WO2016004155A1 - Devices and methods for monitoring and quantifying nucleic acid amplification - Google Patents

Devices and methods for monitoring and quantifying nucleic acid amplification Download PDF

Info

Publication number
WO2016004155A1
WO2016004155A1 PCT/US2015/038739 US2015038739W WO2016004155A1 WO 2016004155 A1 WO2016004155 A1 WO 2016004155A1 US 2015038739 W US2015038739 W US 2015038739W WO 2016004155 A1 WO2016004155 A1 WO 2016004155A1
Authority
WO
WIPO (PCT)
Prior art keywords
reaction
nucleic acid
diffusion
sample chamber
conduit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/038739
Other languages
French (fr)
Inventor
Changchun Liu
Haim H. Bau
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Pennsylvania Penn
Original Assignee
University of Pennsylvania Penn
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Pennsylvania Penn filed Critical University of Pennsylvania Penn
Priority to US15/323,193 priority Critical patent/US12186757B2/en
Publication of WO2016004155A1 publication Critical patent/WO2016004155A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L7/00Heating or cooling apparatus; Heat insulating devices
    • B01L7/54Heating or cooling apparatus; Heat insulating devices using spatial temperature gradients
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L3/00Containers or dishes for laboratory use, e.g. laboratory glassware; Droppers
    • B01L3/50Containers for the purpose of retaining a material to be analysed, e.g. test tubes
    • B01L3/502Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures
    • B01L3/5027Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip
    • B01L3/50273Containers for the purpose of retaining a material to be analysed, e.g. test tubes with fluid transport, e.g. in multi-compartment structures by integrated microfluidic structures, i.e. dimensions of channels and chambers are such that surface tension forces are important, e.g. lab-on-a-chip characterised by the means or forces applied to move the fluids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2200/00Solutions for specific problems relating to chemical or physical laboratory apparatus
    • B01L2200/06Fluid handling related problems
    • B01L2200/0694Creating chemical gradients in a fluid
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/08Geometry, shape and general structure
    • B01L2300/0809Geometry, shape and general structure rectangular shaped
    • B01L2300/0816Cards, e.g. flat sample carriers usually with flow in two horizontal directions
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/18Means for temperature control
    • B01L2300/1805Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks
    • B01L2300/1822Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks using Peltier elements
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/18Means for temperature control
    • B01L2300/1805Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks
    • B01L2300/1827Conductive heating, heat from thermostatted solids is conducted to receptacles, e.g. heating plates, blocks using resistive heater
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2300/00Additional constructional details
    • B01L2300/18Means for temperature control
    • B01L2300/1855Means for temperature control using phase changes in a medium
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00Moving or stopping fluids
    • B01L2400/04Moving fluids with specific forces or mechanical means
    • B01L2400/0403Moving fluids with specific forces or mechanical means specific forces
    • B01L2400/0472Diffusion
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B01PHYSICAL OR CHEMICAL PROCESSES OR APPARATUS IN GENERAL
    • B01LCHEMICAL OR PHYSICAL LABORATORY APPARATUS FOR GENERAL USE
    • B01L2400/00Moving or stopping fluids
    • B01L2400/06Valves, specific forms thereof
    • B01L2400/0677Valves, specific forms thereof phase change valves; Meltable, freezing, dissolvable plugs; Destructible barriers

