WO2016023077A1 - Biological markers - Google Patents

Biological markers Download PDF

Info

Publication number
WO2016023077A1
WO2016023077A1 PCT/AU2015/050452 AU2015050452W WO2016023077A1 WO 2016023077 A1 WO2016023077 A1 WO 2016023077A1 AU 2015050452 W AU2015050452 W AU 2015050452W WO 2016023077 A1 WO2016023077 A1 WO 2016023077A1
Authority
WO
WIPO (PCT)
Prior art keywords
mirna
cfs
hsa
mir
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2015/050452
Other languages
French (fr)
Inventor
Sonya M MARSHALL-GRADISNIK
Ekua W BRENU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Griffith University
Original Assignee
Griffith University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2014903190A external-priority patent/AU2014903190A0/en
Application filed by Griffith University filed Critical Griffith University
Publication of WO2016023077A1 publication Critical patent/WO2016023077A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/30Psychoses; Psychiatry
    • G01N2800/306Chronic fatigue syndrome
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates, inter alia, to the use of differentially expressed microRNAs (miRNAs) as biological markers for identifying and/or managing subjects that have Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME), or are at risk of developing CFS and/or ME.
  • miRNAs differentially expressed microRNAs
  • the present invention also relates to probes, tools, reagents, kits and assays for screening subjects for CFS and/or ME and/or managing subjects with CFS and/or ME.
  • CFS/ME Chronic Fatigue Syndrome/Myalgic Encephalomyelitis
  • CFS/ME may display differential expression in the mRNA and microRNA (miRNA) genes that regulate various physiological processes known to be dysregulated in CFS/ME including cytotoxicity, cytokine secretion and apoptosis [4,7,8,9,10,11,12].
  • miRNA microRNA
  • MicroRNAs are a class of small (typically 18-25 nucleotides in size) single- stranded, non-coding RNAs that regulate gene expression at the post-transcriptional level [13]. Their regulatory roles have been implicated in most biological processes including immunological, neurological and physiological processes [14,15,16,17]. Differential expression of miRNA has been associated with over 300 diseases, including cancer, cardiomyopathies, neurological disorders and unexplained disorders such as CFS/ME [4,18,19,20,21]. SUMMARY OF INVENTION
  • the present inventors have now discovered and characterised miRNAs that are differentially expressed in subjects having CFS and/or ME as compared with healthy subjects.
  • the inventors have found that the miRNAs can be used, inter alia, as biological markers to identify subjects having, or at risk of developing, CFS and/or ME. This, of course, means that the illness can be managed in those subjects that have been identified. This also means that subjects that have not been identified as having the illness (or at risk of developing the illness) need not be subjected to a management regime developed for CFS/ME sufferers.
  • CFS and/or ME may also be referred to by other names by skilled persons, such as systemic exertion intolerance disease (SEID). Therefore, context allowing, it is to be understood that CFS and/or ME as used herein may be interchangeable with the term SEID.
  • SEID systemic exertion intolerance disease
  • the present invention in one form, resides broadly in at least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME).
  • CFS Chronic Fatigue Syndrome
  • ME Myalgic Encephalomyelitis
  • the present invention resides broadly in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME.
  • the present invention resides broadly in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME.
  • the present invention resides broadly in a method of identifying or diagnosing a subject having CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of identifying or diagnosing a subject having CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of identifying or diagnosing a subject at risk of developing CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of identifying or diagnosing a subject at risk of developing CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
  • the present invention resides broadly in a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
  • the present invention resides broadly in a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
  • the present invention resides broadly in a method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed (expressed differently) in CFS and/or ME.
  • the present invention resides broadly in a method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME, said method comprising the steps of:
  • step b optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
  • the present invention resides broadly in a method of identifying or characterising at least one miRNA biological marker for CFS and/or ME, said method comprising the steps of:
  • step b optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
  • the present invention resides broadly in an isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS and/or ME.
  • the present invention resides broadly in a: (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, nucleic acid, oligonucleotide or cDNA form of a miRNA biological marker (or fragment thereof or pre-processed [eg. pre- miRNA] form thereof) that is differentially expressed in CFS and/or ME; or (2) a polynucleotide, nucleic acid, cDNA or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
  • a miRNA biological marker or fragment thereof or pre-processed [eg. pre- miRNA] form thereof
  • the present invention resides broadly in a miRNA-based probe, tool or reagent for identifying a subject having CFS and/or ME.
  • the present invention resides broadly in a miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME.
  • the present invention resides broadly in a miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME.
  • the present invention resides broadly in a kit for identifying a subject having CFS and/or ME, said kit comprising one or more tools or reagents for determining expression or the amount of at least one miRNA biological marker in a biological sample derived from the subject.
  • the present invention resides broadly in a kit for identifying a subject at risk of developing CFS and/or ME, said kit comprising one or more tools or reagents for determining expression or the amount of at least one miRNA biological marker in a biological sample derived from the subject.
  • the present invention resides broadly in a kit for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
  • the present invention resides broadly in an assay for measuring expression of a miRNA biological marker differentially expressed in CFS and/or ME.
  • the present invention resides broadly in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • the present invention resides broadly in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
  • the present invention resides broadly in an array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to a miRNA that is differentially expressed in CFS and/or ME.
  • the present invention resides broadly in a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
  • the present invention resides broadly in measuring expression of at least one miRNA as described in Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA substantially as described in Table 3, Table 4, Table 5, Table 6 or Table 7. (Expression can be measured in a biofluid such as cerebrospinal fluid, plasma or serum, for example.)
  • the present invention resides broadly in an isolated, purified, synthetic or recombinant form of at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5,Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50).
  • the present invention resides broadly in a (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID.
  • the present invention resides broadly in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
  • the present invention resides broadly in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
  • the present invention resides broadly in an isolated, purified, synthetic or recombinant form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof.
  • the form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the present invention resides broadly in a non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof - single stranded or double stranded.
  • the form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the present invention resides broadly in an expression product of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof.
  • the expression product may be unlabelled or labelled with a detectable moiety.
  • the expression product can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the present invention resides broadly in a polynucleotide, oligonucleotide, probe or primer (unlabelled or labelled with a detectable moiety) for specifically binding to, annealing to, detecting, isolating or amplifying (eg. by PCR) a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof.
  • the polynucleotide, oligonucleotide, probe or primer can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the present invention resides broadly in an expression vector, recombinant cell or biological sample comprising the nucleic acid or polynucleotide of 1, 2, 3 or
  • Figures 1A, IB and 1C Read classification as predicted by miRanalyzer.
  • FIG. 1 Expression stability values (M) of the putative reference genes tested in plasma. The expression of four genes was analysed to determine the most suitable reference gene. MicroRNAs are ranked from the most stable to the least stable (left to right). The dotted line indicates the recommended threshold value of ⁇ 1.0 for heterogeneous samples.
  • CFS Chronic Fatigue Syndrome
  • ME Myalgic Encephalomyelitis
  • CFS and ME are significantly debilitating medical conditions characterised by persistent fatigue and other specific symptoms that last for a minimum of six months.
  • CFS and ME are often used interchangeably to describe the same illness, although this need not be the case.
  • the fatigue experienced by human subjects suffering from CFS is not due to exertion or caused by other medical condition, and is not significantly relieved by rest. It is a complex disease involving dysregulation of immune and central nervous system, dysfunction of cellular energy metabolism and ion transport, and cardiovascular abnormalities.
  • CFS and/or ME may also be referred to by other names such as the recently adopted name of systemic exertion intolerance disease (SEID). Therefore, it is to be understood that CFS and/or ME as used herein may - context allowing - be interchangeable with the term SEID.
  • SEID systemic exertion intolerance disease
  • CFS/ME Although there is no specific treatment for CFS/ME, it can be appropriately managed once a patient is diagnosed as suffering from CFS. Additionally, there is some evidence to suggest that earlier a management regime is adopted the greater the chance of improvement. A diagnostic/screening test would significantly help in diagnosis/screening of CFS/ME, thereby reducing the patient suffering and healthcare costs associated with waiting for many months before being diagnosed with CFS/ME.
  • the present inventors have now identified and characterised miRNAs that are found in different quantities in biological samples obtained for CFS and/or ME subjects when compared with healthy controls. This, of course, means that CFS/ME can be managed in those subjects that have been identified.
  • the present inventors have identified and characterised (1) novel miRNAs, (2) miRNAs that are expressed in cerebrospinal fluid, as well as (3) miRNAs that are differentially expressed in subjects having CFS and/or ME as compared with healthy subjects.
  • the present inventors believe themselves to be the first to identify miRNAs, particularly circulating or extracellular miRNAs that are differentially expressed in subjects having CFS and/or ME.
  • the inventors have found that these miRNAs, particularly from biofluid such as plasma, (but also from serum, urine, sputum and cerebrospinal fluid), can serve as novel reproducible biological markers for CFS/ME screening, prevalence, diagnosis, monitoring and/or prognosis.
  • the present invention is not limited to circulating miRNAs, extracellular miRNA, nor extracellular miRNA found in plasma, serum, urine, sputum and cerebrospinal fluid, nor to the afore-mentioned uses.
  • the inventors have also, for the first time, characterised miRNAs that are expressed in cerebrospinal fluid.
  • the subject can be any mammal. Mammals include humans, primates, livestock and farm animals (eg. horses, sheep and pigs), companion animals (eg. dogs and cats), and laboratory test animals (eg. rats, mice and rabbits).
  • the subject is preferably human.
  • Non-fatigued/healthy 'controls' or 'references'/subjects preferably have no medical history or symptoms of persistent fatigue or illness. Human subjects also preferably exclude individuals who were smokers, pregnant/breast- feeding or immobile, or had autoimmune, thyroid or cardiac related disorders prior to the onset of CFS/ME.
  • the term 'extracellular miRNA' means that the miRNA is found, located or circulates in a biofluid (biological fluid).
  • the term 'extracellular miRNA' includes any one or more of miRNA found in exosomes or in other vesicles of cellular origin, miRNA originating from cells or more generally being of cellular origin, or being cellular isolates.
  • Biofluid can be, for example, blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid, and can be fresh, frozen or fixed.
  • biofluid can comprise cells, cellular isolates, lysed cells or any type of cellular material.
  • the biofluid is plasma or serum.
  • the at least one extracellular miRNA will be relatively stable in plasma.
  • miRNAs may be discharged into biofluid/plasma following tissue damage, for example, following acute myocardial infarction [34].
  • the miRNA biological marker is either up-regulated (having an elevated level of expression) or down-regulated (having a reduced level of expression or no expression) in a subject having CFS and/or ME compared with a healthy subject or reference or control - regardless of the actual molecular regulatory mechanism (eg. transcription or incomplete RNA processing to mature miRNA).
  • up-regulated having an elevated level of expression
  • down-regulated having a reduced level of expression or no expression
  • pre-miRNA/precursor/pre-processed miRNA could be used as a biological marker to identify subjects having, or at risk of developing, CFS and/or ME - both in method and product forms (eg. assays, tools and reagents) of the invention.
  • the at least one miRNA can be any suitable differentially expressed miRNA (up- regulated/having an elevated level of expression or down-regulated/having a reduced level of expression or no expression), and will typically be about 18 to 25 nucleotides in length/size. This means that the miRNA will typically be 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides/residues in length/size.
  • SNPs Single nucleotide polymorphisms
  • UTR and 3' UTR may be pre-processed miRNAs, flanking regions or target sites, and have been demonstrated to affect certain physiological processes or be related to diseases.
  • the at least one miRNA can be a SNP, including a SNP in pre-miRNA or miRNA flanks.
  • the present invention resides in at least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic
  • the present invention resides in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject having, or at risk of developing, CFS or ME.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10 or even more different types of miRNAs can be used for identification or diagnosis of CFS and/or ME at the same time or substantially same time.
  • the at least one miRNA biological marker can have increased or decreased expression relative to a reference, control, or normal sample by at least about 0.5 fold, at least about 0.6 fold, at least about 0.7 fold, at least about 0.8 fold, at least about 0.9 fold, at least about 1.0 fold, at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9- fold, at least about 2.0-fold, at least about 2.1 -fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 2.6-fold, at least about 2.7-fold, at least about 2.8-fold, at least about 2.9-fold, at least about 3.0-fold, at least about 3.1 -fold, at least about 3.2-fold, at least about 3.3-fold, at
  • the at least one miRNA biological marker has increased or decreased expression relative to a reference, control, or normal sample by about the value listed in Table 5 (column labeled 'Fold Change').
  • the at least one miRNA biological marker is cellular miRNA.
  • the at least one miRNA biological marker is extracellular or circulating miRNA or miRNA found in biofluid.
  • the at least one miRNA biological marker is both extracellular and cellular miRNA.
  • the at least one miRNA biological marker is circulating miRNA.
  • Cropculating miRNA means miRNA that circulates in the bloodstream or other body fluid, such as the lymphatic system.
  • “Circulating miRNA” means miRNA, for example, found in blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid.
  • the at least one miRNA biological marker can be selected from a miRNA listed in any one or more of Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA having a sequence substantially as listed in Table 3, Table 4, Table 5, Table 6 or Table
  • the at least one miRNA biological marker can be selected from a miRNA listed in Table 6 (SEQ. ID. NOs.: l-19) or a miRNA having a sequence substantially as listed in Table 6.
  • the at least one miRNA biological marker is preferably a biological marker selected from the group consisting of: hsa-miR127-3p (SEQ. ID. NO.: l); hsa-miR-143-3p (SEQ. ID. NO.:2); and hsa-miR-142-5p (SEQ. ID. NO.:3) or a biological marker having a sequence substantially the same a marker of that group - each of which is up-regulated (increased in expression) in CFS and/or ME.
  • the invention concerns a method of identifying or diagnosing CFS and/or ME in a subject, a method of identifying a subject at risk of developing CFS and/or ME, and a method of identifying whether a subject having CFS and/or ME is likely to respond to, or is responding to, management of that illness.
  • the present invention resides in a method of identifying or diagnosing a subject having, or at risk of developing, CFS and/or ME, said method comprising the steps of:
  • the present invention resides in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
  • the reference can be any suitable control sample known in the art, such as, for example, a sample from a normal, healthy subject.
  • the reference can be a sample from the same subject prior to demonstration of illness symptoms or prior to
  • the reference can be a 'standardised' sample, such as a sample comprising material or data from several samples, preferably also from several subjects.
  • a reference, control or normal sample can be, or can be obtained, prepared or derived from, a subject not having CFS/ME, and preferably having no medical history or symptoms of persistent fatigue or illness.
  • a reference, control or normal sample can be, or can be obtained, prepared or derived from, more than one subject not having CFS/ME, and preferably having no medical history or symptoms of persistent fatigue or illness.
  • a further method step for the third and fourth forms of the invention can comprise (c) managing a subject having, or at risk of developing, CFS and/or ME.
  • the present invention resides in a method of identifying whether a subject having a CFS and/or ME illness is likely to respond to, or is responding to, management of that illness, said method comprising the steps of:
  • the method according to the fifth form can comprise step (a).
  • the method according to the fifth form can comprise the step of managing the subject for the illness.
  • the present invention resides in a method of managing a subject with CFS and/or ME, or at risk of developing CFS and/or ME, comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • the methods of the different forms of the invention can comprise the step of isolating a biological sample from a subject.
  • the methods of the different forms of the invention can comprise processing a biological sample.
  • the methods of the different forms of the invention can comprise the step of extracting RNA from a biological sample. [00103] In some embodiments, the methods of the different forms of the invention can comprise the step of identifying miRNA.
  • the methods of the different forms of the invention can comprise the step of miRNA profiling.
  • the methods of the different forms of the invention can comprise the step of miRNA screening.
  • the methods of the different forms of the invention can comprise the step of miRNA sequencing.
  • the methods of the different forms of the invention can comprise the step of miRNA sequence analyses.
  • the methods of the different forms of the invention can comprise the step of measuring a level of expression of miRNA.
  • the methods of the different forms of the invention can comprise the step of comparing expression levels (differential expression) of a miRNA.
  • the methods of the different forms of the invention can comprise the step of using a reference or control in the form of a reference gene.
  • the reference gene can be any suitable stably expressed gene but is preferably hsa-miR-16-5p or RNU6B.
  • RNA extraction techniques PureLink (Invitrogen), Trizol reagent (Invitrogen), MiRNEasy (Qiagen), mirVana (ambion), mRCURY (Exiqon), Stratagene (total and small RNA), TRI-Reagent (Sigma-Aldrich), Nucleospin (Machery-Nagel) and RNA-Bee (Tel-test). Reference [89].
  • the degree to which miRNA expression differs need only be large enough to quantify via standard characterization techniques such as expression arrays, RT-qPCR, northern analysis and RNase protection.
  • Microarrays [105].
  • Profiling methods Agilent microarray, exiqon array, exiqon microarray, miRCURY LNA ncode array, LC Sciences array ABI Taqman array, affymetrix , illumine array, SOLiD ligation sequencing, Illumina HiSeq and TaqMan miR assay.
  • Radiolabeled splinted ligation detection [110,111].
  • the level of miRNA expression or differential expression can be carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed miRNA.
  • RT-PCR reverse transcription-polymerase chain reaction
  • a universal primer can be used in combination with the one or more
  • the method/s can comprise the step of statistical analysis so as to identify differential expression.
  • the method/s can comprise the step of extracting miRNA.
  • the biological sample can be any suitable sample derived from the subject - obtained either non-invasively or invasively. It can be cellular- or extracellular-derived, or both.
  • Buccal (mouth) cells obtained by swishing mouthwash in the mouth or by swabbing or bushing the inside of the cheek with a swab or brush; 2. Blood - obtained by pricking the finger and collecting the drops (dried blood spot) or by venepuncture (whole blood); 3. Skin - obtained by a (punch) biopsy; 4. Organ tissue - obtained by biopsy; 5. Plasma - obtained by blood plasma fractionation; 6. Urine - obtained by urination; 7. Faeces - obtained by stool sample; 8. Cerebrospinal fluid - obtained by spinal tap; and 9. Sputum - obtained by expectoration or nasotracheal suctioning.
  • the biological sample can be a biofluid such as plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid, and can be fresh, frozen or fixed.
  • biofluid or biological sample comprising plasma or serum can be removed surgically and preferably by extraction, e.g. by hypodermic or other types of needles.
  • Plasma harvesting is employed.
  • Plasma harvesting/extraction can be performed in any suitable way, but preferably immediately after peripheral blood collection.
  • Plasma harvesting can involve a centrifugation step so as to separate the plasma from other blood components, and frozen storage of that plasma.
  • RNA can be extracted from plasma using a commercially available kit such as the miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany). The size, quantity and quality of the extracted extracellular RNA can be assessed using a small RNA chip on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).
  • a commercially available kit such as the miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany).
  • the size, quantity and quality of the extracted extracellular RNA can be assessed using a small RNA chip on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).
  • MiRNA profiling and sequencing can be carried out in any suitable way.
  • HTS high throughput sequencing
  • CFS/ME patients and non- fatigued controls with the highest abundance of small RNA can be used for HTS.
  • Small RNA libraries can be constructed using the TruSeq Small RNA Sample Preparation kit (Illumina, San Diego, CA). Small RNA samples can be ligated with 5' and 3' adapters, followed by reverse transcription-polymerase chain reaction (RT-PCR) for cDNA library construction and incorporation of index tags. The cDNA library fragments can be separated and size fractioned, and an about 145-160 bp size fraction containing miRNA inserts can be isolated. cDNA library samples can be pooled in equimolar amounts and used for cluster generation and sequence analysis.
  • a genome-wide small RNA screening of CFS/ME subjects and non-fatigued subjects can be carried out to select for candidate miRNAs differentially expressed in CFS/ME (eg. circulating, extracellular and/or cellular miRNAs).
  • Sequence data that has been generated can be analysed in any suitable way.
  • raw FASTQ sequences can be generated and demultiplexed using the Illumina CASAVA vl.8 pipeline. Per base sequence quality (quality score >30) can then be assessed using the FastQC toolkit (http://www.bioinformatics.babraham.ac.uk/projects/fastqc).
  • the FastQC toolkit http://www.bioinformatics.babraham.ac.uk/projects/fastqc.
  • Prior to mapping the read data can be pre-processed using the UEA small RNA Workbench (http://srna- workbench.cmp.uea.ac.uk) [27].
  • the 3' adapter sequences can be trimmed, the read size filtered (16-35nt), unique reads can be counted and low abundance reads ( ⁇ 10 reads) can be discarded.
  • Unique sequence reads can then be aligned to the human genome (hgl8) and miRBase_vl6 using the miRanalyzer web server tool
  • RT-qPCR reverse transcription-quantitative polymerase chain reaction
  • the expression of miRNAs can be validated using PerfeCTa miRNA primers (Quanta Biosciences, Gaithersburg, MD). The choice of a stable reference gene may be important for accurate gene expression analysis by RT-qPCR.
  • MiRNAs miR-10, miR-15b, miR-16 and miR-24
  • Extracted RNA may be reverse transcribed into cDNA using the NCode miRNA First-Strand cDNA Synthesis kit (Life Technologies,
  • RT-qPCR can be performed as previously described in [4].
  • the term 'managing' a subject or 'management' is such that at least one symptom of CFS or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated, or improved.
  • Management can include administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect the illness or a symptom of the illness.
  • the term can also refer to providing the subject with a management regime which can comprise, for example, psychological counseling and/or administration of one or more therapeutic compounds by any appropriate route to achieve the desired effect.
  • Potential therapeutic compounds include: antidepressants (eg. low-dose tricyclic antidepressants, SSRIs); pain relievers (eg. NSAIDs, COX-2 inhibitors); medications for helping with sleep (eg. tricyclics, melatonin); stimulants (eg. dexamphetamine, adderall,
  • methylphenidate and Ritalin-like drugs
  • herbal and dietary supplements and, vitamin and mineral supplements.
  • Administration can include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial,
  • the present inventors have also devised a method of identifying or characterising differentially expressed miRNA biological markers for CFS and/or ME. [00141] Accordingly, in a seventh form, the present invention resides in a method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME.
  • the method can also comprise the step of producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
  • the present invention also resides in a miRNA biological marker for CFS and/or ME identified by the method of the seventh form.
  • screening and expression techniques can comprise a suitable technique or protocol described in this specification or as otherwise known to those of skill in the art.
  • the present inventors have also devised reagents, tools, kits and assays for screening, identifying, diagnosing and/or managing subjects with CFS and/or ME and for performing measurement of miRNA biological markers known to be differentially expressed in CFS and/or ME.
  • the miRNA biological markers can be, for example, the miRNAs of any one or more of Tables 1 to 7.
  • the present inventors have also devised other useful types of products based on the miRNA biological markers, particularly those of any one or more of Tables 1-7, and more particularly those miRNA markers listed in Table 6.
  • the present invention resides in an isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS or ME.
  • the present invention resides in a: (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, nucleic acid, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide, oligonucleotide or cDNA that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
  • the present invention resides in a miRNA- based probe, tool or reagent for identifying a subject having, or at risk of developing, CFS and/or ME.
  • the present invention also resides in a miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME.
  • the present invention resides in a kit for identifying a subject having, or at risk of developing, CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
  • the present invention resides in a kit for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
  • the present invention resides in an assay for measuring expression of a miRNA biological marker differentially expressed in CFS and/or ME.
  • the present invention resides in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS or ME.
  • the present invention resides in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
  • the present invention resides in an array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
  • the probes can bind to the same type of miRNA (ie. miRNAs having the same sequence).
  • the probes can selectively bind to different types of miRNAs (ie. miRNAs having different sequences).
  • the present invention resides in a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
  • the probes can bind to the same type of miRNA (ie. miRNAs having the same sequence).
  • the probes can selectively bind to different types of miRNAs (ie. miRNAs having different sequences).
  • the one or more tools or reagents can comprise one or more tools or reagents for: processing a biological sample; RNA extraction from a biological sample; miRNA identification, miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses;
  • the one or more tools or reagents may be suitable for use in one or more of the techniques/references/methods cited herein.
  • the one or more tools or reagents can comprise oligonucleotides (primers or probes) or other types of polynucleotides or nucleic acids that hybridise to miRNA biological markers for miRNA detection, characterisation, quantification and/or expression etc.
  • the one or more tools or reagents comprise oligonucleotides or probes that hybridise to any of the miRNA sequences preferably as listed in Table 6.
  • the assay can comprise any technique for measuring expression of a miRNA biological marker as described herein.
  • the kit or assay can comprise a package insert containing written instructions for performing screening, detection and/or measurement etc of the miRNA biological marker and/or for determining expression of the miRNA biological marker etc.
  • the present invention resides in an isolated, purified or recombinant form of a miRNA having a sequence, preferably as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50).
  • the present invention resides in a: (1) non- naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos.
  • the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 4 (SEQ. ID.
  • the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID.
  • the present invention resides in an isolated, purified, synthetic or recombinant form of at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID.
  • the present invention resides in a (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50) or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ.
  • the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
  • the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
  • the invention resides in a reagent, tool, kit or assay based on the twentieth to twenty-third forms of the invention, said reagent, tool, kit or assay being as described above for other forms of the invention.
  • the invention resides in measuring expression of at least one miRNA as described in Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA substantially as described in Table 3, Table 4, Table 5, Table 6 or Table 7.
  • Oligonucleotide refers to a single- stranded sequence of ribonucleotide or deoxyribonucleotide bases, known analogues of natural nucleotides, or mixtures thereof.
  • An oligonucleotide comprises a nucleic-acid based molecule including DNA, cDNA, RNA, PNA,
  • Oligonucleotides are typically less than about 50 nucleotides in length and may be prepared by direct chemical synthesis or cloning and restriction of appropriate sequences.
  • polynucleotide' refers to a single- or double- stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues of natural nucleotides, or mixtures thereof.
  • a polynucleotide comprises a nucleic-acid based molecule including DNA, cDNA, RNA, PNA, LNA, UNA or any combination thereof.
  • the term includes reference to the specified sequence as well as to the sequence complimentary thereto, unless otherwise indicated.
  • the term 'polynucleotide' includes chemically modified variants, as realised by those skilled in the art.
