WO2015168534A1

WO2015168534A1 - Therapeutic treatment of gastrointestinal microbial imbalances through competitive microbe displacement

Info

Publication number: WO2015168534A1
Application number: PCT/US2015/028767
Authority: WO
Inventors: Colin R. South
Original assignee: Novogy, Inc.
Priority date: 2014-05-02
Filing date: 2015-05-01
Publication date: 2015-11-05

Abstract

Disclosed are genetically-engineered bacteria and other organisms thai have die ability to metabolize atypical sources of nitrogen, phosphorous, and sulfur. These organisms may be used to populate the gastrointestinal ("GI") tract of a subject or to displace other organisms from the GI tract. Specifically, the genetically-engineered organisms can be administered to a subject along with a functional food containing one or more atypical sources of nitrogen, phosphorous, or sulfur, which provides a selective advantage for the genetically-engineered organisms. The methods of the invention have a variety of uses, and they are particuiariy useful in creating bacterial infections of the GI tract, such as Clostridium difficile infections.

Description

Therapeutic Treatment of Gastrointestinal Microbial

Imbalances Through Competitive Microbe Displacement

PRIORITY CLAIM

This application claims the benefit of priority to U.S. Provisional Patent Application No. 61/987,702, filed May 2, 2014; and U.S. Provisional Patent Application No.

62/013,201 , filed June 17, 2014.

BACKGROUND

The human digestive tract contains a diverse population of beneficial and harm ul bacteria, with over 400 different bacterial species in the intestine alone. This diverse intestinal microflora plays a substantial role in regulating the intestinal barrier defense mechanism, and it effectively comprises approximately 80% of our immune system.

Ongoing research continues to support the theory that a finely-tuned microbial balance in the intestine greatly enhances an individual's general health and immune system compared to individuals lacking such balance.

A healthy population of beneficial, mutualistic, and/or commensal microorganisms in the digestive tract plays a substantial role in maintaining the health and welfare of humans and animals. Such microorganisms benefit their hosts in many ways: through competition with pathogenic microorganisms, aiding in digestion and the absorption of food, vitamin and cofactor synthesis, and regulating immune responses. Therefore, healthy individuals possess a robust collection of beneficial microorganisms in their digestive systems, which aids them in maintaining a disease free state and further contributes to their overall well-being.

However, over the course of an ordinary lifetime, disruptive events can lead to an imbalance in the ecology of the digestive tract. Such disruptive events include illnesses caused by exposure to bacteria, viruses, and other organisms; exposure to certain pharmaceuticals, including antibiotics; exposure to high levels of mental, physical, or emotional stress, including surgery or travel; and poor nutrition or malnutrition. In addition, as individuals age, the stability of this delicate balance of intestinal flora declines, which can lead to an unhealthy imbalance that may weaken the immune system and give rise to the possibility of infection, inflammation, autoimmune dysfunction, and other downstream effects. Broad-spectrum antibiotics can disrupt the balance of bacteria in the gastrointestinal tract ("GI tract") and allow harmful bacteria to rcpopulatc the gut. In particular,

Clostridium difficile has become a growing problem in modern medical facilities. C.

difficile went relatively unnoticed until the wide usage of broad-spectrum antibiotic agents, such as lincomycin and clindamycin. These antibiotics cause diarrhea in approximately 10% of the patients and pseudomembranous colitis in approximately 1%. C. difficile is the main culprit, and it is responsible for 15-25% of all cases of antibiotic-associated diarrhea and virtually all cases of pseudomembranous colitis. Most patients with C. difficile infections can be treated with vancomycin, bacitracin, or metronidazole, but relapses occur in about 10-20% of cases. Thus, alternative treatments arc necessary for some patients to restore healthy bacteria to the gut.

Recent clinical trials indicate that fecal microbial transplants may be effective at treating antibiotic-associated diarrhea, generally, and C. difficile infections, specifically (see, e.g., Pctrof et al., Microbiome 1:3 (2013)). This strategy involves rcpopulating the gut using fecal microbial transplants where cither harvested "healthy" fecal material or a cocktail of cultured microbial strains arc reintroduced into the patient's colon. Successful treatments have been described for patients who underwent a colonoscopy in which transplant bacteria was drizzled throughout the cecum, proximal ascending colon, and transverse colon. In contrast, oral administration has proven ineffective (see, e.g., Lancet 382: 1249-57 (2013)).

The colonoscopy approach to populating the GI tract with healthy bacteria has limited utility: it has not progressed significantly beyond pilot studies, it is inherently tedious, time-consuming, and expensive, it presents a risk of harm, and thus, it is not tolerated by all patients, and it is not practical for treating mild conditions or for prophylactic use. Therefore, a means to populate the GI tract with transplant bacteria that docs not require a colonoscopy would prove advantageous.

Escherichia coli is a mainstay organism for manufacturing therapeutic proteins, such as insulin and monoclonal antibodies. Often, the therapeutic protein is expressed via a strongly inducible promoter on a multi-copy plasmid; this arrangement allows bioproccsscs to reach high protein titers, which is valuable for efficient use of capital and downstream purification operations.

High-copy plasmid production may also be used in the generation of DNA vaccines, which are cultivated in E. coli prior to purification and delivery as a human or animal vaccine. However, in order to maintain during fermentation genetically unstable plasmids an antibiotic, such as kanamycin, is added to the fermentation broth, and a complimentary antibiotic resistance marker is designed into the plasmid. E. colt cells harboring the plasmid have antibiotic resistance and are able to proliferate, while those that have lost the plasmid arc susceptible to the antibiotic and arc unable to multiply.

Although it allows for reliable manufacture of high titer plasmid DNA in E. co/i, the presence of an antibiotic or antibiotic resistance marker is problematic for a product destined for application in humans because of the associated risk of enabling antibiotic- resistant bacteria to colonize humans.

There exists a need for an alternative to the use of antibiotic resistance markers in E. coli, so that the organisms can effectively and efficiently produce pharmaceutical products while minimizing the risk of fostering antibiotic resistance in humans.

SUMMARY

Disclosed arc genetically-engineered bacteria and other organisms that have the ability to metabolize atypical sources of nitrogen, phosphorous, and sulfur. These organisms may be used to populate the gastrointestinal ("GI") tract of a subject and to displace other organisms from the Gl tract. Specifically, the genetically-engineered organisms and a functional food containing one or more atypical sources of nitrogen, phosphorous, or sulfur may be administered to a subject to provide a selective advantage for the genetically-engineered organisms. The methods of the invention have a variety of uses, and they arc particularly useful in treating bacterial infections of the Gl tract, such as Clostridium difficile infections.

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a phosphorus source or a sulfur source that otherwise would not have been accessible to the native organism; and the enzyme is phosphite dehydrogenase, hypophosphitc dehydrogenase, phosphonoacctatc hydratasc, glyccrol-3- phosphate dehydrogenase (sn-glycerol 3-phosphate: NAD(+) oxidoreductase, EC 1.1.1.8), glyccraIdehyde-3-phosphatc dehydrogenase, an organophosphatc degradation enzyme, a phosphodiesterase, a phospholipasc, dcsulfurization enzyme, a dibcnzothiophcnc-5,5- dioxide monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, or a NADH-FMN oxidorcductasc; and

(ii) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to produce a pharmaceutical product.

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a nitrogen source that otherwise would not have been accessible to the native organism; and the enzyme is allophanate hydrolase, biuret amidohydrolasc, cyanuric acid amidohydrolasc, guanine deaminase, ammclinc hydrolase, ammelide hydrolyase, melamine deaminase, isopropylammelide isopropylaminohydrolase, cyanamidc hydratasc, urease, or urea carboxylase; and

In certain embodiments, the invention relates to a genetically engineered E. coli, wherein the genetically engineered E. coli has been transformed by a nucleic acid molecule, wherein

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a phosphorus source or a sulfur source that otherwise would not have been accessible to the native organism; and the enzyme is phosphite dehydrogenase, hypophosphitc dehydrogenase, phosphonoacctatc hydratasc, glycerol phosphate dehydrogenase (sn-glycerol 3-phosphate: NAD(+) oxidorcductasc, EC 1.1.1.8), glyccraldchydc-3-phosphatc dehydrogenase, an organophosphatc degradation enzyme, a phosphodiesterase, a phospholipasc, dcsulfurization enzyme, a dibcnzothiophcne-5,5- dioxide monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, or a NADH-FMN oxidorcductasc; and

(ii) the nucleic acid molecule encodes a heterologous enzyme that provides /^". coli with the ability to produce a pharmaceutical product.

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a nitrogen source that otherwise would not have been accessible to the native organism; and the enzyme is allophanatc hydrolase, biuret amidohydrolasc, cyanuric acid amidohydrolasc, guanine deaminase, ammclinc hydrolase, ammelide hydro lyase, melamine deaminase, isopropylammelide isopropylaminohydrolase, cyanamidc hydratase, urease, or urea carboxylase; and

In certain embodiments, the invention relates to a method for producing a recombinant E. coli cell, the method comprising the steps of:

a) introducing into the E. coli cell a recombinant D A construct comprising i. a first heterologous polynucleotide that encodes a first heterologous enzyme that provides the cell with the ability to assimilate a phosphorus source, a nitrogen source, or a sulfur source that otherwise would not have been accessible to the host cell; and ii. a second heterologous polynucclotidc that encodes a second heterologous enzyme that provides the organism with the ability to produce a pharmaceutical product;

b) expressing the first heterologous enzyme; and

c) cultivating the E. coli cell.

In certain embodiments, the invention relates to a method, comprising the step of contacting with a substrate any of the genetically engineered E. coli described herein,

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of phosphorus-containing compounds;

the second fraction comprises, in an amount from about 10% by weight to about 100% by weight, a phosphorus-containing compound selected from the group consisting of: a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctatc ester, a mcthylphosphonatc ester, a mcthylphosphonatc salt, phosphonoacetaldehyde, hypophosphite, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, diethyl phosphate, trimethyl phosphate, dimethyl phosphate, diethyl phosphite, tricthyl phosphite, trimethyl phosphite, dimethyl phosphite, glyphosatc, Ο,Ο,Ο-tricthyl phosphorothioatc, etidronate, ctidronic acid, methylene diphosphonatc, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zolcdronic acid, oxidronatc, and oxidronic acid; and

the genetically engineered coli converts the substrate to a product.

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of nitrogen-containing compounds;

the second fraction comprises, in an amount from about 10% by weight to about 100% by weight, a nitrogen-containing compound selected from the group consisting of triazinc, urea, mclaminc, cyanamidc, 2-cyanoguanidinc, ammelinc, guanidinc carbonate, cthylcncdiaminc, ammclidc, biuret, dicthylcnctriaminc, tricthylcnctctraminc, 1 ,3- diaminopropanc, calcium cyanamidc, cyanuric acid, aminoethylpipcrazinc, piperazine, and allophantc; and

the genetically engineered E. coli converts the substrate to a product.

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of sulfur-containing compounds;

the sulfur-containing fraction comprises, in an amount from about 10% by weight to about 100% by weight, a sulfur-containing compound selected from the group consisting of dimcthylsulfoxidc, dibenzothiophene, cthancthiol, dimcrcaptosuccinatc, dimcrcaptosuccinic acid, thioacctatc, thioacctic acid, tcrt-butyl thiol, thiourea, thiocyanatc, sodium thiocyanatc, thioacetamide, isothiazole, benzisothiazolinone, isothiazolinone, methanesulfonate, mcthancsulfonic acid, thioglycerol, metabisulfite, potassium mctabisulfitc, accsulfamc potassium, bcnzcncsulfonatc, bcnzcncsulfonic acid, methyl bcnzcncsulfonatc, cyclamatc, sodium cyclamatc, saccharin, 2,4-dithiapcntanc, dioctyl sodium sulfosuccinatc, mcthylisothiazolinonc, sulfolanc, and mcthylchloroisothiazolinonc; and

the genetically engineered E. coli converts the substrate to a product. BRIEF DESCRIPTION OF THE FIGURES

Figure 1 depicts a schematic representation of the mclamine degradation pathway. 1 - Melamine deaminase (tzrA) (EC 3.5.4.-); 2 - Ammeline deaminase (guanine deaminase) (EC 3.5.4.3); 3 - N-isopropylammelide isopropylamino (Ammelide) hydrolyase (EC 3.5.99.4); 4 - Cyanuric acid hydrolyase (EC 3.5.2.15); 4a - Carboxybiuret decarboxylase, spontaneous reaction; 5 - Biuret amidohydrolasc (EC 3.5. 1.84); 6 - Allophanatc hydrolyase (EC 3.5.1.54). Nitrogen can be assimilated (as NH₃) by the action of the complete pathway acting on mclamine, liberating 6 mol NH₃ per mol mclamine, or via a subset of enzymes acting on pathway intermediates (e.g., steps 4, 4a, 5, and 6 acting on cyanuric acid releasing 3 mol NH₃ per mol cyanuric acid).

Figure 2 depicts a schematic representation of the cyanamidc assimilation pathway.

After conversion of cyanamidc to urea by cyanamidc hydratasc (EC 4.2.1.69), urea can be degraded either via urease (EC 3.5.1.5) or by urea carboxylase (EC 6.3.4.6) and allophanatc hydrolyase (EC 3.5.1.54).

Figures 3 - 10 depict various plasmids of the invention.

Figure 11 depicts the growth progress of NS88 and NS91 (control) in media containing various concentrations of ammonium ion or mclamine.

Figure 12 depicts the growth progress of NS90 and NS91 (control) in media containing various concentrations of ammonium ion or biuret.

Figure 13 depicts images, taken after 48 h, of cultures grown in MOPS media with different nitrogen sources. From left to right: NS88 with 10 mM mclamine; NS 1 with 10 mM mclamine; NS90 with 10 mM biuret (replicate 1 ); NS90 with 1 mM biuret (replicate 2); and NS91 with 10 mM biuret.

Figure 14 depicts the growth of four organisms of the invention (NS91 = control) on 0.25 mM mclamine, as compared to the standard curves for a native organism on NH₄C1. Because melamine has six nitrogen atoms, organisms having the ability to utilize melamine should be approximately six times more efficient (sec, for example, NS110 on 0.25 mM mclamine, as compared to a native organism on 1.5 mM NH₄CI). Figure 15 depicts the growth of four organisms of the invention (NS91 = control) on 0.25 mM ammclinc, as compared to the standard curves for a native organism on NH₄CI. Because ammeline has five nitrogen atoms, organisms having the ability to utilize mclaminc should be approximately five times more efficient (see, for example, NS 110 on 0.25 mM ammclinc, as compared to a native organism on 1.25 mM NH₄CI).

Figure 16 depicts depicts the growth of various organisms of the invention on 0.5 mM NH₄CI. Importantly, the organisms described in Figures 50-52, for example NS 120, NS91 , NS 107, and NS 123, are E. coli strains derived from E. coli I2, E. coli B, E. coli Crooks, and E. coli MG 1655 and are intended to show the breadth of the invention across various strains of E. coli.

Figure 17 depicts the growth of various organisms of the invention on a medium containing no nitrogen.

Figure 18 depicts the growth of various organisms of the invention on a medium containing 0.5 mM mclaminc.

Figure 19 depicts the names and structures of various organophosphorus compounds.

Figure 20 depicts the names and structures of various organosulfur compounds. Figure 21 depicts pVAX l with htxA.

Figure 22 depicts a pET9a vector with a kanamycin resistance gene.

Figure 23 depicts a pET9a vector with htxA gene replacing the kanamycin resistance gene.

Figure 24 tabulates enzymes and related genes involved in the mclaminc degradation pathway. DETAILED DESCRIPTION

Overview

In certain embodiments, the invention relates to a genetically-engineered host organism, wherein the genetically-engineered host organism has a non-native ability to obtain a growth-limiting nutrient from a complex substrate, and the complex substrate could not have been metabolized by the native host organism. In certain embodiments, the non-native ability will provide the organism with a significant competitive advantage, and provide a major barrier to the success harmful microorganisms in populating the gastrointestinal tract. In certain embodiments, the genetically-engineered host organism is a bacterium.

In certain embodiments, the invention relates to a method of using the above- mentioned genetically-engineered host organism, comprising administering a therapeutically effective amount of the organism to a subject in need thereof. Additionally, to provide the selective advantage to the genetically-engineered organism, the method may further comprise administering to the subject a nutritionally effective amount of functional food, wherein the functional food comprises a nitrogen-, phosphorous-, and/or sulfur- containing compound that the genetically-engineered organism can metabolize, but that a native cell of the same species cannot metabolize. In certain embodiments, the above- mentioned methods minimize the growth of harmful organisms and provide a valuable competitive advantage for the genetically-engineered organisms.

In certain embodiments, the invention relates to a functional food comprising a compound, wherein the compound is a nitrogen-containing compound, a phosphorus- containing compound, and/or a sulfur-containing compound, a transformed cell can metabolize the compound, and a native cell of the same species as the transformed cell cannot metabolize said compound. The functional food may optionally comprise one or more transformed cells. In some embodiments, the functional food comprises one or more immunoglobulins.

In certain embodiments, the invention relates to a method of producing a product by using a genetically engineered host organism that has a non-native ability to obtain a growth-limiting element, protein, or other nutrient from a non-natural compound. In certain embodiments, the non-native ability will provide the organism with a significant competitive advantage, e.g., over native organisms.

In certain embodiments, using this approach provides a unique and targeted manner to promote the growth of the desired genetically engineered host organism. In certain embodiments, the above-mentioned methods minimize the growth of contaminant organisms, provide a valuable competitive advantage, and allow management of production of a range of valuable products.

In certain embodiments, the inventive methods decrease or eliminate the need for use of prophylactic antibiotics in large-scale cultures of /:^'. coli. Avoiding unnecessary antibiotics is an important benefit due to emerging environmental considerations and societal pressures. In certain embodiments, the inventive technology is applicable in the production of one or more commodities, fine chemicals, and pharmaceuticals.

Definitions

The articles "a" and "an" arc used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an clement" means one clement or more than one clement.

The term "encode" refers to nucleic acids that comprise a coding region, portion of a coding region, or compliments thereof. Both DNA and RNA may encode a gene. Both DNA and RNA may encode a protein.

The term "enterally" refers to administration into the gastrointestinal tract, including all forms of administration through a feeding tube, such as a nasogastric tube, nasojejunal tube, nasoduodcnal tube, gastric feeding tube, gastrojejunostomy feeding tube, and jejunostomy feeding tube.

The term "gene " as used herein, may encompass genomic sequences that contain introns, particularly polynucleotide sequences encoding polypeptide sequences involved in a specific activity. The term further encompasses synthetic nucleic acids that did not derive from genomic sequence. In certain embodiments, the genes lack introns, as they are synthesized based on the known DNA sequence of cDNA and protein sequence. In other embodiments, the genes arc synthesized, non-native cDNA wherein the codons have been optimized for expression in E. coli or other bacterium based on codon usage. The term can further include nucleic acid molecules comprising upstream, downstream, and/or intron nucleotide sequences.

The term "genetic modification" refers to the result of a transformation. Every transformation causes a genetic modification by definition.

"Inducible promoter" is a promoter that mediates transcription of an opcrably linked gene in response to a particular stimulus.

The term "integrated" refers to a nucleic acid that is maintained in a cell as an insertion into the cell's genome, such as insertion into a chromosome, including insertions into a plastid genome.

