WO2015200501A1 - Strain prioritization for natural product discovery by a high throughput real-time pcr method - Google Patents

Strain prioritization for natural product discovery by a high throughput real-time pcr method Download PDF

Info

Publication number
WO2015200501A1
WO2015200501A1 PCT/US2015/037455 US2015037455W WO2015200501A1 WO 2015200501 A1 WO2015200501 A1 WO 2015200501A1 US 2015037455 W US2015037455 W US 2015037455W WO 2015200501 A1 WO2015200501 A1 WO 2015200501A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
conserved
acid sequences
enediyne
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/037455
Other languages
French (fr)
Other versions
WO2015200501A9 (en
Inventor
Ben Shen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of WO2015200501A1 publication Critical patent/WO2015200501A1/en
Publication of WO2015200501A9 publication Critical patent/WO2015200501A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor

Definitions

  • Embodiments of the invention are directed to high-throughput methods for screening and identification of compounds.
  • some of the methods utilize high-throughput real-time PCR.
  • Natural products offer unmatched chemical and structural diversity compared to other small molecule libraries. Thus, natural products remain the best source of drugs and drug leads and serve as excellent small molecule probes to investigate biological processes (Newman, D.J. & Cragg, G.M., J. Nat. Prod. 75, 311- 335 (2012); Li, J.W.H. & Vederas, J.C., Science 325, 161-165 (2009)).
  • the recently discovered diterpenoids platensimycin (PTM) and platencin (PTN) represent two promising natural product drug leads that target fatty acid biosynthesis.
  • Embodiments of the invention are directed to drug discovery.
  • the methods comprise the steps of real-time PCR and targeting genes characteristic to the biosynthetic machinery of natural products with distinct scaffolds, in a high-throughput format.
  • Embodiments are also directed to identification and screening for non-natural or synthetic products.
  • Figure 1A is a schematic representation showing the strategies for discovering natural product from microorganisms.
  • Figure 1A shows the "grind and find” approach of traditional natural product discovery relying on bioassays or chemotypes.
  • Figure IB shows the post-genomics approach of natural product discovery featuring a high-throughput real-time PCR method for strain prioritization, genome sequencing, and genome mining of the high priority hit strains.
  • Figures 2A- 2D show an embodiment of strain prioritization for natural product discovery by a high-throughput real-time PCR method, showcasing the identification of platensimycin, platencin, viguiepinol and oxaloterpin, and other diterpenoid producers by targeting selected diterpene synthases from the actinomycete collection.
  • Figure 2A is a schematic representation showing the pathways for the biosynthesis of bacterial diterpenoid, highlighting the four diterpene synthases and the tailoring enzymes leading to platensimycin (PTM), platencin (PTN), viguiepinol and oxaloterpin, and other known diterpenoids in bacteria.
  • Figure 2B is a schematic representation showing the genetic organization of the PTM-PTN dual biosynthetic gene cluster in Streptomyces platensis MA7327 and the PTN biosynthetic gene cluster in S. platensis MA7339, and primer design targeting the genes encoding the four diterpene synthases ent-atiserene synthase (Tl), ent-copalyl diphosphate synthase (T2), ent-kaurene synthase (T3), and geranylgeranyl diphosphate synthase (T4).
  • Black arrows depicting the relative locations of the primers with the predicted sizes for each of the products indicated.
  • FIG. 2C shows a high-throughput real-time PCR method targeting (i) T4, (ii) T2, (iii) Tl, and (iv) T3 and melting curve analysis of the resultant products to identify putative diterpenoid producers from a collection of 1 ,911 strains.
  • Solid lines with open circles representing the positive controls with a normalized melting temperature (T m ). Solid lines representing hits found during the melting step of the real-time PCR experiment with T m range at T m ⁇ 0.8 °C. Dashed lines representing the negative controls with no template DNA.
  • FIG. 2D shows a Euler diagram depicting the 488 putative diterpenoid producers identified from the 1,91 1 strains by targeting T4, among which nine, six, and six were co-identified by targeting T2, Tl, and T3, respectively, and confirmed by DNA sequencing.
  • Figures 3A-3C show that the new platensimycin and platencin dual- producers are distinct from S. platensis MA7327, showing superior genetic amenability.
  • Figure 3A is a scan of a photograph showing the morphology of the six new platensimycin and platencin dual-producers of Streptomyces platensis CB00739, CB00765, CB00775, CB00789, CB02289, and CB02304 in comparison with S. platensis MA7327 and MA7339 on an ISP4 agar plate.
  • Figure 3B is a phylogenetic tree generated from the alignment of concatenated partial sequences of the four housekeeping genes 16S rRNA, recA, rpoB, and trpB (2975 bp total) using the Tamura-Nei evolutionary distance method and the neighbor-joining algorithm. Bootstrap values >70% (based on 100 resampled trials) are given at nodes. Bar, 0.02 substitutions per nucleotide position.
  • Figure 3C is a scan of a photograph showing the morphology of the three new platensimycin and platencin overproduces SB 12026, SB 12027, and SB 12028 in comparison with SB 12001 and SB 12002 derived from S.
  • Figures 4A to 4D show the Tl, T2, T3, and T4 sequence analysis for primer design.
  • Figure 4A SEQ ID NOS: 39-46) Tl,
  • Figure 4B SEQ ID NOS: 47-66
  • Figure 4C SEQ ID NOS: 67, 68
  • Figure 4D SEQ ID NOS: 69-92
  • Tl , T2, and T4 amino acid sequences were aligned using Clustal 210 and conserved sequences were highlighted using Boxshade. Consensus sequences highlighted in black were chosen for primer design, which was based on the associated nucleotide sequences.
  • Figures 5A to 5D show the sequence comparisons of Tl, T2, T3, and T4 PCR hit fragments.
  • Figure 5A SEQ ID NOS: 93-103) T4,
  • Figure 5B SEQ ID NOS: 104-1 13
  • Figure 5C SEQ ID NOS 1 14-120
  • Figure 5D SEQ ID NOS: 121-127
  • the percent identities of hit sequences was between 97-98, 63-98, 96-97, and 38-98, respectively.
  • Figure 6 is a schematic representation showing the genetic organization of the PTM-PTN biosynthetic gene clusters in S. platensis MA7327, S. platensis CB00739, and S. platensis CB00765.
  • the PTM-PTN clusters in S. platensis CB00739 (KJ189771) and S. platensis CB00765 (KJ 189772) share 99% identity in nucleotide sequence, and their nucleotide sequences are 97% identical to S. platensis MA7327 (FJ655920).
  • Figures 7 A to 7C show results from the production of platensimycin ( ⁇ ) and platencin ( ⁇ ) by Streptomyces platensis spp.
  • Figure 7A Structures of platensimycin (PTM) and platencin (PTN),
  • Figure 7B HPLC chromatograms of crude extracts prepared from: left column, original and new PTM-PTN-producing Streptomyces platensis spp.; and right column, previously reported and new ptmRl deletion mutants.
  • the y-axes are kept constant between the two panels for visualization of the significant increase in titers.
  • Figures 8A, 8B show the results from the inactivation of ptmRl in three new PTM-PTN producers affording S. platensis SB12026, SB12027, and SB12028.
  • Figure 8A Schematic representation of the deletion of S. platensis ptmRl by insertion of an apramycin resistance-oriT cassette (aac(3)IV + oriT),
  • Figure 8B PCR verification of wild-type and double crossover mutant genotypes, using the primers ptmRidF and ptmRidR.
  • Figures 9A-9J show results from the studies demonstrating the feasibility of the experiments.
  • Figure 9A Alignment of the 11 known enediyne biosynthetic loci, highlighting (i) the enediyne PKS gene cassettes common to all enediynes (shown in red) (note two different clusters, CYA and CYN, for the cyanosporasides and the nomenclature difference for 9- and 10-membered enediyne PKS gene cassettes), (ii) a subset of genes specific for 9-membered enediynes (shown in green), and (iii) pathway regulators (shown in blue).
  • FIG. 9B Design of PCR primers for enediyne PKS gene cassette taking into consideration of E5/E/E10 all clustered together or E5 or E10 separated from E.
  • Figure 9C Representative melting curve analysis in real-time PCR in a 384-well plate format, as exemplified by using the E/E5 primers, with each of the peaks indicating a specific PCR product.
  • Figure 9D Confirmation of PCR products, identified on the basis of melting curve analysis, by gel electrophoresis.
  • Figure 9E A unified model for enediyne core biosynthesis, featuring (i) enediyne PKS and TE common to both 9- and 10-membered enediynes, (ii) production of heptaene by PKS and TE in the absence of associated enzymes (path a), and (iii) functional interactions between PKS-TE and 9- or 10-membered specific associated enzymes differentiating 9- (path b) or 10- membered (path c) core biosynthesis.
  • FIG. 9F Detection of heptaene ( ⁇ ) by HPLC analysis from wild-type enediyne producers and selected ApksE mutant (i.e., AsgcE) strains, supporting heptaene as a phenotypic indicator for enediyne production.
  • Figure 9G HPLC analysis of heptaene ( ⁇ ) production from selected new enediyne producers and their ApksE mutants ( Figure 10) under the conditions examined.
  • Figure 10 is a schematic representation showing genome sequencing of 20 of the 89 hits in comparison with 1 1 enediyne gene clusters whose enediyne structures are known, confirmed that 19 are distinct to all enediyne clusters known to date, hence encoding novel enediyne natural products, and one, CB02366, is identical to the C-1027 cluster and has been confirmed as a new C-1027 producer.
  • Figure 1 1 shows an embodiment of a high throughput method to survey enediyne biosynthetic machinery in an Actinomycetale collection and prioritize the most promising producers for new enediyne natural product discovery, isolation, structural elucidation, production, and evaluation of the resultant new enediynes as novel anticancer ADC payload leads.
  • the new enediyne gene cluster or enediyne structures shown are hypothetical.
  • Embodiments of the invention may be practiced without the theoretical aspects presented. Moreover, the theoretical aspects are presented with the understanding that Applicants do not seek to be bound by the theory presented.
  • genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, for example, for the genes disclosed herein, are intended to encompass homologous and/or orthologous genes and gene products from other organisms.
  • the practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art.
  • Such conventional techniques include polymer array synthesis, hybridization, ligation, phage display, and detection of hybridization using a label.
  • Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used.
  • Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols.
  • the terms “comprising,” “comprise” or “comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope/definition of the defined item, composition, apparatus, method, process, system, etc.
  • the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude within 5-fold, and also preferably within 2-fold, of a value.
  • nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non- translated sequences (e.g., as in cDNA).
  • the information by which a protein is encoded is specified by the use of codons.
  • amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
  • isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs, and refers to nucleic acid sequences in which one or more introns have been removed.
  • cDNA complementary DNA
  • cDNA complementary DNA
  • cDNA also can contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule.
  • cDNA can be synthesized in the laboratory by reverse transcription from RNA.
  • the term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences.
  • polynucleotide sequence may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, "allelic,” “splice,” “species,” or “polymorphic” variants.
  • a splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing.
  • the corresponding polypeptide may possess additional functional domains or an absence of domains.
  • Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the invention are variants of wild type gene products. Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
  • a "target nucleic acid molecule” is a nucleic acid molecule whose detection, amplification, quantitation, qualitative detection, or a combination thereof, is intended.
  • the nucleic acid molecule need not be in a purified form.
  • Various other nucleic acid molecules can also be present with the target nucleic acid molecule.
  • the target nucleic acid molecule can be a specific nucleic acid molecule (which can include RNA such as viral RNA), the amplification of which is intended.
  • Purification or isolation of the target nucleic acid molecule, if needed, can be conducted by methods known to those in the art, such as by using a commercially available purification kit or the like.
  • a target nucleic acid region or segment is a segment of gDNA which comprises conserved nucleic acid sequences.
  • Targeting an oligonucleotide to a particular nucleic acid molecule can be a multistep process. The process usually begins with the identification of a target nucleic acid sequence. This target nucleic acid may be, for example, a gene associated with biosynthetic machineries (or mRNA transcribed from the gene). The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid as described in detail in the examples section which follows.
  • region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. “Segments” are defined as smaller or sub-portions of regions within a target nucleic acid. “Sites,” as used in the present invention, are defined as positions within a target nucleic acid.
  • amplification refers to increase in the number of copies of a nucleic acid molecule.
  • the resulting amplification products are called "amplicons.”
  • Amplification of a nucleic acid molecule refers to use of a technique that increases the number of copies of a nucleic acid molecule in a sample.
  • An example of amplification is the polymerase chain reaction (PCR), in which a sample is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample.
  • PCR polymerase chain reaction
  • the primers are extended under suitable conditions, dissociated from the template, re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. This cycle can be repeated.
  • the product of amplification can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing.
  • Other examples of in vitro amplification techniques include quantitative real-time PCR; reverse transcriptase PCR; real-time reverse transcriptase PCR (rt RT-PCR); nested PCR; strand displacement amplification (see U.S. Pat. No.
  • transcription-free isothermal amplification see U.S. Pat. No. 6,033,881 , repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Pat. No. 5,427,930); coupled ligase detection and PCR (see U.S. Pat. No. 6,027,889); and NASBATM RNA transcription-free amplification (see U.S. Pat. No. 6,025,134) amongst others.
  • the term "complementary" refers to two complementary strands of base pairs of a double-stranded DNA or RNA. Complementary binding occurs when the base of one nucleic acid molecule forms a hydrogen bond to the base of another nucleic acid molecule.
  • the base adenine (A) is complementary to thymidine (T) and uracil (U), while cytosine (C) is complementary to guanine (G).
  • T thymidine
  • U uracil
  • C cytosine
  • G guanine
  • the sequence 5'-ATCG-3' of one ssDNA molecule can bond to 3'-TAGC-5' of another ssDNA to form a dsDNA.
  • nucleic acid molecules can be complementary to each other even without complete hydrogen-bonding of all bases of each molecule.
  • hybridization with a complementary nucleic acid sequence can occur under conditions of differing stringency in which a complement will bind at some but not all nucleotide positions.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences.
  • the temperature of hybridization and the ionic strength (such as the Na + concentration) of the hybridization buffer will determine the stringency of hybridization.
  • the stringency conditions can be varied depending on the sequence identity desired for detection. For example, the very high stringency can detect sequences that share at least 90% identity; high stringency detects stringency can detect sequences that share at least 80% identity; low stringency can detect sequences that share at least 50% identity.
  • primers are short nucleic acid molecules, such as a DNA oligonucleotide, for example sequences of at least 5 nucleotides, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
  • a primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule wherein the sequence of the primer is specific for the target nucleic acid molecule, for example so that the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions. The specificity of a primer increases with its length.
  • a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides.
  • probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides.
  • Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art.
  • An "upstream” or “forward” primer is a primer 5' to a reference point on a nucleic acid sequence.
  • a “downstream” or “reverse” primer is a primer 3' to a reference point on a nucleic acid sequence.
  • at least one forward and one reverse primer are included in an amplification reaction.
  • PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as PRIMER® (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.).
  • a primer includes a label.
  • determining means determining if an element is present or not. These terms include both quantitative and/or qualitative determinations. Assessing may be relative or absolute. “Assessing the presence of includes determining the amount of something present, as well as determining whether it is present or absent.
  • assay used herein, whether in the singular or plural shall not be misconstrued or limited as being directed to only one assay with specific steps but shall also include, without limitation any further steps, materials, various iterations, alternatives etc., that can also be used. Thus, if the term “assay” is used in the singular, it is merely for illustrative purposes.
  • a “label” or a “detectable label” is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • useful labels include radio labeled molecules fluorophores, luminescent compounds, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins which can be made detectable, e.g., by incorporating a label into the peptide.
  • HTS high-throughput screening
  • technologies and disciplines for example, optics, chemistry, biology or image analysis to permit rapid, highly parallel biological research and drug discovery.
  • HTS methods are known in the art and they are generally performed in multiwell plates with automated liquid handling and detection equipment; however it is envisioned that the methods of the invention may be practiced on a microarray or in a microfiuidic system.
  • embodiments of the invention are directed to, inter alia, high throughput screening assays for identifying and prioritizing organisms which produce a potential agent having utility as a diagnostic, a therapeutic agent, research tool, etc.
  • the organisms which are targeted can produce a natural product, and/or one which has been transformed with a plasmid and encodes any number of agents. Once the organisms producing certain products are identified these organisms can be classed as a priority strain in which further studies can be conducted and products isolated and produced for further development.
  • the studies herein provide for a strain prioritization method(s) for natural product discovery, details of which are discussed in the examples section which follows.
  • Central to the method is the application of real-time PCR, targeting genes characteristic to the biosynthetic machinery of natural products with distinct scaffolds in a high-throughput format.
  • the practicality and effectiveness of the method were showcased by prioritizing 1911 actinomycete strains for diterpenoid discovery.
  • a total of 488 potential diterpenoid producers were identified, among which six were confirmed as platensimycin and platencin dual producers and one as a viguiepinol and oxaloterpin producer.
  • a method of high throughput screening for identifying compounds encoded by an organism comprises isolating genomic DNA (gDNA) from the organism; incubating the gDNA with a detectable label; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (T m ) of the amplified conserved nucleic acid sequences; and, comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding a compound by an organism.
  • Probes or primers can be used for targeting the regions comprising conserved nucleic acid sequences.
  • the probes or primers can be labeled with a detectable label.
  • a method of high throughput screening for identifying organisms encoding a compound comprises isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (T m ) of the amplified conserved nucleic acid sequences; and, comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001°C to about 5°C deviation from the control; thereby identifying a organisms encoding a compound.
  • Probes or primers can be used for targeting the regions comprising conserved nucleic acid sequences.
  • the probes or primers can be labeled with a detectable label.
  • the gDNA is labeled with a detectable label.
  • a method of high throughput screening for prioritizing organisms encoding compounds comprising isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (T m ) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby prioritizing organisms encoding compounds.
  • the gDNA is labeled with a detectable label.
  • the melting curve analysis is described in detail in the "Examples" section which follows.
  • the melting curve analysis may generally comprise the following steps: after nucleic acid amplification, a probe bound to a target sequence dissociates from the target sequence and results in changes of fluorescence intensity as the temperature increases; obtaining a melting curve by plotting the rate of fluorescence intensity change (as y axis) as a function of changing temperature (x axis); by detecting during this process, in real-time, the changes of fluorescence intensity with the change of the temperature, variations of the target sequences may be detected using this melting curve.
  • the melting curve mentioned above may also be obtained in a manner of decreasing the temperature, namely from high temperature to low temperature, to detect fluorescence changes.
  • a target nucleic acid sequence comprises conserved regions.
  • a conserved region is when two or more nucleic acid sequences (or amino acid sequences) have a high sequence identity or similarity. One can arbitrarily set the percent sequence identity as a parameter when identifying target sequences, for example, a 90% sequence identity between two or more nucleic acid sequences.
  • the conserved regions can be particular to one species or across species, e.g. homologs, paralogs, orthologs.
  • Target nucleic acid sequences can be identified by any known method including databases.
  • sequence identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981 ; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci.
  • NCBI National Center for Biological Information
  • blastp blastn
  • blastx blastx
  • tblastn tblastx
  • Additional information can be found at the NCBI web site. Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences.
  • 75.1 1 , 75.12, 75.13, and 75.14 are rounded down to 75.1
  • 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2.
  • the length value will always be an integer.
  • the target nucleic acid sequences are conserved nucleic acid sequences encoding for one or more biosynthetic molecules.
  • the agents can be any type of molecule produced by an organism.
  • the organism can be transformed with a vector encoding one or more compounds.
  • the organism comprises one or more mutants, e.g. the organism can be subjected to one or more mutagens.
  • the organism is cultured under varying conditions and culture media so that the organism produces compounds produced only under certain conditions, e.g. acidic, low oxygen, etc.
  • the organisms are contacted with regulators which suppress or enhance the transcription of one molecule over another.
  • a mammalian cell is used as the "organism.”
  • the conserved nucleic acid sequences encoding for the biosynthetic molecules are spliced into an expression vector.
  • the expression vector encoding the biosynthetic molecule is transfected into an appropriate host cell to express the biosynthetic molecule.
  • the nucleic acid sequences are mutated or are synthetic, the synthetic nucleic acid sequences comprising one or more segments of sequences having at least about 50% sequence identity to an isolated nucleic acid sequence encoding for an identified product.
  • the organisms may be cultured under varying culture conditions and culture media.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E.
  • coli plasmids col El, pCRl , pBR322, pMal-C2, ET, pGEX (Smith et al., Gene 67:31 -40, 1988), pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof, vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • phage DNAs e.g., the numerous derivatives of phage 1, e.g., NM
  • Yeast expression systems can also be used according to the invention to express the biosynthetic moelcules.
  • the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl, GstXI, EcoRI, BstXI, BamHl , Sad, Kpnl, and Hindlll cloning sites; Invitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXI, EcoRI, BamHl, Sad, Kpnl, and Hindlll cloning sites, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention.
  • a yeast two-hybrid expression system can be prepared in accordance with the invention.
  • RT-PCR real time polymerase chain reaction
  • real time PCR is a method for detecting and measuring products generated during each cycle of a PCR, which are proportionate to the amount of template nucleic acid prior to the start of PCR. The information obtained, such as an amplification curve, melting temperatures can be used to determine the presence of a target nucleic acid and/or quantitate the initial amounts of a target nucleic acid sequence.
  • real time PCR is real time reverse transcriptase PCR (rt RT-PCR).
  • the real time PCR is a multiplex real time PCR targeting multiple genes in a sample. Details of the RT-PCR are provided in the "Examples" section which follows.
  • the primers for targeting a particular conserved nucleic acid sequence optionally comprise one or more modifications.
