WO2015196146A2 - Rna-based compositions and adjuvants for prophylactic and therapeutic treatment - Google Patents

Rna-based compositions and adjuvants for prophylactic and therapeutic treatment Download PDF

Info

Publication number
WO2015196146A2
WO2015196146A2 PCT/US2015/036798 US2015036798W WO2015196146A2 WO 2015196146 A2 WO2015196146 A2 WO 2015196146A2 US 2015036798 W US2015036798 W US 2015036798W WO 2015196146 A2 WO2015196146 A2 WO 2015196146A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
composition
cpg
nanostructure
triangle
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/036798
Other languages
French (fr)
Other versions
WO2015196146A3 (en
Inventor
Peixuan Guo
Hui Li
Emil KHISAMUTDINOV
Daniel JASINSKI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Kentucky Research Foundation
Original Assignee
University of Kentucky Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Kentucky Research Foundation filed Critical University of Kentucky Research Foundation
Priority to CN201580043770.7A priority Critical patent/CN106795517A/en
Publication of WO2015196146A2 publication Critical patent/WO2015196146A2/en
Publication of WO2015196146A3 publication Critical patent/WO2015196146A3/en
Priority to US15/383,575 priority patent/US10378018B2/en
Anticipated expiration legal-status Critical
Priority to US16/265,154 priority patent/US11060096B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/117Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/60Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6025Nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/64Medicinal preparations containing antigens or antibodies characterised by the architecture of the carrier-antigen complex, e.g. repetition of carrier-antigen units
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/17Immunomodulatory nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/52Physical structure branched