The terms "operable linkage" or "in operable linkage" mean a functional linkage between two nucleic acid sequences, such a control sequence (typically a promoter) and the linked sequence (typically a sequence that encodes a protein, also called a coding sequence). A promoter is in operable linkage with a gene if it can mediate transcription of the genc.

The term "native" refers to the composition of a cell or parent cell prior to a transformation event.

The term "nucleic acid' refers to a polymeric form of nucleotides of any length, cither dcoxyribonuclcotidcs or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function. The following arc non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. A polynucleotide may be further modified, such as by conjugation with a labeling component. In all nucleic acid sequences provided herein, U nucleotides arc

interchangeable with T nucleotides.

The term "parent cell'' refers to every cell from which a cell descended. A cell's genome is comprised of the parent cell's genome and any subsequent genetic modifications to the parent cell's genome.

As used herein, the term "plasmid" refers to a circular DNA molecule that is physically separate from an organism's genomic DNA. Plasmids may be linearized before being introduced into a host cell (referred to herein as a linearized plasmid). Linearized plasmids may not be sclf-rcplicating, but may integrate into and be replicated with the genomic DNA of an organism.

A "promoter" is a nucleic acid control sequence that directs transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.

"Recombinant" refers to a cell, nucleic acid, protein, or vector, which has been modified due to the introduction of an exogenous nucleic acid or the alteration of a native nucleic acid. Thus, e.g., recombinant cells can express genes that arc not found within the native (non-rccombinant) form of the cell or express native genes differently than those genes arc expressed by a non-rccombinant cell. Recombinant cells can, without limitation, include recombinant nucleic acids that encode for a gene product or for suppression elements such as mutations, knockouts, antisense, interfering R A (RNAi), or dsRNA that reduce the levels of active gene product in a cell. A "recombinant nucleic acid" is a nucleic acid originally formed in vitro, in general, by the manipulation of nucleic acid, e.g., using polymerases, ligascs, cxonuclcascs, and cndonuclcascs, or otherwise is in a form not normally found in nature. Recombinant nucleic acids may be produced, for example, to place two or more nucleic acids in operable linkage. Thus, an isolated nucleic acid or an expression vector formed in vitro by ligating DNA molecules that are not normally joined in nature, arc both considered recombinant for the purposes of this invention. Once a recombinant nucleic acid is made and introduced into a host cell or organism, it may replicate using the in vivo cellular machinery of the host cell; however, such nucleic acids, once produced recombinantly, although subsequently replicated intraccllularly, arc still considered recombinant for purposes of this invention. Similarly, a "recombinant protein" is a protein made using recombinant techniques, i.e., through the expression of a recombinant nucleic acid.

" Transformation" refers to the transfer of a nucleic acid into a host organism or the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments arc referred to as "recombinant", "transgenic" or "transformed" organisms. Thus, isolated polynucleotides of the present invention can be incorporated into recombinant constructs, typically DNA constructs, capable of introduction into and replication in a host cell. Such a construct can be a vector that includes a replication system and sequences that arc capable of transcription and translation of a polypeptide-cncoding sequence in a given host cell. Typically, expression vectors include, for example, one or more cloned genes under the transcriptional control of 5' and 3' regulatory sequences and a selectable marker. Such vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or dcvclopmcntally-rcgulatcd, or location-specific expression), a transcription initiation start site, a ribosomc binding site, a transcription termination site, and/or a polyadenylation signal.

The term "transformed celF refers to a cell that has undergone a transformation. Thus, a transformed cell comprises the parent's genome and an inheritable genetic modification. The term "vector" refers to the means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include plasmids, linear DNA fragments, viruses, bacteriophage, pro-viruses, phagemids, transposons, and artificial chromosomes, and the like, that may or may not be able to replicate autonomously or integrate into a chromosome of a host cell.

As used herein, a "biologically active portion" may refer to a fragment of a protein having a specific biological activity. Biologically active portions include peptides or polypeptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the protein. Typically, biologically active portions comprise a domain or motif having the desired catalytic activity.

The term "domain", as used herein, refers to a set of amino acids conserved at specific positions along an alignment of sequences of cvolutionarily related proteins. While amino acids at other positions can vary between homologucs, amino acids that arc highly conserved at specific positions indicate amino acids which arc likely to be essential in the structure, stability or unction of a protein. Identified by their high degree of conservation in aligned sequences of a family of protein homologucs, they can be used as identifiers to determine if any polypeptide in question belongs to a previously identified polypeptide family.

"Exogenous gene" is a nucleic acid that codes for the expression of an RNA and or protein that has been introduced into a cell (e.g., by transformation/transfection), and is also referred to as a "transgenc." A cell comprising an exogenous gene may be referred to as a recombinant cell, into which additional exogenous gene(s) may be introduced. The exogenous gene may be from a different species (and so heterologous), or from the same species (and so homologous), relative to the cell being transformed. Thus, an exogenous gene can include a homologous gene that occupies a different location in the genome of the cell or is under different control, relative to the endogenous copy of the gene. An exogenous gene may be present in more than one copy in the cell. An exogenous gene may be maintained in a cell as an insertion into the genome (nuclear or plastid) or as an cpisomal molecule.

"Expression vector" or "expression construct" or "plasmid" or "recombinant DNA construct" is a vehicle for introducing a nucleic acid into a host cell. The nucleic acid can be one that has been generated via human intervention, including by recombinant means or direct chemical synthesis, with a scries of specified nucleic acid elements that permit transcription and/or translation of a particular nucleic acid. The expression vector can be part of a plasmid, virus, or nucleic acid fragment, or other suitable vehicle. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.

The term "heterologous," as used herein, refers to a polynucleotide or polypeptide which is different from the host cell in which the polynucleotide is introduced or polypeptide is produced. For example, an isolated host cell of the present invention is generated by introducing a polynucleotide from one genus into a host cell which has a different genus from the polynucleotide. The polynucleotide may be synthetic or from a different species, so long as the polynucleotide is non-native to the host cell.

The term "host cell", as used herein, includes any cell type which is susceptible to transformation, transfection, transduction, expression and the like with a nucleic acid construct or expression vector comprising and/or consisting of a heterologous polynucleotide of the present invention. In certain embodiments, the host cell comprises E. coli.

The term "homologucs", as used herein, refers to a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived.

"Isolated" means altered "by the hand of man" from the natural state. If a composition or substance occurs in nature, it has been "isolated" if it has been changed or removed from its original environment, or both.

"Lysatc" is a solution containing the contents of lysed cells.

"Lysis" is the breakage of the plasma membrane and optionally the cell wall of a biological organism sufficient to release at least some intracellular content, often by mechanical, viral or osmotic mechanisms that compromise its integrity.

"Lysing" is disrupting the cellular membrane and optionally the cell wall of a biological organism or cell sufficient to release at least some intracellular content.

The term "motif, as used herein, refers to a short conserved region in the sequence of cvolutionarily related proteins. Motifs arc frequently highly conserved parts of domains, but may also include only part of the domain, or be located outside of conserved domain (if all of the amino acids of the motif fall outside of a defined domain).

Specialist databases exist for the identification of domains, for example, SMART (Schultz et al. ( 1998) Proc. Natl. Acad. Sci. USA 95, 5857-5864; Lctunic et al. (2002) Nucleic Acids Res 30, 242-244), IntcrPro (Mulder ct al., (2003) Nucl. Acids. Res. 3 1 , 3 15- 3 18), Prositc (Buchcr and Bairoch ( 1994), A generalized profile syntax for biomolccular sequences motifs and its function in automatic sequence interpretation. (In) 1SMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Scarls D., Eds., pp53-61 , AAAI Press, Mcnlo Park; Hulo ct al., Nucl. Acids. Res. 32:D 134-D 137, (2004)), or Pfam (Batcman ct al., Nucleic Acids Research 30( 1 ): 276-280 (2002)). A set of tools for in silico analysis of protein sequences is available on the ExPASy proteomics server (Swiss Institute of Bioinformatics (Gasteiger et al., ExPASy: The Proteomics Server for In-Depth Protein Knowledge and Analysis, Nucleic Acids Res. 3 1 :3784-3788(2003)). Domains or motifs may also be identified using routine techniques, such as by sequence alignment.

The term "nucleic acid construct" or "DNA construct" is sometimes used to refer to a coding sequence or sequences opcrably linked to appropriate regulatory sequences and inserted into a vector for transforming a cell. This term may be used interchangeably with the term "transforming DNA" or "transgenc."

"Osmotic shock" is the rupture of cells in a solution following a sudden reduction in osmotic pressure. Osmotic shock is sometimes induced to release cellular components of such cells into a solution.

As used herein, a "polynucleotide" is a nucleotide sequence such as a full-length or nucleic acid fragment. A polynucleotide may be a polymer of RNA or DNA that is single- or double-stranded, that optionally contains synthetic, non-natural or altered nucleotide bases. A polynucleotide in the form of a polymer of DNA may comprise and/or consist of one or more segments of cDNA, genomic DNA, synthetic DNA, or mixtures/combination thereof.

"Promoter" is a nucleic acid control sequence that directs transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.

"Sonication" is a process of disrupting biological materials, such as a cell, by use of sound wave energy. Microbe Eneineering

A. Overview

Genes and gene products may be introduced into microbial host cells. Suitable host cells for expression of the genes and nucleic acid molecules are microbial hosts that can be found broadly within the bacterial families. Examples of suitable host strains include but are not limited to bacterial species, including species of Acidaminococcus, Bacillus, Bacteroides, Bifidobacterium, Blauta, Clostridium, Collinsella, Dorea, Escherichia, Eubacterium, Faecalibacterium, Lachnospira, Iaclobacillus, Listeria, Parabacteroides, RaouUella, Roseburia, Ruminococcus, Saccharomyces, and Streptococcus.

Additional examples of suitable host strains include but arc not limited to fungal or yeast species, such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Candida, Hansenula, Kluyveromyces, or bacterial species, such as member of the protcobactcria and actinomycetcs as well as the specific genera Acinetobacter, Arthrobacter, Brevibacterium, Acidovorax, Bacillus, Clostridia, Streptomyces, Escherichia, Salmonella, Pseudomonas, and Cornyebacteritim. E. coli is well-suited to use as the host microorganism in the invention fermentative processes.

Microbial expression systems and expression vectors containing regulatory sequences that direct high level expression of foreign proteins are known to those skilled in the art. Any of these could be used to construct chimeric genes to produce any one of the gene products of the instant sequences. These chimeric genes could then be introduced into appropriate microorganisms via transformation techniques to provide high-level expression of the enzymes.

For example, a gene encoding an enzyme can be cloned in a suitable plasmid, and the aforementioned starting parent strain as a host can be transformed with the resulting plasmid. This approach can increase the copy number of each of the genes encoding the enzymes and, as a result, the activities of the enzymes can be increased. The plasmid is not particularly limited so long as it renders a desired gene inheritable to the microorganism's progeny.

Vectors or cassettes useful for the transformation of suitable host cells arc well known in the art. Typically the vector or cassette contains sequences directing transcription and translation of the relevant gene, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene harboring transcriptional initiation controls and a region 3' of the DNA fragment which controls transcriptional termination. It is preferred when both control regions arc derived from genes homologous to the transformed host cell, although it is to be understood that such control regions need not be derived from the genes native to the specific species chosen as a production host.

Promoters, cDNAs, and 3'UTRs, as well as other elements of the vectors, can be generated through cloning techniques using fragments isolated from native sources (Green & Sambrook, Molecular Cloning: A Laboratory Manual. (4th ed., 2012); U.S. Patent No. 4,683,202; incorporated by reference). Alternatively, elements can be generated synthetically using known methods (Gene 764:49-53 ( 1995)).

B. Vectors and Vector Components

Vectors for transformation of microorganisms in accordance with the present invention can be prepared by known techniques familiar to those skilled in the art in view of the disclosure herein. A vector typically contains one or more genes, in which each gene codes for the expression of a desired product (the gene product) and is opcrably linked to one or more control sequences that regulate gene expression or target the gene product to a particular location in the recombinant cell.

This subsection is divided into subsections. Subsection 1 describes control sequences typically contained on vectors as well as novel control sequences provided by the present invention. Subsection 2 describes genes typically contained in vectors as well as novel codon optimization methods and genes prepared using them provided by the invention.

1. Control Sequences

Control sequences arc nucleic acids that regulate the expression of a coding sequence or direct a gene product to a particular location in or outside a cell. Control sequences that regulate expression include, for example, promoters that regulate transcription of a coding sequence and terminators that terminate transcription of a coding sequence. Another control sequence is a 3' untranslated sequence located at the end of a coding sequence that encodes a polyadenylation signal. Control sequences that direct gene products to particular locations include those that encode signal peptides, which direct the protein to which they are attached to a particular location in or outside the cell.

Thus, an exemplary vector design for expression of a gene in a microbe contains a coding sequence for a desired gene product (for example, a selectable marker, or an enzyme) in operable linkage with a promoter active in bacteria. Alternatively, if the vector docs not contain a promoter in operable linkage with the coding sequence of interest, the coding sequence can be transformed into the cells such that it becomes opcrably linked to an endogenous promoter at the point of vector integration.

The promoter used to express a gene can be the promoter naturally linked to that gene or a different promoter.

A promoter can generally be characterized as constitutive or inducible. Constitutive promoters are generally active or function to drive expression at all times (or at certain times in the cell life cycle) at the same level. Inducible promoters, conversely, are active (or rendered inactive) or are significantly up- or down-regulated only in response to a stimulus. Both types of promoters find application in the methods of the invention.

Inducible promoters useful in the invention include those that mediate transcription of an opcrably linked gene in response to a stimulus, such as an exogenously provided small molecule, temperature (heat or cold), lack of nitrogen in culture media, etc. Suitable promoters can activate transcription of an essentially silent gene or uprcgulatc, preferably substantially, transcription of an opcrably linked gene that is transcribed at a low level.

Inclusion of termination region control sequence is optional, and if employed, then the choice is primarily one of convenience, as the termination region is relatively interchangeable. The termination region may be native to the transcriptional initiation region (the promoter), may be native to the DNA sequence of interest, or may be obtainable from another source (See, e.g., Chen & Orozco, Nucleic Acids Research 7(5:841 1 ( 1988)).

2. Genes and odon Optimization

Typically, a gene includes a promoter, coding sequence, and termination control sequences. When assembled by recombinant DNA technology, a gene may be termed an expression cassette and may be flanked by restriction sites for convenient insertion into a vector that is used to introduce the recombinant gene into a host cell. The expression cassette can be flanked by DNA sequences from the genome or other nucleic acid target to facilitate stable integration of the expression cassette into the genome by homologous recombination. Alternatively, the vector and its expression cassette may remain unintcgratcd (e.g., an cpisomc), in which case, the vector typically includes an origin of replication, which is capable of providing for replication of the vector DNA.

A common gene present on a vector is a gene that codes for a protein, the expression of which allows the recombinant cell containing the protein to be differentiated rom cells that do not express the protein. Such a gene, and its corresponding gene product, is called a selectable marker or selection marker. Any of a wide variety of selectable markers can be employed in a transgene construct useful for transforming the organisms of the invention.

For optimal expression of a recombinant protein, it is beneficial to employ coding sequences that produce mRNA with codons optimally used by the host cell to be transformed. Thus, proper expression of transgcncs can require that the codon usage of the transgene matches the specific codon bias of the organism in which the transgene is being expressed. The precise mechanisms underlying this effect are many, but include the proper balancing of available aminoacylated tRNA pools with proteins being synthesized in the cell, coupled with more efficient translation of the transgenic messenger RNA (mRNA) when this need is met. When codon usage in the transgene is not optimized, available tRNA pools are not sufficient to allow for efficient translation of the transgenic mRNA resulting in ribosomal stalling and termination and possible instability of the transgenic mRNA.

C. Expression of Two or More Exogenous Genes

Further, a genetically-engineered microorganism may comprise and express more than one exogenous gene. One or more genes can be expressed using an inducible promoter, which allows the relative timing of expression of these genes to be controlled. Expression of the two or more exogenous genes may be under control of the same inducible promoter or under control of different inducible promoters. In the latter situation, expression of a first exogenous gene can be induced for a first period of time (during which expression of a second exogenous gene may or may not be induced) and expression of a second or further exogenous gene can be induced for a second period of time (during which expression of a first exogenous gene may or may not be induced). Provided herein arc vectors and methods for engineering microbes to grow and proliferate on non-traditional growth media and in a subject's GI tract.

D. Transformation

Cells can be transformed by any suitable technique including, e.g., biolistics, clcctroporation, glass bead transformation, and silicon carbide whisker transformation. Any convenient technique for introducing a transgene into a microorganism can be employed in the present invention. Transformation can be achieved by, for example, the method of D. M. Morrison (Methods in Enzymology 68:326 ( 1979)), the method by increasing permeability of recipient cells for DNA with calcium chloride (Mandcl & Higa, J. Molecular Biology, 53: 159 ( 1 70)), or the like. Examples of expression of exogenous genes in bacteria such as coli arc well known (Green & Sambrook, Molecular Cloning: A Laboratory Manual. (4th cd., 2012)).

Vectors for transformation of microorganisms in accordance with the present invention can be prepared by known techniques familiar to those skilled in the art. In one embodiment, an exemplary vector design for expression of a gene in a microorganism contains a gene encoding an enzyme in operable linkage with a promoter active in the microorganism. Alternatively, if the vector does not contain a promoter in operable linkage with the gene of interest, the gene can be transformed into the cells such that it becomes operably linked to a native promoter at the point of vector integration. The vector can also contain a second gene that encodes a protein. Optionally, one or both gcnc(s) is/arc followed by a 3' untranslated sequence containing a polyadenylation signal. Expression cassettes encoding the two genes can be physically linked in the vector or on separate vectors. Co-transformation of microbes can also be used, in which distinct vector molecules arc simultaneously used to transform cells (Protist 755:381-93 (2004)). The transformed cells can be optionally selected based upon the ability to grow in the presence of the antibiotic or other selectable marker under conditions in which cells lacking the resistance cassette would not grow.

E. Homologous Recombination

Homologous recombination is the ability of complementary DNA sequences to align and exchange regions of homology. Transgenic DNA ("donor") containing sequences homologous to the genomic sequences being targeted ("template") is introduced into the organism and then undergoes recombination into the genome at the site of the corresponding genomic homologous sequences.

The ability to carry out homologous recombination in a host organism has many practical implications for what can be carried out at the molecular genetic level and is useful in the generation of a microbe that can produced a desired product. By its very nature homologous recombination is a precise gene targeting event, hence, most transgenic lines generated with the same targeting sequence will be essentially identical in terms of phenotype, necessitating the screening of far fewer transformation events. Homologous recombination also targets gene insertion events into the host chromosome, potentially resulting in excellent genetic stability, even in the absence of genetic selection. Because different chromosomal loci will likely impact gene expression, even from heterologous promotcrs/UTRs, homologous recombination can be a method of querying loci in an unfamiliar genome environment and to assess the impact of these environments on gene expression.

A particularly useful genetic engineering approach using homologous recombination is to co-opt specific host regulatory elements such as promoters/UTRs to drive heterologous gene expression in a highly specific fashion.