Definitions

  • nucleic acid quantification requires expensive instruments, such as real-time PCR machines, for continuous monitoring of fluorescence emission from intercalating dye or molecular beacon probes. Although enzymatic amplification products can be detected without an instrument with lateral flow strips, this method suffers from low accuracy and low sensitivity.
  • the target concentration is estimated from a length measurement along a reaction-diffusion-conduit.
  • Exemplary uses of the disclosed devices, methods, and systems include on-site or high throughput applications and the identification of gene expression profiles.
  • each of the chamber and the conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • nucleic acid amplification monitors comprising a substrate and, on or forming a part of the substrate, a plurality of nuclemeters, each nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber; each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
  • Methods of quantifying nucleic acid amplification comprising amplifying a sample comprising a nucleic acid molecule in any of the devices or the nucleic acid amplification monitors disclosed herein to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample and time.
  • each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule, and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample.
  • nuclemeter comprising a sample chamber, at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification, an optical imager, and a heat source.
  • FIG 1, comprising FIGS. 1 A-1E, represent the design and operation of an exemplary nuclemeter for HIV viral load testing
  • (a) A schematic depiction of the cross-section of the nuclemeter, consisting of a sample well and a reaction-diffusion microconduit.
  • (b) An illustration of the nuclemeter's operation. Initially, only the sample chamber contains the nucleic acid template (top). The template amplifies and diffuses into the reaction-conduit, where it continues to amplify at 62.5°C (middle).
  • XF indicates the position of the reaction front that propagates with a constant velocity (vo) (bottom),
  • (c) A photograph of a plastic chip housing four nuclemeters.
  • FIG 2 comprising FIGS. 2A-2I, represent exemplary experimental data and theoretical predictions of nuclemeter's performance, (a) Normalized emission intensity
  • c _ c ⁇ c max as a function of position along the reaction-diffusion conduit at various times.
  • the solid lines and symbols correspond, respectively, to predictions and experimental data.
  • the number of target molecules is 10 3 copies,
  • (b) Normalized emission intensity ⁇ as a function of time at positions x 1.2, 1.8, and 2.4 mm along the length of the conduit.
  • the solid lines and symbols correspond, respectively, to the predictions and experimental data.
  • FIG. 3 represents an exploded view of an exemplary nuclemeter chip consisting of three layers: a top PMMA film, a PMMA chip body, and a bottom PCR SealersTM tape. The various features of the chip body were milled with a CNC machine.
  • FIG. 4 represents a micrograph of the reaction-diffusion micro-conduit's cross- section. The dashed line indicates the interface between the PMMA film and the PMMA chip body.
  • FIG. 5 represents an exemplary experimental setup for the nuclemeter chip.
  • the portable processor includes a USB-based, fluorescence microscope (AM41 13T-GFBW Dino- Lite Premier, AnMo Electronics, Taipei, Taiwan).
  • the processor can be powered either with four AA batteries or by grid power.
  • the fluorescence image of the nuclemeters can be directly displayed on the computer screen.
  • the USB microscope can be replaced with LED illumination and a smartphone camera or other imaging devices.
  • FIG. 6, comprising FIGS. 6A-6C, represent an exemplary portable, processor for RT-LAMP amplification and detection
  • Inset a flexible, polyimide-based, thin film heater (HK5572R7.5L23A, Minco Products, Inc., Minneapolis, MN).
  • the heater can be replaced with an exothermic reaction chamber
  • the four reaction-diffusion reactors are located within the dashed square
  • the mask is equipped with a ruler to assist in determining the position of the reaction front (XF).
  • FIG. 7, comprising FIGS. 7A-7B represent an evaluation of the limits of detection of an examplary nuclemeter and benchtop, "tubed-based" LAMP, (a) A representative, endpoint fluorescent image of the nuclemeter chip with 50 copies (lanes 1 and 2) and 5 copies (lanes 3 and 4) of target HIV RNA molecules, (b) Real-time, benchtop monitoring of RT-LAMP amplification of HIV viral RNA with 50, 5, and 0 (negative control) target RNA copies per tube. Both the nuclemeter and the real time machine detected successfully 50 target molecules and failed to detect 5 target molecules.
  • FIG. 8 represents real-time, benchtop monitoring of RT-LAMP amplification of HIV viral RNA with 10 4 , 10 3 , 10 2 , and 0 (negative control) target RNA molecules per tube on the benchtop PCR machine.
  • the tubes include 0.04% HPMC to replicate the conditions in the nuclemeter chip.
  • FIG. 10 comprising FIGS. 10A- 10D, represent an exemplary nuclemeter' s sample well emission (a) before RT-LAMP amplification, (b) shortly after the onset of amplification, and (c) at saturation of amplification.
  • the number of target molecules is 10 3 copies
  • the solid line and the symbols correspond, respectively, to the best fit line based on equation 4 and the experimental data.
  • the number of target molecules is 10 3 copies.
  • FIG. 11 comprising FIGS. 1 lA- 1 IB, represents: (a) the concentration distribution of the labeled primers in the reaction-diffusion conduit at various times in the absence of an amplification reaction, (b) The emission intensity (normalized with the initial concentration) as a function of position at various times.
  • the lines correspond to theoretical predictions and the symbols to the experimental data (with optimal estimate for the diffusion coefficient).
  • FIG. 12 illustrates a schematic depiction of an exemplary nuclemeter in which the sample chamber and the reaction-diffusion conduits are separated with a barrier consisting of a phase change material, (i) represents a top view with the barrier in place; (ii) represents a side-view with the barrier in place; (iii) represents a side view after the barrier had dissolved, melted, moved, been removed, etc. to allow hydraulic communications between the sample chamber and the reaction-diffusion conduit.
  • the sample chamber contains an optional membrane for the isolation of nucleic acids. The device enables multi-stage amplification with one amplicon being amplified in the sample chamber and the other in the diffusion-reaction conduit.
  • FIG. 13 illustrates a schematic depiction of an exemplary nuclemeter comprising a single sample chamber and multiple reaction-diffusion conduits, each customized to amplify a different nucleic acid.
  • the relative quantities of the various nucleic acids are determined from the relative lengths of the reacted regions, as indicated by the fluorescence emission, in the reaction-diffusion columns, enabling the identification of, among other things, a gene expression profile or bacterial flora.
  • FIG. 14 is an image of an exemplary nuclemeter utilizing bioluminescent assay for real-time recording of the position of the reaction front.
  • the luminescence blob propagates along the conduit and indicates the instantaneous position of the reaction front.
  • the target in this particular assay is HIV.
  • any description as to a possible mechanism or mode of action or reason for improvement is meant to be illustrative only, and the disclosed devices, methods, and systems are not to be constrained by the correctness or incorrectness of any such suggested mechanism or mode of action or reason for improvement.
  • the term "about” is meant to encompass variations of ⁇ 20% or less, variations of 10% or less, variations of ⁇ 5% or less, variations of ⁇ 1% or less, variations of ⁇ 0.5% or less, or variations of ⁇ 0.1% or less from the specified value.
  • fluid communication refers to ability of liquids to diffuse between the sample chamber and the at least one reaction-diffusion conduit.
  • nucleic acid molecules diffuse from the sample chamber into the at least one reaction- diffusion conduit.
  • nucleic acid amplification includes any technique used to detect nucleic acids by amplifying (generating numerous copies of) the target molecules in the sample. Suitable nucleic acid amplification techniques include, but are not limited to, loop- mediated isothermal amplification (LAMP), reverse transcription-loop mediated isothermal amplification (RT-LAMP), or polymerase chain reaction.
  • LAMP loop- mediated isothermal amplification
  • RT-LAMP reverse transcription-loop mediated isothermal amplification
  • polymerase chain reaction polymerase chain reaction
  • nuclemeter refers to a reaction-diffusion device for monitoring and quantitative detection of amplified nucleic acid molecules based on the position of the reaction front.
  • Each nuclemeter comprises at least one sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber.
  • Target refers to a sequence, or partial sequence, of a nucleic acid of interest.
  • Target and “nucleic acid molecule” are used interchangeably herein.
  • the nuclemeter comprises a sample chamber and at least one reaction- diffusion conduit in fluid communication with the chamber.
  • each of the chamber and the at least one reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification.
  • each of the chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • the sample chamber may also serve as a nucleic acid amplification reactor.
  • the device for monitoring nucleic acid amplification can comprise a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
  • the device for monitoring nucleic acid amplification can comprise a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit holding a blend of reactants for nucleic acid amplification.
  • the sample chamber and diffusion-reaction conduit can be separated with a barrier.
  • the barrier can be configured to block passage of reactants between the sample chamber and the reaction-diffusion conduit during sample introduction, nucleic acid isolation, etc. and can be configured to allow passage of reactants between the sample chamber and the reaction- diffusion conduit at a specified time or in response to an event.
  • the barrier can be removable.
  • the barrier can be physically removed from the nuclemeter.
  • the barrier can be degradable.
  • the barrier can be composed of, or can comprise, a material that degrades.
  • the barrier can be dissolvable.
  • the barrier can be composed of a material that dissolves in solution.
  • the barrier can be capable of being melted.
  • the barrier can be composed of, or can comprise, a phase change material that melts, or partially melts, at a certain temperature .
  • the barrier can melt and move through the action of surface tension (capillary) forces or buoyancy or combination thereof, thereby allowing diffusion between the sample chamber and the reaction diffusion conduit.
  • the barrier can be movable.
  • the barrier can be configured to open or otherwise allow passage of sample between the sample chamber and the reaction diffusion conduit in response to a mechanical force or various means of actuation.
  • the actuator may consist of bimetal or shape memory alloy that alters shape in response to temperature variations.
  • the barrier can allow for a two-step or nested-like amplification. For example, two different amplification reactions can be run; one in the sample chamber and one in the reaction-diffusion conduit.
  • the reaction in the sample chamber can, for example, amplify nucleic acid molecules non-specifically.
  • the barrier can be removed, dissolved, degraded, melted, etc. allowing the amplified nucleic acid molecules to diffuse into the reaction-diffusion conduit, which can contain primers for a specific nucleic acid molecule. Within the reaction-diffusion conduit, specific nucleic acid molecules will then be amplified.
  • the two reactions can operate with different enzymes, temperatures, etc.
  • the sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction.
  • the cross-section of the sample chamber can have a variety of suitable shapes, including, but not limited to, square, rectangular, triangular, pentagonal, hexagonal, heptagonal, octagonal, nonagonal, decagonal, round, or elliptical.
  • the bottom of the sample chamber can be flat, substantially flat, conical, round, substantially round, or pointed or contain depressions, for example, for the purpose of storing reagents needed for the amplification process.
  • the sample chamber can be a droplet, which can be manipulated to make contact with the reaction-diffusion conduit.
  • Numerous techniques are known for manipulating droplets including, but not limited to, electrowetting, thermal gradients, solute gradients, conduit geometry such as taper, or any combination thereof.
  • a droplet comprising the reactant mixture and nucleic acid sample can be placed onto a surface containing a plurality of electrodes.
  • An electric field can be applied to the surface resulting in migration of the droplet towards (or away from) the reaction-diffusion conduit. The electric field can be applied until the droplet makes contact, such as a hydraulic connection, with the reaction-diffusion conduit.
  • the amplified nucleic acid sample can diffuse into the reaction-diffusion conduit.
  • the droplet is the sample chamber. In other embodiments, the droplet is placed within the sample chamber. In some embodiments, the droplet can be encased in oil. In some embodiments, the droplet can be produced by a microfluidic device.
  • the sample chamber when used for nucleic acid amplification, will have a size suitable for a containing a nucleic acid amplification reaction. Suitable sizes include sample chambers having a volume of from about 0.1 ⁇ to about 300 ⁇ . In one embodiment, the sample chamber has a volume of about 0.1 ⁇ . In one embodiment, the sample chamber has a volume of about 0.5 ⁇ . In one embodiment, the sample chamber has a volume of about 1 ⁇ . In one embodiment, the sample chamber has a volume of about 10 ⁇ . In one embodiment, the sample chamber has a volume of about 20 ⁇ . In one embodiment, the sample chamber has a volume of about 50 ⁇ . In one embodiment, the sample chamber has a volume of about 100 ⁇ .
  • the sample chamber has a volume of about 150 ⁇ . In one embodiment, the sample chamber has a volume of about 200 ⁇ . In one embodiment, the sample chamber has a volume of about 250 ⁇ . In one embodiment, the sample chamber has a volume of about 300 ⁇ . In some embodiments, the sample chamber has a volume greater than 300 ⁇ .
  • the sample chamber can be from about 0.1 ⁇ to about 300 ⁇ in volume. In some aspects, the sample chamber can be from about 0.1 ⁇ to about 250 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 200 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 150 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 100 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 50 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 300 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 200 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 150 ⁇ in volume.
  • the sample chamber can be from about 10 ⁇ to about 100 ⁇ in volume.
  • the sample chamber can be from about 10 ⁇ to about 50 ⁇ in volume. In some aspects, the sample chamber can be from about 25 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 50 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 75 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 100 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 125 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 150 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 175 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 200 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 225 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 250 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 275
  • the height of the sample chamber can be from about 0.05 mm to about 10 mm.
  • the height of the sample chamber can be from about 0.1 mm to about 9 mm.
  • the height of the sample chamber can be from about 0.2 mm to about 8 mm.
  • the height of the sample chamber can be from about 0.3 mm to about 7 mm.
  • the height of the sample chamber can be from about 0.4 mm to about 6 mm.
  • the height of the sample chamber can be from about 0.5 mm to about 5 mm.
  • the height of the sample chamber can be from about 0.6 mm to about 4 mm.
  • the height of the sample chamber can be from about 0.7 mm to about 3 mm.
  • the height of the sample chamber can be from about 0.8 mm to about 2 mm.
  • the height of the sample chamber can be from about 0.9 mm to about 1 mm.
  • the height of the sample chamber can be about 0.05 mm. In some aspects, the height of the sample chamber can be about 0.1 mm. In some aspects, the height of the sample chamber can be about 0.2 mm. In some aspects, the height of the sample chamber can be about 0.3 mm. In some aspects, the height of the sample chamber can be about 0.4 mm. In some aspects, the height of the sample chamber can be about 0.5 mm. In some aspects, the height of the sample chamber can be about 0.6 mm. In some aspects, the height of the sample chamber can be about 0.7 mm. In some aspects, the height of the sample chamber can be about 0.8 mm. In some aspects, the height of the sample chamber can be about 0.9 mm.
  • the height of the sample chamber can be about 1 mm. In some aspects, the height of the sample chamber can be about 2.5 mm. In some aspects, the height of the sample chamber can be about 5 mm. In some aspects, the height of the sample chamber can be about 7.5 mm. In some aspects, the height of the sample chamber can be about 10 mm.
  • the width of the sample chamber can be from about 0.05 mm to about 5 mm.
  • the width of the sample chamber can be from about 0.1 mm to about 4 mm.
  • the width of the sample chamber can be from about 0.2 mm to about 3 mm.
  • the width of the sample chamber can be from about 0.3 mm to about 2 mm.
  • the width of the sample chamber can be from about 0.4 mm to about 1 mm.
  • the width of the sample chamber can be from about 0.5 mm to about 0.9 mm.
  • the width of the sample chamber can be from about 0.6 mm to about 0.8 mm.
  • the width of the sample chamber can be about 0.05.
  • the width of the sample chamber can be about 0.1 mm.
  • the width of the sample chamber can be about 0.2 mm.
  • the width of the sample chamber can be about 0.3 mm.
  • the width of the sample chamber can be about 0.4 mm.
  • the width of the sample chamber can be about 0.5 mm.
  • the width of the sample chamber can be from 0.6 mm.
  • the width of the sample chamber can be about 0.7.
  • the width of the sample chamber can be about 0.8 mm.
  • the width of the sample chamber can be about 0.9 mm.
  • the width of the sample chamber can be about 1 mm.
  • the width of the sample chamber can be about 2 mm.
  • the width of the sample chamber can be about 3 mm.
  • the width of the sample chamber can be about 4 mm.
  • the width of the sample chamber can be about 2 mm.
  • the width of the sample chamber can be about 5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 100 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 75 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 50 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 25 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 10 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 2.5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 1 mm.
  • the length of the reaction- diffusion conduit can be from about 0.05 mm to about 0.5 mm.
  • the length of the reaction-diffusion conduit can be about 100 mm.
  • the length of the reaction-diffusion conduit can be about 75 mm.
  • the length of the reaction-diffusion conduit can be about 50 mm.
  • the length of the reaction-diffusion conduit can be about 25 mm.
  • the length of the reaction-diffusion conduit can be about 10 mm.
  • the length of the reaction-diffusion conduit can be about 5 mm.
  • the length of the reaction-diffusion conduit can be about 2.5 mm.
  • the length of the reaction-diffusion conduit can be about 1 mm.
  • the length of the reaction- diffusion conduit can be about 0.5 mm.
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 mm.
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 750 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 500 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 250 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 100 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 50 ⁇ .
  • the height of the reaction- diffusion conduit can be from about 0.1 ⁇ to about 25 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 10 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 5 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 0.5 ⁇ .
  • the height of the reaction-diffusion conduit can be about 1 mm.
  • the height of the reaction-diffusion conduit can be about 750 ⁇ .
  • the height of the reaction-diffusion conduit can be about 500 ⁇ .
  • the height of the reaction-diffusion conduit can be about 250 ⁇ .
  • the height of the reaction-diffusion conduit can be about 100 ⁇ .
  • the height of the reaction- diffusion conduit can be about 50 ⁇ .
  • the height of the reaction-diffusion conduit can be about 25 ⁇ .
  • the height of the reaction-diffusion conduit can be about 10 ⁇ .
  • the height of the reaction-diffusion conduit can be about 5 ⁇ .
  • the height of the reaction-diffusion conduit can be about 1 ⁇ .
  • the height of the reaction-diffusion conduit can be about 0.5 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 mm.
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 750 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 500 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 250 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 100 ⁇ .
  • the width of the reaction- diffusion conduit can be from about 0.1 ⁇ to about 50 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 25 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 10 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 5 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 0.5 ⁇ .
  • the width of the reaction-diffusion conduit can be about 1 mm.
  • the width of the reaction-diffusion conduit can be about 750 ⁇ .
  • the width of the reaction-diffusion conduit can be about 500 ⁇ .
  • the width of the reaction-diffusion conduit can be about 250 ⁇ .
  • the width of the reaction-diffusion conduit can be about 100 ⁇ .
  • the width of the reaction-diffusion conduit can be about 50 ⁇ .
  • the width of the reaction-diffusion conduit can be about 25 ⁇ .
  • the width of the reaction-diffusion conduit can be about 10 ⁇ .
  • the width of the reaction-diffusion conduit can be about 5 ⁇ .
  • the width of the reaction-diffusion conduit can be about 1 ⁇ .
  • the width of the reaction-diffusion conduit can be about 0.5 ⁇ .
  • the cross-section of the reaction-diffusion conduit may be, for example, a rectangle, a square, a circle, a semi-circle, a triangle, a trapezoid.
  • the reaction-diffusion conduit may be, for example, straight, curved, spiral, or contain turns.
  • the device can have one reaction-diffusion conduct in fluid communication with the sample chamber.
  • the device can have a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
  • the device can have between 2 to about 100 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the device can have 2 reaction- diffusion conduits in fluid communication with the sample chamber.
  • the device can have 3 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the device can have 4 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the device can have 5 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the device can have 10 reaction- diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 15 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 20 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the device can have more than 20 reaction-diffusion conduits in fluid communication with the sample chamber. [0062] In some embodiments, the device can have 1 sample chamber, said sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. In some aspects, the device can have 1 sample chamber, said sample chamber having 1 reaction- diffusion conduit in fluid communication therewith. In some aspects, the device can have 1 sample chamber, said sample chamber having a plurality of reaction-diffusion conduits in fluid communication therewith. For example, in some aspects, the device can have 1 sample chamber, said sample chamber having about 2 to about 100 reaction-diffusion conduits in fluid
  • the device can have a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
  • the device can have 1 to 100 sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
  • the device can have 1 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the device can have 2 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid
  • the device can have 3 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 4 sample chambers, each sample chamber having 2-100 reaction- diffusion conduits in fluid communication therewith. In some aspects, the device can have 5 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 10 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 50 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the device can have 75 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 100 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the device can have a plurality of sample chambers, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • less than 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith.
  • 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
  • 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 5% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 1% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 5% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 10% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 15% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 25% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 40% to about 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith. In some aspects, about 55% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 70% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 85% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
  • about 1% to about 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • the device can have at least one sample chamber having a known quantity of a preselected, nucleic acid molecule, which can serve has a "positive control” or "calibration" nuclemeter.
  • the disclosed devices can be used in combination with porous membranes for nucleic acid extraction, concentration, and purification.
  • Suitable porous membranes include, but are not limited to, silica membrane, Whatman FTA membrane, alumina membrane, cellulose membrane.
  • Such porous membranes specifically bind nucleic acids allowing other non-nucleic acid material to pass through the membrane.
  • a nucleic acid sample can be incubated with a porous membrane, the porous membrane can be washed to remove non-nucleic acid material, and the porous membrane can be added to the sample chamber.
  • the device can have a sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
  • Suitable sample chambers include those disclosed in U.S. Application No. 14/001,347 (US2014/0162244).
  • the porous membrane can be removably located within the sample chamber.
  • the porous membrane can be attached to the inside of the sample chamber.
  • all or a portion of the sample chamber can be made from a porous membrane.
  • the sample chamber and/or the reaction-diffusion conduit can be made of a porous polymer or cellulose material. The blend of reactants can be stored in the porous polymer or cellulose material until the device is ready for use.
  • the device further comprises a waste conduit.
  • the waste conduit can, for example, be used to empty the sample chamber, decrease the volume of the sample in the sample chamber, extract amplified material from the sample chamber, remove non- nucleic acid material from the sample chamber, or any combination thereof.
  • the waste conduit and reaction-diffusion conduits can have a valve to open and close the conduit, allowing and preventing, respectively, sample from flowing into the conduit.
  • the sample chamber contains a porous membrane.
  • the valves on both the waste conduit and reaction-diffusion conduits can be closed to allow the sample to interact with the membrane.
  • the valve on the waste conduit can be opened, while the valve on the reaction-diffusion conduit can remain closed. After the waste is removed, the valve on the waste conduit can be closed.
  • the appropriate reactant mixture can be added to the sample chamber and the valve on the reaction-diffusion conduit can be opened, allowing diffusion of the amplified sample into the reaction-diffusion conduit.
  • the valve can be a passive valve. In other embodiments, the valve can be an active valve.
  • the device further comprises a light source.
  • Suitable light sources include, but are not limited to, light-emitting diode (LED), compact fluorescent lamp (CFL), or incandescent.
  • the device can further comprise an optical imager.
  • Suitable optical imagers include, but are not limited to, a fluorescent microscope or a camera.
  • the camera can be from a cellular telephone, smart-phone camera, tablet computer, or computer.
  • the device can be operatively connected to a controller or computer.
  • the device further comprises a ruler along the length of the reaction-diffusion conduit.
  • the device can further comprise a heat source.
  • Suitable heat sources include a thermoelectric unit, an electric heater, an exothermic reactor, a laser, or any combination thereof.
  • the heat source can provide a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
  • Such a heat source enables different temperatures to be applied to different regions of the reaction-diffusion conduit at different times.
  • the temperature can be regulated with a phase change material.
  • the temperature gradient along the reaction-diffusion conduit can be linear.
  • the temperature in the sample chamber can be different from the temperature in the reaction-diffusion conduit. In other embodiments, the temperature in the sample chamber can be the same as the temperature in the reaction-diffusion conduit.
  • each of the chamber and the at least one reaction- diffusion conduit hold a blend of reactants for nucleic acid amplification.
  • each of the chamber and the at least on reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • the blend of reactants can comprise a plurality of primers and enzymes.
  • the blend of reactants can further comprise one or more types of reporters. Those skilled in the art would understand that numerous primers, enzymes, and reporters are suitable for nucleic acid amplification procedures. Primers of any length suitable for nucleic acid amplification can be used herein.
  • primers of nucleic acid amplification are used in pairs - a forward or sense primer and a reverse or antisense primer.
  • “Plurality of primers” and “primer sets” are used interchangeably herein and refer to at least one pair of primers.
  • the plurality of primers can be a pair of primers.
  • the plurality of primers can be 2 pairs of primers.
  • plurality of primers can be more than 2 pairs of primers.