  • the primers may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos.
  • modified primers include those comprising modified backbones, for example, phosphorothioates, phosphotri esters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
  • oligonucleotides with phosphorothioate backbones and those with heteroatom backbones include without limitation: CH 2 -NH-0 ⁇ CH 2 , CH, -N(CH 3 )-0-CH 2 [known as a methylene(methylimino) or MMI backbone], CH 2 -0-N(CH 3 )-CH 2 , CH 2 -N(CH 3 )-N (CH 3 )-CH 2 and O— N(CH 3 )-CH 2 -CH 2 backbones, wherein the native phosphodiester backbone is represented as 0--P— 0--CH,).
  • a primer comprises morpholino backbone structures (Summerton and Weller, U.S. Pat. No. 5,034,506).
  • PNA peptide nucleic acid
  • the phosphodiester backbone of the nucleic acid sequence is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. (1991) Science 254, 1497).
  • Nucleic acid sequences may also comprise one or more substituted sugar moieties.
  • the primers may also include, additionally or alternatively, nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobase often referred to in the art simply as “base”
  • “unmodified” or “natural” nucleotides include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
  • Modified nucleotides include nucleotides found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleotides, e.g., 2- aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2- thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and
  • the nucleic acid sequences, gDNA, primers, probes etc. comprise a detectable label.
  • the detectable label allows for the detection and melting temperature analysis of the amplified products.
  • the detectable label comprises: nucleic acid intercalating dyes, fluorophores, radio labeled molecules, fluorescent agents, molecular beacons, chemiluminescent agents, luminescent agents, electron-dense reagents, enzymes, biotin, digoxigenin, haptens or peptides.
  • a method of high throughput screening for prioritizing bacterial strains producing diterpenoids comprises isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions comprising conserved nucleic acid sequences; determining melting temperatures (T m ) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding a diterpenoid by a bacterial strain.
  • gDNA genomic DNA
  • T m melting temperatures
  • the bacterial strain is an Actinomycetale strain.
  • the conserved nucleic acid sequences encode for one or more diterpene synthase molecules.
  • the conserved diterpene synthase sequences are targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved diterpene synthase sequences.
  • the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 1-127.
  • the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 1-31.
  • a compound is identified by any of the methods embodied herein.
  • a pharmaceutical composition comprises a compound identified by the methods embodied herein.
  • an oligonucleotide comprises the nucleic acid sequences set forth as SEQ ID NOS: 1-127, mutants, variants or complementary sequences thereof. In other embodiments, an oligonucleotide comprises a nucleic acid sequence having at least about 50% sequence identity to one or more oligonucleotides set forth as SEQ ID NOS: 1-127 or complementary sequences thereof.
  • a method of high throughput screening for prioritizing bacterial strains producing enediynes comprises; isolating genomic DNA (gDNA) from the organism; targeting and amplifying regions in the gDNA comprising conserved nucleic acid sequences; determining melting temperatures (T m ) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding an enediyne by a bacterial strain.
  • the gDNA is labeled with a detectable label.
  • the conserved nucleic acid sequences encode for one or more enediyne molecules.
  • a conserved nucleic acid sequence comprises polyketide synthase (PKS) nucleic acid sequences, mutants or variants thereof.
  • PKS polyketide synthase
  • a conserved enediyne nucleic acid producer sequence is targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved enediyne nucleic acid producer sequences.
  • the primers comprise a detectable label.
  • the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 33-38 or 1-127.
  • Example 1 Strain Prioritization for Natural Product Discovery by A High-Throughput Real-Time PCR Method - Discovery of Ditepenoids in General and Platensimycin and Platencin in Particular
  • platensis strains CB00739, CB00765, CB00775, CB00789, CB02289 and CB02304 respectively: ptmTl, KJ46931 1- J469316; ptmT2, KJ469317-KJ469322; ptmT3, KJ469323- KJ469328; ptmT4, KJ469329-KJ469334; and ptmRl, KJ469335-KJ469340.
  • the PTM- PTN gene clusters for S. platensis CB00739 and CB00765 were deposited as KJ189771 and KJ 189772, respectively.
  • gDNA samples were diluted to several dilution factors in 10 mM Tris-HCl, pH 8.0.
  • SYBR Green I dye (Sigma- Aldrich) was added to each dilution of DNA, mixed, and incubated at room temperature for 10 min in the dark. Fluorescence levels were measured using a SpectraMax M5 Multi-Mode Microplate Reader (Molecular Devices) with excitation and emission wavelengths of 450 and 520 nm, respectively.
  • samples were arrayed in 384-well masterblock deep-well plates as working stocks. gDNA samples were transferred (from working stocks) to microplates using Biomek FX workstation (Beckman Coulter).
  • Real-time PCR Real-time PCR was performed with an Applied Biol
  • Biosystems 7900HT Fast Real-Time PCR system Primer design was based on the ptmT3 sequence and the conserved sequences of ptmTl, ptmT2, and ptmT4 homologues ( Figure 4A to 4D).
  • Genomic DNA (1-100 ng), 0.1 ⁇ of each primer (10 ⁇ stock), 0.5 ⁇ of DMSO, 0.5 of 10X SYBR Green I dye, 5 ⁇ , of Taq 2X Master Mix, and water were mixed to give a reaction volume of 10 ⁇ . per well.
  • a "no template" negative control and one positive control with the genomic DNA of S. platensis MA7327 were included in each 384-well plate.
  • the reaction conditions consisted of a background check at 50 °C for 2 min; initial denaturation at 95 °C for 7 min; 37-40 cycles of denaturation at 95 °C for 30 s, primer annealing at 64-68 °C for 15 s, extension at 68 °C for 30-60 s, and melting at 95 °C for 15 s with a ramp rate of 2% from 68 °C to 95 °C.
  • T4 amplification three additional cycles of denaturation at 95 °C for 30 s, temperature ramping to 30 °C, and extension at 68 °C for 30 s were included after the initial denaturation step mentioned above.
  • the melting step subjected amplicons to a range of temperatures for determining melting temperatures (T m ).
  • T m melting temperatures
  • Each T m was normalized to a theoretical T m calculated using the nearest neighbor model (Kibbe W.A. et al, Nucleic Acids Res. 35 (suppl 2), W43-W46 (2007); Breslauer K.J. et al, Proc. Natl. Acad. Sci. USA 83, 3746-3750 (1986); Sugimoto N. et al, Nucleic Acids Res. 24, 4501-4505 (1996)).
  • the sequence of the target gene was used assuming an initial DNA amount of 100 ng and salt concentration of 50 mM.
  • platensis CB00739 and CB00765 was obtained using the Ion 316TM chips and the Ion PGMTM Sequencing 300 kit (Life Technologies) following the manufacturer's instructions. Fragment libraries (-300 bp inserts) and matepair libraries ( ⁇ 5 kb inserts) were sequenced. For S. platensis CB00739, a final sequence assembly of 5,955,880 reads was completed using GS De Novo Assembler (454 Life Sciences), including 3,018,552 reads from fragment ends and 2,937,328 reads from matepair ends, resulting in a 9,441 ,068 bp- draft genome consisting of 23 scaffolds. For S.
  • PTM and PTN were produced from Streptomyces spp. following previously published procedures (Smanski M.J. et al, Proc. Natl. Acad. Sci. USA 108, 13498-13503 (201 1); Smanski M.J. et al, Antimicrob. Agents Chemother. 53, 1299-1304 (2009); Yu Z. et al, Org. Lett. 12, 1744-1747 (2010)). Briefly, Streptomyces spp.
  • spores were inoculated into seed medium, incubated for 48 h, and 2 mL of seed culture were used to inoculate 50 mL of PTM medium (REF) supplemented with 10 mL L "1 trace elements and 1.5 g of Amberlite XAD-16 resin (Sigma-Aldrich). After incubation for 7 days at 28 °C and 250 rpm, the resin was harvested by centrifugation, washed three times with water, and extracted with actone (3 x 10 mL). Acetone was removed under reduced pressure and the resulting oil was resuspended in 1.5 mL of methanol. HPLC and LC-MS analysis.
  • HPLC was carried out on a Varian Liquid Chromatography System consisting of Varian ProStar 210 pumps and a ProStar 330 photodiode array detector equipped with an Apollo C 18 column.
  • HPLC analysis of PTM and PTN was performed using a 20 min solvent gradient (1 mL min "1 ) from 15% acetonitrile in H 2 0 containing 0.1% formic acid to 90% acetonitrile in 3 ⁇ 40 containing 0.1% formic acid. The peak area at 240 nm was used to quantify PTM and PTN production.
  • Liquid chromatography-mass spectrometry was carried out on an Agilent 1260 Infinity LC coupled to a 6230 TOF equipped with an Agilent Extend Cig column (50 mm x 2.1 mm, 1.8 ⁇ ). Liquid chromatography was performed using a 17 min solvent gradient (0.4 mL min "1 ) from 10% acetonitrile (CH 3 CN) in H 2 0 containing 0.1 % formic acid to 100% acetonitrile in H 2 0 containing 0.1% formic acid, and PTM and PTN were eluted with retention times of 7.4 and 9.7 min, respectively.
  • LCMS Liquid chromatography-mass spectrometry
  • fluorescence levels which correspond to the amount of accumulating products, are generated by fluorophores that intercalate double-stranded (ds) DNA or by fluorophore-conjugated oligonucleotides that prime to DNA targets.
  • SYBR Green I was chosen as the DNA intercalating fluorophore as it enabled us to apply melting curve analysis of the PCR products. Melting curve analysis reveals the apparent melting temperature (T m ) of the PCR products, a value dependent on product length, base composition, and nucleotide mismatch (Wetmur, J.G., Crit. Rev. Biochem. Mol. Biol. 26, 227-259 (1991)).
  • T m apparent melting temperature
  • diterpene synthase genes were targeted to search for diterpenoid producers in general and PTM and PTN producers in particular from the actinomycete strain collection at The Scripps Research Institute.
  • Diterpenoids of bacterial origin are underrepresented among known natural products (Smanski, M.J., Peterson, R.M., Huang, S.-X. & Shen, B. Curr. Opinion Chem. Biol. 16, 132-141 (2012)). All diterpenoids are derived from the common precursor geranylgeranyl diphosphate (GGDP).
  • Diterpene synthases catalyze the critical steps in diterpenoid biosynthesis by morphing geranylgeranyl diphosphate into one of the many diterpenoid scaffolds, further transformations of which by pathway-specific tailoring enzymes afford the vast structural diversity known for diterpenoid natural products (Figure 2A).
  • geranylgeranyl diphosphate synthase (PtmT4/PtnT4) is common for all bacterial diterpenoids, erci-copalyl diphosphate synthase (PtmT2/PtnT2) is shared by both PTM and PTN, but eni-kaurene synthase (PtmT3) or e «/-atiserene synthase (PtmTl/PtnTl) is specific for PTM or PTN, respectively ( Figure 2A).
  • Tl or T3 should specifically narrow the search to producers of erci-atiserene-derived or e «t-kaurene-derived diterpenoids, such as PTM or PTN, while targeting T2 or T4 could broaden the search to include producers that biosynthesize other e «/-copalyl diphosphate-derived or all geranylgeranyl diphosphate-derived diterpenoids, respectively ( Figure 2A).
  • the primers, targeting the genes that encode Tl , T2, T3 and T4 were designed based on the conserved nucleotide sequences of ptmTl/ptnTl, ptmT2lptnT2, ptmT3, and ptmT/ptnT4 within the PTM and PTN gene clusters, as well as known homologues of actinomycete origin, and one of each primers for Tl and T3 was selected based on the atypical amino acid motifs (DXXXD; SEQ ID NO: 32) found in bacterial type I diterpene synthases (Smanski, M.J. et al., Curr. Opinion Chem. Biol.
  • the specificity cutoff for each of the targeted PCR products was arbitrarily set at T m ⁇ 0.8°C, where T m is the melting temperature of the positive control, to identify putative hits.
  • T m is the melting temperature of the positive control.
  • the deviation from T m is inversely proportional to PCR product specificity, and smaller deviations were preferred to minimize false positives.
  • the hit strains were next subjected to polyphasic taxonomy studies. Phylogenetic analysis based on four selected housekeeping genes (16S rRNA, recA, rpoB, and trpB) (Table 2) assigned all six hits as Streptomyce platensis species (Figure 3A). Close examination of the six hit strains, in comparison with S. platensis MA7327 and MA7339, however, revealed that the new strains were distinct as judged by the morphology and appearance of pigmented spores ( Figure 3B). Two of the hit strains, CB00739 and CB00765, were selected and subjected to genome sequencing, confirming that these strains contained complete PTM-PTN gene clusters.
  • the PTM-PTN dual biosynthetic gene clusters from CB00739 and CB00765 have the same number of open reading frames and same genetic organization as the one from S. platensis MA7327, and the overall nucleotide sequence identities among the three clusters are >97% (Figure 6).
  • the six hits produce and three of their engineered strains overproduce PTM and PTN.
  • the six hit strains were first subjected to fermentation optimization for PTM and PTN production and confirmation.
  • S. platensis MA7327 and MA7339 (Smanski, M.J. et al., Proc. Natl. Acad. Sci. USA 108, 13498-13503 (2011); Smanski, M.J. et al., Antimicrob. Agents Chemother. 53, 1299-1304 (2009); Yu, Z. et al, Org. Lett.
  • SB 12026, SB 12027, and SB 12028 indeed overproduced PTM and PTN up to 310-fold, consistent with what has been observed for the S. platensis MA7327 and MA7339 strains (Table 1 and Figures 4A-4C). Gratifyingly, SB12026, SB12027, and SB12028 sporulate well ( Figure 3C), opening up the opportunity to further manipulate PTM and PTN biosynthesis in these overproduces for pathway characterization and structural diversity.
  • T m range used in this study was 0.8 C, and this range allowed for the identification of hits with 97-98%, 63-98%, 96-97%, and 38-98% identity to ptmTl, ptmT2, ptmT3, and ptmT4, respectively ( Figures 5A-5D).
  • the range of T m can be exploited to address the needs of each experiment, and a larger range of T m would increase the likelihood of finding diverse hits.
  • 16SrRNA_rev ACGGCTACCTTGTTACGACTT (SEQ ID NO: 10) Phylogenetic Analysis recAfor TAATACGACTCACTATAGGGCCGCRCTCGCACARATTG Phylogenetic Analysis
  • E. coli DH5a E. coli host for cloning Life Technolo
  • Figure 1 1 depicts the overall research design and methods to mine genomes of the Actinomycetale collection for new enediyne natural products.
  • Central to the approach are: (i) the recognition of Actinomycetales as the most prolific enediyne producers, (ii) the development of a genome survey method to rapidly identify the most promising enediyne producers from our Actinomycetale collection, and (iii) the combination of genomics, bioinformatics, metabolic pathway engineering, medium and fermentation optimization, and metabolomics to activate enediyne biosynthesis in the new producers, thereby production, isolation, and structural characterization, of the novel enediynes.
  • Microbial cultures are typically grown in 250- mL flasks (containing 50 mL culture) in a shaker for analytical scale production and could be scaled up in fermentors (10 L in a 14-L vessel or 30 L in a 40-L vessel) for preparation scale. It was found that metabolite profiles are readily amenable to HPLC and LC-MS analyses by a metabolomics approach, in particular if knockout mutant strains for the targeted natural products are available as negative controls.
  • the inventor has an inventory of >40 different fermentation media, collected from both pharmaceutical industry and academic labs all over the world, to support natural product production in Actinomycetales. As summarized in Figure 9G and Figure 10, by fermenting the hits in five different media, the production of heptaene has been realized, and by association the novel enediyne natural products, for 15 of the 66 new producers examined, as exemplified by the discovery and confirmation of CB02366 as a new C-1027 producer.
  • the inventor has extensive experience in the application of all four methods and has developed genetic systems for more than 30 antibiotic-producing Streptomyces species over the years, as exemplified by the engineered production of novel C-1027 analogues in S. globisporus and generation of the AucmE mutant in S. sp. for fermentation optimization and UCM detection by a metabolomics approach (Figure 9J), as well as development of genetic systems for the 69 new enediyne producers and generation of the ApksE mutants for nine of them in preliminary studies (Figure 9G and Figure 10).
  • Streptomyces ensures that the expedient recombinant DNA technologies and genetic tools in Streptomyces can be readily adopted, (iii) Complementary to manipulating natural product biosynthetic gene clusters in their native producers, expression of biosynthetic gene clusters in heterologous hosts for natural product production has emerged as an attractive alternative.
  • the inventor has extensive experience and has made several important contributions to heterologous expression of complex natural product biosynthetic pathways in selected model Streptomyces hosts, producing some of the most complex natural products known to the field, including fredericamycin, iso-migrastatin, platensimycin and platencin, and bleomycin.
  • the new enediyne natural products can be isolated by common chromatographic techniques, and their structures determined by standard spectroscopic methods, such as MS, ID and 2D ⁇ and 13 C NMR (COSY, TOCSY, HMQC, and HMBC).
  • Real-time PCR were carried out, in a 384-well plate format, with either the E/E5 pair ((5'- CCCCGCVCACATCACSGSCCTCGCSGTGAACATGCT-3' (SEQ ID NO: 33)/5'- GCAGGCKCCGTCSACSGTGTABCCGCCGCC-3' (SEQ ID NO: 34)) or E10/E pair ((5'-TGYGYSCCSSACSSSVSGSTGCTGCC-3' (SEQ ID NO: 35)/5'- ACGTTGCCGACSAGRTTSGTYTCCTCGAACCGAC-3' (SEQ ID NO: 36)) of primers.
  • E/E5 pair ((5'- CCCCGCVCACATCACSGSCCTCGCSGTGAACATGCT-3' (SEQ ID NO: 33)/5'- GCAGGCKCCGTCSACSGTGTABCCGCCGCC-3' (SEQ ID NO: 34))
  • E10/E pair ((5'-TGYGYSCCSSACSSSVSGSTGC
  • Genome sequencing to confirm the prioritized hits as new enediyne producers The most unique 20 hits, selected on the basis of the above two criteria, have been subjected to genome sequencing.
  • the mate-pair library protocols (with 5-6 kb inserts) have been optimized which greatly facilitated de novo genome assembly.
  • Genome sequencing of the selected 20 hits has been completed, affording draft genomes, consisting on average 15-30 scaffolds that can be readily mined for natural product biosynthetic gene clusters ( Figure 10).
  • Various programs for automatic annotation of secondary metabolite biosynthetic gene clusters are known, each of which has different strengths and limitations.
  • Heptaene production has been proven to be a sensitive phenotypic indicator for enediyne biosynthesis, and its utility was demonstrated following functional expression of the enediyne biosynthesis gene clusters ( Figure 9F). Heptaene production was followed by HPLC analysis, to monitor the activation of enediyne biosynthetic gene clusters and optimization of enediyne production in both the native producers and their engineered recombinant variants ( Figure 9G).
  • Enediynes as anticancer drugs and payloads in ADCs are the most cytotoxic molecules in existence today, and their use as anticancer drugs has been demonstrated clinically. Although the natural enediynes have seen limited use as clinical drugs mainly because of substantial toxicity, various polymer- based delivery systems or ADCs have shown great clinical success or promise in anticancer therapy. Indeed, the poly(styrene-co-maleic acid)-conjugated NCS (SMANCS ® ) has been marketed since 1994 for use against hepatoma.
  • SMANCS ® poly(styrene-co-maleic acid)-conjugated NCS
  • ADCs have been successfully developed, including a CD33 mAB-CAL conjugate (i.e., MYLOTARG ® ) for acute myeloid leukemia (AML), a CD22 mAB-CAL conjugate (inotuzumab ozogamicin) for non-Hodgkin lymphoma, as well as, several mAB-C-1027 conjugates for hepatoma and mAB-UCM conjugates for selected tumors.
  • MYLOTARG ® a CD33 mAB-CAL conjugate for acute myeloid leukemia (AML)
  • CD22 mAB-CAL conjugate inotuzumab ozogamicin
  • non-Hodgkin lymphoma hepatoma
  • mAB-UCM conjugates for selected tumors.
  • ADCs provide the possibility of selectively ablating cancer cells by combining the specificity of a mAB for a target antigen with the delivery of a highly potent cytotoxic agent.
  • the ideal number of drug molecules per mAB for most current ADCs appears to be about four. Underconjugation can decrease potency of the resultant ADCs, whereas the conjugation of too many drugs per mAB can lead to decreased circulation half-life, reduced tolerability, and impaired antigen binding.
  • the preferred payload molecules therefore have to be highly cytotoxic (IC50S in the range of 1 nM to 10 pM) and ideally active in many tumor types.
  • the enediynes represent some of the most cytotoxic molecules in existence today (for example, the IC 50 s of CAL and C-1027 towards selected cancer cell lines are in the range of 10 pM to 10 "3 pM). While the enediynes are most known for their activity by DNA DSBs, ICL was discovered by the inventors, as an alternative mode of action for the enediyne family of anticancer agents and engineered C-1027 analogues capable of DNA DSBs, ICLs, or both (Kennedy, D.R. et al., Cancer Res. 2007, 67, 773- 781 ; Kennedy, D.R. et al, Proc. Natl. Acad. Sci.
  • Enediyne biosynthesis and engineering The enediyne natural products present an outstanding opportunity to (i) decipher the genetic and biochemical basis for the biosynthesis of complex natural products, (ii) explore ways to make novel analogues by manipulating genes governing their biosynthesis, and (iii) discover new enediyne natural products by mining microbial genomes for the trademark enediyne biosynthetic machineries. Significant progress has been made in enediyne biosynthesis and engineering in the last decade.
  • Highlights include: (i) cloning and characterization of the C-1027, NCS, MDP, KED, SPO, CYA and CYN biosynthetic gene clusters as examples of nine-membered enediyne natural products, (ii) cloning and characterization of the CAL, ESP (partial), and DY biosynthetic gene clusters as examples of 10-membered enediyne natural products, (iii) establishment of the polyketide origin for all enediynes and discovery of the enediyne PKS as an acyl carrier protein (ACP)-dependent, self- phosphopantetheinylating, iteratively acting, type I polyketide synthase (PKS) that produces a linear polyene to initiate both nine- and 10-membered enediyne core biosynthesis, (iv) characterization of numerous enzymes from the enediyne biosynthetic machineries that catalyze novel chemistries, (v
  • the so-called 'epigenetic'- related approaches include challenging the microorganisms through culture conditions, nutritional or environmental factors, external cues, and stress, as well as, exploiting interspecies crosstalk.
  • the genomics-based approaches include mining the genomes to predict metabolite structures, engineering the pathways by manipulating global and/or pathway-specific regulators, and expressing the cryptic pathways in selected heterologous hosts. While each of the various approaches has different strengths and weaknesses, they have been successful in yielding cryptic natural products but only on a case-by-case basis and are far from being of practical use for natural product discovery. Thus, in spite of the rapid advances in DNA sequencing technologies and bioinformatics, it is still unlikely to sequence all strains within a collection as a practical means to discover new natural products.
  • the CAL, DYN, and ESP (partial) clusters were cloned from M. echinospora, M. chersina, and A. verrucosospora, respectively, and genetic manipulations in Micromonospora and Actinomadura are known to be notoriously difficult.
  • the ESP cluster is incomplete, and the boundaries of both the CAL and DYN clusters have yet to be determined experimentally.
  • biosynthesis and engineering of C-1027, NCS, and UCM have been greatly facilitated by the expedient genetic systems in S. globisporus, S. carzinostaticus, and S. sp., respectively. Accordingly, Streptomyces in the Actinomycetale strain collection was selected, and this selection is vital to overcoming the current challenges of, and meeting future objectives for, enediyne discovery, biosynthesis, and engineering in their native producers.
  • Target metabolites can be produced by recombinant organisms that are amenable to large-scale fermentation, thus lowering production costs.
  • Application of combinatorial biosynthesis strategies to the biosynthetic machineries in the new enediyne producers from our Actinomycetale collection promises to enable the discovery of novel enediynes and production of novel enediyne analogues.
  • Actinomycetales as the most prolific enediyne producers.
  • a virtual survey of the entire GenBank was carried out, using each of the five genes within the enediyne cassette, alone or in combination, as queries, for genes encoding enediyne biosynthetic machineries.
  • griseus species on the basis of selected house- keeping genes (16S rRNA, recA, trpB, rpoB), but the original C-1027 producer is known as S. globisporus, although the two C-1027 clusters are highly homologous ( ⁇ 90%/ ⁇ 94% identity at DNA/amino acid sequences).
  • strains are prioritized, fermentation in multiple media and preparation of crude extracts allow chemical profiling of heptaene production, and bioassays for DNA damage activity (i.e., by BIA) can then be utilized to determine which strains readily produce enediynes or enediyne-like metabolites. Fractionation of promising crude extracts guided by the BIA allows a simple detection method for isolating novel enediynes. With the conserved enediyne PKS gene cassettes known, ApksE deletion mutants can be easily constructed to correlate putative gene clusters with the production of heptaene or DNA-damaging natural products.
  • Silent or cryptic gene clusters can be overcome by the genetic manipulation of positive or negative regulators found within the enediyne gene clusters or by extensive fermentation optimization.
  • the expedient technologies and tools of recombinant DNA work in Streptomyces species and related actinomycetes that have been developed in the past two decades will facilitate these efforts.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A high throughput method for identifying organisms which produce agents or classes of compounds. The method allows for the prioritizing or identifying those organisms having the most optimal success in producing the compound.