Definitions

  • RNA-based compositions including immunostimulatory R -contaimng compositions and RNA nanoparticle- containing compositions, methods of making the compositions, and use of RNA -based adjuvants for prophylactic and therapeutic treatment.
  • HIV/AIDS immunodeficiency virus infection / acquired immunodeficiency syndrome
  • RNA Ribonucleicacid
  • RNA roiling cycle transcription lias been utilized to generate RNA sponges (22,23).
  • RNA tectonics approach structural motifs like double helices, loops and junctions can be isolated from iarge and complex RNA molecules appearing in structural data bases and used to build artificial nanostructures by manipulating their interchangeable units (24,25).
  • RNA nanoparticles e.g.
  • RNA nanoparticles one that uses naturally-selected stable RNA building blocks for structure building
  • the example is the 3WJ motif from pRNA of bacteriophage phi29 DNA packaging motorioaal nucleic acids.
  • the aim is to design nanostructures that undergo self-assembly in controllable and recyclable fashion
  • a new approach is needed to increase overall stability of RNA nanoparticles, one that uses naturally- selected stable RNA building blocks for structure building.
  • An example is the 3WJ motif from pRNA of bacteriophage phi29 D A packaging motor.
  • thermodynamic stability of the 3W.T is entropy driven. (37).
  • Stable RNA. polygons have the potential to serve as a ne w generation of deli very systems for immunomodu!ators.
  • compositions and adjuvants useful for prophylactic and. therapeutic treatment including immunostimulatory RN - conteining compositions and RN A nanopatticle-coniaining compositions.
  • the compositions disclosed herein are safe, effective, versatile, and easy to manufacture, offering new solutions to address unmet needs associated with current approaches to vaccine design and
  • RNA thai can be used as a construction material and/or immunostimulatory agent for the development, of novel nanovaccines and adjuvants for disease prevention and treatment.
  • composition which is comprised of an R A-oiigonudeoiide, which can be single-stranded or double stranded, and an immunostimulatory motif.
  • the RNA-oIigomicIcotide includes a chemical modification, hi some preierrend embodiments, the chemical modification is selected from 2'Fluoro, 2 'Amine, and 2O-Methyl in some ebodiments, the RNA-o!igonue!eotide is about 8-50 bases in length. In some embodiments, the RNA-oligonucIeotide is partially double stranded, for example containing a hair-pin.
  • the immunostimulatory motif is immunostiniulatyory
  • the immunostimulatory motif is conjugated to the RNA-oligonisekxrtide. In some embodiments the immunostiraulatory motif is oligodeoxyriboaucfeotidc. la some embodiments, the
  • composition is provided as an adjuvant
  • the presently-disclosed subject matter includes an artificial RNA
  • the nanostructure comprising multiple external strands and one internal strand, wherein the external strands and internal strand self-assemble to form, a nanostructure.
  • the multiple external strands can, for example, be 3, , or 5 strands.
  • the external strands comprise about 48 nucleotides; and in some preferred embodiments, the nanostructure comprises a p NA 3WI motif at each vertex,
  • the artificial RNA nanostructure is a triangle and has a stretched intrahelical angle between HI and 112.
  • the nanostmctitre is a square and has a stretched intrahelical angle between H and H2.
  • nanostructure is a pentagon and has a stretched intsaheiical angle between HI and H2.
  • the A natiostructure is selected from RNA triangle, RNA square, RNA pentagon, RNA hexagon, RNA three-way junction, and RNA four-way junction.
  • the RNA nanostructure is derived from a 3WJ motif.
  • the RNA nanostructure contains a stretched iiitraiielical angle between HI and H2, as exemplified in Figure ⁇ .
  • the subject matter relates to a composition comprising an RNA nanostructure that includes an adjuvant, an antigen, and/or a targeting ligand.
  • the composition induces an immune response.
  • the immune response increases cytokine at least ten fold as compared to the adjuvant, the antigen, and/or the targeting ligand provided independently of the RN A nanostructure.
  • the adjuvant is a composition comprising an RNA-oligonncleotide and an immunostimiiiatory motif.
  • the RNA- oligonucleotide and immunostirau!atory motif are incorporated into the RNA nanoparticlc by the R A-oligonucleotide being covalently bonded to an RNA strand of the R ' NA
  • the RNA-oligonucleotide and immunostimulatory motif are incorporated into the RNA nanoparticle by base pairing between the RNA- oligonucleotide and the RNA nanoparticle.
  • the adjuvant is selected mimunosttmulatory RNA (tsR ' NA), and in some embodiments the adjuvant is a CpG oh odeoxyriboniicleotide.
  • the adjiivant is isR A that is about 8 to about 50 bases in length.
  • the adjuvant is CpG RNA.
  • the adjuvant is covalently bonded to an R A strand of the RNA nanoparticle.
  • the adjuvant is incorporated into the RNA nanoparticle by base pairing.
  • the RNA nanostructure includes an antigen, in some embodiments, the antigen is derived from a bacteria, virus, or cell. In some embodiments, the antigen binds to a neutralizing antibody or an inhibitory antibody. In some embodiments, the antigen is a neutralizing epitope, in some embodiments, the antigen is selected from: B-eeli epitope, T-cell epitope, T-helper epitope, epitopes derived from PG 120, gp ieptopes, glycans, peptides, T-helper peptides, and streptavidin.
  • the RNA nanostructure includes a targeting ligand.
  • the targeting Hgand is selected from: an aptamer, a ceil surface marker, folate, siRNA and shRNA.
  • the aptamer binds to an HIV epitope, i other embodiments, the cell surface marker is a macrophage or lymphocyte.
  • the targeting ligand targets B cells, T cells, dendritic ceils, macrophages, and/or cancer cells. In some embodiments, there are more than one targeting ligand.
  • the targeting ligands are the same. In other embodiments, the targeting Ugands are not all the same.
  • the presentl disclosed subject matter also related to a method of inducing art immune response in a subject, comprising administering to the subject an effective amount of the compositions of the present invention.
  • the method comprises administering an RNA-oligoniicleotide and an immunostimulatory motif.
  • the method comprises administering a composition comprising an RNA nanostrueture and an adj vant, aa antigen, and/or a targeting ligaad.
  • the presently disclosed subject matter is directed to a method of inducing the production of cytokines.
  • the cytokines include THF-ahpha, lL-6 and/or IL-l 2.
  • the method comprises administering an R A-oligonucleottde and an immuoosti initiatory motif, in some embodiments, the production of cytokines is increased at least ten fold as compared to the imr mosti alatory motif provided independently of the RNA-o ' ligonucleotide.
  • the method comprises administering a composition comprising an RNA nanostrueture and an adjuvant, an antigen., and/or a targeting ligand.
  • the inducing the production of cytokines is increased at least ten fold as compared to the adjuvant, the antigen, and/or the targeting ligand provided independently of the RNA nanostrueture.
  • administering the compositions of the presently disclosed subject matter to a subject induces the production of high affinity neutralizing antibodies or inhibitory antibodies.
  • the subject has or is at risk of having a pathol gical condition.
  • the pathoiogicai condition is cancer, human immunodeficiency vims (HIV), influenza, or drug and substance abuse.
  • compositions of the presently disclosed su bject matter is used for the manufacture of a medicament useful for the treatment of a pathoiogicai condition in a subject.
  • the medicament is used prophy!actically.
  • the method of making an RNA nanostructure includes mixing cquimoiar concentrations of a multiple of external RNA strands, and one internal RNA strand to make a mixture, annealing the mixture,, and cooling the mixture slowly.
  • the mixture is cooled at about ⁇ °C- per minute.
  • the mixture is cooled from about 8(TC to about 4 f! C. in some embodiments, the mixture is annealed for about one hour.
  • the method includes modifying one or more of the external strands to contain an antigen, adjuvants and/or targeting ligand.
  • the external strands comprise about 48 nucleotides, in some
  • the nanostructure produces by the method comprises a pRNA 3WJ motif at each vertex.
  • the nanostructure had a shape selected form, a triangle, square and pen tagon.
  • the shapes produced b the method have a stretched intraheiieai angle between HI and H2.
  • FlGs. 1A and IB include details of the structural features of the pRNA 3WJ motif.
  • B Tertiary structure of the 3WJ motif with indication of the AOB ⁇ 60° angle formed between H 1 and H2.
  • the ZAOB Angle corresponds to inner angles of polygons.
  • FiGs. 2A-2C include the design of RNA nanostructure polygons and assembl properties.
  • A 3D modeled structures of polygons with 3WJ motif located at vertices, inner angle corresponds to ZAOB 60 » .
  • B The increasing length of the interna! strand stretches the 3WJ ZAOB at which the nanoparticlcs assemble, along with increasing number of external 'short' strands.
  • FIG. 3 Includes structural characterization of polygons, (A) Atomic Force
  • ⁇ 002S ⁇ FiGs. 4A and 4B include a comparison of polygon stabilities, (A) Melting temperatures of triangle, square and pentagon measured by 7% perpendicular TGGE and (B) boiling resistance assay in absence and presence of 8 M urea. Calculated percentage of recovery for polygons after boiling is shown below each gel with error bars calculated from several independent experiments.
  • FIGs. 5A-5D illustrate the effect of cytokine induction in macrophage-like
  • RNA-CpG polygons RAW264.7 cells and mice by RNA-CpG polygons, induction of (A) TNF-a and (B) IL-6 cytokines by 50 nM RNA polygons-CpG.
  • C Dependences of TNF-a induction with the number of CpGs per RNA polygon. The error bars represent standard deviation from at least three independent experiments.
  • D Iramunostmrnlatory activity by triangle-CpG nanoparticle in animal model. The error bars represent standard deviations of two independent measuremen ts of the cytokine levels from serum aliquots of the tested mouse. ⁇ 0030J FiGs. 6A and ⁇ >B include a comparison of RNA poly ori-CpG complexes binding to the cells.
  • FIGs. 7A-7D include RNA polygons dissociation constan determination at equilibrium state. These are 7% native PAGE titration data tor formation of triangle (a), square (b), and pentagon (e) polygons. Below, the gels is the plot used to determine the equilibrium concentration for each polygon which were then used to calculate the apparent dissociation constant.
  • FIGs. 8A-8C include sequences and secondary structures of RN A polygons.
  • FIG. 9A- C include RNA polygons population on mica surface AFM image of RNA polygons and population distribution of RNA triangle (a), square (b), and pentagon (c) polygons in 0.5 mnV area of AFM mica surface. Error represents counts from several independent images.
  • FIG. lOA and 10B include secondary structure of triangle-CpG naooparticle and characterization, (a) 2D structure of RNA triangle harboring 3 CpG adjuvants. Note: Arrows indicate to base pairs that have been deieted in RNA triangle na iopartiele use for animal confocal microscope, and cytotoxicity studies, (b) This is 4% agarose gel showing assembly of RNA triangle nanoscaffold with CpG adjuvants, (c) DLS characterization of the tnangle-3CpG complex showing apparent hydrodytianiic diameter of around 14 nm. The error represents standard deviation .from several independent measurements.
  • FIG. 11 includes the secondary structure of a square-CpG nanoparticie and characterization, (a) 2D structure of RNA square harboring 4 CpG adjuvants, (b) This is 4% agarose gel showing assembly of RNA square naiioscaffoid with CpG adjuvants, (c) DLS characterization of the square-4Cp complex showing apparent hydrodynaraic diameter of around 15 nm. The error represents standard deviation from several independent measurements,
  • FIG. 12 includes the secondary structure of a pe tagon-CpG nanoparticie and characterization, (a) 2D structure of R A pentagon harboring 5 CpG adjuvants, (h) This is 4% agarose gel showing assembly of RNA pentagon naiioscaffoid with CpG adjuvants, (c) DLS characterization of the pentagon-5CpG complex showing apparent hydrodynamtc diameter of around 16 nm. The error represents standard deviation from several independent measurements.
  • FIG. 13 illustrated the effect of RNA-CpG adjuvants on RAW264.7 cell viabiitty.
  • the celts were incubated with different concentrations of RNA polygons only, RNA polygons-CpG complexes, and free CpG.
  • FIG. 14 illustrates the binding effect of RNA polygons harboring CpG adjuvants to RAW264.7 ceils. Concentration dependent binding of (a) triang!e-3CpGs, (b) scfuare-4CpGs, and (c) pentagon- SCpGs nanoparticies.
  • FIG. IS includes the results of a serum stability assay of RNA polygons coupled with CpGs motifs.
  • Preassembled complexes (1 ⁇ ) of RNA triangle, square and pentagon (2'-F modified) harboring DNA CpG were incubated in RPMS-164Q medium containing 1( % fetal bovine serum (Sigma).
  • Aliquots ( 10 pL> were taken at 0 hr, 1 hr, 3 hr, 6 hr, 8hr and 16 hr time points after incubation at 3 ? a C, followed by analysis using 6% native ⁇ 0040 ⁇
  • FIG. 16 illustrates thcrmodyoamically stable RNA nanoparticles for efficient delivery of iramunostimulaiory CpG oligonucleotides, RNA or antigen to immune cells,
  • FIG. 17 depicts RNA and DNA sequence for triangle-3CpGs
  • FIG. 18 depicts CpG only, a nanostructure RNA triangle only, and a RNA nanostructure triangle with optionally one. two and three CpGs.
  • FIG. 19 ThcrmodynaraicaUy stable RNA three-way junction (3WJ) for efficient delivery of immunosrimulatory CpG oligonucleotides, RNA or antigen to immune cells.
  • 3WJ ThcrmodynaraicaUy stable RNA three-way junction
  • FIG. 20 Depicts a bowtie-!ike RNA uanoparttcle triangle di titer for delivery of 4CpG.
  • the size of the uanopartick is twice as trianbk (about 20nro S 5 nm).
  • FIG. 21 shows RNA triangle, square and pentagon nanoparticles harboring different numbers ofCpGs and Cy 3 -labeled ON As
  • FIG. 22 depicts a RN A nanoparticie for anticancer vaccine or
  • FIG. 23 depicts a 3WJ nanovaccine containing CpG-ODN adjuvant and antitumor antigen and a 4WJ nanovaccine containing CpG-ODN adjuvant and antitumor antigen
  • FIG. 24 depicts a Triangle RN A nanostructure harboring CpG-G ODN and siRNA
  • ⁇ 0049 ⁇ BIG. 25 depicts the assemblies of RNA nanostructure traingles harboring
  • FIG, 26 shows AFM images of RNA nanostructure triangles harboring three
  • FIG. 27 shows AFM images of RN A nanostructure triangles harboring three
  • FIG. 2$ shows AFM images of RNA nanostructure triangles harboring three
  • FIG. 29 shows AFM images of RMA nanostnictitre itiatigies harboring' three
  • FIG. 30 shows AFM images of RNA nanostructure triangles harboring three
  • FIG.31 shows detailed AFM images of RNA nanostructure triangles harboring three CpGs and a scheme of the CpG harboring R A triangle.
  • Triangle with 2 CpG ODN can be successfully purified and imaged by AFM.
  • the image shows that triatigie-CpG assemble well and most of the particles are shown as triangular shape.
  • the diameter of triangle with 3 CpG is around 30 am, a bit larger than the original triangle.
  • FIG. 32 provides Dynamic Light Scattering (DLS) data showing the mean diameter of triangle-SCpGs of 16.7nM and its agreement with ATM imaging data.
  • DLS Dynamic Light Scattering
  • FIG. 33 shows how the RNA nanostructure triangle protects CpG
  • FIG. 34 is a Temperature Gradient Gel Elecctropheresis (TGGE) of R A nanostructure triangle harboring CpG oligonucleotides over increasing temperatures from 3(fC to 8iFC,
  • FIG. 35 includes a chart of relative cell viability vs. concentration from investigation of toxicity of RNA Triangie-CpG.
  • FIG.36 is a fiovvcytometry study of 3O0 «M triangle RNA harboring different numbers of CpGs binding to raw 264.7 ceils. Positive binding: Triangle- 1 CpG 300n.M - Triang!e-2CpGs 300 aM - Triangle-3Cpgs 3 ⁇ K>n CpG 300oM, (00611).
  • FIG.37 is a flowcytometry study of 1 SOOnM triangle RNA harboring different numbers of CpGs binding to raw 264.7 cells. Positive binding: Triangle- ⁇ CpG
  • FIG. 38 is a flowcytometry stud of 75nM triangle RNA harboring different mimbers of CpGs binding to raw 264.7 ceils. Positive binding: Triangle- iCpG 75nM ⁇
  • FIG.39 is a flowcytometry study of 37.5nM triangle RNA harboring different numbers of CpGs binding to raw 264.7 cells. Positive binding: Triangle- 1 CpG 37.5 n - Triangle 2CpGs 37.5«M - Triangle-3CpGs 37.5nM > CpG 37.5n .
  • FIG. 40 is a flowcytometry studying different concentration of triangle- 1 CpG binding to raw 264,7 cells. Positive binding: Triangle- 1 CpG 300nM > Triangle- 1 CpG
  • FIG. 41 is a flowcytometry studying different concentration of triangle-
  • FIG. 42 is a flowcytometry study ing different concentration of triangle-
  • FIG. 43 is a flowcytometry studying different concentration of CpG binding to raw 264.7 cells. Positive binding: CpG 300BM > CpG 130n > CpG 75nM > CpG 37.5n .
  • FIG. 44 includes a table showin differing concentrations of CpG, Triangle-
  • FIG. 45 is a flowcytometry comparing square RNA harboring different number of CpGs binding to raw 264.7 cells. Positive binding; Square- 1 CpG- - Square-
  • FIG. 46 is a flo cytometr comparing pentagon R A harboring different number of CpGs binding to raw 264,7 cells. Positive binding: Pentagon-SCpG ::: Pentagon-
  • FIG. 48 includes confocal imaging of triangie-CpG interacting with raw ceils.
  • FIG. 4.9 includes confocal imaging of triangie ⁇ €pG interacting with raw ceils.
  • FIG. 50 provides fluorescent imaging of nwrphology changes of triangle-
  • CpG induced raw celis Upon treatment with triangie-CpG or CpG, the cell morphology changed ftOtti a round form to an elongated form with more spreading and forming pse dopodia.
  • FIG. 51 includes results of TNF-aipha cytokine ELISA assay for I ⁇ Triangle
  • FIG. 52 depicts IL-6 cytokine ELISA assay for 1) Triangle -CpG compared to Triangle R A, CpG, cell only, and blank medium and 2) increasing concentration of Trtangle-CpG.
  • FIG. 53 provides a chart comparing TNF-alptia cytokine ELISA assay for
  • FIG. 54 provides a chart comparing TNF-alpha cytokine ELISA assay for
  • FIG. 55 provides a chart comparing TNF-alpha cytokine ELISA assay for
  • RNA pentagons harboring different numbers of CpG harboring different numbers of CpG.
  • FIG. 56 provides a schematic showing self-assembly of RNA triangle nauostmcture harboring CpG R As, and the CpG RNA sequences with 21 nucleotide overhang and 5U linker.
  • FIG. 57 pro ides the sequence of A21 CpGRNA, the 63 nucleotide DNA, the
  • FIG. 58 provides the sequence of B2 i CpGRNA, the 63 nucleotide DN A, the
  • FIG. 59 provides the sequence of C 1 CpGRNA, the 63 nucleotide DNA, lite
  • FIG. 60 is the PCR of the DNA fempiates for A21 , B21. and C21 CpG RNA .
  • FIG. 61 is the image of 2'F CpG RNA made by in vitro transcription.
  • FIG. 62 provides a summary of data of the cytokine testing of 2'F RNA triangle harboring DNA CpG, DNA triangle harboring DNA CpG, and 2'F RNA triangle harboring 2'F RN CpG.
  • SEQ ID NO 1 is an exemplary RNA sequence for Triangle short strand A used in assembly of an RNA triangle nanostructure.
  • SEQ ID NO 2 is an exemplary RNA sequence for Triangle short strand B used in assembly of an RNA triangle nanostructure.
  • SEQ I ' D NO 3 is an exemplary RN A sequence for Triangle short strand C used in assembly of an RN A triangle nanostructure.
  • ⁇ 0091 ⁇ SEQ ID NO 4 is an exemplary RN A sequence for Triangle long strand D used in assembly of an RNA triangle nanostructure.
  • SEQ ID NO 5 is an exemplary RNA sequence for Square short strand A used in assembly of an RNA square nanostructure.
  • SEQ ID NO 6 is an exemplary RNA sequence for Square short strand B used in assembly of an RN A square nanostructure.
  • SEQ ID NO 7 is an exemplary RNA sequence for Square short strand C used in assembly of an RNA square nanostructure.
  • SEQ ID NO 8 is an exemplary RNA sequence for Square short strand D used in assembly of an RNA square nanostructure.
  • SEQ ID NO 9 is an exemplary RN A sequence for Square long strand E used in assembly of an RNA square nanostructure.
  • j0097j SEQ ID NO 10 is an exemplary RNA sequence for pentagon short strand A used in assembly of an RN A pentagon nanostructure.
  • SEQ ID NO 1.1 is an exemplary RNA sequence for pentagon short strand B used in assembly of an RNA pentagon nanostructure
  • SEQ ID NO 12 is an exemplary RN A sequence for pentagon short strand C used in assembly of an RNA pentagon nanostructure.
  • SEQ ID NO 13 is an exemplary RN sequence for pentagon short stand D used in assembl of an RNA pentagon nanostrucfure.
  • [OOlO!j SEQ ID NO 14 is an exemplary R A sequence for pentagon short strand E used in assembly of an RNA pentagon nanostructure.
  • SEQ ID NO 15 is an exemplary RNA sequence for pentagon long strand F used in assembly of an RNA pentagon nanostructure.
  • SEQ ID NO 16 is an exemplary strand A21 CpG RNA.
  • SEQ ID NO 17 is an exemplary strand A21 CpG DNA
  • SEQ ID NO 18 is an exemplary strand 821 CpG RNA.
  • SEQ ID NO 19 is an exemplary st and B21 CpG D A.
  • SEQ ID NO 20 is an exemplary strand C21 CpG RNA.
  • SEQ ID NO 21 is an exemplary strand. C2i CpG DNA .
  • SEQ ID NO 22 is an exemplary RNA sequence Tri A-Cpg for assembly of
  • SEQ ID NO 23 is an exemplary RN A sequence Tri B-CpG for assembly of
  • SEQ ID NO 24 is an exemplary RNA sequence Tri C-CpG for assembly of
  • SEQ ID NO: 25 is a 63 nucleotide D A sequence including the sequence of
  • SEQ ID NO: 17, and SEQ ID NO: 26 and SEQ ID NO: 27 are 5'- and 3 ' -primers, as set forth in FIG. 57.
  • SEQ ID NO: 28 is a 63 nucleotide DNA sequence including the sequence of
  • SEQ ID NO: 1 and SEQ ID NO: 29 and SEQ ID NO: 30 are 5'- and 3 '-primers, as set forth in FIG. 58.
  • ⁇ 00114 ⁇ SEQ ID NO: 31 is a 63 nucleotide DNA sequence including the sequence of
  • SEQ ID NO: 21, and SEQ ID NO: 32 and SEQ ID NO: 33 are 5'- and 3 '-primers, as set forth in FIG. 59,
  • nucleotides and polypeptides disclosed herein are included in publicly-available databases, such as GENBANK-& and SWISSPR.OT.
  • ⁇ 001 1 As used herein, the term "about,” when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ⁇ 20%, in some embodiments ⁇ 10%, in so me embodiments ⁇ 5%, in some embodiments ⁇ 1%, in some embodiments ⁇ 0.5%, and in some embodiments ⁇ 0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
  • ranges can be expressed as from “about” one particular value, and/or to "about” another particular value, it is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed, as “about” thai particular value in addition, to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed, it is also understood that each unit between two -particular units are also disclosed. For example, if .10 and 15 are disclosed, then i 1, 12, 13, and 14 are also disclosed.
  • compositions and adjuvants useful for prophylactic and therapeutic treatment including immunostimulatory RNA- containing compositions and RNA nanoparticle-eontaining compositions.
  • the compositions disclosed herein are safe, effective, versatile,, and easy to manufacture, offering new solutions to address unmet needs associated with current approaches to vaccine design and
  • RNA can be used as a construction material and/or iniraunostiroulatory agent for the development of novel nanovacdnes and ad juvants for disease pre vention and treatment.
  • RNA nanoparttc!es composed of RNA, CpG D , peptide antigen or protein antigen can be pre-designed in silica and fabricated by thermodynamieally- driven self-assembly.
  • the fabricated RNA. nanopartiele-based nanovaeeme and adjuvants have pre-defined stoichiometry, size and structure, and are also ttemiodynamicaliy ultrastable and resistant to degradation in serum.
  • RNA nanoparticie-based nanovaccines and adjuvants could also be conjugated to a variety of targeting ligands for targeting to 8 ceils, T ceils, dendritic ceils, macrophages and cancer cells.
  • the targeting ligands include but are not limited to filiate and RNA aptamers and DNA aptamers. I certai embodiments, multiple targeting ligands can be conjugated to one nanopartiele to enhance the targeting efficacy.
  • ssRNA, dsRNA and siRNA have bee shown to have inimiinostimulaiory activities.
  • the present invention relates to an vmmunostimulatory agent containing chemically modified RNA.
  • the chemically modified RNA contains immunostimulatary motifs which include, but arc not limited to the CpG motif.
  • the invention furthermore relates to vaccine and adjuvant platforms that use the imimmosttmulafory RNA as one of the platform
  • the inimunostimulatory RNA can also be incorporated into
  • RNA nanopart cles composed of RNA, CpG DNA impress peptide antigen or protein antigen to form nanovaccines.
  • the fabricated RNA nanoparticle-based nanovaccme and adjuvants have pre-defined stoichiometty, size and structure, and are also thcrmodynamically uitrastab!e and resistant to degradation in serum.
  • the immune response induced by the immunostiraulatory RNA platform will be greatly enhanced compared to CpG DNA only and antigen only.
  • the immuaosttmulatory RNA platform could also be conjugated to a variety of targeting iigands for targeting to B cells, T ceils, dendritic cells, macrophages and cancer cells.
  • the targeting iigand include but are not limited to folate, siRNA, shRNA, RNA aptamers and D A aptamers.
  • multiple targeting Iigands can be conjugated to one platform to enhance the targeting efficacy.
  • the vaccine platform according to the invention and the adiisvaiits platform according to the invention are employed to treat or prevent various diseases including, but not limited to cancer, immunology, respiratory, central nervous system., inflammatory, cardiovascular, infectious diseases and drug and substance abuse.
