WO2015179656A2 - Specific targeted activation of cystic fibrosis transmembrane conductance regulator (cftr) - Google Patents

Specific targeted activation of cystic fibrosis transmembrane conductance regulator (cftr) Download PDF

Info

Publication number
WO2015179656A2
WO2015179656A2 PCT/US2015/031995 US2015031995W WO2015179656A2 WO 2015179656 A2 WO2015179656 A2 WO 2015179656A2 US 2015031995 W US2015031995 W US 2015031995W WO 2015179656 A2 WO2015179656 A2 WO 2015179656A2
Authority
WO
WIPO (PCT)
Prior art keywords
cftr
seq
agent
nucleic acid
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/031995
Other languages
French (fr)
Other versions
WO2015179656A3 (en
Inventor
Kevin Morris
Sheena SAAYMAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Scripps Research Institute
Original Assignee
Scripps Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Scripps Research Institute filed Critical Scripps Research Institute
Publication of WO2015179656A2 publication Critical patent/WO2015179656A2/en
Publication of WO2015179656A3 publication Critical patent/WO2015179656A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • Cystic Fibrosis is a life shortening genetic disease that is defined by chronic lung infections and pancreatic insufficiencies.
  • the root cause of CF is heritable mutations that affect the cystic fibrosis transmembrance conductance regulator (CFTR) ultimately resulting in substantially less CFTR at the cell surface. Individuals suffering this genetic predisposition can only expect to live to their late-thirties.
  • CFTR cystic fibrosis transmembrance conductance regulator
  • the invention provides methods for enhancing expression or cellular level of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell.
  • the methods entail contacting the cell with an agent that specifically disrupts or downregulates CFTR associated antisense long non-coding RNA (IncR A) BG213071 and/or AI805947.
  • Some of the methods are directed enhancing CFTR expression in an epithelial cell.
  • the cell can be an epithelial cell present in the lung, pancreas, liver, or intestine.
  • the cell is an epithelial cell present in a subject afflicted with cystic fibrosis.
  • the agent inhibits expression of BG213071 and/or AI805947.
  • the agent disrupts or suppresses the function of BG213071 and/or AI805947 by binding to the IncRNA.
  • the employed agent can be an antisense nucleic acid, an siRNA or an shRNA.
  • the agent can be an antisense RNA shown in Figure 4B.
  • the agent can be a nucleic acid molecule comprising a sequence that is substantially identical or complementary to at least 10 contiguous residues shown in any of SEQ ID NOs: 1-5 and 59-69.
  • inhibitory oligonucleotides that target the specific loci in CFTR that are important for BG213071 regulation of CFTR expression. Examples of such inhibitory oligonucleotides are shown in SEQ ID NOs:4, 5 and 59-62.
  • the invention provides methods for treating or ameliorating symptoms of cystic fibrosis in a subject. These methods involve administering to the subject a pharmaceutical composition comprising an agent that specifically disrupts or
  • the administered agent downregulates CFTR associated antisense long non-coding RNA (IncRNA) BG213071 and/or AI805947.
  • the administered agent inhibits expression of BG213071 and/or AI805947.
  • the administered agent binds to BG213071 and/or AI805947 to disrupt or suppress the cellular functions of BG213071 and/or AI805947.
  • the administered agent can be an antisense nucleic acid, an siRNA or an shRNA, e.g., any of the antisense RNA molecules shown in Figure 4B.
  • Some other methods can employ a nucleic acid molecule comprising a sequence that is substantially identical or complementary to at least 10 contiguous residues shown in SEQ ID NO: l , SEQ ID NO:2, or SEQ ID NO:3.
  • the invention provides isolated or recombinant nucleic acid molecules comprising a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5, and 59-69; or (3) at least
  • nucleic acid compounds can all be employed in any of the therapeutic methods described herein.
  • the nucleic acid molecules are capable of disrupting or downregulating CFTR associated long non-coding RNA (IncRNA) BG213071 and/or AI805947.
  • Some of the nucleic acid molecules comprise a sequence that is substantially identical to the sequence shown in SEQ ID NO:4 or SEQ ID NO:5, or a fragment thereof.
  • Some of the nucleic acid molecules can specifically disrupt or downregulate CFTR associated long non-coding RNA (IncRNA) BG213071, e.g., molecules comprising a sequence shown in SEQ ID NO:4 or SEQ ID NO:5, or a functional fragment thereof.
  • Some other molecules comprise a sequence that is identical or complementary to an antisense RNA shown in Figure 4B or a functional fragment thereof.
  • FIG. 1 shows BG213071 mediated transcriptional regulation of CFTR-
  • A A schematic is depicted showing the CFTR locus with transcriptional start sites (TSS) for CFTR, BG213071, and AI805947 shown along with the small antisense RNA target sites (BGAS1-4) and some of those primers used to evaluate CFTR locus.
  • B The effects of candidate sasRNAs targeted to the promoter and transcribed region for BG213071 on activating CFTR expression as determined by unspliced CFTR transcript analysis.
  • C Small antisense BGas4 mediated activation results in increased (C) spliced and (D) full-length and spliced CFTR.
  • FIG. 2 shows BG213071 interacts specifically with CFTR and several proteins involved in DNA architecture and chromatin structure-
  • A A close up snap-shot from UCSC genome browser of BGAS4 target site and those primers used to distinguish the epigenetic changes at the BG213071 or BGAS4 targeted loci in CFTR are shown.
  • B-C The effects of over-expression of (B) BG213071 and (C) BGas4 on H3K27me3 enrichment at the Set 8 BG213071 exon 1 locus.
  • RNAPII Relative enrichment of RNAPII at the (D) Set 8 BG213071 exon 1 locus and (E) Set7 BG213071 promoter locus in BG213071 CFPAC treated cells.
  • F Transcription is not required for BG213071 localization to CFTR. CFPAC cells were transfected with biotin labeled BG213071 or Lambda (Control) (50nM) and then treated with alpha-amanitin and CHIP carried out 30hrs later. For B-F the averages of triplicate treated cultures are shown with the standard error of the means and a p value from a paired T-test.
  • G BG213071 associated proteins. Biotin labeled antisense
  • oligonucleotides BGAS l and BGAS2, antisense and specific for BG213071 (Table 6), were used to immuneprecipitate BG213071.
  • the resulting elutes were subjected to LC/MS analysis and several candidates determined. The top 10 candidates found in both BGASl and BGAS2 immunoprecipitations are shown.
  • FIG. 3 shows a model for BG213071 regulation of CFTR expression-
  • the CFTR locus is shown with the internal expressed BG213071 and truncated CFTR transcript NM_000492.
  • the BG213071 IncRNA is expressed and localizes to the homology containing locus in the CFTR gene body. The localization of BG213071 to its target locus allows for chromatin structural and DNA binding proteins such as HMG-14, HMG-17, HMGB 1 and WIBG to localize specifically to the CFTR gene body and affect the local structure of the gene ultimately diminishing RNAPII activity.
  • Figure 4 shows the CFTR locus of interest -
  • A The transcriptional start sites (TSS) of CFTR, BG213071, and AI805947 is shown along with the small antisense RNA target sites evaluated in figure 2.
  • B The sequences of the expressed small antisense RNAs targeted to BG213071 or the predicted BG213071 promoter.
  • BGasl Shown in the figure are BGasl (SEQ ID NO:59), BGas2 (SEQ ID NO:60), BGas3 (SEQ ID NO:61), BGas4 (SEQ ID NO:62), BGas5 (SEQ ID NO:63), BGas6 (SEQ ID NO:64), BGas7 (SEQ ID NO:65), asBGl (SEQ ID NO:66), asBG2 (SEQ ID NO:67), asBG3 (SEQ ID NO:68), and asBG4 (SEQ ID NO:69).
  • C The effects of small antisense RNA targeting BG213071 on CFTR expression.
  • U6M2 small antisense RNA expressing plasmids were transfected in triplicate into CFPAC cells and cellular mRNAs assessed (Set 4). CFTR expression was measured 72hrs later and the average of triplicate treated CFPAC cells is shown with the standard error of the means and p values from a paired T-test.
  • FIG. 5 shows the effects of BG213071 and AI805947 expression on CFTR transcription and epigenetic states-
  • A a schematic is depicted showing those IncRNAs endogenous AI805947 (AI805 l, ⁇ 439b), positive control AI805947 (AI805 2, ⁇ 676bp) and BG213071.
  • TSS transcriptional start sites
  • B The effects of over-expression of AI805947 (AI805-439bp and AI805- 676bp) on CFTR as shown relative to the pCDNA3.1 treated cells (Control) on CFTR unspliced transcript expression.
  • C Assessment of the biotin linked transcripts AI805-1, AI805-2 and BG213071 for binding at other non-homologous containing loci in the CFTR locus.
  • Endogenous long non-coding RNAs are involved in epigenetically regulating gene expression in human cells. Some of these regulatory transcripts are antisense to their protein-coding gene counterpart and function in the target specific recruitment of epigenetic complexes and transcriptional silencing of the corresponding complimentary targeted loci.
  • the present inventors observed that CFTR is regulated transcriptionally by the actions of long non-coding RNAs (IncRNAs).
  • BG213071 also termed “BGAS” or “BGas” herein
  • BGAS BG213071
  • HMGN2 HMGN2
  • WIBG WIBG-binding protein
  • BG213071 can serve as therapeutic target for specifically activating expression of CFTR. They provide basis for novel and more effective treatment paradigms for CF patients.
  • the present invention provides compositions and methods for upregulating CFTR expression and for treating cystic fibrosis. Detailed description for practicing the invention is provided below.
  • agent includes any substance, molecule, element, compound, entity, or a combination thereof. It includes, but is not limited to, e.g., protein, polypeptide, peptide or mimetic, small organic molecule, polysaccharide, polynucleotide, and the like. It can be a natural product, a synthetic compound, or a chemical compound, or a combination of two or more substances. Unless otherwise specified, the terms “agent”, “substance”, and “compound” are used interchangeably herein. In some screening methods of the invention, the employed test agents or candidate compounds are small organic molecules.
  • analog or “derivative” is used herein to refer to a molecule that structurally resembles a reference molecule (e.g., a CFTR-activating agent exemplified herein) but which has been modified in a targeted and controlled manner, by replacing a specific substituent of the reference molecule with an alternate substituent.
  • a reference molecule e.g., a CFTR-activating agent exemplified herein
  • an analog would be expected, by one skilled in the art, to exhibit the same, similar, or improved utility.
  • Synthesis and screening of analogs to identify variants of known compounds having improved traits is an approach that is well known in pharmaceutical chemistry.
  • the term "contacting" has its normal meaning and refers to combining two or more agents (e.g., polypeptides or small molecule compounds) or combining agents and cells. Contacting can occur in vitro, e.g., combining two or more agents or combining an agent and a cell or a cell lysate in a test tube or other container. Contacting can also occur in a cell or in situ, e.g., contacting two polypeptides in a cell by coexpression in the cell of recombinant polynucleotides encoding the two polypeptides, or in a cell lysate. Contacting can also occur inside the body of a subject, e.g., by administering to the subject an agent which then interacts with the intended target (e.g., a tissue or a cell).
  • the intended target e.g., a tissue or a cell.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same.
  • Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
  • subject and “patient” are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals.
  • Animals include all vertebrates, e.g., mammals and non-mammals, such as dogs, cats, sheeps, cows, pigs, rabbits, chickens, and etc.
  • Preferred subjects for practicing the therapeutic methods of the present invention are human.
  • treat refers to the administration of compounds or agents to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., cystic fibrosis), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder.
  • Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease.
  • a "variant" of a reference molecule refers to a molecule substantially similar in structure and biological activity to either the entire reference molecule, or to a fragment thereof. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the sequence of nucleotide residues is not identical.
  • siRNA Small interfering RNA
  • siRNA sometimes known as short interfering RNA or silencing RNA
  • dsRNA double strand of RNA
  • Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group.
  • This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs.
  • siRNAs can also be exogenously (artificially) introduced into cells by various transfection methods to bring about the specific knockdown of a gene of interest.
  • any gene of which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA.
  • Transfection of an exogenous siRNA can be problematic because the gene knockdown effect is only transient, particularly in rapidly dividing cells.
  • One way of overcoming this challenge is to modify the siRNA in such a way as to allow it to be expressed by an appropriate vector, e.g., a plasmid. This is done by the introduction of a loop between the two strands, thus producing a single transcript, which can be processed into a functional siRNA.
  • Such transcription cassettes typically use an RNA polymerase III promoter (e.g., U6 or HI), which usually directs the transcription of small nuclear RNAs (snRNAs) (U6 is involved in gene splicing; HI is the RNase component of human RNase P). The resulting siRNA transcript is believed to be processed subsequently by Dicer.
  • U6 or HI RNA polymerase III promoter
  • a small hairpin RNA or short hairpin RNA is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference.
  • shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited.
  • the shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it.
  • RISC RNA-induced silencing complex
  • the invention provides various agents which can enhance or stimulate CFTR expression.
  • these CFTR-activating agents function by targeting long non-coding RNA BG213071 and/or AI805947 which suppress CFTR expression.
  • Some of the agents inhibit or suppress expression of the long ncRNA (e.g., BG213071).
  • BG213071 the long ncRNA
  • several loci in CFTR sequences have been identified that are important for BG213071 regulation of CFTR expression.