Because homologous recombination is a precise gene targeting event, it can be used to precisely modify any nuclcotidc(s) within a gene or region of interest, so long as sufficient flanking regions have been identified. Therefore, homologous recombination can be used as a means to modify regulatory sequences impacting gene expression of RNA and/or proteins. It can also be used to modify protein coding regions in an effort to modify enzyme activities such as substrate specificity, affinities and Km, and thus affecting the desired change in metabolism of the host cell. Homologous recombination provides a powerful means to manipulate the host genome resulting in gene targeting, gene conversion, gene deletion, gene duplication, gene inversion and exchanging gene expression regulatory elements such as promoters, enhancers and 3'UTRs.

Homologous recombination can be achieved by using targeting constructs containing pieces of endogenous sequences to "target" the gene or region of interest within the endogenous host cell genome. Such targeting sequences can either be located 5' of the gene or region of interest, 3' of the genc/rcgion of interest or even flank the genc/rcgion of interest. Such targeting constructs can be transformed into the host cell cither as a supcrcoilcd plasmid DNA with additional vector backbone, a PCR product with no vector backbone, or as a linearized molecule. In some cases, it may be advantageous to first expose the homologous sequences within the transgenic DNA (donor DNA) with a restriction enzyme. This step can increase the recombination efficiency and decrease the occurrence of undesired events. Other methods of increasing recombination efficiency include using PCR to generate transforming transgenic DNA containing linear ends homologous to the genomic sequences being targeted.

I. COMPOSITIONS AND METHODS RELATED TO THE THERAPEUTIC

TREATMENT OF GASTROINTESTINAL MICROBIAL IMBALANCES THROUGH COMPETITIVE MICROBE DISPLACEMENT

Exemplary Isolated Nucleic Acid Molecules and Vectors

I. Enzymes that metabolize nitroeen-containine functional foods

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule encodes an enzyme that provides the organism with the ability to assimilate a nitrogen source that otherwise would not have been accessible to the native organism; and the enzyme is allophanate hydrolase, biuret amidohydrolasc, cyanuric acid amidohydrolasc, guanine deaminase, melaminc deaminase, isopropylammelidc isopropylaminohydrolasc, cyanamidc hydratase, urease, or urea carboxylase.

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of atzF from Pseudomonas sp. strain ADP, DUR 1 ,2 from .S. cerevisiae, YALIOE 07271g from Y. lipolytica CLIB 122, alze from Pseudomonas sp. strain ADP, atzD from Pseudomonas sp. strain ADP, trzD from Pseudomonas sp. strain NRRLB- 12227, atzD from Rhodococcus sp. Mel, trzD from Rhodococcus sp. Mel, guaD from E. coli 12 strain MG1566, blr3880 from Bradyrhizobium japonicu USDA 110, GUD1/Y DL238C from S. cerevisiae, YAL10E2 5740p from Y. lipolytica CLIB122, trzA from Williamsia sp. NRRL B- 15444R, triA from Pseudomonas sp. strain NRRL B- 12227, atzC from Pseudomonas sp. strain ADP, and cah from Myrothecium verrucaria.

In certain embodiments, the invention relates to nucleic acid molecules that encode enzymes that can catalyze steps in the melaminc degradation pathway. In certain embodiments, the invention relates to enzymes that can catalyze steps in the melaminc degradation pathway. In certain embodiments, the invention relates to transformed cells that express enzymes that can catalyze steps in the melaminc degradation pathway.

Table I

DNA and protein sequences encoding the mclaminc degradation pathway.

In certain embodiments, the invention relates to nucleic acid molecules that encode enzymes that can catalyze the conversion of cyanamide to urea, urea to ammonia, urea to allophanate, or allophanate to ammonia. In certain embodiments, the invention relates to enzymes that can catalyze the conversion of cyanamide to urea, urea to ammonia, urea to allophanate, or allophanate to ammonia. In certain embodiments, the invention relates to transformed cells that express enzymes that catalyze the conversion of cyanamidc to urea, urea to ammonia, urea to allophanatc, or allophanatc to ammonia.

2. Enzvmes that metabolize phosphorous- and sulfur- containing fiinctional foods

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule encodes an enzyme that provides the organism with the ability to assimilate a phosphorus source or a sulfur source that otherwise would not have been accessible to the native organism; and the enzyme is glyccrol-3-phosphatc dehydrogenase (sn-glycerol 3-phosphate: NAD(+) oxidoreductase, EC 1.1.1.8), glyccraIdchydc-3-phosphatc dehydrogenase, an organophosphatc degradation enzyme, a phosphodiesterase, a phospholipase, desulfurization enzyme, a dibenzothiophene-5,5- dioxidc monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, or a NADH-FMN oxidoreductase.

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule is selected from the group consisting of Delftia acidoorans phosphodiesterase pdeA, Knterobacter aerogenes updARDE gpdQ, Flavobacteritim opdA without periplasmic leader sequence, Pseudomonas aeruginosa PAO l phoA, Pseudomonas monteilii C11 hoc A, Pseudomonas stutzeri WM88 htxAB DEFHGIJKLMN, Pseudomonas stutzeri WM88 ptxABCDE, Rhodococcus dszD, and Rhodococcus dszABC.

3. Identifying additional enzvmes that metabolize fiinctional foods

Any organism may be used as a source of the non-native gene, as long as the organisms has the desired enzymatic activity. The non-native gene can each be obtained from chromosomal DNA of any one of the aforementioned microorganisms by isolating a DNA fragment complementing auxotrophy of a variant strain lacking the enzymatic activity. Alternatively, if the nucleotide sequence of these gene of the organism has already been elucidated (Biochemistry, 22:5243-49 ( 1983); J. Biochemistry 95:909- 16 ( 1984); Gene 27: 193-99 ( 1984); Microbiology 140: 1817-28 (1994); Molecular Genetics &

Genomics 2/3:330-39 ( 1989); Molecular Microbiology 6:317-26 ( 1992)), the genes can be obtained by PCR using primers synthesized based on each of the elucidated nucleotide sequences and using the chromosome DNA as a template.

Nucleotide sequences may comprise conservative substitutions, deletions, or insertions while still maintaining functional activity. For example, codons may be optimized for a particular host cell, different codons may be substituted for convenience, such as to introduce a restriction site or to create optimal PCR primers, or codons may be substituted for another purpose. Similarly, the nucleotide sequence may be altered to create conservative amino acid substitutions, deletions, and/or insertions. Conservative substitution tables arc well known in the art (Crcighton, Proteins (2d cd., 1992)).

In certain embodiments, the invention relates to gene comprising any one of the nucleotide sequences disclosed herein. In certain embodiments, the invention relates to a gene having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence homology with any one of the nucleotide sequences disclosed herein.

Amino acid substitutions, deletions, and/or insertions may readily be made using recombinant D A manipulation. Methods for the manipulation of DNA sequences to produce substitution, insertion, or deletion variants of a protein arc well known in the art. For example, techniques for making substitution mutations at predetermined sites in DNA arc well known to those skilled in the art and include M 13 mutagenesis, T7-Gcn in vitro mutagenesis (USB, Cleveland, OH), Quick Change Site Directed mutagenesis (Stratagcnc, San Diego, CA), PCR-mcdiatcd site-directed mutagenesis, and other site-directed mutagenesis protocols.

To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences can be aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes can be at least 95% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions can then be compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules arc identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the percent identity between two amino acid sequences can be determined using the Nccdlcman and Wunsch (J. Molecular Biology 48:444-453 ( 1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at

http://www.gcg.com), using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another embodiment, the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of E. Meyers and W. Miller (Computer Applications in the Biosciences 4: 1 1- 17 (1 88)) which has been incorporated into the ALIGN program (version 2.0 or 2.0U), using a PAM120 weight residue tabic, a gap length penalty of 12 and a gap penalty of 4.

Exemplary computer programs which can be used to determine identity between two sequences include, but arc not limited to, the suite of BLAST programs, e.g., BLASTN, MEGABLAST, BLASTX, TBLASTN, TBLASTX, and BLASTP, and Clustal programs, e.g., ClustalW, ClustalX, and Clustal Omega.

Sequence searches are typically carried out using the BLASTN program, when evaluating a given nucleic acid sequence relative to nucleic acid sequences in the GcnBank DNA Sequences and other public databases. The BLASTX program is effective for searching nucleic acid sequences that have been translated in all reading frames against amino acid sequences in the GcnBank Protein Sequences and other public databases.

An alignment of selected sequences in order to determine "% identity" between two or more sequences is performed using for example, the CLUSTAL-W program.

A "coding sequence" or "coding region" refers to a nucleic acid molecule having sequence information necessary to produce a protein product, such as an amino acid or polypeptide, when the sequence is expressed. The coding sequence may comprise and/or consist of untranslated sequences (including introns or 5' or 3' untranslated regions) within translated regions, or may lack such intervening untranslated sequences (e.g., as in cDNA).

The abbreviation used throughout the specification to refer to nucleic acids comprising and/or consisting of nucleotide sequences arc the conventional one-letter abbreviations. Thus when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosinc (C), thymine (T) and uracil (U). Also, unless otherwise specified, the nucleic acid sequences presented herein is the 5'→3* direction.

As used herein, the term "complementary" and derivatives thereof are used in reference to pairing of nucleic acids by the well-known rules that A pairs with T or U and C pairs with G. Complement can be "partial" or "complete". In partial complement, only some of the nucleic acid bases arc matched according to the base pairing rules; while in complete or total complement, all the bases are matched according to the pairing rule. The degree of complement between the nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands as well known in the art. The efficiency and strength of said hybridization depends upon the detection method. Exemplary Genetically-Engineered Organisms

L Organisms that metabolize nitrogen-containing functional foods

In certain embodiments, the invention relates to a genetically-engineered organism, wherein the genetically-engineered organism has been transformed by a nucleic acid molecule; the nucleic acid molecule comprises a non-native gene; and the non-native gene encodes for a non-native enzyme selected from the group consisting of allophanate hydrolase, biuret amidohydrolase, cyanuric acid amidohydrolase, guanine deaminase, ammeline hydrolase, ammelide hydrolyase, melamine deaminase, and isopropylammelide isopropylaminohydrolasc, cyanamidc hydratasc, urease, or urea carboxylase.

In certain embodiments, the invention relates to any one of the aforementioned genetically-engineered organisms, wherein the non-native gene is selected from the group consisting of atzF, DUR 1 ,2 YALIOE 0727 1g, atzE, atzD, trzC trzD, trzE, atzD, guiaD, blr3880, GUD1 Y DL238C, YAL10E2 5740p, trzA, friA, atzC, and can. In certain embodiments, the invention relates to any one of the aforementioned genetically-engineered organisms, wherein the non-native gene is selected from the group consisting of atzF, DUR l ,2 YALIOE 0727lg, atzE, atzD, (rzD, atzD, guaD, blr3880, GUD l Y DL238C, YAL10E2 5740p, trzA, triA, atzC, and cah. Any organism may be used as a source of the non-native gene, as long as the organisms has the desired enzymatic activity The non-native gene can each be obtained from chromosomal DNA of any one of the aforementioned microorganisms by isolating a DNA fragment complementing auxotrophy of a variant strain lacking the enzymatic activity. Alternatively, if the nucleotide sequence of these gene of the organism has already been elucidated (Biochemistry, 22:5243-49 ( 1983); J. Biochemistry 95:909-16 (1984); Gene 27: 193-99 ( 1984); Microbiology 140: 1817-28 ( 1994); Molecular Genetics & Genomics 2/8:330-39 ( 1989); Molecular Microbiology 6:3 17-26 ( 1992)), the genes can be obtained by PCR using primers synthesized based on each of the elucidated nucleotide sequences, and the chromosome DNA as a template.

In certain embodiments, the invention relates to any one of the aforementioned genetically-engineered organisms, wherein the non-native gene is selected from the group consisting of trzE from Rhodococcus sp. strain Mel, trzE from Rhizobium feguminosarum, trzC MEL, trzC 12227, cah from Fusarium oxysporum Fo5176, cah from F. pseudograminaearum CS3096, cah from Gibberella zeae PH- 1 , cah from Aspergillus kawachii IFO 4308, cah from A. niger CBS 5 13.88, cah from A. niger ATCC 1015, cah from A. oryzae 3.042, cah from S. cerevisiae FostcrsB, al∑F from Pseudomonas sp. strain ADP, DUR 1 ,2 from S. cerevisiae, YALI0E 0727 1g from Y. lipolyiica CLIB 122, atzK from Pseudomonas sp. strain ADP, atzD from Pseudomonas sp. strain ADP, trzD from Pseudomonas sp. strain NRRLB- 12227, alzD from Rhodococcus sp. Mcl, irzD from Rhodococcus sp. Mcl, guaD from E. coli K12 strain MG 1566, blr3880 from Bradyrhizobium japonicum USDA 1 10, GUD1 Y DL238C from .V. cerevisiae, YAL 10E2 5740p from Y. lipolyiica CLIB 122, trzA from Williamsia sp. NRRL B- 15444R, triA from Pseudomonas sp. strain NRRL B- 12227, atzC from Pseudomonas sp. strain ADP, and caA from Myroihecium verrucaria.

2. Organisms thai metabolize phosphorous- and sulfur- containing, functional foods

In certain embodiments, the invention relates to a genetically-engineered organism, wherein the genetically-engineered organism has been transformed by a nucleic acid molecule; the nucleic acid molecule comprises a non-native gene; and the non-native gene encodes for a non-native enzyme selected from the group consisting of glycerol-3- phosphate dehydrogenase (sn-glycerol 3-phosphate: NAD(+) oxidorcductase, EC 1 . 1 . 1.8), glyccraldchyde-3-phosphatc dehydrogenase, an organophosphatc degradation enzyme, a phosphodiesterase, a phospholipasc, dcsulfurization enzyme, a dibcnzothiophcnc-5,5- dioxidc monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, and a NADH-FMN oxidorcductase.

In certain embodiments, the invention relates to any one of the aforementioned genetically-engineered organisms, wherein the non-native gene is selected from the group consisting of dszABC, dszA, dszABCD, dszB, dszC, dszD, gpdQ, hocA, htxA, htxABCDEFHGIJLMN, htxB, htxC, htxD, htxE, htxF, htxG, htxH, htxl, htxJ, htxK, htxL, htxM, htxN, opdA, ophA, pde, pdeA, phoA, ptxABCDE, ptxD, ugpA, ugpAE B, ugpB, ngp , ugpE, pdA, updABDE, updB, updD, and updE.

In certain embodiments, the invention relates to any one of the aforementioned genetically-engineered organisms, wherein the non-native gene is selected from the group consisting of Delftia acidoorans phosphodiesterase pdeA, Enterobacter aerogenes updABDE gpdQ, Elavobacterium opdA without pcriplasmic leader sequence, Pseudomonas aeruginosa PAO l phoA, Pseudomonas monteilii C11 hocA, Pseudomonas stutzeri WM88 htxABCDEFHGIuKI.MN, Pseudomonas stutzeri WM88 p/xABCDE, Rhodococcus dszD, and Rhodococcus dszABC.

Exemplary Compounds in Functional Foods

l Nitrogen-Containing Compounds in Functional Foods

In certain embodiments, the invention relates to use of a functional food comprising, consisting essentially of, or consisting of a nitrogen-containing compound of any one of Formulas I-III In certain embodiments, a non-genctically-cnginccrcd organism, i.e., a native organism, could not metabolize the nitrogen-containing compound.

In certain embodiments, the invention relates to any one of the aforementioned nitrogen-containing functional foods, wherein the nitrogen-containing compound is a compound of formula I or a salt thereof:

wherein, independently for each occurrence,

is a five-, six, nine-, or tcn-mcmbercd aryl or hetcroaryl group;

R is -OH, -CO₂H, -NO₂, -CN, substituted or unsubstituted amino, or substituted unsubstituted alkyl; and

n is 0, 1 , 2, 3, 4, or 5. In certain embodiments, the invention relates to any one of the aforementioned nitrogen-containing functional food, wherein the nitrogen-containing compound is a compound of formula II or a salt thereof:

wherein, independently for each occurrence,

X is -NH-, -N(alkyl)-, -0-, -C(R1)₂-, -S-, or absent;

Y is -H, -NH₂, -N(H)(alkyl), -N(alkyl)₂, -CO₂H, -CN, or substituted or unsubstituted alkyl; and

R¹ is -H, -OH, -CO₂H, -NO₂, -CN, substituted or unsubstituted amino, or substituted or unsubstituted alkyl.

In certain embodiments, the invention relates to any one of the aforementioned nitrogen-containing functional foods, wherein the nitrogen-containing compound is a compound of formula III or a salt thereof:

wherein, independently for each occurrence,

Y is -H, -NH₂, -N(H)(alkyl), -N(alkyl)₂, -C0₂H, -CN, or substituted or unsubstituted alkyl.

In certain embodiments, the invention relates to any one of the aforementioned nitrogen-containing functional foods, wherein the nitrogen-containing compound is selected from the group consisting of:

In certain embodiments, the invention relates to any one of the aforementioned nitrogen-containing feedstocks, wherein the nitrogen-containing compound is selected from the group consisting of Hydrazine, 5-Aminotctrazolc, Tctrazolc, Mclaminc, Cyanamidc, 2- Cyanoguanidinc, Sodium azidc, Carbohydrazidc, 1 ,2,3-Triazole, 1,2,4-Triazolc, 1 ,3- Diaminoguanidinc HC1, Ammclinc, 1 ,3,5-triazine, Aminoacctonitrilc, Cyanocthylhydrazinc, Azodicarbonamidc, Biurea, Formamidoxime, 1 ,2- Dimcthylhydrazinc, 1 , 1-Dimcthylhydrazinc, cthylhydrazinc, Ethylcncdiamine, Sodium dicyanamidc, Guanidinc carbonate, Mcthylaminc, Ammclidc, Hydroxy laminc, Malononitrile, Biuret, Diethyltriamine, Hexamethylenetetramine, Triethylenetetramine, 1 ,3- Diaminopropane, Triethylenetetramine, 1,3-Diaminopropane, Hydroxyurea, Tetraethylenepentamine, Thiourea, Succinonitrile, Calcium cyanamide, Cyanuric acid, Aminocthylpipcrazinc, Pipcrazinc, Dimcthylaminc, Ethylaminc, dalfampridinc, Tctranitromcthanc, Imidazolidinyl urea, Trinitromcthanc, malonamidc, Chloraminc, Allophantc, Trimcthylaminc, Nitromcthanc, Acctaldoxime, Diazolidinyl urea, 1,2- Cyclohexancdionc dioxime, Acetone oximc, Thioacctamide, Sodium thiocyanatc, Isothiazole, Thiazole, Dimcthylacctamide, Isothiazolinone, Methylene blue, Dicthanolamine, Aspartame, Benzisothiazolinone, and Acesulfame potassium.