  • RNA-based compositions disclosed herein including RNA-nauoparticle- contaimng and RN A ⁇ oiigomieleotide ⁇ eoniaining compositions, have a number of advantageous features. Such advantages include the following.
  • compositions have defined size, structure and stoicbionietry, such that unpredictable side effects arising from heterogeneous panicles can be avoided.
  • multiple antigen and adjuvants could be incorporated into one particle for achieving synergistic or enhanced immune repose such as cytokine induction and antibody production.
  • the nanosize of the particles will facilitate tissue penetration and target to important immune tissues or organs such as lymph nodes for achieving targeted and enhanced immune stimulation.
  • Multiple targeting ligands cou!d be incorporated into one particle for achieving better targeting to immune cells such as B ceils, T cells, dendritic ceils and macrophages.
  • RNA-based compositions could be performed in a cell-free system: which allows for industrial scale production and avoids possible contamination.
  • R A nanoparticies are highly soluble and not prone to aggregation. They do not require any addition steps, such as linkage to PEG to keep them stable in solution.
  • RNA nanoparlicles are also thennodynamically stable. For example, the triangular shaped RNA nanopartici.es are resistant to boiling.
  • RNA nanoparticies are resistant to 8M urea denaturatton. Thus R A nanoparticies will remain intact and not disassociate at ultra-low concentrations in vivo.
  • 2T-modified RNA-based compositions for example, are resistant to degradation in serum and stable in the blood.
  • the cellular uptake of the RNA nanoparticie-based nanovaccine and adjuvants is greatly enhanced compared to CpG DNA only and antigen only.
  • the inimnnosttmulatory activity of the chemical modified RNA-based compositions disclosed herein is stronger than other adjuvants such as CpG DNA. Due to the larger size of RNA nanoparticie-based nanovaccine and adjuvants compared to antigen and ad juvants onl y, the in vivo half -life of RNA
  • RNA-based nanovaccine and adjuvants is significantly prolonged, offering better pharmacokinetics profiles and better patient compliance.
  • the im unostimi aiory R A can also be incorporated into ultrastable RNA nanoparticies composed of RNA, CpG DNA, peptide antigen or protein antigen to form nanovaccine.
  • the fabricated RNA nanoparticie- based nanovaccine and adjuvants have pre-defined stoichiometry, size and structure, and are also thermodynaniieally ultrastable and resistant to degradation in serum.
  • the immune response induced by the immunostimulatory R.NA platform will be greatly enhanced compared to CpG DNA only and. antigen only.
  • RNA-based compositions disclosed herein are ultrastablc and resistant to degradation in serum, and can be conjugated to iigands to target, for example, B, T, dendritic, macrophage, and cancer cells.
  • composition comprising an
  • RNA-oligonucleotide and an immunostimulator motif.
  • the RNA-oligonucleotide includes a chemical modification selected from 2 ' Fluoro, 2'Amine, and 2'0-Methyi.
  • the RNA-oiigonucleodde is about 5 : , 6, 7, 8, 9, 10, 1 1 , 12, B, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length.
  • the RN A-otigoiutc!eoiide is single- stranded.
  • the RNA-oi tgonucieotide is double-stranded or partially double-stranded (e.g., containing a hair-pin).
  • the immunostimulatory motif is selected from, an immunostimulatory RNA (isRNA) and a CpG oHgodeoxyribonucIeotide (CpG).
  • isRNA can be any isRNA known to the skilled artisan, for example, those set forth in Patent Application Publication Nos. US 2014/0135487 and WO 2003/086280.
  • the immunostimulatory motif is conjugated to the R A-oiigonucieottde.
  • the immunostimulatory motif is CpG conjugated to the RNA- oligonucleotide.
  • the composition including an RNA -oligonucleotide and an immunostimulatory motif is provided as an adj u vant in some embodiment, the immune modulation effect for cytokine induction is increased at least ten fold as compared to the immunostimulatory motif provided independently of the R A-oligonucleotide.
  • the immune modulation effect for cytokine induction and ceil binding i enhanced at least 10, 20, 30, 40, SO, 100, or 200 times.
  • the presently-disclosed subject matter further includes a composition including au ' RNA nanostructure, and au adjuvant, an antigen, and/or a targeting ligand.
  • flic RNA nanostructure is selected from NA triangle,
  • the RNA nanostruemre is derived from, a 3WJ motif.
  • the ' RNA nanostructure can be derived from the 3WJ motif, as described in the Examiners herein.
  • nanostructure can be as described in International Patent Application Publication No. WO 2012/170372.
  • the adjuvant in some embodiments including an adjuvant, is selected from an immunostimulatory RNA (is NA) and a CpG oiigodeoxyribonueleotide (CpG).
  • an isRNA it can be .5, 6, 7, 8, 9, 10, 1.1, 12, 13, 14, .15, 1.6, 17, 18, 19, 20, 21 , 22, 23, 24 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases in length.
  • the isR A is about 8-30 bases in length.
  • the adjuvant is is ' RNA and the isRNA. is incorporated into the RNA nanoparticle by base pairing.
  • the adjuvant is.RNA and the is ' RNA is incorporated into the R.NA
  • the adjuvant is the composition as described hereinabove, including an RNA- oHgo icleoiide and an immunostimuiatory motif.
  • the RNA- oligonucleotide and iromunosii uiatory motif are incorporated into the RNA nanoparticle by- base pairing between the RNA-oiigonucieotide and the RNA nanoparticle-
  • the RNA-oiigonucieotide and i mmunostimulatory motif are incorporated into the R.
  • the antigen is derived from a bacteria, virus, or cell. In some embodiments, the antigen binds to a
  • the antigen is a neutralizing epitope, in some embodiments, the antigen is selected from: B-celi epitope, T ⁇ cell epitope, T-helper epitope, epitopes derived from PG120, gp41eptopes, glycans, peptides, T-helper peptides, streptavidia
  • the targeting ligand is selected from: an aplamer, a cell surface marker, and a cancer cell.
  • the targeting ligand is an aptarner
  • the aptamer binds to an HIV epitope.
  • the targeting ligand is a cell surface marker
  • the cell surface marker is a macrophage or a lymphocyte.
  • the composition includes at least two targeting ligands.
  • the multiple targeting ligands are the same. In some embodiments, not all of the multiple targeting ligands are the same.
  • compositions disclosed herein can be formulated to include a pharmaceutieally-aeeeptable carrier.
  • pharmaceutically acceptable carrier refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconshtution into steriie in jectable solutions or dispersions just prior to use.
  • aqueous and nonaqueous earners, diluents, solvents or vehicles examples include water, ethanoL poiyols (such as glycerol, propylene glycol, polyethylene glycol and the like.), earboxyraethylceilulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate.
  • ethanoL poiyols such as glycerol, propylene glycol, polyethylene glycol and the like.
  • earboxyraethylceilulose and suitable mixtures thereof
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle s ize in the ease of dispersions and by the ose of surfactants.
  • compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be cosured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobittanoi, phenol, sorbie acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like.
  • Prolonged absorption of the injectable pharmaceutical form can he brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption.
  • Injectable depot forms are made by forming microencapsuie matrices of the drug in biodegradable polymers such as polylactide-polygiycolide, poiy(ordioesters) and polyi anhydrides)- Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapptng the drug in liposomes or microemulsions which are compatible with bod tissues.
  • the injectable formulations can be sterilized,, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in. the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use.
  • Suitable inert carriers can include sugars such as lactose.
  • at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
  • the presently-disclosed subject matter further includes methods as disclosed herein.
  • a method of inducing an immune response in a subject includes administering to the subject an effective amount of a composition as disclosed herein.
  • the presently-disclosed subject matter further includes a method of inducing an immune response in a subject, which involves administering to the subject an effective amount of a composition as disclosed herein.
  • the subject has or is at risk of ha ving a pathological condition.
  • the presently-disclosed subject matter ftjrther includes a method of inducing the production of cytokines comprising administering to a subject an effective amount of a composition as disclosed herein .
  • the cytokines include T F-alpha, IL-6 and/or IL-12.
  • the presently-disclosed subject matter further includes a method of inducing the production of high affinity neutralizing antibodies or inhibitory antibodies comprising administering a composition as disclosed herein to a subject having a pathological condition.
  • pathological conditions include, but are not limited to, cancer, immunology,, respiratory, centra! nervous system, inflammatory, cardiovascular, infectious diseases, influenza, human immunodeficiency virus (HIV), and drug and substance abuse, such as cocaine or nicotine abuse.
  • the term "subject" refers to a target of administration.
  • the subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian.
  • the subject of the herein disclosed methods can be a human or non-human.
  • veterinary therapeutic uses are provided in accordance with the presently disclosed subject matter.
  • the presently disclosed subject matter provides for administration to mammals such as humans and non-human primates, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic- importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos.
  • Examples of such animals include but are not limited to; carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; rabbits, guinea pigs, and rodents.
  • carnivores such as cats and dogs
  • swine including pigs, hogs, and wild boars
  • ruminants and or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels
  • rabbits guinea pigs, and rodents.
  • a lso provided is the treatment of birds, including the treatment of those kinds of birds that are endangered and/or kept in zoos, as well as fowl and more particularly domesticated fowl, i.e., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economic- importance to humans.
  • Tims also provided is the treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), poultry, and the like. The term does not denote a particular age or sex.
  • the presently-disclosed subject matter is further illustrated by the following specific but aon-limiting examples. " The following examples may include compilations of data that are representative of data gathered at v arious times during the course of development and experimentation related to the present invention.
  • RNA nanoparticles were delivered to macrophages specifically.
  • the degree of immunostimulation greatly depended on the size, shape and number of the pay load per nanoparticles. Stronger immune response was observed when the number of adjuvants per polygon was increased, demonstrating the advantage of shape transition from triangle to pentagon.
  • thermodynamically stable pRNA 3WJ motif By stretching the 60° AOB angle ( Z) ( Figure 1.) of the thermodynamically stable pRNA 3WJ motif, stable RNA architectures can be designed. We demonstrate that it can he stretched to wide conformations resulting in different 2D polygons; triangle (ZAOB - 60 ), square (ZAOB ⁇ 90°) and pentagon ( ZAOB - 108°). Intermoiecular interactions such as kissing loops, receptor loop, or 'sticky-ends' were avoided by introducing linkages through base pairing between corners of the polygons using RNA double helices. Therefore, this system is advantageous with an increased thermo-stability in the overall construct.
  • T F-alplia tumor necrosis factor-alpha
  • I ' L-12 interleukin- 6 fiL-6
  • lFN mterferoa
  • RNA CpG The characteristic of RN A that differentiates it from DNA is the 2 '-hydroxy! (2'-OH) on each ribose sugar of the backbone.
  • the 2' -OH group offers RNA a special property. From a structural point of view, the advantage of mis additional hydroxy 1 group is that it locks the ribose sugar into a 3'-endo chair conformation.
  • RNA double helix is more thermodynamicaliy stable than the D A double helix considering AGO for RNA double helix formation is -3.6 to -8.5 kimol- 1 per base pair stacked and AGO for DNA double heiix formation is -1.4 kJmol-1 per base pair stacked. Moreo ver, the presence of special structures such as bends, stacks, j unctions and loops in the 3D strueiure of RNA as well as various proteins and metal ions may also further improve its stability. Similar to DNA CpG sequence, RNA CpG sequence can also induce immune response and can be appl ied to the development of cancer immunotherapy and vaccine adjuvants.
  • RNA polygons were assembled in one pot by mixing equimoiar
  • RNA concentrations (fmal concentration of 1 IIM) of four RNA strands for the triangle,, fi ve RNA strands for the square and six RNA strands for the pentagon in is " IMS buffer (50 mM TR1S pH 8.0, 100 mM NaCl and 10 mM MgCi2), Samples were annealed for I h in a thermocycler with controlled, slow cooling (i°C/min) from 80 to 4°C. All RNA polygons harboring CpG ODNs were assembled from their corresponding 2'F-IJ/C modified strands in one pot. (00149] The three short NA strands and one long RNA stands for assembly of the
  • RNA olygon are provided in Table I.
  • Table 4 provides sequences for CpG motifs.
  • Table 5 provides the sequences for the RNA Triangle harboring the RNA
  • RNA assemblies were evaluated on 7% (29: 1 ) native poly-aery! amide gels in the presence of 0.5 x TMS buffer. Gels were run at constant 90 V, ⁇ °C. Gels were imaged with Typhoon FLA 7000 fGE Healthcare) to visualize RN A strands. Temperature gradient gel electrophoresis (TGGE) analysis was performed on 7% native PAGE in a buffer containing 50 KIM TR1S pH 8.0, .100 mM NaCl and 0.2 mM MgC12neig as previously described ( 4,26,28 ). A gradient temperature o 30-70° € was applied perpendicular to electrical current and the experiment was run for I h at 20 W.
  • TGGE Temperature gradient gel electrophoresis
  • RNA concentration of 100 aM was used in TGGE analysis.
  • Apparent TM values corresponded to the temperature at which half of the polygons fractions were dissociated and apparent D values for multiple RNA strands were calculated, as described pre viously (7).
  • Modified Eagle's Medium supplemented with H)% fetal bovine serum, .100 units/ml penicillin and 100 rag/m! streptomycin at 37°C in humidified air containing 5% C02. Cells were then seeded on 24-welI plates or 96-welf plates at a density of 5 x 105 cells/ml and cultured overnight before use.
  • RAW 264.7 cells were plated into 24-we!I plates with the density of 2.5 x 105 cells per well and cultured overnight. Then, RNA nanoparticles harboring different numbers ofCpO ODNs were dilated in Opti-MEM medium (Life Technologies Corporation, Carlsbad, CA, US A) and. added to the cells. The cells were continually cultured for 8 h at 37°C in humidified air containing 5% C02, and the cell culture supernatant were collected and stored at -SfPC until use.
  • Opti-MEM medium Life Technologies Corporation, Carlsbad, CA, US A
  • the concentration of TNF-a and lL- in the supernatant were determined by enzyme-linked immunosorbent assay (E.L1SA) using Mouse ELiSA MAXTM Deluxe sets (BioLe-gend, Inc., San Diego, CA), foS lowing protocols provided by the manufacturer.
  • R triangular nanoparticles harboring CpG ODN, RNA triangular nanoparticles, or CpG ODN were dissolved in phosphate buffered saline (PBS) and administrated to the .mice via tail vein injection at 2 mg/kg (CpG ODN per body weight). The same volume of PBS was injected into a mouse as a control. Blood samples were collected 3 h post-injection by cardiac puncture.
  • PBS phosphate buffered saline
  • Scrum was prepared by centrifitgafioti. at 12 800 g for 10 mm. Serum TNF-a and IL-6 levels were determined by cnzytne-litikcd immunosorbent assay (EIJSA) -using Mouse ELISA MAXIM Deluxe sets (BioLegend, inc., San Diego, CA, USA), following protocols provided by die manufacturer.
  • EIJSA cnzytne-litikcd immunosorbent assay
  • RAW 264.7 cells were seeded on glass coversiips in 24-well plates and cultured at 37 & C in humidified air containing 5% C02 overnight The culture medium was removed and the cells were washed with Opti-MEM medium twice to remove dead cells. RNA oanoparttcles harboring Cy3-labeled CpG DMA or Cy3-!ab!ed CpG DNA only were diluted in Opti-MEM medium and added to the cells. After 4 h incubation at 37°C in humidified air containing 5% C02, the cells were washed twice with PBS and fixed with 4% formaldehyde. ProLong Gold Antifade Reagent with DAPI ⁇ Life Technologies
  • RNA polygons were imaged with MnitiMode AFM anoSeope IV system
  • RNA samples were diluted with I * IMS buffer to a final concentration of 3-5 nM. Then, droplets of samples (5-10 L) were immediately deposited on APS mica. After 2 min incubation on the specifically modified APS mica surfaee(4 ! ;42), excess samples were washed with DEPC treated water and dried under a flow of Argon gas. AFM images in air were acquired using Mu ode AFM NanoScope IV system (Vceco Digita Instruments, Santa Barbara, CA) operating in tapping mode.
  • RNA nanopaifieies harboring CpG OD.Ns were evaluated with an MTT assay kit (Promega, Madison, Wl), according to the protocol provided by the manufacturer. Briefly, RAW 264.7 cells were seeded at 96 well plates and cultured overnight at 37 C in humidified air containing 5% CQ2. RNA nanoparticles harboring CpG ODNs and controls were dissolved in fresh cell culture medium at the indieated concentrations and added to the cells for incubation at 3?*C for 24 h.
  • RNA polygons triangle, square and pentagon fabrication and self-assembly
  • vertex refers to a point of an angle, such as ZAOB
  • vertex refers to a corner of a polygon.
  • the triangular polygon defined by internal strand D and external strands A, B, and C includes three vertexes; the square polygon defined by internal strand R and external strands A , B, C, and D, includes four vertexes; and the pentagon polygon defined by interna! strand F and external strands A, B, C, D, and E, includes five vertexes.
  • Each polygon was composed of a different number of RNA strands classified as short strands (external) and long strands (internal) ( Figure 2B).
  • the tension on the inter-helical ZAOB increased to 60°, 90° and 108°, allowing for 2D formation of corresponding triangle, square and pentagon shapes.
  • DLS was performed to determine the apparent hydrodynamic diameters for each of the polygons.
  • the diameters were found to be 9.1 , ⁇ 1.2 and 13.5 nm for triangles, squares and pentagons, respectively ( Figure 3B).
  • the increase in number of 3WJ cores corresponds with the larger observed diameter.
  • the measured diameters agreed with their corresponding 3D models.
  • w!nle AFM imaging can produce images larger than the real diameter due to tip size used (54) and the resolution of imaging equipment. Nevertheless ; the two techniques demonstrated that the relative size of the nanoparticlcs increased from triangle to square to pentagon,
  • the triangular nanoscaffolds were more stable than squares and pentagons, although the number of RNA bp was much, higher in the pentagon construct, as compared to the square and triangle.
  • the stability of nucleic acids with the same base-pair content is directly dependent on metal ton and total nucleic acid concentrations. Since these two criteria were the same, it was assumed that the higher the number of bp in a given RNA structure the higher the stability. Therefore, the most stable shape produced should be the pentagon. However, based on TGGE data the opposite was found. This was iikely due to the tension caused by the stretching of the native pRNA 3Wi 60° ZAOB.
  • TM is the measured temperature when half the RNA concentration has melted, i.e. 50% recovery.
  • the percentage of recovery for square was 28 ⁇ ⁇ 2% and for pentagon was 16 5%, much lower than the value estimated for triangie recovery.
  • immunologic adjuvant CpG ol igonucleotide is an immunological adjuvant popularly used as vaccine adjuvant or immunotherapy reagent for disease control and treatment (42). To evaluate whether RNA polygons can enhance the innmtnomodufation effect, CpG ol igonucleotide is an immunological adjuvant popularly used as vaccine adjuvant or immunotherapy reagent for disease control and treatment (42). To evaluate whether RNA polygons can enhance the innmtnomodufation effect, CpG
  • oligonucleotide was incorporated with each RNA polygon using one-pot self-assembly ( Figures 10-12).
  • the toxicity assay for the resulting complexes revealed no toxicity; moreover the RNA poiygon-CpG complexes induced ceil proliferation during the incubation period, as compared to the ceil only control (figure 13).
  • ⁇ 001 1 J Measurement of the release of T F -alpha and IL-6 cytokines
  • RNA polygons The extracellular imnrunostimulatory efficacy of RNA polygons was evaluated by measuring flic release of cytokines T F-a. and iL-6 after addition to mouse macrophage- like RAW264.7 cell ( Figure 5A and B), as previously described (56 f 57).
  • the triangular RNA nanoparticie coupled with only one CpG exhibited the highest level of cytokine induction for both TNF-a and IL-6 compared to square and pentagonal RNA nanoparticles.
  • RNA particles with the size of about 10 tan, such as the triangle induced the greatest amount of TNF-a and IL-6.
  • the induction of cytokines was highly dependent on the number of CpG per polygon. With increasing number of CpG per polygon, a stronger immune response is observed (Figure 5C), demonstrating an advantage of transiting from triangle to pentagon that can carry five CpG oligonucleotides.
  • RNA nanoparticles were administered to CD-I mice by injection mto the tail vein at 2 mg kg (CpG oligonucleotide per body weight), following l evel determination of cytokine TNF-a and IL-6 levels after 3 h post-administration in collected blood serum.
  • Figure 5D shows that free triangle nanoparticles and free CpGs did not. induce any cytokine production, whereas the complex triangie-CpG resulted in elevated levels of both cytokines.
  • RNA polygons-CpG complexes remain intact after 16 Ii incubation in fetai. bovine serum (FBS indicating robustness of the assembled complex in extracellular environment ( Figure 1 ).
  • FBS bovine serum
  • Figure 1 RNA pol on-CpG complexes exhibit significantly more binding efficiency to cells compared to CpG oligonucleotides alone.
  • RNA nanoparticles with different shape and harboring CpGs have much stronger binding and cellular entry to the maerophage-like RAW 264.7 cells compared to free CpGs.
  • cellular uptake was highly dependent on the number of CpG per polygon. With the increasing number of CpG per polygon, more efficient cell entry was observed (Figure 5C), demonstrating the ad vantage of the transition fro t triangle to pentagon nanopartic!es that can carry five CpG,
  • RNA motifs such as interhelical or intraheUcal distances,, X-Y and X-Y-Z angles, number and orientations of RNA branches in multi-way junctions, canonical and non-canonical interactions, binding sites for proteins, metal tons and small molecules (2,1.0, 16,25,51 ,60).
  • RNA 3D motifs Progression in RNA structural biology allowed for the analysis of RNA 3D motifs from existing RNA structures at atomic resolution and various data bases, including www.pdb.eora, RNA multi-way junction (61 ) and find RNA motif (62),
  • This study based on the previously repotted versatile pR A 3WJ 3D motifs (PDB accession ID: 4KZ2) (10,51), show that the 3WJ structure can be folded into desired conformations based on die dynamics of the 60*ZAOC, demonstrating the ability to tune the physical and structural, properties of RNA polygons for a variety of technological, biological and medicinal needs.
  • the number and combination of therapeutic molecules can be tuned to an RNA-based nano-eamer; (it) the nano-seaffbid has a controllable size and shape and (sii) variable thermodynamic and RNase resistance properties can be appl ied depending on the application of the nano-seaffoid.
  • each RNA polygon has the potential to serve as multivalent nanocarriers of vaccine adjuvants, particularly of CpG oiigodeoxynucieoiides.
  • the designed RNAs sclf-asscrable into distinct, non-toxic
  • RNA nanoparticies harboring CpGs are safe, effective, versatile and easy to manufacture, offering new solutions to address die unmet needs in current vaccines and adjuvants.
  • thermody- namicaity ultra-stable ( 10,1.1 ) and heat-resistant ( 18) R A nanoparticies have expanded the potential for application of pRNA 3W.1 derived nanoparticies in the fields of biomedical, nanotechnoiogy, or polymer industries.
  • GNRA/reeeptor interacting modules versatile modular units for natural and artificial A architectures.
  • RNA as a boiling-resistant anionic poly mer material to build robust stntc gains with defined shape and stoiehiometrv. ACS Nana
  • RNA naaopartielcs for cell entry RNA naaopartielcs for cell entry .
  • TectoRNA modular assembly units for die construction of RNA nano-objects. Nucleic Acids Res., 29, 455-463.
  • RNA 3 ⁇ 4 Chen,C, Shertg,S., Shao,Z. and Guo , ⁇ . (2000) A dimer as a building block in assembling RNA: a hexamer that gears bacterial vims phi29 DNA-translocarina noachinery. J. Biol. Ckem., 275. 17 510-17 516. 31. Cayrol,B., Nogues,C, DawidA. Sagi , Silbcrzan,P. and lsambert,H. (2009) A nanostrueture made of a bacterial noncoding RNA. J. Am. Chew. Sac , 131 , .17 270-17 276,
  • RNAJunction a database of R A junctions and kissing loops for three-dimensional structural analysis and nanodesign. Nucleic Acids Res., 36, ' D392-D397.
  • si. Petrov ,A. ZirbeLC.L. and Leo is,N.B, (201 1 ) WebFR3.D-a server for finding, aligning and analyzing recurrent RNA 3D motifs. Nucleic Acids Res., 39, W50-W55.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

