WO2015184375A2 - Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function - Google Patents

Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function Download PDF

Info

Publication number
WO2015184375A2
WO2015184375A2 PCT/US2015/033359 US2015033359W WO2015184375A2 WO 2015184375 A2 WO2015184375 A2 WO 2015184375A2 US 2015033359 W US2015033359 W US 2015033359W WO 2015184375 A2 WO2015184375 A2 WO 2015184375A2
Authority
WO
WIPO (PCT)
Prior art keywords
ppar
agonist
intestinal
subject
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/033359
Other languages
French (fr)
Other versions
WO2015184375A3 (en
Inventor
David M. Sabatini
Omer Yilmaz
Maria Mihaylova
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Massachusetts Institute of Technology
Whitehead Institute for Biomedical Research
Original Assignee
Massachusetts Institute of Technology
Whitehead Institute for Biomedical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Massachusetts Institute of Technology, Whitehead Institute for Biomedical Research filed Critical Massachusetts Institute of Technology
Priority to US15/314,852 priority Critical patent/US10426757B2/en
Publication of WO2015184375A2 publication Critical patent/WO2015184375A2/en
Publication of WO2015184375A3 publication Critical patent/WO2015184375A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/4261,3-Thiazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • Intestinal atrophy or damage affects a significant portion of hospitalized patients in the US, including those suffering from inflammatory bowel disease, vascular disease, cancer, infection or malnourishment, as well as those exposed to ionizing radiation. Accordingly, there remains a need for therapies capable of modulating the processes of intestinal cell proliferation and remodeling.
  • the present disclosure relates in some aspects to novel methods, agents, and compositions useful for promoting intestinal stem cell function and/or intestinal non-stem progenitor cell function.
  • Certain of the methods, agents, and compositions are particularly useful for stimulating the proliferation and/or self-renewal of intestinal stem cells and/or non- stem progenitor cells in mammalian intestinal tissue, for example, by contacting a population of cells in the mammalian intestinal tissue with an effective amount of a high fat diet mimetic, which may be useful for ameliorating afflictions characterized by intestinal atrophy, as well as for preventing or ameliorating harmful effects of ionizing radiation, particularly during radiation cancer therapy or upon accidental or incidental exposure to ionizing radiation.
  • the disclosure provides methods for stimulating the proliferation and/or self-renewal of intestinal stem cells in mammalian intestinal tissue.
  • the disclosure provides a method of stimulating the proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR- ⁇ ) or a PPAR- ⁇ target protein, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
  • PPAR- ⁇ peroxisome proliferator activated receptor delta
  • the disclosure provides, a method of promoting regeneration of mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR- ⁇ ) or a PPAR- ⁇ target protein, thereby promoting regeneration of the mammalian intestinal tissue.
  • PPAR- ⁇ peroxisome proliferator activated receptor delta
  • the intestinal stem cells comprise Ieucine-rich repeat- containing G-protein coupled receptor 5-positive (LGR5 1 ) stem cells.
  • the population of cells is selected from the group consisting of LGR5 + stem cells, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells.
  • the population of cells is contacted with both an agent that increases the level and/or activity of PPAR- ⁇ and an agent that increases the level and/or activity of a PPAR- ⁇ target protein.
  • the PPAR- ⁇ target protein is selected from the group consisting of carnitine palmitoyltransferase lA (CPTl A), 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), and fatty acid binding protein l (FABPl ).
  • CPTl A carnitine palmitoyltransferase lA
  • HMGCS2 3-hydroxy-3-methylglutaryl-CoA synthase 2
  • FBPl fatty acid binding protein l
  • the agent increases the level and/or activity of both PPAR- ⁇ and the PPAR- ⁇ target protein.
  • the agent increases the level and/or activity of the PPAR- ⁇ target protein in intestinal stem and/or non-stem cell progenitor cells.
  • the agent comprises a high fat diet mimetic.
  • the agent comprises a PPAR- ⁇ agonist.
  • the agent comprises 2-[2-methyl-4-[[4-methyl ⁇ 2-[4- (trifluoromethyl)phenyl]-l ,3-thiazol-5-yl]methylsulfanyl]phenoxy]acetic acid (GW501516) or an analog or derivative thereof.
  • the agent comprises a PPAR- ⁇ target protein agonist selected from the group consisting of a CPT 1A agonist, a HMGCS2 agonist, and a FAB P I agonist.
  • the contacting occurs in vitro.
  • the contacting occurs in vivo in a subject. In some embodiments the contacting occurs in vivo in a subject.
  • the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis.
  • the method includes determining that the subject is in need of treatment for a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis.
  • inflammatory bowel disease is selected from the group consisting of Crohn's disease and ulcerative colitis.
  • the subject is selected for treatment of an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
  • an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
  • the affliction characterized by intestinal atrophy is an advanced age.
  • the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, exposure to ionizing radiation and advanced age.
  • exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, radiotherapy, and space or cosmic radiation.
  • the method includes determining that the subject is in need of enhanced intestinal function. For example, in certain embodiments an aged or aging subject may be in need of enhanced intestinal function. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the high fat diet comprises a macronutritional composition of at least 60% of total daily calories comprising fat. In some embodiments the high fat diet comprises a diet restricted in terms of total calories.
  • the high fat diet comprises a diet restricted in terms of total daily calories
  • the disclosure provides a method of treating an affliction characterized by intestinal atrophy in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby treating the affliction characterized by intestinal atrophy.
  • the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy.
  • the affliction is selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin- induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
  • the affliction characterized by intestinal atrophy is an advanced aged.
  • the affliction is selected from the group consisting of Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a H GCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • composition comprises (a) at least one
  • the method includes placing the subject on a high fat diet.
  • the high fat diet comprises a calorie restricted diet.
  • the disclosure provides a method of minimizing the risk of exposure to an ionizing radiation source, the method comprising administering to an individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby minimizing the risk of exposure to the ionizing radiation source.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises
  • the PPAR- ⁇ target protein is selected from the group consisting of CPTl A, HMGCS2, and FABP 1.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTIA agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the ionizing radiation source is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation.
  • individual is an individual that is being administered, or about to be administered, radiotherapy.
  • the disclosure provides a method of increasing tolerance to ionizing radiation in an individual, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, wherein the composition increases the threshold dose of lethal ionizing radiation to above 8 Gy.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTIA agonist, (ii) a HMGCS2 agonist, (iii) a FABPl agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABPl agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the threshold dose of lethal ionizing radiation is increased to about 15 Gy.
  • the disclosure provides a method of treating an individual exposed to harmful ionizing radiation, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby treating the individual exposed to harmful ionizing radiation.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW5015 16 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the harmful ionizing radiation is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation.
  • the individual is an individual that is being administered, or about to be administered, radiotherapy.
  • the method includes placing the individual on a high fat diet.
  • the high fat diet comprises a calorie restricted diet.
  • the disclosure provides a method of treating cancer in a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein; and (b) administering an effective amount of ionizing radiation to the subject.
  • the composition : (i) increases the subject's tolerance for ionizing radiation; (ii) minimizes undesirable side-effects due to the ionizing radiation; (iii) protects against gastrointestinal drug toxicity.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition is: (i) administered to the patient prior to administering the ionizing radiation to the subject; (ii) co-administered to the subject with the ionizing radiation; (iii) administered to the subject after administering the ionizing radiation to the subject; and combinations thereof.
  • the method includes administering a chemotherapeutic agent to the subject.
  • the method includes placing the individual on a high fat diet.
  • the high fat diet comprises a calorie
  • the disclosure provides a method of administering radiotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ ; and (b) administering radiotherapy to the subject.
  • the composition is administered prior to administering the radiotherapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the radiotherapy).
  • the composition is administered to the subject concomitantly with the radiotherapy.
  • the disclosure provides a method administering proton therapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ ; and (b) administering proton therapy to the subject.
  • the composition is administered prior to administering the proton therapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 0 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the proton therapy).
  • the composition is administered to the subject concomitantly with the proton therapy.
  • the disclosure provides a method of administering chemotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ ; and (b) administering chemotherapy to the subject.
  • the composition is administered prior to administering the chemotherapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the chemotherapy).
  • the composition is administered to the subject concomitantly with the chemotherapy.
  • the composition comprises a high fat diet mimetic.
  • the disclosure provides the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the method includes placing the individual on a high fat diet.
  • the high fat diet comprises a calorie restricted diet.
  • the disclosure provides a radioprotective composition
  • a radioprotective composition comprising an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the disclosure provides a chemoprotective composition
  • a chemoprotective composition comprising an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the agents or the chemoprotective compositions may be administered prior to initiation of chemotherapy (e.g., as a chemotherapy pre-treatment).
  • the agents or the chemoprotective compositions may be concurrently administered with chemotherapy.
  • the agent comprises a high fat diet mimetic.
  • the agent comprises a PPAR- ⁇ agonist.
  • the agent comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a HMGCS2 agonist, (iii) a FAB 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition includes a chemotherapeutic agent.
  • the composition includes a radiotherapeutic agent.
  • the composition is formulated for administration as an enema.
  • the composition is formulated for oral administration.
  • aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PP AR- ⁇ target protein to promote intestinal regeneration, protect against intestinal tissue damage, and/or stimulate the proliferation and/or self-renewal of one or more intestinal stem cells.
  • aspects of the disclosure involve t he use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein to treat an affliction characterized by intestinal atrophy.
  • the affliction is selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome.
  • the affliction is selected from the group consisting of Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis.
  • the affliction characterized by intestinal atrophy is an advanced age.
  • aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein to protect against, mitigate, or alleviate, the harmful effects of exposure to ionizing radiation
  • exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, cosmic or space radiation.
  • aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with radiotherapy to protect against the harmful effects of ionizing radiation. Certain aspects of the disclosure involve the administration of the agent prior to exposure to ionizing radiation. Certain aspects of the disclosure involve the concomitant administration of the agent during the exposure to ionizing radiation.
  • aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with chemotherapy to protect against gastrointestinal drug toxicity. Certain aspects of the disclosure involve the administration of the agent prior to administration of the chemotherapy. Certain aspects of the disclosure involve the concomitant administration of the agent during the administration of the chemotherapy.
  • aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with total parenteral nutrition to protect against intestinal atrophy. Certain aspects of the disclosure involve the administration of the agent prior to administration of total parenteral nutrition. Certain aspects of the disclosure involve the concomitant administration of the agent during the administration of total parenteral nutrition.
  • the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR- ⁇ agonist. In some embodiments the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the agent comprises a PPAR- ⁇ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist.
  • the disclosure provides a method for expanding a population of intestinal stem cells and/or non-stem intestinal progenitor cells comprising contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • the intestinal stem cells comprise LGR5 + stem cells.
  • the agent comprises a high fat diet mimetic.
  • the agent comprises a PPAR- ⁇ agonist.
  • the PPAR- ⁇ agonist comprises
  • the agent comprises or a PPAR- ⁇ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist.
  • Paneth cells are not present in the population of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • the method is performed ex vivo. In some embodiments the method is performed in vivo in a subject. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the diet comprises a calorie restricted diet.
  • the disclosure provides a method of endowing at least one non-stem intestinal progenitor cell with at least one attribute of intestinal stem cells, the method comprising contacting a population of mammalian intestinal cells comprising at least one non-stem progenitor cell with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby endowing at least one non-stem intestinal progenitor cell with the at least one attribute of intestinal stem cells.
  • the at least one attribute comprises the ability to form organoid mini-intestines in culture in the absence of the Paneth cell niche.
  • the intestinal stem cells comprise LGR5 ' stem cells.
  • the agent comprises a high fat diet mimetic.
  • the agent comprises a PPAR- ⁇ agonist.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the agent comprises or a PPAR- ⁇ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist.
  • the disclosure provides a method of obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with an enhanced ability to form organoid bodies in culture in the absence of the Paneth cells, the method comprising: (a) administering a high fat diet or a high fat diet mimetic to a mammal, wherein the high fat diet or high fat diet mimetic enhances the ability of intestinal stem cells and/or non-stem intestinal progenitor cells in the mammal to form organoid bodies in culture; and (b) isolating intestinal stem cells and/or non-stem intestinal progenitor cells from the mammal, thereby obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with the enhanced ability to form organoid bodies in culture.
  • the method includes assessing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells to form organoid bodies in culture in the absence of Paneth cells. In some embodiments assessing is performed by comparing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells obtained from the mammal in step (b) to form organoid bodies in culture in the absence of Paneth cells to the ability of intestinal stem cells and/or non-stem intestinal progenitor cells obtained from control mammals which were not administered a high fat diet of high fat diet mimetic to form organoid bodies in culture in the absence of Paneth cells.
  • the method includes a step (c) forming organoid bodies in culture in the absence of Paneth cells.
  • the high fat diet or the high fat diet mimetic increases the level and/or activity of PPAR-5 or a PPAR- ⁇ target protein in the mammal's intestinal stem cells and/or non-stem intestinal progenitor cells.
  • the high fat diet mimetic comprises a PPAR- ⁇ agonist.
  • the high fat diet mimetic comprises a PPAR- ⁇ target protein agonist selected from the group consisting of a CPT1A agonist, a HMGCS2 agonist, and a FABP 1 agonist.
  • the mammal comprises a mouse.
  • aspects of the disclosure involve the use of PPAR- ⁇ and/or a PPAR- ⁇ target gene as a prognostic biomarker to detect obese individuals at risk for colorectal cancer.
  • the disclosure provides a method of identifying an obese individual at risk of developing colorectal carcinoma, the method comprising: (a) determining the level of expression of PPAR- ⁇ or a PPAR- ⁇ target gene in a biological sample obtained from an obese individual; and (b) identifying an obese individual as being at risk of developing colorectal carcinoma if the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene in the biological sample is elevated as compared to the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene in control individuals without colorectal carcinoma.
  • the biological sample comprises a colon biopsy specimen.
  • the biological sample comprises an epithelial cell.
  • the biological sample comprises an intestinal stem cell.
  • the biological sample comprises a non-stem intestinal progenitor cell. In some embodiments the biological sample comprises a Paneth cell. In some embodiments the biological sample comprises a goblet cell. In some embodiments the biological sample is obtained by performing a colonoscopic biopsy. In some embodiments (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene comprises determining the mRNA level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene. In some embodiments (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene is accomplished by performing a hybridization-based assay, a polymerase chain reaction-based assay, or sequencing.
  • determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene comprises determining the protein level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene. In some embodiments (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene is accomplished by ELISA, Western blot, mass spectrometry, or immunohistochemistry.
  • disclosed here are methods of reducing loss of intestinal stem cells and/or non-stem intestinal progenitor cells in a subject at risk thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby intestinal stem cells and/or non-stem intestinal progenitor cells loss.
  • aged subjects e.g., human subjects that are at least about 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old or older
  • the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy.
  • the affliction characterized by intestinal atrophy is an advanced age.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the PPAR- ⁇ agonist comprises GW501516 or an analog or derivative thereof.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the disclosure provides a composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the method includes placing the subject on a high fat diet.
  • the high fat diet comprises a calorie restricted diet.
  • the methods and uses disclosed herein further comprise a step of determining, for example, that a subject (e.g., an aged subject) has or is at risk of developing compromised gut regeneration (e.g., as evidenced by a loss of intestinal stem cells and/or non- stem intestinal progenitor cells). Accordingly, in certain embodiments, the methods and uses disclosed herein further comprise a step of determining that the subject is in need of enhanced intestinal function. In some aspects, such a determination may be made by assessing expression of PPAR- ⁇ in one or more tissues or biological samples obtained from the subject. In certain aspects, such a determination may be made by assessing expression of one or more of CPT1A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the subject.
  • the methods and uses disclosed herein further comprise a step of determining that a subject (e.g., an aged or elderly subject) has or is at risk of developing loss of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • a determination may comprise assessing expression of PPAR- ⁇ in one or more tissues or biological samples obtained from the subject.
  • such a determination may comprise determining that the subject has loss of intestinal stem cells and/or non-stem intestinal progenitor cells by assessing expression of one or more of CPT1 A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the subject.
  • RNA interference RNA interference
  • FIGS. lA-lB demonstrate that high fat diet High Fat Diet increases intestinal stem cell numbers and permits Paneth Cell independent organoid initiation.
  • FIG. 1A demonstrates that High fat diet (HFD) fed Lgr5-GFP-IRES-CreERT2 mice show a selective increase in the number of GFP hl intestinal stem cells (ISCs) as enumerated by flow cytometry. In contrast, high fat does not modulate the numbers of GFP low intestinal progenitor cells.
  • FIG. IB demonstrates that HFD-derived GFP 1 " ISCs, in contrast to those isolated from control fed mice, posses the capacity to initiate organoid bodies without co-culture of niche Paneth cells.
  • FIGS. 2A-2C demonstrate that peroxisome proliferator activated receptor delta (PPAR- ⁇ ) agonist, GW501516, boosts intestinal stem cell numbers and allows for niche independent organoid formation by stem cells and progenitor cells.
  • FIG. 2A demonstrates that Lgr5-GFP-IRES-CreERT2 mice administered GW5015 16 at 4mg/kg for 2-4 weeks show a selective increase in the number of GFP hl intestinal stem cells (ISCs) but not in progenitor cells as enumerated by flow cytometry.
  • FIG. 2B demonstrates that GW5015 16-derived GFP 1 " ISCs, in contrast to those isolated from vehicle-treated mice, demonstrate the capacity to initiate organoid bodies without co-culture of niche Paneth cells.
  • FIG. 2C demonstrates that HFD and GW501516-derived GFP low progenitor cells possess the potential to autonomously form organoid bodies in vitro, (values are mean; error bars indicate standard deviation;
  • FIGS. 3A-3I demonstrate that high fat diet (HFD) augments ISC numbers and function.
  • FIG. 3E shows that Day 14 HFD-derived organoids possessed less crypt domains than compared to control counterparts
  • FIGS. 4A-F illustrate that ex vivo exposure of ISCs to palmitic acid recapitulates aspects of a HFD.
  • FIG. 4A shows that exposure of na ' ive crypts to 30 ⁇ palmitic acid (PA) had no effect on primary organoid formation (n ⁇ 5).
  • FIGS. 5A-5K illustrate that activated PPAR- ⁇ in ISCs mediates the effects of HFD.
  • FIG. 5A illustrates a heat map of differentially expressed genes in Lgr5-GFP hl ISCs and Lgr5-GFP low progenitors revealed induction of a PPAR- ⁇ program in HFD-fed mice.
  • FIG. 5B shows that PPAR and LXR/RXR motifs were enriched in genes that are upregulated in ISCs from HFD-fed mice.
  • FIGS. 5F and 5G show 01fm4+ ISCs numbers per jejunal crypt were increased in GW5015 16-treated mice (FIG. 5F), whereas, Cryptdin 4+ Paneth cell numbers (FIG.
  • FIG. 5J shows that PPAR- ⁇
  • FIGS. 6A-6G illustrate that HFD and PPAR- ⁇ signaling leads to increased ⁇ -catenin nuclear local ization and target gene expression.
  • FIGS. 6A and 6B show that increased nuclear ⁇ -catenin localization was observed by immunostaining in flow sorted Lgr5-GFP hl ISCs and GFP low progenitors isolated from HFD (FIG. 6A) and GW501516-treated (FIG. 6B) mice compared to their respective controls.
  • FIG. 6C shows t-distributed stochastic neighbor embedding (t-SNE) plot of the single-cell gene expression data for all ⁇ -catenin target genes. Each mark represents a single cell.
  • FIGS. 6F and 6G confirm PPAR- ⁇ mediated induction of the most upregulated ⁇ -catenin transcriptional targets by single cell qRT-PCR in Lgr5-GFP hi ISCs (FIG. 6F) and (FIG. 6G) GFP low progenitors from GW501 516-treated mice. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; * P ⁇ 0.05, * *P ⁇ 0.01.)
  • FIGS. 7A-7G show that PPAR- ⁇ activation confers organoid and tumor-initiating capacity to non-stem-cells.
  • FIG. 7B depicts a schematic for assessing the in vitro and in vivo adenoma-initiating capacity of Ape-null Lgr5-GFP b ' ISCs and Lgr5-GFP low progenitors from veh icle or PPAR- ⁇ agonist GW501 516-treated mice.
  • FIG. 7C shows that PPAR- ⁇ agonist treatment increased the in vitro adenomatous organoid forming potential of Ape-null Lgr5-GFP ow progenitors by four-fold in EN media, which includes Noggin and EGF but lacks Wnt3 and R-spondin.
  • FIG. 7D presents representative images of adenomatous organoids derived from Ape-null Lgr5-GFP hi ISCs (top) and Lgr5-GFP low progenitors (bottom).
  • FIG. 7E and 7F show orthotopic transplantation of Ape-null GFP ,0W progenitors from PPAR- ⁇ agonist-treated mice (bottom), but not from vehicle controls, initiated tumors that were visible with optical colonoscopy and verified by histology (FIG. 13).
  • FIG. 7G illustrates a model of intestinal adaptation to HFD. HFD has opposing effects on the numbers of stem- cells (increases) and their Paneth cell niche (decreases) per intestinal crypt.
  • HFD activates a PPAR-8-mediated program that augments the organoid and tumor-initiating potential of ISCs and TA-cells.
  • a feature of the PPAR- ⁇ program includes induction of a subset of ⁇ -catenin target genes.
  • S stem cell
  • P Paneth cell
  • Pr progenitor cell
  • T tumor cell
  • red dotted line Ape-null cells with tumor-forming capability.
  • FIGS. 8A-K demonstrate that HFD enhances the proliferation of progenitors in the intestinal crypt.
  • FIGS. 9A-9D illustrate that HFD and PPAR- ⁇ signaling has minimal effects on enteroendocrine and goblet cell differentiation.
  • FIGS. 1 OA- I OC show that PPAR- ⁇ is the predominant PPAR family member expressed in intestinal progenitors.
  • FIG. 10A illustrates that PPAR- ⁇ is the most abundant PPAR family member in intestinal progenitors based on RNA-seq data.
  • FIG. 10B shows confirmation of PPAR family member mRNA expression levels in Lgr5-GFP hl ISCs and Lgr5-GFP low progenitors by qPCR.
  • FIG. IOC shows the results of a gene set enrichment analysis (GSEA) of RNA-seq revealed enrichment of PPAR- ⁇ targets in Lgr5-GFP hl ISCs and Lgr5-GFP' 0W progen itors after HFD treatment.
  • GSEA gene set enrichment analysis
  • FIGS. 11A-11E illustrate that HFD and PPAR- ⁇ signaling boost nuclear ⁇ -catenin localization and target gene expression in intestinal progenitors.
  • FIGS. 1 1 A and 1 I B show that increased nuclear ⁇ -catenin local ization was observed in Lgr5-GFP hl ISCs and Lgr5- GFP
  • 0W progenitors from HFD (FIG. 1 1 A) or PPAR- ⁇ agonist GW501 516-treated (FIG. 11B) mice by immunostaining ( « 4 each).
  • FIG. HE Representative images are shown in FIG. HE; arrowheads highlight ⁇ -catenin positive nuclei.
  • FIGS. 12A-12E illustrate HFD mediated changes in ⁇ -catenin target gene expression in single stem and progenitor cells.
  • FIG. 12A shows a heat map representation of ⁇ -catenin target gene expression in single Lgr5-GFP hl ISCs and Lgr5-GFP low progenitor cells.
  • FIG. 12B shows stem cell signature genes identified by comparing control Lgr5-GFP hl ISCs to control Lgr5-GFP ,0W progenitor cells.
  • FIG. 12C shows HFD signature genes identified by comparing HFD Lgr5-GFP hi ISCs to control GFP hi ISCs.
  • FIG. 12D shows tSNE analysis of single cells using stem cell signature genes.
  • FIG. 12E shows tSNE analysis of single cells using HFD signature genes.
  • FIG. 13 illustrates that PPAR- ⁇ activation bestows adenoma-initiating capacity to organoids derived from Ape-null non-LGR5 + cells.
  • Representative adenomas verified by histology (H&E), derived from orthotopic transplantation of Ape-null Lgr5-GFP hl ISCs from vehicle and PPAR- ⁇ agonist GW5015 16-treated mice and Lgr5-GFP' 0 progenitors from PPAR- ⁇ agonist-treated mice exhibit lack of maturation and nuclear crowding. The results were interpreted blinding by 2 independent pathologists.
  • FIGS. 14A-14B demonstrate age associated changes in the intestine.
  • FIG. 14A shows decreased frequencies of ISCs and progenitor cells (TAs) in aged relative to young.
  • FIG. 14B shows decreased frequency of organoid formation in aged crypts compared to young ones.
  • FIGS. 15A-15B illustrate that PPAR5 pathway activation improves intestinal crypt function.
  • FIG. 15A shows that GW501516 treatment increases the frequency of stem cells.
  • FIG. 15B shows that GW501516 treatment increases the frequency of organoid formation in aged crypts.
  • FIGS. 16A-16B illustrate that activation of the PPAR8 signaling pathway in vivo increases intestinal organoid formation in aged animals.
  • FIG. 16A shows that co-culturing intestinal stem cells (ISCs) and Paneth cells from aged mice yields a significantly lower frequency of organoid formation compared to co-cultured ISCs and Paneth cells derived from young animals.
  • Co-culturing ISCs and Paneth cells from aged animals treated with the PPAR5 agonist GW501516 significantly boosts organoid formation compared to co-cultured old vehicle treated ISCs and Paneth cells. Counts and frequencies were done on day 3 post culturing.
  • FIG. 16B shows representative images from co-culturing experiments.
  • a method of stimulat ing proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR- ⁇ ) or a PPAR- ⁇ target protein, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
  • PPAR- ⁇ peroxisome proliferator activated receptor delta
  • a method of stimulating proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
  • a method of enhancing non-stem intestinal progenitor cell number and/or function comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of (PPAR- ⁇ ) or a PPAR- ⁇ target protein, thereby enhancing non-stem intestinal progenitor cell number and/or function
  • a method of enhancing non-stem intestinal progenitor cell number and/or function comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby enhancing non-stem intestinal progenitor cell number and/or function.
  • a method of promoting regeneration of mammalian intestinal tissue comprises contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby promoting regeneration of the mammalian intestinal tissue.
  • a method of promoting regeneration of mammalian intestinal tissue comprises contacting a population of cells in the mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby promoting regeneration of the mammalian intestinal tissue.
  • any of the methods described herein further includes contacting the population of cells in the mammalian intestinal tissue with an effective amount of a calorie restriction mimetic. In some embodiments, any of the methods described herein further includes contacting the population of cells in the mammalian intestinal tissue with an effective amount of an agent that inhibits the level and/or activity of mTORC l . In some embodiments, any of the methods described herein further include contacting the population f cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of Bstl or a product of Bstl .
  • stimulation and derivations thereof, may be used interchangeably with terms such as “activate”, “enhance”, “promote”, “increase” and like terms, as appropriate in the context. It will be understood that the magnitude or extent of stimulation, activation, enhancement, or an increase described herein may vary.
  • stimulating proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells may refer to an increase in proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% relative to level of proliferation and/or self-renewal in the absence of an agent or composition described herein.
  • stimulating the proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells increases the proliferation and/or self-renewal of such cells by at least 1 . 1 fold, 1.2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1.6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, or 1 00 fold or more.
  • promoting regeneration of mammalian intestinal tissue may refer to regeneration of mammalian intestinal tissue (e.g., atrophied, damaged, aged, dysfunctional, etc.) to at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, of its normal condition as compared to the condition of mammalian intestinal tissue in the absence of contact with an agent or composition described herein.
  • mammalian intestinal tissue e.g., atrophied, damaged, aged, dysfunctional, etc.
  • intestinal stem cells refer to stem cells residing at the base of the small intestinal crypts. Methods for identifying, isolating, and/or purifying intestinal stem cells are available to the skilled artisan art, for example, intestinal stem cells can be identified by determining the presence of expression of one or more markers of intestinal stem cells, such as leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5), oflactomedin 4 (OLFM4), achaete scute-like 2 (ASCL2).
  • LGR5 stem cells LGR5 stem cells.
  • the intestinal stem cells comprise OLFM4 + stem cells.
  • the intestinal stem cells comprise ASCL2 + stem cells.
  • non-stem intestinal progenitor cells refer to non-stem progenitor cells residing above Paneth cells in the intestinal crypts. Methods for identifying, isolating, and/or purifying non-stem progenitor cells are available to the skilled artisan, for example, non-stem intestinal progenitor cells can be identified by the absence of expression or diminished expression of LGR5, OLFM4, and ASCL2, or expression of WDR3 (KIAA0007) in the cells.
  • mammalian intestinal tissue refers to the portion of the mammalian alimentary canal that extends from the stomach to the rectum, including the small intestine, the large intestine, and the colon.
  • mammalian intestinal tissue comprises mouse intestinal tissue.
  • mammalian intestinal tissue comprises human intestinal tissue.
  • a "population of cells" can be a single cell or can comprise multiple cells in various embodiments.
  • a population of cells comprises at least 10, 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 M cells, or more, or any range therebetween.
  • a population of cells refers to multiple cells in a culture vessel such as a culture plate or dish.
  • a population of cells refers to multiple cells exposed in parallel to the same agents or conditions.
  • a population of cells refers to cells in mammalian intestinal tissue in vivo.
  • a "population of cells" of a given type such as population of intestinal stem cells at the base of the small intestinal crypts, or having particular characteristic(s) comprises at least one cell of such type or having such characteristic(s) and may or may not further comprise one or more cells of different type(s) and/or lacking such characteristic(s).
  • a population of cells is selected or purified to a desired level of uniformity or homogeneity with respect to type and/or characteristic(s).
  • a population of cells contains at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more cells of such type and/or having such characteristic(s). It will be understood that many of the methods described herein are often practiced using populations of cells comprising multiple cells, e.g., in vitro or in vivo. In some instances, ex vivo methods described herein are performed using populations of cells. Thus references to "a cell” should be understood as including embodiments in which the cell is a member of a population of cells. References to "cells” should be understood as including embodiments applicable to individual cells within a population comprising multiple cells and embodiments applicable to individual isolated cells.
  • the number of members and/or one or more characteristic(s) of a population of cells may change over time, e.g., during a culture period. For example, at least some cells in the population may divide once or more and/or some cells may die.
  • the term "population of cells” may thus refer to the population as it exists at the relevant time, e.g., the population resulting from the previous manipulation or step.
  • any manipulation or step performed on a population of cells may be performed on a subpopulation. For example, cells may be passaged, and only a portion of the cells retained for subsequent manipulation or steps, or a population may be divided into multiple aliquots, which may be used for different purposes.
  • the disclosure contemplates contacting any population of cells in mammalian intestinal tissue that stimulates the proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells in the population.
  • the population of cells comprises LGR5 + stem cells.
  • the population of cells comprises non-stem cell progenitor cells (e.g. WDR3 + intestinal cells).
  • the population of cells optionally comprises Paneth cells.
  • the population of cells optionally comprises goblet cells.
  • the population of cells is selected from the group consisting of LGR5 + stem cells, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells. It should be appreciated that in embodiments in which calorie restriction mimetics are employed it is preferable that the population of cells comprise Paneth cells, in addition to other intestinal cells in the population (e.g., intestinal stem cells and/or non-stem intestinal progenitor cells).
  • an "effective amount” or “effective dose” of an agent generally refers to the amount sufficient to achieve a desired biological and/or pharmacological effect, e.g., when contacted with a cell in vitro or administered to a subject according to a selected administration form, route, and/or schedule.
  • an agent or composition containing such agent generally refers to the amount sufficient to achieve a desired biological and/or pharmacological effect, e.g., when contacted with a cell in vitro or administered to a subject according to a selected administration form, route, and/or schedule.
  • the absolute amount of a particular agent or composition that is effective may vary depending on such factors as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, etc.
  • an "effective amount” may be contacted with cells or administered in a single dose, or through use of multiple doses, in various embodiments. It will be understood that agents, compounds, and compositions herein may be employed in an amount effective to achieve a desired biological and/or therapeutic effect. In some embodiments, an “effective amount” refers to an amount of an agent or composition described herein which is stimulates proliferation and/or self-renewal of intestinal stem cells. In some embodiments, an “effective amount” refers to an amount of an agent or composition described herein which is stimulates proliferation and/or self-renewal of non-stem intestinal progenitor cells.
  • an "effective amount” refers to an amount of agent or composition described herein which promotes the regeneration of intestinal tissue.
  • an effective amount of the agents and compositions disclosed herein may be administered to a subject for a limited period of time (e.g., several days, weeks or months).
  • the agents and compositions disclosed herein may be administered to a subject in conjunction with, for example, chemotherapy or radiotherapy, and in such embodiments the agents or compositions may be discontinued upon completion of such chemotherapy or radiotherapy.
  • such agents or compositions may be administered prior to initiation of chemotherapy and discontinued upon initiation or completion of the chemotherapy.
  • aspects of the disclosure involve contacting cells or populations of cells with agents or compositions described herein.
  • contacting means contacting a cell
  • contacting a population of cells are used interchangeably to refer to any means of introducing an agent or composition into sufficient proximity with a target cell for the agent to exert its intended effect on a cell, including chemical and physical means, whether the agent or composition physically contacts the cell directly or is introduced into an environment in which the cell is present.
  • contacting includes binding of an agent to an extracellular or extranuclear domain of a receptor and exerting its effects in that way.
  • Contacting encompass methods of exposing a cell, delivering to a cell, or “loading" a cell with an agent or composition by viral or non-viral vectors, and wherein such agent is bioactive upon delivery. The method of delivery will be chosen for the particular agent and use.
  • contacting includes administering the agent to a subject.
  • contacting refers to exposing mammalian intestinal tissue (e.g., crypts) or an environment in which the cell line is located (e.g., cell culture) to one or more agents or compositions described herein.
  • mammalian intestinal tissue e.g., crypts
  • the populations of cells in mammal ian intestinal tissue are exposed to an agent or composition in vitro.
  • populations of cells in mammalian intestinal tissue are exposed to an agent or composition in vivo.
  • agents e.g., an agent that increases the level and/or activity of PPAR- ⁇ or a ⁇ - ⁇ target protein.
  • Agent encompasses proteins, small molecules, nucleic acids, lipids, supramolecular complexes, entities such as viruses or portions thereof, and other biological or chemical entities that can be contacted with cells ex vivo or administered to a subject.
  • An “agent” may comprise multiple different agents of distinct structure or sequence. The term “agent” may be used interchangeably with the term
  • an agent disclosed herein can be prepared or obtained using any of a variety of methods. Methods suitable for preparation of particular agents or types of agents are known to those of ordinary skill in the art.
  • an agent is isolated from an organism that naturally contains or produces it (e.g., plants, animals, fungi, bacteria).
  • an agent is at least partly synthesized, e.g., using chemical or biological methods.
  • recombinant nucleic acid technology is used to produce an agent, e.g., a gene expression product such as an RNA or protein. Methods for generating genetically modified cells or organisms, e.g., cells
  • a protein or nucleic acid has or comprises a naturally occurring sequence.
  • a protein or nucleic acid comprises or has a sequence that is at least in part invented or generated by man and/or not known to be found in nature.
  • an agent or composition herein comprises a naturally occurring polypeptide.
  • a polypeptide is said to be "naturally occurring” if it has the amino acid sequence of a polypeptide found in nature.
  • a recombinantly produced polypeptide identical in sequence to a polypeptide found in nature is said to be a "naturally occurring" polypeptide.
  • One of skill in the art can readily obtain sequences of naturally occurring polypeptides, e.g., from publicly available databases such as those available at the National Center for Biotechnology Information (NCBI) website (e.g., GenBank, OMIM, Gene) using a Gene ID or GenBank Accession Number disclosed herein.
  • NCBI National Center for Biotechnology Information
  • GenBank GenBank, OMIM, Gene
  • a variant of a naturally occurring polypeptide is used.
  • an agent disclosed herein or used in a method or composition herein i.e., any such agent is an isolated or purified agent.
  • a high fat diet promotes intestinal stem cell and/or non-stem intestinal progenitor cell function, including, for example, increased proliferation and/or self-renewal of intestinal stem cells and/or enhanced number and/or function of non-stem intestinal progenitor cells.
  • a high fat diet and/or a high fat diet mimetic stimulates proliferation and/or self-renewal of intestinal stem cells and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • Exemplary PPAR- ⁇ target proteins include, without limitation, carnitine
  • CPT 1A palmitoyltransferase 1 A
  • HMGCS2 3-hydroxy-3-methylglutaryl-CoA synthase 2
  • FBP 1 fatty acid binding protein 1
  • the PPAR- ⁇ gene also known as FAAR, NR1 C2, NUC1 , NUCI, NUCII, PPARB, PPARD; see Gene ID: 5467 for information pertaining to the human PPAR- ⁇ gene; Gene ID: 19015 for information pertaining to the mouse PPAR- ⁇ gene; Gene ID: 25682 for information pertaining to the rat PPAR- ⁇ gene; Accessions: NP_001 165289.1 for information pertaining to human PPAR- ⁇ protein isoform 1 , NP_803184.1 for information pertaining to human
  • ⁇ - ⁇ protein isoform 2 NP_001 165290.1 for information pertaining to human PPAR- ⁇ protein isoform 3
  • NP__001 165291 .1 for information pertaining to human PPAR- ⁇ protein isoform 4
  • P35396.1 for information pertaining to mouse PPAR- ⁇ protein
  • AAC52419.1 for information pertaining to rat PPAR- ⁇ protein
  • PPARs regulate a variety of bioprocesses, and the protein encoded by this gene is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma.
  • PPAR- ⁇ protein is believed to function as an integrator of transcription repression and nuclear receptor signaling, and expression of the PPAR- ⁇ gene is elevated in colorectal cancer cells.
  • CPTl A also known as CPTl, GPT1 -L, and L-CPT1 ; see, e.g., Gene ID: 1374 for information relating to the human CPTl A gene; Gene ID: 12894 for information pertaining to the mouse CPTl A gene; Gene ID: 25757 for information pertaining to the rat CPT1A gene; Accession: NP_001867.2 for information relating to human CPT l A isoform 1 protein;
  • NP__001 027017.1 for information relating to human CPTl A isoform 2 protein; Accession: P97742.4 for information relating to mouse CPTl A protein; Accession: P32198.2 for information relating to rat CPTl A protein) is responsible for catalyzing the transfer of acyl groups of long-chain fatty acid-CoA conjugates onto carnitine, which is an important step for mitochondrial uptake of long-chain fatty acids and their subsequent beta-oxidation in mitochondria.
  • the CPTl A comprises a PPAR- ⁇ target gene.
  • HMGCS2 see, e.g., Gene ID: 3 158 for information pertaining to the human
  • HMGCS2 gene Gene ID: 15360 for information pertaining to the mouse HMGCS2 gene; Gene ID: 24450 for information pertaining to the rat HMGCS2 gene; Accession:
  • NP_005509.1 for information relating to human HMGCS2 isoform 1 protein
  • NP_001 1 59579.1 for information relating to human HMGCS2 isoform 2 protein
  • Accession: P54869.2 for information pertaining to mouse HMGCS2 protein
  • NP 7751 17,2 for information relating to rat H GCS2 protein is a member of the HMG-coA synthase family, which is a mitochondrial enzyme that is responsible for catalyzing the first reaction of ketogenesis-the metabolic pathway that generates lipid-derived energy for organs under carbohydrate deprivation, for example fasting.
  • the HMGCS2 comprises a PPAR- ⁇ target gene.
  • FABP1 (also known as FAB PL, L-FABP; see, e.g., Gene ID: 2168 for information pertaining to the human FABP1 gene; Gene ID: 14080 for information pertaining to the mouse FABP1 gene; Gene ID: 24360 for information pertaining to the rat FABP1 gene; Accession: NP__001434.1 for information relating to human FABP 1 protein; Accession: P12710.2 for information pertaining to mouse FABP 1 protein; and Accession: P02692.1 for information relating to rat FABP1 protein).
  • the FABP1 comprises a PPAR- ⁇ target gene.
  • FABP 1 is a fatty acid binding protein expressed in liver.
  • Fatty acid binding proteins comprise a small, highly conserved, family of proteins that bind to long- chain fatty acids and other ligands that are hydrophobic. FABP 1 also binds to bile acids. Fatty acid binding proteins are believed to play roles in fatty acid uptake, transport, and metabolism.
  • the population of cells is contacted with both an agent that increases the level and/or activity of PPAR- ⁇ and an agent that increases the level and/or activity of a PPAR- ⁇ target protein.
  • an agent that increases the level and/or activity of PPAR- ⁇ increases the level and/or activity of a PPAR- ⁇ target protein.
  • the agent increases the level and/or activity of both PPAR- ⁇ and the PPAR- ⁇ target protein.
  • the agent increases the level and/or activity of the PPAR- ⁇ target protein in intestinal stem and/or non-stem cell progenitor cells.
  • agents described herein may, for example, increase the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold,
  • Agents can be assessed for their ability to increase the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein using assays which are available to the skilled artisan, for example, using the in vitro PPAR- ⁇ activation assay, cell culture and transfection, in vitro transcription assay, and statistical methods described in U.S. Publication No. 2013/0102610, incorporated herein by reference in its entirety.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises a high fat diet mimetic.
  • high fat diet mimetic refers to an agent that attempts to reproduce one or more of the physiological effects that a high fat diet has on a mammal.
  • a high fat diet refers to a diet in which a significant percentage of total daily calories comprise calories from fats.
  • a high fat diet mimetic comprises an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • the "high fat diet mimetic” increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein (e.g., in a population of cells in mammalian intestinal tissue, e.g., intestinal stem cells and/or non-stem intestinal progenitor cells) by at least about 5%, 10%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1 .8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold,
  • a PPAR- ⁇ target protein e.g., in a population
  • a PPAR- ⁇ and/or a PPAR- ⁇ target protein e.g., the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein in a population of cells in mammalian intestinal tissue not contacted with a high fat diet mimetic.
  • the high fat diet mimetic stimulates proliferation and/or self-renewal of intestinal stem cells, e.g., by at least about 5%o, 10%>, 15%,
  • the high fat diet mimetic stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 1 0%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1 .7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the high fat diet mimetic.
  • the high fat diet mimetic comprises a fatty acid or a salt or ester thereof. In some embodiments the high fat diet mimetic comprises a derivative or a structural analog of a fatty acid. In some embodiments, the high fat diet mimetic comprises an essential fatty acid. In some embodiments, the fatty acid comprises a poly unsaturated fatty acid. In some embodiments, the fatty acid comprises an omega-3 fatty acid. In some embodiments, the fatty acid comprises an omega-3 fatty acid. In some embodiments, the fatty acid comprises a short chain polyunsaturated fatty acid, e.g., a SCPUFA in Table 1. Table 1 below lists exemplary short chain polyunsaturated acids (SCPUFAs) with a carbon chain length of 18 or less for use as high fat diet mimetics.
  • SCPUFAs short chain polyunsaturated acids
  • the fatty acid comprises a long chain polyunsaturated fatty acid, e.g., a LCPLJFA in Table 2.
  • LCPUFAs long chain PUFAs
  • the high fat diet mimetic comprise palmitic acid.
  • palmitic acid comprises an in vitro HFD-mimetic.
  • the high fat diet mimetic comprises an analog or derivative of palmitic acid.
  • the high fat diet mimetic comprise DHA.
  • the high fat diet mimetic comprises EPA.
  • the high fat diet mimetic comprises ALA.
  • the high fat diet mimetic comprises an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein.
  • the high fat diet mimetic comprises a PPAR- ⁇ agonist.
  • the high fat diet mimetic comprise a CPT 1 A agonist. In some embodiments, the high fat diet mimetic comprise a HMGCS2 agonist. In some embodiments, the high fat diet mimetic comprises a FABPl agonist. In some embodiments, the high fat diet mimetic comprises GW501516. In some embodiments, the high fat diet mimetic comprises GW 0742 CAS#[3 173 18-84-6]. In some embodiments, the high fat diet mimetic comprises L-l 65,041 CAS#[79558-09-l ]. In some embodiments, the high fat diet mimetic comprises CER-002 (being commercially developed by CERENIS Therapeutics).
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises a PPAR- ⁇ agonist.
  • the PPAR- ⁇ agonist increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein (e.g., in a population of cells in mammalian intestinal tissue, e.g., intestinal stem cells and/or non-stem intestinal progenitor cells) by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%,
  • the PPAR- ⁇ agonist stimulates proliferation and/or self-renewal of intestinal stem cells, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1.2 fold, 1.3 fold, 1.4 fold,
  • the PPAR- ⁇ agonist stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1 .6 fold, 1 .7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1 000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the PPAR- ⁇ agonist.
  • the PPAR- ⁇ agonists described herein comprise high fat diet mimetics. In some embodiments, the PPAR- ⁇ agonists described herein comprise PPAR- ⁇ target protein agonists. In some embodiments, the PPAR- ⁇ agonists described herein comprise CPT1 A agonists. In some embodiments, the PPAR- ⁇ agonists described herein comprise HMGGCS2 agonists. In some embodiments, the PPAR- ⁇ agonists described herein comprise FABP 1 agonists.
  • the PPAR- ⁇ agonist is a compound of formula (I) and pharmaceutically acceptable salts and solvates thereof; wherein X represents a COOH (or a hydrolysable ester thereof), X 1 is O or S, and the depicted bond with a dashed line is a single bond; X 2 represents O, S; R' and R 2 independently represent H, CH 3 , OCH 3 or halogen; n is 1 or 2; one of Y and Z is N and the other is S or O; y represents 1 or 2; each R 3 independently represents CF 3 or halogen.
  • Methods of synthesizing compounds of formula (I) are described in U.S. Patent No. 6,710,063, which is incorporated herein by reference in its entirety.
  • Exemplary compounds of formula (I) include, without limitation, 2-[2-methyl-4-( ⁇ 4- methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-oxazol-5-yl ⁇ methoxy)phenoxy]acetic acid, 3-[2- methyl-4-( ⁇ 4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-thiazol-5- yl ⁇ methoxy)phenyl]propanoic acid, 3-[2-methyl-4-( ⁇ 4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5-yl ⁇ methoxy)phenyl]propanoic acid,
  • the PPAR- ⁇ agonist is a compound of formula (II) and pharmaceutically acceptable salts
  • R is a hydrogen atom, an alkyl group having 1-8 carbon atoms, an alkyl group having 1-8 carbon atoms and a halogen atom substituent, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1-8 carbon atom and a 3-7 membered substituent, an arylalkyl group that has a C 6 -ioaryl portion and alkyl portion and optionally has a substituent, or an aryl or heterocyclic group which optionally has a substituent;
  • R 2 is a hydrogen atom, an alkyl group having 1-8 carbon atoms, an alkyl group having 1-8 carbon atoms and a halogen atom substituent, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cyc!oal
  • the PPAR- ⁇ agonist is an oxazole derivative compound of formu la (III) and pharmaceutically acceptable salts thereof:
  • R 1 1 is an alkyl group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms and 1 -3 halogen atom substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom and a 3-7 membered substituent, or a phenylalkyl group having C
  • the PPAR- ⁇ agonist is a thiazole derivative compound of formula IV) and pharmaceutically acceptable salts thereof:
  • each of R 21 and R 22 independently is an alkyl group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms and 1 -3 halogen atom substituents, an alkenyl group having 2- 8 carbon atoms, an a!kynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom and a 3-7 membered substituent, or a phenylalkyl group having Q .4 alkyl portion, phenyl group, naphthyl group, pyridyl group, thienyl group, furyl group, quinolyl group, benzofliranyl group or benzothienyl group which optionally contains a substituent of halogen, hydroxyl, nitro, amino, Cj.g alkyl, C].
  • g alkyl having 1 -3 halogen substituents Q.g alkoxy, Q.g alk
  • the PPAR- ⁇ agonist is a compound of formula (V):
  • ARYL is phenyl or pyridinyl, wherein said phenyl or pyridinyl is optionally substituted with one or more substituents selected from the group consisting of halogen, Cl - 6alkyl, C2-6alkenyl, Cl -6alkoxy, Cl -6perfluoroalkyl,Cl-6alkylthio, hydroxy, hydroxyCl - 6alkyl, Cl -4acyloxy, nitro, cyano, C l -6alkylsuIfonyl, amino, Cl -6alkylainino and C I - 6alkoxycarbonyl;
  • Z is 0(CH2)n, S02(CH2)n, (CH2)nY(CH2)n,(CH2)nCO, 0(CH2)nCO, or (CH2)nY(CH2)nCO wherein Y is NR3, O or S and R3 is selected from the group consisting of H, C l -6alkyl, C3-8cyclo
  • X is NR3, O or S wherein R3 is as defined above;
  • Rl is H, halogen, Cl-6alkyl, Cl -6alkoxy, C l -6perfluoroalkyl; hydroxyC16 ⁇ alkyl, nitro, cyano, and C I -6aIkyIamino; and
  • R2 is substituted or unsubstituted phenyl, pyridinyl or thienyl wherein the substituents are selected from the group consisting of halogen, Cl-6alkyi, C2-6alkenyl, Cl-6 eperfluoroalkyl, C l -6alkylthio, hydroxy, hydroxyCl -6alkyl, Cl -6acyloxy, nitro, cyano, Cl-6alkylsulfonyl, amino, Cl-6alkylamino and C 1 -6alkoxycarbonyl; with the proviso that when Z is 0(CH2)n or S02(CH
  • the PPAR- ⁇ agonist is a compound of formula (VI):
  • R] R2, R3 and R are independently selected from the group comprising H, F, CI, Br,— CF 3 , (Ci-Oalkyl, (C0-C 4 )alkylene-O— (C0-C 4 )alkylene-H, SCH 3 , S(0)CH 3 , S(0) 2 CPI 3 , CN,— OCF3,— OCHF 2 , and ⁇ -OCH 2 F;
  • Z is a bond or— CP1 2 ;
  • Y is O,— S—— S(O) or— S(0) 2 ;
  • W is— CH 2 or— CH 2 CH 2 ;
  • one of U and V is N the other is— S— or— O— ;
  • R 5 is selected from the group comprising of (CpCg) alkyl, (C
  • R 6 , R 7 are independently selected from the group comprising H, F, Br,— CF 3 ,— OCF 3 , (C r C 6 )alkyl, (C 0 -C 4 )alkylene-O— (C 0 -C 4 )alkylene-H,— SCF 3 ,— SF 5 ,— OCF2— CHF 2 ,—
  • OCHF 2 — OCH 2 F, O-phenyl, phenyl, N0 2 ;
  • the PPAR- ⁇ agonist is selected from the group consisting of 2- ⁇ 2-methyl-4[( ⁇ 4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-rhiazol-5 yl ⁇ methyl)sulfanyl] phenoxy ⁇ acetic acid 2- ⁇ 2-methyl-4[( ⁇ 4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5- yl ⁇ methyl) sulfanyl] phenoxy ⁇ acetic acid methyl 2- ⁇ 4-[( ⁇ 4-methyl-2-[4-(trifluoromethyl) phenyl]- !, 3-thiazol-5-yl ⁇ methyl)sulfanyl]phenoxy ⁇ acetate 2- ⁇ 4-[( ⁇ 4-methyl-2-[4- (trifluoromethyl)phenyl]-l ,3-thiazol-5-yl ⁇ methyl) sulfanyl] phenoxy ⁇ acetate 2- ⁇
  • the PPAR- ⁇ agonist is selected from the group consisting of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-l ,2-benzisoxazol- 6-yl]oxyacetic acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopiOpyl-5-thiazolyl]propionyl]2- methyl phenoxy] acetic acid or [4-[3-[2-(2-hydroxy-4-chIorophenyl)-5-isopropyl-4- oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or a pharmacologically acceptable salt thereof, as described in U.S. Publication No. 2012/0270910, which is incorporated herein by reference in its entirety.
  • the PPAR- ⁇ agonist is ⁇ 2-methyl-4- [4-methyl-2- (4- trifluoromethyl phenyl) thiazol-5-ylmethylthio] phenoxy ⁇ -acetic acid and pharmaceutically acceptable safts, solvates, and hydrolyzable esters thereof.
  • exemplary physiologically acceptable salts include conventional salts formed from pharmaceutical acceptable inorganic or organic acids or bases as well as quaternary ammonium acid addition salts.
  • Suitable acid salts include hydrochloric, hydrobromic, sulfuric, phosphoric, nitric, perchloric, fumaric, acetic, propionic, succinic, glycolic, formic, lactic, maleic, tartaric, citric, palmoic, malonic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, fumaric, toluenesulfonic, methanesulfonic, naphthalene-2-sulfonic, benzenesulfonic hydroxynaphthoic, hydroiodic, malic, steroic, tannic and the like, as described in further detail in PCX
  • the PPAR- ⁇ agonist is a phenoxy acetic acid compound selected from the group consisting of: (Z)-[2-Methyl-4-[3-(4-methylphenyl)-3-[4-[3- (morpholin-4-yl)propynyl]phenyl]allyloxy]-phenoxy]acetic acid; (E)-[2-Methyl-4-[3-[4-[3- (pyrazol-l -yl)prop- l -ynyl]phenyI]-3-(4-trifluoromethylphenyl)-allyloxy]phenoxy]acetic acid; (E)-[2-Methyl-4-[3-[4-[3-(morpholin-4-yl)propynyl]phenyl]-3-(4-trifluoromethylphenyl) allyloxy]-phenoxy]acetic acid; (E)-[2-Methyl-4-[3-(4-methylphenyl)
  • the PPAR- ⁇ agonist is a compound of Formula (VII)
  • X is selected from O, S, OCH 2 , and SCH 2 ;
  • X ' is O or S
  • ⁇ ' is selected from H, Q.galkyl, C2-8 aIkenyI, aryl, heteroaryl, C 3 _io cycloalkyl, and a heterocyclyi, wherein each R 1 group is substituted with 0-4 R l a ; R la , at each occurrence, is selected from S substituted with 0-1 R lb , O substituted with 0-1 R , b , halogen, NH 2 substituted with 0-2 R , b ,— CN, NO.-. d. 6 alkyl substituted with 0-3 R lb , C 2 .
  • R lb at each occurrence, is selected from S substituted with 0- 1 R l c , O substituted with 0-1 R lc , halogen, methanesulfonyl, NH 2 substituted with 0-2 R lc ,— CN, N0 2 , Ci -6 alkyl substituted with 0-3 R l c , C 2 . 6 alkenyl substituted with 0-2 R l c , aryl substituted with 0-2 R'°, heteroaryl substituted with 0-2 R l c , C 3 _io cycloalkyl substituted with 0-2 R l c , and a heterocycle substituted with 0-2 R , c ;
  • R lc at each occurrence, is selected from S substituted with 0-1 R ld , O substituted with 0-1 R ld , halogen, NH 2 substituted with 0-2 R ld ,— CN, N0 2 , C,. 6 alkyl substituted with 0-2 R ld , C 2 .
  • R ld at each occurrence, is selected from OH, SH, S, O, halogen, NH 2 ,— CN, N0 2 , Ci-6 alkyl, C 2 . 6 alkenyl, aryl, CF , and OCF 3 ;
  • R 2 is selected from C-C- -R 2 '.
  • CH CI I - -R 2 ⁇ aryl substituted with 0-3 R 2a , and heteroaryl substituted with 0-3 R 2a ;
  • R 2a is selected from S substituted with 0-1 R 2b , O substituted with 0-1 R 2b , halogen, NH 2 substituted with 0-2 R 2b ,— CN, N0 2 , C,. 6 alkyl substituted with 0-2 C 2 . 6 alkenyl substituted with 0-2 R 2b , aryl substituted with 0-2 R 2b , heteroaryl substituted with 0-2 R 2b , C3.10 cycloalkyl substituted with 0-2 R 2b , and a heterocycle substituted with 0-2;
  • R 2b is selected from S substituted with 0-1 R 2c , O substituted with 0-1 R 2c , halogen, methanesulfonyl, NH 2 substituted with 0-2 R 2c ,— CN, N0 2 , C 1 -6 alkyl substituted with 0-2 R 2c , C 2 . 6 alkenyl substituted with 0-2 R 2c , aryl substituted with 0-2 R 2c , heteroaryl substituted with 0-2 R 2c , C3.10 cycloalkyl substituted with 0-2 R 2c , and a heterocycle substituted with 0-2 R 2c ;
  • R 2c is selected from S substituted with 0-1 R 2d , O substituted with 0-1 R 2d , halogen, NH 2 substituted with 0-2 R 2d ,— CN, N0 2 , C,, 6 alkyl substituted with 0-2 R 2d , C 2 . 6 alkenyl substituted with 0-2 R 2d , aryl substituted with 0-2 R 2d , heteroaryl substituted with 0-2 R 2 , C3.
  • cycloalkyl substituted with 0-2 R 2d and a heterocycle substituted with 0-2 R 2d R 2d , at each occurrence, is selected from OH, SH, S, O, halogen, NH 2 ,— CN, N0 2 , Q. 6 alkyl, C 2 . 6 alkenyl, aryl, CF 3 , and OCF 3 ;
