WO2016005789A1 - Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages - Google Patents
Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages Download PDFInfo
- Publication number
- WO2016005789A1 WO2016005789A1 PCT/IB2014/062926 IB2014062926W WO2016005789A1 WO 2016005789 A1 WO2016005789 A1 WO 2016005789A1 IB 2014062926 W IB2014062926 W IB 2014062926W WO 2016005789 A1 WO2016005789 A1 WO 2016005789A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- hpv
- mrnas
- alpha
- reads
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16H—HEALTHCARE INFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR THE HANDLING OR PROCESSING OF MEDICAL OR HEALTHCARE DATA
- G16H50/00—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics
- G16H50/30—ICT specially adapted for medical diagnosis, medical simulation or medical data mining; ICT specially adapted for detecting, monitoring or modelling epidemics or pandemics for calculating health indices; for individual health risk assessment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- HPV infections are associated with the development of cervix carcinoma and possibly other cancers like head and neck cancers.
- cancer of the cervix is one of the most common cancers among women in all countries.
- Human papillomaviruses HPV are the etiologic agents responsible for over 99% of all cancers of the cervix.
- HPVs are DNA viruses commonly transmitted through sexual contact, which include more than 100 genotypes.
- Human Papillomaviruses are small, non-enveloped DNA viruses, approximately 55 nm in diameter, that infect basal cells and replicate in the nucleus of squamous epithelial cells.
- each of the papillomaviruses is similar and can be divided into three functional regions. Following infection, the early HPV genes (E6, E7, El, E2, E4 and E5) are expressed and the viral DNA replicates from the episomal form of the virus. In the upper layer of the epithelium the viral genome is replicated further, and the late genes (LI and L2) and E4 are expressed. The shed virus can then initiate new infections.
- HPV Human papillomaviruses
- HPV infections are very common and depending on the HPV types and host immune defense, the infection disappears in 6-12 months in 90% of women. According to a recent CDC report, there are 14 million new HPV infections each year in the USA alone, which account for 50% of sexually transmitted infections (STIs). This means that 1.4 million individuals are each year at risk of developing HPV induced cancer.
- STIs sexually transmitted infections
- Two HPV vaccines have been approved, but they are not broadly used in the total population. In addition, these vaccines only cover several types such as HPV6, 11, 16 and 18 and leave unprotected a significant part of the population.
- HPV are common viruses that can cause usually warts and because there are more than 100 types of HPV, diagnosis and disease management are complex. It is even further complicated taken that most HPVs are deemed harmless, and so far only about 14 types have been shown to be associated with increased risk of cancer. These HPV types affect the genital tract and are transmitted through sexual contact with an infected partner. As of today, HPV types have been classified as low- risk or high-risk HPVs according to observations in clinical cohorts. Low-risk HPVs have been classified according to their association with genital warts ; whereas High-risk HPVs (HR HPVs) are identified as a limited number of types which are shown to induce cancers of the cervix, vulva, vagina, and anus in women. In men, these High-risk HPVs can lead to cancers of the anus and penis.
- HR HPVs High-risk HPVs
- Cancer biomarkers in HPV-related cancers are greatly needed for a better diagnostic of pre-cancer and cancer stages of the disease, prognosis and therapeutic management.
- Low-grade intraepithelial lesions are a site of productive viral replication. Progression to high- grade intraepithelial lesions and invasive carcinomas is associated with a persistent high-risk HPV infection and often integration of the HPV genome into the host chromosomes, loss or disruption of E2 and subsequent upregulation of E6 and E7 expression.
- E6 and E7 are the oncogenes of the virus and expression of these genes is required for malignant transformation.
- E6 and E7 mediate degradation of the tumor suppressors p53 and RB, respectively, and interfere with cell- cycle regulation.
- E6 and E7 proteins from low-risk types are less competent in interfering with p53 and pRb functions than E6/E7 proteins from high-risk types. Therefore, low-risk HPV infections are associated with benign proliferations, such as genital warts and low-grade intraepithelial lesions prone to regress.
- LINEAR ARRAY HPV Genotyping Test (Roche) is a qualitative test that detects 37 high- and low-risk human papillomavirus genotypes, including those considered a significant risk factor for High-grade Squamous Intraepithelial (HSIL) progression to cervical cancer. This test is a qualitative in vitro test for the detection of Human Papilloma Virus in clinical specimens.
- the test utilizes amplification of target DNAs by PCR of the late gene LI of HPV DNA genotypes 6, 11, 16, 18, 26, 31, 33, 35, 39, 40, 42, 45, 51, 52, 53, 54, 55, 56, 58, 59, 61, 62, 64, 66, 67, 68, 69, 70, 71, 72, 73 (MM9) (novel type related to HPV73), 81, 82 (MM4) (novel type related to HPV82), 83 (MM7) (novel type related to HPV83), 84 (MM8) (novel type related to HPV84), IS39 and CP6108.
- the digene HC2 HPV DNA Test developed by Qiagen, is based on Capture Hybridization of HPV DNAs (LI gene) for the qualitative detection of 18 types (HPV 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68 [68a], 73, 82MM4 [82IS39]) in cervical specimens.
- probes are used as a multiplex assay based on nested PCR amplification and the Luminex xMAP technology for genotyping DNA of LI genes of HPV types 6, 11, 13, 16, 18, 26, 30, 31, 32, 33, 35, 39, 40, 42 , 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 61, 62, 66, 67, 68, 69, 70, 71, 72, 73, 74, 81, 82, 83, 84 , 85, 86, 87, 89, 90, 91 and 97.
- HPV identification uses molecular techniques based on species/genus genotype specific oligonucleotides binding to specifically amplify and/or probe papillomavirus nucleic acids. In addition, these tests all share a specific qualitative detection restricted to some specific HPVs, but not a general and broad range of HPVs. Finally, the presence of HPV nucleic acid, especially DNA, does not mean the presence of cervical dysplasia or cervical cancer.
- HPV infection during cancer development is associated with a shift from productive infection towards non-productive infection characterized by a high level of E6 and E7 and low levels of expression E2 and of late genes, often associated with an integration of HPV DNA in the host chromosomes, at least for HPV16.
- the inventors investigated shared homology of sequences of all HPV types and no clear global homologies are found within features between polypeptide or nucleic acid sequences. Nonetheless, the inventors designed consensus primers within all intra subgroup alpha, and provide hereafter several compositions of primers depending of the desired coverage of the test.
- the inventors propose here an approach for detecting cancer or risk of developing cancer not limited to the specific HPVs known today to be classified as High-risk.
- the present invention does not rely on the above 14 H species/genotype specific oligonucleotides binding to specifically amplify and/or probe papillomavirus few DNAs or few transcripts.
- the invention also provides generic consensus primers allowing a broad amplification or pre- amplification of relevant genes of alphaPV, not depending on the specific transcripts of the 14 HR HPVs, which are amenable to PCR testing or enhance signal/noise ratio in connection with the High- Throughput sequencing mentioned above.
- the invention relates to identification of all E6/E7 transcripts in a given sample, and recognizing to which specie/genotypes they belong to, sorting the reads corresponding to other viral transcripts of the same genotype/species so as to compute ratios defining relative molecular abundance of transcripts within this (these) given genotype(s) as biomarker of cancer development.
- the inventors therefore designed a kit for HPV diagnosis based on a broad screening of the level of E6 and/or E7 mRNAs within the group alpha of HPVs.
- the inventors designed consensus primers allowing amplification or pre-amplification E6 and/or E7 mRNAs of genotypes of sub-group alpha to detect the level of expression of, wherein a significant expression level of E6 and/or E7 of group alpha HPVs in a single time point or over time is indicative of risk of developing HPV induced cancers.
- the inventors also propose to quantitate E6 and or E7 as reads delivered by next generation sequencing techniques.
- the present invention also provides a method for determining the level of expression of structural or late viral proteins such as LI or 12.
- a ratio Rl between E6 and/or E7 and LI and/or L2 is determined, and compared to a ratio R found in low risk or non-persistent HPV infections, wherein a ratio Rl below a reference value R is indicative of HPV infections associated with higher risk of developing genital neoplasia and cancer.
- the invention provide a high through put sequencing method allowing relative quantification of reads across oncongenic viruses, such as polyoma virus or group alpha HPV, comprising enrichment of the viral RNAs in a sample using ramdom pre-amplification and/or specific reverse transcriptase reation, determing the number of reads matching said viruses based on species discrimination, comparing the most prevalent high risk specie, further determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes.
- oncongenic viruses such as polyoma virus or group alpha HPV
- ratios are calculated to detect increase in relative level of high risk species versus low risk species and ratios within said high risk species of reads matching oncogenic genes versus structural or regulatory genes.
- this test encompasses determining the level of HR HPVs reads versus LR HPVs reads through group alpha HPVs, determing the ratio of early versus late genes (E6 and or E7 versus LI and/or L2) within the most prevalent HR HPVs, and assessing risk of developing HPV induced cancer in patients which said ratio tend towards infinity.
- Refined ratios can be obtained using a filter applied on reads mapping specifically RNA spliced events.
- the method is for assessing risk of developing HPV induced cancer in patients infected with at least two different HPV species of group alpha.
- the method is for assessing HPV virus clearance in patient receiving HPV preventive or curative HPV vaccine.
- the present invention relates to a method for determining a patient risk of developing oncongenic virus induced cancer, such as polyoma virus or group alpha HPV comprising: a) enrichment of the viral RNAs in a sample using random or consensus pre-amplification and/or specific reverse transcriptase reation,
- step b) sequencing cDNA produced in step a), and generating reads of said cDNA
- ratio R tend towards infinity, such as for example when ratio R is between 0.25, 0.4, 0.5, 1 to infinity.
- This method is suitable for diagnosis or prognosis of risk to develop virus induced cancer in a human subject.
- This method is particularly suited for assessing risk of developing HPV induced cancer in patients infected with at least two different HPV species of group alpha, for example multiple infected with HPV16, HPV35 and HPV6.
- This method is also specifically suitable for assessing HPV virus clearance in patient receiving HPV preventive or curative HPV vaccine. It can be performed before vaccination to confirm vaccine potential for clearing exsiting inferctions or post-vaccination for follow-up.
- Ratio (R) is calculated as the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
- This method further include correlating a higher number of reads of HPV16 transcripts relative to reads of transcripts of another HPV species with an increased risk of developing high-grade malignant HPV-induced cancer.
- the cDNA is generated using random primers or using HPV-specific primers.
- the ratio is calculated by calculating a ratio (Rl) of the number of reads of one HPV HR E6 and/or E7 transcripts to the number of reads of said one HPV HR LI and/or L2 transcripts and the ratio is calculated by calculating a ratio (R2) of the number of reads of a second HPV HR E6 and E7 transcripts to the number of reads of said second HPV HR LI and L2 transcripts.
- Rl ratio
- R2 ratio of the number of reads of a second HPV HR E6 and E7 transcripts to the number of reads of said second HPV HR LI and L2 transcripts.
- pre-amplify viral mRNAs wherein said viral mRNAs comprises oncogenic mRNAs and at least one other mRNA
- step e) identifying to which species or genotypes said oncogenic mRNAs of step d) belong to, f) sorting the reads corresponding to said at least one other viral mRNAs, or cDNAs thereof obtained after steps a) and b), of the same genotype or species identified in step e), g) optionally, identifying fusion transcripts as a signature of viral DNA integrations events in the host chromosome and/or additional human cancer cell biomarkers,
- virus induced cancer it is more particularly contemplated herein Papova virus induced cancer, more specifically Papilloma or Polyma virus induced cancer.
- viral mRNAs in step f) it is meant mRNAs of viral genes selected from structural genes, for example capsid genes as well as from regulatory genes, and replication/transcription genes.
- the present invention relates to a method for diagnosis or prognosis of risk to develop HPV induced cancer in a human subject comprising:
- pre-amplify HPVs mRNAs wherein said mRNAs comprises E6 and/or E7 HPV RNAs and at least one other HPV mRNAs,
- step e) identifying to which species or genotypes E6 and/or E7 HPV mRNAs of step d)belong to, f) sorting the reads corresponding to other viral HPV mRNAs of the same genotype or species identified in step e), g) optionally, identifying fusion transcripts as a signature of HPV DNA integrations events in the host chromosome and/or additional human cancer cell biomarkers,
- step f By other viral mRNAs in step f), it is more particularly referred to selected mRNAs from genes coding for capsid proteins (LI and L2), gene coding for the growth stimulation protein (E5), genes coding for replication or transcription proteins (E4, E2 and El, E8).
- additional human cancer cell biomarkers can be selected for example from PRC1, CCNB2, SYCP2 CDKN3, NUSAP1, CDC20, pl6INK4a , Ki-67.
- step f) comprises sorting the reads of LI and/or L2 HPV mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs identified in step d).
- step h) comprises computing ratios defining relative molecular abundance of E6 and/or E7 HPV mRNAs relative to the reads of LI and/or at least one other viral mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs.
- step b) optionally comprises pre-amplifying HPVs mRNAs, wherein said mRNAs comprises E6 and/or E7 HPV RNAs and LI and/or at least one other viral HPV mRNAs.
- the present invention relates to a method for diagnosis risk to develop HPV induced cancer comprising:
- step (b) comparing the levels determined in step (a) to a reference value of E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both in low risk individuals infected with HPVs
- step (c) wherein an increased level as determined in step a) compared to the reference level in step b) is indicative of higher risk to develop HPV cancer induced.
- these biomarkers are not restricted to E6 or E7 mRNAs of HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 but extend to all E6 or E7 mRNAs of HPVs of several genus alpha, comprising and covering HPVs of groups cx5, 6, 7, 10; optionally extending to additional alpha group HPVs as desired
- the levels of E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both are determined inter alia by hybridization with a labeled probe, amplification, including PCR, nucleic acid microarrays, high-throughput sequencing with or without pre-amplification.
- the measure may be carried out directly on an extracted messenger RNA (rnRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted rnRNA. From the rnRNA or cDNA sample, the amount of nucleic acid transcripts is determined using nucleic acid microarrays, quantitative PCR, hybridization with a labeled probe, or directly by counting corresponding reads following high-throughput sequencing.
- amplification or pre-amplification is depicted in details below with specifically designed consensus primers allowing generic pre-amplification of all or desired HPVs belonging to group alpha.
- primers depicted below are provided to amplify and detect the amount of E6 mRNAs and E7 mRNAs of all or several group alpha HPVs depending of the desired scope of the test.
- the invention provides a much broader test extending beyond types such as HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 which are today classified as High-risk HPVs; as it allows the determination of high level expression of E6 and/E7 of several alpha subgroups of HPVs and even covering the all HPVs of the alpha group.
- the quantification is performed on E6 and/or E7 mRNAs of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58 and papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82.
- the combined generic consensus primers to generically amplify alpha subgroups are described herein-after.
- the method of the invention further refines the above method aiming at the quantitative determination of expression levels of a panel of biomarkers in biological samples of patients or individuals suspected to be infected with HPVs, which combined biomarkers are indicative and /or predictive, in a single time-point, of patients at risk of developing HPV induced cancers.
- the panel provided by the invention comprises the following biomarkers:
- At least one host cellular marker indicative of neoplasia or cancer is optionally, at least one host cellular marker indicative of neoplasia or cancer.
- the panel is composed of at least 5, 10, 20, 30 or 50 different mRNAs of said E6, E7, LI and L2 mRNAs of group alpha HPVs.
- the panel is composed of all group alpha HPVs mRNAs of E6 and/or E7, and LI and/or L2.
- the combined generic consensus primers to generically amplify alpha subgroups depending on the desired scope of the test are provided herein- after.
- the invention is performed using sequence-independent-amplified or direct HT- sequencing for quantitative detection of individual mRNA of E6 and/or E7 HPV sequences belonging to the HPV alpha group.
- Such method according to the invention is also provided for predicting the progression of HPV infection in a patient suffering from HPV infection.
- the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient comprising: generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV specie; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the number of HPV sequence reads according to HPV species and HPV gene transcript, determining the number of HPV sequence reads of at least 2 HPV gene transcripts; and determining the number of HPV sequence reads of at least 2 HPV species; wherein the patient sample contains 2 or more HPV species.
- HPV human papilloma virus
- the method comprises calculating a ratio (R) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
- the method comprises correlating a higher number of reads of HPV16 transcripts relative to reads of transcripts of another HPV species with an increased risk of developing high-grade malignant HPV-induced cancer.
- the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV-specific primers. In one embodiment, the ratio is calculated by calculating the ratio (R) of the number of reads of HPV16 E6 and/or E7 transcripts to the number of reads of HPV16 LI and/or L2 transcripts. In one embodiment, the ratio is calculated by calculating the ratio (R) of the number of reads of HPV16 E6 and E7 transcripts to the number of reads of LI and L2 transcripts. In one embodiment, the method comprises determining the number of HPV sequence reads of at least 2 Alpha group HPV species. In one embodiment, the method comprises generating at least 10 6 reads of sequence of the cDNA. In one embodiment, the method comprises generating at least 10 7 reads of sequence of the cDNA
- the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient comprising generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the level of HPV sequence reads according to HPV gene transcript; determining the number of HPV sequence reads of at least one HPV early gene transcript; determining the number of HPV sequence reads of at least one HPV late gene transcript; and determining the ratio of the number of HPV sequence reads of at least one HPV early gene transcript to the number of HPV sequence reads of at least one HPV late gene transcript.
- HPV human papilloma virus
- the method comprises calculating a ratio (R) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
- the at least one early transcript is HPV E6 or E7 and the at least one late transcript is LI or L2. In one embodiment, the at least one early transcript is HPV E6 and E7 and the at least one late transcript is LI and L2.
- the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV specific primers.
- Biological samples as referred herein include, without limitation, mammalian bodily fluids, especially oral fluids or scrapings, genital scrapings, in particular cervix scrapings.
- HPV Alpha group HPVs are contained within five evolutionary groups. HPV types that infect the cervix come from the Alpha group which contains over 60 members. HPV types from the Beta, Gamma, Mu and Nu groups or genus primarily infect cutaneous sites. Alpha papillomaviruses can be subdivided into three categories (high risk, low risk and cutaneous), depending on their prevalence in the general population and on the frequency with which they cause cervical cancer. High-risk types come from the Alpha 5, 6, 7, and 10 groups.
- Primers encompassed by the invention are not limited to the sequences defined in the primers depicted below but they can comprise extra bases at the 5' end, for example from 1 to 5 extra bases as extension corresponding to sequences of the corresponding HPVs E6 or E7. Also, primers shall be understood as embracing shorter sequences of at least 12, 15, 20 or 25 consecutive bases of the primers featured below. In some embodiments, it shall be understood that the invention also contemplates generic probes which have the sequences of the primers depicted herein and which are directly or indirectly labeled.
- the probes and primers can be extended or swifted from 1 to 15 bases depending on the desired specificity of the PCR amplification step and/or on the specificity of the detection step using standard parameters such as the nucleic acid size and GC contents, stringent hybridization conditions and temperature reactions.
- standard parameters such as the nucleic acid size and GC contents, stringent hybridization conditions and temperature reactions.
- low stringency conditions are used when it is desired to obtain broad positive results on a range of homologous targets whereas high stringency conditions are preferred to obtain positive results only if the specific target nucleic is present in the sample.
- stringent hybridization conditions refers to conditions under which the primer or probe will hybridize only to that exactly complementary target(s). The hybridization conditions affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like.
- Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequences at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe or primer.
- Tm thermal melting point
- stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+, typically about 0.01 to 1.0 M Na+ concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60°C for long probes or primers (e.g. greater than 50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- Exemplary low stringent conditions include hybridization with a buffer solution of 20-30% formamide, 1 M NaCI, 1% SDS at 37°C and a wash in 2*SSC at A0°C.