An artificial RNA nanostructure includes multiple external strands of RNA, each external strand including about 40-50 nucleotides, one internal strand of RNA, including more than about 50 nucleotides, the internal strands and external strands assembled to form a triangle nanostructure, a square nanostructure, or a polygon nanostructure and a pRNA three-way junction (3WJ) motif at each vertex of the nanostructure. Such nanostructure can be provided in a composition together with an adjuvant for use in inducing the production of high affinity neutralizing antibodies or inhibitory antibodies, inducing the production of cytokines, and/or inducing an immune response in a subject.

Description

RNA-BASED COMPOSITIONS AND ADJUVANTS FOR PROPHYLACTIC AND
THERAPEUTIC TREATMENT by
Peixuan Guo, Hut Li, Emil Khisamutdtnov, and Daniel jasinski
Assignee: University of Kentucky Research Foundation
Attorney Docket No, : 13177N/I973US
RELATED APPLICATIONS JOOOlf This application claims the benefit of U.S. Provisional Patent Application No.
62/014,503, filed June 19, 2014, the entire diseiosare of which is hereby incorporated by reference.
GOVERNMENT INTEREST
{0002} This invention was made with government support under EB0G3730, EB
0121.35, and CA 151648 awarded by the 'National Institutes of Health. The government 'has certain rights in the invention.
TECHNICAL FIELD
[0 03| The presently-disclosed subject matter relates to RNA-based compositions, including immunostimulatory R -contaimng compositions and RNA nanoparticle- containing compositions, methods of making the compositions, and use of RNA -based adjuvants for prophylactic and therapeutic treatment.
I INTRODUCTION
J0004J Cancer and infectious diseases such as influenza and human
immunodeficiency virus infection / acquired immunodeficiency syndrome (HIV/AIDS) are still a huge threat to public health world-wide. Prophylactic and treatment vaccines could offer promising opportunities for controlling these diseases. However, despite tens of years of extensive research, such vaccines are still far away from completely controlling these diseases due to either low effectiveness or safety issues. New strategies and approaches in designing and developing new vaccines and adjuvants targeting these diseases are urgently needed.
[0O05J The area of hiomimetic nanotechnology involves the construction of nano- scale, supramolecitiar architectures utilizing modular units of functional nucleic acids. The aim is to design nanostructures thai undergo self-assembly in controllable and recyclable fashion, Ribonucleicacid (RNA) was discovered as an attractive material to build
nanoparticles via nanoteclinology (I), offering a variety of structural modules and motifs that can be manipulated into ID, 2D and 3D architectures (for review see (2)). in the past decade, a variety of geometric 'RNA nanoparticles and nano-scaffolds have been obtained via the approaches of hand-in-hand (.1 ,3-5 ), fbot-to-foot (6-9), branch extension ( 10-14), loop- receptor contact (15-17), 'sticky' or 'dangling' ends (6,18,19) and synthetic RNA-protein complex interactions (20), These motifs are available in data bases and can be used to build artificial nanostrneiures by manipulating their interchangeable units (21), Recently, RNA roiling cycle transcription lias been utilized to generate RNA sponges (22,23). In RNA tectonics approach, structural motifs like double helices, loops and junctions can be isolated from iarge and complex RNA molecules appearing in structural data bases and used to build artificial nanostructures by manipulating their interchangeable units (24,25). As such, previously reported designs of RNA nanoparticles, e.g. tecto-square (26), square-shaped nano-scaf ds (27,28), NA nano-rtngs (1,5,7,9) or pRNA dimers, tetraraers and hexaraers (1 ,7,9,2930), as well as RNA nano-cubcs (19), RNA polyhedron ( 14), RNA bundles (6,31) and filaments ( 15, 1 ) -utilize fundamental principles of .RNA structure- and folding (32-36), Overall stability of conventional constructs though, mainly relies on the stability of canonical and non-canonical base pair (bp) forming by loop-loop, receptor-loop, or 'sticky-ends* with a number of pairing nucleotides usually not exceeding six. A ne approach is needed to increase overall stability of RNA nanoparticles, one that uses naturally-selected stable RNA building blocks for structure building, and the example is the 3WJ motif from pRNA of bacteriophage phi29 DNA packaging motorioaal nucleic acids. The aim is to design nanostructures that undergo self-assembly in controllable and recyclable fashion, A new approach is needed to increase overall stability of RNA nanoparticles, one that uses naturally- selected stable RNA building blocks for structure building. An example is the 3WJ motif from pRNA of bacteriophage phi29 D A packaging motor. In addition to discovering that the pRNA-3WJ shows exceptional stability under physiological conditions and in the presence of strong denaturing agent ( 1 , 1 1 ), recent studies also suggest that the
thermodynamic stability of the 3W.T is entropy driven. (37). Stable RNA. polygons have the potential to serve as a ne w generation of deli very systems for immunomodu!ators.
}O006) The presently-disclosed subject matter relates to compositions and adjuvants useful for prophylactic and. therapeutic treatment, including immunostimulatory RN - conteining compositions and RN A nanopatticle-coniaining compositions. The compositions disclosed herein are safe, effective, versatile, and easy to manufacture, offering new solutions to address unmet needs associated with current approaches to vaccine design and
development. SliMMARY
J0007J The presently -disclosed subject matter meets some or ail of the abo ve- identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document.
J 008J This Summary describes several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is l ikewise exemplary. Such an embodiment can typicall exist with or without, the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, tin's Summary docs not list or suggest all possible combinations of such features,
J0609| The presently-disclosed subject matter includes RNA thai can be used as a construction material and/or immunostimulatory agent for the development, of novel nanovaccines and adjuvants for disease prevention and treatment.
{0010} The presently-disclosed subject matter includes a composition which is comprised of an R A-oiigonudeoiide, which can be single-stranded or double stranded, and an immunostimulatory motif.
jO llj in some embodiments, the RNA-oIigomicIcotide includes a chemical modification, hi some preierrend embodiments, the chemical modification is selected from 2'Fluoro, 2 'Amine, and 2O-Methyl in some ebodiments, the RNA-o!igonue!eotide is about 8-50 bases in length. In some embodiments, the RNA-oligonucIeotide is partially double stranded, for example containing a hair-pin.
}0012| In some embodiments, the immunostimulatory motif is immunostiniulatyory
RNA or a CpG oligodeoxyribointcleoiide. In some embodiments, the immunostimulatory motif is conjugated to the RNA-oligonisekxrtide. In some embodiments the immunostiraulatory motif is oligodeoxyriboaucfeotidc. la some embodiments, the
composition is provided as an adjuvant,
}O013) The presently-disclosed subject matter includes an artificial RNA
nanostructure comprising multiple external strands and one internal strand, wherein the external strands and internal strand self-assemble to form, a nanostructure. In some embodiments, the multiple external strands can, for example, be 3, , or 5 strands. In some embodiments, the external strands comprise about 48 nucleotides; and in some preferred embodiments, the nanostructure comprises a p NA 3WI motif at each vertex,
[001 } in some embodiments the artificial RNA nanostructure is a triangle and has a stretched intrahelical angle between HI and 112. In other embodiments,, the nanostmctitre is a square and has a stretched intrahelical angle between H and H2. In other embodiments, nanostructure is a pentagon and has a stretched intsaheiical angle between HI and H2. In some embodiments, the A natiostructure is selected from RNA triangle, RNA square, RNA pentagon, RNA hexagon, RNA three-way junction, and RNA four-way junction. In sortie embodiments, the RNA nanostructure is derived from a 3WJ motif. In some
embodiments, the RNA nanostructure contains a stretched iiitraiielical angle between HI and H2, as exemplified in Figure Ϊ .
{0015} in some embodiments, the subject matter relates to a composition comprising an RNA nanostructure that includes an adjuvant, an antigen, and/or a targeting ligand. In some embodiments, the composition induces an immune response. In some embodiments, the immune response increases cytokine at least ten fold as compared to the adjuvant, the antigen, and/or the targeting ligand provided independently of the RN A nanostructure. In some embodiments, the In some embodiments, the adjuvant is a composition comprising an RNA-oligonncleotide and an immunostimiiiatory motif. In some embodiments, the RNA- oligonucleotide and immunostirau!atory motif are incorporated into the RNA nanoparticlc by the R A-oligonucleotide being covalently bonded to an RNA strand of the R'NA
nanopaniele. In some embodiments, the RNA-oligonucleotide and immunostimulatory motif are incorporated into the RNA nanoparticle by base pairing between the RNA- oligonucleotide and the RNA nanoparticle. in some embodiments, the adjuvant is selected mimunosttmulatory RNA (tsR'NA), and in some embodiments the adjuvant is a CpG oh odeoxyriboniicleotide. In some embodiments, the adjiivant is isR A that is about 8 to about 50 bases in length. In some embodiments, the adjuvant is CpG RNA. In some embodiments, the adjuvant is covalently bonded to an R A strand of the RNA nanoparticle. In other embodiments, the adjuvant is incorporated into the RNA nanoparticle by base pairing.
J0016J in some embodiments, the RNA nanostructure includes an antigen, in some embodiments, the antigen is derived from a bacteria, virus, or cell. In some embodiments, the antigen binds to a neutralizing antibody or an inhibitory antibody. In some embodiments, the antigen is a neutralizing epitope, in some embodiments, the antigen is selected from: B-eeli epitope, T-cell epitope, T-helper epitope, epitopes derived from PG 120, gp ieptopes, glycans, peptides, T-helper peptides, and streptavidin.
.0017 In some embodiments, the RNA nanostructure includes a targeting ligand. In some embodiments, the targeting Hgand is selected from: an aptamer, a ceil surface marker, folate, siRNA and shRNA. In some embodiments, the aptamer binds to an HIV epitope, i other embodiments, the cell surface marker is a macrophage or lymphocyte. I some embodiments, the targeting ligand targets B cells, T cells, dendritic ceils, macrophages, and/or cancer cells. In some embodiments, there are more than one targeting ligand. In some embodiments, the targeting ligands are the same. In other embodiments, the targeting Ugands are not all the same. {0018} The presentl disclosed subject matter also related to a method of inducing art immune response in a subject, comprising administering to the subject an effective amount of the compositions of the present invention. In some embodiments, the method comprises administering an RNA-oligoniicleotide and an immunostimulatory motif. In some embodiments, the method comprises administering a composition comprising an RNA nanostrueture and an adj vant, aa antigen, and/or a targeting ligaad.
{001 j In some embodiments, the presently disclosed subject matter is directed to a method of inducing the production of cytokines. In some embodiments, the cytokines include THF-ahpha, lL-6 and/or IL-l 2. In some embodiments, the method comprises administering an R A-oligonucleottde and an immuoosti initiatory motif, in some embodiments, the production of cytokines is increased at least ten fold as compared to the imr mosti alatory motif provided independently of the RNA-o'ligonucleotide.
{0020} in some embodiments, the method comprises administering a composition comprising an RNA nanostrueture and an adjuvant, an antigen., and/or a targeting ligand. In some embodiments, the inducing the production of cytokines is increased at least ten fold as compared to the adjuvant, the antigen, and/or the targeting ligand provided independently of the RNA nanostrueture.
J0021J In some embodiments, administering the compositions of the presently disclosed subject matter to a subject induces the production of high affinity neutralizing antibodies or inhibitory antibodies. In some embodiments, the subject has or is at risk of having a pathol gical condition. In some embodimen s, the pathoiogicai condition is cancer, human immunodeficiency vims (HIV), influenza, or drug and substance abuse.
{0022 J In some embodiments, the compositions of the presently disclosed su bject matter is used for the manufacture of a medicament useful for the treatment of a pathoiogicai condition in a subject. In some embodiments, the medicament is used prophy!actically. (00231 The presentl disclosed subject matter also provides methods of making an
RNA nanostructure. in some embodiments, the method of making an RNA nanostructure includes mixing cquimoiar concentrations of a multiple of external RNA strands, and one internal RNA strand to make a mixture, annealing the mixture,, and cooling the mixture slowly. In some embodiments, the mixture is cooled at about \°C- per minute. In some embodiments, the mixture is cooled from about 8(TC to about 4f!C. in some embodiments, the mixture is annealed for about one hour. In some embodiments, the method includes modifying one or more of the external strands to contain an antigen, adjuvants and/or targeting ligand. In some embodiments, there are optionally 3, 4, or 5 external strands. In some embodiments, the external strands comprise about 48 nucleotides, in some
embodiments, the nanostructure produces by the method comprises a pRNA 3WJ motif at each vertex. In some methods, the nanostructure had a shape selected form, a triangle, square and pen tagon. In some embodiments, the shapes produced b the method have a stretched intraheiieai angle between HI and H2.
BRIEF DESCRIPTION OF THE DRAWINGS
(0024} The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which, the principles of the invention are used, and the accompanying drawings of which;
|0025| FlGs. 1A and IB include details of the structural features of the pRNA 3WJ motif. (A) Secondary structure of 3WJ motif with base pairs annotated using Leontts- Westhof nomenclature. (B) Tertiary structure of the 3WJ motif with indication of the AOB □ 60° angle formed between H 1 and H2. The ZAOB Angle corresponds to inner angles of polygons.
[0026} FiGs. 2A-2C include the design of RNA nanostructure polygons and assembl properties. (A) 3D modeled structures of polygons with 3WJ motif located at vertices, inner angle corresponds to ZAOB 60». (B) The increasing length of the interna! strand stretches the 3WJ ZAOB at which the nanoparticlcs assemble, along with increasing number of external 'short' strands. FIG, 2 (C) Assembly properties of polygons evaluated on 7% native PAGEs. Asterisks "*' indicate the y5 labeled strands utilized on each type of polygon assembly.
J0027} FIG. 3 Includes structural characterization of polygons, (A) Atomic Force
Microscopy (AFM) images of triangular, square and pentagonal nanoparticles derived from the p'R A 3WJ motif. (B) Polygons size distribution histogram obtained via dynamic light scattering.
}002S{ FiGs. 4A and 4B include a comparison of polygon stabilities, (A) Melting temperatures of triangle, square and pentagon measured by 7% perpendicular TGGE and (B) boiling resistance assay in absence and presence of 8 M urea. Calculated percentage of recovery for polygons after boiling is shown below each gel with error bars calculated from several independent experiments.
(0029{ FIGs. 5A-5D illustrate the effect of cytokine induction in macrophage-like
RAW264.7 cells and mice by RNA-CpG polygons, induction of (A) TNF-a and (B) IL-6 cytokines by 50 nM RNA polygons-CpG. (C) Dependences of TNF-a induction with the number of CpGs per RNA polygon. The error bars represent standard deviation from at least three independent experiments. (D) Iramunostmrnlatory activity by triangle-CpG nanoparticle in animal model. The error bars represent standard deviations of two independent measuremen ts of the cytokine levels from serum aliquots of the tested mouse. {0030J FiGs. 6A and <>B include a comparison of RNA poly ori-CpG complexes binding to the cells. (A) "The plot represents the summary of the flow cytometry data showing cadi RN A nanopartick-CpG adjuvants binding to the cell in a dose-dependent manner. (B) Confocal images showing the binding comparison of the triangle-CpG and CpG to the RAW624.7 cells by colocalixation of nucleus (blue), actio, or cytoplasm (green) and Cy-3~ labeled CpGs (red) signals,
{0031.1 FIGs. 7A-7D include RNA polygons dissociation constan determination at equilibrium state. These are 7% native PAGE titration data tor formation of triangle (a), square (b), and pentagon (e) polygons. Below, the gels is the plot used to determine the equilibrium concentration for each polygon which were then used to calculate the apparent dissociation constant.
{00321 FIGs. 8A-8C include sequences and secondary structures of RN A polygons.
RNA polygons and quantified assembly yields for triangle (a), square (b) and pentagon (c). {0033} FIG. 9A- C include RNA polygons population on mica surface AFM image of RNA polygons and population distribution of RNA triangle (a), square (b), and pentagon (c) polygons in 0.5 mnV area of AFM mica surface. Error represents counts from several independent images.
}0034J FIG. lOA and 10B include secondary structure of triangle-CpG naooparticle and characterization, (a) 2D structure of RNA triangle harboring 3 CpG adjuvants. Note: Arrows indicate to base pairs that have been deieted in RNA triangle na iopartiele use for animal confocal microscope, and cytotoxicity studies, (b) This is 4% agarose gel showing assembly of RNA triangle nanoscaffold with CpG adjuvants, (c) DLS characterization of the tnangle-3CpG complex showing apparent hydrodytianiic diameter of around 14 nm. The error represents standard deviation .from several independent measurements.
1.0 (00351 FIG. 11 includes the secondary structure of a square-CpG nanoparticie and characterization, (a) 2D structure of RNA square harboring 4 CpG adjuvants, (b) This is 4% agarose gel showing assembly of RNA square naiioscaffoid with CpG adjuvants, (c) DLS characterization of the square-4Cp complex showing apparent hydrodynaraic diameter of around 15 nm. The error represents standard deviation from several independent measurements,
(0036{ FIG. 12 includes the secondary structure of a pe tagon-CpG nanoparticie and characterization, (a) 2D structure of R A pentagon harboring 5 CpG adjuvants, (h) This is 4% agarose gel showing assembly of RNA pentagon naiioscaffoid with CpG adjuvants, (c) DLS characterization of the pentagon-5CpG complex showing apparent hydrodynamtc diameter of around 16 nm. The error represents standard deviation from several independent measurements.
(00371 FIG. 13 illustrated the effect of RNA-CpG adjuvants on RAW264.7 cell viabiitty. The celts were incubated with different concentrations of RNA polygons only, RNA polygons-CpG complexes, and free CpG.
(00381 FIG. 14 illustrates the binding effect of RNA polygons harboring CpG adjuvants to RAW264.7 ceils. Concentration dependent binding of (a) triang!e-3CpGs, (b) scfuare-4CpGs, and (c) pentagon- SCpGs nanoparticies.
(00391 FIG. IS includes the results of a serum stability assay of RNA polygons coupled with CpGs motifs. Preassembled complexes (1 μΜ) of RNA triangle, square and pentagon (2'-F modified) harboring DNA CpG were incubated in RPMS-164Q medium containing 1( % fetal bovine serum (Sigma). Aliquots ( 10 pL> were taken at 0 hr, 1 hr, 3 hr, 6 hr, 8hr and 16 hr time points after incubation at 3 ?aC, followed by analysis using 6% native {0040} FIG. 16 illustrates thcrmodyoamically stable RNA nanoparticles for efficient delivery of iramunostimulaiory CpG oligonucleotides, RNA or antigen to immune cells,
(0041 FIG. 17 depicts RNA and DNA sequence for triangle-3CpGs
}0O42j FIG. 18 depicts CpG only, a nanostructure RNA triangle only, and a RNA nanostructure triangle with optionally one. two and three CpGs.
{0043} FIG. 19 ThcrmodynaraicaUy stable RNA three-way junction (3WJ) for efficient delivery of immunosrimulatory CpG oligonucleotides, RNA or antigen to immune cells.
|0 44J FIG. 20 Depicts a bowtie-!ike RNA uanoparttcle triangle di titer for delivery of 4CpG. The size of the uanopartick is twice as trianbk (about 20nro S 5 nm).
|0045} FIG. 21 shows RNA triangle, square and pentagon nanoparticles harboring different numbers ofCpGs and Cy 3 -labeled ON As
{0046} FIG. 22 depicts a RN A nanoparticie for anticancer vaccine or
immunotherapy
[0047} FIG. 23 depicts a 3WJ nanovaccine containing CpG-ODN adjuvant and antitumor antigen and a 4WJ nanovaccine containing CpG-ODN adjuvant and antitumor antigen
J0048} FIG. 24 depicts a Triangle RN A nanostructure harboring CpG-G ODN and siRNA,
{0049} BIG. 25 depicts the assemblies of RNA nanostructure traingles harboring
CpG oligonucleotides.
(0050| FIG, 26 shows AFM images of RNA nanostructure triangles harboring three
CpGs.
1.0051 FIG. 27 shows AFM images of RN A nanostructure triangles harboring three
CpGs.
1.2 (00521 FIG. 2$ shows AFM images of RNA nanostructure triangles harboring three
CpGs.
(0053} FIG. 29 shows AFM images of RMA nanostnictitre itiatigies harboring' three
CpGs.
(005 1 FIG. 30 shows AFM images of RNA nanostructure triangles harboring three
CpGs.
(0055.1 FIG.31 shows detailed AFM images of RNA nanostructure triangles harboring three CpGs and a scheme of the CpG harboring R A triangle. Triangle with 2 CpG ODN can be successfully purified and imaged by AFM. The image shows that triatigie-CpG assemble well and most of the particles are shown as triangular shape. Based on the AFM image, the diameter of triangle with 3 CpG is around 30 am, a bit larger than the original triangle.
(0056} FIG. 32 provides Dynamic Light Scattering (DLS) data showing the mean diameter of triangle-SCpGs of 16.7nM and its agreement with ATM imaging data.
(0057} FIG. 33 shows how the RNA nanostructure triangle protects CpG
oligonucleotides from degradation in serum over time.
10058} FIG. 34 is a Temperature Gradient Gel Elecctropheresis (TGGE) of R A nanostructure triangle harboring CpG oligonucleotides over increasing temperatures from 3(fC to 8iFC,
(0059 J FIG. 35 includes a chart of relative cell viability vs. concentration from investigation of toxicity of RNA Triangie-CpG.
{0060} FIG.36 is a fiovvcytometry study of 3O0«M triangle RNA harboring different numbers of CpGs binding to raw 264.7 ceils. Positive binding: Triangle- 1 CpG 300n.M - Triang!e-2CpGs 300 aM - Triangle-3Cpgs 3<K>n CpG 300oM, (00611 FIG.37 is a flowcytometry study of 1 SOOnM triangle RNA harboring different numbers of CpGs binding to raw 264.7 cells. Positive binding: Triangle- Ϊ CpG
S 50fiM - Triangle 2CpGs 15-«M - Triangk-3CpGs 150aM > CpG I 50nM,
1.0062 FIG. 38 is a flowcytometry stud of 75nM triangle RNA harboring different mimbers of CpGs binding to raw 264.7 ceils. Positive binding: Triangle- iCpG 75nM ~
Triangle-2CpGs 75nM - Triangie-3CpGs 75n CpG 75nM.
(0063.1 FIG.39 is a flowcytometry study of 37.5nM triangle RNA harboring different numbers of CpGs binding to raw 264.7 cells. Positive binding: Triangle- 1 CpG 37.5 n - Triangle 2CpGs 37.5«M - Triangle-3CpGs 37.5nM > CpG 37.5n .
[006 1 FIG. 40 is a flowcytometry studying different concentration of triangle- 1 CpG binding to raw 264,7 cells. Positive binding: Triangle- 1 CpG 300nM > Triangle- 1 CpG
150nM > Triangle- ί CpG 75nM > TriangSe-iCpG 37.5nM.
(00651 FIG. 41 is a flowcytometry studying different concentration of triangle-
2CpGs binding to raw 264.7 ceils. Positive binding: Tria.ngle-2CpG 30OnM > Triangle- 2CpG l 50nM > Triangie-2CpG 75nM > Triangle-2CpG 37.5nM.
('00661 FIG. 42 is a flowcytometry study ing different concentration of triangle-
3CpGs binding to raw 264.7 cells. Positive binding: Triangle-3CpG 300n > Triangle- 3CpG ISOnlVl > Triaiigle-3CpG 75nM > TriangSe-3CpG 37.5nM
(00671 FIG. 43 is a flowcytometry studying different concentration of CpG binding to raw 264.7 cells. Positive binding: CpG 300BM > CpG 130n > CpG 75nM > CpG 37.5n .
(0068} FIG. 44 includes a table showin differing concentrations of CpG, Triangle-
ICpG, Tri.angle-2CpGs, and Triang!e-3CpGs and their respective levels of binding. Triangle- I CpG, Triang!e-2CpGs and Triangle-3CpGs all have much stronger binding than CpG only. Triangle should enhance the deliver of CpG, which is also m ' agreement with the previous cytokine data (stronger binding correlates to stronger cytokine induction),
i¾069J FIG. 45 is a flowcytometry comparing square RNA harboring different number of CpGs binding to raw 264.7 cells. Positive binding; Square- 1 CpG- - Square-
2CpGs- i ~ Square~2CpGs~2 - $quare-3CpGs ~ Square-4CpGs > CpG Only
j0 70| FIG. 46 is a flo cytometr comparing pentagon R A harboring different number of CpGs binding to raw 264,7 cells. Positive binding: Pentagon-SCpG ::: Pentagon-
4CpG - Pentagon~3CpGs- l— Pentagon-3CpGs-2 = Pentagon-2CpGs-l -Pentagon-2CpGs-2
> Pentagon- 1 CpG > CpG only,
}ø<)? . } FIG. 47 is a flowcytometry comparing triangle-SCpG, square-4-CpG, and pentagon-5CpG RNA eanostntciitres binding to raw 264.7 cei!s. Positive binding: Pentagon- 5CpG = Square~4CpG ~ Triange-3CpG > CpG only.
J0072} FIG. 48 includes confocal imaging of triangie-CpG interacting with raw ceils.
{0073} FIG. 4.9 includes confocal imaging of triangie~€pG interacting with raw ceils.
J0074J FIG. 50 provides fluorescent imaging of nwrphology changes of triangle-
CpG induced raw celis. Upon treatment with triangie-CpG or CpG, the cell morphology changed ftOtti a round form to an elongated form with more spreading and forming pse dopodia.
{0075J FIG. 51 includes results of TNF-aipha cytokine ELISA assay for I } Triangle