  • R 3 is selected from halogen and Ci_ 6 alkyl substituted with 0-2 R 3a ;
  • R ' ⁇ at each occurrence, is selected from OH, O, S, halogen, C(0)NH 2 , C(0)NH— C alkyl, and C(0)N(C aIkyl) 2 ;
  • R 3 and R 5e combine to form a 5, 6, or 7 membered ring consisting of carbon atoms and 0-2 heteroatoms selected from O, N, and S(0)o-2 and there are 0-2 ring double bonds in the bridging portion formed by R 3 and R 5e ;
  • R 4a at each occurrence, is selected from H, halogen, and C]_ 6 alkyl substituted with 0-2 R ;
  • R 4d at each occurrence, is selected from OH, O, halogen, NH 2 , NH— C 1 -4 alkyl, and N(C )-4 alkyl) 2 ;
  • R 4b at each occurrence, is selected from H, halogen, and Ci -6 alkyl substituted with 0-2 R c ;
  • R 4e at each occurrence, is selected from OH, O, halogen, NH 2 , NH— C
  • R 4c at each occurrence, is selected from H, halogen, and C 1 -6 alkyl substituted with 0-2 R 4f ;
  • R 4f at each occurrence, is selected from OH, O, halogen, NH 2 , NH— Ci. 4 alkyl, and N(C M alkyl) 2 ;
  • R 5a at each occurrence, is selected from H, halogen, CH 3 , and CH 2 CH 3 ;
  • R 5b at each occurrence, is selected from H, halogen, CH 3 , and CH 2 CH 3 ;
  • R 5c at each occurrence, is selected from H, halogen, CH 3 , and CH 2 CH 3 ;
  • R 5d is selected from H, halogen, CH 3 , and CH 2 CH 3 ;
  • R 5e at each occurrence, is selected from H, halogen, CH 3 , and CH 2 CH 3 .
  • Methods of synthesizing compounds of Formula (Vll) are described in U.S. Patent No. 8,217,086, which is incorporated herein by reference in its entirety.
  • the PPAR- ⁇ agonist is a compound of Formula (VIII) or a salt thereof:
  • R ' is phenyl, naphthyl, pyridyl, thienyl, furyl, quinolyl or benzothienyl, any of which can have substituents selected from the group consisting of Cj .galkyl, C i_ 8 alkyl having halogen, C ⁇ alkoxy, Cl-salkoxy having halogen, C 2 -8alkenyl, C 2 .8alkynyl, halogen, C 2 -7acyl, benzoyl, hydroxyl, nitro, amino, phenyl and pyridyl;
  • R 2 is Ci _ 8 alkyl, Ci _ 8 alkyl having halogen, C 2 -8alkenyl, C 2 . 8 alkynyl, 3-7 membered cycloalkyl, Ci _ g alkyl having 3-7 membered cycloalkyl, or Ci ⁇ alkyl substituted with phenyl, naphthyl or pyridyl, any of which can have substituents selected from the group consisting of Ci .galkyl, Ci _ s alkyl having halogen, Ci .galkoxy, Ci .galkoxy having halogen, C 2 - 8 alkenyl, C 2 - 8 alkynyl, halogen, C 2- 7 acyl, benzoyl, hydroxyl, nitro, amino, phenyl and pyridyl;
  • A is oxygen, sulfur or NR 9 in which R 9 is hydrogen or Cj. 8 alkyl;
  • X is a Ci . 8 alkylene chain which can have substituents selected from the group consisting Of Ci .galky], Ci .galkoxy and hydroxyl and which can contain a double bond;
  • B is CH or nitrogen
  • Z is oxygen or sulfur; each of R 6 and R 7 is hydrogen, Ci . 8 alkyl, Ci _ 8 alkyl having halogen; R 8 is hydrogen or Ci _ 8 alkyl; provided that at least one of R 3 , R 4 and R 5 is not hydrogen;
  • each of R 'and R independently is a hydrogen atom, a halogen atom, nitro, an alkyl group having 1 -8 carbon atoms, an alkoxy group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkoxy group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom which has a 3-7 membered cycloalkyl substituent, an aryl group having 6-10 carbon atoms which optionally has a substituent, an arylalkyl group which has a C 6-[ o aryl portion and Ci .galkyl portion, a heterocyclic group which optionally has a substituent or a heterocyclic-alky
  • each of R "and R 1 independently is a hydrogen atom, a halogen atom, nitro, hydroxyl, amino, an alkyl group having 1 -8 carbon atoms, an alkoxy group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkoxy group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atoms which has a 3-7 membered cycloalkyl substituent, or a phenyl, naphthyl, benzyl, phenethyl, pyridyl, thienyl, furyl, quinolyl, or benzothienyl group which optionally has a substituent selected from the group
  • A is O, S or NR 7 in which R 7 is hydrogen or C j.galkyl;
  • B ' is CW or N in which W is hydrogen or a bond;
  • B 2 is 0, S or NR 8 in which R 8 is hydrogen or C ⁇ alkyl;
  • Y is a C ] . 8 alky!ene chain, which can be substituted with Ci _ 8 alkyl or Cj _ 8 alkyl substituted with 1-3 halogens;
  • Z is NH, O or S;
  • R ' is aryl, which can be substituted with a group or atom selected from the group consisting Of Ci .
  • Ci _ s alkoxy Ci _ 3 ⁇ 4 alkyl substituted with 1 -3 halogens, hydroxyl, nitro, amino, phenyl, pyridyl and halogen, or a heterocyclic group having five to eight membered ring comprising one to three hetero atoms selected from the group consisting of nitrogen, oxygen and sulfur and the other atoms consisting of carbon (benzene ring can be condensed with the heterocyclic ring);
  • R 2 is C 2-8alkyl, Ci _ 8 alkyl substituted with 1 -3 halogens, C 3 . 7 cycloalkyl, C 2-8alkenyl, C 2 . 8 alkynyl, alkyl (comprising Ci ⁇ alkyl moiety) substituted with aryl, which can be substituted with a group or atom selected from the group consisting of Ci . 8 alkyl, Ci .
  • Ci -8 alkyl substituted with 1 -3 halogens, hydroxyl, nitro, amino, phenyl, pyridyl and halogen, or alkyl (comprising Ci _ 4 alkyl moiety) substituted with a heterocyclic group having five to eight membered ring (comprising one to three hetero atoms selected from the group consisting of n itrogen, oxygen and sulfur and the other atoms consisting of carbon);
  • R 3 is halogen, trifluoromethyl, Ci_ 8 alkyl, C 2 -8alkenyl or C 2 solicit 8 alkynyl; each of R 4 and R 5 is hydrogen, Ci_ 8 alkyl or C]. 8 alkyl substituted with 1 -3 halogens; and R 6 is hydrogen, C ⁇ alkyl substituted with am ino, Ci_ 8 alkyl or alkali metal; provided that each of Z and R 3 is attached to the benzene ring, and X 2 is not attached to the benzene ring.
  • the PPAR- ⁇ agonist comprises 2-[2-methyl-4-[[4-methyl-2-[4- (trifluoromethyI)phenyl]- l ,3-thiazol-5-yl]methylsuIfanyl]phenoxy]acetic acid (GW501516) or an analog or derivative thereof.
  • the PPAR- ⁇ agonist comprises GW 0742 CAS#[3 173 18-84- 6] . In some embodiments, the PPAR- ⁇ agonist comprises L- 165,041 CAS#[79558-09- l ] , In some embodiments, the PPAR- ⁇ agonist comprises CER-002 (being commercially developed by CERENIS Therapeutics).
  • the PPAR- ⁇ agonist comprises a polyunsaturated fatty acid (PUFA).
  • PUFA polyunsaturated fatty acid
  • PUFA is used in its generally accepted meaning; it relates to fatty acids with at least 2 carbon-carbon double bonds (preferably 2 to 6, more preferably 4 or 5 or 6 carbon- carbon double bonds), preferably consisting of 1 6-24 carbon atoms (preferably 1 8-22 carbon atoms), and comprise n-3, n-6 and n-9 acids.
  • PUFA defines free acids it is generally understood to also mean their salts and these acids in the form of their naturally occurring esters, i .e.
  • glycerides comprising mono-, di- and triglycerides
  • esters into which they are converted, e.g. by transesterification, such as ethyl esters.
  • PUFAs of preferred interest in the context of the present invention are n-3 and n-6 PUFAs, especially EPA (eicosapenta-5,8, 1 1 , 14, 1 7-enoic acid), DPA (docosapentaenoic acid), DHA
  • Edible oils and fat compositions comprising PUFAs are generally regarded as safe for human consumption.
  • the PPAR- ⁇ agonist is a SCPUFA listed in Table 1 .
  • the PPAR- ⁇ agonist is a LCPUFA listed in Table 2.
  • Saturated C16 and C I 8 fatty acids e.g. Palmitic and Stearic acids occur both in animal and plant derived fats and can be desatu rated by mammals.
  • Stearic acid is desaturated in mammals to give oleic acid (CI 8: 1 co9).
  • the marine PUFAs e.g. EPA, DPA and DHA, by way of contrast, contain long chain fatty acids with a carbon chain length of C20-22 respectively. Mammals, and in particular humans, cannot produce the LCPUFAs by further de-saturation of ⁇ -9 fatty acids, nor chain-elongate ⁇ 3 and co6 plant derived fatty acids efficiently.
  • These LCPUFAs can be obtained from diet, and marine lipids are a suitable economic source.
  • the PPAR- ⁇ agonist comprises an eicosanoid. It has been reported that eicosanoids activate PPAR- ⁇ with micromolar affinity. Exemplary eicosanoids include, without limitation, PGAI, its semisynthetic analog (cPGI), and PGE2.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises an agonist of a transcriptional coactivator to PPAR- ⁇ (e.g., an agonist of PGC1 alpha).
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises an agonist of a binding partner to PPAR- ⁇ that heterodimerizes with PPAR- ⁇ to form a transcription factor complex that binds to cognate sequences in promoter regions of PPAR- ⁇ target genes (e.g., an agonist or ligand for retinoid X receptor (RXR).
  • an agonist or ligand for retinoid X receptor (RXR) e.g., an agonist or ligand for retinoid X receptor (RXR).
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises an inhibitor of a transcriptional repressor of PPAR- - ⁇ and/or RXR.
  • inhibitor encompasses agents that inhibit (decrease, reduce) the expression or activity of a target.
  • inhibitor encompasses agents that inhibit expression and/or inhibit one or more activities of a molecule or complex of interest (the "target").
  • an agent is an "inhibitor" of a target if one or more activities of the target is reduced in the presence of the compound, or as a consequence of its use, as compared with in the absence of the compound, and/or if the level or amount of the target is reduced in the presence of the compound, or as a consequence of its use, as compared with in the absence of the compound.
  • an inhibitor acts directly on a target in that it physically interacts with the target.
  • an inhibitor acts indirectly, e.g., by inhibiting a second molecule that is needed for synthesis or activity of the target.
  • an inhibitor is an antagonist.
  • Methods of inhibiting encompass methods that result in a decreased amount of a target and methods that interfere with one or more functions (activities) of a target.
  • a target is inhibited by inhibiting or interfering with its expression or post-translational processing, so that a decreased amount of functional target is produced, resulting in a decreased overall activity of the target in a cell or system.
  • a variety of methods useful for inhibiting or interfering with expression can be used in various embodiments. In general, such methods result in decreased synthesis of a mRNA and/or polypeptide and as a result, a reduction in the total level of activity present.
  • Other means of inhibition include interfering with proper localization, secretion, or co- or post-translational processing, or promoting increased degradation.
  • Methods of inhibiting activity can include binding to a target or to a receptor or co-receptor for the target and thereby blocking the target from interacting with its receptor(s) or with other molecule(s) needed for activity of the target.
  • an inhibitor binds to an active site or catalytic residue or substrate binding site of an enzyme or blocks dimerization or other protein-protein interactions, etc.
  • a protein that acts as a dimer is inhibited using an agent that blocks dimerization.
  • an inhibitor comprises an RNA i agent, e.g., an siRNA or shRNA, or an antisense oligonucleotide, that inhibits expression of a target.
  • an inhibitor comprises an antibody or aptamer or small molecule that binds to and inhibits a target.
  • an inhibitor comprises an agent that acts in a dominant negative fashion to inhibit a target.
  • a dominant negative agent may comprise a fragment of a target molecule that lacks one or more domains necessary for function.
  • a dominant negative form of a TF comprises a DNA binding domain and/or dimerization domain but lacks an activation domain.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein comprises an inhibitor of degradation of PPAR- ⁇ protein and/or a PPAR- ⁇ target protein.
  • the agent comprises GW501516 or an analog or derivative thereof.
  • GW50156 Exemplary analogs and/or derivatives of GW50156 may be found in the following U.S. Patents and/or published U.S. Applications: US7084161 , US7091225, US7091237, US7105551 , US7176204. US6710063, US6723740, US6518290, US2009149519,
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein is a nucleic acid sequence that encodes PPAR- ⁇ . In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a nucleic acid encoding the PPAR- ⁇ target protein. In some embodiments, the agent comprises a nucleic acid encoding CPT1 A. In some embodiments, the agent comprises a nucleic acid encoding HMGCS2. In some embodiments, the agent comprises a nucleic acid encoding FABP 1.
  • Nucleic acid is used interchangeably with “polynucleotide” and encompasses polymers of nucleotides.
  • Olionucleotide refers to a relatively short nucleic acid, e.g., typically between about 4 and about 1 00 nucleotides (nt) long, e.g., between 8-60 nt or between 10-40 nt long. Nucleotides include, e.g., ribonucleotides or deoxyribonucleotides.
  • a nucleic acid comprises or consists of DNA or RNA.
  • a nucleic acid comprises or includes only standard nucleobases (often referred to as "bases").
  • a nucleic acid may comprise one or more non-standard nucleobases, which may be naturally occurring or non- natural ly occurring (i.e., artificial; not found in nature) in various embodiments.
  • a nucleic acid may comprise chemically or biologically modified bases (e.g., alkylated (e.g., methylated) bases), modified sugars (e.g., 2'-0-alkyribose (e.g., 2'-0 methylribose), 2'-fluororibose, arabinose, or hexose), modified phosphate groups (e.g., phosphorothioates or 5'-N-phosphoramidite linkages).
  • a nucleic acid comprises subunits (residues), e.g., nucleotides, that are linked by phosphodiester bonds.
  • a nucleic acid comprises a locked nucleic acid, morpholino, or peptide nucleic acid.
  • a nucleic acid may be linear or circular in various embodiments.
  • a nucleic acid may be single-stranded, double- stranded, or partially double-stranded in various embodiments.
  • An at least partially double- stranded nucleic acid may be blunt-ended or may have one or more overhangs, e.g., 5' and/or 3 ' overhang(s).
  • Nucleic acid modifications e.g., base, sugar, and/or backbone
  • RNA interference RNA interference
  • modifications may, for example, increase stability (e.g., by reducing sensitivity to cleavage by nucleases), decrease clearance in vivo, increase cell uptake, or confer other properties that improve the potency, efficacy, specificity, or otherwise render the nucleic acid more suitable for an intended use.
  • nucleic acid may, for example, increase stability (e.g., by reducing sensitivity to cleavage by nucleases), decrease clearance in vivo, increase cell uptake, or confer other properties that improve the potency, efficacy, specificity, or otherwise render the nucleic acid more suitable for an intended use.
  • nucleic acid may be modified uniformly or on only a portion thereof and/or may contain multiple different modifications. It will be appreciated that naturally-occurring allelic variants of the reference sequence for a particular nucleic acid or protein may exist in the population, and such variants may be used in certain embodiments. It will also be appreciated that variants arising due to alternative splicing may exist, which are encompassed herein in various embodiments.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein is a functional fragment of a nucleic acid sequence that encodes PPAR- ⁇ . In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a functional fragment of a nucleic acid sequence that encodes the PPAR- ⁇ target protein. In some embodiments, the agent comprises a functional fragment of a nucleic acid sequence that encodes CPT1A. In some embodiments, the agent comprises a functional fragment of a nucleic acid sequence that encodes HMGCS2. In some
  • the agent comprises a functional fragment of a nucleic acid sequence that encodes FABP 1 .
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein is a variant of a nucleic acid sequence that encodes PPAR- ⁇ . In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a variant of a nucleic acid sequence that encodes the PPAR- ⁇ target protein. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes CPT1 A. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes HMGCS2. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes FABP 1.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein is a sequence that is homologous to a nucleic acid sequence that encodes PPAR- ⁇ .
  • the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a sequence that is homologous to a nucleic acid sequence that encodes the PPAR- ⁇ target protein.
  • the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes CPT1A.
  • the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes HMGCS2.
  • the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes FABP l .
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or the PPAR- ⁇ target protein is a PPAR- ⁇ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a PPAR- ⁇ target protein. In some embodiments, the agent comprises a CPT1 A protein. In some embodiments, the agent comprises a HMGCS2 protein, A "polypeptide" refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule comprising one or more polypeptides.
  • a peptide is a relatively short polypeptide, typically between about 2 and 100 amino acids (aa) in length, e.g., between 4 and 60 aa; between 8 and 40 aa; between 10 and 30 aa.
  • the terms "protein”, “polypeptide”, and “peptide” may be used interchangeably.
  • a polypeptide may contain only standard amino acids or may comprise one or more non-standard amino acids (which may be naturally occurring or non-naturally occurring amino acids) and/or amino acid analogs in various embodiments.
  • a "standard amino acid” is any of the 20 L-amino acids that are commonly utilized in the synthesis of proteins by mammals and are encoded by the genetic code.
  • non-standard amino acid is an amino acid that is " ' not commonly utilized in the synthesis of proteins by mammals.
  • Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and non-naturally occurring amino acids.
  • a non-standard, naturally occurring amino acid is found in mammals. For example, orn ithine, citrulline, and homocysteine are naturally occurring nonstandard amino acids that have important roles in mammalian metabolism.
  • nonstandard amino acids include, e.g., singly or multiply halogenated (e.g., fluorinated) amino acids, D-amino acids, homo-ammo acids, N-alkyl amino acids (other than proline), dehydroamino acids, aromatic amino acids (other than histidine, phenylalanine, tyrosine and tryptophan), and ⁇ , ⁇ disubstituted amino acids.
  • amino acid e.g., one or more of the amino acids in a polypeptide
  • Polypeptides may be conjugated with, encapsulated by, or embedded within a polymer or polymeric matrix, dendrimer, nanoparticle, microparticle, liposome, or the like. Modification may occur prior to or after an amino acid is incorporated into a polypeptide in various embodiments.
  • Polypeptides may, for example, be purified from natural sources, produced in vitro or in vivo in suitable expression systems using recombinant DNA technology (e.g., by recombinant host cells or in transgenic animals or plants), synthesized through chemical means such as conventional solid phase peptide synthesis, and/or methods involving chemical ligation of synthesized peptides (see, e.g., Kent, S., J Pept Sci , 9(9): 574-93, 2003 or U. S. Pub. No. 200401 15774), or any combination of the foregoing.
  • a protein may be composed of a single amino acid chain or multiple chains associated covalently or noncovalently.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or the PPAR- ⁇ target protein is a functional domain or fragment of PPAR- ⁇ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a functional domain or fragment of the PPAR- ⁇ target protein. In some embodiments, the agent comprises a functional domain or fragment of CPT1 A protein. In some embodiments, the agent comprises a functional domain or fragment of HMGCS2 protein. In some embodiments, the agent comprises a functional domain or fragment of FAB P I protein.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or the PPAR- ⁇ target protein is a functional homolog of PPAR- ⁇ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a functional homolog of the PPAR- ⁇ target protein. In some embodiments, the agent comprises a functional homolog of CPT1 A protein. In some embodiments, the agent comprises is a functional homolog of HMGCS2 protein, in some embodiments, the agent comprises is a functional homolog of FABP1 protein.
  • the agent that increases the level and/or activity of PPAR- ⁇ and/or the PPAR- ⁇ target protein is a fusion protein comprising PPAR- ⁇ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR- ⁇ target protein is a fusion protein comprising the PPAR-8 target protein. In some embodiments, the agent is a fusion protein comprising CPT 1A protein. In some embodiments, the agent is a fusion protein comprising HMGCS2 protein. In some embodiments, the agent is a fusion protein comprising FABP 1 protein.
  • a “variant" of a particular polypeptide or polynucleotide has one or more alterations (e.g., additions, substitutions, and/or deletions, which may be referred to collectively as “mutations") with respect to the polypeptide or polynucleotide, which may be referred to as the "original polypeptide” or “original polynucleotide”, respectively.
  • An addition may be an insertion or may be at either terminus.
  • a variant may be shorter or longer than the original polypeptide or polynucleotide.
  • the term “variant” encompasses "fragments".
  • a “fragment” is a continuous portion of a polypeptide or polynucleotide that is shorter than the original polypeptide.
  • a variant comprises or consists of a fragment. In some embodiments a fragment or variant is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%o, 97%, 98%o, 99%>, or more as long as the original polypeptide or polynucleotide.
  • a fragment may be an N-terminal, C-terminal, or internal fragment.
  • a variant polypeptide comprises or consists of at least one domain of an original polypeptide.
  • a variant polynucleotide hybridizes to an original polynucleotide under stringent conditions, e.g., high stringency conditions, for sequences of the length of the original polypeptide.
  • a variant polypeptide or polynucleotide comprises or consists of a polypeptide or polynucleotide that is at least 50%, 60%, 70%, 80%,
  • a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical in sequence to the original polypeptide over at least 20%o, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%o, 99%o, or 1 00%o of the original polypeptide, with the proviso that, for purposes of computing percent identity, a conservative amino acid substitution is considered identical to the amino acid it replaces.
  • a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical to the original polypeptide over at least 20%, 30%o, 40%, 50%o, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the original polypeptide, with the proviso that any one or more amino acid substitutions (up to the total number of such substitutions) may be restricted to conservative substitutions.
  • a percent identity is measured over at least 1 00; 200; 300; 400; 500; 600; 700; 800; 900; 1 ,000; 1 ,200; 1 ,500;
  • sequence of a variant polypeptide comprises or consists of a sequence that has N amino acid differences with respect to an original sequence, wherein N is any integer between 1 and 10 or between 1 and 20 or any integer up to 1 %, 2%, 5%, or 10% of the number of amino acids in the original polypeptide, where an "amino acid difference" refers to a substitution, insertion, or deletion of an amino acid. In some embodiments a difference is a conservative substitution.
  • Conservative substitutions may be made, e.g., on the basis of similarity in side chain size, polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved.
  • conservative substitutions may be made according to Table A, wherein amino acids in the same block in the second column and in the same line in the third column may be substituted for one another other in a conservative substitution.
  • Certain conservative substitutions are substituting an amino acid in one row of the third column corresponding to a block in the second column with an amino acid from another row of the third column within the same block in the second column.
  • nucleic acids and proteins of the present invention can include stability and expression enhancing modifications. Suitable stabi lity and expression enhancing modifications are apparent to those of ordinary skill in the art.
  • a PPAR- ⁇ target protein agonist comprises a CPTl A agonist.
  • the CPTl A agonists comprise high fat diet mimetics.
  • high fat diet stimulates proliferation and/or self- renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of CPT1 A or a product of CPT l A (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells).
  • the high fat diet mimetic comprises an agent that increases the level and/or activity of CPTl A or a product of CPTl A.
  • the CPTl A agonist stimulates proliferation and/or self- renewal of intestinal stem cells, e.g., by at least about 5%, 10%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 1 00, or 1000 fold or more relative to the level of proliferation and/or self-renewal of intestinal stem cells in the absence of treatment with a CPT l A agonist.
  • the CPTl A agonist stimulates proliferation of non- stem intestinal progenitor cel ls, e.g., by at least about 5%, 1 0%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .
  • Exemplary CPTI A agonists include, without limitation, nucleic acids encoding CPTI A, functional fragments of nucleic acid sequences that encode CPT I A, variants of nucleic acid sequences that encode CPTI A, nucleic acid sequences homologous to nucleic acid sequences that encode CPT 1 A, CPTI A proteins, functional domains or fragments of CPT I A proteins, functional homologs of CPT I A proteins, and fusion proteins comprising CPT I A protein, or a functional domain, fragment, or homolog of CPTIA protein.
  • a PPAR- ⁇ target protein agonist comprises a HMGCS2 agonist.
  • the HMGCS2 agonists comprise high fat diet mimetics.
  • high fat diet stimulates proliferation and/or self-renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of HMGCS2 or a product of HMGCS2 (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells, etc.).
  • the high fat diet mimetic comprises an agent that increases the level and/or activity of HMGCS2 or a product of HMGCS2 as described herein.
  • the HMGCS2 agonist stimulates proliferation and/or self- renewal of intestinal stem cells, e.g., by at least about 5%, 1 0%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1.7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferat ion and/or self-renewal of intestinal stem cells in the absence of treatment with a HMGCS2 agonist.
  • the TTMGCS2 agonist stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 1 0%>, 15%, 20%, 25%>, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .
  • Exemplary HMGCS2 agonists include, without limitation, nucleic acids encoding HMGCS2, functional fragments of nucleic acid sequences that encode HMGCS2, variants of nucleic acid sequences that encode HMGCS2, nucleic acid sequences homologous to nucleic acid sequences that encode HMGCS2, HMGCS2 proteins, functional domains or fragments of HMGCS2 proteins, functional homologs of HMGCS2 proteins, and fusion proteins comprising HMGCS2 protein, or a functional domain, fragment, or homolog of HMGCS2 protein.
  • a PPAR- ⁇ target protein agonist comprises a FABP l agonist.
  • the FABP l agonists comprise high fat diet mimetics.
  • high fat diet stimulates proliferation and/or self- renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of FABP l (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells, etc.).
  • the high fat diet mimetic comprises an agent that increases the level and/or activity of FABP l as described herein.
  • the FABP l agonist stimulates proliferation and/or self-renewal of intestinal stem cel ls, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1.3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 1 0 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation and/or self-renewal of intestinal stem cells in the absence of treatment with a FABP l agonist.
  • the FABP l agonist stimulates proliferation of non- stem intestinal progenitor cel ls, e.g., by at least about 5%, 1 0%, 15%, 20%, 25%>, 30%, 35%o, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .
  • Exemplary FABP 1 agonists include, without limitation, nucleic acids encoding FABP1 , functional fragments of nucleic acid sequences that encode FABP 1 , variants of nucleic acid sequences that encode FABP 1 , nucleic acid sequences homologous to nucleic acid sequences that encode FABP 1 , FABP 1 proteins, functional domains or fragments of FABP 1 proteins, functional homologs of FABP1 proteins, and fusion proteins comprising FABP l protein, or a functional domain, fragment, or homolog of FABP 1 protein.
  • aspects of the methods described herein can be used in combination with one or more methods, compositions, and or agents (e.g., a calorie restriction mimetic, a calorie restriction regimen, an agent that inhibits the level and/or activity of mTORC l , a radioprotective agent, etc.) described in PCT Application Publication WO2013/ 152120, "COMPOSITIONS AND METHODS FOR PROMOTING INTESTINAL STEM CELL FUNCTION", which is incorporated herein by reference in its entirety.
  • agents e.g., a calorie restriction mimetic, a calorie restriction regimen, an agent that inhibits the level and/or activity of mTORC l , a radioprotective agent, etc.
  • aspects of the present disclosure involve using calorie and/or a calorie restriction mimetic in combination with a high fat diet, a high fat diet mimetic and/or an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein to stimulate proliferation and/or self-renewal of intestinal stem cells and/or enhance the number and/or function of non-stem intestinal progenitor cells and/or stimulate proliferation and/or preserve the morphology of Paneth cells, and/or promote regeneration of mammalian intestinal tissue, e.g., to treat a gastrointestinal disorder, and/or an affliction characterized by intestinal atrophy, and/or to minimize the risk of exposure to ionizing radiation, and/or treat the harmful effects of exposure to ionizing radiation, and/or to increase an individual 's tolerance to ionizing radiation, and/or in combination with radiotherapy, proton therapy, immunotherapy, and/or chemotherapy to protect against drug-induced gastrointestinal injury and or exposure to ionizing radiation.
  • a synergistic effect in enhancing mammalian intestinal stem cell function e.g., stimulating the proliferation and/or self-renewal of intestinal stem cells, enhancing
  • calorie restriction mimetic refers to an agent that attempts to reproduce one or more of the physiological effects that calorie restriction has on a mammal.
  • calorie restriction refers to the protocol of reducing caloric intake while maintaining adequate nutrition of a mammal. Without wishing to be bound by theory, it is believed that CR stimulates proliferation and self-renewal of intestinal stem cells, in part, by inhibiting the level and/or activity of mTORCl in Paneth cells.
  • the calorie restriction mimetic comprises an agent that inhibits the level and/or activity of mTORCl .
  • the calorie restriction mimetic comprises an agent that increases the level and/or activity of Bstl or a product of Bstl .
  • Exemplary calorie restriction mimetics include, without limitation, sirolimus (aka rapamycin) and rapalogs thereof.
  • Exemplary rapalogs include, without limitation, temsirolimus, everolimus, and ridaforolimus.
  • the calorie restriction mimetic comprises a sirolimus analog having a compound of any one of Formula (V), Formula (VI), and Formula (VII), as described in PCT Application Publication
  • Additional exemplary agents that inhibit the level and/or activity of mTORC l include, without limitation, biguanidines, Rag GTPAse inhibitors, agents that phenocopy TSC1 , and/or TSC2, AMPK activators.
  • the contacting occurs in vitro or ex vivo.
  • populations of cells in mammalian intestinal tissue can be obtained from different sources.
  • intestinal stem cells and/or non-stem intestinal progenitor cells can be obtained from a subject, or derived from non intestinal cells from a subject.
  • an intestinal stem cell and/or non-stem intestinal progenitor cell is a whole cell.
  • the contacting occurs in vivo in a subject.
  • a therapeutically effective amount of an agent or composition described herein can be administered to a subject.
  • Methods of administering compounds to a subject are known in the art and easily available to one of skill in the art.
  • the subject is suffering from or at risk of developing a gastrointestinal disorder. In some embodiments, the subject is suffering from or at risk of developing inflammatory bowel disease. In some embodiments, the subject is suffering from or at risk of developing infectious colitis. In some embodiments, the subject is suffering from or at risk of developing ischemic colitis. In some embodiments, the subject is suffering from or at risk of developing inflammatory colitis. In some embodiments, the subject is suffering from or at risk of developing ulcerative colitis. In some embodiments, the subject is suffering from or at risk of developing Crohn's disease. In some embodiments, the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis.
  • the method further comprises determining that the subject is in need of treatment for a gastrointestinal disorder, e.g., that the subject is in need of treatment for inflammatory bowel disease (e.g., Crohn's disease and/or ulcerative colitis), infectious colitis, ischemic colitis, and inflammatory colitis.
  • a gastrointestinal disorder e.g., that the subject is in need of treatment for inflammatory bowel disease (e.g., Crohn's disease and/or ulcerative colitis), infectious colitis, ischemic colitis, and inflammatory colitis.
  • the subject is suffering from or at risk of developing an affliction characterized by intestinal atrophy. In some embodiments, the subject is suffering from or at risk of developing an inflammatory disease. In some embodiments, the subject is suffering from or at risk of developing an autoimmune disease. In some embodiments, the subject is suffering from or at risk of developing vascular disease. In some embodiments, the subject is suffering from or at risk of developing cancer. In some embodiments, the subject is suffering from or at risk of developing infection. In some embodiments, the subject is suffering from or at risk of developing short bowel syndrome. In some embodiments, the subject is suffering from or at risk of developing drug-induced or toxin-induced intestinal in jury.
  • the subject is suffering from or at risk of developing a disorder requiring total parenteral nutrition or lifelong parenteral nutrition intervention. In some embodiments, the subject is suffering from or at risk of exposure to ionizing radiation. In some embodiments, the subject is selected for treatment of an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
  • the subject is aged or has an advanced aged (e.g., mammalian subjects that are at least about 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old or older), rendering the subject at an increased risk of loss or decline in the production and/or functionality of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • an advanced aged e.g., mammalian subjects that are at least about 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old or older
  • the method further comprises determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
  • the subject is human.
  • the method further comprises determining that the subject is in need of enhanced intestinal function.
  • a subject may be in need of enhanced intestinal function, for example, if the subject exhibits intestinal atrophy, is suffering from or at risk of developing a gastrointestinal disorder or affliction characterized by intestinal atrophy described herein.
  • a subject may be in need of enhanced intestinal function, for example, if the subject exhibits decreased numbers of intestinal stem cells and/or non-stem intestinal progenitor cells relative to a control subject with normal numbers of intestinal stem cells and/or non-stem intestinal progenitor cells, or a reference normal level of intestinal stem cells and/or non stem intestinal progenitor cells.
  • a method described herein further comprises placing a subject on a high fat diet.
  • the high fat diet comprises consumption of a macronutritional composition comprising at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of total daily calories comprising fat.
  • the high fat diet comprises consumption of a macronutritional composition comprising at least 60% of total dai ly calories comprising fat.
  • the h igh fat diet comprises consumption of a macronutritional composition comprising at least 65%, at least 70%, at least 75%o, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of total daily calories comprising fat.
  • the high fat diet comprises consumption of a macronutritional composition comprising 100% of total daily calories comprising fat.
  • the high fat diet comprises a diet restricted in terms of total daily calories consumed. In some embodiments, the high fat diet comprises a diet restricted to 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, or 25% of the total daily calories recommended for a healthy subject of a particular age, gender, and body weight. In some embodiments, the high tat diet comprises a diet restricted to 2000, 1900, 1 800, 1 700, 1600, 1500, 1400, 1300, 1200, 1 100, 1000, 900, 800, 750, 700, 650, 600, 550, 500 or less total daily ca lories.
  • the high fat diet comprises a diet restricted to 2000, 1900, 1 800, 1700, 1600, 1 500, 1400, 1300, 1200, 1 100, 1000, 900, 800, 750, 700, 650, 600, 550, 500 or less total daily calories, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%o of which consist of fat.
  • stimulating the proliferation and/or renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells, and/or promoting regeneration of mammalian intestinal tissue in a subject can lead to treatment, prevention or amelioration of a number of gastrointestinal disorders and/or afflictions characterized by intestinal atrophy.
  • aspects of the disclosure relate to treating afflictions characterized by intestinal atrophy.
  • Treatment can include, but is not limited to, administering an agent or composition (e.g., a pharmaceutical composition) to a subject.
  • Treatment is typically undertaken in an effort to alter the course of a disease, disorder, or undesirable condition in a manner beneficial to the subject.
  • the effect of treatment can generally include reversing, alleviating, reducing severity of, delaying the onset of, curing, inhibiting the progression of, and/or reducing the likelihood of occurrence or reoccurrence of the disease, disorder, or condition to which such term applies, or one or more symptoms or manifestations of such disease, disorder or condition.
  • an agent or composition is administered to a subject who has developed a disease or condition or is at increased risk of doing so relative to a member of the general population.
  • an agent or composition is administered prophylactically, i.e., before development of any symptom or manifestation of a condition.
  • administering encompasses self-administration.
  • Preventing can refer to administering an agent or composition (e.g., a pharmaceutical composition) to a subject who has not developed a disease or condition, so as to reduce the likelihood that the disease or condition will occur or so as to reduce the severity of the disease or condition should it occur.
  • a subject may be identified as at risk of developing the disease or condition (e.g., at increased risk relative to many most other members of the population who may be matched with respect to various demographic factors such as age, sex, ethnicity, etc.) or as having one or more risk factors that increases likelihood of developing the disease or condition.
  • a subject at or approaching an advanced age may have or may be at an increased risk of developing compromised gut regeneration (e.g., loss of intestinal stem cells and/or non-stem intestinal progenitor cells), or may otherwise be at risk of developing a disease or condition.
  • compromised gut regeneration e.g., loss of intestinal stem cells and/or non-stem intestinal progenitor cells
  • secondary insults e.g., chemotherapy, infection, etc.
  • Such an aged subject may be identified based on their age (e.g., age greater than sixty years old) or, for example, on the basis of decreased frequency of organoid formation in aged crypts compared to a younger population of subjects, or by exhibiting a failure to thrive.
  • an aged subject at risk for developing a disease or condition e.g., compromised gut regeneration or loss of intestinal stem cells and/or non-stem intestinal progenitor cells
  • may be identified on the basis of their low PPAR-delta activity e.g., by assessing expression of PPAR-delta and/or one or more PPAR-delta target genes such as CPT1 A, HMGCS2, FABP 1 in a biological sample obtained from the subject.
  • aged subjects may present with, or may be suspected of having inflammatory or infectious colitis, further rendering such aged subjects at an increased risk for developing a disease or condition, and making such subjects candidates for receiving the compositions and agents described herein.
  • aged subjects undergoing chemotherapy, radiotherapy or proton therapy may be at an increased risk for developing a disease or condition, again making such subjects candidates for receiving the compositions and agents described herein.
  • the methods and uses disclosed herein further comprise a step of determining, for example, that a subject has or is at risk of developing compromised gut regeneration. Simi larly, in some embodiments, the methods and uses disclosed herein further comprise a step of determining that a subject (e.g., an aged or elderly subject) has or is at risk of developing loss of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • the methods and uses disclosed here further comprise a step of determining that the subject is in need of enhanced intestinal function.
  • a determination may be made, for example, by assessing expression of PPAR- ⁇ in one or more tissues or biological samples obtained from the subject.
  • a determ ination may be made, for example, by assessing expression of one or more of CPT 1 A, HMGCS2 and FABP 1 in one or more tissues or biological samples obtained from the subject.
  • treating an affliction characterized by intestinal atrophy can be achieved by stimulating the proliferation and/or self-renewal of intestinal stem cells in a subject and/or enhancing the number and/or function of non-stem intestinal progenitor cells in a subject and/or promoting intestinal regeneration.
  • stimulating the proliferation and/or self-renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cel ls and/or promoting intestinal regeneration in the subject can be achieved by administering to the subject an effective amount of a composition comprising a high fat diet mimetic.
  • stimulating the proliferation and/or self- renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells and/or promoting intestinal regeneration in the subject can be achieved by administering to the subject an effective amount of a composition comprising an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • a composition comprising an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • a high fat diet may be appropriate before administering a high fat diet mimetic or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein to the subject, and the number of intestinal stem cells and/or non-stem intestinal progenitor cells in the subject can be assayed for an increase in the number intestinal stem cells and/or non-stem intestinal progenitor cells.
  • results of the assay can thus be used as a quantitative measure of the success of the high fat diet alone, and to determine whether it may be advantageous to administer a high fat diet mimetic or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein. It may also be advantageous to place the patient on a high fat diet regiment if, for example, the subject is taking medication which is contraindicated for the high fat diet mimetic or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • stimulating the proliferation and/or self-renewal of intestinal stem cel ls and/or enhancing the number and/or function of non-stem intestinal progenitor cells may ameliorate intestinal atrophy by regenerating intestinal tissue as the intestinal stem cells in the intestine proliferate and self-renew.
  • a method of treating an affliction characterized by intestinal atrophy in a subject in need thereof comprises administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby treating the affliction characterized by intestinal atrophy.
  • the method further comprises placing the subject on a high fat diet.
  • the method further comprises administering a calorie restriction intervention to the subject.
  • the method further comprises administering to the subject an effective amount of a calorie restriction mimetic.
  • the method further comprises adm inistering to the subject an effective amount of an agent that inhibits the level and/or activity of mTORC l .
  • the method further comprises administering to the subject an effective amount of an agent that increases the level and/or activity of Bstl or a product of Bstl .
  • the composition comprises a high fat d iet mimetic. In some embodiments, the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (i ii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT 1 A agonist, (ii) a IIMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR- ⁇ agonist; (ii i) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABP l agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of niTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bst l ; and a pharmaceutically acceptable carrier, diluent, or excipient.
  • Non-limiting examples of afflictions that are characterized by intestinal atrophy and for which a high fat diet and/or high fat diet mimetic (e.g., a composition or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein) disclosed herein may provide a useful remedy include inflammatory diseases (e.g, inflammatory bowel disease, e.g., Crohn's disease, ulcerative colitis), autoimmune diseases, vascular disease, cancer, infection, drug-induced or toxin-induced intestinal inj ury (e.g., cancer chemotherapy induced GI damage), an affliction treatable by parenteral nutrition (PN) or life-long parenteral nutrition, and exposure to ionizing radiation.
  • inflammatory diseases e.g, inflammatory bowel disease, e.g., Crohn's disease, ulcerative colitis
  • autoimmune diseases e.g., vascular disease, cancer, infection, drug-induced or toxin-induced intestinal inj ury (e.
  • compositions which increase the level and/or activity of PPAR- ⁇ and/or PPAR- ⁇ target proteins can be administered over a limited duration of time in order to treat a gastrointestinal disorder and/or affliction characterized by intestinal atrophy described herein.
  • the composition can be adm inistered once or more daily (e.g., once, twice, thrice, etc.) over the limited duration of time, e.g., up to 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, etc. until regeneration of intestinal tissue has reached a satisfactory level.
  • the composition can be administered after an insult, such as an infection, exposure to a toxin, drug, or ionizing radiation, injury, and/or ischemic event until intestinal atrophy, damage, or injury resulting from that insult is restored to the condition it was in prior to that insult, or to a condition in which major symptoms or manifestations of such insult subside or reduce to manageable levels.
  • an insult such as an infection, exposure to a toxin, drug, or ionizing radiation, injury, and/or ischemic event until intestinal atrophy, damage, or injury resulting from that insult is restored to the condition it was in prior to that insult, or to a condition in which major symptoms or manifestations of such insult subside or reduce to manageable levels.
  • the compositions can be administered over one or more courses separated by time periods in which the compositions are not administered.
  • a high fat diet mimetic and/or a PPAR- ⁇ agonist may be administered for 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, or more, to promote intestinal regeneration in a subject suffering from an affliction characterized by intestinal atrophy, e.g., cancer wh ile the subject is undergoing chemotherapy, radiotherapy, proton therapy, and/or immunotherapy for treatment of the affliction, e.g., cancer, and then placed on a high fat, calorie restricted diet for a subsequent limited time interval, e.g., 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, or more while the subject continues to receive the chemotherapy, radiotherapy, proton therapy, and/or immunotherapy, and then chemotherapy, radiotherapy, proton therapy, and/or immunotherapy can be halted while the subject is administered the high fat diet mimetic and/or PPAR- ⁇ agonist, optionally while being placed on a high fat, calorie restricted diet, for a period of 1 week, 2 weeks
  • compositions, agents, and methods for treating colitis contemplates compositions, agents, and methods for treating colitis, and particularly contemplates any suitable therapy for treating any type of colitis manifesting throughout the entire gastrointestinal tract (including, for example, colon, small intestine, and large intestine).
  • Illustrative examples of the types of colitis that can be treated by the compositions, agents, and methods of the present disclosure include, but are not limited to infectious colitis, inflammatory colitis, vascular colitis (e.g., ischemic colitis), pseudomembranous colitis (e.g., caused by bacteria, such as Clostridium difficile, for example), microscopic col itis, drug-induced colitis, allergic colitis, colitis related to diverticular disease, and intestinal lesions (e.g., ulcers) resulting from any of foregoing, or gastrointestinal lesions resulting from any other cause whether causes by any other factors (e.g., genetics, physical injury, stress, to name only a few).
  • infectious colitis e.g., infectious colitis, vascular colitis (e.g., ischemic colitis), pseudomembranous colitis (e.g., caused by bacteria, such as Clostridium difficile, for example), microscopic col itis, drug-induced colitis, allergic colitis, colitis related to
  • a high fat diet and/or high fat diet mimetic, a composition comprising the high fat diet mimetic, and/or an agent or composition that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein can be used to treat pseudomembranous colitis (e.g., microorganism induced colitis, e.g., bacteria, e.g., C. difficile).
  • pseudomembranous colitis e.g., microorganism induced colitis, e.g., bacteria, e.g., C. difficile.
  • a method for treating colitis resulting at least in part from infection by a pathogen comprises: (a) administering an effective amount of an antibiotic to a patient, wherein the antibiotic rids or helps rid the patient of a pathogen; and (b) grafting gastrointestinal tissue generated ex vivo into the patient; and optionally (c) administering to the patient and effective amount of a high fat diet mimetic.
  • such method further comprises (d) placing the patient on a high fat diet.
  • the gastrointestinal tissue comprises crypts generated ex vivo.
  • the gastrointestinal tissue generated ex vivo replaces damaged intestinal lining. In some embodiments, the gastrointestinal tissue generated ex vivo replaces denuded intestinal lining. In some embodiments, the high fat diet mimetic is administered to the patient for a pre-determined period of time prior to administration of the antibiotic and/or grafting the gastrointestinal tissue generated ex vivo into the patient.
  • Administering the high fat diet mimetic to the patient prior to administration of the antibiotic and/or grafting the gastrointestinal tissue can advantageously serve as a way to prime the gastrointestinal cells of the patient (intestinal stem cells and/or non-stem intestinal progenitor cells) to minimize drug induced injury resulting from administration of the antibiotic, as well as, to prime the existing gastrointestinal tissue to facilitate the grafting of the gastrointestinal tissue generated ex vivo, for example, to aid the process of healing of the tissue as the existing tissue and the grafted tissue become whole.
  • the pre-determined period of time can range widely, for example, from up to one month prior to administration of the antibiotic agent and/or grafting of the ex vivo produced gastrointestinal tissue, until as little as a few hours prior thereto (e.g., 1 -4 hours). It should be appreciated that any antibiotic agent that is known to treat the bacterial infection can be used to rid the patient of pathogens, for example, C. difficile can be treated with the antibiotics metronidazole and vanocin.
  • a high fat diet mimetic can be employed in combination with parenteral nutrition (PN) treatment.
  • PN parenteral nutrition
  • a high fat diet mimetic can be used to treat short bowel syndrome (SBS).
  • SBS in infants and children include necrotizing enterocolitis, midgut volvulus, intestinal atresia, and gastroschisis.
  • SBS typically occurs as a postsurgical event post resection of substantial portions of the small intestine, such as, for example, surgery due to cancer, gastrointestinal bleeding (e.g., repeated or intractable, inflammatory bowel disease, trauma, etc.).
  • a method for treating SBS comprises administering to a patient in need thereof an effective amount of a high fat diet mimetic, and administering to the patient parenteral nutrition (PN).
  • PN patient parenteral nutrition
  • such method for treating SBS further comprises administering to the patient an effective amount of glucagon-like peptide-2 (GLP-2) or an analog of GLP-2, for example, teduglutide (Tee et al. Clin. Exper. Gastroenterology. 4: 189-196, 201 1 ).
  • GLP-2 glucagon-like peptide-2
  • teduglutide Tee et al. Clin. Exper. Gastroenterology. 4: 189-196, 201 1 .
  • a radioprotective composition for protecting cells against ionizing radiation and/or drug induced intestinal injury.
  • the radioprotective and/or chemoprotective compositions stimulate the proliferation and/or self-renewal of intestinal stem cells.
  • the radioprotective and/or chemoprotective compositions enhance the number and/or function of non-stem intestinal progenitor cells.
  • the radioprotective and/or chemoprotective compositions promote regeneration of intestinal tissue.
  • a radioprotective and/or chemoprotective composition disclosed herein may prevent or ameliorate the harmful effects of ionizing radiation on mammalian cells (e.g., damage to gastrointestinal cells).
  • a radioprotective composition comprises an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, and a pharmaceutically acceptable carrier, di luent, or excipient.
  • a chemoprotective composition comprises an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition further comprises a chemotherapeutic agent.
  • the composition further comprises a radiotherapeutic agent.
  • the composition further comprises an immunotherapeutic agent.
  • the composition further comprises a calorie restriction mimetic.
  • the composition further comprises an agent that inhibits the level and/or activity of mTORC l .
  • the composition further comprises an agent that increases the level and/or activity of Bstl or a product of Bstl .
  • the composition further comprises sirolimus or a derivative or analog thereof, such as temsirolimus, everolimus, and ridaforlimus.
  • the composition is formulated for administration as an enema. Ln some embodiments, the composition is formulated for oral administration.
  • an agent of the present invention is administered in combination with a cancer therapeutic agent. It should be appreciated that the combined administration of an agent of the present invention and a cancer therapeutic agent can be achieved by formulating the cancer therapeutic agent and agent in the same composition or by administering the cancer therapeutic agent and agent separately (e.g., before, after, or interspersed with doses or administration of the cancer therapeutic agent).
  • the an agent of the present invention e.g., a radioprotective agent
  • the cancer therapeutic agent is administered to a patient undergoing conventional chemotherapy and/or radiotherapy e.g., to prevent, minimize or ameliorate harmful effects to the patient as a result of drug induced GI toxicity or damage, and/or exposure to the cancer therapeutic agent or ionizing radiation of the radiotherapy.
  • the cancer therapeutic agent is a chemotherapeutic agent.
  • the cancer therapeutic agent is an immunotherapeutic agent.
  • the cancer therapeutic agent is a radiotherapeutic agent.
  • alkylating agents e.g. cisplatin, carboplatin, oxaloplatin,
  • topoisomerase inhibitors e.g. notecan, topotecan, amasacrine, etoposide phosphate
  • antitumor antibiotics include lactinomycin, doxorubicin, epirubicin, and bleomycin; ribonucleotides reductase inhibitors; antimicrotubule agents; and retinoids.
  • ribonucleotides reductase inhibitors include ribonucleotides reductase inhibitors; antimicrotubule agents; and retinoids.
  • Cancer Principles and Practice of Oncology (V.T. DeVita, et al ., eds., J.B. Lippincott Company, 9 th ed., 201 1 ;
  • immunotherapeutic agents include cytokines, such as, for example interleukin- 1 (IL-I), IL-2, IL-4, IL-5, lL- ⁇ , IL-7, IL-10, IL- 12, IL-I5, IL- 18, CSF-GM, CSF- G, IFN- ⁇ , IFN-a, TNF, TGF- ⁇ but not limited thereto.
  • cytokines such as, for example interleukin- 1 (IL-I), IL-2, IL-4, IL-5, lL- ⁇ , IL-7, IL-10, IL- 12, IL-I5, IL- 18, CSF-GM, CSF- G, IFN- ⁇ , IFN-a, TNF, TGF- ⁇ but not limited thereto.
  • an agent of the present invention can be linked or conjugated to a delivery vehicle, which may also contain cancer therapeutic.
  • Suitable delivery vehicles include liposomes (Hughes et al. Cancer Res 49(22):6214-20, 1989, which is hereby incorporated by reference in its entirety), nanoparticles (Farokhzad et al. Proc Nat'l Acad Sci USA 1 03( 16):63 1 5-20, 2006, wh ich is hereby incorporated by reference in its entirety), biodegradable microspheres, microparticles, and collagen minipellets.
  • the delivery vehicle can contain any of the radioprotective, chemotherapeutic, radiotherapeutic, or
  • an agent of the present invention can be conjugated to a liposome delivery vehicle (Sofou and Sgouros, Exp Opin Drug Deliv. 5(2): 189-204, 2008, which is hereby incorporated by reference in its entirety).
  • Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. Suitable liposomal delivery vehicles are apparent to those skilled in the art. Different types of liposomes can be prepared according to Bangham et al. J. Mol. Biol. 13 :238-52, 1965 ; U.S. Pat. No. 5,653,996 to Hsu; U. S. Pat. No.
  • liposomes can be produced such that they contain, in addition to the therapeutic agents of the present invention, other therapeutic agents, such as immunotherapeutic cytokines, which would then be released at the target site (e.g., Wolff et al., Biochim.
  • the present disclosure also contemplates a composition comprising an agent of the present invention (e.g., an agent that stimulates the proliferation and/or self-renewal of ISCs, enhances the number and/or function of non-stem intestinal progenitor cells, and/or promotes regeneration of intestinal tissue) and a pharmaceutically acceptable carrier, diluent, or excipient.
  • an agent of the present invention e.g., an agent that stimulates the proliferation and/or self-renewal of ISCs, enhances the number and/or function of non-stem intestinal progenitor cells, and/or promotes regeneration of intestinal tissue
  • a pharmaceutically acceptable carrier diluent, or excipient.
  • Therapeutic formulations of the agents of the present invention can be prepared having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (REMINGTON'S PHARMACEUTICAL SCIENCES (A. Osol ed.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as acetate, Tris-phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride;
  • hexamethonium chloride benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
  • polypeptides such as serum albumin, gelatin, or immunoglobulins
  • proteins such as serum albumin, gelatin, or immunoglobulins
  • hydrophilic polymers such as polyvinylpyrrolidone
  • amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine
  • monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins chelating agents such as EDTA; tonicifiers such as trehalose and sodium chloride
  • sugars such as sucrose, mannitol, trehalose or sorbitol
  • sugars such as sucrose, mannitol, trehalose or sorbitol
  • surfactant such as polysorbate; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN.RTM.,
  • PLURONICS.RTM or polyethylene glycol (PEG).
  • the active therapeutic ingredients of the pharmaceutical compositions can be entrapped in microcapsules prepared using coacervation techniques or by interfacial polymerization, e.g., hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (e.g., l iposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems e.g., l iposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • the radioprotective agents of the present invention can be conjugated to the microcapsule delivery vehicle to target the delivery of the therapeutic agent to the site of the cells exposed to toxic effects of ionizing radiation.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antibody or polypeptide, which matrices are in the form of shaped articles, e.g., films or microcapsules.
  • sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl- methacrylate), or poly(vinylalcohol)), polylactides, copolymers of L-glutamic acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid- glycolic acid copolymers such as the LUPRON DEPOT. RTM. (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3- hydroxybutyric acid.
  • polyesters for example, poly(2-hydroxyethyl- methacrylate), or poly(vinylalcohol)
  • polylactides copolymers of L-glutamic acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable
  • an agent of the present disclosure can be provided with an enteric coating or otherwise protected from hydrolysis or low stomach pH.
  • an agent of the present disclosure can be formulated for release in the small intestine, for example, lectins, can be used to target agents to the gastrointestinal tract, and particularly can recognize and bind to villus and crypt cells in the intestines (see, e.g., Handbook of plant lectins; properties and biomedical applications, Els J. M. Van Damme, et al., eds., John Wiley and Sons, 1998).
  • compositions containing the agents of the disclosure are administered to a subject, in accordance with known methods, such as intravenous administration, e.g., as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinai, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes.
  • a radioprotective agent comprises a radioprotective agent.
  • an agent or composition of the present invention is administered as an enema.
  • Administration of the agents and compositions as an enema may be advantageous, for example, administration as an enema facilitates local, rather than systemic, delivery to the targeted area (GI system) where the agent exerts its biological effects, as well as avoids factors which result in diminished or insufficient absorption of a drug and its ultimate transport to its biological target resulting from elimination and metabolism of drugs that are administered systemically (e.g., oral administration). Accordingly, administration of the agents and compositions of the present invention as an enema may result in an enhanced therapeutic effect while minimizing side effects.
  • GI system targeted area
  • administration of the agents and compositions of the present invention as an enema may result in an enhanced therapeutic effect while minimizing side effects.
  • a method of treating or preventing harm resulting from exposure to ionizing radiation comprises administering an effective amount of agent or composition of the present disclosure to a subject in need thereof, wherein the agent or composition is administered as an enema.
  • Other therapeutic regimens may be combined with the administration of the agents of the present invention.