  • the term 'complementary' refers to the ability of two single-stranded nucleotide sequences to base pair, typically according to the Watson-Crick base pairing rules. For two nucleotide molecules to be complementary they need not display 100% complementarity across the base pairing regions, but rather there must be sufficient complementarity to enable base pairing to occur. Thus a degree of mismatching between the sequences may be tolerated and the sequences may still be complementary.
  • 'Nucleic acid' as used herein includes 'polynucleotide', 'oligonucleotide', and 'nucleic acid molecule', and generally means a polymer of DNA or RNA, which can be single- stranded or double- stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide.
  • This can include cDNA.
  • the term 'recombinant' refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above.
  • the replication can be in vitro replication or in vivo replication.
  • the terms 'isolated', 'purified' and 'substantially purified' as used herein mean essentially free of association with other biological components/contaminants, e.g., as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture.
  • Probes may mean an oligonucleotide (or cDNA) capable of binding to a target nucleic acid/miRNA of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of
  • a probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
  • 'Target' as used herein can mean an oligonucleotide or portions or fragments thereof, which may be bound by one or more probes under stringent hybridization conditions. 'Target' as used herein may also mean a specific miRNA or portions or fragments thereof, which may be bound by one or more probes under stringent hybridization conditions.
  • Probes may be used for screening and diagnostic methods, as described herein.
  • the probes may be attached or immobilized to a solid substrate or apparatus, such as a biochip.
  • a biochip is also provided.
  • the biochip is an apparatus which, in certain aspects
  • a solid substrate comprising an attached probe or plurality of probes/oligonucleotides.
  • the probes may be capable of hybridizing to a target sequence under stringent hybridization conditions.
  • the probes may be attached at spatially defined address on the substrate. More than one probe per target sequence may be used, with either overlapping probes or probes to different sections of a particular target sequence. In an embodiment, two or more probes per target sequence are used.
  • the probes may be capable of hybridizing to different target sequences (miRNAs) associated with CFS/ME.
  • the probes may be attached to the biochip in a wide variety of ways, as will be appreciated by those of skill in the art.
  • the probes may either be synthesized first, with subsequent attachment to the biochip, or may be directly synthesized on the biochip.
  • the solid substrate may be a material that may be modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method.
  • substrates include glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses and plastics.
  • the substrates may allow optical detection without appreciably fluorescing.
  • the substrate may be planar, although other configurations of substrates may be used as well. For example, probes may be placed on the inside surface of a tube, for flow-through sample analysis to minimize sample volume.
  • the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.
  • the biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two.
  • the biochip may be derivatized with a chemical functional group including, but not limited to, amino groups, carboxyl groups, oxo groups or thiol groups.
  • the probes may be attached using functional groups on the probes either directly or indirectly using linkers.
  • the probes may be attached to the solid support by either the 5' terminus, 3' terminus, or via an internal nucleotide.
  • the probe may also be attached to the solid support non-covalently.
  • biotinylated oligonucleotides can be made, which may bind to surfaces covalently coated with streptavidin, resulting in attachment.
  • probes may be synthesized on the surface using techniques such as photopolymerization and photolithography.
  • hybridization conditions may be used, including high, moderate and low stringency conditions as outlined above.
  • the assays may be performed under stringency conditions which allow hybridization of the probe only to the target.
  • Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration H, or organic solvent concentration.
  • Hybridization reactions may be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in different orders.
  • the reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g., albumin, detergents, etc. which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors and antimicrobial agents may also be used as appropriate, depending on the sample preparation methods and purity of the target.
  • Exemplary biochips of the present invention include an organized assortment of oligonucleotide probes described above immobilized onto an appropriate platform. Each probe selectively binds a miRNA in a sample. In certain embodiments, each probe of the biochip selectively binds a biologically active mature miRNA in a sample.
  • the biochip of the present invention can also include one or more positive or negative controls.
  • oligonucleotides with randomized sequences can be used as positive controls, indicating orientation of the biochip based on where they are placed on the biochip, and providing controls for the detection time of the biochip when it is used for detecting miRNAs in a sample.
  • Embodiments of the biochip can be made in the following manner.
  • oligonucleotide probes to be included in the biochip are selected and obtained.
  • the probes can be selected, for example, based on a particular subset of miRNAs of interest.
  • the probes can be synthesized using methods and materials known to those skilled in the art, or they can be synthesized by and obtained from a commercial source, such as GeneScript USA (Piscataway, N.J.).
  • Each discrete probe is then attached to an appropriate platform in a discrete location, to provide an organized array of probes.
  • Appropriate platforms include membranes and glass slides.
  • Appropriate membranes include, for example, nylon membranes and nitrocellulose membranes.
  • the probes are attached to the platform using methods and materials known to those skilled in the art. Briefly, the probes can be attached to the platform by synthesizing the probes directly on the platform, or probe- spotting using a contact or non-contact printing system. Probe- spotting can be accomplished using any of several commercially available systems, such as the GeneMachines(TM) OmniGrid (San Carlos, Calif.).
  • the miRNA sample can be amplified and labeled as is appropriate or desired.
  • the miRNA samples can be labeled using various methods known to those skilled in the art.
  • the miRNA samples are labeled with digoxigenin using a Digoxigenin
  • the labeled miRNA sample is incubated with the biochip, allowing the miRNAs in the sample to hybridize with a probe specific for the miRNAs in the sample.
  • the labeled miRNA sample is added to a DIG Easy Hyb Solution or Hybrid Easy Buffer (Roche Diagnostics Corporation, Indianapolis, Ind.) that has been preheated to hybridization temperature.
  • the miRNA sample is the incubated with the biochip in the solution, for example, for about 4 hours to about 24 hours.
  • the miRNAs in the sample can be detected, identified, and quantified in the following manner. After the miRNA sample has been incubated with the biochip for an appropriate time period, the biochip is washed with a series of washing buffers, and then incubated with a blocking buffer. When Digoxigenin (DIG) labeling of the miRNA samples has been used, the biochip is then incubated with an Anti-DIG-AP antibody (Roche Diagnostics Corporation, Indianapolis, Ind.). The biochip is them washed with washing buffer and incubated with detection buffer, for example, for about 5 minutes.
  • DIG Digoxigenin
  • NBT/BCIP dye (5-Bromo-4-Chloro-3'- Indolyphosphate p-Toluidine Salt and NBT Nitro-Blue Tetrazolium Chloride) diluted with detection buffer is added to the biochip, which is allowed to develop in the dark, for example, for about 1 hour to about 2 days under humid conditions.
  • the biochips are scanned, for example, using an Epson Expression 1680 Scanner (Seiko Epson Corporation, Long Beach, Calif.) at a resolution of about 1500 dpi and 16-bit grayscale.
  • Epson Expression 1680 Scanner Silicon Epson Corporation, Long Beach, Calif.
  • the biochip images are analyzed using Array-Pro Analyzer (Media Cybernetics, Inc., Silver Spring, Md.) software. Because the identity of the miRNA probes on the biochip are known, the sample can be identified as including particular miRNAs when spots of hybridized miRNAs-and-probes are visualized. Additionally, the density of the spots can be obtained and used to quantitate the identified miRNAs in the sample.
  • the identity and relative quantity of miRNAs in a sample can be used to provide a miRNA profiles for a particular sample.
  • a miRNA profile for a sample includes information about the identities of miRNAs contained in the sample, quantitative levels of miRNAs contained in the sample, and/or changes in quantitative levels of miRNAs relative to another sample.
  • a miRNA profile for a sample includes information about the identities, quantitative levels, and/or changes in quantitative levels of miRNAs associated a particular cellular type, process, condition of interest, illness, or other cellular state. Such information can be used, for diagnostic purposes, illness management, drug development, drug screening and/or drug efficacy testing.
  • CFS Chronic Fatigue Syndrome
  • ME Myalgic Encephalomyelitis
  • a miRNA when used as a biological marker for CFS and/or ME or a miRNA biological marker when used in identifying or diagnosing a subject having CFS and/or ME.
  • a method of identifying or diagnosing a subject having CFS and/or ME comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
  • a method of identifying or diagnosing a subject at risk of developing CFS and/or ME comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject is at risk of developing CFS and/or ME.
  • a method of screening subjects for a prevalence of CFS and/or ME comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression in each said biological sample to a level of expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME.
  • a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness comprising the steps of: (a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness; (b) measuring the level of expression in the biological samples of at least one miRNA biological marker that is differentially expressed in CFS and/or ME; and (c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
  • a method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • a method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME comprising the steps of: (a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker; and (b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised.
  • a miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME or a miRNA-based probe, tool or reagent for use in identifying a subject at risk of developing CFS and/or ME.
  • a miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME.
  • kits for identifying a subject having CFS and/or ME comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
  • kits for identifying a subject at risk of developing CFS and/or ME comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
  • kits for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME comprising one or more tools or reagents for measuring expression of the miRNA biological marker.
  • a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
  • oligonucleotide probes for identifying miRNAs in a biological sample comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
  • a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
  • [00224] 24 The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraph 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is circulating miRNA, extracellular miRNA, cellular miRNA, or both extracellular and cellular miRNA.
  • managing or management comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
  • kit of any one of paragraphs 16 to 18, wherein the tool or reagent is for: processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses;
  • [00250] 50 An isolated, purified or recombinant form of a miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or substantially as found in Table 4 (SEQ. ID. Nos.:20- 32).
  • CFS Chronic Fatigue Syndrome
  • ME Myalgic Encephalomyelitis
  • At least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME, or use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME, or use of at least one miRNA as a biological marker for managing a subject having or at risk of developing CFS and/or ME.
  • a method of identifying or diagnosing a subject having CFS and/or ME, or at risk of developing CFS and/or ME comprising the steps of:
  • managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
  • a method of screening subjects for a prevalence of CFS and/or ME comprising the steps of:
  • a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness comprising the steps of:
  • managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
  • a method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
  • a method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME comprising the steps of:
  • step b optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
  • 81 The method of any one of paragraphs 74 to 80, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
  • RT-PCR reverse transcription-polymerase chain reaction
  • An article of manufacture comprising: (1) non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
  • kits for identifying a subject having, at risk of developing, and/or managing CFS and/or ME comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
  • kit of any one of paragraphs 99 to 105 wherein the tool or reagent is for: processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses; measuring miRNA expression; or comparing miRNA expression levels (differential expression).
  • kits or assays for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME comprising one or more tools or reagents for measuring expression of the miRNA biological marker.
  • kit or assay of any one of paragraphs 107 to 111 wherein said kit comprises a plurality of tools or reagents based on miRNAs shown in Table 5 or Table 6.
  • a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
  • oligonucleotide probes for identifying miRNAs in a biological sample comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
  • a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
  • Figures 1 to 3 relate to Example 1.
  • Figure 4 relates to Example 2.
  • Plasma harvesting was performed immediately after peripheral blood collection. Briefly 10 mL of whole blood was collected from each participant into EDTA collection tubes. Plasma was immediately separated via centrifugation at 500 x g for 10 min, and 5 mL of the plasma was transferred to a new tube and stored at -80°C. Prior to RNA extraction, the plasma samples were centrifuged for 10 min at 16,000 x g at 4°C in order to remove any cellular debris left in the plasma. Circulating RNA was extracted from plasma using the miRNeasy
  • Serum/Plasma kit (Qiagen, Hilden, Germany) according to manufacturer's instruction with minor modifications. Briefly, 1 mL of plasma was incubated with 5 mL of QIAzol Lysis Reagent for 10 min. Samples were processed using a vacuum manifold to help process the larger quantity of plasma. An additional 80% ethanol wash step was included and sample elution was performed twice using 15 of RNase-free water. The size, quantity and quality of the extracted circulating RNA was assessed using a small RNA chip on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).
  • RNA libraries were constructed using the TruSeq Small RNA Sample Preparation kit (Illumina, San Diego, CA) according to the manufacturer's protocols. Briefly, small RNA samples (5-10ng) were ligated with 5' and 3' adapters, followed by reverse transcription-PCR (RT-PCR) for cDNA library construction and incorporation of index tags. The cDNA library fragments were purified by way of separation on a 6% TBE PAGE gel and a 145-160 bp size fraction containing miRNA inserts was isolated. The twelve cDNA library samples were pooled in equimolar amounts and used for cluster generation and sequence analysis in a single lane on an Illumina HiSeq2000 (50 bp single read).
  • Raw FASTQ sequences were generated and demultiplexed using the Illumina CASAVA vl.8 pipeline. Per base sequence quality (quality score >30) was then assessed using the FastQC toolkit (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Prior to mapping the read data was pre-processed using the UEA small RNA Workbench (http://srna- workbench.cmp.uea.ac.uk) [27]. Briefly, the 3' adapter sequences were trimmed, the read size filtered (16-35nt), unique reads counted and low abundance reads ( ⁇ 10 reads) discarded.
  • miRNAs The expression of eight miRNAs was validated using PerfeCTa miRNA primers (Quanta Biosciences, Gaithersburg, MD). In addition four miRNAs (miR-10, miR-15b, miR-16 and miR-24) were assessed for their suitability as a stable reference gene. Briefly, 15 ⁇ of extracted RNA were reverse transcribed into cDNA using the NCode miRNA First-Strand cDNA Synthesis kit (Life Technologies, Carlsbad, CA). RT-qPCR was performed as previously described [4].
  • Table 1 Characteristics of CFS/ME and non-fatigued control participants.
  • Lymphocytes ( ⁇ 10 3 / ⁇ ⁇ ) 2.14 + 0.53 1.89 + 0.46 0.13
  • Table 2 Characteristics of miRNA-Seq subset of CFS/ME and non-fatigued control participants.
  • MiRNA characterisation A total of 375 mature miRNA were initially identified in one or more samples based on sequence alignment to the miRBase registry (release 19). The top 25 expressed miRNAs in each sample group are listed in Table 3.
  • Table 3 Top 25 most abundant miRNAs identified.
  • the base mean is the mean of the counts for each miRNA divided by the size factor for each condition (as calculated by DESeq).
  • 13 tentatively novel candidate miRNAs were predicted, although these amounted to a very small fraction of the total read count. However, using the current techniques, it appeared that none of these novel miRNA showed significant differences between CFS/ME and non-fatigued controls (Table 4). These novel candidate miRNAs nevertheless remain tentatively useful screening tools.
  • hsa-miR-450b-5p 1.72 1.23 0.71 0.0208 hsa-miR-26a-l-3p 1.56 1.16 0.75 0.0106 hsa-mir-126* 1.39 0.91 0.65 0.0449 hsa-miR-5187-3p 1.31 1.10 0.84 0.0217 hsa-miR-641 1.07 0.78 0.73 0.0240 hsa-miR-548j 1.07 1.10 1.03 0.0446 hsa-miR-3065-3p 0.90 0.71 0.79 0.0126 hsa-miR-16-2-3p 0.82 0.71 0.87 0.0128 hsa-let-7g-3p 0.82 0.78 0.95 0.0251 hsa-miR-548ax 0.82 0.91 1.11 0.0484
  • the base mean is the mean of the counts for each miRNA divided by the size factor for each condition (as calculated by DESeq).
  • miRNAs 16 were considered low in abundance due to a base mean count of less than 1,000 reads, their detection was found to be unreliable for confirmative RT-qPCR. However, they remain excellent candidates as miRNA biological markers for CFS/ME. The remaining three miRNAs (hsa-miR127-3p, hsa-miR-142-5p and hsa- miR-143-3p) were all up-regulated in CFS/ME compared to non-fatigued controls.
  • RNA- Seq data Three differentially expressed miRNAs (hsa-miR127-3p, hsa-miR- 142-5p and hsa-miR- 143-3p) and four non-differentially expressed miRNAs (hsa-miR-21-5p, hsa-miR- 103-3p, hsa-miR- 146a-5p and hsa-miR- 223-3p) were selected and their expression levels quantified using RT-qPCR. The four non-differentially expressed miRNAs were selected as they previously demonstrated dysregulation in cytotoxic lymphocytes in CFS/ME patients [3], although HTS did not identify differential expression in plasma. All RT-qPCR results for the remaining three miRNAs were consistent with the RNA- Seq data ( Figure 3).
  • miRNAs may be discharged into the plasma following tissue damage for example, circulating miR-1 and miR-133a, are significantly increased following acute myocardial infarction [34].
  • the miRNAs as described herein have expressions in various tissues. MiR-127-3p is found in the testicular and nervous system [35], miR-143-3p is expressed in the colon [36] while miR-142-5p is expressed by cells of the immune system [37,38].
  • miR-142-5p and miR-143-3p are reported to be amongst the miRNAs frequently found in plasma and serum [32].
  • Over-expression of miR-142-5p has been observed in most cancer-related and immunological disorders [39]. This particular miRNA is abundant in most hematopoietic cell lines and may be involved in thwarting inflammatory processes [40].
  • SLE Systemic Lupus Erythematosus
  • increased expression of miR-142-5p in CD4+T cells prevents autoimmunity while a downregulation may result in autoreactive T cells and
  • MiR-142-5p is important for T cell development where it targets SLAM associate protein (SAP). Inhibition of miR-142-5p may increase the expression of CD84, IL-10, SAP and IgG production [41].
  • CD84 is an important T cell regulatory marker as it regulates cytokine production, function, adhesion and interaction with B cells [42].
  • the levels of IL-10 have been shown to be equivocal in CFS/ME patients. The cause of an increase in miR-142-5p is unknown, however, it is possible that this may be related to heightened Treg suppression and additional autoimmune responses.
  • MiR-143-3p targets IgG Fey receptor 1 and also CD64 reducing lung inflammation. It is a tumour suppressor gene and is highly down regulated in colorectal cancer [43]. It inhibits the oncogene KRAS [44]. Overexpression of miR-143-3p in most cancer cells stagnates the growth of tumours and cancer cells [45] as it may act to reduce BCL2 mRNA thereby preventing tumour or cancer cell proliferation and promoting apoptosis [46]. miR-143-3p has been identified as a neutrophil specific miRNA [47]. Importantly, its expression is upregulated in cases of heightened erythropoiesis such as in polycythemia [48]. In CFS/ME increased levels of neutrophil apoptosis occurs in some patients [49,50,51], and this potentially ensues from high levels of miR-143-3p.
  • MiR-127-3p interferes with ERK signalling, a tumour suppressor and upregulations have been shown to increase apoptosis [52]. Importantly, it targets BCL6 a transcription factor which increases p53 expression [53]. BCL6 inhibits the production of IL-10 therefore by dampening BCL6 as a consequence of miR-127 upregulation may result in significant increases in IL-10 [54]. In CFS/ME equivocal levels of IL-10 have been reported and an over expression of miR-127-3p may explain to some extent some of these patterns. BCL6 is an important transcription factor required for germinal centre B cell and follicular helper T cell development
  • RNA Y4 are components of Ro
  • RNAs ribonucleoproteins
  • RNPs ribonucleoproteins
  • Y RNAs are similar in size and structure to miRNAs as they both have comparable stem and loop structures [60] . These similarities may explain the presence of Y RNA following small RNA library construction. Efficient depletion of Y RNA would yield higher quality HTS miRNA data allowing deeper sequencing. Methods for the reduction of Y RNA in a similar manner to rRNA depletion could be employed to improve the ratio of useful miRNA data [61]. Most extracellular miRNA studies do not report on the abundance of Y RNAs in circulation and this may be related to the read size filtering used. Given that Y RNAs upon degradation produce two classes of fragments and majority of which bind to Ro60, it is possible to posit that these fragments that we observed in the plasma samples are those Y RNAs bound to Ro60.
  • Plasma miRNAs show great promise as potential non-invasive biological markers, but at present the precise and accurate measurement is challenging. A number of factors including cellular contamination, haemolysis and low quantity can result in significant bias that does not reflect the original biological state of the sample. Current circulating miRNA research indicates that haemolysis may influence the availability of miRNAs in circulation [33].
  • Haemolysis may be evaluated in archival data by examining the delta Cq of miR-451 and miR- 23a [33].
  • 194 miRNAs may be detected in both haemolysed and non- haemolysed blood samples, where 40.2% may be upregulated following haemolysis, 13% may be down regulated and 28.9% are unaffected by haemolysis [62,63].
  • three candidate miRNAs, miR-127-3p, miR-143-3p and miR-142-5p are among the miRNA genes unaffected by haemolysis in healthy individuals [62] .
  • biofluid/circulating miRNAs as biological markers for diseases relates to a number of characteristics such as reduced complexity compared to proteins, stability, conserved sequences in various species and restricted expression in specific tissues and biological processes. It has been suggested that 206 miRNAs are expressed in blood cells, serum and plasma, thus in most plasma and serum studies it is highly necessary to observe strict sample processing procedures to ensure the samples are cell free [64]. Cellular content contamination of biofluids may be reduced by employing additional centrifugation steps during the initial plasma separation to lessen potential contamination from cellular debris and haemolysis [65]. Additionally, it may be important to assess blood cell counts and lysis during sample collection as variation in plasma levels of miRNAs in some cases have been credited to circulating blood cell effects [66,67].
  • the present inventors are of the view that one or more earlier studies not finding differentially expressed miRNA for CFS/ME may have been limited by the particular
  • Example 1 Three miRNAs upregulated in CFS/ME patients were described in Example 1 (hsa- miR-127-3p, hsa-miR-l42-5p, hsa-miR- 1.43 -3p ).
  • This second example confirms and validates the expression of these miRNAs in new cohort of CFS/ME patients in comparison to controls. 49 CFS/ E patients and 15 controls were used in this validation study. Hence a total of 69 CFS/ME patients and 35 controls have been examined for the expression of these three miRNAs (hsa- miR-127-3p, hsa-miR-142-5p, hsa-miR-143-3p).
  • Plasma isolation was achieved as described in Example 1 and stored at -80°C.
  • RNA extraction was performed as previously described in Example 1 using the miRNeasy Serum/Plasma kit (Qiagen, Profen, Germany) and the niiRVana Paris kit (Life Technologies, Carlsbad, CA) according to manufacturer's instructions with slight adjustments. Quantity and quality of the total RNA and miRNA extracted was determined using the small RNA chip on an Agilent 2100 Bioanaiyzer (Agilent Technologies, Palo Alto, CA).
  • hsa-miR-16-5p was the preferred reference gene.
  • RT-qPCR was undertaken in a new and larger cohort of CFS/ME patients (n-49).
  • RT-qPCR results for hsa-miR-127-3p, hsa-miR-l42-5p, hsa-miR-143-3p were consistent with previous findings in Example 1.
  • hsa-miR ⁇ 142-5p was not statistically significant. See Figure 4, wherein CFS/ME patients are labelled 'CPS' and non-fatigued (healthy) controls are labelled 'HE' .
  • biofluids such as, for example, serum, urine, sputum and cerebrospinal fluid. Any one of these biofluids could have been equally examplified by the present inventors.
  • Biological samples could have been obtained from a subject either non-invasively or invasively. For example: urine - obtained by urination; cerebrospinal fluid - obtained by spinal tap; and sputum - obtained by
  • the present inventive concept further embraces miRNAs from cellular sources.
  • Biological samples could have been obtained from a subject either non-invasively or invasively.
  • buccal (mouth) cells obtained by swishing mouthwash in the mouth or by swabbing or bushing the inside of the cheek with a swab or brush; 2. blood cells - obtained by pricking the finger and collecting the drops (dried blood spot) or by venepuncture (whole blood); 3. skin - obtained by a (punch) biopsy; 4. organ tissue - obtained by biopsy. Any one of these cellular sources of miRNA could have been equally examplified by the present inventors.
  • Advantages of using plasma as a source of biological marker miRNA for CFS/ME include: (1) plasma samples are obtained less invasively; (2) plasma- derived miRNAs can be stored for a lengthy period of time, as they highly stable and can resist freeze-thawing, temperature variation, acids, etc.; (3) plasma is likely to contain a great diversity of circulating miRNAs, particularly because of their role in extracellular communication and release from cells/tissues (eg. plasma miRNAs may be reflective of a lesion or an injured tissue, and plasma miRNAs may be involved in cellular signal transduction through various
  • MicroRNAs in Cerebrospinal Fluid Samples from Patients with CFS/ ME were assessed the presence and expression of miRNAs in cerebrospinal fluid (CSF) from CFS/ME and healthy control patients.
  • CSF cerebrospinal fluid
  • CSF samples were collected from 18 well-characterized CFS/ME patients and 5 healthy controls.
  • RNAs from cerebrospinal fluid samples were used as per manufacturer's instructions. Briefly, 625 ⁇ ⁇ of CSF samples were mixed with 625 ⁇ of denaturing solution. An equal volume of acid phenol chloroform was then added to the total volume of CSF plus the denaturing solution. Following centrifugation, the aqueous layer was removed and supplemented with ethanol. A filter cartridge was used to separate the small RNAs from the samples. This was washed with buffer solutions containing ethanol and eluted with 95 °C nuclease-free water. Samples were stored at -20°C.
  • cDNA synthesis was performed using 10 ng of total RNA.
  • the TaqMan MicroRNA Reverse Transcription Kit was the preferred kit for cDNA synthesis. Therefore RNA was converted into cDNA as per manufacturer's instructions. Briefly, an RT master mix was prepared using lOOmM dNTPs (with dTTP), MultiScribe Reverse Transcriptase 50 ⁇ / ⁇ , 10 X Reverse Transcription Buffer, RNase Inhibitor, 20 ⁇ JI ⁇ iL , Nuclease-free water, 5X RT primer (Primer specific RT for each gene of interest). The master mix was added to the total RNA template.
  • the expression profile of miRNAs in CSF was performed on the 480 Light Cycler instrument (Roche).
  • the TaqMan MicroRNA Assays were used in designing the miRNA primers. Five miRNAs were screened to determine the relative abundance of these miRNAs in CSF. RNU6B was the housekeeping or normalization gene. The miRNAs screened are shown in Table 7 below.
  • Table 7 miRNA sequences.
  • the miRNA are characterised at http://www.genenames.org/cgi- and at miRBase at http://www.mirbase.org/.
  • the reaction mixture for the RT-qPCR reaction was comprised of TaqMan Universal PCR Master Mix, primer of interest, nuclease-free water and cDNA.
  • RT-qPCR conditions applied were as follows; 95°C for 10 mins, 40 cycles of 95°C for 15s, 60°C for 60s, melt curves were generated at 65 to 95°C.
  • Each reaction was performed in triplicate on a 96 well plate and a no template control was used each time.
  • miRNAs can be used for identifying, screening, diagnosing or monitoring subjects with CFS/ME or at risk of developing CFS/ME. This, of course, means that the illness can be better managed in those subjects that have been identified. This also means that subjects that have not been identified as having the illness (or at risk of developing the illness) need not be subjected to a management regime developed for CFS/ME sufferers.
  • miRNAs of interest are listed in Tables 4, 5, 6 and 7.
  • the miRNAs of particular interest are hsa-miR-127-3p, hsa-miR-142-5p, hsa-miR-143-3p.
  • miRNA sequence-based probes, tools, reagents, methods and assays can be used for identifying, screening, diagnosing or monitoring or treating subjects with, or predisposed to, CFS/ME.
  • probes, tools or reagents can be for use in nucleic acid- based techniques, assays and protocols, including miRNA detection, qualitative measurement of miRNA and quantitative measurement of miRNA.
  • probes, tools or reagents can also be an antibody or other type of molecule or chemical entity capable of detecting miRNA.
  • probes, tools and reagents of particular interest include, but are not limited to, the following:
  • the form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • the expression product may be unlabelled or labelled with a detectable moiety.
  • the expression product can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • a polynucleotide, oligonucleotide, probe or primer (unlabelled or labelled with a detectable moiety) for specifically binding to, annealing to, detecting, isolating or amplifying (eg. by PCR) a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof.
  • the polynucleotide, oligonucleotide, probe or primer can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
  • An expression vector, recombinant cell or biological sample comprising the nucleic acid or polynucleotide of 1, 2, 3 or 4.
  • the kit, assay, microarray, biochip or method for identifying, screening, diagnosing, monitoring and/or treating subjects with, or predisposed to, CFS/ME can comprise one or more materials of any one of 1-5. This may be, for example, for identifying or measuring miRNA expression or lack of expression.
  • Blimp- 1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation.
  • microRNAs and their targets including a stress-induced miRNA. Mol. Cell. 2004;14:787-799.
  • RNA-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res 35:e60.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

In one embodiment the invention relates to the use of differentially expressed microRNAs (miRNAs) as biological markers for identifying subjects that have Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME) [systemic exertion intolerance disease (SEID)], or are at risk of developing CFS and/or ME. In another embodiment, the invention relates to probes, tools, reagents, kits and assays for screening subjects for CFS and/or ME and/or managing CFS and/or ME.