-CpG compared to Triangle RNA, CpG, cell only, and blank medium and 2) increasing concentration of Triangie-CpG. J0076J FIG. 52 depicts IL-6 cytokine ELISA assay for 1) Triangle -CpG compared to Triangle R A, CpG, cell only, and blank medium and 2) increasing concentration of Trtangle-CpG.
(0077} FIG. 53 provides a chart comparing TNF-alptia cytokine ELISA assay for
RN A triangles harboring different num bers of CpG .
j0 78| FIG. 54 provides a chart comparing TNF-alpha cytokine ELISA assay for
RNA squares harboring different numbers of CpG.
{0079} FIG. 55 provides a chart comparing TNF-alpha cytokine ELISA assay for
RNA pentagons harboring different numbers of CpG.
[0080} FIG. 56 provides a schematic showing self-assembly of RNA triangle nauostmcture harboring CpG R As, and the CpG RNA sequences with 21 nucleotide overhang and 5U linker.
10081 ! FIG. 57 pro ides the sequence of A21 CpGRNA, the 63 nucleotide DNA, the
5' Primer and the 3* Primer.
|0082| FIG. 58 provides the sequence of B2 i CpGRNA, the 63 nucleotide DN A, the
5' .Primer and the 3' Primer.
|ϋβ$31 FIG. 59 provides the sequence of C 1 CpGRNA, the 63 nucleotide DNA, lite
5' Primer and the 3' Primer.
(00841 FIG. 60 is the PCR of the DNA fempiates for A21 , B21. and C21 CpG RNA .
(0085 J FIG. 61 is the image of 2'F CpG RNA made by in vitro transcription.
(0086] FIG. 62 provides a summary of data of the cytokine testing of 2'F RNA triangle harboring DNA CpG, DNA triangle harboring DNA CpG, and 2'F RNA triangle harboring 2'F RN CpG.
[0087} FtG. 63 provides the design of an RNA Nanosimciure Triangle with RNA
CpG motif. DESCRIPTION O THE SEQUENCE LISTING
[0088} SEQ ID NO 1 is an exemplary RNA sequence for Triangle short strand A used in assembly of an RNA triangle nanostructure.
[0089} SEQ ID NO 2 is an exemplary RNA sequence for Triangle short strand B used in assembly of an RNA triangle nanostructure.
[009O| SEQ I'D NO 3 is an exemplary RN A sequence for Triangle short strand C used in assembly of an RN A triangle nanostructure.
{0091} SEQ ID NO 4 is an exemplary RN A sequence for Triangle long strand D used in assembly of an RNA triangle nanostructure.
[0092} SEQ ID NO 5 is an exemplary RNA sequence for Square short strand A used in assembly of an RNA square nanostructure.
(0093} SEQ ID NO 6 is an exemplary RNA sequence for Square short strand B used in assembly of an RN A square nanostructure.
{0094} SEQ ID NO 7 is an exemplary RNA sequence for Square short strand C used in assembly of an RNA square nanostructure.
[0095} SEQ ID NO 8 is an exemplary RNA sequence for Square short strand D used in assembly of an RNA square nanostructure.
[0096} SEQ ID NO 9 is an exemplary RN A sequence for Square long strand E used in assembly of an RNA square nanostructure.
j0097j SEQ ID NO 10 is an exemplary RNA sequence for pentagon short strand A used in assembly of an RN A pentagon nanostructure.
(0098} SEQ ID NO 1.1 is an exemplary RNA sequence for pentagon short strand B used in assembly of an RNA pentagon nanostructure,
[0099} SEQ ID NO 12 is an exemplary RN A sequence for pentagon short strand C used in assembly of an RNA pentagon nanostructure. {00100] SEQ ID NO 13 is an exemplary RN sequence for pentagon short stand D used in assembl of an RNA pentagon nanostrucfure.
[OOlO!j SEQ ID NO 14 is an exemplary R A sequence for pentagon short strand E used in assembly of an RNA pentagon nanostructure.
1.00102] SEQ ID NO 15 is an exemplary RNA sequence for pentagon long strand F used in assembly of an RNA pentagon nanostructure.
(00103] SEQ ID NO 16 is an exemplary strand A21 CpG RNA.
(00104] SEQ ID NO 17 is an exemplary strand A21 CpG DNA
100105] SEQ ID NO 18 is an exemplary strand 821 CpG RNA.
(00106] SEQ ID NO 19 is an exemplary st and B21 CpG D A.
(00107] SEQ ID NO 20 is an exemplary strand C21 CpG RNA.
(00108] SEQ ID NO 21 is an exemplary strand. C2i CpG DNA .
(001091 SEQ ID NO 22 is an exemplary RNA sequence Tri A-Cpg for assembly of
RNA Triangle harboring RNA CpG motif.
(00110] SEQ ID NO 23 is an exemplary RN A sequence Tri B-CpG for assembly of
RNA Triangle harboring R A CpG motif
[001.11] SEQ ID NO 24 is an exemplary RNA sequence Tri C-CpG for assembly of
RNA Triangle harboring R A CpG motif.
(00112] SEQ ID NO: 25 is a 63 nucleotide D A sequence including the sequence of
SEQ ID NO: 17, and SEQ ID NO: 26 and SEQ ID NO: 27 are 5'- and 3'-primers, as set forth in FIG. 57.
{00113] SEQ ID NO: 28 is a 63 nucleotide DNA sequence including the sequence of
SEQ ID NO: 1 , and SEQ ID NO: 29 and SEQ ID NO: 30 are 5'- and 3 '-primers, as set forth in FIG. 58. {00114} SEQ ID NO: 31 is a 63 nucleotide DNA sequence including the sequence of
SEQ ID NO: 21, and SEQ ID NO: 32 and SEQ ID NO: 33 are 5'- and 3 '-primers, as set forth in FIG. 59,
DESCRIPTION OF EXEMPLARY EMBODIMENTS
{00115) The details of one or more embodiments of the presently-disclosed subject matter are set ford) in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom, in case of conflict, the specification of this document, including definitions, will control
{00116) fn certain instances, nucleotides and polypeptides disclosed herein are included in publicly-available databases, such as GENBANK-& and SWISSPR.OT.
Information including sequences and other information related to such nucleotides and polypeptides included in such publicly-available databases are expressly incorporated by reference. Unless otherwise indicated or apparent the references to such publicly-available diiiabases are references to the most recent version of the database as of the filing date of this Application.
{00117} While the terms used herein are believed to be well understood by one of ordinary skill in the art, definitions are set forth to facilitate explanation of the presently- disclosed subject matter.
{00118'} Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject: matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representati ve methods, devices, and materials are now described.
|00119] Following long-standing patent law convention, the terms 'V\ "an", and
"the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a cell"' includes a plurality of such cells, and so forth.
{00120] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter,
{001 1] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in so me embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.
{001221 As used herein, ranges can be expressed as from "about" one particular value, and/or to "about" another particular value, it is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed, as "about" thai particular value in addition, to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed, it is also understood that each unit between two -particular units are also disclosed. For example, if .10 and 15 are disclosed, then i 1, 12, 13, and 14 are also disclosed. J00123| The presently-disclosed subject matter relates to compositions and adjuvants useful for prophylactic and therapeutic treatment, including immunostimulatory RNA- containing compositions and RNA nanoparticle-eontaining compositions. The compositions disclosed herein are safe, effective, versatile,, and easy to manufacture, offering new solutions to address unmet needs associated with current approaches to vaccine design and
development.
{00124| RNA can be used as a construction material and/or iniraunostiroulatory agent for the development of novel nanovacdnes and ad juvants for disease pre vention and treatment.
[00125) Uhrastable RNA nanoparttc!es composed of RNA, CpG D , peptide antigen or protein antigen can be pre-designed in silica and fabricated by thermodynamieally- driven self-assembly. The fabricated RNA. nanopartiele-based nanovaeeme and adjuvants have pre-defined stoichiometry, size and structure, and are also ttemiodynamicaliy ultrastable and resistant to degradation in serum. The cellular uptake of the R A
nanopartiele-based nanovaeeme and adjuvants is greatly enhanced compared to CpG DNA only and antigen only. The immune response induced by the RNA nanoparticie-based nanovaeeme and adjuvants will also be greatly enhanced compared to CpG DNA onl and antigen only. The RNA nanoparticie-based nanovaccines and adjuvants could also be conjugated to a variety of targeting ligands for targeting to 8 ceils, T ceils, dendritic ceils, macrophages and cancer cells. The targeting ligands include but are not limited to filiate and RNA aptamers and DNA aptamers. I certai embodiments, multiple targeting ligands can be conjugated to one nanopartiele to enhance the targeting efficacy.
[00126) ssRNA, dsRNA and siRNA have bee shown to have inimiinostimulaiory activities. The present invention relates to an vmmunostimulatory agent containing chemically modified RNA. The chemically modified RNA contains immunostimulatary motifs which include, but arc not limited to the CpG motif. The invention furthermore relates to vaccine and adjuvant platforms that use the imimmosttmulafory RNA as one of the platform
components. Moreover, the inimunostimulatory RNA can also be incorporated into
ultra-stable RNA nanopart cles composed of RNA, CpG DNA„ peptide antigen or protein antigen to form nanovaccines. The fabricated RNA nanoparticle-based nanovaccme and adjuvants have pre-defined stoichiometty, size and structure, and are also thcrmodynamically uitrastab!e and resistant to degradation in serum. The immune response induced by the immunostiraulatory RNA platform will be greatly enhanced compared to CpG DNA only and antigen only. The immuaosttmulatory RNA platform, could also be conjugated to a variety of targeting iigands for targeting to B cells, T ceils, dendritic cells, macrophages and cancer cells. The targeting iigand include but are not limited to folate, siRNA, shRNA, RNA aptamers and D A aptamers. In certain embodiments, multiple targeting Iigands can be conjugated to one platform to enhance the targeting efficacy. The vaccine platform according to the invention and the adiisvaiits platform according to the invention are employed to treat or prevent various diseases including, but not limited to cancer, immunology, respiratory, central nervous system., inflammatory, cardiovascular, infectious diseases and drug and substance abuse.
(00127} RNA-based compositions disclosed herein, including RNA-nauoparticle- contaimng and RN A~oiigomieleotide~eoniaining compositions, have a number of advantageous features. Such advantages include the following. The RNA-based
composition have defined size, structure and stoicbionietry, such that unpredictable side effects arising from heterogeneous panicles can be avoided. Due to the multivalent nature of RNA nanoparticles, multiple antigen and adjuvants could be incorporated into one particle for achieving synergistic or enhanced immune repose such as cytokine induction and antibody production. The nanosize of the particles will facilitate tissue penetration and target to important immune tissues or organs such as lymph nodes for achieving targeted and enhanced immune stimulation. Multiple targeting ligands cou!d be incorporated into one particle for achieving better targeting to immune cells such as B ceils, T cells, dendritic ceils and macrophages. Economic and easy fabrication of RNA-based compositions could be performed in a cell-free system: which allows for industrial scale production and avoids possible contamination. R A nanoparticies are highly soluble and not prone to aggregation. They do not require any addition steps, such as linkage to PEG to keep them stable in solution. RNA nanoparlicles are also thennodynamically stable. For example, the triangular shaped RNA nanopartici.es are resistant to boiling. The three-way junction RNA
nanoparticies are resistant to 8M urea denaturatton. Thus R A nanoparticies will remain intact and not disassociate at ultra-low concentrations in vivo. 2T-modified RNA-based compositions, for example, are resistant to degradation in serum and stable in the blood. The cellular uptake of the RNA nanoparticie-based nanovaccine and adjuvants is greatly enhanced compared to CpG DNA only and antigen only. The inimnnosttmulatory activity of the chemical modified RNA-based compositions disclosed herein is stronger than other adjuvants such as CpG DNA. Due to the larger size of RNA nanoparticie-based nanovaccine and adjuvants compared to antigen and ad juvants onl y, the in vivo half -life of RNA
nanoparticie-based nanovaccine and adjuvants is significantly prolonged, offering better pharmacokinetics profiles and better patient compliance. The im unostimi aiory R A can also be incorporated into ultrastable RNA nanoparticies composed of RNA, CpG DNA, peptide antigen or protein antigen to form nanovaccine. The fabricated RNA nanoparticie- based nanovaccine and adjuvants have pre-defined stoichiometry, size and structure, and are also thermodynaniieally ultrastable and resistant to degradation in serum. The immune response induced by the immunostimulatory R.NA platform will be greatly enhanced compared to CpG DNA only and. antigen only. RNA-based compositions disclosed herein are ultrastablc and resistant to degradation in serum, and can be conjugated to iigands to target, for example, B, T, dendritic, macrophage, and cancer cells.
[00128) The presently-disclosed subject matter includes a composition, comprising an
RNA-oligonucleotide, and an immunostimulator motif.
(00129] In some embodiments, the RNA-oligonucleotide includes a chemical modification selected from 2'Fluoro, 2'Amine, and 2'0-Methyi. in some embodiments, the RNA-oiigonucleodde is about 5:, 6, 7, 8, 9, 10, 1 1 , 12, B, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the RN A-otigoiutc!eoiide is single- stranded. In other embodiments, the RNA-oi tgonucieotide is double-stranded or partially double-stranded (e.g., containing a hair-pin).
(00130] in some embodiments, the immunostimulatory motif is selected from, an immunostimulatory RNA (isRNA) and a CpG oHgodeoxyribonucIeotide (CpG). The isRNA can be any isRNA known to the skilled artisan, for example, those set forth in Patent Application Publication Nos. US 2014/0135487 and WO 2003/086280. In some
embodiments, the immunostimulatory motif is conjugated to the R A-oiigonucieottde. In some embodimen ts, the immunostimulatory motif is CpG conjugated to the RNA- oligonucleotide.
(0 1311 In some embodiments, the composition including an RNA -oligonucleotide and an immunostimulatory motif is provided as an adj u vant in some embodiment, the immune modulation effect for cytokine induction is increased at least ten fold as compared to the immunostimulatory motif provided independently of the R A-oligonucleotide. In some embodiment when immunostimulatory motif is conjugated to the RNA -oltogomicleotide, the immune modulation effect for cytokine induction and ceil binding i enhanced at least 10, 20, 30, 40, SO, 100, or 200 times. }00132| The presently-disclosed subject matter further includes a composition including au 'RNA nanostructure, and au adjuvant, an antigen, and/or a targeting ligand.
[00133) ht some embodiments, flic RNA nanostructure is selected from NA triangle,
RNA square, RNA pentagon, RNA hexagon, RNA three-way junction, RNA four-way junction. In some embodiments, the RNA nanostruemre is derived from, a 3WJ motif. For one non-limiting example, the 'RNA nanostructure can be derived from the 3WJ motif, as described in the Examiners herein. For another non-limiting example, the RNA
nanostructure can be as described in International Patent Application Publication No. WO 2012/170372.
J00134) in some embodiments including an adjuvant, the adjuvant is selected from an immunostimulatory RNA (is NA) and a CpG oiigodeoxyribonueleotide (CpG). hi some embodiments including an isRNA, it can be .5, 6, 7, 8, 9, 10, 1.1, 12, 13, 14, .15, 1.6, 17, 18, 19, 20, 21 , 22, 23, 24 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 bases in length. In some embodiments the isR A is about 8-30 bases in length. In some embodiments, the adjuvant is is'RNA and the isRNA. is incorporated into the RNA nanoparticle by base pairing. In some embodiments, the adjuvant is is.RNA and the is'RNA is incorporated into the R.NA
nanoparticle by being eovalently bonded to an RNA strand of the RN A nanoparticle. In some embodiments, the adjuvant is the composition as described hereinabove, including an RNA- oHgo icleoiide and an immunostimuiatory motif. In some embodiments, the RNA- oligonucleotide and iromunosii uiatory motif are incorporated into the RNA nanoparticle by- base pairing between the RNA-oiigonucieotide and the RNA nanoparticle- In some embodiments, the RNA-oiigonucieotide and i mmunostimulatory motif are incorporated into the R. A nanoparticle by the RN -oligonucieoiide being eovalently bonded to an R. A strand of the RNA nanoparticle. {0013SJ In some embodiments of the composition including an antigen, the antigen is derived from a bacteria, virus, or cell. In some embodiments, the antigen binds to a
neutralizing antibody or an inhibitory antibody. In some embodiments, the antigen is a neutralizing epitope, in some embodiments, the antigen is selected from: B-celi epitope, T~ cell epitope, T-helper epitope, epitopes derived from PG120, gp41eptopes, glycans, peptides, T-helper peptides, streptavidia
J00136| fn some embodiments of the composition including a targetin ligand, the targeting ligand is selected from: an aplamer, a cell surface marker, and a cancer cell. In some embodiments, where the targeting ligand is an aptarner, the aptamer binds to an HIV epitope. In some embodiments, where the targeting ligand is a cell surface marker, the cell surface marker is a macrophage or a lymphocyte. In some embodiments, the composition includes at least two targeting ligands. In some embodiments the multiple targeting ligands are the same. In some embodiments, not all of the multiple targeting ligands are the same. {00137] As will be appreciated by the skilled artisan, compositions disclosed herein can be formulated to include a pharmaceutieally-aeeeptable carrier. As used herein, the term "pharmaceutically acceptable carrier" refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconshtution into steriie in jectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous earners, diluents, solvents or vehicles include water, ethanoL poiyols (such as glycerol, propylene glycol, polyethylene glycol and the like.), earboxyraethylceilulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle s ize in the ease of dispersions and by the ose of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be cosured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobittanoi, phenol, sorbie acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like.
Prolonged absorption of the injectable pharmaceutical form can he brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsuie matrices of the drug in biodegradable polymers such as polylactide-polygiycolide, poiy(ordioesters) and polyi anhydrides)- Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapptng the drug in liposomes or microemulsions which are compatible with bod tissues. The injectable formulations can be sterilized,, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in. the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[00138] The presently-disclosed subject matter further includes methods as disclosed herein. For example, a method of inducing an immune response in a subject includes administering to the subject an effective amount of a composition as disclosed herein. The presently-disclosed subject matter further includes a method of inducing an immune response in a subject, which involves administering to the subject an effective amount of a composition as disclosed herein. In some embodiments, the subject has or is at risk of ha ving a pathological condition. The presently-disclosed subject matter ftjrther includes a method of inducing the production of cytokines comprising administering to a subject an effective amount of a composition as disclosed herein . In some embodiments, the cytokines include T F-alpha, IL-6 and/or IL-12. The presently-disclosed subject matter further includes a method of inducing the production of high affinity neutralizing antibodies or inhibitory antibodies comprising administering a composition as disclosed herein to a subject having a pathological condition. Exemplary pathological conditions include, but are not limited to, cancer, immunology,, respiratory, centra! nervous system, inflammatory, cardiovascular, infectious diseases, influenza, human immunodeficiency virus (HIV), and drug and substance abuse, such as cocaine or nicotine abuse.
{00139] As used herein, the term "subject" refers to a target of administration. The subject of the herein disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human or non-human. Thus, veterinary therapeutic uses are provided in accordance with the presently disclosed subject matter. As such, the presently disclosed subject matter provides for administration to mammals such as humans and non-human primates, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic- importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to; carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; rabbits, guinea pigs, and rodents. A lso provided is the treatment of birds, including the treatment of those kinds of birds that are endangered and/or kept in zoos, as well as fowl and more particularly domesticated fowl, i.e., poultry, such as turkeys, chickens, ducks, geese, guinea fowl, and the like, as they are also of economic- importance to humans. Tims, also provided is the treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), poultry, and the like. The term does not denote a particular age or sex. (00140] The presently-disclosed subject matter is further illustrated by the following specific but aon-limiting examples. "The following examples may include compilations of data that are representative of data gathered at v arious times during the course of development and experimentation related to the present invention.
EXAMPLES
(00141 Ί Modulation of immune response is important in cancer immunotherapy, vaccine adjuvant development and inflammatory or immune disease therapy. Here we report the development of new immunomodulatory via control of shape transition among RNA triangle, square and pentagon nanostructures. Changing one RNA strand in polygons automatically induced the stretching of the inferior angle from 60» to 90» or 108°, resulting in self-assembly of elegant RNA triangles, squares and pentagons. When immunological adjuvants were incorporated, their imiminomodulation effect for cytokine TNF-a and 1I.-6 induction was greatly enhanced in vi tro and in animals up to 100-fold, while RN A polygon controls induced unnoticeable effect. The RNA nanoparticles were delivered to macrophages specifically. The degree of immunostimulation greatly depended on the size, shape and number of the pay load per nanoparticles. Stronger immune response was observed when the number of adjuvants per polygon was increased, demonstrating the advantage of shape transition from triangle to pentagon.
(001421 By stretching the 60° AOB angle ( Z) (Figure 1.) of the thermodynamically stable pRNA 3WJ motif, stable RNA architectures can be designed. We demonstrate that it can he stretched to wide conformations resulting in different 2D polygons; triangle (ZAOB - 60 ), square (ZAOB ~ 90°) and pentagon ( ZAOB - 108°). Intermoiecular interactions such as kissing loops, receptor loop, or 'sticky-ends' were avoided by introducing linkages through base pairing between corners of the polygons using RNA double helices. Therefore, this system is advantageous with an increased thermo-stability in the overall construct. {00143] We further demonstrate that the NA polygons have the potential to serve as a new generation of deli ery systems for mimunomodulators. Synthetic unmethylatcd cytosinc-phosphate-guanmc oUgodcoxymtelcorides (CpG ODN) arc immimostimuiatory DNA molecules that mimic the imraunostimulatory activity of bacterial DNA (38,39). CpG D A motifs strongly activate the mammalian innate immune system: by interacting with various immune cells via cndosomal Toll-like receptor 9 (TLR9) (40, 1). Upon the
stimulation by CpG DNA, immune cells could secret a variety of proinflammatory and antiviral cy tokines including tumor necrosis factor-alpha (T F-alplia, or TNF-o), interleukin- 6 fiL-6), iatcr!cukin-12 (I'L-12) and mterferoa (lFN), which leads to potent immune response. The therapeutic potential of CpG DNA has also been extensively explored in both basic research and human clinical trials, including the development of new vaccine adjuvants, anticancer agents, immunoprotective agents and anti-allergic agents (42-45). Recently, several groups have reported the utilization of DNA nanostructures such as DNA
tetrahedrons (46), DNA polypod-like structures (47), DNA origami structures (48), Y-shaped DNA (49) and DNA dendrimers (50) to deliver immunostimulatory CpG DNA. In this work, to the best of our knowledge, we report the first use of R nanostructures to deliver CpG DNA in vitro and in vivo. The uaraunostimu!atory efficacy of R A polygons was evaluated by measuring the release of cytokines. We found that the induction of cytokines is highly dependent on the number of CpG per polygon. With increasing number of CpG per polygon, stronger immune response was observed, demonstrating the advantage of the transition from a triangle to a pentagon that can carry fi e CpGs,
{00144] We also report RNA CpG. The characteristic of RN A that differentiates it from DNA is the 2 '-hydroxy! (2'-OH) on each ribose sugar of the backbone. The 2' -OH group offers RNA a special property. From a structural point of view, the advantage of mis additional hydroxy 1 group is that it locks the ribose sugar into a 3'-endo chair conformation. and it will be structurally favorable for the RNA double helix to adopt the A-forra helix rattier than the B-form helix, that is typically present in the DMA, From a thermodynamic point of view, remarkably, the RNA double helix is more thermodynamicaliy stable than the D A double helix considering AGO for RNA double helix formation is -3.6 to -8.5 kimol- 1 per base pair stacked and AGO for DNA double heiix formation is -1.4 kJmol-1 per base pair stacked. Moreo ver, the presence of special structures such as bends, stacks, j unctions and loops in the 3D strueiure of RNA as well as various proteins and metal ions may also further improve its stability. Similar to DNA CpG sequence, RNA CpG sequence can also induce immune response and can be appl ied to the development of cancer immunotherapy and vaccine adjuvants.