  • Enzymes suitable for nucleic acid amplification include, but are not limited to, DNA polymerase, RNA-dependent DNA polymerase (reverse transcriptase), or DNA-dependent RNA polymerase (RNA polymerase).
  • reporter means any tag, label, or dye that can bind to, or intercalate within, the nucleic acid molecule or be activated by byproducts of the amplification process to enable visualization of the nucleic acid molecule or the amplification process.
  • Suitable reporters include, but are not limited to, fluorescent labels/tags/dyes, intercalating agents, molecular beacon labels, and bioluminescent molecules.
  • the sample chamber and reaction-diffusion conduit may contain a mixture of primers engineered to be specific to various targets, enabling the concurrent amplification and detection of multiple targets.
  • the sample chamber may contain universal primers to amplify all targets, while the reaction-diffusion conduits may contain primers for specific targets.
  • the universal primers in the sample chamber can be immobilized to prevent passage of the primers into the reaction-diffusion conduit. Primers can be immobilized to, for example, the sample chamber or something within the sample chamber that cannot pass into the reaction-diffusion conduit.
  • the reaction-diffusion conduit may also contain reporters (molecular beacons) each engineered to bind to a specific target and each emitting at different range of the spectrum, allowing the detector, with appropriate filters, to image each target separately.
  • reactants include, but are not limited to, buffers and dNTPs.
  • the blend of reactants, or a portion thereof can be pre-stored in the device.
  • the blend of reactants, or a portion thereof are pre-stored in the device and are released upon an increase in temperature.
  • the blend of reactants can be released when the device is heated to its operating temperature.
  • the blend of reactants can be liquid or can be in a form that is capable of forming a liquid upon a change in temperature, such as a gel or solid.
  • the blend of reactants can be encased in, embedded in, or surrounded by, a material that melts with increasing temperatures, such as, for example, paraffin.
  • the primers and/or enzymes may be immobilized to the conduit walls or to a porous matrix that fills the reaction- diffusion conduit.
  • the device can have at least two nuclemeters, each containing different primers.
  • the primers can recognize the same nucleic acid molecule but differ in length.
  • the primers can recognize different nucleic acid molecules and be the same length.
  • the primers can recognize different nucleic acid molecules and be different lengths.
  • a single nuclemeter can have multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
  • one reaction- diffusion conduit can contain a first plurality of primers and another reaction-diffusion conduit can contain a second plurality of primers, the second plurality of primers being different from the first plurality of primers.
  • the sample chamber can contain: a mix of a first plurality of primers and second plurality of primers; only a first plurality of primers; only a second plurality of primers; or a third plurality of primers.
  • the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying different nucleic acid molecules.
  • the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying at least two different nucleic acid molecules.
  • At least one of the reaction-diffusion conduits can contain at least one polymer. In some embodiments, at least one of the reaction-diffusion conduit and the sample chamber can contain at least one polymer. The presence of the polymer in the reaction-diffusion conduit or reaction-diffusion conduit and sample chamber can slow the diffusion of the amplified DNA and control the speed of propagation of the reaction front in the reaction-diffusion conduit, so that the diffusion may be easily monitored and/or quantified.
  • the at least one polymer can be a gel. In embodiments wherein the at least one polymer is a gel, the primers, enzymes, or both can be immobilized to the gel.
  • the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
  • ambient temperature refers to the temperature of the device prior to the amplification procedure.
  • the polymer prior to the amplification procedure, can be a solid.
  • the reaction-diffusion conduit contains gel.
  • the disclosed devices can be used for a number of purposes including, but not limited to, melting curve analysis, reverse transcription, identifying a nucleic acid in a sample, diagnosis, quantifying the number of nucleic acid molecules in a sample, and testing
  • the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
  • nucleic acid amplification monitors comprising a substrate and, on or forming a part of the substrate, and a plurality of nuclemeters.
  • Each nuclemeter comprises an sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber.
  • each of the chamber and the at least on reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification.
  • each of the chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • Suitable substrates include, but are not limited to, glass, plastic, polymers, metal, silicon, aluminum oxide membrane, acrylic, paper, or any combination thereof.
  • the substrate is a polymeric chip.
  • Polymeric chips can be composed of numerous polymers including, but not limited to, polycarbonate (PC), poly-methyl methacrylate (PMMA), cyclic olefin co-polymers (COC), or any combination thereof.
  • the polymeric chip comprises polymethyl methacrylate (PMMA).
  • the plurality of nuclemeters can be on the substrate.
  • the nuclemeter and the substrate can be separate components, and can be combined or attached such that the nuclemeter is on a top surface of the substrate.
  • the nuclemeter and substrate can be from a single component wherein the nuclemeter is located on a top surface of the substrate.
  • the nuclemeter can form a part of the substrate.
  • the nuclemeter can be etched into the substrate.
  • the substrate can be molded to form the nuclemeter.
  • the sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction.
  • the cross-section of the sample chamber can have a variety of suitable shapes, including, but not limited to, square, rectangular, triangular, pentagonal, hexagonal, heptagonal, octagonal, nonagonal, decagonal, round, or elliptical.
  • the bottom of the sample chamber can be flat, substantially flat, conical, round, substantially round, or pointed.
  • the sample chamber can be a droplet covered by oil, wherein the droplet is propelled by means such as electrowetting to make hydraulic connection with the reaction- diffusion conduit.
  • the sample chamber and diffusion-reaction conduit can be separated with a barrier.
  • the barrier can be configured to block passage of reactants between the sample chamber and the reaction-diffusion conduit during sample introduction, nucleic acid isolation, etc. and can be configured to allow passage of reactants between the sample chamber and the reaction- diffusion conduit at a specified time or in response to an event.
  • the barrier can be removable.
  • the barrier can be physically removed from the nuclemeter.
  • the barrier can be degradable.
  • the barrier can be composed of, or can comprise, a material that degrades.
  • the barrier can be dissolvable.
  • the barrier can be composed of a material that dissolves in solution.
  • Exemplary materials that dissolve in solution include, for example, salt.
  • the barrier can be capable of being melted.
  • the barrier can be composed of, or can comprise, a phase change material that melts at a certain temperature.
  • the barrier can be movable.
  • the barrier can be configured to open or otherwise allow passage of sample between the sample chamber and the reaction diffusion conduit in response to a force, such as the amplification of the nucleic acid molecule or other surface tension.
  • the barrier can allow for a two-step or nested-like amplification. For example, two different amplification reactions can be run; one in the sample chamber and one in the reaction-diffusion conduit.
  • the reaction in the sample chamber can, for example, amplify nucleic acid molecules non-specifically.
  • the barrier can be removed, dissolved, degraded, melted, etc. allowing the amplified nucleic acid molecules to diffuse into the reaction-diffusion conduit, which can contain primers for a specific nucleic acid molecule. Within the reaction-diffusion conduit, specific nucleic acid molecules will then be amplified.
  • the two reactions can operate with different enzymes, temperatures, etc.
  • the sample chamber has a size suitable for a containing a nucleic acid amplification reaction. Suitable sizes include sample chambers having a volume of from about 0.1 ⁇ to about 300 ⁇ . In one embodiment, the sample chamber has a volume of about 0.1 ⁇ . In one embodiment, the sample chamber has a volume of about 0.5 ⁇ . In one embodiment, the sample chamber has a volume of about 1 ⁇ . In one embodiment, the sample chamber has a volume of about 10 ⁇ . In one embodiment, the sample chamber has a volume of about 20 ⁇ . In one embodiment, the sample chamber has a volume of about 50 ⁇ . In one embodiment, the sample chamber has a volume of about 100 ⁇ . In one embodiment, the sample chamber has a volume of about 150 ⁇ .
  • the sample chamber has a volume of about 200 ⁇ . In one embodiment, the sample chamber has a volume of about 250 ⁇ . In one embodiment, the sample chamber has a volume of about 300 ⁇ . In some embodiments, the sample chamber has a volume greater than 300 ⁇ .
  • the sample chamber can be from about 0.1 ⁇ to about 300 ⁇ in volume. In some aspects, the sample chamber can be from about 0.1 ⁇ to about 250 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 200 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 150 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 100 ⁇ in volume. The sample chamber can be from about 0.1 ⁇ to about 50 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 300 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 200 ⁇ in volume. The sample chamber can be from about 10 ⁇ to about 150 ⁇ in volume.
  • the sample chamber can be from about 10 ⁇ to about 100 ⁇ in volume.
  • the sample chamber can be from about 10 ⁇ to about 50 ⁇ in volume. In some aspects, the sample chamber can be from about 25 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 50 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 75 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 100 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 125 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 150 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 175 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 200 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 225 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 250 ⁇ to about 300 ⁇ in volume.
  • the sample chamber can be from about 275 ⁇ to about 300 ⁇ in volume.
  • the height of the sample chamber can be from about 0.05 mm to about 10 mm.
  • the height of the sample chamber can be from about 0.1 mm to about 9 mm.
  • the height of the sample chamber can be from about 0.2 mm to about 8 mm.
  • the height of the sample chamber can be from about 0.3 mm to about 7 mm.
  • the height of the sample chamber can be from about 0.4 mm to about 6 mm.
  • the height of the sample chamber can be from about 0.5 mm to about 5 mm.
  • the height of the sample chamber can be from about 0.6 mm to about 4 mm.
  • the height of the sample chamber can be from about 0.7 mm to about 3 mm.
  • the height of the sample chamber can be from about 0.8 mm to about 2 mm.
  • the height of the sample chamber can be from about 0.9 mm to about 1 mm.
  • the height of the sample chamber can be about 0.05 mm. In some aspects, the height of the sample chamber can be about 0.1 mm. In some aspects, the height of the sample chamber can be about 0.2 mm. In some aspects, the height of the sample chamber can be about 0.3 mm. In some aspects, the height of the sample chamber can be about 0.4 mm. In some aspects, the height of the sample chamber can be about 0.5 mm. In some aspects, the height of the sample chamber can be about 0.6 mm. In some aspects, the height of the sample chamber can be about 0.7 mm. In some aspects, the height of the sample chamber can be about 0.8 mm. In some aspects, the height of the sample chamber can be about 0.9 mm.
  • the height of the sample chamber can be about 1 mm. In some aspects, the height of the sample chamber can be about 2.5 mm. In some aspects, the height of the sample chamber can be about 5 mm. In some aspects, the height of the sample chamber can be about 7.5 mm. In some aspects, the height of the sample chamber can be about 10 mm.
  • the width of the sample chamber can be from about 0.05 mm to about 5 mm.
  • the width of the sample chamber can be from about 0.1 mm to about 4 mm.
  • the width of the sample chamber can be from about 0.2 mm to about 3 mm.
  • the width of the sample chamber can be from about 0.3 mm to about 2 mm.
  • the width of the sample chamber can be from about 0.4 mm to about 1 mm.
  • the width of the sample chamber can be from about 0.5 mm to about 0.9 mm.
  • the width of the sample chamber can be from about 0.6 mm to about 0.8 mm.
  • the width of the sample chamber can be about 0.05.
  • the width of the sample chamber can be about 0.1 mm.
  • the width of the sample chamber can be about 0.2 mm.
  • the width of the sample chamber can be about 0.3 mm.
  • the width of the sample chamber can be about 0.4 mm.
  • the width of the sample chamber can be about 0.5 mm.
  • the width of the sample chamber can be from 0.6 mm.
  • the width of the sample chamber can be about 0.7.
  • the width of the sample chamber can be about 0.8 mm.
  • the width of the sample chamber can be about 0.9 mm.
  • the width of the sample chamber can be about 1 mm.
  • the width of the sample chamber can be about 2 mm.
  • the width of the sample chamber can be about 3 mm.
  • the width of the sample chamber can be about 4 mm.
  • the width of the sample chamber can be about 2 mm.
  • the width of the sample chamber can be about 5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 100 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 75 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 50 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 25 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 10 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 2.5 mm.
  • the length of the reaction-diffusion conduit can be from about 0.05 mm to about 1 mm.
  • the length of the reaction- diffusion conduit can be from about 0.05 mm to about 0.5 mm.
  • the length of the reaction-diffusion conduit can be about 100 mm.
  • the length of the reaction-diffusion conduit can be about 75 mm.
  • the length of the reaction-diffusion conduit can be about 50 mm.
  • the length of the reaction-diffusion conduit can be about 25 mm.
  • the length of the reaction-diffusion conduit can be about 10 mm.
  • the length of the reaction- diffusion conduit can be about 5 mm.
  • the length of the reaction-diffusion conduit can be about 2.5 mm.
  • the length of the reaction-diffusion conduit can be about 1 mm.
  • the length of the reaction-diffusion conduit can be about 0.5 mm.
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 mm.
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 750 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 500 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 250 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 100 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 50 ⁇ .
  • the height of the reaction- diffusion conduit can be from about 0.1 ⁇ to about 25 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 10 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 5 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 ⁇ .
  • the height of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 0.5 ⁇ .
  • the height of the reaction-diffusion conduit can be about 1 mm.
  • the height of the reaction-diffusion conduit can be about 750 ⁇ .
  • the height of the reaction-diffusion conduit can be about 500 ⁇ .
  • the height of the reaction-diffusion conduit can be about 250 ⁇ .
  • the height of the reaction-diffusion conduit can be about 100 ⁇ .
  • the height of the reaction- diffusion conduit can be about 50 ⁇ .
  • the height of the reaction-diffusion conduit can be about 25 ⁇ .
  • the height of the reaction-diffusion conduit can be about 10 ⁇ .
  • the height of the reaction-diffusion conduit can be about 5 ⁇ .
  • the height of the reaction-diffusion conduit can be about 1 ⁇ .
  • the height of the reaction-diffusion conduit can be about 0.5 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 mm.
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 750 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 500 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 250 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 100 ⁇ .
  • the width of the reaction- diffusion conduit can be from about 0.1 ⁇ to about 50 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 25 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 10 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 5 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 1 ⁇ .
  • the width of the reaction-diffusion conduit can be from about 0.1 ⁇ to about 0.5 ⁇ .
  • the width of the reaction-diffusion conduit can be about 1 mm.
  • the width of the reaction-diffusion conduit can be about 750 ⁇ .
  • the width of the reaction-diffusion conduit can be about 500 ⁇ .
  • the width of the reaction-diffusion conduit can be about 250 ⁇ .
  • the width of the reaction-diffusion conduit can be about 100 ⁇ .
  • the width of the reaction-diffusion conduit can be about 50 ⁇ .
  • the width of the reaction-diffusion conduit can be about 25 ⁇ .
  • the width of the reaction-diffusion conduit can be about 10 ⁇ .
  • the width of the reaction-diffusion conduit can be about 5 ⁇ .
  • the width of the reaction-diffusion conduit can be about 1 ⁇ .
  • the width of the reaction-diffusion conduit can be about 0.5 ⁇ .
  • the cross-section of the reaction-diffusion conduit may be, for example, a rectangle, a square, a circle, a semi-circle, a triangle, a trapezoid.
  • the reaction-diffusion conduit may be, for example, straight, curved, spiral, or contain turns.
  • the nucleic acid amplification monitor can have 1 reaction-diffusion conduct in fluid communication with the sample chamber. In other embodiments, the nucleic acid amplification monitor can have a plurality of reaction-diffusion conduits in fluid communication with the sample chamber. For example, the nucleic acid amplification monitor can have between 2 to about 100 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 2 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 3 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the nucleic acid amplification monitor can have 4 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 5 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 10 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 15 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 20 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have more than 20 reaction-diffusion conduits in fluid communication with the sample chamber.
  • the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having at least one reaction-diffusion conduit in fluid
  • the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having 1 reaction-diffusion conduit in fluid
  • the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having a plurality of reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having about 2 to about 100 reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
  • the nucleic acid amplification monitor can have 1 to 100 sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
  • the nucleic acid amplification monitor can have 1 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have 2 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have 3 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 4 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 5 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 10 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have 50 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 75 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 100 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have a plurality of sample chambers, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • less than 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 5% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 1% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 5% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 10% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 15% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 25% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 40% to about 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith. In some aspects, about 55% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 70% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 85% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
  • about 1% to about 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • about 1% to about 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • the nucleic acid amplification monitor can have at least one sample chamber having a known quantity of a preselected, nucleic acid molecule, which can serve has a "positive control” or "calibration" nuclemeter.
  • the disclosed nucleic acid amplification monitors can be used in combination with porous membranes for nucleic acid extraction, concentration, and purification.
  • Suitable porous membranes include, but are not limited to, silica membrane, Whatman FTA membrane, alumina membrane, cellulose membrane.
  • Such porous membranes specifically bind nucleic acids allowing other non-nucleic acid material to pass through the membrane.
  • a nucleic acid sample can be incubated with a porous membrane, the porous membrane can be washed to remove non-nucleic acid material, and the porous membrane can be added to the sample chamber.
  • the nucleic acid amplification monitor can have an sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
  • Suitable sample chambers include those disclosed in U.S. Application No. 14/001,347 (US2014/0162244).
  • the porous membrane can be removably located within the sample chamber.
  • the porous membrane can be attached to the inside of the sample chamber.
  • all or a portion of the sample chamber can be made from a porous membrane.
  • the nucleic acid amplification monitor further comprises a waste conduit.
  • the waste conduit can, for example, be used to empty the sample chamber, decrease the volume of the sample in the sample chamber, extract amplified material from the sample chamber, remove non-nucleic acid material from the sample chamber, or any combination thereof.
  • the waste conduit and reaction-diffusion conduits can have a valve to open and close the conduit, allowing and preventing, respectively, sample from flowing into the conduit.
  • the sample chamber contains a porous membrane.
  • the valves on both the waste conduit and reaction-diffusion conduits can be closed to allow the sample to interact with the membrane.
  • the valve on the waste conduit can be opened, while the valve on the reaction-diffusion conduit can remain closed. After the waste is removed, the valve on the waste conduit can be closed.
  • the appropriate reactant mixture can be added to the sample chamber and the valve on the reaction-diffusion conduit can be opened, allowing diffusion of the amplified sample into the reaction-diffusion conduit.
  • the valve can be a passive valve. In other embodiments, the valve can be an active valve.
  • the nucleic acid amplification monitor further comprises a light source.
  • Suitable light sources include, but are not limited to, light-emitting diode (LED), compact fluorescent lamp (CFL), filtered flash light of a cell phone camera, or incandescent.
  • the nucleic acid amplification monitor can further comprise an optical imager.
  • Suitable optical imagers include, but are not limited to, a fluorescent microscope or a camera.
  • the camera can be from a cellular telephone, smart-phone camera, tablet computer, or computer.
  • the nucleic acid amplification monitor can be operatively connected to a controller or computer.
  • the nucleic acid amplification monitor further comprises a ruler along the length of the reaction-diffusion conduit.
  • the nucleic acid amplification monitor can further comprise a heat source.
  • Suitable heat sources include a thermoelectric unit, an electric heater, an exothermic reactor, a laser, or any combination thereof.
  • the heat source can provide a spatially varying temperature distribution along the length of the reaction-diffusion conduit. Such a heat source enables different temperatures to be applied to different regions of the reaction-diffusion conduit at different times.
  • the temperature can be regulated with a phase change material.
  • the temperature gradient along the reaction-diffusion conduit can be linear.
  • the temperature in the sample chamber can be different from the temperature in the reaction- diffusion conduit. In other embodiments, the temperature in the sample chamber can be the same as the temperature in the reaction-diffusion conduit.
  • each of the chamber and the at least one reaction- diffusion conduit hold a blend of reactants for nucleic acid amplification.
  • each of the chamber and the at least on reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • the blend of reactants can comprise a plurality of primers and enzymes.
  • the blend of reactants can further comprise one or more types of reporters. Those skilled in the art would understand that numerous primers, enzymes, and reporters are suitable for nucleic acid amplification procedures. Suitable primers include, for example, DNA or RNA primers. The length of the primer (i.e.
  • primers of nucleic acid amplification are used in sets or pairs - a forward or sense primer and a reverse or antisense primer. "Plurality of primers" and “primer sets” are used interchangeably herein and refer to at least one pair of primers.
  • the plurality of primers can be a pair of primers.
  • the plurality of primers can be 2 pairs of primers. In some embodiments, the plurality of primers can be more than 2 pairs of primers.
  • Enzymes suitable for nucleic acid amplification include, but are not limited to, DNA polymerase, RNA-dependent DNA polymerase (reverse transcriptase), or DNA-dependent RNA polymerase (RNA polymerase).
  • reporter means any tag, label, or dye that can bind to, or intercalate within, the nucleic acid molecule to enable visualization of the nucleic acid molecule. Suitable reporters include, but are not limited to, fluorescent
  • the sample chamber and reaction-diffusion conduit may contain a mixture of primers engineered to be specific to various targets, enabling the concurrent amplification and detection of multiple targets.
  • the sample chamber may contain universal primers to amplify all targets, while the reaction-diffusion conduits may contain primers for specific targets.
  • the universal primers in the sample chamber can be immobilized to prevent passage of the primers into the reaction-diffusion conduit.
  • Primers can be immobilized to, for example, the sample chamber or something within the sample chamber that cannot pass into the reaction-diffusion conduit.
  • the reaction-diffusion conduit may also contain reporters (molecular beacons) each engineered to bind to a specific target and each emitting at different range of the spectrum, allowing the detector, with appropriate filters, to image each target separately.
  • reactants include, but are not limited to, buffers and dNTPs.
  • the blend of reactants, or a portion thereof can be pre-stored in the nucleic acid amplification monitor.
  • the blend of reactants, or a portion thereof are pre-stored in the nucleic acid amplification monitor and are released upon an increase in temperature.
  • the blend of reactants can be released when the nucleic acid amplification monitor is heated to its operating temperature.
  • the blend of reactants can be liquid or can be in a form that is capable of forming a liquid upon a change in temperature, such as a gel or solid.
  • the blend of reactants can be encased in, embedded in, or surrounded by, a material that melts with increasing temperatures, such as, for example, paraffin.
  • the nucleic acid amplification monitor can have at least two nuclemeters, each containing different primers.
  • the primers can recognize the same nucleic acid molecule but differ in length. Alternatively, the primers can recognize different nucleic acid molecules and be the same length. Alternatively, the primers can recognize different nucleic acid molecules and be different lengths.
  • a single nuclemeter can have multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
  • one reaction- diffusion conduit can contain a first plurality of primers and another reaction-diffusion conduit can contain a second plurality of primers, the second plurality of primers being different from the first plurality of primers.
  • the sample chamber can contain: a mix of a first plurality of primers and second plurality of primers; only a first plurality of primers; only a second plurality of primers; or a third plurality of primers.
  • the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying different nucleic acid molecules.
  • the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying at least two different nucleic acid molecules.
  • At least one of the reaction-diffusion conduits can contain at least one polymer.
  • at least one of the reaction-diffusion conduits and the sample chamber can contain at least one polymer. The presence of the polymer in the reaction-diffusion conduit or reaction-diffusion conduit and sample chamber can slow the diffusion of the amplified DNA and control the speed of propagation of the reaction front in the reaction-diffusion conduit, so that the diffusion may be easily monitored and/or quantified.
  • the at least one polymer can be a gel. In embodiments wherein the at least one polymer is a gel, the primers, enzymes, or both can be immobilized to the gel.
  • the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
  • ambient temperature refers to the temperature of the nucleic acid amplification monitor prior to the amplification procedure.
  • the polymer prior to the amplification procedure, can be a solid.
  • the reaction- diffusion conduit contains gel.
  • the disclosed nucleic acid amplification monitors can be used for a number of purposes including, but not limited to, melting curve analysis, reverse transcription, identifying a nucleic acid in a sample sample, diagnosis, quantifying the number of nucleic acid molecules in a sample, and testing amplification reactants.
  • the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
  • the sample chamber and the reaction-diffusion conduit can be separate components.
  • Also disclosed herein are methods of quantifying nucleic acid amplification comprising amplifying a sample comprising a nucleic acid molecule in any of the devices or the nucleic acid amplification monitors disclosed herein to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample.
  • amplifying the nucleic acid molecule comprises thermo- cycling. In other embodiments, amplifying the nucleic acid molecule comprises isothermal nucleic acid amplification.