Table II

Various organonitrogcn compounds useful in a functional food of the invention, and the chemical formula of each compound.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 100 Da, about 110 Da, about 120 Da, about 130 Da, about 140 Da, about 150 Da, about 160 Da, about 170 Da, about 180 Da, about 190 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have less than 12 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have less than 8 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have 1 , 2, 3, 4, 5, 6, or 7 carbon atoms.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-watcr partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-watcr partition coefficient (log P) of about -0.5, about 0, about 0.5, about 1 , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds arc soluble in water at about 20 °C at a concentration of between about 0.01 g/L to about 1000 g/L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen- containing compounds are soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g/L, about 0.1 g/L, about 0.5 g/L, about 1 g/L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g/L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g/L, about 70 g/L, about 75 g/L, about 80 g/L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing fraction of the functional food comprises the nitrogen-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

2. Phosphorus-Containing Compounds in Functional Foods

In certain embodiments, the invention relates to use of a functional food comprising, consisting essentially of, or consisting of a phosphorus-containing compound of any one of Formulas IV- VI. In certain embodiments, a non-genetically-enginecred organism, i.e., a native organism, could not metabolize (i.e., use as a source of phosphorus) the phosphorus- containing compound.

In certain embodiments, the invention relates to any one of the aforementioned phosphorus-containing functional foods, wherein the phosphorus-containing compound is a compound of formula IV or a salt thereof:

wherein, independently for each occurrence,

R is -H, alkyl, -OH, -OR², -SH, or -SR²;

R¹ is -H, or alkyl;

Y is O or S;

Y¹ is O or S; and

R² is alkyl. In certain embodiments, the invention relates to any one of the aforementioned phosphorus-containing functional foods, wherein the phosphorus-containing compound is a compound of formula V or a salt thereof:

wherein, independently for each occurrence,

R' is -H, or alkyl; and

Y¹ is O or S.

In certain embodiments, the invention relates to any one of the aforementioned phosphorus-containing functional foods, wherein the phosphorus-containing compound is a compound of formula VI or a salt thereof:

wherein, independently for each occurrence,

R³ is -H, -OH, -OR⁴, -SH, -SR⁴, halo, alkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; and

R⁴ is alkyl or aryl.

In certain embodiments, the invention relates to any one of the aforementioned phosphorus-containing functional foods, wherein the phosphorus-containing compound is selected from the group consisting of a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacetatc ester, a methylphosphonate ester, a methylphosphonate salt, phosphonoacetaldehyde, hypophosphite, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, tricthyl phosphate, trimcthyl phosphate, dimethyl phosphate, diethyl phosphite, tricthyl phosphite, trimcthyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-tricthyl phosphorothioatc, etidronate, etidronic acid, methylene diphosphonate, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zoledronic acid, oxidronatc, and oxidronic acid.

Table III

Various organophosphorus compounds useful in a functional food of the invention, and the chemical formula of each compound.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 100 Da, about 110 Da, about 120 Da, about 130 Da, about 140 Da, about 150 Da, about 160 Da, about 170 Da, about 180 Da, about 190 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have less than 12 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have less than 8 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have 1 , 2, 3, 4, 5, 6, or 7 carbon atoms.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-watcr partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-water partition coefficient (log P) of about -0.5, about 0, about 0.5, about 1 , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds arc soluble in water at about 20 °C at a concentration of between about 0.01 g/L to about 1000 g/L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus- containing compounds arc soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g/L, about 0.1 g/L, about 0.5 g/L, about 1 g/L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g/L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g/L, about 70 g/L, about 75 g/L, about 80 g/L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing fraction of the functional food comprises the phosphorus-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

3. Sulfur-Conlaining Compounds in Functional Foods

In certain embodiments, the invention relates to use of a functional food comprising, consisting essentially of, or consisting of a sulfur-containing compound of any one of Formulas VII-XIV. In certain embodiments, a non-gcnctically-cnginccrcd organism, i.e., a native organism, could not metabolize (i.e., use as a source of sulfur) the sulfur-containing compound.

In certain embodiments, the invention relates to any one of the aforementioned sulfur-containing functional foods, wherein the sulfur-containing compound is a compound of formula IV or a salt thereof:

O

R⁵ S=O

R⁶

VII

wherein, independently for each occurrence,

R⁵ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, hctcroaralkyl,

-SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁶ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, hctcroaralkyl,

-SO₂H, -NHR⁷, or - H-C(=O)-R⁷; and

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- membcrcd ring.

In certain embodiments, the invention relates to any one of the aforementioned sulfur-containing functional foods, wherein the sulfur-containing compound is a compound of formula VIII, formula IX, or formula X, or a salt thereof:

VIII

wherein, independently for each occurrence,

R⁸ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hctcroaryl, aralkyl, hetcroaralkyl,

-SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- membercd ring.

In certain embodiments, the invention relates to any one of the aforementioned sulfur-containing functional foods, wherein the sulfur-containing compound is a compound of formula XI, formula XII, or formula XIII or a salt thereof:

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, heteroaralkyl,

-SO₂H, -NH₂, -NHR⁷, or -NH-C(=O)-R⁷; R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- mcmbcrcd ring;

R¹⁰ is hydroxyalkyl, R⁹, or -(CH₂)_XR⁹; and

x is 1

, 2, 3, or 4.

In certain embodiments, the invention relates to any one of the aforementioned sulfur-containing functional foods, wherein the sulfur-containing compound is a compound of formula XIV or a salt thereof:

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hctcroaryl, aralkyl, hctcroaralkyl,

-SO₂H, -NH₂, -NHR⁷, or -NH-C(=O)-R⁷; and

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- mcmbcrcd ring.

In certain embodiments, the invention relates to any one of the aforementioned sulfur-containing functional foods, wherein the sulfur-containing compound is selected from the group consisting of dimethylsulfoxidc, dibenzothiophene, cthancthiol, dimcrcaptosuccinate, dimcrcaptosuccinic acid, thioacctatc, thioacetic acid, tcrt-butylthiol, thiourea, thiocyanatc, sodium thiocyanatc, thioacctamidc, isothiazolc, bcnzisothiazolinonc, isothiazolinonc, mcthancsulfonatc, mcthancsulfonic acid, thioglyccrol, mctabisulfitc, potassium metabisulfite, acesulfame potassium, benzenesulfonate, benzenesulfonic acid, methyl benzenesulfonate, cyclamate, sodium cyclamate, saccharin, 2,4-dithiapentane, dioctyl sodium sulfosuccinate, methylisothiazolinone, sulfolane, and mcthylchloroisothiazolinonc. Table IV

Various organosulfur compounds useful in a functional food of the invention, and the chemical formula of each compound.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 100 Da, about 110 Da, about 120 Da, about 130 Da, about 140 Da, about 150 Da, about 160 Da, about 170 Da, about 180 Da, about 190 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have less than 12 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have less than 8 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have 1 , 2, 3, 4, 5, 6, or 7 carbon atoms.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-watcr partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-water partition coefficient (log P) of about - 0.5, about 0, about 0.5, about 1 , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds are soluble in water at about 20 °C at a concentration of between about 0.01 g/L to about 1000 g/L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds are soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g/L, about 0.1 g/L, about 0.5 g/L, about 1 g/L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g/L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g/L, about 70 g/L, about 75 g/L, about 80 g/L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing fraction of the functional food comprises the phosphorus-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

Methods of Repop lating the Gut

1. Administration of one or more antibiotics

Antibiotics may be administered prior to the administration of bacteria and may include antibiotics such as cephalosporins, β-lactams, clindamycin, macrolidcs, and/or quinolones. Antibiotics are preferentially administered when the subject has a bacterial infection such as C. difficile infection, Salmonella infection, Campylobacter jejuni infection, or infection by an ESBL-producing bacterium. The antibiotics serve to eliminate harmful bacteria from the GI tract prior to repopulating it with healthy bacteria.

2. Administration of the transformed cell

The transformed cell may be administered orally, rcctally, or cntcrally. Enteral administration includes all forms of administration through a feeding tube. The transformed cell may be administered in a drink, food, or any pharmaceutically acceptable carrier, such as in a pill, capsule, or powder. For example, the transformed cell may be formulated in a liquid such as milk, a milk product, or whey, {See, e.g., U.S. Patent No. 5,53 1 ,988; incorporated herein by reference), or as a food (See, e.g., U.S. Patent No. 8,460,726; incorporated herein by reference). Alternatively, the transformed cell may be formulated into pills or capsules (See, e.g., U.S. Patent No. 3,988,440; incorporated herein by reference).

The composition can take the final form of cither a liquid, solid, or semi-solid. For example, a bacterial composition may be a set or creamy yogurt. Alternatively, a bacterial composition may be lyophilizcd and separated into specific dosing units. The dosing units may be packaged in one of several forms including but not limited to packets, capsules, tablets, or caplcts. Any other packaging form as is common in the art may be utilized.

In some embodiments, the total number of bacteria per docs ranges from 1 x 1 ⁶ to about 2x 10¹². In certain embodiments, the total number of bacteria per docs ranges from 1 x 1010 to about 2x 10¹² per dose.

When antibiotics arc administered as part of the treatment, the bacteria may be administered either prior to the use of antibiotic treatment (to reduce the relative amount of harmful bacteria in the gut) or following the antibiotic treatment (to minimize recovery of the harmful bacteria population and increase the population of preferred gut bacteria). 3. Administration of a funclional food

In some aspects, the invention combines the use of genetically modified bacteria and a functional food to cause the preferential growth of beneficial organisms that contain the genetic modifications while limiting the growth of harmful organisms which are incapable of accessing one or more nutrients from the function food. Microorganisms without the genetic modification, such as C. difficile, arc unable to thrive in subjects who preferentially injest the function food, and the proportion of those organisms decrease as a percentage of the gut population.

The use of a functional food lowers the cost of treatment dramatically because the treatment can be undertaken in non-clinical settings and because subjects may injest the functional foods prophylactically to prevent the occurrence of gastrointestional infection.

For example, a physician may treat a patent in a clinical situation where antibiotic use is required and the patient profile indicates C. difficile is a possibility.

Rcpopulation of the gut flora may be accomplished passively, relying on the natural rate of microbial regeneration, or actively by providing external sources of active microbial cultures. An active treatment consists of providing a patient with a defined diet and a genetically modified organism cocktail to provide a defined diet tailored to increase the relative quantity of beneficial organisms in the gut. The food source and the organism can be provided separately or as a formulation in cither a liquid or tablet form. The key clement of the technology requires the genetically modified organisms to be delivered to the gut in conjunction with a growth supporting food source which will substantially not support the growth of harmful bacteria.

The functional food may be optionally formulated with high-immunoglobulin milk products or isolated milk immunoglobulins, including bovine colostrum, which can have an immunoglobulin content as high as 40%. Thus, the functional food may comprise an immunoglobulin-containing fraction. Further, the functional food may comprise immunoglobulins in an amount of about 1 %, 5%, 10%, 15%, 20%, 25%, 30%, 35%, or

40% by weight.

In some embodiments, the present invention relates to a transformed cell comprising a genetic modification. The genetic modification may encode an enzyme selected from the group consisting of an allophanatc hydrolase, a biuret amidohydrolase, a cyanuric acid amidohydrolase, a guanine deaminase, an ammclinc hydrolase, an ammclidc hydrolyasc, a melaminc deaminase, an isopropylammclidc isopropylaminohydrolasc, a cyanamidc hydratasc, an urease, an urea carboxylase, a glyccrol-3-phosphatc

dehydrogenase (sn-glyccrol 3-phosphatc: N AD(+) oxidorcductase, EC 1 . 1 . 1.8), a glyceraldehyde-3-phosphate dehydrogenase, an organophosphate degradation enzyme, a phosphodiesterase, a phospholipasc, a dcsulfurization enzyme, a dibcnzothiophene-5,5- dioxide monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, and a NADH-FMN oxidorcductasc.

In some embodiments, the transformed cell is selected from the group consisting of Acidaminococcus, Bacteroides, Bifidobacterium, Blautia, Columella, Dorea,

Eubacterium, Faecal ibacterium, Lachnospira, Ixictobacillus, Parabacteroides, Raouliella, Roseburia, and Ruminococcus. In certain embodiments, the transformed cell is selected from the group consisting of Bifidobacterium and Lactobacillus.

In some embodiments, the transformed cell is selected from the group consisting of Acidaminococcus intestinalis, Bacteroides ovatus, Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breven, Bifidobacterium infantis,

Bifidobacterium lacfis, Bifidobacterium longtum, Blautia producta, Clostridium coclea/um, Collinsella aerofaciens, Dorea longicafena, Eubacterium desmolam, Eubacterium eligens, Eubacterium limosum, Eubacterium rectale, Eubacterium ventriosum, Faecalibacterium prausnitzii, Lachnospira peclinoshiza, Ixictobacillus acidophilus, Lactobacillus bulgaricus, Ixictobacillus casei, Lactobacillus delbrueckii, Lactobacillus paracasei, Ixictobacillus reuteri, Listeria innocua, Parabacteroides distasonis, Roseburia faecalis, Roseburia intestinalis, Ruminococcus torques, Ruminococcus obeum, Saccharomyces boulardii, Streptococcus mitis, and Streptococcus thermophilus. In some embodiments, the transformed cell is selected from the group consisting of Acidaminococcus intestinalis, Bacteroides ovatus, Bifidobacterium longum, Blautia producta, Clostridium coclealum, Collinsella aerofaciem, Dorea longicafena, Eubacterium desmolans, Eubacterium eligens, Eubacterium limosum, Eubacterium rectale, Eubacterium ventriosum, Eaecalibacterium prausnitzii, Lachnospira peclinoshiza, Ixictobacillus casei, Ixictobacillus paracasei, Parabacteroides distasonis, Roseburia faecalis, Roseburia intestinalis, Ruminococcus torques, Ruminococcus obeum, and Streptococcus mitis. In some embodiments, the transformed cell is selected from the group consisting of Bifidobacterium bifidum,

Ixictobacillus acidophilus, Lactobacillus bulgariciis, Lactobacillus casei, Saccharomyces boulardii, and Streptococcus thermophiles. In some embodiments, the transformed cell is Bifidobacterium bifidum or Lactobacillus acidophilus. In some embodiments, the genetic modification is transformation with a nucleic acid comprising a gene selected from the group consisting of atzF, DUR1,2 YALIOE 07271g, atzE, atzD, irzC, trzD, trzE, guaD, blr3880, GUD1/Y DL238C, YAL10E2 5740p, trzA, triA, atzC, cah, dszABC, dszA, dszABCD, dszB, dszC, dszD, gpdQ, hocA, htxA, hlxABCDEFHGIJKLMN, htxB, htxC, htxD, htxE, htxF, h/xG, hfxH, htxl, htxJ, htxK, htxL, htxM, htxN, opdA, ophA, pde, pdeA, phoA, plxABCDE, pfxD, ugpA, ugpAECB, ugpB, ugpC, ugpE, tipdA, updABDE, updB, updD, and updE. In certain embodiments, the genetic modification is transformation with a nucleic acid comprising a gene selected from the group consisting of Rhodococcus sp. strain Mel trzE; Rhizobium leguminosarum trzE; Rhodococcus sp. strain Mel (rzC; Pseitdomonas sp. strain NRRLB-12227 frzC; Fusarhim oxysporwn Fo5176 cah; F. pseudograminaearum CS3096 cah; Gibberella zeae PH- 1 cah; Aspergillus kawachii IFO 4308 cah; A. niger CBS 513.88 cah; A. niger ATCC 1015 cah; A. oryzae 3.042 cah; S. cerevisiae FostcrsB cah; Pseitdomonas sp. strain ADP atzF;

S. cerevisiae DUR1,2; Y. lipolytica CLIB 122 YALIOE 07271g; Pseitdomonas sp. strain ADP atzE; Pseudomonas sp. strain ADP atzD; Pseitdomonas sp. strain NRRLB-12227 trzD; Rhodococcus sp. Strain Mel atzD; Rhodococcus sp. strain Mel trzD; E. coli K 12 strain MG 1566 guaD ; Bradyrhizobium japonicum USDA 110 blr3880; S. cerevisiae GUD 1/Y DL238C; Y lipolyfica CLIB 122 YAL10E2 5740p; Williamsia sp. NRRL B- 15444R trzA; Pseudomonas sp. strain NRRL B- 12227 triA; Pseudomonas sp. strain ADP atzC;

Myrothecium verritcaria cah; Delflia acidoorans phosphodiesterase pdeA; Enterobacter aerogenes updABDE gpdQ; Flavobacterium opdA without periplasm ic leader sequence; Pseudomonas aeruginosa PAO l phoA; Pseudomonas monteilii CI 1 hoc A; Pseudomonas stutzeri WM88 hlxABCDEFHGIJKLMN; Pseitdomonas stulzeri WM88 ptxABCDE;

Rhodococcus dszD; and Rhodococcus dszABC.

In some embodiments, the present invention relates to a method of preventing, reducing the risk of, or treating a condition, comprising administering to a subject in need thereof a therapeutically effective amount of a transformed cell. The subject may be a mammal. In certain embodiments, the subject is a primate, canine, feline equine, bovine, ovine, or porcine. In certain embodiments, the subject is a human.

In some embodiments, the transformed cell is administered orally, rectally, entcrally, or laparoscopically.

In some embodiments, the condition is inflammatory bowel disease, Crohn's disease, ulcerative colitis, irritable bowel syndrome, irritable bowel movement, obesity, pouchitis, post infection colitis, gastrointestinal cancer, rheumatoid arthritis,

hypcrlipidcmia, hypovitaminosis, diarrhea, antibiotic-associated diarrhea, Rotavirus- associated diarrhea, Clostridium difficile infection, Salmonella infection, Campylobacter jejuni infection, or an infection by an Extended Spectrum Beta Lactamase (ESBL)- producing bacteria. In certain embodiments, the condition is antibiotic-associated diarrhea, Clostridium difficile infection, Salmonella infection, Campylobacter jejuni infection, or an infection by an Extended Spectrum Beta Lactamase (ESBL)-producing bacteria. In certain embodiments, the condition is Clostridium difficile infection.

In some embodiments, the present invention comprises the step of administering to a subject a nutritionally effective amount of a functional food. The functional food comprises a nitrogen-containing compound, a phosphorus-containing compound, and/or a sulfur-containing compound, wherein a transformed cell can metabolize the compound and a native cell of the same species as the transformed cell cannot metabolize the compound.

In some embodiments, the functional food comprises a nitrogen-containing fraction and a non-nitrogen-containing fraction. The nitrogen-containing fraction may comprise, in an amount from about 10% by weight to about 100% by weight, one or more nitrogen-containing compounds of any one of Formulas I-III, or a salt thereof, wherein: the compound of formula I is

wherein, independently for each occurrence,

is a five-, six, nine-, or ten-membered aryl or heteroaryl group; R is -OH, -C0 H, -NO:, -CN, substituted or unsubstitutcd amino, or substituted or unsubstitutcd alkyl; and

n is 0, 1 , 2, 3, 4, or 5;

the compound of formula II is

wherein, independently for each occurrence,

X is -NH-, -N(alkyl)-, -0-, -C(R^l)₂-, -S-, or absent;

Y is -H, -NH₂, -N(H)(alkyl), -N(alkyl)₂, -C0₂H, -CN, or substituted or unsubstitutcd alkyl; and

R¹ is -H, -OH, -CO₂H, -NO₂, -CN, substituted or unsubstitutcd amino, or subst unsubstituted alkyl; and

the compound of formula III is

wherein, independently for each occurrence,

Y is -H, -NH₂, -N(H)(alkyl), -N(alkyl)₂, -C0₂H, -CN, or substituted or unsubstitutcd alkyl.

In some embodiments, a native cell of the same species as the transformed cell cannot metabolize (i.e., use as a source of nitrogen) the nitrogen-containing compounds.