Description

STRAIN PRIORITIZATION FOR NATURAL PRODUCT DISCOVERY
BY A HIGH-THROUGHPUT REAL-TIME PCR METHOD
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
This invention was made with U.S. government support under grant numbers GM086184, AI079070, CA078747 awarded by the National Institutes of Health. The U.S. government may have certain rights in the invention.
FIELD OF THE INVENTION
Embodiments of the invention are directed to high-throughput methods for screening and identification of compounds. In particular embodiments, some of the methods utilize high-throughput real-time PCR.
BACKGROUND
Natural products offer unmatched chemical and structural diversity compared to other small molecule libraries. Thus, natural products remain the best source of drugs and drug leads and serve as excellent small molecule probes to investigate biological processes (Newman, D.J. & Cragg, G.M., J. Nat. Prod. 75, 311- 335 (2012); Li, J.W.H. & Vederas, J.C., Science 325, 161-165 (2009)). The recently discovered diterpenoids platensimycin (PTM) and platencin (PTN) represent two promising natural product drug leads that target fatty acid biosynthesis. PTM and PTN were discovered via the systematic screening of fermentation extracts from 83,000 strains, each of which was fermented in three different media (affording a total of -250,000 extracts) (Wang, J. et al, Nature 441, 358-361 (2006); Jayasuriya, H. et al, Angew. Chem., Int. Ed. 46, 4684-4688 (2007); Wang, J. et al, Proc. Natl Acad. Sci. USA 104, 7612-7616 (2007); Singh, S.B. et al, J. Am. Chem. Soc. 128, 1 1916-11920 (2006); Young, K. et al, Antimicrob. Agents Chemother. 50, 519-526 (2006); Genilloud, O. et al, J. nd. Microbiol Biotechnol. 38:375-389 (2011)). The discovery of PTM and PTN highlighted the exhaustiveness necessary for the successful isolation of novel natural products by the traditional methods.
While effective, traditional natural product discovery programs are not sustainable, demanding too much time, effort, and resources. As the sizes of microbial strain collections continue to grow, innovations in strain prioritization are clearly needed. Resources could then be devoted preferentially to the strains that hold the highest promise in producing novel natural products, thereby accelerating detection and isolation of the targeted natural products and cutting the time and cost associated with traditional natural product discovery programs. Rapid strain prioritization could fundamentally change how microbial natural products are discovered.
SUMMARY
Embodiments of the invention are directed to drug discovery. In some embodiments, the methods comprise the steps of real-time PCR and targeting genes characteristic to the biosynthetic machinery of natural products with distinct scaffolds, in a high-throughput format. Embodiments are also directed to identification and screening for non-natural or synthetic products.
Other aspects are described infra.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1A, IB is a schematic representation showing the strategies for discovering natural product from microorganisms. Figure 1A shows the "grind and find" approach of traditional natural product discovery relying on bioassays or chemotypes. Figure IB shows the post-genomics approach of natural product discovery featuring a high-throughput real-time PCR method for strain prioritization, genome sequencing, and genome mining of the high priority hit strains.
Figures 2A- 2D show an embodiment of strain prioritization for natural product discovery by a high-throughput real-time PCR method, showcasing the identification of platensimycin, platencin, viguiepinol and oxaloterpin, and other diterpenoid producers by targeting selected diterpene synthases from the actinomycete collection. Figure 2A is a schematic representation showing the pathways for the biosynthesis of bacterial diterpenoid, highlighting the four diterpene synthases and the tailoring enzymes leading to platensimycin (PTM), platencin (PTN), viguiepinol and oxaloterpin, and other known diterpenoids in bacteria. Figure 2B is a schematic representation showing the genetic organization of the PTM-PTN dual biosynthetic gene cluster in Streptomyces platensis MA7327 and the PTN biosynthetic gene cluster in S. platensis MA7339, and primer design targeting the genes encoding the four diterpene synthases ent-atiserene synthase (Tl), ent-copalyl diphosphate synthase (T2), ent-kaurene synthase (T3), and geranylgeranyl diphosphate synthase (T4). Black arrows depicting the relative locations of the primers with the predicted sizes for each of the products indicated. Figure 2C shows a high-throughput real-time PCR method targeting (i) T4, (ii) T2, (iii) Tl, and (iv) T3 and melting curve analysis of the resultant products to identify putative diterpenoid producers from a collection of 1 ,911 strains. Each panel depicting the melting curves with 6F/6T (y-axis) representing the rate of change in fluorescence as a function of temperature. Solid lines with open circles representing the positive controls with a normalized melting temperature (Tm). Solid lines representing hits found during the melting step of the real-time PCR experiment with Tm range at Tm ± 0.8 °C. Dashed lines representing the negative controls with no template DNA. Insets showing PCR products of the hits that were analyzed by agarose gel electrophoresis and confirmed by DNA sequencing. Only the melting curves for one of the five plates were shown for T4, which yielded 71 putative hits. For Tl , T2, and T3, the melting curves of the respective hits from all five plates were combined and depicted together. Figure 2D shows a Euler diagram depicting the 488 putative diterpenoid producers identified from the 1,91 1 strains by targeting T4, among which nine, six, and six were co-identified by targeting T2, Tl, and T3, respectively, and confirmed by DNA sequencing.
Figures 3A-3C show that the new platensimycin and platencin dual- producers are distinct from S. platensis MA7327, showing superior genetic amenability. Figure 3A is a scan of a photograph showing the morphology of the six new platensimycin and platencin dual-producers of Streptomyces platensis CB00739, CB00765, CB00775, CB00789, CB02289, and CB02304 in comparison with S. platensis MA7327 and MA7339 on an ISP4 agar plate. Figure 3B is a phylogenetic tree generated from the alignment of concatenated partial sequences of the four housekeeping genes 16S rRNA, recA, rpoB, and trpB (2975 bp total) using the Tamura-Nei evolutionary distance method and the neighbor-joining algorithm. Bootstrap values >70% (based on 100 resampled trials) are given at nodes. Bar, 0.02 substitutions per nucleotide position. Figure 3C is a scan of a photograph showing the morphology of the three new platensimycin and platencin overproduces SB 12026, SB 12027, and SB 12028 in comparison with SB 12001 and SB 12002 derived from S. platensis MA7327, and SB12600 derived from S. platensis MA7339 on an ISP4 agar plate. While SB12001 failed to sporulate and SB 12002 sporulated poorly under all conditions examined, SB 12026, SB 12027, and SB 12028 sporulated well on several media as exemplified with ISP4.
Figures 4A to 4D show the Tl, T2, T3, and T4 sequence analysis for primer design. (Figure 4A; SEQ ID NOS: 39-46) Tl, (Figure 4B; SEQ ID NOS: 47-66) T2, (Figure 4C; SEQ ID NOS: 67, 68) T3, and (Figure 4D; SEQ ID NOS: 69-92) T4. For Tl , T2, and T4, amino acid sequences were aligned using Clustal 210 and conserved sequences were highlighted using Boxshade. Consensus sequences highlighted in black were chosen for primer design, which was based on the associated nucleotide sequences. Accession codes of proteins used in the alignment: PtmTl (AC031274), PtnTl (ADD83014), Sko3988_Orf2 (BAD86797), Swtl .2 (AEV45183), Swt2.2 (AEW22921), PtmT2 (AC031276), PtnT2 (ADD83015), PtmT3 (AC031279), PtmT4 (AC031283), PtnT4 (ADD83016), Kgris Orfl (BAB07816), PlaT4 (ABB69754), Bra2 (BAG16276), and Sko3988_Orf4 (BAD86799).
Figures 5A to 5D show the sequence comparisons of Tl, T2, T3, and T4 PCR hit fragments. (Figure 5A; SEQ ID NOS: 93-103) T4, (Figure 5B; SEQ ID NOS: 104-1 13) T2, (Figure 5C; SEQ ID NOS 1 14-120) T3, and (Figure 5D; SEQ ID NOS: 121-127) Tl . Relative to ptmTl, ptmT2, ptmT3, and ptmT4 sequences, the percent identities of hit sequences was between 97-98, 63-98, 96-97, and 38-98, respectively.
Figure 6 is a schematic representation showing the genetic organization of the PTM-PTN biosynthetic gene clusters in S. platensis MA7327, S. platensis CB00739, and S. platensis CB00765. The PTM-PTN clusters in S. platensis CB00739 (KJ189771) and S. platensis CB00765 (KJ 189772) share 99% identity in nucleotide sequence, and their nucleotide sequences are 97% identical to S. platensis MA7327 (FJ655920).
Figures 7 A to 7C show results from the production of platensimycin (·) and platencin (♦) by Streptomyces platensis spp. (Figure 7A). Structures of platensimycin (PTM) and platencin (PTN), (Figure 7B) HPLC chromatograms of crude extracts prepared from: left column, original and new PTM-PTN-producing Streptomyces platensis spp.; and right column, previously reported and new ptmRl deletion mutants. The y-axes are kept constant between the two panels for visualization of the significant increase in titers. Crude extracts for SB12001, SB12002, SB12026, and SB12028 were diluted 4-fold for better representation of PTM and PT production, (Figure 7C) Extracted ion (m/z at 442.1863 for the [PTM + H]+ ion and m/z at 426.1914 for the [PTN + H]+ ion) chromatograms from LC-MS analyses of: left column, original and new PTM- PTN-producing Streptomyces platensis spp.; and right column, previously reported and new AptmRl deletion mutants.
Figures 8A, 8B show the results from the inactivation of ptmRl in three new PTM-PTN producers affording S. platensis SB12026, SB12027, and SB12028. (Figure 8A) Schematic representation of the deletion of S. platensis ptmRl by insertion of an apramycin resistance-oriT cassette (aac(3)IV + oriT), (Figure 8B) PCR verification of wild-type and double crossover mutant genotypes, using the primers ptmRidF and ptmRidR. Lane 1, 1 Kb Plus DNA ladder (Invitrogen); lane 2, S. platensis CB00739; lanes 3-4, two isolates of S. platensis SB12026; lane 5, S. platensis CB00775; lanes 6-7, S. platensis SB12028; lane 8, S. platensis CB00765; lanes 9-10, S. platensis SB12027.
Figures 9A-9J show results from the studies demonstrating the feasibility of the experiments. (Figure 9A) Alignment of the 11 known enediyne biosynthetic loci, highlighting (i) the enediyne PKS gene cassettes common to all enediynes (shown in red) (note two different clusters, CYA and CYN, for the cyanosporasides and the nomenclature difference for 9- and 10-membered enediyne PKS gene cassettes), (ii) a subset of genes specific for 9-membered enediynes (shown in green), and (iii) pathway regulators (shown in blue). (Figure 9B) Design of PCR primers for enediyne PKS gene cassette taking into consideration of E5/E/E10 all clustered together or E5 or E10 separated from E. (Figure 9C) Representative melting curve analysis in real-time PCR in a 384-well plate format, as exemplified by using the E/E5 primers, with each of the peaks indicating a specific PCR product. (Figure 9D) Confirmation of PCR products, identified on the basis of melting curve analysis, by gel electrophoresis. (Figure 9E) A unified model for enediyne core biosynthesis, featuring (i) enediyne PKS and TE common to both 9- and 10-membered enediynes, (ii) production of heptaene by PKS and TE in the absence of associated enzymes (path a), and (iii) functional interactions between PKS-TE and 9- or 10-membered specific associated enzymes differentiating 9- (path b) or 10- membered (path c) core biosynthesis. (Figure 9F) Detection of heptaene (·) by HPLC analysis from wild-type enediyne producers and selected ApksE mutant (i.e., AsgcE) strains, supporting heptaene as a phenotypic indicator for enediyne production. (Figure 9G) HPLC analysis of heptaene (·) production from selected new enediyne producers and their ApksE mutants (Figure 10) under the conditions examined. (Figure 9H) Correlation between heptaene production and functional expression of the enediyne PKS gene by RT-PCR transcriptional analysis of selected new enediyne producers (CB01580 produced heptaene, while CB02459 did not) with the C-1027 producer S. globisporus as a positive control. (Figure 91) Comparison of C-1027 (♦) and heptaene (·) titers by HPLC analysis between the wild-type and an engineered strain (SB1023), highlighting titer improvement by manipulating pathway regulation. (Figure 9J) Detection and isolation of UCM (0) by comparison of the metabolite profiles between the UCM producing S. sp. wild-type and the AucmE mutant strains, exemplifying a metabolomics approach for new enediyne discovery. The identity of compound 6 as UCM was confirmed by bioassay and MS analysis.
Figure 10 is a schematic representation showing genome sequencing of 20 of the 89 hits in comparison with 1 1 enediyne gene clusters whose enediyne structures are known, confirmed that 19 are distinct to all enediyne clusters known to date, hence encoding novel enediyne natural products, and one, CB02366, is identical to the C-1027 cluster and has been confirmed as a new C-1027 producer. While all clusters featured the conserved enediyne PKS cassettes, they are rich in other open reading frames that are unprecedented in gene clusters that encode production of the known enediynes, indicative of novel structural features/functional groups for these new enediynes, and in gene clusters that encode production of other natural products, promising the discovery of new chemistries and biosynthetic knowledge.
Figure 1 1 shows an embodiment of a high throughput method to survey enediyne biosynthetic machinery in an Actinomycetale collection and prioritize the most promising producers for new enediyne natural product discovery, isolation, structural elucidation, production, and evaluation of the resultant new enediynes as novel anticancer ADC payload leads. The new enediyne gene cluster or enediyne structures shown are hypothetical.
DETAILED DESCRIPTION
Several aspects of the invention are described below with reference to example applications for illustration. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. One having ordinary skill in the relevant art, however, will readily recognize that the invention can be practiced without one or more of the specific details or with other methods. The present invention is not limited by the illustrated ordering of acts or events, as some acts may occur in different orders and/or concurrently with other acts or events. Furthermore, not all illustrated acts or events are required to implement a methodology in accordance with the present invention.
Embodiments of the invention may be practiced without the theoretical aspects presented. Moreover, the theoretical aspects are presented with the understanding that Applicants do not seek to be bound by the theory presented.
All genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, for example, for the genes disclosed herein, are intended to encompass homologous and/or orthologous genes and gene products from other organisms.
The practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art. Such conventional techniques include polymer array synthesis, hybridization, ligation, phage display, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells: A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press), Stryer, L. (1995) Biochemistry (4th Ed.) Freeman, New York, Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London, Nelson and Cox (2000), Lehninger, Principles of Biochemistry 3 rd Ed., W. H. Freeman Pub., New York, N.Y. and Berg et al. (2002) Biochemistry, 5th Ed., W. H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entirety by reference for all purposes. Definitions
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including", "includes", "having", "has", "with", or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising."
As used herein, the terms "comprising," "comprise" or "comprised," and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate, equivalents thereof— and that other elements can be included and still fall within the scope/definition of the defined item, composition, apparatus, method, process, system, etc.
As used in this specification and the appended claims, the term "or" is generally employed in its sense including "and/or" unless the content clearly dictates otherwise.
The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude within 5-fold, and also preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed. By "encoding" or "encoded", "encodes", with respect to a specified nucleic acid, is meant comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid, or may lack such intervening non- translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code.
An "isolated nucleic acid" refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, e.g., the sequences adjacent to the fragment in a genome in which it naturally occurs, and refers to nucleic acid sequences in which one or more introns have been removed. The term applies to cDNA (complementary DNA) which is a piece of DNA lacking internal, non-coding segments (introns) and transcriptional regulatory sequences. cDNA also can contain untranslated regions (UTRs) that are responsible for translational control in the corresponding RNA molecule. cDNA can be synthesized in the laboratory by reverse transcription from RNA. The term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences. It also includes a recombinant DNA, for instance, DNA which is part of a hybrid gene encoding additional polypeptide sequences. The term "variant," when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, "allelic," "splice," "species," or "polymorphic" variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the invention are variants of wild type gene products. Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
As used herein, a "target nucleic acid molecule" is a nucleic acid molecule whose detection, amplification, quantitation, qualitative detection, or a combination thereof, is intended. The nucleic acid molecule need not be in a purified form. Various other nucleic acid molecules can also be present with the target nucleic acid molecule. For example, the target nucleic acid molecule can be a specific nucleic acid molecule (which can include RNA such as viral RNA), the amplification of which is intended. Purification or isolation of the target nucleic acid molecule, if needed, can be conducted by methods known to those in the art, such as by using a commercially available purification kit or the like. In embodiments, a target nucleic acid region or segment is a segment of gDNA which comprises conserved nucleic acid sequences. Targeting an oligonucleotide to a particular nucleic acid molecule, in the context of this invention, can be a multistep process. The process usually begins with the identification of a target nucleic acid sequence. This target nucleic acid may be, for example, a gene associated with biosynthetic machineries (or mRNA transcribed from the gene). The targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid as described in detail in the examples section which follows. Within the context of the present invention, the term "region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of target nucleic acids are segments. "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid. "Sites," as used in the present invention, are defined as positions within a target nucleic acid.
As used herein, "amplification" refers to increase in the number of copies of a nucleic acid molecule. The resulting amplification products are called "amplicons." Amplification of a nucleic acid molecule (such as a DNA or RNA molecule) refers to use of a technique that increases the number of copies of a nucleic acid molecule in a sample. An example of amplification is the polymerase chain reaction (PCR), in which a sample is contacted with a pair of oligonucleotide primers under conditions that allow for the hybridization of the primers to a nucleic acid template in the sample. The primers are extended under suitable conditions, dissociated from the template, re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. This cycle can be repeated. The product of amplification can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing. Other examples of in vitro amplification techniques include quantitative real-time PCR; reverse transcriptase PCR; real-time reverse transcriptase PCR (rt RT-PCR); nested PCR; strand displacement amplification (see U.S. Pat. No. 5,744,31 1); transcription-free isothermal amplification (see U.S. Pat. No. 6,033,881 , repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see EP-A-320 308); gap filling ligase chain reaction amplification (see U.S. Pat. No. 5,427,930); coupled ligase detection and PCR (see U.S. Pat. No. 6,027,889); and NASBA™ RNA transcription-free amplification (see U.S. Pat. No. 6,025,134) amongst others.
As used herein, the term "complementary" refers to two complementary strands of base pairs of a double-stranded DNA or RNA. Complementary binding occurs when the base of one nucleic acid molecule forms a hydrogen bond to the base of another nucleic acid molecule. Normally, the base adenine (A) is complementary to thymidine (T) and uracil (U), while cytosine (C) is complementary to guanine (G). For example, the sequence 5'-ATCG-3' of one ssDNA molecule can bond to 3'-TAGC-5' of another ssDNA to form a dsDNA. In this example, the sequence 5'-ATCG-3' is the reverse complement of 3'-TAGC-5\ Nucleic acid molecules can be complementary to each other even without complete hydrogen-bonding of all bases of each molecule. For example, hybridization with a complementary nucleic acid sequence can occur under conditions of differing stringency in which a complement will bind at some but not all nucleotide positions. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, N.Y. (chapters 9 and 11). The stringency conditions can be varied depending on the sequence identity desired for detection. For example, the very high stringency can detect sequences that share at least 90% identity; high stringency detects stringency can detect sequences that share at least 80% identity; low stringency can detect sequences that share at least 50% identity.
As used herein, "primers" are short nucleic acid molecules, such as a DNA oligonucleotide, for example sequences of at least 5 nucleotides, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. A primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule wherein the sequence of the primer is specific for the target nucleic acid molecule, for example so that the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions. The specificity of a primer increases with its length. Thus, for example, a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity than a corresponding primer of only 15 nucleotides. Thus, to obtain greater specificity, probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides.
Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art. An "upstream" or "forward" primer is a primer 5' to a reference point on a nucleic acid sequence. A "downstream" or "reverse" primer is a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as PRIMER® (Version 0.5, 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Methods for preparing and using primers are described in, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y.; Ausubel et al. (1987) Current Protocols in Molecular Biology, Greene Publ. Assoc. & Wiley- Intersciences. In one example, a primer includes a label.
