WO2015153800A2 - Compositions for modulating sod-1 expression - Google Patents

Compositions for modulating sod-1 expression Download PDF

Info

Publication number
WO2015153800A2
WO2015153800A2 PCT/US2015/023934 US2015023934W WO2015153800A2 WO 2015153800 A2 WO2015153800 A2 WO 2015153800A2 US 2015023934 W US2015023934 W US 2015023934W WO 2015153800 A2 WO2015153800 A2 WO 2015153800A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
modified
sugar
tds
internucleoside linkage
Prior art date
Application number
PCT/US2015/023934
Other languages
French (fr)
Other versions
WO2015153800A3 (en
Inventor
Eric E. Swayze
Tracy COLE
Holly Kordasiewicz
Susan M. Freier
Thomas P. Condon
Edward Wancewicz
Trisha Lockhart
Timothy Vickers
Priyam SINGH
Original Assignee
Isis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US201461973803P priority Critical
Priority to US61/973,803 priority
Application filed by Isis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Priority claimed from US15/301,004 external-priority patent/US10385341B2/en
Publication of WO2015153800A2 publication Critical patent/WO2015153800A2/en
Publication of WO2015153800A3 publication Critical patent/WO2015153800A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y115/00Oxidoreductases acting on superoxide as acceptor (1.15)
    • C12Y115/01Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
    • C12Y115/01001Superoxide dismutase (1.15.1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3231Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications

Abstract

Disclosed herein are antisense compounds and methods for decreasing SOD-1 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate SOD-1 associated diseases, disorders, and conditions. Such SOD-1 associated diseases include amyotrophic sclerosis (ALS).

Description

COMPOSITIONS FOR MODULATING SOD-1 EXPRESSION Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0240WOSEQ_ST25.pdf created March 30, 2015, which is 320 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

Provided are compositions and methods for reducing expression of superoxide dismutase 1 , soluble (SOD-1) mPvNA and protein in an animal. Such methods are useful to treat, prevent, or ameliorate neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) by inhibiting expression of SOD-1 in an animal.

Background

The soluble SOD-1 enzyme (also known as Cu/Zn superoxide dismutase) is one of the superoxide dismutases that provide defense against oxidative damage of biomolecules by catalyzing the dismutation of superoxide to hydrogen peroxide (H202) (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). The superoxide anion (02-) is a potentially harmful cellular by-product produced primarily by errors of oxidative phosphorylation in mitochondria (Turrens, J. Physiol. 2003, 552, 335-344)

Mutations in the SOD-1 gene are associated with a dominantly-inherited form of amyotrophic lateral sclerosis (ALS, also known as Lou Gehrig's disease) a disorder characterized by a selective degeneration of upper and lower motor neurons (Rowland, N. Engl. J. Med. 2001, 344, 1688-1700). There is a tight genetic linkage between familial ALS and missense mutations in the SOD1 gene (Rosen, Nature, 1993, 362, 59-62).

The toxicity of mutant SOD1 is believed to arise from an initial misfolding (gain of function) reducing nuclear protection from the active enzyme (loss of function in the nuclei), a process that may be involved in

ALS pathogenesis (Sau, Hum. Mol. Genet. 2007, 16, 1604-1618).

ALS is a devastating progressive neurodegenerative disease affecting as many as 30,000 Americans at any given time. The progressive degeneration of the motor neurons in ALS eventually leads to their death.

When the motor neurons die, the ability of the brain to initiate and control muscle movement is lost. With voluntary muscle action progressively affected, patients in the later stages of the disease may become totally paralyzed.

Currently lacking are acceptable options for treating such neurodegenerative diseases. It is therefore an object herein to provide methods for the treatment of such diseases. Summary

Provided herein are methods, compounds, and compositions for modulating expression of superoxide dismutase 1, soluble (SOD-1) mRNA and protein. In certain embodiments, compounds useful for modulating expression of SOD-1 mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds are modified oligonucleotides.

In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, SOD-1 mRNA levels are reduced. In certain embodiments, SOD-1 protein levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.

Also provided are methods, compounds, and compositions useful for preventing, treating, and ameliorating diseases, disorders, and conditions. In certain embodiments, such SOD-1 related diseases, disorders, and conditions are neurodegenerative diseases. In certain embodiments, such neurodegenerative diseases, disorders, and conditions include amyotrophic lateral sclerosis (ALS).

Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common. Certain risk factors and causes for development of ALS include growing older, having a personal or family history, or genetic predisposition. However, the majority of ALS cases are sporadic and no known risk factors are known. Certain symptoms and outcomes associated with development of ALS include but are not limited to: fasciculations, cramps, tight and stiff muscles (spasticity), muscle weakness affecting an arm or a leg, slurred and nasal speech, difficulty walking, difficulty chewing or swallowing (dysphagia), difficulty speaking or forming words (dysarthria), weakness or atrophy, spasticity, exaggerated reflexes (hyperreflexia), and presence of Babinski's sign. As ALS progresses, symptoms and outcomes by include weakening of other limbs, perhaps accompanied by twitching, muscle cramping, and exaggerated, faster reflexes; problems with chewing, swallowing, and breathing; drooling may occur; eventual paralysis; and death.