  • Suitable methods for measuring a reaction-diffusion length of said amplified nucleic acid molecule include, but are not limiting to, measuring an electrical resistance, measuring a capacitance, measuring an absorption (for example, UV absorption), measuring an emission of a reporter, or any combination thereof.
  • the reaction-diffusion length of said amplified nucleic acid molecule can be measured, for example, using a ruler.
  • the device or nucleic acid amplification monitor has a ruler along the length of the reaction-diffusion conduit. In other embodiments, the ruler is separate from the nuclemeter.
  • quantifying the length of the emitting column in the reaction-diffusion column can be a function of nucleic acid concentration and time. By reading the length of the emitting column and the time elapsed from the onset of the amplification reaction, for example, one can determine the number of nucleic acid molecules in the sample. In other embodiments, quantification can be independent of time. For example, one can monitor two or more nuclemeters, at least one of which containing a known number of molecules (calibrator) and at least one containing an unknown number of nucleic acids (tester). The difference in the emission lengths of the tester and calibrator can enable one to determine the number of nucleic acid molecules in the tester, independent of the measurement time.
  • the methods can further comprise comparing the reaction-diffusion length of the one or more reaction-diffusion conduits. For example, one or more of the reaction-diffusion conduits within the device can be compared to one or more of the reaction-diffusion conduits within the same device. Conversely, one or more of the reaction- diffusion conduits within the device can be compared to one or more reaction-diffusion conduits within a separate device. Comparison of the one or more reaction-diffusion conduits to reaction- diffusion conduits in the same device or in a separate device will allow one to evaluate, for example, the relative amount of one or more nucleic acid molecules.
  • the methods can further comprise comparing the reaction-diffusion length of the one or more reaction-diffusion conduits to a control.
  • the control can be a reaction-diffusion conduit from the same device or from a separate device that contains a known quantity of a nucleic acid molecule, a nucleic acid molecule of a known identity, a sample from a subject having a known disease or condition, or any combination thereof.
  • the quantity, identity, or sample from a subject may be indicative of the presence or absence of a disease or condition.
  • the comparing can be used, for example, to determine: the presence or absence of a disease in a subject; the type or stage of a disease in a subject; or the effectiveness of therapy.
  • the one or more known nucleic acid molecules can be nucleic acid molecules that exhibit altered expression in the disease.
  • the one or more nucleic acid molecules can be nucleic acid molecules whose expression is decreased in the disease.
  • the one or more nucleic acid molecules can be nucleic acid molecules whose expression is increased in the disease.
  • the reaction-diffusion length from the one or more known nucleic acid molecules can be indicative of a disease state.
  • the reaction-diffusion length from the one or more known nucleic acid molecules can be indicative of a disease type.
  • the reaction- diffusion length from the one or more known nucleic acid molecules can be indicative of a disease stage.
  • the reaction-diffusion length from the one or more known nucleic acid molecules is indicative of a normal (non-disease) state.
  • the one or more known nucleic acid molecules can be derived from cells, blood, serum, bacteria, or any other suitable source of a nucleic acid molecule.
  • the nucleic acid molecules can be derived from cells from a subject suspected of having a disease.
  • the nucleic acid molecules can be derived from the bacterial flora of a subject. Comparing the reaction-diffusion length of the sample to the reaction-diffusion length from one or more known nucleic acid molecules that are indicative of a disease state, a normal (non-disease) state, or both, can be used to determine if a subject has the disease state.
  • Exemplary diseases include, for example, cancer.
  • reaction-diffusion conduits can store different primers specific to genes of interest. By comparing the reaction-diffusion lengths in different reaction-diffusion conduits, in which selected genes were amplified, with a library of gene expression profiles, one can determine, for example, the gene expression profile of the sample.
  • the nucleic acid molecule is DNA. In some embodiments, the nucleic acid molecule is DNA.
  • the nucleic acid molecule is RNA.
  • the methods can further comprise, prior to the amplifying, reverse transcribing the RNA to generate cDNA.
  • the one or more known nucleic acid molecules can be markers of a disease.
  • the one or more known nucleic acid molecules can be nucleic acid molecules that exhibit altered expression in the disease.
  • the one or more nucleic acid molecules can be nucleic acid molecules whose expression is decreased in the disease.
  • the one or more nucleic acid molecules can be nucleic acid molecules whose expression is increased in the disease.
  • the one or more known nucleic acid molecules can be markers of cancer.
  • results of the methods of obtaining a gene expression profile can be used, for example, to screen for a disease of interest, select an appropriate drug for a patient, or monitor therapy.
  • the disclosed methods can be used to determine the number of nucleic acid molecules in a sample by, for example, comparing the reaction-diffusion length in a reaction- diffusion conduit containing molecules from the sample to a reaction-diffusion length in a conduit having a known number of nucleic acid molecules.
  • the control molecules may be pre- stored in the device or consist of house-keeping molecules in the sample.
  • the disclosed methods can also be used to determine the relative expression of nucleic acid molecules in a sample by, for example, comparing the reaction-diffusion length to a reaction-diffusion conduit having a control sample and calculating the percentage or the reaction-diffusion length of the sample.
  • Also disclosed herein are methods of identifying an unknown nucleic acid molecule comprising amplifying a sample comprising an unknown nucleic acid molecule in any of the devices or nucleic acid amplification monitors disclosed herein, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample.
  • the device or nucleic acid amplification monitor suitable for the disclosed methods of identifying an unknown nucleic acid molecule can contain one or more nuclemeters.
  • the nuclemeters can have a plurality of reaction-diffusion conduits, each of said reaction-diffusion conduit containing a plurality of primers specific for a different known nucleic acid molecule.
  • each of the reaction-diffusion conduits can contain different primers for different viral nucleic acids.
  • each of the reaction-diffusion conduits can contain different primers for different pathogens, such as bacteria, virus, and parasite nucleic acids.
  • each of the reaction-diffusion conduits can contain different primers for different fungal nucleic acids.
  • each of the reaction-diffusion conduits can contain different primers for different biomarkers which identify human disease.
  • each of the reaction-diffusion conduits can contain different primers for different cancer biomarkers.
  • a single nuclemeter can comprise a plurality of reaction- diffusion conduits, each reaction-diffusion conduit containing different primers for a variety of different pathogens, viruses, bacteria, fungus, human, animal, and plant diseases, or any combination thereof.
  • a nucleic acid sample can be isolated from a human, an animal, or a plant and added to the sample chamber of any one of the devices or nucleic acid amplification monitors disclosed herein, wherein the device or nucleic acid amplification monitor comprises at least one nuclemeter comprising at least one sample chamber and at least one reaction-diffusion conduit, said at least one conduit containing a plurality of primers specific for a different known nucleic acid molecule. Amplification will proceed in a reaction-diffusion conduit if that conduit contains primers specific for the unknown nucleic acid molecule.
  • Amplification which can be monitored by an emission, will indicate that the sample having an unknown nucleic acid molecule comprises at least a nucleic acid molecule for which the primers are specific.
  • the disclosed methods can be used to determine a number of nucleic acid molecules in the unknown nucleic acid sample.
  • the method comprises determining the difference in length of reaction-diffusion from a nuclemeter having a sample having a known quantity of a nucleic acid and a nuclemeter having a sample having an unknown nucleic acid molecule, wherein the difference in the length of the reaction-diffusion between the known quantity of a nucleic acid molecule and the sample having an unknown nucleic acid molecule indicates a number of nucleic acid molecules in the sample having the unknown nucleic acid molecule.
  • Suitable methods for measuring a reaction-diffusion length of said amplified nucleic acid molecule include, but are not limiting to, measuring an electrical resistance, measuring a capacitance, measuring an absorption (for example, UV absorption), measuring an emission of a reporter, or any combination thereof.
  • the length of the reaction-diffusion can be determined by using a ruler.
  • the device or nucleic acid amplification monitor has a ruler along the length of the reaction-diffusion conduit. In other embodiments, the ruler is separate from the nuclemeter.
  • the nuclemeter comprises an sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber.
  • each of the sample chamber and the at least one reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification.
  • each of the sample chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
  • the system can further comprise a controller, an output device, or a combination thereof.
  • the sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction.
  • Each of the optical imager, heat source and output device can be operably controlled by the controller.
  • the chip body was dipped in DeconTM ELIMINaseTM decontaminant (Thermo Fisher Scientific Inc., Walthman, MA) for 2 minutes, rinsed twice with sterile molecular biology-grade water (Thermo Fisher Scientific Inc.), and air-dried at room temperature.
  • DeconTM ELIMINaseTM decontaminant Thermo Fisher Scientific Inc., Walthman, MA
  • Viral RNA was extracted from HIV-1 standards (AcroMetrix ® HIV-1 High Control, Benicia, CA) with QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Briefly, 140 ⁇ ., of virus suspension was lysed with 560 ⁇ ., virus lysis buffer containing carrier RNA. 560 ⁇ ⁇ ethanol was added to the lysate and the mixture was centrifuged in a spin column (630 ⁇ ., aliquots) at 10,000 rpm for 2 minutes. Prior to eluting the HIV viral RNA, wash buffers were loaded into the spin column and centrifuged at 14,000 rpm for 5 minutes.
  • HIV-1 standards AcroMetrix ® HIV-1 High Control, Benicia, CA
  • QIAamp Viral RNA Mini Kit Qiagen, Valencia, CA
  • RNA was eluted with 60 ⁇ ., of elution buffer.
  • Negative controls were prepared from a de-identified HIV-negative plasma sample (provided by the Penn Center for AIDS Research CFAR with the Institutional Review Board approval (protocol: 814752)) using the same extraction procedures as described above.
  • RT-LAMP reagents were prepared from a de-identified HIV-negative plasma sample (provided by the Penn Center for AIDS Research CFAR with the Institutional Review Board approval (protocol: 814752)) using the same extraction procedures as described above.
  • RT-LAMP primers were designed as described in Curtis, K.A., Rudolph, D.L. & Owen, S.M. J. Virol. Meth. 151, 264-270 (2008) at the Center for Disease Control and Prevention (CDC) and were synthesized by Sigma- Aldrich.
  • the real-time benchtop RT-LAMP experiments were carried out with 15 ⁇ ⁇ reaction volumes.
  • the reaction mixture consisted of 0.2 ⁇ of F3 and B3, each; 0.8 ⁇ Loop F and Loop B, each; and 1.6 ⁇ of FIP and BIP, each, 1.25 U AMV reverse transcriptase (Life Technologies, Carlsbad, CA); 0.53 x EvaGreen dye (Biotium, Hayward, CA); 0.04% (w/v) hydroxypropyl-methyl-cellulose (HPMC); and 9 ⁇ ⁇ Isothermal Master Mix (ISO-OOlnd, OptiGene, Horsham, UK).
  • HPMC was dissolved in Isothermal Master Mix, centrifuged at 10,000 rpm for 2 minutes, and filtered through a Corning Costar ® Spin-X ® centrifuge tube equipped with cellulose acetate membrane filters with a pore size of 0.45 ⁇ to remove any traces of insoluble HPMC.
  • a ten- fold dilution series of HIV viral RNA extracted from a HIV-1 standard panel and a negative control without template prepared from a HIV-negative plasma sample were tested in parallel.
  • the real-time, "tubed-based" RT-LAMP was carried out in a Peltier Thermal Cycler PTC-200 (Bio-Rad DNA Engine, Hercules, CA). Reactions were carried out at 62.5 °C for 60 minutes with real-time fluorescence monitoring. Real-time RT-LAMP results were analyzed and the threshold time C t (the time needed for the emission intensity to exceed a predetermined value) was obtained.
  • RT-LAMP master mixture comprised of all the reagents necessary for the RT-LAMP and 0.04% HPMC (excluding the HIV RNA template)
  • inlet port 1 (FIG. 1A and 1C)
  • inlet ports 1 of all four nuclemeters were sealed with PCR SealersTM tape.
  • 15 ⁇ of RT-LAMP master mixture and HIV RNA template of various concentrations were injected into the sample chambers through the inlet ports 2 (FIG. 1A and 1C).
  • both the inlet ports 2 and outlet ports were sealed with PCR SealersTM tape to minimize evaporation during the amplification process.
  • the nuclemeter chip was placed on a custom, portable heater and incubated at 62.5 °C for about 60 minutes to enable isothermal amplification.
  • the custom made, portable processor (FIGS. 5 and 6) for the nuclemeter consisted of a chip holder equipped with a flexible, polyimide-based, thin film heater (Model HK5572R7.5L23A, Minco Products, Inc., Minneapolis, MN) (inset in FIG. 6A), an electronic circuit board, and a thermocouple positioned at the interface between the thin film heater and the nuclemeter chip.
  • a flexible, polyimide-based, thin film heater Model HK5572R7.5L23A, Minco Products, Inc., Minneapolis, MN
  • thermocouple thermocouple
  • thermocouple Omega Engr., each wire 75 mm in diameter, and a junction diameter of 170 ⁇
  • the sample chambers and reaction-diffusion conduits were filled with water.
  • the thermocouple reading was monitored with a HH506RA multilogger thermometer (Omega Engr., Stamford, CT, USA).
  • an infrared image of the heated micro fluidic chip was taken with an infrared thermography camera T360 (FLIR Systems, Wilsonville, USA) to evaluate temperature uniformity (FIG. 6B).
  • the fluorescence excitation and emission imaging were carried out with a handheld, USB-based, fluorescence microscope (AM4113T-GFBW Dino-Lite Premier, AnMo Electronics, Taipei, Taiwan) (FIGS. 5 and 6).
  • the USB-based, fluorescence microscope has built-in, filtered blue LEDs for excitation, a 510 nm emission filter, and a CCD camera for fluorescence imaging.
  • the microscope was interfaced with a computer through a USB interface. Images were acquired with a DinoCapture 2.0 software program.
  • the images were processed with MatLabTM software to remove background noise and uneven illumination effects.
  • a normalized and averaged fluorescence intensity signal for each lane was extracted from each processed image.
  • the locations of the reaction fronts of different samples were directly read out by eye with the fluorescence ruler (FIG. 6C).
  • bioluminescence can be used (FIG. 14).
  • the bioluminescent real time reporter (BART) was included with the reagents. During DNA amplification in microconduits, the reporter emits visible light at the reaction front, providing an indication of the position of the reaction front. When bioluminescence is used, there is no need for excitation, eliminating any background emission. The emission consists of white light that can be recorded directly by charged coupled device camera, cell phone camera or by eye (FIG. 14).
  • c is the corrected emission intensity
  • * is the background intensity
  • is the flat maximum intensity.
  • the background intensity is the average of the first five video frames when there are too few amplicons to generate a significant signal.
  • the maximum intensity was obtained from the last frame acquired.
  • the intensity signal at each position x was averaged along the width of the conduit. All image processing and mathematical calculations were performed with MatLab.
  • the disclosed nuclemeters enable monitoring and end-point quantitative detection of amplified nucleic acids based on the position of a reaction front.
  • the nuclemeter is comprised of a sample chamber and a reaction-diffusion conduit, containing all the reagents needed for enzymatic amplification, polymeric additive HPMC to slow diffusion, as well as intercalating dye reporter (FIG. 1A-C).
  • a sample laden with target nucleic acids was introduced into the sample chamber and the amplification reaction was triggered thermally.
  • amplicons diffused into the conduit, where they continue to react and amplify. After a certain time threshold, the conduit consisted of two distinct regions (FIG.
  • PMMA Polymethyl methacrylate chips consisting of four nuclemeters (FIG. 1C and FIG. 3) were fabricated. Each nuclemeter consisted of a 2mm diameter x 2.80mm deep sample well ( ⁇ 9 ⁇ ) connected to a 330 ⁇ wide x 330 ⁇ deep x 12mm long reaction-diffusion conduit (FIG. 1A and FIG. 4). Reverse transcription, loop-mediated isothermal amplification (RT-LAMP), as described in Notomi, T. et al. Nucleic Acids Res. 28, E63 (2000) and Tomita, N., Mori, Y., Kanda, H. & Notomi, T. Nat. Protoc.
  • R-LAMP Reverse transcription, loop-mediated isothermal amplification
  • FIG. 2 illustrates the experimental data and compares it with the predictions of a simple theoretical model.
  • the emission intensity was taken to be proportional to the amplicons' concentration c(x,t), assumed uniform in each cross-section of the conduit.
  • FIG. 2A depicts c c max as a unction of position x at various times t.
  • the lines and symbols correspond, respectively, to predictions and experimental data.
  • the location of the reaction front Xp(t) was defined as the position at which ⁇ > ⁇ -0.5 When ⁇ >, £ ⁇ 1 and the amplification reaction is nearly complete (the regions with fluorescent emission in FIG. ID).
  • x>Xp c ⁇ 0 and no amplification has yet occurred (the dark regions in FIG. Id).
  • FIG. 2B depicts c as a function of time at various positions x. An observer located at position x will not see a signal until after a certain time delay.
  • FIG. 2C depicts the experimentally-determined rate of the reaction ⁇ 3 ⁇ 4 as a function of position (x) at various times. The rate of the reaction resembles a propagating peak that travels at a fixed velocity vg. The peak's width at midheight ( ⁇ ) did not vary with time (FIG. 2D), i.e., the reaction front is non-dispersive.
  • a calibration nuclemeter c
  • a monitoring device includes two calibration nuclemeters cl and c2 with known target concentrations c0I(l) and c02(2), respectively, the difference of the emission len ths of the two calibration columns is and
  • boundary and interfacial conditions are: ⁇ 3 ⁇ 4 ;
  • FIG. 2H depicts the position of the predicted reaction front as a function of time for different initial concentrations ⁇ .
  • the front velocity varies as a function of ⁇ , soon enough all the curves asymptote to straight lines with a slope independent of time and the initial target concentration.
  • the dimensionless predicted reaction front velocity is
  • Equation (7) with initial condition (8) admits the solution:
  • the number of target molecules is 10 3 copies.
  • oligonucleotides tagged with a fluorescent dye (HEX-1)
  • GGTGTCTCATTGTTTATACTA were introduced into the sample well and monitored the nucleic acid diffusion in the microconduit as a function of time (FIG. 1 1A). This experiment was carried out at the LAMP incubation temperature of 62.5 °C, but in the absence of enzymes so that no amplification took place.
  • the normalized signal intensity (normalized concentration) is depicted (dashed lines) in FIG. 10B as a function of position along the conduit at various times.
  • Equations (10) and (1 1) admit the classical solution
  • the nuclemeter requires only a single image to quantify the nucleic acid at a prescribed time or, in the presence of a calibration column, at any time.
  • the nuclemeter is compatible with multiplexing, allowing low-cost, high throughput nucleic acid screening, and it may be readily combined with modules for nucleic acid isolation, concentration, purification, and self-heating to facilitate inexpensive non-instrumented, quantitative, on-site molecular detection.
  • Embodiment 1 A device for monitoring nucleic acid amplification comprising a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
  • Embodiment 2 The device of embodiment 1, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction.
  • Embodiment 3 The device of embodiment 1 or 2, wherein the sample chamber and the conduit are separated with a barrier.
  • Embodiment 4 The device of any one of the previous embodiments, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any combination thereof.
  • Embodiment 5 The device of any one of the previous embodiments, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
  • Embodiment 6 The device of any one of the previous embodiments, having a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
  • Embodiment 7 The device of embodiment 6, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • Embodiment 8 The device of embodiment 7, at least one sample chamber having a known quantity of a preselected, target nucleic acid molecule.
  • Embodiment 9 The device of any one of the previous embodiments, the sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
  • Embodiment 10 The device of any one of the previous embodiments, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof.
  • Embodiment 1 The device of embodiment 10, wherein the optical imager is a fluorescent microscope or a camera.
  • Embodiment 12 The device of embodiment 10 or 1 1, wherein the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
  • Embodiment 13 The device of embodiment 12, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
  • Embodiment 14 The device of embodiment 12 or 13, wherein the temperature is regulated with a phase change material.
  • Embodiment 15 The device of any one of embodiments 12-14, wherein the temperature in the sample chamber is different from the temperature in the conduit.
  • Embodiment 16 The device of any one of the previous embodiments, said device being operatively connected to a controller or computer.
  • Embodiment 17 The device of any one of the previous embodiments, further comprising a ruler along the length of the reaction-diffusion conduit.
  • Embodiment 18 The device of any one of the previous embodiments, further comprising a blend of reactants.
  • Embodiment 19 The device of embodiment 18, wherein the blend of reactants comprises a plurality of primers and enzymes.
  • Embodiment 20 The device of embodiment 19, having at least two nuclemeters, each containing different primers.
  • Embodiment 21 The device of embodiment 19, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
  • Embodiment 22 The device of any one of the previous embodiments, wherein the reaction diffusion conduit contains at least one polymer.
  • Embodiment 23 The device of any one of the previous embodiments, wherein the sample chamber contains at least one polymer.
  • Embodiment 24 The device of embodiment 23, wherein the at least one polymer is a gel.
  • Embodiment 25 The device of embodiment 24, wherein the primers, enzymes, or both are immobilized to the gel.
  • Embodiment 26 The device of any one of embodiments 23-25, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
  • Embodiment 27 The device of any one of the previous embodiments, wherein the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
  • Embodiment 28 A nucleic acid amplification monitor comprising a substrate and, on or forming a part of the substrate, a plurality of nuclemeters, each nuclemeter comprising an sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber, each of the chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
  • Embodiment 29 The nucleic acid amplification monitor of embodiment 28, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction.
  • Embodiment 30 The nucleic acid amplification monitor of embodiment 28 or 29, wherein the sample chamber and the conduit are separated with a barrier.
  • Embodiment 31 The nucleic acid amplification monitor of embodiment 30, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any combination thereof.
  • Embodiment 32 The nucleic acid amplification monitor of any one of embodiments 28-31, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
  • Embodiment 33 The nucleic acid amplification monitor of any one of embodiments 28-32, having a plurality of sample chambers, each sample chamber having at least one reaction- diffusion conduit in fluid communication therewith.
  • Embodiment 34 The nucleic acid amplification monitor of embodiment 33, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
  • Embodiment 35 The nucleic acid amplification monitor of embodiment 34, at least one sample chamber having a known quantity of a preselected, target nucleic acid molecule.
  • Embodiment 36 The nucleic acid amplification monitor of any one of embodiments 28-35, the sample chamber having a porous membrane for nucleic acids extraction,
  • Embodiment 37 The nucleic acid amplification monitor of any one of embodiments 28-36, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof.
  • Embodiment 38 The nucleic acid amplification monitor of embodiment 37, wherein the optical imager is a fluorescent microscope or a camera.
  • Embodiment 39 The nucleic acid amplification monitor of embodiment 37 or 38, wherein the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
  • the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
  • Embodiment 40 The nucleic acid amplification monitor of embodiment 39, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
  • Embodiment 41 The nucleic acid amplification monitor of embodiment 39 or 40, wherein the temperature is regulated with a phase change material.
  • Embodiment 42 The nucleic acid amplification monitor of any one of embodiments 39-41, wherein the temperature in the sample chamber is different from the temperature in the conduit.
  • Embodiment 43 The nucleic acid amplification monitor of any one of embodiments 28-42, said device being operatively connected to a controller or computer.
  • Embodiment 44 The nucleic acid amplification monitor of any one of embodiments 28-43, further comprising a ruler along the length of the reaction-diffusion conduit.
  • Embodiment 45 The nucleic acid amplification monitor of any one of embodiments 28-44, further comprising a blend of reactants.
  • Embodiment 46 The nucleic acid amplification monitor of embodiment 45, wherein the blend of reactants comprises a plurality of primers and enzymes.
  • Embodiment 47 The nucleic acid amplification monitor of embodiment 46, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
  • Embodiment 48 The nucleic acid amplification monitor of any one of embodiments 28-47, wherein the reaction diffusion conduit contains at least one polymer.
  • Embodiment 49 The nucleic acid amplification monitor of embodiment 48, wherein the at least one polymer is a gel.
  • Embodiment 50 The nucleic acid amplification monitor of embodiment 49, wherein the primers, enzymes, or both are immobilized to the gel.
  • Embodiment 51 The nucleic acid amplification monitor of any one of embodiments 48-50, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
  • Embodiment 52 The nucleic acid amplification monitor of any one of embodiments 28-51, wherein the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
  • Embodiment 53 The nucleic acid amplification monitor of any one of embodiments 28-52, wherein the substrate is a polymeric chip.
  • Embodiment 54 The nucleic acid amplification monitor of embodiment 53, wherein the polymeric chip comprises polymethyl methacrylate (PMMA).
  • PMMA polymethyl methacrylate
  • Embodiment 55 A method of quantifying nucleic acid amplification comprising amplifying a sample comprising a nucleic acid molecule in the device of any one of
  • embodiments 1-27 or the nucleic acid amplification monitor of any one of embodiments 28-54 to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample.
  • Embodiment 56 The method of embodiment 55, wherein amplifying the nucleic acid molecule comprises thermo-cycling or isothermal nucleic acid amplification.
  • Embodiment 57 The method of embodiment 55 or 56, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits.
  • Embodiment 58 The method of embodiment 55-57, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits to a control
  • Embodiment 59 The method of any one of embodiments 55-58, wherein the nucleic acid molecule is RNA.
  • Embodiment 60 The method of embodiment 59, further comprising, prior to the amplifying, reverse transcribing the RNA to generate cDNA.
  • Embodiment 61 A method of identifying an unknown nucleic acid molecule, comprising: amplifying a sample comprising an unknown nucleic acid molecule in the device of any one of embodiments 1-27, or the nucleic acid amplification monitor of any one of embodiments 28-54, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule; and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample.
  • Embodiment 62 The method of embodiment 61, comprising determining the difference in length of reaction-diffusion from a nuclemeter having a sample having a known quantity of a nucleic acid and a nuclemeter having a sample having an unknown nucleic acid molecule, wherein the difference in the length of the reaction-diffusion between the known quantity of a nucleic acid molecule and the sample having an unknown nucleic acid molecule indicates a number of nucleic acid molecules in the sample having the unknown nucleic acid molecule.
  • Embodiment 63 A system for monitoring nucleic acid amplification comprising: a nuclemeter comprising a sample chamber, at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification; an optical imager; and a heat source.
  • Embodiment 64 The system of embodiment 63, further comprising a controller.
  • Embodiment 65 The system of any one of embodiments 63 or 64, further comprising an output device.
  • Embodiment 66 The system of embodiment 65, each of the optical imager, heat source and output device being operably controlled by the controller.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Clinical Laboratory Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Hematology (AREA)
  • Dispersion Chemistry (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Provided herein are devices for monitoring nucleic acid amplification, nucleic acid amplification monitors, methods of quantifying nucleic acid amplification, methods of identifying an unknown nucleic acid molecule, and systems for monitoring nucleic acid amplification. The disclosed devices, methods, and systems comprise at least one nuclemeter, comprising at least one sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber.