In some embodiments, the one or more nitrogen-containing compounds arc selected from the group consisting of Hydrazine, 5-Aminotctrazolc, Tetrazole, Melamine, Cyanamidc, 2-Cyanoguanidine, Sodium azide, Carbohydrazide, 1 ,2,3-Triazole, 1 ,2,4- Triazole, 1,3-Diaminoguanidine HC1, Ammeline, 1 ,3,5-triazine, Aminoacetonitrile, Cyanoethylhydrazine, Azodicarbonamide, Biurea, Formamidoxime, 1 ,2-

Dimcthylhydrazinc, 1, 1-Dimcthylhydrazinc, cthylhydrazinc, Ethylcncdiaminc, Sodium dicyanamidc, Guanidinc carbonate, Mcthylaminc, Ammclidc, Hydroxylaminc,

Malononitrilc, Biuret, Dicthylcnctriaminc, Hcxamcthylcnctctraminc, Tricthylcnctctraminc, 1,3-Diaminopropanc, Triethylenctetraminc, 1,3-Diaminopropanc, Hydroxyurea,

Tctracthylcncpcntaminc, Thiourea, Succinonitrilc, Calcium cyanamidc, Cyanuric acid, Aminocthylpipcrazinc, Pipcrazinc, Dimcthylaminc, Ethylaminc, dalfampridinc,

Tctranitromcthanc, Imidazolidinyl urea, Trinitromcthanc, malonamidc, Chloraminc, Allophanate, Trimethylamine, Nitromethane, Acetaldoxime, Diazolidinyl urea, 1 ,2- Cyclohcxancdionc dioximc, Acetone oximc, Thioacctamidc, Sodium thiocyanatc, Isothiazolc, Thiazolc, Dimcthylacctamidc, Isothiazolinonc, Methylene blue,

Dicthanolaminc, Aspartame, Bcnzisothiazolinonc, and Accsulfamc potassium.

In some embodiments, the nitrogen-containing fraction consists essentially of one or more nitrogen-containing compounds selected from the group consisting of Hydrazine, 5-Aminotctrazolc, Tetrazole, Mclaminc, Cyanamidc, 2-Cyanoguanidinc, Sodium azidc, Carbohydrazide, 1 ,2,3-Triazolc, 1,2,4-Triazole, 1 ,3-Diaminoguanidinc HC1, Ammeline, 1 ,3,5-triazine, Aminoacetonitrile, Cyanoethylhydrazine, Azodicarbonamide, Biurea, Formamidoxime, 1 ,2-Dimethylhydrazine, 1 , 1 -Dimethylhydrazine, ethylhydrazine, Ethylcncdiaminc, Sodium dicyanamidc, Guanidinc carbonate, Mcthylaminc, Ammclidc, Hydroxylaminc, Malononitrilc, Biuret, Dicthylcnctriaminc, Hcxamcthylcnctctraminc, Triethylenetetramine, 1 ,3-Diaminopropane, Triethylenetetramine, 1 ,3-Diaminopropane, Hydroxyurea, Tetraethylenepcntamine, Thiourea, Succinonitrile, Calcium cyanamidc, Cyanuric acid, Aminoethylpipcrazinc, Pipcrazinc, Dimcthylaminc, Ethylaminc, dalfampridinc, Tctranitromcthanc, Imidazolidinyl urea, Trinitromcthanc, malonamidc, Chloramine, Allophanate, Trimethylamine, Nitromethane, Acetaldoxime, Diazolidinyl urea 1 ,2-Cyclohcxancdionc dioxime. Acetone oxime, Thioacctamidc, Sodium thiocyanate, Isothiazole, Thiazole, Dimethylacetamide, Isothiazolinone, Methylene blue,

Dicthanolaminc, Aspartame, Bcnzisothiazolinonc, and Accsulfamc potassium.

In some embodiments, the functional food comprises a phosphorus-containing fraction and a non-phosphorus-containing fraction. The phosphorus-containing fraction may comprise, in an amount from about 10% by weight to about 100% by weight, one or more phosphorus-containing compounds of any one of Formulas IV- VI, wherein:

the compound of formula IV is

Y

R-P-Y'-R¹

R

IV

wherein, independently for each occurrence,

R is -H, alkyl, -OH, -OR², -SH, or -SR²;

R¹ is -H, or alkyl;

Y is O or S;

Y¹ is O or S; and

R² is alkyl;

the compound of formula V is

Y I ¹-Rⁿ

_R1._VV ^P 1._R1

V

wherein, independently for each occurrence,

R¹ is -H, or alkyl; and

Y¹ is O or S; and the compound of formula VI is

^HO HO _R°¾₃O^OH^H

VI

wherein, independently for each occurrence,

R³ is -H, -OH, -OR⁴, -SH, -SR⁴, halo, alkyl, aryl, hctcroaryl, aralkyl, or hctcroaralkyl; and

R⁴ is alkyl or aryl.

In some embodiments, a native cell of the same species as the transformed cell cannot metabolize (i.e., use as a source of phosphorus) the phosphorus-containing compounds.

In some embodiments, the one or more phosphorus-containing compounds arc selected from the group consisting of a hypophosphitc salt, a phosphite salt,

phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctatc ester, a

mcthylphosphonatc ester, a methylphosphonatc salt, phosphonoacctaldchydc,

hypophosphitc, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, triethyl phosphate, trimethyl phosphate, dimethyl phosphate, diethyl phosphite, triethyl phosphite, trimethyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-triethyl

phosphorothioatc, etidronate, ctidronic acid, methylene diphosphonate, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zolcdronic acid, oxidronatc, and oxidronic acid.

In some embodiments, the phosphorus-containing fraction consists essentially of one or more phosphorus-containing compounds selected from the group consisting of a hypophosphite salt, a phosphite salt, phosphonoacetic acid, a phosphonoacetate salt, a phosphonoacctatc ester, a mcthylphosphonatc ester, a mcthylphosphonatc salt,

phosphonoacetaldehyde, hypophosphite, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, triethyl phosphate, trimethyl phosphate, dimethyl phosphate, diethyl phosphite, triethyl phosphite, trimethyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-tricthyl phosphorothioatc, etidronate, ctidronic acid, methylene diphosphonatc, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronate, zoledronic acid, oxidronatc, and oxidronic acid.

In some embodiments, the functional food comprises a sulfur-containing fraction and a non-sulfur-containing fraction. The sulfur-containing fraction may comprise, in an amount from about 10% by weight to about 100% by weight, one or more sulfur-containing compounds of any one of Formulas VII-XIV, wherein:

the compound of formula VII is

O

R⁵ S=O

R⁶

VII

wherein, independently for each occurrence,

R⁵ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hctcroaryl, aralkyl, hctcroaralkyl, - SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁶ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hctcroaryl, aralkyl, hctcroaralkyl, - SO₂H, -NHR⁷, or -NH-C(=O)-R⁷; and

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6-mcmbcrcd ring;

the compound of formula IIX, formula IX, or formula X, is

wherein, independently for each occurrence,

R⁸ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hctcroaryl, aralkyl, hctcroaralkyl, - SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6-mcmbercd ring; the compound of formula XI, formula XII, or formula XIII is

S

R⁹^R⁹

XI

o I I

R^{9 ' S^} R⁹

XII

r10-S^_R9

XIII

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, heteroaralkyl, - SO₂H, -NH₂, -NHR⁷, or -NH-C(=O)-R⁷;

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6-membered

ring;

R'° is hydroxyalkyl, R⁹, or -(CH₂)_XR⁹; and

x is 1 , 2, 3, or 4; and

the compound of formula XIV is

R⁹ S-N

R⁹

XIV

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, hctcroaral R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6-mcmbcrcd

ring.

In some embodiments, a native cell of the same species as the transformed cell

cannot metabolize (i.e., use as a source of sulfur) the sulfur-containing compounds.

In some embodiments, the one or more sulfur-containing compounds arc selected

from the group consisting of dimcthylsulfoxidc, dibenzothiophene, cthancthiol,

dimcrcaptosuccinatc, dimcrcaptosuccinic acid, thioacctatc, thioacctic acid, tcrt-butylthiol,

thiourea, thiocyanatc, sodium thiocyanatc, thioacctamidc, isothiazolc, bcnzisothiazolinonc,

isothiazolinonc, mcthancsulfonatc, mcthanesulfonic acid, thioglyccrol, metabisulfite,

potassium metabisulfite, accsulfamc potassium, bcnzcncsulfonatc, bcnzcncsulfonic acid, methyl bcnzcncsulfonatc, cyclamatc, sodium cyclamatc, saccharin, 2,4-dithiapcntanc, dioctyl sodium sulfosuccinatc, methyl isothiazolinonc, sulfolanc, and

methylchloroisothiazolinone.

In some embodiments, the sulfur-containing fraction consists essentially of one or more sulfur-containing compounds selected from the group consisting of

dimcthylsulfoxidc, dibenzothiophene, cthancthiol, dimcrcaptosuccinatc, dimcrcaptosuccinic acid, thioacetate, thioacetic acid, tcrt-butylthiol, thiourea, thiocyanate, sodium thiocyanatc, thioacetamide, isothiazole, bcnzisothiazolinonc, isothiazolinonc, methanesulfonate, methanesulfonic acid, thioglycerol, metabisulfite, potassium metabisulfite, acesulfame potassium, bcnzcncsulfonatc, bcnzcncsulfonic acid, methyl bcnzcncsulfonatc, cyclamatc, sodium cyclamate, saccharin, 2,4-dithiapentane, dioctyl sodium sulfosuccinate,

mcthylisothiazolinonc, sulfolanc, and methylchloroisothiazolinone.

In some embodiments, the functional food further comprises an immunoglobul in- containing fraction. The functional food may comprise immunoglobulins in an amount from about 1 % by weight to about 40% by weight.

In some embodiments, the functional food comprises a transformed cell.

II. COMPOSITIONS AND METHODS R I.ATFD TO GFNFTICAI.I.Y-MODIFTF.D E. COU

FOR PRODUCTION OF PIIARMACI.U TICAI. PRODUCTS

Nitroeen-Coniainine Compounds in Feedstocks

In certain embodiments, the invention relates to use of an atypical nitrogen- containing feedstock comprising, consisting essentially of, or consisting of a nitrogen- containing compound of any one of Formulas I-III. In certain embodiments, a non- genetically engineered organism, i.e., a native organism, could not metabolize (i.e., use as a source of nitrogen) the nitrogen-containing compounds in the feedstock.

In certain embodiments, the invention relates to use of any one of the aforementioned nitrogen-containing feedstocks, wherein the nitrogen-containing compound is selected from the group consisting of:

N N o o

O NH,

H.N

OH

O-^NH ^O , and

H

ΝΞΞΞΞ— N

H

In certain embodiments, the invention relates to use of any one of the aforementioned nitrogen-containing feedstocks, wherein the nitrogen-containing compound is selected from the group consisting of Hydrazine, 5-Aminotctrazolc, Tctrazolc, Mclaminc, Cyanamidc, 2-Cyanoguanidinc, Sodium azidc, Carbohydrazidc, 1 ,2,3-Triazolc, 1 ,2,4- Triazole, 1 ,3-Diaminoguanidine HC1, Ammelinc, 1 ,3,5-triazine, Aminoacetonitrilc, Cyanocthylhydrazinc, Azodicarbonamidc, Biurea, Formamidoxime, 1 ,2- Dimcthylhydrazinc, 1 , 1-Dimcthylhydrazinc, cthylhydrazinc, Ethylcncdiamine, Sodium dicyanamidc, Guanidinc carbonate, Mcthylaminc, Ammclide, Hydroxy laminc, Malononitrile, Biuret, Diethyltriamine, Hexamethylenetetramine, Triethylenetetramine, 1 ,3- Diaminopropane, Triethylenetetramine, 1,3-Diaminopropane, Hydroxyurea, Tetraethylenepentamine, Thiourea, Succinonitrile, Calcium cyanamide, Cyanuric acid, Aminocthylpipcrazinc, Pipcrazinc, Dimcthylaminc, Ethylaminc, dalfampridinc, Tctranitromcthanc, Imidazolidinyl urea, Trinitromcthanc, malonamidc, Chloraminc, Allophantc, Trimcthylaminc, Nitromcthanc, Acctaldoxime, Diazolidinyl urea, 1,2- Cyclohexancdionc dioxime, Acetone oximc, Thioacctamide, Sodium thiocyanatc, Isothiazole, Thiazole, Dimcthylacctamidc, Isothiazolinone, Methylene blue, Dicthanolamine, Aspartame, Benzisothiazolinone, and Acesulfame potassium.

In certain embodiments, the invention relates to the use of nitrogen-containing feedstock described in international patent application serial no. PCT/US 14/010332, filed January 6, 2014, which is hereby incorporated by reference in its entirety.

Phosphonis-Containins Compounds in Feedstocks

In certain embodiments, the invention relates to use of an atypical phosphorus- containing feedstock comprising, consisting essentially of, or consisting of a phosphorus- containing compound of any one of Formulas IV-VI. In certain embodiments, a non- genetically engineered organism, i.e., a native organism, could not metabolize (i.e., use as a source of phosphorus) the phosphorus-containing compounds in the feedstock.

In certain embodiments, the invention relates to use of any one of the aforementioned phosphorus-containing feedstocks, wherein the phosphorus-containing compound is selected from the group consisting of a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctatc ester, a methylphosphonate ester, a methylphosphonate salt, phosphonoacetaldchyde, hypophosphite, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, triethyl phosphate, trimethyl phosphate, dimethyl phosphate, diethyl phosphite, triethyl phosphite, trimethyl phosphite, dimethyl phosphite, glyphosatc, Ο,Ο,Ο-tricthyl phosphorothioate, etidronate, etidronic acid, methylene diphosphonate, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zoledronatc, zolcdronic acid, oxidronatc, and oxidronic acid.

In certain embodiments, the invention relates to use of any one of the aforementioned phosphorus-containing feedstocks, wherein the phosphorus-containing compound is a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctate ester, a methylphosphonate ester, a methylphosphonate salt, phosphonoacetaldehyde.

Sulfur-Containine Compounds in Feedstocks

In certain embodiments, the invention relates to use of an atypical sulfur-containing feedstock comprising, consisting essentially of, or consisting of a sulfur-containing compound of any one of Formulas VII-XIV. In certain embodiments, a non-genetically engineered organism, i.e., a native organism, could not metabolize (i.e., use as a source of sulfur) the sulfur-containing compounds in the feedstock.

In certain embodiments, the invention relates to use of any one of the aforementioned sulfur-containing feedstocks, wherein the sulfur-containing compound is selected from the group consisting of dimcthylsulfoxidc, dibenzothiophene, cthanethiol, dimcrcaptosuccinatc, dimcrcaptosuccinic acid, thioacctatc, thioacctic acid, tcrt-butylthiol, thiourea, thiocyanatc, sodium thiocyanatc, thioacctamidc, isothiazolc, bcnzisothiazolinonc, isothiazolinone, methanesulfonate, methanesulfonic acid, thioglycerol, metabisulfite, potassium metabisulfite, accsulfamc potassium, bcnzencsulfonatc, benzcnesulfonic acid, methyl bcnzencsulfonatc, cyclamatc, sodium cyclamatc, saccharin, 2,4-dithiapcntanc, dioctyl sodium sulfosuccinatc, mcthylisothiazolinonc, sulfolanc, and mcthy lch loro isoth iazol i none.

Exemplary Isolated Nucleic Acid Molec ules and Vectors

Relating to Genes for Metabolizing Nitrogen-Containing Compounds

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a nitrogen source that otherwise would not have been accessible to the native organism; and the enzyme is allophanatc hydrolase, biuret amidohydrolasc, cyanuric acid amidohydrolasc, guanine deaminase, ammclinc hydrolase, ammclide hydrolyasc, melaminc deaminase, isopropylammclide isopropylaminohydrolasc, cyanamide hydratase, urease, or urea carboxylase; and

(ii) the nucleic acid molecule encodes a heterologous enzyme that provides /^'. coli with the ability to produce a pharmaceutical product.

In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule comprises trzE from Rhodococctis sp. strain Mel, trzE from Rhizobium leguminosartim, trzC MEL, trz 12227, cah from Fusarhim oxyspomm Fo5176, cah from F. pseudograminaeamm CS30 6, cah from Gibberella zeae PH- 1 , cah from Aspergillus kawachii IFO 4308, cah from A. niger CBS 513.88, cah from A. niger ATCC 1015, cah from A. oryzae 3.042, cah from S. cerevisiae FostcrsB, afzF from Pseudotnonas sp. strain ADP, DUR 1.2 from Λ^". cerevisiae, YALI0E 0727 I g from Y. lipolytica CLIB 122, atzE from Pseudotnonas sp. strain ADP, atzD from Pseudotnonas sp. strain ADP, trzD from Pseudotnonas sp. strain NRRLB- 12227, atzD from Rhodococcus sp. Mel, trzD from Rhodococcus sp. Mel, guaD from E. coli K 12 strain MG 1566, blr3880 from Bradyrhizobium japonicum USDA 110, GUD1/Y DL238C from S. cerevisiae, YAL 10E2 5740p from Y. lipolytica CLIB122, trzA from Williamsia sp. NRRL B- 15444R, iriA from Psetidomonas sp. strain NRRL B-12227, atzC from Psetidomonas sp. strain ADP, or cah from Myrolhecium verrucaria.

In certain embodiments, the invention relates to an isolated nucleic acid molecule comprising any one of the sequences disclosed herein. In certain embodiments, the invention relates to an isolated nucleic acid molecule having at least 85% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to an isolated nucleic acid molecule having at least 90% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to an isolated nucleic acid molecule having at least 95% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to an isolated nucleic acid molecule having at least 99% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to an isolated nucleic acid molecule having any one of the sequences disclosed herein.

A recombinant vector comprising any one of the aformcntioned nucleic acid molecules operably linked to a promoter.

In certain embodiments, the invention relates to a recombinant vector comprising any one of the sequences disclosed herein. In certain embodiments, the invention relates to a recombinant vector having at least 85% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to a recombinant vector having at least 90% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to a recombinant vector having at least 95% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to a recombinant vector having at least 99% sequence homology with any one of the sequences disclosed herein.

Relating to Genes for Metabolizing; Phosporus- or Sulfur-Containing Compounds In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein

(i) the nucleic acid molecule encodes a heterologous enzyme that provides E. coli with the ability to assimilate a phosphorus source or a sulfur source that otherwise would not have been accessible to the native organism; and the enzyme is phosphite dehydrogenase, hypophosphitc dehydrogenase, phosphonoacctatc hydratasc, glycerol-3- phosphatc dehydrogenase (sn-glycerol 3-phosphatc: NAD(+) oxidorcductasc, EC 1.1. 1.8), glyccraIdchyde-3-phosphatc dehydrogenase, an organophosphatc degradation enzyme, a phosphodiesterase, a phospholipasc, dcsulfurization enzyme, a dibcnzothiophcnc-5,5- dioxidc monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, or a NADH-FMN oxidoreductase; and

(ii) the nucleic acid molecule encodes a heterologous enzyme that provides /^'. coli with the ability to produce a pharmaceutical product. In certain embodiments, the invention relates to an isolated nucleic acid molecule, wherein the nucleic acid molecule comprises Delflia acidoorans phosphodiesterase pdeA, Enterobacter aerogenes updABDE gpdQ, Elavobacterhim opdA without periplasmic leader sequence, Pseudomonas aeruginosa PAOl phoA, Pseudomonas monteilii C l l hoc A, Pseudomonas stutzeri WM88 htxABCDEFHGIJKLMN, Pseudomonas stutzeri WM88 ptxABCDE, Rhodococcus dszD, or Rhodococcus dszABC.

