites of PXR were destroyed. The steps consisting in (a) contacting cells with a ligand known to bind specifically to PXR; (b) contacting the cells of step (a) with a candidate compound; (c) comparing the reporters activities (PXRE and mutated PXRE reporters) of the ligand known to bind to PXR in the presence of said candidate compound, to the activities of ligand known to bind to PXR in the absence of said candidate compound, and (d)
selecting positively the candidate compound that specifically reduces the PXRE signal of the ligand known to bind to PXR.
The person skilled in the art would also be aware of further techniques such as cell- free technique, based on the detection of coactivator recrutment upon PXR activation.
Other suitable in vitro screening method according to the invention can be carried out using labeled candidate compounds which are then incubated with a polypeptide that has a PXR ligand binding domain. Labels include radioisotopes, immunochemicals, fluorophores, and the like. The person skilled in the art will recognize a variety of ways of separating the bound labeled candidate therapeutic agent from the free labeled candidate therapeutic agent. The affinity of the labeled candidate therapeutic agent for a PXR polypeptide can be calculated using standard ligand binding methods. Another type of a screening method according to the invention may consist in testing the ability of a test compound to modulate binding of PXR to a ligand for PXR such as rifampincin, SR12813, hyperforin. These can be conducted, for example, as a direct binding assay with a labeled PXR ligand in the presence of a candidate therapeutic agent. The assays involve placing the test compound into an assay mixture that includes at least a ligand-binding domain of a PXR polypeptide and a ligand for PXR. The effect on binding of the PXR ligand to PXR is determined. Ligands that are suitable for use in the in vitro screening methods of the invention include, but are not limited to, bile acids and related compounds such as CDCA (chenodeoxycholic acid), GCDCA (glycochenodeoxycholic acid), TCDCA (taurochenodeoxycholic acid), GCA (glycocholic acid), TCA (taurocholic acid), DCA (deoxycholic acid), LCA (lithocholic acid), DHCA (dehydrocholic acid), UDCA (ursodeoxycholic acid) and CA (cholic acid).
In another embodiment, the compound of the invention is an inhibitor of PXR.
The expression "inhibitor of PXR" should be understood broadly as it encompasses inhibitors of PXR activity, as well as inhibitors of PXR expression. Thus, said expression refers to compounds useful for gene silencing, more preferably of :
transcriptional gene silencing, thanks to inhibitors of expression; and
- post-transcriptional gene silencing, thanks to inhibitors of activity.
Preferably, said inhibitor is an inhibitor of PXR expression. An "inhibitor of PXR expression" refers to a natural or synthetic compound that has a biological effect to inhibit or significantly reduce the expression of the gene encoding for the PXR gene.
Said inhibitors are thus useful for down-regulating PXR. More preferably, said inhibitor is a selective inhibitor. As used herein, the term "selective inhibitor of PXR" refers to an inhibitor that is selective for PXR. By "selective" it is meant that Ki of the inhibitor for PXR is at least 5-fold, preferably 10-fold, more preferably 25-fold, still preferably 100-fold lower than the Ki for other protein. The Ki of an inhibitor of PXR may be determined using various methods well known in the art.
The term "small organic molecule" refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
Inhibitors of PXR expression for use in the present invention may be microRNAs (miRNAs). MicroRNAs are a class of short non-coding regulatory RNA, which act as post-transcriptional regulators of gene expression. Preferably, said Inhibitors of PXR expression is miR-148-3p. The sequence is available under the accession number MI0000253.
Inhibitors of PXR expression for use in the present invention may be based on anti-sense oligonucleotide constructs. Anti-sense oligonucleotides, including anti-sense RNA molecules and anti-sense DNA molecules, would act to directly block the translation of PXR mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of PXRs, and thus activity, in a cell. For example, antisense oligonucleotides of at least about 15 bases and complementary to unique regions of the mRNA transcript sequence encoding PXR can be synthesized, e.g., by conventional phosphodiester techniques and administered by e.g., intravenous injection or infusion. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732).
Small inhibitory RNAs (siRNAs) can also function as inhibitors of PXR expression for use in the present invention. PXR expression can be reduced by contacting a subject or cell to a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that PXR expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for
selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836).
In a preferred embodiment, the compound of the invention is an inhibitor of PXR expression selected from the group consisting of the following siRNA :
- GAUUCAACACAGUGUUCAATT (SEQ ID No. 1) ; and
- GGAGUUGUUCGGCAUCACATT (SEQ ID No. 2).
shRNAs (short hairpin RNA) can also function as inhibitors of PXR expression for use in the present invention.
Ribozymes can also function as inhibitors of PXR expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of PXR mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable.
Both antisense oligonucleotides and ribozymes useful as inhibitors of PXR expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti- sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to
the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-0-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone. Antisense oligonucleotides, siRNAs, shRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid to the cells and preferably cells expressing PXR.
Alternatively, said inhibitor is an inhibitor of the activity of PXR. An "inhibitor of the activity" refers to a compound that alters the activity of PXR, i.e. the transcriptional activity of PXR. Examples of inhibitors of PXR activity include, but are not limited to, L-sulphoraphane, sesamin, ketokonazole, A-792611, silybin, metformin, phorbol 12-myristate 13-acetate and okadaic acid. Preferably, said inhibitors of PXR activity is selected from the group consisting of L-sulphoraphane, sesamin, ketokonazole, A-792611, silybin, phorbol 12-myristate 13-acetate , okadaic acid, and FLB-12.
As used herein, A-792611 is (S)-l-[(lS,3S,4S)-4-[(S)-2-(3-benzyl-2-oxo- imidazolidin-l-yl)-3,3-dimethyl-butyrylamino]-3-hydroxy-5-phenyl-l-(4-pyridin-2-yl- benzyl)-pentylcarbamoyl]-2,2-dimethyl-propyl-carbamic acid methyl ester.
As used herein, FLB- 12 is l-(4-(4-(((2R,4S)-2-(2,4-difluorophenyl)-2-methyl- l,3-dioxolan-4-yl)methoxy)phenyl)piperazin-l-yl)ethanone. This specific azole analog is disclosed in the publication Venkatesh M et al., "In vivo and in vitro characterization of a first-in-class novel azole analog that targets pregnane X receptor activation", Mol Pharmacol. 2011 Jul;80(l): 124-35.
Typically, said inhibitors of PXR modify the phosphorylation of the PXR, hereby modifying its inherent activity.
As an example, a method for the in vitro screening of inhibitors of PXR may comprise the use of reporter gene assays. The PXR-reporter gene (such as luciferase, GFP, RFT, etc.) is placed under the control of PXR target promoter (PXRE) and the reporter gene product's activity is quantitatively measured. The results will be reported relative to the activity under a "mutated PXRE" promoter where the binding sites of PXR were destroyed. The steps consisting in (a) contacting cells with a ligand known to bind specifically to PXR; (b) contacting the cells of step (a) with a candidate compound; (c) comparing the reporters activities (PXRE and mutated PXRE reporters) of the ligand
known to bind to PXR in the presence of said candidate compound, to the activities of ligand known to bind to PXR in the absence of said candidate compound, and (d) selecting positively the candidate compound that specifically reduces the PXRE signal of the ligand known to bind to PXR.
As used herein, the term "chemotherapy" refers to a strategy of treatment useful in treating cancer, based on the administration of a "chemotherapeutic agent". "Chemotherapeutic agents' or "anticancer drugs" 'include, but are not limited to, fludarabine, gemcitabine, capecitabine, methotrexate, taxol, taxotere, mercaptopurine, thioguanine, hydroxyurea, cytarabine, cyclophosphamide, ifosfamide, nitrosoureas, platinum complexes such as cisplatin, carboplatin and oxaliplatin, mitomycin, dacarbazine, procarbizine, etoposide, teniposide, campathecins, bleomycin, doxorubicin, idarubicin, daunorubicin, dactinomycin, plicamycin, mitoxantrone, L- asparaginase, doxorubicin, epimbicm, 5-fluorouracil, taxanes such as docetaxel and paclitaxel, leucovorin, levamisole, irinotecan, estramustine, etoposide, nitrogen mustards, BCNU, nitrosoureas such as carmustme and lomustine, vinca alkaloids such as vinblastine, vincristine and vinorelbine, imatimb mesylate, hexamethyhnelamine, topotecan, kinase inhibitors, phosphatase inhibitors, ATPase inhibitors, tyrphostins, protease inhibitors, inhibitors herbimycm A, genistein, erbstatin, lavendustin, and regorafenib.
Preferably, said chemotherapeutic agent is selected from the groups consisting of
5-Fluorouracil, cyclophosphamide, campathecins such as SN-38 which is the active metabolite of irinotecan, cisplatin, taxanes, vincristine, and gemcitabine.
Alternatively, the anticancer drug can be a monoclonal antibody. Monoclonal antibodies include, but are not limited to, bevacizumab (avastin), cetuximab (ertibux), panitumumab (vectibix).
Preferably, the compound of the invention sensitizes cancer stem cells to chemotherapy. As used herein, the expression 'sensitization of cancer stem cells to chemotherapy" refers to a process by which chemotherapy resistant cancer stem cells are efficiently targeted and become sensitive to chemotherapy, i.e. the anti-cancer drug shows its therapeutic effects. The precise mechanism underlying CSC drug resistance remains partly unclear, but may involve multiple parameters such as slow proliferation, increased resistance to DNA damage, activation of anti-apoptosis mechanisms, but also
expression of multidrug transporters such as ATP-binding cassette G2 (ABCG2) and of drug metabolizing enzymes such as aldehyde dehydrogenase 1A1 (ALDH1A1).
The expressions "PXR-expressing cancer stem cells" or "PXR-overexpressing cancer stem cell" refer to a population of cancer stem cells which express PXR or overexpress PXR in comparison with other tumor cells. The expression of PXR in said cancer stem cells is higher than the expression of PXR of the rest of the tumor cells, i.e. tumor cells other than cancer stem cells.
In the context of the invention, said chemotherapy targets a cancer comprising PXR-expressing cancer stem cells. The term "cancer" or "tumor", as used herein, refers to the presence of cells possessing characteristics typical of cancer-causing cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, and certain characteristic morphological features. A non-limiting list of examples of "cancer comprising PXR-expressing cancer stem cells" include colorectal cancer, ovarian cancer, pancreas cancer and breast cancer, melanoma, adrenal gland cancer, biliary tract cancer, bladder cancer, brain or central nervous system cancer, bronchus cancer, blastoma, carcinoma, a chondrosarcoma, cancer of the oral cavity or pharynx, cervical cancer, colon cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, glioblastoma, hepatic carcinoma, hepatoma, hepatocellular carcinoma, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, non-small cell lung cancer, osteosarcoma, peripheral nervous system cancer, prostate cancer, sarcoma, salivary gland cancer, small bowel or appendix cancer, small-cell lung cancer, squamous cell cancer, stomach cancer, testis cancer, thyroid cancer, urinary bladder cancer, uterine or endometrial cancer, and vulval cancer.
Preferably, said cancer comprising PXR-expressing cancer stem cells is selected from the group consisting of colorectal cancer, hepatocellular carcinoma, endometrial cancer, prostate cancer, ovarian cancer, pancreas cancer, breast cancer, melanoma and lung cancer.
More preferably, said cancer is selected from the group consisting of ovarian cancer, pancreas cancer and breast cancer. In this specific embodiment, the compound of the invention sensitizes cancer stems cells of respectfully ovarian, pancreatic and breast origins.
While their initial results were obtained in colorectal cancer models, the inventors have further shown that the adjuvant or neoadjuvant therapy as described herein is also
highly useful in other cancers, especially cancers comprising PXR-expressing cancer stem cells. Consequently, the invention further relates to a compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy,
wherein:
- said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; and
said chemotherapy targets a cancer selected from the group consisting of ovarian cancer, pancreas cancer and breast cancer. Also, the invention relates to a compound for use for treating cancer in a patient going through chemotherapy, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; and wherein said cancer comprises PXR-expressing cancer stem cells. All the previously disclosed are applicable here.