  • the combined administration includes co-administration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents
  • composition of the present disclosure is administered in combination with a therapy selected from the group consisting of chemotherapy, radiotherapy, proton therapy, surgery, and combinations thereof.
  • the composition can include any number of additional active ingredients which can act in concert to provide a therapeutic effect, (e.g., a synergistic therapeutic effect), such as a chemotherapeutic agent, a radiotherapeutic agent, an immunotherapeutic agent, and combinations thereof.
  • a therapeutic effect e.g., a synergistic therapeutic effect
  • chemotherapeutic agent e.g., a chemotherapeutic agent, a radiotherapeutic agent, an immunotherapeutic agent, and combinations thereof.
  • aspects of the disclosure involve methods of minimizing the risk of exposure to an ionizing radiation source, treating individuals exposed to harmful levels of ionizing radiation, and/or increasing an individual's tolerance to ionizing radiation .
  • a method of minimizing the risk of exposure to an ionizing radiation source comprises administering to an individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby minimizing the risk of exposure to the ionizing radiation source.
  • a method of treating an individual exposed to ionizing radiation comprises administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby treating the individual exposed to harmful ionizing radiation.
  • the ionizing radiation comprise harmful ion izing radiation.
  • a method of increasing tolerance to ionizing radiation in an individual comprises administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, wherein the composition increases the threshold dose of lethal ionizing radiation to above 8 Gy.
  • the composition increases the threshold dose of lethal ionizing radiation to about 9 Gy, about 1 0 Gy, about 1 1 Gy, about 1 2 Gy, about 13 Gy, about 14 Gy, or about 1 5 Gy.
  • the high fat diet mimetic increases a threshold dose of lethal ionizing radiation in a human mammal.
  • the high fat diet mimetic increases a threshold dose of lethal ionizing radiation in a non-human mammal.
  • the composition comprises a high fat diet mimetic.
  • the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT 1A agonist, (ii) a HMGCS2 agonist, (i ii) a FABP l agonist, and (vv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT l A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR- ⁇ agonist; (iii) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABP l agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of mTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bstl ; and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the high fat diet mimetic and/or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein can be used to minimize the risk of exposure to any ionizing radiation source and/or treat exposure to harmful ionizing radiation from any ionizing radiation source, and/or increase an individual's tolerance to ionizing radiation from any source, including any source of accidental or incidental ionizing radiation, such as radioactive material, a nuclear power plant, a nuclear weapon, or cosmic radiation, to name but a few,
  • the ionizing radiation source is cosmic radiation in outer space.
  • the cosmic radiation is cosmic radiation that has not penetrated the Earth's atmosphere.
  • the cosmic radiation has penetrated at least a portion of the Earth's atmosphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the ionosphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the thermosphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the mesosphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the stratosphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the troposphere.
  • the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation at sea level .
  • the high fat diet mimetic and/or agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein can also be adm in istered to an individual that is being administered radiotherapy, or an individual that is about to be admin istered radiotherapy, to minimize the risk of exposure to the ionizing radiation administered during the radiotherapy.
  • a method of minimizing the risk of exposure to an ionizing radiation source comprises placing the individual on a high fat diet for a pre-determined period of time prior to exposure to the ionizing radiation source.
  • the pre-determined period of time for placing an individual on a high fat diet prior to exposure to an ionizing radiation source can range from hours to months (e.g., from about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about a week and half, about two weeks, about three weeks, about a month, two months, three months, four months, five months, six months, seven months, eight months, nine months, 10 months, 1 1 months, or 12 months, and any interval therebetween).
  • the method of minimizing the risk of exposure to an ionizing radiation source comprises placing the individual on a high fat diet prior to exposure to an ionizing radiation source, and
  • composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • the method further comprises placing the individual on a high fat diet. In some embodiments, the method further comprises placing the individual on a high fat, calorie restricted diet.
  • the disclosure contemplates treating individuals exposed to any amount of ionizing radiation from any source described herein.
  • an individual may have been exposed to at least 0. 1 Gy, 0.2 Gy, 0.3 Gy, 0.4 Gy, 0.5 Gy, 0.6 Gy, 0.7 Gy, 0.8 Gy, 0.9 Gy, 1 Gy, 1 ,5Gy, 2 Gy, 2.5 Gy, 3 Gy, 3.5 Gy, 4 Gy, 4.5 Gy, 5 Gy, 5.5 Gy, 6 Gy, 6.5 Gy, 6.6 Gy, 6.7 Gy, 6.8 Gy, 6.9 Gy, 7.0 Gy, 7.5 Gy, 8 Gy, 9 Gy, 10 Gy, 1 1 Gy, 12 Gy, 13 Gy, 14 Gy, or up to 15 Gy or more.
  • a method of treating cancer in a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein; and (b) administering an effective amount of ionizing radiation to the subject.
  • the composition : (i) increases the subject's tolerance for ionizing radiation; (ii) minimizes undesirable side-effects due to the ionizing radiation; (iii) protects against gastrointestinal drug toxicity.
  • a method of administering radiotherapy to a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, and (b) administering radiotherapy to the subject.
  • a method administering proton therapy to a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein; and (b) administering proton therapy to the subject.
  • a method of administering chemotherapy to a subject in need thereof comprises (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-5 and/or a PPAR- ⁇ target protein; and (b) administering chemotherapy to the subject.
  • the composition comprises a high fat diet mimetic. In some embodiments, the composition comprises a PPAR- ⁇ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a H GCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises (a) at least one PPAR- ⁇ agonist; (b) at least one PPAR- ⁇ target protein agonist selected from the group consisting of (i) a CPTl A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
  • the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR- ⁇ agonist; (iii) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABPl agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of mTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bstl ; and a pharmaceutically acceptable carrier, diluent, or excipient.
  • composition that increases the level and/or activity of PPAR- ⁇ and/or the PPAR- ⁇ target protein or high fat diet mimetic can be employed in the course of treating any cancer that involves radiotherapy.
  • the method of treatment can include placing the subject on a high fat diet prior to, or during the course of, administering the ionizing radiation.
  • the method of treatment can also include administering to the subject a chemotherapeutic agent, a radiotherapeutic agent, surgery, and combinations thereof.
  • the high fat diet mimetic can be administered prior, during, or after administering the ionizing radiation to the patient.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein to promote intestinal regeneration, protect against intestinal tissue damage, and/or stimulate the proliferation and/or self-renewal of one or more intestinal stem cells.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein to treat an affliction characterized by intestinal atrophy.
  • Exemplary afflictions include, without limitation, an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative col itis.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein to protect against, mitigate, or alleviate, the harmful effects of exposure to ionizing radiation.
  • Exposure to ionizing radiation can be from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, cosmic or space radiation.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with radiotherapy to protect against the harmful effects of ionizing radiation.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with chemotherapy to protect against gastrointestinal drug toxicity.
  • the disclosure relates to the use of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, in combination with total parenteral nutrition to protect against intestinal atrophy.
  • the present disclosure includes a method for expanding a population of intestinal stem cells and/or non-stem intestinal progenitor cells comprising contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein.
  • Paneth cells are not present in the population of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • the population of intestinal stem cells and/or non-stem intestinal progenitor cells comprises Paneth cells.
  • the method for expanding the ISCs is performed in vitro. In some embodiments, method for expanding the ISCs is performed ex vivo. It should be appreciated that the ex vivo methods and compositions of the present invention for generating ISCs and intestinal tissues, as well as grafting those generated cells and tissues, can be used for any condition that would benefit from restoration and/or augmentation of intestinal function.
  • the method for expanding ISCs can be used to maintain intestinal stem cells for a patient that may be preserved and eventually engrafted into an atrophic or damaged intestine or used ex vivo in the construction of an artificial organ which may subsequently be implanted into a subject, in some embodiments, the ex vivo methods of the present invention can be used to study intestinal transport, metabolism (of drugs, etc.) and drug design to enhance absorption and bioavailability.
  • compositions for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells are disclosed.
  • a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells comprises a population of intestinal stem cells and/or non-stem intestinal progenitor cells and a high fat diet mimetic.
  • a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes Paneth cells.
  • a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes Paneth-like cells.
  • intestinal stem cells and/or Paneth or Paneth-like cells for use in the ex vivo expansion compositions and methods of the present invention can be autologous or non-autologous.
  • Intestinal stem cells and/or non-stem intestinal progenitor cells, and/or Paneth cells are found within the crypts of the mucosa of the intestine, e.g., small intestines or colon.
  • Such cells can be isolated and/or extracted according to routine methods (e.g., non-limiting examples of obtaining intestinal stem cells and/or non-stem intestinal progenitor cells and/or Paneth cells include, surgery and biopsy, for example).
  • the cells thus obtained can be banked and maintained for subsequent use in the ex vivo expansion compositions and methods of the present invention.
  • the ISCs can be obtained from pluripotent stem cells (PSCs) or embryonic stem cells (ESCs) that have been induced or directed to differentiate into ISCs, for example, by a process to direct the differentiation of human PSCs into intestinal tissue in vitro using growth factors to simulate embryonic intestinal development (Wells et al. Nature. 470 (7332): 1 05- 109, 201 1 ).
  • This process of directed differentiation can be used to produce ISCs, for example, from fibroblasts obtained from a skin biopsy of the patient.
  • a method for expanding ISCs of a patient comprises: (a) obtaining a pluripotent stem cell non-invasively from a patient (e.g., skin biopsy of fibroblast cells); (b) directing differentiation of the pluripotent stem cells obtained non-invasively in step (a) by manipulating the pluripotent stem cells with one or more appropriate growth factors, wherein the pluripotent stem cells differentiate into intestinal tissue; and (c) contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells in the intestinal tissue generated in step (b) with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein, thereby activating and expanding the ISCs of the patient.
  • a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes a culture medium. Suitable culture mediums are apparent to those skilled in the art (see, for example, materials and methods below).
  • a pluripotent cell is an induced pluripotent stem (iPS) cell that has been derived in vitro from a non-pluripotent somatic cell such as a skin cell, fibroblast or myoblast (or is descended from a cell that has been so derived).
  • iPS induced pluripotent stem
  • An iPS cell can be derived using a variety of different protocols.
  • an iPS cell is derived by causing a somatic cell to express at least one, two, or three of the pluripotency factors Oct4, Nanog, and Sox2.
  • the cells are caused to overexpress c-Myc.
  • an iPS cell is derived by causing a somatic cell to express at least one, two, three, or four of the transcription factors Oct4, Nanog, Sox2, and Liii28.
  • viral transduction is used to cause a cell to express a reprogramming factor.
  • an iPS cell is generated without use of retroviruses or other integrating viruses and/or without inserting exogenous DNA into the genome of the cell.
  • RNA molecules e.g., encoding one or more pluripotency factor(s)
  • translatable RNA molecules e.g., encoding one or more pluripotency factor(s)
  • Lyssiotis CA., Proc Natl Acad Sci U S A. 2009 Jun 2; 106(22):8912-7. Epub 2009 May 15; Carey BW, Proc Natl Acad Sci U S A. 2009 Jan 6; 106(1 ): 157-62.
  • compositions and methods described in PCT/US2009/057692, "Compositions and Methods for Enhancing Cell Reprogramming", filed 21 Sept. 2009, is contemplated.
  • the disclosure provides a method of endowing at least one non-stem intestinal progenitor cell with at least one attribute of intestinal stem cells, the method comprising contacting a population of mammalian intestinal cells comprising at least one non-stem progenitor cell with an effective amount of an agent that increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein, thereby endowing at least one non-stem intestinal progenitor cell with the at least one attribute of intestinal stem cells.
  • the at least one attribute comprises the ability to form organoid mini-intestines in culture in the absence of the Paneth cell niche.
  • the intestinal stem cells comprise LGR5 + stem cells.
  • the non-stem intestinal progenitor cells comprise WDR43 ' non-stem cells. In some embodiments, the non-stem intestinal progenitor cells express diminished expression of LGR5, OLFM4, and ASCL2, and express WDR43. In some embodiments, the non-stem intestinal progenitor cells do not express LGR5, OLFM4, or ASCL2, and express WDR43.
  • the disclosure provides a method for obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with an enhanced ability to form organoid bodies in culture in the absence of the Paneth cells, the method comprising: (a) administering a high fat diet or a high fat diet mimetic to a mammal, wherein the high fat diet or high fat diet mimetic enhances the ability of intestinal stem cells and/or non-stem intestinal progenitor cel ls in the mammal to form organoid bodies in culture; and (b) isolating intestinal stem cells and/or non-stem intestinal progenitor cells from the mammal, thereby obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with the enhanced ability to form organoid bodies in culture.
  • the method includes assessing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells to form organoid bodies in culture in the absence of Paneth cells. In some embodiments, assessing is performed by comparing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells obtained from the mammal in step (b) to form organoid bodies in culture in the absence of Paneth cells to the ability of intestinal stem cells and/or non-stem intestinal progenitor cells obtained from control mammals which were not administered a high fat diet of high fat diet mimetic to form organoid bodies in culture in the absence of Paneth cells.
  • the method includes a step (c) forming organoid bodies in cu lture in the absence of Paneth cells.
  • the high fat diet or the high fat diet mimetic increases the level and/or activity of PPAR- ⁇ or a PPAR- ⁇ target protein in the mammal' s intestinal stem cel ls and/or non-stem intestinal progenitor cells.
  • aspects of the disclosure relate to the use of PPAR- ⁇ and/or a PPAR- ⁇ target gene as a prognostic biomarker to detect obese individuals at risk for colorectal cancer.
  • the d isclosure provides a method of identifying an obese individual at risk of developing colorectal carcinoma, the method comprising: (a) determining the level of expression of PPAR- ⁇ or a PPAR- ⁇ target gene in a biological sample obtained from an obese individual; and (b) identifying an obese individual as being at risk of developing colorectal carcinoma if the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene in the biological sample is elevated as compared to the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene in control individuals without colorectal carcinoma.
  • aspects of the disclosed methods include obtaining a biological sample from a subject comprising a cell or tissue of interest e.g., a cell or tissue that is affected by a disease, e.g., a gastrointestinal disorder described herein or an affliction characterized by intestinal atrophy described herein.
  • a biological sample used in the methods described herein will typically comprise or be derived from cells or tissues isolated from a subject.
  • the cells or tissues may comprise cells or tissues affected by a disease described herein.
  • the cells or tissues are isolated from a tumor cell or tissue described herein. .
  • Samples can be, e.g., surgical samples, tissue biopsy samples, fine needle aspiration biopsy samples, core needle samples.
  • the sample may be obtained using methods known in the art.
  • a sample can be subjected to one or more processing steps.
  • the sample is frozen and/or fixed.
  • the sample is sectioned and/or embedded, e.g., in paraffin.
  • tumor cells e.g., epithelial tumor cells
  • stromal tissue e.g., stromal cells and/or extracellular matrix. Cells or tissue of interest can be isolated using, e.g., tissue
  • microdissection e.g., laser capture microdissection. It should be appreciated that a sample can be a sample isolated from any of the subjects described herein.
  • cells of the sample are lysed. Nucleic acids or polypeptides may be isolated from the samples (e.g., cells or tissues of interest).
  • DNA optionally isolated from a sample, is amplified. A wide variety of methods are available for detection of DNA, e.g., DNA encoding PPAR- ⁇ or a PPAR- ⁇ target protein.
  • RNA optionally isolated from a sample, is reverse transcribed and/or amplified. A wide variety of solution phase or solid phase methods are available for detection of RNA, e.g., mRNA encoding PPAR- ⁇ or a PPAR-o target protein.
  • Suitable methods include e.g., hybridization-based approaches (e.g., nuclease protection assays, Northern blots, microarrays, in situ hybridization), amplification-based approaches (e.g., reverse transcription polymerase chain reaction (which can be a real-time PGR reaction), or sequencing (e.g., RNA-Seq, which uses high throughput sequencing techniques to quantify RNA transcripts (see, e.g., Wang, Z,, et al. Nature Reviews Genetics 10, 57-63, 2009)).
  • qPCR quantitative PCR
  • Other methods include electrochemical detection, bioluminescence-based methods, fluorescence-correlation spectroscopy, etc.
  • aspects of the methods described herein involve detecting the levels or presence of expression products, e.g., an expression product of PPAR- ⁇ or a PPAR- ⁇ target gene.
  • Levels of expression products may be assessed using any suitable method. Either mRNA or protein level may be measured. Exemplary methods for measuring mRNA include hybridization based assays, polymerase chain reaction assay, sequencing, in situ hybridization, etc. Exemplary methods for measuring protein levels include ELISA assays, Western blot, mass spectrometry, or immunohistochemistry. It will be understood that suitable controls and normalization procedures can be used to accurately quantify expression. Values can also be normalized to account for the fact that different samples may contain different proportions of a cell type of interest, e.g., tumor cells or tissues compared to corresponding non-tumor cells or tissues (e.g., health cells or tissues).
  • the biological sample comprises a colon biopsy specimen, in some embodiments, the biological sample comprises an epithelial cell. In some embodiments the biological sample comprises an intestinal stem cell. In some embodiments the biological sample comprises a non-stem intestinal progenitor cell. In some embodiments the biological sample comprises a Paneth cell. In some embodiments the biological sample comprises a goblet cell. In some embodiments, the biological sample is obtained by performing a colonoscopic biopsy. In some embodiments, (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene comprises determining the mRNA level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene.
  • determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene is accomplished by performing a hybridization-based assay, a polymerase chain reaction-based assay, or sequencing. In some embodiments, (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene comprises determining the protein level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene. In some embodiments, (a) determining the level of expression of PPAR- ⁇ or the PPAR- ⁇ target gene is accomplished by ELISA, Western blot, mass spectrometry, or
  • the present invention includes a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells and/or non-stem intestinal progenitor cells.
  • a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells comprises: (a) contacting a cell culture comprising small intestinal crypt cells with a candidate agent; and (b) assaying for (i) an increase in the amount of an intestinal stem cell marker in the cell culture, wherein an increase in the amount of the intestinal stem cell marker in the cell culture is indicative of the proliferation and/or self-renewal of ISCs in the cell culture, and indicates that the candidate agent is an agent that is capable of stimulating the proliferation of and/or self-renewal of ISCs or (ii) a decrease in the amount of or absence of an intestinal stem cell marker in the cell culture and/or an increase in the
  • an intestinal stem cell marker comprises 01mf4.
  • step (b) of the method comprises assaying for an increase in 01mf4 in the cell culture, wherein increase in the level of 01mf4 in the cell culture is indicative of the proliferation and self-renewal of ISCs in the cell culture.
  • an intestinal stem cell marker comprises LGR5.
  • step (b) of the method comprises assaying for an increase in LGR5 in the cell culture, wherein increase in the level of LGR5 in the cell culture is indicative of the proliferation and self- renewal of ISCs in the cell culture.
  • an intestinal stem cell marker comprises ASCL2.
  • step (b) of the method comprises assaying for an increase in ASCL2in the cell culture, wherein increase in the level of ASCL2 iin the cell culture is indicative of the proliferation and self-renewal of ISCs in the cell culture.
  • the non-stem intestinal progenitor cell marker comprises WDR43.
  • a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells comprises: (a) contacting a cell culture comprising intestinal crypts, e.g., small intestinal crypts with a candidate agent; and (b) assaying Lgr5 !' ISCs in the cell culture for an increase in the amount of organoid bodies formed, wherein an increase in the amount of organoid bodies formed by the Lgr5 + ISCs is ind icative of the proliferation of Paneth cells in the culture.
  • test agents can be used in the methods.
  • a test agent can be a small molecule, polypeptide, peptide, nucleic acid, oligonucleotide, lipid, carbohydrate, or hybrid molecule.
  • Compounds can be obtained from natural sources or produced synthetically. Compounds can be at least partially pure or may be present in extracts or other types of mixtures. Extracts or fractions thereof can be produced from, e.g., plants, animals, microorganisms, marine organisms, fermentation broths (e.g., soil, bacterial or fungal fermentation broths), etc.
  • a compound collection (“library") is tested.
  • the library may comprise, e.g., between 100 and 500,000 compounds, or more.
  • Compounds are often arrayed in multwell plates. They can be dissolved in a solvent (e.g., DMSO) or provided in dry form, e.g., as a powder or solid. Collections of synthetic, semisynthetic, and/or naturally occurring compounds can be tested. Compound libraries can comprise structurally related, structurally diverse, or structurally unrelated compounds.
  • a library comprises at least some compounds that have been identified as “hits” or “leads” in other drug discovery programs and/or derivatives thereof.
  • a compound library can comprise natural products and/or compounds generated using non-directed or directed synthetic organic chemistry. Often a compound library is a small molecule library.
  • Other libraries of interest include peptide or peptoid libraries, cDNA libraries, and oligonucleotide libraries.
  • a library can be focused (e.g., composed primarily of compounds having the same core structure, derived from the same precursor, or having at least one biochemical activity in common).
  • MLMR Molecular Libraries Small Molecule Repository
  • NCC NIH Clinical Collection
  • the NCC collection is arrayed in six 96-well plates. 50 ⁇ of each compound is supplied, as an approximately 10 mM solution in 100% DMSO.
  • a collection of compounds comprising "approved human drugs” is tested.
  • An "approved human drug” is a compound that has been approved for use in treating humans by a government regulatory agency such as the US Food and Drug Administration, European Medicines Evaluation Agency, or a similar agency responsible for evaluating at least the safety of therapeutic agents prior to allowing them to be marketed.
  • the test agent may be, e.g., an antineoplastic, antibacterial, antiviral, antifungal, antiprotozoal, antiparasitic, antidepressant, antipsychotic, anesthetic, antianginal, antihypertensive, antiarrhythmic, antiinflammatory, analgesic, antithrombotic, antiemetic, immunomodulator, antidiabetic, lipid- or cholesterol-lowering (e.g., statin), anticonvulsant, anticoagulant, antianxiety, hypnotic (sleep-inducing), hormonal, or anti-hormonal drug, etc.
  • an antineoplastic antibacterial, antiviral, antifungal, antiprotozoal, antiparasitic, antidepressant, antipsychotic, anesthetic, antianginal, antihypertensive, antiarrhythmic, antiinflammatory, analgesic, antithrombotic, antiemetic, immunomodulator, antidiabetic, lipid- or cholesterol-lowering (e.g
  • a compound is one that has undergone at least some preclinical or clinical development or has been determined or predicted to have "drug-like" properties.
  • the test agent may have completed a Phase I trial or at least a preclinical study in non-human animals and shown evidence of safety and tolerability.
  • a test agent is substantially non-toxic to cel ls of an organ ism to wh ich the compound may be administered or cells in which the compound may be tested, at the concentration to be used or, in some embodiments, at concentrations up to 1 0-fold, i 00-fold, or 1 , 000-fold higher than the concentration to be used.
  • there may be no statistically significant adverse effect on cell viability and/or proliferation or the reduction in viability or proliferation can be no more than 1 %, 5%, or 10% in various embodiments.
  • the screen may be performed using a single test agent or multiple test agents in a given reaction vessel.
  • the number of reaction vessels and/or test agents is at least 10; 100; 1000; 10,000; 100,000, or more.
  • a high throughput screen (HTS) is performed. High throughput screens often involve testing large numbers of test agents with high efficiency, e.g., in parallel. For example, tens or hundreds of thousands of agents may be routinely screened in short periods of time, e.g., hours to days.
  • Such screening is often performed in multiwell plates (sometimes referred to as microwell or microtiter plates or microplates) containing, e.g., 96, 384, 1536, 3456, or more wells or other vessels in which multiple physically separated depressions, wells, cavities, or areas (collectively "wells") are present in or on a substrate.
  • Different test agent(s) may be present in or added to the different wells. It will be understood that some wells may be empty, may comprise replicates, or may contain control agents or vehicle.
  • High throughput screens may involve use of automation, e.g., for liquid handling, imaging, and/or data acquisition or processing, etc.
  • an integrated robot system comprising one or more robots transports assay-microplates from station to station for, e.g., addition, mixing, and/or incubation of assay constituents (e.g., test agent, target, substrate) and, in some embodiments, readout or detection.
  • a HTS system may prepare, incubate, and analyze many plates simultaneously. Certain general principles and techniques that may be applied in embodiments of a HTS are described in Macarron R & Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565 : 1 -32, 2009 and/or An WF & Tolliday NJ., Introduction: cell-based assays for high- throughput screening. Methods Mol Biol.
  • Test agent(s) showing an activity of interest may be retested and/or, optionally (e.g., depending at least in part on results of retesting) selected for further testing, development, or use.
  • one or more structural analogs of a hit is synthesized.
  • Such analogs may, for example, comprise substitution of one or more functional groups or heteroatorns present in the hit by a different functional group or heteroatom or substituting a heteroatom or functional group present in place of a hydrogen in the hit, etc.
  • one or more such analog(s) are then tested for a property or activity of interest (e.g., ability to increase the level and/or activity of PPAR- ⁇ and/or a PPAR- ⁇ target protein or to mimic the physiological response to a high fat diet).
  • Positive and/or negative controls may be used in any of the screens.
  • An appropriate positive or negative control can be selected based at least in part on the assay.
  • a negative control may be to perform the assay in the absence of a test agent.
  • information derived from sequence analysis, mutational analysis, and/or structural analysis is used in the identification of a modulator.
  • a structure e.g., a two-dimensional or three-dimensional structure
  • a target e.g., a TF
  • a structure obtained with a ligand (e.g., an inhibitor) bound to the target may be used.
  • a computer-aided computational approach sometimes referred to as "virtual screening" is used in the identification of candidate modulators.
  • Structures of compounds, e.g., small molecules may be screened for ability to bind to a region (e.g., a "pocket") accessible to the compound.
  • the region may be any region accessible to the compound, e.g., a concave region on the surface or a cleft or a region involved in dimerization.
  • pharmacophore-based algorithms are known in the art, and computer programs implementing such algorithms are available. Commonly used programs include Gold, Dock, Glide, FlexX, Fred, and LigandFit (including the most recent releases thereof). See, e.g., Ghosh, S., et al., Current Opinion in Chemical Biology, 10(3): 194-2-2, 2006; Mclnnes C, Current Opinion in Chemical Biology; 1 1(5): 494-502, 2007, and references in either of the foregoing articles, which are incorporated herein by reference.
  • a virtual screening algorithm may involve two major phases: searching (also called "docking") and scoring.
  • the program automatically generates a set of candidate complexes of two molecules (test compound and target molecule) and determines the energy of interaction of the candidate complexes.
  • the scoring phase assigns scores to the candidate complexes and selects a structure that displays favorable interactions based at least in part on the energy. To perform virtual screening, this process may be repeated with a large number of test compounds to identify those that, for example, display the most favorable interactions with the target.
  • low-energy binding modes of a small molecule within an active site or possible active site or other target region are identified.
  • a compound capable of docking at a site where mutations are known to inhibit activity of the target is identified.
  • Variations may include the use of rigid or flexible docking algorithms and/or including the potential binding of water molecules.
  • the three- dimensional structure of an enzyme's active site may be used to identify potential inhibitors. Agent(s) that have the potential to bind in or near an active site may be identified. These predictions may then be tested using the actual compound. A new inhibitor thus identified may then be used to obtain a structure of the enzyme in an inhibitor/enzyme complex to show how the molecule is binding to the active site. Further changes may be made to the inhibitor, e.g., to try to improve binding. This cycle may be repeated until an inhibitor of sufficient predicted or actual potency (e.g., a desired potency for therapeutic purposes) is identified. Numerous small molecule structures are available and can be used for virtual screening. A collection of compound structures may sometimes referred to as a "virtual library". For example, ZINC is a publicly available database containing structures of mi llions of commercially avai lable compounds that can be used for virtual screening
  • Compounds identified in virtual screens can be tested in cell-free or cell-based assays or in animal models to confirm their ability to inhibit activity of a target molecule, their ability to activate a target molecule, and/or to assess their biological and/or pharmacological activity.
  • Computational approaches may be used to predict one or more physico-chemical, pharmacokinetic and/or pharmacodynamic properties of compounds identified in a physical or virtual screen. Such information may be used, e.g., to select one or more hits for, e.g., further testing, development, or use. For example, small molecules having characteristics typical of "drug-like" molecules may be selected and/or small molecules having one or more undesired characteristics may be avoided.
  • test agents are contacted with test cells (and optionally control cells) or used in cell-free assays at a predetermined concentration.
  • concentration is about up to 1 nM.
  • concentration is between about 1 nM and about 1 00 nM.
  • concentration is between about 100 nM and about 10 ⁇ .
  • concentration is at or above 10 ⁇ , e.g., between 10 ⁇ and 100 ⁇ .
  • the effect of compounds or composition on a paramter of interest in the test cells is determined by an appropriate method known to one of ordinary skill in the art, e.g., as described herein.
  • Cells can be contacted with compounds for various periods of time. In certain embodiments cells are contacted for between 12 hours and 20 days, e.g., for between 1 and 10 days, for between 2 and 5 days, or any interven ing range or particular value. Cells can be contacted transiently or continuously. If desired, the compound can be removed prior to assessing the effect on the cells.
  • composition of matter e.g., a nucleic acid, polypeptide, cell, or non-human transgenic animal
  • methods of making or using the composition of matter according to any of the methods disclosed herein, and methods of using the composition of matter for any of the purposes disclosed herein are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
  • claims or description relate to a method, e.g., it is to be understood that methods of making
  • compositions useful for performing the method, and products produced according to the method are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
  • the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. It should be assumed that both endpoints are included unless indicated otherwise. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
  • the invention includes embodiments that relate analogously to any intervening value or range defined by any two values in the series, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum.
  • Numerical values include values expressed as percentages. For any embodiment of the invention in which a numerical value is prefaced by "about” or “approximately”, the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by "about” or “approximately”, the invention includes an embodiment in which the value is prefaced by "about” or “approximately”.
  • Diet is a modifiable lifestyle factor that has a profound impact on mammalian physiology, health, and disease.
  • Long-lived mammalian tissue-specific stem cells play a key role in how tissues adapt to diverse diet-induced physiological states.
  • Such stem-cells dynamically remodel tissue composition in response to physiological cues by altering the balance between self-renewal and differentiation divisions. 1
  • the mechanisms through which diet perturbs tissue stem and progenitor cell biology and influences pathologies, such as cancer are poorly understood.
  • the mammalian intestine is known to respond to dietary cues. In low calories states the mammalian intestinal stem cell niche orchestrates tissue remodeling by sensing organismal physiology and pharmacologic targeting of the stem cell niche can promote tissue regeneration.
  • Lgr5 + cells at the base of intestinal crypts constitute a majority of the intestinal stem cells (ISCs) that drive the rapid renewal of the intestinal epithelium. 2 ' 3
  • ISCs intestinal stem cells
  • Paneth cells which are a central component of the ISC niche.
  • Paneth cells regulate ISC function in response to the physiologic state evoked by calorie restriction (CR, a reduction in calorie intake of 20-40%).
  • Paneth cells for example, the presence of Paneth cells in co-culture experiments enhance the potential of Lgr5 + ISCs to propagate organoid bodies or "mini-intestines", and Paneth cells derived from mice on a CR regimen further boost the organoid-forming potential of these ISCs. 4 ' 5 These findings raise the question of whether the Paneth cell niche invariably directs ISC function in response to all dietary cues or whether some diets, such as pro-obesity diets, can alter stem cel l function by acting directly on them.
  • pro-obesity diets While in diverse species CR diets promote lifespan, health, or both; generally enhance tissue progenitor function; and reduce cancer growth ' "5"8 , pro-obesity diets are associated with metabolic syndrome and linked to increases in many cancer types.' However, little is known about how stem and progenitor cell adaptation to a pro-obesity diet alters their potential to initiate tumors. 1 In the mouse intestine, Lgr5 + stem cells serve as the cell-of- origin for precancerous adenomatous lesions upon loss of the Ape tumor suppressor gene; yet, it is unclear whether this is the case in the context of obesity-linked intestinal
  • the present inventors interrogate how long-term high fat d iet (HFD)-induced obesity influences intestinal stem and progenitor cell function and the implications of this physiologic state on the cellular origins of intestinal dysplasia.
  • HFD high fat d iet
  • the present inventors conducted studies to identify methods and processes that augment the function of endogenous stem cells in order to enhance tissue regeneration.
  • the inventors demonstrated that high fat diet-induced obesity by activating a PPAR-delta transcriptional program boosts the function of not only intestinal stem cells (ISCs) but also that of their immediate differentiated progeny (non-stem cell progenitor cells).
  • the PPARs, including PPAR-delta are a subgroup of nuclear hormone receptors that transcriptionally regulate nutrient and metabolic pathways, including the sensing of fatty acids.
  • mice placed mice on a 60% high fat diet for greater than 8 months and found that this increased the number and function of ISCs (FIG. 1A) and moreover, that a high fat diet increases the incidence of spontaneous intestinal carcinoma.
  • a functional 3- dimenisional organoid assay high fat diet-derived ISCs where able to form mini-intestines (organoid bodies) in culture without their endogenous Paneth cells niche, which are required in order for ISCs from regular chow fed mice to form organoid bodies (FIG. IB).
  • Example 2 To assess the effects of obesity on intestinal homeostasis, the present inventors maintained mice on a long-term HFD for 9- 14 months, which is sufficient time to observe many of the metabolic phenotypes associated with obesity. H ' 12 Consistent with previous reports, HFD-fed mice gained considerably more mass (36.18 ⁇ 4.78 versus 53.3 ⁇ 15.8g) than their regular chow fed counterparts (FIG. 8A). While the small intestines from HFD-fed mice were shorter in length (39.7 ⁇ 2.3 versus 34.7 ⁇ 2,8cm; FIG. 8C) and weighed less ( 1 .46 ⁇ 0.19 versus 1.20 ⁇ 0.20; FIG.
  • FIG. 8B there was no change in the density of crypt-villous units (FIG. 8D) or in the number of apoptotic cells (FIG. 8K). Morphologically, HFD led to a mild reduction in villi length (480 ⁇ 8 versus 448 ⁇ 18 urn; FIG. 8G), an associated decrease in villous enterocyte numbers ( 1 55 ⁇ 5 versus 135 ⁇ 10; FIG. 8F), and an increase in crypt depth (FIG. 8E). HFD did not change the numbers of chromogranin A+ enteroendocrine cells or alcian blue+ goblet cells per crypt-villous unit of the small intestine (FIGS. 9A and 9B).
  • the HFD also augmented mitochondria numbers in progenitors relative to control, and a HFD also increased mitochondrial numbers in stem cells relative to control as measured by relative mitochondrial DNA quality per cell.
  • olfactomedin 4 01fm4
  • stem cells also termed crypt base columnar cells or CBCs
  • HFD had the opposite effect on cryptidin 4+ Paneth cell numbers, leading to a 23% reduction in these niche cells (FIG. 3B).
  • progenitors differentiated progeny
  • transit-amplifying cells differentiated progeny
  • the inventors assessed incorporation of 5-bromodeoxyuridine (BrdU) into ISCs and TA-cells. After a 4-h pulse of BrdU, crypts of HFD mice had nearly two-fold more BrdU+ ISCs compared to crypts from controls ( 1 .2 ⁇ 0.3 versus 2.1 ⁇ 0.7; FIG. 3C and FIG. 8H). Furthermore, HFD augmented the number of BrdU+ cells in the larger pool of progenitors (1 1 .6 ⁇ 2.0 versus J 4.7 ⁇ 2.04), indicating that output and migration from this compartment into the villi may also increase.
  • PrdU 5-bromodeoxyuridine
  • HFD mice 24-h after a single dose of BrdU had more absolute numbers of BrdU-labelled cells in the villi (14.0 ⁇ 2.6 versus 19. 1 ⁇ 1 .7; FIG. 81) and a greater percentage of villus enterocytes that were BrdU+ (8.0 ⁇ 1 .4 versus 12.0 ⁇ 2.3%; FIG. 81).
  • HFD-derived crypts were almost twofold more likely to initiate these mini-intestines in culture than those derived from controls (0.29 ⁇ 0.05 versus 0.58 ⁇ 0.09; FIG. 3D).
  • these organoids were more cystic (i.e. less differentiated 15 ) in structure and contained fewer crypt domains (8.3 ⁇ 2.4 versus 3.4 ⁇ 2.2; FIG. 3E), and when sub-cloned the HFD-derived primary organoids generated more secondary organoids (3.4 ⁇ 0.8 versus 6.9 ⁇ 2.8; FIG. 3F).
  • HFD crypts and primary organoids derived from them possess more stem-cell activity.
  • HFD-fed mice manifested increased numbers of surviving and regenerating crypts (FIG. 3G).
  • the foregoing data therefore support the notion that HFD- treatment boosts the numbers and regenerative capacity of ISCs in vitro and in vivo.
  • Lgr5-EGFP-IRES-CreERT2 knock-in mice which allow for the quantification and isolation of Lgr5-GFP hl stem-cells and Lgr5-GFP lo progenitors.
  • mice on a HFD had a nearly a 2-fold increase in the frequency of Lgr5- GFP hi ISCs (4.4 ⁇ 1 .8% versus 7.7 ⁇ 2.2%; FIG. 3H ), which corroborates that observed in 01fni4 + ISCs (FIG. 3A).
  • the opposing effects of HFD on ISC and Paneth cell numbers led the present inventors to ask whether HFD altered ISC function and their niche dependence. We assayed the clonogenic potential of ISCs from control and HFD-fed mice either alone or in combination with the niche Paneth cells.
  • the present inventors expanded control diet-derived organoids in crypt media supplemented with palmitic acid (PA), which is an abundant fatty acid constituent of the HFD regimen. 17 Low doses of PA did not change the clonogenic potential of control crypts in primary culture (FIG. 4A); however, just as observed with organoids from HFD mice, the PA-treated organoids had fewer crypt domains per organoid (4.2 ⁇ 0.6 versus 2.8 ⁇ 0.7; FIG. 4B).
  • PA palmitic acid
  • HFD-derived organoids maintain increased self-renewal capacity in culture conditions that are not supplemented with fatty acids (FIG. 3F); and second, HFD-derived ISCs are poised for niche-independent growth in the organoid assay, indicating that these ISCs have autonomously activated a program that compensates for reduced Paneth cell interactions.
  • the present inventors performed mRNA-sequencing on flow sorted LgrS-GFP' 11 ISCs and Lgr5-GFP ,0W progenitor cells from control and HFD-fed mice, respectively (pooling 2 mice from each treatment group; FIG. 5A).
  • GSEA pathway and transcription factor binding motif analysis revealed enrichment for transcriptional targets and binding motifs of the nuclear receptor PPAR (peroxisome proliferator-activated receptor) family and PPAR heterodimeric binding partners liver/retinoid X receptor (LXR/RXR; FIGS. 5A, 3B and IOC).
  • the PPAR family is comprised of three members (alpha, beta/delta, and gamma); amongst these PPAR-delta (PPAR- ⁇ ) is the dominant member expressed in intestinal stem and progenitor cells at the mRNA level in control and HFD mice (greater than 6 to 26-fold overexpressed compared to PPAR-alpha and PPAR-gamma, respectively; FIGS. 10A and 10B). Therefore, we focused our attention on PPAR- ⁇ and its potential role in coupling HFD to ISC function.
  • PPAR- ⁇ expression itself does not substantially change (FIG. 10B)
  • a HFD robustly increased the expression of many of its target genes at the mRNA and protein level in ISCs and progenitors (FIGS. 5C and 5D).
  • the present inventors administered the PPAR- ⁇ agonist GW501 516 for 4 weeks to Lgr5-EGFP-IRES-CreERT2 mice. 20,21 This led to the strong induction of PPAR- ⁇ target proteins in ISCs and progenitors (FIG. 5E).
  • agonist- activated PPAR- ⁇ signaling augmented the in vivo frequencies of 01fm4 + and Lgr5 + ISCs (FIGS. 5F and 5.1 ) and proliferation of stem and TA-cells (FIG. 5H) but had no impact on Paneth cell numbers (FIG. 5G).
  • crypts from agonist-treated mice gave rise to more organoids than those from vehicle-treated mice (FIG. 51), and isolated ISCs were much more effective at Paneth cell-independent organoid-initiation than their control counterparts (0.025 ⁇ 0.009 versus 0.15 ⁇ 0.04; FIG. 5K).
  • HFD activates PPAR- ⁇ signaling, which in turn can mediate many of the effects of the HFD on ISC function.
  • HFD did not alter expression of stem cell signature genes ( ⁇ -catenin target genes that differ between stem and progenitor cells, FIGS. 12B and 12D) 24 , it significantly evoked expression of several other ⁇ -catenin target genes, including Bmp4, Jagl, Jag2 and
  • HFD signature HFD signature
  • FIG. 12C HFD-induced ⁇ -catenin signature genes
  • ABCB 1 F CAGCAGTCAGTGTGCTTACAA ABCB 1 R ATGGCTCTTTTATCGGCCTCA
  • BCL2L 1 F GACAAGGAGATGCAGGTATTGG BCL2L1 R TCCCGTAGAGATCCACAAAAGT BIRC5F GAGGCTGGCTTCATCCACTG BIRC5R , CTTTTTGCTTGTTGTTGGTCTCC
  • CD44F CACCATTGCCTCAACTGTGC CD44R TTGTGGGCTCCTGAGTCTGA
  • CDKN2AF CGCAGGTTCTTGGTCACTGT CDKN2AR TGTTCACGAAAGCCAGAGCG
  • CDX1F GGACGCCCTACGAATGGATG CDX1R GTACCGGCTGTAGTGAAACTC
  • EDN1F GCACCGGAGCTGAGAATGG EDNIR GTGGCAGAAGTAGACACACTC
  • EPHB2F GCGGCTACGACGAGAACAT EPHB2R GGCTAAGTCAAAATCAGCCTCA
  • FGF18F CCTGCACTTGCCTGTGTTTAC FGF18R TGCTTCCGACTCACATCATCT
  • FGFBP1F CTAAATCTCTGACGCATGGCA FGFBP1R AACTCCTGATCGGCTTGTGTGTGTGTGTG
  • FGFBP3F GGTCGCTTCGTGAGTCCAG FGFBP3R AGCAGCCGTCTCCAGTAGT
  • NEDD9F ATGTGGGCGAGGAATCTTATGG NEDD9R TTCCCTGGGACAATGCCTTG
  • HES1F CCAGCCAGTGTCAACACGA HES1R AATGCCGGGAGCTATCTTTCT
  • TCF4F CGAAAAGTTCCTCCGGGTTTG TCF4R CGTAGCCGGGCTGATTCAT
  • L1CAMF AAAGGTGCAAGGGTGACATTC L1CAMR TCCCCACGTTCCTGTAGGT
  • LAMC2F CAGACACGGGAGATTGCTACT LAMC2R CCACGTTCCCCAAAGGGAT
  • PLAURF CAGAGCTTTCCACCGAATGG PLAURR GTCCCCGGCAGTTGATGAG
  • TCF1F AGGAGTGTAATAGGGCGGAGT TCF1R GAGGTCCGTTATAGGTGTCCA
  • T1AM 1 F GAAGCACACTTCACGCTCC TTAM1R CTCCAGGCCATTTTCAGCCA
  • FZD 1 F CAGCAGTACAACGGCGAAC FZD1 R GTCCTCCTGATTCGTGTGGC
  • FZ7F GCCACACGAACCAAGAGGAC FZ7R CGGGTGCGTACATAGAGCATAA
  • LRP5F AAGGGTGCTGTGTACTGGAC LRP5R AGAAGAGAACCTTACGGGACG
  • OLF 4F CAGCCACTTTCCAATTTCACTG OLFM4R GCTGGACATACTCCTTCACCTTA
  • TCF7F AGCTTTCTCCACTCTACGAACA TCF7R AATCCAGAGAGATCGGGGGTC
  • JAG2F CAATGACACCACTCCAGATGAG JAG2R GGCCAAAGAAGTCGTTGCG
  • NcadherinF ATGTGCCGGATAGCGGGAGC NcadherinR TACACCGTGCCGTCCTCGTC
  • somatic stem cells often accumulate the initial mutations that lead to oncogenic transformation.
  • HFD-induced PPAR- ⁇ activates a ⁇ -catenin signature in progenitor cells
  • the present inventors hypothesized that in diet-induced obesity non-stem cell populations can acquire stem-cell features and potentially serve as an additional cells-of-origin for tumor initiation. 1 ' 25
  • the present inventors sought to determine whether HFD and agonist-activated PPAR- ⁇ influenced the organoid-initiating capacity of progenitors (non-ISCs).
  • Lgr5-GFP low progenitors from HFD and PPAR- ⁇ agonist treated mice were capable of forming organoids, as illustrated in FIG.
  • the present inventors generated Apc loxp loxp ; Lgr5-EGFP-IRES- CreERT2 mice to assess whether pharmacological PPAR- ⁇ activation modifies the tumorigenic capacity of the Lgr5-GFP' 0W progenitors. Injection with tamoxifen leads to Ape- loss in the Lgr5-GFP hl ISCs, which in turn generate Ape-null Lgr5-GFP' 0W progenitors.
  • the PPAR- ⁇ agonist had no additive effect on the ability of Ape-null stem- cells to form intestinal adenomas (0.67 ⁇ 0.13 versus 0.61 ⁇ 0.19; FIGS. 5E and 5F) compared to the vehicle controls.
  • enforced PPAR- ⁇ signaling permitted Ape-null progenitors, but not their veh icle-treated counterparts, to robustly initiate adenomas upon transplantation into recipient colons (0 ⁇ 0 versus 0.58 ⁇ 0. 16; FIG. 7F and FIG. 13).
  • PPAR- ⁇ signaling in a subset of progenitors augments this responsiveness— thus enabling them to initiate tumors upon Ape-loss.
  • HFD uncouples stem and Paneth cell numbers and, functionally, these stem-cells have less dependence on Paneth cells in functional assays.
  • the Paneth cell niche tightly controls ISC growth and function 4 ; however, decreased contact between stem-cells and their niche in PIFD (i.e. more stem-cells than Paneth cells) may result in uncoordinated stem-cel l proliferation and render them more susceptible to accjuiring mutations.
  • lateral Notch inhibition between proximate stem-cells or progenitor cells may serve as a surrogate source of Notch ligands for Lgr5 + stem-cel ls that are not in direct contact with Paneth cells, allowing them to persist in vivo and in the organoid assay.
  • mice were housed in the Unit for Laboratory Animal Medicine at the Whitehead Institute for Biomedical Research and Koch Institute for Integrative Cancer Research.
  • Lgr5- EGFP-IRES- CreER T2 mice (strain name: B6.129P2-Lgr5 Unl(cre ERT2)Cle /J, stock number 008875), and Rosa26-lacZ mice (strain name: B6.129S4-Gt(ROSA)26Sor tm lSo 7J, stock number 003474) were obtained from the Jackson Laboratory. Apc loxp exon l 4 has been previously described.
  • mice Long-term high fat diet was achieved by feeding mice a dietary chow consisting of 60 kcal% fat (Research Diets D 12492) beginning at the age of 8- 12 weeks and extending for 9 to 14 months. Control mice were age-matched and fed normal chow ad libitum.
  • GW501516 (Enzo) was reconstituted in DMSO at 4.5 mg ml "1 and diluted 1 : 10 in a solution of 5% PEG400 (Hampton Research), 5% Tween80 (Sigma), 90% H 2 0 for a daily intraperitoneal injection of 4mg/kg.
  • Ape exon 14 was excised by tamoxifen suspended in sunflower seed oil (Spectrum S 1929) at a concentration of 10 mg ml " ', and 250 ⁇ per 25g of body weight was administered by intraperitoneal injection to mice twice over 4 days before harvesting tissue.
  • BrdU was prepared at 10 mg ml "1 in PBS, passed through 0.22 ⁇ filter and injected at l OOmg kg "1 .
  • the Vectastain Elite ABC immunoperoxidase detection kit (Vector Labs PK-6101 ) followed by Dako Liquid DAB+ Substrate (Dako) was used for visualization.
  • Alexa Fluor 568 secondary antibody (Invitrogen) was used with Prolong Gold (Life Technologies) mounting media. All antibody incubations were performed with Common Antibody Diluent (Biogenex).
  • the in situ hybridization probes used in this study correspond to expressed sequence tags or fully sequenced cDNAs obtained from Open Biosystems.
  • accession numbers IMAGE mouse cDNA clone in parenthesis
  • mice were exposed to 15 Gy of ionizing irradiation from a 137-cesium source (GammaCell) and killed after 72 hours. The number of surviving crypts per length of the intestine was enumerated from haematoxyiin and eosiii stained sections. 16 Immunoblotting
  • Antibodies rabbit polyclonal anti-PPAR- ⁇ ( 1 : 100, Thermo PA 1 -823A), rabbit polyclonal anti-Cpt l a ( 1 :250, ProteinTech 15 1 84- 1 -AP), rabbit polyclonal anti-HMGCS2 ( 1 : 500, Sigma AV41 562), rabbit monoclonal anti-FABP l ( 1 : 1 000, Abeam ab l 29203), rabbit polyclonal anti-y-tubulin ( 1 : 1 000, Sigma T51 92). Lgr5-GFP hl ISCs or GFP ,0W progenitors were sorted directly into sample buffer and boiled for five minutes.
  • Fabp1_F GGGAAGAAAATCAAACTCACCATC Fabp1_ R AGTTGTCACCATTTTATTGTCACC
  • Hmgcs2_F ATACCACCAACGCCTGTTATGG Hmgcs2_R CAATGTCACCACAGACCACCAG
  • small intestines were removed, washed with cold PBS-/-, opened laterally and cut into 3-5mm fragments. Pieces were washed multiple times with cold PBS-/- until clean, washed 2-3 with PBS-/-/EDTA ( l OmM), and incubated on ice for 90- 1 20 minutes while m ixing at 30-minute intervals. Crypts were then mechanically separated from the connective tissue by shaking, and filtered tiirough a 70- ⁇ mesh into a 50-ml conical tube to remove villous material and tissue fragments. At this point the suspension was mainly composed of crypts.
  • Crypts were removed from this step for crypt culture experiments and embedded in MatrigelTM with crypt culture media.
  • the crypt suspensions were dissociated to individual cells with TrypLE Express (Invitrogen).
  • Cell labeling consisted of an antibody cocktail comprising CD45-PE
  • ISCs were isolated as Lgr5-
  • EGFP h Epcam + CD24 low/ " CD3 LTerl 19 ⁇ CD45 ⁇ 7-AAD ⁇ EGFP low progenitors were isolated as EGFP ,ow Epcam + CD24 low " CD31 Terl 19 ⁇ CD45 ⁇ 7-AAD ⁇ and Paneth cells were isolated as CD24 hi Sidescatter hi Lgr5-EGFP " Epcam + CD3 TTerl 19 ⁇ CD45 ⁇ 7-AAD ⁇ with a BD FACS Aria II SORP cell sorter into supplemented crypt culture medium for culture. Dead cells were excluded from the analysis with the viability dye 7-AAD (Life Technologies).
  • populations were cytospun (Thermo Cytospin 4) at 800 r.p.m. for 2 minutes, or allowed to settle at 37°C in fully humidified chambers containing 5% C0 2 onto poly-L-lysine- coated slides (Polysciences). The cells were subsequently fixed in 4% paraformaldehyde (pH 7.4, Electron Microscopy Sciences) before staining.
  • Isolated crypts were counted and embedded in MatrigelTM (Coming 356231 growth factor reduced) at 5-10 crypts per ⁇ and cultured in a modified form of medium as described previously. 14 Briefly, Advanced DMEM (Gibco) was supplemented by EGF
  • Clonogenicity was calculated by plating 50-300 crypts and assessing organoid formation 3-7 days or as specified after initiation of cultures.
  • Isolated ISCs or progenitor cells were centrifuged for 5 minutes at 250g, re-suspended in the appropriate volume of crypt culture medium (500-1 ,000 cells ⁇ 1 ), then seeded onto 25-30 ⁇ MatrigelTM (Corning 35623 1 growth factor reduced) containing 1 ⁇ jagged (Ana- Spec) in a flat bottom 48-well plate (Corning 3548).
  • ISCs and Paneth cells were mixed after sorting in a 1 : 1 ratio, centrifuged, and then seeded onto MatrigelTM.
  • the MatrigelTM and cells were allowed to solidify before adding 300 ⁇ of crypt culture medium.
  • the crypt media was changed every second or third day.
  • Organoid bodies were quantified on days 3, 7 and 10 of culture, unless otherwise specified. With respect to the study results presented in FIGS. 14-16, organoid bodies were quantified on day 3-4. In secondary experiments, individual primary organoids were mechanically dissociated and re-plated, or organoids were dissociated for 10 minutes in TrypLE Express at 32°C, re-suspended with SMEM (Life Technologies), centrifuged and re-suspended in cold SMEM with viability dye 7-AAD. Live cells were sorted and seeded onto Matrigel 1 M as previously described.
  • RNA Isolation For RNA-seq, total RNA was extracted from 200 sorted Lgr5-GFP hl ISCs or Lgr5-GFP low progenitors by pooling two to five 71 -week old male mice per HFD and HFD-control using Tri Reagent (Life Technologies) according to the manufacturer's instructions, except for a overnight isopropanol precipitation at -20°C, From the total RNA, poly(A) + RNA was selected using 01igo(dT) 2 5-Dynabeads (Life technologies) according to the manufacturer's protocol.
  • RNA-Seq Library Preparation Strand-specific RNA-seq libraries were prepared using the dUTP-based, Illumina-compatible NEXTflex Directional RNA-Seq Kit (Bioo Scientific) according to the manufacturer's directions. All libraries were sequenced with an Illumina HiSeq 2000 sequencing machine.
  • RNA-seq Processing of RNA-seq reads and measuring expression level.
  • raw stranded reads 40 nt were trimmed to remove adapter and bases with quality scores below 20, and reads shorter than 35 nt were excluded.
  • High-quality reads were mapped to the mouse genome (mm 10) with Top Hat version 1 .4.1 45 , using known splice junctions from Ensembl Release 70 and allowing at most 2 mismatches.
  • Genes were quantified with htseq- count (with the "intersect strict" mode) using Ensembl Release 70 gene models. Gene counts were normalized across all samples using estimateSizeFactors() from the DESeq
  • Sequence specific pre-amplification PCR protocol was as following: 1 ) 60 minutes at 50°C for cell lyses and sequence specific reverse transcription, 2) 3 'minutes at 95°C for reverse transcriptase inactivation and Taq polymerase activation. Then, cDNA was amplified by 20 cycles of 15 seconds at 95°C for initial denaturation, 15 minutes at 60°C for annealing and elongation. After pre-amplification, samples were diluted 1 :5 prior to high throughput m icrofluidic real time PCR analysis using Fluidgm platform.
  • Amplified single cell cDNA samples were assayed for gene expression using individual qPCR primers and 96.96 dynamic arrays on a BioMark System by following manufacturers protocol (Fluidgm).
  • Fluidgm For confirming PPAR- ⁇ mediated induction of the most upregulated genes, regular single cell qRT-PCR was performed using preamplified cDNA with corresponding primers. Threshold crossing (Ct) values were calculated using the BioMark Real-Time PCR Analysis software (Fluidgm). Gene expression levels were estimated by subtracting the Ct values from the background level of 32, which approximately represent the log 2 gene expression levels.
  • the t-SNE analysis 47 was performed using the MATLAB toolbox for dimensionality reduction.
  • Apc loxp/i " xp ; Lgr5-EGFP-IRES-CreERT2 mice were treated with vehicle or GW5015 16 for one month, and then injected with two doses of tamoxifen I. P.
  • Ape-null Lgr5-GFP hl ISCs and Lgr5-GFP Unv progenitors were sorted by flow cytometry, as described above. For primary cell transplantations, 1 0,000 Ape-null Lgr5-GFP hl ISCs and Lgr5-GFP low progenitors were resuspended into 90% crypt culture media (as described) and 10%
  • MatrigelTM then transplanted into the colonic lamina intestinal of C57BL/6 recipient mice by optical colonoscopy using an injection needle (Hamilton Inc., part number 7750-21, 30 gauge, Kel-F Hub NDL, 14 inches length, 45 degree bevel) and specialized syringe (Hamilton Inc, part number 81242, 500 ⁇ , Model 1750 LT Threaded Plunger).
  • Optical colonoscopy was performed using a Karl Storz Image 1 HD Camera System, Image 1 HUB CCU, 175 Watt Xenon Light Source, and Richard Wolf 1 .9mm/9.5 Fr Integrated Telescope (part number 8626.43 1 ). Four injections were performed per mouse. Mice then underwent colonoscopy four weeks later to assess tumor formation.
  • Colonoscopy videos and images were saved for offline analysis. Following sacrifice, the distal colons were excised and fixed in 10% formalin, then examined by hematoxylin and eosin section to identify adenomas. All histology images were reviewed by a gastrointestinal pathologist who was blinded to treatment groups (S.S. and V.D.).
  • Lgr5-EGFP-IRES-CreER T2 mice (strain name: B6. 129P2-Lgr5 tuU(cre/ERT2)C1 7J, stock number 008875), and Rosa26-lacZ mice (strain name: B6.129S4-Gt(ROSA)26Sor tm l So 7J, stock number 003474) were obtained from the Jackson Laboratory.
  • GW501 516 (Enzo) was reconstituted in DMSO at 4.5 mg mf 1 and diluted 1 : 10 in a solution of 5% PEG400
  • mice were injected with vehicle.
  • mice were 2-4 months old. Old mice range from 18-25 months of age. The mice were on a standard chow diet. Mice received a single daily injection with the indicated amount of GW501516 or vehicle in the afternoon. Intestines were harvested the following morning.
  • small intestines were removed, washed with cold PBS-/-, opened laterally and cut into 3-5mm fragments. Pieces were washed multiple times with cold PBS-/- until clean, washed 2-3 with PBS-/-/EDTA ( l OmM), and incubated on ice for 90-120 minutes while mixing at 30-minute intervals. Crypts were then mechanically separated from the connective tissue by shaking, and filtered through a 70- ⁇ mesh into a 50-ml conical tube to remove villous material and tissue fragments. At this point the suspension was mainly composed of crypts. Crypts were removed from this step for crypt culture experiments and embedded in MatrigelTM with crypt culture media. For ISC isolation, the crypt suspensions were dissociated to individual cells with TrypLE Express (Invitrogen). Cell labeling consisted of an antibody cocktail comprising CD45-PE
  • ISCs were isolated as Lgr5-
  • EGFP low progenitors were isolated as EGFP l0W Epcam + CD24 l0W ⁇ CD3 rTerl l 9 ⁇ CD45 ⁇ 7-AAD ⁇
  • Paneth cells were isolated as CD24 hi Sidescatter hi Lgr5-EGFP Epcam + CD3 1 " Terl 19 " CD45 "' 7-AAD " with a BD FACS Aria II SORP cell sorter into supplemented crypt culture medium for culture. Dead cells were excluded from the analysis with the viability dye 7-AAD (Life Technologies).
  • Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469, 41 5-418, doi : 10.1038/nature09637 (201 1 ).
  • Rodi! la, V. et al. Jagged 1 is the pathological link between Wnt and Notch pathways in colorectal cancel-. Proceedings of the National Academy of Sciences of the United States of America 106, 63 1 5-6320, doi: 10. 1073/pnas.0813221 106 (2009).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Disclosed herein are novel methods and compositions useful for promoting intestinal stem cell function. The methods and compositions are particularly useful for stimulating the proliferation of and/or self-renewal of intestinal stem cells, as well as for minimizing, preventing, or ameliorating cellular damage resulting from incidental or accidental exposure to radiation (e.g., cancer radiation therapy).