A recombinant vector comprising any one of the aformcntioncd nucleic acid molecules opcrably linked to a promoter.

In certain embodiments, the invention relates to the use of an isolated nucleic acid or a recombinant vector described in international patent application serial no. PC17US 14/010332, filed January 6, 2014, or U.S. provisional patent application no. 61/870,469, filed August 27, 2013, which arc hereby incorporated by reference in their entireties.

Exemplary Genetically Engineered E. coli Ce/ls

For Utilizing Non-Traditional Sources of Nitrogen

In certain embodiments, the invention relates to a genetically engineered E. coli, wherein the genetically engineered E. coli has been transformed by a nucleic acid molecule or a recombinant vector comprising any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 85% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 90% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 95% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 99% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to a genetically engineered E. coli, wherein the genetically engineered E. coli has been transformed by a nucleic acid molecule or a recombinant vector having any one of the sequences disclosed herein.

In certain embodiments, the invention relates to a genetically engineered E. coli, wherein the genetically engineered E. coli has been transformed by a nucleic acid molecule; the nucleic acid molecule comprises a non-native gene; and the non-native gene encodes for a non-native enzyme selected from the group consisting of allophanatc hydrolase, biuret amidohydrolasc, cyanuric acid amidohydrolasc, guanine deaminase, ammelinc hydrolase, ammclidc hydrolyasc, mclaminc deaminase, and isopropylammelidc isopropylaminohydrolase, cyanamidc hydratase, urease, or urea carboxylase.

In certain embodiments, the invention relates to any one of the aforementioned genetically engineered E. coli, wherein the non-native gene is selected from the group consisting of a/zE, DUR 1 ,2 YALI0E 0727 l g, afzE, atz , frzC, irzD, IrzE, atzD, gtiaD, blr3880, GUDl Y DL238C, YAL 10E2 5740p, trzA, MA, atz , and cah. In certain embodiments, the invention relates to any one of the aforementioned genetically engineered E. coli, wherein the non-native gene is selected from the group consisting of atzF, DUR1,2 YALI0E 07271g, atzE, atzD, trzD, atzD, gtiaD, blr3880, GUDl/Y DL238C, YAL10E2 5740p, trzA, triA, atzC, and cah. Any organism may be used as a source of the non-native gene, as long as the organisms has the desired enzymatic activity The non-native gene can each be obtained from chromosomal DNA of any one of the aforementioned microorganisms by isolating a DNA fragment complementing auxotrophy of a variant strain lacking the enzymatic activity. Alternatively, if the nucleotide sequence of these gene of the organism has already been elucidated (Biochemistry, Vol. 22, pp. 5243-5249, 1983; J. Biochcm. Vol. 95, pp. 909-916, 1984; Gene, Vol. 27, pp. 193-199, 1984; Microbiology, Vol. 140, pp. 1817-1828, 1994; Mol. Gene Genet. Vol. 218, pp. 330-339, 1989; and Molecular Microbiology, Vol. 6, pp. 317-326, 1992), the genes can be obtained by PCR using primers synthesized based on each of the elucidated nucleotide sequences, and the chromosome DNA as a template.

In certain embodiments, the invention relates to any one of the aforementioned genetically engineered coli, wherein the non-native gene is selected from the group consisting of irzE from Rhodococcus sp. strain Mcl, IrzE from Rhizobium leguminosarum, trzC MEL, tr∑C 12227, cah from Fusarium oxysporum Fo5176, cah from F. pseudograminaearum CS3096, cah from GibbereUa zeae PH- 1 , cah from Aspergillus kawachii IFO 4308, cah from A. niger CBS 513.88, cah from A. niger ATCC 1015, cah from A. oryzae 3.042, cah from .V. cerevisiae FostcrsB, aizF from Psetidomonas sp. strain ADP, DUR 1 ,2 from S. cerevisiae, YALI0E 0727 l g from Y. lipol lica CLIB 122, alzK from Psetidomonas sp. strain ADP, atzD from Psetidomonas sp. strain ADP, trzD from Psetidomonas sp. strain NRRLB- 12227, atzD from Rhodococcus sp. Mcl, trzD from Rhodococcus sp. Mcl, gtiaD from coli 12 strain MG 1566, blr3880 from Bradyrhizobium japonicum USDA 110, GUD1 Y DL238C from S. cerevisiae, YAL 10E2 5740p from Y. lipolylica CLIB 122, trzA from Williamsia sp. NRRL B- 15444R, triA from Psetidomonas sp. strain NRRL B- 12227, alzC from Psetidomonas sp. strain ADP, and cah from Myrolhecium verrucaria.

For Utilizing Non-Traditional Sources of Phosphorus or Sulfur

In certain embodiments, the invention relates to a genetically engineered E. coli, wherein the genetically engineered /·.". coli has been transformed by a nucleic acid molecule or a recombinant vector comprising any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 85% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 90% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 95% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the nucleic acid molecule or recombinant vector has at least 99% sequence homology with any one of the sequences disclosed herein. In certain embodiments, the invention relates to a genetically engineered E. cofi, wherein the genetically engineered K. co/i has been transformed by a nucleic acid molecule or a recombinant vector having any one of the sequences disclosed herein.

In certain embodiments, the invention relates to a genetically engineered E. colt, wherein the genetically engineered E. co/i has been transformed by a nucleic acid molecule; the nucleic acid molecule comprises a non-native gene; and the non-native gene encodes for a non-native enzyme selected from the group consisting of glycerol-3-phosphate dehydrogenase (sn-glyccrol 3-phosphatc: NAD(+) oxidorcductasc, EC 1.1. 1.8), glyceraIdehyde-3-phosphate dehydrogenase, an organophosphate degradation enzyme, a phosphodiesterase, a phospholipasc, dcsulfurization enzyme, a dibcnzothiophcnc-5,5- dioxidc monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyasc, a dibenzothiophene monooxygenase, and a NADH-FMN oxidorcductasc.

In certain embodiments, the invention relates to any one of the aforementioned genetically engineered E. co//', wherein the non-native gene is selected from the group consisting of d.szABC, ds∑A, dszAB D, dszB, dsz , dszD, gpd , hocA, hixA, hlxAB EFHGUKI.MN, hlxB, hlxC, htxD, hlxE, hlxF, htxG, hlxH, hlxl, htxJ, htxK, hlxL, htxM, htxN, opdA, ophA, pde, pdeA, phnA, phoA, pfxAB DE, pixD, gpA, ugpAECB, iigpB, ugp , gpE, updA, updABDE, pdB, tipdD, and iipdE.

In certain embodiments, the invention relates to any one of the aforementioned genetically engineered E. co/i, wherein the non-native gene is selected from the group consisting of ptxD, hlxA, or phnA.

Any organism may be used as a source of the non-native gene, as long as the organism has the desired enzymatic activity The non-native gene can each be obtained from chromosomal DNA of any one of the aforementioned microorganisms by isolating a DNA fragment complementing auxotrophy of a variant strain lacking the enzymatic activity. Alternatively, if the nucleotide sequence of these gene of the organism has already been elucidated (Biochemistry, Vol. 22, pp.5243-5249, 1983; J. Biochcm. Vol. 95, pp.909-916, 1984; Gene, Vol. 27, pp.193- 199, 1984; Microbiology, Vol. 140, pp.1817-1828, 1994; Mol. Gene Genet. Vol. 218, pp.330-339, 1989; and Molecular Microbiology, Vol. 6, pp317-326, 1992), the genes can be obtained by PCR using primers synthesized based on each of the elucidated nucleotide sequences, and the chromosome DNA as a template. In certain embodiments, the invention relates to any one of the aforementioned genetically engineered E. coli, wherein the non-native gene is selected from the group consisting of Delflia acitioorans phosphodiesterase pcieA, Enterobacter aerogenes updABDE gpdQ, Elavohacteriiim opdA without periplasmic leader sequence, Pseudomonas aeruginosa PAOl p oA, Pseudomonas onteilii CI 1 hoc A, Pseudomonas stutzeri WM88 htxABCDEFHGUKLMN, Pseudomonas stutzeri W 88 pixABCDE, Rhodococc s dszD, and Rhodococcus dszABC.

In certain embodiments, the invention relates to the use of a genetically engineered E. coli described in international patent application serial no. PCT/US 14/010332, filed January 6, 2014, or U.S. provisional patent application no. 61/870,469, filed August 27, 2013, which are hereby incorporated by reference in their entireties.

Exemplary Methods

a) introducing into the /;. coli cell a recombinant DNA construct comprising

iii. a first heterologous polynucleotide that encodes a first heterologous enzyme that provides the cell with the ability to assimilate a nitrogen source, a phosphorus source, or a sulfur source that otherwise would not have been accessible to the host cell: and

iv. a second heterologous polynucclotidc that encodes a second heterologous enzyme that provides the organism with the ability to produce a pharmaceutical product;

b) expressing the first heterologous enzyme; and

c) cultivating the E. coli cell.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the recombinant DNA construct further comprises

iii. an E. coli origin of replication.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the pharmaceutical product is a therapeutic protein, an antibody or antibody peptide, a DNA vaccine, or a RNAi gene slicing product.

In certain embodiments, the invention relates to any one of the aforementioned methods, further comprising the step of expressing the second heterologous enzyme. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the recombinant DNA construct comprises SEQ ID NO: 1 ; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:4; SEQ ID NO:5; SEQ ID NO:6; SEQ ID NO:7; SEQ ID NO:8; SEQ ID NO:9; SEQ ID NO: 10; SEQ ID NO: l l ; SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID NO:20; SEQ ID NO:21 ; SEQ ID NO:22; SEQ ID NO:23; SEQ ID NO:24; SEQ ID NO:25; SEQ ID NO:26; SEQ ID NO:27; SEQ ID NO:28; SEQ ID NO:29; SEQ ID NO:30; SEQ ID NO:32; SEQ ID NO:34; SEQ ID NO:36; SEQ ID NO:38; SEQ ID NO:40; SEQ ID NO:42; SEQ ID NO:44; SEQ ID NO:46; SEQ ID NO:48; SEQ ID NO:50; SEQ ID NO:52; SEQ ID NO:54; SEQ ID NO:56; SEQ ID NO:57; SEQ ID NO:58; SEQ ID NO:59; SEQ ID NO:60; SEQ ID NO:61 ; SEQ ID NO:62; SEQ ID NO:63; SEQ ID NO:64; SEQ ID NO:65; and/or SEQ ID NO:66.

In certain embodiments, the invention relates to a method, comprising the step of contacting any one of the aforementioned genetically engineered E. coli with a substrate,

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction does not comprise a substantial quantity of nitrogen-containing compounds, phosphorus-containing compounds, or sulfur-containing compounds;

the second fraction comprises, in an amount from about 10% by weight to about

100% by weight of the second fraction, a nitrogen-containing compound, a phosphorus- containing compound, or a sulfur-containing compound;

a native E. coli could not metabolize (i.e., use as a source of essential clement) the nitrogen-containing compound, the phosphorus-containing compound, or the sulfur- containing compound; and

the genetically engineered /:. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compound, the phosphorus-containing compound, or the sulfur-containing compound is a compound of any one of Formulas I- XIV.

In certain embodiments, the invention relates to a method, comprising the step of contacting any one of the aforementioned genetically engineered E. coli with a substrate, wherein

the substrate comprises a first fraction and a second fraction;

the first fraction does not comprise a substantial quantity of nitrogen-containing compounds;

5 the second fraction comprises, in an amount from about 10% by weight to about

100% by weight, a nitrogen-containing compound of any one of Formulas I-III;

a native E. coli could not metabolize (i.e., use as a source of nitrogen) the nitrogen- containing compound; and

the genetically engineered E. coli converts the substrate to a product.

10 In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the

I S aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 100 Da, about 110 Da, about 120 Da, about 130 Da, 0 about 140 Da, about 150 Da, about 1 0 Da, about 170 Da, about 180 Da, about 190 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

5 In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have less than 12 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have less than 8 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the 0 nitrogen-containing compounds have 1 , 2, 3, 4, 5, 6, or 7 carbon atoms.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 nitrogen atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have 0, 1 , 2, 3, 4, 5, 6, 7, or 8 oxygen atoms.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-water partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds have an octanol-watcr partition coefficient (log P) of about -0.5, about 0, about 0.5, about 1 , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds arc soluble in water at about 20 °C at a concentration of between about 0.01 g L to about 1000 g L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen- containing compounds are soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g L, about 0.1 g/L, about 0.5 g/L, about 1 g L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g L, about 70 g L, about 75 g/L, about 80 g L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds move through the cell membrane by passive transport. Passive transport includes diffusion, facilitated diffusion, and filtration.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds move through the cell membrane by active transport, such as, for example, via an ATP-Binding Cassette (ABC) transporter or other known transmembrane transporter.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds are transported through the cell membrane.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds arc substantially non-biocidal. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing compounds arc substantially biodegradable.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing fraction comprises the nitrogen-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

wherein

the substrate comprises a first fraction and a second fraction;

the second fraction comprises, in an amount from about 10% by weight to about

100% by weight, a nitrogen-containing compound selected from the group consisting of triazine, urea, melaminc, cyanamide, 2-cyanoguanidine, ammeline, guanidine carbonate, ethylenediamine, ammelide, biuret, diethylenetriamine, triethylenetetramine, 1,3- diaminopropanc, calcium cyanamide, cyanuric acid, aminocthylpipcrazinc, pipcrazinc, and allophantc; and

the genetically engineered E. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the nitrogen-containing fraction comprises the nitrogen-containing compound in about 1 %, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of nitrogen-containing compounds; the second fraction consists essentially of a nitrogen-containing compound selected from the group consisting of triazinc, urea, mclaminc, cyanamidc, 2-cyanoguanidinc, ammeline, guanidine carbonate, ethylenediamine, ammelide, biuret, diethylenetriamine, triethylenetctraminc, 1 ,3-diaminopropane, calcium cyanamidc, cyanuric acid, aminocthylpipcrazinc, pipcrazinc, and allophantc; and

the genetically engineered coli converts the substrate to a product.

In certain embodiments, the invention relates to a method, comprising the step of contacting any one of the aforementioned genetically engineered /·.'. coli with a substrate,

wherein

the substrate consists of a first fraction and a second fraction;

the second fraction consists of a nitrogen-containing compound selected from the group consisting of triazinc, urea, mclaminc, cyanamidc, 2-cyanoguanidinc, ammeline, guanidine carbonate, ethylenediamine, ammelide, biuret, diethylenetriamine, triethylenetctraminc, 1 ,3-diaminopropane, calcium cyanamide, cyanuric acid, aminoethylpiperazine, piperazine, and allophante; and

the genetically engineered coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the genetically engineered E. coli sequesters the product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a plurality of genetically engineered E. coli is used.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the substrate docs not comprise an antibiotic.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the substrate docs not comprise ammonium sulfate.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the substrate docs not comprise urea.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a non-genctically engineered E. coli, i.e., a native coli, could not metabolize (i.e., use as a source of nitrogen) the nitrogen-containing compound.

wherein

the substrate comprises a first fraction and a second fraction;

the second fraction comprises, in an amount from about 10% by weight to about 100% by weight, a phosphorus-containing compound of any one of Formulas IV-VI;

a native E. coli could not metabolize (i.e., use as a source of phosphorus) the phosphorus-containing compound; and

the genetically engineered E. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 100 Da, about 110 Da, about 120 Da, about 130 Da, about 140 Da, about 150 Da, about 160 Da, about 170 Da, about 180 Da, about 1 0 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have less than 12 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have less than 8 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have 1, 2, 3, 4, 5, 6, or 7 carbon atoms. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds arc between about 8% and about 75% phosphorus by weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds are between about 15% and about 47% phosphorus by weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds are about 8%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 30%, about 32%, about 34%, about 36%, about 38%, about 40%, about 42%, about 44%, about 46%, about 48%, about 50%, about 52%, about 54%, about 56%, about 58%, about 60%, about 62%, about 64%, about 66%, about 68%, about 70%, about 72%, or about 74% phosphorus by weight.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-water partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds have an octanol-water partition coefficient (log P) of about -0.5, about 0, about 0.5, about 1 , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds arc soluble in water at about 20 °C at a concentration of between about 0.01 g/L to about 1000 g L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus- containing compounds are soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g L, about 0.1 g/L, about 0.5 g/L, about 1 g/L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g L, about 70 g/L, about 75 g/L, about 80 g L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds move through the cell membrane by passive transport. Passive transport includes diffusion, facilitated diffusion, and filtration. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds move through the cell membrane by active transport, such as, for example, via an ATP-Binding Cassette (ABC) transporter or other known transmembrane transporter.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds arc transported through the cell membrane.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds are substantially non-biocidal.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing compounds are substantially biodegradable.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing fraction comprises the phosphorus-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

wherein

the substrate comprises a first fraction and a second fraction;

the second fraction comprises, in an amount from about 10% by weight to about 100% by weight, a phosphorus-containing compound selected from the group consisting of: a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctatc ester, a mcthylphosphonate ester, a methyl phosphonatc salt, phosphonoacctaldchydc, hypophosphitc, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, tricthyl phosphate, tri methyl phosphate, dimethyl phosphate, diethyl phosphite, triethyl phosphite, trimethyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-tricthyl phosphorothioatc, etidronate, etidronic acid, methylene diphosphonatc, disodium methylene diphosphonatc, mcdronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zolcdronic acid, oxidronatc, and oxidronic acid; and

the genetically engineered E. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the phosphorus-containing raction comprises the phosphorus-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

wherein

the substrate comprises a first fraction and a second fraction;

the second fraction consists essentially of a phosphorus-containing compound selected from the group consisting of a hypophosphite salt, a phosphite salt, phosphonoacetic acid, a phosphonoacetate salt, a phosphonoacetate ester, a mcthylphosphonatc ester, a mcthylphosphonatc salt, phosphonoacctaldchydc, hypophosphite, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, tricthyl phosphate, trimcthyl phosphate, dimethyl phosphate, diethyl phosphite, tricthyl phosphite, trimcthyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-tricthyl phosphorothioatc, etidronate, ctidronic acid, methylene diphosphonatc, disodium methylene diphosphonatc, medronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zolcdronic acid, oxidronatc, and oxidronic acid; and

the genetically engineered /:. coli converts the substrate to a product.