Method for preventing cancer recurrence
Despite huge breakthroughs in cancer treatment over the past few decades, cancer remains a very challenging condition to treat, especially because of its ability to relapse. Cancer stem cells may generate new tumors through the stem cell processes of self-renewal and differentiation into multiple cell types. Such cells are proposed to persist in tumors as a distinct population and cause relapse and metastasis by giving rise to new tumors.
Typically, a tumor comprises three types of cells: including cancer stem cells, progenitor cells, and differentiated cells. Progenitor cells have limited proliferative potential. Typically, chemotherapeutic agents target progenitor cells. The progenitor cells then mature into differentiated cells, which do not proliferate. Standard treatments in cancer therapy merely target the progenitor cells. Unfortunately what looks like a successful treatment is often only the reduction of tumor mass (including for example progenitor cells and differentiated cells) without killing the cancer stem cells that, after the treatment is terminated, may induce new tumors or metastases.
In other words, in conventional cancer therapy the cancer stem cells survive and the cancer can relapse. Cancer stem cells are thus known to be responsible for a cancer recurrence. As used herein, "cancer recurrence" or "cancer relapse" refers to the
return of a cancer that occurs after treatment of such cancer and after a period of time during which the cancer is considered as non-detectable. The cancer recurrence may be a local recurrence or a distal recurrence. Local recurrence refers to cancers that recur in tissues or organs adjacent to or proximate to the initial cancer tissue or organ, whereas distal recurrence refers to cancers that recur distant from the cancerous tissue or organ. Preferably, the cancer recurrence is a local recurrence. Typically, recurrence may occur after the removal of the initial tumor. In the context of colorectal cancer, local recurrence may occur from metastatic cells.
Consequently, when a chemotherapeutic agent targets a cancer tissue or organ, it may destroy cancerous cells without affecting a group of chemo-resistant cancer cells within said tissue or organ. In other words, a cancer tissue or organ may globally react positively to cancer therapy, even though a small population of the cells constituting the cancer tissue or organ are resistant to the treatment. Typically, these resistant cells are cancer stem cells. While cancer stem cells are not necessarily derived from normal stem cells, defining characteristics of CSCs include the ability to self-renew as well as differentiate into cancer cells.
As used herein, the expression "globally well responsive cancer" or "responsive cancer" refers to a cancer that responds correctly to cancer therapy, i.e. which is sensitive to cancer therapy, preferably chemotherapy. A responsive cancer appears to be entirely destroyed by such therapy. However, said cancer comprises a subpopulation of cancer cells which is resistant to cancer therapy, preferably a subpopulation of cells consisting of CSC. The inventors have discovered a promising strategy to specifically target these cells. The results of the inventors indeed indicate that the compound of the invention is extremely useful for specifically targeting the chemoresistant cancer stem cells within an otherwise sensitive cancerous tissue.
Consequently, in a second aspect, the invention relates to a compound for use for preventing cancer recurrence, wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity.
All the previously disclosed technical data are applicable here.
In a preferred embodiment, said cancer is globally well-responsive to chemotherapy, i.e. said cancer responds correctly to chemotherapy. In an alternative embodiment, said cancer is selected from the group consisting of drug resistant cancer, a refractory cancer, a recurrent cancer or a non-resectable tumor.
In a preferred embodiment, said cancer is a metastatic cancer, more preferably a metastatic cancer from a primary colorectal cancer.
Preferably, said compound acts specifically in a chemoresistant subpopulation of cells of globally well responsive cancer, preferably the cancerous stem cells. In this embodiment, said compound acts specifically on cancerous stem cells, typically chemoresistant cancerous stem cells. In other words, the compound sensitizes cancer stem cells to chemotherapy.
Method of screening
In a third aspect, the invention relates to a method of screening patients suffering from a cancer who might benefit from an adjuvant or a neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said patient, wherein patients who show an expression or an overexpression of PXR are good candidates for said adjuvant or neoadjuvant therapy.
In a preferred embodiment, the invention is drawn to a compound for use for preventing cancer recurrence wherein said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity; said cancer responds correctly to chemotherapy; said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy, and
wherein the patient is identified by a method comprising :
the step of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said patient; and
- the step of selecting patients who show an expression or an overexpression of PXR.
As used herein, the term "gene expression level" or "the expression level of a gene" refers to an amount or a concentration of a transcription product, for instance mRNA, or of a translation product, for instance a protein or polypeptide. Typically, a level of mRNA expression can be expressed in units such as transcripts per cell or nanograms per microgram of tissue. A level of a polypeptide can be expressed as nanograms per microgram of tissue or nanograms per milliliter of a culture medium, for example. Alternatively, relative units can be employed to describe an expression level.
As used herein, the expression "mRNA transcript" refers to the product resulting from RNA polymerase-catalyzed transcription of a DNA sequence without introns and that can be translated into polypeptides by the cell.
As used herein, the term "biological sample" as used herein refers to any biological sample obtained for the purpose of evaluation in vitro. Typically, said biological sample can be obtained from solid tissues and tumor tissues. Examples of further biological samples include blood, serum, plasma, nipple aspirate fluid, urine, saliva, synovial fluid and cephalorachidian liquid (CRL). The tissue sample may be obtained from a biopsy procedure in the subject or from a surgical procedure to remove a tumor mass from the subject, preferably a primary tumor and not a metastasis. Alternatively, said biological sample is blood, which may comprise tumor derived material such as tumor cells, tumor relapsed proteins and/or nucleic acids or tumor released material such as exosomes,
As used herein, the expression of "measuring the expression level of a gene" encompasses the step of measuring the quantity of a transcription product, preferably mRNA obtained through transcription of said gene, and/or the step of measuring the quantity of translation product, preferably the protein obtained through translation of said gene. Preferably, the step of measuring the expression of a gene refers to the step of measuring the quantity of mRNA obtained through transcription of said gene. Typically, the step a) of measuring the level of gene expression of said gene(s) may be performed according to the routine techniques, well known of the person skilled in the art.
In one embodiment, step a) of measuring the level of expression of PXR is a step of measuring the expression level of translation products, preferably PXR proteins.
Methods for measuring the quantity of protein in a biological sample may be measured by using standard immunodiagnostic techniques, including immunoassays such as competition, direct reaction, or sandwich type assays. In such embodiments, cancer cells are purified from the isolated biological sample. Such assays include, but are not limited to, agglutination tests; enzyme-labelled and mediated immunoassays, such as ELISAs; biotin/avidin type assays; radioimmunoassays; immunoelectrophoresis; immunoprecipitation.
The reactions generally include revealing labels such as fluorescent, chemiluminescent, radioactive, enzymatic labels or dye molecules, or other methods for detecting the formation of a complex between the antigen and the antibody or antibodies reacted
therewith. More particularly, an ELISA method can be used, wherein the wells of a microtiter plate are coated with a set of antibodies against the target protein of the invention. The cancer cells of the biological sample that are suspected of containing a target protein of the invention are then added to the coated wells. After a period of incubation sufficient to allow the formation of antibody-antigen complexes, the plate(s) can be washed to remove unbound moieties and a detectably labelled secondary binding molecule added. The secondary binding molecule is allowed to react with any captured sample marker protein, the plate washed and the presence of the secondary binding molecule detected using methods well known in the art.
In a particular embodiment, the methods of the invention comprise contacting the cancer cells of the biological sample with a binding partner capable of selectively interacting with at least one of the target proteins of the invention (i.e. a protein coded by one of the genes of interest of the invention) present in the biological sample. The binding partner may be an antibody that may be polyclonal or monoclonal, preferably monoclonal. In another embodiment, the binding partner may be an aptamer.
Polyclonal antibodies of the invention or a fragment thereof can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred.
Monoclonal antibodies of the invention or a fragment thereof can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV- hybridoma technique (Cole et al. 1985).
Alternatively, techniques described for the production of single chain antibodies (see e.g. U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific to a target protein of the invention. Antibodies useful in practicing the present invention also include fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to the target protein of the invention. For example, phage display of antibodies may be used. In such a method, single-chain Fv (scFv) or Fab fragments are expressed on the surface of a suitable bacteriophage, e. g., M13. Briefly, spleen cells of a suitable host, e. g., mouse, that has been immunized with a protein are removed. The coding regions of the VL and VH chains are obtained from those cells that are producing the desired antibody against the protein. These coding regions are then fused to a terminus of a phage sequence. Once the phage is inserted into a suitable carrier, e.g. bacteria, the phage displays the antibody fragment. Phage display of antibodies may also be provided by combinatorial methods known to those skilled in the art. Antibody fragments displayed by a phage may then be used as part of an immunoassay.
In another embodiment, the binding partner may be an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. 1997. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consist of conformationally constrained antibody variable regions displayed by a platform protein, such as E. coli Thioredoxin A, that are selected from combinatorial libraries by two hybrid methods (Colas et al, 1996).
The binding partners of the invention, such as antibodies or aptamers, may be labelled with a detectable molecule or substance, such as a fluorescent molecule, a radioactive molecule or any others labels known in the art. Labels are known in the art that generally provide (either directly or indirectly) a signal.
As used herein, the term "labelled", with regard to the antibody, is intended to encompass direct labelling of the antibody or aptamer by coupling (i.e., physically linking) a detectable substance, such as a radioactive agent or a fluorophore (e.g. fluorescein isothiocyanate (FITC) or phycoerythrin (PE) or Indocyanine (Cy5)) to the
antibody or aptamer, as well as indirect labelling of the probe or antibody by reactivity with a detectable substance. An antibody or aptamer of the invention may be labelled with a radioactive molecule by any method known in the art. For example radioactive molecules include but are not limited radioactive atom for scintigraphic studies such as 1123, 1124, Inlll, Rel86, Rel88.
The aforementioned assays generally involve the binding of the binding partner (i.e. antibody or aptamer) to a solid support. Solid supports that can be used in the practice of the invention include substrates such as nitrocellulose (e. g., in membrane or microtiter well form); polyvinylchloride (e. g., sheets or microtiter wells); polystyrene latex (e.g., beads or microtiter plates); polyvinylidine fluoride; diazotized paper; nylon membranes; activated beads, magnetically responsive beads, and the like.
In another embodiment, said step a) of measuring the level of expression of PXR is a step of measuring the expression level of transcription products, preferably mRNA.
Methods for measuring the quantity of mRNA are well known in the art. Typically, the nucleic acid contained in the biological sample may be extracted according to standard methods, for example using lytic enzymes or chemical solutions or extracted by nucleic-acid-binding resins following the manufacturer's instructions. The extracted mRNA may be then detected by hybridization (e. g., Northern blot analysis). Alternatively, the extracted mRNA may be subjected to coupled reverse transcription and amplification, such as reverse transcription and amplification by polymerase chain reaction (RT-PCR), using specific oligonucleotide primers that enable amplification of a region in said genes. Preferably, quantitative or semi-quantitative RT- PCR is used. Extracted mRNA may be reverse-transcribed and amplified, after which amplified sequences may be detected by hybridization with a suitable probe or by direct sequencing, or any other appropriate method known in the art. Other methods of amplification include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA).
Nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to the mRNA of interest, herein find utility as hybridization probes or amplification primers. It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-
95% identical. In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, enzymatic or other ligands (e. g. avidin/biotin).
Probes typically comprise single- stranded nucleic acids of between 10 to 1000 nucleotides in length, for instance of between 10 and 800, more preferably of between 15 and 700, typically of between 20 and 500.
Primers typically are shorter single- stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified. The probes and primers are "specific" to the nucleic acids they hybridize to, i.e. they preferably hybridize under high stringency hybridization conditions (corresponding to the highest melting temperature Tm, e.g., 50 % formamide, 5x or 6x SCC. SCC is a 0.15 M NaCl, 0.015 M Na-citrate).