Description

TITLE
Biological Markers
TECHNICAL FIELD
[0001] The present invention relates, inter alia, to the use of differentially expressed microRNAs (miRNAs) as biological markers for identifying and/or managing subjects that have Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME), or are at risk of developing CFS and/or ME. The present invention also relates to probes, tools, reagents, kits and assays for screening subjects for CFS and/or ME and/or managing subjects with CFS and/or ME.
BACKGROUND ART
[0002] It will be clearly understood that, if a prior art publication is referred to herein, this reference does not constitute an admission that the publication forms part of the common general knowledge in the art in Australia or in any other country.
[0003] Chronic Fatigue Syndrome/Myalgic Encephalomyelitis (CFS/ME) is known to affect about 1-4% of individuals worldwide [1,2]. CFS/ME is a multi-symptom disorder including profound disabling fatigue and post-exertional sickness, cognitive disturbances, tender or painful lymph nodes, muscle ache and pain and irregular sleep patterns [3]. There is evidence to suggest a dominant disruption of immunological process in CFS/ME and this may be characterised by reduced cytotoxic activity and increases in regulatory T cells [4,5,6]. In addition patients with CFS/ME may display differential expression in the mRNA and microRNA (miRNA) genes that regulate various physiological processes known to be dysregulated in CFS/ME including cytotoxicity, cytokine secretion and apoptosis [4,7,8,9,10,11,12]. Despite intensive research the pathophysiology of CFS/ME is not yet fully understood and clear diagnostic biomarkers remain elusive.
[0004] MicroRNAs are a class of small (typically 18-25 nucleotides in size) single- stranded, non-coding RNAs that regulate gene expression at the post-transcriptional level [13]. Their regulatory roles have been implicated in most biological processes including immunological, neurological and physiological processes [14,15,16,17]. Differential expression of miRNA has been associated with over 300 diseases, including cancer, cardiomyopathies, neurological disorders and unexplained disorders such as CFS/ME [4,18,19,20,21]. SUMMARY OF INVENTION
[0005] The present inventors have now discovered and characterised miRNAs that are differentially expressed in subjects having CFS and/or ME as compared with healthy subjects. The inventors have found that the miRNAs can be used, inter alia, as biological markers to identify subjects having, or at risk of developing, CFS and/or ME. This, of course, means that the illness can be managed in those subjects that have been identified. This also means that subjects that have not been identified as having the illness (or at risk of developing the illness) need not be subjected to a management regime developed for CFS/ME sufferers.
[0006] CFS and/or ME may also be referred to by other names by skilled persons, such as systemic exertion intolerance disease (SEID). Therefore, context allowing, it is to be understood that CFS and/or ME as used herein may be interchangeable with the term SEID.
[0007] With the foregoing in view, the present invention in one form, resides broadly in at least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME).
[0008] In another form, the present invention resides broadly in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME.
[0009] In another form, the present invention resides broadly in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME.
[0010] In another form, the present invention resides broadly in a method of identifying or diagnosing a subject having CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
[0011] In another form, the present invention resides broadly in a method of identifying or diagnosing a subject having CFS and/or ME, said method comprising the steps of:
(a) determining the amount of at least one miRNA biological marker in a biological sample obtained from the subject that is differently expressed in CFS and/or ME; and (b) comparing the amount of the miRNA biological marker in the biological sample to a reference, wherein detection of a difference in the amount of miRNA biological marker in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
[0012] For another form, the present invention resides broadly in a method of identifying or diagnosing a subject at risk of developing CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject is at risk of developing CFS and/or ME.
[0013] In another form, the present invention resides broadly in a method of identifying or diagnosing a subject at risk of developing CFS and/or ME, said method comprising the steps of:
(a) determining the amount of at least one miRNA biological marker in a biological sample obtained from the subject that is differently expressed in CFS and/or ME; and
(b) comparing the amount of miRNA biological marker in the biological sample to a
reference, wherein detection of a difference in the amount of miRNA biological marker in the biological sample relative to the reference indicates that the subject is at risk of developing CFS and/or ME.
[0014] In another form, the present invention resides broadly in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression in each said biological sample to a level of
expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression relative to the reference identifies the subject as having CFS and/or ME.
[0015] In another form, the present invention resides broadly in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
(a) determining the amount of at least one miRNA biological marker in a biological sample obtained from each subject that is differently expressed in CFS and/or ME; and (b) comparing the amount in each said biological sample to a reference, wherein detection of a difference in the amount of miRNA biological marker relative to the reference identifies the subject as having CFS and/or ME.
[0016] In another form, the present invention resides broadly in a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
(a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness;
(b) measuring the level of expression in the biological samples of at least one miRNA
biological marker that is differentially expressed in CFS and/or ME; and
(c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
[0017] In another form, the present invention resides broadly in a method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
(a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness;
(b) measuring in the biological samples the amount of at least one miRNA biological marker that is differently expressed in CFS and/or ME; and
(c) comparing the amount of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the amount identifies the subject as having responded to the management of the illness.
[0018] In another form, the present invention resides broadly in a method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed (expressed differently) in CFS and/or ME.
[0019] In another form, the present invention resides broadly in a method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME, said method comprising the steps of:
(a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker; (b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised; and
(c) optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
[0020] In another form, the present invention resides broadly in a method of identifying or characterising at least one miRNA biological marker for CFS and/or ME, said method comprising the steps of:
(a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker;
(b) confirming different expression of the potential CFS and/or ME miRNA biological
marker relative to a reference using a nucleic acid-based technique, wherein different expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised; and
(c) optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
[0021] In another form, the present invention resides broadly in an isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS and/or ME.
[0022] In another form, the present invention resides broadly in a: (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, nucleic acid, oligonucleotide or cDNA form of a miRNA biological marker (or fragment thereof or pre-processed [eg. pre- miRNA] form thereof) that is differentially expressed in CFS and/or ME; or (2) a polynucleotide, nucleic acid, cDNA or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
[0023] In another form, the present invention resides broadly in a miRNA-based probe, tool or reagent for identifying a subject having CFS and/or ME.
[0024] In another form, the present invention resides broadly in a miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME.
[0025] In another form, the present invention resides broadly in a miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME.
[0026] In another form, the present invention resides broadly in a kit for identifying a subject having CFS and/or ME, said kit comprising one or more tools or reagents for determining expression or the amount of at least one miRNA biological marker in a biological sample derived from the subject.
[0027] In another form, the present invention resides broadly in a kit for identifying a subject at risk of developing CFS and/or ME, said kit comprising one or more tools or reagents for determining expression or the amount of at least one miRNA biological marker in a biological sample derived from the subject.
[0028] In another form, the present invention resides broadly in a kit for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
[0029] In another form, the present invention resides broadly in an assay for measuring expression of a miRNA biological marker differentially expressed in CFS and/or ME.
[0030] In another form, the present invention resides broadly in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[0031] In another form, the present invention resides broadly in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
[0032] In another form, the present invention resides broadly in an array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to a miRNA that is differentially expressed in CFS and/or ME.
[0033] In another form, the present invention resides broadly in a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
[0034] In another form, the present invention resides broadly in measuring expression of at least one miRNA as described in Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA substantially as described in Table 3, Table 4, Table 5, Table 6 or Table 7. (Expression can be measured in a biofluid such as cerebrospinal fluid, plasma or serum, for example.)
[0035] In another form, the present invention resides broadly in an isolated, purified, synthetic or recombinant form of at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5,Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50).
[0036] In another form, the present invention resides broadly in a (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50); or (2) a polynucleotide, oligonucleotide or cDNA that is complementary to the miRNA of (1); or (3) an expression vector, recombinant cell, biological sample, tool, reagent, kit or assay comprising (1) or (2).
[0037] In another form, the present invention resides broadly in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50).
[0038] In another form, the present invention resides broadly in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), when isolated for the purpose for testing the biological sample.
[0039] In another form, the present invention resides broadly in an isolated, purified, synthetic or recombinant form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[0040] In another form, the present invention resides broadly in a non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof - single stranded or double stranded. The form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[0041] In another form, the present invention resides broadly in an expression product of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The expression product may be unlabelled or labelled with a detectable moiety. The expression product can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[0042] In another form, the present invention resides broadly in a polynucleotide, oligonucleotide, probe or primer (unlabelled or labelled with a detectable moiety) for specifically binding to, annealing to, detecting, isolating or amplifying (eg. by PCR) a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The polynucleotide, oligonucleotide, probe or primer can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[0043] In another form, the present invention resides broadly in an expression vector, recombinant cell or biological sample comprising the nucleic acid or polynucleotide of 1, 2, 3 or
4.
[0044] Any of the forms of the invention or its features described above can be combined in any combination with any one or more of the other forms of the invention or features described below within the scope of the invention.
[0045] Other forms and advantages of the invention will become apparent from a reading of this specification.
[0046] Preferred features, embodiments and variations of the invention may be discerned from the following Detailed Description which provides sufficient information for those skilled in the art to perform the invention. The Detailed Description is not to be regarded as limiting the scope of the preceding Summary of Invention in any way. The Detailed Description will make reference to a number of drawings as follows.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figures 1A, IB and 1C. Read classification as predicted by miRanalyzer.
Percentage of A) read count and B) unique reads mapped to mature miRNAs, other microRNAs (ambiguous, star and hairpin), other non-coding RNAs and unmapped. C) Length distribution of sequenced small RNA. Data represents mean + SEM (n=6/group).
[0048] Figure 2. Expression stability values (M) of the putative reference genes tested in plasma. The expression of four genes was analysed to determine the most suitable reference gene. MicroRNAs are ranked from the most stable to the least stable (left to right). The dotted line indicates the recommended threshold value of < 1.0 for heterogeneous samples.
[0049] Figure 3. Relative expression data presented as boxplots for miRNAs identified as differentially expressed by Illumina HTS. Boxes indicate the interquartile range (25%- 75%) with the horizontal bar within each box indicating the media. The whiskers show the minimum and maximum values. *P<0.05 vs. non-fatigued control (n=20/group). [0050] Figure 4. Relative expression data presented as boxplots for miRNAs hsa-miR' -
127~3p, hsa-miR-142~5p axid hsa-miR~143~3p. Boxes indicate the interquartile range (25%- 75%) with the horizontal bar within each box indicating the media. The whiskers show the minimum and maximum values. Results for CFS/ME patients (n-49) are labelled 'CPS' . Results for non-fatigued (healthy) controls (n=15) are labelled 'HE*. *P<0.05 vs. non-fatigued control.
DETAILED DESCRIPTION
[0051] Chronic Fatigue Syndrome (CFS) and Myalgic Encephalomyelitis (ME) are significantly debilitating medical conditions characterised by persistent fatigue and other specific symptoms that last for a minimum of six months. CFS and ME are often used interchangeably to describe the same illness, although this need not be the case. The fatigue experienced by human subjects suffering from CFS is not due to exertion or caused by other medical condition, and is not significantly relieved by rest. It is a complex disease involving dysregulation of immune and central nervous system, dysfunction of cellular energy metabolism and ion transport, and cardiovascular abnormalities.
[0052] Note that CFS and/or ME may also be referred to by other names such as the recently adopted name of systemic exertion intolerance disease (SEID). Therefore, it is to be understood that CFS and/or ME as used herein may - context allowing - be interchangeable with the term SEID.
[0053] A number of healthcare initiatives have been undertaken to advance research into the likely cause(s), mechanism, preventive measures and potential therapeutic strategies for
CFS/ME. Presently, none of these initiatives have been successful and the medical community remains baffled by the illness.
[0054] Currently there are no commercially available diagnostic tests or definitive methods for screening of CFS/ME.
[0055] The most puzzling aspect of CFS/ME is its multifactorial, multi-symptom nature and resulting difficulty in the diagnosis of CFS/ME. The current method of diagnosis is to rule out other potential causes of the symptoms presented by the patients. When symptoms are attributable to certain other conditions, the diagnosis of CFS/ME is excluded. As a result, there is a prolonged 'elimination' process often including several attempted unsuccessful treatment strategies. This process can often take from 6 to 18 months. Accordingly, it is a serious financial burden to the subject and to the healthcare system and economy.
[0056] Although there is no specific treatment for CFS/ME, it can be appropriately managed once a patient is diagnosed as suffering from CFS. Additionally, there is some evidence to suggest that earlier a management regime is adopted the greater the chance of improvement. A diagnostic/screening test would significantly help in diagnosis/screening of CFS/ME, thereby reducing the patient suffering and healthcare costs associated with waiting for many months before being diagnosed with CFS/ME.
[0057] The present inventors have now identified and characterised miRNAs that are found in different quantities in biological samples obtained for CFS and/or ME subjects when compared with healthy controls. This, of course, means that CFS/ME can be managed in those subjects that have been identified.
[0058] The present inventors have identified and characterised (1) novel miRNAs, (2) miRNAs that are expressed in cerebrospinal fluid, as well as (3) miRNAs that are differentially expressed in subjects having CFS and/or ME as compared with healthy subjects.
[0059] The present inventors believe themselves to be the first to identify miRNAs, particularly circulating or extracellular miRNAs that are differentially expressed in subjects having CFS and/or ME. The inventors have found that these miRNAs, particularly from biofluid such as plasma, (but also from serum, urine, sputum and cerebrospinal fluid), can serve as novel reproducible biological markers for CFS/ME screening, prevalence, diagnosis, monitoring and/or prognosis. However, the present invention is not limited to circulating miRNAs, extracellular miRNA, nor extracellular miRNA found in plasma, serum, urine, sputum and cerebrospinal fluid, nor to the afore-mentioned uses.
[0060] As mentioned, the inventors have also, for the first time, characterised miRNAs that are expressed in cerebrospinal fluid.
[0061] The subject can be any mammal. Mammals include humans, primates, livestock and farm animals (eg. horses, sheep and pigs), companion animals (eg. dogs and cats), and laboratory test animals (eg. rats, mice and rabbits). The subject is preferably human.
[0062] Human subjects having CFS and/or ME can be defined as per the American CDC 1994 case definition [26] and in the following citations [75,76,77,78,79,80,81,82].
[0063] Non-fatigued/healthy 'controls' or 'references'/subjects (not having CFS/ME) preferably have no medical history or symptoms of persistent fatigue or illness. Human subjects also preferably exclude individuals who were smokers, pregnant/breast- feeding or immobile, or had autoimmune, thyroid or cardiac related disorders prior to the onset of CFS/ME.
[0064] The term 'extracellular miRNA' means that the miRNA is found, located or circulates in a biofluid (biological fluid). For clarity, the term 'extracellular miRNA' includes any one or more of miRNA found in exosomes or in other vesicles of cellular origin, miRNA originating from cells or more generally being of cellular origin, or being cellular isolates.
[0065] Biofluid can be, for example, blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid, and can be fresh, frozen or fixed. For clarity, biofluid can comprise cells, cellular isolates, lysed cells or any type of cellular material.
[0066] In some embodiments, the biofluid is plasma or serum. Typically the at least one extracellular miRNA will be relatively stable in plasma.
[0067] Although, there is currently no definitive source identified for extracellular miRNAs - i.e. a definitive source leading to miRNAs locating within biofluids - blood cells in particular reticulocytes, myeloid cells, lymphoid cells, platelets, cells from the liver, lungs and kidneys or lysed cells may release miRNAs into the circulation [31,32,33]. Similarly, miRNAs may be discharged into biofluid/plasma following tissue damage, for example, following acute myocardial infarction [34].
[0068] By 'differentially expressed' and 'alteration in the level of miRNA expression', it is meant that the miRNA biological marker is either up-regulated (having an elevated level of expression) or down-regulated (having a reduced level of expression or no expression) in a subject having CFS and/or ME compared with a healthy subject or reference or control - regardless of the actual molecular regulatory mechanism (eg. transcription or incomplete RNA processing to mature miRNA). Put another way, the terms 'differentially expressed' and
'alteration in the level of miRNA expression' can be understood as meaning 'a differing amount of miRNA'. It also compassed situations where there is no detectable RNA or mature miRNA expression whatsoever. The inventors have found some preferred biological markers for
CFS/ME to be up-regulated.
[0069] Although the different forms (definitions) of the invention in this specification mostly refer to mature microRNA (miRNA), it is to be appreciated that some forms of the invention (definitions) could equally apply to pre-miRNA/precursor/pre-processed miRNA. That is, pre-miRNA/precursor/pre-processed miRNA could be used as a biological marker to identify subjects having, or at risk of developing, CFS and/or ME - both in method and product forms (eg. assays, tools and reagents) of the invention.
[0070] The at least one miRNA can be any suitable differentially expressed miRNA (up- regulated/having an elevated level of expression or down-regulated/having a reduced level of expression or no expression), and will typically be about 18 to 25 nucleotides in length/size. This means that the miRNA will typically be 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides/residues in length/size.
[0071] Single nucleotide polymorphisms (SNPs) in coding, regulatory, intron, promoter, 5'
UTR and 3' UTR may be pre-processed miRNAs, flanking regions or target sites, and have been demonstrated to affect certain physiological processes or be related to diseases. The at least one miRNA can be a SNP, including a SNP in pre-miRNA or miRNA flanks.
[0072] It is to be appreciated that features described for one form of the invention can be features of one or more other forms of the invention. For the sake of succinctness, those features have not been recited after each form of the invention.
[0073] Accordingly, in a first form, the present invention resides in at least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic
Encephalomyelitis (ME).
[0074] Accordingly, in a second form, the present invention resides in the use of at least one miRNA as a biological marker for identifying or diagnosing a subject having, or at risk of developing, CFS or ME.
[0075] In some embodiments 2, 3, 4, 5, 6, 7, 8, 9, 10 or even more different types of miRNAs can be used for identification or diagnosis of CFS and/or ME at the same time or substantially same time.
[0076] In some embodiments, the at least one miRNA biological marker can have increased or decreased expression relative to a reference, control, or normal sample by at least about 0.5 fold, at least about 0.6 fold, at least about 0.7 fold, at least about 0.8 fold, at least about 0.9 fold, at least about 1.0 fold, at least about 1.1 fold, at least about 1.2 fold, at least about 1.3 fold, at least about 1.4 fold, at least about 1.5 fold, at least about 1.6-fold, at least about 1.7-fold, at least about 1.8-fold, at least about 1.9- fold, at least about 2.0-fold, at least about 2.1 -fold, at least about 2.2-fold, at least about 2.3-fold, at least about 2.4-fold, at least about 2.5-fold, at least about 2.6-fold, at least about 2.7-fold, at least about 2.8-fold, at least about 2.9-fold, at least about 3.0-fold, at least about 3.1 -fold, at least about 3.2-fold, at least about 3.3-fold, at least about 3.4- fold, at least about 3.5-fold, at least about 3.6-fold, at least about 3.7-fold, at least about 3.8-fold, at least about 3.9-fold, at least about 4.0-fold, at least about 4.1 -fold, at least about 4.2-fold, at least about 4.3-fold, at least about 4.4- fold, at least about 4.5-fold, at least about 4.6-fold, at least about 4.7-fold, at least about 4.8-fold, at least about 4.9-fold, at least about 5.0-fold, at least about 5.1 -fold, at least about 5.2-fold, at least about 5.3-fold, at least about 5.4- fold, at least about 5.5-fold, at least about 5.6-fold, at least about 5.7-fold, at least about 5.8-fold, at least about 5.9-fold, at least about 6.0-fold, at least about 6.1 -fold, at least about 6.2-fold, at least about 6.3-fold, at least about 6.4- fold, at least about 6.5-fold, at least about 6.6-fold, at least about 6.7-fold, at least about 6.8-fold, at least about 6.9-fold, at least about 7.0-fold, at least about 7.1 -fold, at least about 7.2-fold, at least about 7.3-fold, at least about 7.4- fold, at least about 7.5-fold, at least about 7.6-fold, at least about 7.7-fold, at least about 7.8-fold, at least about 7.9-fold, at least about 8.0-fold, at least about 8.1 -fold, at least about 8.2-fold, at least about 8.3-fold, at least about 8.4- fold, at least about 8.5-fold, at least about 8.6-fold, at least about 8.7-fold, at least about 8.8-fold, at least about 8.9-fold, at least about 9.0-fold, at least about 9.1 -fold, at least about 9.2-fold, at least about 9.3-fold, at least about 9.4- fold, at least about 9.5-fold, at least about 9.6-fold, at least about 9.7-fold, at least about 9.8-fold, at least about 9.9-fold, at least about 10.0-fold, at least about 10.1 fold, at least about 10.2 fold, at least about 10.3 fold, at least about 10.4 fold, at least about 10.5 fold, at least about 10.6-fold, at least about 10.7-fold, at least about 10.8-fold, at least about 10.9- fold, at least about 11.0-fold, at least about 11.1 -fold, at least about 11.2-fold, at least about 11.3-fold, at least about 11.4-fold, at least about 11.5-fold, at least about 11.6-fold, at least about 11.7-fold, at least about 11.8-fold, at least about 11.9-fold, at least about 12.0-fold, at least about 12.1 -fold, at least about 12.2-fold, at least about 12.3-fold, at least about 12.4- fold, at least about 12.5-fold, at least about 12.6-fold, at least about 12.7-fold, at least about 12.8-fold, at least about 12.9-fold, at least about 13.0-fold, at least about 13.1 -fold, at least about 13.2-fold, at least about 13.3-fold, at least about 13.4- fold, at least about 13.5-fold, at least about 13.6-fold, at least about 13.7-fold, at least about 13.8-fold, at least about 13.9-fold, at least about 14.0-fold, at least about 14.1 -fold, at least about 14.2-fold, at least about 14.3-fold, at least about 14.4- fold, at least about 14.5-fold, at least about 14.6-fold, at least about 14.7-fold, at least about 14.8-fold, at least about 14.9-fold, at least about 15.0-fold, at least about 15.1 -fold, at least about 15.2-fold, at least about 15.3-fold, at least about 15.4- fold, at least about 15.5-fold, at least about 15.6-fold, at least about 15.7-fold, at least about 15.8-fold, at least about 15.9-fold, at least about 16.0-fold, at least about 16.1 -fold, at least about 16.2-fold, at least about 16.3-fold, at least about 16.4- fold, at least about 16.5-fold, at least about 16.6-fold, at least about 16.7-fold, at least about 16.8-fold, at least about 16.9-fold, at least about 17.0-fold, at least about 17.1 -fold, at least about 17.2-fold, at least about 17.3-fold, at least about 17.4- fold, at least about 17.5-fold, at least about 17.6-fold, at least about 17.7-fold, at least about 17.8-fold, at least about 17.9-fold, at least about 18.0-fold, at least about 18.1 -fold, at least about 18.2-fold, at least about 18.3-fold, at least about 18.4- fold, at least about 18.5-fold, at least about 18.6-fold, at least about 18.7-fold, at least about 18.8-fold, at least about 18.9-fold, at least about 19.0-fold, at least about 19.1 -fold, at least about 19.2-fold, at least about 19.3-fold, at least about 19.4- fold, at least about 19.5-fold, at least about 19.6-fold, at least about 19.7-fold, at least about 19.8-fold, at least about 19.9-fold, or at least about 20.0-fold. (Of course, these amounts may equally be expressed as percentage increases or decreases.)
[0077] Preferably, the at least one miRNA biological marker has increased or decreased expression relative to a reference, control, or normal sample by about the value listed in Table 5 (column labeled 'Fold Change'). [0078] In some embodiments, the at least one miRNA biological marker is cellular miRNA.
[0079] In some embodiments, the at least one miRNA biological marker is extracellular or circulating miRNA or miRNA found in biofluid.