- Exemplary high stringency conditions include hybridization in 40-50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1*SSC at 60°C. Determination of particular hybridization conditions relating to a specified nucleic acid is routine and is well known in the art, for instance, as described in J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and F.M. Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.
- Preferred PCR primers which can be used separately or together as a set to amplify a HPV nucleic acid sequence comprise the primers. al:
- G is used to designate Guanine
- A is used to designate Adenine
- T is used to designate a Thymine
- C is used to designate a Cytosine.
- R is commonly used to designate a Purine (A or G)
- Y is commonly used to designate a Pyrimidine (T or C)
- W is commonly used to designate A or T
- S is commonly used to designate C or G
- K is commonly used to designate G or T
- H is commonly used to designate A or T or C
- B is commonly used to designate G or C or T
- V is commonly used to designate G or A or T
- D is commonly used to designate G or A or T
- N is commonly used to designate any nucleotide (A or T or C or G).
- said primers can be used in solution or linked to a solid support.
- the primer is generally functionalized.
- it may be modified by a thiol, amine or carboxyl terminal group at the 5 Or 3' position.
- a thiol, amine or carboxyl group makes it possible, for example, to couple the oligonucleotide to a support bearing disulphide, maleimide, amine, carboxyl, ester, epoxide, cyanogen bromide or aldehyde functions.
- These couplings form by establishment of disulphide, thioether, ester, amide or amine links between the primer and the support. Any other method known to a person skilled in the art may be used, such as bifunctional coupling reagents, for example.
- the oligonucleotide can contain an "arm" and a "spacer" sequence of bases.
- the use of an arm makes it possible, in effect, to bind the primer at a chosen distance from the support, enabling its conditions of interaction with the DNA to be improved.
- the arm advantageously consists of a linear carbon chain, comprising 1 to 18 and preferably 6 or 12 (CH 2 ) groups, and an amine which permits binding to the column.
- the arm is linked to a phosphate of the oligonucleotide or of a "spacer” composed of bases which do not interfere with the hybridization.
- the "spacer” can comprise purine bases.
- the "spacer” can comprise the sequence GAGG.
- the arm is advantageously composed of a linear carbon chain comprising 6 or 12 carbon atoms.
- chromatographic supports in bulk or prepacked in a column,_functionalized plastic surfaces or functionalized latex beads, magnetic or otherwise.
- Chromatographic supports are preferably used.
- the chromatographic supports capable of being used are agarose, acrylamide or dextran as well as their derivatives (such as Sephadex, Sepharose, Superose, etc.), polymers such as poly(styrene/divinylbenzene), or grafted or ungrafted silica, for example.
- the chromatography columns can operate in the diffusion or perfusion mode.
- sequencing is used in a broad sense and refers to any technique known by the skilled person including but not limited to Sanger dideoxy termination sequencing, whole- genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, cycle sequencing, single-base extension sequencing, solid- phase sequencing, high-throughput sequencing, massively parallel signature sequencing (MPSS), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse- terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD( ) sequencing, MS-PET sequencing, mass spectrometry, and a combination thereof.
- MPSS massively parallel signature sequencing
- the method and kit of the invention is adapted to run on ABI PRISM( ) 377 DNA Sequencer, an ABI PRISM(R) 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM(R) 3700 DNA Analyzer, or an Applied Biosystems SOLiD(TM) System (all from Applied Biosystems), a Genome Sequencer 20 System (Roche Applied Science).
- the said primers can be used in solution, in another embodiment the said primers are linked to a solid support.
- the primer is generally functionalized.
- it may be modified by a thiol, amine or carboxyl terminal group at the 5 ' or 3' position.
- a thiol, amine or carboxyl group makes it possible, for example, to couple the oligonucleotide to a support bearing disulphide, maleimide, amine, carboxyl, ester, epoxide, cyanogen bromide or aldehyde functions.
- These couplings form by establishment of disulphide, thioether, ester, amide or amine links between the primer and the support. Any other method known to a person skilled in the art may be used, such as bifunctional coupling reagents, for example.
- the oligonucleotide can contain an "arm" and a "spacer" sequence of bases.
- the use of an arm makes it possible, in effect, to bind the primer at a chosen distance from the support, enabling its conditions of interaction with the DNA to be improved.
- the arm advantageously consists of a linear carbon chain, comprising 1 to 18 and preferably 6 or 12 (CH2) groups, and an amine which permits binding to the column.
- the arm is linked to a phosphate of the oligonucleotide or of a "spacer” composed of bases which do not interfere with the hybridization.
- the "spacer” can comprise purine bases.
- the "spacer” can comprise the sequence GAGG.
- the arm is advantageously composed of a linear carbon chain comprising 6 or 12 carbon atoms.
- chromatographic supports in bulk or prepacked in a column, functionalized plastic surfaces or functionalized latex beads, magnetic or otherwise.
- Chromatographic supports are preferably used.
- the chromatographic supports capable of being used are agarose, acrylamide or dextran as well as their derivatives (such as Sephadex, Sepharose, Superose, etc.), polymers such as poly(styrene/divinylbenzene), or grafted or ungrafted silica, for example.
- the chromatography columns can operate in the diffusion or perfusion mode.
- oncogenic genes or oncogenic m NAs refers to genes or mRNAs which are directly or indirectly inducing cell transformation into cancer cells development.
- oncogenic genes are used to designated E6 genes and /or E7 genes.
- other viral mRNAs refers to mRNAs coding for capsid proteins (LI and L2), mRNAs coding for the growth stimulation (E5), mRNAs coding for replication/transcription (E4 and E2) and mRNAs coding for replication (El and E8), which are not oncogenic genes.
- R ratios as used herein are defined as the relative level of an oncogenic mRNA, for example E6, E7 or E6 + E7, compared to other viral mRNAs of the same genotype or specie, more particularly compared to selected mRNAs from genes coding for capsid proteins (LI and L2), gene coding for the growth stimulation protein (E5), genes coding for replication or transcription proteins (E4, E2 and El, E8).
- a reference Ratio R can be defined as
- R ⁇ (xE6 and/or xE7) / ⁇ (xLl and/or xL2 and/or xE2.7) Wherein x is a factor in the range 0-1000000,
- xE6 is for example either the number of reads mapped to the gene Ex, or the number of times each nucleotide of the gene Ex is sequenced
- xLl is for example the number of reads mapped to the gene Lx, or the number of times each nucleotide of the gene Lx is sequenced.
- FIG. 1 represents percentage homology between oncogenic proteins E6 HPVs HR and LR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HPVs compared to LR HR HPVs.
- FIG. 2 represents percentage homology between oncogenic proteins E7 HPVs HR and LR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HPVs compared to LR HR HPVs.
- FIG. 3 represents percentage homology between oncogenic proteins E6 HPVs HR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
- FIG. 4 represents percentage homology between oncogenic proteins E7 HPVs HR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of H HPVs.
- FIG. 5 represents percentage homology between oncogenic proteins E6 HPVs LR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
- FIG. 6 represents percentage homology between oncogenic proteins E7 HPVs LR.
- the x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
- the method is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58 and papillomaviruses ot5 comprising HPV 26, HPV, 69, HPV 51, HPV 82.
- the invention also contemplates a composition of primers comprising for E6: ct5: both SEQ ID N-44 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N.58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N.121,
- the invention also contemplates a composition of primers comprising for E7: a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N»84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127,
- the method is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses aJ comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82 and papillomaviruses ot9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44.
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N-46, SEQ ID N47 and SEQ ID N48and; ct6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9
- LI ct5 SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57
- a6 SEQ ID N-71 and SEQ ID N-72
- a7 both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90
- olO both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134
- a9 both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114.
- the invention also contemplates a composition of primers comprising for E7: ⁇ x5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and ct7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N 23 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N ° 126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, SEQ
- LI ct5 SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and 6: SEQ ID N-71 and SEQ ID N «72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and ct9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114.
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a.7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses otlO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses ot5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44 and papillomaviruses 8 comprising HPV 91, HPV 43, HPV 7, HPV 40.
- papillomaviruses a 6 comprising HPV
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N 4 and SEQ ID N 5, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; ot6: SEQ ID N-58 or both SEQ ID N ° 59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N ° 73, SEQ ID N-75 and SEQ ID N ° 76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N»77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N 17 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N 21
- the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N «67 and SEQ ID ⁇ 68, and both SEQ ID N»69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N»83, SEQ ID N-84, and both SEQ ID N°85, SEQ ID N»86; and alO: all three SEQ ID N 22, SEQ ID N423 and SEQ ID N 24, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N 27; and ct9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N ° 107, and all three SEQ ID N-108, SEQ ID N
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses ct8 comprising HPV 91, HPV 43, HPV 7, HPV 40 and papillomaviruses ctl compris
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; ct7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and ct9
- the invention also contemplates a composition of primers comprising for E7: ⁇ x5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N°68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N ° 82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and olO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N 25, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, S
- LI ct5 SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57
- a6 SEQ ID N-71 and SEQ ID N-72
- a7 both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID l ⁇ U89and SEQ ID N-90
- olO both SEQ ID N 28, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134
- ct9 both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114
- a8 SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6.
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses ct7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses ctlO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses 5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses ct9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV
- the invention also contemplates a composition of primers comprising for E6: ct5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; ot7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N*79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9
- the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N «83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N 05, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses al comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV 42, HPV
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N-44 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID IM.115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121;
- the invention also contemplates a composition of primers comprising for E7: a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N°70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV 42,
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID IM46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9:
- the invention also contemplates a composition of primers comprising for E7 : oc5: both SEQ ID N 9, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and al: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N 27; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses ct5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses ct8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses otl comprising
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; cx6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a.7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N «76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N.115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and ct
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, H PV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40, papillomaviruses al comprising HPV 42
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N-44 and SEQ ID N 5, and all three SEQ ID N46, SEQ ID N-47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID NSQ, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N.73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9
- the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N°67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N.126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, SEQ ID
- the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97, papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40, papillomaviruses al comprising HPV
- the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N 4 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N ° 58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121;
- a5 SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57
- a6 SEQ ID N-71 and SEQ ID N-72
- a7 both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90
- alO both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID ⁇ 132, SEQ ID N-133, SEQ ID N 34
- a9 both SEQ ID N 11 and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114
- a8 SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99
- the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID
- the present invention relates to the use of composition of primers describe above for diagnosis or prognosis of risk to develop HPV induced cancer in a human subject.
- Said primers can further comprise at least one of:
- the present invention relates to a composition of primers comprising at least one primer selected from SEQ ID No 153 to 158.
- Said composition can comprise 1, 2, 3, 4, 5 or the 6 primers selected from SEQ ID No 153 to 158.
- the present invention relates to a kit for diagnosis or prognosis risk to develop HPV induced cancer comprising:
- the present invention relates to a kit for diagnosis or prognosis risk to develop HPV induced cancer comprising : a) primers or probes for detecting at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both b) primers or probes for detecting at least a second marker selected from LI mRNAs of group alpha HPVs, L2 mRNAs of group alpha HPVs, or both,
- E6, E7, LI and L2 mRNAs have corresponding intragenetic sequences, c) and optionally, primers or probes for detecting at least one host cellular marker indicative of neoplasia or cancer.
- the primers can be selected from primers comprising or consisting of the nucleic acid sequence of any of SEQ ID NOs:l-152.
- the primers comprise or consist of at least 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of any of SEQ ID NOs:l-152.
- the kit can contain any of the compositions of primers described herein.
- the kit can further contain at least 1, 2, 3, 4, or more controls for the determination of R.
- the controls can contain a known ratio of E6 and/or E7 to LI and/or L2.
- the controls Preferably, contain a known ratio of E6 and E7 to LI and L2.
- the kit contains at least 1 or at least 2 controls indicating a low risk or non- persistent HPV infection.
- the kit contains at least 1 or at least 2 controls indicative of a high risk infection or associated with higher risk of developing genital neoplasia and cancer.
- the kit contains at least 1 or at least 2 controls indicating a low risk or non-persistent HPV infection and at least 1 or at least 2 controls indicating a high risk infection or associated with higher risk of developing genital neoplasia and cancer.
- the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient.
- the method comprises generating cDNA from a patient sample comprising RNA and sequencing the cDNA to generate reads of sequence of the cDNA.
- the number of reads is at least 10 6 , 5xl0 6 , 10 7 , 2xl0 7 , or 5xl0 7 reads.
- the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV-specific primers. In preferred embodiments, at least one of the primers comprises or consists of the nucleic acid sequences in Table 3.
- the method comprises discriminating HPV sequence reads on the basis of HPV species including any of the specific species referenced herein. In various embodiments, the method comprises discriminating HPV sequence reads on the basis of HPV gene transcript, including El, E2, E4, E5, E6, E7, E8, LI, and L2 transcripts.
- the transcripts can be spliced transcripts.
- the cDNA or the sequencing can be performed with HPV-specific or random primers.
- the primers comprise or consist of any of the nucleic acid sequences of SEQ. ID NOs: 1-158.
- the cDNA is generated with HPV-specific primers and the sequencing performed randomly or specifically for HPV sequences. In various embodiments, the cDNA is generated with random primers and the sequencing performed randomly or specifically for HPV sequences.
- the number of HPV sequence reads according to HPV species and/or HPV gene transcript can be determined.
- the method comprises determining the number of HPV sequence reads of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 HPV species. In one embodiment, the method comprises determining the number of HPV sequence reads of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 Alpha group HPV species.
- the method comprises calculating a ratio (R) of the number of reads of at least one early HPV transcript to the number of reads of at least one late HPV transcript.
- the HPV transcripts are Alpha group HPV species HPV transcripts, most preferably HPV16 or HPV18 transcripts. R values can be determined using any of the various formulas presented in Table 9.
- the ratio is calculated by calculating a ratio (R) of the number of reads of HPV E6 and/or E7 transcripts to the number of reads of HPV LI and/or L2 transcripts.
- the ratio is calculated by calculating a ratio (R) of the number of reads of HPV E6 and E7 transcripts to the number of reads of HPV LI and L2 transcripts.
- a higher ratio (R) correlates with an increased risk of developing high-grade malignant HPV-induced cancer.
- an R value tending towards high values above 0.5, 1, 25, 50, 100 and tending towards infinity indicates that the viral cycle is integrated, non replicating viruses expressing high level of oncogenes E6 and E7; whereas, an R value below 0.25, 0.2, 0.1, 0.05, and tending towards 0, indicates that the viral lifecycle is replicative and expressing low levels of E6 and E7.
- a higher number of reads of transcripts of HPV16, HPV18, or another high-risk HPV relative to reads of transcripts of a lower risk HPV species correlates with an increased risk of developing high-grade malignant HPV-induced cancer.
- the method comprises determining the number of reads matching the viruses based on species discrimination and determining the most prevalent high risk species present in the sample relative to other species and /or determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes.
- the invention encompasses methods for assessing a human papilloma virus (HPV) infected patient comprising generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the level of HPV sequence reads according to HPV gene transcript; determining the number of HPV sequence reads of at least one HPV early gene transcript; determining the number of HPV sequence reads of at least one HPV late gene transcript; and determining the ratio of the number of HPV sequence reads of at least one HPV early gene transcript to the number of HPV sequence reads of at least one HPV late gene transcript.
- HPV human papilloma virus
- Example 1 General amplification ct5, a6, a7 and ctlO HPVs
- a new diagnosis test comprising a set of probes for the pre amplification of E7 ct5, a6, a7 and alO HPVs mRNAs and LI ct5, a6, a7 and alO HPVs mRNAs level and which allows to assess the ratio between the expression of E7 (early gene) and LI (late gene) as a marker of the risk for a patient developing cancer
- One preferred set of primers for the pre-amplification comprises the following sequences: a 5:
- V- CTCCASCRCTCG R ACGTTCTGT -5 * (SEQ ID N-51)
- Example 2 Quantifying E6 and E7 reads versus other viral reads
- a sample of cells is collected from the cervix using a spatula or small brush and put in a conservative solution.
- RNAs are extracted from the cells using standard procedure and polyA mRIMAs are selected using standard procedures like using poly dT beads.
- Librairies are prepared using standard library preparation (RNA fragmentation and reverse transcription into double-stranded complementary DNA primed by random hexamer followed by adapter selection, or reverse transcription to single strand cDNA, ligation of cDNA and random amplification by phi 29 polymerase followed by fragmentation and adpaterligation).
- RT-PCT is conducted using set of primers for E6 and E7 and at least one another late gene as described.
- reads are mapped on a database of E6 and E7 genes: HPV genotypes expressing E6/E7 are identified. The other reads are mapped on the subset of genomes corresponding to the corresponding genotypes. Within each genotype, ratio of the number of E6/E7 reads to the reads mapped to at least one anther gene is calculated and compared to thresholds.
- Example 3 Biological samples
- HSIL high grade lesions
- Example 4 HPV database Sixty four (64) reference sequences representing the entire HPV alpha genus were retrieved from the International Human Papillomavirus Reference Center ( ; updated May 2014). Additional nine (9) sublineage sequences corresponding to HPV16, plus nine (9) sublineage sequences corresponding to HPV18 (described in Burk et al. Virology 2013) were added. The resulting eighty two (82) HPV genomes (listed in table 2) were aligned using ClustalW2 (default parameters) and the output file was analyzed using the Geneious software (Geneious 7.1.5, Biomatters Ldt).
- RT-primers HPV reverse transcription-primers
- the overall approach consists in targeting the entire early and late populations of HPV transcripts starting from a limited number of specific RT primers.
- the design is achieved by taking advantage of the sequence shared by all early and late transcripts, located in the 5' vicinity of the early and late polyA signals, respectively (figure 1). In order to minimize the number of RT primers required to cover all kind of alpha HPV, the degree of similarity between the 82 HPV genomes was taken into account.
- RT primers Additional criteria for the design of RT primers were as follows: (i) an overall good specificity of the primer aligned against all existing sequences databases (BLAST NCBI) with special attention paid in considering the 3' part of the primer, (ii) a GC content around 50% (+/-12%), (Mi) a melting temperature (Tm) > 50°C (assuming 0,2 ⁇ primers and 50mM salt), (iv) no T tracts, (v) no or low GC content in the 3' part of the primer and (vi) no or limited number of putative secondary structures.
- RNA from samples 117 and 119 were extracted using the PicoPure RNA isolation kit (Life Technologies), adding a DNAse treatment step directly on column (RNAse-free DNAse set, Qiagen) as recommended by the supplier. Elution was achieved in 30 ⁇ elution buffer. Assessment of RNA quantity and quality was done with a Nanodrop 1000 (Thermo Engineer) and a Bioanalyzer 2100 using the RNA Nano chips (Agilent).
- Random reverse transcription of total RNA was carried out using the Superscript III First-Strand cDNA Synthesis kit (Invitrogen). Briefly, 8 ⁇ of total RNA was used for template and the reaction was performed in the presence of 50nM random hexamers (provided by Invitrogen), incubated lOmin at 25°C, 50min at 50°C and 5min at 85°C before a final RNAse H treatment 20min at 37°C. The resulting cDNA were stored at -20°C.
- HPV-specific reverse transcription was carried out using the Superscript III First-Strand cDNA Synthesis kit (Invitrogen) and primed with the HPV-specific RT-primers described above. Briefly, 8 ⁇ of total RNA was used for template and reaction was performed with a 0,2 ⁇ mixture of the 6 HPV- specific RT primers, incubated 50min at 50°C and 5min at 85°C before a final RNAse H treatment 20min at 37°C. The resulting cDNA were stored at -20°C.
- HPV16 E7 and the human cellular beta-actin (ACTB) genes were used as controls of the random and HPV-specific reverse-transcription steps, respectively.
- ⁇ of reverse-transcribed cDNA was used as PCR templates in 20 ⁇ final volume, working with LightCycler DNA Master SybrGreen I reagents (Roche Diagnostics). 45 amplification cycles were achieved on a Light Cycler 480 (Roche) as follows: 95°C lOsec, 56°C lOsec, 72°C 30sec. Fusion curves and electrophoresis gels served for validation.