The terms "determining", "measuring", "evaluating", "detecting", "assessing" and "assaying" are used interchangeably herein to refer to any form of measurement, and include determining if an element is present or not. These terms include both quantitative and/or qualitative determinations. Assessing may be relative or absolute. "Assessing the presence of includes determining the amount of something present, as well as determining whether it is present or absent.
The term "assay" used herein, whether in the singular or plural shall not be misconstrued or limited as being directed to only one assay with specific steps but shall also include, without limitation any further steps, materials, various iterations, alternatives etc., that can also be used. Thus, if the term "assay" is used in the singular, it is merely for illustrative purposes.
A "label" or a "detectable label" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. For example, useful labels include radio labeled molecules fluorophores, luminescent compounds, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins which can be made detectable, e.g., by incorporating a label into the peptide.
The term "high-throughput screening" or "HTS" refers to a method drawing on different technologies and disciplines, for example, optics, chemistry, biology or image analysis to permit rapid, highly parallel biological research and drug discovery. HTS methods are known in the art and they are generally performed in multiwell plates with automated liquid handling and detection equipment; however it is envisioned that the methods of the invention may be practiced on a microarray or in a microfiuidic system. Strain Prioritization
The connection between natural products and the genes encoding their biosynthesis has now been well recognized, and genes, as well as chemistry, are being increasingly exploited to categorize known natural products and discover new ones. Targeting biosynthetic genes using regular PCR methods has proven useful for natural product discovery; however, the lack of high-throughput capabilities has limited their utility in natural product discovery. Real-time PCR, an advancement in PCR technology, has not been fully utilized for natural product discovery efforts. In real-time PCR, each cycle of amplification can be directly monitored based on the detection of fluorescence, hence eliminating gel electrophoresis and staining for visualization as the necessary post- PCR analysis steps. Real-time PCR also offers improved sensitivity for target detection and melting curve analysis for target specificity.
Traditional natural product discovery programs are not sustainable, demanding too much time, effort, and resources.
Accordingly, embodiments of the invention are directed to, inter alia, high throughput screening assays for identifying and prioritizing organisms which produce a potential agent having utility as a diagnostic, a therapeutic agent, research tool, etc. The organisms which are targeted can produce a natural product, and/or one which has been transformed with a plasmid and encodes any number of agents. Once the organisms producing certain products are identified these organisms can be classed as a priority strain in which further studies can be conducted and products isolated and produced for further development.
Briefly, the studies herein provide for a strain prioritization method(s) for natural product discovery, details of which are discussed in the examples section which follows. Central to the method is the application of real-time PCR, targeting genes characteristic to the biosynthetic machinery of natural products with distinct scaffolds in a high-throughput format. The practicality and effectiveness of the method were showcased by prioritizing 1911 actinomycete strains for diterpenoid discovery. A total of 488 potential diterpenoid producers were identified, among which six were confirmed as platensimycin and platencin dual producers and one as a viguiepinol and oxaloterpin producer. While the method as described is most appropriate to prioritize strains for discovering specific natural products, variations of this method is applicable to the discovery of other classes of natural products. Applications of genome sequencing and genome mining to the high-priority strains would essentially eliminate the chance elements from traditional discovery programs and fundamentally change how natural products are discovered.
Accordingly, in some embodiments, a method of high throughput screening for identifying compounds encoded by an organism comprises isolating genomic DNA (gDNA) from the organism; incubating the gDNA with a detectable label; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences; and, comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding a compound by an organism. Probes or primers can be used for targeting the regions comprising conserved nucleic acid sequences. The probes or primers can be labeled with a detectable label.
In another embodiment, a method of high throughput screening for identifying organisms encoding a compound comprises isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences; and, comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001°C to about 5°C deviation from the control; thereby identifying a organisms encoding a compound. Probes or primers can be used for targeting the regions comprising conserved nucleic acid sequences. The probes or primers can be labeled with a detectable label. In other embodiments the gDNA is labeled with a detectable label. In another embodiment, a method of high throughput screening for prioritizing organisms encoding compounds comprising isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions or segments comprising conserved nucleic acid sequences; determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby prioritizing organisms encoding compounds. In some embodiments the gDNA is labeled with a detectable label.
The melting curve analysis is described in detail in the "Examples" section which follows. The melting curve analysis may generally comprise the following steps: after nucleic acid amplification, a probe bound to a target sequence dissociates from the target sequence and results in changes of fluorescence intensity as the temperature increases; obtaining a melting curve by plotting the rate of fluorescence intensity change (as y axis) as a function of changing temperature (x axis); by detecting during this process, in real-time, the changes of fluorescence intensity with the change of the temperature, variations of the target sequences may be detected using this melting curve. The melting curve mentioned above may also be obtained in a manner of decreasing the temperature, namely from high temperature to low temperature, to detect fluorescence changes. Melting curve analysis is then performed by processing the data obtained. In some embodiments, a target nucleic acid sequence comprises conserved regions. A conserved region is when two or more nucleic acid sequences (or amino acid sequences) have a high sequence identity or similarity. One can arbitrarily set the percent sequence identity as a parameter when identifying target sequences, for example, a 90% sequence identity between two or more nucleic acid sequences. The conserved regions can be particular to one species or across species, e.g. homologs, paralogs, orthologs. Target nucleic acid sequences can be identified by any known method including databases.
The sequence identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981 ; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al., Nuc. Acids Res. 16: 10881 -90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31 , 1994. Altschul et al, J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Blastn is used to compare nucleic acid sequences, while blastp is used to compare amino acid sequences. Additional information can be found at the NCBI web site. Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1 166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (1 166/1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.1 1 , 75.12, 75.13, and 75.14 are rounded down to 75.1 , while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer.
One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters.
Accordingly, in some embodiments, the target nucleic acid sequences are conserved nucleic acid sequences encoding for one or more biosynthetic molecules. However, it is to be understood, that the agents can be any type of molecule produced by an organism. For example, the organism can be transformed with a vector encoding one or more compounds. In other embodiments, the organism comprises one or more mutants, e.g. the organism can be subjected to one or more mutagens. In other embodiments, the organism is cultured under varying conditions and culture media so that the organism produces compounds produced only under certain conditions, e.g. acidic, low oxygen, etc. In some embodiments, the organisms are contacted with regulators which suppress or enhance the transcription of one molecule over another. In some embodiments, a mammalian cell is used as the "organism." In some embodiments, the conserved nucleic acid sequences encoding for the biosynthetic molecules are spliced into an expression vector. The expression vector encoding the biosynthetic molecule is transfected into an appropriate host cell to express the biosynthetic molecule. In some embodiments the nucleic acid sequences are mutated or are synthetic, the synthetic nucleic acid sequences comprising one or more segments of sequences having at least about 50% sequence identity to an isolated nucleic acid sequence encoding for an identified product. The organisms may be cultured under varying culture conditions and culture media.
A wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention. Useful expression vectors, for example, may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E. coli plasmids col El, pCRl , pBR322, pMal-C2, ET, pGEX (Smith et al., Gene 67:31 -40, 1988), pMB9 and their derivatives, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2μ plasmid or derivatives thereof, vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
Yeast expression systems can also be used according to the invention to express the biosynthetic moelcules. For example, the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl, GstXI, EcoRI, BstXI, BamHl , Sad, Kpnl, and Hindlll cloning sites; Invitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXI, EcoRI, BamHl, Sad, Kpnl, and Hindlll cloning sites, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen), to mention just two, can be employed according to the invention. A yeast two-hybrid expression system can be prepared in accordance with the invention.
In embodiments, once the target nucleic acid sequences have been identified, and the primers synthesized, these regions comprising the conserved nucleic acid sequences are amplified by real time polymerase chain reaction (RT-PCR). Realtime PCR is a method for detecting and measuring products generated during each cycle of a PCR, which are proportionate to the amount of template nucleic acid prior to the start of PCR. The information obtained, such as an amplification curve, melting temperatures can be used to determine the presence of a target nucleic acid and/or quantitate the initial amounts of a target nucleic acid sequence. In some examples, real time PCR is real time reverse transcriptase PCR (rt RT-PCR). In some embodiments, the real time PCR is a multiplex real time PCR targeting multiple genes in a sample. Details of the RT-PCR are provided in the "Examples" section which follows.
In some embodiments, the primers for targeting a particular conserved nucleic acid sequence optionally comprise one or more modifications. The primers may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,71 1 ; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
Specific examples of some modified primers include those comprising modified backbones, for example, phosphorothioates, phosphotri esters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Examples of oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, include without limitation: CH2-NH-0~CH2, CH, -N(CH3)-0-CH2 [known as a methylene(methylimino) or MMI backbone], CH2-0-N(CH3)-CH2, CH2-N(CH3)-N (CH3)-CH2 and O— N(CH3)-CH2-CH2 backbones, wherein the native phosphodiester backbone is represented as 0--P— 0--CH,). The amide backbones disclosed by De Mesmaeker et al. (1995) Acc. Chem. Res. 28:366-374 are also one example. In other embodiments, a primer comprises morpholino backbone structures (Summerton and Weller, U.S. Pat. No. 5,034,506). In other embodiments, such as the peptide nucleic acid (PNA) backbone, the phosphodiester backbone of the nucleic acid sequence is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen et al. (1991) Science 254, 1497). Nucleic acid sequences may also comprise one or more substituted sugar moieties.
The primers may also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleotides include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleotides include nucleotides found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleotides, e.g., 2- aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2- thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6-diaminopurine. (Kornberg, A., DNA Replication, W.H. Freeman & Co., San Francisco, 1980, pp 75-77; Gebeyehu, G., (1987) et al. Nucl. Acids Res. 15:4513). A "universal" base known in the art, e.g., inosine, may be included.
In embodiments, the nucleic acid sequences, gDNA, primers, probes etc., comprise a detectable label. The detectable label allows for the detection and melting temperature analysis of the amplified products. In some embodiments, the detectable label comprises: nucleic acid intercalating dyes, fluorophores, radio labeled molecules, fluorescent agents, molecular beacons, chemiluminescent agents, luminescent agents, electron-dense reagents, enzymes, biotin, digoxigenin, haptens or peptides.
In another embodiment, a method of high throughput screening for prioritizing bacterial strains producing diterpenoids comprises isolating genomic DNA (gDNA) from the organism; targeting and amplifying gDNA regions comprising conserved nucleic acid sequences; determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding a diterpenoid by a bacterial strain.
In some embodiments, the bacterial strain is an Actinomycetale strain.
In some embodiments, the conserved nucleic acid sequences encode for one or more diterpene synthase molecules. In some embodiments, the conserved diterpene synthase sequences are targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved diterpene synthase sequences. In other embodiments, the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 1-127. In other embodiments, the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 1-31.
In other embodiments, a compound is identified by any of the methods embodied herein. In some embodiments, a pharmaceutical composition comprises a compound identified by the methods embodied herein.
In embodiments, an oligonucleotide comprises the nucleic acid sequences set forth as SEQ ID NOS: 1-127, mutants, variants or complementary sequences thereof. In other embodiments, an oligonucleotide comprises a nucleic acid sequence having at least about 50% sequence identity to one or more oligonucleotides set forth as SEQ ID NOS: 1-127 or complementary sequences thereof.
In other embodiments, a method of high throughput screening for prioritizing bacterial strains producing enediynes comprises; isolating genomic DNA (gDNA) from the organism; targeting and amplifying regions in the gDNA comprising conserved nucleic acid sequences; determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences; comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding an enediyne by a bacterial strain. In some embodiments the gDNA is labeled with a detectable label.
In embodiments, the conserved nucleic acid sequences encode for one or more enediyne molecules.
In other embodiments, a conserved nucleic acid sequence comprises polyketide synthase (PKS) nucleic acid sequences, mutants or variants thereof. In other embodiments, a conserved enediyne nucleic acid producer sequence is targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved enediyne nucleic acid producer sequences. In some embodiments, the primers comprise a detectable label.
In other embodiments, the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 33-38 or 1-127.
The invention has been described in detail with reference to preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of this disclosure, may make modifications and improvements within the spirit and scope of the invention.
All documents mentioned herein are incorporated herein by reference. All publications and patent documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, Applicants do not admit any particular reference is "prior art" to their invention.
EXAMPLES
While various embodiments of the present invention have been described above, it should be understood that they have been presented by way of example only, and not limitation. The following non-limiting examples are illustrative of the invention.
Example 1: Strain Prioritization for Natural Product Discovery by A High-Throughput Real-Time PCR Method - Discovery of Ditepenoids in General and Platensimycin and Platencin in Particular
A high-throughput method is described for strain prioritization by realtime PCR to identify the most promising strains from a microbial strain collection for natural product discovery (Figure IB). Considering the tremendous effort spent in discovering the original PTM and PTN producers, Streptomyces platensis MA7327 and MA7339, respectively, as well as the limited genetic amenabilities of the two producers for metabolic pathway engineering, new PTM and PTN producers from a collection of 1,911 actinomycete strains were chosen for identification to demonstrate the utility and effectiveness of this method. Six new PTM and PTN producers were identified - (i) all six were confirmed to contain the targeted diterpene synthase genes and verified as true PTM and PTN producers, (ii) three of them were demonstrated to overproduce PTM and PTN upon inactivation of the pathway-specific negative regulator, and (iii) two of them were confirmed to harbor the complete PTM-PTN dual biosynthetic gene clusters. The six new PTM and PTN producers, all classified as Streptomyces platensis species on the basis of their housekeeping genes, show distinct morphology, differing from S. platensis MA7327 and MA7339, and three of them showed superior genetic amenability. While the method as described is most appropriate to prioritize strains for discovering specific natural products, variations of this method should be applicable to the discovery of other classes of products, natural or otherwise.
Materials and Methods
Accession codes: The following partial gene sequences were deposited to GenBank for the S. platensis strains MA7327, MA7339, CB00739, CB00765, CB00775, CB00789, CB02289 and CB02304, respectively: 16S rRNA, KJ469279-KJ469286; recA, KJ469287-KJ469294; rpoB, KJ469295-KJ469302; and trpB, KJ469303-KJ469310. The following complete gene sequences were deposited to GenBank for the S. platensis strains CB00739, CB00765, CB00775, CB00789, CB02289 and CB02304, respectively: ptmTl, KJ46931 1- J469316; ptmT2, KJ469317-KJ469322; ptmT3, KJ469323- KJ469328; ptmT4, KJ469329-KJ469334; and ptmRl, KJ469335-KJ469340. The PTM- PTN gene clusters for S. platensis CB00739 and CB00765 were deposited as KJ189771 and KJ 189772, respectively.
Preparation of genomic DNA library. The actinomycete collection at The Scripps Research Institute consists of strains isolated from various unexplored and underexplored ecological niches (Xie, P. et al., J. Nat. Prod. 11, 377-387 (2014)). The cultivation of actinomycete strains and genomic DNA (gDNA) preparation followed standard protocols (Kieser, T. et al, Practical Streptomyces Genetics (The John Innes Foundation, Norwich, UK, 2000)). The concentrations of genomic DNA samples were estimated using a microplate fluorescence assay with minor modifications (Leggate, J. et al, Biotechnol. Lett. 28, 1587-1594 (2006)). Briefly, gDNA samples were diluted to several dilution factors in 10 mM Tris-HCl, pH 8.0. SYBR Green I dye (Sigma- Aldrich) was added to each dilution of DNA, mixed, and incubated at room temperature for 10 min in the dark. Fluorescence levels were measured using a SpectraMax M5 Multi-Mode Microplate Reader (Molecular Devices) with excitation and emission wavelengths of 450 and 520 nm, respectively. After the normalization of gDNA concentration, samples were arrayed in 384-well masterblock deep-well plates as working stocks. gDNA samples were transferred (from working stocks) to microplates using Biomek FX workstation (Beckman Coulter). Real-time PCR. Real-time PCR was performed with an Applied
Biosystems 7900HT Fast Real-Time PCR system. Primer design was based on the ptmT3 sequence and the conserved sequences of ptmTl, ptmT2, and ptmT4 homologues (Figure 4A to 4D). Genomic DNA (1-100 ng), 0.1 μί of each primer (10 μΜ stock), 0.5 μΐ of DMSO, 0.5 of 10X SYBR Green I dye, 5 μΐ, of Taq 2X Master Mix, and water were mixed to give a reaction volume of 10 μΐ. per well. A "no template" negative control and one positive control with the genomic DNA of S. platensis MA7327 were included in each 384-well plate. The reaction conditions consisted of a background check at 50 °C for 2 min; initial denaturation at 95 °C for 7 min; 37-40 cycles of denaturation at 95 °C for 30 s, primer annealing at 64-68 °C for 15 s, extension at 68 °C for 30-60 s, and melting at 95 °C for 15 s with a ramp rate of 2% from 68 °C to 95 °C. For T4 amplification, three additional cycles of denaturation at 95 °C for 30 s, temperature ramping to 30 °C, and extension at 68 °C for 30 s were included after the initial denaturation step mentioned above. The melting step subjected amplicons to a range of temperatures for determining melting temperatures (Tm). Each Tm was normalized to a theoretical Tm calculated using the nearest neighbor model (Kibbe W.A. et al, Nucleic Acids Res. 35 (suppl 2), W43-W46 (2007); Breslauer K.J. et al, Proc. Natl. Acad. Sci. USA 83, 3746-3750 (1986); Sugimoto N. et al, Nucleic Acids Res. 24, 4501-4505 (1996)). For determining each theoretical Tm, the sequence of the target gene was used assuming an initial DNA amount of 100 ng and salt concentration of 50 mM. Samples with Tm ± 0.8 °C compared to the positive control were considered hits. To confirm hits, regular PCR was performed, and the resulting products were analyzed by 1% agarose gel electrophoresis, purified by gel extraction, and sequenced.
DNA sequencing. To amplify and sequence the Tl, T2, T3, T4 and Rl genes of six new PTM-PTN dual producers (CB00739, CB00765, CB00775, CB00789, CB02289, and CB02304), primers were designed (Table 2) according to the PTM-PTN dual biosynthetic gene cluster from S. platensis MA7327. The amplification and sequencing of four housekeeping gene (16S rRNA, recA, rpoB, trpB) regions was performed using primers listed in Table 2. The draft genome sequences of S. platensis CB00739 and CB00765 was obtained using the Ion 316™ chips and the Ion PGM™ Sequencing 300 kit (Life Technologies) following the manufacturer's instructions. Fragment libraries (-300 bp inserts) and matepair libraries (~5 kb inserts) were sequenced. For S. platensis CB00739, a final sequence assembly of 5,955,880 reads was completed using GS De Novo Assembler (454 Life Sciences), including 3,018,552 reads from fragment ends and 2,937,328 reads from matepair ends, resulting in a 9,441 ,068 bp- draft genome consisting of 23 scaffolds. For S. platensis CB00765, a final sequence assembly of 5,293,288 reads was completed, including 2,963,442 reads from fragment ends and 2,329,846 reads from matepair ends, resulting in a 9,404,443 bp-draft genome consisting of 20 scaffolds. Gaps found within the PTM-PTN gene clusters were manually filled by PCR. Putative protein-coding sequences were predicted using Glimmer 3.02 (Salzberg S.L. et al., Nucleic Acids Res. 26, 544-548 (1998); Delcher A.L. et al, Nucleic Acids Res. 27, 4636-4641 (1999)) and the open reading frames in the PTM-PTN gene clusters were analyzed by FramePlot (Ishikawa J. & Hotta, K. FEMS Microbiol. Lett. 174, 251-253 (1999)). All DNA sequences were deposited in the NCBI database (see Accession codes).