100145] MATERIALS AND METHODS
[00146] RNA nanopartieies design, synthesis and self-assembly
{00147} The 3WJ crystal structure of the pRNA molecule (PDB ID: 4KZ2) was primaril used for designing polygon models using Swiss PDB viewer, as previously described (51). RNA strands for correspondin triangle, square and pentagon, were
synthesized by in vitro "17 transcription 'using' polymerase chain reaction (PCR) generated DNA templates. RN As were purified by denaturing polyacryl amide gel. electrophoresis (PAGE) and. were either CyS whole body RNA labeled (Mirus .Bio LLC) or S'-end j -32P j ATP (PerkinElmer) labeled, as previously described (8).
JO0148] RNA polygons were assembled in one pot by mixing equimoiar
concentrations (fmal concentration of 1 IIM) of four RNA strands for the triangle,, fi ve RNA strands for the square and six RNA strands for the pentagon in is "IMS buffer (50 mM TR1S pH 8.0, 100 mM NaCl and 10 mM MgCi2), Samples were annealed for I h in a thermocycler with controlled, slow cooling (i°C/min) from 80 to 4°C. All RNA polygons harboring CpG ODNs were assembled from their corresponding 2'F-IJ/C modified strands in one pot. (00149] The three short NA strands and one long RNA stands for assembly of the
RNA olygon are provided in Table I.
Figure imgf000033_0002
j00150] The four short stands and one long strand for assembly of the square RNA narrastructure arc provided in Table 2.
Figure imgf000033_0001
Square Short 5'OG :ACCA.GCCAA.UCAUGGCAAUAUA.CA.CGCAUAC 8 Strand D UU UGUUG ACGGCGG -3 '
Square Long S'GGACACUUGUCAUGUGUAUGCGUGUAUAUUGUC 9 Strand E AUOUGUAUGCUCUAUCGUUGUCAUGUGUAUGC'GA
UGCGCUUGUCAUGUGUAUGGC -3'
[00151.1 The five short strands and one long strand for assembly of the pentagon RNA naoostraciure are rovided in Table 3.
Figure imgf000034_0001
[00152) Table 4 provides sequences for CpG motifs.
J3
Figure imgf000035_0001
{00153} Table 5 provides the sequences for the RNA Triangle harboring the RNA
CpG motif.
Figure imgf000035_0002
GUUGGCUGGC C -3'
Tri C-CpG 5'- GGUCCAUGAC GUUCCUGACG tlUUUUUUGGC 24
CAGCCAAU CAUGGCAAUA UACACGCAUA C UUU
GUUGACGGCC C -3'
{00154] Nati ve PAGE, Temperature gradient gel electrophoresis (TGGE) and boiling resistance assays
(00155] RNA assemblies were evaluated on 7% (29: 1 ) native poly-aery! amide gels in the presence of 0.5 x TMS buffer. Gels were run at constant 90 V, ÷ °C. Gels were imaged with Typhoon FLA 7000 fGE Healthcare) to visualize RN A strands. Temperature gradient gel electrophoresis (TGGE) analysis was performed on 7% native PAGE in a buffer containing 50 KIM TR1S pH 8.0, .100 mM NaCl and 0.2 mM MgC12„ as previously described ( 4,26,28 ). A gradient temperature o 30-70°€ was applied perpendicular to electrical current and the experiment was run for I h at 20 W. A total RNA concentration of 100 aM was used in TGGE analysis. Apparent TM values corresponded to the temperature at which half of the polygons fractions were dissociated and apparent D values for multiple RNA strands were calculated, as described pre viously (7).
(00156] Boiling resistance assay was performed in 10 III containing I llSVl
preassemhled polygons in TMS buffer or in the presence of 8M urea. Samples were
incubated at 100°C for several minutes, then snap cooled on dry ice to pre vent refolding following evaluation on 7% native PAGE at 4°C. Individual experiments were repeated several times to reduce error.
(00157} Quantification analysis was performed using Image.! (52), Equal-sized boxes were drawn around the lanes corresponding to the triangle, square, or pentagon complexes and corresponding quantified values for each type of polygon were divided by the sum of the values presented ia the corresponding lane,
[00158] Ceil cultures
(00159) Mouse macrophage-like RAW 264.7 cells were grows in Dulbeeco's
Modified Eagle's Medium supplemented with H)% fetal bovine serum, .100 units/ml penicillin and 100 rag/m! streptomycin at 37°C in humidified air containing 5% C02. Cells were then seeded on 24-welI plates or 96-welf plates at a density of 5 x 105 cells/ml and cultured overnight before use.
|0 160] Cytokine secretion from RAW264.7 Cells
[0016!) RAW 264.7 cells were plated into 24-we!I plates with the density of 2.5 x 105 cells per well and cultured overnight. Then, RNA nanoparticles harboring different numbers ofCpO ODNs were dilated in Opti-MEM medium (Life Technologies Corporation, Carlsbad, CA, US A) and. added to the cells. The cells were continually cultured for 8 h at 37°C in humidified air containing 5% C02, and the cell culture supernatant were collected and stored at -SfPC until use. The concentration of TNF-a and lL- in the supernatant were determined by enzyme-linked immunosorbent assay (E.L1SA) using Mouse ELiSA MAXTM Deluxe sets (BioLe-gend, Inc., San Diego, CA), foS lowing protocols provided by the manufacturer.
{00162) Cytokine secretion from mice
(00163'j Male CD-I mice (4-5 weeks old) were purchased from Charles River
Laboratories. All animal procedures were approved by the Institutional Animal Care and Use Committee at University of Kentucky and were performed in accordance with guidelines issued by the National Institutes of Health for the care of laboratory animals. For in vivo ira- niunostitmi!ation, R triangular nanoparticles harboring CpG ODN, RNA triangular nanoparticles, or CpG ODN were dissolved in phosphate buffered saline (PBS) and administrated to the .mice via tail vein injection at 2 mg/kg (CpG ODN per body weight). The same volume of PBS was injected into a mouse as a control. Blood samples were collected 3 h post-injection by cardiac puncture. Scrum was prepared by centrifitgafioti. at 12 800 g for 10 mm. Serum TNF-a and IL-6 levels were determined by cnzytne-litikcd immunosorbent assay (EIJSA) -using Mouse ELISA MAXIM Deluxe sets (BioLegend, inc., San Diego, CA, USA), following protocols provided by die manufacturer.
JOO 1.64 Cotifocal microscopy imaging
{00165] RAW 264.7 cells were seeded on glass coversiips in 24-well plates and cultured at 37&C in humidified air containing 5% C02 overnight The culture medium was removed and the cells were washed with Opti-MEM medium twice to remove dead cells. RNA oanoparttcles harboring Cy3-labeled CpG DMA or Cy3-!ab!ed CpG DNA only were diluted in Opti-MEM medium and added to the cells. After 4 h incubation at 37°C in humidified air containing 5% C02, the cells were washed twice with PBS and fixed with 4% formaldehyde. ProLong Gold Antifade Reagent with DAPI {Life Technologies
Corporation, Carlsbad.. CA) was used to stain the cell nucleus and mount the sampies. Alexa FluorR. 488 phaiSoidin (Life Technologies Corporation, Carlsbad, CA, USA) was used to stain actio.. The images were obtained on a Olympus FV 1 (XX) confocal microscope (Olympus Corporation, Tokyo, Japan).
{00166j Atomic force microscopy imaging
{00167] RNA polygons were imaged with MnitiMode AFM anoSeope IV system
(Veeco), as per previously repotted methods(61). Briefly, the RNA samples were diluted with I * IMS buffer to a final concentration of 3-5 nM. Then, droplets of samples (5-10 L) were immediately deposited on APS mica. After 2 min incubation on the specifically modified APS mica surfaee(4 ! ;42), excess samples were washed with DEPC treated water and dried under a flow of Argon gas. AFM images in air were acquired using Mu ode AFM NanoScope IV system (Vceco Digita Instruments, Santa Barbara, CA) operating in tapping mode.
[00168) Dynamic Hght scattering
[06169) Apparent hydrodynamic sizes ofpreassembled triangle, square, and pentagon complexes (10 μΜ) in 5ϋμΧ.· TMS buffer were measured by Zetasizer nano~ZS (Malvern Instrument. LTD) at 25'"JC. "The laser wavelength was 633 am.
[001 ?0| Flow cytometry Assay
[00171 J RAW264.7 cells were detached from the cell culture flask by using a ceil scraper. The cells were washed with Opti- EM medium and aliquot in i .5 tnL Eppendorf tubes at the density of 5 x 105 eel Is per tube. NA nanoparttc!es harboring Cy3-iabied CpG DNA or Cy3 abled CpG DNA only were diluted in Opti-MEM medium and incubated with the ceils at 37°C for .5 h. The cel ts were vortexed eve 1 30 mm during the incubation. After washing with PBS, the ceils were resitspeoded in PBS and the intensity of fluorescence was determined by FACSCalibur flow eytometer (BD Biosciences, San Jose, CA).
[00172] Cytotoxicity assay
[00173) The cytotoxicity of RNA nanopaifieies harboring CpG OD.Ns was evaluated with an MTT assay kit (Promega, Madison, Wl), according to the protocol provided by the manufacturer. Briefly, RAW 264.7 cells were seeded at 96 well plates and cultured overnight at 37 C in humidified air containing 5% CQ2. RNA nanoparticles harboring CpG ODNs and controls were dissolved in fresh cell culture medium at the indieated concentrations and added to the cells for incubation at 3?*C for 24 h. Then, 15 iL of the dye solution was added to each well, followed by a 4 h incubation at 37°C, Next, Ι ΟΟμΙ of the solubilization solution was added to each well and the plate was future incubated at room temperature on a plate shaker until the forniazao crystals were completely sohibiSized. The absorbanee was measured at 57 nm using a microp!ate reader. The cell viability was calculated relative to the absorbance of the cell only control (viability of cell only control™ 1 ).
}0t)174] RNA polygons: triangle, square and pentagon fabrication and self-assembly
J0O175J The structural features of the recently discovered uhrastable pRNA WJ module from the bacteriophage Plii29 D A packaging motor were utilized tor in silico design of the RNA triaagie, square and pentagon 2D polygons. During the computer modeling we used the particular angle of the 3WJ formed by H I and H2 as an inner angle of the polygons as we hypothesized that, the angle could be stretched to a more open conformation. Throughout tilts report the mtra-heiteaJ angle between Hi and H2 is denoted as ZAOB, as shown in figure 1. Each RNA model contained a pRNA 3WJ motif at each vertex, and the inner angles correspond to ZAOB. The resulting 3D models exhibited fiat conformations, as expected from the plane geometry of the 3WJ motif (51} (Figure 2.4). As used herein, vertex refers to a point of an angle, such as ZAOB, and vertex refers to a corner of a polygon. By way of example, and with reference Figure 2B, the triangular polygon defined by internal strand D and external strands A, B, and C, includes three vertexes; the square polygon defined by internal strand R and external strands A , B, C, and D, includes four vertexes; and the pentagon polygon defined by interna! strand F and external strands A, B, C, D, and E, includes five vertexes.
(00176] Each polygon was composed of a different number of RNA strands classified as short strands (external) and long strands (internal) (Figure 2B). By increasing the number of external strands and the propagati on of the central or internal strand, the tension on the inter-helical ZAOB increased to 60°, 90° and 108°, allowing for 2D formation of corresponding triangle, square and pentagon shapes. The measured widths, from one corner to another, were 10.2 nm, while the heights differed as follows; triangle = 9.1 tun, square ~ 10.2 nm and pentagon - 12,7 nm. Following the transcription of individual RNA strands. self-assembly properties of the triangle, square and pentagon designs were evaluated on 7% native polyaerylamide gel electrophoresis (PAGE) (Figure 2C). Ail polygon formations were obtained by one-step seif-asscmbiy (7,10,11 ,19). Each. RNA component of corresponding nanopartides were whole chain labeled with Cy5 to evaluate participation of all RNA strands in their corresponding assemblies. Yield of correctly assembled polygons was estimated to be >9()% based on native PAGE gel evaluations. Equilibrium constants of dissociation were obtained from apparent D gels, and KD values were determined to be 18.8, 20,3 and 22.5 iiM for triangles, squares and pentagons, respectively (Figures 7 and 8).
[00177] These results demonstrate that each RNA nanopartiele assembles into the desired nanostructure. and indicated by a stretching of the 6i AOB to wider conformations. The assembly of RNA strands into specific-shaped nanoparticles based on the 60*ZA.OB of the p'R A 3WJ motif was controlled by modulating the number of short external stands and the length of the long in ternal strand,
{00178] Structural characterization of polygons by atomic force microscopy (AFM) and DLS
|00179] To further evaluate the size and shape of the resulting R A assemblies, structural characterization of each polygon was conducted by AFM. AFM images of the pRNA 3WJ based polygons revealed that the shapes of resul ting polygons were similar to their predicted, theoretical 3D models (Figure 3.4). The estimated average dimensions were found to be 13 ± 1.1 , 14 ± 1 ,8 and 17 1.6 nra for triangles, squares and pentagons, respectively. These values do not reflect the true sizes of the RNA polygons due to the AFM tip convolution, but rather demonstrate that the average size of the nanoparticles increases from triangle to pentagon, in addition, the central cavity of each RN A shape is visible, and the size of the ca vity gradually increases with the number of polygon vertices. The measured heights for all naiioparticles was found to be 2 nra, in agreement with previously reported heights of nucleic acid double helices (26,53).
[00180) Quantification analysts was performed to compare apparent yields between polygons observed on AFM mica surface,
1.00181] Equal concentrations ( 1 nM) of the polygons were deposited on a mica surface and correctly folded polygons were manually cottnted in a 0.5 μπΤ area, resulting in 48 triangular particles, 33 square particles and 17 pentagon nanopariic!es (Figure 9). The estimated number of triangular narioparticles adsorbed on the mica was 1.5 times more than that of the square and three times more than that of the pentagon. However, native PAGE revealed thai the yields among the three polygons were almost equal. The difference in adsorption amounts between polygon on the mica surface was presumably due to variation in their sizes and 3D conformations, resulting in different dynamic and physical -properties. {00182] Hydrodynaraie Diameters of the Polygons by DLS was performed to determine the apparent hydrodynamic diameters for each of the polygons.
{00183] DLS was performed to determine the apparent hydrodynamic diameters for each of the polygons. The diameters were found to be 9.1 , ί 1.2 and 13.5 nm for triangles, squares and pentagons, respectively (Figure 3B). The increase in number of 3WJ cores corresponds with the larger observed diameter. The measured diameters agreed with their corresponding 3D models. However, there was a discrepancy between polygon, sizes determined by AFM and DLS. This could be attributed to the fundamentally different techniques, as DLS determines the average size distribution profile of nanoparticles in solution assuming that the polygons have globular shapes [refer to manual at http:
/www.malvera.com], w!nle AFM imaging can produce images larger than the real diameter due to tip size used (54) and the resolution of imaging equipment. Nevertheless; the two techniques demonstrated that the relative size of the nanoparticlcs increased from triangle to square to pentagon,
[00184) Accordingly, native PAGE, AFM and DLS showed the formation of compact molecular 2D assemblies of triangle, square and pentagon based on the pRNA 3WJ ZAOB. (00185] Consequently, the naturally preserved 60 ZAOB could be stretched to reach the formation of square and pentagon. The stretching, or tension, t hat the angle underwent could have bad a significant impact on the overall stability of the naooparticles. Therefore, it was of great interest to evaluate and compare the polygon's stabilities.
(00186) Stability comparison between triangle, square and pentagon
(00187) TGGE investigation of Polygon Stability
(00188) The stabilities of polygons were studied using a perpendicular TGGE (Biometra GmbH). This convenient technique has garnered widespread use for measuring melting temperatures of RNA nanopatlicles with multiple strands (5,7, 1 ,26,28,55). The preassembled polygons were subjected to 7% native TGGE with a gradient temperature of 30-70°C perpendicular to electrical current. The following apparent TM values were obtained for the polygons at 100 n total concentration (Ct in presence of 0.2 roM MgC12: triangle TM ::: 56°C, square TM ::: S aC and pentagon TM ::: 30°C (Figure 4A). The triangular nanoscaffolds were more stable than squares and pentagons, although the number of RNA bp was much, higher in the pentagon construct, as compared to the square and triangle. Usually, the stability of nucleic acids with the same base-pair content is directly dependent on metal ton and total nucleic acid concentrations. Since these two criteria were the same, it was assumed that the higher the number of bp in a given RNA structure the higher the stability. Therefore, the most stable shape produced should be the pentagon. However, based on TGGE data the opposite was found. This was iikely due to the tension caused by the stretching of the native pRNA 3Wi 60° ZAOB. The triangular construct angle was preserved (60*)., the square and pentagon angles were stretched to the wider conformations of 90° and 108°, respectively. Previously it has been shown that any nucleotide mutations or deletions within the nati ve core structure of the p'RNA 3 WJ motif woitid also result in the loss of its thermodynamic stability (10). Interestingly, the measured triangle and square TM values differed by +3°C, as did the square nd pentagon. Boiling resistance assay in the presence and absence of 8 M urea further confirmed that the triangle was the most stable nanoparticle {Figure 4B), The quantification of nanoparticle bands after heating to I 0 °C resulted in 75 * 4% recovery of the triangular assembly, suggesting a TM i OO C. By definition, TM is the measured temperature when half the RNA concentration has melted, i.e. 50% recovery. The percentage of recovery for square was 28± 2% and for pentagon was 16 5%, much lower than the value estimated for triangie recovery. The experiment with the presence of 8 urea irt boiling solution showed that the overall trend of stability remained the same, but the percentage of recovery was 55 ± 4% for triangie, 8 .3% for square and no pentagon fraction was detected. Overall, the nanoparticle with fewer 3 WJ motifs (triangie) resulted in a higher thermostability and resistance in chemical degradation and the change in stability was in large part due to the stretching of the ZAO.B.
100189) Toxicity Assay for CpG -RNA polygons
(00190) The modulation effect of triangle, square and pentagon harboring
immunologic adjuvant CpG ol igonucleotide is an immunological adjuvant popularly used as vaccine adjuvant or immunotherapy reagent for disease control and treatment (42). To evaluate whether RNA polygons can enhance the innmtnomodufation effect, CpG
oligonucleotide was incorporated with each RNA polygon using one-pot self-assembly (Figures 10-12). The toxicity assay for the resulting complexes revealed no toxicity; moreover the RNA poiygon-CpG complexes induced ceil proliferation during the incubation period, as compared to the ceil only control (figure 13). {001 1 J Measurement of the release of T F -alpha and IL-6 cytokines
[00192) The extracellular imnrunostimulatory efficacy of RNA polygons was evaluated by measuring flic release of cytokines T F-a. and iL-6 after addition to mouse macrophage- like RAW264.7 cell (Figure 5A and B), as previously described (56f57). The triangular RNA nanoparticie coupled with only one CpG exhibited the highest level of cytokine induction for both TNF-a and IL-6 compared to square and pentagonal RNA nanoparticles. Increasing the number of CpG per nanoparticie yielded the opposite effect, as pentagonal RNA nanocarriers showed the highest level of the induction of both TNF-a and IL-6 presumably doe to the increased local CpG concentration. The results suggest that the cytokine release by CpG coupled to RNA polygons with different shapes remarkably increases the imomnostimuiatory activity compared to CpG alone (Figure 5). RNA particles with the size of about 10 tan, such as the triangle, induced the greatest amount of TNF-a and IL-6. In addition, the induction of cytokines was highly dependent on the number of CpG per polygon. With increasing number of CpG per polygon, a stronger immune response is observed (Figure 5C), demonstrating an advantage of transiting from triangle to pentagon that can carry five CpG oligonucleotides.
{00193) Enhancement of modulation effect in animal by immunological adjuvant incorporated into RNA triangle
{00194 | To examine whether RNA nanoparticles retain their im-munostimulatory activity in vivo, nanoparticles were administered to CD-I mice by injection mto the tail vein at 2 mg kg (CpG oligonucleotide per body weight), following l evel determination of cytokine TNF-a and IL-6 levels after 3 h post-administration in collected blood serum. Figure 5D shows that free triangle nanoparticles and free CpGs did not. induce any cytokine production, whereas the complex triangie-CpG resulted in elevated levels of both cytokines. The
difference in immunostimulatory activity of triangle-CpG was estimated to be 10-fold compared to free CpG in vivo. These data arc in agreement with the in vitro s&raulation of murine RAW264.7 cells.
J¾0195j Comparison of cell ular uptake by different CpG-R A polygons
{00196} Previously, it has been demonstrated that the CpG oligonucleotide can be readily recognize by TLR.9 on the endosoraal membrane of macrophages, resulting in cellular uptake of the CpG adjuvants (5 ,59). To investigate whether there is a difference between the efficiency of RNA polygons binding to the cells, we quantified the cellular uptake of polygons-CpG using flow cytometr ' assay (9,10). Figure 6A demonstrates the binding of different RNA polygon-CpG to the RAW264.7 cells in a dose-dependent maimer. There was an increase in binding efficiency from triangle to pentagon with more CpGs (Figure 14). Notably, ail RNA polygons-CpG complexes remain intact after 16 Ii incubation in fetai. bovine serum (FBS indicating robustness of the assembled complex in extracellular environment (Figure 1 ). Overall, RNA pol on-CpG complexes exhibit significantly more binding efficiency to cells compared to CpG oligonucleotides alone.
{00197] This observation was further confirmed by confocal microscopy images
(Figure 6.B) revealing that RNA nanoparttele harboring CpGs are localized in the cytoplasm exclusively and that there are much higher amounts of triangular nanopartieies inside the cell compared to free CpG, suggesting that RNA nanoparticles could efficiently enhance the cellular uptake of the CpG adjuvants.
1001 81 Collectively, both flow cytometry and confocal imaging demonstrated that all
RNA nanoparticles with different shape and harboring CpGs have much stronger binding and cellular entry to the maerophage-like RAW 264.7 cells compared to free CpGs. In addition, cellular uptake was highly dependent on the number of CpG per polygon. With the increasing number of CpG per polygon, more efficient cell entry was observed (Figure 5C), demonstrating the ad vantage of the transition fro t triangle to pentagon nanopartic!es that can carry five CpG,
|0019 j Artificial construction of R A nanoparticles requires knowledge of the structural properties of RNA motifs, such as interhelical or intraheUcal distances,, X-Y and X-Y-Z angles, number and orientations of RNA branches in multi-way junctions, canonical and non-canonical interactions, binding sites for proteins, metal tons and small molecules (2,1.0, 16,25,51 ,60). Progression in RNA structural biology allowed for the analysis of RNA 3D motifs from existing RNA structures at atomic resolution and various data bases, including www.pdb.eora, RNA multi-way junction (61 ) and find RNA motif (62), This study, based on the previously repotted versatile pR A 3WJ 3D motifs (PDB accession ID: 4KZ2) (10,51), show that the 3WJ structure can be folded into desired conformations based on die dynamics of the 60*ZAOC, demonstrating the ability to tune the physical and structural, properties of RNA polygons for a variety of technological, biological and medicinal needs. This approach, based on the propagation of the central RNA strand used to direct the folding of corresponding short or external strands into planar triangle, square and pentagon conformations, resulted in the 60°, 90" and 108*·' bending of interhelical ZAOC of the pRNA 3WJ, This is especially important for medical applications where one needs to construct different RNA nano-seaffo s based on a nontoxic and therrnodynamicaHy stable building block. The following advantages result from this technique: (i) the number and combination of therapeutic molecules can be tuned to an RNA-based nano-eamer; (it) the nano-seaffbid has a controllable size and shape and (sii) variable thermodynamic and RNase resistance properties can be appl ied depending on the application of the nano-seaffoid.
[0020 | In addi tion to the discovery of the unique approach for the rational design of stable RNA nanoparticles, it has been demonstrated that each RNA polygon has the potential to serve as multivalent nanocarriers of vaccine adjuvants, particularly of CpG oiigodeoxynucieoiides. The designed RNAs sclf-asscrable into distinct, non-toxic