The nucleic acid primers or probes used in the above amplification and detection method may be assembled as a kit. Such a kit includes consensus primers and molecular probes. A preferred kit also includes the components necessary to determine if amplification has occurred. The kit may also include, for example, PCR buffers and enzymes; positive control sequences, reaction control primers; and instructions for amplifying and detecting the specific sequences.
In a preferred embodiment, the method of the invention further comprises a step b) of comparing the level of expression of PXR obtained in step a) to a threshold value. Typically, a "control value" or "threshold value" or "cut-off value" can be determined experimentally, empirically, or theoretically. A threshold value can also be arbitrarily selected based upon the existing experimental and/or clinical conditions, as would be recognized by person skilled in the art. It is noteworthy that the expression of PXR may be seen as a higher level in comparison with a reference level. Similarly, an absence of expression of PXR may be seen as a lower level in comparison with a reference level.
The inventors have identified a population of 213 patients that were monitored for several years. Said patients were diagnosed with stage II or III colon cancer and treated with 5-FU-based chemotherapy. The level of expression of PXR was monitored in said subjects, which allowed the inventors to determine a threshold value, useful for sorting out patients with good prognosis and bad prognosis. Analysis of Kaplan-Meier
curves showed that CRC patients bearing tumors with high PXR expression level display a significantly lower probability of disease-free survival (p=0.048), suggesting that high expression levels of PXR are associated with poor prognosis in stage Will colon cancer patients treated with 5-FU-based chemotherapy. Thus, in a preferred embodiment, said threshold value is the mean level of expression of a population of patients who are healthy or who recovered from a cancer.
All the technical features disclosed above are applicable.
In one embodiment, step a) is a step of measuring the activity of PXR in a biological sample of said subject. Preferably, said step performed by quantification of PXR target gene expression. Typically, target genes of PXR are cancer stem cell- specific target genes such as ALDH1A1, LGR5, CD26, CD24, TERT, ABCG2, CXCR4, OLFM4, EphB2 or target genes involved in treatment resistance and tumour recurrence such as respectively UGT1A1, S100A10 and ABCC6, BLVRA, and BCL11A.
Most preferably, the quantification of PXR target gene expression is performed by DNA microarray. The person skilled in the art is able to design or identify appropriate probes for carrying out such microarray.
The term "ALDH1A1" refers to the gene of "aldehyde dehydrogenase 1 family, member Al". The sequence is available under the accession number Gene ID: 216.
The term "LGR5" refers to the gene of "leucine-rich repeat containing G protein-coupled receptor 5". The sequence is available under the accession number Gene ID: 8549.
The term "CD26" refers to the gene of "dipeptidyl-peptidase 4". The sequence is available under the accession number Gene ID: 1803.
The term "CD24" refers to the gene of "CD24 molecule". The sequence is available under the accession number Gene ID: 100133941.
The term "TERT" refers to the gene of "telomerase reverse transcriptase". The sequence is available under the accession number Gene ID: 7015.
The term "ABCG2" refers to the gene of "ATP-binding cassette, sub-family G (WHITE), member 2". The sequence is available under the accession number Gene ID: 9429.
The term "CXCR4" refers to the gene of "chemokine (C-X-C motif) receptor 4". The sequence is available under the accession number Gene ID: 7852.
The term "OLFM4" refers to the gene of "olfactomedin 4". The sequence is available under the accession number Gene ID: 105620.
The term "EphB2" refers to the gene of "EPH receptor B2". The sequence is available under the accession number Gene IS: 2048.
SlOOAlO gene
The term "UGT1A1" refers to the gene of "UDP glucuronosyltransferase 1 family, polypeptide Al". The sequence is available under the accession number Gene ID: 54658.
The term "S100A10" refers to S100 calcium binding protein A100. The sequence is available under the accession number Gene ID: 6281.
The term "ABCC6" refers to the gene of "ATP-binding cassette, sub-family C (CFTR/MRP), member 6". The sequence is available under the accession Gene ID: 368.
The term "BLVRA" refers to the gene of "biliverdin reductase A". The sequence is available under the accession number Gene ID: 644
The term "BCLllA" refers to the gene of "B-cell CLL/lymphoma 11A (zinc finger protein)". The sequence is available under the accession number Gene ID: 53335.
The person skilled in the art may refer to the sequences of primer set forth in SEQ ID No. 3 to SEQ ID No. 36 for measuring gene expression of the above mentioned gene, for example by real-time PCR.
Method for monitoring the response to treatment
In a fourth aspect, the invention pertains to a method for monitoring the response to a treatment of a patient going through a chemotherapy comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
All the technical features disclosed above are applicable.
High level of expression of PXR is associated with a negative prognosis and said patient can therefore be construed as a bad responder to chemotherapy. Typically, a patient having a negative vital prognosis would have high risk of treatment failure to drug therapies, a cancer recurrence, and/or metastasis. The term "negative prognosis" indicates a decreased patient survival and/or an early disease progression and/or an
increase disease recurrence and/or an increase metastasis formation. The physician would thus have to adapt the treatment.
On the contrary, low levels of expression of PXR are associated with a positive prognosis. As used herein, the term "positive prognosis" refers to an increased patient survival and/or a late disease progression and/or a decreased disease recurrence and/or a decreased metastasis formation.
Depending on the level of expression of PXR, the physician would thus be able to adapt the treatment and provide the best therapeutic strategy for each patient. In addition, the monitoring of a patient undergoing chemotherapy by quantifying PXR expression or activity of PXR provide predictive information as to whether the patient is likely :
to resist treatment or on the contrary to respond well to treatment, and/or to relapse after treatment.
In one embodiment of the invention, the step of measuring the gene expression level is performed by the following method:
i) obtaining a biological sample comprising cancer cells from said patient, and ii) measuring the level of expression of PXR in said cancer cells in said biological sample.
According to the invention, in case of monitoring the response to a treatment of a patient going through chemotherapy, a biological sample may be a sample of the cancerous tissue or cells obtained from the patient according to methods known in the art. Said biological sample is for example a biopsy. Typically, the sample comes from complete surgical resection of the primary tumour. Alternatively, said biological sample is composed of tumor cells circulating in the blood of cancer patients or of a metastatic sample biopsy.
Typically, the step of measuring the gene expression level may be performed according to the routine techniques, well known of the person skilled in the art. More preferably, the measurement comprises contacting the cancer cells of the biological sample with selective reagents such as probes, primers, ligands or antibodies, and thereby detecting the presence of nucleic acids or proteins of interest originally in the sample.
The person skilled in the art would easily construe that for the purpose of monitoring, the method of the invention may involve the following steps:
- determining at a first time point the level of expression or activity of PXR in a biological sample of said subject at said first time point; and
- determining said level at a second time point in a biological sample obtained from said subject at said second time point, and
- comparing the levels of the two time points.
An "increased level" or "level higher" or a "decreased level" or a "lower level" than a comparative level, or a "change" or "deviation" or from said comparative level is statistically significant.
An increased level or a decreased level from, or change or deviation from a comparative level can be considered to exist if the level differs from the comparative level by about 5% or more, by about 10% or more, by about 20% or more, or by about 50% or more compared to the comparative level. In the context of the present invention, the "comparative level" preferably refers to the level of expression or activity of PXR obtained at the first time point.
Statistically significant may alternatively be calculated as P<0.05 when using any relevant statistical assay familiar to the man of the art.
The invention thus provides a biomarker by which a practitioner may predict the reaction of a patient subjected to a treatment.
Typically, the treatment is considered to be effective when the level of expression or activity of PXR between the first and the second time point decreases of at least 10%, preferably at least 20%, more preferably at least 30%, even more preferably at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, still even more preferably at least 80%. This generally indicates a good prognosis.
Conversely, the treatment is considered to be ineffective when the level PXR are detected in the second time point whereas they were not at the first point time.
Further, the treatment is also considered to be ineffective when the level of expression or activity of PXR between the first and the second time point increases by at least 5%, preferably at least 10%, more preferably at least 20%, even more preferably at least 30%, still even more preferably at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, still even more preferably at least 80% or more..
Method for assessing the prognosis of a patient suffering from a cancer
As previously explained, the invention provides a mean for monitoring the responsiveness of a patient to chemotherapy. In addition, in a fifth aspect, the invention relates to a method for assessing the prognosis of a patient suffering from a cancer, preferably a colorectal cancer, said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject.
In a preferred embodiment, the method of the invention further comprises a step b) of comparing the level of expression of PXR obtained in step a) to a threshold value. In this embodiment, a decrease in the level of expression or activity of PXR is indicative of a good prognosis. Conversely, an increase in the level of expression or activity of PXR is indicative of a poor prognosis.
Typically, in this specific embodiment, a "poor prognosis" preferably refers to a high chance of cancer recurrence whereas "a good prognosis" refers to a diminished chance of cancer recurrence.
The method of the invention provides the physician with highly valuable information regarding the risk of a patient to relapse. Consequently, the method allows the screening and identification of patients who would benefit from a therapy based on the administration of a compound selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity.
Pharmaceutical composition and uses thereof In a sixth aspect, the invention relates to a composition comprising :
at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof and
at least one chemotherapeutic agent.
The above mentioned substances can be formulated in pharmaceutical compositions. Said compositions are highly promising for treating cancer. Indeed, they address the need for treating cancer as well as for sensitizing cancer stem cells.
In one embodiment, the invention relates to:
i) at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof, and
ii) at least one chemotherapeutic agent,
as a combined preparation for simultaneous, separate or sequential use in the treatment of cancer, , or a recurrence of said cancer, said cancer being selected from the group consisting of colorectal cancer, ovarian cancer, pancreas cancer and breast cancer.
Another object of the invention is a pharmaceutical composition comprising: i) at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
ii) at least one chemotherapeutic agent,
for use for preventing and/or treating a cancer, or a recurrence of said cancer, said cancer being preferably selected from the group consisting of colorectal cancer, ovarian cancer, pancreas cancer and breast cancer.
Typically, said cancers are cancer comprising PXR-expressing cancer stem cells. All the previously mentioned technical features are applicable here.
The pharmaceutical composition of the invention may comprise, in addition to one of the above substances, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal or patch routes.
Prescription of treatment, e. g. decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disorder to be treated, the condition of the individual patient, the site of delivery, the method of administration and other factors known to practitioners.
In a therapeutic application, the compounds of the invention and the chemotherapeutic agents are embodied in pharmaceutical compositions intended for administration by any effective means, including parenteral, topical, oral, pulmonary (e.g. by inhalation) or local administration.
Preferably, the pharmaceutical compositions are administered parenterally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly, or intranasally.
In one embodiment of the invention, the pharmaceutical composition of the invention is administrated by intranasal route.
In another embodiment of the invention, the pharmaceutical composition of the invention is administrated intravenously.
In one embodiment, the invention provides compositions for parenteral administration that comprise a solution of the compounds of the invention, as described above, dissolved or suspended in an acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be used including, for example, water, buffered water, 0.4% saline, 0.3% glycine, hyaluronic acid and the like. These compositions may be sterilized by conventional, well-known sterilization techniques or, they may be sterile filtered. The resulting aqueous solutions may be packaged for use as is or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions including pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, such as, for example, sodium acetate, sodium lactate, sodium chloride potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
For solid compositions, conventional nontoxic solid carriers may be used that include, for, example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For oral administration, a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient and more preferably at a concentration of 25%-75%.
For aerosol administration, the NAP or ADNF polypeptides are preferably supplied in finely divided from along with a surfactant and propellant. The surfactant must, of course, be nontoxic, and preferably soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. A carrier can also be included, as
desired, as with, e.g., lecithin for intranasal delivery. An example includes a solution in which each milliliter included 7.5 mg NaCl, 1.7 mg citric acid monohydrate, 3 mg disodium phosphate dihydrate and 0.2 mg benzalkonium chloride solution (50%)
(Gozes et al., J Mol Neurosci. 19(1-2): 167-70 (2002)).