In certain embodiments, methods of treatment include administering an SOD-1 antisense compound to an individual in need thereof. In certain embodiments, methods of treatment include administering an SOD-1 modified oligonucleotide to an individual in need thereof.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Additionally, as used herein, the use of "and" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise. Also, all sequences described herein are listed 5' to 3', unless otherwise stated.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this disclosure, including, but not limited to, patents, patent applications, published patent applications, articles, books, treatises, and GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis.

Unless otherwise indicated, the following terms have the following meanings:

"2'-deoxynucleoside" (also 2'-deoxyribonucleoside) means a nucleoside comprising 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleosides (DNA). In certain embodiments, a 2'- deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (e.g., uracil).

"2'-deoxyribose sugar" means a 2'-H furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA).

"2'-0-methoxyethyl" (also 2'-MOE and 2'-OCH2CH2-OCH3 and MOE and 2'-0- methoxyethylribose) refers to an O-methoxy-ethyl modification of the 2' position of a furanose ring. A 2'-0- methoxyethylribose modified sugar is a modified sugar.

"2'-0-methoxyethylribose modified nucleoside" (also2'-MOE nucleoside) means a nucleoside comprising a 2' -MOE modified sugar moiety.

"2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2 '-position of the furanose ring other than H or OH. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications.

"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5- methylcytosine is a modified nucleobase. "About" means within ±10% of a value. For example, if it is stated, "the compounds affected at least about 50% inhibition of SOD-1", it is implied that the SOD-1 levels are inhibited within a range of 45% and 55%. "Administered concomitantly" refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time.

Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

"Administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.

"Amelioration" refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

"Antibody" refers to a molecule characterized by reacting specifically with an antigen in some way, where the antibody and the antigen are each defined in terms of the other. Antibody may refer to a complete antibody molecule or any fragment or region thereof, such as the heavy chain, the light chain, Fab region, and Fc region.

"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

"Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single- stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

"Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound.

"Antisense mechanisms" are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.

"Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid. "Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.

"Bicyclic sugar" means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.

"Bicyclic nucleic acid" or "BNA" refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.

"cEt" or "constrained ethyl" or "cEt modified sugar" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4 '-carbon and the 2 '-carbon, wherein the bridge has the formula: 4'-CH(CH3)-0-2'. A cEt modified sugar is a modified sugar.

"cEt modified nucleoside" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH3)-0-2'. A cEt modified sugar is a modified sugar.

"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'- O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-0- methoxyethyl modifications.

"Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.

"Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

"Comprise," "comprises," and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

"Contiguous nucleobases" means nucleobases immediately adjacent to each other.

"Designing" or "designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule. "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.

"Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.

"Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

"Efficacy" means the ability to produce a desired effect.

"Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.

"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as the "wings."

"Gap-narrowed" means a chimeric antisense compound having a gap segment of 9 or fewer contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides.

"Gap-widened" means a chimeric antisense compound having a gap segment of 12 or more contiguous 2'-deoxyribonucleosides positioned between and immediately adjacent to 5' and 3' wing segments having from 1 to 6 nucleosides. "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.

"Identifying an animal having a SOD-1 associated disease" means identifying an animal having been diagnosed with a SOD-1 associated disease or predisposed to develop a SOD-1 associated disease.

Individuals predisposed to develop a SOD-1 associated disease include those having one or more risk factors for developing a SOD-1 associated disease, including, growing older, having a personal or family history, or genetic predisposition of one or more SOD-1 associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.

"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.

"Individual" means a human or non-human animal selected for treatment or therapy.

"Inhibiting SOD-1" means reducing the level or expression of a SOD-1 m NA and/or protein. In certain embodiments, SOD-1 mRNA and/or protein levels are inhibited in the presence of an antisense compound targeting SOD-1, including a modified oligonucleotide targeting SOD-1, as compared to expression of SOD-1 mRNA and/or protein levels in the absence of a SOD-1 antisense compound, such as a modified oligonucleotide.

"Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage. "Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

"Mixed backbone" means a pattern of internucleoside linkages including at least two different internucleoside linkages. For example, an oligonucleotide with a mixed backbone may include at least one phosphodiester linkage and at least one phosphorothioate linkage.

"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e., a phosphodiester internucleoside bond).

"Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

A "modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. "Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and/or modified nucleobase.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified

internucleoside linkage, modified sugar, and/or modified nucleobase.

"Modified sugar" means substitution and/or any change from a natural sugar moiety.

"Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

"Motif means the pattern of unmodified and modified nucleosides in an antisense compound.

"Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2' -OH).

"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

"Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

"Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).

"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

"Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.

"Nucleoside" means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

"Off-target effect" refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

"Oligomeric compound" or "oligomer" means a polymer of linked monomelic subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

"Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.

"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.

"Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, a modified oligonucleotide targeted to SOD-1 is a pharmaceutical agent.

"Pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise a modified oligonucleotide and a sterile aqueous solution.

"Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e. , salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound. "Prevent" or "preventing" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.

"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.

"Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

"Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

"Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

"Salts" mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.