Description

COMPOSITIONS AND METHODS FOR PROMOTING INTESTINAL STEM CELL AND/OR NON-STEM PROGENITOR CELL FUNCTION
RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No.
62/004,747, filed May 29, 2014, the entire teachings of which are incorporated herein by reference.
GOVERNMENT SUPPORT
This invention was made with government support under NIH AG045144 and NIH CA 129107 awarded by the National Institutes of Health. The government has certain rights in the invention.
BACKGROUND OF THE INVENTION
Adult stem cells maintain tissues for the life of an organism by achieving equilibrium between self-renewal and differentiation. These stem cells often require cues from their microenvironment or "niche" for their maintenance and function. In the mammalian intestine, for example, most intestinal stem cells (ISCs) reside at the bottom of the crypts and are adjacent to Paneth cells, which constitute a key component of the stem cell niche.
Intestinal atrophy or damage affects a significant portion of hospitalized patients in the US, including those suffering from inflammatory bowel disease, vascular disease, cancer, infection or malnourishment, as well as those exposed to ionizing radiation. Accordingly, there remains a need for therapies capable of modulating the processes of intestinal cell proliferation and remodeling. SUMMARY OF THE INVENTION
The present disclosure relates in some aspects to novel methods, agents, and compositions useful for promoting intestinal stem cell function and/or intestinal non-stem progenitor cell function. Certain of the methods, agents, and compositions are particularly useful for stimulating the proliferation and/or self-renewal of intestinal stem cells and/or non- stem progenitor cells in mammalian intestinal tissue, for example, by contacting a population of cells in the mammalian intestinal tissue with an effective amount of a high fat diet mimetic, which may be useful for ameliorating afflictions characterized by intestinal atrophy, as well as for preventing or ameliorating harmful effects of ionizing radiation, particularly during radiation cancer therapy or upon accidental or incidental exposure to ionizing radiation.
In some aspects the disclosure provides methods for stimulating the proliferation and/or self-renewal of intestinal stem cells in mammalian intestinal tissue.
In an aspect the disclosure provides a method of stimulating the proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR-δ) or a PPAR-δ target protein, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
In an aspect the disclosure provides, a method of promoting regeneration of mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR-δ) or a PPAR-δ target protein, thereby promoting regeneration of the mammalian intestinal tissue.
In some embodiments the intestinal stem cells comprise Ieucine-rich repeat- containing G-protein coupled receptor 5-positive (LGR51 ) stem cells. In some embodiments the population of cells is selected from the group consisting of LGR5+ stem cells, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells. In some embodiments the population of cells is contacted with both an agent that increases the level and/or activity of PPAR-δ and an agent that increases the level and/or activity of a PPAR-δ target protein. In some embodiments the PPAR-δ target protein is selected from the group consisting of carnitine palmitoyltransferase lA (CPTl A), 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), and fatty acid binding protein l (FABPl ). In some embodiments the agent increases the level and/or activity of both PPAR-δ and the PPAR-δ target protein. In some embodiments the agent increases the level and/or activity of the PPAR-δ target protein in intestinal stem and/or non-stem cell progenitor cells. In some embodiments the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR-δ agonist. In some embodiments the agent comprises 2-[2-methyl-4-[[4-methyl~2-[4- (trifluoromethyl)phenyl]-l ,3-thiazol-5-yl]methylsulfanyl]phenoxy]acetic acid (GW501516) or an analog or derivative thereof. In some embodiments the agent comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT 1A agonist, a HMGCS2 agonist, and a FAB P I agonist. In some embodiments the contacting occurs in vitro.
In some embodiments the contacting occurs in vivo in a subject. In some
embodiments the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis. In some embodiments the method includes determining that the subject is in need of treatment for a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis. In some embodiments inflammatory bowel disease is selected from the group consisting of Crohn's disease and ulcerative colitis. In some embodiments the subject is selected for treatment of an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation. In some embodiments, the affliction characterized by intestinal atrophy is an advanced age.
In some embodiments the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, exposure to ionizing radiation and advanced age. In some embodiments exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, radiotherapy, and space or cosmic radiation.
In some embodiments the method includes determining that the subject is in need of enhanced intestinal function. For example, in certain embodiments an aged or aging subject may be in need of enhanced intestinal function. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the high fat diet comprises a macronutritional composition of at least 60% of total daily calories comprising fat. In some embodiments the high fat diet comprises a diet restricted in terms of total calories. In some embodiments the high fat diet comprises a diet restricted in terms of total daily calories In an aspect, the disclosure provides a method of treating an affliction characterized by intestinal atrophy in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR- δ or a PPAR-δ target protein, thereby treating the affliction characterized by intestinal atrophy. In some embodiments the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy. In some embodiments the affliction is selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin- induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation. In some embodiments, the affliction characterized by intestinal atrophy is an advanced aged.
In certain aspects, the affliction is selected from the group consisting of Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis. In some embodiments the composition comprises a high fat diet mimetic. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a H GCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
In certain aspects the disclosure provides a composition comprises (a) at least one
PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the high fat diet comprises a calorie restricted diet.
In some aspects the disclosure provides a method of minimizing the risk of exposure to an ionizing radiation source, the method comprising administering to an individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby minimizing the risk of exposure to the ionizing radiation source. In some embodiments the composition comprises a high fat diet mimetic. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises
GW501516 or an analog or derivative thereof. In some embodiments the PPAR-δ target protein is selected from the group consisting of CPTl A, HMGCS2, and FABP 1. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTIA agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the ionizing radiation source is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation. In some embodiments individual is an individual that is being administered, or about to be administered, radiotherapy.
In an aspect the disclosure provides a method of increasing tolerance to ionizing radiation in an individual, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, wherein the composition increases the threshold dose of lethal ionizing radiation to above 8 Gy. In some embodiments the composition comprises a high fat diet mimetic. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTIA agonist, (ii) a HMGCS2 agonist, (iii) a FABPl agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABPl agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the threshold dose of lethal ionizing radiation is increased to about 15 Gy.
In some aspects the disclosure provides a method of treating an individual exposed to harmful ionizing radiation, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby treating the individual exposed to harmful ionizing radiation. In some embodiments the composition comprises a high fat diet mimetic. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises GW5015 16 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the harmful ionizing radiation is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation. In some embodiments the individual is an individual that is being administered, or about to be administered, radiotherapy. In some embodiments the method includes placing the individual on a high fat diet. In some embodiments the high fat diet comprises a calorie restricted diet.
In some aspects the disclosure provides a method of treating cancer in a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein; and (b) administering an effective amount of ionizing radiation to the subject. In some embodiments the composition: (i) increases the subject's tolerance for ionizing radiation; (ii) minimizes undesirable side-effects due to the ionizing radiation; (iii) protects against gastrointestinal drug toxicity. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some
embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition is: (i) administered to the patient prior to administering the ionizing radiation to the subject; (ii) co-administered to the subject with the ionizing radiation; (iii) administered to the subject after administering the ionizing radiation to the subject; and combinations thereof. In some embodiments the method includes administering a chemotherapeutic agent to the subject. In some embodiments the method includes placing the individual on a high fat diet. In some embodiments the high fat diet comprises a calorie In some aspects the disclosure provides a method of administering radiotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering radiotherapy to the subject. In some embodiments, the composition is administered prior to administering the radiotherapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the radiotherapy). In some embodiments, the composition is administered to the subject concomitantly with the radiotherapy.
In some aspects the disclosure provides a method administering proton therapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering proton therapy to the subject. In some embodiments, the composition is administered prior to administering the proton therapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 0 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the proton therapy). In some embodiments, the composition is administered to the subject concomitantly with the proton therapy.
In some aspects the disclosure provides a method of administering chemotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering chemotherapy to the subject. In some embodiments, the composition is administered prior to administering the chemotherapy to the subject (e.g., about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 24 days, 28 days, 30 days, 42 days, 60 days, 90 days or more prior to administering the chemotherapy). In some embodiments, the composition is administered to the subject concomitantly with the chemotherapy.
In some embodiments the composition comprises a high fat diet mimetic. In some aspects the disclosure provides the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In certain aspects, the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the method includes placing the individual on a high fat diet. In some embodiments the high fat diet comprises a calorie restricted diet.
In some aspects the disclosure provides a radioprotective composition comprising an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient.
In some aspects the disclosure provides a chemoprotective composition comprising an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient. In some aspects, the agents or the chemoprotective compositions may be administered prior to initiation of chemotherapy (e.g., as a chemotherapy pre-treatment). In some aspects, the agents or the chemoprotective compositions may be concurrently administered with chemotherapy. In some embodiments the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR-δ agonist. In some embodiments the agent comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a HMGCS2 agonist, (iii) a FAB 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the composition includes a chemotherapeutic agent. In some embodiments the composition includes a radiotherapeutic agent. In some embodiments the composition is formulated for administration as an enema. In some embodiments the composition is formulated for oral administration.
Aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR-δ and/or a PP AR-δ target protein to promote intestinal regeneration, protect against intestinal tissue damage, and/or stimulate the proliferation and/or self-renewal of one or more intestinal stem cells.
Aspects of the disclosure involve t he use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to treat an affliction characterized by intestinal atrophy. In some embodiments the affliction is selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome. In some embodiments the affliction is selected from the group consisting of Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis. In some embodiments, the affliction characterized by intestinal atrophy is an advanced age.
Aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to protect against, mitigate, or alleviate, the harmful effects of exposure to ionizing radiation, in some embodiments exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, cosmic or space radiation.
Aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with radiotherapy to protect against the harmful effects of ionizing radiation. Certain aspects of the disclosure involve the administration of the agent prior to exposure to ionizing radiation. Certain aspects of the disclosure involve the concomitant administration of the agent during the exposure to ionizing radiation.
Aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with chemotherapy to protect against gastrointestinal drug toxicity. Certain aspects of the disclosure involve the administration of the agent prior to administration of the chemotherapy. Certain aspects of the disclosure involve the concomitant administration of the agent during the administration of the chemotherapy.
Aspects of the disclosure involve the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with total parenteral nutrition to protect against intestinal atrophy. Certain aspects of the disclosure involve the administration of the agent prior to administration of total parenteral nutrition. Certain aspects of the disclosure involve the concomitant administration of the agent during the administration of total parenteral nutrition.
In some embodiments the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR-δ agonist. In some embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the agent comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist.
In some aspects the disclosure provides a method for expanding a population of intestinal stem cells and/or non-stem intestinal progenitor cells comprising contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. In some embodiments the intestinal stem cells comprise LGR5+ stem cells. In some embodiments the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR-δ agonist. In some embodiments the PPAR-δ agonist comprises
GW501516 or an analog or derivative thereof. In some embodiments the agent comprises or a PPAR-δ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist. In some embodiments Paneth cells are not present in the population of intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments the method is performed ex vivo. In some embodiments the method is performed in vivo in a subject. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the diet comprises a calorie restricted diet.
In some aspects the disclosure provides a method of endowing at least one non-stem intestinal progenitor cell with at least one attribute of intestinal stem cells, the method comprising contacting a population of mammalian intestinal cells comprising at least one non-stem progenitor cell with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby endowing at least one non-stem intestinal progenitor cell with the at least one attribute of intestinal stem cells. In some embodiments the at least one attribute comprises the ability to form organoid mini-intestines in culture in the absence of the Paneth cell niche. In some embod iments the intestinal stem cells comprise LGR5 ' stem cells. In some embodiments the agent comprises a high fat diet mimetic. In some embodiments the agent comprises a PPAR-δ agonist. In some
embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the agent comprises or a PPAR-δ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP1 agonist.
In some aspects the disclosure provides a method of obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with an enhanced ability to form organoid bodies in culture in the absence of the Paneth cells, the method comprising: (a) administering a high fat diet or a high fat diet mimetic to a mammal, wherein the high fat diet or high fat diet mimetic enhances the ability of intestinal stem cells and/or non-stem intestinal progenitor cells in the mammal to form organoid bodies in culture; and (b) isolating intestinal stem cells and/or non-stem intestinal progenitor cells from the mammal, thereby obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with the enhanced ability to form organoid bodies in culture. In some embodiments the method includes assessing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells to form organoid bodies in culture in the absence of Paneth cells. In some embodiments assessing is performed by comparing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells obtained from the mammal in step (b) to form organoid bodies in culture in the absence of Paneth cells to the ability of intestinal stem cells and/or non-stem intestinal progenitor cells obtained from control mammals which were not administered a high fat diet of high fat diet mimetic to form organoid bodies in culture in the absence of Paneth cells. In some embodiments the method includes a step (c) forming organoid bodies in culture in the absence of Paneth cells. In some embodiments the high fat diet or the high fat diet mimetic increases the level and/or activity of PPAR-5 or a PPAR-δ target protein in the mammal's intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments the high fat diet mimetic comprises a PPAR-δ agonist. In some embodiments the high fat diet mimetic comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT1A agonist, a HMGCS2 agonist, and a FABP 1 agonist. In some embodiments the mammal comprises a mouse.
Aspects of the disclosure involve the use of PPAR-δ and/or a PPAR-δ target gene as a prognostic biomarker to detect obese individuals at risk for colorectal cancer.
In some aspects the disclosure provides a method of identifying an obese individual at risk of developing colorectal carcinoma, the method comprising: (a) determining the level of expression of PPAR-δ or a PPAR-δ target gene in a biological sample obtained from an obese individual; and (b) identifying an obese individual as being at risk of developing colorectal carcinoma if the level of expression of PPAR-δ or the PPAR-δ target gene in the biological sample is elevated as compared to the level of expression of PPAR-δ or the PPAR-δ target gene in control individuals without colorectal carcinoma. In some embodiments the biological sample comprises a colon biopsy specimen. In some embodiments the biological sample comprises an epithelial cell. In some embodiments the biological sample comprises an intestinal stem cell. In some embodiments the biological sample comprises a non-stem intestinal progenitor cell. In some embodiments the biological sample comprises a Paneth cell. In some embodiments the biological sample comprises a goblet cell. In some embodiments the biological sample is obtained by performing a colonoscopic biopsy. In some embodiments (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene comprises determining the mRNA level of expression of PPAR-δ or the PPAR-δ target gene. In some embodiments (a) determining the level of expression of PPAR-δ or the PPAR- δ target gene is accomplished by performing a hybridization-based assay, a polymerase chain reaction-based assay, or sequencing. In some embodiments (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene comprises determining the protein level of expression of PPAR-δ or the PPAR-δ target gene. In some embodiments (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene is accomplished by ELISA, Western blot, mass spectrometry, or immunohistochemistry.
In certain aspects, disclosed here are methods of reducing loss of intestinal stem cells and/or non-stem intestinal progenitor cells in a subject at risk thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby intestinal stem cells and/or non-stem intestinal progenitor cells loss. In certain aspects, aged subjects (e.g., human subjects that are at least about 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old or older) are at risk of losing or, in certain aspects, at risk of suffering from declining quantities, production and/or function of intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments the method includes determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy. In some embodiments, the affliction characterized by intestinal atrophy is an advanced age. In some embodiments the composition comprises a high fat diet mimetic. In some embodiments the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof. In some embodiments the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In certain aspects the disclosure provides a composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a HMGCS2 agonist, (iii) a FABP1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments the method includes placing the subject on a high fat diet. In some embodiments the high fat diet comprises a calorie restricted diet.
In certain aspects the methods and uses disclosed herein further comprise a step of determining, for example, that a subject (e.g., an aged subject) has or is at risk of developing compromised gut regeneration (e.g., as evidenced by a loss of intestinal stem cells and/or non- stem intestinal progenitor cells). Accordingly, in certain embodiments, the methods and uses disclosed herein further comprise a step of determining that the subject is in need of enhanced intestinal function. In some aspects, such a determination may be made by assessing expression of PPAR-δ in one or more tissues or biological samples obtained from the subject. In certain aspects, such a determination may be made by assessing expression of one or more of CPT1A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the subject.
In some embodiments, the methods and uses disclosed herein further comprise a step of determining that a subject (e.g., an aged or elderly subject) has or is at risk of developing loss of intestinal stem cells and/or non-stem intestinal progenitor cells. In some aspects, such a determination may comprise assessing expression of PPAR-δ in one or more tissues or biological samples obtained from the subject. In some aspects, such a determination may comprise determining that the subject has loss of intestinal stem cells and/or non-stem intestinal progenitor cells by assessing expression of one or more of CPT1 A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the subject.
The practice of the present invention will typically employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference (RNAi) which are within the skill of the art. Non-limiting descriptions of certain of these techniques are found in the following publications: Ausubel, F., et al., (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, all John Wiley & Sons, N.Y., edition as of December 2008; Sambrook, Russell, and Sambrook, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001 ; Harlow, E. and Lane, D., Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988; Freshney, R.I., "Culture of Animal Cells, A Manual of Basic Technique", 5th ed., John Wiley & Sons, Hoboken, NJ, 2005. Non-limiting information regarding therapeutic agents and human diseases is found in Goodman and Oilman's The Pharmacological Basis of Therapeutics, 1 1th Ed., McGraw Hill, 2005, atzung, B. (ed.) Basic and Clinical Pharmacology, McGraw-Hill/Appleton & Lange; 10th ed. (2006) or 1 1th edition (July 2009). Non-limiting information regarding genes and genetic disorders is found in McKusick, V.A.: Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins University Press, 1998 (12th edition) or the more recent online database: Online Mendelian Inheritance in Man, OMIM™.
McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), as of May 1 , 2010, World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/ and in Online Mendelian Inheritance in Animals (OMIA), a database of genes, inherited disorders and traits in animal species (other than human and mouse), at
http;//omia,angis, org.au/contact. shtml. All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) mentioned herein are incorporated by reference in their entirety. In case of a conflict between the specification and any of the incorporated references, the specification (including any amendments thereof, which may be based on an incorporated reference), shall control. Standard art-accepted meanings of terms are used herein unless indicated otherwise. Standard abbreviations for various terms are used herein.
BRIEF DESCRIPTION OF THE DRAWINGS
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
FIGS. lA-lB demonstrate that high fat diet High Fat Diet increases intestinal stem cell numbers and permits Paneth Cell independent organoid initiation. FIG. 1A demonstrates that High fat diet (HFD) fed Lgr5-GFP-IRES-CreERT2 mice show a selective increase in the number of GFPhl intestinal stem cells (ISCs) as enumerated by flow cytometry. In contrast, high fat does not modulate the numbers of GFPlow intestinal progenitor cells. FIG. IB demonstrates that HFD-derived GFP1" ISCs, in contrast to those isolated from control fed mice, posses the capacity to initiate organoid bodies without co-culture of niche Paneth cells. The co-culture of ISCs with Paneth cells enables control ISCs to form organoid bodies and further enhances the capacity of HFD-derived stem cells to give rise to organoid bodies, (values are mean; error bars indicate standard deviation; **P<0.01 .)
FIGS. 2A-2C demonstrate that peroxisome proliferator activated receptor delta (PPAR-δ) agonist, GW501516, boosts intestinal stem cell numbers and allows for niche independent organoid formation by stem cells and progenitor cells. FIG. 2A demonstrates that Lgr5-GFP-IRES-CreERT2 mice administered GW5015 16 at 4mg/kg for 2-4 weeks show a selective increase in the number of GFPhl intestinal stem cells (ISCs) but not in progenitor cells as enumerated by flow cytometry. FIG. 2B demonstrates that GW5015 16-derived GFP1" ISCs, in contrast to those isolated from vehicle-treated mice, demonstrate the capacity to initiate organoid bodies without co-culture of niche Paneth cells. FIG. 2C demonstrates that HFD and GW501516-derived GFPlow progenitor cells possess the potential to autonomously form organoid bodies in vitro, (values are mean; error bars indicate standard deviation;
*P<0.05; **P<0.01.)
FIGS. 3A-3I demonstrate that high fat diet (HFD) augments ISC numbers and function. FIG. 3A shows that 01fm4+ ISCs were increased in HFD fed mice, whereas FIG. 3B illustrates that the number of cryptdin 4+ Paneth cells were decreased (in situ hybridization, proximal jejunum, «=3 and 4, respectively). Control was ad libitum fed on normal chow. FIG. 3C illustrates that ISCs (or crypt base columnar cells adjacent to Paneth cells) and progenitor cells (or transit-amplifying cells) showed increased BrdU incorporation after a 4h pulse in HFD treated mice (n=6). FIG. 3D illustrates that HFD-derived crypts were twofold more capable of forming organoids. Representative control and HFD-derived organoids are shown at day 7 (white arrow marks organoids and white asterisk indicates aborted crypts, «=4). FIG. 3E shows that Day 14 HFD-derived organoids possessed less crypt domains than compared to control counterparts
Figure imgf000016_0001
FIG. 3F shows that dissociated HFD-derived organoids gave rise to two-fold more secondary organoids («=7). FIG. 3G illustrates that HFD increased the number of surviving crypts after ionizing irradiation- induced (XRT) damage. Yellow arrows mark regenerated crypts and yellow asterisks illustrate aborted crypts (»=3). FIG. 3H shows that HFD increased the frequency of Lgr5- GFP1"6'1 ISCs (dark green) by nearly twofold but had no effect on Lgr5-GFPlow progenitors (light green) (n=l 0). FIG. 31 shows that HFD-derived Lgr5-GFPhl ISCs were able to initiate organoids efficiently without Paneth cells. Co-culture with Paneth cells boosted organoid- forming capacity for both control and HFD-derived ISCs. A representative image of primary organoids from Lgr5-GFPh' ISCs at day 10 is shown («=4). (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, **P<0.01 , scale bars in FIGS. 3B and 3C= 20μιη, in FIG.
Figure imgf000016_0002
FIGS. 4A-F illustrate that ex vivo exposure of ISCs to palmitic acid recapitulates aspects of a HFD. FIG. 4A shows that exposure of na'ive crypts to 30μΜ palmitic acid (PA) had no effect on primary organoid formation (n~5). FIG.4B shows that organoids exposed to 30μΜ PA developed less crypt domains as enumerated after seven days in culture («=4). FIGS. 4C and 4D demonstrate that individually dissociated primary organoids (FIG. 4C) or 1 ,000 sorted live cells from primary organoids (n=4) (FIG. 41)) possessed more secondary organoid-forming activity after four weeks of treatment with 30μΜ PA (n=3). FIGS. 4E and 4F show that four- week PA treatment increased the frequency (FIG. 4E, «=3) and organoid forming capacity (FIG. 4F, n=3) of Lgr5-GFPhl ISCs. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, **P<0.01 , ** *P<0.001 )
FIGS. 5A-5K illustrate that activated PPAR-δ in ISCs mediates the effects of HFD. FIG. 5A illustrates a heat map of differentially expressed genes in Lgr5-GFPhl ISCs and Lgr5-GFPlow progenitors revealed induction of a PPAR-δ program in HFD-fed mice. FIG. 5B shows that PPAR and LXR/RXR motifs were enriched in genes that are upregulated in ISCs from HFD-fed mice. FIGS. 5C, 5D and 5E demonstrate confirmation of upregulated rr/λκ-ο larger gene expression in now sorceu i_.gr j-vjrr io _s and Lgr -urr progenitors by qRT-PCR (FIG. 5C, all fold changes are significant, n=5, p<0.05) and at the protein level from HFD (FIG. 51)) and GW501 516-treated (FIG. 5E) mice. FIGS. 5F and 5G show 01fm4+ ISCs numbers per jejunal crypt were increased in GW5015 16-treated mice (FIG. 5F), whereas, Cryptdin 4+ Paneth cell numbers (FIG. 5G) remained unchanged {in situ hybridization, proximal jejunum, n=3 and 4, respectively). FIG. 51 show that PPA R-o agonist GW5015 16 administration enhanced the proliferation of crypt base columnar cells (CBC cells) and transient-amplifying cells as assessed 4 hours after a pulse of BrdU («=4). FIG. 51 shows that PPAR-δ agonist treatment boosted the organoid-forming capacity of intestinal crypts («=3). FIG. 5J shows that PPAR-δ agonist administration doubled the number of Lgr5-GFPhi ISCs but had no effect on the Lgr5-GFPlow progenitors («=3). FIG. 5K shows that Lgr5-GFPhi ISCs derived fiora PPAR-δ agonist-treated mice were capable of forming organoids in the absence of Paneth cells. Representative images of primary organoids at day 12 are illustrated («=3). (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, * *P<0.01 ; scale bars in FIGS. 3f-3h= 20μιτι, and FIG.
Figure imgf000017_0001
FIGS. 6A-6G illustrate that HFD and PPAR-δ signaling leads to increased β-catenin nuclear local ization and target gene expression. FIGS. 6A and 6B show that increased nuclear β-catenin localization was observed by immunostaining in flow sorted Lgr5-GFPhl ISCs and GFPlow progenitors isolated from HFD (FIG. 6A) and GW501516-treated (FIG. 6B) mice compared to their respective controls. FIG. 6C shows t-distributed stochastic neighbor embedding (t-SNE) plot of the single-cell gene expression data for all β-catenin target genes. Each mark represents a single cell. FIGS. 6D and 6E show violin plots demonstrated the expression levels of the most upregulated β-catenin target genes in Lgr5-GFPhl ISCs (FIG. 6B) and GFP'0W progenitors (FIG. 6E) after HFD treatment. FIGS. 6F and 6G confirm PPAR-δ mediated induction of the most upregulated β-catenin transcriptional targets by single cell qRT-PCR in Lgr5-GFPhi ISCs (FIG. 6F) and (FIG. 6G) GFPlow progenitors from GW501 516-treated mice. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; * P<0.05, * *P<0.01.)
FIGS. 7A-7G show that PPAR-δ activation confers organoid and tumor-initiating capacity to non-stem-cells. FIG. 7A shows that HFD or PPAR-δ agonist treatment conferred organoid-initiating capacity to Lgr5-GFPio v progenitors. Representative images of primary organoids at day 7 are shown («=3). FIG. 7B depicts a schematic for assessing the in vitro and in vivo adenoma-initiating capacity of Ape-null Lgr5-GFPb' ISCs and Lgr5-GFPlow progenitors from veh icle or PPAR-δ agonist GW501 516-treated mice. FIG. 7C shows that PPAR-δ agonist treatment increased the in vitro adenomatous organoid forming potential of Ape-null Lgr5-GFP ow progenitors by four-fold in EN media, which includes Noggin and EGF but lacks Wnt3 and R-spondin. Ape-null Lgr5-GFPhl ISC organoid-forming potential was not altered by PPAR-δ agonist treatment («=6). FIG. 7D presents representative images of adenomatous organoids derived from Ape-null Lgr5-GFPhi ISCs (top) and Lgr5-GFPlow progenitors (bottom). FIGS. 7E and 7F show orthotopic transplantation of Ape-null GFP,0W progenitors from PPAR-δ agonist-treated mice (bottom), but not from vehicle controls, initiated tumors that were visible with optical colonoscopy and verified by histology (FIG. 13). Transplanted Ape-null Lgr5-GFPh' ISCs from vehicle or PPAR-δ agonist- treated mice formed tumors at similar rates (FIG. 7F, «=4 separate experiments). FIG. 7G illustrates a model of intestinal adaptation to HFD. HFD has opposing effects on the numbers of stem- cells (increases) and their Paneth cell niche (decreases) per intestinal crypt. Mechanistically, HFD activates a PPAR-8-mediated program that augments the organoid and tumor-initiating potential of ISCs and TA-cells. A feature of the PPAR-δ program includes induction of a subset of β-catenin target genes. S= stem cell, P= Paneth cell, Pr= progenitor cell, T= tumor cell, red dotted line= Ape-null cells with tumor-forming capability. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, **P<0.01 ; scale bars in FIG. 7Λ-50μιη, FIG. 7D(upper)= 200μηι, FIG. 7D(lower)=5(^m, FIG.
7E(lower)=5(Vm.)
FIGS. 8A-K demonstrate that HFD enhances the proliferation of progenitors in the intestinal crypt. FIGS. 8A-G show that in comparison to mice fed normal chow, mice on a HFD gained on average 50% mass (FIG. 8A, n=\ 1 and 15), had reduced small intestinal mass and length (FIGS. 8B and 8C, n=\ 1 and 15), shorter crypts and villi (FIGS. 8E and 8G, «=3 each), and fewer villus enterocytes (FIG. 8F, n=3 each). HFD did not change the density of crypts (FIG. 81), n=3 each) in the proximal jejunum. FIGS. 811 and 81 show that HFD enhanced the proliferation of ISCs (or crypt base columnar cells) and progenitor cells (or transient-amplifying cells) as assessed 4 hours (FIG. 811. «=6) and 24 hours (FIG. 81, «=6) after a pulse of BrdU. FIG. 8K illustrates that no significant difference in the number of jejunal caspase3+ cells was detected by immunohistochemistry. Images are representative of three separate experiments («=3); arrows highlight caspase3+ enterocytes. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, **P<0.01 , ** *P<0.001 , scale bars in FIG.
Figure imgf000018_0001
and 50μιη (inset), FIG. 8K- Ι ΟΟμηι. )
FIGS. 9A-9D illustrate that HFD and PPAR-δ signaling has minimal effects on enteroendocrine and goblet cell differentiation. FIGS. 9A-9B depict that quantification (FIG. 9A) and immunostain (FIG. 9B) for chromogranin A revealed no difference in the numbers of jejunal enteroendocrine cells (FIG. 9B, black arrowhead) per crypt-villous unit in mice from h igh fat diet compared to control («=3), or veh icle-treated mice compared to PPAR-δ agonist GW501 5 16-treated mice («=3). FIGS. 9C-9D depict that quantification (FIG. 9C) and Alcian blue/PAS stain (FIG. 9D) showed no difference in mucinous goblet cells (black arrowhead) in HFD compared to controls («=4), or vehicle-treated mice compared to PPAR-δ agonist- treated mice («=4).
FIGS. 1 OA- I OC show that PPAR-δ is the predominant PPAR family member expressed in intestinal progenitors. FIG. 10A illustrates that PPAR-δ is the most abundant PPAR family member in intestinal progenitors based on RNA-seq data. FIG. 10B shows confirmation of PPAR family member mRNA expression levels in Lgr5-GFPhl ISCs and Lgr5-GFPlow progenitors by qPCR. FIG. IOC shows the results of a gene set enrichment analysis (GSEA) of RNA-seq revealed enrichment of PPAR-δ targets in Lgr5-GFPhl ISCs and Lgr5-GFP'0W progen itors after HFD treatment.
FIGS. 11A-11E illustrate that HFD and PPAR-δ signaling boost nuclear β-catenin localization and target gene expression in intestinal progenitors. FIGS. 1 1 A and 1 I B show that increased nuclear β-catenin local ization was observed in Lgr5-GFPhl ISCs and Lgr5- GFP|0W progenitors from HFD (FIG. 1 1 A) or PPAR-δ agonist GW501 516-treated (FIG. 11B) mice by immunostaining («=4 each). FIGS. 11C and 11D illustrate that increased nuclear β- catenin localization was observed in the stem and progenitor cells of crypts from HFD (FIG. 11C) or PPAR-δ agonist-treated (FIG. 11D) mice by immunostaining («=4 each).
Representative images are shown in FIG. HE; arrowheads highlight β-catenin positive nuclei. (Unless otherwise indicated, in all panels: values are mean; error bars indicate s.d.; *P<0.05, **P<0.01 , ** *P<0.001 , scale bars in FIG. 11E= 20μηι).
FIGS. 12A-12E illustrate HFD mediated changes in β-catenin target gene expression in single stem and progenitor cells. FIG. 12A shows a heat map representation of β-catenin target gene expression in single Lgr5-GFPhl ISCs and Lgr5-GFPlow progenitor cells. FIG. 12B shows stem cell signature genes identified by comparing control Lgr5-GFPhl ISCs to control Lgr5-GFP,0W progenitor cells. FIG. 12C shows HFD signature genes identified by comparing HFD Lgr5-GFPhi ISCs to control GFPhi ISCs. FIG. 12D shows tSNE analysis of single cells using stem cell signature genes. FIG. 12E shows tSNE analysis of single cells using HFD signature genes.
FIG. 13 illustrates that PPAR-δ activation bestows adenoma-initiating capacity to organoids derived from Ape-null non-LGR5+ cells. Representative adenomas, verified by histology (H&E), derived from orthotopic transplantation of Ape-null Lgr5-GFPhl ISCs from vehicle and PPAR-δ agonist GW5015 16-treated mice and Lgr5-GFP'0 progenitors from PPAR-δ agonist-treated mice exhibit lack of maturation and nuclear crowding. The results were interpreted blinding by 2 independent pathologists. Unless otherwise indicated, in all panels: scale bars in (20X)= 50μπι, (60X)= 20μΐΉ , (H&E, 20X)= 50μηι, (60X)= 20μιτι.) FIGS. 14A-14B demonstrate age associated changes in the intestine. FIG. 14A shows decreased frequencies of ISCs and progenitor cells (TAs) in aged relative to young.
FIG. 14B shows decreased frequency of organoid formation in aged crypts compared to young ones.
FIGS. 15A-15B illustrate that PPAR5 pathway activation improves intestinal crypt function. FIG. 15A shows that GW501516 treatment increases the frequency of stem cells. FIG. 15B shows that GW501516 treatment increases the frequency of organoid formation in aged crypts.
FIGS. 16A-16B illustrate that activation of the PPAR8 signaling pathway in vivo increases intestinal organoid formation in aged animals. FIG. 16A shows that co-culturing intestinal stem cells (ISCs) and Paneth cells from aged mice yields a significantly lower frequency of organoid formation compared to co-cultured ISCs and Paneth cells derived from young animals. Co-culturing ISCs and Paneth cells from aged animals treated with the PPAR5 agonist GW501516 significantly boosts organoid formation compared to co-cultured old vehicle treated ISCs and Paneth cells. Counts and frequencies were done on day 3 post culturing. FIG. 16B shows representative images from co-culturing experiments.
Abbreviations used in the figure: Y = young, O = old; "hi" = intestinal stem cells, "pan" =
Paneth cells.
DETAILED DESCRIPTION OF THE INVENTION
Aspects of the disclosure relate to compositions, methods, and agents for stimulating the proliferation and/or self-renewal of one or more intestinal stem cells in, enhancing the number and/or function of non-stem progenitor cells in, and/or promoting regeneration of, mammalian intestinal tissue.
In an aspect, a method of stimulat ing proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR-δ) or a PPAR-δ target protein, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
In an aspect, a method of stimulating proliferation and/or self-renewal of one or more intestinal stem cells in mammalian intestinal tissue comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
In an aspect, a method of enhancing non-stem intestinal progenitor cell number and/or function comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of (PPAR-δ) or a PPAR-δ target protein, thereby enhancing non-stem intestinal progenitor cell number and/or function
In an aspect, a method of enhancing non-stem intestinal progenitor cell number and/or function comprises contacting a population of cells in mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby enhancing non-stem intestinal progenitor cell number and/or function.
In an aspect, a method of promoting regeneration of mammalian intestinal tissue comprises contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby promoting regeneration of the mammalian intestinal tissue.
In an aspect, a method of promoting regeneration of mammalian intestinal tissue comprises contacting a population of cells in the mammalian intestinal tissue with an effective amount of a high fat diet mimetic, thereby promoting regeneration of the mammalian intestinal tissue.
In some embodiments, any of the methods described herein further includes contacting the population of cells in the mammalian intestinal tissue with an effective amount of a calorie restriction mimetic. In some embodiments, any of the methods described herein further includes contacting the population of cells in the mammalian intestinal tissue with an effective amount of an agent that inhibits the level and/or activity of mTORC l . In some embodiments, any of the methods described herein further include contacting the population f cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of Bstl or a product of Bstl .
As used herein, "stimulating" and derivations thereof, may be used interchangeably with terms such as "activate", "enhance", "promote", "increase" and like terms, as appropriate in the context. It will be understood that the magnitude or extent of stimulation, activation, enhancement, or an increase described herein may vary.
For example, stimulating proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells may refer to an increase in proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% relative to level of proliferation and/or self-renewal in the absence of an agent or composition described herein. In some embodiments, stimulating the proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells increases the proliferation and/or self-renewal of such cells by at least 1 . 1 fold, 1.2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1.6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, or 1 00 fold or more.
As another example, promoting regeneration of mammalian intestinal tissue may refer to regeneration of mammalian intestinal tissue (e.g., atrophied, damaged, aged, dysfunctional, etc.) to at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, of its normal condition as compared to the condition of mammalian intestinal tissue in the absence of contact with an agent or composition described herein.
As used herein, "intestinal stem cells" refer to stem cells residing at the base of the small intestinal crypts. Methods for identifying, isolating, and/or purifying intestinal stem cells are available to the skilled artisan art, for example, intestinal stem cells can be identified by determining the presence of expression of one or more markers of intestinal stem cells, such as leucine-rich repeat-containing G-protein coupled receptor 5 (LGR5), oflactomedin 4 (OLFM4), achaete scute-like 2 (ASCL2). In some embodiments, the intestinal stem cells comprise LGR5 stem cells. In some embodiments, the intestinal stem cells comprise OLFM4+ stem cells. In some embodiments, the intestinal stem cells comprise ASCL2+ stem cells.
As used herein, "non-stem intestinal progenitor cells" refer to non-stem progenitor cells residing above Paneth cells in the intestinal crypts. Methods for identifying, isolating, and/or purifying non-stem progenitor cells are available to the skilled artisan, for example, non-stem intestinal progenitor cells can be identified by the absence of expression or diminished expression of LGR5, OLFM4, and ASCL2, or expression of WDR3 (KIAA0007) in the cells.
As used herein, "mammalian intestinal tissue" refers to the portion of the mammalian alimentary canal that extends from the stomach to the rectum, including the small intestine, the large intestine, and the colon. In some embodiments, mammalian intestinal tissue comprises mouse intestinal tissue. In some embodiments, mammalian intestinal tissue comprises human intestinal tissue.
Aspects of the disclosure involve manipulating (e.g., contacting, isolating, purifying, expanding, etc.) populations of cells. As used herein, a "population of cells" can be a single cell or can comprise multiple cells in various embodiments. In some embodiments a population of cells comprises at least 10, 102, 103, 104, 105, 106, 107, 108, 109, 1010, 10Mcells, or more, or any range therebetween. In some embodiments of any relevant aspect herein a population of cells refers to multiple cells in a culture vessel such as a culture plate or dish. In some embodiments a population of cells refers to multiple cells exposed in parallel to the same agents or conditions. In some embodiments a population of cells refers to cells in mammalian intestinal tissue in vivo. One of ordinary skill in the art will appreciate that a "population of cells" of a given type, such as population of intestinal stem cells at the base of the small intestinal crypts, or having particular characteristic(s) comprises at least one cell of such type or having such characteristic(s) and may or may not further comprise one or more cells of different type(s) and/or lacking such characteristic(s). In various embodiments a population of cells is selected or purified to a desired level of uniformity or homogeneity with respect to type and/or characteristic(s). For example, in various embodiments a population of cells contains at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more cells of such type and/or having such characteristic(s). It will be understood that many of the methods described herein are often practiced using populations of cells comprising multiple cells, e.g., in vitro or in vivo. In some instances, ex vivo methods described herein are performed using populations of cells. Thus references to "a cell" should be understood as including embodiments in which the cell is a member of a population of cells. References to "cells" should be understood as including embodiments applicable to individual cells within a population comprising multiple cells and embodiments applicable to individual isolated cells. As will be understood by those of ordinaiy skill in the art, the number of members and/or one or more characteristic(s) of a population of cells may change over time, e.g., during a culture period. For example, at least some cells in the population may divide once or more and/or some cells may die. Hence, if a population of cells is maintained and/or subjected to one or more manipulations or steps, it should be understood that the population may have changed over time, and the term "population of cells" may thus refer to the population as it exists at the relevant time, e.g., the population resulting from the previous manipulation or step. It will also be appreciated that, in general, any manipulation or step performed on a population of cells may be performed on a subpopulation. For example, cells may be passaged, and only a portion of the cells retained for subsequent manipulation or steps, or a population may be divided into multiple aliquots, which may be used for different purposes.
The disclosure contemplates contacting any population of cells in mammalian intestinal tissue that stimulates the proliferation and/or self-renewal of one or more intestinal stem cells and/or non-stem intestinal progenitor cells in the population. In some embodiments, the population of cells comprises LGR5+ stem cells. In some embodiments, the population of cells comprises non-stem cell progenitor cells (e.g. WDR3+ intestinal cells). In some embodiments, the population of cells optionally comprises Paneth cells. In some embodiments, the population of cells optionally comprises goblet cells. In some
embodiments, the population of cells is selected from the group consisting of LGR5+ stem cells, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells. It should be appreciated that in embodiments in which calorie restriction mimetics are employed it is preferable that the population of cells comprise Paneth cells, in addition to other intestinal cells in the population (e.g., intestinal stem cells and/or non-stem intestinal progenitor cells).
Aspects of the disclosure involve employing effect amounts of agents and/or compositions. An "effective amount" or "effective dose" of an agent (or composition containing such agent) generally refers to the amount sufficient to achieve a desired biological and/or pharmacological effect, e.g., when contacted with a cell in vitro or administered to a subject according to a selected administration form, route, and/or schedule. As will be appreciated by those of ordinary skill in the art, the absolute amount of a particular agent or composition that is effective may vary depending on such factors as the desired biological or pharmacological endpoint, the agent to be delivered, the target tissue, etc. Those of ordinary skill in the art will further understand that an "effective amount" may be contacted with cells or administered in a single dose, or through use of multiple doses, in various embodiments. It will be understood that agents, compounds, and compositions herein may be employed in an amount effective to achieve a desired biological and/or therapeutic effect. In some embodiments, an "effective amount" refers to an amount of an agent or composition described herein which is stimulates proliferation and/or self-renewal of intestinal stem cells. In some embodiments, an "effective amount" refers to an amount of an agent or composition described herein which is stimulates proliferation and/or self-renewal of non-stem intestinal progenitor cells. In some embodiments, an "effective amount" refers to an amount of agent or composition described herein which promotes the regeneration of intestinal tissue. The skilled artisan can readily determine the effective amount of an agent or composition described herein for achieving its effective purpose using routine methods, without undue experimentation. It should be understood that in certain embodiments, an effective amount of the agents and compositions disclosed herein may be administered to a subject for a limited period of time (e.g., several days, weeks or months). In certain embodiments, the agents and compositions disclosed herein may be administered to a subject in conjunction with, for example, chemotherapy or radiotherapy, and in such embodiments the agents or compositions may be discontinued upon completion of such chemotherapy or radiotherapy. Similarly, in certain embodiments where such agents or compositions are administered as a pre-treatment, such agents or compositions may be administered prior to initiation of chemotherapy and discontinued upon initiation or completion of the chemotherapy.
Aspects of the disclosure involve contacting cells or populations of cells with agents or compositions described herein. As used herein, "contacting", "contacting a cell",
"contacting a population of cells", and any derivations thereof, are used interchangeably to refer to any means of introducing an agent or composition into sufficient proximity with a target cell for the agent to exert its intended effect on a cell, including chemical and physical means, whether the agent or composition physically contacts the cell directly or is introduced into an environment in which the cell is present. For example, contacting includes binding of an agent to an extracellular or extranuclear domain of a receptor and exerting its effects in that way. "Contacting" encompass methods of exposing a cell, delivering to a cell, or "loading" a cell with an agent or composition by viral or non-viral vectors, and wherein such agent is bioactive upon delivery. The method of delivery will be chosen for the particular agent and use. Parameters that affect delivery, as is known in the medical art, can include, inter alia, the cell type affected, and cellular location. In some embodiments, contacting includes administering the agent to a subject. In some embodiments, contacting refers to exposing mammalian intestinal tissue (e.g., crypts) or an environment in which the cell line is located (e.g., cell culture) to one or more agents or compositions described herein. In some embodiments, the populations of cells in mammal ian intestinal tissue are exposed to an agent or composition in vitro. In some embodiments, populations of cells in mammalian intestinal tissue are exposed to an agent or composition in vivo.
Aspects of the disclosure involve contacting populations of cells (e.g., in mammalian intestinal tissue) with agents (e.g., an agent that increases the level and/or activity of PPAR-δ or a ΡΡΑΡν-δ target protein). "Agent" as used herein encompasses proteins, small molecules, nucleic acids, lipids, supramolecular complexes, entities such as viruses or portions thereof, and other biological or chemical entities that can be contacted with cells ex vivo or administered to a subject. An "agent" may comprise multiple different agents of distinct structure or sequence. The term "agent" may be used interchangeably with the term
"compound" herein. In general, an agent disclosed herein can be prepared or obtained using any of a variety of methods. Methods suitable for preparation of particular agents or types of agents are known to those of ordinary skill in the art. For example, in various embodiments an agent is isolated from an organism that naturally contains or produces it (e.g., plants, animals, fungi, bacteria). In some embodiments an agent is at least partly synthesized, e.g., using chemical or biological methods. In some embodiments recombinant nucleic acid technology is used to produce an agent, e.g., a gene expression product such as an RNA or protein. Methods for generating genetically modified cells or organisms, e.g., cells
(prokaryotic or eukaryotic) or organisms (e.g., animals, plants) that can serve as sources of the agent are known to those of ordinary skill in the art. Exemplary methods are described in various references cited herein. In some embodiments a protein or nucleic acid has or comprises a naturally occurring sequence. In some embodiments a protein or nucleic acid comprises or has a sequence that is at least in part invented or generated by man and/or not known to be found in nature. In some embodiments an agent or composition herein comprises a naturally occurring polypeptide. For purposes herein, a polypeptide is said to be "naturally occurring" if it has the amino acid sequence of a polypeptide found in nature. For example, a recombinantly produced polypeptide identical in sequence to a polypeptide found in nature is said to be a "naturally occurring" polypeptide. One of skill in the art can readily obtain sequences of naturally occurring polypeptides, e.g., from publicly available databases such as those available at the National Center for Biotechnology Information (NCBI) website (e.g., GenBank, OMIM, Gene) using a Gene ID or GenBank Accession Number disclosed herein. In some embodiments, a variant of a naturally occurring polypeptide is used. In some embodiments an agent disclosed herein or used in a method or composition herein (i.e., any such agent) is an isolated or purified agent.
Surprisingly, the present inventors observed that a high fat diet promotes intestinal stem cell and/or non-stem intestinal progenitor cell function, including, for example, increased proliferation and/or self-renewal of intestinal stem cells and/or enhanced number and/or function of non-stem intestinal progenitor cells. Without wishing to be bound by theory, it is believed that a high fat diet and/or a high fat diet mimetic stimulates proliferation and/or self-renewal of intestinal stem cells and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of PPAR-δ or a PPAR-δ target protein. Exemplary PPAR-δ target proteins include, without limitation, carnitine
palmitoyltransferase 1 A (CPT 1A), 3-hydroxy-3-methylglutaryl-CoA synthase 2 (HMGCS2), and fatty acid binding protein 1 (FABP 1 ).
PPAR-δ
The PPAR-δ gene (also known as FAAR, NR1 C2, NUC1 , NUCI, NUCII, PPARB, PPARD; see Gene ID: 5467 for information pertaining to the human PPAR-δ gene; Gene ID: 19015 for information pertaining to the mouse PPAR-δ gene; Gene ID: 25682 for information pertaining to the rat PPAR-δ gene; Accessions: NP_001 165289.1 for information pertaining to human PPAR-δ protein isoform 1 , NP_803184.1 for information pertaining to human
ΡΡΑΡν-δ protein isoform 2, NP_001 165290.1 for information pertaining to human PPAR-δ protein isoform 3, NP__001 165291 .1 for information pertaining to human PPAR-δ protein isoform 4, P35396.1 for information pertaining to mouse PPAR-δ protein, and AAC52419.1 for information pertaining to rat PPAR-δ protein) encodes a member of the peroxisome proliferator-activated receptor (PPAR) family of nuclear hormone receptors that bind peroxisome proliferators to regulate the number and size of peroxisomes made by cells. PPARs regulate a variety of bioprocesses, and the protein encoded by this gene is a potent inhibitor of ligand-induced transcription activity of PPAR alpha and PPAR gamma. PPAR-δ protein is believed to function as an integrator of transcription repression and nuclear receptor signaling, and expression of the PPAR-δ gene is elevated in colorectal cancer cells.
CARNITINE PALMITOYLTRANSFERASE J A (CPTl A)
CPTl A (also known as CPTl, GPT1 -L, and L-CPT1 ; see, e.g., Gene ID: 1374 for information relating to the human CPTl A gene; Gene ID: 12894 for information pertaining to the mouse CPTl A gene; Gene ID: 25757 for information pertaining to the rat CPT1A gene; Accession: NP_001867.2 for information relating to human CPT l A isoform 1 protein;
NP__001 027017.1 for information relating to human CPTl A isoform 2 protein; Accession: P97742.4 for information relating to mouse CPTl A protein; Accession: P32198.2 for information relating to rat CPTl A protein) is responsible for catalyzing the transfer of acyl groups of long-chain fatty acid-CoA conjugates onto carnitine, which is an important step for mitochondrial uptake of long-chain fatty acids and their subsequent beta-oxidation in mitochondria. In some embodiments, the CPTl A comprises a PPAR-δ target gene.
3-HYDROXY-3-METHYLGL UTARYL-COA SYNTHASE 2 (HMGCS2)
HMGCS2 (see, e.g., Gene ID: 3 158 for information pertaining to the human
HMGCS2 gene; Gene ID: 15360 for information pertaining to the mouse HMGCS2 gene; Gene ID: 24450 for information pertaining to the rat HMGCS2 gene; Accession:
NP_005509.1 for information relating to human HMGCS2 isoform 1 protein;
NP_001 1 59579.1 for information relating to human HMGCS2 isoform 2 protein; Accession: P54869.2 for information pertaining to mouse HMGCS2 protein; and Accession:
NP 7751 17,2 for information relating to rat H GCS2 protein) is a member of the HMG-coA synthase family, which is a mitochondrial enzyme that is responsible for catalyzing the first reaction of ketogenesis-the metabolic pathway that generates lipid-derived energy for organs under carbohydrate deprivation, for example fasting. In some embodiments, the HMGCS2 comprises a PPAR-δ target gene.
FA TTY ACID BINDING PROTEIN 1 (FABP1)
FABP1 (also known as FAB PL, L-FABP; see, e.g., Gene ID: 2168 for information pertaining to the human FABP1 gene; Gene ID: 14080 for information pertaining to the mouse FABP1 gene; Gene ID: 24360 for information pertaining to the rat FABP1 gene; Accession: NP__001434.1 for information relating to human FABP 1 protein; Accession: P12710.2 for information pertaining to mouse FABP 1 protein; and Accession: P02692.1 for information relating to rat FABP1 protein). In some embodiments, the FABP1 comprises a PPAR-δ target gene. FABP 1 is a fatty acid binding protein expressed in liver. Fatty acid binding proteins comprise a small, highly conserved, family of proteins that bind to long- chain fatty acids and other ligands that are hydrophobic. FABP 1 also binds to bile acids. Fatty acid binding proteins are believed to play roles in fatty acid uptake, transport, and metabolism.
In some embodiments, the population of cells is contacted with both an agent that increases the level and/or activity of PPAR-δ and an agent that increases the level and/or activity of a PPAR-δ target protein. In some embodiments, an agent that increases the level and/or activity of PPAR-δ increases the level and/or activity of a PPAR-δ target protein. In some embodiments, the agent increases the level and/or activity of both PPAR-δ and the PPAR-δ target protein. In some embodiments, the agent increases the level and/or activity of the PPAR-δ target protein in intestinal stem and/or non-stem cell progenitor cells.
The present disclosure contemplates the use of any agent which is capable of increasing the level and/or activity of PPAR-δ or a PPAR-δ target protein. It will be understood that the extent of increased level and/or activity may vary. Generally, agents described herein may, for example, increase the level and/or activity of PPAR-δ and/or a PPAR-δ target protein by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to level and/or activity of PPAR-δ and/or the PPAR-δ target protein in the absence of use of such agents. Agents can be assessed for their ability to increase the level and/or activity of PPAR-δ and/or a PPAR-δ target protein using assays which are available to the skilled artisan, for example, using the in vitro PPAR-δ activation assay, cell culture and transfection, in vitro transcription assay, and statistical methods described in U.S. Publication No. 2013/0102610, incorporated herein by reference in its entirety.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises a high fat diet mimetic. Aspects of the disclosure involve employing high fat diet mimetics. As used herein, "high fat diet mimetic" refers to an agent that attempts to reproduce one or more of the physiological effects that a high fat diet has on a mammal. As used herein, a "high fat diet" refers to a diet in which a significant percentage of total daily calories comprise calories from fats. In some embodiments, a high fat diet mimetic comprises an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. In some embodiments, the "high fat diet mimetic" increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein (e.g., in a population of cells in mammalian intestinal tissue, e.g., intestinal stem cells and/or non-stem intestinal progenitor cells) by at least about 5%, 10%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1 .8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold,
80 fold, 90 fold, 100, or 1000 fold or more relative to a reference level and/or activity of a PPAR-δ and/or a PPAR-δ target protein (e.g., the level and/or activity of PPAR-δ and/or a PPAR-δ target protein in a population of cells in mammalian intestinal tissue not contacted with a high fat diet mimetic). In some embodiments, the high fat diet mimetic stimulates proliferation and/or self-renewal of intestinal stem cells, e.g., by at least about 5%o, 10%>, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1.3 fold, 1 .4 fold, 1 .5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation and/or self-renewal of intestinal stem cells in the absence of treatment with the high fat diet mimetic. In some embodiments, the high fat diet mimetic stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 1 0%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1 .7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the high fat diet mimetic.
In some embodiments, the high fat diet mimetic comprises a fatty acid or a salt or ester thereof. In some embodiments the high fat diet mimetic comprises a derivative or a structural analog of a fatty acid. In some embodiments, the high fat diet mimetic comprises an essential fatty acid. In some embodiments, the fatty acid comprises a poly unsaturated fatty acid. In some embodiments, the fatty acid comprises an omega-3 fatty acid. In some embodiments, the fatty acid comprises an omega-3 fatty acid. In some embodiments, the fatty acid comprises a short chain polyunsaturated fatty acid, e.g., a SCPUFA in Table 1. Table 1 below lists exemplary short chain polyunsaturated acids (SCPUFAs) with a carbon chain length of 18 or less for use as high fat diet mimetics.