Another object of the invention is a method for preventing and/or treating cancer in a subject in need thereof, said method comprising administering a therapeutically effective amount of at least one compound of the invention as described here above, and a chemotherapeutic agent or a therapeutically effective amount of a pharmaceutical composition as described here above.
All the previously mentioned technical data are applicable here.
In one embodiment, the compound of the invention and the chemotherapeutic agent are administered to a patient in an amount sufficient to prevent and/or treat cancer.
An amount adequate to accomplish this is defined as "therapeutically effective dose".
Amounts effective for this use will depend on, for example, the particular compound employed, the type of cancer to be prevented, the route of administration, the weight and general state of health of the patient, and the judgement of the prescribing physician.
For example, an amount of the compound of the invention falling within the range of a 100 ng to 10 mg dose given intra-nasally once a day (e.g., in the evening) would be a therapeutically effective amount. Alternatively, dosages may be outside of this range, or on a different schedule. For example, dosages may range from 0.0001 mg kg to 10,000 mg/kg, and will preferably be about 0.001 mg kg, 0.1 mg/kg, 1 mg/kg
5 mg kg, 50 mg/kg or 500 mg/1 g per dose. Doses may be administered hourly, every 4,
6 or 12 hours, with meals, daily, every 2, 3, 4, 5, 6, for 7 days, weekly, every 2, 3, 4 weeks, monthly or every 2, 3 or 4 months, or any combination thereof. The duration of dosing may be single (acute) dosing, or over the course of days, weeks, months, or years, depending on the condition to be treated.
Method of treatment
The invention also relates to a theragnosis method. As used herein, the term "theragnosis" refers to the identification, for example by diagnostic methods, of patients who might benefit from a particular therapy.
The invention thus relates to a method for preventing a patient suffering from a cancer from developing a cancer recurrence, said method comprising the steps of :
1) measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said patient ;
2) if step 1) shows an expression or an overexpression of PXR, then the method comprises a step 3) of administering a compound selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity to said patient. All the previously disclosed technical data are applicable here. The invention will be further illustrated by the following examples. However, these examples should not be interpreted in any way as limiting the scope of the present invention.
BRIEF DESCRIPTION OF FIGURES:
Figure 1; Knock-down of PXR decreases CSC tumorigenicity and chemoresistance, and improves recurrence free survival in a mouse xenograft model.
(a) Schematic representation of the experimental plan. PXR and PXR target genes mRNA expression were quantified by RT-qPCR in CRC1 cells expressing control (shLuc) or PXR-specific (shPXR) shRNA. Data are expressed as mean±SEM of 4 experiments compared to untransfected CRC1 cells. *, p<0.05 (student's t-tests).
(b) Evolution of tumor volume over time after subcutaneous injection of 15.000 shLuc or shPXR CRC1 colon cancer cells isolated from colonospheres (18mice/group). Once tumors reached a 100 mm3 volume, mice were randomized (day 20). Three days after randomization, one group (6 mice/group) was treated twice weekly for 4 weeks with vehicle or with Folfiri (90mg kg leucovorin, 50mg/kg 5-FU and 30mg/kg irinotecan, twice a week during 4 weeks, 12mice/group). At day 48, three days after the end of treatment, 6 mice/group were sacrificed and the remaining ones from Folfiri- treated groups (6 mice/group) were kept for 7 weeks without treatment to further monitor tumor growth.
Data are expressed as mean+SEM of the fold-increase (F.I.) compared to tumor volume at day 20. Tumor samples from mice sacrificed at day 48 were processed for cell dissociation and, live (7-AAD-negative) tumor cells were further analyzed for their (c) ability to generate new tumors in vivo after de novo implantation in immunodeficient mice (6 mice/group, 1.500 cells/mouse),
(d) initiate colonosphere formation in vitro (percentage of sphere-forming cells), and (e) ALDH activity (% of ALDHbr cells). The ALDH inhibitor, diethylaminobenzaldehyde (DEAB), was added to ensure the accurate identification of ALDH-positive (ALDHbr) cells. Data are expressed as mean+SEM. *p<0.05 (student's t-test)
Figure 2: PXR depletion impairs chemotherapy-induced enrichment of PXR and CSC markers in vivo.
(a) Hematoxylin/Eosin and immunostaining on Folfiri-treated shLuc and shPXR paraffin-embedded tumor sections (day 48) using antibodies directed against human
ALDH1A (a-huALDHlA) or human mitochondria (a-huMitoch). Ratio of ALDHlA human mitochondria-stained areas on tumor sections (n=4/group) are presented on right. Data are expressed as mean±SEM. , *p<0.05 (student's t-test)
(b) Expression of indicated mRNAs was quantified by RT-qPCR on cells isolated from dissociated tumors (day 48) of non-treated mice or Folfiri-treated mice.
Data are expressed as mean±SEM. "a", p<0.05 compared to non-treated shLUC tumors and p<0.05 compared to Folfiri-treated shLuc tumors using one-way ANOVA Tukey's multiple comparisons test. Figure 3: PXR expression is increased in colorectal CSCs.
(a) PXR mRNA expression were quantified by RT-qPCR on CRC1 cells maintained as colonospheres for multiple passages (S I to S8). RT-qPCR data are expressed as the mean+SEM of >3 experiments and are reported as fold change compared to cells grown under adherent conditions ('2D'). *, p<0.05 compared to 'Sl'or 2D conditions (student's t-test).
(b) mRNA expression for PXR, PXR target genes and CSC marker genes were quantified by RT-qPCR on ALDHbr compared to the ALDH10 population (F.I., Fold
Induction). Data are expressed as mean+SEM (n=3); *, p<0.05 compared to ALDH 0 fraction (student's t-test).
(c) PXR, GAPDH and ALDH1A1 protein expression in unsorted (NS), ALDHbr and ALDH10 cells.
(d) Lucif erase activity of control (TK-Luc) or PXRE-TK-Luc promoter luciferase reporter constructs in ALDHlc and ALDHbr CRC1 cells. Data are expressed as mean+SEM (n=3) of luciferase/pGalactosidase ratio normalized to ALDH10 cells. *, p<0.05 compared to ALDH10 fraction (student's t-test). Figure 4: PXR transcriptional activity marks chemoresistant CSCs.
(a) Percentage of surviving cells 72 hours after exposure of sorted cells to the indicated dilutions of firi (1Χ=50μΜ 5-FU + 500nM SN38). Data are expressed as mean+SEM of 3 experiments. *p<0.05 (student's t-test) compared to Lo cells for each GFP construct.
(b) mRNA expression for PXR, PXR target genes and CSC marker genes in Hi and Lo populations compared to T84 parental (NT) cells (F.I., Fold Induction). Data are expressed as mean+SEM of 3 experiments. *p<0.05 (student's t-test) compared to Lo cells for each GFP construct. Figure 5: PXR regulates colorectal CSC gene markers
(a) Detection of PXR (50kDa), ALDH1A1 (55kDa) and GAPDH (37kDa) protein expression by Western blotting in LS 174T cells expressing control (shLUC) or PXR-specific shRNA (shPXR) or a PXR cDNA construct (LS PXR2 and LS PXR6). N.E.=nuclear extracts, C.E.= cytosolic extracts.
(b) mRNA expression of PXR and PXR target genes by RT-qPCR in shLUC, shPXR and LS PXR2 cells. Data are expressed as mean+SEM of n>3 experiments compared to shLUC cells (F.I.,Fold Induction). *p<0.05 (student's t-test).
(c) Expression of indicated mRNAs was quantified by RT-qPCR on control LS174T cells (pcDNA3.1) and in cells overexpressing PXR (LS PXR2 and LS PXR6). Data are expressed as mean+SEM of n>3 experiments compared to control LS174T cells (F.I.,Fold Induction). *p<0.05 (student's t-test).
(d) mRNA expression for PXR, PXR target genes and CSC marker genes in shLuc and shPXR transduced CRC1 colon cancer cells maintained in adherent condition ('2D') or as colonospheres during 4 to 8 passages ('Sphe'). Data are expressed as mean+SEM of 4 experiments compared to shLuc CRC1 cells maintained in adherent condition (2D), "a", p<0.05 compared to '2D' shLuc cells and '¾>", p<0.05 compared to 'Sphe' shLuc cells (student's t-tests).
Figure 6: Impact of effective and ineffective PXR shRNA on ALDHlAl mRNA expression and Aldefluor activity in LS174T cells
(a) PXR, ALDHlAl, CYP3A4 and ABCG2 expression in LS174T cells transduced with effective (shl334 & shl976) or ineffective (sh2116) PXR-targeting shRNAs or shLUC control. Data are expressed as mean+SEM of 4 experiments compared to LS174shLUC (F.I.,Fold Induction). *p<0.05 (student's t-test) compared to control LS I 74TshLUC.
(b) PXR mRNA and protein expression in control LS 174T cells (expressing pcDNA3.1) or in LS 174T cells overexpressing human PXR (LSPXR2) transduced with effective (shl334) or ineffective (sh2116) PXR-targeting shRNAs or control FG12 vector.
(c) Expression of ALDHlAl and UGT1A1 mRNAs. Data are expressed as mean+SEM of 3 experiments compared to LS 174 control cells (F.I.,Fold Induction). *p<0.05 (student's t-test) compared to LSPXR2 transduced with FG12 vector.
Figure 7: Down-regulation of PXR mRNA suppressed tumor growth and prolonged survival in patient-derived colon cancer xenografts.
(a) Survival plot after treatment release or (b) after secondary injection of residual Folfiri-treated shLUC or shPXR cells. The time courses of percent survival in shLUC and shPXR Folfiri treated tumor mice are shown in a Kaplan-Meier plots, p- values from likelihood ratio tests and calculated median survival are shown.
(c) PXR mRNA expression over time before (injected cells) and after subcutaneous injection of shLUC or shPXR CRC1 colon cancer cells: Day 0, injected cells, Day 48, tumors treated for 4 weeks with folfiri and used for the secondary xenograft assay; Day 96, relapsed tumors after folfiri treatment; and Days 60 post-
reinjection, secondary xenograft tumors from folriri-treated tumors dissociated at Day 48.
Figure 8: PXR depletion in CRC cell lines impairs chemotherapy-induced enrichment of PXR and CSC markers in vitro.
(a) Relative mRNA expression for PXR, PXR targets and CSC markers,
(b) ALDH1A1 protein expression levels (bands intensities were quantified and the ratio between the ALDH1A1 and GAPDH are shown),
(c) Percentage of ALDHbr cells in CRC1 colon cancer cells expressing control (shLuc) or PXR-targeting (shPXR) shRNA maintained in adherent conditions and exposed for 72 hours to vehicle (NT) or the indicated dilutions of Firi (1X=50 DM 5-FU + 500nM SN38). Data are expressed as mean±SEM of >4 experiments and compared to CRClshLuc cells, "a", p<0.05 compared to untreated shLuc cells; "b", p<0.05 compared to 0.1X Folfiri-treated shLuc cells, "c", p<0.05 compared to 0.2X Folfiri- treated shLuc cells (student's t-tests).
(d) Relative mRNA expression for PXR, PXR target genes and CSC markers in LS 174T colon cancer cells expressing control (shLuc) or PXR-targeting (shPXR) shRNA maintained in adherent conditions and exposed for 72 hours to vehicle (NT) or to 0.2X Firi (1Χ=50μΜ 5-FU + 500nM SN38). Data are expressed as the mean+SEM of 3 experiments and normalized compared to LSshLuc cells "a", p<0.05 compared to untreated shLuc cells; "b", p<0.05 compared to 0.2X Firi-treated shLuc cells.
Figure 9: PXR expression is increased in colorectal colonosphere models
(a) mRNA expression of PXR and ALDH1A1 in CRC cell lines grown under adherent conditions ('2D', white bars) or as colonospheres ('Sphe', black bars). Data are expressed as mean+SD of 3 experiments compared to 2D conditions. *, p<0.05 (student's t-test).