Phylogenetic analysis. Alignment of the concatenated housekeeping genes (partial sequences, 2975 bp total) was generated using MegAlign 10.1 (Ikeda C. et al, J. Biochem. 141, 37-45 (2007); Guo Y. et al, Int. J. Syst. Evol. Microbiol. 58, 149- 159 (2008)). Phylogenetic analysis was performed using the MEGA 5.2.1 software (Tamura, K. et al, Mol. Biol. Evol 28, 2731 -2739 (201 1)). The phylogenetic tree was constructed using the Tamura-Nei evolutionary distance method and 1000 bootstrap replications. Nucleotide sequences of the housekeeping genes for S. coelicolor A3 (2) (AL645882), S. avermitilis MA-4680 (BA000030), S. rimosus ATCC 10970 (ANSJ00000000), S. griseus NBRC 13350 (AP009493), S. scabiei 87.22 (NC 013929), S. venezuelae ATCC 10712 (FR845719), and S. clavuligerus ATCC 27064 (ADWJ00000000) were obtained from the NCBI database and used as relevant Streptomyces spp. for phylogenetic analysis. Streptosporangium roseum DSM43021 (CP001814) and Mycobacterium tuberculosis H37Rv (AL123456) were used as outgroups.
Gene disruption. Strains and plasmids/cosmids used in this study are summarized in Table 3. Gigapack III XL packaging extracts and E. coli XLl-Blue MRF' (Agilent) were used for cosmid library construction. Primers used in the gene disruption experiments are listed in Table 3. Gene disruption of ptmRl was performed in E. coli BW251 13/pIJ790 (Gust B. et al, Proc. Natl. Acad. Sci. USA 100, 1541-1546 (2003)) carrying appropriate cosmids. The ptmRl genes were replaced with the aac(3)IV + oriT resistance cassette from pIJ773. The mutant cosmids were introduced into the S. platensis CB00739, CB00765, and CB00775 by intergeneric conjugation (Bierman M. et al., Gene 1 16, 43-49 (1992)) after passaging the mutant cosmids through the non- methylating E. coli ET12567/pUZ8002 (Kieser T. et al, Practical Streptomyces Genetics (The John Innes Foundation, Norwich, UK, 2000)). Apramycin selection, and kanamycin sensitivity, on ISP4 medium were used to determine double crossover mutants of the ptmRl genes. The mutations were confirmed by PCR analysis.
Production of PTM and PTN. PTM and PTN were produced from Streptomyces spp. following previously published procedures (Smanski M.J. et al, Proc. Natl. Acad. Sci. USA 108, 13498-13503 (201 1); Smanski M.J. et al, Antimicrob. Agents Chemother. 53, 1299-1304 (2009); Yu Z. et al, Org. Lett. 12, 1744-1747 (2010)). Briefly, Streptomyces spp. spores were inoculated into seed medium, incubated for 48 h, and 2 mL of seed culture were used to inoculate 50 mL of PTM medium (REF) supplemented with 10 mL L"1 trace elements and 1.5 g of Amberlite XAD-16 resin (Sigma-Aldrich). After incubation for 7 days at 28 °C and 250 rpm, the resin was harvested by centrifugation, washed three times with water, and extracted with actone (3 x 10 mL). Acetone was removed under reduced pressure and the resulting oil was resuspended in 1.5 mL of methanol. HPLC and LC-MS analysis. HPLC was carried out on a Varian Liquid Chromatography System consisting of Varian ProStar 210 pumps and a ProStar 330 photodiode array detector equipped with an Apollo C18 column. HPLC analysis of PTM and PTN was performed using a 20 min solvent gradient (1 mL min"1) from 15% acetonitrile in H20 containing 0.1% formic acid to 90% acetonitrile in ¾0 containing 0.1% formic acid. The peak area at 240 nm was used to quantify PTM and PTN production.
Liquid chromatography-mass spectrometry (LCMS) was carried out on an Agilent 1260 Infinity LC coupled to a 6230 TOF equipped with an Agilent Extend Cig column (50 mm x 2.1 mm, 1.8 μηι). Liquid chromatography was performed using a 17 min solvent gradient (0.4 mL min"1) from 10% acetonitrile (CH3CN) in H20 containing 0.1 % formic acid to 100% acetonitrile in H20 containing 0.1% formic acid, and PTM and PTN were eluted with retention times of 7.4 and 9.7 min, respectively. Extracted ion (m/z at 442.1863 for the [PTM + H]+ ion and m/z at 426.1914 for the [PTN + H]+ ion) chromatograms (m/z at [M + H]+ ± 0.5) verified PTM and PTN production.
Results
Development of a strain prioritization method by real-time PCR for natural product discovery. The continued growth of microbial strain collections used for natural product discovery demands a high-throughput method for rapid strain prioritization. Sensitive and reliable survey of microbial genomes in a strain collection for genes characteristic for biosynthesis of the targeted class of natural products would identify the most promising ones for strain prioritization, thereby significantly increasing the likelihood of discovering the targeted class of natural products. The methods described herein, exploit the capability of real-time PCR, in a high-throughput manner, to detect DNA regions, encoding biosynthesis of the targeted class of natural products, from the genomic DNA samples of a microbial strain collection for strain prioritization. Subsequent genome sequencing and genome mining of the high priority hit strains promise to accelerate natural product discovery (Figure IB).
In real-time PCR applications, fluorescence levels, which correspond to the amount of accumulating products, are generated by fluorophores that intercalate double-stranded (ds) DNA or by fluorophore-conjugated oligonucleotides that prime to DNA targets. SYBR Green I was chosen as the DNA intercalating fluorophore as it enabled us to apply melting curve analysis of the PCR products. Melting curve analysis reveals the apparent melting temperature (Tm) of the PCR products, a value dependent on product length, base composition, and nucleotide mismatch (Wetmur, J.G., Crit. Rev. Biochem. Mol. Biol. 26, 227-259 (1991)). The Tm values therefore can be exploited as an indicator of PCR product specificity without the need for gel electrophoresis.
To demonstrate the utility and effectiveness of the strain prioritization method by real-time PCR, the diterpene synthase genes were targeted to search for diterpenoid producers in general and PTM and PTN producers in particular from the actinomycete strain collection at The Scripps Research Institute. Diterpenoids of bacterial origin are underrepresented among known natural products (Smanski, M.J., Peterson, R.M., Huang, S.-X. & Shen, B. Curr. Opinion Chem. Biol. 16, 132-141 (2012)). All diterpenoids are derived from the common precursor geranylgeranyl diphosphate (GGDP). Diterpene synthases catalyze the critical steps in diterpenoid biosynthesis by morphing geranylgeranyl diphosphate into one of the many diterpenoid scaffolds, further transformations of which by pathway-specific tailoring enzymes afford the vast structural diversity known for diterpenoid natural products (Figure 2A).
The biosynthetic gene clusters for PTM and PTN production in S. platensis MA7327 and MA7339 (Figure 2B) (Smanski, M.J. et al, Proc. Natl. Acad. Sci. USA 108, 13498-13503 (201 1)) were previously cloned and characterized in the inventor's laboratory. Among the four diterpene synthases from the PTM and PTN biosynthetic machineries, geranylgeranyl diphosphate synthase (PtmT4/PtnT4) is common for all bacterial diterpenoids, erci-copalyl diphosphate synthase (PtmT2/PtnT2) is shared by both PTM and PTN, but eni-kaurene synthase (PtmT3) or e«/-atiserene synthase (PtmTl/PtnTl) is specific for PTM or PTN, respectively (Figure 2A). It was reasoned that targeting Tl or T3 should specifically narrow the search to producers of erci-atiserene-derived or e«t-kaurene-derived diterpenoids, such as PTM or PTN, while targeting T2 or T4 could broaden the search to include producers that biosynthesize other e«/-copalyl diphosphate-derived or all geranylgeranyl diphosphate-derived diterpenoids, respectively (Figure 2A). The primers, targeting the genes that encode Tl , T2, T3 and T4, were designed based on the conserved nucleotide sequences of ptmTl/ptnTl, ptmT2lptnT2, ptmT3, and ptmT/ptnT4 within the PTM and PTN gene clusters, as well as known homologues of actinomycete origin, and one of each primers for Tl and T3 was selected based on the atypical amino acid motifs (DXXXD; SEQ ID NO: 32) found in bacterial type I diterpene synthases (Smanski, M.J. et al., Curr. Opinion Chem. Biol. 16, 132-141 (2012); Smanski, M.J. et al, Proc. Natl. Acad. Sci. USA 108, 13498-13503 (201 1)) (Figures 4A-4D and Table 2). The sizes for each of the PCR products were predicted to be 696 bp, 559 bp, 461 bp, or 41 1 bp, with the calculated Tm of 92.1 °C, 91.6 C, 91.6 °C, or 91.8 C for Tl , T2, T3, or T4, respectively, according the ptmTl/ptnTl, ptmT2lptnT2, ptmT3, and ptmT/ptnT4 sequences (Figure 2B). The specificity cutoff for each of the targeted PCR products was arbitrarily set at Tm ± 0.8°C, where Tm is the melting temperature of the positive control, to identify putative hits. The deviation from Tm is inversely proportional to PCR product specificity, and smaller deviations were preferred to minimize false positives.
Strain prioritization by real-time PCR for four diterpene synthase genes affording six PTM and PTN producers. 1 ,91 1 strains were selected from the actinomycete collection (Xie, P. et al, J. Nat. Prod. 11, 377-387 (2014)) and applied the method described above to prioritize the strains for diterpenoid producers in general and PTM and PTN producers in particular. The genomic DNAs for each of the 1 ,91 1 strains were individually prepared, normalized, and arrayed in 384-well plates. Each of the plates also contained one blank (i.e., no template DNA) as a negative control and one with the genomic DNA of S. platensis MA7327 as a positive control. Real-time PCRs were carried out with each of the four sets of primers (Figure 2B and Table 2), and the resultant PCR products were subjected to melting curve analysis to identify putative hits (Figure 2C).
As summarized in Figure 2D: 488, 17, 6, and 6 out of the 1 ,91 1 strains were identified as putative hits using the primers, targeting T4, T2, T3, and Tl , respectively. Although the 488 hits identified using the T4 primers represented a hit rate that was too high to justify detailed follow up analysis of each hit, confirmatory PCR on selected hits, using the same T4 primers followed by agarose gel electrophoresis of the resultant products, yielded specific bands with the predicted size (Figure 2C, panel i). However, the resultant PCR products from each of the T4 hits were not all sequenced (Figure 5A), and the possibility of false positives due to nonspecific PCR amplification therefore cannot be excluded. For the 17 hits identified using the T2 primers, follow up analysis by PCR using the same T2 primers all afforded specific products with the predicted size (Figure 2C, panel ii). DNA sequencing of the resultant products revealed that nine out of the 17 hits were true hits that contain genes encoding putative ent-copalyl diphosphate synthase (Figure 5B), with the remaining eight hits resulting from nonspecific PCR amplification. Finally, each set of the six hits identified using T3 or Tl primers, respectively, were similarly validated by PCR using the same T3 and Tl primers, and remarkably both set of six hits afforded specific PCR products with the predicted size (Figure 2C, panels iii and iv). DNA sequencing of the resultant products confirmed that both set of six hits were true diterpenoid producers that contain genes encoding the putative eni-kaurene synthase (Figure 5C) or ent-atiserene synthase (Figure 5D), respectively.
Cross examination of all hits revealed that six strains, CB00739, CB00765, CB00775, CB00789, CB02289, and CB02304, harbored all four targeted genes (Figure 2D). The fact that they possessed both Tl and T3, in addition to T2 and T4, would predict all six hits as PTM-PTN dual producers, a genetic disposition that resembled the PTM-PTN dual producer S. platensis MA7327 but contrasted to the PTN- only producer S. platensis MA7339 (Figures 2A and 2B). Of the remaining three hits identified using T2, they (CB00028, CB00830, and CB01059) all also harbored T4 as would be expected for diterpenoid producers (Figure 2A). In fact, this laboratory previously isolated from CB00830 viguiepinol, oxaloterpin E and C, diterpenoids whose biosynthesis was confirmed to involve T2 and T4 (Xie, P. et al., J. Nat. Prod. 77, 377- 387 (2014); Ikeda, C. et al, J. Biochem. 141 , 37-45 (2007)). Therefore, CB00028 and CB01059 are promising producers of new diterpenoid natural products featuring ent- copalyl diphosphate-derived scaffolds (Figure 2A).
DNA sequencing confirming the six hits to harbor PTM-PTN dual biosynthetic gene clusters. To verify each of the six hits possessing a functional PTM- PTN dual biosynthetic cluster gene, selected intact genes, encoding the four diterpene synthases Tl, T2, T3, and T4, as well as the pathway-specific negative transcriptional regulator PtmRl, were first amplified by PCR using primers that were designed according to the PTM-PTN dual biosynthetic gene cluster from S. platensis MA7327 (Table 2). DNA sequencing of the resultant products confirmed that each of the targeted genes were highly homologous (>95%) to those of the known PTM-PTN producers and each other (Figure 6). The hit strains were next subjected to polyphasic taxonomy studies. Phylogenetic analysis based on four selected housekeeping genes (16S rRNA, recA, rpoB, and trpB) (Table 2) assigned all six hits as Streptomyce platensis species (Figure 3A). Close examination of the six hit strains, in comparison with S. platensis MA7327 and MA7339, however, revealed that the new strains were distinct as judged by the morphology and appearance of pigmented spores (Figure 3B). Two of the hit strains, CB00739 and CB00765, were selected and subjected to genome sequencing, confirming that these strains contained complete PTM-PTN gene clusters. The PTM-PTN dual biosynthetic gene clusters from CB00739 and CB00765 have the same number of open reading frames and same genetic organization as the one from S. platensis MA7327, and the overall nucleotide sequence identities among the three clusters are >97% (Figure 6).
The six hits produce and three of their engineered strains overproduce PTM and PTN. To validate that the identified PTM-PTN dual biosynthetic gene clusters are functional, the six hit strains were first subjected to fermentation optimization for PTM and PTN production and confirmation. Under the same conditions used for S. platensis MA7327 and MA7339, (Smanski, M.J. et al., Proc. Natl. Acad. Sci. USA 108, 13498-13503 (2011); Smanski, M.J. et al., Antimicrob. Agents Chemother. 53, 1299-1304 (2009); Yu, Z. et al, Org. Lett. 12, 1744-1747 (2010)) PTM and PTN production was confirmed for all six hit strains (Figures 7A-7C), with PTM and PTN titers varying from 0.66 - 10 mg L"1 and <0.1 - 11 mg L"', respectively (Table 1). These titers correlated well with those reported previously from the S. platensis MA7327 and MA7339 wild- type strains.
Removal of the pathway specific, negatively acting transcriptional regulator PtmRl or PtnRl from S. platensis MA7327 and MA7339, afforded recombinant strains that dramatically overproduced PTM, PTN or both. However, the recombinant strains sporulated poorly under all conditions examined (Figure 3C). This has prevented further engineering PTM and PTN biosynthesis in these overproduces. PtmRl was similarly inactivated in three of the six hits, CB00739, CB00765, and CB00775 (Table 3), and the genotypes of the resultant recombinant strains SB 12026, SB 12027, and SB 12028, respectively, were confirmed by PCR (Figures 8A, 8B). Under the same conditions for PTM and PTN production with the wild-type strains as controls, SB 12026, SB 12027, and SB 12028 indeed overproduced PTM and PTN up to 310-fold, consistent with what has been observed for the S. platensis MA7327 and MA7339 strains (Table 1 and Figures 4A-4C). Gratifyingly, SB12026, SB12027, and SB12028 sporulate well (Figure 3C), opening up the opportunity to further manipulate PTM and PTN biosynthesis in these overproduces for pathway characterization and structural diversity.
Discussion
In spite of the indisputable track record of natural products as drugs and drug leads and small molecule probes, the "grind and find" approach of traditional natural product discovery, with its elements of serendipity, demands too much time, effort, and resources (Newman, D.J. & Cragg, G.M., J. Nat. Prod. 75, 31 1-335 (2012); Li, J.W.H. & Vederas, J.C. Science 325, 161 -165 (2009)). It is reported herein, a high-throughput method using real-time PCR for strain prioritization to identify the most promising strains from a microbial strain collection for natural product discovery. Resources could then be devoted preferentially to the strains that hold the highest promise in producing novel natural products, thereby accelerating detection and isolation of the targeted natural products and cutting the time and cost associated with traditional natural product discovery programs. Applications of genome sequencing and genome mining to the high priority strains could essentially eliminate the chance elements from traditional natural product discovery programs and fundamentally change how microbial natural products are to be discovered (Figures 1 A, IB).
Central to the method is the application of real-time PCR, targeting genes characteristic to the biosynthetic machinery of natural products with distinct scaffolds, in a high throughput format and with superior sensitivity and specificity. The practicality and effectiveness of this method was showcased by targeting four diterpene synthase genes, Tl, T2, T3, and T4, to prioritize 1 ,91 1 strains, selected from the actinomycete strain collection at The Scripps Research Institute, for diterpenoid producers in general and PTM and PTN producers in particular (Figures 2A-2D). Diterpenoid producers were chosen because they are underrepresented among microbial natural products and for new PTM and PTN producers because of the heroic effort in the discovery of the original S. platensis MA7327 and MA7339 strains, as well as the need for alternative producers with better genetic amenability. A total of 488 potential diterpenoid producers were rapidly identified, among which six were confirmed as PTM-PTN dual producers and one as a viguiepinol and oxaloterpin producer. Although the new PTM-PTN dual producers are all S. platensis species on the basis of polyphasic taxonomy, they exhibit district morphology, three of which showed superior genetic amenability to the original S. platensis MA7327 and MA7339 strains. Genetic amenability of the producing organisms is of paramount importance in applying microbial genomics to natural product discovery, and new strains, alternatives to genetically recalcitrant original producers for the same natural products or families of natural products with similar scaffolds, represent an innovative solution to this critical challenge. The 25% (i.e., 488 out of 1911) hit rate of diterpenoid producers is higher than expected, given the small number of bacterial diterpenoids known to date, but is consistent with an early survey of this strain collection. These findings support that the biosynthetic potential of diterpenoids in bacterial is significantly underestimated, and further prioritization of the hits identified in this study promises the discovery of novel diterpenoid natural products.
Natural products occupy tremendous chemical structural space that is unmatched by any other small molecule libraries. While the rich functionality of natural products is, without doubt, one of their great strengths, providing potency and selectivity, the biosynthetic machineries for each of the major molecular scaffolds are highly conserved across the entire family of natural products, as exemplified by the diterpene synthases Tl , T2, T3, and T4, for diterpenoids. Variations among the myriad of tailoring enzymes associated with each of the biosynthetic machineries further imbue the remarkable structural diversity within each of the natural product families (Figure 2A). Although the method has been showcased by targeting diterpenoids, variation of the method is readily applicable to the discovery of other classes of natural products by targeting conserved genes within each of the major biosynthetic machineries. Deviations to the targeted Tm value would be correlated to the product specificity. The Tm range used in this study was 0.8 C, and this range allowed for the identification of hits with 97-98%, 63-98%, 96-97%, and 38-98% identity to ptmTl, ptmT2, ptmT3, and ptmT4, respectively (Figures 5A-5D). The range of Tm can be exploited to address the needs of each experiment, and a larger range of Tm would increase the likelihood of finding diverse hits. Finally, a DNA intercalating fluorophore was used in the current method, allowing detection and subsequent melting temperature analysis of the amplified products. One could envision variations of the method with fluorophore-labeled oligonucleotides or molecular beacons in a multiplex approach of real-time PCR to target multiple genes simultaneously within a single reaction, further expanding its utility in strain prioritization, thereby accelerating natural product discovery.
Table 1. Titers of platensimycin and platencin produced by Streptomyces platemis spp.
Titer3 (mg L"') for the following S. platensis strain:
Compound
MA7327 SB12001b SB12002b CB00739 SB12026 CB00765 SB12027 CB00775 SB 12028 CB00789 CB02289 CB02304
PTM 4.1 ± 1.0 110 ± 4 220 ±9 1.0 ±0.3 310 ± 12 5.2 ±1.0 11 ±0.9 4.7 ±1.3 230 ±20 6.5 ± 1.7 0.66 ±0.17 10±4
PTN 0.77 ±0.21 150 ± 14 74 ±3 1.6 ±0.2 170 ±6 2.4 ±0.2 12 ±1 0.65 ± 0.05 200 ±25 2.2 ±0.6 <0.1c 11 ±4 aUnless otherwise noted, values are the averages of at least three independent trials and are reported with standard deviations. bStrains originally reported in reference 24.
cThe PTN peak at λ240 was too small to calculate a reliable titer; PTN was detected by EIC (m/z at 426.20 for the [PTN + H]+ ion) and is shown in Figure 6C.
Table 2. Primers used in this study.
Primer Nucleotide Sequence (5'-3') Function (Reference) ptmnl-S CCGGGCTGGACATCCGGGCGGAC (SEQ ID NO: 1) PCR targeting ptm/ptnTl ptmnl-AS GGATGGCGCAGAGCAGGAGGTC (SEQ ID NO: 2) PCR targeting ptm/ptnTl ptmn2-S CTGCTCCCCCGCCGCCACC (SEQ ID NO: 3) PCR targeting ptm/ptnT2 ptmn2-AS CGTAGTACGGCGAGGCGTGC(SEQ ID NO: 4) PCR targeting ptm/ptnT2 ptm3-S TATCTGCTCGACGGCAGGCTCGAC (SEQ ID NO: 5) PCR targeting ptmT3 ptm3-AS TTGGCCCAGGTCCGCAGATCGTT (SEQ ID NO: 6) PCR targeting ptmT3 ptmnT4mix-S CTGBTSCACGACGAYVTSATGGAC (SEQ ID NO: 7) PCR targeting ptm/ptnT4 ptmnT4mix-AS GCCSAKBABGTCGTCSRYVWDYTGGAA (SEQ ID NO: 8) PCR targeting ptm/ptnT4
16SrRNA for AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 9) Phylogenetic Analysis
16SrRNA_rev ACGGCTACCTTGTTACGACTT (SEQ ID NO: 10) Phylogenetic Analysis recAfor TAATACGACTCACTATAGGGCCGCRCTCGCACARATTG Phylogenetic Analysis
AACG (SEQ ID NO: 1 1)
recArev GCTAGTTATTGCTCAGCGGCGTCGGGGTTGTCCTTSAG Phylogenetic Analysis
GAAG (SEQ ID NO: 12)
οΒ-2 CATCGACCACTTCGGCAAC (SEQ ID NO: 13) Phylogenetic Analysis
ActRpoB3303R GAANCGCTGDCCRCCGAACTG (SEQ ID NO: 14) Phylogenetic Analysis (1 ) trpBfor TAATACGACTCACTATAGGGGCGCGAGGACCTGAACC Phylogenetic Analysis
ACAC (SEQ ID NO: 15)
trpBrev GCTAGTTATTGCTCAGCGGCATGGCCGGGATGATGCCC Phylogenetic Analysis
(SEQ ID NO: 16)
ptmTlfor GACATCGAGGGGCATGGGAAGG (SEQ ID NO: 17) Sequencing
ptmTlrev GTCAATCCGGAGACCGGGGTAC (SEQ ID NO: 18) Sequencing
ptmT2for CTTGTGGGCGTCCAGGAAGGAG (SEQ ID NO: 19) Sequencing
ptmT2rev CCACGAACGACAACAACAGTTGCG (SEQ ID NO: 20) Sequencing
ptmT2mid GATGTGTGCGTTGGTGCTGG (SEQ ID NO: 21) Sequencing
ptmT3for CATCTGGCGCGACAACCGCATTG (SEQ ID NO: 22) Sequencing