[0080] In some embodiments, the at least one miRNA biological marker is both extracellular and cellular miRNA.
[0081] In some embodiments, the at least one miRNA biological marker is circulating miRNA.
[0082] "Circulating miRNA" means miRNA that circulates in the bloodstream or other body fluid, such as the lymphatic system. "Circulating miRNA" means miRNA, for example, found in blood, plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid.
[0083] In some embodiments, the at least one miRNA biological marker can be selected from a miRNA listed in any one or more of Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA having a sequence substantially as listed in Table 3, Table 4, Table 5, Table 6 or Table
7.
[0084] The at least one miRNA biological marker can be selected from a miRNA listed in Table 6 (SEQ. ID. NOs.: l-19) or a miRNA having a sequence substantially as listed in Table 6. The at least one miRNA biological marker is preferably a biological marker selected from the group consisting of: hsa-miR127-3p (SEQ. ID. NO.: l); hsa-miR-143-3p (SEQ. ID. NO.:2); and hsa-miR-142-5p (SEQ. ID. NO.:3) or a biological marker having a sequence substantially the same a marker of that group - each of which is up-regulated (increased in expression) in CFS and/or ME.
[0085] In other forms, the invention concerns a method of identifying or diagnosing CFS and/or ME in a subject, a method of identifying a subject at risk of developing CFS and/or ME, and a method of identifying whether a subject having CFS and/or ME is likely to respond to, or is responding to, management of that illness.
[0086] Accordingly, in a third form, the present invention resides in a method of identifying or diagnosing a subject having, or at risk of developing, CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has, or is at risk of developing, CFS and/or ME. [0087] Accordingly, in a fourth form, the present invention resides in a method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression in each said biological sample to a level of expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME.
[0088] The reference can be any suitable control sample known in the art, such as, for example, a sample from a normal, healthy subject. In some embodiments, the reference can be a sample from the same subject prior to demonstration of illness symptoms or prior to
identification with CFS and/or ME.
[0089] In some embodiments, the reference can be a 'standardised' sample, such as a sample comprising material or data from several samples, preferably also from several subjects.
[0090] In some embodiments, a reference, control or normal sample can be, or can be obtained, prepared or derived from, a subject not having CFS/ME, and preferably having no medical history or symptoms of persistent fatigue or illness.
[0091] In some embodiments, a reference, control or normal sample can be, or can be obtained, prepared or derived from, more than one subject not having CFS/ME, and preferably having no medical history or symptoms of persistent fatigue or illness.
[0092] In view of the fact that one or more miRNA biological markers for CFS and/or ME have been discovered and characterised, this enables management of a subject that has been identified as having CFS and/or ME, and identifying whether a subject having CFS and/or ME is likely to respond to, or is responding to, management of that illness.
[0093] Therefore, a further method step for the third and fourth forms of the invention can comprise (c) managing a subject having, or at risk of developing, CFS and/or ME.
[0094] Accordingly, there is provided a method of identifying or diagnosing and managing a subject having, or at risk of developing, CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME;
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has, or is at risk of developing, CFS and/or ME; and (c) managing the subject having, or at risk of developing, CFS and/or ME.
[0095] Accordingly, there is provided a method of screening subjects for a prevalence of CFS and/or ME and treating subjects having CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from each subject that is differentially expressed in CFS and/or ME;
(b) comparing the level of expression in each said biological sample to a level of expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME;
(c) managing the subject having, or at risk of developing, CFS and/or ME.
[0096] Accordingly, in a fifth form, the present invention resides in a method of identifying whether a subject having a CFS and/or ME illness is likely to respond to, or is responding to, management of that illness, said method comprising the steps of:
(a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness;
(b) measuring the level of expression in the biological samples of at least one miRNA
biological marker that is differentially expressed in CFS and/or ME; and
(c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
[0097] The method according to the fifth form can comprise step (a).
[0098] The method according to the fifth form can comprise the step of managing the subject for the illness.
[0099] Accordingly, in a sixth form, the present invention resides in a method of managing a subject with CFS and/or ME, or at risk of developing CFS and/or ME, comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[00100] In some embodiments, the methods of the different forms of the invention can comprise the step of isolating a biological sample from a subject.
[00101] In some embodiments, the methods of the different forms of the invention can comprise processing a biological sample.
[00102] In some embodiments, the methods of the different forms of the invention can comprise the step of extracting RNA from a biological sample. [00103] In some embodiments, the methods of the different forms of the invention can comprise the step of identifying miRNA.
[00104] In some embodiments, the methods of the different forms of the invention can comprise the step of miRNA profiling.
[00105] In some embodiments, the methods of the different forms of the invention can comprise the step of miRNA screening.
[00106] In some embodiments, the methods of the different forms of the invention can comprise the step of miRNA sequencing.
[00107] In some embodiments, the methods of the different forms of the invention can comprise the step of miRNA sequence analyses.
[00108] In some embodiments, the methods of the different forms of the invention can comprise the step of measuring a level of expression of miRNA.
[00109] In some embodiments, the methods of the different forms of the invention can comprise the step of comparing expression levels (differential expression) of a miRNA.
[00110] In some embodiments, the methods of the different forms of the invention can comprise the step of using a reference or control in the form of a reference gene. The reference gene can be any suitable stably expressed gene but is preferably hsa-miR-16-5p or RNU6B.
[00111] The steps/techniques of isolating a biological sample from a subject, processing a biological sample, RNA extraction from a biological sample, miRNA location and identification, miRNA profiling, miRNA screening, miRNA sequencing, miRNA sequence analyses, measuring a level of expression of miRNA in a biological sample, and comparing expression levels
(differential expression) of a miRNA in a biological sample can be carried out in any suitable way. Such steps are described, for example, in the following references, the entire contents of which are incorporated herein:
[00112] RNA extraction techniques: PureLink (Invitrogen), Trizol reagent (Invitrogen), MiRNEasy (Qiagen), mirVana (ambion), mRCURY (Exiqon), Stratagene (total and small RNA), TRI-Reagent (Sigma-Aldrich), Nucleospin (Machery-Nagel) and RNA-Bee (Tel-test). Reference [89].
[00113] The degree to which miRNA expression differs need only be large enough to quantify via standard characterization techniques such as expression arrays, RT-qPCR, northern analysis and RNase protection.
[00114] Blotting and hybridization assays: [103,104].
[00115] Different ways of locating putative miRNAs. Computational prediction Methods: 1. miRdeep [90,91]; 2. miRdeep* [92]; 3. MIReNA [93]; 4. miRanalyzer [94,95]; 5. MIRcheck [96]; 6. MiRalign [97]; 7. ProMir [98]; 8. MatureBayes [99]; 9. MaturePred [100]; 10. MiRmat [101]; and 11. MiRdup [102].
[00116] Microarrays: [105].
[00117] MiRNA cloning assays: [106].
[00118] Next generation assays covering all platforms: [107].
[00119] Different ways of assaying expression: Real time PCR, Affymetrix, Agilent, Illumina, miRNA-Seq and Nanostring.
[00120] Profiling methods: Agilent microarray, exiqon array, exiqon microarray, miRCURY LNA ncode array, LC Sciences array ABI Taqman array, affymetrix , illumine array, SOLiD ligation sequencing, Illumina HiSeq and TaqMan miR assay.
[00121] Tools or reagents for assaying for miRNA differential expression: SYBR green probes and TaqMan probes.
[00122] Radiolabeled splinted ligation detection: [110,111].
[00123] Preferably, for one or more methods of the present invention, the level of miRNA expression or differential expression can be carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed miRNA. A universal primer can be used in combination with the one or more
oligonucleotides/primers that will amplify transcribed miRNA. Preferably, RT-qPCR is used. Preferably, for one or more methods of the present invention, the method/s can comprise the step of statistical analysis so as to identify differential expression.
[00124] Preferably, for one or more methods of the present invention, the method/s can comprise the step of extracting miRNA.
[00125] The biological sample can be any suitable sample derived from the subject - obtained either non-invasively or invasively. It can be cellular- or extracellular-derived, or both. For example: 1. Buccal (mouth) cells - obtained by swishing mouthwash in the mouth or by swabbing or bushing the inside of the cheek with a swab or brush; 2. Blood - obtained by pricking the finger and collecting the drops (dried blood spot) or by venepuncture (whole blood); 3. Skin - obtained by a (punch) biopsy; 4. Organ tissue - obtained by biopsy; 5. Plasma - obtained by blood plasma fractionation; 6. Urine - obtained by urination; 7. Faeces - obtained by stool sample; 8. Cerebrospinal fluid - obtained by spinal tap; and 9. Sputum - obtained by expectoration or nasotracheal suctioning.
[00126] Techniques for biological sample collection are well known to skilled persons.
[00127] As mentioned, in some embodiments, the biological sample can be a biofluid such as plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid, and can be fresh, frozen or fixed. [00128] In some preferred embodiments, for example, biofluid or biological sample comprising plasma or serum can be removed surgically and preferably by extraction, e.g. by hypodermic or other types of needles.
[00129] In some embodiments, plasma harvesting is employed. Plasma harvesting/extraction can be performed in any suitable way, but preferably immediately after peripheral blood collection. Plasma harvesting can involve a centrifugation step so as to separate the plasma from other blood components, and frozen storage of that plasma.
[00130] In some embodiments, RNA can be extracted from plasma using a commercially available kit such as the miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany). The size, quantity and quality of the extracted extracellular RNA can be assessed using a small RNA chip on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).
[00131] MiRNA profiling and sequencing can be carried out in any suitable way. Preferably high throughput sequencing (HTS) is utilised. In some embodiments, CFS/ME patients and non- fatigued controls with the highest abundance of small RNA can be used for HTS. Small RNA libraries can be constructed using the TruSeq Small RNA Sample Preparation kit (Illumina, San Diego, CA). Small RNA samples can be ligated with 5' and 3' adapters, followed by reverse transcription-polymerase chain reaction (RT-PCR) for cDNA library construction and incorporation of index tags. The cDNA library fragments can be separated and size fractioned, and an about 145-160 bp size fraction containing miRNA inserts can be isolated. cDNA library samples can be pooled in equimolar amounts and used for cluster generation and sequence analysis.
[00132] In some embodiments, a genome-wide small RNA screening of CFS/ME subjects and non-fatigued subjects can be carried out to select for candidate miRNAs differentially expressed in CFS/ME (eg. circulating, extracellular and/or cellular miRNAs).
[00133] Sequence data that has been generated can be analysed in any suitable way. In some embodiments, raw FASTQ sequences can be generated and demultiplexed using the Illumina CASAVA vl.8 pipeline. Per base sequence quality (quality score >30) can then be assessed using the FastQC toolkit (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Prior to mapping the read data can be pre-processed using the UEA small RNA Workbench (http://srna- workbench.cmp.uea.ac.uk) [27]. Briefly, the 3' adapter sequences can be trimmed, the read size filtered (16-35nt), unique reads can be counted and low abundance reads (<10 reads) can be discarded. Unique sequence reads can then be aligned to the human genome (hgl8) and miRBase_vl6 using the miRanalyzer web server tool
(http://bioinfo2.ugr.es/miRanalyzer/miRanalyzer.php)
[00134] In some embodiments, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) may be used for expression and comparison. The expression of miRNAs can be validated using PerfeCTa miRNA primers (Quanta Biosciences, Gaithersburg, MD). The choice of a stable reference gene may be important for accurate gene expression analysis by RT-qPCR.
Any suitable reference gene can be used. MiRNAs (miR-10, miR-15b, miR-16 and miR-24), for example, may be suitable as a stable reference gene. Extracted RNA may be reverse transcribed into cDNA using the NCode miRNA First-Strand cDNA Synthesis kit (Life Technologies,
Carlsbad, CA). RT-qPCR can be performed as previously described in [4].
[00135] Statistical analyses of the data can be carried out in any suitable way. In some embodiments, Mann- Whitney rank sum test can be used in analysing differences between the
CFS/ME subjects and non-fatigued controls regarding age and haematological characteristics.
[00136] For RT-qPCR analysis unpaired groups of values can be compared according to the non-parametric Mann- Whitney U test. These data can be analysed using GraphPad Prism 5
(GraphPad Software, San Diego, CA). Differential expression of the miRNA-Seq raw count data can be assessed using the BioC/R package DESeq [29] . Due to the small sample size and the heterogeneity of the CFS/ME phenotype the inventors interpreted significance from the unadjusted P-value, without the Benjamini-Hochberg method for False Discovery (FDR) correction. Statistical significance can be accepted at P<0.05.
[00137] As used herein, the term 'managing' a subject or 'management' is such that at least one symptom of CFS or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated, or improved. Management can include administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect the illness or a symptom of the illness. The term can also refer to providing the subject with a management regime which can comprise, for example, psychological counselling and/or administration of one or more therapeutic compounds by any appropriate route to achieve the desired effect.
[00138] Potential therapeutic compounds include: antidepressants (eg. low-dose tricyclic antidepressants, SSRIs); pain relievers (eg. NSAIDs, COX-2 inhibitors); medications for helping with sleep (eg. tricyclics, melatonin); stimulants (eg. dexamphetamine, adderall,
methylphenidate (Ritalin) and Ritalin-like drugs); herbal and dietary supplements; and, vitamin and mineral supplements.
[00139] Administration can include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial,
intrasynovial, intrasternal, intrathecal, intralesional or intracranial injection), transdermal, topical, buccal, rectal, vaginal, nasal, ophthalmic, via inhalation, and implants.
[00140] The present inventors have also devised a method of identifying or characterising differentially expressed miRNA biological markers for CFS and/or ME. [00141] Accordingly, in a seventh form, the present invention resides in a method of identifying or characterising at least one differentially expressed miRNA biological marker for
CFS and/or ME, said method comprising the steps of:
(a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker; and
(b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised. The method can also comprise the step of producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
[00142] The present invention also resides in a miRNA biological marker for CFS and/or ME identified by the method of the seventh form.
[00143] The screening and expression techniques can comprise a suitable technique or protocol described in this specification or as otherwise known to those of skill in the art.
[00144] The present inventors have also devised reagents, tools, kits and assays for screening, identifying, diagnosing and/or managing subjects with CFS and/or ME and for performing measurement of miRNA biological markers known to be differentially expressed in CFS and/or ME. The miRNA biological markers can be, for example, the miRNAs of any one or more of Tables 1 to 7. The present inventors have also devised other useful types of products based on the miRNA biological markers, particularly those of any one or more of Tables 1-7, and more particularly those miRNA markers listed in Table 6.
[00145] Accordingly, in an eighth form, the present invention resides in an isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS or ME.
[00146] Accordingly, in an ninth form, the present invention resides in a: (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, nucleic acid, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide, oligonucleotide or cDNA that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
[00147] Accordingly, in a tenth form, the present invention resides in a miRNA- based probe, tool or reagent for identifying a subject having, or at risk of developing, CFS and/or ME.
[00148] For the tenth form, the present invention also resides in a miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME. [00149] Accordingly, in an eleventh form, the present invention resides in a kit for identifying a subject having, or at risk of developing, CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
[00150] Accordingly, in a twelfth form, the present invention resides in a kit for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
[00151] Accordingly, in a thirteenth form, the present invention resides in an assay for measuring expression of a miRNA biological marker differentially expressed in CFS and/or ME.
[00152] Accordingly, in a fourteenth form, the present invention resides in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS or ME.
[00153] Preferably, the present invention resides in a biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
[00154] Accordingly, in a fifteenth form, the present invention resides in an array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME. In some embodiments, the probes can bind to the same type of miRNA (ie. miRNAs having the same sequence). In other embodiments, the probes can selectively bind to different types of miRNAs (ie. miRNAs having different sequences).
[00155] Accordingly, in a sixteenth form, the present invention resides in a biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME. In some embodiments, the probes can bind to the same type of miRNA (ie. miRNAs having the same sequence). In other embodiments, the probes can selectively bind to different types of miRNAs (ie. miRNAs having different sequences).
[00156] The one or more tools or reagents can comprise one or more tools or reagents for: processing a biological sample; RNA extraction from a biological sample; miRNA identification, miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses;
measuring miRNA expression; and comparing miRNA expression levels (differential
expression). The one or more tools or reagents may be suitable for use in one or more of the techniques/references/methods cited herein.
[00157] The one or more tools or reagents can comprise oligonucleotides (primers or probes) or other types of polynucleotides or nucleic acids that hybridise to miRNA biological markers for miRNA detection, characterisation, quantification and/or expression etc. Preferably the one or more tools or reagents comprise oligonucleotides or probes that hybridise to any of the miRNA sequences preferably as listed in Table 6.
[00158] The assay can comprise any technique for measuring expression of a miRNA biological marker as described herein.
[00159] The kit or assay can comprise a package insert containing written instructions for performing screening, detection and/or measurement etc of the miRNA biological marker and/or for determining expression of the miRNA biological marker etc.
[00160] As already mentioned, the present inventors have discovered and characterised tentatively novel miRNAs that are listed in Table 4 (SEQ. ID. Nos.:20-32).
[00161] As already mentioned, the present inventors have characterised miRNAs that are found in cerebrospinal fluid, as listed in in Table 7.
[00162] Accordingly, in a seventeenth form, the present invention resides in an isolated, purified or recombinant form of a miRNA having a sequence, preferably as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50).
[00163] Accordingly, in an eighteenth form, the present invention resides in a: (1) non- naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50); or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA of (1); or (3) an expression vector, recombinant cell, biological sample, tool, reagent, kit or assay comprising (1) or (2).
[00164] Accordingly, in a nineteenth form, the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 4 (SEQ. ID.
Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50).
[00165] Preferably, the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), or a miRNA having a sequence substantially as found in Table 4 (SEQ. ID.
Nos.:20-32) or Table 7 (SEQ. ID. Nos. 46-50), when isolated for the purpose for testing the biological sample.
[00166] In a twentieth form, the present invention resides in an isolated, purified, synthetic or recombinant form of at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID.
Nos. 46-50) or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID.
Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos.
46-50).
[00167] In a twenty-first form, the present invention resides in a (1) non-naturally occurring or synthetic polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50) or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50); or (2) a polynucleotide, oligonucleotide or cDNA that is complementary to the miRNA of (1); or (3) an expression vector, recombinant cell, biological sample, tool, reagent, kit or assay comprising (1) or (2).
[00168] In a twenty-second form, the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50) or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50).
[00169] In a twenty-third form, the present invention resides in a biological sample comprising at least one miRNA having a sequence as found in Table 3, Table 4 (SEQ. ID.
Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50) or a miRNA having a sequence substantially as found in Table 3, Table 4 (SEQ. ID. Nos.:20-32 and Nos. 33-45), Table 5, Table 6 (SEQ. ID. Nos. 1-19) or Table 7 (SEQ. ID. Nos. 46-50), when isolated for the purpose for testing the biological sample.
[00170] In a twenty-fourth form, the invention resides in a reagent, tool, kit or assay based on the twentieth to twenty-third forms of the invention, said reagent, tool, kit or assay being as described above for other forms of the invention.
[00171] In a twenty-fifth form, the invention resides in measuring expression of at least one miRNA as described in Table 3, Table 4, Table 5, Table 6 or Table 7, or a miRNA substantially as described in Table 3, Table 4, Table 5, Table 6 or Table 7.
[00172] One of more aspects or steps of each form of the present invention, including each use or method of the present invention, can be carried out in vitro. For example, the lst-Sth 10th and 15th- 19th forms of the invention (or steps thereof) can be partially or completely carried out in vitro. [00173] The term Oligonucleotide' refers to a single- stranded sequence of ribonucleotide or deoxyribonucleotide bases, known analogues of natural nucleotides, or mixtures thereof. An oligonucleotide comprises a nucleic-acid based molecule including DNA, cDNA, RNA, PNA,
LNA, UNA or any combination thereof. Oligonucleotides are typically less than about 50 nucleotides in length and may be prepared by direct chemical synthesis or cloning and restriction of appropriate sequences.
[00174] The term 'polynucleotide' refers to a single- or double- stranded polymer of deoxyribonucleotide, ribonucleotide bases or known analogues of natural nucleotides, or mixtures thereof. A polynucleotide comprises a nucleic-acid based molecule including DNA, cDNA, RNA, PNA, LNA, UNA or any combination thereof. The term includes reference to the specified sequence as well as to the sequence complimentary thereto, unless otherwise indicated. The term 'polynucleotide' includes chemically modified variants, as realised by those skilled in the art.
[00175] The term 'complementary' refers to the ability of two single-stranded nucleotide sequences to base pair, typically according to the Watson-Crick base pairing rules. For two nucleotide molecules to be complementary they need not display 100% complementarity across the base pairing regions, but rather there must be sufficient complementarity to enable base pairing to occur. Thus a degree of mismatching between the sequences may be tolerated and the sequences may still be complementary.
[00176] 'Nucleic acid' as used herein includes 'polynucleotide', 'oligonucleotide', and 'nucleic acid molecule', and generally means a polymer of DNA or RNA, which can be single- stranded or double- stranded, synthesized or obtained (e.g., isolated and/or purified) from natural sources, which can contain natural, non-natural or altered nucleotides, and which can contain a natural, non-natural or altered internucleotide linkage, such as a phosphoroamidate linkage or a phosphorothioate linkage, instead of the phosphodiester found between the nucleotides of an unmodified oligonucleotide. This can include cDNA.
[00177] As used herein, the term 'recombinant' refers to (i) molecules that are constructed outside living cells by joining natural or synthetic nucleic acid segments to nucleic acid molecules that can replicate in a living cell, or (ii) molecules that result from the replication of those described in (i) above. For purposes herein, the replication can be in vitro replication or in vivo replication.
[00178] The terms 'isolated', 'purified' and 'substantially purified' as used herein mean essentially free of association with other biological components/contaminants, e.g., as a naturally occurring protein that has been separated from cellular and other contaminants by the use of antibodies or other methods or as a purification product of a recombinant host cell culture.
[00179] 'Probe' as used herein may mean an oligonucleotide (or cDNA) capable of binding to a target nucleic acid/miRNA of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, usually through hydrogen bond formation. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. There may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids described herein. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of
hybridization conditions, the sequence is not a complementary target sequence. A probe may be single stranded or partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. Probes may be directly labeled or indirectly labeled such as with biotin to which a streptavidin complex may later bind.
[00180] The term 'miRNA...having a sequence substantially the same as... ' (as well as similar terms used herein), is meant to encompass sequence variants such as natural
polymorphisms of those miRNAs. It is possible that the sequence of any given miRNA may differ between subjects and the present invention encompasses those sequence variants.
[00181] 'Target' as used herein can mean an oligonucleotide or portions or fragments thereof, which may be bound by one or more probes under stringent hybridization conditions. 'Target' as used herein may also mean a specific miRNA or portions or fragments thereof, which may be bound by one or more probes under stringent hybridization conditions.
[00182] Probes may be used for screening and diagnostic methods, as described herein. The probes may be attached or immobilized to a solid substrate or apparatus, such as a biochip.
[00183] A biochip is also provided. The biochip is an apparatus which, in certain
embodiments, comprises a solid substrate comprising an attached probe or plurality of probes/oligonucleotides. The probes may be capable of hybridizing to a target sequence under stringent hybridization conditions. The probes may be attached at spatially defined address on the substrate. More than one probe per target sequence may be used, with either overlapping probes or probes to different sections of a particular target sequence. In an embodiment, two or more probes per target sequence are used. The probes may be capable of hybridizing to different target sequences (miRNAs) associated with CFS/ME.