(b) mRNA expression for PXR, PXR target genes and CSC marker genes in CRC1 colon cancer cells grown under colonospheres compared to adherent condition (2D) (F.I., Fold Induction). Data are expressed as mean+SD of 3 experiments compared to 2D conditions. *, p<0.05 (student's t-test).
(c) Percentage of surviving cells 72 hours after exposure of CRC1 cells grown as adherent (2D) or colonosphere (Sphe) cultures to the indicated concentrations of Firi
(1Χ=50μΜ 5-FU + 500nM SN38). Data are expressed as mean+SEM of n>3 experiments, and half maximal effective concentration (EC50) is indicated for each condition. *p<0.05 (student's t-test) compared to 2D cells.
(d) Percentage of Sphere-Forming Cells,
(e) Percentage of ALDHbr cells and
(f) OCT4 and LGR5 mRNA expression were quantified by RT-qPCR on CRC1 cells maintained as colonospheres for multiple passages (SI to S8). RT-qPCR data are expressed as the mean+SEM of >3 experiments and are reported as fold change compared to cells grown under adherent conditions ('2D'). *, p<0.05 compared to 2D conditions (student's t-test).
Figure 10: PXR expression is increased in Aldefluor-positive cells
(a) RT-qPCR analysis of ALDH isoforms in CRC1 ALDHbr and ALDH10 sorted cells. Data are expressed as mean+SD of 3 experiments.
(b) Percentage of Sphere-Forming Cells of CRC1 ALDHbr and ALDH10 sorted cells, N.S.= unsorted cells.
(c) Percentage of surviving cells 72 hours after exposure of ALDHbr and ALDH10 sorted cells to the indicated dilutions of firi (1Χ=50μΜ 5-FU + 500nM SN38). Data are expressed as mean+SEM of 3 experiments. *p<0.05 (student's t-test) compared to ALDH10 cells.
(d) Expression of PXR mRNA in ALDHbr and ALDH10 HT29, HTC116, T84 and LS 174T cell lines.
(e) PXR transcriptional activity was measured with PXR-promoter luciferase reporters assay , i.e. the synthetic PXRE response element (CYP2B6 NRlx3TKpGL3b, PXREx3TK) or the [-7600/-7200] pCYP3A4- 163/+l lpGL2b construct (XREM CYP3A4), in ALDH10 and ALDHbr T84 cells. Data in are expressed as the mean+SEM of >3 experiments and are compared to ALDH10 cells. *, P<0.05 compared to ALDHbr cells (student's t-test).
Figure 11: PXR drives the expression of a large number of genes that protect CSCs against genotoxic death stimuli and promote self-renewal.
Significantly enriched pathways through a Gene Ontology analysis of differentially expressed genes between PXR siRNA (siPXR) and control siRNA (sibGAL)-transfected ALDHbr cell-derived CRC1 colonospheres.
Figure 12: PXR expression enrichment following chemotherapies in multiple cancer cell models
(a) PXR mRNA expression in established colorectal cancer cell lines from 4 different patients maintained in adherent conditions and exposed for 72 hours to vehicle (UT) or to Firi (50 μΜ 5-FU + 500nM SN38), folfox (50μΜ 5-FU + ΙμΜ oxaliplatin) or firinox (50μΜ 5-FU + 500nM SN38 + ΙμΜ oxaliplatin) treatments. Data are expressed as mean±SD of 2 experiments performed in triplicates and are normalized according to UT cells; *p<0.05 (student's t-test).
(b) mRNA expression for PXR, ALDH1A1 and ABCG2 in ovarian (SKOV-3), pancreas (MIA-PACA2) and breast (MDA-MB237) cancer cells maintained in adherent condition and exposed for 72 hours to vehicle (NT) or doxorubicin treatment. Data are expressed as mean±SEM of 3 experiments and compared to untreated cells. *p<0.05 (student's t-test).
Figure 13: PXR transcriptional activity marks chemoresistant CSCs in lung cell cancer cells.
Percentage of surviving A549 cell CYP3A4eGFP transfected cells, 72 hours after exposure of sorted cells to the indicated dilutions of docetaxel (A) or doxorubicin (B). Data are expressed as mean±SEM of 3 experiments. *p<0.05 (student's t-test) compared to untreated cells.
EXAMPLES
Example 1: Pregnane X-receptor drives post-treatment tumor recurrence in colon cancer by regulating a cancer stem cell genes signature network
MATERIAL AND METHODS
Cell lines and patient-derived tumor cells culture
LS174T stable PXR transfectants (LS-PXR2 and LS-PXR6) were previously described. CRC cell lines (T84, LS174T, HT29, DLD1, SW620) and SKOV3, MIA- PACA2 and MDA-MB237 were obtained from ATCC and maintained in DMEM (Gibco) with 10% FBS or as spheroids in defined Mil media in ultra-low attachment flasks (Corning). Mil is DMEM/F12 (1: 1) medium (Gibco), supplemented with N2, Glutamine 3 mM, Glucose 0.6%, insulin 4μg/ml (Sigma-Aldrich), Penicilin G lOOU/ml, Streptomycin lOOug/ml, hBasic-FGF 10 ng/ml (R&D Systems), hEGF 20 ng/ml (R&D Systems). Patient-derived cell cultures (CRC1, 19, 24, 25) of colon cancer cells were obtained from CRC biopsies provided by CHU-Caremeau (Nimes, France, ClinicalTrial.gov Identifier#NCT01577511) within an approved protocol. Signed informed consents were obtained from patients prior to samples acquisition in accordance with all ethical and legal aspects. Tumors were washed, minced into fragments (<2mm3) and digested with liberase H (0.26U/mL, Roche) resuspended in Accumax (Sigma-Aldrich). After 2 hours at 37°C, cell suspension was filtered through a 40μηι mesh to obtain a single cell suspension and plated in DMEM medium, supplemented with FBS, glutamine, antibiotics and non-essential aminoacids. When a monolayer of patient-derived tumor cells was formed, cells were detached using trypsin/EDTA and resuspended in DMEM with 10% FBS (for adherent cells) or defined Mil media (for spheres formation). Cells were cultured in a humidified atmosphere at 37 °C and 5% C02. For PXR depleted cell lines, cells were transduced with shLUC- or shPXR- pLKO-lentiviral vectors (Sigma-Aldrich) and were selected in presence of ^g/mL puromycin (Life Technologies).
Xenograft transplantation and chemotherapy treatment
Suspension of 15.000 or 1.500 cells from colonospheres were injected subcutaneously into the right flanks on BALB/c nu/nu (nude) in a 1:1 mixture of Matrigel and DMEM in a final volume of ΙΟΟμί. Body weight and clinical signs of the mice were determined every second day, tumor volume [(length x width x thickness)/2] was measured using a caliper. Folfiri, ie. 90mg/kg Leucovorin + 50mg/kg 5-FU + 30mg/kg Irinotecan, treatment (two i.p. injection/week) was started once tumor volume reached 100mm3, and mice were sacrificed when tumors reached 1500mm3. These studies were approved by the ethics committee of the Languedoc Roussillon Region and carried out in compliance with the CNRS and INSERM ethical guidelines of animal experimentation (CEEA-LR- 12051).
Patients
Liver metastasis samples obtained from patients with metastatic colorectal disease were obtained according to French government regulations and with ethical committee approval (CHU Montpellier, agreement #CT 094173). Patients diagnosed with stage II or III colon cancer and treated at the Colorectal Cancer Unit of the Hospital Clinic of Barcelona between 1998 and 2005 were previously described. The study was approved by the institutional Ethics Committee of the Hospital Clinic of Barcelona.
RNA extraction and gene expression analysis from paraffin embedded (FFPE) tissue blocks
Hematoxylin and eosin-stained slides and FFPE blocks of all patients included in the study were retrieved from the Pathology Department archive. Four 10 μΜ thick slices were obtained from each FFPE block and used to isolate total nucleic acids using a fully automated method of iron oxide beads coated with a nanolayer of silica on a modified VERSANT® kPCR Molecular System* (Siemens Healthcare Diagnostics, Tarrytown, NY) as previously described. Samples were treated 20 minutes with DNAse- 1 and reversed-transcribed using SuperScriptlll reverse transcriptase (Invitrogen) using GAPDH, PXR, ALDH1A1, 18S gene specific primers. Expression of PXR and ALDH1A1 mRNAs were analyzed by real-time qRT-PCR, blinded to patient
characteristics and clinical endpoints. Expression levels were normalized to GAPDH as an endogenous control.
RNA extraction and real-time PCR
Total RNA was extracted using the RNeasy mini kit (Qiagen) and treated with
DNAse-1. The first strand cDNA was synthetized using Superscript II (Invitrogen) and random hexamers, and gene expression was measured by real-time PCR. Primer sequences are detailed in the following table:
Genes Primers Sequences (5'-3') SEQ ID No.
forward AGCACGG CATCGTC ACCAACT 3
B-Actin
reverse TG G CTG G G GTGTTG AAG GTCT 4 forward TCCTG GTTATG G GCCTACAG 5
ALDH1A1
reverse CAACAGCATTGTCCAAGTCG 6 forward TATTCTGTCTTCACAAACCG 7
CYP3A4
reverse TTTCTCACCAACACATCTCC 8 forward AATTGAGCCCGCAGCCTCCC 9
GAPDH
reverse CCAGGCGCCCAATACGACCA 10 forward GGTG CTG GTTG CTG CTTACA 11
MDR1
reverse TGGCCAAAATCACAAGGGT 12 forward AAATCCACTATCCCAG G AAT 13
UGT1A1
reverse AGTATCGTGTTGTTCG CAAG 14 forward G G CTTTCTACCTG CACG AAAACCAGTTG AG 15
ABCG2
reverse ATGGCGTTGAGACCAG 16 forward TCCGGAAAGATCTGTGCTCT 17
PXR
reverse AGG GAG ATCTG GTCCTCG AT 18 forward TGACGGACAAGTACAGGCTGC 19
CXCR4
reverse CCAGAAGGGAAGCGTGATGA 20 forward CTTCCAACCTCAGCGTCTTC 21
LGR5
reverse TTTCCCGCAAGACGTAACTC 22 oct-04 forward GTGGAGAGCAACTCCGATG 23
reverse TGCTCCAGCTTCTCCTTCTC 24
OLFM4 forward AAGCTGCAGGGGATTTGGGGG 25
reverse AGGTCCCACGGTCATCCACG 26
ABCC6 forward GCTGGGACCCACGACGACAG 27
reverse GGGGTACCCAGACCCCTGCT 28
TERT forward CAGGGCTCCATCCTCTCCAC 29
reverse TGATGGAGGTCCGGGCATA 30
TNFRSF11A forward CGGCTGGGTACCACTGGAGC 31
reverse TGCAAGGCAAGG TTTG C A C ACTG 32
S100A10 forward gctcatgaaatccttctatggg 33
reverse AGCAGAAGGGAAAGAAGTAGGC 34
EphB2 forward GAT GGT ACA TCC CCC ATC AG 35
reverse ACG CAC CGA GAA CTT CAT CT 36
mRNA expression profiling
RNA expression profiling of LS 174T overexpressing PXR were performed on 44K Agilent Human Genome, Agilent Technologies with competitive hybridization of each LS174T transfectants (LS-CTRL, LS-PXR2 and LS-PXR6) versus a pool of equal amounts of total RNA from all samples. Five microgram aliquots of total RNA from each sample and from the reference pool were used to generate labeled antisense cRNAs with T7 RNA polymerase. Reverse transcription, linear amplification, cRNA labeling, and purification were performed with the Agilent Linear Amplification kit. Hybridization was allowed to proceed for 17h at 60°C, with lpg of cyanine 5-labeled cRNA from each sample (n=3/transfectant) mixed with the same amount of cyanine 3- labeled cRNA from the reference pool. The arrays were then washed with 0.6x and O.Olx SSC buffers containing Triton, and were dried with a nitrogen gun before scanning with an Agilent DNA microarray scanner. The fluorescence images thus obtained were quantified with Feature Extraction software (Agilent Technologies).