"Shortened" or "truncated" versions of oligonucleotides SOD-lght herein have one, two or more nucleosides deleted.

"Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.

"Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a

complementary strand.

"Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.

"Slows progression" means decrease in the development of the disease.

"SOD-1" means the mammalian gene superoxide dismutase 1, soluble (SOD-1), including the human gene superoxide dismutase 1, soluble (SOD-1).

"SOD-1 associated disease" means any disease associated with any SOD-1 nucleic acid or expression product thereof. Such diseases may include a neurodegenerative disease. Such neurodegenerative diseases may include amyotrophic lateral sclerosis (ALS).

"SOD-1 mRNA" means any messenger RNA expression product of a DNA sequence encoding SOD-

1.

"SOD-1 nucleic acid" means any nucleic acid encoding SOD-1. For example, in certain

embodiments, a SOD-1 nucleic acid includes a DNA sequence encoding SOD-1, an RNA sequence transcribed from DNA encoding SOD-1 (including genomic DNA comprising introns and exons), and a mRNA sequence encoding SOD-1. "SOD-1 mRNA" means a mRNA encoding a SOD-1 protein.

"SOD-1 protein" means the polypeptide expression product of a SOD-1 nucleic acid.

"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.

"Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

"Subject" means a human or non-human animal selected for treatment or therapy.

"Sugar chemistry motif means a pattern of sugar modifications including at least two different sugar modifications. For example, an oligonucleotide with a mixed backbone may include at least one 2'-0- methoxyethyl modified nucleoside, and/or one cEt modified nucleoside, and/or one 2'-deoxynucleoside.

"Target" refers to a protein, the modulation of which is desired.

"Target gene" refers to a gene encoding a target.

"Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

"Target nucleic acid," "target RNA," and "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds.

"Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.

"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.

"Treat" or "treating" or "treatment" refers administering a composition to effect an alteration or improvement of the disease or condition.

"Unmodified nucleobases" mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

"Wing segment" means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases. Certain Embodiments

Certain embodiments provide methods, compounds, and compositions for inhibiting SOD-1 m NA and protein expression. Certain embodiments provide methods, compounds, and composition for decreasing SOD-1 mRNA and protein levels.

Certain embodiments provide antisense compounds targeted to a SOD-1 nucleic acid. In certain embodiments, the SOD-1 nucleic acid is the sequence set forth in GENBANK Accession No. NM 000454.4 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000 (incorporated herein as SEQ ID NO: 2), and the complement of

GENBANK Accession No. NW 001114168.1 truncated from nucleotides 2258000 to 2271000 (incorporated herein as SEQ ID NO: 3).

Certain embodiments provide methods for the treatment, prevention, or amelioration of diseases, disorders, and conditions associated with SOD-1 in an individual in need thereof. Also contemplated are methods for the preparation of a medicament for the treatment, prevention, or amelioration of a disease, disorder, or condition associated with SOD-1. SOD-1 associated diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, SOD-1 associated diseases include amyotrophic lateral sclerosis (ALS).

Embodiment 1. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 118-1461.

Embodiment 2. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least

20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15, 21, 23, 47, 54, and 67, wherein at least one internucleoside linkage is a phosphodiester linkage.

Embodiment 3. The compound of any preceding embodiment, wherein the modified oligonucleotide has a mixed backbone.

Embodiment 4. The compound of embodiment 3, wherein the mixed backbone motif is any of the following:

sossssssssoooss,

sooossssssssoss,

sooosssssssssoss, soosssssssssooss,

sooossssssssooss,

sooosssssssssooss,

sooossssssssssooss,

sooosssssssssssooos,

soooossssssssssooss,

sooosssssssssssooss,

sososssssssssssosos, and

sooossssssssssoooss, wherein

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 5. The compound of any preceding embodiment, wherein the modified oligonucleotide has a sugar chemistry motif of any of the following:

ekddddddddekekee,

kekeddddddddekek,

eeeedddddddddkkee,

eeeeddddddddekeke,

eeeeddddddddkekee,

eeeeddddddddkkeee,

eeeeeddddddddkkee,

eeeekddddddddkeee,

eeeekdddddddkeeee,

eeekddddddddkeeee,

eeekkdddddddkkeee,

eekkdddddddddkkee,

eekkddddddddeeeee,

eekkddddddddkkeee,

ekekddddddddeeeee,

ekekddddddddkekee, and

kekeddddddddeeeee, wherein

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

Embodiment 6. The compound of any preceding embodiment, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1 or SEQ ID NO: 2.

Embodiment 7. The compound of any preceding embodiment, consisting of a single-stranded modified oligonucleotide.

Embodiment 8. The compound of any preceding embodiment, wherein at least one internucleoside linkage is a modified internucleoside linkage.

Embodiment 9. The compound of embodiment 8, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 10. The compound of embodiment 9, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 11. The compound of any preceding embodiment, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

Embodiment 12. The compound of any preceding embodiment, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

Embodiment 13. The compound of any preceding embodiment, wherein at least one nucleoside comprises a modified nucleobase.

Embodiment 14. The compound of embodiment 13, wherein the modified nucleobase is a 5- methylcytosine.