  • the agents for promoting CFTR expression can be any compounds that specifically target these loci, e.g., binding sites of the exemplified inhibitory oligonucleotides BGas_Biol (SEQ ID NO:4), BGas_Bio2 (SEQ ID NO:5), BGasl (SEQ ID NO:59), BGas2 (SEQ ID NO:60), BGas3 (SEQ ID NO:61), and BGas4 (SEQ ID NO:62).
  • BGas_Biol SEQ ID NO:4
  • BGas_Bio2 SEQ ID NO:5
  • BGasl SEQ ID NO:59
  • BGas2 SEQ ID NO:60
  • BGas3 SEQ ID NO:61
  • BGas4 SEQ ID NO:62
  • the agents are small molecule organic compounds. Some other agents are capable of specifically disrupting the structure or cellular function of the long ncRNA in suppressing CFTR expression.
  • the agents are inhibitory polynucleotides such as antisense oligonucleotides or other inhibitory RNA molecules such as shRNAs or siRNAs.
  • the CFTR-activating agent of the invention is an isolated or recombinant inhibitory oligonucleotide or polynucleotide molecule that comprises a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5, and 59-69; or (3) at least 10 contiguous residues of an antisense RNA shown in Figure 4B.
  • Some specific examples of such inhibitory oligonucleotides are exemplified herein, e.g., SEQ ID NOs:4, 5 and 59-69.
  • the CFTR activating agents are oligonucleotides or polynucleotides which contains a sequence that is substantially identical or complementary to at least 10, 15, 20, 25, 30, 40, 50 or more contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3.
  • the CFTR-activating agents specifically disrupt or downregulate BG213071 and/or AI805947. These include molecules which have a sequence that is substantially identical to any of the sequences shown in SEQ ID NOs:4, 5 and 59-69, or a fragment thereof.
  • the CFTR- activating oligonucleotides e.g., SEQ ID NO:4 or 5
  • CFTR modulating compounds suitable for the invention also include agents that target the BGAS associated proteins described herein, e.g., HMGA1, HMGN2, HMGB 1 or WIBG. Any compounds that are capable of inhibiting expression of these proteins or disrupting their interactions with BGAS are suitable for the invention.
  • BGAS associated proteins described herein e.g., HMGA1, HMGN2, HMGB 1 or WIBG. Any compounds that are capable of inhibiting expression of these proteins or disrupting their interactions with BGAS are suitable for the invention.
  • the compounds are inhibitory polynucleotides or oligonucleotides such shRNAs or siRNAs.
  • inhibitory oligonucleotides are exemplified herein (see Table 1). Additional inhibitory nucleic acid agents targeting these proteins are commercially available. As described in the Examples herein, these include siRNAs for suppressing expression of any of the BGAS-associated proteins, which are available from commercial vendors, e.g., Santa Cruz Biotechnology (Dallas, Texas).
  • the CFTR modulating compounds described herein can be useful in various therapeutic or prophylactic applications. They can be readily employed for enhancing or activating CFTR expression, and for treating or ameliorating symptoms of cystic fibrosis. Accordingly, the invention provides methods for upregulating CFTR expression or cellular level in a cell (e.g., epithelial cells). In some embodiments, the cell is present in a subject (e.g., a subject afflicted with cystic fibrosis). In some embodiments, the therapeutic applications of the invention are directed to preventing development of cystic fibrosis in a subject. Typically, the therapeutic methods of the invention entail administering to a subject a pharmaceutical composition that comprises an effective amount of the CFTR-activating agent disclosed herein.
  • the CFTR-activating agents can be administered alone to a subject in need of treatment. More preferably, they are administered in the form of a pharmaceutical composition or preparation in admixture with any of various pharmacologically-acceptable additives.
  • the compounds may be administered in the form of a convenient pharmaceutical composition or formulation suitable for oral, topical, parenteral application, or the like.
  • the active ingredient of the pharmaceutical composition or formulation comprises essentially of a CFTR-activating agent disclosed herein.
  • compositions of the invention can be prepared in accordance with methods well known and routinely practiced in the art. See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20 th ed., 2000; and Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. Pharmaceutical compositions are preferably manufactured under GMP conditions.
  • Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes.
  • Biocompatible, biodegradable lactide polymer
  • lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds.
  • Other potentially useful parenteral delivery systems for molecules of the invention include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes.
  • Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, e.g., polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
  • composition containing a CFTR-activating agent can be administered locally or systemically in a therapeutically effective amount or dose. They can be administered parenterally, enterically, by injection, rapid infusion, nasopharyngeal absorption, dermal absorption, rectally and orally.
  • the agents for use in the methods of the invention should be administered to a subject in an amount that is sufficient to achieve the desired therapeutic effect (e.g., eliminating or ameliorating symptoms associated with cystic fibrosis) in a subject in need thereof.
  • compositions of the invention should enhance CFTR expression or activities in a cell, or slow or suppress cystic fibrosis in a subject.
  • actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response without being toxic to the subject.
  • the selected dosage level depends upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, the route of administration, the time of administration, and the rate of excretion of the particular compound being employed. It also depends on the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, gender, weight, condition, general health and prior medical history of the subject being treated, and like factors. Methods for determining optimal dosages are described in the art, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20 th ed., 2000. For a given CFTR-activating agent, one skilled in the art can easily identify the effective amount of the agent by using routinely practiced pharmaceutical methods. Dosages used in vitro or in situ studies may provide useful guidance in the amounts useful for in vivo administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders. Typically, a
  • pharmaceutically effective dosage would be between about 0.001 and 100 mg/kg body weight of the subject to be treated.
  • CFTR-activating agents described herein can be readily synthesized using methods routinely practiced or disclosed herein. Some specific protocols or assays that can be used for practicing the present invention are exemplified below.
  • Example 1 Regulation of CFTR expression by IncRNAs
  • BG213071 may be functional as an active IncRNA suppressor of CFTR, similar to previous observations whereby particular IncRNAs have been observed to direct transcriptional and epigenetic gene silencing of the Oct4, p21 , pi 5 and PTEN genes (Hawkins et al. Transcription 1 : 165- 75, 2010; Morris et al, PLoS Genet. 4:el 000258, 2008; Lai et al, PLoS One. 3:el 864, 2008; and Johnsson et al, Nat. Struct. Mol. Biol. 20:440-6, 2013).
  • BG213071 promoter as determined by chromatin immunoprecipitation (ChIP) analysis ( Figure 2A-C). These observations suggest that that BG213071 is not functioning to epigenetically modulate the gene body of CFTR and that BGAS4 is actively recruiting H3K27me3 to the BG213071 promoter in a manner similar to previous observations with small RNA directed transcriptional gene silencing (Weinberg et al., RNA 12:256-62, 2006).
  • RNAPIl RNA Polymerase II
  • RNAPIl As RNAPIl seemed to be specifically enriched at the BG213071 locus and previous studies have found a role for transcription in non-coding RNA directed regulation of gene expression (Han et al., Proc. Natl. Acad. Sci. USA 104: 12422-7, 2007), we surmised that transcription may be required for BG213071 localization to this region in the CFTR gene body.
  • CFPAC cells were treated with biotin linked BG213017 followed by treatment with the RNAPIl inhibitor alpha-amanitin. Alpha-amanitin treatment had no effect on BG213071 localization to the CFTR gene body ( Figure 2F), suggesting that the BG213071 is functional in modulating CFTR expression in manner different than previous observations with lncRNAs.
  • BG213071 was immunoprecipitated and ChIRP performed with BG213071 specific biotin labeled primers (Table 6) (as described in Hawkins et al., Transcription 1 : 165-75, 2010; and Chu et al, J. Vis. Exp. 61 : 3912, 2012) to determine those proteins associating in complex with BG213071.
  • BG213071 appears to be mechanistically modulating CFTR expression in a manner not previously known.
  • BG213071 appears to function as a scaffolding to partition the CFTR locus by tethering chromatin associated proteins known to be involved in DNA architecture and structure ( Figure 3).
  • Some of the BG213071 binding partners such as HMGB 1 have been observed to create bends in DNA and obstruct RNAPII activity.
  • the suppression of this BG213071 scaffolding with small antisense RNAs targeted to the BG213071 promoter results in increased transcriptional activation of CFTR that may prove therapeutically relevant.
  • RNAs can direct stable epigenetic silencing to gene promoters and instill a long-term silent state. This form of RNA directed transcriptional silencing is presumably long-term because changes are instilled in the chromatin space around the gene, making transcription more difficult (Knowling et al., Progr. Mol. Biol. Transl. Sci. 102: 1-10, 201 1). The observations presented here suggest that the promoter of BG213071 is also susceptible to RNA targeting.
  • HMGAl , HMGB l, and WIBG following suppression of each transcript with RNAi relative to the scrambled control siRNAs (Control) in 16HBE14o- , ⁇ 508 containing cells.
  • HMGAl, HMGB l, and WIBG resultsed in significantly increased CFTR expression. This suggests that these proteins are indeed involved in modulating CFTR expression.
  • BGAS functions to modulate CFTR expression by tethering various structural and chromatin architectural modifying proteins to intron 1 1 of CFTR.
  • BGas targeted small antisense RNAs and AI805947 targeted shRNAs-
  • small antisense non-coding RNAs targeted to the reported expressed and upstream putative promoter sites for EST BG213071 .
  • the small RNA target sites are shown ( Figure 1A).
  • Small antisense RNA expression vectors were generated by annealing oligonucleotides (IDT technologies, Coralville, Iowa, USA) (Table 1 ) and subsequent cloning into the U6M2 construct using the Bgl II and Kpn I restriction sites (as described in Amarzguioui et al., FEBS letters.
  • CFPAC cells or l HAEo- cells were utilized were utilized.
  • CFPAC cells were transfected using Lipofectamine 2000 (Life Technologies, Carlsbad CA, USA) ( ⁇ g/10 A 6 cells).
  • the culture mRNAs were collected 48-72 hours later and DNAse treated (Promega Maxwell, Madison WI, USA).
  • the culture RNAs were then subjected to RT conversion and qPCR using various primer sets (Table 1). To determine changes in antisense EST BG213071 expression directional RT and PCR was carried out.
  • T7-transcribed synthetic RNA pulldown for localization studies Synthetic biotinylated ncRNAs were generated by T7 transcription using the AmpliscribeTM T7- FlashTM Biotin -RNA Transcription Kit (Epicentre® Biotechnologies, WI, USA) according to the manufacturer's instruction. Templates for T7 transcription was prepared by PCR of pcDNA3.1 plasmids expressing the relevant ncRNAs. The following primers were used: T7-BG213071 F: 5'-CAGTGAATTGTAATACGACTCACTATAGGGGTAATATATCTA- 3 ' (SEQ ID NO:70) and BG213071 R: 5 '-
  • CTCAAAGAGGATATACTTCATTCCTCAAAAGG-3' (SEQ ID NO:71); T7-AI805#2 F: 5'- CAGTGAATTGTAATACGACTCACTATAGGGCTTTTCTCCGAC-3 ' (SEQ ID NO:72) and AI805#2 R: GCTTCCAATTCCCCCCACC (SEQ ID NO:73); T7-AI805#1 F: 5' - CAGTGAATTGTAATACGACTCACTATAGGGTCGGAGAAAAGA-3 ' (SEQ ID NO:74) and T7-AI805# 1 R: 5'- GAAGGCGCCTACGCCTG-3 ' (SEQ ID NO:75).
  • Transcripts were transfected into CFPAC cells at a concentration of 50nM. 30 hours post- transfection, cells were cross-linked with formaldehyde at 1% for 10 minutes at room temperature followed by addition of glycine to a final concentration of 0.125M and a further incubation for 5 minutes at room temperature. Cells were then washed with PBS supplemented with PMSF, aproteinin and leupeptin and lysed with ChIP lysis buffer (50 mM Hepes, 140 mM NaCl, 1% Triton X, 0.1% NAD) on ice for 20 minutes. Chromatin was sheared by sonication. Cell lysates containing sheared chromatin, or ChIP eluates in the case of ChlP-biotin dual pull-down assays, were incubated with Dynabeads® MyOneTM
  • Streptavidin C I (Life Technologies, CA, USA) prepared according to the manufacturer's instructions for 2 hours on a rotating platform. Beads were pulled down with a magnet for 3 minutes and washed with Low salt immune complex wash buffer (0.1% SDS; 1% Triton X- 100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1 ; 150 mM NaCl); High salt immune complex wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1 ; 500 mM NaCl); LiCl Immune complex wash buffer (0.25 M LiCl; 1% NP40; 1% sodium
  • Biotin-tagged oligo pull down for mass spec studies CFPAC cells were cross- linked with formaldehyde at 1% for 10 minutes at room temperature followed by addition of glycine to a final concentration of 0.125M and a further incubation for 5 minutes at room temperature. Cells were then washed with and resuspended in PBS supplemented with PMSF, aproteinin and leupeptin and lysed with ChIP lysis buffer (5 mM PIPES, 85 mM KC1, 0.5 % NP40) on ice for 20 minutes.
  • ChIP lysis buffer 5 mM PIPES, 85 mM KC1, 0.5 % NP40
  • BGas_biol 5'-/5Biosg/GCCAGCACAAGAATCCCTCA-3 ' (SEQ ID NO:76) and BGas_bio2: 5'-/5Biosg/CCAAATGCAAACATTCATGATTC-3' (SEQ ID NO:77) for 15 minutes on a rotating platform at room temperature.
  • Cell lysate/biotin-tagged oligo solutions were incubated with Dynabeads® MyOneTM Streptavidin C I (Life
  • LC/MS Liquid chromatography mass spectrometry analysis
  • siRNAs for HMGA1 siRNA sc-44333 Santa Cruz
  • HMGN2 siRNA sc-37988, Santa Cruz
  • HMGB 1 siRNA sc-37982, Santa Cruz
  • WIBG siRNA sc- 96076, Santa Cruz
  • a scrambled control siRNA sc- 37007, Santa Cruz
  • CFTR FACS analysis- CFPAC- 1 cells (ATCC Number CRL- 1918) were used for CFTR FACS analysis experiments. The cells were plated onto a 24-well plate (1.5 ⁇ 10 ⁇ 5 cells/well). Twenty-four hours later, the cultures were transfected with Lipofectamine 2000 (Life Technologies, Carlsbad CA, USA), using 300ng DNA + 0.75 ⁇ , Lipofectamine 2000 per well and ⁇ of media without serum.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