homogeneous nanoparticies with high chemical, thermal and intracellular stability. We found that the size and shape of the A nanostructures arc- important factors for the indu ction of immunostimulatory processes m vitro and in animal models ami that there is a correlation, between the cytokine induction and the local CpG concentration effect. The highest level of secretion of pro-inflammatory cytokines tumor necrosis factor TNF-a, intcricukin 0L)-6 was obtained with the smallest: nanoparticle (triangle -· 9 um size) harboring one CpG compared to square i-l 1 ran) and pentagon (-13 nra). However, upon increasing the numbers of CpG per RNA nanoparticle the cytokine induction was affected more by pentagon as the number or local concentration of CpG is highest in the pentagon. This study illustrates the importance of the size and shape of RNA nanoparticies for improvement of activity of CpG based vaccines targeting infectious diseases and cancer cells, as well as for increasing immune- response by the .innate and adaptive immune systems. The RNA nanoparticies harboring CpGs are safe, effective, versatile and easy to manufacture, offering new solutions to address die unmet needs in current vaccines and adjuvants. Recent findings on the thermody- namicaity ultra-stable ( 10,1.1 ) and heat-resistant ( 18) R A nanoparticies have expanded the potential for application of pRNA 3W.1 derived nanoparticies in the fields of biomedical, nanotechnoiogy, or polymer industries.
{00203| In Figure 64, cytokine testing of 2'F triangle harboring CpG, DNA triangle harboring DNA CpG and 2'F triangle harboring 2'F RNA CpG shows increased TNF-a in ce l culture supernatant in the 2 Triangle harboring 2'F RNA CpG compared to 2'F triangle harboring DNA CpG and DNA triangle harboring DNA CpG.
[00202] Throughout this document, various references are mentioned. All such references are incorporated herein by reference, including the references set forth in the following list: REFERENCES
1. Ουο,Ρ., Zhang,C., Che C., Trotticr,M. and Garveri- . (1998.) Inter-RNA interaction of phage pM29 p A to form a hexarneric complex for viral DNA transportation. Mol. Ceil, 2, 149-155.
2. Guo,P, (2010) The emerging field of RNA nanoiechnology, Nat. NanotechnoL, 5, 833-842.
Chen,C., Zhang,C. and GuofP. (.1 99) Sequence requirement for haod-io-hand interaction in formation of pRN A diniers and hexamers to gear phi29 DNA translocation motor. RNA, 5, 805-818.
4 Geary ,C, Chworos^A. and Iaeger L. (2010) Promoting RNA helical stacking via A-rarnor junctions. Nucleic Acids Res., 39, 1066-1080.
s. GraboWjW.W., Zakrevsky,?., Albnin^ .A., ChworosA.,
Shapiro,B.A. and JaegerX. (2011 ) Self-assembling RNA nanorings based on RNAI 11 inverse kissing complexes. Nana Left., 11, 878-887.
6. ShuJD., MolLW D., Deng ., Mao,C. and Guo,F. (2004) Bottom-up assembly of RNA arrays and superstructures as potential parts in nanotechnology. Nemo Lett, 4, 1717-1723.
?. Shu,Y., Haque,P\, S'huJD., Li,W., 7Mn,Z.., otb,M., LyubehenkoA'- and Guo,.P. (2013) Fabrication of 14 different RNA nanoparticles for specific tumor targeting without accumulation in normal organs. RNA, 19, 766-777.
s. Shu,D., Hnang ., HoepriekS- and Οηο,Ρ. (2003) Construction of phi29 DNA- packaging RNA (pR A) monomers, diniers and trimers with variable sizes and shapes as potential parts for naao-devices. J. NenascL NanotechnoL, 3, 295-302.
9. Shu.Y.. Shu,D.s HaqueJF. and Guo,P. (2013) Fabrication of RNA nanoparticles to deliver fherapeutic RNAs and btoactive compounds into tumor cells. Nat. Protoc , 8, 1635 1659.
1 . SIHLD., Shit , HaqueJP., Abdea«awla,S- and Guo,P, (201 1) Therraodynamically stable RNA three-way junctions for constructing niuitifuntionai -nanoparticles for
deli very of therapeutics. Nat. NanotechnoL, 6, 658-667.
n. Haque,F.s Shu,D., Shu,Y.? SMyakhtenko ,, Rychahou,P.s Evers.M. and Guo,P. (2012) Ultrastable synergistic tetravalent RNA nanoparticles for targeting to cancers. Nana Today. 7, 245-257,
is. Shu J). , Zhang,!,. , Khisamutdmov,E. and Guo,P. (2013) Programmable folding of fijsion RNA complex, driven by the 3WJ motif of phi2.9 motor pRNA. Nucleic Acids Res. u. PonchonJL and DardeLF. (2007) Recombinant RNA technology: the {RNA scaffold. Nat. Methods, 4, 571-576,
1 . SevercanX,. Geary ,C, ChworosA,, VossJN., iacovettyX, and JaegerX, (2010) A polyhedron made of tRNAs. Nat. Ckem., 2, 772-779. is. asalcanJ Baudrey.S., Lcontis,N.B. and Jaeger ,L. (2006) Controlling RNA self- assembl to form filaments. Nucleic Acids Res., 34, 1381-1392.
is. Novikova„I.V.„ Hassan,B.H., MirzoyanfM,G. and Leontis.N .B. (2010) Engineering cooperative tecto-R A complexes having progran nable stoichiometrics. Nucleic Acids Res,, 39, 2903-2 17.
«?. IsMkawa ., FirjitaX, Maeda,Y., Furataii and lkawa,Y. (2010) GNRA/reeeptor interacting modules: versatile modular units for natural and artificial A architectures.
Methods >4> 226-238.
is, hisamutdinov.E.F., .lasinski,D.L. and Guo,P. (201 ) RNA as a boiling-resistant anionic poly mer material to build robust stntctitres with defined shape and stoiehiometrv. ACS Nana
59. Αίοηίη,Κ.Α., Bindewaid,E,, YagboubianA-k, Voss,N„ Jacovetty,E., Shaptro.BA. and Jaeger,L. (20.10) In vitro assembly of cubic RNA-based scaffolds designed in silico. Nat. Nanotectmol, 5, 676-682..
20. OiifK H., KobayashiX, KabataJ ., ΕίκΙο, ,, lwasa,T., Yoshimura,S.H., Ta'keyasujli,, ϊηουε,Τ. and Saito,H, (2011) Synthetic RNA-protein complex shaped. Hkc an equilateral triangle. Nat. Ntmotee no!., 6, 116-120.
2i Shaptro,B,A., BindewaldJE., asprzak,W, and Yitig!ing (2008) Protocols for the in silico design of RNA nanostructures.' Methods Mol. Biol, 474, 93-1 15.
a. LeeJ.B., HongJ., BonnerJD.K., Ροοη,Ζ. and Hammond,?.!. (2012) Self-assembled RNA interference microsponges for efficient siRNA delivery. Nat. Mater., 1 1, 3 Ϊ 6-322.
23. Guo,P (2012) Rolling circle transcription of tandem siRNA to generate spheruUtic
RNA naaopartielcs for cell entry . Mol. Ther. Nucleic Acids, 1 , e36.
a*. iaegcr.L., Westhof.E. and Leontis.N.B. (2001 ) TectoRNA: modular assembly units for die construction of RNA nano-objects. Nucleic Acids Res., 29, 455-463.
25. Leontis, .B . and Westho E. (2002) The annotation of RNA motifs. Comp. Fund. Genomics, 3, 518—524.
26. ChworosA-, Severean,!., Koyfman,A.Y„ Weinkam,P., Οκη ν,Ε., Hansma,H.G. and Jaeger ,L. (2004) Building programmable jigsaw puzzles with RN A. Science, 306, 2068—2072.
27. DibrowS , McLean J., Parsons, J. and Hermann,!. (201 1 ) Self-assembling RNA square. Proc. Natl. Acad. Set. U.S.A., 1 8, 6405-6408.
2s. Severean JU Geary,C., Verzemnieks,E., ChworosA. and Jaeger.L. (2009) Square- shaped RNA particles from different RNA folds. Ni o Lett. , 9, 1270-1277.
29. Garver,K. and Guo.P. (2000) Mapping the inter- RNA interaction of phage p 29 by site- specific photoaffinity erosslinking. J. Biol Chem. , 275, 2817-2824.
¾ Chen,C, Shertg,S., Shao,Z. and Guo ,Ρ. (2000) A dimer as a building block in assembling RNA: a hexamer that gears bacterial vims phi29 DNA-translocarina noachinery. J. Biol. Ckem., 275. 17 510-17 516. 31. Cayrol,B., Nogues,C, DawidA. Sagi , Silbcrzan,P. and lsambert,H. (2009) A nanostrueture made of a bacterial noncoding RNA. J. Am. Chew. Sac , 131 , .17 270-17 276,
32. LescoutcA. and WesthofE. (2006) Τοροΐοεγ of three-way junctions in folded RNAs. RNA., .12, 83-93.
3 . Leontis.N.B. aod WesthoCE, (2003 ) Analysis of RNA motifs. CUIT. Opto. Struct. Biol , 13, 300-308.
34. Walter,F., MurehieAX, DuckettjD.R, and. tiiiey,D.M. (1998) Global structure of four-way RNA junctions studied using fluorescence resonance energy transfer. RNA., 4, 719-728.
3. Ul.ley,D..M (2000) Structures of helical junctions in nucleic acids. Q. Rev. Bfophvs., 33, 109-159.
Batey,R.1\, Rambo,R..P. and DoudnaJ.A. (1 99) Tertiary motifs in RNA structure and folding. Angew. Chem. Int. Ed Engl., 38, 2326-2343.
37. BirtzeLD.W,, Khisamutdinov.E.F. and G o.P. (2014) Entropv-driven one-step formation of P 29 pR A 3WJ from three RNA fragments. Biochemistry,' 53, 2221-2231 .
Krieg„A.M. (2003) CpG motifs: the active ingredient in bacterial extracts'? Nat Med., 9, 831-835.
3 , Medziiitov,R. (2001) CpG 0ΝΑ; security code for host defense. Nat Immunol., 2, 15- 16.
40. LatzJS., Sehoenenieyer.A,, VisiutrtvA, Fitegerald. .A., Monks-B.G.., netter.C.F,, ϋοπ,Ε, NilsenJX!L Espev& and Golenbock.D.T. (2004) TLR9 signals after
translocating from the ER to CpG DNA in the iysosome. Nei, ImmurmL, 5, 1 0-1 8. i Hemmi,H., Takeuchi.,0., Ka aiJ'., Kaisho,T., Sato,S., Saajo,H,« MatsnniotoJvl,
Hoshm K., agnerJT, Takeda.K. et l (2M0) A toll-like receptor recognizes bacterial DNA. Nature, 408, 740-745.
43. BorsiX., Carnemolla,B,, Nicoio l, Spi«a,B,, Ta«ara,G. and Zardi,L. ( 1992) Expression of different tenascin isoforms in normal, hyperplastic and neoplastic human breast tissues. Int. J. Cancer, 52, 688-692.
43. MoJ.H., PartcS.W., Rhce.CS., Takabayashi.K., Lee.S.S., Quan,S.H, Kim,I.S., ΜίΠ,Υ.Ο ,, R.az,E. and Lee.C.H. (2006) Suppression of allergic response by CpG motif oiigodeoxyniucieotide-house-dust mite conjugate in animal model of allergic rhinitis. Am. J. .Rhinol., 20, 212-218.
44. Sandler,A.D,, Crahara,H"., Kobayashi,G.s Zhu Y., Md!eivMA, Scott,D,L,. and Krteg.A.M. (2003) CpG oligonucleotides enhance the tumor antigen-specific immune response of a granulocyte macrophage colony-stimulating factor-based vaccine strategy in neuroblastoma. Cancer Res., 63, 394-399.
1 Saha,A., Barai,R.N., Cha.tterjee,S. ., Mohanty, ., Pal,S., Foon, .A.. Primus,?.!., Krteg,A,.M.s Werne ,G, I and Bhattacharya-ChatterjeesM. (2006) CpG oligonucleotides enhance the tumor antigen-specific immune response of an anti-idiotype antibod -based vaccine strategy in CEA transgenic mice. Cancer Immunol Immtmother. , 55, 5.15-527.
*. Winier,P.M., MorawskLA ., Carisihes S.D., FuhrhopJLW., Zhangll, Wi!liarosXA., AllenJ'.S,, Lacy,E, ., RobertsonJ.D., La.oza,G.M. ei «/, (2003) Molecular imaging of angiogenesis in early-stage atherosclerosis with aipha(v) eta3-integrin-targetBd
nanoparticies. Circulation, 108, 2270-2274.
7. Moht K,, Nishikawa,M.f Takahashi,N., Shiomi,T., MatsuokafR„ OgawaJC., Endo.M., Hidaka,K., Sugiyama,H., Takahashi,Y . et al. (2012) Design and development: of nauosized DNA assemblies in polypod-like structures as efficie t vehicles for irnmunostimulatory CpG motifs to immune cells. ACS Nana, 6, 5931 5940.
4S. NoeLA., JostM. and aquoiE. (2008) Matrix metal proteinases at cancer tumor-host interface. Serntn. Cell Dev. Biol, 19, 52-60.
MatsuokaJN., .tshika a,M., Mohri, ., RartaoakiaLS. and Takakura.Y. (2010) Structural and immunostimulatory properties of Y-shaped DNA consisting o phosphodiester and phosphorothioate oligodeoxynitcieotkles. J. Control Release, 148, 31 1-316.
.¾>. Narunsky,L,. Oren,R.s Bochner,F. and NeemanjVL (2014) Imaging aspects of the tumor stroma with therapeutic implications. Pharmacol. Then, 141 , 192-208.
;i. Zhang,H.s Endrizzi.J.A., Shu,Y., Haque,F., Sauter,C, Shlyakhtenko,L.S
Lyu chenko,Y., Guo,F. and Chi, Y.I. (2013) Crystal structure of 3WJ core revealing divalent ion-promoted therraostabiiity and assembly of the Phi29 hexaraeric motor pRNA. RNA, 19,
1226-1237.
5Ϊ. Collins, TJ. (2007) ImageJ for microscopy. BiotechMques, 43, 25-30.
Lyubchenko,Y.L. and ShiyakhienkoJL.S. (2009) AFM for analysis of structure and dynamics of DNA and proteirt-DNA complexes. Methods, 47, 206-213,
5 , Lyubchenko,Y.L., GaU,A.A., Shlyakhtenko .S., Hamngton,R.E., Jaeobs,B.L.,
Oden,P.I. and Lmdsay ,S.M, ( .1992) Atomic force microscopy imaging of double s tranded DNA and RNA. J. Biomol Struct. Dyn. , I (I, 589-606.
55. ChadalavadaJD.M. and Beviiaee.ua,P,C, (2009) Analyzing RNA and DNA folding using temperature gradient gel electrophoresis (TGGE) with application to in vitro selections. Methods Enz ol, 468, 389-408.
sc. LLL Pei J L, Zhu.B., Liang,L,, Wei,M,5 He,Y., C¾en,N., L D., Huang,Q. and Fan,C,H. (201 .1 ) Self-assembled multivalent DNA nanostruetures for noninvasive intracellular delivery of immunostimulatory CpG oUgonucleotides. ACS Nana, 5, 8783-8789.
$?. Mohn,K,5 TakahashLN., Nishika a^'L usuki,&, ShioroiX, TakahashiY. and
Takakura,Y. (2012) Increased immunostimulatory activity of polypod-like structured DN A by ligation of the terminal loop structures. J. Control Release, 163, 285-292, 58. Murplry K., Piper,R. ., Grce voodJLR., MitohAtG., Laraperti,PJ., Seltzer,S.M., BakSjMJ. and Phillips,M.H. (2004) Evaluation of the new cesium- 131 seed for use in low-energy x-ray braehymerapy. Med. Phys., 31 , 1529-1538,
59. LecF.T., Rigopo sA, HalLC, ClarkeJL, CodySiL SraythJFE., Liu,Z., Bs¾chbieLM.W., Hanai,N., NiceJB.C. et ai. (2001 } Specific localization, gamma camera imaging, and intracellular trafficking ofradiolabelled chimeric anti-G(D3) gaaglioside monoclonal antibody KM87 in S - MEL-28 melanoma, xenografts. Cancer Res., 61 f 4474-4482.
so. Αίοιώι,Κ.Α,, Ctepiy?DJ. and Leontis,N.B. (2008) Specific RNA self-assembly with minima! paranemte motifs../. Am. Chem. Soc, 130, 93-102.
6! Bindewakf E., HayesyR., Ymgling,Y.G., Kasprzak,W. and ShapirojlA. (2008)
RNAJunction: a database of R A junctions and kissing loops for three-dimensional structural analysis and nanodesign. Nucleic Acids Res., 36, 'D392-D397.
si. Petrov ,A. ZirbeLC.L. and Leo is,N.B, (201 1 ) WebFR3.D-a server for finding, aligning and analyzing recurrent RNA 3D motifs. Nucleic Acids Res., 39, W50-W55.
«s. Shu V. Shu D, Haque F, Guo P. Fabrication of pR. A Nanoparticles to Deliver
Therapeutic RNAs and Bioactive Compounds tato Tumor Cells. Nature Protocols 8, .1635- 1659 (2013).
w Slut Y, Haque F, Shu D, Li W, Zhu Z, otb M, Lyubchenko Y, Guo P. Fabrication of 14 different RNA nanoparticles for specific tumor targeting without: accumulation in normal organs. RNA. 2013 jiin;! 9(6):767-77.
65. Reif R, Haque F, Guo P. Fluorogcnic RNA Nanoparticles for Monitoring RNA
Folding and Degradation in Real Time in Living Cells. Nucleic Acid Ther. 2012
Dec;22(6):428-37.
m. Shu D, Shu Y, Haque F, Abdebnaw a S and Guo P. 201 1. Tbermodynamica!iy stable RN A three-way junction for most recent constructing multifunctional nanoparticles for delivery of therapeutics. Nature Nanotechoology. 6( i0):658-6?,
67. Abdehnawla S, Guo S, Zhang L, Pulukuri SM, Patankar P, Conley P, Trebley J, Guo P, Li QX. 201 1 , Phannacological Characterization of Chemically Synthesized Monomeric pM2 pRNA Nanoparticles for Systemic Delivery. oi Ther. 19(7): 13.12-22.
68. Liu J, Guo S, Cinier M, Shlyakhtenko L, Shu Y, Chen C. Shen G, and Guo P. 201 . Fabrication of Stable and RNase- Resistant RNA Nanoparticles Active in Gearing the
Nanometers for Viral DNA Packaging. ACS Nano. 5 (1 ), 237-45.
69. Guo P. 20! 0. The emerging field of RNA nanotechnoloa . Nature anotechnology. 5, 833-45.
7 . Guo S, Huang F, and Guo P. 2006. Construction of Mate-conjugated phage phi29 motor p.RNA for delivery of chimeric siRNA to nasopharyngeal carcinoma cells. Gene Ther. 13,814-820. 7i. Khalcd A, Gno S, LI F, Guo P. 2005. Controllable Self- Assembly of Naiioparticies for Specific Delivery of Multiple Therapeutic Molecules to Cancer Ceils Using RNA
Nanotechnology. Nano Letters, 5: 1797-1808.
n. Guo S, Tschammer N, Mohammed S and Guo P. Specific Delivery of Therapeutic RNAs to Cancer Cells via the Dinienzatioii Mechanism ofphi29 Motor pRNA. Human Gene Therapy. 2005, 16(9.) 1097- U.09S.
73. U.S. Patent Application Publication No, 2009/0081157 to Kombtut et ah for
"InHtiuiiostiulator Combinations for Vaccine Adjuvants."
7 . International Patent Application Publication No. WO 2005/003293 to Guo et ai. for "pRNA Chimera."
7s. International Patent Appiication Publication No. WO 2012/170372 to Guo for "p'RNA Multivalent Junction Domain for Use in Stable Multivalent RNA Nanoparticles."
} 0203| All publications, patents, and patent applications mentioned in this specification, including the Appendixes, are herein incorporated by reference to the same extent as if each individual publication, patent;, or patent application was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:
1, A composition, comprising:
(a) an RNA-oligonucleotide, which can be: single-stranded or double stranded, and
(b) an immunosti initiatory motif.
2. The composition of claim 1 , wherein the RNA-oligonucleotide includes a chemical modification selected from 2'Fiuoro, 2' Amine, and 2'O-Methyl.
3. The composition of claim 1 , wherem the RNA-oligonucleotide is about 8-50 bases in length.
4. The composition of claim 1, wherein the RNA-oligonucleotide is single-stranded.
5. The composition of claim 1 , w herein the RN A-oligonucleotide is double-stranded or partially double-stranded.
6. The composition of claim 1, wherein the inirtiunostimidaiory motif is selected from an immitnosrimuiatory RNA (isRNA), and a CpG oligodeoxyribormcleodde.
7. The composition of claim 6, wherein the immunostimulatory motif is conjugated to the RNA-oligonucleotide .
8. The composition, of claim 6, wherein th immimosttmuktory motif is CpG oligodeoxyribonucleotide conjugated to the RNA-oligonucleotide.
9.. The composition of claim 7, wherein the isRNA is CpG RNA conjugated to the R A- oligonucleotide.
10. The composition of claim 6, wherein the composition is provided as an adjuvant,
11. The composition of claim 9, wherein the oligonucleotide sequence is selected from A21 CpG RNA (SEQ IB NO: 16), B2I CpG RNA (SEQ IB NO: 18), and C2I CpG RNA (SEQ IB NO: 20).
12. An artificial RNA nanostructure., comprising
three, four, or five exteraal strands of RNA, each external strand including about 40-50 nucleotides;
one internal strand of RNA, including more than about 50 nucleotides, the internal strands and exteraal strands assembled to form a triangle nanostructure, a square nanostructure, or a polygon nanostructure; and
a pRNA three-way junction (3WJ) motif at each vertex of the nanostructure.
13. TSie nanostructure of claim 1.2 wherein the nanostructure is a triangle and has a stretched iotrahelical angle between i l l and H2.
14. The nanostructuie of claim 12 wherein the nauostructure is a square and has a stretched intrahelical angl between HI and E2. 5. The naaostr uciitre of claim 12 wherein the nanost cture is a pentagon aad has a stretched intrahelical aagle between H 1 and 112.
16. The oanostructure of claim 12 , comprising one or more the sequences of SEQ ID NOs 1- 4. i 7. The nanostriicTure of claim 12, comprising the nanostructure comprises one or more the sequences of SEQ ID NOs 5-9.
18. The oanostructure of claim 12, comprisin the oanostructure comprises one or more the sequences of SEQ ID NOs 10-15.
.1 . The nanosiructure of claim 12, comprising the uanostructure comprises one or more the sequences of SEQ ID NO 1, 2, 3, and 4.
20. The nanostmcture of any one of claims 12- .19, comprising one or more
immimosiimui tory motifs.
23 . The naoosif uctiire of claim 20, wherein the one or mor immimostimulatory motifs are selected from selected from one or more immunostimu!atory RNAs (isRNA) or CpG motifs.
22. The iiaaosti ueiure of claim 21 , wherein the one or more CpG motifs are selected from the CPG motifs having the sequences of SEQ ID NOs: 16, I S, and 20.
23. A composition, comprising;
fa) the RNA nanostructure of any one of claims 12-22,
(b) and an adjuvant, an antigen, and/or a targeting Hgand.
24. A composition, comprising:
(a) an RNA nanostructure , and
(b) an adjuvant, an antigen, and/or a targeting Kgarsd.
25. The composition of claim 24, wherein the RNA nanostructure is selected from RNA triangle, RNA square, RNA pentagon, RNA hexagon, RNA three-way junction, and RNA four- way junction.
26. The composition of claim 24, wherein the RNA nanostructure is derived from a 3WJ motif.
27. The composition of claim 24, wherein the RNA nanostructure contains a stretched intrahehcal angle between H I and 112.
28. The composition of claim 16 or 17, wherein the adjuvant is selected from an imm nostimulatory RNA (isRNA) and a CpG oHgodeoxyribonucleotide (CpG).
29. The composition of claim 28, wherem the adjuvant is isRNA that is about 8-50 bases in length.
30. The composition of claim 28, wherem the adjuvant is isRNA and the is RNA is incorporated, into the RNA nanoparticie by being covalently bonded to an RNA strand of the RNA nanoparticie.
31 . The composition of claim 30, wherein the isRNA is a CpG RNA.
32. The composition of claim 31 , wherein the CpG RN A is selected from the group consisting of A21 CpG RNA (SEQ ID NO: 16), B21 CpG RNA (SEQ ID NO: 18), and C21 CpG RNA (SEQ IB NO: 20).
33. The composition of claim 28, wherein the adjuvant is isRNA and the isRNA is incorporated into the RNA nanoparticie by base pairing.
34. The composition of claim 33,, wherein the isRNA is a CpG RNA, 35, The composition of claim 34, wherein th CpG RNA is selected from the group consisting of All CpG RNA (SEQ IB NO: 16), B21 CpG RNA (SEQ ID NO: 18), and C21 CpG RNA (SEQ 10 NO: 20).
36. The composition, of claim 24, wherem t he adjuvant is t he composition of any one of claims 1-1 ! .
37. The composition of claim 36, wherein the RNA-oiigonucleotide and immunostimulatory motif are incorporated into the RNA naiioparticle by base pairing between the RNA- oligonucleotide and the RNA nanoparticle.
38. The composition of claim 36, wherein the RN A-oiigonucleotide and immnnostimulatory motif are incorporated into the RNA nanoparticle by the RNA-oiigonucleotide being covalently bonded to an RNA strand of the RNA nanoparticle.
39. The composition of any one of claims 24-27, wherein the antigen is derived from a bacteria, vims, or cell.
40. The composition of any one of claims 24-27, wherein the antigen binds to a neutralizing antibody or an inhibitory antibody.
41. The composition of any one of claims 24-27, wherein the antigen is a neutralizing epitope.
42. The composition of airy one of claims 24-27, wherein {lie aaiigen is selected from: B-cell epitope, T-cell epitope, T-helper epitope, epitopes derived from PG120, gp4leptopes, glyeans, peptides, T-heiper peptides, and streptavidin,
43. The composition, of any one of claims 24-27, wherein the targeting ligand is selected from; an aptamer, a ceil surface marker, folate, siR A and shR A.
44. The composition of claim 43, wherein the aptamer binds to an B1Y epitope.
45. The composition of claim 43, whereio the cell surface marker is a macrophage or a lymphocyte.
46. The composition of any one of claims 24-27, wherein the targeting ligand targets B cells, T cells, dendritic cells, macrophages, and/or cancer cells,
47. The composition of any one of claims 24-27, comprising at least two targeting iigands.
48. The composition of claim 47, wherein the targeting Hgands are the same.
49. The composition of claim 47, wherem the targeting Hgands are not all the same.
50. The composition of claim 24, wherein the composition induces an immune response.
51. The composition of claim 51„ wherein the immune response increases cytokine at least ten fold as compared to th adjuvant, the antigen, and/or the targeting Ligand provided
independently of the RNA nanostructure.
51. A method of inducing an. immune response in a subject, comprising administering to the subject an effective amount of the composition of any one of claims 1-35.
52. A method of inducing the production of cytokines comprising administering to a subject an effective amount of the composition of any one of claims 1-1 L
53. The method of claim 52, wherein the inducing the production of cytokines is increased at least ten fold as compared to the tmtnunostimulatory motif provided independently of the RNA - oligonucleotide.
54. The method of claim 52 wherein the subject has or is at risk of having a pathological condition.
55. A method of inducing the production of cytokines, comprising administering to the subject an effective amount of the composition of any one of claims .12-35.
56. The method of claim 55, wherein the inducing the production of cytokines is increased at least ten fold as compared to die adjuvant, the antigen, and/or the targeting ligand pro vided independently of the A nanostructure.
57. The method of claim 55, wherein the subject, has or is at risk of having a pathological condition.
58. The method of claim 55, wherein the cytokines include T F-aipha, lL-6 and/or lL-12,
59. A method of inducing the production of high affinity neutralizing antibodies or inhibitory antibodies comprising administering the composition of any one of claims Ϊ -35 to a subject having a pathological condition.
60. The method of claim 59, wherein the pathological condition is cancer, human immunodeficiency virus (HIV), influenza, or drug and substance abuse.
61. The method of claim 60, wherein the pathological condition is cancer, human immunodeficiency virus (HIV), influenza, or drug and substance abuse.
62. The use of a composition as described in any one of claims 1 -35 for the manufacture of a medicament useful for the treatment of a pathological condition in a subject.
63. A compos ition as descr ibed in any one of claims 1 -35 for use in the prophylactic or therapeutic treatment of a pathological condition.
64. The method of making an RNA aanos ructare, the method comprising:
.raking equiraolar concentrations of a multiple of external RNA strands, and one internal RNA strand to make a mixture,
anneal ing the mixture for one hour in a themiocycler;
cooling the mixture at about I °C er minute from about 80°C to about 4 C.
65. The method of claim 64, further comprising modifying one or more of the externa! strands to contain an antigen, adjuvant and/or targeting iigand.
66. The method of claim 65, wherein the modifying the external strands are selected from the group consisting of 3, 4 or 5 strands.
67. The method of claim 65, wherein the external strands comprise about 48 nucleotides.
68. The method of claim 65, wherein the nanostructure comprises a p NA 3WJ motif at each vertex.
69. The method of claim 65, wherein the nanostruetwe has a shape selected from the group consisting of a triangle, squar and pentagon, and the shape has a stretched intrahelical angl between 1 and 112,
PCT/US2015/036798 2014-06-19 2015-06-19 Rna-based compositions and adjuvants for prophylactic and therapeutic treatment Ceased WO2015196146A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201580043770.7A CN106795517A (en) 2014-06-19 2015-06-19 Composition based on RNA and for preventative and therapeutic treatment adjuvant
US15/383,575 US10378018B2 (en) 2014-06-19 2016-12-19 RNA-based compositions and adjuvants for prophylactic and therapeutic treatment
US16/265,154 US11060096B2 (en) 2014-06-19 2019-02-01 RNA-based compositions and adjuvants for prophylactic and therapeutic treatment