Description

DEVICES AND METHODS FOR MONITORING AND QUANTIFYING NUCLEIC
ACID AMPLIFICATION
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Patent Application Nos. 62/020,135, filed July 2, 2014, and 62/020,484, filed July 3, 2014, the disclosures of which are incorporated herein by reference in their entirety.
GOVERNMENT RIGHTS
[0002] The subject matter disclosed herein was made with government support under grant numbers K25AI099160 and 1R41AI104418-01A1 awarded by the National Institutes of Health. The Government has certain rights in the herein disclosed subject matter.
TECHNICAL FIELD
[0003] Provided herein are devices, methods, and systems for monitoring and quantifying nucleic acid amplification.
BACKGROUND
[0004] Real-time amplification and quantification of nucleic acids has revolutionized genetic research, medical diagnostics, and environmental monitoring. In the case of infectious diseases, quantification of the pathogen-load in patient specimens is critical to assess disease progression, effectiveness of drug therapy, and emergence of drug-resistance. Currently, nucleic acid quantification requires expensive instruments, such as real-time PCR machines, for continuous monitoring of fluorescence emission from intercalating dye or molecular beacon probes. Although enzymatic amplification products can be detected without an instrument with lateral flow strips, this method suffers from low accuracy and low sensitivity.
[0005] Thus, there is a need for devices and methods providing low-cost, instrument- free, monitoring and end-point quantification of target nucleic acids undergoing enzymatic amplification. The invention is directed to these and other important needs.
SUMMARY
[0006] Disclosed are devices, methods, and systems for low-cost, reaction-diffusion based, instrument-free, monitoring and end-point quantification of target nucleic acids undergoing enzymatic amplification. The target concentration is estimated from a length measurement along a reaction-diffusion-conduit. Exemplary uses of the disclosed devices, methods, and systems include on-site or high throughput applications and the identification of gene expression profiles.
[0007] Provided herein are devices for monitoring nucleic acid amplification comprising a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber. In some embodiments, each of the chamber and the conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the conduit are capable of holding a blend of reactants for nucleic acid amplification.
[0008] Also disclosed are nucleic acid amplification monitors comprising a substrate and, on or forming a part of the substrate, a plurality of nuclemeters, each nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber; each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
[0009] Methods of quantifying nucleic acid amplification are also provided herein, said methods comprising amplifying a sample comprising a nucleic acid molecule in any of the devices or the nucleic acid amplification monitors disclosed herein to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample and time.
[0010] Further disclosed are methods of identifying an unknown nucleic acid molecule, comprising amplifying a sample having an unknown nucleic acid molecule in any of the devices or nucleic acid amplification monitors disclosed herein, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule, and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample..
[0011] Further disclosed are systems for monitoring nucleic acid amplification comprising a nuclemeter comprising a sample chamber, at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification, an optical imager, and a heat source.
[0012] The general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as defined in the appended claims. Other aspects of the present invention will be apparent to those skilled in the art in view of the detailed description as provided herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The summary, as well as the following detailed description, is further understood when read in conjunction with the appended drawings. For the purpose of illustrating the disclosed devices, methods, and systems, there are shown in the drawings exemplary embodiments of the devices, methods, and systems; however, the invention is not limited to the specific devices, methods, and systems disclosed. In the drawings:
[0014] FIG 1, comprising FIGS. 1 A-1E, represent the design and operation of an exemplary nuclemeter for HIV viral load testing, (a) A schematic depiction of the cross-section of the nuclemeter, consisting of a sample well and a reaction-diffusion microconduit. (b) An illustration of the nuclemeter's operation. Initially, only the sample chamber contains the nucleic acid template (top). The template amplifies and diffuses into the reaction-conduit, where it continues to amplify at 62.5°C (middle). XF indicates the position of the reaction front that propagates with a constant velocity (vo) (bottom), (c) A photograph of a plastic chip housing four nuclemeters. (d) Fluorescence images of the reaction-diffusion conduits of four nuclemeters containing 104, 103, 102, and 0 (negative control) HIV-1 RNA templates at various times after the start of incubation, (e) Four nuclemeters each containing 100 HIV-1 RNA templates to illustrate reproducibility.
[0015] FIG 2, comprising FIGS. 2A-2I, represent exemplary experimental data and theoretical predictions of nuclemeter's performance, (a) Normalized emission intensity
c _ c^cmax as a function of position along the reaction-diffusion conduit at various times. The solid lines and symbols correspond, respectively, to predictions and experimental data. The number of target molecules is 103 copies, (b) Normalized emission intensity ^ as a function of time at positions x=1.2, 1.8, and 2.4 mm along the length of the conduit. The solid lines and symbols correspond, respectively, to the predictions and experimental data. The number of target dc
molecules is 103 copies, (c) The experimental rate of the reaction ( ^t )exp as a function of position (x) at various times, (d) The measured width of the reaction-rate peak at midheight Aexp as a function of time, (e) The measured position of the reaction front Xp: ^ as a function of time for various template concentrations (error bars = standard deviation (s.d.); n = 3; R2=0.998). (f) The intercept (to, exp) of the line in FIG. 2e and the threshold time CT of real-time RT-LAMP curves as functions of the number of templates (error bars = s.d.; n = 3; R2=0.99). (g) XF, EXP- XF,exp 3) as a function of the template number at various times t (error bars = s.d.; R2= 0.99, n = 15). (h) The predicted position of the reaction front (Xp, th) as a function of time for various numbers of templates, (i) The predicted intercept (to, th) of the asymptotes in FIG. 2h as a function of template number.
[0016] FIG. 3 represents an exploded view of an exemplary nuclemeter chip consisting of three layers: a top PMMA film, a PMMA chip body, and a bottom PCR Sealers™ tape. The various features of the chip body were milled with a CNC machine.
[0017] FIG. 4 represents a micrograph of the reaction-diffusion micro-conduit's cross- section. The dashed line indicates the interface between the PMMA film and the PMMA chip body.
[0018] FIG. 5 represents an exemplary experimental setup for the nuclemeter chip. The portable processor includes a USB-based, fluorescence microscope (AM41 13T-GFBW Dino- Lite Premier, AnMo Electronics, Taipei, Taiwan). The processor can be powered either with four AA batteries or by grid power. The fluorescence image of the nuclemeters can be directly displayed on the computer screen. The USB microscope can be replaced with LED illumination and a smartphone camera or other imaging devices.
[0019] FIG. 6, comprising FIGS. 6A-6C, represent an exemplary portable, processor for RT-LAMP amplification and detection, (a) A photograph of the processor. Inset: a flexible, polyimide-based, thin film heater (HK5572R7.5L23A, Minco Products, Inc., Minneapolis, MN). The heater can be replaced with an exothermic reaction chamber (b) A thermograph of the nuclemeter chip's surface taken with an infrared camera T360 (FLIR Systems, Wilsonville, USA). The four reaction-diffusion reactors are located within the dashed square, (c) A mask made with black 3M Scotch electrical tape to block background emission. The mask is equipped with a ruler to assist in determining the position of the reaction front (XF).
[0020] FIG. 7, comprising FIGS. 7A-7B represent an evaluation of the limits of detection of an examplary nuclemeter and benchtop, "tubed-based" LAMP, (a) A representative, endpoint fluorescent image of the nuclemeter chip with 50 copies (lanes 1 and 2) and 5 copies (lanes 3 and 4) of target HIV RNA molecules, (b) Real-time, benchtop monitoring of RT-LAMP amplification of HIV viral RNA with 50, 5, and 0 (negative control) target RNA copies per tube. Both the nuclemeter and the real time machine detected successfully 50 target molecules and failed to detect 5 target molecules.
[0021] FIG. 8, represents real-time, benchtop monitoring of RT-LAMP amplification of HIV viral RNA with 104, 103, 102, and 0 (negative control) target RNA molecules per tube on the benchtop PCR machine. The tubes include 0.04% HPMC to replicate the conditions in the nuclemeter chip.
[0022] FIG. 9 represents the position of the reaction front (Xp) as a function of the number of target molecules (n = 3) at times (from bottom to top) 32, 40, 48 and 56 min after the start of incubation.
[0023] FIG. 10, comprising FIGS. 10A- 10D, represent an exemplary nuclemeter' s sample well emission (a) before RT-LAMP amplification, (b) shortly after the onset of amplification, and (c) at saturation of amplification. The number of target molecules is 103 copies, (d) a fluorescent emission from the exemplary nuclemeter's sample chamber as a function of the time. The solid line and the symbols correspond, respectively, to the best fit line based on equation 4 and the experimental data. The number of target molecules is 103 copies.
[0024] FIG. 11, comprising FIGS. 1 lA- 1 IB, represents: (a) the concentration distribution of the labeled primers in the reaction-diffusion conduit at various times in the absence of an amplification reaction, (b) The emission intensity (normalized with the initial concentration) as a function of position at various times. The lines correspond to theoretical predictions and the symbols to the experimental data (with optimal estimate for the diffusion coefficient).
[0025] FIG. 12, comprising FIGS. 12A- 12B, illustrates a schematic depiction of an exemplary nuclemeter in which the sample chamber and the reaction-diffusion conduits are separated with a barrier consisting of a phase change material, (i) represents a top view with the barrier in place; (ii) represents a side-view with the barrier in place; (iii) represents a side view after the barrier had dissolved, melted, moved, been removed, etc. to allow hydraulic communications between the sample chamber and the reaction-diffusion conduit. Furthermore, the sample chamber contains an optional membrane for the isolation of nucleic acids. The device enables multi-stage amplification with one amplicon being amplified in the sample chamber and the other in the diffusion-reaction conduit. [0026] FIG. 13, comprising FIGS. 13A-13B, illustrates a schematic depiction of an exemplary nuclemeter comprising a single sample chamber and multiple reaction-diffusion conduits, each customized to amplify a different nucleic acid. The relative quantities of the various nucleic acids are determined from the relative lengths of the reacted regions, as indicated by the fluorescence emission, in the reaction-diffusion columns, enabling the identification of, among other things, a gene expression profile or bacterial flora.
[0027] FIG. 14 is an image of an exemplary nuclemeter utilizing bioluminescent assay for real-time recording of the position of the reaction front. The luminescence blob propagates along the conduit and indicates the instantaneous position of the reaction front. The target in this particular assay is HIV.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0028] The disclosed devices, methods, and systems may be understood more readily by reference to the following detailed description taken in connection with the accompanying figures, which form a part of this disclosure. It is to be understood that the disclosed devices, methods, and systems are not limited to the specific devices, methods, and systems described and/or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed devices, methods, and systems.
[0029] Unless specifically stated otherwise, any description as to a possible mechanism or mode of action or reason for improvement is meant to be illustrative only, and the disclosed devices, methods, and systems are not to be constrained by the correctness or incorrectness of any such suggested mechanism or mode of action or reason for improvement.
[0030] Reference to a particular numerical value includes at least that particular value, unless the context clearly dictates otherwise. When a range of values is expressed, another embodiment includes from the one particular value and/or to the other particular value. Further, reference to values stated in ranges include each and every value within that range. All ranges are inclusive and combinable.
[0031] When values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment.
[0032] It is to be appreciated that certain features of the disclosed devices, methods, and systems which are, for clarity, described herein in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosed devices, methods, and systems that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination.
[0033] As used herein, the singular forms "a," "an," and "the" include the plural.
[0034] Various terms relating to aspects of the description are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein.
[0035] As used herein, the term "about" is meant to encompass variations of ± 20% or less, variations of 10% or less, variations of ± 5% or less, variations of ± 1% or less, variations of ± 0.5% or less, or variations of ± 0.1% or less from the specified value.
[0036] As used herein, the term "fluid communication" refers to ability of liquids to diffuse between the sample chamber and the at least one reaction-diffusion conduit. For example, nucleic acid molecules diffuse from the sample chamber into the at least one reaction- diffusion conduit.
[0037] As used herein, "nucleic acid amplification" includes any technique used to detect nucleic acids by amplifying (generating numerous copies of) the target molecules in the sample. Suitable nucleic acid amplification techniques include, but are not limited to, loop- mediated isothermal amplification (LAMP), reverse transcription-loop mediated isothermal amplification (RT-LAMP), or polymerase chain reaction.
[0038] As used herein, the term "nuclemeter" refers to a reaction-diffusion device for monitoring and quantitative detection of amplified nucleic acid molecules based on the position of the reaction front. Each nuclemeter comprises at least one sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber.
[0039] "Target" refers to a sequence, or partial sequence, of a nucleic acid of interest. "Target" and "nucleic acid molecule" are used interchangeably herein.
Devices for monitoring nucleic acid amplification
[0040] Provided herein are devices for monitoring nucleic acid amplification comprising a nuclemeter. The nuclemeter comprises a sample chamber and at least one reaction- diffusion conduit in fluid communication with the chamber. In some embodiments, each of the chamber and the at least one reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification. The sample chamber may also serve as a nucleic acid amplification reactor.
[0041] In some embodiments, the device for monitoring nucleic acid amplification can comprise a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
[0042] In other embodiments, the device for monitoring nucleic acid amplification can comprise a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit holding a blend of reactants for nucleic acid amplification.
[0043] The sample chamber and diffusion-reaction conduit can be separated with a barrier. The barrier can be configured to block passage of reactants between the sample chamber and the reaction-diffusion conduit during sample introduction, nucleic acid isolation, etc. and can be configured to allow passage of reactants between the sample chamber and the reaction- diffusion conduit at a specified time or in response to an event. In some embodiments, the barrier can be removable. In some aspects, for example, the barrier can be physically removed from the nuclemeter. In some embodiments, the barrier can be degradable. For example, the barrier can be composed of, or can comprise, a material that degrades. In some embodiments, the barrier can be dissolvable. For example, the barrier can be composed of a material that dissolves in solution. Exemplary materials that dissolve in solution include, for example, salt. In some embodiments, the barrier can be capable of being melted. For example, the barrier can be composed of, or can comprise, a phase change material that melts, or partially melts, at a certain temperature . For example, the barrier can melt and move through the action of surface tension (capillary) forces or buoyancy or combination thereof, thereby allowing diffusion between the sample chamber and the reaction diffusion conduit. In some embodiments, the barrier can be movable. For example, the barrier can be configured to open or otherwise allow passage of sample between the sample chamber and the reaction diffusion conduit in response to a mechanical force or various means of actuation. For example, the actuator may consist of bimetal or shape memory alloy that alters shape in response to temperature variations.
[0044] The barrier can allow for a two-step or nested-like amplification. For example, two different amplification reactions can be run; one in the sample chamber and one in the reaction-diffusion conduit. The reaction in the sample chamber can, for example, amplify nucleic acid molecules non-specifically. Once the reaction in the sample chamber is complete, the barrier can be removed, dissolved, degraded, melted, etc. allowing the amplified nucleic acid molecules to diffuse into the reaction-diffusion conduit, which can contain primers for a specific nucleic acid molecule. Within the reaction-diffusion conduit, specific nucleic acid molecules will then be amplified. The two reactions can operate with different enzymes, temperatures, etc.
[0045] The sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction. For example, the cross-section of the sample chamber can have a variety of suitable shapes, including, but not limited to, square, rectangular, triangular, pentagonal, hexagonal, heptagonal, octagonal, nonagonal, decagonal, round, or elliptical.
[0046] The bottom of the sample chamber can be flat, substantially flat, conical, round, substantially round, or pointed or contain depressions, for example, for the purpose of storing reagents needed for the amplification process.
[0047] In some embodiment the sample chamber can be a droplet, which can be manipulated to make contact with the reaction-diffusion conduit. Numerous techniques are known for manipulating droplets including, but not limited to, electrowetting, thermal gradients, solute gradients, conduit geometry such as taper, or any combination thereof. For example, in some embodiments, a droplet comprising the reactant mixture and nucleic acid sample can be placed onto a surface containing a plurality of electrodes. An electric field can be applied to the surface resulting in migration of the droplet towards (or away from) the reaction-diffusion conduit. The electric field can be applied until the droplet makes contact, such as a hydraulic connection, with the reaction-diffusion conduit. As amplification progresses, the amplified nucleic acid sample can diffuse into the reaction-diffusion conduit. In some embodiments, the droplet is the sample chamber. In other embodiments, the droplet is placed within the sample chamber. In some embodiments, the droplet can be encased in oil. In some embodiments, the droplet can be produced by a microfluidic device.
[0048] The sample chamber, when used for nucleic acid amplification, will have a size suitable for a containing a nucleic acid amplification reaction. Suitable sizes include sample chambers having a volume of from about 0.1 μΐ to about 300 μΐ. In one embodiment, the sample chamber has a volume of about 0.1 μΐ. In one embodiment, the sample chamber has a volume of about 0.5 μΐ. In one embodiment, the sample chamber has a volume of about 1 μΐ. In one embodiment, the sample chamber has a volume of about 10 μΐ. In one embodiment, the sample chamber has a volume of about 20 μΐ. In one embodiment, the sample chamber has a volume of about 50 μΐ. In one embodiment, the sample chamber has a volume of about 100 μΐ. In one embodiment, the sample chamber has a volume of about 150 μΐ. In one embodiment, the sample chamber has a volume of about 200 μΐ. In one embodiment, the sample chamber has a volume of about 250 μΐ. In one embodiment, the sample chamber has a volume of about 300 μΐ. In some embodiments, the sample chamber has a volume greater than 300 μΐ.
[0049] The sample chamber can be from about 0.1 μΐ to about 300 μΐ in volume. In some aspects, the sample chamber can be from about 0.1 μΐ to about 250 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 200 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 150 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 100 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 50 μΐ in volume. The sample chamber can be from about 10 μΐ to about 300 μΐ in volume. The sample chamber can be from about 10 μΐ to about 200 μΐ in volume. The sample chamber can be from about 10 μΐ to about 150 μΐ in volume. The sample chamber can be from about 10 μΐ to about 100 μΐ in volume. The sample chamber can be from about 10 μΐ to about 50 μΐ in volume. In some aspects, the sample chamber can be from about 25 μΐ to about 300 μΐ in volume. The sample chamber can be from about 50 μΐ to about 300 μΐ in volume. The sample chamber can be from about 75 μΐ to about 300 μΐ in volume. The sample chamber can be from about 100 μΐ to about 300 μΐ in volume. The sample chamber can be from about 125 μΐ to about 300 μΐ in volume. The sample chamber can be from about 150 μΐ to about 300 μΐ in volume. The sample chamber can be from about 175 μΐ to about 300 μΐ in volume. The sample chamber can be from about 200 μΐ to about 300 μΐ in volume. The sample chamber can be from about 225 μΐ to about 300 μΐ in volume. The sample chamber can be from about 250 μΐ to about 300 μΐ in volume. The sample chamber can be from about 275 μΐ to about 300 μΐ in volume.
[0050] The height of the sample chamber can be from about 0.05 mm to about 10 mm. The height of the sample chamber can be from about 0.1 mm to about 9 mm. The height of the sample chamber can be from about 0.2 mm to about 8 mm. The height of the sample chamber can be from about 0.3 mm to about 7 mm. The height of the sample chamber can be from about 0.4 mm to about 6 mm. The height of the sample chamber can be from about 0.5 mm to about 5 mm. The height of the sample chamber can be from about 0.6 mm to about 4 mm. The height of the sample chamber can be from about 0.7 mm to about 3 mm. The height of the sample chamber can be from about 0.8 mm to about 2 mm. The height of the sample chamber can be from about 0.9 mm to about 1 mm.
[0051] In some aspects, the height of the sample chamber can be about 0.05 mm. In some aspects, the height of the sample chamber can be about 0.1 mm. In some aspects, the height of the sample chamber can be about 0.2 mm. In some aspects, the height of the sample chamber can be about 0.3 mm. In some aspects, the height of the sample chamber can be about 0.4 mm. In some aspects, the height of the sample chamber can be about 0.5 mm. In some aspects, the height of the sample chamber can be about 0.6 mm. In some aspects, the height of the sample chamber can be about 0.7 mm. In some aspects, the height of the sample chamber can be about 0.8 mm. In some aspects, the height of the sample chamber can be about 0.9 mm. In some aspects, the height of the sample chamber can be about 1 mm. In some aspects, the height of the sample chamber can be about 2.5 mm. In some aspects, the height of the sample chamber can be about 5 mm. In some aspects, the height of the sample chamber can be about 7.5 mm. In some aspects, the height of the sample chamber can be about 10 mm.
[0052] The width of the sample chamber can be from about 0.05 mm to about 5 mm. The width of the sample chamber can be from about 0.1 mm to about 4 mm. The width of the sample chamber can be from about 0.2 mm to about 3 mm. The width of the sample chamber can be from about 0.3 mm to about 2 mm. The width of the sample chamber can be from about 0.4 mm to about 1 mm. The width of the sample chamber can be from about 0.5 mm to about 0.9 mm. The width of the sample chamber can be from about 0.6 mm to about 0.8 mm.
[0053] The width of the sample chamber can be about 0.05. The width of the sample chamber can be about 0.1 mm. The width of the sample chamber can be about 0.2 mm. The width of the sample chamber can be about 0.3 mm. The width of the sample chamber can be about 0.4 mm. The width of the sample chamber can be about 0.5 mm. The width of the sample chamber can be from 0.6 mm. The width of the sample chamber can be about 0.7. The width of the sample chamber can be about 0.8 mm. The width of the sample chamber can be about 0.9 mm. The width of the sample chamber can be about 1 mm. The width of the sample chamber can be about 2 mm. The width of the sample chamber can be about 3 mm. The width of the sample chamber can be about 4 mm. The width of the sample chamber can be about 2 mm. The width of the sample chamber can be about 5 mm.
[0054] The length of the reaction-diffusion conduit can be from about 0.05 mm to about 100 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 75 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 50 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 25 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 10 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 5 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 2.5 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 1 mm. The length of the reaction- diffusion conduit can be from about 0.05 mm to about 0.5 mm.
[0055] The length of the reaction-diffusion conduit can be about 100 mm. The length of the reaction-diffusion conduit can be about 75 mm. The length of the reaction-diffusion conduit can be about 50 mm. The length of the reaction-diffusion conduit can be about 25 mm. The length of the reaction-diffusion conduit can be about 10 mm. The length of the reaction-diffusion conduit can be about 5 mm. The length of the reaction-diffusion conduit can be about 2.5 mm. The length of the reaction-diffusion conduit can be about 1 mm. The length of the reaction- diffusion conduit can be about 0.5 mm.
[0056] The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 mm. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 750 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 500 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 250 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 100 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 50 μιη. The height of the reaction- diffusion conduit can be from about 0.1 μιη to about 25 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 10 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 5 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 μηι. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 0.5 μιη.
[0057] The height of the reaction-diffusion conduit can be about 1 mm. The height of the reaction-diffusion conduit can be about 750 μιη. The height of the reaction-diffusion conduit can be about 500 μιη. The height of the reaction-diffusion conduit can be about 250 μιη. The height of the reaction-diffusion conduit can be about 100 μιη. The height of the reaction- diffusion conduit can be about 50 μιη. The height of the reaction-diffusion conduit can be about 25 μιη. The height of the reaction-diffusion conduit can be about 10 μιη. The height of the reaction-diffusion conduit can be about 5 μιη. The height of the reaction-diffusion conduit can be about 1 μηι. The height of the reaction-diffusion conduit can be about 0.5 μιη.
[0058] The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 mm. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 750 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 500 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 250 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 100 μιη. The width of the reaction- diffusion conduit can be from about 0.1 μιη to about 50 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 25 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 10 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 5 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 μηι. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 0.5 μιη.
[0059] The width of the reaction-diffusion conduit can be about 1 mm. The width of the reaction-diffusion conduit can be about 750 μιη. The width of the reaction-diffusion conduit can be about 500 μιη. The width of the reaction-diffusion conduit can be about 250 μιη. The width of the reaction-diffusion conduit can be about 100 μιη. The width of the reaction-diffusion conduit can be about 50 μιη. The width of the reaction-diffusion conduit can be about 25 μιη. The width of the reaction-diffusion conduit can be about 10 μιη. The width of the reaction-diffusion conduit can be about 5 μιη. The width of the reaction-diffusion conduit can be about 1 μηι. The width of the reaction-diffusion conduit can be about 0.5 μιη.
[0060] The cross-section of the reaction-diffusion conduit may be, for example, a rectangle, a square, a circle, a semi-circle, a triangle, a trapezoid. The reaction-diffusion conduit may be, for example, straight, curved, spiral, or contain turns.
[0061] In some embodiments, the device can have one reaction-diffusion conduct in fluid communication with the sample chamber. In other embodiments, the device can have a plurality of reaction-diffusion conduits in fluid communication with the sample chamber. For example, the device can have between 2 to about 100 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the device can have 2 reaction- diffusion conduits in fluid communication with the sample chamber. In some aspects, the device can have 3 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 4 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 5 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the device can have 10 reaction- diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 15 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the device can have 20 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the device can have more than 20 reaction-diffusion conduits in fluid communication with the sample chamber. [0062] In some embodiments, the device can have 1 sample chamber, said sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. In some aspects, the device can have 1 sample chamber, said sample chamber having 1 reaction- diffusion conduit in fluid communication therewith. In some aspects, the device can have 1 sample chamber, said sample chamber having a plurality of reaction-diffusion conduits in fluid communication therewith. For example, in some aspects, the device can have 1 sample chamber, said sample chamber having about 2 to about 100 reaction-diffusion conduits in fluid
communication therewith.
[0063] In other embodiments, the device can have a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. For example, the device can have 1 to 100 sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. In some aspects, the device can have 1 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 2 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid
communication therewith. In some aspects, the device can have 3 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 4 sample chambers, each sample chamber having 2-100 reaction- diffusion conduits in fluid communication therewith. In some aspects, the device can have 5 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 10 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 50 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 75 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the device can have 100 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
[0064] In some embodiments, the device can have a plurality of sample chambers, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. Thus, in some aspects, 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, less than 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith. In some aspects, 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
communication therewith. In some aspects, 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 5% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 1% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
[0065] In some aspects, about 1% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 5% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 10% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 15% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 25% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 40% to about 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith. In some aspects, about 55% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 70% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 85% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
communication therewith. In some aspects, about 1% to about 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
[0066] The device can have at least one sample chamber having a known quantity of a preselected, nucleic acid molecule, which can serve has a "positive control" or "calibration" nuclemeter.
[0067] The disclosed devices can be used in combination with porous membranes for nucleic acid extraction, concentration, and purification. Suitable porous membranes include, but are not limited to, silica membrane, Whatman FTA membrane, alumina membrane, cellulose membrane. Such porous membranes specifically bind nucleic acids allowing other non-nucleic acid material to pass through the membrane. For example, in some embodiments, a nucleic acid sample can be incubated with a porous membrane, the porous membrane can be washed to remove non-nucleic acid material, and the porous membrane can be added to the sample chamber. In other embodiments, the device can have a sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification. Suitable sample chambers include those disclosed in U.S. Application No. 14/001,347 (US2014/0162244). In some aspects, the porous membrane can be removably located within the sample chamber. In some aspects, the porous membrane can be attached to the inside of the sample chamber. In other aspects, all or a portion of the sample chamber can be made from a porous membrane. [0068] The sample chamber and/or the reaction-diffusion conduit can be made of a porous polymer or cellulose material. The blend of reactants can be stored in the porous polymer or cellulose material until the device is ready for use.
[0069] In some embodiments, the device further comprises a waste conduit. The waste conduit can, for example, be used to empty the sample chamber, decrease the volume of the sample in the sample chamber, extract amplified material from the sample chamber, remove non- nucleic acid material from the sample chamber, or any combination thereof.
[0070] The waste conduit and reaction-diffusion conduits can have a valve to open and close the conduit, allowing and preventing, respectively, sample from flowing into the conduit. For example, in some embodiments, the sample chamber contains a porous membrane. To extract, concentrate, and/or purify the nucleic acid sample, the valves on both the waste conduit and reaction-diffusion conduits can be closed to allow the sample to interact with the membrane. To remove non-nucleic acid material, the valve on the waste conduit can be opened, while the valve on the reaction-diffusion conduit can remain closed. After the waste is removed, the valve on the waste conduit can be closed. Prior to amplification, the appropriate reactant mixture can be added to the sample chamber and the valve on the reaction-diffusion conduit can be opened, allowing diffusion of the amplified sample into the reaction-diffusion conduit. In some embodiments, the valve can be a passive valve. In other embodiments, the valve can be an active valve.
[0071] In some embodiments the device further comprises a light source. Suitable light sources include, but are not limited to, light-emitting diode (LED), compact fluorescent lamp (CFL), or incandescent.
[0072] The device can further comprise an optical imager. Suitable optical imagers include, but are not limited to, a fluorescent microscope or a camera. In some aspects, the camera can be from a cellular telephone, smart-phone camera, tablet computer, or computer.
[0073] The device can be operatively connected to a controller or computer.
[0074] In some embodiments, the device further comprises a ruler along the length of the reaction-diffusion conduit.
[0075] The device can further comprise a heat source. Suitable heat sources include a thermoelectric unit, an electric heater, an exothermic reactor, a laser, or any combination thereof. In some aspects, the heat source can provide a spatially varying temperature distribution along the length of the reaction-diffusion conduit. Such a heat source enables different temperatures to be applied to different regions of the reaction-diffusion conduit at different times. The temperature can be regulated with a phase change material. In some embodiments, the temperature gradient along the reaction-diffusion conduit can be linear. The temperature in the sample chamber can be different from the temperature in the reaction-diffusion conduit. In other embodiments, the temperature in the sample chamber can be the same as the temperature in the reaction-diffusion conduit.
[0076] In some embodiments, each of the chamber and the at least one reaction- diffusion conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the at least on reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification. The blend of reactants can comprise a plurality of primers and enzymes. In some embodiments, the blend of reactants can further comprise one or more types of reporters. Those skilled in the art would understand that numerous primers, enzymes, and reporters are suitable for nucleic acid amplification procedures. Primers of any length suitable for nucleic acid amplification can be used herein. One skilled in the art would know that primers of nucleic acid amplification are used in pairs - a forward or sense primer and a reverse or antisense primer. "Plurality of primers" and "primer sets" are used interchangeably herein and refer to at least one pair of primers. In some embodiments, the plurality of primers can be a pair of primers. In some embodiments, the plurality of primers can be 2 pairs of primers. In some embodiments, plurality of primers can be more than 2 pairs of primers.