- a comparison of Ct values obtained by following either the random RT or the HPV RT protocol is given in table 4.
- Example 10 Whole transcriptome random amplification cDNA were randomly amplified using the Multiple Displacement Amplification (MDA) protocol with phi29 polymerase and random hexamers (Whole Transcriptome Amplification, Qiagen). Phi 29 was UV-treated for one hour before use, in order to prevent any residual DNA contaminant.
- MDA Multiple Displacement Amplification
- Phi 29 was UV-treated for one hour before use, in order to prevent any residual DNA contaminant.
- Example 11 High throughput sequencing
- Samples 117 (both random RT and HPV-specific RT) and 119 (both random RT and HPV-specific RT) were independently analyzed on two sequencing runs (300bp paired-end sequencing, TruSeq PCR- free library prep, 600 cycle kit) on a MiSeq apparatus (lllumina). fastQ data were generated and QC tests done following standard procedures. Total numbers of sequencing reads per sample are summarized in table 5.
- the sequencing of patient 117 resulted in a total of 1,455 and 126 reads (over 34,977,682) that were successfully mapped to the HPV16 (NC_001526.2) and HPV35 (JX129488.1) genomes, respectively. 15 reads (over 39675490) were mapped to the HPV16 genome for the mono-infected patient 119.
- the sequencing of patient 117 resulted in a total of 2033, 69 and 14 reads (over 28598603) for HPV16, HPV35 and HPV6 genomes, respectively. 6 reads (over 19383833) were mapped to the HPV16 genome for patient 119.
- R score a score based on HPV CDS counts and/or specific transcripts within each genotype present in a given sample , to gain a fine molecular characterization of any individual HPV-positive samples. From this perspective, either one value or a combination of more than one ratio(s) could be considered.
- a non-restrictive list of R scores is given in table 9 in order to illustrate several possible combinations based either on CDS or specific transcripts. As an example, R scores based on a ratio E6 and/or E7 and/or E2 and/or LI and/or L2 succeeded in generating high score values (highlighted) that should be associated of non- or lowly-productive HPV cycles typical of transformed cells.
- weighting coefficients such as ⁇ xE6 and/or ⁇ 7 and/or yE2 and/or 5L1 and/or eL2 can be added as parameters, independently, in order to better discriminate, for instance, low risk and high risk lesions.
- HPV6 reads were detectable in the poly-infected sample 117 only when applying the HPV RT approach, thus recovering the results of the Papillocheck gold standard genotyping test.
- HPV16 splice of HPV16 splice sites Number of reads at Number of reads at transcripts (NC_001526.2) the splice junction the splice junction
- E1C 880 2582 0 0 0 0 0
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Virology (AREA)
- Public Health (AREA)
- Medical Informatics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Epidemiology (AREA)
- Databases & Information Systems (AREA)
- Primary Health Care (AREA)
- Data Mining & Analysis (AREA)
- Biomedical Technology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Algebra (AREA)
- Bioinformatics & Computational Biology (AREA)
- General Physics & Mathematics (AREA)
- Mathematical Analysis (AREA)
- Mathematical Optimization (AREA)
- Mathematical Physics (AREA)
- Pure & Applied Mathematics (AREA)
Abstract
The present invention provides compositions, kits, and method for determining the levels of expression of human polyoma or papillomavirus species and RNA transcipts. These levels can be used for the prognosis of risk of developing virally-induced cancers. The ratio (R) between early and late transcripts is indicative of HPV infections associated with higher risk of developing genital neoplasia and cancer.
Description
BROAD RANGE GENE AND GENOTYPE PAPILLOMAVIRUS TRANSCRIPTOME AS A BIOMARKER OF
PAPILLOMAVIRUS- ASSOCIATED CANCER STAGES
Background of the invention HPV infections are associated with the development of cervix carcinoma and possibly other cancers like head and neck cancers. For example, cancer of the cervix is one of the most common cancers among women in all countries. Human papillomaviruses (HPV) are the etiologic agents responsible for over 99% of all cancers of the cervix. HPVs are DNA viruses commonly transmitted through sexual contact, which include more than 100 genotypes. Human Papillomaviruses are small, non-enveloped DNA viruses, approximately 55 nm in diameter, that infect basal cells and replicate in the nucleus of squamous epithelial cells. The genomic organization of each of the papillomaviruses is similar and can be divided into three functional regions. Following infection, the early HPV genes (E6, E7, El, E2, E4 and E5) are expressed and the viral DNA replicates from the episomal form of the virus. In the upper layer of the epithelium the viral genome is replicated further, and the late genes (LI and L2) and E4 are expressed. The shed virus can then initiate new infections.
Human papillomaviruses (HPV) are viruses displaying a high genetic diversity. About one hundred HPV types which are classified in different genus, mainly the alpha, beta and gamma genus. Within these genus, many species have been identified. HPV classification is based on the genomic sequence of the LI gene which encodes the major capsid protein. The different HPV types are characterized by their tissue tropism, and HPV types with either cutaneous or mucosal tropism can be distinguished. They are also characterized by their oncogenic potential and one can distinguish between highly oncogenic HPV types (high-risk HPV) and weakly oncogneic HPV types (low-risk HPV).
HPV infections are very common and depending on the HPV types and host immune defense, the infection disappears in 6-12 months in 90% of women. According to a recent CDC report, there are 14 million new HPV infections each year in the USA alone, which account for 50% of sexually transmitted infections (STIs). This means that 1.4 million individuals are each year at risk of developing HPV induced cancer. Two HPV vaccines have been approved, but they are not broadly used in the total population. In addition, these vaccines only cover several types such as HPV6, 11, 16 and 18 and leave unprotected a significant part of the population.
Since HPV are common viruses that can cause usually warts and because there are more than 100 types of HPV, diagnosis and disease management are complex. It is even further complicated
taken that most HPVs are deemed harmless, and so far only about 14 types have been shown to be associated with increased risk of cancer. These HPV types affect the genital tract and are transmitted through sexual contact with an infected partner. As of today, HPV types have been classified as low- risk or high-risk HPVs according to observations in clinical cohorts. Low-risk HPVs have been classified according to their association with genital warts ; whereas High-risk HPVs (HR HPVs) are identified as a limited number of types which are shown to induce cancers of the cervix, vulva, vagina, and anus in women. In men, these High-risk HPVs can lead to cancers of the anus and penis.
Cancer biomarkers in HPV-related cancers are greatly needed for a better diagnostic of pre-cancer and cancer stages of the disease, prognosis and therapeutic management.
Despite the responsibility of HR HPVs in most cervix cancers, screening tests of cancer remain mainly based on the Pap cytology test and not on HPV tests. This is largely due to the limitations of current molecular tests. HPV DNA identification of HR HPVs is not fully predictive of cancer: only high loads of HPV16 and possibility persistence for months of HR-HPVs are associated with an increased risk of cancer development. Thus, the usage of DNA HPV tests, as a screening assay, shows low positive predictive value for CIN2/3 lesions. Expression of E6 and E7 mRNAs of HR HPVs has been proposed as a better marker of cancer development, but E6 and E7 are expressed during HPV acute infection, so it remains difficult to define a threshold of expression associated to persistence and cancer development.
Low-grade intraepithelial lesions are a site of productive viral replication. Progression to high- grade intraepithelial lesions and invasive carcinomas is associated with a persistent high-risk HPV infection and often integration of the HPV genome into the host chromosomes, loss or disruption of E2 and subsequent upregulation of E6 and E7 expression. E6 and E7 are the oncogenes of the virus and expression of these genes is required for malignant transformation. Among others, E6 and E7 mediate degradation of the tumor suppressors p53 and RB, respectively, and interfere with cell- cycle regulation. E6 and E7 proteins from low-risk types are less competent in interfering with p53 and pRb functions than E6/E7 proteins from high-risk types. Therefore, low-risk HPV infections are associated with benign proliferations, such as genital warts and low-grade intraepithelial lesions prone to regress.
Different techniques are available today for detecting HPV based on DNA typing. For example, the COBAS (Roche) and APTIMA (GEN-PROBE) kits are PCR tests of specific targets intended for the qualitative in vitro detection of mRNA of the LI gene from 14 types of human papillomavirus (HPV)
virus considered High risk (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66 and 68). However, both of these HPV Assays do not distinguish the differences between the 14 High-risk types. In fact, only 6 different results are obtainable: HPV16 positive or negative, HPV18 positive or negative, others 12 HPVs positive or negative. LINEAR ARRAY HPV Genotyping Test (Roche) is a qualitative test that detects 37 high- and low-risk human papillomavirus genotypes, including those considered a significant risk factor for High-grade Squamous Intraepithelial (HSIL) progression to cervical cancer. This test is a qualitative in vitro test for the detection of Human Papilloma Virus in clinical specimens. The test utilizes amplification of target DNAs by PCR of the late gene LI of HPV DNA genotypes 6, 11, 16, 18, 26, 31, 33, 35, 39, 40, 42, 45, 51, 52, 53, 54, 55, 56, 58, 59, 61, 62, 64, 66, 67, 68, 69, 70, 71, 72, 73 (MM9) (novel type related to HPV73), 81, 82 (MM4) (novel type related to HPV82), 83 (MM7) (novel type related to HPV83), 84 (MM8) (novel type related to HPV84), IS39 and CP6108. The digene HC2 HPV DNA Test, developed by Qiagen, is based on Capture Hybridization of HPV DNAs (LI gene) for the qualitative detection of 18 types (HPV 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68 [68a], 73, 82MM4 [82IS39]) in cervical specimens.
More recently, NucliSENS EasyQ HPV was made available to qualitative detection of oncogenes E6 / E7 mRNAs of 5 specific High risk HPVs 16, 18, 31, 33 and 45. Detection of HPV E6 and E7 has been proposed as a better correlate of cancer development than HPV DNA. In addition, WO2011/088573 (Her Majesty The Queen In Right of Canada as represented by The Minister of Health), describes a set of probes to detect and Identify 46 specifically targeted species of mucosal human papillomaviruses (HPV). These probes are used as a multiplex assay based on nested PCR amplification and the Luminex xMAP technology for genotyping DNA of LI genes of HPV types 6, 11, 13, 16, 18, 26, 30, 31, 32, 33, 35, 39, 40, 42 , 43, 44, 45, 51, 52, 53, 54, 56, 58, 59, 61, 62, 66, 67, 68, 69, 70, 71, 72, 73, 74, 81, 82, 83, 84 , 85, 86, 87, 89, 90, 91 and 97.
All the molecular tests currently described for HPV identification use molecular techniques based on species/genus genotype specific oligonucleotides binding to specifically amplify and/or probe papillomavirus nucleic acids. In addition, these tests all share a specific qualitative detection restricted to some specific HPVs, but not a general and broad range of HPVs. Finally, the presence of HPV nucleic acid, especially DNA, does not mean the presence of cervical dysplasia or cervical cancer.
The inventors analyzed clinical data of cohorts of HPV infected individuals and considered that about 15% of patients are not positive for one of the classified High-risk HPVs but yet, they are at risk of developing HPV induced cancers. Therefore, there is a need to design a new HPV assay with a
transversal and broad approach not limited to few specific HPV types. Moreover, the profile expression of the viral genes must be characterized. In fact, HPV infection during cancer development is associated with a shift from productive infection towards non-productive infection characterized by a high level of E6 and E7 and low levels of expression E2 and of late genes, often associated with an integration of HPV DNA in the host chromosomes, at least for HPV16. In connection with the present invention, the inventors investigated shared homology of sequences of all HPV types and no clear global homologies are found within features between polypeptide or nucleic acid sequences. Nonetheless, the inventors designed consensus primers within all intra subgroup alpha, and provide hereafter several compositions of primers depending of the desired coverage of the test. The inventors propose here an approach for detecting cancer or risk of developing cancer not limited to the specific HPVs known today to be classified as High-risk. Thus, to bypass the limitation of the current tests above, the present invention does not rely on the above 14 H species/genotype specific oligonucleotides binding to specifically amplify and/or probe papillomavirus few DNAs or few transcripts. It relies in one aspect on identification of the different gene transcripts based on High- Throughput sequencing, which allows for further transcripts/species/genotype identification based on sequence comparison with known alpha-papillomavirus sequences in relevant databases. This has the advantage of being capable of testing simultaneously the different transcripts of a great number of papillomavirus genotypes/species and to identify relevant biomarkers along the wide range of HR and LR HPVs.
The invention also provides generic consensus primers allowing a broad amplification or pre- amplification of relevant genes of alphaPV, not depending on the specific transcripts of the 14 HR HPVs, which are amenable to PCR testing or enhance signal/noise ratio in connection with the High- Throughput sequencing mentioned above.
More particularly, the invention relates to identification of all E6/E7 transcripts in a given sample, and recognizing to which specie/genotypes they belong to, sorting the reads corresponding to other viral transcripts of the same genotype/species so as to compute ratios defining relative molecular abundance of transcripts within this (these) given genotype(s) as biomarker of cancer development.
The inventors therefore designed a kit for HPV diagnosis based on a broad screening of the level of E6 and/or E7 mRNAs within the group alpha of HPVs. In the test described in details below, the inventors designed consensus primers allowing amplification or pre-amplification E6 and/or
E7 mRNAs of genotypes of sub-group alpha to detect the level of expression of, wherein a significant expression level of E6 and/or E7 of group alpha HPVs in a single time point or over time is indicative of risk of developing HPV induced cancers. Following broad range amplification with concensus HPV primers or with HPV primers designed to perform a first step of HPV specific Reverse transcription reaction, the inventors also propose to quantitate E6 and or E7 as reads delivered by next generation sequencing techniques.
The present invention also provides a method for determining the level of expression of structural or late viral proteins such as LI or 12. In such embodiment, a ratio Rl between E6 and/or E7 and LI and/or L2 is determined, and compared to a ratio R found in low risk or non-persistent HPV infections, wherein a ratio Rl below a reference value R is indicative of HPV infections associated with higher risk of developing genital neoplasia and cancer.
General description of the invention The invention provide a high through put sequencing method allowing relative quantification of reads across oncongenic viruses, such as polyoma virus or group alpha HPV, comprising enrichment of the viral RNAs in a sample using ramdom pre-amplification and/or specific reverse transcriptase reation, determing the number of reads matching said viruses based on species discrimination, comparing the most prevalent high risk specie, further determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes. From these discriminiation steps on species and interspecies read numbers, ratios are calculated to detect increase in relative level of high risk species versus low risk species and ratios within said high risk species of reads matching oncogenic genes versus structural or regulatory genes. Applied to HPV, this test encompasses determining the level of HR HPVs reads versus LR HPVs reads through group alpha HPVs, determing the ratio of early versus late genes (E6 and or E7 versus LI and/or L2) within the most prevalent HR HPVs, and assessing risk of developing HPV induced cancer in patients which said ratio tend towards infinity. Refined ratios can be obtained using a filter applied on reads mapping specifically RNA spliced events. In one embodiment, the method is for assessing risk of developing HPV induced cancer in patients infected with at least two different HPV species of group alpha.
In one embodiment, the method is for assessing HPV virus clearance in patient receiving HPV preventive or curative HPV vaccine.
In a first aspect, the present invention relates to a method for determining a patient risk of developing oncongenic virus induced cancer, such as polyoma virus or group alpha HPV comprising: a) enrichment of the viral RNAs in a sample using random or consensus pre-amplification and/or specific reverse transcriptase reation,
b) sequencing cDNA produced in step a), and generating reads of said cDNA
c) determining the number of reads matching said viruses based on species discrimination and determining the most prevalent high risk species present in the sample relative to other species, d) determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes.
e) computing ratios within said high risk species of reads matching oncogenic genes versus corresponding interspecies structural or regulatory genes,
f) determining risk of developing oncogenic virus induced cancer in patients wherein said ratio tend towards infinity, such as for example when ratio R is between 0.25, 0.4, 0.5, 1 to infinity.
This method is suitable for diagnosis or prognosis of risk to develop virus induced cancer in a human subject.
This method is particularly suited for assessing risk of developing HPV induced cancer in patients infected with at least two different HPV species of group alpha, for example multiple infected with HPV16, HPV35 and HPV6.
This method is also specifically suitable for assessing HPV virus clearance in patient receiving HPV preventive or curative HPV vaccine. It can be performed before vaccination to confirm vaccine potential for clearing exsiting inferctions or post-vaccination for follow-up.
Ratio (R) is calculated as the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer. This method further include correlating a higher number of reads of HPV16 transcripts relative to reads of transcripts of another HPV species with an increased risk of developing high-grade malignant HPV-induced cancer. To obtain sufficient number of reads, the cDNA is generated using random primers or using HPV-specific primers.
For example, the ratio is calculated by calculating a ratio (Rl) of the number of reads of one HPV HR E6 and/or E7 transcripts to the number of reads of said one HPV HR LI and/or L2 transcripts and the ratio is calculated by calculating a ratio (R2) of the number of reads of a second HPV HR E6 and E7 transcripts to the number of reads of said second HPV HR LI and L2 transcripts. This method is applicable to determining the number of HPV sequence reads of at least 2 Alpha group HPV species, including for example HPV16.
In a specific embodiment but applied to oncogenic viruses in general such as polyoma or HPV, the method of the invention comprises:
a) Optionally, pretreating nucleic acids to remove human genomic DNA
b) Optionally, pre-amplify viral mRNAs, wherein said viral mRNAs comprises oncogenic mRNAs and at least one other mRNA,
c) sequencing mRNAs, or cDNAs thereof, obtained after steps a) and b), in the sample of a human subject,
d) identifying the reads corresponding to said oncogenic mRNAs,
e) identifying to which species or genotypes said oncogenic mRNAs of step d) belong to, f) sorting the reads corresponding to said at least one other viral mRNAs, or cDNAs thereof obtained after steps a) and b), of the same genotype or species identified in step e), g) optionally, identifying fusion transcripts as a signature of viral DNA integrations events in the host chromosome and/or additional human cancer cell biomarkers,
h) Optionally, deleting all other sequences including human sequences which are not sequences identified and sorted following steps d), e), f) and g),
i) computing ratios R defining molecular abundance of said oncogenic mRNAs relative to said at least one other viral mRNAs of the same genotype or species of step f),
wherein an increased of ratios R correlate with an increased risk of developing viral induced cancer.
By virus induced cancer, it is more particularly contemplated herein Papova virus induced cancer, more specifically Papilloma or Polyma virus induced cancer.
By other viral mRNAs in step f) it is meant mRNAs of viral genes selected from structural genes, for example capsid genes as well as from regulatory genes, and replication/transcription genes.
In a particular embodiment, the present invention relates to a method for diagnosis or prognosis of risk to develop HPV induced cancer in a human subject comprising:
a) Optionally, pretreating nucleic acids to remove human genomic DNA
b) Optionally, pre-amplify HPVs mRNAs, wherein said mRNAs comprises E6 and/or E7 HPV RNAs and at least one other HPV mRNAs,
c) sequencing nucleic acids in the sample of a human subject or obtain after steps a) and b), d) identifying the reads corresponding to E6 and/or E7 HPV RNAs,
e) identifying to which species or genotypes E6 and/or E7 HPV mRNAs of step d)belong to, f) sorting the reads corresponding to other viral HPV mRNAs of the same genotype or species identified in step e),
g) optionally, identifying fusion transcripts as a signature of HPV DNA integrations events in the host chromosome and/or additional human cancer cell biomarkers,
h) Optionally, deleting all other sequences including human sequences which are not sequences identified and sorted following steps d), e), f) and g),
i) computing ratios defining molecular abundance of E6 and/or E7 HPV mRNAs relative to said other viral transcripts of the same genotype or species of step f),
wherein an increased level of said ratios correlates with an increased risk of developing viral induced cancer. By other viral mRNAs in step f), it is more particularly referred to selected mRNAs from genes coding for capsid proteins (LI and L2), gene coding for the growth stimulation protein (E5), genes coding for replication or transcription proteins (E4, E2 and El, E8). In step g), additional human cancer cell biomarkers can be selected for example from PRC1, CCNB2, SYCP2 CDKN3, NUSAP1, CDC20, pl6INK4a , Ki-67.