RNA expression profiling of CRC1 ALDHbr transfected with PXR siRNA cells were performed using Affymetrix Human gene ST 2.0 DNA microarrays. ALDH high cell-derived CRC 1 colonospheres were collected after transfection with control (siβGal) siRNA or siPXR and were analysed in biological triplicates. Preparation of cRNA was done with the "GeneChip® WT PLUS Reagent Kit (Affymetrix)" as recommended by the supplier. Hybridizations, washes, detection and quantification were then done as previously described and expression data were normalised by the Robust Multichip Average method using the Affymetrix "Expression Console" software. Then, analyses were done in R and associated packages. Raw transcriptome data was deposited in ArrayExpress (http://www.ebi.ac.uk/arrayexpress/, accession number: E-MTAB-3471.). Gene ontology analysis of the resulting gene list was based on GO biological processes of the Database for Annotation, Visualization and Integrated Discovery (DAVID; http://david.abcc.ncifcrf.gov/ ). Gene set enrichment analysis
Gene set enrichment analysis (GSEA) was used to interrogate the similarity of genes differentially expressed in the microarray experiment to prognosis signatures of patients. GSEA version 2-2.0.13 in preranked mode was used in these analyses. Genes
were first ranked based on log fold change differential expression between PXR overexpressing cells and control. Enrichment scores were calculated directly from probe values by constructing a custom Agilent 6x66k chip file using the chip2chip tool in the GSEA package. This chip file was used to convert gene signatures to probe signatures. We compared PXR-induced genes to gene signatures indicative of patient prognosis. Subtype B was termed the "poor prognosis" signature, conversely subtype A was termed the "good prognosis" signature. A core signature representative of each cell type was generated by subsetting genes with a PAM score greater than 0.2. Western blot
Cells were lysed and prepared for total, cytosolic or nuclear protein extractions (PIERCE) with protease inhibitors (Roche). For western blotting, samples were subjected to 10% SDS-PAGE and transferred to membrane (Amersham). The following antibodies were used: GADPH (sc-32233), ALDH1A1 (sc-22589), CYP3A4 (sc- 27639), and PXR (sc-48403 & sc-48340) from Santa Cruz. Bands intensities were measured on an image Image Lab software (BIORAD, version 4.1).
Lucif erase and GFP reporter constructs
The CYP3A4-XREMpGL3Luc, the PXR responsive (NRl)3TKluc, the control pGL3TK luciferase (TKluc) plasmids and β-galactosidase expressing plasmid, pSV- GAL have been described previously. The EIFlaeGFP plasmid was from addgene (#39196). DNA fragment corresponding to the [-7600/-7200]/(-1100/+ll) CYP3A4 promoter was cloned in the lentiviral expression vector pLV-GFP upstream from the GFP reporter gene (from Anne Corlu, INSERM UMR991, Rennes, France). siRNA duplexes cells transfection
Transfections were performed in p24 wells plate (4 wells/condition) using Fugene-6 (Roche). Lipofectamine RNAimax and siRNA duplexes (βϊβϋΑΕ and siPXR) were obtained from Invitrogen and Genecust respectively. siRNA transfections were performed according to the manufacturer's recommendation. siRNA sequences are set forth ins SEQ ID No.l and 2.
In vitro cytotoxics treatment
Cells were plated at 100.000 cells/well in DMEM with 10% FBS in 6 well plate, after 48 hours cells were exposed to Firi (1Χ=50μΜ 5-FU + 500nM SN38) or vehicle (3 wells/condition). After 72 hours of treatment, cells were washed twice with ice-cold PBS before RNA extraction.
In vitro chemosensitivity assays
Cells were plated at 103 cells per well in P96 well plates in DMEM with 10% FBS. After 16 hours, cells were treated with cytotoxics. After 48 to 72 hours, cell viability was assessed by Cell Titer Glow assay (Promega). EC50 were calculated using Prism Sofware
Aldefluor assay and fluorescence-activated cell sorting (FACS)
The aldefluor assay (Stem Cell Technologies) was performed according to the manufacturer's instructions (Stem Cell Technologies). ALDHbright cells (ALDHbr) and ALDHlow cells (ALDH10) were identified by comparing the same sample with and without the ALDH inhibitor diethylaminobenzaidehyde (DEAB). FACS gating of ALDH activity was set at 0.1% in presence of DEAB. Cells were analyzed and sorted using (BD) FACSAria II and Summit 6.0 or Cyflogic softwares. Dead cells were excluded based on light scatter characteristics.
Slide preparation for immunohistochemistry
After sacrifice, tumors were harvested and fixed 2 hours with PFA 4% and were dehydrated with serial ethanol baths followed by xylene baths before being embedded in paraffin. 6μιη slides were then cut using a microtome (Microm, HM335E). Embedded tumor slides were dewaxed by heating at 56°C and immersing in serial xylene and graded ethanol baths. Antigen retrieval was performed in boiling citrate buffer for 20 min and nonspecific binding sites were blocked for lh in Phosphate Buffered Saline (PBS) containing 5% milk and 0,5% triton. Slides were incubated overnight at 4°C with primary antibodies diluted in blocking buffer. Anti-ALDHlAl (1/100) was from BD Biosciences (60274), anti-human mitochondria (1/100) was from Millipore (MAB 1273). Secondary antibodies used for immunohistochemistry were developed using 3 3' diammobenzidine tetrahydrochloride (DAB). Slides were counterstained with
hematoxylin and coverslipped with permount. Human mitochondria- and ALDH1A1- stained areas in tumor sections were measured on an image analyzer (Image J, NIH) software. Sphere formation assays
Percentage of Cell Forming Sphere was determined after plating 100 cells/well in Mi l medium in P96 wells in ultra-low attachment plates (Corning). Sphere size exceeding 50μΜ were counted. The frequency of cancer cells with in vitro tumorigenic potential was determined using the Extreme Limiting Dilution Analysis after dilution in Mil medium of 1000/100/10 and 1 cell per well (n=18-24 wells/condition) in 96-well. Number of wells containing at least one sphere (>50μΜ) were counted after 10 days.
Statistical analysis
For each experiment, data are shown as mean S.E.M of at least three independent experiments. Graphpad Prism6 software was used for data analysis. The Mann and Whitney test was used to analyze the difference between two groups of quantitative variables. Alpha-value was set at 5%. For comparisons among three groups of quantitative variables, the Kruskal Wallis test was used. In cases where there was a significant difference between the groups, a pairwise comparison was carried out by adjusting the alpha risk using the method of Bonferroni. Student's t-tests were performed when indicated in figure legends.
Disease-free survival was calculated as the time between surgical resection and confirmation of either locoregional relapse and/or distant metastasis. Development of metachronous colorectal lesions was not considered. Patients without tumor recurrence were censored at the last follow-up contact. Initially, expression values of evaluated genes were subjected to a received operating curve (ROC) analysis in order to choose an individual cut-off for each gene. The cut-off value was selected to minimize the distance between the curve and the upper left corner of the graph (Youden index). Thus, continuous data were converted to binary form (high and low). Kaplan-Meier curves were generated using the selected cut-off and compared according to the likelihood ratio test. P-values <0.05 were set as significant.
RESULTS shRNA-mediated PXR knockdown improves recurrence-free survival in a mouse xenograft model.
The inventors first validated PXR shRNA (shPXR) sequences leading to the specific down-expression of PXR expression and its target genes, and performed rescue experiment to confirm the direct involvement of PXR on these effects (Figure 6). Then, to study the relationship between PXR and CSCs chemoresistance, we established colonosphere culture isolated from freshly resected colorectal tumor after infection with lentivirus expressing small hairpin RNAs targeted against human PXR (shPXR1334, hereafter shPXR) or control (shLUC). As expected, a significant down-regulation of PXR, CYP3A4, ALDH1A1 and ABCG2 mRNAs was quantified (Figure la). Then, we generated tumor xenografts by injecting subcutaneously 15.000 shLUC or shPXR cells into athymic nude mice (Figure la). When tumors reached 100 mm3 (day 20), mice were randomized to receive vehicle or a folfiri regimen (i.e. 90mg/kg Leucovorin+50mg/kg 5-fluorouracil+30mg/kg Irinotecan, twice a week during 4 weeks) designed to induce tumor regression (22). The tumor volume was calculated at various time points and represented as tumor volume changes from day 20. Tumor growth was noticeably slower in the vehicle-treated shPXR group compared to shLuc control group (paired t-test=0.025; Figure lb) and tumor regression upon Folfiri treatment was detected in both groups, with a marginally more pronounced effect observed on shPXR tumors after 10 days of treatment (paired t-test=0.001). Three days after treatment completion, six mice from vehicle- and folfiri-treated group were sacrificed for subsequent analysis, while tumor growth and post-treatment relapse were monitored in the remaining mice (6 mice/group). Control shLuc tumor relapse started 20 days post- treatment, showing an accelerated growth rate (xl.8) compared to untreated tumors (Figure lb). In contrast, tumor relapse was strongly delayed in the shPXR group (paired t-test=0.001; Figure lb & Log-rank mantel-Cox p=0,029; Figure 7a), indicating that PXR depletion is efficient to prolong progression-free survival following chemotherapy in a mouse model of human CRC xenografts. In addition, the tumor growth rates of shPXR tumors did not increased after folfiri treatment. Finally, to determine whether PXR down-regulation affected the in vivo tumor-initiating potential of tumor cells that survived the folfiri regimen, the inventors transplanted cells obtained from residual
shLUC or shPXR tumors collected three days after folfiri treatment completion (day 48), into new immunodeficient mice. Sub-cutaneous transplantation of 1.500 cells showed that tumor growth rates were strongly decreased in mice injected with shPXR cells compared to shLUC cells (Figure lc). In addition, we have quantified PXR mRNA expression at day 0 and along the tumor development in our xenograft experiments (figure Sib). As shown, PXR expression was lower in the shPXR tumors compared to the shLUC tumors at the different time points, despite a progressive re-expression of PXR observed in the relapsed tumors. Taken together, these results indicate that down- regulation of PXR delays tumor relapse and tumor-initiating potential of CRC cells following chemotherapy.
PXR depletion impairs chemotherapy-induced enrichment of CSCs in tumor xenografts To understand the cellular mechanism underlying these effects, we analyzed the frequency of CSCs from tumors collected at day 48. After cell dissociation, and in agreement with the literature, we found a 2-fold increase of colonosphere-forming efficiency (CFE) after Folfiri treatment in shLUC tumors (p<0.001; Figure Id). This enrichment was abolished in shPXR-derived tumors (p=0.09). In addition, the CFE of xenografted cells following chemotherapy was lower in shPXR-derived tumors compared to shLUC (p=0.007). In agreement, the inventors observed that while the percentage of ALDHbr cells was increased in Folfiri-treated shLuc tumors (xl.69, p=0.023), this increase was abolished in tumors derived from PXR-depleted cells where we observed a significant reduction of ALDHbr after treatment (p=0.018; Figure le). In addition, the proportion of ALDHbr cells was lower in shPXR-derived tumors compared to controls either in the untreated group (p=0.035) and in the folfiri-treated group (p=0.007). Corroborating these results, ALDH1A protein was barely undetectable by immunohistochemistry in sections of folfiri-treated tumor xenografts (day 48) in the shPXR group compared to shLUC control group. Quantifications of the relative areas of ALDH1A and human mitochondria (highly specific for human cells) immunohistochemical stainings showed a 17-fold decrease of ALDH1A staining in the shPXR tumors compared to control (p<0.001; Figure 2a). In addition, real-time RT-PCR showed a strong increase of PXR (p=0.003), ALDH1A1 (p<0.001) and ABCG2 (p<0.001) mRNA expression after Folfiri treatment of shLuc tumors. These increases were severely impaired in shPXR tumors (Figure 2b). Similarly, the enrichment of CCR
CSCs gene markers, such as OCT4 and LGR5, detected upon Folfiri treatment of control tumors was significantly impaired in PXR-depleted tumors. Comparable results were obtained in vitro on patient cells (CRC1) or LS174T cell line (Figure 8) treated with a mixture of 5FU and SN38. These results indicate that PXR signaling plays an instrumental role in the colorectal CSCs phenotype and that PXR inhibition minimizes the enrichment of these cells in response to chemotherapy.