Enzymes suitable for nucleic acid amplification include, but are not limited to, DNA polymerase, RNA-dependent DNA polymerase (reverse transcriptase), or DNA-dependent RNA polymerase (RNA polymerase). As used herein, the term "reporter" means any tag, label, or dye that can bind to, or intercalate within, the nucleic acid molecule or be activated by byproducts of the amplification process to enable visualization of the nucleic acid molecule or the amplification process. Suitable reporters include, but are not limited to, fluorescent labels/tags/dyes, intercalating agents, molecular beacon labels, and bioluminescent molecules. The sample chamber and reaction-diffusion conduit may contain a mixture of primers engineered to be specific to various targets, enabling the concurrent amplification and detection of multiple targets. The sample chamber may contain universal primers to amplify all targets, while the the reaction-diffusion conduits may contain primers for specific targets. In some embodiments, the universal primers in the sample chamber can be immobilized to prevent passage of the primers into the reaction-diffusion conduit. Primers can be immobilized to, for example, the sample chamber or something within the sample chamber that cannot pass into the reaction-diffusion conduit. The reaction-diffusion conduit may also contain reporters (molecular beacons) each engineered to bind to a specific target and each emitting at different range of the spectrum, allowing the detector, with appropriate filters, to image each target separately.
[0077] Other reactants include, but are not limited to, buffers and dNTPs.
[0078] The blend of reactants, or a portion thereof, can be pre-stored in the device. In some embodiments, the blend of reactants, or a portion thereof, are pre-stored in the device and are released upon an increase in temperature. For example, the blend of reactants can be released when the device is heated to its operating temperature.
[0079] The blend of reactants can be liquid or can be in a form that is capable of forming a liquid upon a change in temperature, such as a gel or solid. For example, the blend of reactants can be encased in, embedded in, or surrounded by, a material that melts with increasing temperatures, such as, for example, paraffin. In yet other embodiments, the primers and/or enzymes may be immobilized to the conduit walls or to a porous matrix that fills the reaction- diffusion conduit.
[0080] In some embodiments, the device can have at least two nuclemeters, each containing different primers. The primers can recognize the same nucleic acid molecule but differ in length. Alternatively, the primers can recognize different nucleic acid molecules and be the same length. Alternatively, the primers can recognize different nucleic acid molecules and be different lengths.
[0081] A single nuclemeter can have multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers. For example, one reaction- diffusion conduit can contain a first plurality of primers and another reaction-diffusion conduit can contain a second plurality of primers, the second plurality of primers being different from the first plurality of primers. In such a device, the sample chamber can contain: a mix of a first plurality of primers and second plurality of primers; only a first plurality of primers; only a second plurality of primers; or a third plurality of primers.
[0082] In some embodiments, the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying different nucleic acid molecules. In some aspects, for example, the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying at least two different nucleic acid molecules.
[0083] In some embodiments, at least one of the reaction-diffusion conduits can contain at least one polymer. In some embodiments, at least one of the reaction-diffusion conduit and the sample chamber can contain at least one polymer. The presence of the polymer in the reaction-diffusion conduit or reaction-diffusion conduit and sample chamber can slow the diffusion of the amplified DNA and control the speed of propagation of the reaction front in the reaction-diffusion conduit, so that the diffusion may be easily monitored and/or quantified. In some embodiments, the at least one polymer can be a gel. In embodiments wherein the at least one polymer is a gel, the primers, enzymes, or both can be immobilized to the gel. In some embodiments, the polymer is a solid at an ambient temperature and a liquid at an amplification temperature. As used herein, "ambient temperature" refers to the temperature of the device prior to the amplification procedure. Thus, prior to the amplification procedure, the polymer can be a solid. As the temperature increases at the start of or during the amplification procedure, the polymer can turn into a liquid. In other embodiment, the reaction-diffusion conduit contains gel.
[0084] The disclosed devices can be used for a number of purposes including, but not limited to, melting curve analysis, reverse transcription, identifying a nucleic acid in a sample, diagnosis, quantifying the number of nucleic acid molecules in a sample, and testing
amplification reactants. In some embodiments, the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
Nucleic acid amplification monitors
[0085] Also disclosed herein are nucleic acid amplification monitors comprising a substrate and, on or forming a part of the substrate, and a plurality of nuclemeters. Each nuclemeter comprises an sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber. In some embodiments, each of the chamber and the at least on reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
[0086] Suitable substrates include, but are not limited to, glass, plastic, polymers, metal, silicon, aluminum oxide membrane, acrylic, paper, or any combination thereof. In some embodiments the substrate is a polymeric chip. Polymeric chips can be composed of numerous polymers including, but not limited to, polycarbonate (PC), poly-methyl methacrylate (PMMA), cyclic olefin co-polymers (COC), or any combination thereof. In one embodiment, the polymeric chip comprises polymethyl methacrylate (PMMA).
[0087] In some embodiments, the plurality of nuclemeters can be on the substrate. For example, the nuclemeter and the substrate can be separate components, and can be combined or attached such that the nuclemeter is on a top surface of the substrate. In other aspects, the nuclemeter and substrate can be from a single component wherein the nuclemeter is located on a top surface of the substrate. In other embodiments, the nuclemeter can form a part of the substrate. For example, the nuclemeter can be etched into the substrate. In other embodiments, the substrate can be molded to form the nuclemeter.
[0088] The sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction. For example, the cross-section of the sample chamber can have a variety of suitable shapes, including, but not limited to, square, rectangular, triangular, pentagonal, hexagonal, heptagonal, octagonal, nonagonal, decagonal, round, or elliptical.
[0089] The bottom of the sample chamber can be flat, substantially flat, conical, round, substantially round, or pointed.
[0090] The sample chamber can be a droplet covered by oil, wherein the droplet is propelled by means such as electrowetting to make hydraulic connection with the reaction- diffusion conduit.
[0091] The sample chamber and diffusion-reaction conduit can be separated with a barrier. The barrier can be configured to block passage of reactants between the sample chamber and the reaction-diffusion conduit during sample introduction, nucleic acid isolation, etc. and can be configured to allow passage of reactants between the sample chamber and the reaction- diffusion conduit at a specified time or in response to an event. In some embodiments, the barrier can be removable. In some aspects, for example, the barrier can be physically removed from the nuclemeter. In some embodiments, the barrier can be degradable. For example, the barrier can be composed of, or can comprise, a material that degrades. In some embodiments, the barrier can be dissolvable. For example, the barrier can be composed of a material that dissolves in solution. Exemplary materials that dissolve in solution include, for example, salt. In some embodiments, the barrier can be capable of being melted. For example, the barrier can be composed of, or can comprise, a phase change material that melts at a certain temperature. In some embodiments, the barrier can be movable. For example, the barrier can be configured to open or otherwise allow passage of sample between the sample chamber and the reaction diffusion conduit in response to a force, such as the amplification of the nucleic acid molecule or other surface tension.
[0092] The barrier can allow for a two-step or nested-like amplification. For example, two different amplification reactions can be run; one in the sample chamber and one in the reaction-diffusion conduit. The reaction in the sample chamber can, for example, amplify nucleic acid molecules non-specifically. Once the reaction in the sample chamber is complete, the barrier can be removed, dissolved, degraded, melted, etc. allowing the amplified nucleic acid molecules to diffuse into the reaction-diffusion conduit, which can contain primers for a specific nucleic acid molecule. Within the reaction-diffusion conduit, specific nucleic acid molecules will then be amplified. The two reactions can operate with different enzymes, temperatures, etc.
[0093] The sample chamber has a size suitable for a containing a nucleic acid amplification reaction. Suitable sizes include sample chambers having a volume of from about 0.1 μΐ to about 300 μΐ. In one embodiment, the sample chamber has a volume of about 0.1 μΐ. In one embodiment, the sample chamber has a volume of about 0.5 μΐ. In one embodiment, the sample chamber has a volume of about 1 μΐ. In one embodiment, the sample chamber has a volume of about 10 μΐ. In one embodiment, the sample chamber has a volume of about 20 μΐ. In one embodiment, the sample chamber has a volume of about 50 μΐ. In one embodiment, the sample chamber has a volume of about 100 μΐ. In one embodiment, the sample chamber has a volume of about 150 μΐ. In one embodiment, the sample chamber has a volume of about 200 μΐ. In one embodiment, the sample chamber has a volume of about 250 μΐ. In one embodiment, the sample chamber has a volume of about 300 μΐ. In some embodiments, the sample chamber has a volume greater than 300 μΐ.
[0094] The sample chamber can be from about 0.1 μΐ to about 300 μΐ in volume. In some aspects, the sample chamber can be from about 0.1 μΐ to about 250 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 200 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 150 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 100 μΐ in volume. The sample chamber can be from about 0.1 μΐ to about 50 μΐ in volume. The sample chamber can be from about 10 μΐ to about 300 μΐ in volume. The sample chamber can be from about 10 μΐ to about 200 μΐ in volume. The sample chamber can be from about 10 μΐ to about 150 μΐ in volume. The sample chamber can be from about 10 μΐ to about 100 μΐ in volume. The sample chamber can be from about 10 μΐ to about 50 μΐ in volume. In some aspects, the sample chamber can be from about 25 μΐ to about 300 μΐ in volume. The sample chamber can be from about 50 μΐ to about 300 μΐ in volume. The sample chamber can be from about 75 μΐ to about 300 μΐ in volume. The sample chamber can be from about 100 μΐ to about 300 μΐ in volume. The sample chamber can be from about 125 μΐ to about 300 μΐ in volume. The sample chamber can be from about 150 μΐ to about 300 μΐ in volume. The sample chamber can be from about 175 μΐ to about 300 μΐ in volume. The sample chamber can be from about 200 μΐ to about 300 μΐ in volume. The sample chamber can be from about 225 μΐ to about 300 μΐ in volume. The sample chamber can be from about 250 μΐ to about 300 μΐ in volume. The sample chamber can be from about 275 μΐ to about 300 μΐ in volume. [0095] The height of the sample chamber can be from about 0.05 mm to about 10 mm. The height of the sample chamber can be from about 0.1 mm to about 9 mm. The height of the sample chamber can be from about 0.2 mm to about 8 mm. The height of the sample chamber can be from about 0.3 mm to about 7 mm. The height of the sample chamber can be from about 0.4 mm to about 6 mm. The height of the sample chamber can be from about 0.5 mm to about 5 mm. The height of the sample chamber can be from about 0.6 mm to about 4 mm. The height of the sample chamber can be from about 0.7 mm to about 3 mm. The height of the sample chamber can be from about 0.8 mm to about 2 mm. The height of the sample chamber can be from about 0.9 mm to about 1 mm.
[0096] In some aspects, the height of the sample chamber can be about 0.05 mm. In some aspects, the height of the sample chamber can be about 0.1 mm. In some aspects, the height of the sample chamber can be about 0.2 mm. In some aspects, the height of the sample chamber can be about 0.3 mm. In some aspects, the height of the sample chamber can be about 0.4 mm. In some aspects, the height of the sample chamber can be about 0.5 mm. In some aspects, the height of the sample chamber can be about 0.6 mm. In some aspects, the height of the sample chamber can be about 0.7 mm. In some aspects, the height of the sample chamber can be about 0.8 mm. In some aspects, the height of the sample chamber can be about 0.9 mm. In some aspects, the height of the sample chamber can be about 1 mm. In some aspects, the height of the sample chamber can be about 2.5 mm. In some aspects, the height of the sample chamber can be about 5 mm. In some aspects, the height of the sample chamber can be about 7.5 mm. In some aspects, the height of the sample chamber can be about 10 mm.
[0097] The width of the sample chamber can be from about 0.05 mm to about 5 mm. The width of the sample chamber can be from about 0.1 mm to about 4 mm. The width of the sample chamber can be from about 0.2 mm to about 3 mm. The width of the sample chamber can be from about 0.3 mm to about 2 mm. The width of the sample chamber can be from about 0.4 mm to about 1 mm. The width of the sample chamber can be from about 0.5 mm to about 0.9 mm. The width of the sample chamber can be from about 0.6 mm to about 0.8 mm.
[0098] The width of the sample chamber can be about 0.05. The width of the sample chamber can be about 0.1 mm. The width of the sample chamber can be about 0.2 mm. The width of the sample chamber can be about 0.3 mm. The width of the sample chamber can be about 0.4 mm. The width of the sample chamber can be about 0.5 mm. The width of the sample chamber can be from 0.6 mm. The width of the sample chamber can be about 0.7. The width of the sample chamber can be about 0.8 mm. The width of the sample chamber can be about 0.9 mm. The width of the sample chamber can be about 1 mm. The width of the sample chamber can be about 2 mm. The width of the sample chamber can be about 3 mm. The width of the sample chamber can be about 4 mm. The width of the sample chamber can be about 2 mm. The width of the sample chamber can be about 5 mm.
[0099] The length of the reaction-diffusion conduit can be from about 0.05 mm to about 100 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 75 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 50 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 25 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 10 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 5 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 2.5 mm. The length of the reaction-diffusion conduit can be from about 0.05 mm to about 1 mm. The length of the reaction- diffusion conduit can be from about 0.05 mm to about 0.5 mm.
[00100] The length of the reaction-diffusion conduit can be about 100 mm. The length of the reaction-diffusion conduit can be about 75 mm. The length of the reaction-diffusion conduit can be about 50 mm. The length of the reaction-diffusion conduit can be about 25 mm. The length of the reaction-diffusion conduit can be about 10 mm. The length of the reaction- diffusion conduit can be about 5 mm. The length of the reaction-diffusion conduit can be about 2.5 mm. The length of the reaction-diffusion conduit can be about 1 mm. The length of the reaction-diffusion conduit can be about 0.5 mm.
[00101] The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 mm. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 750 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 500 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 250 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 100 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 50 μιη. The height of the reaction- diffusion conduit can be from about 0.1 μιη to about 25 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 10 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 5 μιη. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 μηι. The height of the reaction-diffusion conduit can be from about 0.1 μιη to about 0.5 μιη.
[00102] The height of the reaction-diffusion conduit can be about 1 mm. The height of the reaction-diffusion conduit can be about 750 μιη. The height of the reaction-diffusion conduit can be about 500 μηι. The height of the reaction-diffusion conduit can be about 250 μηι. The height of the reaction-diffusion conduit can be about 100 μηι. The height of the reaction- diffusion conduit can be about 50 μηι. The height of the reaction-diffusion conduit can be about 25 μηι. The height of the reaction-diffusion conduit can be about 10 μηι. The height of the reaction-diffusion conduit can be about 5 μηι. The height of the reaction-diffusion conduit can be about 1 μηι. The height of the reaction-diffusion conduit can be about 0.5 μηι.
[0103] The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 mm. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 750 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 500 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 250 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 100 μιη. The width of the reaction- diffusion conduit can be from about 0.1 μιη to about 50 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 25 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 10 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 5 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 1 μιη. The width of the reaction-diffusion conduit can be from about 0.1 μιη to about 0.5 μιη.
[0104] The width of the reaction-diffusion conduit can be about 1 mm. The width of the reaction-diffusion conduit can be about 750 μιη. The width of the reaction-diffusion conduit can be about 500 μιη. The width of the reaction-diffusion conduit can be about 250 μιη. The width of the reaction-diffusion conduit can be about 100 μιη. The width of the reaction-diffusion conduit can be about 50 μιη. The width of the reaction-diffusion conduit can be about 25 μιη. The width of the reaction-diffusion conduit can be about 10 μιη. The width of the reaction-diffusion conduit can be about 5 μιη. The width of the reaction-diffusion conduit can be about 1 μιη. The width of the reaction-diffusion conduit can be about 0.5 μιη.
[0105] The cross-section of the reaction-diffusion conduit may be, for example, a rectangle, a square, a circle, a semi-circle, a triangle, a trapezoid. The reaction-diffusion conduit may be, for example, straight, curved, spiral, or contain turns.
[0106] In some embodiments, the nucleic acid amplification monitor can have 1 reaction-diffusion conduct in fluid communication with the sample chamber. In other embodiments, the nucleic acid amplification monitor can have a plurality of reaction-diffusion conduits in fluid communication with the sample chamber. For example, the nucleic acid amplification monitor can have between 2 to about 100 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 2 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 3 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 4 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 5 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have 10 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 15 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects the nucleic acid amplification monitor can have 20 reaction-diffusion conduits in fluid communication with the sample chamber. In some aspects, the nucleic acid amplification monitor can have more than 20 reaction-diffusion conduits in fluid communication with the sample chamber.
[0107] In some embodiments, the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having at least one reaction-diffusion conduit in fluid
communication therewith. In some aspects, the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having 1 reaction-diffusion conduit in fluid
communication therewith. In some aspects, the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having a plurality of reaction-diffusion conduits in fluid communication therewith. For example, in some aspects, the nucleic acid amplification monitor can have 1 sample chamber, said sample chamber having about 2 to about 100 reaction-diffusion conduits in fluid communication therewith.
[0108] In other embodiments, the nucleic acid amplification monitor can have a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. For example, the nucleic acid amplification monitor can have 1 to 100 sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 1 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 2 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 3 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 4 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 5 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 10 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 50 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 75 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith. In some aspects, the nucleic acid amplification monitor can have 100 sample chambers, each sample chamber having 2-100 reaction-diffusion conduits in fluid communication therewith.
[0109] In some embodiments, the nucleic acid amplification monitor can have a plurality of sample chambers, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. Thus, in some aspects, 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, less than 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 5% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, 1% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
[0110] In some aspects, about 1% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 5% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 10% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 15% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 25% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 40% to about 100% of said plurality of sample chambers have a plurality of reaction- diffusion conduits in fluid communication therewith. In some aspects, about 55% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 70% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 85% to about 100% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 90% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 80% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 70% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 60% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 50% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid
communication therewith. In some aspects, about 1% to about 40% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 30% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 20% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith. In some aspects, about 1% to about 10% of said plurality of sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
[0111] The nucleic acid amplification monitor can have at least one sample chamber having a known quantity of a preselected, nucleic acid molecule, which can serve has a "positive control" or "calibration" nuclemeter.
[0112] The disclosed nucleic acid amplification monitors can be used in combination with porous membranes for nucleic acid extraction, concentration, and purification. Suitable porous membranes include, but are not limited to, silica membrane, Whatman FTA membrane, alumina membrane, cellulose membrane. Such porous membranes specifically bind nucleic acids allowing other non-nucleic acid material to pass through the membrane. For example, in some embodiments, a nucleic acid sample can be incubated with a porous membrane, the porous membrane can be washed to remove non-nucleic acid material, and the porous membrane can be added to the sample chamber. In other embodiments, the nucleic acid amplification monitor can have an sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification. Suitable sample chambers include those disclosed in U.S. Application No. 14/001,347 (US2014/0162244). In some aspects, the porous membrane can be removably located within the sample chamber. In some aspects, the porous membrane can be attached to the inside of the sample chamber. In other aspects, all or a portion of the sample chamber can be made from a porous membrane.
[0113] In some embodiments, the nucleic acid amplification monitor further comprises a waste conduit. The waste conduit can, for example, be used to empty the sample chamber, decrease the volume of the sample in the sample chamber, extract amplified material from the sample chamber, remove non-nucleic acid material from the sample chamber, or any
combination thereof.
[0114] The waste conduit and reaction-diffusion conduits can have a valve to open and close the conduit, allowing and preventing, respectively, sample from flowing into the conduit. For example, in some embodiments, the sample chamber contains a porous membrane. To extract, concentrate, and/or purify the nucleic acid sample, the valves on both the waste conduit and reaction-diffusion conduits can be closed to allow the sample to interact with the membrane. To remove non-nucleic acid material, the valve on the waste conduit can be opened, while the valve on the reaction-diffusion conduit can remain closed. After the waste is removed, the valve on the waste conduit can be closed. Prior to amplification, the appropriate reactant mixture can be added to the sample chamber and the valve on the reaction-diffusion conduit can be opened, allowing diffusion of the amplified sample into the reaction-diffusion conduit. In some embodiments, the valve can be a passive valve. In other embodiments, the valve can be an active valve.
[0115] In some embodiments the nucleic acid amplification monitor further comprises a light source. Suitable light sources include, but are not limited to, light-emitting diode (LED), compact fluorescent lamp (CFL), filtered flash light of a cell phone camera, or incandescent.
[0116] The nucleic acid amplification monitor can further comprise an optical imager. Suitable optical imagers include, but are not limited to, a fluorescent microscope or a camera. In some aspects, the camera can be from a cellular telephone, smart-phone camera, tablet computer, or computer.
[0117] The nucleic acid amplification monitor can be operatively connected to a controller or computer.
[0118] In some embodiments, the nucleic acid amplification monitor further comprises a ruler along the length of the reaction-diffusion conduit.
[0119] The nucleic acid amplification monitor can further comprise a heat source. Suitable heat sources include a thermoelectric unit, an electric heater, an exothermic reactor, a laser, or any combination thereof. In some aspects, the heat source can provide a spatially varying temperature distribution along the length of the reaction-diffusion conduit. Such a heat source enables different temperatures to be applied to different regions of the reaction-diffusion conduit at different times. The temperature can be regulated with a phase change material. In some embodiments, the temperature gradient along the reaction-diffusion conduit can be linear. The temperature in the sample chamber can be different from the temperature in the reaction- diffusion conduit. In other embodiments, the temperature in the sample chamber can be the same as the temperature in the reaction-diffusion conduit.
[0120] In some embodiments, each of the chamber and the at least one reaction- diffusion conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the chamber and the at least on reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification. The blend of reactants can comprise a plurality of primers and enzymes. In some embodiments, the blend of reactants can further comprise one or more types of reporters. Those skilled in the art would understand that numerous primers, enzymes, and reporters are suitable for nucleic acid amplification procedures. Suitable primers include, for example, DNA or RNA primers. The length of the primer (i.e. number of nucleotides) depends, in part, on the nucleic acid molecule to be amplified. Primers of any length suitable for nucleic acid amplification can be used herein. One skilled in the art would know that primers of nucleic acid amplification are used in sets or pairs - a forward or sense primer and a reverse or antisense primer. "Plurality of primers" and "primer sets" are used interchangeably herein and refer to at least one pair of primers. In some embodiments, the plurality of primers can be a pair of primers. In some embodiments, the plurality of primers can be 2 pairs of primers. In some embodiments, the plurality of primers can be more than 2 pairs of primers. Enzymes suitable for nucleic acid amplification include, but are not limited to, DNA polymerase, RNA-dependent DNA polymerase (reverse transcriptase), or DNA-dependent RNA polymerase (RNA polymerase). As used herein, the term "reporter" means any tag, label, or dye that can bind to, or intercalate within, the nucleic acid molecule to enable visualization of the nucleic acid molecule. Suitable reporters include, but are not limited to, fluorescent
labels/tags/dyes and intercalating agents. The sample chamber and reaction-diffusion conduit may contain a mixture of primers engineered to be specific to various targets, enabling the concurrent amplification and detection of multiple targets. The sample chamber may contain universal primers to amplify all targets, while the reaction-diffusion conduits may contain primers for specific targets. In some embodiments, the universal primers in the sample chamber can be immobilized to prevent passage of the primers into the reaction-diffusion conduit.
Primers can be immobilized to, for example, the sample chamber or something within the sample chamber that cannot pass into the reaction-diffusion conduit. The reaction-diffusion conduit may also contain reporters (molecular beacons) each engineered to bind to a specific target and each emitting at different range of the spectrum, allowing the detector, with appropriate filters, to image each target separately.
[0121] Other reactants include, but are not limited to, buffers and dNTPs.
[0122] The blend of reactants, or a portion thereof, can be pre-stored in the nucleic acid amplification monitor. In some embodiments, the blend of reactants, or a portion thereof, are pre-stored in the nucleic acid amplification monitor and are released upon an increase in temperature. For example, the blend of reactants can be released when the nucleic acid amplification monitor is heated to its operating temperature.
[0123] The blend of reactants can be liquid or can be in a form that is capable of forming a liquid upon a change in temperature, such as a gel or solid. For example, the blend of reactants can be encased in, embedded in, or surrounded by, a material that melts with increasing temperatures, such as, for example, paraffin. [0124] In some embodiments, the nucleic acid amplification monitor can have at least two nuclemeters, each containing different primers. The primers can recognize the same nucleic acid molecule but differ in length. Alternatively, the primers can recognize different nucleic acid molecules and be the same length. Alternatively, the primers can recognize different nucleic acid molecules and be different lengths.
[0125] A single nuclemeter can have multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers. For example, one reaction- diffusion conduit can contain a first plurality of primers and another reaction-diffusion conduit can contain a second plurality of primers, the second plurality of primers being different from the first plurality of primers. In such a device, the sample chamber can contain: a mix of a first plurality of primers and second plurality of primers; only a first plurality of primers; only a second plurality of primers; or a third plurality of primers.
[0126] In some embodiments, the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying different nucleic acid molecules. In some aspects, for example, the blend of reactants in the sample chamber and the blend of reactants in the conduit are capable of amplifying at least two different nucleic acid molecules.
[0127] In some embodiments, at least one of the reaction-diffusion conduits can contain at least one polymer. In some embodiments, at least one of the reaction-diffusion conduits and the sample chamber can contain at least one polymer. The presence of the polymer in the reaction-diffusion conduit or reaction-diffusion conduit and sample chamber can slow the diffusion of the amplified DNA and control the speed of propagation of the reaction front in the reaction-diffusion conduit, so that the diffusion may be easily monitored and/or quantified. In some embodiments, the at least one polymer can be a gel. In embodiments wherein the at least one polymer is a gel, the primers, enzymes, or both can be immobilized to the gel. In some embodiments, the polymer is a solid at an ambient temperature and a liquid at an amplification temperature. As used herein, "ambient temperature" refers to the temperature of the nucleic acid amplification monitor prior to the amplification procedure. Thus, prior to the amplification procedure, the polymer can be a solid. As the temperature increases at the start of or during the amplification procedure, the polymer can turn into a liquid. In other embodiment, the reaction- diffusion conduit contains gel.
[0128] The disclosed nucleic acid amplification monitors can be used for a number of purposes including, but not limited to, melting curve analysis, reverse transcription, identifying a nucleic acid in a sample sample, diagnosis, quantifying the number of nucleic acid molecules in a sample, and testing amplification reactants. In some embodiments, the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
[0129] In some embodiments, the sample chamber and the reaction-diffusion conduit can be separate components.
Methods of quantifying nucleic acid amplification
[0130] Also disclosed herein are methods of quantifying nucleic acid amplification comprising amplifying a sample comprising a nucleic acid molecule in any of the devices or the nucleic acid amplification monitors disclosed herein to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample.
[0131] In some embodiments, amplifying the nucleic acid molecule comprises thermo- cycling. In other embodiments, amplifying the nucleic acid molecule comprises isothermal nucleic acid amplification.
[0132] Suitable methods for measuring a reaction-diffusion length of said amplified nucleic acid molecule include, but are not limiting to, measuring an electrical resistance, measuring a capacitance, measuring an absorption (for example, UV absorption), measuring an emission of a reporter, or any combination thereof. In some aspects, the reaction-diffusion length of said amplified nucleic acid molecule can be measured, for example, using a ruler. In some embodiments, the device or nucleic acid amplification monitor has a ruler along the length of the reaction-diffusion conduit. In other embodiments, the ruler is separate from the nuclemeter.
[0133] In some embodiments, quantifying the length of the emitting column in the reaction-diffusion column can be a function of nucleic acid concentration and time. By reading the length of the emitting column and the time elapsed from the onset of the amplification reaction, for example, one can determine the number of nucleic acid molecules in the sample. In other embodiments, quantification can be independent of time. For example, one can monitor two or more nuclemeters, at least one of which containing a known number of molecules (calibrator) and at least one containing an unknown number of nucleic acids (tester). The difference in the emission lengths of the tester and calibrator can enable one to determine the number of nucleic acid molecules in the tester, independent of the measurement time. [0134] In some embodiments, the methods can further comprise comparing the reaction-diffusion length of the one or more reaction-diffusion conduits. For example, one or more of the reaction-diffusion conduits within the device can be compared to one or more of the reaction-diffusion conduits within the same device. Conversely, one or more of the reaction- diffusion conduits within the device can be compared to one or more reaction-diffusion conduits within a separate device. Comparison of the one or more reaction-diffusion conduits to reaction- diffusion conduits in the same device or in a separate device will allow one to evaluate, for example, the relative amount of one or more nucleic acid molecules. In other embodiments, the methods can further comprise comparing the reaction-diffusion length of the one or more reaction-diffusion conduits to a control. The control can be a reaction-diffusion conduit from the same device or from a separate device that contains a known quantity of a nucleic acid molecule, a nucleic acid molecule of a known identity, a sample from a subject having a known disease or condition, or any combination thereof. The quantity, identity, or sample from a subject may be indicative of the presence or absence of a disease or condition. The comparing can be used, for example, to determine: the presence or absence of a disease in a subject; the type or stage of a disease in a subject; or the effectiveness of therapy. For example, the one or more known nucleic acid molecules can be nucleic acid molecules that exhibit altered expression in the disease. In some aspects, the one or more nucleic acid molecules can be nucleic acid molecules whose expression is decreased in the disease. In some aspects, the one or more nucleic acid molecules can be nucleic acid molecules whose expression is increased in the disease. The reaction-diffusion length from the one or more known nucleic acid molecules can be indicative of a disease state. In some aspects, the reaction-diffusion length from the one or more known nucleic acid molecules can be indicative of a disease type. In some aspects, the reaction- diffusion length from the one or more known nucleic acid molecules can be indicative of a disease stage. In other embodiments, the reaction-diffusion length from the one or more known nucleic acid molecules is indicative of a normal (non-disease) state.