In one specific embodiment, step f) comprises sorting the reads of LI and/or L2 HPV mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs identified in step d). In this embodiment, step h) comprises computing ratios defining relative molecular abundance of E6 and/or E7 HPV mRNAs relative to the reads of LI and/or at least one other viral mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs. In such embodiment, step b) optionally comprises pre-amplifying HPVs mRNAs, wherein said mRNAs comprises E6 and/or E7 HPV RNAs and LI and/or at least one other viral HPV mRNAs.
In a second aspect, the present invention relates to a method for diagnosis risk to develop HPV induced cancer comprising:
(a) determining the level of at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both, in the sample of a patient or in the sample of an individual suspected to be infected by HPV,
(b) comparing the levels determined in step (a) to a reference value of E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both in low risk individuals infected with HPVs
(c) wherein an increased level as determined in step a) compared to the reference level in step b) is indicative of higher risk to develop HPV cancer induced.
It must be contemplated that these biomarkers are not restricted to E6 or E7 mRNAs of HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 but extend to all E6 or E7 mRNAs of HPVs of several genus
alpha, comprising and covering HPVs of groups cx5, 6, 7, 10; optionally extending to additional alpha group HPVs as desired
In this second aspect, the levels of E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both are determined inter alia by hybridization with a labeled probe, amplification, including PCR, nucleic acid microarrays, high-throughput sequencing with or without pre-amplification. The measure may be carried out directly on an extracted messenger RNA (rnRNA) sample, or on retrotranscribed complementary DNA (cDNA) prepared from extracted rnRNA. From the rnRNA or cDNA sample, the amount of nucleic acid transcripts is determined using nucleic acid microarrays, quantitative PCR, hybridization with a labeled probe, or directly by counting corresponding reads following high-throughput sequencing.
For both first and second aspect, amplification or pre-amplification is depicted in details below with specifically designed consensus primers allowing generic pre-amplification of all or desired HPVs belonging to group alpha. According to the invention, primers depicted below are provided to amplify and detect the amount of E6 mRNAs and E7 mRNAs of all or several group alpha HPVs depending of the desired scope of the test. Therefore, the invention provides a much broader test extending beyond types such as HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 which are today classified as High-risk HPVs; as it allows the determination of high level expression of E6 and/E7 of several alpha subgroups of HPVs and even covering the all HPVs of the alpha group.
For example, In the above method, the quantification is performed on E6 and/or E7 mRNAs of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58 and papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82. The combined generic consensus primers to generically amplify alpha subgroups are described herein-after.
In a specific embodiment, the method of the invention further refines the above method aiming at the quantitative determination of expression levels of a panel of biomarkers in biological samples of patients or individuals suspected to be infected with HPVs, which combined biomarkers are indicative and /or predictive, in a single time-point, of patients at risk of developing HPV induced cancers.
The panel provided by the invention comprises the following biomarkers:
At least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both
At least a second marker selected from LI mRNAs of group alpha HPVs, L2 mRNAs of group alpha HPVs, or both,
wherein said E6, E7, LI and L2 mRNAs have corresponding intragenetic sequences,
Optionally, at least one host cellular marker indicative of neoplasia or cancer.
For example, the panel is composed of at least 5, 10, 20, 30 or 50 different mRNAs of said E6, E7, LI and L2 mRNAs of group alpha HPVs. In one specific embodiment, the panel is composed of all group alpha HPVs mRNAs of E6 and/or E7, and LI and/or L2. The combined generic consensus primers to generically amplify alpha subgroups depending on the desired scope of the test are provided herein- after. Alternatively, the invention is performed using sequence-independent-amplified or direct HT- sequencing for quantitative detection of individual mRNA of E6 and/or E7 HPV sequences belonging to the HPV alpha group.
Such method according to the invention is also provided for predicting the progression of HPV infection in a patient suffering from HPV infection.
In one embodiment, the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient comprising: generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV specie; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the number of HPV sequence reads according to HPV species and HPV gene transcript, determining the number of HPV sequence reads of at least 2 HPV gene transcripts; and determining the number of HPV sequence reads of at least 2 HPV species; wherein the patient sample contains 2 or more HPV species. In a further embodiment, the method comprises calculating a ratio (R) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
In another embodiment, the method comprises correlating a higher number of reads of HPV16 transcripts relative to reads of transcripts of another HPV species with an increased risk of developing high-grade malignant HPV-induced cancer.
In one embodiment, the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV-specific primers.
In one embodiment, the ratio is calculated by calculating the ratio (R) of the number of reads of HPV16 E6 and/or E7 transcripts to the number of reads of HPV16 LI and/or L2 transcripts. In one embodiment, the ratio is calculated by calculating the ratio (R) of the number of reads of HPV16 E6 and E7 transcripts to the number of reads of LI and L2 transcripts. In one embodiment, the method comprises determining the number of HPV sequence reads of at least 2 Alpha group HPV species. In one embodiment, the method comprises generating at least 106 reads of sequence of the cDNA. In one embodiment, the method comprises generating at least 107 reads of sequence of the cDNA
In one embodiment, the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient comprising generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the level of HPV sequence reads according to HPV gene transcript; determining the number of HPV sequence reads of at least one HPV early gene transcript; determining the number of HPV sequence reads of at least one HPV late gene transcript; and determining the ratio of the number of HPV sequence reads of at least one HPV early gene transcript to the number of HPV sequence reads of at least one HPV late gene transcript.
In one embodiment, the method comprises calculating a ratio (R) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
In one embodiment, the at least one early transcript is HPV E6 or E7 and the at least one late transcript is LI or L2. In one embodiment, the at least one early transcript is HPV E6 and E7 and the at least one late transcript is LI and L2.
In one embodiment, the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV specific primers.
Some of the terms used throughout the specification are specifically defined here below: Definitions
Biological samples as referred herein include, without limitation, mammalian bodily fluids, especially oral fluids or scrapings, genital scrapings, in particular cervix scrapings.
HPV Alpha group: HPVs are contained within five evolutionary groups. HPV types that infect the cervix come from the Alpha group which contains over 60 members. HPV types from the Beta,
Gamma, Mu and Nu groups or genus primarily infect cutaneous sites. Alpha papillomaviruses can be subdivided into three categories (high risk, low risk and cutaneous), depending on their prevalence in the general population and on the frequency with which they cause cervical cancer. High-risk types come from the Alpha 5, 6, 7, and 10 groups.
Primers encompassed by the invention are not limited to the sequences defined in the primers depicted below but they can comprise extra bases at the 5' end, for example from 1 to 5 extra bases as extension corresponding to sequences of the corresponding HPVs E6 or E7. Also, primers shall be understood as embracing shorter sequences of at least 12, 15, 20 or 25 consecutive bases of the primers featured below. In some embodiments, it shall be understood that the invention also contemplates generic probes which have the sequences of the primers depicted herein and which are directly or indirectly labeled. The probes and primers can be extended or swifted from 1 to 15 bases depending on the desired specificity of the PCR amplification step and/or on the specificity of the detection step using standard parameters such as the nucleic acid size and GC contents, stringent hybridization conditions and temperature reactions. For example, low stringency conditions are used when it is desired to obtain broad positive results on a range of homologous targets whereas high stringency conditions are preferred to obtain positive results only if the specific target nucleic is present in the sample. As used herein, the term "stringent hybridization conditions" refers to conditions under which the primer or probe will hybridize only to that exactly complementary target(s). The hybridization conditions affect the stability of hybrids, e.g., temperature, salt concentration, pH, formamide concentration and the like. These conditions are optimized to maximize specific binding and minimize non-specific binding of primer or probe to its target nucleic acid sequence. Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequences at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe or primer. Typically, stringent conditions will be those in which the salt concentration is less than about 1.0 M Na+, typically about 0.01 to 1.0 M Na+ concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes or primers (e.g. 10 to 50 nucleotides) and at least about 60°C for long probes or primers (e.g. greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringent conditions include hybridization with a buffer solution of 20-30% formamide, 1 M NaCI, 1% SDS at 37°C and a wash in 2*SSC at A0°C. Exemplary high stringency conditions include hybridization in 40-50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0.1*SSC at 60°C. Determination of particular hybridization conditions relating to a specified
nucleic acid is routine and is well known in the art, for instance, as described in J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and F.M. Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002. Preferred PCR primers, which can be used separately or together as a set to amplify a HPV nucleic acid sequence comprise the primers. al:
• E6
Forward: 5'- RGTACWTCTGCCTCATCACAGCC -3" (SEQ ID N-l)
Reverse: 3'- CTCTGCAMTGSGTACASCGAC -5' (SEQ ID N-2)
• E7
Forward: S - GGARASRCRCCWACSCTAAAGGA -3~ (SEQ ID N-3)
Reverse: 3'- CACGCRGGCACACAAWGGACA -5 (SEQ ID N-4)
· LI
Forward: 5%- G CG GCCTAGTG AC R AC AAG G -3* (SEQ ID N-5)
Reverse: 3 - GCACGYAACCCRGCYTGCAG -5 (SEQ ID N-6) cx2:
· E6
Forward: 5 - GHGHGCCMTAYGSTGCCTGTG -3' (SEQ ID N-7)
Forward: 5 - CKCCSTACGGTGCWTGTGC -3' (SEQ ID N-8)
Reverse: 3~- GCGGACCGTGCATCKTRWCCA -5s (SEQ ID N-9)
Reverse: 3'- G G CTTTGG CCC ATG CATCGT -5' (SEQ ID Ν·10)
Reverse: 3'- GTGCATCGTGACCAGCAGTAC -5' (SEQ ID N-ll)
• E7
Forward: 5'- TTGRDTCTTGCACCAGAGGMCGT -3' (SEQ ID Ν·12)
Forward: 5'- TGCACGGTCCGCATCCCAC -3' (SEQ ID N 3)
Forward: 5'- TGTCTATGGGTGCACAAGAACCC -3* (SEQ ID N-14)
Reverse: 3 - CCCTT ATATCTG C TSGCTGCWS -5' (SEQ ID N-15)
Reverse: 3'- GCAGCGAGGRCACACGASC -5* (SEQ ID N-16)
Reverse: 3'- GGACCGTGCATCGTGACCA -5' (SEQ ID N-17)
• LI
Forward: 5'- ATGGCWYTSTGGCGCYCTAGTG -3' (SEQ ID N-18)
Reverse: 3~- CCTCC A G CTAGTRG AYGG YG G Y -5' (SEQ ID N-19)
Reverse: 3'- G GG ACYACYG AACG M CG KCGCG -5" (SEQ ID N-20) a3:
· E6
Forward: 5'- AGTGGACRGGRAAGTGCWGCAAC -3" (SEQ ID N-21)
Forward: 5'- YTGTGCAAAGACTGCGASGTGG -3~ (SEQ ID N-22)
Forward: 5'- ACTGGCCATTTGGAGTMTGCGC -3' (SEQ ID N»23)
Reverse: 3*- GGCCRYGCATGTTRCYCTACAGT -5' (SEQ ID N-24)
Reverse: 3'- CACYKTCCTGTCCACTBYCCWGC -5" (SEQ ID N-25)
Reverse: 3 - CC AGTG YCGTAG CTC YCG YRYC -5' (SEQ ID N-26)
Reverse: 3'- CTGGCCGTGCATRSYCCTCT -5¾ (SEQ ID N-27)
• E7
Forward: 5'- VAGCAMAGCWGGCCYWTAGGGTG -3' (SEQ ID N-28)
Forward: 5*- KGYWGAACRRGCACAGCAGGCC -3" (SEQ ID N-29)
Reverse: 3'- GGCCACYRCKTCCACYATAAGCT -5' (SEQ ID N-30)
Reverse: 3'- CAGCYGGGACACACTATRTCCAC -5' (SEQ ID N-31)
Reverse: 3 - G CGC AG CSVG G AC ACACTAT -5' (SEQ ID N-32)
• LI
Forward: 5'- CTWTGTGGCGRCMTGGTGAYGGC -3' (SEQ ID N-33)
Reverse: 3 - GGARGGAGGGGGCAMWACMCC -5' (SEQ ID N-34)
Reverse: 3 - CCCTG BG CVCG NTG YAG CC A R -5' (SEQ ID N-35) a 4:
· E6
Forward: 5~- SAGTATGGTYTGGAGCTAGAGGA -3' (SEQ ID N-36)
Reverse: 3 - GTCCSGTCCAC YG G CCKG M -5' (SEQ ID N-37)
• E7
Forward: 5'- MCGMCCCAGCCTSRMGGAC -3" (SEQ ID N-38)
Reverse: 3*- CCTCCATRACGCTABGCGCAG -5¾(SEQ ID N-39)
• LI
Forward: 5'- TGGCCTAAACGACGTAAACGTGT -3* (SEQ ID N 0)
Forward: 5'- TTCTTTGCAGATGGCTWTGTGGC -3'(SEQ ID N-41)
Reverse: 5X- YGTGTCTCG MAARCGCRCCGC -3% :: 3'- GCGGYGCGYTTKCGAGACACR -5'(SEQ ID N-42)
Reverse: 5'- CGCAAGTTYTTRYTGCAGCGGGG -3" :: 3~- CCCCGCTGCARYAARAACTTGCG -5'(SEQ ID N43) a 5:
• E6
Forward: 5 - GRGAAAGACCACGAACGCTGC -3' (SEQ ID N44)
Forward: 5'- AATAGCAGGGYASTGGAAAGGGT -3' (SEQ ID N45)
Reverse: 3'- GCAATTWGCRCAYTGYCCCGTCC -5' (SEQ ID N46)
Reverse: 3"- TTGTGTTTCTGTTTGGCGCCTTG -5' (SEQ ID N47)
Reverse: 3'- G CCTTG GTCTCCAG C AGTTTG -5'(SEQ ID N48)
• E7
Forward: 5~- YTAG ATYTG GTG CCG C AACCCG -3" (SEQ ID N49)
Forward: 5'- M G CCATG CGTG GTAATGTACCAC -3' (SEQ ID N°50)
Reverse: Ϊ- CTCCASCRCTCGRACGTTCTGT -5' (SEQ ID N«51)
Reverse: 3'- CACGGGCAMACCAGGCTTAGK -5~ (SEQ ID N-52)
• LI
Forward: 5'- KCAGATGGCYTTGYGGCGTACTA -3' (SEQ ID N-53)
Forward: 5'- TG G C YTTG YG GCGTACTAGTG AC -3" (SEQ ID N-54)
Forward: 5~- TGTATTTRCCACCTGCACCWGTG -3' (SEQ ID N°55)
Reverse: 3'- GGGGCRTYRCGYTGACAKGTAGT -5' (SEQ ID N-56)
Reverse: 3~- GGCMGGSCKTTTAAGGCCTGGT -5' (SEQ ID N-57) a 6:
• E6
Forward: 5'- G A RCG H CC ACG WAS H BTG C ACC -3' (SEQ ID N-58)
Forward: 5'- AATACAGRMGAGCGMCCACGTAC -3" (SEQ ID N-59)
Forward: 5'- RCAATMCACAGGAACGTCCACGA -3' (SEQ ID N-60)
Reverse: 3*- CCTCTGGTGTCAACGGMTGTTGA -5* (SEQ ID N-61)
Reverse: 3'- TCTCCARCACYSCAAACATGACC -5' (SEQ ID N-62)
• E7
Forward: 5'- GRACAGCTCAGAGGAWGAGGATG -3 (SEQ ID IM-63)
Forward: 5'- GCTCAGAGGAWGAGGATGAGG -3' (SEQ ID N-64)
Forward: 5'- YTRC WG RAG C RG CCAC AG C A AG C -3" (SEQ ID N°65)
Forward: 5'- GRAGCRGCCACAGCAAGCTAG -3" (SEQ ID N-66)
Forward: 5*- GAACAGCTCAGAGGAWGAGGATG -3' (SEQ ID N-67)
Forward: 5'- ARTAGACCATTTGCWGGAGCGGC -3' (SEQ ID N-68)
Reverse: 3~- GCCTTGTTGCRCASAGGGG -5" (SEQ ID N-69) Reverse: 3'- CGCAGAGTGGGCACGTTACT -5' (SEQ ID N-70)
• LI
Forward: 5'- TTGCAGATGGCGRYGTGGCG -3' (SEQ ID N-71) Reverse: 3~- CACCTAAAGGYTGDCCDCGGC -5~(SEQ ID N-72) a 7:
• E6
Forward: 5%- TASAGGACAGTGYCGMCRSTGC -3' (SEQ ID N-73) Forward: 5'- TCMCAAYCCTGMRGAACGGCCAT -3% (SEQ ID N-74)
Forward: 5'- ASAGGACAGTGTCGYSGGTG -3' (SEQ ID N-75)
Forward: 5'- TGCCAGAAACCRTTGAAYCCAGC -3' (SEQ ID N-76)
Reverse: Ϊ- GTCTGCGGTCCTCYCGBTTDST -5' (SEQ ID N-77)
Reverse: 3'- CTGSCCTCKRTASTGCCCAGCT -5* (SEQ ID N-78) Reverse: 3'- CACCAGTGTTTCACTACGCGC -5%(SEQ ID N-79)
Reverse: 3"- GCCTTGCTGTTCTTGTGCACG -51 (SEQ ID N-80)
Reverse: 3'- GTCTGGAAAGCCTTTCTTGCCGT -5% (SEQ ID N-81)
• E7
Forward: 5 - GACGRGMHGAACMACARCGTCAC -3¾ (SEQ ID N-82) Forward: 5 - GACGRGMHGAACMACAGCGTCAC -3' (SEQ ID N-83) Forward: 5¾- ARCACCYTGTCCTTTGTGTGTCC -3' (SEQ ID N-84) Reverse: 3'- GTGWSTCCATAAACAGCWGCWGT -5* (SEQ ID N-85) Reverse: 3 - CACACCAMGGACACACAAAGGAC -5' (SEQ ID N»86)
• LI
Forward: 5'- GCGBTCTAGYGACARCAHGGTGT -3 (SEQ ID N-87) Forward: 5'- HCCTGCTATTGGKGARCAYTGGG -3 (SEQ ID N-88) Reverse: 3'- CCAGTGYTCYCCMATRGCRGGWA -5' (SEQ ID N-89) Reverse: 3'- TAGASCCACTDGGWGANGGRGAA -5' (SEQ ID Ν·90) a 8:
• E6
Forward: 5'- WATGWCTGCACGKWGCKGCTCC -3* (SEQ ID N-91) Reverse: 3 - GTAGGCARTATCCYTTCCACRCG -5 (SEQ ID N-92) Reverse: 3X- CTCCGAGCGTTGGCCTTTC -5' (SEQ ID N-93)
• E7
Forward: 5'- GCGTGAGCAAYCCACGCAAC -3~ (SEQ ID N-94) Reverse: 3'- CAGCCATKGYAGTCACACMGCTG -5' (SEQ ID N-95) Reverse: 31- TG CC ATTGTTGTCAC KCTGTAG C -5* (SEQ ID N-96) · LI
Forward: 5'- CCYCCHATKGGNGAATATTGGGG -3' (SEQ ID N-97) Reverse: 3 - GGAGGATGGTGCWGMACGC -5' (SEQ ID N-98) Reverse: 3'- GGGTGACTGRCYYAGAAGAGGAA -5' (SEQ ID N-99) a 9:
• E6
Forward: 5*- AGTRMARATGCCTCCACGYCTGC -Ϊ (SEQ ID N 00) Forward: 5¾- CTGCACAGGACCAG ATG G C -3' (SEQ ID N-101) Reverse: 3'- TCCATGCATGWTGWCCAGCARTG -5' (SEQ ID N-102) Reverse: 3'- G C AG CG CCYTTCC AG GTRTCK -5' (SEQ ID N-103) Reverse: 3'- GGCATTTCGCCCACCATTGTTAT -5' (SEQ ID N-104)
• E7
Forward: 5'- G CYTAC ACTG CTG G AC AACATG C -3' (SEQ ID N-105) Forward: 51- AGACAGCTCAGAAGABGAGGTGG -3' (SEQ ID Ν·106) Forward: 5*- AACAATGGTGGGCGAAATGCCAG -3' (SEQ ID N-107) Reverse: 31- CGTCCGCCATCSTTGTTATGKYT -5, (SEQ ID N-108) Reverse: 3'- CCTGTRCACTSCAC ACMAGCC -5" (SEQ ID N-109) Reverse: 3 - CTGTCGCTGTAGGGTGCACA -5'(SEQ ID N 10)
• LI
Forward: 5*- ATGTGCCTCCTCCYRMCCCWGTA -3' (SEQ ID N-lll) Forward: 5'- AGATGGCTGTCTGGTTACCAGC -3" (SEQ ID N-112) Reverse: 3'- CCATAWGG RTCYGCAGCCATTTG -5' (SEQ ID N-113) Reverse: 3'- G CCTTACG CCTG CG CTTGG -5' (SEQ ID N-114) a 10:
• E6
Forward: 5'- CCS A RSTGTAAWC ATG C RTGG AG -3' (SEQ ID N-115) Forward: 5'- MCGSAMCCTGCACGAATTGTGTG -3' (SEQ ID N-116) Forward: 5"- CARGACRCWGAGGARAAACCACG -3~ (SEQ ID N-117)
Reverse: 3*- CCAACACWCTGAACASCGYCC -5' (SEQ ID N-118) Reverse: 3'- CCATGCATGATTACASCTSGGTT -5" (SEQ ID N 19) Reverse: 3'- GTCG GG RYCTCC A ACAC RC YG -5' (SEQ ID N-120) Reverse: 3'- CTCCACGCATGTTTACACTTGGG -5* (SEQ ID N-121) · E7
Forward: 5'- GCWCAYTWGGAATHGTGTGCCCC -3' (SEQ ID N-122) Forward: 5'- CSTGTAAMAACGCCATGAGAGGA -3¾ (SEQ ID N-123) Forward: 5 - CGCCATGAGAGGAMACAASCCA -3' (SEQ ID N-124) Reverse: 3'- G GC AC AC D ATTCC W A RTG WG CCC -5 (SEQ ID N-125) Reverse: 3'- G GTTCGTASGTC RSTTG YTGTAC -5' (SEQ ID N-126) Reverse: 3~- GTG C ACAGS YG G G RCACAC W AYT -5% (SEQ ID N-127)
• LI
Forward: 5'- G A RG CC AC WGTSTACYTG CCTC -3' (SEQ ID N-128) Forward: 5 - ACAGATGTCTCTGTGGCGGC -3' (SEQ ID N-129) Reverse: 3'- GGATG CCACTWAYRCCHACDCC -5' (SEQ ID N-130) Reverse: 3'- GAGGWWACCATAGARCCACTRGG -5' (SEQ ID N 31) Reverse: ?- GTGCACGYTGTAGCCAATAWGGC -5' (SEQ ID N-132) Reverse: 3"- TCCTGTAAACTRGCAGAYGGAGG -5 (SEQ ID N-133) Reverse: 3'- GG CCYTGTG CWCGTTG YA ACC AA -5' (SEQ ID N-134) a 11:
• E6
Forward^- GAACGRCCATACAAGCTACMAGC -31 (SEQ ID N-135) Reverse: 3'- G CAG ATG GTCTCCAG C ACYG -5" (SEQ ID N-136) · E7
Forward: 5 - WATTGTGTGCCCCAACTGTTCCA -3' (SEQ ID N-137) Reverse: 3'- CTGGAACAGTTGGGGCACACA -5' (SEQ ID N-138)
• LI
Forward: 5'- AGTTCTATCTTCCTCCCCAGCC -3% (SEQ ID N 39) Reverse: 3'- GGACGKGCACGCATACCWAG -5% (SEQ ID N-140) a 13:
• E6
Forward: 5'- TGTCTGCTACTGAACCCCACAC -3' (SEQ ID N-141)
Reverse: 3 - GGCTTCCAGCAATGTAGACACC -5' (SEQ ID ΝΊ42)
• E7
Forward: 5^- GTTTGACCTGTACTGCAGGGAG -3' (SEQ ID N-143)
Reverse: 3~- GTGAAGCACAGGTGGGACACA -5* (SEQ ID N-144)
· LI
Forward: 5'- AAAGTATACCTGCCTCCTACCCC -3λ (SEQ ID N-145)
Reverse: 3 - G C ACG CTTG CG CG CTGTAC -5' (SEQ ID N-146) a 14:
· E6
Forward: 5'- TAYS A STG G ACCTG C AG G ACC -3" (SEQ ID N-147)
Reverse: 3'- GGCCWYGCATGRTKTCCAACACT -5"(SEQ ID N-148)
• E7
Forward: 5'- CAATTWGCCAGCTCAGAMGAGGA -3' (SEQ ID N-149)
Reverse: 3'- CCACCACM AG CCTW ACTG YAC R V -5' (SEQ ID N-150)
• LI
Forward: 5X- ARGTATACCTGCCTCCYGCCC -3' (SEQ ID N-151)
Reverse: 3'- CCTGTG CWCGTTG YAG CC AG -5' (SEQ ID N-152) As used herein, G is used to designate Guanine, A is used to designate Adenine, T is used to designate a Thymine, C is used to designate a Cytosine. R is commonly used to designate a Purine (A or G), Y is commonly used to designate a Pyrimidine (T or C), W is commonly used to designate A or T, S is commonly used to designate C or G, K is commonly used to designate G or T, H is commonly used to designate A or T or C, B is commonly used to designate G or C or T, V is commonly used to designate G or A or T, D is commonly used to designate G or A or T, N is commonly used to designate any nucleotide (A or T or C or G).