In certain embodiments, the invention relates to a method comprising the step of contacting any one of the aforementioned genetically engineered E. coli with a substrate,

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of phosphorus-containing compounds; the second fraction consists of a phosphorus-containing compound selected from the group consisting of a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacetate salt, a phosphonoacetate ester, a methylphosphonate ester, a methylphosphonate salt, phosphonoacctaldehydc, hypophosphitc, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, tricthyl phosphate, trimcthyl phosphate, dimethyl phosphate, diethyl phosphite, tricthyl phosphite, trimcthyl phosphite, dimethyl phosphite, glyphosate, Ο,Ο,Ο-triethyl phosphorothioatc, etidronate, etidronic acid, methylene diphosphonate, disodium methylene diphosphonate, mcdronic acid, clodronate, clodronate disodium, clodronic acid, tiludronate, tiludronic acid, zoledronate, zoledronic acid, oxidronatc, and oxidronic acid; and

the genetically engineered E. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a plurality of genetically engineered coli is used.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the substrate does not comprise an antibiotic.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a non-gcnctically engineered E. coli, i.e., a native E. coli, could not metabolize (i.e., use as a source of phosphorus) the phosphorus-containing compound.

wherein

the substrate comprises a first fraction and a second fraction;

the second fraction comprises, in an amount from about 10% by weight to about 100% by weight, a sulfur-containing compound of any one of Formulas VII-XIV;

a native E. coli could not metabolize (i.e., use as a source of sulfur) the sulfur- containing compound; and

the genetically engineered E. coli converts the substrate to a product. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a low molecular weight. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight between about 30 Da and about 800 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight between about 40 Da and about 600 Da. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have a molecular weight of about 40 Da, about 50 Da, about 60 Da, about 70 Da, about 80 Da, about 90 Da, about 1 0 Da, about 110 Da, about 120 Da, about 130 Da, about 140 Da, about 150 Da, about 160 Da, about 170 Da, about 180 Da, about 190 Da, about 200 Da, about 220 Da, about 240 Da, about 260 Da, about 280 Da, about 300 Da, about 320 Da, about 340 Da, about 360 Da, about 380 Da, about 400 Da, about 420 Da, about 440 Da, about 460 Da, about 480 Da, about 500 Da, about 520 Da, about 540 Da, bout 560 Da, about 580 Da, or about 600 Da.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-watcr partition coefficient (log P) less than about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-watcr partition coefficient (log P) from about -0.5 to about 5. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds have an octanol-watcr partition coefficient (log P) of about - 0.5, about 0, about 0.5, about I , about 1.5, about 2, about 2.5, about 3, about 3.5, about 4, or about 4.5.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds arc soluble in water at about 20 °C at a concentration of between about 0.01 g L to about 1000 g L. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds arc soluble in water at about 20 °C at a concentration of about 0.01 g/L, about 0.05 g/L, about 0.1 g/L, about 0.5 g/L, about I g/L, about 5 g/L, about 10 g/L, about 15 g/L, about 20 g/L, about 25 g/L, about 30 g/L, about 35 g/L, about 40 g/L, about 45 g/L, about 50 g/L, about 55 g/L, about 60 g/L, about 65 g/L, about 70 g L, about 75 g/L, about 80 g/L, about 85 g/L, about 90 g/L, about 95 g/L, or about 100 g/L.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur -containing compounds move through the cell membrane by passive transport. Passive transport includes diffusion, facilitated diffusion, and filtration.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds move through the cell membrane by active transport, such as, for example, via an ATP-Binding Cassette (ABC) transporter or other known transmembrane transporter.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds arc transported through the cell membrane.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds are substantially non-biocidal.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing compounds arc substantially biodegradable.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing fraction comprises the phosphorus-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

In certain embodiments, the invention relates to a method, comprising the step of contacting any one of the aforementioned genetically engineered /·.'. oli with a substrate,

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of sulfur-containing compounds; the sulfur-containing fraction comprises, in an amount from about 10% by weight to about 100% by weight, a sulfur-containing compound selected from the group consisting of dimethylsulfoxide. dibenzothiophene. ethanethiol, dimercaptosuccinate, dimercaptosuccinic acid, thioacctatc, thioacctic acid, tert-butylthiol, thiourea, thiocyanatc, sodium thiocyanatc, thioacctamidc, isothiazolc, bcnzisothiazolinonc, isothiazolinonc, mcthancsulfonatc, mcthancsulfonic acid, thioglyccrol, mctabisulfitc, potassium mctabisulfitc, accsulfamc potassium, benzenesulfonate, benzenesulfonic acid, methyl benzcnesulfonate, cyclamate, sodium cyclamate, saccharin, 2,4-dithiapentanc, dioctyl sodium sulfosuccinate, meth lisothiazolinone, sulfolane, and methylchloroisothiazolinone; and

the genetically engineered E. coli converts the substrate to a product.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the sulfur-containing fraction comprises the sulfur-containing compound in about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 100% by weight.

In certain embodiments, the invention relates to a method, comprising the step of contacting any one of the aforementioned genetically engineered K. coli with a substrate,

wherein

the substrate comprises a first fraction and a second fraction;

the first fraction docs not comprise a substantial quantity of sulfur-containing compounds:

the second fraction consists essentially of a sulfur-containing compound selected from the group consisting of dimethylsulfoxide, dibenzothiophene, ethanethiol, dimercaptosuccinate, dimercaptosuccinic acid, thioacctatc, thioacctic acid, tert-butylthiol, thiourea, thiocyanatc, sodium thiocyanatc, thioacctamidc, isothiazolc, bcnzisothiazolinonc, isothiazolinonc, mcthancsulfonatc, mcthancsulfonic acid, thioglyccrol, mctabisulfitc, potassium mctabisulfitc, accsulfamc potassium, benzcnesulfonate, benzenesulfonic acid, methyl benzcnesulfonate, cyclamate, sodium cyclamate, saccharin, 2,4-dithiapcntanc, dioctyl sodium sulfosuccinate, methylisothiazolinone, sulfolane, and methylchloroisothiazolinone; and

the genetically engineered E. coli converts the substrate to a product. In certain embodiments, the invention relates to a method comprising the step of contacting any one of the aforementioned genetically engineered coli with a substrate,

wherein

5 the substrate comprises a first fraction and a second fraction;

the second fraction consists of a sulfur-containing compound selected from the group consisting of dimethylsulfoxide, dibenzothiophene, ethanethiol, dimercaptosuccinate,

10 dimcrcaptosuccinic acid, thioacetatc, thioacctic acid, tcrt-butylthiol, thiourea, thiocyanatc, sodium thiocyanate, thioacetamide, isothiazole, benzisothiazolinone, isothiazolinone, mcthancsulfonatc, mcthancsulfonic acid, thioglyccrol, mctabisulfitc, potassium mctabisulfitc, accsulfamc potassium, bcnzcncsulfonatc, bcnzcncsulfonic acid, methyl bcnzcncsulfonatc, cyclamatc, sodium cyclamatc, saccharin, 2,4-dithiapcntanc, dioctyl

I S sodium sulfosuccinatc, mcthylisothiazolinonc, sulfolanc, and mcthylchloroisothiazolinonc; and

the genetically engineered E. coli converts the substrate to a product.

0 In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a plurality of genetically engineered E. coli is used.

In certain embodiments, the invention relates to any one of the aforementioned 5 methods, wherein a non-gcnetically engineered E. coli, i.e., a native E. coli, could not metabolize (i.e., use as a source of sulfur) the sulfur-containing compound.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the pH of the substrate is from about 2.S to about 10.

In certain embodiments, the invention relates to any one of the aforementioned 0 methods, wherein the genetically engineered E. coli is contacted with the substrate at a temperature of from about 15 "C to about 80 "C. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the genetically engineered E. coli is contacted with the substrate over a time period of from about 6 h to about 10 d.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the genetically engineered E. coli is contacted with the substrate in a fcrmcntor.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein the genetically engineered E. coli is contacted with the substrate in an industrial-size fermentor.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein a plurality of genetically engineered E. coli is contacted with a plurality of substrates in a plurality of fcrmcntors, wherein the plurality of fcrmcntors arc arranged in parallel.

Exemplary Products

In certain embodiments, the invention relates to a product made by any one of the aforementioned methods.

EXEMPLIFICATION

Example I - Bacteria engineered to contain the melamine degradation pathway

Bacteria may be engineered to convert melamine into ammonia. Melamine

(C₃N₆H⁶) is a highly nitrogenous compound that can only be degraded by a very limited number of organisms including Rhodococcus sp. Strain Mel. Incorporating the pathway for melamine degradation into bacteria, accompanied with a functional food that contains compounds from the melamine degradation pathway, will provide engineered bacteria with a selective advantage over other organisms that populate the GI tract. The advantage conferred by this modification is significant enough to provide an advantage in multiple applications including propholactic therapies and the treatment of GI symptoms that may or may not be caused by bacterial infection.

Example 2 Vector construction via veast mediated ligation

Vector pNCI0 (SEQ. ID No.: 55) contains an E. coli pMBl origin of replication and ampicillin resistance gene, a Saccharomyces cerevisiae 2 μιm origin of replication and URA3 gene, and a multiple cloning site containing the 8-bp recognition sequences for Pacl, Pmcl, and Ascl. DNA of interest is inserted in the multiple cloning site via yeast mediated homologous recombination (YML) cloning (Applied & Environmental Microbiology, 72:5027-36 (2006); Plasmid, 62:88-97 (2009)). Briefly, target DNA sequences arc amplified by PCR using primers with 20-40 bp overhang homology to adjacent DNA segments in the final vector. pNC 10 or another suitable base vector is then restriction digested, creating a linearized plasmid. PCR products and linear plasmid arc transformed in S. cerevisiae, and the native S. cerevisiae gap repair mechanism assembles an intact plasmid based on homology overhangs (Figure 3).

The complete vector can then be isolated from .V. cerevisiae via a DNA extraction protocol and used to transform E. coli or other bacterial species. Concentrated vector can then be recovered from E. coli via DNA plasmid mini-prep or other suitable standard molecular biology protocols.

Example 3— Expression of melamine assimilation enzymes in E. coli

Genes from Tabic I, or suitable homologs, arc cloned into a host strain such as Escherichia coli. Enzymes native to the host organism, such as allophantc hydrolase or guanine deaminase may be ovcrcxprcsscd with a heterologous promoter.

Melamine assimilation genes, or a subset of them, can be expressed in E. coli by the construction of a vector using the yeast mediated ligation described above. Expression vectors consist of an E. coli functional promoter, a gene encoding an enzyme of the melamine assimilation pathway, and an coli functional terminator. Alternatively, several genes can be expressed from a single promoter as part of a gene opcron; in this case intcr- gene linker sequences arc placed between genes. Sequences that can act as promoters, terminators, and linkers are listed below, as well as two representative E. coli expression plasmids, AJS67 (Figure 5, expressing genes for degradation of melamine to cyanuric acid with release of three NHj per melamine) and AJS68 (Figure 6, expressing genes for degradation of cyanuric acid to NH₃ and CO₂ with release of three NH₃ per cyanuric acid). E. coli Ptach promoter

agctggtgacaattaatcatcggctcgtataatgtgtggaattgaatcgatataaggaggttaatca

E. coli trpT terminator

ctcaaaatatattttccctctatcttctcgttgcgcttaatttgactaattctcattagcgaggcgcgcctttccataggctccgcccc inter-gene operon linkers

lacZ-lac Y linker

ggaaatccatt

galT-galK linker ggaacgacc

Functional expression is assayed by enzymatic activity and the ability to confer nitrogen limited growth on the appropriate pathway intermediate. Ultimately, strains able to degrade compounds in the melamine degrcdation pathway are selected for improved utilization of the pathway via selective methods. Similar strategics arc devised for nitrogen compounds listed in Table II.

Example 4— Expression of cyanamide assimilation enzymes in E. coli

The gene expression methods described in Example 3 can also be used in Example 4. E. coli strains are unable to utilize urea as a nitrogen source, so these additional conversion steps must also be engineered. Either a urea carboxylasc/allophantc hydrolase system or a urease enzyme with appropriate accessory enzymes must be expressed in addition to a cyanamide hydrolase. Urease can be found in some E. coli isolates (Collins & Falkow, J. Bacteriology 772:7138-44 ( 1 90)) or hctcrologously expressed (Cussac ct al., J. Bacteriology, 774:2466-73 ( 1992)). Alternatively, the DUR1,2 genes from S. cerevisiae could be expressed, as shown in plasmid AJS70 (figure 8), along with a cyanamide hydratase.

Example 5 - Expression of melamine assimilation enzymes in E. coli

Several E. coli strains containing partial or complete melamine utilization pathways were constructed, as shown in Tables VI and VII. Vector and strain construction was as described in Examples 1-4. All vectors contain the ampicillin resistance gene, and 100 ug/mL ampicillin was added to all culture medium. These strains were grown in MOPS defined medium with different nitrogen sources.

E. coli strains and melamine utilization genes (steps correspond to figure 1 ):

NS88 - /r/ 4 (step 1 )

NS89 - trzA, guaD, trz (steps 1 , 2, 3)

NS90 - trzD, trzE, DUR 1 ,2 (steps 4, 5, 6)

NS 1 - none (control strain)

NS93 - iriA, native guaD selected for improved ammclinc utilization (steps 1 , 2) NS 103 - triA, guaD, trzC (steps 1 , 2, 3)

NS109 - triA, guaD, trzC, trzD 12227, irzE, DUR1 ,2 (steps 1-6)

NS110 - triA, guaD, trzC, atzD ADP, trzE, DUR1,2 (steps 1-6) Table VI

Table VII

Figure 1 1 shows the growth progress of NS88 and NS 1 (control) in media containing various concentrations of ammonium chloride or mclaminc. NS88 grown on 1 m mclaminc reaches an optical density comparable to that of the equivalent use of 2 mM ammonium chloride, suggesting that 2 mM ammonia arc liberated from mclaminc by IriA and the natively encoded guaD genes. The control strain S 1 does not grow with mclaminc as nitrogen source.

Figure 12 shows the growth progress of NS90 and NS91 (control) in media containing various concentrations of ammonium chloride or biuret. NS90 grown on 1 mM biuret reaches an optical density comparable to that of the equivalent use of 3 mM ammonium chloride, suggesting that 3 mM ammonia are liberated from biuret by trzE and the DUR 1 ,2. The control strain NS 1 does not grow with biuret as nitrogen source.

Figure 14 shows the growth progress of NS91 , NS 103, NS 109, and NS 1 10 in medium containing 0.25 mM melamine as sole nitrogen source. An average of all four strains grown on different ammonium chloride concentrations from 0 to 1.5 mM is also shown as a standard curve for growth with limiting nitrogen. NS91 grown on mclaminc is similar to the 0 mM ammonium chloride control. NS103 grown on 0.2S mM mclaminc is similar to 1 - 0.75 mM ammonium chloride, suggesting it is approximately utilizating the predicted 3 mM ammonia per I mM mclaminc. Strains NS 109 and NS 110 grown on 0.25 mM melamine are similar to 1.5 - 1.25 mM ammonium chloride, suggesting it is approximately utilizating the predicted 6 mM ammonia per 1 mM melamine.

Figure 15 shows the growth progress of NS91 , NS 103, NS 109, and NS110 in medium containing 0.25 mM ammclinc as sole nitrogen source. An average of all four strains grown on different ammonium chloride concentrations from 0 to 1.5 mM is also shown as a standard curve for growth with limiting nitrogen. NS 1 grown on ammcline is similar to the 0 mM ammonium chloride control. NS103 grown on 0.25 mM ammclinc is similar to 0.5 mM ammonium chloride, suggesting it is approximately utilizating the predicted 2 mM ammonia per I mM ammclinc. Strains NS 109 and NS 110 grown on 0.25 mM ammclinc arc similar to 1.25 - 1.0 mM ammonium chloride, suggesting it is approximately utilizating the predicted 5 mM ammonia per I mM ammclinc.

Figures 16, 17, and 18 show E. coli strains derived from E. coli K 12, E. coli MG 1655, E. coli B, and E. coli Crooks (C) containing cither pNC 12 l with the complete melamine utilization pathway, or pNC53, a control vector. See Tables VI and VII for strain details. All the strains containing pNC 121 arc able to grow on 0.5 mM mclaminc as sole nitrogen source (Figure 18). This indicates that the mclaminc utilization pathway is broadly applicable to E. coli strains that arc commonly utilized for biotechnology applications. Strains can also be selected for improved utilization of mclaminc derived nitrogen sources, in one example NS88 was passaged for 1 1 serial transfers in MOPS defined medium with 0.5 mM ammeline as sole nitrogen source. After the final passage, single colonics were isolated, and one was designated as NS93. NS93 and NS 1 were grown overnight in medium with 0.5 mM ammonium chloride as sole nitrogen source, and then inoculated in medium with 0.5 mM ammeline as sole nitrogen source. NS91 exhibited a maximum growth rate of 0.024 hr^*1 on ammeline, while NS93 exhibited a maximum growth rate of 0.087 hr^"1.

Media utilization

Cultures grown acrobically at 37 °C with 100 mg/L ampicillin. Prc-culturcs were grown in LB media with 1 0 mg/L ampicillin, washed once with an equal volume of MOPS media containing no nitrogen, and inoculated at 5% v/v of the final fermentation volume. The content of the MOPS medium is outlined in Tabic V.

Table V

MOPS defined medium

^♦Additionally 100 ug/niL ampicillin is added for plasmid maintenance. Imaging cultures in various media

Prcculturcs were grown in LB media with 100 mg L ampicillin, 0. 1 mL were directly inoculated into 5 mL MOPS media with 100 mg/L ampicillin and the indicated nitrogen source. Grown at 37 °C in a drum roller at 30 rpm (Figure 13).

Example 6 Creation of a vector for DNA vaccine plasmid selection rather than using an antibiotic resistance sene

This example describes use of plasmid pVAX 1 sold by Invitrogen/Life technologies (http://tools.lifetechnologies.com content sfs/manuals/pvax l_man.pdO, but other plasmids are also suitable starting points, such as plasmid vector VR1012 (Hartikka J, et al. 1996. Hum. Gene Thcr. 7: 1205-1217), pDNAVACCUltra (Williams JA, ct al. 2006. Vaccine 24:4671—4676), or a custom plasmid vector containing the following genetic elements: a bacterial origin of replication, a bacterial selectable marker, a mammalian promoter, an antigen target, and a polyA mammalian transcriptional terminator. To incorporate a gene of the invention in pVA l, the plasmid is restriction digested with restriction enzymes Xcm\ and /'mil. The double restriction digest will remove the kanamycin resistance gene. The kanamycin resistance gene will then be replaced with a gene of the invention that will be used for plasmid selection, in this case a codon optimized htxA gene, encoding for hypophosphite:2-oxoglutarate dioxygenase. Selection will be done using a suitable growth medium containing the appropriate nutrient that corresponds to the enzyme encoded in the gene, in this case hypophosphorous acid (a k/a phosphinic acid) or a hypophosphitc salt. See Figure 21.

Example 7 - A selection system of the invention with recombinant protein expression

For this example, an antibiotic marker is replaced by a gene of the invention to enable antibiotic free production of a protein. The protein could be used for therapeutic or research purposes. The pET expression plasmids are commonly utilized vectors to produce high concentrations of protein in E. coli

The pET System is the most powerful system yet developed for the cloning and expression of recombinant proteins in E. coli.