This invention provides compositions and methods for enhancing CFTR expression in a cell. The invention also provides methods for treating cystic fibrosis.

Description

Specific Targeted Activation of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)
STATEMENT CONCERNING GOVERNMENT SUPPORT
[0001] This invention was made in part with the U.S. government support by the National Institutes of Health Grant No. P01 AI099783-01. The U.S. Government therefore may have certain rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] The subject patent application claims the benefit of priority to U.S. Provisional Patent Application Number 62/002,462 (filed May 23, 2014). The full disclosure of the priority application is incorporated herein by reference in its entirety and for all purposes.
BACKGROUND OF THE INVENTION
[0003] Cystic Fibrosis (CF) is a life shortening genetic disease that is defined by chronic lung infections and pancreatic insufficiencies. The root cause of CF is heritable mutations that affect the cystic fibrosis transmembrance conductance regulator (CFTR) ultimately resulting in substantially less CFTR at the cell surface. Individuals suffering this genetic predisposition can only expect to live to their late-thirties.
[0004] There is a need in the art for better and more effective methods capable of bolstering expression of both wildtype and mutant forms of CFTR, which could prove highly useful as a therapeutic tool for treating CF patients. The present invention addresses this and other unfulfilled needs in the art.
SUMMARY OF THE INVENTION
[0005] In one aspect, the invention provides methods for enhancing expression or cellular level of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell. The methods entail contacting the cell with an agent that specifically disrupts or downregulates CFTR associated antisense long non-coding RNA (IncR A) BG213071 and/or AI805947. Some of the methods are directed enhancing CFTR expression in an epithelial cell. For example, the cell can be an epithelial cell present in the lung, pancreas, liver, or intestine. In some methods, the cell is an epithelial cell present in a subject afflicted with cystic fibrosis.
[0006] In some methods of the invention, the agent inhibits expression of BG213071 and/or AI805947. In some other methods, the agent disrupts or suppresses the function of BG213071 and/or AI805947 by binding to the IncRNA. In these methods, the employed agent can be an antisense nucleic acid, an siRNA or an shRNA. For example, the agent can be an antisense RNA shown in Figure 4B. In some other embodiments, the agent can be a nucleic acid molecule comprising a sequence that is substantially identical or complementary to at least 10 contiguous residues shown in any of SEQ ID NOs: 1-5 and 59-69. Other methods of the invention can employ inhibitory oligonucleotides that target the specific loci in CFTR that are important for BG213071 regulation of CFTR expression. Examples of such inhibitory oligonucleotides are shown in SEQ ID NOs:4, 5 and 59-62.
[0007] In a related aspect, the invention provides methods for treating or ameliorating symptoms of cystic fibrosis in a subject. These methods involve administering to the subject a pharmaceutical composition comprising an agent that specifically disrupts or
downregulates CFTR associated antisense long non-coding RNA (IncRNA) BG213071 and/or AI805947. In some of these methods, the administered agent inhibits expression of BG213071 and/or AI805947. In some other methods, the administered agent binds to BG213071 and/or AI805947 to disrupt or suppress the cellular functions of BG213071 and/or AI805947. In some of these methods, the administered agent can be an antisense nucleic acid, an siRNA or an shRNA, e.g., any of the antisense RNA molecules shown in Figure 4B. Some other methods can employ a nucleic acid molecule comprising a sequence that is substantially identical or complementary to at least 10 contiguous residues shown in SEQ ID NO: l , SEQ ID NO:2, or SEQ ID NO:3.
[0008] In another aspect, the invention provides isolated or recombinant nucleic acid molecules comprising a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5, and 59-69; or (3) at least
10 contiguous residues of an antisense RNA shown in Figure 4B. These nucleic acid compounds can all be employed in any of the therapeutic methods described herein.
Typically, the nucleic acid molecules are capable of disrupting or downregulating CFTR associated long non-coding RNA (IncRNA) BG213071 and/or AI805947. Some of the nucleic acid molecules comprise a sequence that is substantially identical to the sequence shown in SEQ ID NO:4 or SEQ ID NO:5, or a fragment thereof. Some of the nucleic acid molecules can specifically disrupt or downregulate CFTR associated long non-coding RNA (IncRNA) BG213071, e.g., molecules comprising a sequence shown in SEQ ID NO:4 or SEQ ID NO:5, or a functional fragment thereof. Some other molecules comprise a sequence that is identical or complementary to an antisense RNA shown in Figure 4B or a functional fragment thereof.
[0009] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.
DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 shows BG213071 mediated transcriptional regulation of CFTR- (A) A schematic is depicted showing the CFTR locus with transcriptional start sites (TSS) for CFTR, BG213071, and AI805947 shown along with the small antisense RNA target sites (BGAS1-4) and some of those primers used to evaluate CFTR locus. (B) The effects of candidate sasRNAs targeted to the promoter and transcribed region for BG213071 on activating CFTR expression as determined by unspliced CFTR transcript analysis. (C) Small antisense BGas4 mediated activation results in increased (C) spliced and (D) full-length and spliced CFTR. For B-D the averages of triplicate treated cultures are shown with standard errors of the mean and p values from a paired T-test. (E) Expression of CFTR on the cell surface of CFPAC cells following treatment with BG213071 as determined by FACS analysis 72hrs post-transfection with BGas4. A single representative sample is shown for each transfection. (G-I) The localization of biotin containing AI805947 or BG213071 at the (G) promoter and (H) BG213071 intergenic locus of CFTR and (I) the BG213071 promoter in CFPAC cells contrasted with the lamda biotin control. (H) Deep sequencing assessment of Biotin-BG21307 land Biotin-AI805947 (AI805-2) relative to control Lambda-biotin immunoprecipitations in CFPAC cells. For F-1, the averages of triplicate treated cultures are shown with the standard error of the means and a p value from a paired T-test.
[0011] Figure 2 shows BG213071 interacts specifically with CFTR and several proteins involved in DNA architecture and chromatin structure- (A) A close up snap-shot from UCSC genome browser of BGAS4 target site and those primers used to distinguish the epigenetic changes at the BG213071 or BGAS4 targeted loci in CFTR are shown. (B-C) The effects of over-expression of (B) BG213071 and (C) BGas4 on H3K27me3 enrichment at the Set 8 BG213071 exon 1 locus. (D-E) Relative enrichment of RNAPII at the (D) Set 8 BG213071 exon 1 locus and (E) Set7 BG213071 promoter locus in BG213071 CFPAC treated cells. (F) Transcription is not required for BG213071 localization to CFTR. CFPAC cells were transfected with biotin labeled BG213071 or Lambda (Control) (50nM) and then treated with alpha-amanitin and CHIP carried out 30hrs later. For B-F the averages of triplicate treated cultures are shown with the standard error of the means and a p value from a paired T-test. (G) BG213071 associated proteins. Biotin labeled antisense
oligonucleotides, BGAS l and BGAS2, antisense and specific for BG213071 (Table 6), were used to immuneprecipitate BG213071. The resulting elutes were subjected to LC/MS analysis and several candidates determined. The top 10 candidates found in both BGASl and BGAS2 immunoprecipitations are shown.
[0012] Figure 3 shows a model for BG213071 regulation of CFTR expression- (A) The CFTR locus is shown with the internal expressed BG213071 and truncated CFTR transcript NM_000492. (B) The BG213071 IncRNA is expressed and localizes to the homology containing locus in the CFTR gene body. The localization of BG213071 to its target locus allows for chromatin structural and DNA binding proteins such as HMG-14, HMG-17, HMGB 1 and WIBG to localize specifically to the CFTR gene body and affect the local structure of the gene ultimately diminishing RNAPII activity.
[0013] Figure 4 shows the CFTR locus of interest - (A) The transcriptional start sites (TSS) of CFTR, BG213071, and AI805947 is shown along with the small antisense RNA target sites evaluated in figure 2. (B) The sequences of the expressed small antisense RNAs targeted to BG213071 or the predicted BG213071 promoter. Shown in the figure are BGasl (SEQ ID NO:59), BGas2 (SEQ ID NO:60), BGas3 (SEQ ID NO:61), BGas4 (SEQ ID NO:62), BGas5 (SEQ ID NO:63), BGas6 (SEQ ID NO:64), BGas7 (SEQ ID NO:65), asBGl (SEQ ID NO:66), asBG2 (SEQ ID NO:67), asBG3 (SEQ ID NO:68), and asBG4 (SEQ ID NO:69). (C) The effects of small antisense RNA targeting BG213071 on CFTR expression. U6M2 small antisense RNA expressing plasmids were transfected in triplicate into CFPAC cells and cellular mRNAs assessed (Set 4). CFTR expression was measured 72hrs later and the average of triplicate treated CFPAC cells is shown with the standard error of the means and p values from a paired T-test.
[0014] Figure 5 shows the effects of BG213071 and AI805947 expression on CFTR transcription and epigenetic states- (A) a schematic is depicted showing those IncRNAs endogenous AI805947 (AI805 l,~439b), positive control AI805947 (AI805 2,~676bp) and BG213071. Various transcriptional start sites (TSS) and some of those primer sites assessed are also shown. (B) The effects of over-expression of AI805947 (AI805-439bp and AI805- 676bp) on CFTR as shown relative to the pCDNA3.1 treated cells (Control) on CFTR unspliced transcript expression. (C) Assessment of the biotin linked transcripts AI805-1, AI805-2 and BG213071 for binding at other non-homologous containing loci in the CFTR locus.
DETAILED DESCRIPTION
[0015] Endogenous long non-coding RNAs (IncRNAs) are involved in epigenetically regulating gene expression in human cells. Some of these regulatory transcripts are antisense to their protein-coding gene counterpart and function in the target specific recruitment of epigenetic complexes and transcriptional silencing of the corresponding complimentary targeted loci. The present inventors observed that CFTR is regulated transcriptionally by the actions of long non-coding RNAs (IncRNAs). It was found that one particular IncRNA, BG213071 (also termed "BGAS" or "BGas" herein), which is expressed antisense and from intron 1 1 in CFTR, functions in concert with several proteins including HMGN2, HMGB 1, and WIBG to modulate the local chromatin and DNA architecture in the CFTR body and affect transcription. The inventors found that suppression of this IncRNA or its protein binding partners can result in up to a four-fold gain of defective CFTR on the cell surface. As detailed herein, the inventors identified specific sequences or sites in BGAS (e.g., promoter sequences) that can be targeted for suppression. Specific examples of antisense sequences for inhibiting BGAS expression and activating CFTR expression are also exemplified herein.