PXR expression and activity selectively mark colorectal CSCs
The inventors then asked whether the importance of PXR on the ability of CSCs to resist and survive chemotherapy could reflect a preferential expression of PXR in the CSC population. To do so, the inventors compared PXR expression in CSCs versus non- CSCs by using enrichment of self-renewing cells via spheroids passaging or Aldefluor- based cell sorting. Western blot and RT-qPCR analysis showed the selective expression of PXR in CRC cells maintained as colonospheres (Sphe) compared to cells maintained in adherent conditions and exposed to serum-containing medium (2D) (Figure 3a). Similar results were obtained with HT29, SW620, T84 and SW480 CRC cell lines (Figure 9a). In addition, CSCs markers (ALDH1A1, LGR5 and OCT4) and PXR target genes (CYP3A4 and ABCG2) mRNAs were selectively enriched in Sphe conditions (Figure 9b). In agreement, we found that cells grown under colonospheres were significantly more resistant towards 5-FU and SN38 (Firi) treatment than their adherent counterparts (>2.4-fold increase of EC50, p=0.007; Figure 9c). Serial passaging of colonospheres resulted in the gradual and concomitant enrichment of sphere-forming ability (Figure 9d), ALDHbr cell subpopulation (Figure 9e) and of CSC markers mRNA (Figure 9f). As shown, enriched expression of PXR was tightly correlated with that of sphere formation and CSC marker expression, peaking around passage 4 and stabilizing 5-7-fold higher than their original expression level, in agreement with its enhanced protein expression (p=0.02). The inventors then quantified PXR expression in CSC population isolated according to their strong ALDH1A activity level via Aldefluor- mediated flow cytometry. ALDHbr cells displayed higher and specific ALDH1A1 mRNA and protein expression (Figure 3b,c and figure 10a), as well as an enhanced colonosphere-forming efficiency (p<0.001 ; Figure 10b) and stem cell frequency (l/32±9 ALDHbr versus 1/202+50 ALDHlo, p=0.026) (25) compared to ALDHlo cells. In addition, ALDHbr cells displayed a much higher chemoresistance towards Firi
treatment than ALDHlo cells (> 10-fold increase of EC50, p<0.001 ; Figure 10c). RT- PCR (Figure 3b and Figure lOd) clearly showed the specific expression of PXR in ALDHbr cells compared to ALDHlo in CCR cell lines (CRC1, HT29, HTC116, LS 174T, T84). Western blot (Figure 3c) confirmed the preferential expression of PXR protein in ALDHbr cells compared to ALDHlo. In addition, luciferase reporter genes for PXR transcriptional activity (CYP2B6 NRlx3-TKpGL3Luc or XREM pCYP3A4pGL2Luc) were specifically increased in ALDHbr cells (p<0.001; Figure 3d and lOe).
To validate the preferential expression and activity of PXR in CSCs, the inventors infected T84 cells with a GFP-tagged PXR-driven promoter (CYP3A4eGFP) to monitor PXR activity. This composite construct contains both the proximal part of the CYP3A4 promoter (-163/+11 region, that contains a proximal PXRE ER6 element) fused a PXR- driven enhancer (-7600/-7200 regions, also named XREM for Xenobiotic Response Element module that contain 3 PXRE elements). By FACS sorting, cells with high PXR activity (i.e. CYP3A4br) showed higher resistance towards Firi treatment than CYP3A41o cells (Figure 4a), in agreement with an enhanced expression of PXR and its target genes (Figure 4b), confirming the correlation between the endogenous expression and activity of PXR and the CYP3A4 promoter-driven eGFP expression. In addition, the inventors observed that CYP3A4br cells displayed significantly higher expression of CSC marker mRNA expression (Figure 4b), colonosphere-forming efficiency (p<0.001, and stem cell frequency (1/9+3 ALDHbr vs 1/94+32 ALDHlo, p=0.002) compared to CYP3A41o. Accordingly, flow cytometry analysis showed a specific increase of CYP3A4br cells after incubation with firi treatment (p=0.0036) or in Sphe conditions (p=0.0032). Together these data demonstrate that PXR expression and transcriptional activity are enriched in chemoresistant CSCs.
PXR regulates colorectal CSC gene markers
To further investigate the role of PXR in colon CSC biological properties, we used both gain-of function and loss-of function approaches. LS 174T CRC cells were stably transfected with PXR cDNA (clones PXR6 and PXR2) or infected with lentivirus expressing shPXR. Since ALDHlAl activity has been described as colon CSC marker and a regulator of cellular chemoresistance and cell renewal, we focused our attention on its putative regulation by PXR. Indeed, it has already been shown that PXR
activators induce both liver Aldhlal mRNA expression and PXR binding to the aldhlAl gene in mice as measured by chromatin immunoprecipitation. Overexpression, shRNA-mediated down-regulation and recue experiment confirmed that the expression of ALDH1A1 mRNA and protein was positively regulated by PXR in LS 174T cells (Figures 5a,b and figure Sla,c). In addition, the Aldefluor flow cytometry assay indicated that the proportion of cells displaying elevated ALDH activity was enhanced in PXR-overexpressing cells and strongly decreased upon PXR shRNA expression. These results were confirmed in T84, SW620 and HT29 CCR cell lines using both PXR gain- and loss-of function or the unspecific PXR antagonist L-Sulforaphane. Microarray analyses and qRT-PCR analysis (Figure 5c) showed that, in addition of related CSC- drug metabolizing and transporters genes (ALDH1A1, ABCG2, CYP3A4), PXR overexpression increases the expression of multiple colon CSC markers (CD24, CXCR4, OLFM4, EphB2 and LRIG-1) in LS 174T cells. In addition, PXR augments the expression of two prognostic markers for colorectal tumor recurrence (ABCC6 and S IOOAIO), as well as the telomerase reverse transcriptase TERT, a potent enabler of replicative immortality overexpressed in gastric cancer stem cells, and the expression of pluripotency markers such as Zic2. Together these results indicate that PXR controls the expression of a large gene network associated with CSC phenotype. PXR knockdown alters the self-renewal and chemo-sensitivity of colorectal
CSCs
To gain mechanistic insight concerning the role of PXR in CSC biology, we first tested whether PXR was involved in maintaining CSC survival and/or self-renewal using in vitro colonosphere model. As shown in figure 5d, the inventors observed a greater down-regulation of CSCs markers in shPXR cells maintained under colonosphere (Sphe) conditions compared to the non-challenging classical culture contitions (2D) (Figure 5c). In agreement, while PXR depletion slightly downsized the ALDHbr cell population under differentiation conditions (mean shLUC 2D=9.3% ±0.94 versus shPXR 2D=4.3% +0.3, p<0.05), these effects were more pronounced in cells maintained in colonosphere conditions (mean shLUC Sphe 15.6% ±1.9 versus shPXR Sphe=0.94% ±0.3, p<0.05). In agreement, while the sphere-forming potential of shPXR cells maintained in 2D conditions was moderately reduced in comparison with control cells (6.3+2.0% versus 8.0+1.5%, p=0.01), this effect was strongly amplified following serial
colonosphere passaging (1.75+1.2% versus 12.3+2.8, p<0.001. These results demonstrate that CSCs display increased self-renewal during colonosphere passaging and that PXR is instrumental to this process. The inventors then directly assessed the impact of PXR down-regulation on both chemoresistance and mRNA expression profile of ALDHbr cells. ALDHbr cells were sorted from CRC1 colonospheres, transfected with control (βϊβϋΑί) or PXR- specific siRNAs and then treated for 48 hours with increasing firi concentrations. While survival of ALDHbr cells was unaffected by the control siRNA (ALDHbr βίβϋΑί EC50=0.83 versus untransfected ALDHbr EC50=0.90, p>0.1), cell survival was significantly decreased in ALDHbr cells transfected with PXR-selective siRNA (ALDHbr siPXR EC50=0.40, p<0.01). In addition, ALDHbr cells were transfected with control (ςίβΟΑΚ) or PXR siRNAs, maintained for 72h under colonosphere conditions, then subjected to mRNA expression profiling. The expression of 374 genes was significantly altered by PXR down- regulation in ALDHbr cells, 148 of those genes were down-regulated in PXR-depleted cells; including the CSC markers ALDH1A1, OLFM4, and LRIG-1 previously identified as potential PXR target genes in LS 174T cells after PXR gain of function. A Gene Ontology analysis highlighted that PXR depletion in ALDHbr cells down- regulates the DNA damage sensor and repair machinery (known to help CSCs to overcome many standard anticancer treatments), while it promotes the expression of genes involved in apoptosis or cell death (Figure 11). Collectively these results suggest that PXR expression favors self-renewal and drives the expression of a large gene network responsible for the innate chemoresistance of CSC ALDHbr cells ._
PXR mRNA expression and downstream genes network are poor prognosis factors in colon cancer patients treated with chemotherapy
Clinically, these data were corroborated with our observation that PXR and ALDH1A1 mRNA expression were significantly correlated in liver metastastic samples obtained from patients with metastatic colorectal disease (n=12, p=0.022) and in primary tumors from patients diagnosed with stage II or III colon cancer and treated with 5-FU-based chemotherapy (38) (n=78, p=0.002). In addition, analysis of Kaplan-Meier curves showed that in this latest cohort, patient bearing tumors with high PXR expression level display a significant lower probability of disease-free survival, showing that high
expression levels of PXR are associated with poor prognosis in stage II III colon cancer patients treated with 5-FU-based chemotherapy. Finally, having in hand gene expression profiles after gain- or loss- of PXR function, the inventors next investigated potential association with gene signatures predictor of response to adjuvant chemotherapy (either single-treatment 5-fluorouracil/capecitabine or a combination of 5-fluorouracil and oxaliplatin) and progression-free survival in patients with stages II/III colorectal cancer. GSEA analyses showed that the molecular signature associated with poor progression- free survival of colorectal cancer patients was specifically enriched in PXR- overexpressing LS174T cells. Moreover, gene subsets associated with poor progression- free survival of patients were specifically decreased after PXR depletion, while those associated with good progression-free survival were specifically increased after PXR depletion in CRCl ALDHbr cells.
Example 2: Low miR-148-3p expression drives the preferential expression of PXR in colon CSCs
The inventors then attempted to determine why PXR expression was specifically enhanced in colorectal cancer cells displaying CSC characteristics. Because of the emerging role of micro RNA (miRNA) in the regulation of CSCs, they screened 4 independent miRNA databases (DIANAmT, miRanda, miRWalk, Targetscan) to identify miRNAs predicted to, or experimentally validated as targeting PXR. Among the selected miRNAs three stood out as strongly implicated in recurrence or chemoresistance: i.e. Let-7a, miR-130a, and miR148-3p. RT-qPCR demonstrated that of miR-148-3p expression in CRCl and T84 cells was reduced under conditions that enrich CSCs, such as in colonospheres or in ALDH cells, while this was not the case for Let-7a and miR-130a. In addition, they observed an inverse correlation between miR-148-3p and PXR or PXR target genes expression in these conditions. The inventors then investigated whether an up-regulation of miR-148-3p would have a negative impact on both PXR expression and CSC phenotype by transfecting CRC cell lines (T84 and LS174T) with miR-148-3p. RT-qPCR confirmed increased miR-148-3p levels 48 hours post transfection. Compared with a control sequence (RNA.l), ectopic expression of miR-148-3p mimic resulted in significantly reduced expression of miR- 148a target genes PXR and DNMT1, which encodes DNA methyltransferase 1. In
addition, the inventors observed a decreased ALDH1A1 mRNA level, sphere-forming potential and percentage of ALDHbr cells in miR-148-3p transfected cells. Furthermore, overexpression of a PXR cDNA depleted in the 3'UTR miR-148-3p binding site (i.e. LSPXR-2) specifically abrogated the ability of miR-148-3p to decrease the percentage of ALDHbr cells, while it had no effect on miR-148-3p-driven DNMT1 repression. Taken together these results demonstrate that miR-148-3p repression in colorectal CSCs is directly responsible for the selective enrichment of PXR in these cells. In addition, the inventors have shown and illustrated that miR-148-3p inhibits ALDHIA mRNA expression.