Target genes arc cloned in pET plasmids under control of strong bacteriophage T7 transcription and (optionally) translation signals; expression is induced by providing a source of T7 RNA polymerase in the host cell. T7 RNA polymerase is so selective and active that, when fully induced, almost all of the cell's resources arc converted to target gene expression; the desired product can comprise more than 50% of the total cell protein a few hours after induction. Although this system is extremely powerful, it is also possible to attenuate the expression level simply by lowering the concentration of inducer. Decreasing the expression level may enhance the soluble yield of some target proteins. Another important benefit of this system is its ability to maintain target genes transcriptionally silent in the uninduccd state. Target genes arc initially cloned using hosts that do not contain the T7 RNA polymerase gene, thus eliminating plasmid instability due to the production of proteins potentially toxic to the host cell. Once established in a non-expression host, target protein expression may be initiated either by infecting the host with λCE6, a phage that carries the T7 RNA polymerase gene under the control of the λ pL and pl promoters, or by transferring the plasmid into ancxprcssion host containing a chromosomal copy of the T7 RNA polymerase gene under /acUV5 control. In the second case, expression is induced by the addition of IPTG or lactose to the bacterial culture or using an autoinduction medium. Although in some cases (e.g., with innocuous target proteins) it may be possible to clone directly into expression hosts, this approach is not recommended as a general strategy. Two types of T7 promoters and several hosts that differ in their stringency of suppressing basal expression levels arc available, providing great flexibility and the ability to optimize the expression of a wide variety of target genes.

The selective markers amp (ampicillin resistance, also abbreviated Ap or bla for β- lactamasc gene) and kan (kanamycin resistance) arc available with the pET vectors. Both types of selection have been widely used, but several simple guidelines arc recommended when using vectors carrying the bla gene. While ampicillin resistance is commonly used for selection in a variety of cloning vectors, kanamycin resistance may be preferable under certain conditions, such as for protein expression in laboratories requiring GMP standards and when subcloning target genes from other ampicillin-rcsistant vectors. Ampicillin selection tends to be lost in cultures because secreted β-lactamasc and the drop in pH that accompanies bacterial fermentation both degrade the drug. Some ways to avoid this loss of selection are to replace the medium with fresh ampicillin-containing medium or to use the related drug, carbcnicillin, which is less sensitive to low pH.

Another difference between kanR and most of the ampR pET vectors involves the direction of transcription of the drug resistance gene. In kanR pET vectors, the kan gene is in the opposite orientation of the T7 promoter, so induction of the T7 promoter should not result in an increase in kan gene product. In contrast, in some ampR pET vectors the bla is located downstream and in the same orientation as the T7 promoter. All ampR pET translation vectors have the native T7 transcription terminator (Τφ) located before bla.

However, this terminator is only approximately 70% effective, allowing T7 RNA polymerase read-through to produce a small amount of β-lactamase RNA in addition to the target RNA. This results in the accumulation of β-lactamase enzyme in induced cultures. The orientation of bla has been reversed in the pET-43.1 , pET-44, pET-45b, and pET-46

Ek/LIC, pET-51 b, and pET-52b vectors, so that read-through by the T7 RNA polymerase will not result in increased levels of β-lactamase.

See Figure 22 and Figure 23.

Example 8 Examples of nutrients and corresponding genes

hypophosphitc salts (Ca, Mg, Na, ) and htxA (hypophosphitc:2-oxoglutaratc dioxygenase) phosphite salts (K, Na, Mg, Ca) and ptxD (NAD:phosphite oxidoreductase)

phosphonoacctic acid (Fosfonct sodium) and phnA (phosphonoacctatc hydrolyasc) hydroxylaminc and hydroxylaminc oxidoreductase (hao)

mcthy lphosphonatc and phnG, phnH, phnl, phnJ, phnL and phnM

phosphonoacctaldchydc and phnY

dimcthylphosphatc or dicthylphosphatc and pdeA or phoA

Claims

What is claimed is:

1. A transformed cell, comprising:

a genetic modification that encodes an enzyme selected from the group consisting of an allophanatc hydrolase, a biuret amidohydrolase, a cyanuric acid amidohydrolase, a guanine deaminase, an ammclinc hydrolase, an ammclidc hydrolyasc, a mclaminc deaminase, an isopropylammclidc isopropylaminohydrolasc, a cyanamidc hydratasc, an urease, an urea carboxylase, a glycerol-3-phosphate dehydrogenase (sn-glycerol 3- phosphate: NAD(+) oxidoreductase, EC 1. 1.1.8), a glyceraldehyde-3-phosphate dehydrogenase, an organophosphate degradation enzyme, a phosphodiesterase, a phospholipasc, a dcsulfurization enzyme, a dibcnzothiophcnc-5,5-dioxidc monooxygenase, a 2-hydroxybiphenyl-2-sulfinate sulfinolyase, a dibenzothiophene monooxygenase, and a NADH-FMN oxidoreductase;

wherein said cell is selected from the group consisting of Acidaminococcus, Bacleroides, Bifidobacterium, Blautia, Collinsella, Dorea, Eubacteriwn, Faecalibacterium, lxachnospira, Iactobacillus, Parabacteroides, Raoulte/la, Rosehuria, and Ruminococciis.

2. A transformed cell, comprising:

a genetic modification that encodes an enzyme selected from the group consisting of an allophanatc hydrolase, a biuret amidohydrolase, a cyanuric acid amidohydrolase, a guanine deaminase, an ammclinc hydrolase, an ammclidc hydrolyasc, a mclaminc deaminase, an isopropylammclidc isopropylaminohydrolasc, a cyanamidc hydratasc, an urease, an urea carboxylase, a glycerol-3-phosphatc dehydrogenase (sn-glycerol 3- phosphatc: NAD(+) oxidoreductase, EC 1.1.1.8), a glyccraldehydc-3-phosphatc dehydrogenase, an organophosphate degradation enzyme, a phosphodiesterase, a phospholipasc, a dcsulfurization enzyme, a dibcnzothiophenc-5,5-dioxide monooxygenase, a 2-hydroxybiphcnyl-2-sulfinatc sulfinolyase, a dibenzothiophene monooxygenase, and a NADH-FMN oxidoreductase;

wherein said cell is selected from the group consisting of Acidaminococcus intestinal is, Bacleroides ova t us. Bifidobacterium adolescent is, Bifidobacterium bifidum. Bifidobacterium breven, Bifidobacterium infantis. Bifidobacterium lactis, Bifidobacterium longum, Blautia producta, Clostridium cocleatum, Collinsella aerofaciens, Dorea longicatena, Eubacterium desmolans, Eubacterium eligens, Eubacterium limosum, Eubacterium rectale, Eubacterium ventriosum, Faecalibacterium prausnitzii, Lachnospira pectinoshiza, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, fxiclobacii/us delbrueckii, Lactobacillus paracasei, Lactobacillus reuteri, Listeria innocua, Parabacteroides distasonis, Roseburia faecalis, Roseburia intestinalis, Ruminococciis torques, Ruminococcus obeum, Saccharomyces boulardii. Streptococcus mitis, and Streptococcus thermophilus .

3. The transformed cell of claim 1 or 2, wherein said genetic modification is transformation with a nucleic acid comprising a gene selected from the group consisting of atzF, DUR 1 ,2 YALIOE 0727 l g, atzE, alzD, trzC, trzD, trzE, guaD, blr3880, GUD 1 /Y DL238C, YAL10E2 5740p, trzA, triA, atzC, cah, dszABC, dszA, dszABCD, dszB, dszC, dszD, gpdQ, hoc A, htxA, htxABCDEFHGIJKLMN, htxB, htxC, htxD, htxE, htxF, htxG, htxH, htxl, htxJ, htxK, htxL, htxM, hfxN, opdA, ophA, pde, pdeA, phoA, ptxABCDE, ptxD, ugpA, ugpAECB, ifgpB, ugpC, ugpE, updA, updABDE, updB, updD, and updE.

4. The transformed cell of claim 1 or 2, wherein said genetic modification is transformation with a nucleic acid comprising a gene selected from the group consisting of Rhodococcus sp. strain Mel frzE; Rhizobium leguminosarum trzE; Rhodococcus sp. strain Mel trzC; Pseudomonas sp. strain NRRLB- 12227 trzC; Fusarium oxysporum Fo5176 cah; F. pseudograminaearum CS3096 cah; Gibberella zeae PH- 1 cah; Aspergillus kawachii IFO 4308 cah; A. niger CBS 5 13.88 cah; A. niger ATCC 1015 cah; A. oryzae 3.042 cah;

5. cerevisiae FostcrsB cah; Pseudomonas sp. strain ADP atzF; S. cerevisiae DUR1 ,2; Y. lipolytica CLIB 122 YALIOE 0727 l g; Pseudomonas sp. strain ADP atzE; Pseudomonas sp. strain ADP atzD; Pseudomonas sp. strain NRRLB- 12227 trzD; Rhodococcus sp. Strain Mel atzD; Rhodococcus sp. strain Mcl trzD; E. coli K 12 strain MG 1566 guaD; Bradyrhizohium japonicum USDA 110 blr3880; .V. cerevisiae GUD I fY DL238C; Y. lipolytica CLIB 122 YAL 10E2 574()p; Williamsia sp. NRRL B-15444R trzA; Pseudomonas sp. strain NRRL B- 12227 triA; Pseudomonas sp. strain ADP atzC; Myrothecium verrucaria cah; Delftia acidoorans phosphodiesterase pdeA ; Enterobacter aerogenes updABDE gpdQ;

Flavobacterium opdA without pcriplasmic leader sequence; Pseudomonas aeruginosa PAO l phoA; Pseudomonas monteilii C11 hoc A; Pseudomonas stutzeri WM88

htxABCDEFHGIJKLMN; Pseudomonas stutzeri WM88 ptxABCDE; Rhodococcus dszD; and Rhodococcus dszABC. 5. A method of preventing, reducing the risk of, or treating a condition, comprising: administering orally, rcctally, cntcrally, or laparoscopically to a subject in need thereof a therapeutically effective amount of a transformed cell of any one of the preceding claims.

6. The method of claim 5, wherein the subject is a mammal.

7. The method of claim 6, wherein the subject is a primate, canine, feline, equine, bovine, ovine, or porcine.

8. The method of claim 7, wherein the subject is a human.

9. The method of any one of claims 5-8, wherein said condition is inflammatory bowel disease, Crohn's disease, ulcerative colitis, irritable bowel syndrome, irritable bowel movement, obesity, pouchitis, post infection colitis, gastrointestinal cancer, rheumatoid arthritis, hypcrlipidcmia, hypovitaminosis, diarrhea, antibiotic-associated diarrhea, Rotavirus-associatcd diarrhea, Clostridium difficile infection, Salmonella infection, Campylobacter jejuni infection, or an infection by an Extended Spectrum Beta Lactamase (ESBL)-producing bacteria.

10. The method of claim 9, wherein said condition is Clostridium difficile infection.

1 1. The method of any one of claims 5-10, further comprising the step of administering orally, rcctally, cntcrally, or laparoscopically to said subject a nutritionally effective amount of a functional food, wherein:

the functional food comprises a compound; said compound is a nitrogen- containing compound, a phosphorus-containing compound, or a sulfur-containing compound;

the transformed cell can metabolize said compound; and

a native cell of the same species as the transformed cell cannot metabolize the compound.

12. A functional food, comprising a compound; wherein

said compound is a nitrogen-containing compound, a phosphorus-containing compound, or a sulfur-containing compound;

a transformed cell of any one of claims 1 -4 can metabolize said compound; and a native cell of the same species as the transformed cell cannot metabolize said compound.

13. The functional food of claim 12, further comprising a transformed cell of any one of claims 1 -4.

14. The functional food of claim 12 or 13, wherein:

said functional food comprises a nitrogen-containing fraction and a non-nitrogen containing fraction;

the nitrogen-containing fraction comprises, in an amount from about 10% by weight to about 100% by weight, one or more nitrogen-containing compounds of any one of Formulas I-III, or a salt thereof;

a native cell of the same species as the transformed cell cannot metabolize (i.e., use as a source of nitrogen) the nitrogen-containing compound(s); and

the compound of formula I is

wherein, independently for each occurrence,

is a five-, six, nine-, or ten-membered aryl or heteroaryl group; R is -OH, -CO₂H, -NO₂, -CN, substituted or unsubstituted amino, or substituted or unsubstituted alkyl; and

n is 0, 1 , 2, 3, 4, or 5;

the compound of formula II is

wherein, independently for each occurrence,

X is -NH-, -N(alkyl)-, -0-, -C(R')₂-, -S-, or absent;

Y is -H, -NH_:, -N(H)(alkyl), -N(alkyl)₂, -C0₂H, -CN, or substituted or unsubstituted alkyl; and R¹ is -H, -OH, -CO₂H, -NO₂, -CN, substituted or unsubstitutcd amino, or substituted or unsubstitutcd alkyl; and

the compound of formula III is

wherein, independently for each occurrence,

Y is -H, -NH₂, -N(HXalkyl), -N(alkyl)₂, CO₂H , -CN, or substituted or unsubstitutcd alkyl.

15. The functional food of claim 14, wherein the one or more nitrogen-containing compounds are selected from the group consisting of Hydrazine, 5-Aminotctrazole, Tetrazole, Mclaminc, Cyanamide, 2-Cyanoguanidine, Sodium azide, Carbohydrazide, 1 ,2,3-Triazolc, 1 ,2,4-Triazole, 1 ,3-Diaminoguanidinc HC1, Ammelinc, 1 ,3,5-triazine, Aminoacetonitrile, Cyanoethylhydrazine, Azodicarbonamide, Biurea, Formamidoxime, 1 ,2- Dimethylhydrazine, 1 , 1 -Dimethylhydrazine, ethylhydrazine, Ethylenediamine, Sodium dicyanamidc, Guanidinc carbonate, Mcthylaminc, Ammclidc, Hydroxylaminc,

Malononitrilc, Biuret, Dicthylcnctriaminc, Hcxamcthylcnctctraminc, Tricthylcnctctraminc, 1 ,3-Diaminopropanc, Tricthylcnctctraminc, 1 ,3-Diaminopropanc, Hydroxyurea,

Tctracthylcncpcntamine, Thiourea, Succinonitrilc, Calcium cyanamide, Cyanuric acid, Aminocthylpipcrazinc, Pipcrazinc, Dimcthylaminc, Ethylaminc, dalfampridinc,

Tctranitromcthanc, Imidazolidinyl urea, Trinitromcthanc, malonamidc, Chloramine, Allophanatc, Tri mcthylaminc, Nitromcthanc, Acctaldoximc, Diazolidinyl urea, 1 ,2- Cyclohexanedione dioxime, Acetone oxime, Thioacetamide, Sodium thiocyanate,

Isothiazolc, Thiazolc, Dimcthylacctamidc, Isothiazolinonc, Methylene blue,

Dicthanolaminc, Aspartame, Bcnzisothiazolinonc, and Accsulfamc potassium.

16. The functional food of any one of claims 12- 15, wherein

said functional food comprises a phosphorus-containing fraction and a non- phosphorus-containing fraction;

the phosphorus-containing fraction comprises, in an amount from about 10% by weight to about 100% by weight, one or more phosphorus-containing compounds of any one of Formulas IV-VI; a native cell of the same species as the transformed cell cannot metabolize (i.e., use as a source of phosphorus) the phosphorus-containing compound(s); and

the compound of formula IV is

wherein, independently for each occurrence,

R is -H, alkyl, -OH, -OR², -SH, or -SR²;

R¹ is -H, or alkyl;

Y is O or S;

Y¹ is O or S; and

R² is alkyl;

the compound of formula V is

wherein, independently for each occurrence,

R¹ is -H, or alkyl; and

Y¹ is O or S; and

the compound of formula VI is

wherein, independently for each occurrence,

R³ is -H, -OH, -OR⁴, -SH, -SR⁴, halo, alkyl, aryl, heteroaryl, aralkyl, or hctcroaralkyl; and

R⁴ is alkyl or aryl.

17. The functional food of claim 16, wherein the one or more phosphorus-containing compounds arc selected from the group consisting of a hypophosphitc salt, a phosphite salt, phosphonoacctic acid, a phosphonoacctatc salt, a phosphonoacctatc ester, a

mcthylphosphonatc ester, a mcthylphosphonatc salt, phosphonoacctaldchydc,

hypophosphitc, hypophosphorous acid, phosphorous acid, phosphite, diethyl phosphate, tricthyl phosphate, trimcthyl phosphate, dimethyl phosphate, diethyl phosphite, tricthyl phosphite, trimcthyl phosphite, dimethyl phosphite, glyphosatc, Ο,Ο,Ο-tricthyl

phosphorothioate, etidronate, etidronic acid, methylene diphosphonate, disodium methylene diphosphonatc, medronic acid, clodronatc, clodronatc disodium, clodronic acid, tiludronatc, tiludronic acid, zolcdronatc, zolcdronic acid, oxidronatc, and oxidronic acid.

18. The functional food of any one of claims 12-17, wherein

said functional food comprises a sulfur-containing fraction and a non-sulfur- containing fraction;

the sulfur-containing fraction comprises, in an amount from about 10% by weight to about 100% by weight, one or more sulfur-containing compounds of any one of

Formulas VII-XIV;

a native cell of the same species as the transformed cell cannot metabolize (i.e., use as a source of sulfur) the sulfur-containing compound(s); and

the compound of formula VII is

wherein, independently for each occurrence,

R⁵ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, heteroaralkyl, -SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁶ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, heteroaryl, aralkyl, heteroaralkyl, -SO₂H, -NHR⁷, or -NH-C(=O)-R⁷; and

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- mcmbcrcd ring;

the compound of formula IIX, formula IX, or formula X, is

wherein, independently for each occurrence,

R⁸ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hetcroaryl, aralkyl, heteroaralkyl, -SO₂H, -NHR⁷, or -NH-C(=O)-R⁷;

R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6- membered ring;

the compound of formula XI, formula XII, or formula XIII is

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hetcroaryl, aralkyl, heteroaralkyl, -SO₂H, -NH₂, -NHR⁷, or -NH-C(=O)-R⁷;

R'° is hydroxyalkyl, R⁹, or -(CH₂)_XR⁹; and

x is 1 , 2, 3, or 4; and

the compound of formula XIV is

wherein, independently for each occurrence,

R⁹ is -H, -OH, -OR⁷, -SH, -SR⁷, R⁷, halo, alkyl, aryl, hetcroaryl, aralkyl, heteroaralkyl, -SO₂H, -NH₂, -NHR⁷, or -NH-C(=O)-R⁷; and R⁷ is cycloalkyl, alkyl, or aryl, or any two R⁷, taken together, form a 5- or 6-mcmbcrcd ring.

19. The functional food of claim 18, wherein the one or more sulfur-containing compounds arc selected from the group consisting of dimcthylsulfoxidc, dibenzothiophene, cthancthiol, dimcrcaptosuccinatc, dimcrcaptosuccinic acid, thioacctatc, thioacctic acid, tcrt- butylthiol, thiourea, thiocyanate, sodium thiocyanate, thioacetamide, isothiazole, benzisothiazolinone, isothiazolinone, methanesulfonate, methanesulfonic acid, thioglycerol, metabisulfite, potassium metabisulfite, acesulfame potassium, benzenesulfonate, bcnzcncsulfonic acid, methyl benzenesulfonate, cyclamatc, sodium cyclamatc, saccharin, 2,4-dithiapentane, dioctyl sodium sulfosuccinate, methylisothiazolinone, sulfolane, and mcthy lchloro isothiazol inonc.

20. The functional food of any one of claims 12-19, further comprising an

immunoglobulin-containing fraction.

21. The functional food of claim 20, wherein said immunoglobulin-containing fraction is about 1% by weight to about 40% by weight of the functional food.