[0016] The observations described herein indicate that the endogenous IncRNA
BG213071 can serve as therapeutic target for specifically activating expression of CFTR. They provide basis for novel and more effective treatment paradigms for CF patients.
Accordingly, the present invention provides compositions and methods for upregulating CFTR expression and for treating cystic fibrosis. Detailed description for practicing the invention is provided below.
[0017] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. The following references provide one of skill with a general definition of many of the terms used in this invention: Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1 st ed., 1992); Illustrated Dictionary of Immunology, Cruse (Ed.), CRC Pr I Lie (2nd ed., 2002); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. (Eds.), Oxford University Press (revised ed., 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3rd ed., 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1st ed., 1999);
Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer- Verlag Telos (1994);
Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4th ed., 2000). In addition, the following definitions are provided to assist the reader in the practice of the invention.
[0018] The term "agent" or "test agent" includes any substance, molecule, element, compound, entity, or a combination thereof. It includes, but is not limited to, e.g., protein, polypeptide, peptide or mimetic, small organic molecule, polysaccharide, polynucleotide, and the like. It can be a natural product, a synthetic compound, or a chemical compound, or a combination of two or more substances. Unless otherwise specified, the terms "agent", "substance", and "compound" are used interchangeably herein. In some screening methods of the invention, the employed test agents or candidate compounds are small organic molecules.
[0019] The term "analog" or "derivative" is used herein to refer to a molecule that structurally resembles a reference molecule (e.g., a CFTR-activating agent exemplified herein) but which has been modified in a targeted and controlled manner, by replacing a specific substituent of the reference molecule with an alternate substituent. Compared to the reference molecule, an analog would be expected, by one skilled in the art, to exhibit the same, similar, or improved utility. Synthesis and screening of analogs to identify variants of known compounds having improved traits (such as higher binding affinity for a target molecule) is an approach that is well known in pharmaceutical chemistry.
[0020] The term "contacting" has its normal meaning and refers to combining two or more agents (e.g., polypeptides or small molecule compounds) or combining agents and cells. Contacting can occur in vitro, e.g., combining two or more agents or combining an agent and a cell or a cell lysate in a test tube or other container. Contacting can also occur in a cell or in situ, e.g., contacting two polypeptides in a cell by coexpression in the cell of recombinant polynucleotides encoding the two polypeptides, or in a cell lysate. Contacting can also occur inside the body of a subject, e.g., by administering to the subject an agent which then interacts with the intended target (e.g., a tissue or a cell).
[0021] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same. Two sequences are "substantially identical" if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Optionally, the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
[0022] Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482c, 1970; by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; by the search for similarity method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988; by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, WI); or by manual alignment and visual inspection (see, e.g., Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003)). Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977; and Altschul et al., J. Mol. Biol.
215:403-410, 1990, respectively.
[0023] Other than percentage of sequence identity noted above, another indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below. Thus, a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
[0024] The terms "subject" and "patient" are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as dogs, cats, sheeps, cows, pigs, rabbits, chickens, and etc.
Preferred subjects for practicing the therapeutic methods of the present invention are human.
[0025] The term "treat" or "treatment" refers to the administration of compounds or agents to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., cystic fibrosis), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder. Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease.
[0026] A "variant" of a reference molecule refers to a molecule substantially similar in structure and biological activity to either the entire reference molecule, or to a fragment thereof. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the sequence of nucleotide residues is not identical.
[0027] Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, have a well-defined structure: a short (20-25 nt, e.g., 21 nt) double strand of RNA (dsRNA) with 2-nt 3' overhangs on either end. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells by various transfection methods to bring about the specific knockdown of a gene of interest. Essentially any gene of which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA. Transfection of an exogenous siRNA can be problematic because the gene knockdown effect is only transient, particularly in rapidly dividing cells. One way of overcoming this challenge is to modify the siRNA in such a way as to allow it to be expressed by an appropriate vector, e.g., a plasmid. This is done by the introduction of a loop between the two strands, thus producing a single transcript, which can be processed into a functional siRNA. Such transcription cassettes typically use an RNA polymerase III promoter (e.g., U6 or HI), which usually directs the transcription of small nuclear RNAs (snRNAs) (U6 is involved in gene splicing; HI is the RNase component of human RNase P). The resulting siRNA transcript is believed to be processed subsequently by Dicer.
[0028] A small hairpin RNA or short hairpin RNA (shRNA) is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. shRNA uses a vector introduced into cells and utilizes the U6 promoter to ensure that the shRNA is always expressed. This vector is usually passed on to daughter cells, allowing the gene silencing to be inherited. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the siRNA that is bound to it.
[0029] The invention provides various agents which can enhance or stimulate CFTR expression. Typically, these CFTR-activating agents function by targeting long non-coding RNA BG213071 and/or AI805947 which suppress CFTR expression. Some of the agents inhibit or suppress expression of the long ncRNA (e.g., BG213071). As described herein, several loci in CFTR sequences have been identified that are important for BG213071 regulation of CFTR expression. The agents for promoting CFTR expression can be any compounds that specifically target these loci, e.g., binding sites of the exemplified inhibitory oligonucleotides BGas_Biol (SEQ ID NO:4), BGas_Bio2 (SEQ ID NO:5), BGasl (SEQ ID NO:59), BGas2 (SEQ ID NO:60), BGas3 (SEQ ID NO:61), and BGas4 (SEQ ID NO:62).
[0030] In some embodiments, the agents are small molecule organic compounds. Some other agents are capable of specifically disrupting the structure or cellular function of the long ncRNA in suppressing CFTR expression. In some of these embodiments, the agents are inhibitory polynucleotides such as antisense oligonucleotides or other inhibitory RNA molecules such as shRNAs or siRNAs. In various embodiments, the CFTR-activating agent of the invention is an isolated or recombinant inhibitory oligonucleotide or polynucleotide molecule that comprises a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5, and 59-69; or (3) at least 10 contiguous residues of an antisense RNA shown in Figure 4B. Some specific examples of such inhibitory oligonucleotides are exemplified herein, e.g., SEQ ID NOs:4, 5 and 59-69. Some other inhibitory nucleic acid molecules of the invention are shown in Table 1. In some embodiments, the CFTR activating agents are oligonucleotides or polynucleotides which contains a sequence that is substantially identical or complementary to at least 10, 15, 20, 25, 30, 40, 50 or more contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3. In some embodiments, the CFTR-activating agents specifically disrupt or downregulate BG213071 and/or AI805947. These include molecules which have a sequence that is substantially identical to any of the sequences shown in SEQ ID NOs:4, 5 and 59-69, or a fragment thereof. In addition to the nucleic acid molecules specifically exemplified herein, their functional fragments, analogs, variants or other derivatives may also be employed in the practice of the present invention. In some embodiments, the CFTR- activating oligonucleotides (e.g., SEQ ID NO:4 or 5) can be linked to another moiety, e.g., biotin.
[0031] Other than directly targeting BGAS and/or AI805947 to promote CFTR expression, CFTR modulating compounds suitable for the invention also include agents that target the BGAS associated proteins described herein, e.g., HMGA1, HMGN2, HMGB 1 or WIBG. Any compounds that are capable of inhibiting expression of these proteins or disrupting their interactions with BGAS are suitable for the invention. In some
embodiments, the compounds are inhibitory polynucleotides or oligonucleotides such shRNAs or siRNAs. Examples of such inhibitory oligonucleotides are exemplified herein (see Table 1). Additional inhibitory nucleic acid agents targeting these proteins are commercially available. As described in the Examples herein, these include siRNAs for suppressing expression of any of the BGAS-associated proteins, which are available from commercial vendors, e.g., Santa Cruz Biotechnology (Dallas, Texas).
[0032] The CFTR modulating compounds described herein can be useful in various therapeutic or prophylactic applications. They can be readily employed for enhancing or activating CFTR expression, and for treating or ameliorating symptoms of cystic fibrosis. Accordingly, the invention provides methods for upregulating CFTR expression or cellular level in a cell (e.g., epithelial cells). In some embodiments, the cell is present in a subject (e.g., a subject afflicted with cystic fibrosis). In some embodiments, the therapeutic applications of the invention are directed to preventing development of cystic fibrosis in a subject. Typically, the therapeutic methods of the invention entail administering to a subject a pharmaceutical composition that comprises an effective amount of the CFTR-activating agent disclosed herein.