Embodiment 15. The compound of any preceding embodiment, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

Embodiment 16. The compound of embodiment 15, wherein the at least one modified sugar is a bicyclic sugar.

Embodiment 17. The compound of embodiment 16, wherein the bicyclic sugar comprises a chemical link between the 2' and 4' position of the sugar 4'-CH2-N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.

Embodiment 18. The compound of embodiment 17, wherein the bicyclic sugar comprises a 4'-CH2- N(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.

Embodiment 19. The compound of embodiment 15, wherein at least one modified sugar comprises a 2 ' -O -methoxyethyl grou .

Embodiment 20. The compound of embodiment 15, wherein the modified sugar comprises a 2'- 0(CH2)2-OCH3 group.

Embodiment 21. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 10 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 22. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 9 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 23. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. Embodiment 24. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 4 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 25. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 5 linked nucleosides; and

a 3' wing segment consisting of 7 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 26. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 8 linked deoxynucleosides;

a 5' wing segment consisting of 6 linked nucleosides; and

a 3' wing segment consisting of 6 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 27. The compound of any preceding embodiment, wherein the modified oligonucleotide comprises:

a gap segment consisting of 9 linked deoxynucleosides;

a 5' wing segment consisting of 6 linked nucleosides; and

a 3' wing segment consisting of 5 linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

Embodiment 28. The compound of any preceding embodiment, wherein the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides.

Figure imgf000018_0001

 Embodiment 30. A compound consisting of a modified oligonucleotide according to the following formula:

Figure imgf000019_0001

Figure imgf000020_0001



Figure imgf000021_0001

20

Figure imgf000022_0001

21 Embodiment 34. A compound consisting of a modified oligonucleotide according to the following formula:

Figure imgf000023_0001

Embodiment 35. A compound consisting of a modified oligonucleotide according to the following formula:

Figure imgf000024_0001

Embodiment 36. A compound consisting of a modified oligonucleotide according to the following formula:

Figure imgf000025_0001

Embodiment 37. A compound consisting of a modified oligonucleotide according to the following formula: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage. Embodiment 38. A compound consisting of a modified oligonucleotide according to the following formula: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te; wherein,

A = an adenine,

mC = a S'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2,-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 39. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 40. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar, s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 41. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; wherein,

A = an adenine,

mC = a S'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2' -O-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2,-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 42. A compound consisting of a modified oligonucleotide according to the following formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a -O-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 43. A compound consisting of a modified oligonucleotide according to the following formula: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2' -O-methoxyethylribose modified sugar,

k = a cEt modified sugar, d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 44. A compound consisting of a modified oligonucleotide according to the following formula: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 45. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCeo Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Ges mCes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 46. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Ges mCeo Aeo mCeo Ges mCes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar, d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 47. A compound consisting of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Geo mCes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 48. A compound consisting of a modified oligonucleotide according to the following formula: Aes mCeo Aeo mCeo mCes Tds Tds mCds Ads mCds Tds Gds Gds Tds mCds mCeo Aeo Teo Tes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 49. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCeo Aes mCe, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar, d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 50. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tes mCds mCds mCds Ads Ads Tds Tds Ads mCeo Aeo mCeo mCes Aes mCe, wherein,

A = an adenine,

mC = a S'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 51. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Aes mCeo Aeo mCeo mCes Aes mCe, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 52. A compound consisting of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aeo Tes mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCes Aes mCe, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine, e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 53. A compound consisting of a modified oligonucleotide according to the following formula: Ges Teo mCeo Geo mCes mCds mCds Tds Tds mCds Ads Gds mCds Ads mCds Geo mCeo Aeo mCes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 54. A compound consisting of a modified oligonucleotide according to the following formula: Tes mCeo Geo mCeo mCes mCds Tds Tds mCds Ads Gds mCds Ads mCds Gds mCeo Aeo mCeo Aes mCe, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 21-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Embodiment 55. A compound consisting of a modified oligonucleotide according to the following formula: Ges Aes Aes Aes Tes Tds Gds Ads Tds Gds Ads Tds Gds mCds mCds mCes Tes Ges mCes Ae, wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine, e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar, and

s = a phosphorothioate internucleoside linkage.

Embodiment 56. A composition comprising the compound of any preceding embodiment or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.

Embodiment 57. A method comprising administering to an animal the compound or composition of any preceding embodiment.

Embodiment 58. The method of embodiment 57, wherein the animal is a human.

Embodiment 59. The method of embodiment 57, wherein administering the compound prevents, treats, ameliorates, or slows progression of a SOD-1 associated disease.

Embodiment 60. The method of embodiment 59, wherein the SOD-1 associated disease is a neurodegenerative disease.

Embodiment 61. The method of embodiment 60, wherein the SOD-1 associated disease is ALS.

Embodiment 62. Use of the compound or composition of any preceding embodiment for the manufacture of a medicament for treating a neurodegenerative disorder.

Embodiment 63. Use of the compound or composition of any preceding embodiment for the manufacture of a medicament for treating ALS.

Embodiment 64. The compound or composition of any preceding embodiment wherein the modified oligonucleotide does not have the nucleobase sequence of SEQ ID NO: 21.