Addition of indices and sequencing adapters are needed for sequencing technologies and can be added by standard procedures. For example, said primers can be used in solution or linked to a solid support. To permit its covalent coupling to the support, the primer is generally functionalized. Thus, it may be modified by a thiol, amine or carboxyl terminal group at the 5 Or 3' position. In particular, the addition of a thiol, amine or carboxyl group makes it possible, for example, to couple the oligonucleotide to a support bearing disulphide, maleimide, amine, carboxyl, ester, epoxide, cyanogen bromide or aldehyde functions. These couplings form by establishment of disulphide, thioether, ester, amide or amine links between the primer and the support. Any other method
known to a person skilled in the art may be used, such as bifunctional coupling reagents, for example.
Moreover, to improve the hybridization with the coupled oligonucleotide, it can be advantageous for the oligonucleotide to contain an "arm" and a "spacer" sequence of bases. The use of an arm makes it possible, in effect, to bind the primer at a chosen distance from the support, enabling its conditions of interaction with the DNA to be improved. The arm advantageously consists of a linear carbon chain, comprising 1 to 18 and preferably 6 or 12 (CH2) groups, and an amine which permits binding to the column. The arm is linked to a phosphate of the oligonucleotide or of a "spacer" composed of bases which do not interfere with the hybridization. Thus, the "spacer" can comprise purine bases. As an example, the "spacer" can comprise the sequence GAGG. The arm is advantageously composed of a linear carbon chain comprising 6 or 12 carbon atoms.
For implementation of the present invention, different types of support may be used. These can be functionalized chromatographic supports, in bulk or prepacked in a column,_functionalized plastic surfaces or functionalized latex beads, magnetic or otherwise. Chromatographic supports are preferably used. As an example, the chromatographic supports capable of being used are agarose, acrylamide or dextran as well as their derivatives (such as Sephadex, Sepharose, Superose, etc.), polymers such as poly(styrene/divinylbenzene), or grafted or ungrafted silica, for example. The chromatography columns can operate in the diffusion or perfusion mode. As used herein, the term "sequencing" is used in a broad sense and refers to any technique known by the skilled person including but not limited to Sanger dideoxy termination sequencing, whole- genome sequencing, sequencing by hybridization, pyrosequencing, capillary electrophoresis, cycle sequencing, single-base extension sequencing, solid- phase sequencing, high-throughput sequencing, massively parallel signature sequencing (MPSS), sequencing by reversible dye terminator, paired-end sequencing, near-term sequencing, exonuclease sequencing, sequencing by ligation, short-read sequencing, single-molecule sequencing, sequencing-by-synthesis, real-time sequencing, reverse- terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD( ) sequencing, MS-PET sequencing, mass spectrometry, and a combination thereof. In specific embodiments, the method and kit of the invention is adapted to run on ABI PRISM( ) 377 DNA Sequencer, an ABI PRISM(R) 310, 3100, 3100-Avant, 3730, or 3730x1 Genetic Analyzer, an ABI PRISM(R) 3700 DNA Analyzer, or an Applied Biosystems SOLiD(TM) System (all from Applied Biosystems), a Genome Sequencer 20 System (Roche Applied Science).
For all technologies described herein, although the said primers can be used in solution, in another embodiment the said primers are linked to a solid support.
To permit its covalent coupling to the support, the primer is generally functionalized. Thus, it may be modified by a thiol, amine or carboxyl terminal group at the 5 ' or 3' position. In particular, the addition of a thiol, amine or carboxyl group makes it possible, for example, to couple the oligonucleotide to a support bearing disulphide, maleimide, amine, carboxyl, ester, epoxide, cyanogen bromide or aldehyde functions. These couplings form by establishment of disulphide, thioether, ester, amide or amine links between the primer and the support. Any other method known to a person skilled in the art may be used, such as bifunctional coupling reagents, for example.
Moreover, to improve the hybridization with the coupled oligonucleotide, it can be advantageous for the oligonucleotide to contain an "arm" and a "spacer" sequence of bases. The use of an arm makes it possible, in effect, to bind the primer at a chosen distance from the support, enabling its conditions of interaction with the DNA to be improved. The arm advantageously consists of a linear carbon chain, comprising 1 to 18 and preferably 6 or 12 (CH2) groups, and an amine which permits binding to the column. The arm is linked to a phosphate of the oligonucleotide or of a "spacer" composed of bases which do not interfere with the hybridization. Thus, the "spacer" can comprise purine bases. As an example, the "spacer" can comprise the sequence GAGG. The arm is advantageously composed of a linear carbon chain comprising 6 or 12 carbon atoms.
For implementation of the present invention, different types of support may be used. These can be functionalized chromatographic supports, in bulk or prepacked in a column, functionalized plastic surfaces or functionalized latex beads, magnetic or otherwise. Chromatographic supports are preferably used. As an example, the chromatographic supports capable of being used are agarose, acrylamide or dextran as well as their derivatives (such as Sephadex, Sepharose, Superose, etc.), polymers such as poly(styrene/divinylbenzene), or grafted or ungrafted silica, for example. The chromatography columns can operate in the diffusion or perfusion mode.
As used herein, "oncogenic genes or oncogenic m NAs" refers to genes or mRNAs which are directly or indirectly inducing cell transformation into cancer cells development. For example, oncogenic genes are used to designated E6 genes and /or E7 genes. As used herein, "other viral mRNAs" refers to mRNAs coding for capsid proteins (LI and L2), mRNAs coding for the growth stimulation (E5), mRNAs coding for replication/transcription (E4 and E2) and mRNAs coding for replication (El and E8), which are not oncogenic genes.
R ratios as used herein are defined as the relative level of an oncogenic mRNA, for example E6, E7 or E6 + E7, compared to other viral mRNAs of the same genotype or specie, more particularly compared
to selected mRNAs from genes coding for capsid proteins (LI and L2), gene coding for the growth stimulation protein (E5), genes coding for replication or transcription proteins (E4, E2 and El, E8). For example, a reference Ratio R can be defined as
R =∑(xE6 and/or xE7) /∑(xLl and/or xL2 and/or xE2....) Wherein x is a factor in the range 0-1000000,
Wherein xE6 is for example either the number of reads mapped to the gene Ex, or the number of times each nucleotide of the gene Ex is sequenced,
And Wherein xLl is for example the number of reads mapped to the gene Lx, or the number of times each nucleotide of the gene Lx is sequenced. Drawings
FIG. 1 represents percentage homology between oncogenic proteins E6 HPVs HR and LR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HPVs compared to LR HR HPVs.
FIG. 2 represents percentage homology between oncogenic proteins E7 HPVs HR and LR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HPVs compared to LR HR HPVs.
FIG. 3 represents percentage homology between oncogenic proteins E6 HPVs HR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
FIG. 4 represents percentage homology between oncogenic proteins E7 HPVs HR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of H HPVs.
FIG. 5 represents percentage homology between oncogenic proteins E6 HPVs LR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
FIG. 6 represents percentage homology between oncogenic proteins E7 HPVs LR. The x-axis corresponds to HR-HPVs and y-axis represents the percentage of the nucleotide sequences homology of HR HPVs.
Detailed description
Referring to both first and second aspect, and in a first specific embodiment, the method is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58 and papillomaviruses ot5 comprising HPV 26, HPV, 69, HPV 51, HPV 82.
In this regard, the invention also contemplates a composition of primers comprising for E6: ct5: both SEQ ID N-44 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N.58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N.121,
And comprising for LI «5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and ct6: SEQ ID N-71 and SEQ ID N-72; and J; both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7: a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N»84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134.
In a second specific embodiment the method is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses aJ comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO
comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82 and papillomaviruses ot9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44. In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N-46, SEQ ID N47 and SEQ ID N48and; ct6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID Ν·101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104,
And comprising for LI ct5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and olO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7: <x5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and ct7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N 23 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N°126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, SEQ ID N 09 and 110,
And comprising for LI ct5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and 6: SEQ ID N-71 and SEQ ID N«72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and ct9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114.
In a third specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a.7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses otlO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses ot5
comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44 and papillomaviruses 8 comprising HPV 91, HPV 43, HPV 7, HPV 40.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N 4 and SEQ ID N 5, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; ot6: SEQ ID N-58 or both SEQ ID N°59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N°73, SEQ ID N-75 and SEQ ID N°76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N»77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N 17 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N 21; and a9: both SEQ ID N 00 and SEQ ID N 01 and all three SEQ ID N402, SEQ ID N403 and SEQ ID N404; and a8: SEQ ID Ν·91, and both SEQ ID N-92 and SEQ ID N-93.
And comprising for LI a5: SEQ ID N*53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and ct6: SEQ ID N-71 and SEQ ID N-72; and ct7: both SEQ ID N°87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N428, SEQ ID N429 and SEQ ID N430 or all four SEQ ID N431, SEQ ID N432, SEQ ID N433, SEQ ID N-134; and a9: both SEQ ID N411 and SEQ ID N412, and both SEQ ID N413 and SEQ ID N414; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N«67 and SEQ ID Ν·68, and both SEQ ID N»69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N»83, SEQ ID N-84, and both SEQ ID N°85, SEQ ID N»86; and alO: all three SEQ ID N 22, SEQ ID N423 and SEQ ID N 24, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N 27; and ct9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N°107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and ct8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N»55, and both SEQ ID N°56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N°72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N 28, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N 12, and both SEQ ID N 13 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99.
In a forth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses
alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses ct8 comprising HPV 91, HPV 43, HPV 7, HPV 40 and papillomaviruses ctl comprising HPV 42, HPV 32.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; ct7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and ct9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and ctl: SEQ ID N-l and SEQ ID N-2
And comprising for LI ct5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7: <x5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N°68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N°82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and olO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N 25, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, SEQ ID N-109 and 110; and a8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96; and al: SEQ ID Ν·3 and SEQ ID N4
And comprising for LI ct5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID l\U89and SEQ ID N-90; and olO: both SEQ ID N 28, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and ct9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6.
In a fifth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses ct7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses ctlO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses 5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses ct9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV 42, HPV 32 and papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62. In this regard, the invention also contemplates a composition of primers comprising for E6: ct5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; ot7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N*79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID ΝΊ01 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104; and ct8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and ot3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27
And comprising for LI ct5: SEQ ID N»53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and ct6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N=90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N 31, SEQ ID ΝΊ32, SEQ ID N-133, SEQ ID N 34; and ct9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N 14; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID Ν·6; and a3 SEQ ID N-33 and both SEQ ID ISI-34 and SEQ ID N-35.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N«83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N 05, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and a8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96;
and al: SEQ ID N-3 and SEQ ID N-4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N.30, SEQ ID N.31, SEQ ID N-32,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35.
In a sixth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses al comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV 42, HPV 32, papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62 and papillomavirus a2 comprising HPV 117, HPV 10, HPV 94, HPV 28, HPV125, HPV 3, HPV 78, HPV 160, HPV 29, HPV 77.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N-44 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID IM.115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and a2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID N-9, SEQ ID N-10 and SEQ ID N-ll
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N.56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID
Ν·98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7: a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N°70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and a8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96; and al: SEQ ID N-3 and SEQ ID N4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N«30, SEQ ID N-31, SEQ ID N-32; and a2: all three SEQ ID N-12, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N-15, SEQ ID N-16 and SEQ ID N-17,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N°88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N.133, SEQ ID N-134; and ct9: both SEQ ID N 11 and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N.114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N«34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20.
In a seventh specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses al comprising HPV 42, HPV 32, papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62, papillomavirus a2 comprising HPV 117, HPV 10, HPV 94, HPV 28, HPV125, HPV 3, HPV 78, HPV 160, HPV 29, HPV 77 and papillomaviruses a4 comprising HPV 2, HPV 27, HPV 57.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID IM46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three
SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N.104; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and a2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID N-9, SEQ ID N-10 and SEQ ID N-ll; and a4: SEQ ID N-36, and SEQ ID N-37
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and al: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N-40 or SEQ ID N-41, and SEQ ID N 2 or SEQ ID N 3.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : oc5: both SEQ ID N 9, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and al: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N 27; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and ot8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96; and al: SEQ ID N-3 and SEQ ID N4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N-30, SEQ ID N-31, SEQ ID N-32; and a2: all three SEQ ID N-12, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N-15, SEQ ID N-16 and SEQ ID N 7;, and a4: SEQ ID N-38, and SEQ ID N-39
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N°89and SEQ ID N-90; and olO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N40 or SEQ ID N41, and SEQ ID N42 or SEQ ID N43.
In an eighth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses ct5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses ct8 comprising HPV 91, HPV 43, HPV 7, HPV 40 papillomaviruses otl comprising HPV 42, HPV 32, papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62, papillomavirus cx2 comprising HPV 117, HPV 10, HPV 94, HPV 28, HPV125, HPV 3, HPV 78, HPV 160, HPV 29, HPV 77, papillomaviruses a4 comprising HPV 2, HPV 27, HPV 57 and papillomaviruses all comprising HPV 73, HPV 34.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; cx6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a.7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N«76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N.115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and ct9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N.104; and ct8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and oil: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N°22 and SEQ ID N.23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and <x2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID Ν·9, SEQ ID N 0 and SEQ ID N-ll; and a4: SEQ ID N-36, and SEQ ID N-37; and all: SEQ ID N-135, and SEQ ID N-136,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID IM°89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N.130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N 34; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID -98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID Ν·6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N40 or SEQ ID N41, and SEQ ID N42 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : ot5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N°64 or SEQ ID N-65 SEQ ID N°66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N=69 and SEQ ID N-70; and a7: SEQ ID N°82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID Ν·106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and ct8: SEQ ID N°94 , and both SEQ ID N-95 and SEQ ID N-96; and ctl: SEQ ID N-3 and SEQ ID N»4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N-30, SEQ ID N-31, SEQ ID N-32; and a2: all three SEQ ID Ν·12, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N-15, SEQ ID N 6 and SEQ ID N-17; and a4: SEQ ID N-38, and SEQ ID N-39; and all SEQ ID N°137 , and SEQ ID N 38,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N 29 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID ΝΊ34; and a9: both SEQ ID IM-lll and SEQ ID N 12, and both SEQ ID N 13 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N«34 and SEQ ID N-35; and a2 SEQ ID Ν·18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N 0 or SEQ ID N-41, and SEQ ID N-42 or SEQ ID N-43; and all: SEQ ID N-139, and SEQ ID N-140.