[0033] The CFTR-activating agents can be administered alone to a subject in need of treatment. More preferably, they are administered in the form of a pharmaceutical composition or preparation in admixture with any of various pharmacologically-acceptable additives. For example, the compounds may be administered in the form of a convenient pharmaceutical composition or formulation suitable for oral, topical, parenteral application, or the like. In some embodiments, the active ingredient of the pharmaceutical composition or formulation comprises essentially of a CFTR-activating agent disclosed herein.
Pharmaceutical compositions of the invention can be prepared in accordance with methods well known and routinely practiced in the art. See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th ed., 2000; and Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. Pharmaceutical compositions are preferably manufactured under GMP conditions.
Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer,
lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for molecules of the invention include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, for example, lactose, or may be aqueous solutions containing, e.g., polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.
[0034] Pharmaceutical composition containing a CFTR-activating agent can be administered locally or systemically in a therapeutically effective amount or dose. They can be administered parenterally, enterically, by injection, rapid infusion, nasopharyngeal absorption, dermal absorption, rectally and orally. The agents for use in the methods of the invention should be administered to a subject in an amount that is sufficient to achieve the desired therapeutic effect (e.g., eliminating or ameliorating symptoms associated with cystic fibrosis) in a subject in need thereof. Typically, a therapeutically effective amount or efficacious dose of the CFTR-activating agents employed in the pharmaceutical
compositions of the invention should enhance CFTR expression or activities in a cell, or slow or suppress cystic fibrosis in a subject. As noted below, actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response without being toxic to the subject.
[0035] The selected dosage level depends upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, the route of administration, the time of administration, and the rate of excretion of the particular compound being employed. It also depends on the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, gender, weight, condition, general health and prior medical history of the subject being treated, and like factors. Methods for determining optimal dosages are described in the art, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th ed., 2000. For a given CFTR-activating agent, one skilled in the art can easily identify the effective amount of the agent by using routinely practiced pharmaceutical methods. Dosages used in vitro or in situ studies may provide useful guidance in the amounts useful for in vivo administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of particular disorders. Typically, a
pharmaceutically effective dosage would be between about 0.001 and 100 mg/kg body weight of the subject to be treated.
[0036] The CFTR-activating agents described herein can be readily synthesized using methods routinely practiced or disclosed herein. Some specific protocols or assays that can be used for practicing the present invention are exemplified below.
EXAMPLES
[0037] The following examples are offered to illustrate, but not to limit the present invention. Example 1. Regulation of CFTR expression by IncRNAs
[0038] Examination of the CFTR locus using the UCSC genome browser uncovered some IncRNAs that are antisense to the CFTR gene (Figures 1A). One IncRNA, BG213071 (Table 2), is embedded within the downstream transcribed region, between exons 1 1 and 12 in the antisense orientation of CFTR (Figure 1 A); curiously terminating just ~1079bp downstream of the well-known Δ508 CFTR mutation and emanating from a previously reported enhancer region (Ott et al, Proc. Natl. Acad. Sci. USA, 106, 19934-39, 2009). When this IncRNA BG213071 , (BGas), was repressed using small antisense RNAs (sasRNAs; prepared as described in Ackley et al, Mol. Therapy Nucleic Acids 2:el04, 2013) (Figures S1A-B), transcriptional activation of CFTR; ranging from 1.4 to 2.4 fold, was observed (Figure 4C). This transcriptional activation appeared to be transcriptional in nature (Figure IB) and to result in increases in both spliced CFTR transcripts (Figures 1C-D) as well as viable CFTR expression on the cell surface (Figure IE). These data suggest that BG213071 may be functional as an active IncRNA suppressor of CFTR, similar to previous observations whereby particular IncRNAs have been observed to direct transcriptional and epigenetic gene silencing of the Oct4, p21 , pi 5 and PTEN genes (Hawkins et al. Transcription 1 : 165- 75, 2010; Morris et al, PLoS Genet. 4:el 000258, 2008; Lai et al, PLoS One. 3:el 864, 2008; and Johnsson et al, Nat. Struct. Mol. Biol. 20:440-6, 2013).
[0039] A survey of the CFTR promoter uncovered another IncRNA, AI805947, which is upstream of BG213071 and also in the antisense orientation relative to the CFTR promoter (Figures 1A and Table 3). The relatively close proximity of AI805947 to the CFTR promoter suggested this transcript might also be involved in regulating CFTR expression. To determine whether AI805947 is functional in suppressing CFTR expression we generated two different clones for AI805947, one expressing the endogenous AI805947 (Table 3) and one positive transcriptional silencing control expressing an antisense transcript to the CFTR promoter (Table 4 and Figure 5 A). The endogenous IncRNA AI805-1 (Table 3), the control AI805-2 (Table 4), and BG213071 (Table 2) were capable of suppressing CFTR expression (Figure IF) and this suppression appeared to be transcriptional in nature as determined by a reduction in unspliced variants of CFTR (Figure 5B). These data suggest that the over- expression of both BG213071 and AI805947 affects the transcriptional expression of CFTR.
[0040] To determine if these CFTR associated IncRNAs interact with their homology containing loci in CFTR, biotin linked BG213071 and AI805947 transcripts were generated, and their binding loci were determined in CFPAC cells. Interestingly, the control AI805947 variant, AI805-2 (Table 2) which is antisense to the CFTR promoter was found to bind the CFTR promoter (Figure 2D), while BG21307 was found to bind at its homology containing loci in the body of CFTR (Figure 2E). Notably other loci in the CFTR gene were assessed and not found to be targeted by the biotin linked transcripts (Figures 2F and S2C). Thus, both BG21307 and AI805-2 indeed localized specifically to their homology containing loci at the CFTR locus and nowhere else in the genome (Figure 2J). Collectively, these data suggest that IncRNAs are active participants in CFTR expression and that the targeting of CFTR by these IncRNAs is specifically at the chromatin/nuclear level.
[0041] Previous studies have found a role for epigenetic changes at both small and IncRNA targeted loci (reviewed in Morris et al., Nat. Rev. Genet. 15:423-37, 2014). One common silent state epigenetic mark found at non-coding RNA targeted loci is histone 3 lysine 27 tri-methylation (H3K27me3). Interestingly, H3K27me3 appeared reduced at the BG213071 target locus and enriched at the BGAS4 small RNA target locus in the
BG213071 promoter as determined by chromatin immunoprecipitation (ChIP) analysis (Figure 2A-C). These observations suggest that that BG213071 is not functioning to epigenetically modulate the gene body of CFTR and that BGAS4 is actively recruiting H3K27me3 to the BG213071 promoter in a manner similar to previous observations with small RNA directed transcriptional gene silencing (Weinberg et al., RNA 12:256-62, 2006).
[0042] Next, we interrogated the occupancy of active forms of RNA Polymerase II (RNAPIl) at the BG213071 binding locus in the CFTR gene body (Figure 2A). Interestingly, BG213071 over-expression resulted in significant and specific enrichment of active forms of RNAPIl specifically at the locus overlapping BG213071 (Figures 3D-E). These data suggest that BG213071 over-expression results in the retention of active forms of RNAPIl specifically at the BF213071 homology-containing locus in the CFTR gene body. As RNAPIl seemed to be specifically enriched at the BG213071 locus and previous studies have found a role for transcription in non-coding RNA directed regulation of gene expression (Han et al., Proc. Natl. Acad. Sci. USA 104: 12422-7, 2007), we surmised that transcription may be required for BG213071 localization to this region in the CFTR gene body. To determine if transcription is required for localization of BG213071 to the CFTR gene body, CFPAC cells were treated with biotin linked BG213017 followed by treatment with the RNAPIl inhibitor alpha-amanitin. Alpha-amanitin treatment had no effect on BG213071 localization to the CFTR gene body (Figure 2F), suggesting that the BG213071 is functional in modulating CFTR expression in manner different than previous observations with lncRNAs.
[0043] To explore mechanistically how BG213071 is modulating CFTR expression, BG213071 was immunoprecipitated and ChIRP performed with BG213071 specific biotin labeled primers (Table 6) (as described in Hawkins et al., Transcription 1 : 165-75, 2010; and Chu et al, J. Vis. Exp. 61 : 3912, 2012) to determine those proteins associating in complex with BG213071. Several interesting proteins were found associated with BG213071 (Table 5), with a subset including non-histone chromosomal proteins (HMG-14 and HMG-17), High mobility group protein B l (HMGB 1) and Partner of Y14 and mago (WIBG) (Figure 2G) which are known to be involved in binding DNA and inducing changes in the local architecture that affect transcription (Klune et al., Mol. Med. 14:476-84, 2008).
[0044] These studies indicate that at least two lncRNAs, BG213071 and AI805947, are functionally relevant with regards to modulating CFTR expression. However, BG213071 appears to be mechanistically modulating CFTR expression in a manner not previously known. BG213071 appears to function as a scaffolding to partition the CFTR locus by tethering chromatin associated proteins known to be involved in DNA architecture and structure (Figure 3). Some of the BG213071 binding partners such as HMGB 1 have been observed to create bends in DNA and obstruct RNAPII activity. Notably, the suppression of this BG213071 scaffolding with small antisense RNAs targeted to the BG213071 promoter results in increased transcriptional activation of CFTR that may prove therapeutically relevant.