Embodiment 65. The compound or composition of any preceding embodiment wherein the modified oligonucleotide does not have the nucleobase sequence of any of SEQ ID NOs: 21-118.

Embodiment 66. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence, wherein the nucleobase sequence comprises an at least 12 consecutive nucleobase portion complementary to an equal number of nucleobases of nucleotides 665 to 684 of SEQ ID NO: 1, wherein the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.

Embodiment 67. The compound of embodiment 66, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO: 1.

Embodiment 68. The compound of embodiment 66, wherein the modified oligonucleotide is a single- stranded modified oligonucleotide.

Embodiment 69. The compound of embodiments 66-68 wherein at least one internucleoside linkage is a modified internucleoside linkage.

Embodiment 70. The compound of embodiment 69, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 71. The compound of embodiment 70, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.

Embodiment 72. The compound of embodiments 66-69, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

Embodiment 73. The compound of embodiments 66-71 and 72-73, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.

Embodiment 74. The compound of embodiments 66-73, wherein at least one nucleoside comprises a modified nucleobase.

Embodiment 75. The compound of embodiment 74, wherein the modified nucleobase is a 5- methylcytosine.

Embodiment 76. The compound of embodiments 66-75, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.

Embodiment 77. The compound of embodiment 76, wherein the at least one modified sugar is a bicyclic sugar.

Embodiment 78. The compound of embodiment 77, wherein the bicyclic sugar comprises a 4'- CH(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.

Embodiment 79. The compound of embodiment 78, wherein R is methyl.

Embodiment 80. The compound of embodiment 78, wherein R is H.

Embodiment 81. The compound of embodiment 76, wherein the at least one modified sugar comprises a 2'-0-methoxyethyl group. Antisense Compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, modified oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 12 to 30 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 12 to 25 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 12 to 22 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 14 to 20 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 15 to 25 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 18 to 22 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 19 to 21 subunits in length. In certain embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 30, 18 to 50, 19 to 30, 19 to 50, or 20 to 30 linked subunits in length.

In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 12 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 13 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 14 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 15 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 16 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 17 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 18 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 19 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 20 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 21 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 22 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 23 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 24 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 25 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 26 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 27 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 28 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 29 subunits in length. In certain embodiments, an antisense compound targeted to a SOD-1 nucleic acid is 30 subunits in length. In certain embodiments, the antisense compound targeted to a SOD-1 nucleic acid is 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In certain embodiments the antisense compound is a modified

oligonucleotide, and the linked subunits are nucleosides.

In certain embodiments, oligonucleotides targeted to a SOD-1 nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a SOD-1 nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.

When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.

It is possible to increase or decrease the length of an antisense compound, such as a modified oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.

Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase

oligonucleotides, including those with 1 or 3 mismatches.

Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase oligonucleotides, and a 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.

Antisense Compound Motifs

In certain embodiments, antisense compounds targeted to a SOD-1 nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE, and 2'-0-CH3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'-(CH2)n-0-2' bridge, where n=l or n=2 and 4'-CH2-0-CH2-2'). In certain embodiments, wings may include several modified sugar moieties, including, for example 2'-MOE. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2'-MOE nucleosides and 2'-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing, "Y" represents the length of the gap, and "Z" represents the length of the 3' wing. "X" and "Z" may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" may include one or more 2'-deoxynucleosides. "Y" may comprise 2'-deoxynucleosides. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap is positioned immediately adjacent to each of the 5' wing and the 3' wing. Thus, no intervening nucleotides exist between the 5' wing and gap, or the gap and the 3 ' wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments they are different.

In certain embodiments, gapmers provided herein include, for example 20-mers having a motif of 5-

10-5.

In certain embodiments, gapmers provided herein include, for example 19-mers having a motif of 5- 9-5.

In certain embodiments, gapmers provided herein include, for example 18-mers having a motif of 5-

8-5.

In certain embodiments, gapmers provided herein include, for example 18-mers having a motif of 4-

8-5.

In certain embodiments, gapmers provided herein include, for example 18-mers having a motif of 5-

8-7.

In certain embodiments, gapmers provided herein include, for example 18-mers having a motif of 6-

8-6.

In certain embodiments, gapmers provided herein include, for example 18-mers having a motif of 6- 8-5.

In certain embodiments, the modified oligonucleotide contains at least one 2'-0-methoxyethyl modified nucleoside , at least one cEt modified nucleoside , and at least one 2'-deoxynucleoside. In certain embodiments, the modified oligonucleotide has a sugar chemistry motif of any of the following:

ekddddddddekekee

kekeddddddddekek

eeeedddddddddkkee

eeeeddddddddekeke

eeeeddddddddkekee

eeeeddddddddkkeee

eeeeeddddddddkkee

eeeekddddddddkeee

eeeekdddddddkeeee

eeekddddddddkeeee

eeekkdddddddkkeee

eekkdddddddddkkee eekkddddddddeeeee

eekkddddddddkkeee

ekekddddddddeeeee

ekekddddddddkekee

kekeddddddddeeeee, wherein

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar, Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode SOD-1 include, without limitation, the following: GENBANK Accession No. NM 000454.4 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No.