ptmT3rev CATCGCGTCCTTTGATCGGGAGG (SEQ ID NO: 23) Sequencing
ptmT4for2 CGGAACACCGCCGCGTAG (SEQ ID NO: 24) Sequencing
ptmT4rev GAGCACCACGTCGCCGTG (SEQ ID NO: 25) Sequencing
ptmRl for GTCTTCGGCAGCCGGCTCTC (SEQ ID NO: 26) Sequencing
ptmRlrev CGACTCAACAGGGCGTAAAGGTGC (SEQ ID NO: 27) Sequencing
ptmRtgtF CCCGCCGGAATCGGCCCTGATGGAGCAGTTCGGCATTT RED-mediated PCR targeting
CCATTCCGGGGATCCGTCGACC (SEQ ID NO: 28) replacement of ptmRl ptmRtgtR TCGAGGAGTTCCAGACGGGTATTGGCGCCGCTCGCATT RED-mediated PCR targeting
CAATGTAGGCTGGAGCTGCTTC (SEQ ID NO: 29) replacement of ptmRl ptmRidF CCTGATGGAGCAGTTCGG (SEQ ID NO: 30) AptmRl PCR confirmation ptmRidR GGAGTTCCAGACGGGTATTG (SEQ ID NO: 31) AptmRl PCR confirmation
Table 3. Strains and plasmids used in this study.
Strain/Plasmid Genotype, Description Source (Reference)
E. coli DH5a E. coli host for cloning Life Technolo,
E. co// XL1 -Blue MRP' E. coli host for library construction Agilent
E. coli ET12567/pUZ8002 Methylation-deficient E. coli host for (2)
intergeneric conjugation; contains pUZ8002,
a nontransmissible oriT mobilizing plasmid
E. coli BW25113/pIJ790 E. coli host for PCR targeting (3)
S. platensis MA7327 Wildtype PTM/PTN producer Merck (4,5) S. platensis MA7339 Wildtype PTN producer Merck (6,7) S. platensis SB 12001 PTM/PTN overproducing strain (8)
S. platensis SB 12002 PTM/PTN overproducing strain (8)
S. platensis SB 12600 PTN overproducing strain (9)
S. platensis CB00739 PTM-PTN strain hit This study
S. platensis CB00765 PTM-PTN strain hit This study
S. platensis CB00775 PTM-PTN strain hit This study
S. platensis CB00789 PTM-PTN strain hit This study
S. platensis CB02289 PTM-PTN strain hit This study
S. platensis CB02304 PTM-PTN strain hit This study
S. platensis SB 12026 CB00739 with ptmRl replaced with This study
aac(3)IV+oriT cassette
S. platensis SB 12027 CB00765 with ptmRl replaced with This study
aac(3)IV+on T cassette
S. platensis SB 12028 CB00775 with ptmRl replaced with This study
aac(3)IV+on T cassette
SuperCosl Vector for the construction of cosmid Agilent
libraries
pIJ773 Plasmid containing the apramycin resistance (3)
cassette (aac(3)IV+on T)
pBS 12031 Cosmid 18H9 from CB00739 cosmid library, This study
containing partial ptm gene cluster
pBS12032 Cosmid 18H10 from CB00765 cosmid This study
library, containing partial ptm gene cluster
pBS12033 Cosmid 10F8 from CB00775 cosmid library, This study
containing partial ptm gene cluster
pBS 12034 pBS 12031 with ptmRl replaced with This study
aac(3)lV+onT by PCR targeting
pBS12035 pBS 12032 with ptmRl replaced with This study
aac(3)IV+on l by PCR targeting
pBS12036 pBS12033 with ptmRl replaced with This study
aac(3)lV+onT by PCR targeting Examples 2: Strain Prioritization for Natural Product Discovery by A High-Throughput Real-Time PCR Method - Enediyne Natural product Discovery
The following have been achieved herein: (i) completed the genome survey of 3,200 strains, identifying 89 hits as new enediyne producers, (ii) established the genetic amenability for 66 hits, (iii) constructed the ApksE mutants for 9 hits, (iv) detected heptaene production for 15 hits, (v) sequenced the genomes for 20 hits, revealing 20 enediyne gene clusters with distinct organization and architecture, and (v) confirmed one hit CB02366 as a new C-1027 producer (Figure 10). Taken together, these results: (i) validate the genome survey strategy to identify new enediyne producers, (ii) unveil Actinomycetales as the most prolific enediyne producers, and (iii) demonstrate the feasibility to mine the genomes of the Actinomycetale collection for the discovery, production, and isolation of new enediyne natural products.
Materials and Methods Figure 1 1 depicts the overall research design and methods to mine genomes of the Actinomycetale collection for new enediyne natural products. Central to the approach are: (i) the recognition of Actinomycetales as the most prolific enediyne producers, (ii) the development of a genome survey method to rapidly identify the most promising enediyne producers from our Actinomycetale collection, and (iii) the combination of genomics, bioinformatics, metabolic pathway engineering, medium and fermentation optimization, and metabolomics to activate enediyne biosynthesis in the new producers, thereby production, isolation, and structural characterization, of the novel enediynes.
General methods for microbial natural product discovery, (i) While the "grind and find" paradigm of traditional natural product discovery program is laborious, it remains effective, variations of which still characterize new natural product discovery today. Microbial cultures (wild-type and engineered strains) are typically grown in 250- mL flasks (containing 50 mL culture) in a shaker for analytical scale production and could be scaled up in fermentors (10 L in a 14-L vessel or 30 L in a 40-L vessel) for preparation scale. It was found that metabolite profiles are readily amenable to HPLC and LC-MS analyses by a metabolomics approach, in particular if knockout mutant strains for the targeted natural products are available as negative controls. The inventor has an inventory of >40 different fermentation media, collected from both pharmaceutical industry and academic labs all over the world, to support natural product production in Actinomycetales. As summarized in Figure 9G and Figure 10, by fermenting the hits in five different media, the production of heptaene has been realized, and by association the novel enediyne natural products, for 15 of the 66 new producers examined, as exemplified by the discovery and confirmation of CB02366 as a new C-1027 producer.
(ii) Complementary to traditional natural product discovery, connecting natural products to the genes that encode their biosynthesis has fundamentally changed the landscape of natural products research and sparked the emergence of a suite of contemporary approaches to natural product discovery. Critical to these contemporary approaches is to have a genetic system in place for the producing organisms so that the biosynthetic machinery of the targeted natural products can be manipulated in vivo. Four general methods are available for introduction of plasmid DNAs into Streptomyces and closely related species: protoplast transformation, electroporation, conjugation, and phage transduction. The inventor has extensive experience in the application of all four methods and has developed genetic systems for more than 30 antibiotic-producing Streptomyces species over the years, as exemplified by the engineered production of novel C-1027 analogues in S. globisporus and generation of the AucmE mutant in S. sp. for fermentation optimization and UCM detection by a metabolomics approach (Figure 9J), as well as development of genetic systems for the 69 new enediyne producers and generation of the ApksE mutants for nine of them in preliminary studies (Figure 9G and Figure 10). The fact that most of the new enediyne producers identified in this application are Streptomyces ensures that the expedient recombinant DNA technologies and genetic tools in Streptomyces can be readily adopted, (iii) Complementary to manipulating natural product biosynthetic gene clusters in their native producers, expression of biosynthetic gene clusters in heterologous hosts for natural product production has emerged as an attractive alternative. The inventor has extensive experience and has made several important contributions to heterologous expression of complex natural product biosynthetic pathways in selected model Streptomyces hosts, producing some of the most complex natural products known to the field, including fredericamycin, iso-migrastatin, platensimycin and platencin, and bleomycin.
(iv) The new enediyne natural products can be isolated by common chromatographic techniques, and their structures determined by standard spectroscopic methods, such as MS, ID and 2D Ή and 13C NMR (COSY, TOCSY, HMQC, and HMBC).
Strain prioritization for enediyne natural product discovery by a real-time PCR method, (i) The Actinomycetale strain collection at The Scripps Research Institute consists of strains collected from various unexplored and underexplored ecological niches, (ii) A genome survey of 3,200 strains was completed, identifying 89 hits. Thus, genomic DNAs for each of the strains were prepared according to standard procedures (Kieser, T. et al., Practical Streptomyces genetics, The John Innes Foundation: Norwich, UK, 2000), arrayed in 384-well plates, and their concentrations normalized (0.1 - 1 ng/well). Real-time PCR were carried out, in a 384-well plate format, with either the E/E5 pair ((5'- CCCCGCVCACATCACSGSCCTCGCSGTGAACATGCT-3' (SEQ ID NO: 33)/5'- GCAGGCKCCGTCSACSGTGTABCCGCCGCC-3' (SEQ ID NO: 34)) or E10/E pair ((5'-TGYGYSCCSSACSSSVSGSTGCTGCC-3' (SEQ ID NO: 35)/5'- ACGTTGCCGACSAGRTTSGTYTCCTCGAACCGAC-3' (SEQ ID NO: 36)) of primers. Specific PCR products were identified by melting curve analysis, each of the hits was confirmed by gel electrophoresis, and strains affording a specific PCR product with the E/E5, E/E10, or both primers were considered as potential enediyne producers. The PCR-amplified E/E5 and E/E10 fragments, as well as, an additional PCR amplified internal fragment of the E gene, with primer pair of 5'- TGTAAAACGACGGCCAGTATGGGSTTCGGCGGSATCAAC-3' (SEQ ID NO: 37)/5'-CAGGAAACAGCTATGACCAGMGGNGAGTGGAANGCGTG-3' (SEQ ID NO: 38), were sequenced. Those strains that harbor enediyne PKS gene cassettes that are distinct to all enediynes known to date were identified as hits.
(iii) The 89 hits were further prioritized, on the basis of enediyne PKS gene cassette novelty and taxonomic distinctness of the producers, and the most promising 20 hits were identified for genome sequencing (Figure 10). The multilocus sequence analysis approach was adopted, on the basis of selected house-keeping genes (16S rRNA, recA, trpB, rpoE), to characterize the taxonomy of the hits. Diverse representations from each of the individual phylogenetic clades were considered as one criterion to select strains for genome sequencing. It was shown that phylogenetic analysis of the enediyne PKS gene cassettes, on the basis of the internal fragment of E, E5, E10, or a combination of them, afforded distinct clades, each of which most likely encode enediynes with distinct structures (Figure 10). While the 11 known enediyne PKS gene cassettes are well dispersed, there are clades to which none of the known enediyne PKS gene cassettes fall, a provocative suggestion for novel enediynes. Phylogenetic representation of the enediyne PKS gene cassettes was considered as another criterion.
Genome sequencing to confirm the prioritized hits as new enediyne producers. The most unique 20 hits, selected on the basis of the above two criteria, have been subjected to genome sequencing. For genome sequencing, the mate-pair library protocols (with 5-6 kb inserts) have been optimized which greatly facilitated de novo genome assembly. Genome sequencing of the selected 20 hits has been completed, affording draft genomes, consisting on average 15-30 scaffolds that can be readily mined for natural product biosynthetic gene clusters (Figure 10). Various programs for automatic annotation of secondary metabolite biosynthetic gene clusters are known, each of which has different strengths and limitations. Given the high sequence homology and organizational conservation of the enediyne PKS gene cassettes, it was found that the anti-SMASH program is sufficient and most useful for rapid identification of new enediyne gene clusters (Medema, M.H. et al., Nucleic Acids Res. 2011 , 39, W339-W346). Follow-up manual annotation corrects errors generated by the anti-SMASH program and affords accurate and complete annotation of the new enediyne clusters. From the 20 sequenced genomes, 19 enediyne clusters have been identified that are distinct to all enediyne clusters known to date, hence novel enediyne natural products, and confirmed one of them, CB02366, as a new C-1027 producer.
Fermentation optimization of the hit strains for new enediyne natural product production, (i) The hit strains were first subjected to medium and fermentation optimization, taking advantage of the extensive medium (>40) collection and experience in culturing rare Actinomycetales and optimizing their fermentation for secondary metabolite, as well as, enediyne production, (ii) The regulation of the enediyne biosynthetic machinery was by inactivating repressors, overexpressing activators, or both. Various regulators have been identified within the enediyne gene clusters (Figure 9A) and their roles in regulating enediyne biosynthesis and improving enediyne production have been demonstrated, (iii) Functional expression of the enediyne biosynthetic gene clusters were followed at transcriptional level by RT-PCR following the transcription of enediyne PKS gene cassette, as exemplified by pksE in Figure 9H, as well as, other genes within the clusters in various natural product biosynthetic machineries (Yang, D. et al. Appl. Microbiol. Biotechnol. 201 1, 89, 1709-1719; Smanski, M.J. et al. J. Nat. Prod. 2012, 75, 2158-2167). (iv) Heptaene production has been proven to be a sensitive phenotypic indicator for enediyne biosynthesis, and its utility was demonstrated following functional expression of the enediyne biosynthesis gene clusters (Figure 9F). Heptaene production was followed by HPLC analysis, to monitor the activation of enediyne biosynthetic gene clusters and optimization of enediyne production in both the native producers and their engineered recombinant variants (Figure 9G). (v) While the 1 1 known enediynes all feature a 9- or 10-membered enediyne core it is far from certain that the new endiyenes will have to feature the same scaffolds, in particular those encoded by the enediyne PKS gene cassettes that fall into distinct phylogenetic clades (Figure 10). Unbiased comparative analysis of all metabolites in fermentation will be carried out. The metabolomics platform is ideally suited to help rapidly detect the new enediynes and optimize fermentations for their production as exemplified in Figures 9G and 9J. The genetic amenability for 66 of the 89 hits was confirmed and ApksE mutants were constructed for 9 of them (Figure 10). (vi) To ensure the discovery of the most potent enediynes, preliminary cytotoxicity assays of the new enediynes were conducted before committing large scale fermentation for their production, isolation, and structural elucidation. Only the most potent, promising new enediyne natural products were isolated and their structures determined by standard chromatographic and spectroscopic methods, (v) Fermentations were scaled up to produce and isolate sufficient quantities of the new enediynes for evaluation as anticancer ADC payload candidates, and the fermentation facility at TSRI should greatly facilitate these efforts. The regulatory network of the new enediyne biosynthetic machinery was manipulated to improve their production if necessary, (vi) The cytotoxicity of the new enediynes were evaluated against selected cancer cell lines in house, and selected enediynes were also be sent to NCI for comprehensive evaluation in the NCI-60 cell line panel. Results and Discussion
Enediynes as anticancer drugs and payloads in ADCs. The enediyne natural products are the most cytotoxic molecules in existence today, and their use as anticancer drugs has been demonstrated clinically. Although the natural enediynes have seen limited use as clinical drugs mainly because of substantial toxicity, various polymer- based delivery systems or ADCs have shown great clinical success or promise in anticancer therapy. Indeed, the poly(styrene-co-maleic acid)-conjugated NCS (SMANCS®) has been marketed since 1994 for use against hepatoma. Various ADCs have been successfully developed, including a CD33 mAB-CAL conjugate (i.e., MYLOTARG®) for acute myeloid leukemia (AML), a CD22 mAB-CAL conjugate (inotuzumab ozogamicin) for non-Hodgkin lymphoma, as well as, several mAB-C-1027 conjugates for hepatoma and mAB-UCM conjugates for selected tumors. (Pfizer voluntarily withdrew MYLOTARG® from the market in 2010, however, significant survival benefits observed in recent phase III trials suggest that MYLOTARG® may have an important future role in treating patients with good- or intermediate-risk AML). These examples clearly demonstrate that the enediynes can be developed into powerful drugs when their extremely potent cytotoxicity is harnessed and delivered to tumor cells. It is remarkable that among the 1 1 enediynes known to date, two (NCS and CAL) have been developed into clinic drugs and one (C-1027) is in clinical trial, representing an astonishing -30% success rate with the enediyne class of natural products. Thus, developing innovative methods to discover new enediynes holds a great promise for anticancer drug discovery.
Interests in anticancer ADCs continue to grow. Inspired by the recent success of two ADCs (ADCETRIS® in 2011 and KADCYLA® in 2013), virtually every major pharmaceutical company with an oncology program now has an initiative on ADCs. Among the 30+ ADCs currently in development, however, the majority of them (>90%) use one of the four available cytotoxic drugs, all of which are of natural product origin. The ADC field is therefore in critical need of new, highly potent cytotoxic payloads (1 nM to 10 pM), active in many tumor types, with improved physical, chemical, and biological properties. Thus, new enediynes that can be readily produced by microbial fermentation would be extremely valuable assets in the development of safer, more effective ADCs with a validated mode of action.
The enediynes as ideal payload candidates for anticancer ADCs. ADCs provide the possibility of selectively ablating cancer cells by combining the specificity of a mAB for a target antigen with the delivery of a highly potent cytotoxic agent. The ideal number of drug molecules per mAB for most current ADCs appears to be about four. Underconjugation can decrease potency of the resultant ADCs, whereas the conjugation of too many drugs per mAB can lead to decreased circulation half-life, reduced tolerability, and impaired antigen binding. The preferred payload molecules therefore have to be highly cytotoxic (IC50S in the range of 1 nM to 10 pM) and ideally active in many tumor types. The enediynes represent some of the most cytotoxic molecules in existence today (for example, the IC50s of CAL and C-1027 towards selected cancer cell lines are in the range of 10 pM to 10"3 pM). While the enediynes are most known for their activity by DNA DSBs, ICL was discovered by the inventors, as an alternative mode of action for the enediyne family of anticancer agents and engineered C-1027 analogues capable of DNA DSBs, ICLs, or both (Kennedy, D.R. et al., Cancer Res. 2007, 67, 773- 781 ; Kennedy, D.R. et al, Proc. Natl. Acad. Sci. USA 2007, 104, 17632- 17637). It was further demonstrated that the ICL property of the enediynes can be exploited to target solid tumors or other cancer cells under hypoxic environments, which do not respond well to enediynes that predominantly induce oxygen dependent DSBs. The exquisite potency and mechanisms of action of the enediynes, as well as the demonstrated feasibility to engineer designer enediynes with altered activities (i.e., DSBs, ICLs, or both), make them ideal payload candidates for ADCs. However, only 11 enediynes are known to date, and most of them are produced in trace quantities, intrinsically unstable, produced by rare actinomycetes that are refractory to all means of genetic manipulations for either titer improvement or analogue generation, or simply not available in sufficient quantities for a full evaluation as ADC payload candidates. New enediynes with varying mechanisms and potency, functional groups for linkage, solubility to enable the reaction with antibodies, prolonged stability in formulation, that can be reliably produced in sufficient quantities by microbial fermentation of genetically amenable Streptomyces species, therefore will provide outstanding opportunities to address issues of potency, mechanism, permeability, tractability, stability, and efflux, critical challenges encountered with the known enediynes and other ADC payloads currently in development.
Enediyne biosynthesis and engineering. The enediyne natural products present an outstanding opportunity to (i) decipher the genetic and biochemical basis for the biosynthesis of complex natural products, (ii) explore ways to make novel analogues by manipulating genes governing their biosynthesis, and (iii) discover new enediyne natural products by mining microbial genomes for the trademark enediyne biosynthetic machineries. Significant progress has been made in enediyne biosynthesis and engineering in the last decade. Highlights include: (i) cloning and characterization of the C-1027, NCS, MDP, KED, SPO, CYA and CYN biosynthetic gene clusters as examples of nine-membered enediyne natural products, (ii) cloning and characterization of the CAL, ESP (partial), and DY biosynthetic gene clusters as examples of 10-membered enediyne natural products, (iii) establishment of the polyketide origin for all enediynes and discovery of the enediyne PKS as an acyl carrier protein (ACP)-dependent, self- phosphopantetheinylating, iteratively acting, type I polyketide synthase (PKS) that produces a linear polyene to initiate both nine- and 10-membered enediyne core biosynthesis, (iv) characterization of numerous enzymes from the enediyne biosynthetic machineries that catalyze novel chemistries, (v) engineered production of novel enediyne analogues with altered modes of action, and exploitation of the ICL property of the enediynes to target solid tumors or other cancer cells under hypoxic environments, (vi) manipulation of the enediyne biosynthetic machinery for titer improvement and production of selected enediynes in sufficient quantities to support further mechanistic studies and preclinical development, (vii) development of methodologies to screen microorganisms for the discovery of new enediyne natural products, and (viii) discovery that, in spite of the fact that only 11 enediyne natural products (14 if including the ones isolated in the cycloaromatized form) have been isolated to date, the biosynthetic potential of Actinomycetales to produce enediynes is greatly underappreciated. These findings have laid the foundation to explore microbial genomics for the discovery of new enediyne natural products. Thus, (i) genome survey of microbial strain collections for the hallmark enediyne PKS gene cassettes allows for rapid identification of potential enediyne producers, (ii) genome sequencing of the potential producers for the enediyne biosynthetic gene clusters could allow accurate prediction of the structural novelty of the new enediynes, and (iii) genetic manipulation and fermentation optimization of the most promising producers would ultimately allow efficient production, isolation, and structural and biological characterization of new enediyne natural products. Strain prioritization for novel natural product discovery. Traditional microbial natural product discovery programs start from fermenting each strain individually, often in multiple media, followed by preparation of crude extracts. There are two primary approaches to search for novel natural products from extracts: bioassay- guided fractionation and chemical profiling of agents possessing unique structural features and/or novelty as important representatives of different chemical classes. In both cases, a molecule of interest must be produced in sufficient amounts in order to permit isolation, purification, and characterization on a reasonable timeframe. The ultimate success in discovering a new natural product typically requires three principal steps: dereplication of known compounds to avoid duplication of effort, isolation and purification of the targeted molecules from a highly complex matrix, and structural elucidation of the purified natural product. This traditional sequence of steps still characterizes new natural product discovery from crude extracts today. While successful, it is a tedious and laborious process. As exemplified by the discovery of platensimycin from Streptomyces platensis MA7327 in 2006 and platencin from Streptomyces platensis MA7339 in 2007, Merck screened 250,000 crude extracts made from 83,000 strains, each of which was fermented in three different media. The process could be significantly shortened and more cost effective should Merck know in advance the biosynthetic potential of the strains in its collection so that resources could be devoted preferentially to interrogate only the strains that hold the highest promise in producing novel natural products. Complementary to traditional approaches, the progress made in the last two decades in connecting natural products to the genes that encode their biosynthesis has fundamentally changed the landscape of natural products research and sparked the emergence of a suite of contemporary approaches to natural product discovery. Thus, genes have become as important as chemistry in categorizing known natural products and identifying likely new ones yet to be discovered. Advances in microbial genomics have unequivocally demonstrated that -90% of the natural product biosynthetic capacity is missing, even from the workhorse producers, the Actinobacteria. To gain access to this untapped reservoir of potentially new natural products, two principal strategies have been applied to induce these "cryptic biosynthetic pathways". The so-called 'epigenetic'- related approaches include challenging the microorganisms through culture conditions, nutritional or environmental factors, external cues, and stress, as well as, exploiting interspecies crosstalk. The genomics-based approaches include mining the genomes to predict metabolite structures, engineering the pathways by manipulating global and/or pathway-specific regulators, and expressing the cryptic pathways in selected heterologous hosts. While each of the various approaches has different strengths and weaknesses, they have been successful in yielding cryptic natural products but only on a case-by-case basis and are far from being of practical use for natural product discovery. Thus, in spite of the rapid advances in DNA sequencing technologies and bioinformatics, it is still unlikely to sequence all strains within a collection as a practical means to discover new natural products. Clearly, a high throughput method is needed to rapidly survey the biosynthetic potential of our strain collection. Strains that harbor the highest biosynthetic potential can then be identified, prioritized, and subjected to epigenetic- and/or genomics-based approaches to induce all cryptic biosynthetic pathways for novel natural product discovery.