[0045] Small antisense non-coding RNAs can direct stable epigenetic silencing to gene promoters and instill a long-term silent state. This form of RNA directed transcriptional silencing is presumably long-term because changes are instilled in the chromatin space around the gene, making transcription more difficult (Knowling et al., Progr. Mol. Biol. Transl. Sci. 102: 1-10, 201 1). The observations presented here suggest that the promoter of BG213071 is also susceptible to RNA targeting. These observations are similar to previous work whereby promoter targeted transcriptional silencing was found to silence an endogenous IncRNA that actively regulates the tumor suppressor gene DUSP6, resulting ultimately in increased expression of DUSP6 (Ackley et al., Mol. Therapy Nucleic Acids 2:el 04, 2013). Collectively, the findings reported here indicate that BG213071 acts as a IncRNA scaffolding to specifically modulate CFTR expression and that this IncRNA can serve as a bona fide therapeutic target to activate CFTR expression.
Example 2. Further characterization of BGAS regulation of CFTR expression
[0046] Additional studies were performed to confirm the Regulatory functions of BGAS on CFTR expression. We observed when BGAS was over-expressed in lHAEo- cells, an observable suppression of CFTR was observed. This, coupled with the observation that sasRNAs targeting BGAS resulted in significant activation of functionally relevant CFTR and that the BGAS locus in intron 1 1 of CFTR is the only locus in human genome that is bound by the biotin-BGAS transcript, indicates that BGAS functions in cis and has CFTR regulatory properties.
[0047] To better understand the roles of BGAS-associated proteins in CFTR expression, 213071 binding partners such as HMGBl, we measured expression of the mass
spectrophotometry identified HMGAl , HMGB l, and WIBG following suppression of each transcript with RNAi relative to the scrambled control siRNAs (Control) in 16HBE14o- , Δ508 containing cells. We also observed that suppression of HMGAl, HMGB l, and WIBG with RNAi resulted in significantly increased CFTR expression. This suggests that these proteins are indeed involved in modulating CFTR expression. Collectively, the observations presented here indicate that BGAS functions to modulate CFTR expression by tethering various structural and chromatin architectural modifying proteins to intron 1 1 of CFTR.
[0048] We further observed that suppression of HMGAl, HMGB l, and WIBG with RNAi resulted in significantly increased CFTR expression. This suggests that these protein are involved in modulating CFTR expression. Collectively, the observations presented here suggest that BGAS functions to modulate CFTR expression by tethering various structural and chromatin architectural modifying proteins to intron 1 1 of CFTR.
Example 3. Some exemplified methods and materials
[0049] This Example describes some materials and methods that are used in the above described studies. These and other methods well known in the art can all be employed in the practice of the present invention.
[0050] Cloning EST AI805947 ncRNA into pcDNA3.1 - Two different antisense RNAs, representing different segments of AI805947, were cloned into pcDNA3.1(+). PCR was carried out using NheI_AI805947_For and KpnI_AI805947_Rev (Table 1) to generate the 439 bp antisense RNA (Clone 1). To generate the 676 bp antisense RNA (Clone 2) primers NheI_AI805_For and KpnI_AI805_Rev were used. Both PCRs were carried out using CFPAC genomic DNA and the resulting products were ligated into pcDNA3.1 , specifically into the Kpn l and Nhel sites. To generate the pcDNA3.1 -BG213071 , the EST BG213071 sequence was submitted to Genwiz, synthesized and cloned into pcDNA3.1 commercially.
[0051] Generation of BGas targeted small antisense RNAs and AI805947 targeted shRNAs- To delineate any role that EST BG213071 might be playing in the regulation of CFTR we generated several small antisense non-coding RNAs targeted to the reported expressed and upstream putative promoter sites for EST BG213071 . The small RNA target sites are shown (Figure 1A). Small antisense RNA expression vectors were generated by annealing oligonucleotides (IDT technologies, Coralville, Iowa, USA) (Table 1 ) and subsequent cloning into the U6M2 construct using the Bgl II and Kpn I restriction sites (as described in Amarzguioui et al., FEBS letters. 2005 ;579:5974-5981 ). Positive clones were determined by sequencing and then midi-prepped (Qiagen, Valencia CA, USA). To generate shRNAs targeted to AI805947 the IDT shRNA design algorithm was used and target shRNAs were cloned as 21 mers into the U6M2 expression plasmids. Mis-matches were placed on the sense strand to facility the correct strand loading and minimize any off- targeting of the shRNAs, e.g. for the CFTR promoter.
[0052] Transfections - CFPAC- 1 cells (ATCC Number CRL- 1918) and HAEo- (a gift from Dieter Gruenert) culture experiments. The cells were plated onto a 24-well plate (1 - 2x10Λ5 cells/well). Twenty-four hours later, the cultures were transfected with either the Neon electroporation system or Lipofectamine 2000 (Life Technologies, Carlsbad CA, USA), using 100-200ng DNA + Ι μΙ. Lipofectamine 2000 per well and 50μL· of media without serum.
[0053] qRT-PCR and directional RT analysis of gene expression- To determine the small RNA effects on CFTR, CFPAC cells or l HAEo- cells were utilized were utilized. CFPAC cells were transfected using Lipofectamine 2000 (Life Technologies, Carlsbad CA, USA) (~^g/10A6 cells). The culture mRNAs were collected 48-72 hours later and DNAse treated (Promega Maxwell, Madison WI, USA). The culture RNAs were then subjected to RT conversion and qPCR using various primer sets (Table 1). To determine changes in antisense EST BG213071 expression directional RT and PCR was carried out. Pooled aliquots of triplicate treated cultures ~15ng total were utilized in the RT step either with a directional RT primer (Set8F) or without any primer (background control). Following the RT step a qPCR was carried out with primer Set7F and Set7R and Set8F and Set8R (Table 1) and overall transcript expression determined. For analysis of other genes degenerately RT primed cDNAs were assessed for particular gene expression relative to beta actin.
[0054] Chromatin Immunoprecipitation- ChIP analysis was carried out on small RNA treated CFPAC cells (~4xl 0Λ6 cells) for Histone 3 Lysine 4 and histone 3 lysine 36 trimethylated sates (H3K4me3 and H3K36me3 respectively). The antibodies used for ChIP for H3K4me3 (Upstate, Antibody 07-473), and H3K36me3 (Abeam, ab9050) following previously described techniques {Weinberg, 2006 #2433} . The relative enrichment of the various epigenetic marks was determined at the CFTR promoter using primer sets 1 and 2 (Table 1). Any IgG or no antibody values are first subtracted from the resultant
immunoprecipitation and input values, and then everything is standardized to input. In the case of the AI805947 CHIP, histone 3 lysine 27 me3 antibody (Abeam, ab6002) was used 72hrs post-transfection. The resultant elutes from triplicate treated cultures were pooled and assessed following subtraction of no antibody controls and standardized to inputs.
[0055] T7-transcribed synthetic RNA pulldown for localization studies- Synthetic biotinylated ncRNAs were generated by T7 transcription using the Ampliscribe™ T7- Flash™ Biotin -RNA Transcription Kit (Epicentre® Biotechnologies, WI, USA) according to the manufacturer's instruction. Templates for T7 transcription was prepared by PCR of pcDNA3.1 plasmids expressing the relevant ncRNAs. The following primers were used: T7-BG213071 F: 5'-CAGTGAATTGTAATACGACTCACTATAGGGGTAATATATCTA- 3 ' (SEQ ID NO:70) and BG213071 R: 5 '-
CTCAAAGAGGATATACTTCATTCCTCAAAAGG-3' (SEQ ID NO:71); T7-AI805#2 F: 5'- CAGTGAATTGTAATACGACTCACTATAGGGCTTTTCTCCGAC-3 ' (SEQ ID NO:72) and AI805#2 R: GCTTCCAATTCCCCCCACC (SEQ ID NO:73); T7-AI805#1 F: 5' - CAGTGAATTGTAATACGACTCACTATAGGGTCGGAGAAAAGA-3 ' (SEQ ID NO:74) and T7-AI805# 1 R: 5'- GAAGGCGCCTACGCCTG-3 ' (SEQ ID NO:75).
Transcripts were transfected into CFPAC cells at a concentration of 50nM. 30 hours post- transfection, cells were cross-linked with formaldehyde at 1% for 10 minutes at room temperature followed by addition of glycine to a final concentration of 0.125M and a further incubation for 5 minutes at room temperature. Cells were then washed with PBS supplemented with PMSF, aproteinin and leupeptin and lysed with ChIP lysis buffer (50 mM Hepes, 140 mM NaCl, 1% Triton X, 0.1% NAD) on ice for 20 minutes. Chromatin was sheared by sonication. Cell lysates containing sheared chromatin, or ChIP eluates in the case of ChlP-biotin dual pull-down assays, were incubated with Dynabeads® MyOne™
Streptavidin C I (Life Technologies, CA, USA) prepared according to the manufacturer's instructions for 2 hours on a rotating platform. Beads were pulled down with a magnet for 3 minutes and washed with Low salt immune complex wash buffer (0.1% SDS; 1% Triton X- 100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1 ; 150 mM NaCl); High salt immune complex wash buffer (0.1% SDS; 1% Triton X-100; 2 mM EDTA; 20 mM Tris-HCl, pH 8.1 ; 500 mM NaCl); LiCl Immune complex wash buffer (0.25 M LiCl; 1% NP40; 1% sodium
deoxycholate; 1 mM EDTA; 10 mM Tris-HCl, pH 8.1); and TE buffer (10 mM Tris-HCl; 1 mM EDTA, pH 8.0). Each wash step was carried out for 3 minutes on a rotating platform. Streptavidin bead-biotinylated NA-DNA complexes were re-suspended in nuclease-free water and heated at 95°C for 5 minutes to denature RNA-DNA hybrids. Streptavidin bead- biotinylated RNA complexes were pulled down with a magnet and DNA-containing supernatants were analyzed by qPCR.
[0056] Biotin-tagged oligo pull down for mass spec studies- CFPAC cells were cross- linked with formaldehyde at 1% for 10 minutes at room temperature followed by addition of glycine to a final concentration of 0.125M and a further incubation for 5 minutes at room temperature. Cells were then washed with and resuspended in PBS supplemented with PMSF, aproteinin and leupeptin and lysed with ChIP lysis buffer (5 mM PIPES, 85 mM KC1, 0.5 % NP40) on ice for 20 minutes. Cell lysates were incubated with the following biotin-tagged oligos: BGas_biol : 5'-/5Biosg/GCCAGCACAAGAATCCCTCA-3 ' (SEQ ID NO:76) and BGas_bio2: 5'-/5Biosg/CCAAATGCAAACATTCATGATTC-3' (SEQ ID NO:77) for 15 minutes on a rotating platform at room temperature. Cell lysate/biotin-tagged oligo solutions were incubated with Dynabeads® MyOne™ Streptavidin C I (Life
Technologies, CA, USA) prepared according to the manufacturer's instructions for 15 minutes on a rotating platform. Captured compounds were pulled down with a magnet for 3 minutes and washed twice with PBS supplemented with PMSF, aproteinin and leupeptin. Each wash step was carried out for 3 minutes on a rotating platform. Proteins were eluted with 50uL elution buffer (l OmM Tris-HCl (pH 6.0), ImM EDTA, and 2.0 M NaCl) at 70°C for 10 minutes. The eluates were used for mass spec. [0057] Liquid chromatography mass spectrometry analysis (LC/MS): Those elutes from the biotin tagged oligonucleotide immunoprecipitation (described above) were subjected to Mass Spec analysis (BMSF core facility at the University of New South Wales, Australia) . Nano-Liquid chromatography (nano-LC) was performed using an Ultimate 3000 HPLC and autosampler system (Dionex, Amsterdam, Netherlands). Samples were injected into a fritless nanoLC column (75 μηι x -l Ocm) containing CI 8 media (3μιη, 200 A Magic, Michrom) manufactured according to Gatlin et al. (Anal. Biochem. 263 : 93-101,