NT 011512.10 truncated from nucleotides 18693000 to 18704000 (incorporated herein as SEQ ID NO: 2), and the complement of GENBANK Accession No. NW 001114168.1 truncated from nucleotides 2258000 to 2271000 (incorporated herein as SEQ ID NO: 3).

It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for SOD-1 can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.

Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.

Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.

The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in SOD-1 mRNA levels are indicative of inhibition of SOD-1 expression. Reductions in levels of a SOD-1 protein are also indicative of inhibition of target mRNA expression. Phenotypic changes are indicative of inhibition of SOD-1 expression. Improvement in neurological function is indicative of inhibition of SOD-1 expression. Improved motor function is indicative of inhibition of SOD-1 expression.

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a SOD-1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g.,

Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a SOD-1 nucleic acid. Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a SOD- 1 nucleic acid).

Non-complementary nucleobases between an antisense compound and a SOD-1 nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a SOD-1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%o, 99%), or 100% complementary to a SOD-1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four)

noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or

complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary {i.e., 100%> complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a SOD-1 nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a SOD-1 nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18,

19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a SOD-1 nucleic acid, or specified portion thereof.

The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds, are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3 Or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide. Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.

Representative phosphorus containing internucleoside linkages include, but are not limited to,

phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, modified oligonucleotides targeted to a SOD-1 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate internucleoside linkage.

In certain embodiments, the modified oligonucleotides targeted to a SOD-1 nucleic acid comprise one or more phosphodiester internucleoside linkages. In certain embodiments, modified oligonucleotides targeted to a SOD-1 nucleic acid comprise at least one phosphorothioate internucleoside linkage and at least one phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has a mixed backbone motif of the following:

sossssssssoooss,

sooossssssssoss,

sooosssssssssoss,

soosssssssssooss,

sooossssssssooss,

sooosssssssssooss, sooossssssssssooss,

sooosssssssssssooos,

soooossssssssssooss,

sooosssssssssssooss,

sososssssssssssosos, and

sooossssssssssoooss, wherein

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage. Modified Sugar Moieties

Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non- geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R2) (R, Ri and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F- 5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent

Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5*-vinyl, 5*-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'- OCH2CH2F and 2'-0(CH2)2OCH substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, OCF3, OCH2F, 0(CH2)2SCH3, 0(CH2)2-0-N(Rm)(Rn), 0-CH2-C(=0)-N(Rm)(Rn), and 0-CH2-C(=0)-N(Ri)-(CH2)2-N(Rm)(Rn), where each Rls Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl.

As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH2)-0-2' (LNA); 4'-(CH2)-S-2'; 4,-(CH2)2-0-2' (ENA); 4'-CH(CH3)-0-2' and 4*-CH(CH20CH3)-0-2* (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4,-C(CH3)(CH3)-0-2' (and analogs thereof see PCT/US2008/068922 published as

WO/2009/006478, published January 8, 2009); 4,-CH2-N(OCH3)-2' (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published December 11, 2008); 4'-CH2-0- N(CH3)-2* (see published U.S. Patent Application US2004-0171570, published September 2, 2004 ); 4'-CH2-N(R)-0-2', wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134); and 4,-CH2-C(=CH2)-2' (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on December 8, 2008).

Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al, J. Am. Chem. Soc, 2007, 129(26) 8362-8379; Frieden et al, Nucleic Acids

Research, 2003, 21, 6365-6372; Elayadi et al, Curr. Opinion Inverts. Drugs, 2001, 2, 558-561;

Braasch et al, Chem. Biol, 2001, 8, 1-7; Oram et al, Curr. Opinion Mol Ther., 2001, 3, 239-243; Wahlestedt et al, Proc. Natl Acad. Sci. U. S. A., 2000, 97, 5633-5638; Singh et al, Chem.

Commun., 1998, 4, 455-456; Koshkin et al, Tetrahedron, 1998, 54, 3607-3630; Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al, J. Org. Chem., 1998, 63, 10035-10039; U.S. Patents Nos.: 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. Patent Applications, Serial Nos.: 12/129,154; 61/099,844; 61/097,787; 61/086,231;

61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.:

PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position. As used herein, "4 '-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, - C(=0)-, -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, Ci-C12 alkyl, substituted Ci-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJiJ2, SJi, N3, COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C2o aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is , -[C(Ra)(Rb)]n- , -[C(Ra)(Rb)]n-0-, -C(RaRb)-N(R)-0- or -C(RaRb)-0-N(R)-. In certain embodiments, the bridge is 4'-CH2-2', 4,-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-0-2', 4,-(CH2)2-0-2', 4'-CH2-0-N( )-2' and 4'-CH2- N(R)-0-2'- wherein each R is, independently, H, a protecting group or Ci-C12 alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-(CH2)-0-2' bridge, may be in the a-L configuration or in the β-D configuration. Previously, a-L-methyleneoxy (4'-CH2-0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids

Research, 2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include those having a 4' to 2' bridge wherein such bridges include without limitation, a-L-4'-(CH2)-0-2', P-D-4'-CH2-0-2', 4,-(CH2)2-0-2', 4'- CH2-0-N(R)-2', 4'-CH2-N(R)-0-2', 4'-CH(CH3)-0-2', 4'-CH2-S-2', 4'-CH2-N(R)-2', 4'-CH2- CH(CH3)-2', and 4'-(CH2)3-2', wherein R is H, a protecting group or Ci-Ci2 alkyl.