In a ninth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97 , papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, H PV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40, papillomaviruses al comprising HPV 42, HPV 32, papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62, papillomavirus a2 comprising HPV 117, HPV 10, HPV 94, HPV 28, HPV125, HPV 3, HPV 78, HPV 160, HPV 29, HPV 77, papillomaviruses a4 comprising HPV 2, HPV 27, HPV 57, papillomaviruses all comprising HPV 73, HPV 34 and papillomaviruses al3 comprising HPV 54.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N-44 and SEQ ID N 5, and all three SEQ ID N46, SEQ ID N-47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID NSQ, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three
SEQ ID N.73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and a2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID N-9, SEQ ID N-10 and SEQ ID N-ll; and a4: SEQ ID N-36, and SEQ ID N-37; and all: SEQ ID N-135, and SEQ ID N-136; and al3 SEQ ID N-141, and SEQ ID N-142,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID IM-18, and both SEQ ID Ν·19 and SEQ ID N-20; and a4: SEQ ID N-40 or SEQ ID N-41, and SEQ ID N-42 or SEQ ID N-43; and all: SEQ ID N-139, and SEQ ID N-140; and al3 SEQ ID N-145, and SEQ ID N.146. Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N°67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N.126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N 07, and all three SEQ ID N-108, SEQ ID N-109 and 110; and a8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N°96; and al: SEQ ID ^3 and SEQ ID N ;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N-30, SEQ ID N.31, SEQ ID N-32; and a2: all three SEQ ID N-12, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N-15, SEQ ID N-16 and SEQ ID N-17;, and a4: SEQ ID N-38, and SEQ ID N-39; and all SEQ ID N-137 , and SEQ ID N-138; and al3: SEQ ID N-143, and SEQ ID N-144,
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6 : SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N°88 ,and both SEQ ID N°89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N 33, SEQ ID N 34; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID
N°98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N 0 or SEQ ID N-41, and SEQ ID N-42 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140; and al3 SEQ ID N.145, and SEQ ID N-146.
In a tenth specific embodiment, the above defined invention is practiced to include at least the group consisting of papillomaviruses a 6 comprising HPV 30, HPV 53, HPV 56 and HPV 66, papillomaviruses a7 comprising HPV 68, HPV 39, HPV 70, HPV 85, HPV 59, HPV 45, HPV 18, HPV 97, papillomaviruses alO comprising HPV 16, HPV 35, HPV 31, HPV 52, HPV 67, HPV 33, HPV 58, papillomaviruses a5 comprising HPV 26, HPV, 69, HPV 51, HPV 82, papillomaviruses a9 comprising HPV 6, HPV 11, HPV 13, HPV 1, HPV 74, HPV 44, papillomaviruses a8 comprising HPV 91, HPV 43, HPV 7, HPV 40, papillomaviruses al comprising HPV 42, HPV 32, papillomavirus a3 comprising HPV 114, HPV 84, HPV 86, HPV87, HPV 102, HPV83, HPV89, HPV 61, HPV 72, HPV 62, papillomavirus a2 comprising HPV 117, HPV 10, HPV 94, HPV 28, HPV125, HPV 3, HPV 78, HPV 160, HPV 29, HPV 77, papillomaviruses a4 comprising HPV 2, HPV 27, HPV 57, papillomaviruses all comprising HPV 73, HPV 34, papillomaviruses al3 comprising HPV 54 and papillomaviruses al4 comprising HPV 106, HPV 90 , HPV 71.
In this regard, the invention also contemplates a composition of primers comprising for E6: a5: both SEQ ID N 4 and SEQ ID N-45, and all three SEQ ID N-46, SEQ ID N-47 and SEQ ID N-48and; a6: SEQ ID N°58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N 04; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and a2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID N-9, SEQ ID N-10 and SEQ ID N-ll; and a4: SEQ ID N°36, and SEQ ID N°37; and all: SEQ ID N 35, and SEQ ID N-136; and al3 SEQ ID N-141, and SEQ ID N-142; and al4: SEQ ID N-147, and SEQ ID N.148,
And comprising for LI, a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID Ν·132, SEQ ID N-133, SEQ ID N 34; and a9: both SEQ ID N 11
and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N40 or SEQ ID N-41, and SEQ ID N42 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140; and al3 SEQ ID N-145, and SEQ ID N-146; and al4: SEQ ID N-151 and SEQ ID N-152.
Or, in this regard, the invention also contemplates a composition of primers comprising for E7 : a5: both SEQ ID N49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID N-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N-122, SEQ ID N-123 and SEQ ID N-124, and all three SEQ ID N-125, SEQ ID N-126 and SEQ ID N-127; and a9: all three SEQ ID N-105, SEQ ID N-106 and SEQ ID N-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and a8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96; and al: SEQ ID N-3 and SEQ ID N4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N-30, SEQ ID N-31, SEQ ID N-32; and a2: all three SEQ ID N-12, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N-15, SEQ ID N-16 and SEQ ID N-17;, and a4: SEQ ID N-38, and SEQ ID N-39; and all SEQ ID N-137 , and SEQ ID N-138; and ol3: SEQ ID N-143, and SEQ ID N-144; and al4: SEQ ID N-149,and SEQ ID N-150
And comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N»56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N»72; and a7: both SEQ ID N°87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N 29 and SEQ ID N.130 or all four SEQ ID N 31, SEQ ID N-132, SEQ ID N-133, SEQ ID N 34; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID Ν·19 and SEQ ID N-20; and a4: SEQ ID N40 or SEQ ID N41, and SEQ ID N42 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140; and ol3 SEQ ID N-145, and SEQ ID N-146; and ol4: SEQ ID N-151 and SEQ ID N-152.
In another embodiment, the present invention relates to the use of composition of primers describe above for diagnosis or prognosis of risk to develop HPV induced cancer in a human subject.
Said primers can further comprise at least one of:
- a functional group for covalent coupling at the 5' or 3' end, such as a terminal group
comprising a thiol, amine or carboxyl group,
a spacer molecule or sequence at the 5' or 3' end,
additional sequences as index or tag sequences to perform pre or post additional and general amplification steps not depending on the target sequences to be quantified.
In another embodiment, the present invention relates to a composition of primers comprising at least one primer selected from SEQ ID No 153 to 158. Said composition can comprise 1, 2, 3, 4, 5 or the 6 primers selected from SEQ ID No 153 to 158.
In another embodiment, the present invention relates to a kit for diagnosis or prognosis risk to develop HPV induced cancer comprising:
a) a composition of primers,
b) reagents to detect amplification products
In a specific embodiment , the present invention relates to a kit for diagnosis or prognosis risk to develop HPV induced cancer comprising : a) primers or probes for detecting at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both b) primers or probes for detecting at least a second marker selected from LI mRNAs of group alpha HPVs, L2 mRNAs of group alpha HPVs, or both,
wherein said E6, E7, LI and L2 mRNAs have corresponding intragenetic sequences, c) and optionally, primers or probes for detecting at least one host cellular marker indicative of neoplasia or cancer.
In various embodiments, the primers can be selected from primers comprising or consisting of the nucleic acid sequence of any of SEQ ID NOs:l-152. Preferably the primers comprise or consist of at least 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides of any of SEQ ID NOs:l-152. The kit can contain any of the compositions of primers described herein.
The kit can further contain at least 1, 2, 3, 4, or more controls for the determination of R. The controls can contain a known ratio of E6 and/or E7 to LI and/or L2. Preferably, the controls contain a known ratio of E6 and E7 to LI and L2. In various embodiments, the kit contains at least 1 or at least 2 controls indicating a low risk or non- persistent HPV infection. In various embodiments, the kit contains at least 1 or at least 2 controls indicative of a high risk infection or associated with higher risk of developing genital neoplasia and cancer. In preferred embodiments, the kit contains at least 1 or at least 2 controls indicating a low
risk or non-persistent HPV infection and at least 1 or at least 2 controls indicating a high risk infection or associated with higher risk of developing genital neoplasia and cancer.
In various embodiments, the invention encompasses a method for assessing a human papilloma virus (HPV) infected patient. In one embodiment, the method comprises generating cDNA from a patient sample comprising RNA and sequencing the cDNA to generate reads of sequence of the cDNA.
In various embodiments, the number of reads is at least 106, 5xl06, 107, 2xl07, or 5xl07 reads.
In one embodiment, the cDNA is generated using random primers. In one embodiment, the cDNA is generated using HPV-specific primers. In preferred embodiments, at least one of the primers comprises or consists of the nucleic acid sequences in Table 3.
In various embodiments, the method comprises discriminating HPV sequence reads on the basis of HPV species including any of the specific species referenced herein. In various embodiments, the method comprises discriminating HPV sequence reads on the basis of HPV gene transcript, including El, E2, E4, E5, E6, E7, E8, LI, and L2 transcripts. The transcripts can be spliced transcripts. In various embodiments, the cDNA or the sequencing can be performed with HPV-specific or random primers. In various embodiments, the primers comprise or consist of any of the nucleic acid sequences of SEQ. ID NOs: 1-158. In various embodiments, the cDNA is generated with HPV-specific primers and the sequencing performed randomly or specifically for HPV sequences. In various embodiments, the cDNA is generated with random primers and the sequencing performed randomly or specifically for HPV sequences.
In various embodiments, the number of HPV sequence reads according to HPV species and/or HPV gene transcript can be determined.
In one embodiment, the method comprises determining the number of HPV sequence reads of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 HPV species. In one embodiment, the method comprises determining the number of HPV sequence reads of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 Alpha group HPV species.
In a further embodiment, the method comprises calculating a ratio (R) of the number of reads of at least one early HPV transcript to the number of reads of at least one late HPV transcript. Preferably the HPV transcripts are Alpha group HPV species HPV transcripts, most preferably HPV16 or HPV18 transcripts.
R values can be determined using any of the various formulas presented in Table 9. In one embodiment, the ratio is calculated by calculating a ratio (R) of the number of reads of HPV E6 and/or E7 transcripts to the number of reads of HPV LI and/or L2 transcripts. In one embodiment, the ratio is calculated by calculating a ratio (R) of the number of reads of HPV E6 and E7 transcripts to the number of reads of HPV LI and L2 transcripts.
In some embodiments, a higher ratio (R) correlates with an increased risk of developing high-grade malignant HPV-induced cancer. In various embodiments, an R value tending towards high values above 0.5, 1, 25, 50, 100 and tending towards infinity, indicates that the viral cycle is integrated, non replicating viruses expressing high level of oncogenes E6 and E7; whereas, an R value below 0.25, 0.2, 0.1, 0.05, and tending towards 0, indicates that the viral lifecycle is replicative and expressing low levels of E6 and E7.
In some embodiments, a higher number of reads of transcripts of HPV16, HPV18, or another high-risk HPV relative to reads of transcripts of a lower risk HPV species correlates with an increased risk of developing high-grade malignant HPV-induced cancer. In some embodiments, the method comprises determining the number of reads matching the viruses based on species discrimination and determining the most prevalent high risk species present in the sample relative to other species and /or determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes.
In one embodiment, the invention encompasses methods for assessing a human papilloma virus (HPV) infected patient comprising generating cDNA from a patient sample comprising RNA; sequencing the cDNA; generating reads of sequence of the cDNA; discriminating HPV sequence reads on the basis of HPV gene transcript; quantitating the level of HPV sequence reads according to HPV gene transcript; determining the number of HPV sequence reads of at least one HPV early gene transcript; determining the number of HPV sequence reads of at least one HPV late gene transcript; and determining the ratio of the number of HPV sequence reads of at least one HPV early gene transcript to the number of HPV sequence reads of at least one HPV late gene transcript.
The following examples are not limitative
Example 1: General amplification ct5, a6, a7 and ctlO HPVs
We developed a NGS test for quantifying oncogenic HPV E7 mRNAs relative their respective LI mRNAs. We searched and designed consensus primers in this regard for a quantitative pre-
amplification of the oncogenic E7 HPVs mRNAs of all alpha papillomavirus (high and low risk).
We completed the test with the identification of LI mRNA level and determine the ratio between the expression E7 (early gene) and LI (late gene) to determine the risk of a patient developing cancer. This new test allows determining the inherent risk of any HPVs types regardless of the current classification regardless of whether the patient is infected with HPV species 16 or 18, etc. (HR) or 30...etc. (BR).
Furthermore, this assay allows identifications of multiple HPV infections in single individuals First, we analyzed the feasibility of generating consensus sequences for different HPVs type (HR and LR).
We started to determine the percentage protein homology of the different HPVs Type, using NCBI Blastn. We observed that a high heterogeneity exists between the gene sequence of E7 from one type of HPV to another even among HR species (FIGURE 1, 2, 3, 4, 5, 6). This observation did not reveal obvious features in sequences of HPVs explaining the consensus designing partners by current classification as LR or HR. this observation reinforces the hypothesis of a lack of correlation between sequence of a whole E7 gene and the classification based on the risk: this impair a possibility to derive tests based on consensus sequence to differentiate HT=R and LR.
Then, we did a sequence alignment based on oncogenic E7 HPVs HR and LR.
We focus on global comparison of HR and LR, then only within HR and finally only within LR. We observed that no specific consensus sequence emerged from the sequence alignment of HR, HR and LR / LR overall on E7 genes species. There is very little global sequence homology, the locus of homology being very punctual. Nonetheless, we were led to design consensus primers based on subgroup a for E7 using ClustalW for alignments. We found some homologies between HPVs types sequences contained in a subgroup. After having generated all the FASTA files alignment, we searched to generate consensus sequences using GE I program. Sometimes, we couldn't find any consensus sequences in all the HPV subgroup. We divided the subgroup to generate the degenerated consensus sequences. We then selected more particularly combined primers which cover all subgroup parameters such as minimizing the number of required primers selecting primers to obtain the largest possible amplicons, further selecting primers for relative conserved 3' sequences and selecting primers which do not cross hybridize. We did these selections for all the E7 and LI HPVs subgroup. After analyzing all the sequences we elected the best set of primers for a5, ct6, <x7 and alO E7 and ct5, ot6, a7 and alO LI to amplify all the genes.
Finally, we provide here a new diagnosis test comprising a set of probes for the pre amplification of E7 ct5, a6, a7 and alO HPVs mRNAs and LI ct5, a6, a7 and alO HPVs mRNAs level and which allows to assess the ratio between the expression of E7 (early gene) and LI (late gene) as a marker of the risk for a patient developing cancer
One preferred set of primers for the pre-amplification comprises the following sequences: a 5:
• E7
Forward: 5'- YTAGATYTGGTGCCGCAACCCG -3* (SEQ ID N-49)
Forward: 5'- MGCCATGCGTGGTAATGTACCAC -3' (SEQ ID N-50)
Reverse: V- CTCCASCRCTCG R ACGTTCTGT -5* (SEQ ID N-51)
Reverse: 3'- CACGGGCAMACCAGGCTTAGK -5' (SEQ ID N-52)
• LI
Forward: 5V- KCAGATGGCYTTGYGGCGTACTA -3 (SEQ ID N-53)
Reverse: Y- GGGGCRTYRCGYTGACAKGTAGT -5^(SEQ ID N-56)
Reverse: 3'- GGCMGGSCKTTTAAGGCCTGGT -5'(SEQ ID N-57) a 6:
• E7
Forward: 5'- GCTCAGAGGAWGAGGATGAGG -3'(SEQ ID N-64)
Reverse: 3 - GCCTTGTTGCRCASAGGGG -5 (SEQ ID N-69)
Reverse: 3~- CGCAGAGTGGGCACGTTACT -5 (SEQ ID N-70)
• LI
Forward: 5'- TTGCAGATGGCGRYGTGGCG -3~(SEQ ID N-71)
Reverse: 3 - CACCTAAAGGYTGDCCDCGGC -5 (SEQ ID N-72)
a 7:
• E7
Forward: 5 - GACG RG HGAACM ACARCGTCAC -3~(SEQ ID N-82)
Reverse: 3'- GTG WSTCC ATAA AC AG C WG CWGT -5'(SEQ ID N-85)
Reverse: Ϊ- CAC ACCAM G G AC AC AC A AAG G AC -5'(SEQ ID N-86)
• LI
Forward: 5'- GCGBTCTAGYGACARCAHGGTGT -3 (SEQ ID N-87)
Forward: 5~- HCCTGCTATTGG GARCAYTGGG -3' (SEQ ID N-88)
Reverse: 3X- CCAGTGYTCYCCMATRGCRGGWA -5' (SEQ ID N-89)
Reverse: 3'- TAGASCCACTDGGWGANGGRGAA -5' (SEQ ID N-90) a 10:
• E7
Forward: 5 - GCWCAYTWGGAATHGTGTGCCCC -3X (SEQ ID N-122)
Forward: 5'- CSTGTAAMAACGCCATGAGAGGA -3'(SEQ ID N-123)
Forward: 5'- CGCCATGAGAGGAMACAASCCA -3* (SEQ ID N 24)
Reverse: 3"- G G C AC AC D ATTCCW A RTG WG CCC -5' (SEQ ID N-125)
Reverse: 3"- GGTTCGTASGTCRSTTGYTGTAC -5* (SEQ ID N-126)
Reverse: 3'- GTGCACAGSYGGGRCACACWAYT -5~(SEQ ID N-127)
LI
Forward: 5 - G A RG CCAC WGTSTAC YTG CCTC -3% (SEQ ID N-128)
Forward: 5~- AC AG ATGTCTCTGTG G CG G C -3' (SEQ ID N-129)
Reverse: 3'- GGATGNCCACTWAYRCCHACDCC -5' (SEQ ID N-130)
Example 2: Quantifying E6 and E7 reads versus other viral reads A sample of cells is collected from the cervix using a spatula or small brush and put in a conservative solution. RNAs are extracted from the cells using standard procedure and polyA mRIMAs are selected using standard procedures like using poly dT beads. Librairies are prepared using standard library preparation (RNA fragmentation and reverse transcription into double-stranded complementary DNA primed by random hexamer followed by adapter selection, or reverse transcription to single strand cDNA, ligation of cDNA and random amplification by phi 29 polymerase followed by fragmentation and adpaterligation). Alternatively RT-PCT is conducted using set of primers for E6 and E7 and at least one another late gene as described. After sequencing using several million reads of at least lOOnt, reads are mapped on a database of E6 and E7 genes: HPV genotypes expressing E6/E7 are identified. The other reads are mapped on the subset of genomes corresponding to the corresponding genotypes. Within each genotype, ratio of the number of E6/E7 reads to the reads mapped to at least one anther gene is calculated and compared to thresholds.
Example 3: Biological samples
Two high grade lesions (HSIL) samples of the cervix from two donor women, hereinafter referred to as 117 and 119, were collected in PreservCyt medium (Hologic) and kept at room temperature for a couple of days. After homogenization, lmL aliquots were collected from the 20μί total liquid medium for HPV genotyping (Papillocheck, Greiner Bio-One). Results of HPV typing are given in table 1. The remaining samples were centrifuged at 4,500xg for 10 min and the pellets were stabilized in lmL RNAProtect Cell (Qiagen) for storage at -80°C before RNA extraction.