[0135] The one or more known nucleic acid molecules can be derived from cells, blood, serum, bacteria, or any other suitable source of a nucleic acid molecule. In some aspects, the nucleic acid molecules can be derived from cells from a subject suspected of having a disease. In some aspects, the nucleic acid molecules can be derived from the bacterial flora of a subject. Comparing the reaction-diffusion length of the sample to the reaction-diffusion length from one or more known nucleic acid molecules that are indicative of a disease state, a normal (non-disease) state, or both, can be used to determine if a subject has the disease state.
Exemplary diseases include, for example, cancer.
[0136] Different reaction-diffusion conduits can store different primers specific to genes of interest. By comparing the reaction-diffusion lengths in different reaction-diffusion conduits, in which selected genes were amplified, with a library of gene expression profiles, one can determine, for example, the gene expression profile of the sample.
[0137] In some embodiments, the nucleic acid molecule is DNA. In some
embodiments, the nucleic acid molecule is RNA. In embodiments wherein the nucleic acid molecule is RNA, the methods can further comprise, prior to the amplifying, reverse transcribing the RNA to generate cDNA.
[0138] The one or more known nucleic acid molecules can be markers of a disease. For example, the one or more known nucleic acid molecules can be nucleic acid molecules that exhibit altered expression in the disease. In some aspects, the one or more nucleic acid molecules can be nucleic acid molecules whose expression is decreased in the disease. In some aspects, the one or more nucleic acid molecules can be nucleic acid molecules whose expression is increased in the disease. For example, the one or more known nucleic acid molecules can be markers of cancer.
[0139] The results of the methods of obtaining a gene expression profile can be used, for example, to screen for a disease of interest, select an appropriate drug for a patient, or monitor therapy.
[0140] The disclosed methods can be used to determine the number of nucleic acid molecules in a sample by, for example, comparing the reaction-diffusion length in a reaction- diffusion conduit containing molecules from the sample to a reaction-diffusion length in a conduit having a known number of nucleic acid molecules. The control molecules may be pre- stored in the device or consist of house-keeping molecules in the sample. The disclosed methods can also be used to determine the relative expression of nucleic acid molecules in a sample by, for example, comparing the reaction-diffusion length to a reaction-diffusion conduit having a control sample and calculating the percentage or the reaction-diffusion length of the sample.
Methods of identifying an unknown nucleic acid molecule
[0141] Also disclosed herein are methods of identifying an unknown nucleic acid molecule, comprising amplifying a sample comprising an unknown nucleic acid molecule in any of the devices or nucleic acid amplification monitors disclosed herein, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample..
[0142] For example, the device or nucleic acid amplification monitor suitable for the disclosed methods of identifying an unknown nucleic acid molecule can contain one or more nuclemeters. The nuclemeters can have a plurality of reaction-diffusion conduits, each of said reaction-diffusion conduit containing a plurality of primers specific for a different known nucleic acid molecule. For example, each of the reaction-diffusion conduits can contain different primers for different viral nucleic acids. In some aspects, each of the reaction-diffusion conduits can contain different primers for different pathogens, such as bacteria, virus, and parasite nucleic acids. In other aspects, each of the reaction-diffusion conduits can contain different primers for different fungal nucleic acids. In yet other aspects, each of the reaction-diffusion conduits can contain different primers for different biomarkers which identify human disease. For example, each of the reaction-diffusion conduits can contain different primers for different cancer biomarkers. In some embodiments, a single nuclemeter can comprise a plurality of reaction- diffusion conduits, each reaction-diffusion conduit containing different primers for a variety of different pathogens, viruses, bacteria, fungus, human, animal, and plant diseases, or any combination thereof.
[0143] The disclosed methods of identifying an unknown nucleic acid molecule can be used, for example, in diagnosing a patient with an unknown infection or disease. For example, a nucleic acid sample can be isolated from a human, an animal, or a plant and added to the sample chamber of any one of the devices or nucleic acid amplification monitors disclosed herein, wherein the device or nucleic acid amplification monitor comprises at least one nuclemeter comprising at least one sample chamber and at least one reaction-diffusion conduit, said at least one conduit containing a plurality of primers specific for a different known nucleic acid molecule. Amplification will proceed in a reaction-diffusion conduit if that conduit contains primers specific for the unknown nucleic acid molecule. Amplification, which can be monitored by an emission, will indicate that the sample having an unknown nucleic acid molecule comprises at least a nucleic acid molecule for which the primers are specific. [0144] In addition to identifying unknown nucleic acid samples, the disclosed methods can be used to determine a number of nucleic acid molecules in the unknown nucleic acid sample. For example, in some embodiments, the method comprises determining the difference in length of reaction-diffusion from a nuclemeter having a sample having a known quantity of a nucleic acid and a nuclemeter having a sample having an unknown nucleic acid molecule, wherein the difference in the length of the reaction-diffusion between the known quantity of a nucleic acid molecule and the sample having an unknown nucleic acid molecule indicates a number of nucleic acid molecules in the sample having the unknown nucleic acid molecule.
[0145] Suitable methods for measuring a reaction-diffusion length of said amplified nucleic acid molecule include, but are not limiting to, measuring an electrical resistance, measuring a capacitance, measuring an absorption (for example, UV absorption), measuring an emission of a reporter, or any combination thereof. In some aspects, for example, the length of the reaction-diffusion can be determined by using a ruler. In some embodiments, the device or nucleic acid amplification monitor has a ruler along the length of the reaction-diffusion conduit. In other embodiments, the ruler is separate from the nuclemeter.
Systems for monitoring nucleic acid amplification
[0146] Further disclosed are systems for monitoring nucleic acid amplification comprising a nuclemeter, an optical imager, and a heat source. The nuclemeter comprises an sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber. In some embodiments, each of the sample chamber and the at least one reaction-diffusion conduit hold a blend of reactants for nucleic acid amplification. In other embodiments, each of the sample chamber and the at least one reaction-diffusion conduit are capable of holding a blend of reactants for nucleic acid amplification.
[0147] Any of the nuclemeters disclosed herein are suitable for the disclosed system.
[0148] The system can further comprise a controller, an output device, or a combination thereof.
[0149] The sample chamber can have a size and shape suitable for containing a nucleic acid amplification reaction.
[0150] Each of the optical imager, heat source and output device can be operably controlled by the controller.
EXAMPLES Methods
Nuclemeter chip fabrication
[0151] The 46 mm long x 36 mm wide x 3.0 mm thick, Poly(methyl methacrylate) (PMMA, Acrylic glass) body of the chip was milled with a precision, computer-controlled (CNC, HAAS Automation Inc., Oxnard, CA) milling machine (FIG. 1C). An inlet port and an exit port were connected to the sample chamber and a third port was connected to the distal end of the microconduit (FIG. 1A). After milling, the chip body was sonicated in 100% ethanol for 15 minutes, rinsed with water, and air-dried at room temperature. To eliminate any RNase and DNase that could degrade nucleic acids or interfere with enzymatic reactions, the chip body was dipped in Decon™ ELIMINase™ decontaminant (Thermo Fisher Scientific Inc., Walthman, MA) for 2 minutes, rinsed twice with sterile molecular biology-grade water (Thermo Fisher Scientific Inc.), and air-dried at room temperature.
[0152] The chip body was ceiled and floored with PMMA film (top) and PCR
Sealers™ tape (bottom), respectively (FIG. 3). Both were cut with a CO2 laser (Universal Laser Systems). The top PMMA film was solvent-bonded to the chip body with acetonitrile (Sigma- Aldrich) at room temperature. The bonded chip was heated overnight (Isotemp Vacuum Oven Model 280A, Fisher Scientific Inc., Pittsburgh, PA) at 55 °C to remove any residual solvent. Finally, the PCR Sealers™ tape was used to seal the bottom of the chip.
HIV RNA purification from plasma samples
[0153] Viral RNA was extracted from HIV-1 standards (AcroMetrix® HIV-1 High Control, Benicia, CA) with QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Briefly, 140 μΐ., of virus suspension was lysed with 560 μΐ., virus lysis buffer containing carrier RNA. 560 μϊ^ ethanol was added to the lysate and the mixture was centrifuged in a spin column (630 μΐ., aliquots) at 10,000 rpm for 2 minutes. Prior to eluting the HIV viral RNA, wash buffers were loaded into the spin column and centrifuged at 14,000 rpm for 5 minutes. The RNA was eluted with 60 μΐ., of elution buffer. Negative controls were prepared from a de-identified HIV-negative plasma sample (provided by the Penn Center for AIDS Research CFAR with the Institutional Review Board approval (protocol: 814752)) using the same extraction procedures as described above. RT-LAMP reagents
[0154] The RT-LAMP primers were designed as described in Curtis, K.A., Rudolph, D.L. & Owen, S.M. J. Virol. Meth. 151, 264-270 (2008) at the Center for Disease Control and Prevention (CDC) and were synthesized by Sigma- Aldrich. The real-time benchtop RT-LAMP experiments were carried out with 15 μϊ^ reaction volumes. The reaction mixture consisted of 0.2 μΜ of F3 and B3, each; 0.8 μΜ Loop F and Loop B, each; and 1.6 μΜ of FIP and BIP, each, 1.25 U AMV reverse transcriptase (Life Technologies, Carlsbad, CA); 0.53 x EvaGreen dye (Biotium, Hayward, CA); 0.04% (w/v) hydroxypropyl-methyl-cellulose (HPMC); and 9 μΐ^ Isothermal Master Mix (ISO-OOlnd, OptiGene, Horsham, UK).
[0155] The HPMC was dissolved in Isothermal Master Mix, centrifuged at 10,000 rpm for 2 minutes, and filtered through a Corning Costar® Spin-X® centrifuge tube equipped with cellulose acetate membrane filters with a pore size of 0.45 μιη to remove any traces of insoluble HPMC.
[0156] A ten- fold dilution series of HIV viral RNA extracted from a HIV-1 standard panel and a negative control without template prepared from a HIV-negative plasma sample were tested in parallel. The real-time, "tubed-based" RT-LAMP was carried out in a Peltier Thermal Cycler PTC-200 (Bio-Rad DNA Engine, Hercules, CA). Reactions were carried out at 62.5 °C for 60 minutes with real-time fluorescence monitoring. Real-time RT-LAMP results were analyzed and the threshold time Ct (the time needed for the emission intensity to exceed a predetermined value) was obtained.
Device operation
[0157] 5 μϊ^ of RT-LAMP master mixture, comprised of all the reagents necessary for the RT-LAMP and 0.04% HPMC (excluding the HIV RNA template), was inserted into each reaction-diffusion microconduit through inlet port 1 (FIG. 1A and 1C). Then, inlet ports 1 of all four nuclemeters were sealed with PCR Sealers™ tape. Next, 15 μΐ of RT-LAMP master mixture and HIV RNA template of various concentrations were injected into the sample chambers through the inlet ports 2 (FIG. 1A and 1C). Subsequently, both the inlet ports 2 and outlet ports were sealed with PCR Sealers™ tape to minimize evaporation during the amplification process. The nuclemeter chip was placed on a custom, portable heater and incubated at 62.5 °C for about 60 minutes to enable isothermal amplification. Portable processor for RT-LAMP
[0158] The custom made, portable processor (FIGS. 5 and 6) for the nuclemeter consisted of a chip holder equipped with a flexible, polyimide-based, thin film heater (Model HK5572R7.5L23A, Minco Products, Inc., Minneapolis, MN) (inset in FIG. 6A), an electronic circuit board, and a thermocouple positioned at the interface between the thin film heater and the nuclemeter chip. When the nuclemeter chip, filled with LAMP master mixture, was inserted into the processor, the sample chambers and diffusion conduits were in thermal contact with the thin film heater.
[0159] To thermally calibrate the device, a calibration chip with a type-K thermocouple (Omega Engr., each wire 75 mm in diameter, and a junction diameter of 170 μιη) was constructed in the reaction-diffusion conduit. The sample chambers and reaction-diffusion conduits were filled with water. The thermocouple reading was monitored with a HH506RA multilogger thermometer (Omega Engr., Stamford, CT, USA). In addition, an infrared image of the heated micro fluidic chip was taken with an infrared thermography camera T360 (FLIR Systems, Wilsonville, USA) to evaluate temperature uniformity (FIG. 6B).
Endpoint, fluorescence image for quantitative detection
[0160] The fluorescence excitation and emission imaging were carried out with a handheld, USB-based, fluorescence microscope (AM4113T-GFBW Dino-Lite Premier, AnMo Electronics, Taipei, Taiwan) (FIGS. 5 and 6). The USB-based, fluorescence microscope has built-in, filtered blue LEDs for excitation, a 510 nm emission filter, and a CCD camera for fluorescence imaging. The microscope was interfaced with a computer through a USB interface. Images were acquired with a DinoCapture 2.0 software program. The images were processed with MatLab™ software to remove background noise and uneven illumination effects. A normalized and averaged fluorescence intensity signal for each lane was extracted from each processed image. The locations of the reaction fronts of different samples were directly read out by eye with the fluorescence ruler (FIG. 6C).
[0161] As an alternative to fluorescent dye to indicate the length of the reaction zone, bioluminescence can be used (FIG. 14). The bioluminescent real time reporter (BART) was included with the reagents. During DNA amplification in microconduits, the reporter emits visible light at the reaction front, providing an indication of the position of the reaction front. When bioluminescence is used, there is no need for excitation, eliminating any background emission. The emission consists of white light that can be recorded directly by charged coupled device camera, cell phone camera or by eye (FIG. 14).
Image Processing and Analysis
[0162] Images were processed post-acquisition to facilitate comparison with numerical simulations. Initially, the noise was removed from all images using a low pass filter. Then, the images were corrected by applying the following scaling:
j j - c I -I '
I *> I
where c is the corrected emission intensity, is the filtered intensity, * is the background intensity, and ^ is the flat maximum intensity. The background intensity is the average of the first five video frames when there are too few amplicons to generate a significant signal. The maximum intensity was obtained from the last frame acquired. The intensity signal at each position x was averaged along the width of the conduit. All image processing and mathematical calculations were performed with MatLab.
Results
[0163] The disclosed nuclemeters enable monitoring and end-point quantitative detection of amplified nucleic acids based on the position of a reaction front. The nuclemeter is comprised of a sample chamber and a reaction-diffusion conduit, containing all the reagents needed for enzymatic amplification, polymeric additive HPMC to slow diffusion, as well as intercalating dye reporter (FIG. 1A-C). A sample laden with target nucleic acids was introduced into the sample chamber and the amplification reaction was triggered thermally. As time progresses, amplicons diffused into the conduit, where they continue to react and amplify. After a certain time threshold, the conduit consisted of two distinct regions (FIG. IB): the bright, left segment (0<X<XF), where the amplification reaction had already generated a sufficient number of amplicons to emit detectable fluorescence emission; and the dark, right section (X>XF) into which amplicons had yet to diffuse. As time proceeded, the reaction front (XF), separating between the bright and dark regions, propagated to the right. Without intent to be bound by theory, it is believed that the position of the reaction front indicates target analyte concentration. Many nuclemeters can be housed on a single chip and imaged simultaneously for concurrent monitoring of multiple amplification processes, calibration standards, and controls.
[0164] Polymethyl methacrylate (PMMA) chips consisting of four nuclemeters (FIG. 1C and FIG. 3) were fabricated. Each nuclemeter consisted of a 2mm diameter x 2.80mm deep sample well (~9μΚ) connected to a 330μιη wide x 330μιη deep x 12mm long reaction-diffusion conduit (FIG. 1A and FIG. 4). Reverse transcription, loop-mediated isothermal amplification (RT-LAMP), as described in Notomi, T. et al. Nucleic Acids Res. 28, E63 (2000) and Tomita, N., Mori, Y., Kanda, H. & Notomi, T. Nat. Protoc. 3, 877-882 (2008), was used to quantify HIV viral load. Samples containing 0, 102, 103, and 104 HIV-1 RNA molecules were inserted into the sample wells (FIG. IB) and incubated at 62.5 °C using a custom, portable, processor (FIG. 5 and 6). The emission from the reaction-diffusion conduits was recorded using an USB fluorescent microscope (FIG. ID). The position of the reaction front (XF) was quantified with a ruler affixed on the processor (FIG. 6C). At any given time, the greater the number of target molecules, the larger Xp. Thus, with appropriate calibration, the number of initial target molecules can be inferred ΐΐ να Χρ. Although Xp increases as time increases at any target concentration, the differences between Xp values associated with different concentrations are time-independent.
[0165] The reproducibility of the nuclemeter was evaluated by introducing identical target concentrations (102 copies HIV-1 RNA) into all four sample wells (FIG. IE). All four conduits exhibited nearly identical Xp (± 4.5%) at any given time. Furthermore, the limits of detection were tested by reducing the number of target molecules. As few as 50 RNA copies were consistently detected, comparable to the performance of a benchtop RT-LAMP (FIG. 7).
[0166] FIG. 2 illustrates the experimental data and compares it with the predictions of a simple theoretical model. The emission intensity was taken to be proportional to the amplicons' concentration c(x,t), assumed uniform in each cross-section of the conduit. FIG. 2A depicts c cmax as a unction of position x at various times t. The lines and symbols correspond, respectively, to predictions and experimental data. The location of the reaction front Xp(t) was defined as the position at which ^>ή -0.5 When χ<Λ>, £~1 and the amplification reaction is nearly complete (the regions with fluorescent emission in FIG. ID). When x>Xp, c~0 and no amplification has yet occurred (the dark regions in FIG. Id). FIG. 2B depicts c as a function of time at various positions x. An observer located at position x will not see a signal until after a certain time delay. FIG. 2C depicts the experimentally-determined rate of the reaction <¾ as a function of position (x) at various times. The rate of the reaction resembles a propagating peak that travels at a fixed velocity vg. The peak's width at midheight (Λ) did not vary with time (FIG. 2D), i.e., the reaction front is non-dispersive.
[0167] The position of the reaction ΐΐοηί Χρ(ί) was depicted as a function of time when the number of target molecules is 102, 103, and 104 (FIG. 2E, n = 3). For sufficiently large times, t>ti>tg, the experimental data correlates well with straight lines (R2 = 0.998).
XF {t) = va {t - t0 ) s ( 1)
Where t (s) is the observation time, to (s) is the intercept with the horizontal axis, and ti (s) is the delay time until a visible signal is observed. All the lines in FIG. 2E have nearly the same slope,
*p _i 7
ating that the front propagates at a nearly constant speed of 0 · ¾+ -o 15
indic · μιη/s (n=9) independent of target concentration. In contrast, to decreases as the target concentration increases (FIG. 2F), playing a similar role to the threshold time (G) in a standard real-time quantitative amplification. For comparison, Ct is also shown in FIG. 2F (see also FIG. 8).
t0 = A - B \og (c0 ) ^ ^ where A and B are constants and Co is the number of target molecules (R2 = 0.996).
[0168] Although the position of the front XF is time-dependent, the distances between any two fronts associated with different numbers of target molecules are not (FIG. 9). Thus, time-dependence can be eliminated by subtracting the position of the front of a calibration lane (XF(C)) containing a known target concentration from that of the test lane. To demonstrate this, variables associated with lanes 1, 2, and 3 (FIG. ID) were denoted with superscripts 1 , 2, and 3. FIG. 2G depicts XF (i)-X > as a function of the number of target molecules co(i) . It is observed that all the data collapses to a single straight line (n = 15, R2 = 0.99), eliminating any explicit dependence on the time at which Xp was measured. Thus, in the presence of a calibration nuclemeter (c),
Figure imgf000044_0001
[0169] In the presence of one or more calibration nuclemeters, one can rely on the differences among reaction front positions to determine target concentration, independent of measurement time. Although not essential, a device could include at least one calibration nuclemeter. The calibration nuclemeters can, of course, also serve as positive controls. With the aid of equation (2), equation (3) can be rewritten to express explicitly the dependence of ΔΧΡ on target analyte concentration.
Figure imgf000045_0001
[0170] When a monitoring device includes two calibration nuclemeters cl and c2 with known target concentrations c0I(l) and c02(2), respectively, the difference of the emission len ths of the two calibration columns is
Figure imgf000045_0002
and
Figure imgf000045_0003
[0171] A simple reaction-diffusion mathematical model to simulate the experiment was proposed to gain further insight into the operation of the nuclemeter. The amplicon production during enzymatic amplification was approximated with the production term ' , where the reaction rate constant -0.008 s"1 was determined empirically by fitting theoretical predictions with real time RT-LAMP amplification curves (See below - estimation of the reaction rate constant). cmax was estimated at ~ 1.1 x 10"10 mol/m3. The variable c in the theory plays the same role as I in the experiment. The reaction diffusion process in the nuclemeter was modeled with the dimensionless equation
Figure imgf000045_0004
In the above, distance was scaled with D/£ an(j†jme wjm diffusion coefficient D ~
10-10 m2/s was estimated by monitoring the diffusion of labeled primers in the conduit in the absence of amplification reaction (See below - Estimating the Diffusion Coefficient (D)). The dc(-d,X
boundary and interfacial conditions are: <¾ ;
/ - / - dc (0-,t) dc (0+, t)
(0-,t) - (0+,t) = ^^ = 0
dx dx (the interface between the well and the conduit); and ¾∞^ =0 . The initial conditions are ¾ Ό)=¾ when -d<x< (sample well) and c(x,0) =0 when o<x<oo (conduit).
[0172] The predictions of equation (5) (solid lines in FIGS. 2A and B) closely resemble the experimental data. FIG. 2H depicts the position of the predicted reaction front as a function of time for different initial concentrations ^ . Although at short times, the front velocity varies as a function of ^ , soon enough all the curves asymptote to straight lines with a slope independent of time and the initial target concentration. The dimensionless predicted reaction front velocity is
2. The dimensional predicted reaction front velocity vo 2 [kD
Figure imgf000046_0001
js very ciose0 the experimentally measured one. Moreover, consistent with experiments, the theory predicts a constant reaction front velocity independent of target concentration. When >zo ; the front location can be estimated with equation (1), where ^ depends on the initial concentration through equation (2). FIG. 21 depicts the predicted to as a function of the number of target molecules using an estimated value of cmax. FIG. 21 is in qualitative agreement with the experimental data of FIG. 2F.
Estimation of the reaction rate constant
[0173] To estimate the reaction rate constant, LAMP amplification was carried out in the nuclemeter's sample well (FIG. 10). The amplification process was approximated with
* =fc(l_?-) where c is the concentration (mol/m3), k (s 1) is the reproductive parameter, and c (mol/m3) is the saturation concentration. The fluorescence emission intensity was assumed to be proportional to the concentration. This assumption is not critical and equation (6) could have been formulated in terms of the emission intensity instead of the concentration. It is convenient to introduce the
„_ c
normalized concentration Cmax . Accordin ly, equation (6) reduces to
Figure imgf000046_0002
with the initial condition:
(8)
Equation (7) with initial condition (8) admits the solution:
(l-c0)exp(-£t)+c0 (9) By minimizing the discrepancy between the predictions of equation (9) and the experimental data, the reaction rate constant k and and ^ were estimated. FIG. 10D depicts the predictions of equation (9) with the optimal estimate k = 0.008 s"1 and ^ = 0.006 (solid lines) along with the experimental data (symbols). The number of target molecules is 103 copies.
Estimating the Diffusion Coefficient (D)
[0174] To estimate the diffusion coefficient of nucleic acids in the HPMC polymer solution, oligonucleotides tagged with a fluorescent dye (HEX-
GGTGTCTCATTGTTTATACTA) were introduced into the sample well and monitored the nucleic acid diffusion in the microconduit as a function of time (FIG. 1 1A). This experiment was carried out at the LAMP incubation temperature of 62.5 °C, but in the absence of enzymes so that no amplification took place. The normalized signal intensity (normalized concentration) is depicted (dashed lines) in FIG. 10B as a function of position along the conduit at various times.
[0175] The concentration distribution was modeled with a diffusion equation in a semi- infinite medium:
with the initial and boundary
Figure imgf000047_0001
c(0,t) -l = c(∞,t)
(1 1) c
c-
In the above, where is assumed to be time-independent. Since the volume of the sample chamber far exceeds the volume of the conduit, the error introduced by assuming that c(0,t) remains constant throughout the process is quite small, as has been verified both by scaling analysis and by obtaining a more accurate solution for equation (10) that allows for time- dependence of as mandated by mass conservation.
[0176] Equations (10) and (1 1) admit the classical solution
Figure imgf000047_0002
[0177] Using the MatLab Optimization toolbox (The Math Works, Inc., Natick, MA), it was observed that D ~ 10"10 mV1 minimized the discrepancy between the predictions of equation (12) and the experimental data. The predictions of equation (12) with the optimal D are depicted (dashed lines) along with the experimental data (symbols) in FIG. 1 IB. [0178] Disclosed herein are devices and endpoint methods for the quantification of nucleic acids undergoing enzymatic amplification. Unlike traditional quantitative fluorescence enzymatic amplification detection, the disclosed devices and methods do not require continuous monitoring of the amplicons and is based on inferring the number of target nucleic acid molecules from the position of the amplification reaction front. The nuclemeter requires only a single image to quantify the nucleic acid at a prescribed time or, in the presence of a calibration column, at any time. The nuclemeter is compatible with multiplexing, allowing low-cost, high throughput nucleic acid screening, and it may be readily combined with modules for nucleic acid isolation, concentration, purification, and self-heating to facilitate inexpensive non-instrumented, quantitative, on-site molecular detection.
[0179] Those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention. It is, therefore, intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention.
[0180] The disclosures of each patent, patent application, and publication cited or described in this document are hereby incorporated herein by reference, in its entirety.
EMBODIMENTS
The following list of embodiments is intended to complement, rather than displace or supersede, the previous descriptions.
Embodiment 1. A device for monitoring nucleic acid amplification comprising a nuclemeter comprising a sample chamber and at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
Embodiment 2. The device of embodiment 1, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction.
Embodiment 3. The device of embodiment 1 or 2, wherein the sample chamber and the conduit are separated with a barrier.
Embodiment 4. The device of any one of the previous embodiments, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any combination thereof.
Embodiment 5. The device of any one of the previous embodiments, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
Embodiment 6. The device of any one of the previous embodiments, having a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
Embodiment 7. The device of embodiment 6, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
Embodiment 8. The device of embodiment 7, at least one sample chamber having a known quantity of a preselected, target nucleic acid molecule.
Embodiment 9. The device of any one of the previous embodiments, the sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
Embodiment 10. The device of any one of the previous embodiments, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof.
Embodiment 1 1. The device of embodiment 10, wherein the optical imager is a fluorescent microscope or a camera. Embodiment 12. The device of embodiment 10 or 1 1, wherein the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
Embodiment 13. The device of embodiment 12, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
Embodiment 14. The device of embodiment 12 or 13, wherein the temperature is regulated with a phase change material.
Embodiment 15. The device of any one of embodiments 12-14, wherein the temperature in the sample chamber is different from the temperature in the conduit.
Embodiment 16. The device of any one of the previous embodiments, said device being operatively connected to a controller or computer.
Embodiment 17. The device of any one of the previous embodiments, further comprising a ruler along the length of the reaction-diffusion conduit.
Embodiment 18. The device of any one of the previous embodiments, further comprising a blend of reactants.
Embodiment 19. The device of embodiment 18, wherein the blend of reactants comprises a plurality of primers and enzymes.
Embodiment 20. The device of embodiment 19, having at least two nuclemeters, each containing different primers.
Embodiment 21. The device of embodiment 19, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
Embodiment 22. The device of any one of the previous embodiments, wherein the reaction diffusion conduit contains at least one polymer.
Embodiment 23. The device of any one of the previous embodiments, wherein the sample chamber contains at least one polymer.
Embodiment 24. The device of embodiment 23, wherein the at least one polymer is a gel.
Embodiment 25. The device of embodiment 24, wherein the primers, enzymes, or both are immobilized to the gel.
Embodiment 26. The device of any one of embodiments 23-25, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature. Embodiment 27. The device of any one of the previous embodiments, wherein the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
Embodiment 28. A nucleic acid amplification monitor comprising a substrate and, on or forming a part of the substrate, a plurality of nuclemeters, each nuclemeter comprising an sample chamber and at least one reaction-diffusion conduit in fluid communication with the chamber, each of the chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
Embodiment 29. The nucleic acid amplification monitor of embodiment 28, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction.
Embodiment 30. The nucleic acid amplification monitor of embodiment 28 or 29, wherein the sample chamber and the conduit are separated with a barrier.
Embodiment 31. The nucleic acid amplification monitor of embodiment 30, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any combination thereof.
Embodiment 32. The nucleic acid amplification monitor of any one of embodiments 28-31, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
Embodiment 33. The nucleic acid amplification monitor of any one of embodiments 28-32, having a plurality of sample chambers, each sample chamber having at least one reaction- diffusion conduit in fluid communication therewith.
Embodiment 34. The nucleic acid amplification monitor of embodiment 33, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
Embodiment 35. The nucleic acid amplification monitor of embodiment 34, at least one sample chamber having a known quantity of a preselected, target nucleic acid molecule.
Embodiment 36. The nucleic acid amplification monitor of any one of embodiments 28-35, the sample chamber having a porous membrane for nucleic acids extraction,
concentration, and purification.
Embodiment 37. The nucleic acid amplification monitor of any one of embodiments 28-36, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof. Embodiment 38. The nucleic acid amplification monitor of embodiment 37, wherein the optical imager is a fluorescent microscope or a camera.
Embodiment 39. The nucleic acid amplification monitor of embodiment 37 or 38, wherein the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
Embodiment 40. The nucleic acid amplification monitor of embodiment 39, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
Embodiment 41. The nucleic acid amplification monitor of embodiment 39 or 40, wherein the temperature is regulated with a phase change material.
Embodiment 42. The nucleic acid amplification monitor of any one of embodiments 39-41, wherein the temperature in the sample chamber is different from the temperature in the conduit.
Embodiment 43. The nucleic acid amplification monitor of any one of embodiments 28-42, said device being operatively connected to a controller or computer.
Embodiment 44. The nucleic acid amplification monitor of any one of embodiments 28-43, further comprising a ruler along the length of the reaction-diffusion conduit.
Embodiment 45. The nucleic acid amplification monitor of any one of embodiments 28-44, further comprising a blend of reactants.
Embodiment 46. The nucleic acid amplification monitor of embodiment 45, wherein the blend of reactants comprises a plurality of primers and enzymes.
Embodiment 47. The nucleic acid amplification monitor of embodiment 46, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
Embodiment 48. The nucleic acid amplification monitor of any one of embodiments 28-47, wherein the reaction diffusion conduit contains at least one polymer.
Embodiment 49. The nucleic acid amplification monitor of embodiment 48, wherein the at least one polymer is a gel.
Embodiment 50. The nucleic acid amplification monitor of embodiment 49, wherein the primers, enzymes, or both are immobilized to the gel. Embodiment 51. The nucleic acid amplification monitor of any one of embodiments 48-50, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
Embodiment 52. The nucleic acid amplification monitor of any one of embodiments 28-51, wherein the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
Embodiment 53. The nucleic acid amplification monitor of any one of embodiments 28-52, wherein the substrate is a polymeric chip.
Embodiment 54. The nucleic acid amplification monitor of embodiment 53, wherein the polymeric chip comprises polymethyl methacrylate (PMMA).
Embodiment 55. A method of quantifying nucleic acid amplification comprising amplifying a sample comprising a nucleic acid molecule in the device of any one of
embodiments 1-27, or the nucleic acid amplification monitor of any one of embodiments 28-54 to generate an amplified nucleic acid molecule and measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein reaction-diffusion length is proportional to the number of nucleic acid copies in the sample.
Embodiment 56. The method of embodiment 55, wherein amplifying the nucleic acid molecule comprises thermo-cycling or isothermal nucleic acid amplification.
Embodiment 57. The method of embodiment 55 or 56, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits.
Embodiment 58. The method of embodiment 55-57, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits to a control
Embodiment 59. The method of any one of embodiments 55-58, wherein the nucleic acid molecule is RNA.
Embodiment 60. The method of embodiment 59, further comprising, prior to the amplifying, reverse transcribing the RNA to generate cDNA.
Embodiment 61. A method of identifying an unknown nucleic acid molecule, comprising: amplifying a sample comprising an unknown nucleic acid molecule in the device of any one of embodiments 1-27, or the nucleic acid amplification monitor of any one of embodiments 28-54, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule; and measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample.
Embodiment 62. The method of embodiment 61, comprising determining the difference in length of reaction-diffusion from a nuclemeter having a sample having a known quantity of a nucleic acid and a nuclemeter having a sample having an unknown nucleic acid molecule, wherein the difference in the length of the reaction-diffusion between the known quantity of a nucleic acid molecule and the sample having an unknown nucleic acid molecule indicates a number of nucleic acid molecules in the sample having the unknown nucleic acid molecule.
Embodiment 63. A system for monitoring nucleic acid amplification comprising: a nuclemeter comprising a sample chamber, at least one reaction-diffusion conduit in fluid communication with the sample chamber, each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification; an optical imager; and a heat source.
Embodiment 64. The system of embodiment 63, further comprising a controller.
Embodiment 65. The system of any one of embodiments 63 or 64, further comprising an output device.
Embodiment 66. The system of embodiment 65, each of the optical imager, heat source and output device being operably controlled by the controller.