[00184] The probes may be attached to the biochip in a wide variety of ways, as will be appreciated by those of skill in the art. The probes may either be synthesized first, with subsequent attachment to the biochip, or may be directly synthesized on the biochip.
[00185] The solid substrate may be a material that may be modified to contain discrete individual sites appropriate for the attachment or association of the probes and is amenable to at least one detection method. Representative examples of substrates include glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses and plastics. The substrates may allow optical detection without appreciably fluorescing.
[00186] The substrate may be planar, although other configurations of substrates may be used as well. For example, probes may be placed on the inside surface of a tube, for flow-through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.
[00187] The biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. For example, the biochip may be derivatized with a chemical functional group including, but not limited to, amino groups, carboxyl groups, oxo groups or thiol groups. Using these functional groups, the probes may be attached using functional groups on the probes either directly or indirectly using linkers. The probes may be attached to the solid support by either the 5' terminus, 3' terminus, or via an internal nucleotide.
[00188] The probe may also be attached to the solid support non-covalently. For example, biotinylated oligonucleotides can be made, which may bind to surfaces covalently coated with streptavidin, resulting in attachment. Alternatively, probes may be synthesized on the surface using techniques such as photopolymerization and photolithography.
[00189] A variety of hybridization conditions may be used, including high, moderate and low stringency conditions as outlined above. The assays may be performed under stringency conditions which allow hybridization of the probe only to the target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration H, or organic solvent concentration.
[00190] Hybridization reactions may be accomplished in a variety of ways. Components of the reaction may be added simultaneously, or sequentially, in different orders. In addition, the reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g., albumin, detergents, etc. which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors and antimicrobial agents may also be used as appropriate, depending on the sample preparation methods and purity of the target.
[00191] Exemplary biochips of the present invention include an organized assortment of oligonucleotide probes described above immobilized onto an appropriate platform. Each probe selectively binds a miRNA in a sample. In certain embodiments, each probe of the biochip selectively binds a biologically active mature miRNA in a sample.
[00192] In accordance with another embodiment, the biochip of the present invention can also include one or more positive or negative controls. For example, oligonucleotides with randomized sequences can be used as positive controls, indicating orientation of the biochip based on where they are placed on the biochip, and providing controls for the detection time of the biochip when it is used for detecting miRNAs in a sample.
[00193] Embodiments of the biochip can be made in the following manner. The
oligonucleotide probes to be included in the biochip are selected and obtained. The probes can be selected, for example, based on a particular subset of miRNAs of interest. The probes can be synthesized using methods and materials known to those skilled in the art, or they can be synthesized by and obtained from a commercial source, such as GeneScript USA (Piscataway, N.J.).
[00194] Each discrete probe is then attached to an appropriate platform in a discrete location, to provide an organized array of probes. Appropriate platforms include membranes and glass slides. Appropriate membranes include, for example, nylon membranes and nitrocellulose membranes. The probes are attached to the platform using methods and materials known to those skilled in the art. Briefly, the probes can be attached to the platform by synthesizing the probes directly on the platform, or probe- spotting using a contact or non-contact printing system. Probe- spotting can be accomplished using any of several commercially available systems, such as the GeneMachines(TM) OmniGrid (San Carlos, Calif.). [00195] The miRNA sample can be amplified and labeled as is appropriate or desired. If amplification is desired, methods known to those skilled in the art can be applied. The miRNA samples can be labeled using various methods known to those skilled in the art. In accordance with an embodiment, the miRNA samples are labeled with digoxigenin using a Digoxigenin
(DIG) Nucleotide Tailing Kit (Roche Diagnostics Corporation, Indianapolis, Ind.) in a
GeneAmp(R) PCR System 9700 (Applied Biosystems, Foster City, Calif.).
[00196] The labeled miRNA sample is incubated with the biochip, allowing the miRNAs in the sample to hybridize with a probe specific for the miRNAs in the sample. In certain embodiments, the labeled miRNA sample is added to a DIG Easy Hyb Solution or Hybrid Easy Buffer (Roche Diagnostics Corporation, Indianapolis, Ind.) that has been preheated to hybridization temperature. The miRNA sample is the incubated with the biochip in the solution, for example, for about 4 hours to about 24 hours.
[00197] The miRNAs in the sample can be detected, identified, and quantified in the following manner. After the miRNA sample has been incubated with the biochip for an appropriate time period, the biochip is washed with a series of washing buffers, and then incubated with a blocking buffer. When Digoxigenin (DIG) labeling of the miRNA samples has been used, the biochip is then incubated with an Anti-DIG-AP antibody (Roche Diagnostics Corporation, Indianapolis, Ind.). The biochip is them washed with washing buffer and incubated with detection buffer, for example, for about 5 minutes. NBT/BCIP dye (5-Bromo-4-Chloro-3'- Indolyphosphate p-Toluidine Salt and NBT Nitro-Blue Tetrazolium Chloride) diluted with detection buffer is added to the biochip, which is allowed to develop in the dark, for example, for about 1 hour to about 2 days under humid conditions.
[00198] The biochips are scanned, for example, using an Epson Expression 1680 Scanner (Seiko Epson Corporation, Long Beach, Calif.) at a resolution of about 1500 dpi and 16-bit grayscale. The biochip images are analyzed using Array-Pro Analyzer (Media Cybernetics, Inc., Silver Spring, Md.) software. Because the identity of the miRNA probes on the biochip are known, the sample can be identified as including particular miRNAs when spots of hybridized miRNAs-and-probes are visualized. Additionally, the density of the spots can be obtained and used to quantitate the identified miRNAs in the sample.
[00199] The identity and relative quantity of miRNAs in a sample can be used to provide a miRNA profiles for a particular sample. A miRNA profile for a sample includes information about the identities of miRNAs contained in the sample, quantitative levels of miRNAs contained in the sample, and/or changes in quantitative levels of miRNAs relative to another sample. For example, a miRNA profile for a sample includes information about the identities, quantitative levels, and/or changes in quantitative levels of miRNAs associated a particular cellular type, process, condition of interest, illness, or other cellular state. Such information can be used, for diagnostic purposes, illness management, drug development, drug screening and/or drug efficacy testing.
[00200] Some embodiments of the invention are defined below.
[00201] 1. A miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME), or a miRNA biological marker for use in identifying or diagnosing a subject having CFS and/or ME, or a miRNA biological marker for use in identifying or diagnosing a subject at risk of developing CFS and/or ME
[00202] 2. A miRNA when used as a biological marker for CFS and/or ME, or a miRNA biological marker when used in identifying or diagnosing a subject having CFS and/or ME.
[00203] 3. Use of at least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME.
[00204] 4. Use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME.
[00205] 5. A method of identifying or diagnosing a subject having CFS and/or ME, said method comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
[00206] 6. A method of identifying or diagnosing a subject at risk of developing CFS and/or ME, said method comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject is at risk of developing CFS and/or ME. [00207] 7. A method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of: (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and (b) comparing the level of expression in each said biological sample to a level of expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME.
[00208] 8. A method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of: (a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness; (b) measuring the level of expression in the biological samples of at least one miRNA biological marker that is differentially expressed in CFS and/or ME; and (c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
[00209] 9. A method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[00210] 10. A method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME, said method comprising the steps of: (a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker; and (b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised.
[00211] 11. An isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS and/or ME.
[00212] 12. An article of manufacture comprising: (1) non-naturally occurring
polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (l) or (2).
[00213] 13. A miRNA-based probe, tool or reagent for identifying a subject having CFS and/or ME, or a miRNA-based probe, tool or reagent for use in identifying a subject having CFS and/or ME.
[00214] 14. A miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME, or a miRNA-based probe, tool or reagent for use in identifying a subject at risk of developing CFS and/or ME.
[00215] 15. A miRNA-based probe, tool or reagent when used for identifying a subject having, or at risk of developing, CFS and/or ME.
[00216] 16. A kit for identifying a subject having CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
[00217] 17. A kit for identifying a subject at risk of developing CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
[00218] 18. A kit for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
[00219] 19. An assay for measuring expression of a miRNA biological marker differentially expressed in CFS and/or ME.
[00220] 20. A biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[00221] 21. A biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME, when isolated for the purpose for testing the biological sample for CFS and/or ME.
[00222] 22. An array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
[00223] 23. A biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
[00224] 24. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraph 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is circulating miRNA, extracellular miRNA, cellular miRNA, or both extracellular and cellular miRNA.
[00225] 25. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is circulating miRNA or extracellular miRNA.
[00226] 26. The miRNA of paragraph 1 paragraph claim 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraph 16 to 18, the assay of claim 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is found in a biofluid (biological fluid).
[00227] 27. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is found in plasma, serum, urine, sputum or cerebrospinal fluid, milk or ductal fluid.
[00228] 28. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraph 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is found in plasma or serum.
[00229] 29. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA has an elevated level of expression in CFS and/or ME.
[00230] 30. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA has a reduced level of expression or no expression in CFS and/or ME.
[00231] 31. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA has increased or decreased expression by at least about 0.5 fold to at least about 20.0-fold.
[00232] 32. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA has increased expression by about a value listed in Table 5.
[00233] 33. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is selected from a miRNA listed in Table 6 (SEQ. ID. NOs.: l-19) or has a sequence substantially the same as a miRNA listed in Table 6 (SEQ. ID. N0s.: l-19).
[00234] 34. The miRNA of paragraph 1 or paragraph 2, the use of paragraph 3 or paragraph 4, the method of any one of paragraphs 5 to 10, the miRNA biological marker of paragraph 11, the article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, the kit of any one of paragraphs 16 to 18, the assay of paragraph 19, the biological sample of paragraph 20 or paragraph 21, the array of paragraph 22, or the biochip of paragraph 23, wherein the miRNA is selected from the group consisting of: hsa-miR127-3p (SEQ. ID. NO.: l); hsa-miR-143-3p (SEQ. ID. NO.:2); and hsa-miR-142-5p (SEQ. ID. NO.:3), or has a sequence substantially the same as a miRNA of that group.
[00235] 35. The method of any one of paragraphs 5 to 8 and 10, wherein the method further comprises a step of obtaining the biological sample.
[00236] 36. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample is obtained from the subject non-invasively.
[00237] 37. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample is obtained from the subject invasively.
[00238] 38. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample is obtained from a cellular source.
[00239] 39. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample is obtained from an extracellular source.
[00240] 40. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample is obtained from both a cellular and extra-cellular source.
[00241] 41. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample comprises buccal cells, blood, skin, organ tissue, plasma, urine, faeces, cerebrospinal fluid and/or sputum.
[00242] 42. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample comprises a biofluid.
[00243] 43. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample comprises plasma, serum, urine, sputum, cerebrospinal fluid, milk, or ductal fluid.
[00244] 44. The method of any one of paragraphs 5 to 8 and 10, wherein the biological sample comprises plasma or serum.
[00245] 45. The method of paragraph 8 or paragraph 9, wherein managing or management is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
[00246] 46. The method of paragraph 8 or paragraph 9, wherein managing or management comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
[00247] 47. The kit of any one of paragraphs 16 to 18, wherein the tool or reagent is for: processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses;
measuring miRNA expression; or comparing miRNA expression levels (differential expression).
[00248] 48. The article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, or the kit of any one of paragraphs 16 to 18, wherein the tool or reagent comprises an oligonucleotide that hybridises to miRNA for miRNA detection, characterisation, quantification and/or expression.
[00249] 49. The article of manufacture of paragraph 12, the probe, tool or reagent of any one of paragraphs 13 to 15, or the kit of any one of paragraphs 16 to 18, wherein the tool or reagent comprises an oligonucleotide that hybridises to any one of the miRNA sequences listed in Table 6 or to a miRNA having a sequence substantially as listed in Table 6.
[00250] 50. An isolated, purified or recombinant form of a miRNA having a sequence as found in Table 4 (SEQ. ID. Nos.:20-32) or substantially as found in Table 4 (SEQ. ID. Nos.:20- 32).
[00251 ] 51. A ( 1 ) non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA having a sequence as found in, or substantially as found in, Table 4 (SEQ. ID. Nos.:20-32); or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA of (1); or (3) an expression vector, recombinant cell, biological sample, tool, reagent, kit or assay comprising (1) or (2).
[00252] 52. A biological sample comprising at least one miRNA having a sequence as found in, or substantially as found in, Table 4 (SEQ. ID. Nos.:20-32). [00253] 53. A biological sample comprising at least one miRNA having a sequence as found in, or substantially as found in, Table 4 (SEQ. ID. Nos.:20-32), when isolated for the purpose for testing the biological sample.
[00254] 54. The method of any one of paragraphs 5, 6, 7, 8, 9 and 10, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
[00255] 55. The method of any one of paragraphs 5, 6, 7, 8 and 10, wherein the method comprises the step of extracting miRNA.
[00256] 56. The method of any one of paragraphs 5, 6, 7, 8 and 10, wherein the method comprises the step of statistical analysis.
[00257] Further, particularly preferred, embodiments of the invention are defined below.
[00258] 1. At least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME), or at least one miRNA biological marker for use in identifying or diagnosing a subject having CFS and/or ME, or at least one miRNA biological marker for use in identifying or diagnosing a subject at risk of developing CFS and/or ME, or at least one miRNA biological marker for use in managing a subject having or at risk of developing CFS and/or ME, or at least one miRNA when used as a biological marker for CFS and/or ME, or at least one miRNA biological marker when used in identifying, diagnosing and/or managing a subject having or at risk of developing CFS and/or ME.
[00259] 2. The at least one miRNA of paragraph 1, wherein said at least one miRNA is a circulating miRNA.
[00260] 3. The at least one miRNA of paragraph 1 or 2, wherein said at least one miRNA is found in a biofluid.
[00261] 4. The at least one miRNA of paragraph 3, wherein said biofluid is plasma or serum.
[00262] 5. The at least one miRNA of any one of paragraphs 1 to 4, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00263] 6. The at least one miRNA of any one of paragraphs 1 to 5, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of
Table 6.
[00264] 7. The at least one miRNA of any one of paragraphs 1 to 6, wherein said miRNA is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00265] 8. The at least one miRNA of any one of paragraphs 1 to 7, wherein said use involves the use of more than one said at least one miRNA.
[00266] 9. Use of at least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME, or use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME, or use of at least one miRNA as a biological marker for managing a subject having or at risk of developing CFS and/or ME.
[00267] 10. The use of paragraph 9, wherein said at least one miRNA is a circulating miRNA.
[00268] 1 l.The use of paragraph 9 or paragraph 9 or 10, wherein said at least one miRNA is found in a biofluid.
[00269] 12. The use of paragraph 11, wherein said biofluid is plasma or serum.
[00270] 13. The use of any one of paragraphs 9 to 12, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00271] 14. The use of any one of paragraphs 9 to 13, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00272] 15. The use of any one of paragraphs 6 to 14, wherein said miRNA is hsa-miR127- 3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00273] 16. The use of any one of paragraphs 6 to 15, wherein said use involves the use of more than one said at least one miRNA.
[00274] 17. A method of identifying or diagnosing a subject having CFS and/or ME, or at risk of developing CFS and/or ME, said method comprising the steps of:
[00275] (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and [00276] (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
[00277] 18. The method of paragraph 17, wherein said at least one miRNA is a circulating miRNA.
[00278] 19. The method of paragraph 17 or paragraph 18, wherein said biological sample is a biofluid.
[00279] 20.The method of paragraph 19, wherein said biofluid is plasma or serum.
[00280] 21. The method of any one of paragraphs 17 to 20, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00281] 22. The method of any one of paragraphs 17 to 21, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00282] 23. The method of any one of paragraphs 17 to 22, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00283] 24. The method of any one of paragraphs 17 to 23, wherein said method involves the use of more than one said at least one miRNA.
[00284] 25. The method of any one of paragraphs 17 to 24, wherein said method comprises the step of managing the subject for CFS and/or ME.
[00285] 26. The method of paragraph 25, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
[00286] 27. The method of paragraph 25 or paragraph 26, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
[00287] 28. The method of any one of paragraphs 17 to 27, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
[00288] 29. A method of identifying or diagnosing and managing a subject having, or at risk of developing, CFS and/or ME, said method comprising the steps of:
[00289] (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from the subject that is differentially expressed in CFS and/or ME;
[00290] (b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has, or is at risk of developing, CFS and/or ME; and
[00291] (c) managing the subject having, or at risk of developing, CFS and/or ME.
[00292] 30. The method of paragraph 29, wherein said at least one miRNA is a circulating miRNA.
[00293] 31. The method of paragraph 29 or 30, wherein said biological sample is a biofluid.
[00294] 32. The method of paragraph 31, wherein said biofluid is plasma or serum.
[00295] 33. The method of any one of paragraphs 29 to 32, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00296] 34. The method of any one of paragraphs 29 to 33, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00297] 35. The method of any one of paragraphs 29 to 34, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00298] 36. The method of any one of paragraphs 29 to 35, wherein said method involves the use of more than one said at least one miRNA.
[00299] 37. The method of any one of paragraphs 29 to 36, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
[00300] 38. The method of any one of paragraphs 29 to 37, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
[00301] 39. The method of any one of paragraphs 29 to 38, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
[00302] 40. A method of screening subjects for a prevalence of CFS and/or ME, said method comprising the steps of:
[00303] (a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and
[00304] (b) comparing the level of expression in each said biological sample to a level of expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME.
[00305] 41. The method of paragraph 40, wherein said at least one miRNA is a circulating miRNA.
[00306] 42. The method of paragraph 40 or paragraph 41, wherein said biological sample is a biofluid.
[00307] 43. The method of paragraph 42, wherein said biofluid is plasma or serum.
[00308] 44. The method of any one of paragraphs 40 to 43, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00309] 45. The method of any one of paragraphs 40 to 44, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00310] 46. The method of any one of paragraphs 40 to 45, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00311] 47. The method of any one of paragraphs 40 to 46, wherein said method involves the use of more than one said at least one miRNA. [00312] 48. The method of any one of paragraphs 40 to 47, wherein said method comprises the step of managing the subject having CFS and/or ME.
[00313] 49. The method of any one of paragraphs 40 to 48, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
[00314] 50. A method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
[00315] (a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness;
[00316] (b) measuring the level of expression in the biological samples of at least one miRNA biological marker that is differentially expressed in CFS and/or ME; and
[00317] (c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
[00318] 51. The method of paragraph 50, wherein said at least one miRNA is a circulating miRNA.
[00319] 52. The method of paragraph 50 or paragraph 51, wherein said biological sample is a biofluid.
[00320] 53. The method of paragraph 52, wherein said biofluid is plasma or serum.
[00321] 54. The method of any one of paragraphs 50 to 53, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00322] 55. The method of any one of paragraphs 50 to 54, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00323] 56. The method of any one of paragraphs 50 to 55, wherein said miRNA
miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p. [00324] 57. The method of any one of paragraphs 50 to 56, wherein said method involves the use of more than one said at least one miRNA.
[00325] 58. The method of any one of paragraphs 50 to 57, wherein said method comprises isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness.
[00326] 59. The method of any one of paragraphs 50 to 58, wherein said method comprises the step of managing the subject if still having the illness.
[00327] 60. The method of paragraph 59, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
[00328] 61. The method of paragraph 59 or paragraph 60, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
[00329] 62. The method of any one of paragraphs 50 to 61, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
[00330] 63. A method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[00331] 64. The method of paragraph 63, wherein said at least one miRNA is a circulating miRNA.
[00332] 65. The method of paragraph 63 or paragraph 64, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00333] 66. The method of any one of paragraphs 63 to 65, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00334] 67. The method of any one of paragraphs 63 to 66, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00335] 68. The method of any one of paragraphs 63 to 67, wherein said method involves the use of more than one said at least one miRNA.
[00336] 69. The method of any one of paragraphs 63 to 68, wherein said method comprises isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness.
[00337] 70. The method of paragraph 69, wherein said biological sample is a biofluid.
[00338] 71. The method of paragraph 70, wherein said biofluid is plasma or serum.
[00339] 72. The method of any one of paragraphs 63 to 71, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
[00340] 73. The method of any one of paragraphs 63 to 72, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
[00341] 74. A method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME, said method comprising the steps of:
[00342] (a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker;
[00343] (b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised; and
[00344] (c) optionally, producing a nucleic acid or polynucleotide based on the miRNA biological marker of step b).
[00345] 75. The method of paragraph 74, wherein said at least one miRNA is a circulating miRNA. [00346] 76. The method of paragraph 75, wherein said biological sample is a biofluid.
[00347] 77. The method of paragraph 76, wherein said biofluid is plasma or serum.
[00348] 78. The method of any one of paragraphs 74 to 77, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
[00349] 79. The method of any one of paragraphs 74 to 78, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00350] 80. The method of any one of paragraphs 74 to 79, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00351] 81. The method of any one of paragraphs 74 to 80, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotide s/primers that will amplify transcribed said miRNA.
[00352] 82. An isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS and/or ME.
[00353] 83. The biological marker of paragraph 82, being a circulating miRNA.
[00354] 84. The biological marker of paragraph 82 or paragraph 83, being a miRNA shown in Table 5 or Table 6.
[00355] 85. The biological marker of any one of paragraphs 82 to 84, having a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00356] 86. The biological marker of any one of paragraphs 82 to 85, being hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00357] 87. An article of manufacture comprising: (1) non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
[00358] 88. The article of manufacture of paragraph 87, wherein said miRNA biological marker is a circulating miRNA.
[00359] 89. The article of manufacture of paragraph 87 or paragraph 88, wherein said miRNA biological marker is as shown in Table 5 or Table 6.
[00360] 90. The article of manufacture of any one of paragraphs 87 to 89, wherein said miRNA biological marker has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00361] 91. The article of manufacture of any one of paragraphs 87 to 90, wherein said miRNA biological marker is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00362] 92. The article of manufacture of any one of paragraphs 87 to 91, wherein the tool or reagent comprises an oligonucleotide that hybridises to the miRNA for miRNA detection, characterisation, quantification and/or expression.