In certain embodiment, bicyclic nucleosides have the formula:

Figure imgf000047_0001

wherein:

Bx is a heterocyclic base moiety;

-Qa-Qb-Qc- is -CH2-N(RC)-CH2-, -C(=0)-N(Rc)-CH2-, -CH2-0-N(Rc)-, -CH2-N(Rc)-0- or N(Rc)-0-CH2;

Rc is Ci-Ci2 alkyl or an amino protecting group; and

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleosides have the formula:

Figure imgf000047_0002

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Za is Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Ci-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJc, NJJd, SJC, N3, OC(=X)Jc, and NJeC(=X)NJcJd, wherein each Jc, Jd and Je is, independently, H, Ci-C6 alkyl, or substituted Ci-C6 alkyl and X is O or NJC.

In certain embodiments, bicyclic nucleosides have the formula:

Figure imgf000048_0001

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Zb is Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted Ci-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl or substituted acyl (C(=0)-).

In certain embodiments, bicyclic nucleosides have the formula:

Figure imgf000048_0002

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Rd is Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl;

each qa, qb, qc and qa is, independently, H, halogen, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2- C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, Ci-C6 alkoxyl, substituted Ci-C6 alkoxyl, acyl, substituted acyl, Ci-C6 aminoalkyl or substituted Ci-C6 aminoalkyl;

In certain embodiments, bicyclic nucleosides have the formula:

Figure imgf000048_0003
wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; qa, qb, qe and qf are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj, C(=0)NJjJk, C(=0)Jj, 0-C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJkorN(H)C(=S)NJjJk;

or qe and qf together are =C(qg)(q );

qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4'- ¾-0-2' bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al, Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

Analogs of various bicyclic nucleosides that have 4' to 2' bridging groups such as 4'-CH2-0- 2' and 4'-CH2-S-2', have also been prepared (Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219- 2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al, WO 99/14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al, J. Org. Chem., 1998, 63, 10035- 10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

In certain embodiments, bicyclic nucleosides have the formula:

Figure imgf000049_0001

wherein:

Bx is a heterocyclic base moiety;

Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each φ, qj, qk and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2- C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxyl, substituted C1-C12 alkoxyl, OJj, SJj, SOJj, S02Jj, NJjJk, N3, CN, C(=0)OJj, C(=0)NJjJk, C(=0)Jj, O- C(=0)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=0)NJjJk orN(H)C(=S)NJjJk; and

qi and qj or qi and qk together are =C(qg)(qh), wherein qg and qh are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the alkenyl analog bridge 4'-CH=CH-CH2-2' have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L- methyleneoxy (4'-CH2-0-2') BNA , (B) β-D-methyleneoxy (4'-CH2-0-2') BNA , (C) ethyleneoxy (4'-(CH2)2-0-2') BNA, (D) aminooxy (4'-CH2-0-N(R)-2') BNA, (E) oxyamino (4'-CH2-N(R)-0- 2') BNA, (F) methyl(methyleneoxy) (4'-CH(CH3)-0-2') BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4'-CH2-S-2') BNA, (H) methylene-amino (4'-CH2-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH2-CH(CH3)-2') BNA, (J) propylene carbocyclic (4'-(CH2)3-2') BNA, and (K) vinyl BNA as depicted below.

Figure imgf000050_0001

wherein Bx is the base moiety and R is, independently, H, a protecting group, Ci-C6 alkyl or Ci-C6 alkoxy. As used herein, the term "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted for the pentofuranosyl residue in normal nucleosides and can be referred to as a sugar surrogate. Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med.

Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyranyl ring system as illustrated below.

Figure imgf000051_0001

In certain embodiment, sugar surrogates are selected having the formula:

Figure imgf000051_0002

wherein:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the

tetrahydropyran nucleoside analog to the oligomeric compound or one of T3 and T4 is an

internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;

qi> q2, q3, 14, q5, q6 and q7 are each independently, H, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; and

one of Ri and R2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N3, OC(=X)Ji, OC(=X)NJiJ2, NJ3C(=X)NJiJ2 and CN, wherein X is O, S or NJi and each Jls J2 and J3 is, independently, H or Ci-C6 alkyl.

In certain embodiments, qls q2, q3, q4, q5, q6 and q7 are each H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is other than H. In certain embodiments, at least one of qi, q2, q3, q4, q5, q6 and q7 is methyl. In certain embodiments, THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is fluoro and R2 is H; Ri is methoxy and R2 is H, and Ri is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al, Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the ter "morpholino" means a sugar surrogate having the following formula:

Figure imgf000052_0001

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."