Claims

What is claimed:
1. A device for monitoring nucleic acid amplification comprising:
a nuclemeter comprising:
a sample chamber; and
at least one reaction-diffusion conduit in fluid communication with the sample chamber; each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
2. The device of claim 1, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction
3. The device of claim 1 or 2, wherein the sample chamber and the conduit are separated with a barrier.
4. The device of any one of the previous claims, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any combination thereof.
5. The device of any one of the previous claims, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
6. The device of any one of the previous claims, having a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid
communication therewith.
7. The device of claim 6, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
8. The device of claim 7, at least one sample chamber having a known quantity of a
preselected, target nucleic acid molecule.
9. The device of any one of the previous claims, the sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
10. The device of any one of the previous claims, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof.
1 1. The device of claim 10, wherein the optical imager is a fluorescent microscope or a camera.
12. The device of claim 10 or 11, wherein the heat source is a thermoelectric unit, an
electrical heater, an exothermic reactor, or a laser.
13. The device of claim 12, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
14. The device of claim 12 or 13, wherein the temperature is regulated with a phase change material.
15. The device of any one of claims 12-14, wherein the temperature in the sample chamber is different from the temperature in the conduit.
16. The device of any one of the previous claims, said device being operatively connected to a controller or computer.
17. The device of any one of the previous claims, further comprising a ruler along the length of the reaction-diffusion conduit.
18. The device of any one of the previous claims, further comprising a blend of reactants.
19. The device of claim 18, wherein the blend of reactants comprises a plurality of primers and enzymes.
20. The device of claim 19, having at least two nuclemeters, each containing different
primers.
21. The device of claim 19, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
22. The device of any one of the previous claims, wherein the reaction diffusion conduit contains at least one polymer.
23. The device of any one of the previous claims, wherein the sample chamber contains at least one polymer.
24. The device of claim 23, wherein the at least one polymer is a gel.
25. The device of claim 24, wherein the primers, enzymes, or both are immobilized to the gel.
26. The device of any one of claims 23-25, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
27. The device of any one of the previous claims, wherein the sample chamber, reaction- diffusion conduit, or both are suitable for reverse transcription.
28. A nucleic acid amplification monitor comprising:
a substrate and, on or forming a part of the substrate, a plurality of nuclemeters, each nuclemeter comprising:
an sample chamber; and
at least one reaction-diffusion conduit in fluid communication with the chamber; each of the chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification.
29. The nucleic acid amplification monitor of claim 28, wherein the sample chamber has a size and shape suitable for containing a nucleic acid amplification reaction.
30. The nucleic acid amplification monitor of claim 28 or 29, wherein the sample chamber and the conduit are separated with a barrier.
31. The nucleic acid amplification monitor of claim 30, wherein the barrier is removable, is comprised of a material that degrades, dissolves, or melts, is movable, or any
combination thereof.
32. The nucleic acid amplification monitor of any one of claims 28-31, having a plurality of reaction-diffusion conduits in fluid communication with the sample chamber.
33. The nucleic acid amplification monitor of any one of claims 28-32, having a plurality of sample chambers, each sample chamber having at least one reaction-diffusion conduit in fluid communication therewith.
34. The nucleic acid amplification monitor of claim 33, wherein at least some of the sample chambers have a plurality of reaction-diffusion conduits in fluid communication therewith.
35. The nucleic acid amplification monitor of claim 34, at least one sample chamber having a known quantity of a preselected, target nucleic acid molecule.
36. The nucleic acid amplification monitor of any one of claims 28-35, the sample chamber having a porous membrane for nucleic acids extraction, concentration, and purification.
37. The nucleic acid amplification monitor of any one of claims 28-36, further comprising a waste conduit, a light source, an optical imager, a heat source, or any combination thereof.
38. The nucleic acid amplification monitor of claim 37, wherein the optical imager is a
fluorescent microscope or a camera.
39. The nucleic acid amplification monitor of claim 37 or 38, wherein the heat source is a thermoelectric unit, an electrical heater, an exothermic reactor, or a laser.
40. The nucleic acid amplification monitor of claim 39, wherein the heat source provides a spatially varying temperature distribution along the length of the reaction-diffusion conduit.
41. The nucleic acid amplification monitor of claim 39 or 40, wherein the temperature is regulated with a phase change material.
42. The nucleic acid amplification monitor of any one of claims 39-41, wherein the
temperature in the sample chamber is different from the temperature in the conduit.
43. The nucleic acid amplification monitor of any one of claims 28-42, said device being operatively connected to a controller or computer.
44. The nucleic acid amplification monitor of any one of claims 28-43, further comprising a ruler along the length of the reaction-diffusion conduit.
45. The nucleic acid amplification monitor of any one of claims 28-44, further comprising a blend of reactants.
46. The nucleic acid amplification monitor of claim 45, wherein the blend of reactants comprises a plurality of primers and enzymes.
47. The nucleic acid amplification monitor of claim 46, wherein the nuclemeter has multiple reaction-diffusion conduits, at least two of said reaction-diffusion conduits containing different primers.
48. The nucleic acid amplification monitor of any one of claims 28-47, wherein the reaction diffusion conduit contains at least one polymer.
49. The nucleic acid amplification monitor of claim 48, wherein the at least one polymer is a gel.
50. The nucleic acid amplification monitor of claim 49, wherein the primers, enzymes, or both are immobilized to the gel.
51. The nucleic acid amplification monitor of any one of claims 48-50, wherein the polymer is a solid at an ambient temperature and a liquid at an amplification temperature.
52. The nucleic acid amplification monitor of any one of claims 28-51, wherein the sample chamber, reaction-diffusion conduit, or both are suitable for reverse transcription.
53. The nucleic acid amplification monitor of any one of claims 28-52, wherein the substrate is a polymeric chip.
54. The nucleic acid amplification monitor of claim 53, wherein the polymeric chip
comprises polymethyl methacrylate (PMMA).
55. A method of quantifying nucleic acid amplification comprising:
amplifying a sample comprising a nucleic acid molecule in the device of any one of claims 1-27, or the nucleic acid amplification monitor of any one of claims 28-54 to generate an amplified nucleic acid molecule; and
measuring a reaction-diffusion length of said amplified nucleic acid molecule through the one or more conduits, wherein the reaction-diffusion length is proportional to the number of nucleic acid copies in the sample.
56. The method of claim 55, wherein amplifying the nucleic acid molecule comprises
thermo-cycling or isothermal nucleic acid amplification.
57. The method of claim 55 or 56, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits.
58. The method of claim 55-57, further comprising comparing the reaction-diffusion length of the one or more reaction-diffusion conduits to a control.
59. The method of any one of claims 55-58, wherein the nucleic acid molecule is RNA.
60. The method of any one of claims 59, further comprising, prior to the amplifying, reverse transcribing the RNA to generate cDNA.
61. A method of identifying an unknown nucleic acid molecule, comprising: amplifying a sample comprising an unknown nucleic acid molecule in the device of any one of claims 1-27, or the nucleic acid amplification monitor of any one of claims 28-54, wherein each of the at least one conduits contain a plurality of primers specific for a different known nucleic acid molecule; and
measuring a reaction-diffusion length within the reaction-diffusion conduit, wherein the presence of the reaction-diffusion length indicates that the sample having an unknown nucleic acid molecule comprises the known nucleic acid molecule to which the primers in the at least one conduit are specific and the extent of the reaction-diffusion length within the conduit indicates the number of the unknown nucleic acid molecules in the sample.
62. The method of claim 61, comprising:
determining the difference in length of reaction-diffusion from a nuclemeter having a sample having a known quantity of a nucleic acid and a nuclemeter having a sample having an unknown nucleic acid molecule, wherein the difference in the length of the reaction-diffusion between the known quantity of a nucleic acid molecule and the sample having an unknown nucleic acid molecule indicates a number of nucleic acid molecules in the sample having the unknown nucleic acid molecule.
63. A system for monitoring nucleic acid amplification comprising
a nuclemeter comprising:
a sample chamber;
at least one reaction-diffusion conduit in fluid communication with the sample chamber; each of the sample chamber and the conduit being capable of holding a blend of reactants for nucleic acid amplification;
an optical imager; and
a heat source.
64. The system of claim 63, further comprising a controller.
65. The system of any one of claims 63 or 64, further comprising an output device.
66. The system of claim 65, each of the optical imager, heat source and output device being operably controlled by the controller.
PCT/US2015/038739 2014-07-02 2015-07-01 Devices and methods for monitoring and quantifying nucleic acid amplification Ceased WO2016004155A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/323,193 US12186757B2 (en) 2014-07-02 2015-07-01 Devices and methods for monitoring and quantifying nucleic acid amplification

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201462020135P 2014-07-02 2014-07-02
US62/020,135 2014-07-02
US201462020484P 2014-07-03 2014-07-03
US62/020,484 2014-07-03

Publications (1)

Publication Number Publication Date
WO2016004155A1 true WO2016004155A1 (en) 2016-01-07

Family

ID=55019953

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/038739 Ceased WO2016004155A1 (en) 2014-07-02 2015-07-01 Devices and methods for monitoring and quantifying nucleic acid amplification

Country Status (2)

Country Link
US (1) US12186757B2 (en)
WO (1) WO2016004155A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102197410B1 (en) * 2020-04-24 2020-12-31 유니젠바이오 주식회사 Monitoring system for nucleic acid amplification reaction

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11976269B2 (en) * 2019-03-18 2024-05-07 Cellular Research, Inc. Precise delivery of components into fluids
MX2022014719A (en) * 2020-07-01 2023-03-06 Illumina Inc Nucleic acid capture, concentration, and purification.
NL2026080B1 (en) * 2020-07-01 2022-03-11 Illumina Inc Nucleic acid capture, concentration, and purification
US20240226896A1 (en) * 2023-01-06 2024-07-11 Jincheng Wang Disposable portable lamp detection magnetic box and its constant temperature heating device

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080280285A1 (en) * 2005-05-11 2008-11-13 Chen Zongyuan G Systems and Methods For Testing using Microfluidic Chips

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040110167A1 (en) 1995-07-13 2004-06-10 Gerdes John C. Lateral flow system for nucleic acid detection
KR100247232B1 (en) 1997-05-17 2000-04-01 윤종용 A valve for controlling fluid capacity
WO2001066688A1 (en) 2000-03-08 2001-09-13 Imagene Technology, Inc. Lateral flow pcr with amplicon concentration and detection
US9409166B2 (en) 2007-12-10 2016-08-09 The Trustees Of The University Of Pennsylvania Integrated PCR reactor for cell lysis, nucleic acid isolation and purification, and nucleic acid amplication related applications
US8697007B2 (en) 2008-08-06 2014-04-15 The Trustees Of The University Of Pennsylvania Biodetection cassette with automated actuator
US9476102B2 (en) * 2011-02-25 2016-10-25 The Trustees Of The University Of Pennsylvania Isothermal nucleic acid amplification reactor with integrated solid state membrane
US9233368B2 (en) 2011-05-23 2016-01-12 The Trustees Of The University Of Pennsylvania Moisture-activated self-heating analysis device
WO2013163353A1 (en) * 2012-04-24 2013-10-31 Arizona Board Of Regents, Acting For And On Behalf Of Northern Arizona University Rapid multiplex lateral flow assay device
WO2015054546A1 (en) * 2013-10-10 2015-04-16 Song Diagnostic Research Llc. Improved lateral flow assays
US10472620B2 (en) * 2014-07-01 2019-11-12 General Electric Company Method, substrate and device for separating nucleic acids

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080280285A1 (en) * 2005-05-11 2008-11-13 Chen Zongyuan G Systems and Methods For Testing using Microfluidic Chips

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BAROUD, CN ET AL., REACTION-DIFFUSION DYNAMICS: CONFRONTATION BETWEEN THEORY AND EXPERIMENT IN A MICROFLUIDIC REACTOR., 7 July 2003 (2003-07-07), pages 5 pages ., XP080088947 *
CHEN, D ET AL.: "An integrated, self-contained microfluidic cassette for isolation, amplification, and detection of nucleic acids.", BIOMED MICRODEVICES, vol. 12, no. 4, August 2010 (2010-08-01), pages 705 - 719, XP019814145 *
ZHANG, C ET AL.: "Survey And Summary: Miniaturized PCR Chips For Nucleic Acid Amplification And Analysis: Latest Advances And Future Trends.", NUCLEIC ACIDS RESEARCH, vol. 35, no. 13, 2007, pages 4223 - 4237, XP008133567 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102197410B1 (en) * 2020-04-24 2020-12-31 유니젠바이오 주식회사 Monitoring system for nucleic acid amplification reaction

Also Published As

Publication number Publication date
US20170128947A1 (en) 2017-05-11
US12186757B2 (en) 2025-01-07

Similar Documents

Publication Publication Date Title
JP7709505B2 (en) Methods and systems for nucleic acid analysis and quantification - Patents.com
ES3057190T3 (en) Diagnostic test system and method
CN106660042B (en) microfluidic device
US20220186325A1 (en) Systems for sample analysis
Zai et al. A sample-to-answer, quantitative real-time PCR system with low-cost, gravity-driven microfluidic cartridge for rapid detection of SARS-CoV-2, influenza A/B, and human papillomavirus 16/18
CN109563462B (en) Fully integrated handheld device for detection of specific nucleic acid sequences
JP5232145B2 (en) System and method for real-time PCR
US12186757B2 (en) Devices and methods for monitoring and quantifying nucleic acid amplification
US20140295441A1 (en) Cartridge interface module
JP7577293B2 (en) Apparatus and method for rapid sample processing and analysis - Patents.com
CN101679932A (en) Digital microfluidics based apparatus for heat-exchanging chemical processes
BRPI0814582B1 (en) method, and use of the total viral load in an untreated whole blood sample
Saunders et al. Rapid, quantitative, reverse transcription PCR in a polymer microfluidicchip
Liu et al. Nuclemeter: A reaction-diffusion based method for quantifying nucleic acids undergoing enzymatic amplification
JP7308800B2 (en) Smartphone PCR device
Jiang et al. UbiNAAT: a multiplexed point-of-care nucleic acid diagnostic platform for rapid at-home pathogen detection
Pan et al. Portable loop-mediated isothermal amplification device with spectrometric detection for rapid pathogen identification
US20170023555A1 (en) Devices and kits for measuring biological results
JP2010139491A (en) Method for measuring temperature of reaction liquid, apparatus for measuring temperature of reaction liquid, apparatus for adjusting temperature of reaction liquid, and apparatus for bringing genes into amplification reaction
Nafian et al. Emerging microfluidic technologies for CRISPR-based diagnostics: an overview
JP2020513762A (en) Method for detecting genetic material in a biological sample and apparatus for the implementation thereof
WO2025022690A1 (en) Nucleic acid amplification method and nucleic acid amplification reaction system
JP7766708B2 (en) PCR testing chip and PCR testing device including the same
US20240052433A1 (en) Device and assay for diagnosing tuberculosis and associated antibiotic resistances
Jiang et al. Heat-actuated valve implementation in a point-of-care, paper-based microfluidic device for infectious disease detection

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15816014

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15323193

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15816014

Country of ref document: EP

Kind code of ref document: A1