Table 1 - Exemplary SCPUFAs and sources
Figure imgf000030_0001
In some embodiments, the fatty acid comprises a long chain polyunsaturated fatty acid, e.g., a LCPLJFA in Table 2.
Table 2 below lists exemplary long chain PUFAs (LCPUFAs) with a carbon chain length of 20 or more for use as high fat diet mimetics.
Table 2 - Exemplary SCPUFAs and sources
Figure imgf000030_0002
In some embodiments, the high fat diet mimetic comprise palmitic acid. In some embodiments, palmitic acid comprises an in vitro HFD-mimetic. In some embodiments, the high fat diet mimetic comprises an analog or derivative of palmitic acid. In some embodiments, the high fat diet mimetic comprise DHA. In some embodiments, the high fat diet mimetic comprises EPA. In some embodiments, the high fat diet mimetic comprises ALA. In some embodiments, the high fat diet mimetic comprises an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein. In some embodiments, the high fat diet mimetic comprises a PPAR-δ agonist. In some embodiments, the high fat diet mimetic comprise a CPT 1 A agonist. In some embodiments, the high fat diet mimetic comprise a HMGCS2 agonist. In some embodiments, the high fat diet mimetic comprises a FABPl agonist. In some embodiments, the high fat diet mimetic comprises GW501516. In some embodiments, the high fat diet mimetic comprises GW 0742 CAS#[3 173 18-84-6]. In some embodiments, the high fat diet mimetic comprises L-l 65,041 CAS#[79558-09-l ]. In some embodiments, the high fat diet mimetic comprises CER-002 (being commercially developed by CERENIS Therapeutics).
PPAR-δ AGONISTS In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises a PPAR-δ agonist. In some embodiments, the PPAR-δ agonist increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein (e.g., in a population of cells in mammalian intestinal tissue, e.g., intestinal stem cells and/or non-stem intestinal progenitor cells) by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to a reference level and/or activity of a PPAR-δ and/or a PPAR-δ target protein (e.g., the level and/or activity of PPAR-δ and/or a PPAR-δ target protein in a population of cells in mammalian intestinal tissue not contacted with a PPAR-δ agonist). In some embodiments, the PPAR-δ agonist stimulates proliferation and/or self-renewal of intestinal stem cells, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1.2 fold, 1.3 fold, 1.4 fold,
1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation and/or self- renewal of intestinal stem cells in the absence of treatment with a PPAR-δ agonist. In some embodiments, the PPAR-δ agonist stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1 .6 fold, 1 .7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1 000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the PPAR-δ agonist. In some embodiments, the PPAR-δ agonists described herein comprise high fat diet mimetics. In some embodiments, the PPAR-δ agonists described herein comprise PPAR-δ target protein agonists. In some embodiments, the PPAR-δ agonists described herein comprise CPT1 A agonists. In some embodiments, the PPAR-δ agonists described herein comprise HMGGCS2 agonists. In some embodiments, the PPAR-δ agonists described herein comprise FABP 1 agonists.
In some embodiments, the PPAR-δ agonist is a compound of formula (I) and pharmaceutically acceptable salts and solvates thereof;
Figure imgf000032_0001
wherein X represents a COOH (or a hydrolysable ester thereof), X1 is O or S, and the depicted bond with a dashed line is a single bond; X2 represents O, S; R' and R2 independently represent H, CH3, OCH3 or halogen; n is 1 or 2; one of Y and Z is N and the other is S or O; y represents 1 or 2; each R3 independently represents CF3 or halogen. Methods of synthesizing compounds of formula (I) are described in U.S. Patent No. 6,710,063, which is incorporated herein by reference in its entirety.
Exemplary compounds of formula (I) include, without limitation, 2-[2-methyl-4-({4- methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-oxazol-5-yl} methoxy)phenoxy]acetic acid, 3-[2- methyl-4-({4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-thiazol-5- yl} methoxy)phenyl]propanoic acid, 3-[2-methyl-4-({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5-yl}methoxy)phenyl]propanoic acid,
Figure imgf000032_0002
(trifluoromethyl)phenyl]-l ,3-oxazol-5-yl}methyl)sLilfanyl]phenyl}acetic acid, 2-[2-methyl-4- ({4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-thiazol-5-yl}methoxy)phenoxy]acetic acid, 3- [4-({4-methyl-2-[4-(trifluoromethyl)phenyl]-l,3-thiazol-5-yl}methoxy)phenyl]propanoic acid, (E)-3-[2-methyl-4-({4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-oxazol-5- yl } methoxy)phenyl]-2-propenoic acid, methyl 3-[4-( {4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-thiazol-5-yl}methoxy)phenyl]propanoate, 2-{4-[({4-methyl-2-[4- (trifluoromethy!)phenyl]- l,3 hiazol-5-yl}methyl)sulfanyl]phenyl}acetic acid, 2-({4-[({4- methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-oxazol-5-yl}methyl)sulfanyl] phenyl} sulfanyl)acetic acid, 2-[methyl-4-({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-thiazol-5- yl} methoxy)anilino]acetic acid, 2-{3-chloro-4-[({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3- oxazol-5-yl} methyl)sulfanyl]phenyl} acetic acid, 2-[2-chloro-4-({4-methyl-2-[4- (trifluoromethyl)phenyl]- l ,3-oxazol-5-yl}methoxy)phenoxy]acetic acid, 2-[3-chloro-4-({4- methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-thiazol-5-yl}methoxy)phenyl]acetic acid, 2-{4-[({4- methyl-2-[4-(trifluoromethyi)phenyl]- l ,3-oxazol-5-yl}methyl)sulfanyl]phenoxy} acetic acid, (E)-3-[4-({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5-yl}methoxy)phenyl]-2- propenoic acid, 2-[4-({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5- yl} methoxy)phenoxy I acetic acid, 2-[3-fluoiO-4-({4-methyl-2-[4-(trifluoiOmcthyl)phenyl]- l ,3- thiazol-5-yi ) methoxy)phenyl]acetic acid, methyl 2-[3-chloro-4-({4-methyl-2-[4- (trifluoromethyl)phenyl]-l,3-oxazol-5-yl}methoxy)phenyl]acetate, 2-{2-methyl-4-[({4- methyl-2-[4-bromophenyl]-l,3-thiazol-5-yl}methyl )sulfanyl]phenoxy} acetic acid, ethyl 2- {2-methyl-4-[({4-methyl-2-[4-bromophenyl]-l,3-thiazol-5- yl}methyl)sulfanyl]phenoxy} acetate, 2-{2-methyl-4-[({4-methyl-2-[4-chlorophenyl]-l,3- thiazol-5-yl}methyl)sulfanyl]phenoxy}acetic acid, ethyl 2-{2-methyl-4-[({4-methyl-2-[4- chlorophenyl]-l,3-thiazol-5-yl}methyl)sulfanyl]phenoxy} acetate, 2-{2-methyl-4-[({4-methyl- 2-[4-fluorophenyl]-l,3-thiazol-5-yl}methyl)sulfanyl]phenoxy}acetic acid, ethyl 2-{2-methyl- 4-[( {4-methyl-2-[4-fluorophenyl] - 1 ,3 -thiazol-5 -y 1 } methyl)sulfanyl]phenoxy } acetate, 2- {2- methyI-4-[({4-methyl-2-[3,4-difluorophenyl]-l,3-thiazol-5- y[}methyl)sulfanyl]phenoxy}acetic acid, ethyl 2-{2-methyl-4-[({4-methyl-2-[3,4- difluorophenyl]-l,3-thiazol-5-yl}methyl)sulfanyl]phenoxy} acetate, 2-{2-methyI-4-[({4- methyl-2-[3,4-dichlorophenyl]-l,3-thiazol-5-yl}raethyl)sulfanyl]phenoxy} acetic acid, ethyl- 2-{2-methyl-4-[({4-methyl-2-[3,4-dichlorophenyl]-l,3-thiazol-5- yl}methyl)sulfanyl]phenoxy} acetate, 2-{2-methyl-4-[({4-methyl-2-[3,5- bis(trifluoromethyl)phenyl]-l ,3-thiazol-5-yl}methyl)sulfanyl]phenoxy}acetic acid, ethyl 2- {2-methyl-4-[({4-methyl-2-[3,5-bis(trifluorornethyl)phenyl]-l,3-thiazol-5- yl}methyl)sulfanyl]phenoxy} acetate, and ethyl 2-{2-methyl-4-[({4-methyl-2-[3-fluoro-4- (trifluoromethyl )phenyl]-l,3-thiazol-5-yl}methyl)sulfanyl]phenoxy} acetate.
In some embodiments, the PPAR-δ agonist is a compound of formula (II) and pharmaceutically acceptable salts
Figure imgf000033_0001
wherein R is a hydrogen atom, an alkyl group having 1-8 carbon atoms, an alkyl group having 1-8 carbon atoms and a halogen atom substituent, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1-8 carbon atom and a 3-7 membered substituent, an arylalkyl group that has a C6-ioaryl portion and alkyl portion and optionally has a substituent, or an aryl or heterocyclic group which optionally has a substituent; R2 is a hydrogen atom, an alkyl group having 1-8 carbon atoms, an alkyl group having 1-8 carbon atoms and a halogen atom substituent, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cyc!oalkal group, an alkyl group having 1-8 carbon atom and a 3-7 membered substituent, an arylalkyl group that has a C6-io ryl portion and C alkyl portion and optionally has a substituent, or heterocyclic group which optionally has a substituent; A is O, S, or NR5 in which R5 is H or Ci.g, alkyl; each of X1 and X2 independently is a bond, O, S(0)p in which p is an integer of 0 to 2, C(=0), C(=N— OR6) in which R6 is H or C|.8) alkyl; C(=0)NH, NHC(=0), S02NH, NHS02, CH(OR7) in which R7 is H or C,.8 alkyl, CH=CH, or C≡C; Y is an alkylene chain having 1 -8 carbon atoms and optionally a substituent; Z is O or S; each of R3 and R4 independently is an alkyl group having 1 -8 carbon atoms and optionally a substituent; and R8 is a hydrogen atom or an alkyl group having 1 -8 carbon atoms; provided that X2 is neither O nor S(0)p when X1 is a bond, while X2 is not a bond when X ' is C(=0)NH. Methods of synthesizing compounds of formula (II) are described in U.S. Patent No.
6,678,552, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is an oxazole derivative compound of formu la (III) and pharmaceutically acceptable salts thereof:
Figure imgf000034_0001
wherein R1 1 is an alkyl group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms and 1 -3 halogen atom substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom and a 3-7 membered substituent, or a phenylalkyl group having C|„4 alkyl portion, phenyl group, naphthyl group, pyridyl group, thienyl group, furyl group, quinolyl group, benzofuranyl group or benzothienyl group which optionally contains a substituent of halogen, hydroxy!, nitro, amino, Q.g alkyl, Q.g alkyl having 1 -3 halogen substituents,
Figure imgf000034_0002
alkoxy, Q .g alkoxy having 1 -3 halogen substituents, phenyl, benzyl, phenyloxy, benzoyl or pyridyl; R12 is an alkal group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms and 1 -3 halogen atom substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom and a 3-7 membered substituent, or a phenylalkyl group having CM alkyl portion, naphthyl group, pyridyl group, thienyl group, furyl group, quinolyl group, benzofuranyl group or benzothienyl group which optionally contains a substituent of halogen, hydroxyl, nitro, amino, C |.¾ alkyl, Ci-8 alkyl having 1 -3 halogen substituents,
Figure imgf000034_0003
alkoxy, C,.8 alkoxy having 1 -3 halogen substituents, phenyl, benzyl, phenyloxy, benzoyl or pyridyl; each of X" and X12 independently is a bond, S(0)q in which q is an integer of 0 to 2, C(=0), C(=N— OR16) in which R, 6 is H or C,_8 alkyl; C(=0)NH, NHC(=0), S02NH, NHS02, CH(OR17) in which R17 is H or C,-8 alkyl, CH=CH, or C≡C; Y1 is an alkylene chain having 1 -8 carbon atoms and optionally a C]_8 alkyl or C\.s alkoxy substituent; Z' is O or S; each of R13 and R14 independently is an alkyl group having 1 -8 carbon atoms and optionally a halogen or
Figure imgf000035_0001
alkoxy substituent; provided that X12 is neither O nor S (0)q when X1 1 is a bond, while X12 is not a bond when X11 is C(=0)NH. Methods of synthesizing compounds of formula (III) are described in U.S. Patent No. 6,678,552, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a thiazole derivative compound of formula IV) and pharmaceutically acceptable salts thereof:
Figure imgf000035_0002
wherein each of R21 and R22 independently is an alkyl group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms and 1 -3 halogen atom substituents, an alkenyl group having 2- 8 carbon atoms, an a!kynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom and a 3-7 membered substituent, or a phenylalkyl group having Q .4 alkyl portion, phenyl group, naphthyl group, pyridyl group, thienyl group, furyl group, quinolyl group, benzofliranyl group or benzothienyl group which optionally contains a substituent of halogen, hydroxyl, nitro, amino, Cj.g alkyl, C].g alkyl having 1 -3 halogen substituents, Q.g alkoxy, Q.g alkoxy having 1 -3 halogen substituents, phenyl, benzyl, phenyloxy, benzoyl or pyridyl; each of X21 and X22 independently is a bond, S(0)r in which r is an integer of 0 to 2, C(=0), C(=N— OR26) in which R26 is H or C ,.8 alkyl; C(=0)NH, NHC(=0), S02NH, NHS02, CH(OR27) in which R27 is H or C,_8 alkyl, CH=CH, or C=C; Y2 is an alkylene chain having 1 -8 carbon atoms and optionally a Q.g alkyl or Ci_8 alkoxy substituent; Z2 is 0 or S; each of R23 and R24 independently is an alkyl group having 1 -8 carbon atoms and optionally a halogen or Cj_8 alkoxy substituent; provided that X22 is neither O nor S(0)r when X21 is a bond, while X22 is not a bond when X2i is C(=0)NH. Methods of synthesizing compounds of formula (IV) are described in U.S. Patent No. 6,678,552, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a compound of formula (V):
Figure imgf000036_0001
wherein ARYL is phenyl or pyridinyl, wherein said phenyl or pyridinyl is optionally substituted with one or more substituents selected from the group consisting of halogen, Cl - 6alkyl, C2-6alkenyl, Cl -6alkoxy, Cl -6perfluoroalkyl,Cl-6alkylthio, hydroxy, hydroxyCl - 6alkyl, Cl -4acyloxy, nitro, cyano, C l -6alkylsuIfonyl, amino, Cl -6alkylainino and C I - 6alkoxycarbonyl; Z is 0(CH2)n, S02(CH2)n, (CH2)nY(CH2)n,(CH2)nCO, 0(CH2)nCO, or (CH2)nY(CH2)nCO wherein Y is NR3, O or S and R3 is selected from the group consisting of H, C l -6alkyl, C3-8cycloalkyl, C l -6alkyl, C3-8cycloalkyl and benzyl and n is
independently an integer from 1 to 5; X is NR3, O or S wherein R3 is as defined above; Rl is H, halogen, Cl-6alkyl, Cl -6alkoxy, C l -6perfluoroalkyl; hydroxyC16~alkyl, nitro, cyano, and C I -6aIkyIamino; and R2 is substituted or unsubstituted phenyl, pyridinyl or thienyl wherein the substituents are selected from the group consisting of halogen, Cl-6alkyi, C2-6alkenyl, Cl-6 eperfluoroalkyl, C l -6alkylthio, hydroxy, hydroxyCl -6alkyl, Cl -6acyloxy, nitro, cyano, Cl-6alkylsulfonyl, amino, Cl-6alkylamino and C 1 -6alkoxycarbonyl; with the proviso that when Z is 0(CH2)n or S02(CH2)n, and ARYL is phenyl then R2 is other than phenyl; or a stereoisomer, a tautomer or a solvate thereof or a pharmaceutically acceptable salt thereof. Methods of synthesizing compounds of Formula (V) are described in PCT Publication WO/2005/097763, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a compound of formula (VI):
Figure imgf000036_0002
R], R2, R3 and R, are independently selected from the group comprising H, F, CI, Br,— CF3, (Ci-Oalkyl, (C0-C4)alkylene-O— (C0-C4)alkylene-H, SCH3, S(0)CH3, S(0)2CPI3, CN,— OCF3,— OCHF2, and ~-OCH2F;
Z is a bond or— CP12;
Y is O,— S—— S(O) or— S(0)2;
W is— CH2 or— CH2CH2;
one of U and V is N the other is— S— or— O— ;
R5 is selected from the group comprising of (CpCg) alkyl, (C| -C6)alkylene-0— (C0-C4) alkylene-H, (C0-C6)alkylene-phenyl, (CrC6)alkylene-0— (C0-C4)alkylene-phenyl, (C3- C6)cyc!oalkyl, (C2-C8)alkenyl, and where (Ci-Cg)alkyl or alkylene can be substituted 1 -2 . times by—OH or— O— <Ci -C4)alkyl;
R6, R7 are independently selected from the group comprising H, F, Br,— CF3,— OCF3, (Cr C6)alkyl, (C0-C4)alkylene-O— (C0-C4)alkylene-H,— SCF3,— SF5,— OCF2— CHF2,—
OCHF2,— OCH2F, O-phenyl, phenyl, N02;
as well as their physiologically acceptable salts and tautomeric forms. Methods of synthesizing compounds of Formula (VI) are described in PCT Publication WO2005/097786, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is selected from the group consisting of 2- {2-methyl-4[( {4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3-rhiazol-5 yl} methyl)sulfanyl] phenoxy} acetic acid 2-{2-methyl-4[({4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-oxazol-5- yl} methyl) sulfanyl] phenoxy} acetic acid methyl 2-{4-[( {4-methyl-2-[4-(trifluoromethyl) phenyl]- !, 3-thiazol-5-yl}methyl)sulfanyl]phenoxy}acetate 2-{4-[({4-methyl-2-[4- (trifluoromethyl)phenyl]-l ,3-thiazol-5-yl} methyl) sulfanyl] phenoxy} acetic acid (E)-3- [2- methyl-4- ( 4-methyl-2- [4- (trifluoromethyl) phenyl]- 1 , 3-thiazol-5-<BR> yl} methoxy) phenyl]-2-propenoic acid 2- {3-chloro-4-[({4-methyl-2-[4-(trifluoromethyl)phenyl]-l ,3- thiazol-5-yl} methyl) sulfanyl] phenyl} acetic acid.
In some embodiments, the PPAR-δ agonist is selected from the group consisting of [3-[2-[4-isopropyl-2-(4-trifluoromethyl)phenyl-5-thiazolyl]ethyl]-5-methyl-l ,2-benzisoxazol- 6-yl]oxyacetic acid, [4-[3-[2-(4-trifluoromethyl)phenyl-4-isopiOpyl-5-thiazolyl]propionyl]2- methyl phenoxy] acetic acid or [4-[3-[2-(2-hydroxy-4-chIorophenyl)-5-isopropyl-4- oxazolyl]propionyl]-2-methylphenoxy]acetic acid, or a pharmacologically acceptable salt thereof, as described in U.S. Publication No. 2012/0270910, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is {2-methyl-4- [4-methyl-2- (4- trifluoromethyl phenyl) thiazol-5-ylmethylthio] phenoxy} -acetic acid and pharmaceutically acceptable safts, solvates, and hydrolyzable esters thereof. Exemplary physiologically acceptable salts include conventional salts formed from pharmaceutical acceptable inorganic or organic acids or bases as well as quaternary ammonium acid addition salts. More specific examples of suitable acid salts include hydrochloric, hydrobromic, sulfuric, phosphoric, nitric, perchloric, fumaric, acetic, propionic, succinic, glycolic, formic, lactic, maleic, tartaric, citric, palmoic, malonic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, fumaric, toluenesulfonic, methanesulfonic, naphthalene-2-sulfonic, benzenesulfonic hydroxynaphthoic, hydroiodic, malic, steroic, tannic and the like, as described in further detail in PCX
Publication WO/2002/028433, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a phenoxy acetic acid compound selected from the group consisting of: (Z)-[2-Methyl-4-[3-(4-methylphenyl)-3-[4-[3- (morpholin-4-yl)propynyl]phenyl]allyloxy]-phenoxy]acetic acid; (E)-[2-Methyl-4-[3-[4-[3- (pyrazol-l -yl)prop- l -ynyl]phenyI]-3-(4-trifluoromethylphenyl)-allyloxy]phenoxy]acetic acid; (E)-[2-Methyl-4-[3-[4-[3-(morpholin-4-yl)propynyl]phenyl]-3-(4-trifluoromethylphenyl) allyloxy]-phenoxy]acetic acid; (E)-[2-Methyl-4-[3-(4-methylphenyl)-3-[4-[3-(morpholin-4- yl)propynyl]phenyl]allyloxy]-phenoxy]acetic acid; and (Z)-[2-Methyl-4-[3-[4-[3-(morpholin- 4-yl)propynyl]phenyl]-3-(4-trifluoromethylphenyl) allyloxy]-phenoxy]acetic acid; or a pharmaceutically acceptable salt thereof, as described further in U.S. Patent No. 8,551 ,993, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a compound of Formula (VII)
or a pharmaceutically acceptable salt thereof, wherein:
X is selected from O, S, OCH2, and SCH2;
X ' is O or S;
Ρν' is selected from H, Q.galkyl, C2-8 aIkenyI, aryl, heteroaryl, C3_io cycloalkyl, and a heterocyclyi, wherein each R1 group is substituted with 0-4 Rl a; Rla, at each occurrence, is selected from S substituted with 0-1 Rlb, O substituted with 0-1 R, b, halogen, NH2 substituted with 0-2 R, b,— CN, NO.-. d.6alkyl substituted with 0-3 Rlb, C2. 6 alkenyl substituted with 0-2 Rlb, C2_6alkynyl substituted with 0-2 Rlb, aryl substituted with 0- 2 Rib, heteroaryl substituted with 0-2 Rlb, C3,,0 cycloalkyl substituted with 0-2 Rl b, and heterocycle substituted with 0-2 Rl b;
Rlb, at each occurrence, is selected from S substituted with 0- 1 Rl c, O substituted with 0-1 Rlc, halogen, methanesulfonyl, NH2 substituted with 0-2 Rlc,— CN, N02, Ci-6alkyl substituted with 0-3 Rl c, C2.6alkenyl substituted with 0-2 Rl c, aryl substituted with 0-2 R'°, heteroaryl substituted with 0-2 Rl c, C3_io cycloalkyl substituted with 0-2 Rl c, and a heterocycle substituted with 0-2 R, c;
Rlc, at each occurrence, is selected from S substituted with 0-1 Rld, O substituted with 0-1 Rld, halogen, NH2 substituted with 0-2 Rld,— CN, N02, C,.6 alkyl substituted with 0-2 Rld, C2. 6 alkenyl substituted with 0-2 Rld, aryl substituted with 0-2 Rl d, heteroaryl substituted with 0-2 R,d, C3.10 cycloalkyl substituted with 0-2 R , and a heterocycle substituted with 0-2 RId; Rld, at each occurrence, is selected from OH, SH, S, O, halogen, NH2,— CN, N02, Ci-6 alkyl, C2.6alkenyl, aryl, CF , and OCF3;
R2 is selected from C-C- -R2 '. CH=CI I - -R2\ aryl substituted with 0-3 R2a, and heteroaryl substituted with 0-3 R2a;
R2a, at each occurrence, is selected from S substituted with 0-1 R2b, O substituted with 0-1 R2b, halogen, NH2 substituted with 0-2 R2b,— CN, N02, C,.6alkyl substituted with 0-2
Figure imgf000039_0001
C2. 6 alkenyl substituted with 0-2 R2b, aryl substituted with 0-2 R2b, heteroaryl substituted with 0-2 R2b, C3.10 cycloalkyl substituted with 0-2 R2b, and a heterocycle substituted with 0-2;
R2b, at each occurrence, is selected from S substituted with 0-1 R2c, O substituted with 0-1 R2c, halogen, methanesulfonyl, NH2 substituted with 0-2 R2c,— CN, N02, C1 -6alkyl substituted with 0-2 R2c, C2.6alkenyl substituted with 0-2 R2c, aryl substituted with 0-2 R2c, heteroaryl substituted with 0-2 R2c, C3.10 cycloalkyl substituted with 0-2 R2c, and a heterocycle substituted with 0-2 R2c;
R2c, at each occurrence, is selected from S substituted with 0-1 R2d, O substituted with 0-1 R2d, halogen, NH2 substituted with 0-2 R2d,— CN, N02, C,,6alkyl substituted with 0-2 R2d, C2. 6 alkenyl substituted with 0-2 R2d, aryl substituted with 0-2 R2d, heteroaryl substituted with 0-2 R2 , C3. 10 cycloalkyl substituted with 0-2 R2d, and a heterocycle substituted with 0-2 R2d R2d, at each occurrence, is selected from OH, SH, S, O, halogen, NH2,— CN, N02, Q.6 alkyl, C2.6alkenyl, aryl, CF3, and OCF3;
R3 is selected from halogen and Ci_6 alkyl substituted with 0-2 R3a; R' \ at each occurrence, is selected from OH, O, S, halogen, C(0)NH2, C(0)NH— C alkyl, and C(0)N(C aIkyl)2;
alternatively, R3 and R5e combine to form a 5, 6, or 7 membered ring consisting of carbon atoms and 0-2 heteroatoms selected from O, N, and S(0)o-2 and there are 0-2 ring double bonds in the bridging portion formed by R3 and R5e;
R4a, at each occurrence, is selected from H, halogen, and C]_6 alkyl substituted with 0-2 R ; R4d, at each occurrence, is selected from OH, O, halogen, NH2, NH— C1 -4 alkyl, and N(C)-4 alkyl)2;
R4b, at each occurrence, is selected from H, halogen, and Ci-6 alkyl substituted with 0-2 R c; R4e, at each occurrence, is selected from OH, O, halogen, NH2, NH— C|.4alkyl, and N(Ci„4 alkyl)2;
R4c, at each occurrence, is selected from H, halogen, and C1 -6 alkyl substituted with 0-2 R4f; R4f, at each occurrence, is selected from OH, O, halogen, NH2, NH— Ci.4 alkyl, and N(CM alkyl)2;
R5a, at each occurrence, is selected from H, halogen, CH3, and CH2CH3;
R5b, at each occurrence, is selected from H, halogen, CH3, and CH2CH3;
R5c, at each occurrence, is selected from H, halogen, CH3, and CH2CH3;
R5d, at each occurrence, is selected from H, halogen, CH3, and CH2CH3; and,
R5e, at each occurrence, is selected from H, halogen, CH3, and CH2CH3. Methods of synthesizing compounds of Formula (Vll) are described in U.S. Patent No. 8,217,086, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist is a compound of Formula (VIII) or a salt thereof:
Figure imgf000040_0001
wherein:
R 'is phenyl, naphthyl, pyridyl, thienyl, furyl, quinolyl or benzothienyl, any of which can have substituents selected from the group consisting of Cj .galkyl, C i_8alkyl having halogen, C^alkoxy, Cl-salkoxy having halogen, C 2-8alkenyl, C 2.8alkynyl, halogen, C 2-7acyl, benzoyl, hydroxyl, nitro, amino, phenyl and pyridyl;
R 2is Ci _8alkyl, Ci _8alkyl having halogen, C 2-8alkenyl, C 2.8alkynyl, 3-7 membered cycloalkyl, Ci _galkyl having 3-7 membered cycloalkyl, or Ci ^alkyl substituted with phenyl, naphthyl or pyridyl, any of which can have substituents selected from the group consisting of Ci .galkyl, Ci _salkyl having halogen, Ci .galkoxy, Ci .galkoxy having halogen, C 2-8alkenyl, C 2-8alkynyl, halogen, C 2-7acyl, benzoyl, hydroxyl, nitro, amino, phenyl and pyridyl;
A is oxygen, sulfur or NR 9in which R 9is hydrogen or Cj. 8alkyl; X is a Ci .8alkylene chain which can have substituents selected from the group consisting Of Ci .galky], Ci .galkoxy and hydroxyl and which can contain a double bond;
Y is C(=0), C(==N-OR 10), CH(OR H), CH=CH, C-C, or C(==CH 2) in which each of R 10and R " is hydrogen or Ci -8alkyl; each of R 3, R 4and R 5is hydrogen, Ci ,galkyl, Ci _8alkyl having halogen, Ci .galkoxy, Ci .galkoxy having halogen, C .8alkenyl, C 2-8alkynyl, halogen, Qi.n acyl, benzoyl, hydroxyl, nitro, amino, phenyl, or pyridyl;
B is CH or nitrogen;
Z is oxygen or sulfur; each of R 6and R 7is hydrogen, Ci .8alkyl, Ci _8alkyl having halogen; R 8is hydrogen or Ci _8alkyl; provided that at least one of R 3, R 4and R 5is not hydrogen;
or formula (IX) or a salt thereof:
Figure imgf000041_0001
wherein: each of R 'and R independently is a hydrogen atom, a halogen atom, nitro, an alkyl group having 1 -8 carbon atoms, an alkoxy group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkoxy group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atom which has a 3-7 membered cycloalkyl substituent, an aryl group having 6-10 carbon atoms which optionally has a substituent, an arylalkyl group which has a C 6-[o aryl portion and Ci .galkyl portion, a heterocyclic group which optionally has a substituent or a heterocyclic-alkyl group having an alkyl group of 1 -8 carbon atoms;
A is an oxygen atom, a sulfur atom, or NR 3in which R 3is a hydrogen atom or an alkyl group having 1 -8 carbon atoms; each of X and Z independently is -C(=0)-, -C(0)NH-, -C(=N-0R 4)-, -CH(OR 5)-, - NH(C=0)-, -NHSO 2-, -SO 2NH-, -CH=CH-, -C≡C-, or a bond in which each of R and R 5is a hydrogen atom or an alkyl group having 1 -8 carbon atoms; Y is an alkylene chain having 1 -8 carbon atoms;
or formula (X) or a salt thereof:
Figure imgf000042_0001
wherein: each of R "and R 1 independently is a hydrogen atom, a halogen atom, nitro, hydroxyl, amino, an alkyl group having 1 -8 carbon atoms, an alkoxy group having 1 -8 carbon atoms, an alkyl group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkoxy group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atoms which has a 3-7 membered cycloalkyl substituent, or a phenyl, naphthyl, benzyl, phenethyl, pyridyl, thienyl, furyl, quinolyl, or benzothienyl group which optionally has a substituent selected from the group consisting of a halogen atom, nitro, hydroxyl, amino, an alkyl group having 1 -8 carbon atoms, an alkoxy group having 1 -8 carbon atoms, an alkyl group having 1-8 carbon atoms which has 1 to 3 halogen substituents, an alkoxy group having 1 -8 carbon atoms which has 1 to 3 halogen substituents, an alkenyl group having 2-8 carbon atoms, an alkynyl group having 2-8 carbon atoms, a 3-7 membered cycloalkyl group, an alkyl group having 1 -8 carbon atoms which has a 3-7 membered cycloalkyl substituent, phenyl and pyridyl; each of X 'and Z ' independently is -C(=0)-, -C(0)NH-, -C(=N-0R '4)-, -CH(OR l s)-, -NH(C=0)-, -NHSO 2-, - SO 2NH-, -CH=CH-, -C≡C-, or a bond in which each of R 14and R 15is a hydrogen atom or an alkyl group having 1 -8 carbon atoms; Y ' is an alkylene chain having 1 -8 carbon atoms;
or formula (XI) or a salt thereof:
Figure imgf000042_0002
wherein:
A is O, S or NR 7in which R 7is hydrogen or C j.galkyl;
B ' is CW or N in which W is hydrogen or a bond; B 2is 0, S or NR 8in which R 8is hydrogen or C ^alkyl; each of X ' and X 2is O, S, NH, NHC(=0), C(=0), C(=N-0R CH(OR 10), C=C, ( ' (.' or a bond in which each of R 9and R ,0is hydrogen or C ^alkyl;
Y is a C ] .8alky!ene chain, which can be substituted with Ci _8alkyl or Cj _8alkyl substituted with 1-3 halogens; Z is NH, O or S; R ' is aryl, which can be substituted with a group or atom selected from the group consisting Of Ci .8alkyl, Ci _salkoxy, Ci _¾alkyl substituted with 1 -3 halogens, hydroxyl, nitro, amino, phenyl, pyridyl and halogen, or a heterocyclic group having five to eight membered ring comprising one to three hetero atoms selected from the group consisting of nitrogen, oxygen and sulfur and the other atoms consisting of carbon (benzene ring can be condensed with the heterocyclic ring);
R 2is C 2-8alkyl, Ci _8alkyl substituted with 1 -3 halogens, C 3.7cycloalkyl, C 2-8alkenyl, C 2. 8alkynyl, alkyl (comprising Ci ^alkyl moiety) substituted with aryl, which can be substituted with a group or atom selected from the group consisting of Ci .8alkyl, Ci .8alkoxy, Ci -8alkyl substituted with 1 -3 halogens, hydroxyl, nitro, amino, phenyl, pyridyl and halogen, or alkyl (comprising Ci _4alkyl moiety) substituted with a heterocyclic group having five to eight membered ring (comprising one to three hetero atoms selected from the group consisting of n itrogen, oxygen and sulfur and the other atoms consisting of carbon);
R 3is halogen, trifluoromethyl, Ci_8alkyl, C2-8alkenyl or C 28alkynyl; each of R4 and R5 is hydrogen, Ci_8alkyl or C].8alkyl substituted with 1 -3 halogens; and R 6is hydrogen, C^alkyl substituted with am ino, Ci_8alkyl or alkali metal; provided that each of Z and R3 is attached to the benzene ring, and X 2is not attached to the benzene ring. Methods of synthesizing compounds of Formulas V1II-XI are described in further detail in PCT Publication
WO/2008/154023, which is incorporated herein by reference in its entirety.
In some embodiments, the PPAR-δ agonist comprises 2-[2-methyl-4-[[4-methyl-2-[4- (trifluoromethyI)phenyl]- l ,3-thiazol-5-yl]methylsuIfanyl]phenoxy]acetic acid (GW501516) or an analog or derivative thereof.
In some embodiments, the PPAR-δ agonist comprises GW 0742 CAS#[3 173 18-84- 6] . In some embodiments, the PPAR-δ agonist comprises L- 165,041 CAS#[79558-09- l ] , In some embodiments, the PPAR-δ agonist comprises CER-002 (being commercially developed by CERENIS Therapeutics).
In some embodiments, the PPAR-δ agonist comprises a polyunsaturated fatty acid (PUFA). It has been reported that PUFAs activate PPAR-δ with micromolar affinity. As used herein, "PUFA" is used in its generally accepted meaning; it relates to fatty acids with at least 2 carbon-carbon double bonds (preferably 2 to 6, more preferably 4 or 5 or 6 carbon- carbon double bonds), preferably consisting of 1 6-24 carbon atoms (preferably 1 8-22 carbon atoms), and comprise n-3, n-6 and n-9 acids. Although the term PUFA defines free acids it is generally understood to also mean their salts and these acids in the form of their naturally occurring esters, i .e. as glycerides (comprising mono-, di- and triglycerides) and in form of esters into which they are converted, e.g. by transesterification, such as ethyl esters. PUFAs of preferred interest in the context of the present invention are n-3 and n-6 PUFAs, especially EPA (eicosapenta-5,8, 1 1 , 14, 1 7-enoic acid), DPA (docosapentaenoic acid), DHA
(docosahexa-4,7, 10, 13, 16, 19-enoic acid), GLA (-linolenic acid) and ARA (arachidonic acid), and stearidonic acid (cis-6,9, 12, 1 5-octadecatetraenoic acid; SD A), preferably of food-grade quality, as single compounds or in mixtures, preferably in the form of their esters, e.g., triglycerides, or ethyl esters, especially as components of oils obtained from marine animals, preferably from fish, from plants or by fermentation. They can be stabilized and/or deodorized by methods known in the art, e.g., by addition of antioxidants, emulsifiers, spices or herbs, such as rosemary or sage extracts. Edible oils and fat compositions comprising PUFAs are generally regarded as safe for human consumption.
In some embodiments, the PPAR-δ agonist is a SCPUFA listed in Table 1 .
In some embodiments, the PPAR-δ agonist is a LCPUFA listed in Table 2.
Saturated C16 and C I 8 fatty acids e.g. Palmitic and Stearic acids occur both in animal and plant derived fats and can be desatu rated by mammals. For example Stearic acid is desaturated in mammals to give oleic acid (CI 8: 1 co9). The marine PUFAs e.g. EPA, DPA and DHA, by way of contrast, contain long chain fatty acids with a carbon chain length of C20-22 respectively. Mammals, and in particular humans, cannot produce the LCPUFAs by further de-saturation of ω-9 fatty acids, nor chain-elongate ω3 and co6 plant derived fatty acids efficiently. These LCPUFAs can be obtained from diet, and marine lipids are a suitable economic source.
In some embodiments, the PPAR-δ agonist comprises an eicosanoid. It has been reported that eicosanoids activate PPAR-δ with micromolar affinity. Exemplary eicosanoids include, without limitation, PGAI, its semisynthetic analog (cPGI), and PGE2.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises an agonist of a transcriptional coactivator to PPAR- δ (e.g., an agonist of PGC1 alpha).
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises an agonist of a binding partner to PPAR-δ that heterodimerizes with PPAR-δ to form a transcription factor complex that binds to cognate sequences in promoter regions of PPAR-δ target genes (e.g., an agonist or ligand for retinoid X receptor (RXR).
In some embodiment, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises an inhibitor of a transcriptional repressor of PPAR- -δ and/or RXR. The term "inhibitor" encompasses agents that inhibit (decrease, reduce) the expression or activity of a target. The term "inhibitor" encompasses agents that inhibit expression and/or inhibit one or more activities of a molecule or complex of interest (the "target"). For example, in various embodiments an agent is an "inhibitor" of a target if one or more activities of the target is reduced in the presence of the compound, or as a consequence of its use, as compared with in the absence of the compound, and/or if the level or amount of the target is reduced in the presence of the compound, or as a consequence of its use, as compared with in the absence of the compound. In certain embodiments, an inhibitor acts directly on a target in that it physically interacts with the target. In some embodiments, an inhibitor acts indirectly, e.g., by inhibiting a second molecule that is needed for synthesis or activity of the target. In some embodiments, an inhibitor is an antagonist. Methods of inhibiting encompass methods that result in a decreased amount of a target and methods that interfere with one or more functions (activities) of a target. In some embodiments, a target is inhibited by inhibiting or interfering with its expression or post-translational processing, so that a decreased amount of functional target is produced, resulting in a decreased overall activity of the target in a cell or system. A variety of methods useful for inhibiting or interfering with expression can be used in various embodiments. In general, such methods result in decreased synthesis of a mRNA and/or polypeptide and as a result, a reduction in the total level of activity present. Other means of inhibition include interfering with proper localization, secretion, or co- or post-translational processing, or promoting increased degradation. Methods of inhibiting activity can include binding to a target or to a receptor or co-receptor for the target and thereby blocking the target from interacting with its receptor(s) or with other molecule(s) needed for activity of the target. In some embodiments an inhibitor binds to an active site or catalytic residue or substrate binding site of an enzyme or blocks dimerization or other protein-protein interactions, etc. For example, in some embodiments a protein that acts as a dimer is inhibited using an agent that blocks dimerization. In some embodiments, an inhibitor comprises an RNA i agent, e.g., an siRNA or shRNA, or an antisense oligonucleotide, that inhibits expression of a target. In some embodiments, an inhibitor comprises an antibody or aptamer or small molecule that binds to and inhibits a target. In some embod iments an inhibitor comprises an agent that acts in a dominant negative fashion to inhibit a target. A dominant negative agent may comprise a fragment of a target molecule that lacks one or more domains necessary for function. For example, in some embodiments a dominant negative form of a TF comprises a DNA binding domain and/or dimerization domain but lacks an activation domain. In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein comprises an inhibitor of degradation of PPAR-δ protein and/or a PPAR-δ target protein. In some embodiments, the agent comprises GW501516 or an analog or derivative thereof.
Exemplary analogs and/or derivatives of GW50156 may be found in the following U.S. Patents and/or published U.S. Applications: US7084161 , US7091225, US7091237, US7105551 , US7176204. US6710063, US6723740, US6518290, US2009149519,
US201 1245263, US2010240580, US2012004165, US2012004166, US2012004167, US2012004187, US2012015936, US2012022039, US201 1 1 12097, US201 1 1 18321 , US201 1 178134, US201 1 183998, US201 1207738, US201 1224263, US7683 181 , US7709481 , US7709490, US7709494, US7713988, US7718669, US7732440, US7759366, US7772257, US7772268, US7834030, US785 1493, US7855289, US7858647, US7229998, US7345178, US7439259, US7449468, US8044198, US8088928, US8093401 , US8101583, US8106023, US8148375, US8148395, US8163908, US81 73674, US8178536, US8207146, US7897616, US7897625, US7910612, US7923468, US7956085, US7982050, US7612104, US7648999, US7652045, US7655679, US7241901 , US7265137, US2004242459, US2007149580, US2007179300, US2007190079, US2010249097, US2010261645, US2010286133, US2010331295, US201 1046105, US201 1053947, US201 1059910, US2010105719, US201 01 52246, US2010190801 , US2009163481 , US2009203908, US2009240058, US2009264402, US2009264403, US2009298896, US2010029949, US2007249519, US2008274947, US2008287409, US2009012133, US2009076002, US2009082339, US2009082391 , US2007037865, US2004029938, US2004072838, US2003077298, US2003 1 71377, US8236831 , US8003636, US8003677, each of which are incorporated herein by reference in their entirety.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein is a nucleic acid sequence that encodes PPAR-δ. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a nucleic acid encoding the PPAR-δ target protein. In some embodiments, the agent comprises a nucleic acid encoding CPT1 A. In some embodiments, the agent comprises a nucleic acid encoding HMGCS2. In some embodiments, the agent comprises a nucleic acid encoding FABP 1.
"Nucleic acid" is used interchangeably with "polynucleotide" and encompasses polymers of nucleotides. "Oligonucleotide" refers to a relatively short nucleic acid, e.g., typically between about 4 and about 1 00 nucleotides (nt) long, e.g., between 8-60 nt or between 10-40 nt long. Nucleotides include, e.g., ribonucleotides or deoxyribonucleotides. In some embodiments a nucleic acid comprises or consists of DNA or RNA. In some embodiments a nucleic acid comprises or includes only standard nucleobases (often referred to as "bases"). The standard bases are cytosine, guanine, adenine (which are found in DNA and RNA), thymine (which is found in DNA) and uracil (which is found in RNA), abbreviated as C, G, A, T, and U, respectively. In some embodiments a nucleic acid may comprise one or more non-standard nucleobases, which may be naturally occurring or non- natural ly occurring (i.e., artificial; not found in nature) in various embodiments. In some embodiments a nucleic acid may comprise chemically or biologically modified bases (e.g., alkylated (e.g., methylated) bases), modified sugars (e.g., 2'-0-alkyribose (e.g., 2'-0 methylribose), 2'-fluororibose, arabinose, or hexose), modified phosphate groups (e.g., phosphorothioates or 5'-N-phosphoramidite linkages). In some embodiments a nucleic acid comprises subunits (residues), e.g., nucleotides, that are linked by phosphodiester bonds. In some embodiments, at least some subunits of a nucleic acid are linked by a non- phosphodiester bond or other backbone structure. In some embodiments, a nucleic acid comprises a locked nucleic acid, morpholino, or peptide nucleic acid. A nucleic acid may be linear or circular in various embodiments. A nucleic acid may be single-stranded, double- stranded, or partially double-stranded in various embodiments. An at least partially double- stranded nucleic acid may be blunt-ended or may have one or more overhangs, e.g., 5' and/or 3 ' overhang(s). Nucleic acid modifications (e.g., base, sugar, and/or backbone
modifications), non-standard nucleotides or nucleosides, etc., such as those known in the art as being useful in the context of RNA interference (RNAi), aptamer, or anti sense-based molecules for research or therapeutic purposes may be incorporated in various embodiments. Such modifications may, for example, increase stability (e.g., by reducing sensitivity to cleavage by nucleases), decrease clearance in vivo, increase cell uptake, or confer other properties that improve the potency, efficacy, specificity, or otherwise render the nucleic acid more suitable for an intended use. Various non-limiting examples of nucleic acid
modifications are described in, e.g., Deleavey GF, et al, Chemical modification of siRNA. Curr. Protoc, Nucleic Acid Chem. 2009; 39: 16.3.1 - 16.3.22; Crooke, ST (ed.) Antisense drug technology: principles, strategies, and applications, Boca Raton: CRC Press, 2008; Kurreck, J. (ed.) Therapeutic oligonucleotides, RSC biomolecular sciences. Cambridge: Royal Society of Chemistry, 2008; U. S. Patent Nos. 4,469,863; 5,536,821 ; 5,541 ,306; 5,637,683; 5,637,684; 5,700,922; 5,717,083; 5,719,262; 5,739,308; 5,773,601 ; 5,886, 165; 5,929, 226; 5,977,296; 6, 140,482; 6,455,308 and/or in PCT application publications WO 00/56746 and WO
01/ 14398. Different modifications may be used in the two strands of a double-stranded nucleic acid. A nucleic acid may be modified uniformly or on only a portion thereof and/or may contain multiple different modifications. It will be appreciated that naturally-occurring allelic variants of the reference sequence for a particular nucleic acid or protein may exist in the population, and such variants may be used in certain embodiments. It will also be appreciated that variants arising due to alternative splicing may exist, which are encompassed herein in various embodiments.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein is a functional fragment of a nucleic acid sequence that encodes PPAR-δ. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a functional fragment of a nucleic acid sequence that encodes the PPAR-δ target protein. In some embodiments, the agent comprises a functional fragment of a nucleic acid sequence that encodes CPT1A. In some embodiments, the agent comprises a functional fragment of a nucleic acid sequence that encodes HMGCS2. In some
embodiments, the agent comprises a functional fragment of a nucleic acid sequence that encodes FABP 1 .
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein is a variant of a nucleic acid sequence that encodes PPAR-δ. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a variant of a nucleic acid sequence that encodes the PPAR-δ target protein. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes CPT1 A. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes HMGCS2. In some embodiments, the agent comprises a variant of a nucleic acid sequence that encodes FABP 1.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein is a sequence that is homologous to a nucleic acid sequence that encodes PPAR-δ. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a sequence that is homologous to a nucleic acid sequence that encodes the PPAR-δ target protein. In some embodiments, the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes CPT1A. In some embodiments, the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes HMGCS2. In some embodiments, the agent comprises a sequence that is homologous to a nucleic acid sequence that encodes FABP l .
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or the PPAR-δ target protein is a PPAR-δ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a PPAR-δ target protein. In some embodiments, the agent comprises a CPT1 A protein. In some embodiments, the agent comprises a HMGCS2 protein, A "polypeptide" refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule comprising one or more polypeptides. A peptide is a relatively short polypeptide, typically between about 2 and 100 amino acids (aa) in length, e.g., between 4 and 60 aa; between 8 and 40 aa; between 10 and 30 aa. The terms "protein", "polypeptide", and "peptide" may be used interchangeably. In general, a polypeptide may contain only standard amino acids or may comprise one or more non-standard amino acids (which may be naturally occurring or non-naturally occurring amino acids) and/or amino acid analogs in various embodiments. A "standard amino acid" is any of the 20 L-amino acids that are commonly utilized in the synthesis of proteins by mammals and are encoded by the genetic code. A "non-standard amino acid" is an amino acid that is"' not commonly utilized in the synthesis of proteins by mammals. Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and non-naturally occurring amino acids. In some embodiments, a non-standard, naturally occurring amino acid is found in mammals. For example, orn ithine, citrulline, and homocysteine are naturally occurring nonstandard amino acids that have important roles in mammalian metabolism. Exemplary nonstandard amino acids include, e.g., singly or multiply halogenated (e.g., fluorinated) amino acids, D-amino acids, homo-ammo acids, N-alkyl amino acids (other than proline), dehydroamino acids, aromatic amino acids (other than histidine, phenylalanine, tyrosine and tryptophan), and α,α disubstituted amino acids. An amino acid, e.g., one or more of the amino acids in a polypeptide, may be modified, for example, by addition, e.g., covalent linkage, of a moiety such as an alky] group, an alkanoyl group, a carbohydrate group, a phosphate group, a lipid, a polysaccharide, a halogen, a linker for conjugation, a protecting group, etc. Modifications may occur anywhere in a polypeptide, e.g., the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. A given polypeptide may contain many types of modifications. Polypeptides may be branched or they may be cyclic, with or without branching. Polypeptides may be conjugated with, encapsulated by, or embedded within a polymer or polymeric matrix, dendrimer, nanoparticle, microparticle, liposome, or the like. Modification may occur prior to or after an amino acid is incorporated into a polypeptide in various embodiments. Polypeptides may, for example, be purified from natural sources, produced in vitro or in vivo in suitable expression systems using recombinant DNA technology (e.g., by recombinant host cells or in transgenic animals or plants), synthesized through chemical means such as conventional solid phase peptide synthesis, and/or methods involving chemical ligation of synthesized peptides (see, e.g., Kent, S., J Pept Sci , 9(9): 574-93, 2003 or U. S. Pub. No. 200401 15774), or any combination of the foregoing. One of ordinary skill in the art will understand that a protein may be composed of a single amino acid chain or multiple chains associated covalently or noncovalently.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or the PPAR-δ target protein is a functional domain or fragment of PPAR-δ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a functional domain or fragment of the PPAR-δ target protein. In some embodiments, the agent comprises a functional domain or fragment of CPT1 A protein. In some embodiments, the agent comprises a functional domain or fragment of HMGCS2 protein. In some embodiments, the agent comprises a functional domain or fragment of FAB P I protein.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or the PPAR-δ target protein is a functional homolog of PPAR-δ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a functional homolog of the PPAR-δ target protein. In some embodiments, the agent comprises a functional homolog of CPT1 A protein. In some embodiments, the agent comprises is a functional homolog of HMGCS2 protein, in some embodiments, the agent comprises is a functional homolog of FABP1 protein.
In some embodiments, the agent that increases the level and/or activity of PPAR-δ and/or the PPAR-δ target protein is a fusion protein comprising PPAR-δ protein. In some embodiments, the agent that increases the level and/or activity of the PPAR-δ target protein is a fusion protein comprising the PPAR-8 target protein. In some embodiments, the agent is a fusion protein comprising CPT 1A protein. In some embodiments, the agent is a fusion protein comprising HMGCS2 protein. In some embodiments, the agent is a fusion protein comprising FABP 1 protein.
A "variant" of a particular polypeptide or polynucleotide has one or more alterations (e.g., additions, substitutions, and/or deletions, which may be referred to collectively as "mutations") with respect to the polypeptide or polynucleotide, which may be referred to as the "original polypeptide" or "original polynucleotide", respectively. An addition may be an insertion or may be at either terminus. A variant may be shorter or longer than the original polypeptide or polynucleotide. The term "variant" encompasses "fragments". A "fragment" is a continuous portion of a polypeptide or polynucleotide that is shorter than the original polypeptide. In some embodiments a variant comprises or consists of a fragment. In some embodiments a fragment or variant is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%o, 97%, 98%o, 99%>, or more as long as the original polypeptide or polynucleotide. A fragment may be an N-terminal, C-terminal, or internal fragment. In some embodiments a variant polypeptide comprises or consists of at least one domain of an original polypeptide. In some embodiments a variant polynucleotide hybridizes to an original polynucleotide under stringent conditions, e.g., high stringency conditions, for sequences of the length of the original polypeptide. In some embodiments a variant polypeptide or polynucleotide comprises or consists of a polypeptide or polynucleotide that is at least 50%, 60%, 70%, 80%,
90%, 95%, 96%, 97%), 98%, 99%, or more identical in sequence to the original polypeptide or polynucleotide over at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%>, 99%, or 100% of the original polypeptide or polynucleotide. In some embodiments a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical in sequence to the original polypeptide over at least 20%o, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%o, 99%o, or 1 00%o of the original polypeptide, with the proviso that, for purposes of computing percent identity, a conservative amino acid substitution is considered identical to the amino acid it replaces. In some embodiments a variant polypeptide comprises or consists of a polypeptide that is at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more identical to the original polypeptide over at least 20%, 30%o, 40%, 50%o, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the original polypeptide, with the proviso that any one or more amino acid substitutions (up to the total number of such substitutions) may be restricted to conservative substitutions. In some embodiments a percent identity is measured over at least 1 00; 200; 300; 400; 500; 600; 700; 800; 900; 1 ,000; 1 ,200; 1 ,500;
2,000; 2,500; 3,000; 3 ,500; 4,000; 4,500; or 5,000 amino acids. In some embodiments the sequence of a variant polypeptide comprises or consists of a sequence that has N amino acid differences with respect to an original sequence, wherein N is any integer between 1 and 10 or between 1 and 20 or any integer up to 1 %, 2%, 5%, or 10% of the number of amino acids in the original polypeptide, where an "amino acid difference" refers to a substitution, insertion, or deletion of an amino acid. In some embodiments a difference is a conservative substitution. Conservative substitutions may be made, e.g., on the basis of similarity in side chain size, polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved. In some embodiments, conservative substitutions may be made according to Table A, wherein amino acids in the same block in the second column and in the same line in the third column may be substituted for one another other in a conservative substitution. Certain conservative substitutions are substituting an amino acid in one row of the third column corresponding to a block in the second column with an amino acid from another row of the third column within the same block in the second column. Table A
Aliphatic G A P
Men-polar
! L V
C S T M
is* - ancterg ed.
N Q
Figure imgf000052_0001
It should be appreciated that the nucleic acids and proteins of the present invention (e.g., PPAR-δ, CPTl A, HMGCS2, and variants, homologs, and functional fragments thereof) can include stability and expression enhancing modifications. Suitable stabi lity and expression enhancing modifications are apparent to those of ordinary skill in the art.
CPTl A AGONISTS
In some embodiments, a PPAR-δ target protein agonist comprises a CPTl A agonist. In some embodiments, the CPTl A agonists comprise high fat diet mimetics. Without wishing to be bound by theory, it is also believed that high fat diet stimulates proliferation and/or self- renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of CPT1 A or a product of CPT l A (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells). Accordingly, in some embodiments, the high fat diet mimetic comprises an agent that increases the level and/or activity of CPTl A or a product of CPTl A.
In some embodiments, the CPTl A agonist stimulates proliferation and/or self- renewal of intestinal stem cells, e.g., by at least about 5%, 10%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 1 00, or 1000 fold or more relative to the level of proliferation and/or self-renewal of intestinal stem cells in the absence of treatment with a CPT l A agonist. In some embodiments, the CPTl A agonist stimulates proliferation of non- stem intestinal progenitor cel ls, e.g., by at least about 5%, 1 0%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 . 1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the CPT I A agonist.
Exemplary CPTI A agonists include, without limitation, nucleic acids encoding CPTI A, functional fragments of nucleic acid sequences that encode CPT I A, variants of nucleic acid sequences that encode CPTI A, nucleic acid sequences homologous to nucleic acid sequences that encode CPT 1 A, CPTI A proteins, functional domains or fragments of CPT I A proteins, functional homologs of CPT I A proteins, and fusion proteins comprising CPT I A protein, or a functional domain, fragment, or homolog of CPTIA protein.
HMGCS2 AGONISTS
In some embodiments, a PPAR-δ target protein agonist comprises a HMGCS2 agonist. In some embodiments, the HMGCS2 agonists comprise high fat diet mimetics. Without wishing to be bound by theory, it is also believed that high fat diet stimulates proliferation and/or self-renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of HMGCS2 or a product of HMGCS2 (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells, etc.). Accordingly, in some embodiments, the high fat diet mimetic comprises an agent that increases the level and/or activity of HMGCS2 or a product of HMGCS2 as described herein.
In some embodiments, the HMGCS2 agonist stimulates proliferation and/or self- renewal of intestinal stem cells, e.g., by at least about 5%, 1 0%, 1 5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1.7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferat ion and/or self-renewal of intestinal stem cells in the absence of treatment with a HMGCS2 agonist. In some embodiments, the TTMGCS2 agonist stimulates proliferation of non-stem intestinal progenitor cells, e.g., by at least about 5%, 1 0%>, 15%, 20%, 25%>, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 . 1 fold, 1 .2 fold, 1 ,3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1.8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the HMGCS2 agonist.
Exemplary HMGCS2 agonists include, without limitation, nucleic acids encoding HMGCS2, functional fragments of nucleic acid sequences that encode HMGCS2, variants of nucleic acid sequences that encode HMGCS2, nucleic acid sequences homologous to nucleic acid sequences that encode HMGCS2, HMGCS2 proteins, functional domains or fragments of HMGCS2 proteins, functional homologs of HMGCS2 proteins, and fusion proteins comprising HMGCS2 protein, or a functional domain, fragment, or homolog of HMGCS2 protein.
FABPl AGONISTS
In some embodiments, a PPAR-δ target protein agonist comprises a FABP l agonist. In some embodiments, the FABP l agonists comprise high fat diet mimetics. Without wishing to be bound by theory, it is also believed that high fat diet stimulates proliferation and/or self- renewal of intestinal stem cells and/or enhances the number and/or function of non-stem progenitor cells, and/or promotes regeneration of mammalian intestinal tissue, in part, by increasing the level and/or activity of FABP l (e.g., in mammals, e.g., in mammalian intestinal stem cells and/or non-stem intestinal progenitor cells, etc.). Accordingly, in some embodiments, the high fat diet mimetic comprises an agent that increases the level and/or activity of FABP l as described herein.
In some embodiments, the FABP l agonist stimulates proliferation and/or self-renewal of intestinal stem cel ls, e.g., by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 .1 fold, 1 .2 fold, 1.3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1 .9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 1 0 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation and/or self-renewal of intestinal stem cells in the absence of treatment with a FABP l agonist. In some embodiments, the FABP l agonist stimulates proliferation of non- stem intestinal progenitor cel ls, e.g., by at least about 5%, 1 0%, 15%, 20%, 25%>, 30%, 35%o, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 1 . 1 fold, 1 .2 fold, 1 .3 fold, 1 .4 fold, 1.5 fold, 1 .6 fold, 1 .7 fold, 1 .8 fold, 1.9 fold, 2.0 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 20 fold, 25 fold, 33 fold, 40 fold, 50 fold, 66 fold, 70 fold, 80 fold, 90 fold, 100, or 1000 fold or more relative to the level of proliferation of non-stem intestinal progenitor cells in the absence of treatment with the FAB P I agonist.
Exemplary FABP 1 agonists include, without limitation, nucleic acids encoding FABP1 , functional fragments of nucleic acid sequences that encode FABP 1 , variants of nucleic acid sequences that encode FABP 1 , nucleic acid sequences homologous to nucleic acid sequences that encode FABP 1 , FABP 1 proteins, functional domains or fragments of FABP 1 proteins, functional homologs of FABP1 proteins, and fusion proteins comprising FABP l protein, or a functional domain, fragment, or homolog of FABP 1 protein.
CALORIE RESTRICTION MIMETICS
Aspects of the methods described herein can be used in combination with one or more methods, compositions, and or agents (e.g., a calorie restriction mimetic, a calorie restriction regimen, an agent that inhibits the level and/or activity of mTORC l , a radioprotective agent, etc.) described in PCT Application Publication WO2013/ 152120, "COMPOSITIONS AND METHODS FOR PROMOTING INTESTINAL STEM CELL FUNCTION", which is incorporated herein by reference in its entirety.
Accordingly, aspects of the present disclosure involve using calorie and/or a calorie restriction mimetic in combination with a high fat diet, a high fat diet mimetic and/or an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein to stimulate proliferation and/or self-renewal of intestinal stem cells and/or enhance the number and/or function of non-stem intestinal progenitor cells and/or stimulate proliferation and/or preserve the morphology of Paneth cells, and/or promote regeneration of mammalian intestinal tissue, e.g., to treat a gastrointestinal disorder, and/or an affliction characterized by intestinal atrophy, and/or to minimize the risk of exposure to ionizing radiation, and/or treat the harmful effects of exposure to ionizing radiation, and/or to increase an individual 's tolerance to ionizing radiation, and/or in combination with radiotherapy, proton therapy, immunotherapy, and/or chemotherapy to protect against drug-induced gastrointestinal injury and or exposure to ionizing radiation.
Without wish ing to be bound by theory, it is believed that employing a combination of (a) any combination of one or more of (i) a calorie restriction mimetic, (ii) a calorie restriction regimen, and/or (iii) an agent that inhibits the level and/or activity; and (b) any combination of one or more of (i) a high fat diet, (ii) a high fat diet mimetic, and/or (iii) an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, provides a synergistic effect in enhancing mammalian intestinal stem cell function, e.g., stimulating the proliferation and/or self-renewal of intestinal stem cells, enhancing the number and/or function of non-stem intestinal progenitor cells, stimulating the proliferation of and/or preserving the morphology of Paneth cells, and promoting intestinal regeneration.
As used herein, "calorie restriction mimetic" refers to an agent that attempts to reproduce one or more of the physiological effects that calorie restriction has on a mammal. As used herein, "calorie restriction" (CR), refers to the protocol of reducing caloric intake while maintaining adequate nutrition of a mammal. Without wishing to be bound by theory, it is believed that CR stimulates proliferation and self-renewal of intestinal stem cells, in part, by inhibiting the level and/or activity of mTORCl in Paneth cells. In some embodiments, the calorie restriction mimetic comprises an agent that inhibits the level and/or activity of mTORCl . In some embodiments, the calorie restriction mimetic comprises an agent that increases the level and/or activity of Bstl or a product of Bstl .
Exemplary calorie restriction mimetics include, without limitation, sirolimus (aka rapamycin) and rapalogs thereof. Exemplary rapalogs include, without limitation, temsirolimus, everolimus, and ridaforolimus. In some embodiments, the calorie restriction mimetic comprises a sirolimus analog having a compound of any one of Formula (V), Formula (VI), and Formula (VII), as described in PCT Application Publication
WO2013/1 52120. Additional exemplary agents that inhibit the level and/or activity of mTORC l include, without limitation, biguanidines, Rag GTPAse inhibitors, agents that phenocopy TSC1 , and/or TSC2, AMPK activators.
In some embodiments, the contacting occurs in vitro or ex vivo. For in vitro methods, populations of cells in mammalian intestinal tissue can be obtained from different sources. For example, intestinal stem cells and/or non-stem intestinal progenitor cells can be obtained from a subject, or derived from non intestinal cells from a subject. In some embodiments, an intestinal stem cell and/or non-stem intestinal progenitor cell is a whole cell.
In some embodiments, the contacting occurs in vivo in a subject. For in vivo methods, a therapeutically effective amount of an agent or composition described herein can be administered to a subject. Methods of administering compounds to a subject are known in the art and easily available to one of skill in the art.
In some embodiments, the subject is suffering from or at risk of developing a gastrointestinal disorder. In some embodiments, the subject is suffering from or at risk of developing inflammatory bowel disease. In some embodiments, the subject is suffering from or at risk of developing infectious colitis. In some embodiments, the subject is suffering from or at risk of developing ischemic colitis. In some embodiments, the subject is suffering from or at risk of developing inflammatory colitis. In some embodiments, the subject is suffering from or at risk of developing ulcerative colitis. In some embodiments, the subject is suffering from or at risk of developing Crohn's disease. In some embodiments, the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis. In some embodiments, the method further comprises determining that the subject is in need of treatment for a gastrointestinal disorder, e.g., that the subject is in need of treatment for inflammatory bowel disease (e.g., Crohn's disease and/or ulcerative colitis), infectious colitis, ischemic colitis, and inflammatory colitis.
In some embodiments, the subject is suffering from or at risk of developing an affliction characterized by intestinal atrophy. In some embodiments, the subject is suffering from or at risk of developing an inflammatory disease. In some embodiments, the subject is suffering from or at risk of developing an autoimmune disease. In some embodiments, the subject is suffering from or at risk of developing vascular disease. In some embodiments, the subject is suffering from or at risk of developing cancer. In some embodiments, the subject is suffering from or at risk of developing infection. In some embodiments, the subject is suffering from or at risk of developing short bowel syndrome. In some embodiments, the subject is suffering from or at risk of developing drug-induced or toxin-induced intestinal in jury. In some embodiments, the subject is suffering from or at risk of developing a disorder requiring total parenteral nutrition or lifelong parenteral nutrition intervention. In some embodiments, the subject is suffering from or at risk of exposure to ionizing radiation. In some embodiments, the subject is selected for treatment of an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation. In some embodiments, the subject is aged or has an advanced aged (e.g., mammalian subjects that are at least about 40 years old, 45 years old, 50 years old, 55 years old, 60 years old, 65 years old, 70 years old, 75 years old, 80 years old, 85 years old, 90 years old or older), rendering the subject at an increased risk of loss or decline in the production and/or functionality of intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments, the method further comprises determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation. In some embodiments, the subject is human. In some embodiments, the method further comprises determining that the subject is in need of enhanced intestinal function. A subject may be in need of enhanced intestinal function, for example, if the subject exhibits intestinal atrophy, is suffering from or at risk of developing a gastrointestinal disorder or affliction characterized by intestinal atrophy described herein. A subject may be in need of enhanced intestinal function, for example, if the subject exhibits decreased numbers of intestinal stem cells and/or non-stem intestinal progenitor cells relative to a control subject with normal numbers of intestinal stem cells and/or non-stem intestinal progenitor cells, or a reference normal level of intestinal stem cells and/or non stem intestinal progenitor cells.