Example 3 : Assessment of PXR expression following chemotherapy in various cancer cell models.
The inventors have further shown that ovarian (SKOV-3), pancreas (MIA- PACA2) and breast (MDA-MB237) cancer cells express PXR when exposed to chemotherapeutic agent such as doxorubicin (figure 12). In addition, the inventors have shown by FACS sorting, that lung cancer cells (A549) with high PXR activity (i.e. CYP3A4br) showed higher resistance towards to chemotherapy treatments (docetaxel and doxorubicin) than CYP3A41o cells (Figure 13) and displayed significantly higher colonosphere-forming efficiency compared to CYP3A41o (1/13.5 cells versus 1/45 cells, p=0.02). This strongly indicates that the therapeutic strategy developed by the inventors is highly promising in various cancers such as lung, ovarian cancer, pancreas cancer and breast cancer.
Claims
1. Compound for use for preventing cancer recurrences wherein:
- said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity;
- said cancer responds correctly to chemotherapy; and
- said compound acts specifically on cancerous stem cells by sensitizing them to chemotherapy.
2. Compound for use as an adjuvant or a neoadjuvant therapy to chemotherapy in a subject, wherein
said compound is selected from the group consisting of antagonists of PXR and inhibitors of PXR expression and/or activity;
said subject suffers from a cancer comprising PXR-expressing cancer stem cells; and
- said compound sensitizes cancer stem cells to chemotherapy.
3. Compound for use according to claim 2, wherein said compound is administered before chemotherapy.
4. Compound for use according to any one of claims 1 to 3, wherein said cancer is selected from the group consisting of colorectal cancer, hepatocellular carcinoma, endometrial cancer, prostate cancer, ovarian cancer, pancreas cancer, breast cancer, melanoma, and lung cancer.
5. Compound for use according to any one of claims 1 to 3, wherein said cancer is colorectal cancer.
6. Compound for use according to any one of claims 1 to 3, wherein said cancer is selected from the group consisting of ovarian cancer, pancreas cancer and breast cancer.
7. Compound for use according to any one of claims 1 to 6, wherein the inhibitor is an inhibitor of PXR expression.
8. Compound for use according to claim 7, wherein said inhibitor of PXR expression is selected from the group consisting of antisense RNA or DNA molecules, micro RNAs, small inhibitory RNAs (siRNAs), short hairpin RNA (shRNAs) and ribozymes.
9. Compound for use according to claim 7 or 8, wherein said inhibitor of PXR expression is a siRNA as represented in SEQ ID No.1 or SEQ ID No. 2.
10. Compound for use according to any one of claims 1 to 6, wherein the inhibitor is an inhibitor of PXR activity which modifies the phosphorylation of the PXR.
11. Compound for use according to any one of claims 1 to 6, wherein the inhibitor is an inhibitor of PXR activity selected in the group consisting of L-sulphoraphane, sesamin, ketokonazole, A-792611, silybin, phorbol 12-myristate 13-acetate, okadaic acid and FLB-12.
12. Method for screening patients suffering from a cancer and who might benefit from an adjuvant or a neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy, said method comprising the step a) of measuring the level of expression and/or activity of PXR in a biological sample of said subject, wherein patients who show an expression or an overexpression of PXR are good candidate for said adjuvant therapy.
13. Method for assessing the prognosis of a patient suffering from a cancer said method comprising the step a) of measuring the level of expression of PXR and/or measuring the activity of PXR in a biological sample of said subject,
wherein a decrease in the level of expression or activity of PXR is indicative of a good prognosis and an increase in the level of expression or activity of PXR is indicative of a poor prognosis.
14. Method for monitoring the response to a treatment of a patient going through a chemotherapy comprising:
- determining at a first time point the level of expression or activity of PXR in a biological sample of said subject at said first time point;
- determining said level at a second time point in a biological sample obtained from said subject at said second time point, and
- comparing the levels of the two time points,
wherein :
- the treatment is considered to be effective when the level of expression or activity of PXR between the first and the second time point decreases of at least 10%; and
- the treatment is considered to be ineffective when the level of expression or activity of PXR between the first and the second time point increases by at least 5% .
15. The methods according to any one of claims 12 to 14, wherein said biological sample is selected from the group consisting of :
tissue samples obtained from a biopsy procedure or from a surgical procedure to remove a tumor mass,
- blood, which may comprise tumor derived material such as tumor cells or tumor relapsed proteins and/or nucleic acids.
16. The methods according to any one of claims 12 to 14, wherein step a) of measuring the level of expression of PXR is a step of measuring the expression level of translation products), preferably PXR proteins.
17. The method according to any one of claims 12 to 14, wherein said step a) of measuring the level of expression of PXR is a step of measuring the expression level of transcription product preferably mRNA.
18. The method according to any one of claims 12 to 14, wherein said method further comprises a step b) of comparing the level of expression of PXR profile obtained in step a) to a threshold value, and wherein said threshold value is the mean level of expression of a population of patients who are healthy or who recovered from a cancer.
19. The method according to any one of claims 12 to 14, wherein step a) is a step of measuring the level of activity of PXR by quantification of PXR target gene expression.
20. The method according to claim 19, wherein said target genes of PXR are:
- cancer stem cell-specific target genes such as ALDH1A1, LGR5, CD26, CD24,
TERT, ABCG2, CXCR4, OLFM4, and EphB2; and/or
- target genes involved in treatment resistance and tumour recurrence such as
UGT1A1, S100A10 and ABCC6, BLVRA, BCL11A.
21. A composition comprising:
at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
at least one chemotherapeutic agent.
22. A pharmaceutical composition comprising:
i) at least one compound selected from the group consisting of antagonists of PXR, inhibitors of PXR expression, inhibitors of PXR activity and any mixtures thereof; and
ii) at least one chemotherapeutic agent,
for use for preventing and/or treating a cancer selected from the group consisting of colorectal cancer, ovarian cancer, pancreas cancer and breast cancer, or a recurrence of said cancer.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP14306302.2 | 2014-08-21 | ||
| EP14306302 | 2014-08-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016026933A1 true WO2016026933A1 (en) | 2016-02-25 |
Family
ID=51429234
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2015/069159 Ceased WO2016026933A1 (en) | 2014-08-21 | 2015-08-20 | Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016026933A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330192A (en) * | 2018-03-07 | 2018-07-27 | 东莞理工学院 | Application of olfaction mediating hormone-4 as non-small cell lung cancer marker |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011031474A2 (en) * | 2009-08-25 | 2011-03-17 | President And Fellows Of Harvard College | Use of metformin in cancer treatment and prevention |
-
2015
- 2015-08-20 WO PCT/EP2015/069159 patent/WO2016026933A1/en not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011031474A2 (en) * | 2009-08-25 | 2011-03-17 | President And Fellows Of Harvard College | Use of metformin in cancer treatment and prevention |
Non-Patent Citations (4)
| Title |
|---|
| "FL-B-12", ANNUAL DRUG DATA REPORT, PROUS, BARCELONA, ES, vol. 31, no. 11, 1 January 2009 (2009-01-01), pages 1147, XP009182267, ISSN: 0379-4121 * |
| MANI S ET AL: "PXR antagonists and implication in drug metabolism", DRUG METABOLISM REVIEWS 2013 INFORMA HEALTHCARE GBR, vol. 45, no. 1, February 2013 (2013-02-01), pages 60 - 72, XP002735544, ISSN: 0360-2532 * |
| MASUYAMA HISASHI ET AL: "Down-regulation of pregnane X receptor contributes to cell growth inhibition and apoptosis by anticancer agents in endometrial cancer cells", MOLECULAR PHARMACOLOGY, vol. 72, no. 4, October 2007 (2007-10-01), pages 1045 - 1053, XP002735540, ISSN: 0026-895X * |
| RAYNAL CAROLINE ET AL: "Pregnane * Receptor (PXR) expression in colorectal cancer cells restricts irinotecan chemosensitivity through enhanced SN-38 glucuronidation", MOLECULAR CANCER, BIOMED CENTRAL, LONDON, GB, vol. 9, no. 1, 2 March 2010 (2010-03-02), pages 46, XP021067997, ISSN: 1476-4598 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330192A (en) * | 2018-03-07 | 2018-07-27 | 东莞理工学院 | Application of olfaction mediating hormone-4 as non-small cell lung cancer marker |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7330235B2 (en) | Methods and assays for circulating tumor cells | |
| Sponziello et al. | Fibronectin-1 expression is increased in aggressive thyroid cancer and favors the migration and invasion of cancer cells | |
| Rong et al. | Circular RNA CircEYA3 induces energy production to promote pancreatic ductal adenocarcinoma progression through the miR-1294/c-Myc axis | |
| Kislin et al. | NHERF-1: modulator of glioblastoma cell migration and invasion | |
| CN105980576B (en) | Methods for prognosis and treatment of bone metastases derived from breast cancer | |
| US20130224192A1 (en) | Method for the prognosis of the progression of cancer | |
| Cui et al. | ENC1 facilitates colorectal carcinoma tumorigenesis and metastasis via JAK2/STAT5/AKT axis-mediated epithelial mesenchymal transition and stemness | |
| Zhou et al. | MicroRNA-206 attenuates glioma cell proliferation, migration, and invasion by blocking the WNT/β-catenin pathway via direct targeting of Frizzled 7 mRNA | |
| Huang et al. | Downregulation of CLDN6 inhibits cell proliferation, migration, and invasion via regulating EGFR/AKT/mTOR signalling pathway in hepatocellular carcinoma | |
| WO2010040083A2 (en) | Gene expression predictors of chemoresistance | |
| KR101925125B1 (en) | Biomarker composition for diagnosing colon cancer or prognosing metastasis of colon cancer comprising NCKAP1 | |
| Xu et al. | MicroRNA-1298-3p inhibits proliferation and invasion of glioma cells by downregulating Nidogen-1 | |
| US12037646B2 (en) | Companion diagnostic biomarker for anti-HER2 therapy and use thereof | |
| Wang et al. | MiR-9-5p suppresses cell metastasis and epithelial-mesenchymal transition through targeting FOXP2 and predicts prognosis of colorectal carcinoma. | |
| CN106132435B (en) | Method and kit for screening anticancer adjuvant for enhancing sensitivity of anticancer drug by promoting expression of RIP3 | |
| EP2265286B1 (en) | Methods for the treatment, the prognostic assessment and the staging of non-small cell lung cancer | |
| WO2017064159A1 (en) | Trpv2 as a biomarker and as a therapeutic target for melanoma | |
| Wang et al. | Micro RNA‐203 inhibits tumour growth and metastasis through PDPN | |
| WO2016026933A1 (en) | Adjuvant or neoadjuvant therapy for sensitizing cancer stem cells to chemotherapy | |
| CN114045336B (en) | Application of CGA gene as a target in preparing drugs for diagnosis and treatment of drug-resistant solid tumors | |
| KR101952649B1 (en) | Biomarker composition for diagnosing radiation resistant cancer or predicting prognosis of radiation therapy comprising LRP-1 | |
| KR102743789B1 (en) | Biomarker composition for predicting metastasis of triple negative breast cancer comprising CSDE1 | |
| CN111910005A (en) | Gene related to CDK4/6 inhibitor sensitivity and its application | |
| JP7012363B2 (en) | Biomarkers for predicting the therapeutic effect of FSTL1 inhibitors in cancer patients | |
| US8557532B2 (en) | Diagnosis and treatment of drug-resistant Ewing'S sarcoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15754182 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15754182 Country of ref document: EP Kind code of ref document: A1 |