Example 4: HPV database Sixty four (64) reference sequences representing the entire HPV alpha genus were retrieved from the International Human Papillomavirus Reference Center ( ; updated May 2014). Additional nine (9) sublineage sequences corresponding to HPV16, plus nine (9) sublineage sequences corresponding to HPV18 (described in Burk et al. Virology 2013) were added. The resulting eighty two (82) HPV genomes (listed in table 2) were aligned using ClustalW2 (default parameters) and the output file was analyzed using the Geneious software (Geneious 7.1.5, Biomatters Ldt).
Example 5: Design of HPV reverse transcription primers
A dedicated strategy for the design of HPV reverse transcription (RT)-primers was set up with the goal to carry out a specific enrichment of HVP sequences during the reverse transcription step within a ballast of viral and non-viral RNA sequences. The overall approach consists in targeting the entire early and late populations of HPV transcripts starting from a limited number of specific RT primers. The design is achieved by taking advantage of the sequence shared by all early and late transcripts, located in the 5' vicinity of the early and late polyA signals, respectively (figure 1). In order to minimize the number of RT primers required to cover all kind of alpha HPV, the degree of similarity between the 82 HPV genomes was taken into account. Additional criteria for the design of RT primers were as follows: (i) an overall good specificity of the primer aligned against all existing sequences databases (BLAST NCBI) with special attention paid in considering the 3' part of the primer, (ii) a GC content around 50% (+/-12%), (Mi) a melting temperature (Tm) > 50°C (assuming 0,2μΜ primers and 50mM salt), (iv) no T tracts, (v) no or low GC content in the 3' part of the primer and (vi) no or limited number of putative secondary structures. This approach was implemented manually as a proof of principle to design one (1) RT-specific primer targeting the early transcripts of the 9 HPV16 sequences, one (1) RT-specific primer targeting the late transcripts of the 9 HPV16 sequences, two (2) RT-specific primers targeting the early transcripts of the 9 HPV18 sequences and two (2) RT-specific primers targeting the late transcripts of the 9 HPV18 sequences. The resulting six
(6) RT-specific primers targeting both HPV16 and HPV18 sequences and including sublineages are given in table 3. HPSF-purified primers (0.01 μηιοΙ) were ordered at Eurofins genomics (http://www.eurofinsgenomics.eu). Example 6: RNA extraction and characterization
Total RNA from samples 117 and 119 were extracted using the PicoPure RNA isolation kit (Life Technologies), adding a DNAse treatment step directly on column (RNAse-free DNAse set, Qiagen) as recommended by the supplier. Elution was achieved in 30μί elution buffer. Assessment of RNA quantity and quality was done with a Nanodrop 1000 (Thermo Scientist) and a Bioanalyzer 2100 using the RNA Nano chips (Agilent).
Example 7: Random reverse transcription
Random reverse transcription of total RNA was carried out using the Superscript III First-Strand cDNA Synthesis kit (Invitrogen). Briefly, 8μΙ of total RNA was used for template and the reaction was performed in the presence of 50nM random hexamers (provided by Invitrogen), incubated lOmin at 25°C, 50min at 50°C and 5min at 85°C before a final RNAse H treatment 20min at 37°C. The resulting cDNA were stored at -20°C.
Example 8: HPV-specific reverse transcription
HPV-specific reverse transcription was carried out using the Superscript III First-Strand cDNA Synthesis kit (Invitrogen) and primed with the HPV-specific RT-primers described above. Briefly, 8μί of total RNA was used for template and reaction was performed with a 0,2μΜ mixture of the 6 HPV- specific RT primers, incubated 50min at 50°C and 5min at 85°C before a final RNAse H treatment 20min at 37°C. The resulting cDNA were stored at -20°C.
Example 9: Control PCR
The HPV16 E7 and the human cellular beta-actin (ACTB) genes were used as controls of the random and HPV-specific reverse-transcription steps, respectively. Ιμί of reverse-transcribed cDNA was used as PCR templates in 20μί final volume, working with LightCycler DNA Master SybrGreen I reagents (Roche Diagnostics). 45 amplification cycles were achieved on a Light Cycler 480 (Roche) as follows: 95°C lOsec, 56°C lOsec, 72°C 30sec. Fusion curves and electrophoresis gels served for validation. A comparison of Ct values obtained by following either the random RT or the HPV RT protocol is given in table 4.
Example 10: Whole transcriptome random amplification cDNA were randomly amplified using the Multiple Displacement Amplification (MDA) protocol with phi29 polymerase and random hexamers (Whole Transcriptome Amplification, Qiagen). Phi 29 was UV-treated for one hour before use, in order to prevent any residual DNA contaminant. Example 11: High throughput sequencing
Samples 117 (both random RT and HPV-specific RT) and 119 (both random RT and HPV-specific RT) were independently analyzed on two sequencing runs (300bp paired-end sequencing, TruSeq PCR- free library prep, 600 cycle kit) on a MiSeq apparatus (lllumina). fastQ data were generated and QC tests done following standard procedures. Total numbers of sequencing reads per sample are summarized in table 5.
Example 12: Data analysis
Quality-filtered reads were mapped to reference sequences using the following criteria: (i) alignment identity of at least 90% and (ii) Smith and Waterman score above 100. A selection of 10 human genes served as cellular controls (table 6). The analysis of the reads mapping HPV sequences relied on two strategies: first, at the genomic level, sequencing reads mapping HPV16 (NC_001526.2), HPV6 (HG793939.1) and HPV35 (JX129488.1) were count for each coding sequence (CDS), without adding any particular filter (table 7). In a second and more transcript-specific approach, reads mapping splice junctions of HPV16 were identified (table 8). This latter analysis was done for HPV16 only as a proof of principle, and relied on well-documented donor and acceptor splice sites, as described for example in Zheng et al. FrontBiosci 2006.
Example 13: Sequence results
Following the random reverse-transcription protocol, the sequencing of patient 117 resulted in a total of 1,455 and 126 reads (over 34,977,682) that were successfully mapped to the HPV16 (NC_001526.2) and HPV35 (JX129488.1) genomes, respectively. 15 reads (over 39675490) were mapped to the HPV16 genome for the mono-infected patient 119. Following the alternative procedure with HPV-specific RT primers, the sequencing of patient 117 resulted in a total of 2033, 69 and 14 reads (over 28598603) for HPV16, HPV35 and HPV6 genomes, respectively. 6 reads (over 19383833) were mapped to the HPV16 genome for patient 119.
Two lines of analysis were conducted in order to characterize finely different populations of HPV reads. First, at the genomic level, reads mapping CDS regions were counted, giving a broad view of phenomena such as the early vs late genes equilibrium (table 7). In addition to that, we sought to
characterize deeply specific HPV16 transcripts by taking advantage of well-documented donor and acceptor splice sites described for HPV16. This led us to define 11 spliced transcripts which can be associated unambiguously to one specific RNA event (table 8). Together, these two analysis showed that (i) HPV sequences are reachable using HTS, (ii) it is possible to perform a gene-by-gene reads counting at the genomic level, (iii) reads associated to specific splice junctions exist and can be characterized and counted as well, confirming essentially the detection of transcripts over possible artefacts introduced by residual HPV DNA, (iv) discrepancies exist between samples, between HPV genus and between HPV genes and transcripts patterns, which reflect probably the diversity of HPV infections. Example 14: Examples of R scores
These observations opened the possibly to define a score, referred to as R score, based on HPV CDS counts and/or specific transcripts within each genotype present in a given sample , to gain a fine molecular characterization of any individual HPV-positive samples. From this perspective, either one value or a combination of more than one ratio(s) could be considered. A non-restrictive list of R scores is given in table 9 in order to illustrate several possible combinations based either on CDS or specific transcripts. As an example, R scores based on a ratio E6 and/or E7 and/or E2 and/or LI and/or L2 succeeded in generating high score values (highlighted) that should be associated of non- or lowly-productive HPV cycles typical of transformed cells. Of note, weighting coefficients such as <xE6 and/or βΕ7 and/or yE2 and/or 5L1 and/or eL2 can be added as parameters, independently, in order to better discriminate, for instance, low risk and high risk lesions.
Example 15: Random RT vs HPV-specific RT
As an alternative to the conventional random RT upstream of random amplification, we attempted to define and to use HPV-specific RT primers, with the ultimate goal to achieve a specific HPV enrichment over non-HPV sequences. Such targeted (semi-random) approach may prove extremely important in the perspective of reducing the depth sequencing (that is dependent on the ratio of HPV to non HPV sequences), increasing multiplexing, and reducing costs required before being able to use HTS as a screening test. Although the number of HPV reads remains roughly comparable between the random RT and the HPV-specific RT approaches, a marked difference was observed regarding cellular genes, as exemplified by both PCR (table 4, average ACTB ACt -3,01 for HPV RT compared to E7 ACt -0,56) and HTS results (table 6, average 3,3 fold reduction for HPV RT, after total reads number correction). In addition to that, HPV6 reads were detectable in the poly-infected sample 117 only when applying the HPV RT approach, thus recovering the results of the Papillocheck gold standard genotyping test. These results, albeit based on a limited number of experimental
evidences, suggest a minima that our innovative HPV-specific reverse transcription approach coupled with random amplification is able to reduce the cellular and other non-HPV ballasts, without deteriorate the detection of specific HPV targets. Optimizations of the technique are now required to achieved a strong HPV enrichment and to afford linear quantification.
Table 1: Biological samples and associated HPV-genotyping
Table 2:
Seq index Virus name Genus name Species name GenBank ID
1 HPV2 Alpha Alpha-4 X55964
2 HPV3 Alpha Alpha-2 X74462
3 HPV6 Alpha Alpha-10 X00203
4 HPV7 Alpha Alpha-8 X74463
5 HPV10 Alpha Alpha-2 X74465
6 HPV11 Alpha Alpha-10 M14119
7 HPV13 Alpha Alpha-10 X62843
8 HPV16 Alpha Alpha-9 K02718
9 HPV16 Alpha Alpha-9 AF536179
10 HPV16 Alpha Alpha-9 HQ644236
11 HPV16 Alpha Alpha-9 AF534061
12 HPV16 Alpha Alpha-9 AF536180
13 HPV16 Alpha Alpha-9 HQ644298
14 HPV16 Alpha Alpha-9 AF472509
15 HPV16 Alpha Alpha-9 HQ644257
16 HPV16 Alpha Alpha-9 AY686579
17 HPV16 Alpha Alpha-9 AF402678
18 HPV18 Alpha Alpha-7 X05015
19 HPV18 Alpha Alpha-7 AY262282
HPV18 Alpha Alpha-7 EF202146
HPV18 Alpha Alpha-7 EF202147
HPV18 Alpha Alpha-7 EF202151
HPV18 Alpha Alpha-7 GQ180787
HPV18 Alpha Alpha-7 EF202155
HPV18 Alpha Alpha-7 KC470225
HPV18 Alpha Alpha-7 EF202152
HPV18 Alpha Alpha-7 KC470229
HPV26 Alpha Alpha-5 X74472
HPV27 Alpha Alpha-4 X74473
HPV28 Alpha Alpha-2 U31783
HPV29 Alpha Alpha-2 U31784
HPV30 Alpha Alpha-6 X74474
HPV31 Alpha Alpha-9 J04353
HPV32 Alpha Alpha-1 X74475
HPV33 Alpha Alpha-9 M12732
HPV34 Alpha Alpha-11 X74476
HPV35 Alpha Alpha-9 X74477
HPV39 Alpha Alpha-7 M62849
H V40 Alpha Alpha-8 X74478
HPV42 Alpha Alpha-1 M73236
HPV43 Alpha Alpha-8 AJ620205
HPV44 Alpha Alpha-10 U31788
HPV45 Alpha Alpha-7 X74479
HPV51 Alpha Alpha-5 M62877
HPV52 Alpha Alpha-9 X74481
HPV53 Alpha Alpha-6 X74482
HPV54 Alpha Alpha-13 U37488
HPV56 Alpha Alpha-6 X74483
HPV57 Alpha Alpha-4 X55965
HPV58 Alpha Alpha-9 D90400
HPV59 Alpha Alpha-7 X77858
HPV61 Alpha Alpha-3 U31793
HPV62 Alpha Alpha-3 AY395706
HPV66 Alpha Alpha-6 U31794
HPV67 Alpha Alpha-9 D21208
HPV68 Alpha Alpha-7 X67161
HPV69 Alpha Alpha-5 AB027020
HPV70 Alpha Alpha-7 U21941
HPV71 Alpha Alpha-14 AB040456
HPV72 Alpha Alpha-3 X94164
HPV73 Alpha Alpha-11 X94165
HPV74 Alpha Alpha-10 AF436130
HPV77 Alpha Alpha-2 Y15175
HPV78 Alpha Alpha-2 AB793779
HPV81 Alpha Alpha-3 AJ620209
HPV82 Alpha Alpha-5 AB027021
HPV83 Alpha Alpha-3 AF151983
HPV84 Alpha Alpha-3 AF293960
HPV85 Alpha Alpha-7 AF131950
HPV86 Alpha Alpha-3 AF349909
HPV87 Alpha Alpha-3 AJ400628
HPV89 Alpha Alpha-3 AF436128
HPV90 Alpha Alpha-14 AY057438
HPV91 Alpha Alpha-8 AF419318
HPV94 Alpha Alpha-2 AJ620211
HPV97 Alpha Alpha-7 DQ080080
HPV102 Alpha Alpha-3 DQ080083
HPV106 Alpha Alpha-14 DQ080082
HPV114 Alpha Alpha-3 GQ244463
HPV117 Alpha Alpha-2 GQ246950
HPV125 Alpha Alpha-2 FN547152
HPV160 Alpha Alpha-2 AB745694
Table 3: Primers used for HPV-specific reverse transcription
Table 4: Comparative Ct values obtained by PCR after random or HPV-specific reverse transcription
Table 5: Total number of sequencing reads
Total reads # (raw) Quality Filtering
Sample 117 random RT 37,055,284 34,977,682
Sample 117 HPV RT 30,607,370 28,598,603
Sample 119 random RT 41,994,892 39,675,490
Sample 119 HPV RT 20,462,884 19,383,833
Table 6: Number of sequencing reads mapping human cellular genes (GRCh37) after random or HPV-specific reverse transcription
Table 7: Number of sequencing reads mapping HPV CDS
Table 8: Number of sequencing reads mapping spliced HPV16 transcripts
Genomic coordinates Sample 117 Sample 119
HPV16 splice of HPV16 splice sites Number of reads at Number of reads at transcripts (NC_001526.2) the splice junction the splice junction
Spl. Donor Spl. Accep. Rand. RT HPV RT Rand. RT HPV RT
E6*l 226 409 33 25 0 0
E6*ll 226 526 4 0 0 0
E6*lll, E5 226 3358 0 0 0 0
E6*IV 226 2709 36 23 0 0
Ε6ΛΕ7 226 742 0 0 0 0
E1C 880 2582 0 0 0 0
Ε1ΛΕ4 880 3358 12 4 0 0
E2 880 2709 0 2 0 0
E2C 1302 3358 0 0 0 0
LI 3632 5639 0 0 0 0
LI* 1302 5639 0 0 0 0
Table 9: Examples of R scores established either from reads mapping CDS or specific transcripts
Claims
1. A method for determining a patient risk of developing oncongenic virus induced cancer, such as polyoma virus or group alpha HPV, comprising:
a) enrichment of the viral RNAs in a sample using random or consensus pre-amplification and/or specific reverse transcriptase reation,
b) sequencing cDNA produced in step a), and generating reads of said cDNA
c) determining the number of reads matching said viruses based on species discrimination and determining the most prevalent high risk species present in the sample relative to other species, d) determining within said most prevalent high risk species the relative number of reads matching oncogenic genes compared to non oncogenic genes.
e) computing ratios within said high risk species of reads matching oncogenic genes versus corresponding interspecies structural or regulatory genes.
f) determining risk of developing oncogenic virus induced cancer in patients in which said ratio tend towards infinity.
2. The method according to claim 1 for assessing risk of developing HPV induced cancer in patients infected with at least two different HPV species of group alpha.
3. The method according to claim 1 for assessing HPV virus clearance in patient receiving HPV preventive or curative HPV vaccine.
4. The method of any one of claims 1 to 3, comprising calculating a ratio (R) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV- induced cancer.
5. The method of claim 4, further comprising correlating a higher number of reads of HPV16 transcripts relative to reads of transcripts of another HPV species with an increased risk of developing high-grade malignant HPV-induced cancer.
6. The method of claim 1, wherein the cDNA is generated using random primers.
7. The method of claim 2, wherein the cDNA is generated using HPV-specific primers.
8. The method of claim 4, wherein the ratio is calculated by calculating a ratio (Rl) of the number of reads of one HPV HR E6 and/or E7 transcripts to the number of reads of said one HPV HR LI and/or L2 transcripts.
9. The method of claim 8, wherein the ratio is calculated by calculating a ratio (R2) of the number of reads of a second HPV HR E6 and E7 transcripts to the number of reads of said second HPV HR LI and L2 transcripts.
10. The method of claim 4, comprising determining the number of HPV sequence reads of at least 2 Alpha group HPV species.
11. The method of claim 8, further comprising calculating a ratio (Rl) of the number of reads of at least one early HPV16 transcript to the number of reads of at least one late HPV16 transcript, with a higher ratio (R) correlating with an increased risk of developing high-grade malignant HPV-induced cancer.
12. The method of claim 11, wherein the at least one early transcript is HPV E6 or E7 and the at least one late transcript is LI or L2.
13. The method of any one of claims 1 to 12 comprising:
a) Optionally, pretreating nucleic acids to remove human genomic DNA
b) Optionally, pre-amplify viral mRNAs, wherein said viral mRNAs comprises oncogenic mRNAs and at least one other mRNA,
c) sequencing mRNAs, or cDNAs thereof, obtained after steps a) and b), in the sample of a human subject,
d) identifying the reads corresponding to said oncogenic mRNAs,
e) identifying to which species or genotypes said oncogenic mRNAs of step d) belong to, f) sorting the reads corresponding to said at least one other viral mRNAs, or cDNAs thereof obtained after steps a) and b), of the same genotype or species identified in step e), g) optionally, identifying fusion transcripts as a signature of viral DNA integrations events in the host chromosome and/or additional human cancer cell biomarkers,
h) Optionally, deleting all other sequences including human sequences which are not sequences identified and sorted following steps d), e), f) and g),
i) computing ratios R defining molecular abundance of said oncogenic mRNAs relative to said at least one other viral mRNAs of the same genotype or species of step f),
14. The method according to claim 13, wherein virus induced cancer is HPV induced cancer, wherein oncogenic mRNAs are selected from E6 and/or E7 genus alpha HPV mRNAs, and wherein other viral mRNAs are selected from at least one of genus alpha HPV mRNAs of capsid LI and/or L2, growth stimulation E5, replication or transcription El, E2, E4 and E8.
15. The method according to claim 13, wherein step f) comprises sorting the reads of LI and/or L2 HPV mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs identified in step d).
16. The method according to claim 13, wherein step g) comprises computing ratios defining relative molecular abundance of E6 and/or E7 HPV mRNAs relative to the reads of LI and/or L2 HPV mRNAs corresponding to the species or genotype of E6 and/or E7 HPV mRNAs.
17. The method according to claim 13, wherein step b) comprises pre-amplifying HPVs mRNAs, wherein said mRNAs comprises E6 and/or E7 HPV mRNAs, and LI mRNAs.
18. A method for diagnosis or prognosis risk to develop HPV induced cancer comprising:
(a) determining the level of at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both, in the sample of a patient or in the sample of an individual suspected to be infected by HPV, wherein said level in HPV species selective,
(b) comparing the levels determined in step (a) to a reference value of E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both in low risk individuals infected with HPVs, wherein an increased level as determined in step a) compared to the reference level in step b) is indicative of higher risk to develop HPV induced cancer.