An innovative genome survey strategy was developed herein, that can be applied to rapidly identify strains, from the Actinomycetale collection, that are of high likelihood to produce enediyne natural products. Remarkably, a virtual survey of the bacterial genomes currently available in the public databases revealed that the Actinomycetales are the most prolific enediyne producers. A genome survey of 3,200 strains from the Actinomycetale collection was conducted, identifying 89 potential enediyne producers (hits). It was demonstrated, by genome sequencing, that these hits are true enediyne producers, containing gene clusters that are distinct to all enediyne clusters known to date and, by genetic manipulation and fermentation optimization, that the most promising hits can be activated to produce the new enediyne natural products. Enediyne PKS gene cassettes as a beacon for enediyne producers. In spite of their remarkable structural diversity, the 14 known enediyne natural products all feature a nine- or 10-membered enediyne core. Comparative bioinformatics analyses of the seven nine- (NCS, C-1027, MDP, KED, SPO, CYA, and CYN) and three 10- membered (CAL, DYN, and ESP) enediyne PKS loci revealed a set of five genes common to all enediynes (i.e., the enediyne PKS gene cassette consisting of E10/E/E5/E4/E3); no apparent conservation was observed beyond the enediyne PKS gene cassettes, accounting for the structural diversity characteristic for the periphery moieties of the enediynes. This remarkable sequence homology has resulted in a unified model for the enediyne PKS cassette to catalyze the formation of both nine- and 10-membered enediyne cores. This model has been further supported by the fact that: (i) PKS-TE (i.e., E-E10) catalyze the biosynthesis of heptaene as a shunt metabolite in the absence of the associated enzymes, (ii) heptaene is co-produced in fermentations of known enediyne producers, and (iii) heptaene production is PKS-dependent— inactivation of the pksE gene abolished heptaene production and complementation of the ApksE mutation with a functional pksE restored its production. These observations prompted the selection of genes within the enediyne PKS cassettes as probes to survey genomes for the presence of enediyne biosynthetic machinery. Once the new enediyne producers are identified, heptaene production, complementary to the biochemical induction assay (BIA) for enediyne production, could be used as a sensitive phenotypic indicator to follow enediyne production upon fermentation optimization.
Genetic manipulation of Actinomycetales to activate enediyne biosynthesis and production. There are minimally four requirements for implementing metabolic pathway engineering strategies to natural product discovery and structural diversity. These are: (i) the gene clusters encoding the production of a particular natural product or family of natural products, (ii) genetic and biochemical characterizations of the biosynthetic machinery for the targeted natural products to a degree that combinatorial biosynthesis principles can be rationally applied to engineer the novel analogues, (iii) expedient genetic systems for in vivo manipulation of genes governing the production of the target molecules in either native producers or heterologous hosts, and (iv) production of the natural products or engineered analogues to levels that are sufficient for isolation and structural and biological characterization. Although each of these requirements is essential, establishing an expedient genetic system for in vivo manipulation of the biosynthetic machinery of the targeted metabolites is importance (Galm U., Shen, B. Exp. Opinion Drug Dis. 2006, 1, 409-437; Van Lanen S.G., Shen, B. Drug Disc. Today: Technologies 2006, 3, 285-292; Van Lanen, S.G.; Shen, B. Curr. Opinion Drug Discov. Develop. 2008, 1 1, 186-195). Thus, a decision and opportunity for innovation in manipulating enediyne biosynthesis is the selection of the producers that are compatible with the expedient technologies and tools of recombinant DNA work in Streptomyces species and related organisms that have been developed in the past two decades. The CAL, DYN, and ESP (partial) clusters were cloned from M. echinospora, M. chersina, and A. verrucosospora, respectively, and genetic manipulations in Micromonospora and Actinomadura are known to be notoriously difficult. As a result, the ESP cluster is incomplete, and the boundaries of both the CAL and DYN clusters have yet to be determined experimentally. In contrast, biosynthesis and engineering of C-1027, NCS, and UCM have been greatly facilitated by the expedient genetic systems in S. globisporus, S. carzinostaticus, and S. sp., respectively. Accordingly, Streptomyces in the Actinomycetale strain collection was selected, and this selection is vital to overcoming the current challenges of, and meeting future objectives for, enediyne discovery, biosynthesis, and engineering in their native producers.
The availability of four 9-membered (C-1027, NCS, MDP, KED) and four 10-membered [CAL, ESP (partial), DYN, and UCM] enediyne gene clusters, as well as the three additional clusters encoding the biosynthesis of the cycloaromatized enediyne natural products of sporolides and cyanosporasides, and the commanding role the inventor's laboratory leads in advancing enediyne biosynthesis and engineering provided a unique opportunity to investigate the molecular basis of enediyne biosynthesis by a comparative genomics approach. Thus, by comparing the gene clusters between the 9- and 10-membered enediynes, a unified model was formulated for the enediyne PKS cassette to catalyze the formation of both 9- and 10-membered enediyne cores (Zhang, J. et al. Proc. Natl. Acad. Sci. USA 2008, 105, 1460-1465; Horsman G.P., et al. Proc. Natl. Acad. Sci. USA 2010, 107, 11331-1 1335), on which the current genome survey strategy for enediyne discovery was developed. By comparing metabolite profiles of the enediyne native producers, selected mutant strains, and recombinant strains expressing selected genes within the enediyne PKS cassette, a metabolomics method was established to follow the biosynthesis of heptaene as a sensitive phenotypic indicator for enediyne production. By manipulating the regulatory genes within the C-1027 biosynthetic gene cluster, C-1027 production was significantly improved. Application of the comparative genomics approach to analyze the new enediyne clusters in this application promises to reveal equally informative insights into their structures, biosynthesis, and regulations. The fact that most of the new enediyne producers discovered are of Streptomyces origin ensures that the extensive genetic tools available in Streptomyces can be readily applied to facilitate the discovery and production of the new enediynes in the native producers. Preparation of complex natural products such as the enediynes and their analogues by total synthesis poses a monumental challenge to synthetic chemists. Combinatorial biosynthesis offers an excellent alternative to produce natural products and their analogues biosynthetically. The expedient tools for recombinant DNA work in Streptomyces and related microorganisms developed in the past two decades have made it possible to apply genetic principles to meet the drug discovery and development challenges in these organisms. Target metabolites can be produced by recombinant organisms that are amenable to large-scale fermentation, thus lowering production costs. Application of combinatorial biosynthesis strategies to the biosynthetic machineries in the new enediyne producers from our Actinomycetale collection promises to enable the discovery of novel enediynes and production of novel enediyne analogues.
Actinomycetales as the most prolific enediyne producers. To validate the utility of the selected genes within the enediyne PKS cassette as probes, a virtual survey of the entire GenBank was carried out, using each of the five genes within the enediyne cassette, alone or in combination, as queries, for genes encoding enediyne biosynthetic machineries. Several important lessons were learned from these surveys, (i) All 11 confirmed enediyne biosynthetic machineries were identified (Figure 9A), validating the utility and specificity of the genes with the enediyne PKS cassette as probes, (ii) While each of the five genes alone yields essentially the same outputs, E5, E, or E10 were preferred, and the combination of E5/E or E/E10 afforded the best results, (iii) Together with the 1 1 known enediyne biosynthetic machineries, 55 additional enediyne PKS cassettes were also identified from organisms not known as enediyne producers, consistent with the early findings that the biosynthetic potential of enediynes is significantly underappreciated (i.e., a total of 66 enediyne biosynthetic loci from the publicly accessible GenBank database as of February 24, 2014). (iv) All of the 66 loci are of bacterial origin, and most remarkably, 55 of the 66 loci are in the order of Actinomycetales, revealing the Actinomycetales as the most prolific enediyne producers.
A high-throughput method to survey Actinomycetale genomes for novel enediyne producers. Inspired by the accuracy and specificity observed in the virtual screening, a high- throughput method was developed to survey the genes encoding the enediyne PKS cassettes and applied it to the Actinomycetale collection to identify potential new enediyne producers, (i) Close examination of the enediyne PKS gene cassettes showed that, while the five genes are absolutely conserved among 10 of the 11 known enediynes (the ESP cluster is incomplete hence cannot be included for comparison), there are subtle variations in their relative organization - (a) E5/E/E10 all clustered (as in NCS, MDP, SPO, CYA, CAL, DYN, UCM, ESP), (b) E5/E clustered but E10 separated (as in C-1027), or (c) E/E10 clustered but E5 separated (as in KED, CYN) (Figure 9A). Two sets of PCR primers were designed, specifically targeting E5/E or E/E10, respectively (Figure 9B). (ii) The feasibility to amplify the enediyne PKS gene cassettes by PCR was shown but these early experiments were low throughput, requiring analysis of each of the PCR products by gel electrophoresis. To develop a high- throughput method, genomic DNAs were prepared for each of the strains in the collection, normalized their concentrations, and arrayed the DNAs into a 384-well plate format. Real-time PCR was chosen, in a 384-well plate format, where specific PCR products were rapidly identified by melting curve analysis (Figure 9C). The putative hits were then confirmed by gel electrophoresis (Figure 9D), and the identity of hits as the targeted enediyne PKS gene cassettes was finally established by DNA sequencing. Genome survey of our Actinomycetale collection to identify novel enediyne producers, (i) A genome survey of 3,200 strains has now been completed at the Scripps Research Institute's (TSRI) Actinomycetale collection and 89 novel enediyne producers (Figures 9B, 9C, 9D and Figure 10) were identified, (ii) The two sets of PCR primers, specifically targeting E5/E or E/E10, (Figure 9B), are complementary. Hits that were identified by both sets of the primers featured the enediyne PKS gene cassettes with E5/E/E10 clustered together, while hits that can only be identified by one of the two sets of primers featured enediyne PKS gene cassette with either E5 or E10 separated from the E gene, (iii) The identity of the enediyne PKS gene cassettes from the 89 newly identified enediyne producers have been confirmed by DNA sequencing of E5, E10, and a 1-kb internal fragment of E. They differ from all the enediyne PKS gene cassettes currently known (Figure 10). (iv) Genome sequencing for 20 of the 89 hits at the Next Generation Sequencing (NGS) Core Facility, TSRI have been completed, confirming that they each contain an enediyne biosynthetic gene cluster and therefore are true enediyne producers. Among the 20 clusters, 19 are distinct to all enediyne clusters known to date, indicative of novel structural features/functional groups for these new enediynes, and one (CB02366) has the same genetic organization as the C-1027 cluster from S. globisporus; CB02366 was subsequently confirmed as a new C-1027 producer. Interestingly, CB02366 would be classified as an S. griseus species on the basis of selected house- keeping genes (16S rRNA, recA, trpB, rpoB), but the original C-1027 producer is known as S. globisporus, although the two C-1027 clusters are highly homologous (~90%/~94% identity at DNA/amino acid sequences). The finding of near identical gene clusters from taxonomically distinct species supports the strategy herein, in constructing the TSRI Actinomycetale collection, which has taken geographic and ecological, in addition to taxonomical, diversities into consideration, (v) The 19 new enediyne gene clusters are rich in open reading frames that are unprecedented not only in gene clusters that encode production of the known enediynes but also in gene clusters that encode production of other natural products, promising the discovery of new chemistries and biosynthetic knowledge for natural products in general. Genetic manipulation and fermentation optimization for enediyne production. The sequence homology and organizational conservation of the enediyne PKS gene cassettes also provided the inspiration to formulate a unified mechanism for enediyne biosynthesis, (i) It was confirmed that both 9- and 10-membered PKS- thioesterase (TE) (i.e, E-E10, Figure 9A) produce a common polyene intermediate to initiate the enediyne core biosynthesis, and in the absence of the associate enzymes, PKS- TE catalyze the biosynthesis of heptaene as a shunt metabolite (Figure 9E). (ii) Heptaene was discovered in fermentations of known enediyne producers and established that heptaene production was PKS-dependent - inactivation of PKS, as in the AsgcE mutant strain, abolished heptaene production and complementation of the AsgcE mutation with a functional sgcE restored its production (Figure 9F). These observations allowed for following heptaene as a sensitive phenotypic indicator for enediyne production. Preliminary screening, by HPLC analysis, of the fermentations of 66 of the 89 hits, each in five different media, indeed revealed that at least 15 produced heptaene (Figure 9G and Figure 10). (iii) Correlation between heptaene production and functional expression of the enediyne PKS gene cassette was confirmed by RT-PCR transcriptional analysis (Figure 9H). These findings evidence that the enediyne biosynthetic machinery in these 15 producers are most likely functional under the conditions examined, and further fermentation optimization of the other hits could be readily followed by RT-PCR for the expression of the E gene or other genes within the enediyne gene cluster and by HPLC analysis for heptaene production. It was also shown that enediyne production can be improved by manipulating pathway regulation, and enediyne overproduction is often accompanied by the overproduction of heptaene, a finding that further supports heptaene as a phenotypic indicator for enediyne production. Thus, inactivation of a repressor and overexpression of an activator afforded an engineered strain S. globisporus SB 1023 that overproduces heptaene and C-1027 in titers that are 24-fold and 7-fold higher, respectively, than those from the S. globisporus wild-type (Figure 91). Titer improvement by manipulating the enediyne biosynthetic machinery in these new producers should greatly facilitate their production, isolation, and structural elucidation, (v) Taxonomic analysis of 55 of the 89 hits, on the basis of selected house-keeping genes (16S rRNA, recA, trpB, rpoB), classified 50 (91%) of them as Streptomyces. The fact that most of the new enediyne producers identified are Streptomyces ensures that the expedient recombinant DNA technologies and genetic tools available for Streptomyces can be readily adopted by the current project. In preliminary experiments with 74 of the 89 new enediyne producers, the genetic amenability for 66 (89%) strains were confirmed and constructed the ApksE mutants for nine of them (Figure 10). (vi) With the ability to generate enediyne knockout mutant strains (i.e., ApksE mutants) as negative controls, it also demonstrated a metabolomics approach, by comparison of the metabolite profiles between the enediyne producing wild-type and enediyne knockout mutant strains, to rapidly optimize fermentation conditions to produce the new enediynes. As exemplified in Figure 9J, by comparison of the metabolite profiles between the S. sp. wild-type and AucmE mutant strains, three metabolites were quickly correlated to the UCM biosynthetic machinery, one of which, produced in trace quantity (<20 μg/L), was subsequently confirmed to be UCM by bioassay against M. luteus and high resolution mass spectrometry analysis. Again, the accessibility to the state-of-the-art recombinant DNA technologies and genetic tools available in Streptomyces will greatly facilitate the effort to generate the ApksE mutants in the new producers for enediyne discovery by the metabolomics approach, (vii) Finally, production was confirmed and C-1027 was isolated from CB02366. The discovery of CB02366 as a new C-1027 producer and fermentation optimization of CB02366, leading to the eventual production, isolation, and characterization of C-1027, served as an ultimate demonstration that follow up studies on the other hits will result in the discovery, production, and characterization of new enediynes.
Given the extreme potencies of the enediyne family of natural products, their proven utility as cytotoxic payloads of anticancer ADCs, and the astonishing success rate of these rare natural products in the clinic, the discovery of new enediynes, as well as alternative producers of known enediynes with high titers or better growth characteristics, is a critical step in the development of enediynes as novel anticancer drugs. Thorough bioinformatics analysis of microbial genomes reveals that enediyne natural product gene clusters are widely distributed among Actinomycetales (50 out of 796 sequenced bacterial genomes, accounting for 6.3%), and yet remain underexplored, as the newly identified gene clusters are non-redundant and highly unique. The abundant and highly diverse enediyne gene clusters found within public databases should provoke the interests of scientific communities in pursuing novel enediyne natural products from microbial strain collections, in particular from Actinomycetales.
Combining traditional natural product discovery methods with genomics- based technologies and bioinformatics will expedite the discovery process of novel enediynes. High-throughput methods to rapidly screen a large microbial strain collection for the conserved genes within the enediyne PKS cassettes are essential to allocate resources to strains that show biosynthetic potential for enediyne production. DNA sequencing of the conserved pksE genes or alternatively, the whole genome, allows further prioritization by identifying redundant or unique enediyne biosynthetic gene clusters through bioinformatics analysis (i.e., phylogenetic analysis, cluster annotation, genome neighborhood network). Once strains are prioritized, fermentation in multiple media and preparation of crude extracts allow chemical profiling of heptaene production, and bioassays for DNA damage activity (i.e., by BIA) can then be utilized to determine which strains readily produce enediynes or enediyne-like metabolites. Fractionation of promising crude extracts guided by the BIA allows a simple detection method for isolating novel enediynes. With the conserved enediyne PKS gene cassettes known, ApksE deletion mutants can be easily constructed to correlate putative gene clusters with the production of heptaene or DNA-damaging natural products. Silent or cryptic gene clusters can be overcome by the genetic manipulation of positive or negative regulators found within the enediyne gene clusters or by extensive fermentation optimization. The expedient technologies and tools of recombinant DNA work in Streptomyces species and related actinomycetes that have been developed in the past two decades will facilitate these efforts.
It is evident from the rarity of known enediyne natural products that future enediyne discovery efforts must be approached using new and innovative means as described herein The advancement of DNA sequencing technologies and genomics-based approaches in recent years has opened the door for a multi-disciplinary approach towards the discovery of natural products and enediynes in particular. The potential of the enediynes as relevant clinical drugs and the unique chemistry and enzymology involved in their biosynthesis should be of great interest to cancer biologists, natural product chemists, biochemists, enzymologists, structural biologists, and the community as a whole. Enediynes will continue to play an important role in natural product biosynthesis, engineering, and drug discovery.