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462014503P 2014-06-19 2014-06-19
US62/014,503 2014-06-19

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/383,575 Continuation-In-Part US10378018B2 (en) 2014-06-19 2016-12-19 RNA-based compositions and adjuvants for prophylactic and therapeutic treatment

Publications (2)

Publication Number Publication Date
WO2015196146A2 true WO2015196146A2 (en) 2015-12-23
WO2015196146A3 WO2015196146A3 (en) 2016-02-25

Family

ID=54936254

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/036798 Ceased WO2015196146A2 (en) 2014-06-19 2015-06-19 Rna-based compositions and adjuvants for prophylactic and therapeutic treatment

Country Status (3)

Country Link
US (2) US10378018B2 (en)
CN (1) CN106795517A (en)
WO (1) WO2015196146A2 (en)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017147557A1 (en) * 2016-02-26 2017-08-31 The Board Of Regents Of The University Of Oklahoma Novel prna three-way junctions
CN109196103A (en) * 2016-05-10 2019-01-11 俄亥俄州立创新基金会 The 3D RNA cage type nanoparticle of self assembly
WO2019166877A1 (en) 2018-03-02 2019-09-06 Sixfold Bioscience Ltd. Compositions for delivery of cargo to cells
WO2019147308A3 (en) * 2017-08-30 2019-12-19 Arizona Board Of Regents On Behalf Of Arizona State University Rna nanostructures and methods of making and using rna nanostructures
EP3487536A4 (en) * 2016-07-20 2020-04-01 Guild Biosciences FUNCTIONALIZED NUCLEIC ACID NANOSTRUCTURES FOR RNA DELIVERY
WO2021053405A2 (en) 2019-08-30 2021-03-25 Sixfold Bioscience Ltd. Compositions for transfer of cargo to cells
US11357865B2 (en) 2020-04-27 2022-06-14 Sixfold Bioscience Ltd. Compositions containing nucleic acid nanoparticles with modular functionality
WO2022219409A2 (en) 2021-04-15 2022-10-20 Sixfold Bioscience Ltd. Compositions containing nucleic acid nanoparticles and processes related to alteration of their physicochemical characteristics
WO2023070010A1 (en) * 2021-10-20 2023-04-27 Quantum-Si Incorporated Ultrabright dna nanostructures for biosensing
EP4415827A4 (en) * 2021-10-14 2025-12-03 Univ Arizona State Programmable RNA Structure Release Platforms

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015042101A1 (en) 2013-09-17 2015-03-26 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Multifunctional rna nanoparticles and methods of use
US11512313B2 (en) 2017-04-03 2022-11-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Functionally-interdependent shape switching nucleic acid nanoparticles
WO2019160866A2 (en) 2018-02-13 2019-08-22 Checkmate Pharmaceuticals, Inc. Compositions and methods for tumor immunotherapy
BR112020020479A2 (en) * 2018-04-09 2021-01-12 Checkmate Pharmaceuticals OLIGONUCLEOTIDE PACKAGING IN VIRUS-LIKE PARTICLES
WO2020078219A1 (en) * 2018-10-16 2020-04-23 百药智达(北京)纳米生物技术有限公司 Nucleic acid nano-carrier drug, preparation method therefor, and pharmaceutical composition and application thereof
CN111053913B (en) * 2018-10-16 2022-07-22 百药智达(北京)纳米生物技术有限公司 Cytarabine-containing medicine, preparation method thereof, pharmaceutical composition and application thereof
CN113648430B (en) * 2021-06-17 2023-03-28 四川大学华西医院 Drug-loaded DNA origami raft and preparation method and application thereof
WO2025006625A1 (en) * 2023-06-26 2025-01-02 Illumina, Inc. Interlocking nucleic acids for target hybridization

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7655787B2 (en) 2000-08-23 2010-02-02 Purdue Research Foundation pRNA chimera
EP3006043B1 (en) 2002-04-04 2019-05-29 Zoetis Belgium S.A. Immunostimulatory g,u-containing oligoribonucleotides
AU2006241149A1 (en) * 2005-04-26 2006-11-02 Coley Pharmaceutical Gmbh Modified oligoribonucleotide analogs with enhanced immunostimulatory activity
EP2441846A3 (en) 2006-01-09 2012-07-25 The Regents Of the University of California Immunostimulatory combinations of TNFRSF, TLR, NLR, RHR, purinergic receptor, and cytokine receptor agoinsts for vaccines and tumor immunotherapy
KR101761388B1 (en) * 2010-07-30 2017-07-25 큐어백 아게 Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
CN103403189B (en) * 2011-06-08 2015-11-25 辛辛那提大学 For the pRNA multivalence link field in stable multivalence RNA nano particle
WO2013119676A1 (en) * 2012-02-06 2013-08-15 Arizona Board Of Regents, A Body Corporate Of The State Of Arizona Acting For And On Behalf Of Arizona State University Novel dna-origami nanovaccines

Cited By (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017147557A1 (en) * 2016-02-26 2017-08-31 The Board Of Regents Of The University Of Oklahoma Novel prna three-way junctions
US10900035B2 (en) 2016-02-26 2021-01-26 The Board Of Regents Of The University Of Oklahoma PRNA three-way junctions
CN109196103A (en) * 2016-05-10 2019-01-11 俄亥俄州立创新基金会 The 3D RNA cage type nanoparticle of self assembly
EP3487536A4 (en) * 2016-07-20 2020-04-01 Guild Biosciences FUNCTIONALIZED NUCLEIC ACID NANOSTRUCTURES FOR RNA DELIVERY
US11254941B2 (en) 2017-08-30 2022-02-22 Arizona Board Of Regents On Behalf Of Arizona State University RNA nanostructures and methods of making and using RNA nanostructures
WO2019147308A3 (en) * 2017-08-30 2019-12-19 Arizona Board Of Regents On Behalf Of Arizona State University Rna nanostructures and methods of making and using rna nanostructures
EP4141117A1 (en) * 2017-08-30 2023-03-01 Arizona Board of Regents on behalf of Arizona State University Rna nanostructures and methods of making and using rna nanostructures
US12473553B2 (en) 2017-08-30 2025-11-18 Arizona Board Of Regents On Behalf Of Arizona State University RNA nanostructures and methods of making and using RNA nanostructures
US10982210B2 (en) 2018-03-02 2021-04-20 Sixfold Bioscience Ltd. Compositions for delivery of cargo to cells
WO2019166877A1 (en) 2018-03-02 2019-09-06 Sixfold Bioscience Ltd. Compositions for delivery of cargo to cells
WO2021053405A2 (en) 2019-08-30 2021-03-25 Sixfold Bioscience Ltd. Compositions for transfer of cargo to cells
US11357865B2 (en) 2020-04-27 2022-06-14 Sixfold Bioscience Ltd. Compositions containing nucleic acid nanoparticles with modular functionality
US12472267B2 (en) 2020-04-27 2025-11-18 Sixfold Bioscience Ltd. Compositions containing nucleic acid nanoparticles with modular functionality
WO2022219409A2 (en) 2021-04-15 2022-10-20 Sixfold Bioscience Ltd. Compositions containing nucleic acid nanoparticles and processes related to alteration of their physicochemical characteristics
EP4415827A4 (en) * 2021-10-14 2025-12-03 Univ Arizona State Programmable RNA Structure Release Platforms
WO2023070010A1 (en) * 2021-10-20 2023-04-27 Quantum-Si Incorporated Ultrabright dna nanostructures for biosensing

Also Published As

Publication number Publication date
CN106795517A (en) 2017-05-31
US20190390200A1 (en) 2019-12-26
US11060096B2 (en) 2021-07-13
US10378018B2 (en) 2019-08-13
WO2015196146A3 (en) 2016-02-25
US20170175122A1 (en) 2017-06-22

Similar Documents

Publication Publication Date Title
US11060096B2 (en) RNA-based compositions and adjuvants for prophylactic and therapeutic treatment
Rackley et al. RNA fibers as optimized nanoscaffolds for siRNA coordination and reduced immunological recognition
Li et al. Smart drug delivery nanocarriers with self‐assembled DNA nanostructures
Iswanti et al. Preparation, characterization, and evaluation of chitosan-based nanoparticles as CpG ODN carriers
Wang et al. Targeted delivery of tumor suppressor microRNA-1 by transferrin-conjugated lipopolyplex nanoparticles to patient-derived glioblastoma stem cells
US20260078383A1 (en) Rna nanostructures and methods of making and using rna nanostructures
US20130243689A1 (en) Multi-compartmental macrophage delivery
KR20120059491A (en) Cell-targeting nanoparticles comprising polynucleotide agents and uses thereof
US20140335154A1 (en) Methods and formulations to achieve tumor targeted double stranded rna mediated cell death
Mohri et al. DNA nanotechnology-based development of delivery systems for bioactive compounds
CN103596594B (en) self-gelling nucleic acid
Chen et al. Maximizing TLR9 activation in cancer immunotherapy with dual-adjuvanted spherical nucleic acids
US20250075219A1 (en) Sequence Multiplicity within Spherical Nucleic Acids
Nam et al. Adjuvant-loaded spiky gold nanoparticles for activation of innate immune cells
Geinguenaud et al. Vectorization of nucleic acids for therapeutic approach: tutorial review
CN103536934A (en) Self-assembled nano-gene vector compound based on PAMAM (Poly Amido-Amine) and preparation method thereof
CN101337076A (en) A functionalized dendrimer gene carrier system targeting malignant brain tumors
Sun et al. Nucleic acid nanostructure assisted immune modulation
JP6715775B2 (en) Non-aggregating immunostimulatory oligonucleotide
CN105705639A (en) Dengue virus-specific sirna, double helix oligo-rna structure comprising sirna, and composition for suppressing proliferation of dengue virus comprising rna structure
Zhu et al. Design of mesoporous silica/cytosine− phosphodiester− guanine oligodeoxynucleotide complexes to enhance delivery efficiency
JP2021524735A (en) Hexamar tetrahedral RNA nanostructures
Shcharbin et al. Phosphorus Dendrimers as vectors for gene therapy in cancer
Gamper Plant virus-derived nanoparticles for the imaging and treatment of cancer
Guo RNA Nanoparticle as A Safe and Effective Drug Delivery Platform for Cancer Therapy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15809429

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15809429

Country of ref document: EP

Kind code of ref document: A2