[00363] 93. The article of manufacture of any one of paragraphs 87 to 92, wherein the tool or reagent comprises an oligonucleotide that hybridises to any one of the miRNA sequences listed in Table 6 or to a miRNA having a sequence substantially as listed in Table 6.
[00364] 94. A miRNA-based probe, tool or reagent for identifying a subject having CFS and/or ME, or a miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME, or a miRNA-based probe, tool or reagent for use in managing a subject having or at risk of developing CFS and/or ME, or a miRNA-based probe, tool or reagent when used in identifying, diagnosing and/or managing a subject having or at risk of developing CFS and/or ME.
[00365] 95. The miRNA-based probe, tool or reagent of paragraph 94, wherein said miRNA- based probe, tool or reagent is based on a circulating miRNA.
[00366] 96. The miRNA-based probe, tool or reagent of paragraph 94 or paragraph 95, wherein said miRNA-based probe, tool or reagent is based on a miRNA shown in Table 5 or Table 6.
[00367] 97. The miRNA-based probe, tool or reagent of any one of paragraphs 94 to 96, wherein said miRNA-based probe, tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00368] 98. The miRNA-based probe, tool or reagent of any one of paragraphs 94 to 97, wherein said miRNA-based probe, tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00369] 99. A kit for identifying a subject having, at risk of developing, and/or managing CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
[00370] 100. The kit of paragraph 99, wherein said tool or reagent is based on a circulating miRNA.
[00371] 101. The kit of paragraph 99 or paragraph 100, wherein said tool or reagent is based on a miRNA shown in Table 5 or Table 6.
[00372] 102. The kit of any one of paragraphs 99 to 101, wherein said tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00373] 103. The kit of any one of paragraphs 99 to 102, wherein said tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00374] 104. The kit of any one of paragraphs 99 to 103, wherein said kit comprises a plurality of tools or reagents based on miRNAs shown in Table 5 or Table 6.
[00375] 105. The kit of paragraph 104, wherein said tools or reagents comprise two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
[00376] 106. The kit of any one of paragraphs 99 to 105, wherein the tool or reagent is for: processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses; measuring miRNA expression; or comparing miRNA expression levels (differential expression).
[00377] 107. A kit or assay for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
[00378] 108. The kit or assay of paragraph 107, wherein said tool or reagent is based on a circulating miRNA.
[00379] 109. The kit or assay of paragraph 107 or 108, wherein said tool or reagent is based on a miRNA shown in Table 5 or Table 6.
[00380] 110. The kit or assay of any one of paragraphs 107 to 109, wherein said tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00381] 111. The kit or assay of any one of paragraphs 107 to 110, wherein said tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00382] 112. The kit or assay of any one of paragraphs 107 to 111, wherein said kit comprises a plurality of tools or reagents based on miRNAs shown in Table 5 or Table 6.
[00383] 113. The kit or assay of paragraph 112, wherein said tools or reagents comprise two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
[00384] 114. The kit of any one of paragraphs 107 to 113, wherein the tool or reagent is for: processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses; measuring miRNA expression; or comparing miRNA expression levels (differential expression).
[00385] 115. A biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
[00386] 116. The biological sample of paragraph 115, wherein said at least one miRNA biological marker is a circulating miRNA.
[00387] 117. The biological sample of paragraph 115 or paragraph 116, wherein said at least one miRNA biological marker is a miRNA shown in Table 5 or Table 6.
[00388] 118. The biological sample of any one of paragraphs 115 to 117 wherein said at least one miRNA biological marker has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00389] 119. The biological sample of any one of paragraphs 115 to 118, wherein said at least one miRNA biological marker is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00390] 120. The biological sample of any one of paragraphs 115 to 119, wherein said at least one miRNA biological marker comprises two or more miRNAs shown in Table 5 or Table 6. [00391] 121. The biological sample of any one of paragraphs 115 to 119, wherein said at least one miRNA biological marker comprises one or more of hsa-miR127-3p, hsa-miR-142-
5p and hsa-miR-143-3p.
[00392] 122. The biological sample of any one of paragraphs 115 to 121, wherein isolated for the purpose for testing the biological sample for CFS and/or ME.
[00393] 123. An array of oligonucleotide probes for identifying miRNAs in a biological sample, comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
[00394] 124. The array of paragraph 123, wherein said miRNA is a circulating miRNA.
[00395] 125. The array of paragraph 123 or paragraph 124, wherein said miRNA is a miRNA shown in Table 5 or Table 6.
[00396] 126. The array of any one of paragraphs 123 to 125 wherein said miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
[00397] 127. The array of any one of paragraphs 123 to 126, wherein said miRNA is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00398] 128. The array of any one of paragraphs 123 to 127, wherein said miRNA comprises two or more miRNAs shown in Table 5 or Table 6.
[00399] 129. The array of any one of paragraphs 123 to 128, wherein said miRNA comprises two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
[00400] 130. A biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
[00401] 131. The biochip of paragraph 130, wherein said miRNA is a circulating miRNA.
[00402] 132. The biochip of paragraph 130 or paragraph 131, wherein said miRNA is a miRNA shown in Table 5 or Table 6.
[00403] 133. The biochip of any one of paragraphs 130 to 132, wherein said miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6. [00404] 134. The biochip of any one of paragraphs 130 to 133, wherein said miRNA is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
[00405] 135. The biochip of any one of paragraphs 130 to 134, wherein said miRNA comprises two or more miRNAs shown in Table 5 or Table 6.
[00406] 136. The biochip of any one of paragraphs 130 to 135, wherein said miRNA comprises two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
[00407] 137. At least one miRNA having a sequence listed, or substantially as listed, in Table 4 or Table 6.
[00408] 138. A polynucleotide, nucleic acid, oligonucleotide, probe or primer capable of binding to or detecting the miRNA sequence defined in paragraph 137.
[00409] 139. A tool, reagent, kit or assay containing or based on the miRNA of paragraph 137 or the polynucleotide, nucleic acid, oligonucleotide, probe or primer of paragraph 138.
EXAMPLES
[00410] The following examples are illustrative only and should not be construed as limiting in any way the general nature of the disclosure of the description throughout this specification.
[00411] Figures 1 to 3 relate to Example 1. Figure 4 relates to Example 2.
[00412] EXAMPLE 1
[00413 ] Materials and Methods
[00414] Participants
[00415] CFS/ME patients (n=20, age=44.5 + 6.0 years) were recruited from a South-East Queensland patient database in Australia. Inclusion criteria for the CFS/ME participants were according to the American CDC 1994 case definition [26]. Non-fatigued controls (n=20, age=47.3 + 6.7 years) were recruited mainly from the general public, and were participants with no medical history or symptoms of persistent fatigue or illness. Individuals who were smokers, pregnant/breast-feeding or immobile were excluded from the study, as were individuals with autoimmune, thyroid or cardiac related disorders prior to the onset of CFS/ME. [00416] Sample processing and RNA extraction
[00417] Plasma harvesting was performed immediately after peripheral blood collection. Briefly 10 mL of whole blood was collected from each participant into EDTA collection tubes. Plasma was immediately separated via centrifugation at 500 x g for 10 min, and 5 mL of the plasma was transferred to a new tube and stored at -80°C. Prior to RNA extraction, the plasma samples were centrifuged for 10 min at 16,000 x g at 4°C in order to remove any cellular debris left in the plasma. Circulating RNA was extracted from plasma using the miRNeasy
Serum/Plasma kit (Qiagen, Hilden, Germany) according to manufacturer's instruction with minor modifications. Briefly, 1 mL of plasma was incubated with 5 mL of QIAzol Lysis Reagent for 10 min. Samples were processed using a vacuum manifold to help process the larger quantity of plasma. An additional 80% ethanol wash step was included and sample elution was performed twice using 15 of RNase-free water. The size, quantity and quality of the extracted circulating RNA was assessed using a small RNA chip on an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).
[00418] MicroRNA profiling by HiSeq2000 sequencing
[00419] The six CFS/ME patients and six non-fatigued controls with the highest abundance of small RNA were used for HTS. Small RNA libraries were constructed using the TruSeq Small RNA Sample Preparation kit (Illumina, San Diego, CA) according to the manufacturer's protocols. Briefly, small RNA samples (5-10ng) were ligated with 5' and 3' adapters, followed by reverse transcription-PCR (RT-PCR) for cDNA library construction and incorporation of index tags. The cDNA library fragments were purified by way of separation on a 6% TBE PAGE gel and a 145-160 bp size fraction containing miRNA inserts was isolated. The twelve cDNA library samples were pooled in equimolar amounts and used for cluster generation and sequence analysis in a single lane on an Illumina HiSeq2000 (50 bp single read).
[00420] Sequencing data analysis
[00421] Raw FASTQ sequences were generated and demultiplexed using the Illumina CASAVA vl.8 pipeline. Per base sequence quality (quality score >30) was then assessed using the FastQC toolkit (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Prior to mapping the read data was pre-processed using the UEA small RNA Workbench (http://srna- workbench.cmp.uea.ac.uk) [27]. Briefly, the 3' adapter sequences were trimmed, the read size filtered (16-35nt), unique reads counted and low abundance reads (<10 reads) discarded. Unique sequence reads were then aligned to the human genome (hgl8) and miRBase_vl6 using the miRanalyzer web server tool (http://bioinfo2.ugr.es/miRanalyzer/miRanalyzer.php) [28].
[00422] Quantification of miRNA by RT-qPCR
[00423] The expression of eight miRNAs was validated using PerfeCTa miRNA primers (Quanta Biosciences, Gaithersburg, MD). In addition four miRNAs (miR-10, miR-15b, miR-16 and miR-24) were assessed for their suitability as a stable reference gene. Briefly, 15μί of extracted RNA were reverse transcribed into cDNA using the NCode miRNA First-Strand cDNA Synthesis kit (Life Technologies, Carlsbad, CA). RT-qPCR was performed as previously described [4].
[00424] Statistical analyses
[00425] Mann-Whitney rank sum test was used in analysing differences between the CFS/ME patients and non-fatigued controls regarding age and haematological characteristics (Tables 1A and 2). For RT-qPCR analysis unpaired groups of values were compared according to the non- parametric Mann-Whitney U test. These data were analysed using GraphPad Prism 5 (GraphPad Software, San Diego, CA). Differential expression of the miRNA-Seq raw count data was assessed using the BioC/R package DESeq [29]. Due to the small sample size and the heterogeneity of the CFS/ME phenotype we interpreted significance from the unadjusted P- value, without the Benjamini-Hochberg method for False Discovery (FDR) correction. Statistical significance was accepted at P<0.05.
[00426] Table 1: Characteristics of CFS/ME and non-fatigued control participants.
[00427] The blood characteristics of the participants in the study are presented below following full blood count analysis.
Parameters Non-Fatigued CFS/ME *P-values
(n = 20) (n = 20)
Age 47.3 + 6.7 44.5 + 6.0 0.24
White Blood Cells (10¼iL) 6.19 + 1.58 5.53 + 1.45 0.12
Lymphocytes (%) 35.89 + 8.81 34.80 + 6.41 0.53
Monocytes (%) 6.72 + 1.60 6.96 + 1.77 0.66
Granulocytes (%) 57.39 + 8.94 58.25 + 6.49 0.74
Lymphocytes (χ103/μΙ^) 2.14 + 0.53 1.89 + 0.46 0.13
Monocytes (χ103/μί) 0.41 + 0.12 0.39 + 0.15 0.66
Granulocytes
Figure imgf000053_0001
3.64 + 1.53 3.25 + 1.05 0.36 Red Blood Cells (xlO%iL) 4.20 + 0.36 4.13 + 0.24 0.43
Haemoglobin (g/L) 133.68 ± 8.52 132.20 + 7.88 0.40
Haematocrit (%) 37.14 + 1.95 36.67 + 2.10 0.40
Mean Cell Volume (fl) 88.82 + 5.39 88.69 + 2.58 0.51
Mean Cell Haemoglobin (pg) 31.97 + 2.01 32.02 + 1.13 0.78
Mean Corpuscular 359.95 + 7.17 360.95 + 6.44 0.64
Haemoglobin Concentration
(g L)
Red Blood Cell Distribution 12.52 + 1.28 12.44 + 0.69 0.41
Width (%)
Platelet (χ103/μί) 231.06 + 88.61 243.80 + 53.20 0.38
Mean Platelet Volume (fl) 7.59 + 0.77 7.63 + 1.16 0.72
[00428] Denotes statistical significance set at P < 0.05.
[00429] Table 2: Characteristics of miRNA-Seq subset of CFS/ME and non-fatigued control participants.
[00430] The blood characteristics of the participants chosen for sequencing analysis.
Figure imgf000054_0001
(g L)
Red Blood Cell Distribution 12.03 + 0.47 12.62 + 0.37 0.03*
Width (%)
Platelet (χ103/μί) 248.17 + 85.41 237.17 + 41.39 0.70
Mean Platelet Volume (fl) 7.58 + 0.80 6.90 + 0.86 0.24
[00431] * Denotes statistical significance set at P < 0.05
[00432] Results
[00433] Subject characteristics
[00434] The age of the study participants was recorded and a full blood count performed on whole blood samples prior to plasma separation. There were no significant differences between age or full blood count values in the CFS/ME and control groups (Table 1). For sequencing, a subset of six CFS/ME and six non-fatigued control samples were selected. A significant difference in lymphocyte and granulocyte percentages, lymphocyte count and red blood cell distribution width between the CFS/ME and control groups was observed in these subsets (Table 2).
[00435] niumina high-throughput sequencing of plasma miRNA in CFS/ME
[00436] To select for candidate plasma miRNAs differentially expressed in CFS/ME, an initial genome- wide small RNA screening of six CFS/ME patients and six non-fatigued controls by Illumina HTS was performed. A total of 154,989,205 reads were generated from a single flow cell lane on the HiSeq2000 sequencer. After demultiplexing an average of 12 million reads per library was obtained. Initial analysis of the library read lengths demonstrated a bimodal distribution of reads with peaks at 22 and 32 nucleotides (Figure 1C). These populations were subsequently found to contain miRNA and long non-coding RNA (IncRNA) sequences respectively. On average 57.4% of decoded sequences were mappable, with 97.5% of mappable reads aligning to the human genome (hgl8). Mature miRNA constituted 17% of all mapped reads, whilst other RNA species (including IncRNA and snoRNA) constituted 80.5% of mapped reads (Figure 1A). 75.1% of the mapped other RNA species consisted of IncRNA known as Ro- associated RNA Y4 (RNY4) which is the main component of the 32-33 nucleotide population. When examining unique reads, miRNA comprised 44.3% of all unique reads mapped whilst other RNA species comprised only 7% (Figure IB).
[00437] MiRNA characterisation [00438] A total of 375 mature miRNA were initially identified in one or more samples based on sequence alignment to the miRBase registry (release 19). The top 25 expressed miRNAs in each sample group are listed in Table 3.
[00439] Table 3: Top 25 most abundant miRNAs identified.
Figure imgf000056_0001
[00440] The base mean is the mean of the counts for each miRNA divided by the size factor for each condition (as calculated by DESeq). [00441] Furthermore, 13 tentatively novel candidate miRNAs were predicted, although these amounted to a very small fraction of the total read count. However, using the current techniques, it appeared that none of these novel miRNA showed significant differences between CFS/ME and non-fatigued controls (Table 4). These novel candidate miRNAs nevertheless remain tentatively useful screening tools.
[00442] Table 4: Novel miRNA candidates as predicted by miRanalyzer
Figure imgf000057_0001
AAGAGGGATGCA
GAGTAAGTGGGG AC
(SED. ID. No. 37)
ACTGCTAATGTGA
GACGAATTTTTGA
GCGGGTAAAGGT
CGCCCTCAAGGT
GATGCCTGGGAG GACCCGCCTACTT
Candidate_
chr22 43,011,306 43,011,426 + TTGCGATCTGC TGCGGGATGCCT 6
(SED. ID. No. 25) GGGAGTTGCGAT
CTGCCCGACCTTA
TTCACGCCTAAAA
AGTAGACT
(SED. ID. No. 38)
GGGCGGGGGCAC
AGGCTCCGGGAT
GGGCACTCTGCTC
CTCCGGGATGGG ATGAACAAGATT
Candidate_
chr20 57,598,899 57,598,989 + CACTCTGCTCA AGAGAGGAGTAC 7
(SED. ID. No. 26) CCGGACCGGATC
ATGAATTCCTTCA
GCGTC
(SED. ID. No. 39)
TGGGCCACAGTA
TTTATCAGGCGGC
GCTTCGCTCCCCT
CCGCCTTCTCTTC
CCGGTTCTTCCCG
AAAAGCTGGGTT
Candidate_ GAGTCGGGAAAA chr8 22,102,453 22,102,581 - GAGAGGGCGA
8 GCTGGGTTGAGA
(SED. ID. No. 27)
GGGCGAAAAAGG
ATGAGGTGACTG
GTCTGGGCTACGC
TATG
(SED. ID. No. 40)
ACAGGATAACAC
AGTTGGTCCGAGT
GTTGTGGGTTATT
CGAGTGTTGTGG GTTAAGTTGATTT
Candidate_
chr7 148,638,568 148,638,668 + GTTATTG AACATTGTCTCCC 9
(SED. ID. No. 28) CCCACAACCGCG
CTTGACTAGCTTG
CTGTTTTGCACT
(SED. ID. No. 41)
TTACCTCCCCTGC
ACCTCTGCCTTGG
GGGTGGGGGGAT
CTCTGACCTCTGA AGAGGCATGGAA
Candidate_
chr7 143,079,609 143,079,705 + CCCTCTAG TAGGTGCTCTGAC 10
(SED. ID. No. 29) CTCTGACCCTCTA
GCCCAGGGAGAA
GGTGAGCAG
(SED. ID. No. 42)
CAGCCCACGGCA
GCCAGAGAACCA
CACCCACTGGAG
ACCACACCCACT AACTCTAGGTTCT
Candidate_
chr6 5,831,634 5,831,730 - GGAGAACTC CTACGGCCTCTTG 11
(SED. ID. No. 30) TTACTGCCAGTGC
TTGTGTGGTTTGA
GGTGGGTAA
(SED. ID. No. 43)
Figure imgf000059_0001
[00443] Differential expression of plasma miRNA in CFS
[00444] Differential expression of identified miRNAs from miRBase was calculated using DESeq. A total of 19 microRNAs were significantly dysregulated/differentially expressed in CFS/ME compared to non-fatigued controls (Table 5).
[00445] Table 5: MiRNAs differentially expressed between CFS/ME and non-fatigued controls
Figure imgf000059_0002
hsa-miR-450b-5p 1.72 1.23 0.71 0.0208 hsa-miR-26a-l-3p 1.56 1.16 0.75 0.0106 hsa-mir-126* 1.39 0.91 0.65 0.0449 hsa-miR-5187-3p 1.31 1.10 0.84 0.0217 hsa-miR-641 1.07 0.78 0.73 0.0240 hsa-miR-548j 1.07 1.10 1.03 0.0446 hsa-miR-3065-3p 0.90 0.71 0.79 0.0126 hsa-miR-16-2-3p 0.82 0.71 0.87 0.0128 hsa-let-7g-3p 0.82 0.78 0.95 0.0251 hsa-miR-548ax 0.82 0.91 1.11 0.0484
[00446] The base mean is the mean of the counts for each miRNA divided by the size factor for each condition (as calculated by DESeq).
[00447] Of the 19 differentially expressed miRNAs 16 were considered low in abundance due to a base mean count of less than 1,000 reads, their detection was found to be unreliable for confirmative RT-qPCR. However, they remain excellent candidates as miRNA biological markers for CFS/ME. The remaining three miRNAs (hsa-miR127-3p, hsa-miR-142-5p and hsa- miR-143-3p) were all up-regulated in CFS/ME compared to non-fatigued controls.
[00448] The sequences of the 19 differentially expressed miRNAs are shown in Table 6.
[00449] Table 6: Differentially expressed miRNA sequences.
Figure imgf000060_0001
13 hsa-miR-5187-3p acugaauccucuuuuccucag
14 hsa-miR-641 aaagacauaggauagagucaccuc
15 hsa-miR-548j A A A AGU A AUUGC GGUCUUUGGU
16 hsa-miR-3065-3p ucagcaccaggauauuguuggag
17 hsa-miR- 16-2-3p ccaauauuacugugcugcuuua
18 hsa-let-7g-3p cuguacaggccacugccuugc
19 hsa-miR-548ax agaaguaauugcgguuuugcca
[00450] RT-qPCR confirmation of plasma miRNA-Seq data
[00451] The choice of a stable reference gene is critical for accurate gene expression analysis by RT-qPCR. Of the four putative reference genes tested hsa-miR- 16-5p was determined to be the most stably expressed (Figure 2). To validate the RNA-Seq results (n=6/group) RT-qPCR was performed in an expanded sample cohort (n=20/group). Three differentially expressed miRNAs (hsa-miR127-3p, hsa-miR- 142-5p and hsa-miR- 143-3p) and four non-differentially expressed miRNAs (hsa-miR-21-5p, hsa-miR- 103-3p, hsa-miR- 146a-5p and hsa-miR- 223-3p) were selected and their expression levels quantified using RT-qPCR. The four non-differentially expressed miRNAs were selected as they previously demonstrated dysregulation in cytotoxic lymphocytes in CFS/ME patients [3], although HTS did not identify differential expression in plasma. All RT-qPCR results for the remaining three miRNAs were consistent with the RNA- Seq data (Figure 3).
[00452] Discussion
[00453] To date, screening for CFS/ME has been based on well-established case definitions [3,30]. Profiling of biofluid/circulating miRNA levels serves to enhance the molecular diagnosis of CFS/ME. Using Illumina HTS, 19 miRNAs were identified that were differentially expressed in CFS/ME patients. Of these, only three were confirmed to be highly abundant in the CFS/ME patients in comparison to the controls. These results suggest that miR-127-3p, miR-142-5p and miR-143-3p may be implicated in the pathogenesis of CFS/ME.
[00454] Although, there is currently no definitive source identified for the presence of miRNAs in biofluids, blood cells in particular reticulocytes, myeloid cells, lymphoid cells, platelets, cells from the liver, lungs and kidneys or lysed cells may release miRNAs into the circulation [31,32,33]. Similarly, miRNAs may be discharged into the plasma following tissue damage for example, circulating miR-1 and miR-133a, are significantly increased following acute myocardial infarction [34]. The miRNAs as described herein have expressions in various tissues. MiR-127-3p is found in the testicular and nervous system [35], miR-143-3p is expressed in the colon [36] while miR-142-5p is expressed by cells of the immune system [37,38].
[00455] However, both miR-142-5p and miR-143-3p are reported to be amongst the miRNAs frequently found in plasma and serum [32]. Over-expression of miR-142-5p has been observed in most cancer-related and immunological disorders [39]. This particular miRNA is abundant in most hematopoietic cell lines and may be involved in thwarting inflammatory processes [40]. In Systemic Lupus Erythematosus (SLE), increased expression of miR-142-5p in CD4+T cells prevents autoimmunity while a downregulation may result in autoreactive T cells and
hyperactive B cells [41].
[00456] MiR-142-5p is important for T cell development where it targets SLAM associate protein (SAP). Inhibition of miR-142-5p may increase the expression of CD84, IL-10, SAP and IgG production [41]. CD84 is an important T cell regulatory marker as it regulates cytokine production, function, adhesion and interaction with B cells [42]. The levels of IL-10 have been shown to be equivocal in CFS/ME patients. The cause of an increase in miR-142-5p is unknown, however, it is possible that this may be related to heightened Treg suppression and additional autoimmune responses.
[00457] MiR-143-3p targets IgG Fey receptor 1 and also CD64 reducing lung inflammation. It is a tumour suppressor gene and is highly down regulated in colorectal cancer [43]. It inhibits the oncogene KRAS [44]. Overexpression of miR-143-3p in most cancer cells stagnates the growth of tumours and cancer cells [45] as it may act to reduce BCL2 mRNA thereby preventing tumour or cancer cell proliferation and promoting apoptosis [46]. miR-143-3p has been identified as a neutrophil specific miRNA [47]. Importantly, its expression is upregulated in cases of heightened erythropoiesis such as in polycythemia [48]. In CFS/ME increased levels of neutrophil apoptosis occurs in some patients [49,50,51], and this potentially ensues from high levels of miR-143-3p.
[00458] MiR-127-3p interferes with ERK signalling, a tumour suppressor and upregulations have been shown to increase apoptosis [52]. Importantly, it targets BCL6 a transcription factor which increases p53 expression [53]. BCL6 inhibits the production of IL-10 therefore by dampening BCL6 as a consequence of miR-127 upregulation may result in significant increases in IL-10 [54]. In CFS/ME equivocal levels of IL-10 have been reported and an over expression of miR-127-3p may explain to some extent some of these patterns. BCL6 is an important transcription factor required for germinal centre B cell and follicular helper T cell development
[55,56,57]. Irregularities in the expression of BCL6 may result in aberrant inflammatory responses and the development of various lymphomas [58].
[00459] The presence of a high proportion of the RNA Y4 within the small RNA sequencing libraries reduced miRNA sequencing capacity. Y RNAs are components of Ro
ribonucleoproteins (RNPs) and were first identified in the serum of patients with the autoimmune disorder lupus erythematosus [59]. Y RNAs are similar in size and structure to miRNAs as they both have comparable stem and loop structures [60] . These similarities may explain the presence of Y RNA following small RNA library construction. Efficient depletion of Y RNA would yield higher quality HTS miRNA data allowing deeper sequencing. Methods for the reduction of Y RNA in a similar manner to rRNA depletion could be employed to improve the ratio of useful miRNA data [61]. Most extracellular miRNA studies do not report on the abundance of Y RNAs in circulation and this may be related to the read size filtering used. Given that Y RNAs upon degradation produce two classes of fragments and majority of which bind to Ro60, it is possible to posit that these fragments that we observed in the plasma samples are those Y RNAs bound to Ro60.
[00460] Plasma miRNAs show great promise as potential non-invasive biological markers, but at present the precise and accurate measurement is challenging. A number of factors including cellular contamination, haemolysis and low quantity can result in significant bias that does not reflect the original biological state of the sample. Current circulating miRNA research indicates that haemolysis may influence the availability of miRNAs in circulation [33].
Haemolysis may be evaluated in archival data by examining the delta Cq of miR-451 and miR- 23a [33]. In healthy individuals, 194 miRNAs may be detected in both haemolysed and non- haemolysed blood samples, where 40.2% may be upregulated following haemolysis, 13% may be down regulated and 28.9% are unaffected by haemolysis [62,63]. As described herein, three candidate miRNAs, miR-127-3p, miR-143-3p and miR-142-5p are among the miRNA genes unaffected by haemolysis in healthy individuals [62] .
[00461] The benefit of biofluid/circulating miRNAs as biological markers for diseases relates to a number of characteristics such as reduced complexity compared to proteins, stability, conserved sequences in various species and restricted expression in specific tissues and biological processes. It has been suggested that 206 miRNAs are expressed in blood cells, serum and plasma, thus in most plasma and serum studies it is highly necessary to observe strict sample processing procedures to ensure the samples are cell free [64]. Cellular content contamination of biofluids may be reduced by employing additional centrifugation steps during the initial plasma separation to lessen potential contamination from cellular debris and haemolysis [65]. Additionally, it may be important to assess blood cell counts and lysis during sample collection as variation in plasma levels of miRNAs in some cases have been credited to circulating blood cell effects [66,67].
[00462] Starting concentration of miRNA levels vary among individuals due to age, sex and other factors and this may significantly impact the outcomes of various expression studies
[68,69]. To date there are no established reference values for miRNAs among normal individuals and this may be necessary for diagnostic marker purposes, hence, the inclusion of appropriate calibrator controls during RT-qPCR analysis is necessary. Nonetheless, despite these challenges, miRNA signatures from normal individuals are reproducible with similar expression patterns and a limited amount of variability [32,70].
[00463] Potential shortcomings with using biofluid is the low abundance of RNA thus a large quantity of sample is often required to achieve high yields and quality of RNA. Presently, the use of HTS as a means to detecting possible changes in miRNAs in disease presentations is in its infancy. Further studies are required to evaluate and refine the method to promote better detection and reliable data that can be replicated across studies.
[00464] The present inventors are of the view that one or more earlier studies not finding differentially expressed miRNA for CFS/ME may have been limited by the particular
experimental techniques employed.
[00465] EXAMPLE 2
[00466] Validation of microRNAs
[00467 ] Three miRNAs upregulated in CFS/ME patients were described in Example 1 (hsa- miR-127-3p, hsa-miR-l42-5p, hsa-miR- 1.43 -3p ). This second example confirms and validates the expression of these miRNAs in new cohort of CFS/ME patients in comparison to controls. 49 CFS/ E patients and 15 controls were used in this validation study. Hence a total of 69 CFS/ME patients and 35 controls have been examined for the expression of these three miRNAs (hsa- miR-127-3p, hsa-miR-142-5p, hsa-miR-143-3p).