Aspects of the disclosure involve placing subjects on a high fat diet. In some embodiments, a method described herein further comprises placing a subject on a high fat diet. In some embodiment, the high fat diet comprises consumption of a macronutritional composition comprising at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of total daily calories comprising fat. In some embodiment, the high fat diet comprises consumption of a macronutritional composition comprising at least 60% of total dai ly calories comprising fat. In some embodiment, the h igh fat diet comprises consumption of a macronutritional composition comprising at least 65%, at least 70%, at least 75%o, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of total daily calories comprising fat. In some embodiments, the high fat diet comprises consumption of a macronutritional composition comprising 100% of total daily calories comprising fat.
In some embodiments, the high fat diet comprises a diet restricted in terms of total daily calories consumed. In some embodiments, the high fat diet comprises a diet restricted to 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, or 25% of the total daily calories recommended for a healthy subject of a particular age, gender, and body weight. In some embodiments, the high tat diet comprises a diet restricted to 2000, 1900, 1 800, 1 700, 1600, 1500, 1400, 1300, 1200, 1 100, 1000, 900, 800, 750, 700, 650, 600, 550, 500 or less total daily ca lories. In some embodiments, the high fat diet comprises a diet restricted to 2000, 1900, 1 800, 1700, 1600, 1 500, 1400, 1300, 1200, 1 100, 1000, 900, 800, 750, 700, 650, 600, 550, 500 or less total daily calories, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%o of which consist of fat.
As one of skill in the art is aware, stimulating the proliferation and/or renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells, and/or promoting regeneration of mammalian intestinal tissue in a subject can lead to treatment, prevention or amelioration of a number of gastrointestinal disorders and/or afflictions characterized by intestinal atrophy. Aspects of the disclosure relate to treating afflictions characterized by intestinal atrophy. "Treat", "treating" and similar terms refer to providing medical and/or surgical management of a subject. Treatment can include, but is not limited to, administering an agent or composition (e.g., a pharmaceutical composition) to a subject. Treatment is typically undertaken in an effort to alter the course of a disease, disorder, or undesirable condition in a manner beneficial to the subject. The effect of treatment can generally include reversing, alleviating, reducing severity of, delaying the onset of, curing, inhibiting the progression of, and/or reducing the likelihood of occurrence or reoccurrence of the disease, disorder, or condition to which such term applies, or one or more symptoms or manifestations of such disease, disorder or condition. In some embodiments an agent or composition is administered to a subject who has developed a disease or condition or is at increased risk of doing so relative to a member of the general population. In some embodiments an agent or composition is administered prophylactically, i.e., before development of any symptom or manifestation of a condition. Typically in this case the subject will be at risk of developing the condition. It will be understood that "administering" encompasses self-administration. "Preventing" can refer to administering an agent or composition (e.g., a pharmaceutical composition) to a subject who has not developed a disease or condition, so as to reduce the likelihood that the disease or condition will occur or so as to reduce the severity of the disease or condition should it occur.
A subject may be identified as at risk of developing the disease or condition (e.g., at increased risk relative to many most other members of the population who may be matched with respect to various demographic factors such as age, sex, ethnicity, etc.) or as having one or more risk factors that increases likelihood of developing the disease or condition. For example, a subject at or approaching an advanced age may have or may be at an increased risk of developing compromised gut regeneration (e.g., loss of intestinal stem cells and/or non-stem intestinal progenitor cells), or may otherwise be at risk of developing a disease or condition. In those aged subjects, exposure to secondary insults (e.g., chemotherapy, infection, etc.) may render such aged subjects at further risk of developing compromised gut regeneration. Such an aged subject may be identified based on their age (e.g., age greater than sixty years old) or, for example, on the basis of decreased frequency of organoid formation in aged crypts compared to a younger population of subjects, or by exhibiting a failure to thrive. In some embodiments, an aged subject at risk for developing a disease or condition (e.g., compromised gut regeneration or loss of intestinal stem cells and/or non-stem intestinal progenitor cells) may be identified on the basis of their low PPAR-delta activity (e.g., by assessing expression of PPAR-delta and/or one or more PPAR-delta target genes such as CPT1 A, HMGCS2, FABP 1) in a biological sample obtained from the subject. In certain aspects, aged subjects may present with, or may be suspected of having inflammatory or infectious colitis, further rendering such aged subjects at an increased risk for developing a disease or condition, and making such subjects candidates for receiving the compositions and agents described herein. Similarly, aged subjects undergoing chemotherapy, radiotherapy or proton therapy may be at an increased risk for developing a disease or condition, again making such subjects candidates for receiving the compositions and agents described herein.
In certain aspects the methods and uses disclosed herein further comprise a step of determining, for example, that a subject has or is at risk of developing compromised gut regeneration. Simi larly, in some embodiments, the methods and uses disclosed herein further comprise a step of determining that a subject (e.g., an aged or elderly subject) has or is at risk of developing loss of intestinal stem cells and/or non-stem intestinal progenitor cells.
Accordingly, in certain embodiments, the methods and uses disclosed here further comprise a step of determining that the subject is in need of enhanced intestinal function. Such a determination may be made, for example, by assessing expression of PPAR-δ in one or more tissues or biological samples obtained from the subject. In certain aspects, such a determ ination may be made, for example, by assessing expression of one or more of CPT 1 A, HMGCS2 and FABP 1 in one or more tissues or biological samples obtained from the subject.
It is believed that treating an affliction characterized by intestinal atrophy can be achieved by stimulating the proliferation and/or self-renewal of intestinal stem cells in a subject and/or enhancing the number and/or function of non-stem intestinal progenitor cells in a subject and/or promoting intestinal regeneration. In some aspects, stimulating the proliferation and/or self-renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cel ls and/or promoting intestinal regeneration in the subject can be achieved by administering to the subject an effective amount of a composition comprising a high fat diet mimetic. In some aspects, stimulating the proliferation and/or self- renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells and/or promoting intestinal regeneration in the subject can be achieved by administering to the subject an effective amount of a composition comprising an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. It should be appreciated that, in some instances, it may be advantageous to place the patient on a high fat diet concomitantly with administration of the high fat diet m imetic or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. In certain instances, it may be advantageous to place the patient on a high fat diet intervention alone to stimulate the proliferation and/or self-renewal of intestinal stem cells and/or enhance the number and/or function of non-stem intestinal progenitor cells and/or promote intestinal tissue regeneration in the subject. For example, a high fat diet may be appropriate before administering a high fat diet mimetic or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein to the subject, and the number of intestinal stem cells and/or non-stem intestinal progenitor cells in the subject can be assayed for an increase in the number intestinal stem cells and/or non-stem intestinal progenitor cells. The results of the assay can thus be used as a quantitative measure of the success of the high fat diet alone, and to determine whether it may be advantageous to administer a high fat diet mimetic or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. It may also be advantageous to place the patient on a high fat diet regiment if, for example, the subject is taking medication which is contraindicated for the high fat diet mimetic or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. It is believed that stimulating the proliferation and/or self-renewal of intestinal stem cel ls and/or enhancing the number and/or function of non-stem intestinal progenitor cells may ameliorate intestinal atrophy by regenerating intestinal tissue as the intestinal stem cells in the intestine proliferate and self-renew.
In an aspect, a method of treating an affliction characterized by intestinal atrophy in a subject in need thereof comprises administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby treating the affliction characterized by intestinal atrophy. In some embodiments, the method further comprises placing the subject on a high fat diet. In some embodiments, the method further comprises administering a calorie restriction intervention to the subject. In some embodiments, the method further comprises administering to the subject an effective amount of a calorie restriction mimetic. In some embodiments, the method further comprises adm inistering to the subject an effective amount of an agent that inhibits the level and/or activity of mTORC l . In some embodiments, the method further comprises administering to the subject an effective amount of an agent that increases the level and/or activity of Bstl or a product of Bstl .
In some embodiments, the composition comprises a high fat d iet mimetic. In some embodiments, the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (i ii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT 1 A agonist, (ii) a IIMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR-δ agonist; (ii i) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABP l agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of niTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bst l ; and a pharmaceutically acceptable carrier, diluent, or excipient.
Non-limiting examples of afflictions that are characterized by intestinal atrophy and for which a high fat diet and/or high fat diet mimetic (e.g., a composition or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein) disclosed herein may provide a useful remedy include inflammatory diseases (e.g, inflammatory bowel disease, e.g., Crohn's disease, ulcerative colitis), autoimmune diseases, vascular disease, cancer, infection, drug-induced or toxin-induced intestinal inj ury (e.g., cancer chemotherapy induced GI damage), an affliction treatable by parenteral nutrition (PN) or life-long parenteral nutrition, and exposure to ionizing radiation.
In some embodiments, compositions which increase the level and/or activity of PPAR-δ and/or PPAR-δ target proteins can be administered over a limited duration of time in order to treat a gastrointestinal disorder and/or affliction characterized by intestinal atrophy described herein. The composition can be adm inistered once or more daily (e.g., once, twice, thrice, etc.) over the limited duration of time, e.g., up to 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, etc. until regeneration of intestinal tissue has reached a satisfactory level. For example, the composition can be administered after an insult, such as an infection, exposure to a toxin, drug, or ionizing radiation, injury, and/or ischemic event until intestinal atrophy, damage, or injury resulting from that insult is restored to the condition it was in prior to that insult, or to a condition in which major symptoms or manifestations of such insult subside or reduce to manageable levels. In some instances, the compositions can be administered over one or more courses separated by time periods in which the compositions are not administered. For example, a high fat diet mimetic and/or a PPAR-δ agonist may be administered for 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, or more, to promote intestinal regeneration in a subject suffering from an affliction characterized by intestinal atrophy, e.g., cancer wh ile the subject is undergoing chemotherapy, radiotherapy, proton therapy, and/or immunotherapy for treatment of the affliction, e.g., cancer, and then placed on a high fat, calorie restricted diet for a subsequent limited time interval, e.g., 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, or more while the subject continues to receive the chemotherapy, radiotherapy, proton therapy, and/or immunotherapy, and then chemotherapy, radiotherapy, proton therapy, and/or immunotherapy can be halted while the subject is administered the high fat diet mimetic and/or PPAR-δ agonist, optionally while being placed on a high fat, calorie restricted diet, for a period of 1 week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 12 weeks, to allow the patient to recover from the chemotherapy, radiotherapy, proton therapy, and/or immunotherapy while the patient's intestines regenerate from administration of the high fat diet mimetic and/or PPAR-δ agonist. Multiple cycles can be repeated as often as desired and in various intervals based on the patient's progression toward the treatment of the affliction and the regeneration of atrophied intestines.
In some embod iments, the present disclosure contemplates compositions, agents, and methods for treating colitis, and particularly contemplates any suitable therapy for treating any type of colitis manifesting throughout the entire gastrointestinal tract (including, for example, colon, small intestine, and large intestine). Illustrative examples of the types of colitis that can be treated by the compositions, agents, and methods of the present disclosure include, but are not limited to infectious colitis, inflammatory colitis, vascular colitis (e.g., ischemic colitis), pseudomembranous colitis (e.g., caused by bacteria, such as Clostridium difficile, for example), microscopic col itis, drug-induced colitis, allergic colitis, colitis related to diverticular disease, and intestinal lesions (e.g., ulcers) resulting from any of foregoing, or gastrointestinal lesions resulting from any other cause whether causes by any other factors (e.g., genetics, physical injury, stress, to name only a few). In some embodiments, a high fat diet and/or high fat diet mimetic, a composition comprising the high fat diet mimetic, and/or an agent or composition that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein can be used to treat pseudomembranous colitis (e.g., microorganism induced colitis, e.g., bacteria, e.g., C. difficile). In some embodiments, a method for treating colitis resulting at least in part from infection by a pathogen, e.g., pseudomembranous colitis resulting at least in part from infection by a pathogen comprises: (a) administering an effective amount of an antibiotic to a patient, wherein the antibiotic rids or helps rid the patient of a pathogen; and (b) grafting gastrointestinal tissue generated ex vivo into the patient; and optionally (c) administering to the patient and effective amount of a high fat diet mimetic. In some embodiments, such method further comprises (d) placing the patient on a high fat diet. In some embod iments, the gastrointestinal tissue comprises crypts generated ex vivo. In some embodiments, the gastrointestinal tissue generated ex vivo replaces damaged intestinal lining. In some embodiments, the gastrointestinal tissue generated ex vivo replaces denuded intestinal lining. In some embodiments, the high fat diet mimetic is administered to the patient for a pre-determined period of time prior to administration of the antibiotic and/or grafting the gastrointestinal tissue generated ex vivo into the patient. Administering the high fat diet mimetic to the patient prior to administration of the antibiotic and/or grafting the gastrointestinal tissue can advantageously serve as a way to prime the gastrointestinal cells of the patient (intestinal stem cells and/or non-stem intestinal progenitor cells) to minimize drug induced injury resulting from administration of the antibiotic, as well as, to prime the existing gastrointestinal tissue to facilitate the grafting of the gastrointestinal tissue generated ex vivo, for example, to aid the process of healing of the tissue as the existing tissue and the grafted tissue become whole. The pre-determined period of time can range widely, for example, from up to one month prior to administration of the antibiotic agent and/or grafting of the ex vivo produced gastrointestinal tissue, until as little as a few hours prior thereto (e.g., 1 -4 hours). It should be appreciated that any antibiotic agent that is known to treat the bacterial infection can be used to rid the patient of pathogens, for example, C. difficile can be treated with the antibiotics metronidazole and vanocin.
In some embodiments, a high fat diet mimetic can be employed in combination with parenteral nutrition (PN) treatment.
In some embodiments, a high fat diet mimetic can be used to treat short bowel syndrome (SBS). SBS in infants and children include necrotizing enterocolitis, midgut volvulus, intestinal atresia, and gastroschisis. In adults, SBS typically occurs as a postsurgical event post resection of substantial portions of the small intestine, such as, for example, surgery due to cancer, gastrointestinal bleeding (e.g., repeated or intractable, inflammatory bowel disease, trauma, etc.). In some embodiments, a method for treating SBS comprises administering to a patient in need thereof an effective amount of a high fat diet mimetic, and administering to the patient parenteral nutrition (PN). In some embodiments, such method for treating SBS further comprises administering to the patient an effective amount of glucagon-like peptide-2 (GLP-2) or an analog of GLP-2, for example, teduglutide (Tee et al. Clin. Exper. Gastroenterology. 4: 189-196, 201 1 ).
Aspects of the disclosure relate to radioprotective compositions and/or
chemoprotective compositions for protecting cells against ionizing radiation and/or drug induced intestinal injury. In some embodiments, the radioprotective and/or chemoprotective compositions stimulate the proliferation and/or self-renewal of intestinal stem cells. In some embodiments, the radioprotective and/or chemoprotective compositions enhance the number and/or function of non-stem intestinal progenitor cells. In some embodiments, the radioprotective and/or chemoprotective compositions promote regeneration of intestinal tissue. In embodiments disclosed herein, a radioprotective and/or chemoprotective composition disclosed herein may prevent or ameliorate the harmful effects of ionizing radiation on mammalian cells (e.g., damage to gastrointestinal cells). In an aspect, a radioprotective composition comprises an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, di luent, or excipient.
In an aspect, a chemoprotective composition comprises an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient.
In some embodiments, the composition further comprises a chemotherapeutic agent.
In some embodiments, the composition further comprises a radiotherapeutic agent.
In some embodiments, the composition further comprises an immunotherapeutic agent.
In some embodiments, the composition further comprises a calorie restriction mimetic.
In some embodiments, the composition further comprises an agent that inhibits the level and/or activity of mTORC l .
In some embodiments, the composition further comprises an agent that increases the level and/or activity of Bstl or a product of Bstl .
In some embodiments, the composition further comprises sirolimus or a derivative or analog thereof, such as temsirolimus, everolimus, and ridaforlimus.
In some embodiments, the composition is formulated for administration as an enema. Ln some embodiments, the composition is formulated for oral administration.
In some embodiments, an agent of the present invention is administered in combination with a cancer therapeutic agent. It should be appreciated that the combined administration of an agent of the present invention and a cancer therapeutic agent can be achieved by formulating the cancer therapeutic agent and agent in the same composition or by administering the cancer therapeutic agent and agent separately (e.g., before, after, or interspersed with doses or administration of the cancer therapeutic agent). In some embodiments, the an agent of the present invention (e.g., a radioprotective agent) is administered to a patient undergoing conventional chemotherapy and/or radiotherapy e.g., to prevent, minimize or ameliorate harmful effects to the patient as a result of drug induced GI toxicity or damage, and/or exposure to the cancer therapeutic agent or ionizing radiation of the radiotherapy. In some embodiments, the cancer therapeutic agent is a chemotherapeutic agent. In some embodiments, the cancer therapeutic agent is an immunotherapeutic agent. In some embodiments, the cancer therapeutic agent is a radiotherapeutic agent.
Exemplary chemotherapeutic agents that can be administered in combination with the agents of the present invention (e.g., a radioprotective agent) include alkylating agents (e.g. cisplatin, carboplatin, oxaloplatin, mechlorethamine, cyclophosphamide, chorambucil, nitrosureas); anti-metabolites (e.g. methotrexate, pemetrexed, 6-mercaptopurine, dacarbazine, fludarabine, 5-fluorouracil, arabinosycytosine, capecitabine, gemcitabine, decitabine); plant alkaloids and terpenoids including vinca alkaloids (e.g. vincristine, vinblastine, vinorelbine), podophyllotoxin (e.g. etoposide, teniposide), taxanes (e.g. paclitaxel, docetaxel);
topoisomerase inhibitors (e.g. notecan, topotecan, amasacrine, etoposide phosphate);
antitumor antibiotics (dactinomycin, doxorubicin, epirubicin, and bleomycin); ribonucleotides reductase inhibitors; antimicrotubule agents; and retinoids. (See, e.g., Cancer: Principles and Practice of Oncology (V.T. DeVita, et al ., eds., J.B. Lippincott Company, 9th ed., 201 1 ;
Brunton, L., et al. (eds.) Goodman and Gilman's The Pharmacological Basis of Therapeutics, 12th Ed„ McGraw Hill, 201 0).
Exemplary immunotherapeutic agents include cytokines, such as, for example interleukin- 1 (IL-I), IL-2, IL-4, IL-5, lL-β, IL-7, IL-10, IL- 12, IL-I5, IL- 18, CSF-GM, CSF- G, IFN-γ, IFN-a, TNF, TGF-β but not limited thereto.
In some embodiments, an agent of the present invention can be linked or conjugated to a delivery vehicle, which may also contain cancer therapeutic. Suitable delivery vehicles include liposomes (Hughes et al. Cancer Res 49(22):6214-20, 1989, which is hereby incorporated by reference in its entirety), nanoparticles (Farokhzad et al. Proc Nat'l Acad Sci USA 1 03( 16):63 1 5-20, 2006, wh ich is hereby incorporated by reference in its entirety), biodegradable microspheres, microparticles, and collagen minipellets. The delivery vehicle can contain any of the radioprotective, chemotherapeutic, radiotherapeutic, or
immunotherapeutic agents described supra.
In one embodiment, an agent of the present invention can be conjugated to a liposome delivery vehicle (Sofou and Sgouros, Exp Opin Drug Deliv. 5(2): 189-204, 2008, which is hereby incorporated by reference in its entirety). Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. Suitable liposomal delivery vehicles are apparent to those skilled in the art. Different types of liposomes can be prepared according to Bangham et al. J. Mol. Biol. 13 :238-52, 1965 ; U.S. Pat. No. 5,653,996 to Hsu; U. S. Pat. No. 5,643,599 to Lee et al.; U.S. Pat. No. 5,885,613 to Holland et al.; U.S. Pat. No. 5,63 1 ,237 to Dzau & aneda; and U.S. Pat. No. 5,059,421 to Loughrey et al., which are hereby incorporated by reference in their entirety.
These liposomes can be produced such that they contain, in addition to the therapeutic agents of the present invention, other therapeutic agents, such as immunotherapeutic cytokines, which would then be released at the target site (e.g., Wolff et al., Biochim.
Biophys. Acta. 802:259-73, 1984, which is hereby incorporated by reference in its entirety). The present disclosure also contemplates a composition comprising an agent of the present invention (e.g., an agent that stimulates the proliferation and/or self-renewal of ISCs, enhances the number and/or function of non-stem intestinal progenitor cells, and/or promotes regeneration of intestinal tissue) and a pharmaceutically acceptable carrier, diluent, or excipient. Therapeutic formulations of the agents of the present invention can be prepared having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (REMINGTON'S PHARMACEUTICAL SCIENCES (A. Osol ed. 1980), which is hereby incorporated by reference in its entirety), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as acetate, Tris-phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride;
hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; tonicifiers such as trehalose and sodium chloride; sugars such as sucrose, mannitol, trehalose or sorbitol;
surfactant such as polysorbate; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN.RTM.,
PLURONICS.RTM. or polyethylene glycol (PEG).
The active therapeutic ingredients of the pharmaceutical compositions (e.g., radioprotective agents alone or in combination with or linked to a cancer therapeutic agent or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein can be entrapped in microcapsules prepared using coacervation techniques or by interfacial polymerization, e.g., hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (e.g., l iposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in REMINGTON'S PHARMACEUTICAL SCIENCES (A. Osol ed. 1980), which is hereby incorporated by reference in its entirety. In some embodiments, the radioprotective agents of the present invention can be conjugated to the microcapsule delivery vehicle to target the delivery of the therapeutic agent to the site of the cells exposed to toxic effects of ionizing radiation. Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antibody or polypeptide, which matrices are in the form of shaped articles, e.g., films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl- methacrylate), or poly(vinylalcohol)), polylactides, copolymers of L-glutamic acid and .gamma. ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid- glycolic acid copolymers such as the LUPRON DEPOT. RTM. (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3- hydroxybutyric acid.
In some embodiments, an agent of the present disclosure can be provided with an enteric coating or otherwise protected from hydrolysis or low stomach pH. In some embodiments, an agent of the present disclosure can be formulated for release in the small intestine, for example, lectins, can be used to target agents to the gastrointestinal tract, and particularly can recognize and bind to villus and crypt cells in the intestines (see, e.g., Handbook of plant lectins; properties and biomedical applications, Els J. M. Van Damme, et al., eds., John Wiley and Sons, 1998).
The therapeutically effective compositions containing the agents of the disclosure are administered to a subject, in accordance with known methods, such as intravenous administration, e.g., as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinai, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. In some embodiments, a radioprotective agent comprises a radioprotective agent. In some embodiments, an agent or composition of the present invention is administered as an enema. Administration of the agents and compositions as an enema may be advantageous, for example, administration as an enema facilitates local, rather than systemic, delivery to the targeted area (GI system) where the agent exerts its biological effects, as well as avoids factors which result in diminished or insufficient absorption of a drug and its ultimate transport to its biological target resulting from elimination and metabolism of drugs that are administered systemically (e.g., oral administration). Accordingly, administration of the agents and compositions of the present invention as an enema may result in an enhanced therapeutic effect while minimizing side effects. In some embodiments, a method of treating or preventing harm resulting from exposure to ionizing radiation comprises administering an effective amount of agent or composition of the present disclosure to a subject in need thereof, wherein the agent or composition is administered as an enema. Other therapeutic regimens may be combined with the administration of the agents of the present invention. The combined administration includes co-administration, using separate formulations or a single pharmaceutical formulation, and consecutive administration in either order, wherein preferably there is a time period while both (or all) active agents
simultaneously exert their biological activities. Preferably such combined therapy results in a synergistic therapeutic effect. In some embodiments, a composition of the present disclosure is administered in combination with a therapy selected from the group consisting of chemotherapy, radiotherapy, proton therapy, surgery, and combinations thereof.
The composition can include any number of additional active ingredients which can act in concert to provide a therapeutic effect, (e.g., a synergistic therapeutic effect), such as a chemotherapeutic agent, a radiotherapeutic agent, an immunotherapeutic agent, and combinations thereof.
Aspects of the disclosure involve methods of minimizing the risk of exposure to an ionizing radiation source, treating individuals exposed to harmful levels of ionizing radiation, and/or increasing an individual's tolerance to ionizing radiation .
In an aspect, a method of minimizing the risk of exposure to an ionizing radiation source comprises administering to an individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby minimizing the risk of exposure to the ionizing radiation source.
In an aspect, a method of treating an individual exposed to ionizing radiation comprises administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby treating the individual exposed to harmful ionizing radiation. In some embodiments, the ionizing radiation comprise harmful ion izing radiation.
In an aspect, a method of increasing tolerance to ionizing radiation in an individual comprises administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, wherein the composition increases the threshold dose of lethal ionizing radiation to above 8 Gy. In some
embodiments, the composition increases the threshold dose of lethal ionizing radiation to about 9 Gy, about 1 0 Gy, about 1 1 Gy, about 1 2 Gy, about 13 Gy, about 14 Gy, or about 1 5 Gy. In some embodiments, the high fat diet mimetic increases a threshold dose of lethal ionizing radiation in a human mammal. In some embodiments, the high fat diet mimetic increases a threshold dose of lethal ionizing radiation in a non-human mammal.
In some embod iments, the composition comprises a high fat diet mimetic. In some embodiments, the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT 1A agonist, (ii) a HMGCS2 agonist, (i ii) a FABP l agonist, and (vv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT l A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR-δ agonist; (iii) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABP l agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of mTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bstl ; and a pharmaceutically acceptable carrier, diluent, or excipient.
The high fat diet mimetic and/or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein can be used to minimize the risk of exposure to any ionizing radiation source and/or treat exposure to harmful ionizing radiation from any ionizing radiation source, and/or increase an individual's tolerance to ionizing radiation from any source, including any source of accidental or incidental ionizing radiation, such as radioactive material, a nuclear power plant, a nuclear weapon, or cosmic radiation, to name but a few, In some embodiments, the ionizing radiation source is cosmic radiation in outer space. In some embodiments, the cosmic radiation is cosmic radiation that has not penetrated the Earth's atmosphere. In some embodiments, the cosmic radiation has penetrated at least a portion of the Earth's atmosphere. In some embodiments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the ionosphere. In some embodiments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the thermosphere. In some embodiments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the mesosphere. In some embod iments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the stratosphere. In some embodiments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation in the troposphere. In some embodiments, the high fat diet mimetic can be used to minimize the risk of exposure to cosmic radiation at sea level .
The high fat diet mimetic and/or agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein can also be adm in istered to an individual that is being administered radiotherapy, or an individual that is about to be admin istered radiotherapy, to minimize the risk of exposure to the ionizing radiation administered during the radiotherapy. In some instances, a method of minimizing the risk of exposure to an ionizing radiation source comprises placing the individual on a high fat diet for a pre-determined period of time prior to exposure to the ionizing radiation source. In some embodiments, the pre-determined period of time for placing an individual on a high fat diet prior to exposure to an ionizing radiation source can range from hours to months (e.g., from about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 12 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about a week and half, about two weeks, about three weeks, about a month, two months, three months, four months, five months, six months, seven months, eight months, nine months, 10 months, 1 1 months, or 12 months, and any interval therebetween). In certain instances, the method of minimizing the risk of exposure to an ionizing radiation source comprises placing the individual on a high fat diet prior to exposure to an ionizing radiation source, and
administering to the individual an effective amount of composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein.
In some embodiments, the method further comprises placing the individual on a high fat diet. In some embodiments, the method further comprises placing the individual on a high fat, calorie restricted diet.
The disclosure contemplates treating individuals exposed to any amount of ionizing radiation from any source described herein. For example, an individual may have been exposed to at least 0. 1 Gy, 0.2 Gy, 0.3 Gy, 0.4 Gy, 0.5 Gy, 0.6 Gy, 0.7 Gy, 0.8 Gy, 0.9 Gy, 1 Gy, 1 ,5Gy, 2 Gy, 2.5 Gy, 3 Gy, 3.5 Gy, 4 Gy, 4.5 Gy, 5 Gy, 5.5 Gy, 6 Gy, 6.5 Gy, 6.6 Gy, 6.7 Gy, 6.8 Gy, 6.9 Gy, 7.0 Gy, 7.5 Gy, 8 Gy, 9 Gy, 10 Gy, 1 1 Gy, 12 Gy, 13 Gy, 14 Gy, or up to 15 Gy or more.
In sti ll other embodiments, the disclosure relates to methods of treating cancer. In an aspect, a method of treating cancer in a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein; and (b) administering an effective amount of ionizing radiation to the subject. In some embodiments, the composition: (i) increases the subject's tolerance for ionizing radiation; (ii) minimizes undesirable side-effects due to the ionizing radiation; (iii) protects against gastrointestinal drug toxicity.
In an aspect, a method of administering radiotherapy to a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, and (b) administering radiotherapy to the subject. In an aspect, a method administering proton therapy to a subject in need thereof comprises: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein; and (b) administering proton therapy to the subject.
In an aspect, a method of administering chemotherapy to a subject in need thereof comprises (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-5 and/or a PPAR-δ target protein; and (b) administering chemotherapy to the subject.
In some embodiments, the composition comprises a high fat diet mimetic. In some embodiments, the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a H GCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTl A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. In some embodiments, the composition comprises a combination of (a) any one or combination of (i) a high fat diet mimetic, (ii) a PPAR-δ agonist; (iii) a CPTl A agonist, (iv) a HMGCS2 agonist, and (v) a FABPl agonist; and (b) any one or a combination of (i) a calorie restriction mimetic, (ii) an agent that inhibits the level and/or activity of mTORC l , (iii) an agent that increases the level and/or activity of Bstl or a product of Bstl ; and a pharmaceutically acceptable carrier, diluent, or excipient.
One of skill in the art should appreciate that the composition that increases the level and/or activity of PPAR-δ and/or the PPAR-δ target protein or high fat diet mimetic can be employed in the course of treating any cancer that involves radiotherapy. In some instances, the method of treatment can include placing the subject on a high fat diet prior to, or during the course of, administering the ionizing radiation. In some instances, the method of treatment can also include administering to the subject a chemotherapeutic agent, a radiotherapeutic agent, surgery, and combinations thereof. The high fat diet mimetic can be administered prior, during, or after administering the ionizing radiation to the patient.
In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to promote intestinal regeneration, protect against intestinal tissue damage, and/or stimulate the proliferation and/or self-renewal of one or more intestinal stem cells. In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to treat an affliction characterized by intestinal atrophy. Exemplary afflictions include, without limitation, an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative col itis.
In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to protect against, mitigate, or alleviate, the harmful effects of exposure to ionizing radiation. Exposure to ionizing radiation can be from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, cosmic or space radiation.
In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with radiotherapy to protect against the harmful effects of ionizing radiation.
In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with chemotherapy to protect against gastrointestinal drug toxicity.
In an aspect, the disclosure relates to the use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with total parenteral nutrition to protect against intestinal atrophy.
In another aspect, the present disclosure includes a method for expanding a population of intestinal stem cells and/or non-stem intestinal progenitor cells comprising contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein. In some embodiments, Paneth cells are not present in the population of intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments, the population of intestinal stem cells and/or non-stem intestinal progenitor cells comprises Paneth cells.
In some embodiments, the method for expanding the ISCs is performed in vitro. In some embodiments, method for expanding the ISCs is performed ex vivo. It should be appreciated that the ex vivo methods and compositions of the present invention for generating ISCs and intestinal tissues, as well as grafting those generated cells and tissues, can be used for any condition that would benefit from restoration and/or augmentation of intestinal function. In some embodiments, the method for expanding ISCs can be used to maintain intestinal stem cells for a patient that may be preserved and eventually engrafted into an atrophic or damaged intestine or used ex vivo in the construction of an artificial organ which may subsequently be implanted into a subject, in some embodiments, the ex vivo methods of the present invention can be used to study intestinal transport, metabolism (of drugs, etc.) and drug design to enhance absorption and bioavailability.
In some aspects, compositions for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells are disclosed. In an aspect, a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells comprises a population of intestinal stem cells and/or non-stem intestinal progenitor cells and a high fat diet mimetic. In some embodiments, a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes Paneth cells. In some embodiments, a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes Paneth-like cells. It should be appreciated that intestinal stem cells and/or Paneth or Paneth-like cells for use in the ex vivo expansion compositions and methods of the present invention can be autologous or non-autologous. Intestinal stem cells and/or non-stem intestinal progenitor cells, and/or Paneth cells are found within the crypts of the mucosa of the intestine, e.g., small intestines or colon. Such cells can be isolated and/or extracted according to routine methods (e.g., non-limiting examples of obtaining intestinal stem cells and/or non-stem intestinal progenitor cells and/or Paneth cells include, surgery and biopsy, for example). In some instances, it may be preferable to utilize intact crypts, organoid bodies, intestinal stem cells, non-stem intestinal progenitor cells and/or Paneth cells that have been removed from a patient during a small-intestine (or small-bowel) biopsy as part of diagnosis of a disease of the intestinal mucosa. In such instances, the cells thus obtained can be banked and maintained for subsequent use in the ex vivo expansion compositions and methods of the present invention. In some instances, the ISCs can be obtained from pluripotent stem cells (PSCs) or embryonic stem cells (ESCs) that have been induced or directed to differentiate into ISCs, for example, by a process to direct the differentiation of human PSCs into intestinal tissue in vitro using growth factors to simulate embryonic intestinal development (Wells et al. Nature. 470 (7332): 1 05- 109, 201 1 ). This process of directed differentiation can be used to produce ISCs, for example, from fibroblasts obtained from a skin biopsy of the patient. In some embodiments, a method for expanding ISCs of a patient comprises: (a) obtaining a pluripotent stem cell non-invasively from a patient (e.g., skin biopsy of fibroblast cells); (b) directing differentiation of the pluripotent stem cells obtained non-invasively in step (a) by manipulating the pluripotent stem cells with one or more appropriate growth factors, wherein the pluripotent stem cells differentiate into intestinal tissue; and (c) contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells in the intestinal tissue generated in step (b) with an effective amount of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, thereby activating and expanding the ISCs of the patient. In some embodiments, a composition for ex vivo expansion of intestinal stem cells and/or non-stem intestinal progenitor cells includes a culture medium. Suitable culture mediums are apparent to those skilled in the art (see, for example, materials and methods below). In some embodiments, a pluripotent cell is an induced pluripotent stem (iPS) cell that has been derived in vitro from a non-pluripotent somatic cell such as a skin cell, fibroblast or myoblast (or is descended from a cell that has been so derived). An iPS cell can be derived using a variety of different protocols. In some embodiments an iPS cell is derived by causing a somatic cell to express at least one, two, or three of the pluripotency factors Oct4, Nanog, and Sox2. Optionally the cells are caused to overexpress c-Myc. In some embodiments an iPS cell is derived by causing a somatic cell to express at least one, two, three, or four of the transcription factors Oct4, Nanog, Sox2, and Liii28. In some embodiments viral transduction is used to cause a cell to express a reprogramming factor. In some embodiments an iPS cell is generated without use of retroviruses or other integrating viruses and/or without inserting exogenous DNA into the genome of the cell. A variety of techniques, e.g., involving small molecules and/or protein transduction and/or non-integrating vectors and/or introducing translatable RNA molecules (e.g., encoding one or more pluripotency factor(s)) into cells can employed in the generation of iPS cells in various embodiments. See, e.g., PCT/US2008/004516 (WO 2008/124133) REPROGRAMMING OF SOMATIC CELLS); Lyssiotis, CA., Proc Natl Acad Sci U S A. 2009 Jun 2; 106(22):8912-7. Epub 2009 May 15; Carey BW, Proc Natl Acad Sci U S A. 2009 Jan 6; 106(1 ): 157-62. Epub 2008 Dec 24, and references cited in any of the foregoing, for additional information regarding iPS cells. Use of any of the compositions and methods described in PCT/US2009/057692, "Compositions and Methods for Enhancing Cell Reprogramming", filed 21 Sept. 2009, is contemplated.
In an aspect, the disclosure provides a method of endowing at least one non-stem intestinal progenitor cell with at least one attribute of intestinal stem cells, the method comprising contacting a population of mammalian intestinal cells comprising at least one non-stem progenitor cell with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby endowing at least one non-stem intestinal progenitor cell with the at least one attribute of intestinal stem cells. In some embodiments, the at least one attribute comprises the ability to form organoid mini-intestines in culture in the absence of the Paneth cell niche. In some embodiments, the intestinal stem cells comprise LGR5+ stem cells. In some embodiments, the non-stem intestinal progenitor cells comprise WDR43 ' non-stem cells. In some embodiments, the non-stem intestinal progenitor cells express diminished expression of LGR5, OLFM4, and ASCL2, and express WDR43. In some embodiments, the non-stem intestinal progenitor cells do not express LGR5, OLFM4, or ASCL2, and express WDR43.
In an aspect, the disclosure provides a method for obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with an enhanced ability to form organoid bodies in culture in the absence of the Paneth cells, the method comprising: (a) administering a high fat diet or a high fat diet mimetic to a mammal, wherein the high fat diet or high fat diet mimetic enhances the ability of intestinal stem cells and/or non-stem intestinal progenitor cel ls in the mammal to form organoid bodies in culture; and (b) isolating intestinal stem cells and/or non-stem intestinal progenitor cells from the mammal, thereby obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with the enhanced ability to form organoid bodies in culture.
In some embodiments, the method includes assessing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells to form organoid bodies in culture in the absence of Paneth cells. In some embodiments, assessing is performed by comparing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells obtained from the mammal in step (b) to form organoid bodies in culture in the absence of Paneth cells to the ability of intestinal stem cells and/or non-stem intestinal progenitor cells obtained from control mammals which were not administered a high fat diet of high fat diet mimetic to form organoid bodies in culture in the absence of Paneth cells.
In some embodiments, the method includes a step (c) forming organoid bodies in cu lture in the absence of Paneth cells.
In some embodiments, the high fat diet or the high fat diet mimetic increases the level and/or activity of PPAR-δ or a PPAR-δ target protein in the mammal' s intestinal stem cel ls and/or non-stem intestinal progenitor cells.
Aspects of the disclosure relate to the use of PPAR-δ and/or a PPAR-δ target gene as a prognostic biomarker to detect obese individuals at risk for colorectal cancer.
In an aspect, the d isclosure provides a method of identifying an obese individual at risk of developing colorectal carcinoma, the method comprising: (a) determining the level of expression of PPAR-δ or a PPAR-δ target gene in a biological sample obtained from an obese individual; and (b) identifying an obese individual as being at risk of developing colorectal carcinoma if the level of expression of PPAR-δ or the PPAR-δ target gene in the biological sample is elevated as compared to the level of expression of PPAR-δ or the PPAR-δ target gene in control individuals without colorectal carcinoma. Aspects of the disclosed methods include obtaining a biological sample from a subject comprising a cell or tissue of interest e.g., a cell or tissue that is affected by a disease, e.g., a gastrointestinal disorder described herein or an affliction characterized by intestinal atrophy described herein. A biological sample used in the methods described herein will typically comprise or be derived from cells or tissues isolated from a subject. The cells or tissues may comprise cells or tissues affected by a disease described herein. In some embodiments, the cells or tissues are isolated from a tumor cell or tissue described herein..
Samples can be, e.g., surgical samples, tissue biopsy samples, fine needle aspiration biopsy samples, core needle samples. The sample may be obtained using methods known in the art. A sample can be subjected to one or more processing steps. In some embodiments the sample is frozen and/or fixed. In some embodiments the sample is sectioned and/or embedded, e.g., in paraffin. In some embodiments, tumor cells, e.g., epithelial tumor cells, are separated from at least some surrounding stromal tissue (e.g., stromal cells and/or extracellular matrix). Cells or tissue of interest can be isolated using, e.g., tissue
microdissection, e.g., laser capture microdissection. It should be appreciated that a sample can be a sample isolated from any of the subjects described herein.
In some embodiments, cells of the sample are lysed. Nucleic acids or polypeptides may be isolated from the samples (e.g., cells or tissues of interest). In some embodiments DNA, optionally isolated from a sample, is amplified. A wide variety of methods are available for detection of DNA, e.g., DNA encoding PPAR-δ or a PPAR-δ target protein. In some embodiments RNA, optionally isolated from a sample, is reverse transcribed and/or amplified. A wide variety of solution phase or solid phase methods are available for detection of RNA, e.g., mRNA encoding PPAR-δ or a PPAR-o target protein. Suitable methods include e.g., hybridization-based approaches (e.g., nuclease protection assays, Northern blots, microarrays, in situ hybridization), amplification-based approaches (e.g., reverse transcription polymerase chain reaction (which can be a real-time PGR reaction), or sequencing (e.g., RNA-Seq, which uses high throughput sequencing techniques to quantify RNA transcripts (see, e.g., Wang, Z,, et al. Nature Reviews Genetics 10, 57-63, 2009)). In some embodiments of interest a quantitative PCR (qPCR) assay is used. Other methods include electrochemical detection, bioluminescence-based methods, fluorescence-correlation spectroscopy, etc.
Aspects of the methods described herein involve detecting the levels or presence of expression products, e.g., an expression product of PPAR-δ or a PPAR-δ target gene. Levels of expression products may be assessed using any suitable method. Either mRNA or protein level may be measured. Exemplary methods for measuring mRNA include hybridization based assays, polymerase chain reaction assay, sequencing, in situ hybridization, etc. Exemplary methods for measuring protein levels include ELISA assays, Western blot, mass spectrometry, or immunohistochemistry. It will be understood that suitable controls and normalization procedures can be used to accurately quantify expression. Values can also be normalized to account for the fact that different samples may contain different proportions of a cell type of interest, e.g., tumor cells or tissues compared to corresponding non-tumor cells or tissues (e.g., health cells or tissues).
In some embodiments, the biological sample comprises a colon biopsy specimen, in some embodiments, the biological sample comprises an epithelial cell. In some embodiments the biological sample comprises an intestinal stem cell. In some embodiments the biological sample comprises a non-stem intestinal progenitor cell. In some embodiments the biological sample comprises a Paneth cell. In some embodiments the biological sample comprises a goblet cell. In some embodiments, the biological sample is obtained by performing a colonoscopic biopsy. In some embodiments, (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene comprises determining the mRNA level of expression of PPAR-δ or the PPAR-δ target gene. In some embodiments, (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene is accomplished by performing a hybridization-based assay, a polymerase chain reaction-based assay, or sequencing. In some embodiments, (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene comprises determining the protein level of expression of PPAR-δ or the PPAR-δ target gene. In some embodiments, (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene is accomplished by ELISA, Western blot, mass spectrometry, or
immunohi stochem i stry .
In another aspect, the present invention includes a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells and/or non-stem intestinal progenitor cells. In some embodiments, a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells and/or enhancing the number and/or function of non-stem intestinal progenitor cells comprises: (a) contacting a cell culture comprising small intestinal crypt cells with a candidate agent; and (b) assaying for (i) an increase in the amount of an intestinal stem cell marker in the cell culture, wherein an increase in the amount of the intestinal stem cell marker in the cell culture is indicative of the proliferation and/or self-renewal of ISCs in the cell culture, and indicates that the candidate agent is an agent that is capable of stimulating the proliferation of and/or self-renewal of ISCs or (ii) a decrease in the amount of or absence of an intestinal stem cell marker in the cell culture and/or an increase in the amount of a non- stem intestinal progenitor cell marker in the cell culture, wherein a decrease in the amount of or absence of an intestinal stem cell marker in the cell culture and/or an increase in the amount of the non-stem intestinal progenitor cell marker in the culture indicates that the candidate agent is an agent that is capable of enhancing the number and/or function of non- stem intestinal progenitor cel ls. In some embodiments, an intestinal stem cell marker comprises 01mf4. In such embodiments, step (b) of the method comprises assaying for an increase in 01mf4 in the cell culture, wherein increase in the level of 01mf4 in the cell culture is indicative of the proliferation and self-renewal of ISCs in the cell culture. In some embodiments, an intestinal stem cell marker comprises LGR5. In such embodiments, step (b) of the method comprises assaying for an increase in LGR5 in the cell culture, wherein increase in the level of LGR5 in the cell culture is indicative of the proliferation and self- renewal of ISCs in the cell culture. In some embodiments, an intestinal stem cell marker comprises ASCL2. In such embodiments, step (b) of the method comprises assaying for an increase in ASCL2in the cell culture, wherein increase in the level of ASCL2 iin the cell culture is indicative of the proliferation and self-renewal of ISCs in the cell culture. In some embodiments, the non-stem intestinal progenitor cell marker comprises WDR43.
In some embodiments, a method for identifying an agent that is capable of stimulating the proliferation of and/or self-renewal of intestinal stem cells comprises: (a) contacting a cell culture comprising intestinal crypts, e.g., small intestinal crypts with a candidate agent; and (b) assaying Lgr5 !' ISCs in the cell culture for an increase in the amount of organoid bodies formed, wherein an increase in the amount of organoid bodies formed by the Lgr5+ ISCs is ind icative of the proliferation of Paneth cells in the culture.
A wide variety of test agents can be used in the methods. For example, a test agent can be a small molecule, polypeptide, peptide, nucleic acid, oligonucleotide, lipid, carbohydrate, or hybrid molecule. Compounds can be obtained from natural sources or produced synthetically. Compounds can be at least partially pure or may be present in extracts or other types of mixtures. Extracts or fractions thereof can be produced from, e.g., plants, animals, microorganisms, marine organisms, fermentation broths (e.g., soil, bacterial or fungal fermentation broths), etc. In some embodiments, a compound collection ("library") is tested. The library may comprise, e.g., between 100 and 500,000 compounds, or more. Compounds are often arrayed in multwell plates. They can be dissolved in a solvent (e.g., DMSO) or provided in dry form, e.g., as a powder or solid. Collections of synthetic, semisynthetic, and/or naturally occurring compounds can be tested. Compound libraries can comprise structurally related, structurally diverse, or structurally unrelated compounds.
Compounds may be artificial (having a structure invented by man and not found in nature) or naturally occurring. In some embodiments, a library comprises at least some compounds that have been identified as "hits" or "leads" in other drug discovery programs and/or derivatives thereof. A compound library can comprise natural products and/or compounds generated using non-directed or directed synthetic organic chemistry. Often a compound library is a small molecule library. Other libraries of interest include peptide or peptoid libraries, cDNA libraries, and oligonucleotide libraries. A library can be focused (e.g., composed primarily of compounds having the same core structure, derived from the same precursor, or having at least one biochemical activity in common).
Compound libraries are available from a number of commercial vendors such as Tocris Bioscience, Nanosyn, BioFocus, and from government entities. For example, the Molecular Libraries Small Molecule Repository (MLSMR), a component of the U.S. National Institutes of Health (NIH) Molecular Libraries Program is designed to identify, acquire, maintain, and distribute a col lection of >300,000 chemically diverse compounds with known and unknown biological activities for use, e.g., in high-throughput screening (FITS) assays (see https://mli.nih.gov/mli/). The NIH Clinical Collection (NCC) is a plated array of approximately 450 small molecules that have a history of use in human clinical trials. These compounds are highly drug-like with known safety profiles. The NCC collection is arrayed in six 96-well plates. 50 μΐ of each compound is supplied, as an approximately 10 mM solution in 100% DMSO. In some embodiments, a collection of compounds comprising "approved human drugs" is tested. An "approved human drug" is a compound that has been approved for use in treating humans by a government regulatory agency such as the US Food and Drug Administration, European Medicines Evaluation Agency, or a similar agency responsible for evaluating at least the safety of therapeutic agents prior to allowing them to be marketed. The test agent may be, e.g., an antineoplastic, antibacterial, antiviral, antifungal, antiprotozoal, antiparasitic, antidepressant, antipsychotic, anesthetic, antianginal, antihypertensive, antiarrhythmic, antiinflammatory, analgesic, antithrombotic, antiemetic, immunomodulator, antidiabetic, lipid- or cholesterol-lowering (e.g., statin), anticonvulsant, anticoagulant, antianxiety, hypnotic (sleep-inducing), hormonal, or anti-hormonal drug, etc. In some embodiments, a compound is one that has undergone at least some preclinical or clinical development or has been determined or predicted to have "drug-like" properties. For example, the test agent may have completed a Phase I trial or at least a preclinical study in non-human animals and shown evidence of safety and tolerability. In some embodiments, a test agent is substantially non-toxic to cel ls of an organ ism to wh ich the compound may be administered or cells in which the compound may be tested, at the concentration to be used or, in some embodiments, at concentrations up to 1 0-fold, i 00-fold, or 1 , 000-fold higher than the concentration to be used. For example, there may be no statistically significant adverse effect on cell viability and/or proliferation, or the reduction in viability or proliferation can be no more than 1 %, 5%, or 10% in various embodiments.
In various embodiments of any aspect herein pertaining to screening methods (e.g., methods of identifying agents), the screen may be performed using a single test agent or multiple test agents in a given reaction vessel. In various embodiments the number of reaction vessels and/or test agents is at least 10; 100; 1000; 10,000; 100,000, or more. In some embodiments of any aspect herein pertaining at least in part to screening methods (e.g., methods of identifying agents) a high throughput screen (HTS) is performed. High throughput screens often involve testing large numbers of test agents with high efficiency, e.g., in parallel. For example, tens or hundreds of thousands of agents may be routinely screened in short periods of time, e.g., hours to days. Such screening is often performed in multiwell plates (sometimes referred to as microwell or microtiter plates or microplates) containing, e.g., 96, 384, 1536, 3456, or more wells or other vessels in which multiple physically separated depressions, wells, cavities, or areas (collectively "wells") are present in or on a substrate. Different test agent(s) may be present in or added to the different wells. It will be understood that some wells may be empty, may comprise replicates, or may contain control agents or vehicle. High throughput screens may involve use of automation, e.g., for liquid handling, imaging, and/or data acquisition or processing, etc. In some embodiments an integrated robot system comprising one or more robots transports assay-microplates from station to station for, e.g., addition, mixing, and/or incubation of assay constituents (e.g., test agent, target, substrate) and, in some embodiments, readout or detection. A HTS system may prepare, incubate, and analyze many plates simultaneously. Certain general principles and techniques that may be applied in embodiments of a HTS are described in Macarron R & Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565 : 1 -32, 2009 and/or An WF & Tolliday NJ., Introduction: cell-based assays for high- throughput screening. Methods Mol Biol. 486: 1-12, 2009, and/or references in either of these. Exemplary methods are also disclosed in High Throughput Screening: Methods and Protocols (Methods in Molecular Biology) by William P. Janzen (2002) and High- Throughput Screening in Drug Discovery (Methods and Principles in Medicinal Chemistry) (2006) by Jorg Fhjser. Test agent(s) showing an activity of interest (sometimes termed "hits") may be retested and/or, optionally (e.g., depending at least in part on results of retesting) selected for further testing, development, or use. In some embodiments one or more structural analogs of a hit is synthesized. Such analogs may, for example, comprise substitution of one or more functional groups or heteroatorns present in the hit by a different functional group or heteroatom or substituting a heteroatom or functional group present in place of a hydrogen in the hit, etc. In some embodiments one or more such analog(s) are then tested for a property or activity of interest (e.g., ability to increase the level and/or activity of PPAR-δ and/or a PPAR-δ target protein or to mimic the physiological response to a high fat diet).
Positive and/or negative controls may be used in any of the screens. An appropriate positive or negative control can be selected based at least in part on the assay. A negative control may be to perform the assay in the absence of a test agent.
In some embodiments, information derived from sequence analysis, mutational analysis, and/or structural analysis is used in the identification of a modulator. For example, in some embodiments a structure (e.g., a two-dimensional or three-dimensional structure) of a target, e.g., a TF, generated at least in part using, e.g., nuclear magnetic resonance, homology modeling, and/or X-ray crystallography is used. In some embodiments a structure obtained with a ligand (e.g., an inhibitor) bound to the target may be used. In some embodiments a computer-aided computational approach sometimes referred to as "virtual screening" is used in the identification of candidate modulators. Structures of compounds,, e.g., small molecules may be screened for ability to bind to a region (e.g., a "pocket") accessible to the compound. The region may be any region accessible to the compound, e.g., a concave region on the surface or a cleft or a region involved in dimerization. A variety of docking and