1998). Peptides were eluted using a linear gradient according to the conditions in the table below, over 50 min, at a flow rate of 0.2μί/ιηίη. Mobile phase A consisted of 0.1% Formic Acid in H20, while mobile phase B consisted of ACN:H20 (8:2) with 0.1% Formic Acid. Tandem mass spectrometry (MS/MS): Electrospray tandem mass spectrometry was performed with the LTQ Fourier transform ion cyclotron resistance mass spectrometer (Thermo Fisher Scientific, Waltham, MA USA). High voltage (1800 V) was applied to a low volume tee (Upchurch Scientific) and the column tip positioned ~ 0.5 cm from the heated capillary (T=250°C) of a LTQ FT Ultra (Thermo Electron, Bremen, Germany) mass spectrometer. Positive ions were generated by electrospray and the LTQ FT Ultra operated in data dependent acquisition mode (DDA). A survey scan m/z 350-1750 was acquired in the FT ICR cell (Resolution = 100,000 at m/z 400, with an accumulation target value of 1,000,000 ions). Up to the 6 most abundant ions (>3,000 counts) with charge states > +2 were sequentially isolated and fragmented within the linear ion trap using collisionally induced dissociation with an activation q = 0.25 and activation time of 30 ms at a target value of 30,000 ions. M z ratios selected for MS/MS were dynamically excluded for 30 seconds.
[0058] Analysis of Mass Spectraphotometry Database search parameters - Peak lists were generated using Mascot Daemon/extractjnsn (Matrix Science, London, England, Thermo) using the default parameters, and submitted to the database search program Mascot (Matrix Science, London, UK; version 2.3.02) (Perkins, D et al Electrophoresis 1999:20:3551- 3567). Mascot was used to search the UniProtKB/Swiss-Prot database (release 25 10 13) containing 20352 sequence entries with the database taxonomy restricted to Homo sapiens. The peptide mass tolerance and fragment ion mass tolerance were set to 4 ppm and ± 0.4 Da respectively. Trypsin was specified as the enzyme in Mascot with allowance for up to one missed cleavage site per peptide. Oxidation of methionine and carbarn idomethylation of cysteine were set as variable modifications within Mascot.
[0059] Quantification and validation of protein identifications - Scaffold (version
Scaffold_4.3.2, Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications from Mascot and to compare the relative spectral counts between the BGAS1 and BGAS2 immunoprecipitation samples. The mass spectra from triplicate biological pull-down/LC/MS experiments were combined to give two biological samples: BGasl and BGas2.
[0060] Peptide identifications were accepted if they could be established at greater than 95.0% probability by the Peptide Prophet algorithm (Keller, A et al Anal. Chem.
2002;74(20):5383-92) with Scaffold delta-mass correction. Protein identifications were accepted if they could be established at greater than 99.9% probability by the Protein Prophet algorithm (Nesvizhskii, Al et al Anal. Chem. 2003;75(17):4646-58) and contained at least 3 unique identified peptides.
[0061] A total of 1850 spectra at 95% minimum probability (0.42% peptide false discovery rate) identified 44 proteins containing at least 3 unique peptides at 99.9% probability by the Peptide Prophet algorithm (at 0.0% protein false discovery rate). Total spectral counts for the BGAS1 and BGAS2 pooled biological samples were compiled in Scaffold_4.3.2 and the proteins were identified (Table 5).
[0062] Suppression of BG213071 associated proteins- Those protein candidates determined by LC/MS of biotin-BG213071 elutes were suppressed using RNAi.
Commercially available siRNAs for HMGA1 (siRNA sc-44333 Santa Cruz), HMGN2 (siRNA sc-37988, Santa Cruz), HMGB 1 (siRNA sc-37982, Santa Cruz), WIBG (siRNA sc- 96076, Santa Cruz) and a scrambled control (siRNA sc- 37007, Santa Cruz) were transfected into ΙΗΑΕο-, CFPAC or 16HBEo-cells (50nM) using the Neon Electroporator (Life Technologies, Carlsbad CA). The siRNA transfected cultures were collected 72 hrs later and gene expression determined using qRTPCR.
[0063] Treatment of CFPAC cells with 5' AzaC and TSA- Roughly 1.5xl-A5 cells were plated out and treated in quadruplicate with 4 μΜ 5'Aza cytadine (AzaC) and 0.5 μΜ.
Control cultures were left untreated. Fresh AzaC and/or TSA was added every 24hrs and the cultures collected and RNA isolated 72hrs later. The cultures were assessed for CFTR expression by qRTPCR with b-actin primers vs CFTR primers sets 5 and 6. [0064] CFTR FACS analysis- CFPAC- 1 cells (ATCC Number CRL- 1918) were used for CFTR FACS analysis experiments. The cells were plated onto a 24-well plate (1.5χ10Λ5 cells/well). Twenty-four hours later, the cultures were transfected with Lipofectamine 2000 (Life Technologies, Carlsbad CA, USA), using 300ng DNA + 0.75μ\, Lipofectamine 2000 per well and ΙΟΟμΙ of media without serum. 72 hours later, cells were fixed in 4% formaldehyde, permeabilzed in 0.1 % TBS/Tween, and blocked with 10%FBS/0.3M glycine. Cells were then incubated with CFTR antibody (Abeam, ab2784) or Isotype control antibody (Abeam, ab91545) at room temperature for 30 minutes. Samples treated with CFTR antibody were then treated with goat anti-mouse IgM secondary antibody (Abeam, ab97007) for 30 minutes at room temperature. After antibody treatments, all samples were spun down and resuspended in 2%FBS/PBS solution and run on a BD LSR II Flow Cytometer.
[0065] Table 1 Some oligonucleotide used in the studies.
Figure imgf000024_0001
BG213071
expression
Set 7R TGTTCTCATCTCCAGTTCCAAGTC Directional RT for 21
BG213071
expression
Set 8F TTGATGGTTAAGCAGCTGGTGCC Directional RT for 22
BG213071
expression
Set 8R GAATGTTTGCATTTGGTGATCGGG Directional RT for 23
BG213071
expression
Set 9F GGTGATTATGGGAGAACTGGAG Internal CFTR 24 promoter
(Exonll / intron 11, BGas regulated?)
Set 9R TCTTTAATGGTGCCAGGCATA Internal CFTR 25 promoter
(Exonll/ intron 11, BGas regulated?)
Set TTTGGACTTACCTCAAAGAGGAT Internal CFTR 26 10F promoter
(Exonll/intron 11, BGas regulated?)
Set TCCAACCTCCAGGTTATGAAAT Internal CFTR 27 10R promoter
(Exonll/intron 11, BGas regulated?)
Set TTTGGACTTACCTCAAAGAGGAT Internal CFTR 28 10F promoter
(Exonll / intron 11, BGas regulated?)
Set TCCAACCTCCAGGTTATGAAAT Internal CFTR 29 10R promoter
(Exonll/intron 11, BGas regulated?)
Set CCTTTCCAACAACCTGAACAAA CFTR Exon 5/6 30 11F splicing
Set GCCTGTAACAACTCCCAGATTA CFTR Exon 5/6 31 11R splicing
Set GCTTCCTATGACCCGGATAAC CFTR Exon 4 32 12F
Set GGAGCAGTGTCCTCACAATAA CFTR Exon 4 33 12R
Set CAGGCAAACTTGACTGAACTGG CFTR_unspliced 34 13F
Set GCATTCTACTCAATTGCATTCTGTGG CFTR_unspliced 35
13R G
AI805 CGTACTGAAAGAGAAAAAAAAATC sasRNA targeted 36
947_as to AI805947
1
AI805 TCTGCAAGGAGGTAAGAGGAG sasRNA targeted 37
947_as to AI805947
2
AI805 TGGCACAGAAATCTTAGGACA sasRNA targeted 38
947_as to AI805947
3
AI805 TCTTAGGACACGTACTGAAAG sasRNA targeted 39
947_as to AI805947
4
AI805 CTTTGGAGTGTTTTAGCGATA sasRNA targeted 40
947_as to AI805947
5
NheL gcggctagcTCGGAGAAAAGAACCA 439bp asRNA, 41 AI805 AGCTTTATTAGTTTCAGGTTTAGG clone 1
947_F
or
KpnL gcgggtaccGAAGGCGCCTACGCCTG 439bp asRNA, 42 AI805 GGAATGCCCAGATGCCCCTC clone 1
947_R
ev
NheL gcggctagcCTTTTCTCCGACACGCAA bp asRNA, clone 2 43 AI805 AGGAAGCGCTAAGGT
_For
Kpnl_ gcgggtaccGCTTCCAATTCCCCCCAC bp asRNA, clone 2 44 AI805 CCACCCCTACTCCGCACA
_Rev
HMG GAGGAAGAGGAGGGCATCTcg HMGA1 mRNA 45 A1_F1 detection
HMG TGTCCAGTCCCAGAAGGAAgc HMGA1 mRNA 46 A1_R detection
HMG CTCTGATGAAGCAGGAGAGAAAG HMGN1 mRNA 47
N1_F1 detection
HMG AGACAGGGACCACTGATAAGA HMGN1 mRNA 48
N1_R detection
1
HMG GGCAGCAGCGAAGGATAAAt HMGN1 mRNA 49
N1_F2 detection
HMG CCGCAGGTAAGTCTTCTTTAGTT HMGN1 mRNA 50 N1_R detection
2
HMG GGAATGCTGCCTCTGATCTT HMGN2 mRNA 51 N2„F1 detection
HMG ATGGAGTACCTCAAAGCAGAAC HMGN2 mRNA 52 N2_R detection
HMG TCATAAGGCTGCTTGTCATCT HMGB1 mRNA 53 B1_F1 detection
HMG GCTCTGAGTATCGCCCAAAaa HMGB1 mRNA 54 B1_R1 detection
HMG CCACATCTCTCCCAGTTTCTTC HMGB1 mRNA 55 B1_F2 detection
HMG GTTCGGCCTTCTTCCTCTTC HMGB1 mRNA 56 B1_R2 detection
WIBG CGGAGGGTGAAAGAAGGATATG WIBG mRNA 57 _F1 detection
WIBG GGGCAACTCTGGTTTACTCTT WIBG mRNA 58 _R1 detection
[0066] Primers for cloning AI805947 into pcDNA3.1+
NheI_AI805_For
gcggctagcCTTTTCTCCGACACGCAAAGGAAGCGCTAAGGT (SEQ ID NO:6) KpnI_AI805_Rev
gcgggtaccGCTTCCAATTCCCCCCACCCACCCCTACTCCGCACA(SEQ ID NO:7)
[0067] Table 2 Sequence of IncRNA EST BG213071 cloned into pcDNA3.1.
5'GTAATATATCTAAAAAACACATCAACTTTGGCAGTCAAAATGAAAATATA
CTGAATCATGAATGTTTGCATTTGGTGATCGGGGCTTCATAGAGAACATATT
GAGGGATTCTTGTGCTGGCACCAGCTGCTTAACCATCAAGGATTCTGTTATG
AAATACTATTCCTGGAAGAAGGCCTTTTGAGGAATGAAGTATATCCTCTTTG
AG3' (SEQ ID NO:l)
[0068] Table 3 Sequence of IncRNA EST AI805947 cloned into pcDNA3.1+
(AI805-1, clone 1).
5'TCGGAGAAAAGAACCAAGCTTTATTAGTTTCAGGTTTAGGTGAGTGAACTC
CAAGGGTGGCACAGAAATCTTAGGACACGTACTGAAAGAGAAAAAAAAAT
CTGCAAGGAGGTAAGAGGAGATAATGCTTTGCGTAATTACCGGCCCAGGAT
GTGTTCCTTGTCTATCCTTTTTAGCCCAGTGCGCATTTTTAAGGAAGGCTTTG
GAGTGTTTTAGCGATAATGACAAGGAACAATGTAAACTAACCCGCCCTCCT
ATAGATTTCCTAGTCTCAGTCAGCAAAACATCTTGACTAATCCACCGAAAGG
AAGCCAAGCAGTCTTTGAAGCGAAGGTAATGTGTTAACTTTGACCTGACTCA
GAGAAACGCCATCTTCAACTCTCTGAGGGGCATCTGGGCATTCCCAGGCGT
AGGCGCCTTC3' (SEQ ID NO:2)
[0069] [0070] Table 4 CFTR/AI805947 putative shared promoter (in orientation driving CFTR expression, reverse for AI805947 putative promoter orientation) that was cloned into pcDNA3.1+ (AI805-2, clone 2).
[0071] 5'CTTTTCTCCGACACGCAAAGGAAGCGCTAAGGTAAATGCATCAG
ACCCACACTGCCGCGGAACTTTTCGGCTCTCTAAGGCTGTATTTTGATATAC
GAAAGGCACATTTTCCTTCCCTTTTCAAAATGCACCTTGCAAACGTAACAGG
AACCCGACTAGGATCATCGGGAAAAGGAGGAGGAGGAGGAAGGCAGGCTC
CGGGGAAGCTGGTGGCAGCGGGTCCTGGGTCTGGCGGACCCTGACGCGAAG
GAGGGTCTAGGAAGCTCTCCGGGGAGCCGGTTCTCCCGCCGGTGGCTTCTTC
TGTCCTCCAGCGTTGCCAACTGGACCTAAAGAGAGGCCGCGACTGTCGCCC
ACCTGCGGGATGGGCCTGGTGCTGGGCGGTAAGGACACGGACCTGGAAGG
AGCGCGCGCGAGGGAGGGAGGCTGGGAGTCAGAATCGGGAAAGGGAGGT
GCGGGGCGGCGAGGGAGCGAAGGAGGAGAGGAGGAAGGAGCGGGAGGGG
TGCTGGCGGGGGTGCGTAGTGGGTGGAGAAAGCCGCTAGAGCAAATTTGGG
GCCGGACCAGGCAGCACTCGGCTTTTAACCTGGGCAGTGAAGGCGGGGGA
AAGAGCAAAAGGAAGGGGTGGTGTGCGGAGTAGGGGTGGGTGGGGGGAAT
TGGAAGC3' (SEQ ID NO:3)
[0072] Table 5 Mass spec Identified proteins associated with BG213071.
Figure imgf000028_0001
[0073] Table 6 Biotin linked antisense oligonucleotides (5' linked) for BG210371. >BGas_Biol
5'gccagcacaagaatccctca3' (SEQ ID NO:4) >BGas_Bio2 4'ccaaatgcaaacattcatgattc3' (SEQ ID NO:5)
* # *
[0074] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
[0075] All publications, GenBank sequences, ATCC deposits, patents and patent applications cited herein are hereby expressly incorporated by reference in their entirety and for all purposes as if each is individually so denoted.