19. The method according to one of claims 13 and 18, wherein E6 or E7 mRNAs of HPVs belong to genus alpha HPVs, and wherein it comprises amplification and/or sequencing covering HPVs of at least groups a5, 6, 7, and 10.
20. The method according to one of claims 13 and 18 comprising determining the level of:
a) at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both
b) at least a second marker selected from LI mRNAs of group alpha HPVs, L2 mRNAs of group alpha HPVs, or both,
wherein said E6, E7, LI and L2 mRNAs have corresponding intragenetic sequences,
c) and optionally, at least one host cellular marker indicative of neoplasia or cancer.
21. The method of claim 19 wherein amplification or determination of the levels of E7 and LI biomarkers comprises using a composition of primers comprising for E7: ct5: both SEQ ID N-44 and
SEQ ID N 5, and all three SEQ ID N 6, SEQ ID N 7 and SEQ ID N-48and; a6: SEQ ID N-58 or both SEQ ID N°59 and SEQ ID N«60, and both SEQ ID N-61 and SEQ ID N-62and; ct7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N°79, SEQ ID N-80 and SEQ ID N«81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID Ν 17 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID INM20, SEQ ID N 21 ;
and comprising for LI ot5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and ct6: SEQ ID N=71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N»89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N 30 or all four SEQ ID N 31, SEQ ID ISM32, SEQ ID N-133, SEQ ID N-134.
22. The method of claim 19 wherein amplification or determination of the levels of E7 and LI biomarkers comprises using a composition of primers comprising for E7 comprising for E7 : <x5: both SEQ ID N-49, SEQ ID N-50 and both SEQ ID N-51, SEQ ID N-52; and a6: SEQ ID N-63 or SEQ ID N-64 or SEQ ID N-65 SEQ ID N-66 or both SEQ ID N-67 and SEQ ID N-68, and both SEQ ID N-69 and SEQ ID IM-70; and a7: SEQ ID N-82 or both SEQ ID N-83, SEQ ID N-84, and both SEQ ID N-85, SEQ ID N-86; and alO: all three SEQ ID N 22, SEQ ID N-123 and SEQ ID N 24, and all three SEQ ID N-125, SEQ ID N°126 and SEQ ID N-127; and a9: all three SEQ ID N 05, SEQ ID N-106 and SEQ ID IM-107, and all three SEQ ID N-108, SEQ ID N-109 and 110; and cx8: SEQ ID N-94 , and both SEQ ID N-95 and SEQ ID N-96; and otl: SEQ ID N-3 and SEQ ID N-4;and a3: both SEQ ID N-28 and SEQ ID N-29, and all three SEQ ID N»30, SEQ ID N-31, SEQ ID N-32; and a2: all three SEQ ID N 2, SEQ ID N-13 and SEQ ID N-14, and all three SEQ ID N.15, SEQ ID N-16 and SEQ ID N-17;, and a4: SEQ ID N-38, and SEQ ID N-39; and all SEQ ID N 37 , and SEQ ID N-138; and al3: SEQ ID N-143, and SEQ ID N-144; and al4: SEQ ID N-149,and SEQ ID N-150;
and comprising for LI ct5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and cx6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N 34; and <x9: both SEQ ID N-lll and SEQ ID N 12, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID IM-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N-35; and a2 SEQ ID N-18, and both SEQ ID N 9 and SEQ ID N-20; and ct4: SEQ ID N-40 or SEQ ID
N41, and SEQ ID N42 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140; and al3 SEQ ID N-145, and SEQ ID N-146; and al4: SEQ ID N-151 and SEQ ID N-152.
23. The method of claim 19 wherein amplification or determination of the levels of E6 and LI biomarkers comprises using a composition of primers comprising for E6: a5: both SEQ ID N-44 and
SEQ ID N-45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N.77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121, and comprising for LI a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and otlO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134.
24. The method of one of claims 19 to 23 wherein amplification or determination of the levels of E6 and LI biomarkers comprises using a composition of primers comprising for E6: a5: both SEQ ID N-44 and SEQ ID N45, and all three SEQ ID N46, SEQ ID N47 and SEQ ID N48and; a6: SEQ ID N-58 or both SEQ ID N-59 and SEQ ID N-60, and both SEQ ID N-61 and SEQ ID N-62and; a7: all three SEQ ID N-73, SEQ ID N-75 and SEQ ID N-76 or all three EQ ID N-74, SEQ ID N-75 and SEQ ID N-76, and all five SEQ ID N-77, SEQ ID N-78, SEQ ID N-79, SEQ ID N-80 and SEQ ID N-81 and ; alO: all three SEQ ID N-115, SEQ ID N-116, SEQ ID N-117 and all four SEQ ID N-118, SEQ ID N-119, SEQ ID N-120, SEQ ID N-121; and a9: both SEQ ID N-100 and SEQ ID N-101 and all three SEQ ID N-102, SEQ ID N-103 and SEQ ID N-104; and a8: SEQ ID N-91, and both SEQ ID N-92 and SEQ ID N-93; and al: SEQ ID N-l and SEQ ID N-2; and a3: all three SEQ ID N-21, SEQ ID N-22 and SEQ ID N-23, and all four SEQ ID N-24, SEQ ID N-25, SEQ ID N-26 and SEQ ID N-27; and a2 and both SEQ ID N-7 and SEQ ID N-8, and all three SEQ ID N-9, SEQ ID N-10 and SEQ ID N-ll; and a4: SEQ ID N-36, and SEQ ID N-37; and all: SEQ ID N-135, and SEQ ID N-136; and al3 SEQ ID N-141, and SEQ ID N-142; and al4: SEQ ID N-147, and SEQ ID N-148,
and comprising for LI, a5: SEQ ID N-53 or both SEQ ID N-54 and SEQ ID N-55, and both SEQ ID N-56and SEQ ID N-57; and a6: SEQ ID N-71 and SEQ ID N-72; and a7: both SEQ ID N-87 and SEQ ID N-88 ,and both SEQ ID N-89and SEQ ID N-90; and alO: both SEQ ID N-128, SEQ ID N-129 and SEQ ID N-130 or all four SEQ ID N-131, SEQ ID N-132, SEQ ID N-133, SEQ ID N-134; and a9: both SEQ ID N-lll and SEQ ID N-112, and both SEQ ID N-113 and SEQ ID N-114; and a8: SEQ ID N-97, and both SEQ ID N-98 and SEQ ID N-99; and al: SEQ ID N-5 and SEQ ID N-6; and a3 SEQ ID N-33 and both SEQ ID N-34 and SEQ ID N?35;and a2 SEQ ID N-18, and both SEQ ID N-19 and SEQ ID N-20; and a4: SEQ ID N40 or
SEQ ID N-41, and SEQ ID N 2 or SEQ ID N43; and all: SEQ ID N-139, and SEQ ID N-140; and al3 SEQ ID N-145, and SEQ ID N-146; and al4: SEQ ID N-151 and SEQ ID N-152.
25. The method of one of claims 19 to 24 wherein said primers further comprise at least one of: a functional group for covalent coupling at the 5' or 3' end, such as a terminal group comprising a thiol, amine or carboxyl group,
a spacer molecule or sequence at the 5' or 3' end,
additional sequences as index or tag sequences to perform pre or post additional and general amplification steps not depending on the target sequences to be quantified.
26. A composition of primers as defined in one of claims 21 to 25.
27. A composition of primers comprising at least one primer selected from SEQ ID No 153 to 158.
28. A composition of primers according to claim 26 wherein said primers further comprise at least one of:
a functional group for covalent coupling at the 5' or 3' end, such as a terminal group comprising a thiol, amine or carboxyl group,
a spacer molecule or sequence at the 5' or 3' end,
additional sequences as index or tag sequences to perform pre or post additional and general amplification steps not depending on the target sequences to be quantified.
29. A kit for diagnosis or prognosis risk to develop HPV induced cancer comprising:
a) a composition of primers according to claim 26 or 27,
b) reagents to detect or sequence amplification products.
30. A kit for diagnosis or prognosis risk to develop HPV induced cancer comprising:
a) primers or probes for detecting at least a first marker selected from E6 mRNAs of group alpha HPVs, E7 mRNAs of group alpha HPVs, or both
b) primers or probes for detecting at least a second marker selected from LI mRNAs of group alpha HPVs, L2 mRNAs of group alpha HPVs, or both,
wherein said E6, E7, LI and L2 mRNAs have corresponding intragenetic sequences,
c) and optionally, primers or probes for detecting at least one host cellular marker indicative of neoplasia or cancer.
31. The kit of claim 29 or 30, further comprising at least 1 control containing a known ratio of E6 and/or E7 to LI and/or L2.
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2014/062926 WO2016005789A1 (en) | 2014-07-07 | 2014-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages |
| PCT/IB2015/055136 WO2016005905A2 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
| DK15753461.1T DK3167079T3 (en) | 2014-07-07 | 2015-07-07 | GENERAL GENERAL AND GENOTYPE PAPILLOMAVIRUS TRANSCRIPTOM AS A BIOMARKER OF PAPILLOMAVIRUS-ASSOCIATED CANCER STAGES |
| EP15753461.1A EP3167079B1 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
| ES15753461T ES2819206T3 (en) | 2014-07-07 | 2015-07-07 | Broad-spectrum papillomavirus gene transcriptome and genotype as biomarkers of papillomavirus-associated cancer stages |
| US15/319,893 US10808284B2 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
| EP20183824.0A EP3744855A1 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages |
| US17/011,990 US11530452B2 (en) | 2014-07-07 | 2020-09-03 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2014/062926 WO2016005789A1 (en) | 2014-07-07 | 2014-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016005789A1 true WO2016005789A1 (en) | 2016-01-14 |
Family
ID=53900866
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2014/062926 Ceased WO2016005789A1 (en) | 2014-07-07 | 2014-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages |
| PCT/IB2015/055136 Ceased WO2016005905A2 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2015/055136 Ceased WO2016005905A2 (en) | 2014-07-07 | 2015-07-07 | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus-associated cancer stages |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US10808284B2 (en) |
| EP (2) | EP3167079B1 (en) |
| DK (1) | DK3167079T3 (en) |
| ES (1) | ES2819206T3 (en) |
| WO (2) | WO2016005789A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113795598A (en) * | 2019-03-28 | 2021-12-14 | 巴斯德研究院 | Primer composition for detecting high-grade squamous intraepithelial lesions |
| EP4028560A4 (en) * | 2019-09-09 | 2023-10-25 | Genomtec SA | Primerset for the detection of the human papilloma virus type 16 (HPV16) and the human papilloma virus type 18 (HPV18), procedure for detection of HPV16 and HPV18 infections, use of a primary set to detect HPV16 and HPV18 infections |
| EP4074843A4 (en) * | 2019-12-13 | 2024-01-17 | Zhejiang Wolwo Bio-pharmaceutical Co., Ltd. | METHOD AND TEST KIT FOR DETECTING HUMAN PAPILLOMAVIRUS |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4028559B1 (en) * | 2019-08-15 | 2026-01-07 | Shrestha, Devjani Ghosh | Methods for diagnosis and in vitro risk stratification for head and neck cancer based on exosomal mrnas |
| KR102468839B1 (en) * | 2020-06-03 | 2022-11-18 | 주식회사 제노헬릭스 | A method of detecting rna |
| EP4320278A4 (en) * | 2021-04-08 | 2025-05-07 | Board of Regents, The University of Texas System | METHODS AND SYSTEMS FOR DETECTION AND QUANTIFICATION OF HPV |
| CN121109663B (en) * | 2025-11-13 | 2026-02-27 | 北京大学第一医院(北京大学第一临床医学院) | A primer composition for detecting different types of human papillomavirus and its application |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999029890A2 (en) * | 1997-12-12 | 1999-06-17 | Digene Corporation | Assessment of human papilloma virus-related disease |
| WO2003057914A2 (en) * | 2002-01-07 | 2003-07-17 | Norchip A/S | METHOD FOR DETECTING HUMAN PAPILLOMAVIRUS mRNA |
| EP2184368A1 (en) * | 2008-11-07 | 2010-05-12 | DKFZ Deutsches Krebsforschungszentrum | Diagnostic transcript and splice patterns of HPV16 in different cervical lesions |
| WO2010129941A1 (en) * | 2009-05-08 | 2010-11-11 | Becton, Dickinson And Company | Correlation of hpv e6 and e7 expression with progression of cervical disease |
| WO2011088573A1 (en) | 2010-01-19 | 2011-07-28 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Set of probes for the detection and typing of 46 human papillomavirus mucosal types |
| WO2012116220A2 (en) * | 2011-02-24 | 2012-08-30 | Qiagen Gaithersburg, Inc. | Materials and methods for detection of hpv nucleic acid |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE69033850T2 (en) * | 1989-12-01 | 2002-06-06 | Vysis, Inc. | Nucleic acid probes for the detection of HPV transcripts |
| GB9626074D0 (en) * | 1996-12-16 | 1997-02-05 | Cytocell Ltd | Nucleic acids amplification assay |
| FR2794370B1 (en) * | 1999-06-03 | 2003-10-17 | Biovector Therapeutics | POLYEPITOPIC PROTEIN FRAGMENTS, THEIR OBTAINMENT AND THEIR USES IN PARTICULAR IN VACCINATION |
| US20060222656A1 (en) * | 2005-04-01 | 2006-10-05 | University Of Maryland, Baltimore | MAGE-A3/HPV 16 peptide vaccines for head and neck cancer |
| DK201000356A (en) | 2010-04-22 | 2011-10-23 | Statens Seruminstitut | New nucleotide sequence amplification Method |
-
2014
- 2014-07-07 WO PCT/IB2014/062926 patent/WO2016005789A1/en not_active Ceased
-
2015
- 2015-07-07 ES ES15753461T patent/ES2819206T3/en active Active
- 2015-07-07 EP EP15753461.1A patent/EP3167079B1/en active Active
- 2015-07-07 DK DK15753461.1T patent/DK3167079T3/en active
- 2015-07-07 EP EP20183824.0A patent/EP3744855A1/en not_active Withdrawn
- 2015-07-07 US US15/319,893 patent/US10808284B2/en active Active
- 2015-07-07 WO PCT/IB2015/055136 patent/WO2016005905A2/en not_active Ceased
-
2020
- 2020-09-03 US US17/011,990 patent/US11530452B2/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999029890A2 (en) * | 1997-12-12 | 1999-06-17 | Digene Corporation | Assessment of human papilloma virus-related disease |
| WO2003057914A2 (en) * | 2002-01-07 | 2003-07-17 | Norchip A/S | METHOD FOR DETECTING HUMAN PAPILLOMAVIRUS mRNA |
| EP2184368A1 (en) * | 2008-11-07 | 2010-05-12 | DKFZ Deutsches Krebsforschungszentrum | Diagnostic transcript and splice patterns of HPV16 in different cervical lesions |
| WO2010129941A1 (en) * | 2009-05-08 | 2010-11-11 | Becton, Dickinson And Company | Correlation of hpv e6 and e7 expression with progression of cervical disease |
| WO2011088573A1 (en) | 2010-01-19 | 2011-07-28 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Set of probes for the detection and typing of 46 human papillomavirus mucosal types |
| WO2012116220A2 (en) * | 2011-02-24 | 2012-08-30 | Qiagen Gaithersburg, Inc. | Materials and methods for detection of hpv nucleic acid |
Non-Patent Citations (8)
| Title |
|---|
| "Short Protocols in Molecular Biology", 2002, CURRENT PROTOCOLS |
| DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; 16 February 2005 (2005-02-16), CHEN QING-YUN ET AL: "[Detection of integration status of human papillomavirus 16 in cervical precancerous lesions].", XP002733700, Database accession no. NLM15854531 * |
| DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; August 1990 (1990-08-01), NAGAI N: "[Molecular biologic study on the carcinogenesis of HPV in uterine cervical cancer and related lesions--analysis of HPV types 16, 18 E6/E7 gene mRNA].", XP002733702, Database accession no. NLM2172419 * |
| DATABASE MEDLINE [online] US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US; September 2003 (2003-09-01), LUKASZUK KRZYSZTOF ET AL: "[Quantity estimation of the E2/E6 HPV gene products ratio can be a prognostic marker for the stage of the cervical cancer carcinogenesis].", XP002733701, Database accession no. NLM14674126 * |
| GINEKOLOGIA POLSKA SEP 2003, vol. 74, no. 9, September 2003 (2003-09-01), pages 793 - 798, ISSN: 0017-0011 * |
| J. SAMBROOK; D.W. RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| NIHON SANKA FUJINKA GAKKAI ZASSHI AUG 1990, vol. 42, no. 8, August 1990 (1990-08-01), pages 823 - 833, ISSN: 0300-9165 * |
| ZHONGHUA YI XUE ZA ZHI 16 FEB 2005, vol. 85, no. 6, 16 February 2005 (2005-02-16), pages 400 - 404, ISSN: 0376-2491 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113795598A (en) * | 2019-03-28 | 2021-12-14 | 巴斯德研究院 | Primer composition for detecting high-grade squamous intraepithelial lesions |
| EP4028560A4 (en) * | 2019-09-09 | 2023-10-25 | Genomtec SA | Primerset for the detection of the human papilloma virus type 16 (HPV16) and the human papilloma virus type 18 (HPV18), procedure for detection of HPV16 and HPV18 infections, use of a primary set to detect HPV16 and HPV18 infections |
| EP4074843A4 (en) * | 2019-12-13 | 2024-01-17 | Zhejiang Wolwo Bio-pharmaceutical Co., Ltd. | METHOD AND TEST KIT FOR DETECTING HUMAN PAPILLOMAVIRUS |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016005905A3 (en) | 2016-04-28 |
| WO2016005905A2 (en) | 2016-01-14 |
| US20210032705A1 (en) | 2021-02-04 |
| EP3167079B1 (en) | 2020-08-05 |
| DK3167079T3 (en) | 2020-09-21 |
| US11530452B2 (en) | 2022-12-20 |
| US20170107582A1 (en) | 2017-04-20 |
| US10808284B2 (en) | 2020-10-20 |
| EP3744855A1 (en) | 2020-12-02 |
| EP3167079A2 (en) | 2017-05-17 |
| ES2819206T3 (en) | 2021-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9809864B2 (en) | Dual sequence-capture method for quantifying trans renal HPV DNA in urine | |
| WO2016005789A1 (en) | Broad range gene and genotype papillomavirus transcriptome as a biomarker of papillomavirus- associated cancer stages | |
| US10428391B2 (en) | Method to use viral and host methylation markers for cervical cancer screening and triage in liquid prep, serum/plasma, and urine: PCR and sequencing based process methods | |
| JP6703400B2 (en) | Molecular diagnostic markers PRDM14 and FAM19A4 for HPV-induced erosive cancer and advanced precursor lesions | |
| MX2007008553A (en) | Systems, methods, and compositions for detection of human papilloma virus in biological samples. | |
| EP3341495B1 (en) | Zic1 and ghsr, molecular diagnostic markers for hpv-induced invasive cancers, nonhpv-induced gynaecological and anogenital cancers and their high-grade precursor lesions | |
| JP7299158B2 (en) | Methylation classifier for detecting HPV-induced invasive cancers, non-HPV-induced gynecologic and anogenital cancers, and their high-grade precursor lesions | |
| WO2010033619A2 (en) | Systems, methods, and compositions for detection of human papilloma virus in biological samples | |
| EP4074843B1 (en) | Method and test kit for detecting human papillomavirus | |
| CN113795598A (en) | Primer composition for detecting high-grade squamous intraepithelial lesions | |
| Fischetti et al. | Role of Viral Infection in the Aetiology-Pathogenesis of Bladder Tumor: A Reality or Chimera? | |
| DAS | Identification of Specific Genetic Alterations in Cervical Cancer by Genome wide LOH and Copy Number Analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14761692 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14761692 Country of ref document: EP Kind code of ref document: A1 |