pharmacophore-based algorithms are known in the art, and computer programs implementing such algorithms are available. Commonly used programs include Gold, Dock, Glide, FlexX, Fred, and LigandFit (including the most recent releases thereof). See, e.g., Ghosh, S., et al., Current Opinion in Chemical Biology, 10(3): 194-2-2, 2006; Mclnnes C, Current Opinion in Chemical Biology; 1 1(5): 494-502, 2007, and references in either of the foregoing articles, which are incorporated herein by reference. In some embodiments a virtual screening algorithm may involve two major phases: searching (also called "docking") and scoring. During the first phase, the program automatically generates a set of candidate complexes of two molecules (test compound and target molecule) and determines the energy of interaction of the candidate complexes. The scoring phase assigns scores to the candidate complexes and selects a structure that displays favorable interactions based at least in part on the energy. To perform virtual screening, this process may be repeated with a large number of test compounds to identify those that, for example, display the most favorable interactions with the target. In some embodiments, low-energy binding modes of a small molecule within an active site or possible active site or other target region are identified. In some embodiments a compound capable of docking at a site where mutations are known to inhibit activity of the target is identified. Variations may include the use of rigid or flexible docking algorithms and/or including the potential binding of water molecules. In some embodiments the three- dimensional structure of an enzyme's active site may be used to identify potential inhibitors. Agent(s) that have the potential to bind in or near an active site may be identified. These predictions may then be tested using the actual compound. A new inhibitor thus identified may then be used to obtain a structure of the enzyme in an inhibitor/enzyme complex to show how the molecule is binding to the active site. Further changes may be made to the inhibitor, e.g., to try to improve binding. This cycle may be repeated until an inhibitor of sufficient predicted or actual potency (e.g., a desired potency for therapeutic purposes) is identified. Numerous small molecule structures are available and can be used for virtual screening. A collection of compound structures may sometimes referred to as a "virtual library". For example, ZINC is a publicly available database containing structures of mi llions of commercially avai lable compounds that can be used for virtual screening
(http://zinc.docking.org/; Shoichet, J. Chem. Inf. Model., 45( 1 ): 177-82, 2005). A database containing about 250,000 small molecule structures is available on the National Cancer Institute (U.S.) website (at http://129.43.27.140/ncidb2/). In some embodiments multiple small molecules may be screened, e.g., up to 50,000; 100,000; 250,000; 500,000, or up to 1 million, 2 million, 5 million, 10 million, or more. Compounds can be scored and, optionally, ranked by their potential to bind to a target. Compounds identified in virtual screens can be tested in cell-free or cell-based assays or in animal models to confirm their ability to inhibit activity of a target molecule, their ability to activate a target molecule, and/or to assess their biological and/or pharmacological activity. Computational approaches may be used to predict one or more physico-chemical, pharmacokinetic and/or pharmacodynamic properties of compounds identified in a physical or virtual screen. Such information may be used, e.g., to select one or more hits for, e.g., further testing, development, or use. For example, small molecules having characteristics typical of "drug-like" molecules may be selected and/or small molecules having one or more undesired characteristics may be avoided.
In some aspects of any screening and/or characterization methods, test agents are contacted with test cells (and optionally control cells) or used in cell-free assays at a predetermined concentration. In some embodiment the concentration is about up to 1 nM. In some embodiments the concentration is between about 1 nM and about 1 00 nM. In some embodiments the concentration is between about 100 nM and about 10 μΜ. In some embodiments the concentration is at or above 10 μΜ, e.g., between 10 μΜ and 100 μΜ.
Following incubation for an appropriate time, optionally a predetermined time, the effect of compounds or composition on a paramter of interest in the test cells is determined by an appropriate method known to one of ordinary skill in the art, e.g., as described herein. Cells can be contacted with compounds for various periods of time. In certain embodiments cells are contacted for between 12 hours and 20 days, e.g., for between 1 and 10 days, for between 2 and 5 days, or any interven ing range or particular value. Cells can be contacted transiently or continuously. If desired, the compound can be removed prior to assessing the effect on the cells.
* * *
One skilled in the art readily appreciates that the present disclosure is wel l adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The details of the description and the examples herein are representative of certain embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the invention. It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
The articles "a" and "an" as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention provides all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. It is contemplated that all embodiments described herein are applicable to all different aspects of the invention where appropriate. It is also contemplated that any of the embodiments or aspects can be freely combined with one or more other such embodiments or aspects whenever appropriate. Where elements are presented as lists, e.g., in Markush group or similar format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth in so many words herein. It should also be understood that any embodiment or aspect of the invention can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification. For example, any one or more nucleic acids, polypeptides, cells, species or types of organism, disorders, subjects, or combinations thereof, can be excluded.
Where the claims or description relate to a composition of matter, e.g., a nucleic acid, polypeptide, cell, or non-human transgenic animal, it is to be understood that methods of making or using the composition of matter according to any of the methods disclosed herein, and methods of using the composition of matter for any of the purposes disclosed herein are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where the claims or description relate to a method, e.g., it is to be understood that methods of making
compositions useful for performing the method, and products produced according to the method, are aspects of the invention, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.
Where ranges are given herein, the invention includes embodiments in which the endpoints are included, embodiments in which both endpoints are excluded, and embodiments in which one endpoint is included and the other is excluded. It should be assumed that both endpoints are included unless indicated otherwise. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. It is also understood that where a series of numerical values is stated herein, the invention includes embodiments that relate analogously to any intervening value or range defined by any two values in the series, and that the lowest value may be taken as a minimum and the greatest value may be taken as a maximum. Numerical values, as used herein, include values expressed as percentages. For any embodiment of the invention in which a numerical value is prefaced by "about" or "approximately", the invention includes an embodiment in which the exact value is recited. For any embodiment of the invention in which a numerical value is not prefaced by "about" or "approximately", the invention includes an embodiment in which the value is prefaced by "about" or "approximately". "Approximately" or "about" generally includes numbers that fall within a range of 1 % or in some embodiments within a range of 5% of a number or in some embodiments within a range of 10% of a number in either direction (greater than or less than the number) unless otherwise stated or otherwise evident from the context (except where such number would impermissibly exceed 100% of a possible value). It should be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessari ly limited to the order in which the acts of the method are recited, but the invention includes embodiments in which the order is so limited. It should also be understood that unless otherwise indicated or evident from the context, any product or composition described herein may be considered "isolated".
* * *
EXAMPLES
Diet is a modifiable lifestyle factor that has a profound impact on mammalian physiology, health, and disease. Long-lived mammalian tissue-specific stem cells play a key role in how tissues adapt to diverse diet-induced physiological states. Such stem-cells dynamically remodel tissue composition in response to physiological cues by altering the balance between self-renewal and differentiation divisions.1 However, the mechanisms through which diet perturbs tissue stem and progenitor cell biology and influences pathologies, such as cancer, are poorly understood.
The mammalian intestine is known to respond to dietary cues. In low calories states the mammalian intestinal stem cell niche orchestrates tissue remodeling by sensing organismal physiology and pharmacologic targeting of the stem cell niche can promote tissue regeneration. Lgr5+ cells at the base of intestinal crypts constitute a majority of the intestinal stem cells (ISCs) that drive the rapid renewal of the intestinal epithelium.2'3 These Lgr5+ ISCs are adjacent to Paneth cells, which are a central component of the ISC niche. In addition to elaborating key growth factors essential for ISC identity, recent data illustrate that Paneth cells regulate ISC function in response to the physiologic state evoked by calorie restriction (CR, a reduction in calorie intake of 20-40%). 4,5 For example, the presence of Paneth cells in co-culture experiments enhance the potential of Lgr5+ ISCs to propagate organoid bodies or "mini-intestines", and Paneth cells derived from mice on a CR regimen further boost the organoid-forming potential of these ISCs. 4'5 These findings raise the question of whether the Paneth cell niche invariably directs ISC function in response to all dietary cues or whether some diets, such as pro-obesity diets, can alter stem cel l function by acting directly on them. While in diverse species CR diets promote lifespan, health, or both; generally enhance tissue progenitor function; and reduce cancer growth '"5"8, pro-obesity diets are associated with metabolic syndrome and linked to increases in many cancer types.' However, little is known about how stem and progenitor cell adaptation to a pro-obesity diet alters their potential to initiate tumors.1 In the mouse intestine, Lgr5+ stem cells serve as the cell-of- origin for precancerous adenomatous lesions upon loss of the Ape tumor suppressor gene; yet, it is unclear whether this is the case in the context of obesity-linked intestinal
tumorigenesis.9'10 In the fol lowing studies, the present inventors interrogate how long-term high fat d iet (HFD)-induced obesity influences intestinal stem and progenitor cell function and the implications of this physiologic state on the cellular origins of intestinal dysplasia.
Example 1
The present inventors conducted studies to identify methods and processes that augment the function of endogenous stem cells in order to enhance tissue regeneration. The inventors demonstrated that high fat diet-induced obesity by activating a PPAR-delta transcriptional program boosts the function of not only intestinal stem cells (ISCs) but also that of their immediate differentiated progeny (non-stem cell progenitor cells). The PPARs, including PPAR-delta, are a subgroup of nuclear hormone receptors that transcriptionally regulate nutrient and metabolic pathways, including the sensing of fatty acids.
The inventors placed mice on a 60% high fat diet for greater than 8 months and found that this increased the number and function of ISCs (FIG. 1A) and moreover, that a high fat diet increases the incidence of spontaneous intestinal carcinoma. In a functional 3- dimenisional organoid assay, high fat diet-derived ISCs where able to form mini-intestines (organoid bodies) in culture without their endogenous Paneth cells niche, which are required in order for ISCs from regular chow fed mice to form organoid bodies (FIG. IB). Further, we found that non-stem cell progenitors isolated from high fat diet mice had acquired the ability to initiate and maintain these organoid mini-intestines in contrast to those isolated from regular chow fed mice (FIG. 2C). Mechanistically, our data indicate that a high fat diet- induced PPAR-delta program mediates this ISC and progenitor phenotype in high fat diet- induced obesity. Pharmacologically, we are able to mimic many of the effects of HFD on ISCs and intestinal progenitors. Daily IP injections of a PPAR-delta agonist, GW50151 5, at 4mg/kg for 2-3 weeks was sufficient to enhance the numbers of ISCs in vivo (FIG. 2A) and the niche independent organoid-initiating capacity of ISCs and progenitor cells (FIGS. 2B and 2C).
Example 2 To assess the effects of obesity on intestinal homeostasis, the present inventors maintained mice on a long-term HFD for 9- 14 months, which is sufficient time to observe many of the metabolic phenotypes associated with obesity. H'12 Consistent with previous reports, HFD-fed mice gained considerably more mass (36.18 ± 4.78 versus 53.3 ± 15.8g) than their regular chow fed counterparts (FIG. 8A). While the small intestines from HFD-fed mice were shorter in length (39.7 ± 2.3 versus 34.7 ± 2,8cm; FIG. 8C) and weighed less ( 1 .46 ± 0.19 versus 1.20 ± 0.20; FIG. 8B), there was no change in the density of crypt-villous units (FIG. 8D) or in the number of apoptotic cells (FIG. 8K). Morphologically, HFD led to a mild reduction in villi length (480 ± 8 versus 448 ± 18 urn; FIG. 8G), an associated decrease in villous enterocyte numbers ( 1 55 ± 5 versus 135 ± 10; FIG. 8F), and an increase in crypt depth (FIG. 8E). HFD did not change the numbers of chromogranin A+ enteroendocrine cells or alcian blue+ goblet cells per crypt-villous unit of the small intestine (FIGS. 9A and 9B). The HFD also augmented mitochondria numbers in progenitors relative to control, and a HFD also increased mitochondrial numbers in stem cells relative to control as measured by relative mitochondrial DNA quality per cell. To address how HFD affected the frequency of primitive intestinal progenitor cells, the present inventors performed in situ hybridization for olfactomedin 4 (01fm4), a marker that is expressed by the Lgr5+ stem cells (also termed crypt base columnar cells or CBCs).13 Compared to mice fed a regular chow diet, those on a HFD had a 50% increase in the number of 01fm4+ primitive progenitors, as shown in FIG. 3A. Interestingly, HFD had the opposite effect on cryptidin 4+ Paneth cell numbers, leading to a 23% reduction in these niche cells (FIG. 3B). These observations lead to two important conclusions: first, HFD enhances ISCs numbers and self-renewal (e.g. deeper crypts with more 01fm4+ ISCs) at the expense of differentiation (e.g. shorter and less cellular villi); second, the increase in ISCs occurs despite a decrease in the numbers of Paneth cells, raising the possibility that under a HFD ISCs adapt to decreased Paneth cell interactions.
The fact that FIFD boosted the numbers of ISCs and crypt depth in the small intestine indicated that FIFD potentially enhanced the proliferation of ISCs and their more
differentiated progeny (i.e. progenitors or also termed transit-amplifying cells). To address this possibility, the inventors assessed incorporation of 5-bromodeoxyuridine (BrdU) into ISCs and TA-cells. After a 4-h pulse of BrdU, crypts of HFD mice had nearly two-fold more BrdU+ ISCs compared to crypts from controls ( 1 .2 ± 0.3 versus 2.1 ± 0.7; FIG. 3C and FIG. 8H). Furthermore, HFD augmented the number of BrdU+ cells in the larger pool of progenitors (1 1 .6 ± 2.0 versus J 4.7 ± 2.04), indicating that output and migration from this compartment into the villi may also increase. Indeed, HFD mice 24-h after a single dose of BrdU had more absolute numbers of BrdU-labelled cells in the villi (14.0 ± 2.6 versus 19. 1 ± 1 .7; FIG. 81) and a greater percentage of villus enterocytes that were BrdU+ (8.0 ± 1 .4 versus 12.0 ± 2.3%; FIG. 81). These findings demonstrate that in HFD increased stem and progenitor cell proliferation translates into enhanced output and migration of cells from the crypt compartment into the villi.
Example 3
Given that ISC numbers and proliferation increased in HFD, the present inventors sought to determine whether it also boosted the regeneration of the small intestine using in vitro and in vivo assays. To test in vitro function, we isolated small intestinal crypts, which contain all of the stem-cell activity of the epithelium, and assessed, in an unbiased manner (independent of stem-cell markers), their ability to give rise to organoid bodies in 3-D culture. These organoids recapitulate the epithelial architecture and cellular diversity of the mammalian intestine and are a proxy for ISC activity as only stem cells can initiate and maintain these structures long-term.5'14
HFD-derived crypts were almost twofold more likely to initiate these mini-intestines in culture than those derived from controls (0.29 ± 0.05 versus 0.58 ± 0.09; FIG. 3D).
Furthermore, these organoids were more cystic (i.e. less differentiated15) in structure and contained fewer crypt domains (8.3 ± 2.4 versus 3.4 ± 2.2; FIG. 3E), and when sub-cloned the HFD-derived primary organoids generated more secondary organoids (3.4 ± 0.8 versus 6.9 ± 2.8; FIG. 3F). Collectively, these data illustrate that HFD crypts and primary organoids derived from them possess more stem-cell activity.
To determine whether HFD also enhances crypt regeneration in vivo, we performed a clonogenic microcolony assay to test for ISC activity. 5,16 After administration of a lethal dose of irradiation, HFD-fed mice manifested increased numbers of surviving and regenerating crypts (FIG. 3G). The foregoing data therefore support the notion that HFD- treatment boosts the numbers and regenerative capacity of ISCs in vitro and in vivo.
Example 4
To interrogate the effects of the HFD on stem and progenitor cells, the present inventors utilized Lgr5-EGFP-IRES-CreERT2 knock-in mice, which allow for the quantification and isolation of Lgr5-GFPhl stem-cells and Lgr5-GFPlo progenitors.2
Compared to controls, mice on a HFD had a nearly a 2-fold increase in the frequency of Lgr5- GFPhi ISCs (4.4 ± 1 .8% versus 7.7 ± 2.2%; FIG. 3H ), which corroborates that observed in 01fni4+ ISCs (FIG. 3A). The opposing effects of HFD on ISC and Paneth cell numbers led the present inventors to ask whether HFD altered ISC function and their niche dependence. We assayed the clonogenic potential of ISCs from control and HFD-fed mice either alone or in combination with the niche Paneth cells.5 Consistent with earlier studies4'5'14, control ISCs by themselves were inefficient at forming organoids in culture, but, when co-cultured with Paneth cells, 19% of the stem-cells initiated organoid bodies (FIG. 31). Surprisingly, HFD- derived ISCs by themselves (without Paneth cells) had an augmented capacity (4.0 ± 1 .4% versus 24.3 ± 7.4%) to initiate organoids, and co-culture with Paneth cells further increased their organoid-initiating activity (FIG. 31). The foregoing data, together with the observation that HFD uncouples the in vivo expansion of ISCs from their Paneth cell niche, suggest that ISCs undergo autonomous changes in response to a HFD that poises them for niche- independent growth.
Example 5
To address whether dietary constituents of the HFD can recapitulate aspects of the stem-cell phenotype induced by the HFD, the present inventors expanded control diet-derived organoids in crypt media supplemented with palmitic acid (PA), which is an abundant fatty acid constituent of the HFD regimen.17 Low doses of PA did not change the clonogenic potential of control crypts in primary culture (FIG. 4A); however, just as observed with organoids from HFD mice, the PA-treated organoids had fewer crypt domains per organoid (4.2 ± 0.6 versus 2.8 ± 0.7; FIG. 4B). To examine whether PA, like a HFD, augmented the numbers of ISCs per primary organoid, we assayed the self-renewal capacity of the primary organoids in secondary cultures and assessed how PA -treatment influenced the frequency of ISCs. Cells from PA-treated organoids gave rise to a more than twofold increase in secondary organoids (FIGS. 2C and 2D), which correlated with a twofold increase in ISCs (FIG. 4E). Similar to their counterparts derived from HFD mice, these PA-treated ISCs were primed for Paneth cell-independent organoid formation (0.024 ± 0.014 versus 0.079 ± 0.021 ; FIG. 4F). The foregoing data therefore indicates that key dietary constituents of HFD, like PA, may mediate aspects of the in vivo HFD stem-cell phenotype.
Example 6
Several lines of evidence suggest that HFD engages a stable cell state in ISCs: first, HFD-derived organoids maintain increased self-renewal capacity in culture conditions that are not supplemented with fatty acids (FIG. 3F); and second, HFD-derived ISCs are poised for niche-independent growth in the organoid assay, indicating that these ISCs have autonomously activated a program that compensates for reduced Paneth cell interactions. To gain mechanistic insight into how HFD mediates its effects, the present inventors performed mRNA-sequencing on flow sorted LgrS-GFP'11 ISCs and Lgr5-GFP,0W progenitor cells from control and HFD-fed mice, respectively (pooling 2 mice from each treatment group; FIG. 5A). GSEA pathway and transcription factor binding motif analysis revealed enrichment for transcriptional targets and binding motifs of the nuclear receptor PPAR (peroxisome proliferator-activated receptor) family and PPAR heterodimeric binding partners liver/retinoid X receptor (LXR/RXR; FIGS. 5A, 3B and IOC).18, 19 The PPAR family is comprised of three members (alpha, beta/delta, and gamma); amongst these PPAR-delta (PPAR-δ) is the dominant member expressed in intestinal stem and progenitor cells at the mRNA level in control and HFD mice (greater than 6 to 26-fold overexpressed compared to PPAR-alpha and PPAR-gamma, respectively; FIGS. 10A and 10B). Therefore, we focused our attention on PPAR-δ and its potential role in coupling HFD to ISC function.
Although PPAR-δ expression itself does not substantially change (FIG. 10B), a HFD robustly increased the expression of many of its target genes at the mRNA and protein level in ISCs and progenitors (FIGS. 5C and 5D). To functionally address whether engagement of a PPAR-δ program mimics the HFD, the present inventors administered the PPAR-δ agonist GW501 516 for 4 weeks to Lgr5-EGFP-IRES-CreERT2 mice.20,21 This led to the strong induction of PPAR-δ target proteins in ISCs and progenitors (FIG. 5E). Furthermore, agonist- activated PPAR-δ signaling augmented the in vivo frequencies of 01fm4+ and Lgr5+ ISCs (FIGS. 5F and 5.1 ) and proliferation of stem and TA-cells (FIG. 5H) but had no impact on Paneth cell numbers (FIG. 5G). Notably, crypts from agonist-treated mice gave rise to more organoids than those from vehicle-treated mice (FIG. 51), and isolated ISCs were much more effective at Paneth cell-independent organoid-initiation than their control counterparts (0.025 ± 0.009 versus 0.15 ± 0.04; FIG. 5K). The foregoing data indicate that HFD activates PPAR- δ signaling, which in turn can mediate many of the effects of the HFD on ISC function.
Example 7
Because HFD and PPAR-δ activation confer increased stem-cell function, the present inventors sought to determine whether these interventions regulate the Wnt/p-catenin pathway, which is required for ISC identity. 2'22 β-catenin translocation from the cytoplasm to the nucleus is an essentia! step in pathway activation that enables β-catenin-mediated transcriptional stimulation, and nuclear localization is often a proxy for its activity.9,23 We examined β-catenin localization in isolated Lgr5-GFPhl ISCs and Lgr5-GFPlo progenitors, and found that HFD and agonist-induced PPAR-δ signaling led to more nuclear β-catenin accumulation, as illustrated in FIGS. 6 A and 6B and in FIGS. 11 A and 1 I B. This finding was confirmed separately with β-catenin immunohistochemistry on intestinal sections: a
greater percentage of CBCs and TA-cells demonstrated nuclear β-catenin with a HFD (FIGS.
11C and HE) or PPAR-δ agonist administration compared to their respective controls (FIGS.
I l l) and H E),
To address how HFD and agonist-activated PPAR-δ influenced β-catenin
transcriptional activity, we performed microfluidic-based multiplexed single-cell qPCR using primers for a curated list of known β-catenin target genes and intestinal stem cell markers, shown below in Table 3. Single cell analyses of β-catenin target gene expression revealed heterogeneity in control and HFD-derived ISCs and progenitors (FIG. 12A). t-Distributed stochastic neighbor embedding (t-SNE) analysis of single cell gene expression data of all β- catenin target genes demonstrated clustering of HFD-derived ISCs and progenitors (FIG. 7C) from their control fed counterparts, consistent with the notion that HFD perturbs β-catenin target gene expression in primitive intestinal progenitors.
While HFD did not alter expression of stem cell signature genes (β-catenin target genes that differ between stem and progenitor cells, FIGS. 12B and 12D)24, it significantly evoked expression of several other β-catenin target genes, including Bmp4, Jagl, Jag2 and
Edn3 in ISCs (FIG. 6D) and progenitors (FIG. 6E). Furthermore, we found that that while the HFD-induced β-catenin signature genes (HFD signature; FIG. 12C) are heterogeneously expressed in control ISCs and progenitors, they form a distinct cluster upon HFD as shown in the tSNE analysis (FIG. 12E). We then confirmed using single cell qPCR that agonist- activated PPAR-δ also induced transcription of the HFD-induced β-catenin signature genes:
Bmp4, Jagl, Jagl and Edn3 (FIGS. 6F and 6G). Collectively, these results support a model in which HFD-induced PPAR-δ signaling mediates a distinct β-catenin program in ISCs and progenitor cells.
Table 3 - Primer Sequences for Single Cell Analysis (SEQ ID NOs: 1- 188)
Sequence Sequence
Forwa rd Primer Reverse Primer Name Name
ABCB 1 F CAGCAGTCAGTGTGCTTACAA ABCB 1 R ATGGCTCTTTTATCGGCCTCA
ADAM 1 OF ATGGTGTTGCCGACAGTGTTA ADAM10R GTTTGGCACGCTGGTGTTTTT
A LEX I F CTGGTGCCTGCTACTGTGTAT ALEXI R CCCCTACCCCAACATTAGTCT
ASCL2F AAGCACACCTTGACTGGTACG ASCL2R AAGTGGACGTTTGCACCTTCA
AXIN2F TGACTCTCCTTCCAGATCCCA AXIN2R TGCCCACACTAGGCTGACA
BAMB1F GATCGCCACTCCAGCTACTTC BAMBIR GCAGGCACTAAGCTCAGACTT
BCL2 L2F GCGGAGTTCACAGCTCTATAC BCL2L2R AAAAGGCCCCTACAGTTACCA
BCL2L 1 F GACAAGGAGATGCAGGTATTGG BCL2L1 R TCCCGTAGAGATCCACAAAAGT BIRC5F GAGGCTGGCTTCATCCACTG BIRC5R , CTTTTTGCTTGTTGTTGGTCTCC
BMI1F ATCCCCACTTAATGTGTGTCCT BMI1R CTTGCTGGTCTCCAAGTAACG
BMP4F TTCCTGGTAACCGAATGCTGA BMP4R CCTGAATCTCGGCGACTTTTT
CCND1F GCGTACCCTGACACCAATCTC CCNDIR CTCCTCTTCGCACTTCTGCTC
CD44F CACCATTGCCTCAACTGTGC CD44R TTGTGGGCTCCTGAGTCTGA
CDKN2AF CGCAGGTTCTTGGTCACTGT CDKN2AR TGTTCACGAAAGCCAGAGCG
CDX1F GGACGCCCTACGAATGGATG CDX1R GTACCGGCTGTAGTGAAACTC
CLD 1F GGGGACAACATCGTGACCG CLD 1R AGGAGTCGAAGACTTTGCACT
COX2F TGAGCAACTATTCCAAACCAGC COX2R GCACGTAGTCTTCGATCACTATC
D 1F CTCATCAATTCCAACGCGATCA DKK1R GCCCTCATAGAGAACTCCCG
D K4F GTACTGGTGACCTTGCTTGGA DKK4R CCGTTCATCGTGAAACGCTAAG
DNMTIF AAGAATGGTGTTGTCTACCGAC DN T1R CATCCAGGTTGCTCCCCTTG
EDN1F GCACCGGAGCTGAGAATGG EDNIR GTGGCAGAAGTAGACACACTC
EFNBIF TGTGGCTATGGTCGTGCTG EFNB1R CCAAGCCCTTCCCACTTAGG
E1MC1F CTGTTTCATAAGTCCTCCTACGC ENC1R CACCACTGAACATGGCTTCG
EPHB2F GCGGCTACGACGAGAACAT EPHB2R GGCTAAGTCAAAATCAGCCTCA
EPHB3F CATGGACACGAAATGGGTGAC EPHB3R GCGGATAGGATTCATGGCTTCA
FGF18F CCTGCACTTGCCTGTGTTTAC FGF18R TGCTTCCGACTCACATCATCT
FGFBP1F CTAAATCTCTGACGCATGGCA FGFBP1R AACTCCTGATCGGCTTGTGTG
FGFBP3F GGTCGCTTCGTGAGTCCAG FGFBP3R AGCAGCCGTCTCCAGTAGT
FRA1F ATGTACCGAGACTACGGGGAA FRA1R CTGCTGCTGTCGATGCTTG
FSCN 1 F GACTGCGAAGGTCGCTACC FSCN1R CTGATCGGTCTCTTCATCCTGA
GASTF CGCTCCCAGCTACAGGATG GASTR GGTCTGCTATGAAGTGTTGAGG
HATH IF GAGTGGGCTGAGGTAAAAGAGT HATH1R GGTCGGTGCTATCCAGGAG
NEDD9F ATGTGGGCGAGGAATCTTATGG NEDD9R TTCCCTGGGACAATGCCTTG
HES1F CCAGCCAGTGTCAACACGA HES1R AATGCCGGGAGCTATCTTTCT
ID2F ATGAAAGCCTTCAGTCCGGTG ID2R AGCAGACTCATCGGGTCGT
TCF4F CGAAAAGTTCCTCCGGGTTTG TCF4R CGTAGCCGGGCTGATTCAT
JAG IF CCTCGGGTCAGTTTGAGCTG JAG1R CCTTGAGGCACACTTTGAAGTA
JUNF CCTTCTACGACGATGCCCTC JUNR GGTTCAAG GTC ATGCTCTGTTT
L1CAMF AAAGGTGCAAGGGTGACATTC L1CAMR TCCCCACGTTCCTGTAGGT
LAMC2F CAGACACGGGAGATTGCTACT LAMC2R CCACGTTCCCCAAAGGGAT
LEF1F TGTTTATCCCATCACGGGTGG LEFIR CATGGAAGTGTCGCCTGACAG
LGR5F CCTACTCGAAGACTTACCCAGT LGR5R GCATTGGGGTGAATGATAGCA
MENAF GCCCAGAGCAAGGTTACTG MENAR GCCCACAGAAAATACATCGCAA
METF GTGAACATGAAGTATCAGCTCCC METR TGTAGTTTGTGGCTCCGAGAT
MMP14F CAGTATGGCTACCTACCTCCAG M P14R GCCTTGCCTGTCACTTGTAAA
M P7F CTGCCACTGTCCCAGGAAG MP7R GGGAGAGTTTTCCAGTCATGG
MYBF AGACCCCGACACAGCATCTA MYBR CAGCAGCCCATCGTAGTCAT
MYCF ATGCCCCTCAACGTGAACTTC MYCR CGCAACATAGGATGGAGAGCA
MYCBPF GCTGGACACGCTGACGAAA MYCBPR TCTAGGCGAAGCAGCTCTATTT
N0S2F GTTCTCAGCCCAACAATACAAGA N0S2R GTGGACGGGTCGATGTCAC
N0TCH2F ATGTGGACGAGTGTCTGTTGC N0TCH2R GGAAGCATAGGCACAGTCATC NRCAMF AAAGGGAAACCTCCCCCAAG NRCAMR TGTTGATGACAAGGGTTCCTGA
PLAUF GCGCCTTGGTGGTGAAAAAC PLAUR TTGTAGGACACGCATACACCT
PLAURF CAGAGCTTTCCACCGAATGG PLAURR GTCCCCGGCAGTTGATGAG
PPARDF TCCATCGTCAACAAAGACGGG PPARDR ACTTGGGCTCAATGATGTCAC
S 100A4F TCCACAAATACTCAGGCAAAGAG S 100A4R GCAGCTCCCTGGTCAGTAG
SG 1 F CTGCTCGAAGCACCCTTACC SGK1 R TCCTGAGGATGGGACATTTTCA
SMC3 F CGAAGTTACCGAGACCAAACA SMC3R TCACTGAGAACAAACTGGATTGC
SOX9F AGTACCCGCATCTGCACAAC SOX9R ACGAAGGGTCTCTTCTCGCT
SP5F , TGGGTTCACCCTCCAGACTTT SP5R CCGGCGAGAACTCGTAAGG
SRSF3F GCGCAGATCCCCAAGAAGG SRSF3R ATCGGCTACGAGACCTAGAGA
SUZ12F AACTCGAAATCTTATCGCACCAA SUZ12R TGCAAATGTGCAGACAAGCTAT
TCF1F AGGAGTGTAATAGGGCGGAGT TCF1R GAGGTCCGTTATAGGTGTCCA
T1AM 1 F GAAGCACACTTCACGCTCC TTAM1R CTCCAGGCCATTTTCAGCCA
TNCF ACGGCTACCACAGAAGCTG TNCR ATGGCTGTTGTTGCTATGGCA
VEGFF GCCAGACAGGGTTGCCATAC VEGFR GGAGTGGGATGGATGATGTCAG
YAP I F TACTGATGCAGGTACTGCGG YAP1 R TCAGGGATCTCAAAGGAGGAC
CCND3F CGAGCCTCCTACTTCCAGTG CCND3R GGACAGGTAGCGATCCAGGT
FZD 1 F CAGCAGTACAACGGCGAAC FZD1 R GTCCTCCTGATTCGTGTGGC
FZ7F GCCACACGAACCAAGAGGAC FZ7R CGGGTGCGTACATAGAGCATAA
BTRCPF AAGACTGTAATAATGGCGAACCC BTRCPR TCTCTTGGTTTATGCAAAGCCTG
BCATENINF ATGGAGCCGGACAGAAAAGC BCATENINR CTTGCCACTCAGGGAAGGA
NEMOF AAGCACCCCTGGAAGAACC NEMOR CCTGCTCTGAAGGCAGATGTA
NAKED I F AGGAAAGGCATCGAGGAGTG NAKED FR TCGCTCAGTCTCTCCATTCTC
RNF43F TCCGAAAGATCAGCAGAACAGA RNF43R GGACTGCATTAGCTTCCCTTC
LRP6F TTGTTGCTTTATGCAAACAGACG LRP6R GTTCGTTTAATGGCTTCTTCGC
LRP5F AAGGGTGCTGTGTACTGGAC LRP5R AGAAGAGAACCTTACGGGACG
OLF 4F CAGCCACTTTCCAATTTCACTG OLFM4R GCTGGACATACTCCTTCACCTTA
PREX1 F TTTAACCAGGTCGATTCCATCCA PREX 1 R CGGACCGTGCATTCCTCTTT
RAC I F GAGACGGAGCTGTTGGTAAAA RAC1 R ATAGGCCCAGATTCACTGGTT
Cldnl SF ATGTCGGTAGCTGTGGAGAC Cldnl 5R GGACGGAAAGTCCCAGCAG
Edn3F CCCTGGTGAGAGGATTGTGTC Edn3R CCTTGTCCTTGTAAGTGAAGCAC
EFNB2F ATTATTTGCCCCAAAGTGGACTC EFNB2R GCAGCGGGGTATTCTCCTTC
EPHB4F TATGCCACGATACGCTTCACC EPHB4R AGCTTCGCTCTCGTAATAGAAGA
FGFR4F GCTCGGAGGTAGAGGTCTTGT FGFR4R CCACGCTGACTGGTAGGAA
NEDD8F GGAGCGAATCAAGGAGCGT NEDD8R ACGGAACCACCTAGAATCTTGT
TCF7F AGCTTTCTCCACTCTACGAACA TCF7R AATCCAGAGAGATCGGGGGTC
JAG2F CAATGACACCACTCCAGATGAG JAG2R GGCCAAAGAAGTCGTTGCG
SMC2F GGCTGGGATTACCAAAGCCTC S C2R CACCAATAACCACCTGTCTTGT
Sox9F GAGCCGGATCTGAAGAGGGA Sox9R GCTTGACGTGTGGCTTGTTC
NcadherinF ATGTGCCGGATAGCGGGAGC NcadherinR TACACCGTGCCGTCCTCGTC
EcadherinF CACCTGGAGAGAGGCCATGT EcadherinPv TGGGAAACATGAGCAGCTCT
ACTiNBF GGCTGTATTCCCCTCCATCG ACTFNBR CCAGTTGGTAACAATGCCATGT
GAPDHF AGGTCGGTGTGAACGGATTTG GAPDHR TGTAGACCATGTAGTTGAGGTCA Example 8
It is understood that somatic stem cells often accumulate the initial mutations that lead to oncogenic transformation. Because HFD-induced PPAR-δ activates a β-catenin signature in progenitor cells, the present inventors hypothesized that in diet-induced obesity non-stem cell populations can acquire stem-cell features and potentially serve as an additional cells-of-origin for tumor initiation.1'25 To explore this possibility, the present inventors sought to determine whether HFD and agonist-activated PPAR-δ influenced the organoid-initiating capacity of progenitors (non-ISCs). Interestingly, Lgr5-GFPlow progenitors from HFD and PPAR-δ agonist treated mice were capable of forming organoids, as illustrated in FIG. 7A, albeit at a lower frequency than their respective Lgr5-GFPhl stem-cell counterparts (FIGS. 31 and 5K), raising the possibility that enforced PPAR-δ signaling in intestinal progenitors not only bestows organoid-initiating capacity but also tumor-initiating potential.
To test this possibility, the present inventors generated Apcloxp loxp ; Lgr5-EGFP-IRES- CreERT2 mice to assess whether pharmacological PPAR-δ activation modifies the tumorigenic capacity of the Lgr5-GFP'0W progenitors. Injection with tamoxifen leads to Ape- loss in the Lgr5-GFPhl ISCs, which in turn generate Ape-null Lgr5-GFP'0W progenitors. Four days after tamoxifen administration, we flow sorted Ape-null Lgr5-GFPhl ISCs and Lgr5- Q piow progenjtors from veh icle and PPAR-δ agonist treated mice to assess the tumor- forming potential of these populations using separate assays (FIG. 7B): first, we examined their ability to give rise to adenomatous organoids in culture; and second, we interrogated the ability of 10,000 freshly sorted stem and progenitor cells to initiate adenomatous lesions in syngeneic recipient colons.
We found that Ape-null ISCs from PPAR-δ agonist-treated mice were as clonogenic as those from vehic le controls, as illustrated in FIG. 7C, but that enforced PPAR-δ signaling in Ape-null progenitors dramatically boosted their in vitro adenoma-initiating potential (0.04 ± 0.05 versus 0.1 8 ± 0.07; FIG. 7C). Next, we assessed the potential of freshly isolated intestinal stem and progenitor cells to form in vivo adenomatous lesions (FIG. 7B). As in the organoid assay, the PPAR-δ agonist had no additive effect on the ability of Ape-null stem- cells to form intestinal adenomas (0.67 ± 0.13 versus 0.61 ± 0.19; FIGS. 5E and 5F) compared to the vehicle controls. However, enforced PPAR-δ signaling permitted Ape-null progenitors, but not their veh icle-treated counterparts, to robustly initiate adenomas upon transplantation into recipient colons (0 ± 0 versus 0.58 ± 0. 16; FIG. 7F and FIG. 13). The foregoing data indicate that PPAR-δ activation enables a subset of non-stem cells to initiate adenomatous growth in vitro and in vivo after Ape-loss . It is interesting to note that enforced PPAR-δ signaling differentially affects the adenoma-initiating capacity of stem and progenitor cells upon Ape loss. One possible explanation for this divergence may be that ISCs, in contrast to progenitors, are in a cellular state that is facilitative for β-catenin signaling. Progenitors, however, are in a more differentiated cellular state that is less responsive to β-catenin signaling, and perhaps enforced
PPAR-δ signaling in a subset of progenitors augments this responsiveness— thus enabling them to initiate tumors upon Ape-loss.
Discussion
The foregoing data favor a model in which a HFD augments ISC self-renewal and bestows features of sternness (i.e. organoid-initiating capacity) to non-stem cell progenitors through a PPAR-δ regulated program, as illustrated in FIG. 7G. Previous studies on calorie restriction demonstrated that this dietary regimen concordantly enhanced stem and Paneth cell numbers and regulated ISC function non-cell autonomously through the Paneth cell niche with no noticeable effect on progenitor cell function.5 In contrast, here we find that long-term
HFD uncouples stem and Paneth cell numbers and, functionally, these stem-cells have less dependence on Paneth cells in functional assays. Under normal physiological conditions the Paneth cell niche tightly controls ISC growth and function4; however, decreased contact between stem-cells and their niche in PIFD (i.e. more stem-cells than Paneth cells) may result in uncoordinated stem-cel l proliferation and render them more susceptible to accjuiring mutations.
The fact that we find up-regulation of β-catenin targets Jagl and Jag2 in stem and progen itor cells, both of which are Notch ligands, implicates a possible role for Notch signaling. Paneth cells normally elaborate Notch ligands26 and prevent Lgr5+ stem-cells from adopting a differentiated cellular state.27 Because ISC numbers increase in relation to Paneth cells under a HFD or upon PPAR-δ activation, lateral Notch inhibition between proximate stem-cells or progenitor cells may serve as a surrogate source of Notch ligands for Lgr5+ stem-cel ls that are not in direct contact with Paneth cells, allowing them to persist in vivo and in the organoid assay.
Significant epidemiologic and rodent studies link obesity to colon cancer
incidence.1'28"30 A recent study suggests that the number of somatic stem-cell self-renewal divisions accounts for the majority of variation in human cancer.31 An implication of this model is that dietary interventions that boost stem cell self-renewal should increase the potential pool of cells that can undergo mutagenesis. Our data and a previous study32 demonstrate that pro-obesity diets augment the numbers and proliferation of primitive intestinal progenitors, which may partially account for the increase of intestinal tumors with obesity. Another possibility raised by our results is that a diet-induced PPA -δ program also enhances the susceptibility of non-stem cells to undergo transformation, leading to the generation of a larger and more diverse pool of cells capable of initiating tumors in the obese state. Consistent with this possibility, it has been proposed that differentiated cells in the background of lpodeficiency and genetic activation of KRAS and NF-kB possess the capacity to initiate tumors.10 However, the role that PPAR-δ signaling in ISCs and progenitors plays in connecting obesity-related inflammation to tumor initiation remains to be elucidated. Possessing more stem cells or non-stem cells that can undergo oncogenic transformation may be potential contributors as to why diet-induced obesity increase cancer incidence.
We found that fatty acid constituents of the HFD, and HFD-activated pathways, have the potential to increase stem and progenitor cell function and intestinal regeneration but with the potential untoward risk of increasing cancer incidence. A recent report'13 that PPAR-δ in the bone amplifies β-catenin signaling is consistent with our finding that diet-activated PPAR- δ engages a restricted β-catenin program. Notably, genes within this PPAR^-activated β- catenin program includes genes such as Jagl , Jag2, and BMP4 that are often deregulated in early intestinal tumorigenesis (FIGS. 6D and 6F).34'"16 Furthermore, sustained treatment with a PPAR-δ agonist has been linked to colorectal cancer initiation and progression.3742 Although a goal will be to exploit potential downstream mediators of PPAR-δ signaling that safely enhance intestinal regeneration and minimize carcinogenesis, it is possible that PPAR-δ effectors regulate both of these processes. Strategies that harness the pro-regenerative effects of dietary interventions that mimic HFD or agonist-activated PPAR-δ signaling may have an application in patients afflicted with intestinal atrophy and disease.
Materials and Methods
Mice, High Fat Diet, and drug treatment
Mice were housed in the Unit for Laboratory Animal Medicine at the Whitehead Institute for Biomedical Research and Koch Institute for Integrative Cancer Research. Lgr5- EGFP-IRES- CreER T2 mice (strain name: B6.129P2-Lgr5Unl(cre ERT2)Cle/J, stock number 008875), and Rosa26-lacZ mice (strain name: B6.129S4-Gt(ROSA)26Sortm lSo7J, stock number 003474) were obtained from the Jackson Laboratory. Apcloxp exon l 4 has been previously described.43 Long-term high fat diet was achieved by feeding mice a dietary chow consisting of 60 kcal% fat (Research Diets D 12492) beginning at the age of 8- 12 weeks and extending for 9 to 14 months. Control mice were age-matched and fed normal chow ad libitum. GW501516 (Enzo) was reconstituted in DMSO at 4.5 mg ml"1 and diluted 1 : 10 in a solution of 5% PEG400 (Hampton Research), 5% Tween80 (Sigma), 90% H20 for a daily intraperitoneal injection of 4mg/kg. Ape exon 14 was excised by tamoxifen suspended in sunflower seed oil (Spectrum S 1929) at a concentration of 10 mg ml"', and 250 μΐ per 25g of body weight was administered by intraperitoneal injection to mice twice over 4 days before harvesting tissue. BrdU was prepared at 10 mg ml"1 in PBS, passed through 0.22μτη filter and injected at l OOmg kg"1.
Immunohislochemistry (IHC) and immunofluorescence (IF)
As previously described5, tissues were fixed in 10% formalin, paraffin embedded and sectioned. Antigen retrieval was performed with Borg Decloaker RTU solution (Biocare Medical) in a pressurized Decloaking Chamber (Biocare Medical) for 3 minutes. Antibodies used: rat anti-BrdU ( 1 :2000, Abeam 6326), rabbit chromogranin A (1 :3000, Abeam 15160), rabbit monoclonal non-phospho β-catenin (1 :800(IHC), 1 :400(IF), CST 8814S), mouse monoclonal β-catenin ( 1 :200, BD Biosciences 61 0154), rabbit monoclonal anti-cyclinDl (1 :50, CST 2978S), Biotin-conjugated secondary donkey anti-rabbit or anti-rat antibodies were used from Jackson ImmunoResearch. The Vectastain Elite ABC immunoperoxidase detection kit (Vector Labs PK-6101 ) followed by Dako Liquid DAB+ Substrate (Dako) was used for visualization. For immunofluorescence, Alexa Fluor 568 secondary antibody (Invitrogen) was used with Prolong Gold (Life Technologies) mounting media. All antibody incubations were performed with Common Antibody Diluent (Biogenex).
In situ hybridization
The in situ hybridization probes used in this study correspond to expressed sequence tags or fully sequenced cDNAs obtained from Open Biosystems. The accession numbers (IMAGE mouse cDNA clone in parenthesis) for these probes are as follows:
mouse 01fm4 BC 141 127 (9055739), mouse Cryptdin 4 BC 134360 (40134597). Both sense and antisense probes were generated to ensure specificity by in vitro transcription using DIG RNA labelling mix (Roche) according to the manufacturer's instructions and to previously published detailed methods.24,44
Radiation and clonogenic microcolon}' assay
Adult mice were exposed to 15 Gy of ionizing irradiation from a 137-cesium source (GammaCell) and killed after 72 hours. The number of surviving crypts per length of the intestine was enumerated from haematoxyiin and eosiii stained sections.16 Immunoblotting
Antibodies: rabbit polyclonal anti-PPAR-δ ( 1 : 100, Thermo PA 1 -823A), rabbit polyclonal anti-Cpt l a ( 1 :250, ProteinTech 15 1 84- 1 -AP), rabbit polyclonal anti-HMGCS2 ( 1 : 500, Sigma AV41 562), rabbit monoclonal anti-FABP l ( 1 : 1 000, Abeam ab l 29203), rabbit polyclonal anti-y-tubulin ( 1 : 1 000, Sigma T51 92). Lgr5-GFPhl ISCs or GFP,0W progenitors were sorted directly into sample buffer and boiled for five minutes. Samples were resolved by SDS-PAGE and analyzed by immunoblotting with goat anti-rabbit IgG-HRP secondary antibodies ( 1 : 10,000, Santa Cruz Biotechnology sc-2054) and Western Lightning Plus-ECL detection kit (Perkin Elmer, NEL 104001 EA). qRT-PCR
Cells were sorted into Tri Reagent (Life Technologies) and total RNA was isolated according to the manufacturer's instructions with following modification: the aqueous phase containing total RNA was purified using RNeasy plus kit (Qiagen). RNA was converted to cDNA with cDNA synthesis kit (Bio-Rad). qRT-PCR was performed with SYBR green master mix (Bio-Rad) on Bio-Rad iCycler RT-PCR detection system. Primers used are listed on Table 4 below.
Table 4 - Primer Sequences for qRT-PCR (SEQ ID NOs: 1 89-212)
Gene Forward Primer Gene Reverse Primer
PpargJF CCACCAACTTCGGAATCAGCT PpargR TTTGTGGATCCGGCAGTTAAGA
Ppara_F AGAGCCCCATCTGTCCTCTC Ppara_R ACTGGTAGTCTGCAAAACCAAA
Ppard_F TCCATCGTCAACAAAGACGGG Ppard_R ACTTGGGCTCAATGATGTCAC
Mgll_F CGGACTTCCAAGTTTTTGTCAGA Mgll_R GCAGCCACTAGGATGGAGATG
Slc22a3_F CGTTTCTGCTCTTTCG GCTG Slc22a3__R TGCAACTGTGAACTGCCAAG
Fabp1_F GGGAAGAAAATCAAACTCACCATC Fabp1_ R AGTTGTCACCATTTTATTGTCACC
Pdk4_F AGGGAGGTCGAGCTGTTCTC Pdk4_R GGAGTGTTCACTAAGCGGTCA
Hmgcs2_F ATACCACCAACGCCTGTTATGG Hmgcs2_R CAATGTCACCACAGACCACCAG
Cpt1 a_F CCATGAAGCCCTCAAACAGATC Cpt1 aR ATCACACCCACCACCACGATA
Actb_F GGCTGTATTCCCCTCCATCG Actb_R CCAGTTGGTAACGCCATGT mtCytB_F C ATTTATTATC GCGGCCCTA mtCytB_R TGTTGGGTTGTTTGATCCTG bglobin__F GAAGCGATTCTAGGGAGCAG bglobin_ R GGAGCAGCGATTCTGAGTAGA
Flow cytometry and isolation of ISCs and Paneth cells
As previously reported and briefly summarized here, small intestines were removed, washed with cold PBS-/-, opened laterally and cut into 3-5mm fragments. Pieces were washed multiple times with cold PBS-/- until clean, washed 2-3 with PBS-/-/EDTA ( l OmM), and incubated on ice for 90- 1 20 minutes while m ixing at 30-minute intervals. Crypts were then mechanically separated from the connective tissue by shaking, and filtered tiirough a 70- μιτι mesh into a 50-ml conical tube to remove villous material and tissue fragments. At this point the suspension was mainly composed of crypts. Crypts were removed from this step for crypt culture experiments and embedded in Matrigel™ with crypt culture media. For ISC isolation, the crypt suspensions were dissociated to individual cells with TrypLE Express (Invitrogen). Cell labeling consisted of an antibody cocktail comprising CD45-PE
(eBioscience, 30-F 1 1 ), CD3 1 -PE (Biolegend, Mecl 3.3), Terl 19-PE (Biolegend, Terl 19), CD24-Pacific Blue (Biolegend, M l/69), CD 1 17-APC/Cy7 (Biolegend, 2BS), and EPCAM- APC (eBioscience, G8.8). ISCs were isolated as Lgr5-
EGFPh,Epcam+CD24low/ "CD3 LTerl 19~CD45~7-AAD~ EGFPlow progenitors were isolated as EGFP,owEpcam+CD24low "CD31 Terl 19~CD45~7-AAD~ and Paneth cells were isolated as CD24hiSidescatterhiLgr5-EGFP"Epcam+CD3 TTerl 19~CD45~7-AAD~ with a BD FACS Aria II SORP cell sorter into supplemented crypt culture medium for culture. Dead cells were excluded from the analysis with the viability dye 7-AAD (Life Technologies). When indicated, populations were cytospun (Thermo Cytospin 4) at 800 r.p.m. for 2 minutes, or allowed to settle at 37°C in fully humidified chambers containing 5% C02 onto poly-L-lysine- coated slides (Polysciences). The cells were subsequently fixed in 4% paraformaldehyde (pH 7.4, Electron Microscopy Sciences) before staining.
Culture media for crypts and isolated cells
Isolated crypts were counted and embedded in Matrigel™ (Coming 356231 growth factor reduced) at 5-10 crypts per μΙ and cultured in a modified form of medium as described previously.14 Briefly, Advanced DMEM (Gibco) was supplemented by EGF
40 ng ml"'1 (R&D), Noggin 200 ng mf' (Peprotech), R-spondin 500 ng mf1 (R&D or Sino . Biological), N-acetyl-L-cysteine 1 μΜ (Sigma-Aldrich), Ν2 IX (Life Technologies), B27 I X (Life Technologies), Chiron 10 μΜ (Stemgent), Y-27632 dihydrochloride monohydrate 20 ng mf1 (Sigma-Aldrich). 25
Figure imgf000100_0001
drops of Matrigel I M with crypts were plated onto a flat bottom 48-well plate (Corning 3548) and allowed to solidify for 20-30 minutes in a 37°C incubator. Three hundred microliters of crypt culture medium was then overlaid onto the Matrigel™, changed every three days, and maintained at 37°C in fully humidified chambers containing 5% CO2. Clonogenicity (colony-forming efficiency) was calculated by plating 50-300 crypts and assessing organoid formation 3-7 days or as specified after initiation of cultures.
Isolated ISCs or progenitor cells were centrifuged for 5 minutes at 250g, re-suspended in the appropriate volume of crypt culture medium (500-1 ,000 cells μΓ1), then seeded onto 25-30 μΐ Matrigel™ (Corning 35623 1 growth factor reduced) containing 1 μΜ jagged (Ana- Spec) in a flat bottom 48-well plate (Corning 3548). Alternatively, ISCs and Paneth cells were mixed after sorting in a 1 : 1 ratio, centrifuged, and then seeded onto Matrigel™. The Matrigel™ and cells were allowed to solidify before adding 300 μΙ of crypt culture medium. The crypt media was changed every second or third day. Organoid bodies were quantified on days 3, 7 and 10 of culture, unless otherwise specified. With respect to the study results presented in FIGS. 14-16, organoid bodies were quantified on day 3-4. In secondary experiments, individual primary organoids were mechanically dissociated and re-plated, or organoids were dissociated for 10 minutes in TrypLE Express at 32°C, re-suspended with SMEM (Life Technologies), centrifuged and re-suspended in cold SMEM with viability dye 7-AAD. Live cells were sorted and seeded onto Matrigel1 M as previously described.
RNASeq
RNA Isolation. For RNA-seq, total RNA was extracted from 200 sorted Lgr5-GFPhl ISCs or Lgr5-GFPlow progenitors by pooling two to five 71 -week old male mice per HFD and HFD-control using Tri Reagent (Life Technologies) according to the manufacturer's instructions, except for a overnight isopropanol precipitation at -20°C, From the total RNA, poly(A)+ RNA was selected using 01igo(dT)25-Dynabeads (Life technologies) according to the manufacturer's protocol.
RNA-Seq Library Preparation. Strand-specific RNA-seq libraries were prepared using the dUTP-based, Illumina-compatible NEXTflex Directional RNA-Seq Kit (Bioo Scientific) according to the manufacturer's directions. All libraries were sequenced with an Illumina HiSeq 2000 sequencing machine.
Processing of RNA-seq reads and measuring expression level. For RNA-seq data analysis, raw stranded reads (40 nt) were trimmed to remove adapter and bases with quality scores below 20, and reads shorter than 35 nt were excluded. High-quality reads were mapped to the mouse genome (mm 10) with Top Hat version 1 .4.145, using known splice junctions from Ensembl Release 70 and allowing at most 2 mismatches. Genes were quantified with htseq- count (with the "intersect strict" mode) using Ensembl Release 70 gene models. Gene counts were normalized across all samples using estimateSizeFactors() from the DESeq
R/Bioconductor package46. Differential expression analysis was also performed between two samples of interest with DESeq. Gene Set Enrichment analysis (www.broadinsitute.org/gsea) was performed by using the pre-ranked (according to their ratios) 8,240 differentially expressed genes as the expression data set.
Motif Analysis was performed using Haystack motif enrichment tool.
Single Cell Gene Expression Analysis 24 single LgrS-GFP1" ISCs and 72 single Lgr5-GFP'0W progenitor cells were sorted from control or HFD mice for single cell gene expression analysis. For one-tube single-cell sequence-specific pre-amplification, individual primer sets of β-catenin target genes (total of 96) were pooled to 0.1 raM final concentration for each primer. Single cells were directly sorted into 96well plates containing 5ul RT-PCR master mix (2.5ul CellsDirect reaction mix, Invitrogen; 0.5ul primer pool ; 0. 1 ul RT/Taq enzyme, Invitrogen; 1 .9ul nuclease free water) in each wel l . Immediately after, plates were placed on PGR machine for pre-amplification. Sequence specific pre-amplification PCR protocol was as following: 1 ) 60 minutes at 50°C for cell lyses and sequence specific reverse transcription, 2) 3 'minutes at 95°C for reverse transcriptase inactivation and Taq polymerase activation. Then, cDNA was amplified by 20 cycles of 15 seconds at 95°C for initial denaturation, 15 minutes at 60°C for annealing and elongation. After pre-amplification, samples were diluted 1 :5 prior to high throughput m icrofluidic real time PCR analysis using Fluidgm platform. Amplified single cell cDNA samples were assayed for gene expression using individual qPCR primers and 96.96 dynamic arrays on a BioMark System by following manufacturers protocol (Fluidgm). For confirming PPAR-δ mediated induction of the most upregulated genes, regular single cell qRT-PCR was performed using preamplified cDNA with corresponding primers. Threshold crossing (Ct) values were calculated using the BioMark Real-Time PCR Analysis software (Fluidgm). Gene expression levels were estimated by subtracting the Ct values from the background level of 32, which approximately represent the log2 gene expression levels. The t-SNE analysis47 was performed using the MATLAB toolbox for dimensionality reduction. Differential expression analysis was done using the two-sided Wilcoxon- Mann-Whitney rank sum test implemented in the R coin package (www.r-project.org). /"-values were adjusted for multiple testing48 using the p. adjust function in R with method="fdr" option. Fold-changes were calculated as the difference of median of log2 expression levels for the two cell populations. Violin plots were generated using the vioplot package in R. The master heatmap was generated with the MultiExperiment Viewer (MeV) program (http://www.tm4.org/mev.html) using the correlation-based distance and average linkage method as parameters of the unsupervised hierarchical clustering of genes.
Orthotopic transplantation
Apcloxp/i"xp ; Lgr5-EGFP-IRES-CreERT2 mice were treated with vehicle or GW5015 16 for one month, and then injected with two doses of tamoxifen I. P. Four days later, Ape-null Lgr5-GFPhl ISCs and Lgr5-GFPUnv progenitors were sorted by flow cytometry, as described above. For primary cell transplantations, 1 0,000 Ape-null Lgr5-GFPhl ISCs and Lgr5-GFPlow progenitors were resuspended into 90% crypt culture media (as described) and 10%
Matrigel™, then transplanted into the colonic lamina propria of C57BL/6 recipient mice by optical colonoscopy using an injection needle (Hamilton Inc., part number 7750-21, 30 gauge, Kel-F Hub NDL, 14 inches length, 45 degree bevel) and specialized syringe (Hamilton Inc, part number 81242, 500 μί, Model 1750 LT Threaded Plunger). Optical colonoscopy was performed using a Karl Storz Image 1 HD Camera System, Image 1 HUB CCU, 175 Watt Xenon Light Source, and Richard Wolf 1 .9mm/9.5 Fr Integrated Telescope (part number 8626.43 1 ). Four injections were performed per mouse. Mice then underwent colonoscopy four weeks later to assess tumor formation. Colonoscopy videos and images were saved for offline analysis. Following sacrifice, the distal colons were excised and fixed in 10% formalin, then examined by hematoxylin and eosin section to identify adenomas. All histology images were reviewed by a gastrointestinal pathologist who was blinded to treatment groups (S.S. and V.D.).
Drug treatment and mice
Lgr5-EGFP-IRES-CreER T2 mice (strain name: B6. 129P2-Lgr5tuU(cre/ERT2)C17J, stock number 008875), and Rosa26-lacZ mice (strain name: B6.129S4-Gt(ROSA)26Sortm l So7J, stock number 003474) were obtained from the Jackson Laboratory. GW501 516 (Enzo) was reconstituted in DMSO at 4.5 mg mf1 and diluted 1 : 10 in a solution of 5% PEG400
(Hampton Research), 5% Tween80 (Sigma), 90% H20 for a daily intraperitoneal injection of 4mg/kg. Control mice were injected with vehicle.
With respect to the study results presented in FIGS. 14-16, young mice were 2-4 months old. Old mice range from 18-25 months of age. The mice were on a standard chow diet. Mice received a single daily injection with the indicated amount of GW501516 or vehicle in the afternoon. Intestines were harvested the following morning.
Flow cytometry and isolation of ISCs and Paneth cells
As described elsewhere herein and briefly summarized here, small intestines were removed, washed with cold PBS-/-, opened laterally and cut into 3-5mm fragments. Pieces were washed multiple times with cold PBS-/- until clean, washed 2-3 with PBS-/-/EDTA ( l OmM), and incubated on ice for 90-120 minutes while mixing at 30-minute intervals. Crypts were then mechanically separated from the connective tissue by shaking, and filtered through a 70-μιτι mesh into a 50-ml conical tube to remove villous material and tissue fragments. At this point the suspension was mainly composed of crypts. Crypts were removed from this step for crypt culture experiments and embedded in Matrigel™ with crypt culture media. For ISC isolation, the crypt suspensions were dissociated to individual cells with TrypLE Express (Invitrogen). Cell labeling consisted of an antibody cocktail comprising CD45-PE
(eBioscience, 30-Fl 1 ), CD3 1 -PE (Biolegend, Mec l 3.3), Terl 19-PE (Biolegend, Terl 19), CD24-Pacific Blue (Biolegend, M l/69), CD l 17-APC/Cy7 (Biolegend, 2BS), and EPCAM- APC (eBioscience, G8.8). ISCs were isolated as Lgr5-
EGFP1,iEpcam+CD24low/ CD3 rTerl 19"CD45~7-AAD~. EGFPlow progenitors were isolated as EGFPl0WEpcam+CD24l0W ~CD3 rTerl l 9~CD45 ~7-AAD~, and Paneth cells were isolated as CD24hiSidescatterhiLgr5-EGFP Epcam+CD3 1 "Terl 19"CD45"'7-AAD" with a BD FACS Aria II SORP cell sorter into supplemented crypt culture medium for culture. Dead cells were excluded from the analysis with the viability dye 7-AAD (Life Technologies).
References
1 . Mihaylova, M. M., Sabatini, D. M. & Yilmaz, O. H. Dietary and metabolic control of stem cell function in physiology and cancer. Cell stem cell 14, 292-305,
doi: 10.101 6/j .stem. 201 4.02.008 (2014).
2. Barker, N . et al. Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449, 1 003- 1007, doi:nature06196 [pi i] 10.1038/nature06196 (2007).
. Munoz, J. et al. The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent '+4' cell markers. The EMBO journal 31, 3079-3091 ,
doi : 10.1 038/emboj .2012. 166 (2012).
. Sato, T. et al. Paneth cells constitute the niche for Lgr5 stem cells in intestinal crypts. Nature 469, 41 5-418, doi : 10.1038/nature09637 (201 1 ).
. Yilmaz, O. H. et al. mTORC l in the Paneth cel l niche couples intestinal stem-cell function to calorie intake. Nature 486, 490-495, doi: 1 0.1038/naturel l 163 (2012).
. Longo, V. D. & Fontana, L. Calorie restriction and cancer prevention: metabolic and molecular mechanisms. Trends in pharmacological sciences 31 , 89-98,
doi: 10.1016/j .tips.2009. 1 1.004 (2010).
. Nakada, D., Levi, B. P. & Morrison, S. J. Integrating physiological regulation with stem cell and tissue homeostasis. Neuron 70, 703-718, doi: 10.1016/j . neuron.201 1.05.01 1 (201 1 ).
. Johnson, S. C, Rabinovitch, P. S. & aeberlein, M. mTOR is a key modulator of ageing and age-related disease. Nature 493, 338-345, doi: 10.1038/nature l 1 861 (2013).
. Barker, N . et al. Crypt stem cells as the cells-of-origin of intestinal cancer. Nature 457, 608-61 1 , doi :nature07602 [pii] 10.1038/nature07602 (2009).
0. Schvvitalla, S. et al. Intestinal tuniorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell 152, 25-38, doi: 10.1 016/j .cell.2012.12.01 2 (2013). 1 . Eckel-Mahan, K. L. el al. Reprogramming of the circadian clock by nutritional challenge. Cell 155, 1 64- 1478, doi : 10.1 016/j .eel 1.2013. 1 1 .034 (2 ! 3). 2. Winzell, M. S. & Ahren, B. The high-fat diet-fed mouse: a model for studying
mechanisms and treatment of impaired glucose tolerance and type 2 diabetes. Diabetes 53 Suppl 3, S215-219 (2004).
3. Schuijers, .1., van der Fl ier, L. G., van Es, J . & Clevers, H. Robust cre-mediated
recombination in small intestinal stem cells utilizing the olfm4 locus. Stem cell reports 3, 234-241 , doi : 10.1 016/j .stemcr.201 4.05.01 8 (2014).""
4. Sato, T. et al. Single Lgr5 stem cells build crypt-vi l lus structures in vitro without a mesenchymal niche. Nature, doi:nature07935 [pii] 10.1 038/nature07935 (2009).
5. Schuijers, J . et al. Ascl2 Acts as an R-spondin/Wnt-Responsive Switch to Control
Sternness in Intestinal Crypts. Cell stem cell 16, 158- 170, doi: 1 0.1016/j .stem.2014.12.006 (201 5). Marsh, V. et al. Epithelial Pten is dispensable for intestinal homeostasis but suppresses adenoma development and progression after Ape mutation. Nature genetics 40, 1436- 1444, doi:iig.256 [pii] 10.1038/ng.256 (2008).
Buettner, R. et al. Defining high-fat-diet rat models: metabolic and molecular effects of different fat types. Journal of molecular endocrinology 36, 485-501 ,
doi: 10.1677/jme. 1 .01909 (2006).
Peters, J. M, Shah, Y. M. & Gonzalez, F. J. The role of peroxisome proliferator-activated receptors in carcinogenesis and chemoprevention. Nature reviews. Cancer 12, 1 81 -195, doi: 10.1038/nrc3214 (2012).
Tontonoz, P. & Spiegelman, B. M. Fat and beyond: the diverse biology of PPARgamma. Annual review of biochemistry 77, 289-312,
doi: 10. 1 146/annurev.biochem.77.061307.091829 (2008).
Ito, K. et al. A PML-PPAR-delta pathway for fatty acid oxidation regulates hematopoietic stem cell maintenance. Nature medicine 18, 1350-1358, doi: 10.1038/nm.2882 (2012). Narkar, V. A. et al. AMPK and PPARdeita agonists are exercise mimetics. Cell 134, 405- 415, doi : 10.1016/j .cell.2008.06.051 (2008).
van der Flier, L. G. & Clevers, H. Stem Cells, Self-Renewal, and Differentiation in the Intestinal Epithelium. Annual review of physiology, doi: 10.1 146/annurev.physiol.
010908.163145 (2008).
Myant, K. B. et al. ROS production and NF-kappaB activation triggered by RAC 1 facilitate WNT-driven intestinal stem cell proliferation and colorectal cancer initiation. Cell stem, cell 12, 761 -773, doi: 10.1016/j.stem.2013.04.006 (2013).
van der Flier, L. G. et al. Transcription factor achaete scute-like 2 controls intestinal stem cell fate. Cell 136, 903-912, doi:S0092-8674(09)00079-8 [pii] 10.1016/j.cell.2009.01 .031 (2009).
Meacham, C. E. & Morrison, S. J. Tumour heterogeneity and cancer cell plasticity.
Nature 501, 328-337, doi : 10.1 038/nature 12624 (2013).
Pellegrinet, L. et al. Dil l - and dll4-mediated notch signaling are required for homeostasis of intestinal stem cells. Gastroenterology 140, 1230-1240 el 231-1237, doi: 10.1053/ j.gastro.01 1 .01.005 (201 1 ).
Farin, H. F., van Es, J. H. & Clevers, H. Redundant Sources of W t Regulate Intestinal Stem Cells and Promote Formation of Paneth Cells. Gastroenterology,
doi: 10.1053/j.gastro. 2012.08.031 (2012).
Finucane, M. M. et al. National, regional, and global trends in body-mass index since 1980: systematic analysis of health examination surveys and epidemiological studies with 960 country-years and 9.1 million participants. Lancet 377, 557-567, doi: 10.1016/S0140- 6736( 10)62037-5 (201 1 ).
Calle, E. E. & aaks, R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nature reviews. Cancer 4, 579-591, doi: 10.1038/nrc! 408 (2004). Baltgalvis, K. A., Berger, F. G., Pena, M. M., Davis, J. M . & Carson, J. A. The interaction of a high-fat diet and regular moderate intensity exercise on intestinal polyp development in Ape Min/+ mice. Cancer prevention research 2, 641 -649,
doi : 1 0. 1.1 58/1940-6207.CAPR-09-00 1 7 (2009). Tomasetti, C. & Vogelstein, B. Cancer etiology. Variation in cancer risk among tissues can be explained by the number of stem cell divisions. Science 347, 78-81 , doi: 10.1 126/ science.1260825 (201 5).
Man, A. T., Van Landeghem, L., Gavin, H. E., Magness, S. T. & Lund, P. K. Impact of diet-induced obesity on intestinal stem cells: hyperproliferation but impaired intrinsic function that requires insulin/IGF 1 . Endocrinology 155, 3302-33 14, doi: 10.1210/en.2014- 1 1 12 (2014). Scholtysek, C. el al. PPARbeta/delta governs Wnt signaling and bone turnover. Nature medicine 19, 608-613, doi: 10.1 038/nm.3 146 (2013).
Rodi! la, V. et al. Jagged 1 is the pathological link between Wnt and Notch pathways in colorectal cancel-. Proceedings of the National Academy of Sciences of the United States of America 106, 63 1 5-6320, doi: 10. 1073/pnas.0813221 106 (2009).
Kumar, S. R. et al. Preferential induction of EphB4 over EphB2 and its implication in colorectal cancer progression. Cancer research 69, 3736-3745, doi: 10. 1 1 58/0008- 5472.CAN-08-3232 (2009).
Wang, K. et al. SGK l -dependent intestinal tumor growth in APC-deficient mice. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 25, 271 -278, doi: 10.1 159/000276561 (2010).
Wang, D. el al. Peroxisome proliferator-activated receptor delta promotes colonic inflammation and tumor growth. Proceedings of the National Academy of Sciences of the United States of America 111, 7084-7089, doi: 10.1073/pnas.1324233 1 1 1 (2014).
Wang, D. et al. Crosstalk between peroxisome proliferator-activated receptor delta and VEGF stimu lates cancer progression. Proceedings of the National Academy of Sciences of the United Stales of America 103, 19069- 19074, doi: 10. 1073/pnas.0607948103 (2006). Park, B. H., Vogelstein, B. & Kinzler, K. W. Genetic disruption of PPARdelta decreases the tumorigenicity of human colon cancer cells. Proceedings of the National Academy of Sciences of the United States of America 98, 2598-2603 , doi: 10.1073/pnas.051630998 (2001 ).
Zuo, X. et al. Targeted genetic disruption of peroxisome proliferator-activated receptor- delta and colonic tumorigenesis. Journal of the National Cancer Institute 101, 762-767, doi: 1 0. 1093/jnci/djp078 (2009).
Gupta, R. A. et al. Activation of nuclear hormone receptor peroxisome proliferator- activated receptor-delta accelerates intestinal adenoma growth. Nature medicine 10, 245- 247, doi: 10.1038/nm993 (2004).
Barak, Y. et al. Effects of peroxisome proliferator-activated receptor delta on
placentation, adiposity, and colorectal cancer. Proceedings of the National Academy of Sciences of the United States of America 99, 303-308, doi: 10.1073/pnas.012610299 (2002).
Colnot, S. et al. Colorectal cancers in a new mouse model of familial adenomatous polyposis: influence of genetic and environmental modifiers. Laboratory investigation; a journal of technical methods and pathology 84, 1619- 1630,
doi: 1 0. 1038/labinvest.3700180 (2004).
Gregorieff, A. & Clevers, H. In situ hybridization to identify gut stem cells. Current protocols in stem cell biology Chapter 2, Unit 2F 1 ,
doi: 10.1002/97804701 5 1 808.sc02f01 s 12 (2010).
Trapnell, C, Pachter, L. & Salzberg, S. L. TopHat: discovering splice junctions with RNA-Seq. Bio informatics 25, 1 105-1 1 1 1 , doi: 10.1093/bioinformatics/btp l 20 (2009). Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome biology 11, R106, doi: 10.1 186/gb-2010-l l -10-rl 06 (2010).
van der Maaten, L. & Hinton, G. Visualizing Data using t-SNE. J Mach Learn Res 9, 2579-2605 (2008).
Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate - a Practical and Powerful Approach to Multiple Testing. J Roy Stat Soc B Met 51, 289-300 (1995).