Claims

WE CLAIM:
1. A method for enhancing expression or cellular level of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell, comprising contacting the cell with an agent that specifically disrupts or downregulates CFTR associated long non-coding RNA (lncRNA) BG213071 and/or AI805947, thereby enhancing CFTR expression in the cell.
2. The method of claim 1 , wherein the cell is an epithelial cell.
3. The method of claim 1, wherein the cell is an epithelial cell present in the lung, pancreas, liver, or intestine.
4. The method of claim 1, wherein the cell is an epithelial cell present in a subject afflicted with cystic fibrosis.
5. The method of claim 1, wherein the agent inhibits expression of BG213071 and/or AI805947.
6. The method of claim 1 , wherein the agent binds to BG213071 and/or AI805947.
7. The method of claim 1, wherein the agent inhibits expression of a BG213071 associated protein.
8. The method of claim 7, wherein the BG213071 associated protein is HMGA1 , HMGN2, HMGB 1 or WIBG.
9. The method of claim 1, wherein the agent is an antisense nucleic acid, an siRNA, or an shRNA.
10. The method of claim 9, wherein the agent is an antisense RNA shown in Figure 4B.
11. The method of claim 9, wherein the agent is a nucleic acid molecule comprising a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l , SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5, and 59-69; or (3) at least 10 contiguous residues of an antisense RNA shown in Figure 4B.
12. A method for treating or ameliorating symptoms of cystic fibrosis in a subject, comprising administering to the subject a pharmaceutical composition comprising an agent that specifically disrupts or downregulates CFTR associated long non-coding RNA (IncRNA) BG213071 and/or AI805947, thereby treating or ameliorating symptoms of cystic fibrosis in a subject.
13. The method of claim 12, wherein the agent inhibits expression of BG213071 and/or AI805947.
14. The method of claim 12, wherein the agent binds to BG213071 and/or AI805947.
15. The method of claim 12, wherein the agent inhibits expression of a BG213071 associated protein.
16. The method of claim 15, wherein the BG213071 associated protein is HMGA1, HMGN2, HMGB 1 or WIBG.
17. The method of claim 12, wherein the agent is an antisense nucleic acid, an siRNA, or an shRNA.
18. The method of claim 17, wherein the agent is an antisense RNA shown in Figure 4B.
19. The method of claim 17, wherein the agent is a nucleic acid molecule comprising a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: 1, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any of SEQ ID N0s:4, 5, and 59-69; or (3) at least 10 contiguous residues of an antisense RNA shown in Figure 4B.
20. A nucleic acid molecule comprising a sequence that is substantially identical or complementary to (1) at least 10 contiguous residues shown in SEQ ID NO: l, SEQ ID NO:2, or SEQ ID NO:3; (2) at least 10 contiguous residues shown in any one of SEQ ID NOs:4, 5 and 59-69; or (3) at least 10 contiguous residues of an antisense RNA shown in Figure 4B.
21. The nucleic acid molecule of claim 20, which can disrupt or downregulate CFTR associated antisense long non-coding RNA (IncRNA) BG213071 and/or AI805947.
22. The nucleic acid molecule of claim 20, comprising a sequence that is substantially identical to the sequence shown in any one of SEQ ID NOs:4, 5 and 59-69, or a fragment thereof.
23. The nucleic acid molecule of claim 22, which can disrupt or downregulate CFTR associated long non-coding RNA (IncRNA) BG213071.
24. The nucleic acid molecule of claim 22, comprising a sequence shown in any one of SEQ ID NOs:4, 5 and 59-69, or a functional fragment thereof.
25. The nucleic acid molecule of claim 20, comprising a sequence that is identical to an antisense RNA shown in Figure 4B or a functional fragment thereof.
PCT/US2015/031995 2014-05-23 2015-05-21 Specific targeted activation of cystic fibrosis transmembrane conductance regulator (cftr) Ceased WO2015179656A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462002462P 2014-05-23 2014-05-23
US62/002,462 2014-05-23

Publications (2)

Publication Number Publication Date
WO2015179656A2 true WO2015179656A2 (en) 2015-11-26
WO2015179656A3 WO2015179656A3 (en) 2016-01-14

Family

ID=54554972

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/031995 Ceased WO2015179656A2 (en) 2014-05-23 2015-05-21 Specific targeted activation of cystic fibrosis transmembrane conductance regulator (cftr)

Country Status (1)

Country Link
WO (1) WO2015179656A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017027814A1 (en) * 2015-08-13 2017-02-16 Arcturus Therapeutics, Inc. Una oligomeric agents for stimulating cystic fibrosis transmembrane conductance regulator and uses thereof
WO2022008557A3 (en) * 2020-07-08 2022-02-17 UCB Biopharma SRL Modulation of cftr expression

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7374927B2 (en) * 2004-05-03 2008-05-20 Affymetrix, Inc. Methods of analysis of degraded nucleic acid samples
US9161995B2 (en) * 2011-07-25 2015-10-20 Sangamo Biosciences, Inc. Methods and compositions for alteration of a cystic fibrosis transmembrane conductance regulator (CFTR) gene
EP2850183A4 (en) * 2012-05-16 2016-02-10 Rana Therapeutics Inc COMPOSITIONS AND METHODS FOR MODULATING GENE EXPRESSION

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017027814A1 (en) * 2015-08-13 2017-02-16 Arcturus Therapeutics, Inc. Una oligomeric agents for stimulating cystic fibrosis transmembrane conductance regulator and uses thereof
WO2022008557A3 (en) * 2020-07-08 2022-02-17 UCB Biopharma SRL Modulation of cftr expression

Also Published As

Publication number Publication date
WO2015179656A3 (en) 2016-01-14

Similar Documents

Publication Publication Date Title
JP2019534298A5 (en)
Deng et al. DNA methyltransferase 1 (DNMT1) suppresses mitophagy and aggravates heart failure via the microRNA-152-3p/ETS1/RhoH axis
Saayman et al. Long non-coding RNA BGas regulates the cystic fibrosis transmembrane conductance regulator
JP2017518764A (en) Multi-targeted RNAi for the treatment of cancer
WO2015084254A1 (en) Tailed Mirtron Effectors For RNAi-Mediated Gene Silencing
JP7332585B2 (en) Inhibitor for use in preventing and/or treating hepatitis B virus infection
US20230174958A1 (en) Crispr-inhibition for facioscapulohumeral muscular dystrophy
Wang et al. Tumor‐suppressive miR‐145 co‐repressed by TCF4‐β‐catenin and PRC2 complexes forms double‐negative regulation loops with its negative regulators in colorectal cancer
Fang et al. Circular RNA-circPan3 attenuates cardiac hypertrophy via miR-320-3p/HSP20 axis
WO2017223268A1 (en) COMPOSITIONS AND METHODS OF RESENSITIZING CELLS TO BROMODOMAIN AND EXTRATERMINAL DOMAIN PROTEIN INHIBITORS (BETi)
WO2014049125A1 (en) Nucleotide sequence motifs directing nucleic acid location to extracellular vesicles
Chu et al. CDK6 inhibition targeted by miR-378a-3p protects against intestinal injury induced by ionizing radiation
CN114901835B (en) Compositions containing MIR-335
JP7664233B2 (en) Treatment
JP6508716B2 (en) Cisplatin resistance marker for bladder cancer cells and use thereof
CN105695562B (en) Use of MST4 gene diagnosis and cell therapy for infectious diseases and related drugs
JP2025541838A (en) Sirtuin 6 variants for the treatment of nonalcoholic fatty liver disease
US20150152421A1 (en) Hexim-1 as a target of leptin signaling to regulate obesity and diabetes
US8575330B2 (en) MicroRNA-based short hairpin RNA for gene knockdown of NR1 subunit of N-methyl-D-aspartate receptor and its application on pharmaceutics
Irimura et al. HnRNP C1/C2 may regulate exon 7 splicing in the spinal muscular atrophy gene SMN1
WO2017084610A1 (en) Application of mir-183 or inhibitor thereof
Li et al. Suppression of endothelial nitric oxide synthase expression and endothelial cell proliferation by an intronic 27-ntmiRNA and it’sa novel link to AP-1
US20250228885A1 (en) Compositions and methods for treating liver diseases with sirnas targeting gpam
EP3263706A1 (en) Agents targeting snat7 for treating cellular metabolism reprogramming-associated diseases
US20250326783A1 (en) Discovery of a uridine rna modification and a proposed biosynthesis pathway

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15796586

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15796586

Country of ref document: EP

Kind code of ref document: A2