[00468] Methods and Methods
[00469] Sample processing and RNA extraction
[00470] Plasma isolation was achieved as described in Example 1 and stored at -80°C. RNA extraction was performed as previously described in Example 1 using the miRNeasy Serum/Plasma kit (Qiagen, Bilden, Germany) and the niiRVana Paris kit (Life Technologies, Carlsbad, CA) according to manufacturer's instructions with slight adjustments. Quantity and quality of the total RNA and miRNA extracted was determined using the small RNA chip on an Agilent 2100 Bioanaiyzer (Agilent Technologies, Palo Alto, CA).
[00471 ] Quantification of miRNA by RT-qPCR
[00472] For this study the preparation of cDNA and qRT-PCR was performed using the TaqMan MicroRNA Assays (Applied Biosysteras, Life Technologies, Carlsbad, CA) as per the manufacturer' s instructions.
[00473] Statistical analyses
[00474] The non-parametric Mann-Whitney U test was used to analyse the data from the RT- qPCR using GraphPad Prism 6 (GraphPad Software, San Diego, CA).
[00475] Results
[00476] RT-qPCR validation and confirmation of plasma miRNAs
[00477] As per Example 1 , hsa-miR-16-5p was the preferred reference gene. To determine whether hsa-miR-127-3p, hsa-miR-J42-5p, hsa-miR-143-3p are specific to CFS/ME patients, RT-qPCR was undertaken in a new and larger cohort of CFS/ME patients (n-49). RT-qPCR results for hsa-miR-127-3p, hsa-miR-l42-5p, hsa-miR-143-3p were consistent with previous findings in Example 1. However hsa-miR~142-5p was not statistically significant. See Figure 4, wherein CFS/ME patients are labelled 'CPS' and non-fatigued (healthy) controls are labelled 'HE' .
[00478] Discussion
[00479] The results from this validation study demonstrate that hsa-miR-l27-3p, hsa-miR- 142-5p, hsa-miR-143-3p are upregulated in the plasma samples of patients with CFS/ME as described in Example L thus confirming biological marker suitability.
[00480] Although the use of miRNA in biofluid, particularly plasma, has been exemplified, it is to be appreciated that present inventive concept equally embraces the use of other biofluids such as, for example, serum, urine, sputum and cerebrospinal fluid. Any one of these biofluids could have been equally examplified by the present inventors. Biological samples could have been obtained from a subject either non-invasively or invasively. For example: urine - obtained by urination; cerebrospinal fluid - obtained by spinal tap; and sputum - obtained by
expectoration or nasotracheal suctioning.
[00481] Moreover, the present inventive concept further embraces miRNAs from cellular sources. Biological samples could have been obtained from a subject either non-invasively or invasively. For example: 1. buccal (mouth) cells - obtained by swishing mouthwash in the mouth or by swabbing or bushing the inside of the cheek with a swab or brush; 2. blood cells - obtained by pricking the finger and collecting the drops (dried blood spot) or by venepuncture (whole blood); 3. skin - obtained by a (punch) biopsy; 4. organ tissue - obtained by biopsy. Any one of these cellular sources of miRNA could have been equally examplified by the present inventors. [00482] Advantages of using plasma as a source of biological marker miRNA for CFS/ME, particularly as exemplified, include: (1) plasma samples are obtained less invasively; (2) plasma- derived miRNAs can be stored for a lengthy period of time, as they highly stable and can resist freeze-thawing, temperature variation, acids, etc.; (3) plasma is likely to contain a great diversity of circulating miRNAs, particularly because of their role in extracellular communication and release from cells/tissues (eg. plasma miRNAs may be reflective of a lesion or an injured tissue, and plasma miRNAs may be involved in cellular signal transduction through various
intracellular and extracellular vesicles).
[00483] EXAMPLE 3
[00484] MicroRNAs in Cerebrospinal Fluid Samples from Patients with CFS/ ME. The purpose of this study was to assess the presence and expression of miRNAs in cerebrospinal fluid (CSF) from CFS/ME and healthy control patients.
[00485] Methods
[00486] Participants
[00487] CSF samples were collected from 18 well-characterized CFS/ME patients and 5 healthy controls.
[00488] Extraction of miRNA
[00489] To isolate small RNAs from cerebrospinal fluid samples the mirVANA miRNA extraction kit (Life Technologies) was used as per manufacturer's instructions. Briefly, 625 μΐ^ of CSF samples were mixed with 625μί of denaturing solution. An equal volume of acid phenol chloroform was then added to the total volume of CSF plus the denaturing solution. Following centrifugation, the aqueous layer was removed and supplemented with ethanol. A filter cartridge was used to separate the small RNAs from the samples. This was washed with buffer solutions containing ethanol and eluted with 95 °C nuclease-free water. Samples were stored at -20°C.
[00490] cDNA Synthesis
[00491] cDNA synthesis was performed using 10 ng of total RNA. The TaqMan MicroRNA Reverse Transcription Kit was the preferred kit for cDNA synthesis. Therefore RNA was converted into cDNA as per manufacturer's instructions. Briefly, an RT master mix was prepared using lOOmM dNTPs (with dTTP), MultiScribe Reverse Transcriptase 50 υ/μί, 10 X Reverse Transcription Buffer, RNase Inhibitor, 20 \JI\iL , Nuclease-free water, 5X RT primer (Primer specific RT for each gene of interest). The master mix was added to the total RNA template. The reactions were placed in a thermal cycler where samples were 16°C for 30 minutes and 42°C for 30 minutes. The reaction was stopped at 85°C for 5 minutes and placed on ice. Samples were stored at -20°C for later qPCR analysis. [00492] RT-qPCR Reaction
[00493] The expression profile of miRNAs in CSF was performed on the 480 Light Cycler instrument (Roche). The TaqMan MicroRNA Assays were used in designing the miRNA primers. Five miRNAs were screened to determine the relative abundance of these miRNAs in CSF. RNU6B was the housekeeping or normalization gene. The miRNAs screened are shown in Table 7 below.
[00494] Table 7: miRNA sequences.
Figure imgf000067_0001
[00495] The miRNA are characterised at http://www.genenames.org/cgi- and at miRBase at http://www.mirbase.org/.
[00496] The reaction mixture for the RT-qPCR reaction was comprised of TaqMan Universal PCR Master Mix, primer of interest, nuclease-free water and cDNA. RT-qPCR conditions applied were as follows; 95°C for 10 mins, 40 cycles of 95°C for 15s, 60°C for 60s, melt curves were generated at 65 to 95°C. Each reaction was performed in triplicate on a 96 well plate and a no template control was used each time.
[00497] Results
[00498] Of the 5 miRNAs examined, there were no significant differences in the expression levels of these miRNAs between the CFS/ME patients and the controls. However, miR-124 was the most abundant miRNA expressed in the CSF samples of both the CFS/ME patients and the controls.
[00499] Despite this intial result, it is possible that any one or more of these 5 miRNAs may play a role in the pathology and progression of CFS/ME. Importantly, this Example shows that miRNAs can successfully be characterised in CSF.
[00500] EXAMPLE 4
[00501] MiRNAs as indicators of CFS/ME - probes, tools and reagents
[00502] Based on Examples 1, 2 and 3, the skilled person will appreciate that miRNAs can be used for identifying, screening, diagnosing or monitoring subjects with CFS/ME or at risk of developing CFS/ME. This, of course, means that the illness can be better managed in those subjects that have been identified. This also means that subjects that have not been identified as having the illness (or at risk of developing the illness) need not be subjected to a management regime developed for CFS/ME sufferers.
[00503] One or more miRNAs of interest are listed in Tables 4, 5, 6 and 7. The miRNAs of particular interest are hsa-miR-127-3p, hsa-miR-142-5p, hsa-miR-143-3p.
[00504] One of skill in the art could readily design, produce or manufacture a wide range of miRNA sequence-based probes, tools, reagents, methods and assays based on the information in Tables 3, 4, 5, 6 and 7.
[00505] Generally speaking, such miRNA sequence-based probes, tools, reagents, methods and assays can be used for identifying, screening, diagnosing or monitoring or treating subjects with, or predisposed to, CFS/ME.
[00506] Generally speaking, such probes, tools or reagents can be for use in nucleic acid- based techniques, assays and protocols, including miRNA detection, qualitative measurement of miRNA and quantitative measurement of miRNA.
[00507] Generally speaking, such probes, tools or reagents can also be an antibody or other type of molecule or chemical entity capable of detecting miRNA.
[00508] More specifically, probes, tools and reagents of particular interest include, but are not limited to, the following:
[00509] 1. An isolated, purified, synthetic or recombinant form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[00510] 2. A non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof - single stranded or double stranded. The form can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[00511] 3. An expression product of a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The expression product may be unlabelled or labelled with a detectable moiety. The expression product can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[00512] 4. A polynucleotide, oligonucleotide, probe or primer (unlabelled or labelled with a detectable moiety) for specifically binding to, annealing to, detecting, isolating or amplifying (eg. by PCR) a miRNA, or precursor thereof, or a fragment thereof, or a longer nucleic acid containing the miRNA sequence or fragment thereof. The polynucleotide, oligonucleotide, probe or primer can contain a sequence portion corresponding to the miRNA as well as a non-miRNA sequence portion.
[00513] 5. An expression vector, recombinant cell or biological sample comprising the nucleic acid or polynucleotide of 1, 2, 3 or 4.
[00514] Yet other probes, tools and reagents are described in the specification section entitled "Detailed Description".
[00515] The key finding that particular miRNAs can be differentially expressed also enables the inventors to develop kits, assays, microarrays, biochips and methods for identifying, screening, diagnosing, monitoring and/or treating subjects with, or predisposed to CFS/ME.
[00516] Generally speaking, the kit, assay, microarray, biochip or method for identifying, screening, diagnosing, monitoring and/or treating subjects with, or predisposed to, CFS/ME can comprise one or more materials of any one of 1-5. This may be, for example, for identifying or measuring miRNA expression or lack of expression.
[00517] Yet other kits, assays, microarrays, biochips and methods are described in the specification section entitled "Detailed Description".
[00518] In the present specification and claims, the word 'comprising' and its derivatives including 'comprises' and 'comprise' include each of the stated integers but do not exclude the inclusion of one or more further integers.
[00519] Reference throughout this specification to 'one embodiment' or 'an embodiment' means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearance of the phrases 'in one embodiment' or 'in an embodiment' in various places throughout this specification are not necessarily all referring to the same embodiment.
Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more combinations.
[00520] The articles 'a' and 'an' are used herein to refer to one or to more than one of the article.
[00521] The term 'about' is to be understood as referring to a range of numbers that a person of skill in the art would consider equivalent to the recited value in the context of achieving the same function or result.
[00522] In compliance with the statute, the invention has been described in language more or less specific to structural or methodical features. It is to be understood that the invention is not limited to specific features shown or described since the means herein described comprises preferred forms of putting the invention into effect. The invention is, therefore, claimed in any of its forms or modifications within the proper scope of the appended claims appropriately interpreted by those skilled in the art.
CITATION LIST
[The entire contents of which are incorporated herein by way of cross-reference.]
[00523] 1. Prins JB, van der Meer JW, Bleijenberg G (2006) Chronic fatigue syndrome. Lancet 367: 346-355.
[00524] 2. Johnston S, Brenu EW, Staines D, Marshall-Gradisnik S (2013) The prevalence of chronic fatigue syndrome/ myalgic encephalomyelitis: a meta-analysis. Clin Epidemiol 5: 105- 110.
[00525] 3. Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, et al. (1994) The chronic fatigue syndrome: a comprehensive approach to its definition and study. International Chronic Fatigue Syndrome Study Group. Ann Intern Med 121: 953-959.
[00526] 4. Brenu EW, Ashton KJ, van Driel M, Staines DR, Peterson D, et al. (2012) Cytotoxic lymphocyte microRNAs as prospective biomarkers for Chronic Fatigue Syndrome/Myalgic Encephalomyelitis. J Affect Disord 141: 261-269.
[00527] 5. Brenu EW, van Driel ML, Staines DR, Ashton KJ, Hardcastle SL, et al. (2012) Longitudinal investigation of natural killer cells and cytokines in chronic fatigue syndrome/myalgic encephalomyelitis. J Transl Med 10: 88.
[00528] 6. Brenu EW, Staines DR, Baskurt OK, Ashton KJ, Ramos SB, et al. (2010) Immune and hemorheological changes in chronic fatigue syndrome. J Transl Med 8: 1.
[00529] 7. Kaushik N, Fear D, Richards SC, McDermott CR, Nuwaysir EF, et al. (2005) Gene expression in peripheral blood mononuclear cells from patients with chronic fatigue syndrome. J Clin Pathol 58: 826-832.
[00530] 8. Frampton D, Kerr J, Harrison TJ, Kellam P (2011) Assessment of a 44 gene classifier for the evaluation of chronic fatigue syndrome from peripheral blood mononuclear cell gene expression. PLoS One 6: el6872.
[00531] 9. Kerr JR (2008) Gene profiling of patients with chronic fatigue syndrome/myalgic encephalomyelitis. Curr Rheumatol Rep 10: 482-491.
[00532] 10. Kerr JR, Petty R, Burke B, Gough J, Fear D, et al. (2008) Gene expression subtypes in patients with chronic fatigue syndrome/myalgic encephalomyelitis. J Infect Dis 197: 1171-1184.
[00533] 11. Kerr JR, Burke B, Petty R, Gough J, Fear D, et al. (2008) Seven genomic subtypes of chronic fatigue syndrome/myalgic encephalomyelitis: a detailed analysis of gene networks and clinical phenotypes. J Clin Pathol 61: 730-739.
[00534] 12. Brenu EW, van Driel ML, Staines DR, Ashton KJ, Ramos SB, et al. (2011) Immunological abnormalities as potential biomarkers in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis. J Transl Med 9: 81.
[00535] 13. Sun W, Julie Li YS, Huang HD, Shyy JY, Chien S (2010) microRNA: a master regulator of cellular processes for bioengineering systems. Annu Rev Biomed Eng 12: 1-27.
[00536] 14. Xiao C, Rajewsky K (2009) MicroRNA control in the immune system: basic principles. Cell 136: 26-36.
[00537] 15. Chen CZ, Schaffert S, Fragoso R, Loh C (2013) Regulation of immune responses and tolerance: the microRNA perspective. Immunol Rev 253: 112-128.
[00538] 16. Long JM, Lahiri DK (2012) Advances in microRNA experimental approaches to study physiological regulation of gene products implicated in CNS disorders. Exp Neurol 235: 402-418.
[00539] 17. Nakamoto M, Jin P, O'Donnell WT, Warren ST (2005) Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet 14: 3813-3821.
[00540] 18. Jansson MD, Lund AH (2012) MicroRNA and cancer. Mol Oncol 6: 590-610.
[00541] 19. Mo YY (2012) MicroRNA regulatory networks and human disease. Cell Mol Life Sci 69: 3529-3531.
[00542] 20. Shafi G, Aliya N, Munshi A (2010) MicroRNA signatures in neurological disorders. Can J Neurol Sci 37: 177-185.
[00543] 21. Qiu C, Chen G, Cui Q (2012) Towards the understanding of microRNA and environmental factor interactions and their relationships to human diseases. Sci Rep 2: 318.
[00544] 26. Adachi T, Nakanishi M, Otsuka Y, Nishimura K, Hirokawa G, et al. (2010) Plasma microRNA 499 as a biomarker of acute myocardial infarction. Clin Chem 56: 1183- 1185.
[00545] 27. Stocks MB, Moxon S, Mapleson D, Woolfenden HC, Mohorianu I, et al. (2012) The UEA sRNA workbench: a suite of tools for analysing and visualizing next generation sequencing microRNA and small RNA datasets. Bioinformatics 28: 2059-2061.
[00546] 28. Hackenberg M, Sturm M, Langenberger D, Falcon-Perez JM, Aransay AM (2009) miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing experiments. Nucleic Acids Res 37: W68-76.
[00547] 29. Anders S, Huber W (2010) Differential expression analysis for sequence count data. Genome Biol 11: R106.
[00548] 30. Carruthers BM, van de Sande MI, De Meirleir KL, Klimas NG, Broderick G, et al. (2011) Myalgic encephalomyelitis: International Consensus Criteria. J Intern Med 270: 327- 338.
[00549] 31. Pritchard CC, Cheng HH, Tewari M (2012) MicroRNA profiling: approaches and considerations. Nat Rev Genet 13: 358-369.
[00550] 32. Duttagupta R, Jiang R, Gollub J, Getts RC, Jones KW (2011) Impact of cellular miRNAs on circulating miRNA biomarker signatures. PLoS One 6: e20769.
[00551] 33. Turchinovich A, Weiz L, Langheinz A, Burwinkel B (2011) Characterization of extracellular circulating microRNA. Nucleic Acids Res 39: 7223-7233.
[00552] 34. D'Alessandra Y, Devanna P, Limana F, Straino S, Di Carlo A, et al. (2010) Circulating microRNAs are new and sensitive biomarkers of myocardial infarction. Eur Heart J 31: 2765-2773.
[00553] 35. Robertus JL, Harms G, Blokzijl T, Booman M, de Jong D, et al. (2009) Specific expression of miR-17-5p and miR-127 in testicular and central nervous system diffuse large B- cell lymphoma. Mod Pathol 22: 547-555.
[00554] 36. Zhang Y, Wang Z, Chen M, Peng L, Wang X, et al. (2012) MicroRNA- 143 targets MACC1 to inhibit cell invasion and migration in colorectal cancer. Mol Cancer 11: 23.
[00555] 37. Ansel KM (2013) RNA regulation of the immune system. Immunol Rev 253: 5- 11.
[00556] 38. Mas VR, Dumur CI, Scian MJ, Gehrau RC, Maluf DG (2013) MicroRNAs as biomarkers in solid organ transplantation. Am J Transplant 13: 11-19.
[00557] 39. Saito Y, Suzuki H, Tsugawa H, Imaeda H, Matsuzaki J, et al. (2012) Overexpression of miR-142-5p and miR-155 in gastric mucosa-associated lymphoid tissue (MALT) lymphoma resistant to Helicobacter pylori eradication. PLoS One 7: e47396.
[00558] 40. Merkerova M, Belickova M, Bruchova H (2008) Differential expression of microRNAs in hematopoietic cell lineages. Eur J Haematol 81: 304-310.
[00559] 41. Ding S, Liang Y, Zhao M, Liang G, Long H, et al. (2012) Decreased microRNA- 142-3p/5p expression causes CD4+ T cell activation and B cell hyperstimulation in systemic lupus erythematosus. Arthritis Rheum 64: 2953-2963.
[00560] 42. Cannons JL, Qi H, Lu KT, Dutta M, Gomez-Rodriguez J, et al. (2010) Optimal germinal center responses require a multistage T cell:B cell adhesion process involving integrins, SLAM-associated protein, and CD84. Immunity 32: 253-265.
[00561] 43. Slaby O, Svoboda M, Fabian P, Smerdova T, Knoflickova D, et al. (2007) Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. Oncology 72: 397-402.
[00562] 44. Chen X, Guo X, Zhang H, Xiang Y, Chen J, et al. (2009) Role of miR-143 targeting KRAS in colorectal tumorigenesis. Oncogene 28: 1385-1392.
[00563] 45. Peschiaroli A, Giacobbe A, Formosa A, Markert EK, Bongiorno-Borbone L, et al. (2013) miR-143 regulates hexokinase 2 expression in cancer cells. Oncogene 32: 797-802. [00564] 46. Liu L, Yu X, Guo X, Tian Z, Su M, et al. (2012) miR-143 is downregulated in cervical cancer and promotes apoptosis and inhibits tumor formation by targeting Bcl-2. Mol
Med Rep 5: 753-760.
[00565] 47. Slezak S, Jin P, Caruccio L, Ren J, Bennett M, et al. (2009) Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a. J Transl Med 7: 39.
[00566] 48. Allantaz F, Cheng DT, Bergauer T, Ravindran P, Rossier MF, et al. (2012) Expression profiling of human immune cell subsets identifies miRNA-mRNA regulatory relationships correlated with cell type specific expression. PLoS One 7: e29979.
[00567] 49. Kennedy G, Spence V, Underwood C, Belch JJ (2004) Increased neutrophil apoptosis in chronic fatigue syndrome. J Clin Pathol 57: 891-893.
[00568] 50. See DM, Cimoch P, Chou S, Chang J, Tilles J (1998) The in vitro immunomodulatory effects of glyconutrients on peripheral blood mononuclear cells of patients with chronic fatigue syndrome. Integr Physiol Behav Sci 33: 280-287.
[00569] 51. Vojdani A, Mordechai E, Brautbar N (1997) Abnormal apoptosis and cell cycle progression in humans exposed to methyl tertiary-butyl ether and benzene contaminating water. Hum Exp Toxicol 16: 485-494.
[00570] 52. Mosakhani N, Sarhadi VK, Borze I, Karjalainen-Lindsberg ML, Sundstrom J, et al. (2012) MicroRNA profiling differentiates colorectal cancer according to KRAS status. Genes Chromosomes Cancer 51 : 1-9.
[00571] 53. Parpart S, Wang XW (2013) microRNA Regulation and Its Consequences in Cancer. Curr Pathobiol Rep 1: 71-79.
[00572] 54. Saito Y, Liang G, Egger G, Friedman JM, Chuang JC, et al. (2006) Specific activation of microRNA- 127 with downregulation of the proto-oncogene BCL6 by chromatin- modifying drugs in human cancer cells. Cancer Cell 9: 435-443.
[00573] 55. Crotty S, Johnston RJ, Schoenberger SP (2010) Effectors and memories: Bcl-6 and Blimp- 1 in T and B lymphocyte differentiation. Nat Immunol 11: 114-120.
[00574] 56. Nurieva RI, Chung Y, Martinez GJ, Yang XO, Tanaka S, et al. (2009) Bcl6 mediates the development of T follicular helper cells. Science 325: 1001-1005.
[00575] 57. Johnston RJ, Poholek AC, DiToro D, Yusuf I, Eto D, et al. (2009) Bcl6 and
Blimp- 1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation.
Science 325: 1006-1010.
[00576] 58. Klein U, Dalla-Favera R (2008) Germinal centres: role in B-cell physiology and malignancy. Nat Rev Immunol 8: 22-33.
[00577] 59. Lerner MR, Boyle JA, Hardin JA, Steitz JA (1981) Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus. Science 211:
400-402.
[00578] 60. Verhagen AP, Pruijn GJ (2011) Are the Ro RNP-associated Y RNAs concealing microRNAs? Y RNA-derived miRNAs may be involved in autoimmunity. Bioessays 33: 674- 682.
[00579] 61. O'Neil D, Glowatz H, Schlumpberger M (2013) Ribosomal RNA Depletion for
Efficient Use of RNA-Seq Capacity. Curr Protoc Mol Biol Chapter 4: Unit4 19.
[00580] 62. Kirschner MB, Edelman JJ, Kao SC, Vallely MP, van Zandwijk N, et al. (2013)
The Impact of Hemolysis on Cell-Free microRNA Biomarkers. Front Genet 4: 94.
[00581] 63. Kirschner MB, van Zandwijk N, Reid G (2013) Cell-free microRNAs: potential biomarkers in need of standardized reporting. Front Genet 4: 56.
[00582] 64. Cheng HH, Yi HS, Kim Y, Kroh EM, Chien JW, et al. (2013) Plasma Processing Conditions Substantially Influence Circulating microRNA Biomarker Levels. PLoS One 8: e64795.
[00583] 65. McAlexander MA, Phillips MJ, Witwer KW (2013) Comparison of Methods for miRNA Extraction from Plasma and Quantitative Recovery of RNA from Cerebrospinal Fluid. Front Genet 4: 83.
[00584] 66. Pritchard CC, Kroh E, Wood B, Arroyo JD, Dougherty KJ, et al. (2012) Blood cell origin of circulating microRNAs: a cautionary note for cancer biomarker studies. Cancer Prev Res (Phila) 5: 492-497.
[00585] 67. Boeri M, Verri C, Conte D, Roz L, Modena P, et al. (2011) MicroRNA signatures in tissues and plasma predict development and prognosis of computed tomography detected lung cancer. Proc Natl Acad Sci U S A 108: 3713-3718.
[00586] 68. Duttagupta R, Jones KW (2013) The curious case of miRNAs in circulation: potential diagnostic biomarkers? Wiley Interdiscip Rev RNA 4: 129-138.
[00587] 69. De Guire V, Robitaille R, Tetreault N, Guerin R, Menard C, et al. (2013) Circulating miRNAs as sensitive and specific biomarkers for the diagnosis and monitoring of human diseases: promises and challenges. Clin Biochem 46: 846-860.
[00588] 70. Chen X, Ba Y, Ma L, Cai X, Yin Y, et al. (2008) Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 18: 997-1006.
[00589] 75. 1988 Centres for Disease Control and Prevention: Holmes GP, Kaplan JE, Gantz NM, Komaroff AL, Schonberger LB, Straus SE, et al. Chronic fatigue syndrome: a working case definition. Annals of internal medicine. 1988;108(3):387-9.
[00590] 76. Australian definition: Lloyd AR, Hickie I, Boughton CR, Spencer O, Wakefield D. Prevalence of chronic fatigue syndrome in an Australian population. The Medical journal of
Australia. 1990;153(9):522-8.
[00591] 77. HO-yen definition: Ho-Yen DO. Patient management of post-viral fatigue syndrome. The British journal of general practice: the journal of the Royal College of General Practitioners. 1990;40(330):37-9.
[00592] 78. 1991 Oxford definition: Sharpe MC, Archard LC, Banatvala JE, Borysiewicz LK, Clare AW, David A, et al. A report— chronic fatigue syndrome: guidelines for research. Journal of the Royal Society of Medicine. 1991;84(2): 118-21.
[00593] 79. 1994 CDC: Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. The chronic fatigue syndrome: a comprehensive approach to its definition and study. International Chronic Fatigue Syndrome Study Group. Annals of internal medicine. 1994;121(12):953-9.
[00594] 80. CDC empirical definition: Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, et al. Chronic fatigue syndrome— a clinically empirical approach to its definition and study. BMC medicine. 2005 ;3: 19.
[00595] 81. Canadian Consensus Criteria: Carruthers BM, Jain AK, de Meirleir K, Paterson DL, Klimas N, Lerner AM, et al. Myalgic encephalomyelitis/chronic fatigue syndrome: Clinical working case definition, diagnostic and treatment protocols. Journal of Chronic Fatigue Syndrome. 2003;l l(l):7-36.
[00596] 82. International Consensus Criteria: Carruthers BM, van de Sande MI, De Meirleir KL, Klimas NG, Broderick G, Mitchell T, et al. Myalgic encephalomyelitis: International Consensus Criteria. Journal of internal medicine. 2011;270(4):327-38.
[00597] 89. Chiang V S-C. Post-harvest consideration factors for microRNA research in cellular, tissue, serum and plasma samples. 2014. Cell Biology International.
[00598] 90. Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N. Discovering microRNAs from deep sequencing data using miRDeep. Nat.
Biotechnol. 2008;26:407-415.
[00599] 91. Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2012;40:37-52.
[00600] 92. An J, Lai J, Lehman ML, Nelson CC. miRDeep*: an integrated application tool for miRNA identification from RNA sequencing data. Nucleic Acids Res. 2013;41:727-737.
[00601] 93. Mathelier A, Carbone A. MIReNA: finding microRNAs with high accuracy and no learning at genome scale and from deep sequencing data. Bioinformatics. 2010;26:2226- 2234]. [00602] 94. Hackenberg M, Rodriguez-Ezpeleta N, Aransay AM. miRanalyzer: an update on the detection and analysis of microRNAs in high-throughput sequencing experiments. Nucleic
Acids Res. 2011;39:W132-W138.
[00603] 95. Hackenberg M, Sturm M, Langenberger D, Falcon-Perez JM, Aransay AM. miRanalyzer: a microRNA detection and analysis tool for next-generation sequencing
experiments. Nucleic Acids Res. 2009;37:W68-W76.
[00604] 96. Jones-Rhoades MW, Bartel DP. Computational identification of plant
microRNAs and their targets, including a stress-induced miRNA. Mol. Cell. 2004;14:787-799.
[00605] 97. Wang X, Zhang J, Li F, Gu J, He T, Zhang X, Li Y. MicroRNA identification based on sequence and structure alignment. Bioinformatics. 2005;21:3610-3614].
[00606] 98. Nam JW, Shin KR, Han JJ, Lee Y, Kim VN, Zhang BT. Human microRNA prediction through a probabilistic co-learning model of sequence and structure. Nucleic Acids Res. 2005;33:3570-3581.
[00607] 99. Kirtzou K, Tsamardinos I, Tsakalides P, Poirazi P. MatureBayes: a probabilistic algorithm for identifying the mature miRNA within novel precursors. PLoS One. 2010;5:el l843.
[00608] 100. Xuan P, Guo MZ, Huang YC, Li WB, Huang YF. MaturePred: efficient identification of microRNAs within novel plant pre-miRNAs. PLoS One. 2011;6:e27422.
[00609] 101. He C, Li YX, Zhang G, Gu Z, Yang R, Li J, Lu ZJ, Zhou ZH, Zhang C, Wang J. MiRmat: mature microRNA sequence prediction. PLoS One. 2012;7:e51673.
[00610] 102. Leclercq M, Diallo AB, Blanchette. Computational prediction of the
localization of microRNAs within their pre-miRNA. Nucleric Acids Res. 2013; 41(15):7200- 7211.
[00611] 103. Pall GS, Codony-Servat C, Byrne J, Ritchie L, Hamilton A (2007)
Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res 35:e60.
[00612] 104. Varallyay E, Burgyan J, Havelda Z (2007) Detection of microRNAs by
Northern blot analyses using LNA probes. Methods 43: 140-145.
[00613] 105. Git A, Dvinge H, Salmon-Divon M, Osborne M, Kutter C, Hadfield J, Bertone P, Caldas C (2010) Systematic comparison of microarray profiling, real-time PCR, and next- generation sequencing technologies for measuring differential microRNA expression. RNA 16:991-1006.
[00614] 106. Ambros V, Lee RC (2004) Identification of microRNAs and other tiny noncoding RNAs by cDNA cloning. Methods Mol Biol 265: 131-138.
[00615] 107. Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N (2008) Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol 26:407-415.
[00616] 110. Maroney PA, Chamnongpol S, Souret F, Nilsen TW (2008) Direct detection of small RNAs using splinted ligation. Nat Protoc 3:279-287;
[00617] 111. Maroney PA, Chamnongpol S, Souret F, Nilsen TW (2007) A rapid, quantitative assay for direct detection of microRNAs and other small RNAs using splinted ligation. RNA 13:930-936.