Claims

CLAIMS What is claimed
1. A method of high throughput screening for identifying compounds encoded by an organism comprising:
isolating genomic DNA (gDNA) from the organism;
targeting and amplifying regions of gDNA comprising conserved nucleic acid sequences or conserved genes;
determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences;
comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying a nucleic acid sequence encoding a compound by an organism.
2. A method of high throughput screening for identifying organisms encoding a compound comprising:
isolating genomic DNA (gDNA) from the organism;
targeting and amplifying one or more regions of gDNA comprising conserved nucleic acid sequences or conserved genes;
determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences;
comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; thereby identifying organisms encoding a compound.
3. A method of high throughput screening for prioritizing organisms encoding compounds comprising:
isolating genomic DNA (gDNA) from the organism; targeting and amplifying regions of gDNA comprising conserved nucleic acid sequences or conserved genes;
determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences;
comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001°C to about 5°C deviation from the control; thereby prioritizing organisms encoding compounds.
4. The method of claims 1, 2, or 3, wherein the gDNA is labeled with a detectable label.
5. The method of claims 1 , 2 or 3, wherein the conserved nucleic acid sequences or conserved genes encode for one or more biosynthetic molecules, mutants or variants thereof.
6. The method of claims 5, wherein the biosynthetic molecules are natural and/or synthetic.
7. The method of claim 5, wherein the synthetic molecules are encoded by one or more nucleic acid sequences transfected into an organism.
8. The method of claims 1 , 2, or 3, optionally comprising culturing the organisms under varying culture conditions and culture media.
9. The method of claims 1 , 2, or 3, wherein the organism encodes for mutated natural or synthetic biosynthetic molecules.
10. The method of claims 1, 2 or 3, wherein the conserved nucleic acid sequences are targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the regions comprising the conserved nucleic acid sequences, said primers optionally comprising a detectable label.
1 1. The method of claims 1, 2 or 3, wherein the regions comprising the conserved nucleic acid sequences or conserved genes are amplified by real time polymerase chain reaction (RT-PCR).
12. The method of claim 4, wherein a detectable label comprises: nucleic acid intercalating dyes, fluorophores, radio labeled molecules, fluorescent agents, molecular beacons, chemiluminescent agents, luminescent agents, electron-dense reagents, enzymes, biotin, digoxigenin, haptens or peptides.
13. A method of high throughput screening for prioritizing bacterial strains producing diterpenoids comprising:
isolating genomic DNA (gDNA) from the organism;
targeting and amplifying regions of gDNA comprising conserved nucleic acid sequences or conserved genes;
determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences;
comparing the melting temperatures of the amplified conserved nucleic acid sequences or conserved genes to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; and, identifying a nucleic acid sequence encoding a diterpenoid by a bacterial strain; thereby prioritizing bacterial strains producing diterpenoids.
14. The method of claim 13, wherein the gDNA is labeled with a detectable label.
15. The method of claim 13, wherein the bacterial strain is an Actinomycetale strain.
16. The method of claim 13, wherein the conserved nucleic acid sequences or conserved genes encode for one or more diterpene synthase molecules, mutants or variants thereof.
17. The method of claim 16, wherein the conserved diterpene synthase sequences are targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved diterpene synthase sequences, said primers optionally comprising a detectable label.
18. The method of claim 17, wherein the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 1-127.
19. The method of claim 13, wherein the regions comprising the conserved nucleic acid sequences are amplified by real time polymerase chain reaction (RT-PCR).
20. The method of claim 14, wherein a detectable label comprises: nucleic acid intercalating dyes, fluorophores, radio labeled molecules, fluororescent agents, molecular beacons, chemiluminescent agents, luminescent agents, electron-dense reagents, enzymes, biotin, digoxigenin, haptens or peptides.
21. A method of high throughput screening for prioritizing bacterial strains producing enediynes comprising:
isolating genomic DNA (gDNA) from the organism;
targeting and amplifying regions of gDNA comprising conserved nucleic acid sequences or conserved genes;
determining melting temperatures (Tm) of the amplified conserved nucleic acid sequences;
comparing the melting temperatures of the amplified conserved nucleic acid sequences to the melting temperature of a control and selecting the conserved nucleic acid sequences having a melting temperature within about 0.0001 °C to about 5°C deviation from the control; and identifying a nucleic acid sequence encoding an enediyne by a bacterial strain; thereby prioritizing bacterial strains producing enediynes.
22. The method of claim 21 , wherein the gDNA is labeled with a detectable label.
23. The method of claim 21, wherein the bacterial strain is an Actinomycetale strain.
24. The method of claim 21, wherein the conserved nucleic acid sequences or conserved genes encode for one or more enediyne molecules, mutants or variants thereof.
25. The method of claim 24, wherein the conserved nucleic acid sequences or conserved genes comprise: polyketide synthase (PKS) nucleic acid sequences, mutants or variants thereof.
26. The method of claim 21 , wherein the conserved nucleic acid sequences or conserved genes encoding one or more enediyne molecules are targeted by primers having a sequence identity of at least about 50% with at least five consecutive nucleic acid bases of a 5' to 3' or 3' to 5' strand of the conserved enediyne nucleic acid producer sequences, said primers optionally comprising detectable label.
27. The method of claim 26, wherein the primers comprise any one or combinations of primers set forth in SEQ ID NOS: 33-38.
28. The method of claim 21, wherein the regions comprising the conserved nucleic acid sequences or conserved genes are amplified by real time polymerase chain reaction (RT-PCR).
29. The method of claim 22, wherein a detectable label comprises: nucleic acid intercalating dyes, fluorophores, radio labeled molecules, fluororescent agents, molecular beacons, chemiluminescent agents, luminescent agents, electron-dense reagents, enzymes, biotin, digoxigenin, haptens or peptides.
30. A compound identified by the methods of claims 1 , 2, 3, 13 or 21.
31. A pharmaceutical composition comprising a compound identified by the methods of claims 1, 2, 3, 13 or 21.
32. An oligonucleotide set forth as SEQ ID NOS: 1-38, mutants, variants or complementary sequences thereof.
33. An oligonucleotide having at least about 50% sequence identity to one or more oligonucleotides set forth as SEQ ID NOS: 1-38, mutants, variants or complementary sequences thereof.
34. An oligonucleotide or peptide encoded therefrom comprising one or more sequences set forth as SEQ ID NOS: 1-127.
PCT/US2015/037455 2014-06-24 2015-06-24 Strain prioritization for natural product discovery by a high throughput real-time pcr method Ceased WO2015200501A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462016292P 2014-06-24 2014-06-24
US62/016,292 2014-06-24

Publications (2)

Publication Number Publication Date
WO2015200501A1 true WO2015200501A1 (en) 2015-12-30
WO2015200501A9 WO2015200501A9 (en) 2016-03-03

Family

ID=54938777

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/037455 Ceased WO2015200501A1 (en) 2014-06-24 2015-06-24 Strain prioritization for natural product discovery by a high throughput real-time pcr method

Country Status (1)

Country Link
WO (1) WO2015200501A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114672421A (en) * 2022-03-02 2022-06-28 陕西海斯夫生物工程有限公司 Method for cultivating and screening microalgae with high tocopherol content

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030215798A1 (en) * 1997-06-16 2003-11-20 Diversa Corporation High throughput fluorescence-based screening for novel enzymes

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030215798A1 (en) * 1997-06-16 2003-11-20 Diversa Corporation High throughput fluorescence-based screening for novel enzymes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HINDRA ET AL.: "Strain prioritization for natural product discovery by a high-throughput real-time PCR method.", J NAT PROD, vol. 77, no. 10, pages 2296 - 2303, XP055246436, ISSN: 0163-3864 *
SCHMIDERER ET AL.: "DNA-based identification of Helleborus niger by high-resolution melting analysis.", PLANTA MED, vol. 76, no. 16, November 2010 (2010-11-01), pages 1934 - 1937, XP055246420 *
SMANSKI ET AL.: "Bacterial diterpene synthases: new opportunities for mechanistic enzymology and engineered biosynthesis.", CURR OPIN CHEM BIOL, vol. 16, no. 1-2, April 2012 (2012-04-01), pages 1934 - 1937, XP055246427, ISSN: 1367-5931 *
XIE ET AL.: "Biosynthetic Potential-Based Strain Prioritization for Natural Product Discovery: A Showcase for Diterpenoid-Producing Actinomycetes.", J NAT PROD, vol. 77, no. 2, 28 February 2014 (2014-02-28), pages 377 - 387, XP055246416, ISSN: 0163-3864 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114672421A (en) * 2022-03-02 2022-06-28 陕西海斯夫生物工程有限公司 Method for cultivating and screening microalgae with high tocopherol content

Also Published As

Publication number Publication date
WO2015200501A9 (en) 2016-03-03

Similar Documents

Publication Publication Date Title
JP7350659B2 (en) High-throughput (HTP) genome manipulation platform for the improvement of Saccharopolyspora spinosa
Hindra et al. Strain prioritization for natural product discovery by a high-throughput real-time PCR method
Chaudhuri et al. Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH)
Alberti et al. Triggering the expression of a silent gene cluster from genetically intractable bacteria results in scleric acid discovery
Pedrolli et al. The ribB FMN riboswitch from Escherichia coli operates at the transcriptional and translational level and regulates riboflavin biosynthesis
Pfeifer-Sancar et al. Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique
Wu et al. Genomic and transcriptomic insights into the thermo-regulated biosynthesis of validamycin in Streptomyces hygroscopicus 5008
Hauser et al. Dissection of the Bradyrhizobium japonicum NifA+ σ54 regulon, and identification of a ferredoxin gene (fdxN) for symbiotic nitrogen fixation
Zhuo et al. Reverse biological engineering of hrdB to enhance the production of avermectins in an industrial strain of Streptomyces avermitilis
Romero et al. A comparison of key aspects of gene regulation in S treptomyces coelicolor and E scherichia coli using nucleotide‐resolution transcription maps produced in parallel by global and differential RNA sequencing
US20130143745A1 (en) Compositions and methods for identifying the essential genome of an organism
Ahmed et al. Identification of butenolide regulatory system controlling secondary metabolism in Streptomyces albus J1074
Shen et al. Enediynes: exploration of microbial genomics to discover new anticancer drug leads
Hutter et al. Panel of Bacillus subtilis reporter strains indicative of various modes of action
Liu et al. Development of Streptomyces sp. FR-008 as an emerging chassis
Freiberg et al. Functional genomics in antibacterial drug discovery
Li et al. Genome-wide identification and characterization of reference genes with different transcript abundances for Streptomyces coelicolor
Ji et al. Promoter engineering of natural product biosynthetic gene clusters in actinomycetes: concepts and applications
Noh et al. Isolation and genetic manipulation of the antibiotic down-regulatory gene, wblA ortholog for doxorubicin-producing Streptomyces strain improvement
Sharma et al. Global gene expression analysis of the Myxococcus xanthus developmental time course
Lee et al. Genome-scale analysis of genetic regulatory elements in Streptomyces avermitilis MA-4680 using transcript boundary information
Zhu et al. Discovery and engineered overproduction of antimicrobial nucleoside antibiotic A201A from the deep-sea marine actinomycete Marinactinospora thermotolerans SCSIO 00652
Beaume et al. Orientation and expression of methicillin-resistant Staphylococcus aureus small RNAs by direct multiplexed measurements using the nCounter of NanoString technology
Jeong et al. A guide to genome mining and genetic manipulation of biosynthetic gene clusters in Streptomyces
CN109943545B (en) A kind of method of acyltransferase domain-directed transformation synthetic compound

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15811597

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15811597

Country of ref document: EP

Kind code of ref document: A1