Claims

What is claimed is:
1. A method of stimulating the proliferation and/or self-renewal of one or more
intestinal stem cells in mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR-δ) or a PPAR-δ target protein, thereby stimulating the proliferation and/or self-renewal of one or more intestinal stem cells.
2. A method according to claim 1 wherein the intestinal stem cells comprise leucine-rich repeat-containing G-protein coupled receptor 5-positive (LGR5+) stem cells.
3. A method according to claims 1 or 2 wherein the population of cells is selected from the group consisting of LGR5+ stem cells, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells.
4. A method according to any one of claims 1 to 3 wherein the population of cells is contacted with both an agent that increases the level and/or activity of PPAR-δ and an agent that increases the level and/or activity of a PPAR-δ target protein.
5. A method according to any one of claims 1 to 4 wherein the PPAR-δ target protein is selected from the group consisting of carnitine palmitoyltransferase 1A (CPT1 A), 3- hydroxy-3-methy]glutaryl-CoA synthase 2 (HMGCS2), and fatty acid binding protein 1 (FABP 1 ).
6. A method according to any one of claims 1 to 5 wherein the agent increases the level and/or activity of both PPAR-δ and the PPAR-δ target protein.
7. A method according to any one of claims 1 to 6 wherein the agent increases the level and/or activity of the PPAR-δ target protein in intestinal stem and/or non-stem cell progenitor cells.
8. A method according to any one of claims 1 to 7 wherein the agent comprises a high fat d iet mimetic.
9. A method according to any one of claims 1 to 8 wherein the agent comprises a PPAR- δ agonist.
1 0. A method according to any one of claims 1 to 9 wherein the agent comprises 2-[2- methyl-4-[[4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-thiazol-5- yl]methylsulfanyl]phenoxy]acetic acid (GW50 15 16) or an analog or derivative thereof.
1 1 . A method accord ing to any one of claims 1 to 1 0 wherein the agent comprises a
PPAR-δ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FAB P I agonist.
12. A method according to any one of claims 1 to 1 1 wherein the contacting occurs in vitro.
1 3. A method according to any one of claims 1 to 1 1 wherein the contacting occurs in vivo in a subject.
14. A method according to claim 13 wherein the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious col itis, ischemic colitis, and inflammatory colitis.
1 5. A method according to claims 13 or 14 further comprising determining that the
subject is in need of treatment for a gastrointestinal d isorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic col itis, and inflammatory colitis.
1 6. A method according to claims 14 or 1 5 wherein inflammatory bowel disease is
selected from the group consisting of Crohn's disease and ulcerative colitis.
1 7. A method according to claim 1 3 wherein the subject is selected for treatment of an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation. 8. A method according to claims 1 3 or 1 7 further comprising determining that the
subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
19. A method according to claims 1 7 or 1 8 wherein exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, radiotherapy, and space or cosmic radiation.
20. A method according to any one of claims 13 to 19 further comprising determining that the subject is in need of enhanced intestinal function.
21 . A method according to any one of claims 1 3 to 20 further comprising placing the subject on a high fat diet.
22. A method according to claim 21 wherein the high fat diet comprises a
macronutritional composition of at least 60% of total daily calories comprising fat.
23. A method according to claims 21 or 22 wherein the high fat diet comprises a diet restricted in terms of total calories.
24. A method of promoting regeneration of mammalian intestinal tissue, the method comprising contacting a population of cells in the mammalian intestinal tissue with an effective amount of an agent that increases the level and/or activity of peroxisome proliferator activated receptor delta (PPAR-δ) or a PPAR-δ target protein, thereby promoting regeneration of the mammalian intestinal tissue.
25. A method according to claim 24 wherein the intestinal stem cells comprise leucine- rich repeat-containing G-protein coupled receptor 5-positive (LGR5 ' ) stem cells.
26. A method according to claims 24 or 25 wherein the population of cells is selected from the group consisting of LGR5+ stem cel ls, non-stem cell progenitor cells, and optionally Paneth cells, and/or goblet cells.
27. A method according to any one of claims 24 to 26 wherein the population of cells is contacted with both an agent that increases the level and/or activity of PPAR-δ and an agent that increases the level and/or activity of a PPAR-δ target protein.
28. A method according to any one of claims 24 to 27 wherein the PPAR-δ target protein is selected from the group consisting of CPT1 A, HMGCS2, and FABP 1 .
29. A method according to any one of claims 24 to 28 wherein the agent increases the level and/or activity of both PPAR-δ and the PPAR-δ target protein.
30. A method according to any one of claims 24 to 29 wherein the agent increases the level and/or activity of the PPAR-δ target protein in intestinal stem and/or non-stem cell progenitor cells.
3 1 . A method according to any one of claims 24 to 30 wherein the agent comprises a high fat diet mimetic.
32. A method according to any one of claims 24 to 3 1 wherein the agent comprises a PPAR-δ agonist.
33. A method according to any one of claims 24 to 32 wherein the agent comprises 2-[2- methyl-4-[[4-methyl-2-[4-(trifluoromethyl)phenyl]- l ,3-thiazol-5- yl]methylsulfanyl]phenoxy]acetic acid (GW5015 16) or an analog or derivative thereof.
34. A method according to any one of claims 24 to 33 wherein the agent comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT 1A agonist, a HMGCS2 agonist, and a FABP 1 agonist.
35. A method according to any one of claims 24 to 34 wherein the contacting occurs in vitro.
36. A method according to any one of claims 24 to 34 wherein the contacting occurs in vivo in a subject.
37. A method according to claim 36 wherein the subject is selected for treatment of a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischem ic colitis, and inflammatory colitis,
38. A method according to claims 36 or 37 further comprising determining that the
subject is in need of treatment for a gastrointestinal disorder selected from the group consisting of inflammatory bowel disease, infectious colitis, ischemic colitis, and inflammatory colitis.
39. A method according to claims 37 or 38 wherein inflammatory bowel disease is selected from the group consisting of Crohn's disease and ulcerative colitis.
40. A method according to claim 36 wherein the subject is selected for treatment of an a fl iction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal inj ury, total parenteral nutrition, and exposure to ionizing radiation.
41 . A method according to claims 36 or 37 further comprising determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
42. A method according to claims 40 or 41 wherein exposure to ionizing radiation is from an ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, radiotherapy, and space or cosmic radiation.
43. A method according to any one of claims 36 to 42 further comprising determining that the subject is in need of enhanced intestinal function.
44. A method according to any one of claims 36 to 43 further comprising placing the subject on a high fat diet.
45. A method according to claim 44 wherein the high fat diet comprises a
macronutritional composition of at least 60% of total daily calories comprising fat.
46. A method according to claims 44 or 45 wherein the high fat diet comprises a diet restricted in terms of total daily calories consumed.
47. A method of treating an affliction characterized by intestinal atrophy in a subject in need thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby treating the affliction characterized by intestinal atrophy.
48. A method according to claim 47 further comprising determining that the subject is in need of treatment for an affliction characterized by intestinal atrophy.
49. A method according to claims 47 or 48 wherein the affliction is selected from the group consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome, drug-induced or toxin-induced intestinal injury, total parenteral nutrition, and exposure to ionizing radiation.
50. A method according to any one of claims 47 to 49 wherein the affliction is selected from the group consisting of Crohn's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis.
51. A method according to any one of claims 47 to 50 wherein the composition comprises a high fat diet mimetic.
52. A method according to any one of claims 47 to 5 1 wherein the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
53. A method according to claim 52 wherein the PPAR-δ agonist comprises GW501 51 6 or an analog or derivative thereof.
54. A method according to any one of claims 47 to 51 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
55. A method according to any one of claims 47 to 51 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1A agon ist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
56. A method accord ing to any one of claims 47 to 55 further comprising placing the subject on a high fat diet.
57. A method according to claim 56 wherein the high fat diet comprises a calorie
restricted diet.
58. A method of minimizing the risk of exposure to an ionizing radiation source, the method comprising administering to an individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby minimizing the risk of exposure to the ionizing radiation source.
59. A method according to claim 58 wherein the composition comprises a high fat diet mimetic.
60. A method according to claims 58 or 59 wherein the composition comprises a PPAR-δ agonist and a pharmaceutical ly acceptable carrier, diluent, or excipient.
61 . A method according to claim 60 wherein the PPAR-δ agonist comprises GW501 51 6 or an analog or derivative thereof.
62. A method according to any one of claims 58 to 61 wherein the PPAR-δ target protein is selected from the group consisting of CPT 1 A, HMGCS2, and FABP l .
63. A method accord ing to any one of claims 58 to 62 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
64. A method according to any one of claims 58 to 62 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT 1A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
65. A method according to any one of claims 58 to 64 wherein the ionizing radiation source is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation.
66. A method according to any one of claims 58 to 65 wherein the individual is an
ind ividua l that is being administered, or about to be administered, radiotherapy.
67. A method of increasing tolerance to ionizing radiation in an individual, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, wherein the composition increases the threshold dose of lethal ionizing radiation to above 8 Gy.
68. A method according to claim 67 wherein the composition comprises a high fat diet mimetic.
69. A method according to claim 67 wherein the composition comprises a PPAR-δ
agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
70. A method according to claim 69 wherein the PPAR-δ agonist comprises GW50151 6 or an analog or derivative thereof.
71 . A method according to claim 67 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
72. A method according to claim 67 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT 1 A agonist, (ii) a HMGCS2 agonist, (i ii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
73. A method according to any one of claims 67 to 72 wherein the threshold dose of lethal ionizing radiation is increased to about 15 Gy.
74. A method of treating an individual exposed to harmful ionizing radiation, the method comprising administering to the individual an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby treating the individual exposed to harmfu l ionizing radiation.
75. A method according to claim 74 wherein the composition comprises a high fat diet mimetic.
76. A method according to claim 74 wherein the composition comprises a PPAR-δ
agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
77. A method according to claim 76 wherein the PPAR-δ agonist comprises GW5015 16 or an analog or derivative thereof.
78. A method according to claim 74 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
79. A method according to claim 74 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
80. A method according to any one of claims 74 to 79 wherein the harmful ionizing radiation is a source of accidental or incidental ionizing radiation selected from the group consisting of a nuclear power plant, a nuclear weapon, and space or cosmic radiation.
81 . A method according to any one of claims 74 to 80 wherein the individual is an individual that is being administered, or about to be administered, radiotherapy.
82. A method according to any one of claims 74 to 81 further comprising placing the ind ividual on a high fat diet.
83. A method according to claim 82 wherein the high fat diet comprises a calorie
restricted diet.
84. A method of treating cancer in a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein; and (b) administering an effective amount of ionizing radiation to the subject.
85. A method according to claim 84 wherein the composition: (i) increases the subject's tolerance for ionizing rad iation; (ii) m inimizes undesirable side-effects due to the ionizing radiation; (iii) protects against gastrointestinal drug toxicity.
86. A method according to claims 84 or 85 wherein the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
87. A method according to claim 43 wherein the PPAR-δ agonist comprises GW501 1 6 or an analog or derivative thereof.
88. A method according to claims 84 or 85 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of
(i) -(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
89. A method according to claims 84 or 85 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
90. A method according to any one of claims 84 to 89 wherein the composition is: (i) administered to the patient prior to administering the ionizing radiation to the subject;
(ii) co-administered to the subject with the ionizing radiation; (iii) administered to the subject after administering the ionizing radiation to the subject; and combinations thereof.
91 . A method according to any one of claims 84 to 90 further comprising administering a chemotherapeutic agent to the subject.
92. A method according to claim 91 wherein the composition is administered prior to the chemotherapeutic.
93. A method according to claim 91 , wherein the composition is concomitantly
administered with the chemotherapeutic.
94. A method according to any one of claims 84 to 93 further comprising placing the individual on a high fat diet.
95. A method according to claim 94 wherein the high fat diet comprises a calorie
restricted diet.
96. A method of administering radiotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering radiotherapy to the subject.
97. A method administering proton therapy to a subject in need thereof, the method
comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering proton therapy to the subject.
98. A method of administering chemotherapy to a subject in need thereof, the method comprising: (a) administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ; and (b) administering chemotherapy to the subject.
99. A method according to claim 96 wherein the composition is administered prior to administering the radiotherapy to the subject.
100. A method according to claim 96 wherein the composition is administered to the
subject concomitantly with the radiotherapy.
101 . A method according to claim 97 wherein the composition is administered prior to administering the proton therapy to the subject.
102. A method according to claim 97 wherein the composition is administered to the
subject concomitantly with the proton therapy.
1 03. A method according to claim 98 wherein the composition is administered prior to administering the chemotherapy to the subject.
104. A method according to claim 98 wherein the composition is administered to the
subject concomitantly with the chemotherapy.
105. A method according to any one of claims 96 to 98 wherein the composition comprises a high fat diet mimetic.
106. A method according to any one of claims 96 to 98 wherein the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
107. A method according to claim 106 wherein the PPAR-δ agonist comprises GW5015 16 or an analog or derivative thereof.
1 08. A method according to any one of claims 96 to 98 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT 1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient. 09. A method according to any one of claims 96 to 98 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPT1 A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient. 1 0. A method according to any one of claims 96 to 109 further comprising placing the individual on a high fat diet. 1 1. A method according to claim 1 10 wherein the high fat d iet comprises a calorie
restricted diet. 12. A radioprotective composition comprising an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, diluent, or excipient. 13. A chemoprotective composition comprising an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, and a pharmaceutically acceptable carrier, di luent, or excipient. 14. A composition according to claims 1 1 2 or 1 13 wherein the agent comprises a high fat diet mimetic. 1 5. A composition according to claims 1 12 or 1 13 wherein the agent comprises a PPAR-δ agonist. 16. A composition according to claim 1 1 5 wherein the agent comprises GW501 516 or an analog or derivative thereof.
1 1 7. A composition according to claims 1 12 or 1 13 wherein the composition comprises at least one PPAR-5 target protein agonist selected from the group consisting of (i) a CPU A agonist, (ii) a HMGCS2 agonist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
1 1 8. A composition according to claims 1 12 or 1 13 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTI A agonist, (ii) a HMGCS2 agon ist, (iii) a FABP 1 agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
1 1 9. A composition according to any one of claims 1 12 to 1 18 further comprising a
chemotherapeutic agent.
1 20. A composition according to any one of claims 1 12 to 1 19 further comprising a
radiotherapeutic agent.
12 1. A composition according to any one of claims 1 12 to 120 formu lated for
administration as an enema.
122. A composition according to any one of claims 1 12 to 120 formulated for oral
administration.
123. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to promote intestinal regeneration, protect against intestinal tissue damage, and/or stimulate the proliferation and/or self-renewal of one or more intestinal stem cells.
124. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to treat an affliction characterized by intestinal atrophy.
125. Use according to claim 124 wherein the affliction is selected from the group
consisting of an inflammatory disease, an autoimmune disease, vascular disease, cancer, infection, short bowel syndrome.
126. Use according to claim 124 wherein the affliction is selected from the group consisting of Crohn 's disease, infectious colitis, ischemic colitis, inflammatory colitis, and ulcerative colitis.
127. Use according to claim 124 wherein the affliction is advanced age.
128. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein to protect against, mitigate, or alleviate, the harmful effects of exposure to ionizing radiation.
129. Use according to claim 128 wherein exposure to ionizing radiation is from an
ionizing radiation source selected from the group consisting of a nuclear power plant, a nuclear weapon, cosm ic or space radiation.
1 30. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with radiotherapy to protect against the harmful effects of ionizing radiation.
1 3 1. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with chemotherapy to protect against gastrointestinal drug toxicity.
132. Use of an agent that increases the level and/or activity of PPAR-δ and/or a PPAR-δ target protein, in combination with total parenteral nutrition to protect against intestinal atrophy.
133. Use according to any one of claims 123 to 132 wherein the agent comprises a high fat diet mimetic.
134. Use according to any one of claims 123 to 132 wherein the agent comprises a PPAR- δ agonist.
135. Use according to any one of claim 134 wherein the PPAR-δ agonist comprises
GW501 5 16 or an analog or derivative thereof.
1 36. Use according to any one of claim 123 to 135 wherein the agent comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT 1 A agonist, a HMGCS2 agonist, and a FARP 1 agonist.
1 37. Use of claim 130. wherein the agent is administered prior to exposure to ionizing radiation.
138. Use of claim 130 wherein the agent is concomitantly administered during the
exposure to ionizing radiation.
139. Use of claim 13 1 wherein the agent is administered prior to the chemotherapy.
140. Use of claim 13 1 wherein the agent is concomitantly administered with the
chemotherapy.
141. Use of claim 132 wherein the agent is administered prior to the total parenteral nutrition.
142. Use of claim 132 wherein the agent is concomitantly administered with the total parenteral nutrition.
143. A method for expanding a population of intestinal stem cells and/or non-stem
intestinal progenitor cells comprising contacting a population of intestinal stem cells and/or non-stem intestinal progenitor cells with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein.
144. A method according to claim 143 wherein the intestinal stem cells comprise LGR5+ stem cells.
145. A method according to claims 143 or 1 44 wherein the agent comprises a high fat diet mimetic.
146. A method according to any one of claims 143 to 145 wherein the agent comprises a PPAR-δ agonist.
147. A method according to claim 146 wherein the PPAR-δ agonist comprises GW5015 16 or an analog or derivative thereof.
1 48. A method according to any one of claims 143 or 147 wherein the agent comprises or a PPAR-δ target protein agonist selected from the group consisting of a CPT 1 A agonist, a HMGCS2 agon ist, and a FABP 1 agonist.
149. A method according to any one of claims 143 or 148 wherein Paneth cells are not present in the population of intestinal stem cells and/or non-stem intestinal progenitor cells.
1 50. A method accord ing to any one of claims 143 or 1 49 wherein the method is
performed ex vivo.
1 5 1 . A method according to any one of claims 143 or 149 wherein the method is
performed in vivo in a subject.
152. A method according to claim 151 further comprising placing the subject on a high fat diet.
153. A method according to claim 1 52 wherein the diet comprises a calorie restricted diet.
1 54. A method of endowing at least one non-stem intestinal progenitor cell with at least one attribute of intestinal stem cells, the method comprising contacting a population of mammalian intestinal cells comprising at least one non-stem progenitor cell with an effective amount of an agent that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby endowing at least one non-stem intestinal progenitor cell with the at least one attribute of intestinal stem cells.
155. A method according to claim 154 wherein the at least one attribute comprises the ability to form organoid mini-intestines in culture in the absence of the Paneth cell niche.
1 56. A method according to claims 1 54 or 155 wherein the intestinal stem cells comprise LGR5+ stem cells.
157. A method accord ing to any one of claims 1 54 to 1 56 wherein the agent comprises a high fat diet mimetic.
158. A method accord ing to any one of claims 1 54 to 157 wherein the agent comprises a PPAR-δ agonist.
159. A method according to claim 158 wherein the PPAR-δ agonist comprises GW5015 16 or an analog or derivative thereof.
160. A method according to any one of claims 1 54 to 159 wherein the agent comprises or a PPAR-δ target protein agonist selected from the group consisting of a CPT 1 A agonist, a HMGCS2 agonist, and a FABP 1 agonist.
161 . A method of obtaining mammalian intestinal stem cel ls and/or non-stem intestinal progenitor cells with an enhanced ability to form organoid bodies in culture in the absence of the Paneth cells, the method comprising: (a) administering a high fat diet or a high fat diet mimetic to a mammal, wherein the high fat diet or high fat diet mimetic enhances the ability of intestinal stem cells and/or non-stem intestinal progenitor cells in the mammal to form organoid bodies in culture; and (b) isolating intestinal stem cells and/or non-stem intestinal progenitor cells from the mammal, thereby obtaining mammalian intestinal stem cells and/or non-stem intestinal progenitor cells with the enhanced ability to form organoid bodies in culture.
162. A method according to claims 161 further comprising assessing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells to form organoid bodies in culture in the absence of Paneth cells.
163. A method according to claim 162 wherein assessing is performed by comparing the ability of the intestinal stem cells and/or non-stem intestinal progenitor cells obtained from the mammal in step (b) to form organoid bodies in culture in the absence of Paneth cells to the ability of intestinal stem cells and/or non-stem intestinal progenitor cells obtained from control mammals which were not administered a high fat diet of high fat diet mimetic to form organoid bodies in culture in the absence of Paneth cells.
1 64. A method according to any one of claims 161 to 163 further comprising a step (c) forming organoid bodies in culture in the absence of Paneth cells.
1 65. A method according to any one of claims 16 1 to 164 wherein the high fat diet or the high fat diet mimetic increases the level and/or activity of PPAR-δ or a PPAR-δ target protein in the mammal's intestinal stem cells and/or non-stem intestinal progenitor cells.
1 66. A method according to any one of claims 161 to 165 wherein the high fat diet
mimetic comprises a PPAR-δ agonist.
167. A method according to any one of claims 161 to 166 wherein the high fat diet mimetic comprises a PPAR-δ target protein agonist selected from the group consisting of a CPT1 A agonist, a HMGCS2 agonist, and a FABP 1 agonist.
168. A method according to any one of claims 161 to 167 wherein the mammal comprises a mouse.
169. Use of PPAR-δ and/or a PPAR-δ target gene as a prognostic biomarker to detect obese individuals at risk for colorectal cancer.
170. A method of identifying an obese individual at risk of developing colorectal
carcinoma, the method comprising: (a) determining the level of expression of PPAR- δ or a PPAR-δ target gene in a biological sample obtained from an obese individual; and (b) identifying an obese individual as being at risk of developing colorectal carcinoma if the level of expression of PPAR-δ or the PPAR-δ target gene in the biological sample is elevated as compared to the level of expression of PPAR-δ or the PPAR-δ target gene in control individuals without colorectal carcinoma.
171 . A method according to claim 170 wherein the biological sample comprises a colon biopsy specimen.
1 72. A method according to claims 1 70 or 17 1 wherein the biological sample comprises an epithelial cell.
1 73. A method according to any one of claims 170 to 172 wherein the biological sample is obtained by performing a colonoscopic biopsy.
174. A method according to any one of claims 170 to 1 73 wherein (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene comprises determining the mRNA level of expression of PPAR-δ or the PPAR-δ target gene.
1 75. A method according to any one of claims 1 70 to 174 wherein (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene is accomplished by performing a hybridization-based assay, a polymerase chain reaction-based assay, or sequencing.
1 76. A method according to any one of claims 170 to 1 73 wherein (a) determining the level of expression of PP AR-δ or the PPAR-δ target gene comprises determining the protein level of expression of PPAR-δ or the PPAR-δ target gene.
1 77. A method according to any one of claims 170 to 1 73 or 1 76 wherein (a) determining the level of expression of PPAR-δ or the PPAR-δ target gene is accomplished by ELISA, Western blot, mass spectrometry, or immunohistochemistry.
178. A method of reducing loss of intestinal stem cells and/or non-stem intestinal
progenitor cells in a subject at risk thereof, the method comprising administering to the subject an effective amount of a composition that increases the level and/or activity of PPAR-δ or a PPAR-δ target protein, thereby reducing loss of intestinal stem cells and/or non-stem intestinal progenitor cells.
1 79. A method according to claim 1 78 wherein the subject is aged.
1 80. A method according to claim 179 wherein the subject is a human.
1 81 . A method according to claims 178 or 180 wherein the subject is at least about forty years old. 82. A method according to claims 178 or 180 wherein the subject is at least about fifty years old.
1 83. A method according to claims 178 or 1 80 wherein the subject is at least about sixty years old. 84. A method according to claims 178 or 1 80 wherein the subject is at least about seventy years old. 85. A method according to claims 178 to 184 wherein the subject further exhibits the loss of intestinal stem cel ls and/or non-stem intestinal progenitor cells. 86. A method according to claims 1 78 to 185 wherein the composition further comprises a high fat diet mimetic. 87. A method according to claims 1 78 to 186 wherein the composition comprises a PPAR-δ agonist and a pharmaceutically acceptable carrier, diluent, or excipient.
188. A method according to claim 187 wherein the PPAR-δ agonist comprises GW501516 or an analog or derivative thereof.
189. A method according to claims 178 to 186 wherein the composition comprises at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTl A agonist, (ii) a HMGCS2 agonist, (iii) a FABP l agonist, and (iv) any combination of (i)-(iii); and a pharmaceutically acceptable carrier, diluent, or excipient.
190. A method according to claims 178 to 186 wherein the composition comprises (a) at least one PPAR-δ agonist; (b) at least one PPAR-δ target protein agonist selected from the group consisting of (i) a CPTl A agonist, (ii) a H GCS2 agonist, (iii) a FABPl agonist, and (iv) any combination of (i)-(iii); and (c) a pharmaceutically acceptable carrier, diluent, or excipient.
191. A method according to claims 178 to 190 further comprising placing the subject on a high fat diet.
192. A method according to claim 91 wherein the high fat diet comprises a calorie
restricted diet.
193. A method according to claims 178 to 190 wherein the composition increases organoid formation in the subject.
194. A method according to claims 178 to 190 further comprising determining that the subject is in need of enhanced intestinal function.
195. A method according to claim 194 wherein determining that the subject is in need of enhanced intestinal function comprises assessing expression of PPAR-δ in one or more tissues or biological samples obtained from the subject.
196. A method according to claim 194 wherein determining that the subject is in need of enhanced intestinal function comprises assessing expression of one or more of CPTl A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the subject.
1 97. A method according to claims 178 to 190 further comprising determining that the subject has loss of intestinal stem cells and/or non-stem intestinal progenitor cells.
198. A method according to claim 197 wherein determining that the subject has loss of intestinal stem cells and/or non-stem intestinal progenitor cells comprises assessing expression of PPAR-δ in one or more tissues or biological samples obtained from the subject.
199. A method according to claim 1 97 wherein determining that the subject has loss of intestinal stem cells and/or non-stem intestinal progenitor cells comprises assessing expression of one or more of CPT I A, HMGCS2 and FABP l in one or more tissues or biological samples obtained from the^subject.
200. A method according to claims 13, 36, 47, 84, 96-98, 151 or 1 78, wherein the subject is aged.
PCT/US2015/033359 2014-05-29 2015-05-29 Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function Ceased WO2015184375A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/314,852 US10426757B2 (en) 2014-05-29 2015-05-29 Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462004747P 2014-05-29 2014-05-29
US62/004,747 2014-05-29

Publications (2)

Publication Number Publication Date
WO2015184375A2 true WO2015184375A2 (en) 2015-12-03
WO2015184375A3 WO2015184375A3 (en) 2016-03-17

Family

ID=54700077

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/033359 Ceased WO2015184375A2 (en) 2014-05-29 2015-05-29 Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function

Country Status (2)

Country Link
US (1) US10426757B2 (en)
WO (1) WO2015184375A2 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106636402A (en) * 2016-12-22 2017-05-10 中南大学湘雅医院 A molecular marker for judging radiosensitivity of nasopharyngeal carcinoma and its application
US10174289B2 (en) 2014-05-28 2019-01-08 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
US10426757B2 (en) 2014-05-29 2019-10-01 Whitehead Institute For Biomedical Research Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function
CN110569793A (en) * 2019-09-09 2019-12-13 西南交通大学 An Object Tracking Method Based on Unsupervised Similarity Discriminative Learning
CN111500568A (en) * 2020-04-24 2020-08-07 苏州大学 Method for screening acute radioactive gastrointestinal syndrome treatment target
US10781425B2 (en) 2010-05-06 2020-09-22 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US11066650B2 (en) 2016-05-05 2021-07-20 Children's Hospital Medical Center Methods for the in vitro manufacture of gastric fundus tissue and compositions related to same
US11584916B2 (en) 2014-10-17 2023-02-21 Children's Hospital Medical Center Method of making in vivo human small intestine organoids from pluripotent stem cells
US11767515B2 (en) 2016-12-05 2023-09-26 Children's Hospital Medical Center Colonic organoids and methods of making and using same
US12281334B2 (en) 2017-04-14 2025-04-22 Children's Hospital Medical Center Multi donor stem cell compositions and methods of making same
US12297457B2 (en) 2017-10-10 2025-05-13 Children's Hospital Medical Center Esophageal tissue and/or organoid compositions and methods of making same
US12379372B2 (en) 2017-12-21 2025-08-05 Children's Hospital Medical Center Digitalized human organoids and methods of using same
US12414967B2 (en) 2016-11-04 2025-09-16 Children's Hospital Medical Center Compositions and methods of treating liver disease
US12421500B2 (en) 2018-07-26 2025-09-23 Children's Hospital Medical Center Hepato-biliary-pancreatic tissues and methods of making same
US12428622B2 (en) 2018-09-12 2025-09-30 Children's Hospital Medical Center Organoid compositions for the production of hematopoietic stem cells and derivatives thereof
US12497597B2 (en) 2019-05-31 2025-12-16 Children's Hospital Medical Center Methods of generating and expanding hematopoietic stem cells
US12534709B2 (en) 2019-05-31 2026-01-27 Children's Hospital Medical Center Shaped organoid compositions and methods of making same
US12600943B2 (en) 2019-02-01 2026-04-14 The University Of Hong Kong Innervated organoid compositions and methods of making same

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108588010B (en) * 2018-04-26 2022-03-08 清华大学 Application of two-dimensional culture system in in vitro culture of mouse intestinal epithelial stem cells
CN112168965A (en) * 2019-07-05 2021-01-05 中国科学院生物物理研究所 Application of SRCAP ATPase agonists in the treatment of diseases mediated by the inhibition of intestinal stem cell self-renewal

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7629372B2 (en) * 2004-09-16 2009-12-08 Merck & Co., Inc. Compounds for the treatment of dyslipidemia and other lipid disorders
CA2625744A1 (en) * 2005-10-11 2007-04-19 Tethys Bioscience, Inc. Diabetes-associated markers and methods of use thereof
WO2009111648A1 (en) 2008-03-05 2009-09-11 Vicus Therapeutics, Llc Compositions and methods for mucositis and oncology therapies
WO2010120599A2 (en) * 2009-04-16 2010-10-21 Merck Sharp & Dohme Corp. Compositions and methods for treating cancer
US9532997B2 (en) * 2012-04-03 2017-01-03 Whitehead Institute For Biomedical Research Compositions and methods for promoting intestinal stem cell function
US10426757B2 (en) 2014-05-29 2019-10-01 Whitehead Institute For Biomedical Research Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12258584B2 (en) 2010-05-06 2025-03-25 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US10781425B2 (en) 2010-05-06 2020-09-22 Children's Hospital Medical Center Methods and systems for converting precursor cells into intestinal tissues through directed differentiation
US10174289B2 (en) 2014-05-28 2019-01-08 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
US12241090B2 (en) 2014-05-28 2025-03-04 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
US11053477B2 (en) 2014-05-28 2021-07-06 Children's Hospital Medical Center Methods and systems for converting precursor cells into gastric tissues through directed differentiation
US10426757B2 (en) 2014-05-29 2019-10-01 Whitehead Institute For Biomedical Research Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function
US11584916B2 (en) 2014-10-17 2023-02-21 Children's Hospital Medical Center Method of making in vivo human small intestine organoids from pluripotent stem cells
US11066650B2 (en) 2016-05-05 2021-07-20 Children's Hospital Medical Center Methods for the in vitro manufacture of gastric fundus tissue and compositions related to same
US12414967B2 (en) 2016-11-04 2025-09-16 Children's Hospital Medical Center Compositions and methods of treating liver disease
US11767515B2 (en) 2016-12-05 2023-09-26 Children's Hospital Medical Center Colonic organoids and methods of making and using same
CN106636402B (en) * 2016-12-22 2020-09-15 中南大学湘雅医院 Molecular marker for judging nasopharyngeal carcinoma radiotherapy sensitivity and application thereof
CN106636402A (en) * 2016-12-22 2017-05-10 中南大学湘雅医院 A molecular marker for judging radiosensitivity of nasopharyngeal carcinoma and its application
US12281334B2 (en) 2017-04-14 2025-04-22 Children's Hospital Medical Center Multi donor stem cell compositions and methods of making same
US12297457B2 (en) 2017-10-10 2025-05-13 Children's Hospital Medical Center Esophageal tissue and/or organoid compositions and methods of making same
US12379372B2 (en) 2017-12-21 2025-08-05 Children's Hospital Medical Center Digitalized human organoids and methods of using same
US12421500B2 (en) 2018-07-26 2025-09-23 Children's Hospital Medical Center Hepato-biliary-pancreatic tissues and methods of making same
US12428622B2 (en) 2018-09-12 2025-09-30 Children's Hospital Medical Center Organoid compositions for the production of hematopoietic stem cells and derivatives thereof
US12600943B2 (en) 2019-02-01 2026-04-14 The University Of Hong Kong Innervated organoid compositions and methods of making same
US12497597B2 (en) 2019-05-31 2025-12-16 Children's Hospital Medical Center Methods of generating and expanding hematopoietic stem cells
US12534709B2 (en) 2019-05-31 2026-01-27 Children's Hospital Medical Center Shaped organoid compositions and methods of making same
CN110569793B (en) * 2019-09-09 2022-06-07 西南交通大学 Target tracking method for unsupervised similarity discrimination learning
CN110569793A (en) * 2019-09-09 2019-12-13 西南交通大学 An Object Tracking Method Based on Unsupervised Similarity Discriminative Learning
CN111500568A (en) * 2020-04-24 2020-08-07 苏州大学 Method for screening acute radioactive gastrointestinal syndrome treatment target

Also Published As

Publication number Publication date
US20170258772A1 (en) 2017-09-14
US10426757B2 (en) 2019-10-01
WO2015184375A3 (en) 2016-03-17

Similar Documents

Publication Publication Date Title
US10426757B2 (en) Compositions and methods for promoting intestinal stem cell and/or non-stem progenitor cell function
Khan et al. Geranylgeranyltransferase type I (GGTase-I) deficiency hyperactivates macrophages and induces erosive arthritis in mice
US12540164B2 (en) Peptides for treatment and prevention of nonalcoholic fatty liver disease and fibrosis
US9532997B2 (en) Compositions and methods for promoting intestinal stem cell function
Malamut et al. IL-15 triggers an antiapoptotic pathway in human intraepithelial lymphocytes that is a potential new target in celiac disease–associated inflammation and lymphomagenesis
EP4291239A2 (en) Compounds, compositions and methods for treating age-related diseases and conditions
WO2012134478A1 (en) Compositions and methods for the treatment and prevention of cardiac ischemic injury
US20210030836A1 (en) Novel Tumor Microenvironment-Related Target TAK1 and Application Thereof in Inhibition of Tumor
US11752193B2 (en) Administering methylation-controlled J protein (MCJ) SIRNA to a kidney cell
Miao et al. Morin inhibits the transformation of fibroblasts towards myofibroblasts through regulating “PPAR-γ-glutaminolysis-DEPTOR” pathway in pulmonary fibrosis
US12377092B2 (en) Polycomb inhibitors and uses thereof
KR20170021349A (en) New use of cell-permeable peptide inhibitors of the JNK signal transduction pathway for the treatment of various diseases
US11464786B2 (en) CXCR7 inhibitors for the treatment of cancer
EP3275444A2 (en) Composition for inhibiting growth or proliferation of chronic myelogenous leukemia cancer stem cells, and screening method therefor
US20210338615A1 (en) Inhibition of Acetyl-CoA Metabolism for Treatment and Prevention of Immune System Diseases and Disorders
US20230190718A1 (en) Methods for the treatment of pancreatitis and prevention of pancreatic cancer
KR102091037B1 (en) Hdac inhibitors for suppressing cancer-related cachexia
Ito et al. p18/Lamtor1-mTORC1 signaling controls development of mucin-producing goblet cells in the intestine
WO2022166769A1 (en) Anti-aging combined drug for down-regulating senescence-related secretory phenotype and application of anti-aging combined drug
Haynie Role of sex differences on cancer cachexia progression and fibrosis during cancer cachexia development
EP4424327A1 (en) Method or agent with hdac regulator, for treatment of diabetes and complications
Yu et al. Senescence induced by Nox4 expressed aberrantly in osteoclast precursors accelerates ostoeclastogenesis to promote osteoarthritis
Wang The Role of LIF in Tissue Homeostasis, Disease, and Cancer
KR20180121046A (en) OCT4 expression or ubiquitination regulating composition comprising CHIP
Bruckner et al. P034 Validation of a novel xenograft mouse model for intestinal fistulas

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15800282

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 15314852

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 15800282

Country of ref document: EP

Kind code of ref document: A2