Claims

1. At least one miRNA for use as a biological marker for Chronic Fatigue Syndrome (CFS) and/or Myalgic Encephalomyelitis (ME), or at least one miRNA biological marker for use in identifying or diagnosing a subject having CFS and/or ME, or at least one miRNA biological marker for use in identifying or diagnosing a subject at risk of developing CFS and/or ME, or at least one miRNA biological marker for use in managing a subject having or at risk of developing CFS and/or ME, or at least one miRNA when used as a biological marker for CFS and/or ME, or at least one miRNA biological marker when used in identifying, diagnosing and/or managing a subject having or at risk of developing CFS and/or ME.
2. The at least one miRNA of claim 1, wherein said at least one miRNA is a circulating miRNA.
3. The at least one miRNA of claim 1 or claim 2, wherein said at least one miRNA is found in a biofluid.
4. The at least one miRNA of claim 3, wherein said biofluid is plasma or serum.
5. The at least one miRNA of any one of claims 1 to 4, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
6. The at least one miRNA of any one of claims 1 to 5, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
7. The at least one miRNA of any one of claims 1 to 6, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
8. The at least one miRNA of any one of claims 1 to 7, wherein said use involves the use of more than one said at least one miRNA.
9. Use of at least one miRNA as a biological marker for identifying or diagnosing a subject having CFS and/or ME, or use of at least one miRNA as a biological marker for identifying or diagnosing a subject at risk of developing CFS and/or ME, or use of at least one miRNA as a biological marker for managing a subject having or at risk of developing CFS and/or ME.
10. The use of claim 9, wherein said at least one miRNA is a circulating miRNA.
11. The use of claim 9 or claim 10, wherein said at least one miRNA is found in a biofluid.
12. The use of claim 11, wherein said biofluid is plasma or serum.
13. The use of any one of claims 9 to 12, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
14. The use of any one of claims 9 to 13, wherein said at least one miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
15. The use of any one of claims 6 to 14, wherein said miRNA is hsa-miR127-3p, hsa-miR- 142-5p or hsa-miR-143-3p.
16. The use of any one of claims 6 to 15, wherein said use involves the use of more than one said at least one miRNA.
17. A method of identifying or diagnosing a subject having CFS and/or ME, or at risk of developing CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has CFS and/or ME.
18. The method of claim 17, wherein said at least one miRNA is a circulating miRNA.
19. The method of claim 17 or claim 18, wherein said biological sample is a biofluid.
20. The method of claim 19, wherein said biofluid is plasma or serum.
21. The method of any one of claims 17 to 20, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
22. The method of any one of claims 17 to 21, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table
6.
23. The method of any one of claims 17 to 22, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
24. The method of any one of claims 17 to 23, wherein said method involves the use of more than one said at least one miRNA.
25. The method of any one of claims 17 to 24, wherein said method comprises the step of managing the subject for CFS and/or ME.
26. The method of claim 25, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
27. The method of claim 25 or claim 26, wherein managing the subject comprises
administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
28. The method of any one of claims 17 to 27, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
29. A method of identifying or diagnosing and managing a subject having, or at risk of
developing, CFS and/or ME, said method comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a
biological sample obtained from the subject that is differentially expressed in CFS and/or ME;
(b) comparing the level of expression of the miRNA biological marker in the biological sample relative to a reference, wherein detection of an alteration in the level of miRNA biological marker expression in the biological sample relative to the reference indicates that the subject has, or is at risk of developing, CFS and/or ME; and
(c) managing the subject having, or at risk of developing, CFS and/or ME.
30. The method of claim 29, wherein said at least one miRNA is a circulating miRNA.
31. The method of claim 29 or 30, wherein said biological sample is a biofluid.
32. The method of claim 31, wherein said biofluid is plasma or serum.
33. The method of any one of claims 29 to 32, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
34. The method of any one of claims 29 to 33, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
35. The method of any one of claims 29 to 34, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
36. The method of any one of claims 29 to 35, wherein said method involves the use of more than one said at least one miRNA.
37. The method of any one of claims 29 to 36, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
38. The method of any one of claims 29 to 37, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
39. The method of any one of claims 29 to 38, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
40. A method of screening subjects for a prevalence of CFS and/or ME, said method
comprising the steps of:
(a) measuring the level of expression of at least one miRNA biological marker in a biological sample obtained from each subject that is differentially expressed in CFS and/or ME; and
(b) comparing the level of expression in each said biological sample to a level of
expression in a reference, wherein detection of an alteration in the level of miRNA biological marker expression identifies the subject as having CFS and/or ME.
41. The method of claim 40, wherein said at least one miRNA is a circulating miRNA.
42. The method of claim 40 or claim 41, wherein said biological sample is a biofluid.
43. The method of claim 42, wherein said biofluid is plasma or serum.
44. The method of any one of claims 40 to 43, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
45. The method of any one of claims 40 to 44, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
46. The method of any one of claims 40 to 45, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
47. The method of any one of claims 40 to 46, wherein said method involves the use of more than one said at least one miRNA.
48. The method of any one of claims 40 to 47, wherein said method comprises the step of managing the subject having CFS and/or ME.
49. The method of any one of claims 40 to 48, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
50. A method of identifying whether a subject having a CFS and/or ME illness is responding to management of that illness, said method comprising the steps of:
(a) optionally, isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness;
(b) measuring the level of expression in the biological samples of at least one miRNA
biological marker that is differentially expressed in CFS and/or ME; and
(c) comparing the level of expression of the miRNA biological marker in the biological samples before and during and/or after management of the illness, wherein a change in the level of expression identifies the subject as having responded to the management of the illness.
51. The method of claim 50, wherein said at least one miRNA is a circulating miRNA.
52. The method of claim 50 or claim 51, wherein said biological sample is a biofluid.
53. The method of claim 52, wherein said biofluid is plasma or serum.
54. The method of any one of claims 50 to 53, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
55. The method of any one of claims 50 to 54, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
56. The method of any one of claims 50 to 55, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
57. The method of any one of claims 50 to 56, wherein said method involves the use of more than one said at least one miRNA.
58. The method of any one of claims 50 to 57, wherein said method comprises isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness.
59. The method of any one of claims 50 to 58, wherein said method comprises the step of managing the subject if still having the illness.
60. The method of claim 59, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
61. The method of claim 59 or claim 60, wherein managing the subject comprises
administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
62. The method of any one of claims 50 to 61, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
63. A method of managing a subject with CFS and/or ME comprising the step of managing the subject if the subject has been found to have at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
64. The method of claim 63, wherein said at least one miRNA is a circulating miRNA.
65. The method of claim 63 or claim 64, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
66. The method of any one of claims 63 to 65, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
67. The method of any one of claims 63 to 66, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
68. The method of any one of claims 63 to 67, wherein said method involves the use of more than one said at least one miRNA.
69. The method of any one of claims 63 to 68, wherein said method comprises isolating a biological sample from the subject prior to management of the illness and during and/or after management of the illness.
70. The method of claim 69, wherein said biological sample is a biofluid.
71. The method of claim 70, wherein said biofluid is plasma or serum.
72. The method of any one of claims 63 to 71, wherein managing the subject is such that at least one symptom of CFS and/or ME is cured, healed, alleviated, relieved, altered, remedied, ameliorated or improved.
73. The method of any one of claims 63 to 72, wherein managing the subject comprises administering one or more therapeutic compounds in an amount effective to alleviate, relieve, alter, remedy, ameliorate, improve, or affect CFS and/or ME or a symptom of CFS and/or ME.
74. A method of identifying or characterising at least one differentially expressed miRNA biological marker for CFS and/or ME, said method comprising the steps of:
(a) subjecting a biological sample comprising miRNA obtained from a subject having CFS and/or ME to a screening technique so as to identify a potential CFS and/or ME miRNA biological marker; and
(b) confirming differential expression of the potential CFS and/or ME miRNA biological marker relative to a reference using an expression technique, wherein differential expression of the potential CFS and/or ME miRNA biological marker indicates that a miRNA biological marker for CFS and/or ME has been identified or characterised.
75. The method of claim 74, wherein said at least one miRNA is a circulating miRNA.
76. The method of claim 75, wherein said biological sample is a biofluid.
77. The method of claim 76, wherein said biofluid is plasma or serum.
78. The method of any one of claims 74 to 77, wherein said at least one miRNA is selected from one or more of the miRNAs shown in Table 5 or Table 6.
79. The method of any one of claims 74 to 78, wherein said at least one miRNA has a
sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
80. The method of any one of claims 74 to 79, wherein said miRNA is hsa-miR127-3p, hsa- miR-142-5p or hsa-miR-143-3p.
81. The method of any one of claims 74 to 80, wherein the level of miRNA expression or differential expression is carried out using: Northern analysis and a probe that specifically binds to the miRNA; RNase protection; or, reverse transcription-polymerase chain reaction (RT-PCR) using one or more oligonucleotides/primers that will amplify transcribed said miRNA.
82. An isolated, purified or recombinant form of a miRNA biological marker differentially expressed in CFS and/or ME.
83. The biological marker of claim 82, being a circulating miRNA.
84. The biological marker of claim 82 or claim 83, being a miRNA shown in Table 5 or Table 6.
85. The biological marker of any one of claims 82 to 84, having a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
86. The biological marker of any one of claims 82 to 85, being hsa-miR127-3p, hsa-miR- 142-5p or hsa-miR-143-3p.
87. An article of manufacture comprising: (1) non-naturally occurring polynucleotide, recombinant polynucleotide, oligonucleotide or cDNA form of a miRNA biological marker that is differentially expressed in CFS and/or ME; or (2) a polynucleotide or an oligonucleotide that is complementary to the miRNA biological marker of (1); or (3) an expression vector, recombinant cell or biological sample, tool, reagent, kit or assay comprising (1) or (2).
88. The article of manufacture of claim 87, wherein said miRNA biological marker is a
circulating miRNA.
89. The article of manufacture of claim 87 or claim 88, wherein said miRNA biological marker is as shown in Table 5 or Table 6.
90. The article of manufacture of any one of claims 87 to 89, wherein said miRNA biological marker has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
91. The article of manufacture of any one of claims 87 to 90, wherein said miRNA biological marker is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
92. The article of manufacture of any one of claims 87 to 91, wherein the tool or reagent comprises an oligonucleotide that hybridises to the miRNA for miRNA detection, characterisation, quantification and/or expression.
93. The article of manufacture of any one of claims 87 to 92, wherein the tool or reagent comprises an oligonucleotide that hybridises to any one of the miRNA sequences listed in Table 6 or to a miRNA having a sequence substantially as listed in Table 6.
94. A miRNA-based probe, tool or reagent for identifying a subject having CFS and/or ME, or a miRNA-based probe, tool or reagent for identifying a subject at risk of developing CFS and/or ME, or a miRNA-based probe, tool or reagent for use in managing a subject having or at risk of developing CFS and/or ME, or a miRNA-based probe, tool or reagent when used in identifying, diagnosing and/or managing a subject having or at risk of developing CFS and/or ME.
95. The miRNA-based probe, tool or reagent of claim 94, wherein said miRNA-based probe, tool or reagent is based on a circulating miRNA.
96. The miRNA-based probe, tool or reagent of claim 94 or claim 95, wherein said miRNA- based probe, tool or reagent is based on a miRNA shown in Table 5 or Table 6.
97. The miRNA-based probe, tool or reagent of any one of claims 94 to 96, wherein said miRNA-based probe, tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
98. The miRNA-based probe, tool or reagent of any one of claims 94 to 97, wherein said miRNA-based probe, tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa- miR-143-3p.
99. A kit for identifying a subject having, at risk of developing, and/or managing CFS and/or ME, said kit comprising one or more tools or reagents for determining expression of at least one miRNA biological marker in a biological sample derived from the subject.
100. The kit of claim 99, wherein said tool or reagent is based on a circulating miRNA.
101. The kit of claim 99 or claim 100, wherein said tool or reagent is based on a
miRNA shown in Table 5 or Table 6.
102. The kit of any one of claims 99 to 101, wherein said tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
103. The kit of any one of claims 99 to 102, wherein said tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
104. The kit of any one of claims 99 to 103, wherein said kit comprises a plurality of tools or reagents based on miRNAs shown in Table 5 or Table 6.
105. The kit of claim 104, wherein said tools or reagents comprise two or more of hsa- miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
106. The kit of any one of claims 99 to 105, wherein the tool or reagent is for:
processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses; measuring miRNA expression; or comparing miRNA expression levels (differential expression).
107. A kit or assay for performing measurement of at least one miRNA biological marker that is differentially expressed in CFS and/or ME, wherein the kit comprises one or more tools or reagents for measuring expression of the miRNA biological marker.
108. The kit or assay of claim 107, wherein said tool or reagent is based on a
circulating miRNA.
109. The kit or assay of claim 107 or 108, wherein said tool or reagent is based on a miRNA shown in Table 5 or Table 6.
110. The kit or assay of any one of claims 107 to 109, wherein said tool or reagent is based on a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1- 19 of Table 6.
111. The kit or assay of any one of claims 107 to 110, wherein said tool or reagent is based on hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
112. The kit or assay of any one of claims 107 to 111, wherein said kit comprises a plurality of tools or reagents based on miRNAs shown in Table 5 or Table 6.
113. The kit or assay of claim 112, wherein said tools or reagents comprise two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
114. The kit of any one of claims 107 to 113, wherein the tool or reagent is for:
processing a biological sample; RNA extraction from a biological sample; miRNA identification; miRNA profiling; miRNA screening; miRNA sequencing; miRNA sequence analyses; measuring miRNA expression; or comparing miRNA expression levels (differential expression).
115. A biological sample comprising at least one miRNA biological marker that is differentially expressed in CFS and/or ME.
116. The biological sample of claim 115, wherein said at least one miRNA biological marker is a circulating miRNA.
117. The biological sample of claim 115 or claim 116, wherein said at least one
miRNA biological marker is a miRNA shown in Table 5 or Table 6.
118. The biological sample of any one of claims 115 to 117 wherein said at least one miRNA biological marker has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
The biological sample of any one of claims 115 to 118, wherein said at least one miRNA biological marker is hsa-miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
120. The biological sample of any one of claims 115 to 119, wherein said at least one miRNA biological marker comprises two or more miRNAs shown in Table 5 or Table 6.
121. The biological sample of any one of claims 115 to 119, wherein said at least one miRNA biological marker comprises one or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
122. The biological sample of any one of claims 115 to 121, wherein isolated for the purpose for testing the biological sample for CFS and/or ME.
123. An array of oligonucleotide probes for identifying miRNAs in a biological
sample, comprising probes that each selectively bind to miRNA that is differentially expressed in CFS and/or ME.
124. The array of claim 123, wherein said miRNA is a circulating miRNA.
125. The array of claim 123 or claim 124, wherein said miRNA is a miRNA shown in Table 5 or Table 6.
126. The array of any one of claims 123 to 125 wherein said miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
127. The array of any one of claims 123 to 126, wherein said miRNA is hsa-miR127- 3p, hsa-miR-142-5p or hsa-miR-143-3p.
128. The array of any one of claims 123 to 127, wherein said miRNA comprises two or more miRNAs shown in Table 5 or Table 6.
129. The array of any one of claims 123 to 128, wherein said miRNA comprises two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
130. A biochip comprising a solid substrate and at least one oligonucleotide probe capable of selectively binding to a miRNA that is differentially expressed in CFS and/or ME.
131. The biochip of claim 130, wherein said miRNA is a circulating miRNA.
132. The biochip of claim 130 or claim 131, wherein said miRNA is a miRNA shown in Table 5 or Table 6.
133. The biochip of any one of claims 130 to 132, wherein said miRNA has a sequence as shown, or substantially as shown, in any one of SEQ. ID Nos. 1-19 of Table 6.
134. The biochip of any one of claims 130 to 133, wherein said miRNA is hsa- miR127-3p, hsa-miR-142-5p or hsa-miR-143-3p.
135. The biochip of any one of claims 130 to 134, wherein said miRNA comprises two or more miRNAs shown in Table 5 or Table 6.
136. The biochip of any one of claims 130 to 135, wherein said miRNA comprises two or more of hsa-miR127-3p, hsa-miR-142-5p and hsa-miR-143-3p.
137. At least one miRNA having a sequence listed, or substantially as listed, in Table 4 or Table 6.
138. A polynucleotide, nucleic acid, oligonucleotide, probe or primer capable of
binding to or detecting the miRNA sequence defined in claim 137.
139. A tool, reagent, kit or assay containing or based on the miRNA of claim 137 or the polynucleotide, nucleic acid, oligonucleotide, probe or primer of claim 138.
PCT/AU2015/050452 2014-08-15 2015-08-10 Biological markers Ceased WO2016023077A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2014903190 2014-08-15
AU2014903190A AU2014903190A0 (en) 2014-08-15 Biological Markers

Publications (1)

Publication Number Publication Date
WO2016023077A1 true WO2016023077A1 (en) 2016-02-18

Family

ID=55303696

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2015/050452 Ceased WO2016023077A1 (en) 2014-08-15 2015-08-10 Biological markers

Country Status (1)

Country Link
WO (1) WO2016023077A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018081202A1 (en) * 2016-10-25 2018-05-03 The Regents Of The University Of California Markers of chronic fatigue syndrome
WO2019006382A1 (en) * 2017-06-29 2019-01-03 Nova Southeastern University Method for compiling a genomic database and method for using the same to identify genetic patterns to establish diagnostic biomarkers
CN112840033A (en) * 2018-08-22 2021-05-25 国立研究开发法人国立精神·神经医疗研究中心 Biomarkers of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS)
US11884979B2 (en) 2016-09-16 2024-01-30 Takeda Pharmaceutical Company Limited RNA biomarkers for hereditary angioedema

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014081507A1 (en) * 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Terminally modified rna

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014081507A1 (en) * 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Terminally modified rna

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BRENU, E.W. ET AL.: "Cytotoxic lymphocyte microRNAs as prospective biomarkers for Chronic Fatigue Syndrome/Myalgic Encephalomyelitis", JOURNAL OF AFFECTIVE DISORDERS, vol. 141, 2012, pages 261 - 269 *
BRENU, E.W. ET AL.: "High-throughput sequencing of plasma microRNA in chronic fatigue syndrome/myalgic encephalomyelitis", PLOS ONE, vol. 9, no. 9, September 2014 (2014-09-01), pages e102783 *
DATABASE GEO 17 December 2012 (2012-12-17), "[miRNA-3] Affymetrix Multispecies miRNA-3 Array", Database accession no. GPL16384 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11884979B2 (en) 2016-09-16 2024-01-30 Takeda Pharmaceutical Company Limited RNA biomarkers for hereditary angioedema
WO2018081202A1 (en) * 2016-10-25 2018-05-03 The Regents Of The University Of California Markers of chronic fatigue syndrome
WO2019006382A1 (en) * 2017-06-29 2019-01-03 Nova Southeastern University Method for compiling a genomic database and method for using the same to identify genetic patterns to establish diagnostic biomarkers
US20200176086A1 (en) * 2017-06-29 2020-06-04 Nova Southeastern University Method for Compiling A Genomic Database for A Complex Disease And Method for Using The Compiled Database to Identify Genetic Patterns in The Complex Disease to Establish Diagnostic Biomarkers
CN112840033A (en) * 2018-08-22 2021-05-25 国立研究开发法人国立精神·神经医疗研究中心 Biomarkers of Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS)

Similar Documents

Publication Publication Date Title
CN101835902B (en) An ultra-conserved region encoding NCRNA
EP2800820B1 (en) Methods and kits for detecting subjects having pancreatic cancer
Brenu et al. High-throughput sequencing of plasma microRNA in chronic fatigue syndrome/myalgic encephalomyelitis
WO2011076142A1 (en) Compositions and methods for microrna expession profiling in plasma of colorectal cancer
WO2012047631A2 (en) Compositions and methods useful for the treatment and diagnosis of inflammatory bowel disease
WO2016023077A1 (en) Biological markers
CN107820519B (en) health sign
US20200024667A1 (en) Mirna based treatment monitoring in multiple sclerosis
US20160194712A1 (en) Mirna based treatment monitoring in autoimmune diseases
EP2199412A1 (en) Compositions and methods for micro-RNA expression profiling of cancer stem cells
EP2432896A1 (en) A method for predicting the responsiveness of a patient to a treatment with an anti-cd20 antibody and a method for diagnosing rheumatoid arthritis
EP2823057B1 (en) miRNA BASED TREATMENT MONITORING IN MULTIPLE SCLEROSIS
Brenu et al. High-Throughput Sequencing of Plasma MicroRNA in Chronic Fatigue
HK1204016B (en) Methods and kits for detecting subjects having pancreatic cancer
CN108251519A (en) Pathogenic gene of pre-axial multi-finger disease and application thereof
WO2014033245A1 (en) Methods for predicting the outcome of a cancer in a patient by analysing snorna

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15832313

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15832313

Country of ref document: EP

Kind code of ref document: A1