Combinations of modifications are also provided without limitation, such as 2 -F-5 '-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on 1 1/22/07 wherein a 4'-CH2- 0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the

pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J. Am. Chem. Soc, 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides,

Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al, Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111- 2123; Gu et al, Oligonucleotides, 2003, 13(6), 479-489; Wang et al, J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al, Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al, J. Org. Chem., 2001, 66, 8478-82; Wang et al, Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al, J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have Formula X.

Figure imgf000053_0001

X

wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X:

Bx is a heterocyclic base moiety;

T3 and T4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T and T4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and

qi, q2, q3, q4, q5, q6, q7, qs and q are each, independently, H, Ci-C6 alkyl, substituted Ci-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl or other sugar substituent group .

Many other monocyclic, bicyclic and tricyclic ring systems are known in the art and are suitable as sugar surrogates that can be used to modify nucleosides for incorporation into oligomeric compounds as provided herein (see for example review article: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to further enhance their activity.

As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH2)nO]mCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nF, 0(CH2)nONH2, OCH2C(=0)N(H)CH3, and

0(CH2)nON[(CH2)nCH ]2, where n and m are from 1 to about 10. Other 2'- substituent groups can also be selected from: Ci-Ci2 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, F, CF3, OCF3, SOCH3, S02CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an R A cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'- MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000). Such 2*-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl.

Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486- 504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, "2 '-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non- bridging 2 'substituents, such as allyl, amino, azido, thio, O-allyl, O-Ci-Cio alkyl, -OCF , 0-(CH2)2- 0-CH3, 2'-0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), or 0-CH2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted Ci-Cio alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.

As used herein, "2'-OMe" or "2'-OCH3", "2'-0-methyl" or "2'-methoxy" each refers to a nucleoside comprising a sugar comprising an -OCH group at the 2' position of the sugar ring.

As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH2CH2OCH3 group at the 2' position of the sugar ring. Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981 ,957; 5,1 18,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,81 1 ; 5,576,427; 5,591 ,722; 5,597,909; 5,610,300; 5,627,053;

5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed June 2, 2005 and published as WO 2005/121371 on December 22, 2005, and each of which is herein incorporated by reference in its entirety.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleo sides (R A) and/or deoxyribonucleosides (DNA).

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-0-2') bridging group. In certain embodiments, the (4'-CH(CH3)-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif.

Compositions and Methods for Formulating Pharmaceutical Compositions

Oligonucleotides may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An antisense compound targeted to a SOD-1 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate -buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a SOD-1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the

pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is a modified oligonucleotide. Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on

January 16, 2003.

Cell culture and antisense compounds treatment

The effects of antisense compounds on the level, activity or expression of SOD-1 nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors (e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A431 cells, and SH-SY5Y cells. In vitro testing of oligonucleotides

Described herein are methods for treatment of cells with oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

Cells may be treated with oligonucleotides when the cells reach approximately 60-80% confluency in culture.

One reagent commonly used to introduce oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM oligonucleotide.

Another reagent used to introduce oligonucleotides into cultured cells includes LIPOFECT AMINE (Invitrogen, Carlsbad, CA). Oligonucleotide is mixed with LIPOFECT AMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM oligonucleotide.

Another technique used to introduce oligonucleotides into cultured cells includes electroporation. Cells are treated with oligonucleotides by routine methods. Cells may be harvested 16-24 hours after oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of oligonucleotide used varies from cell line to cell line. Methods to determine the optimal oligonucleotide concentration for a particular cell line are well known in the art.

Oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Analysis of inhibition of target levels or expression

Inhibition of levels or expression of a SOD-1 nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE- Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time -PCR reactions are carried out by methods well known to those skilled in the art.

Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are SOD-lght in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A

CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

Probes and primers are designed to hybridize to a SOD-1 nucleic acid. Methods for designing realtime PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).

Analysis of Protein Levels

Antisense inhibition of SOD-1 nucleic acids can be assessed by measuring SOD-1 protein levels. Protein levels of SOD-1 can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In certain embodiments, the compounds herein provide improved reduction in protein levels. In vivo testing of antisense compounds

Antisense compounds, for example, modified oligonucleotides, are tested in animals to assess their ability to inhibit expression of SOD-1 and produce phenotypic changes, such as, improved motor function. In certain embodiments, motor function is measured by walking initiation analysis, rotarod, grip strength, pole climb, open field performance, balance beam, hindpaw footprint testing in the animal. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate -buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Oligonucleotide dosage and dosing frequency depends upon multiple factors such as, but not limited to, route of administration and animal body weight. Following a period of treatment with oligonucleotides, RNA is isolated from CNS tissue or CSF and changes in SOD-1 nucleic acid expression are measured. Certain Indications

In certain embodiments, provided herein are methods, compounds, and compositions of treating an individual comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk for developing a neurodegenerative disease, including, but not limited to, amyotrophic lateral sclerosis (ALS). In certain embodiments, the individual has been identified as having a SOD-1 associated disease. In certain embodiments, provided herein are methods for prophylactically reducing SOD-1 expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a SOD-1 nucleic acid.

In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a SOD-1 nucleic acid is accompanied by monitoring of SOD-1 levels in an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound may be used by a physician to determine the amount and duration of therapeutic intervention.

In certain embodiments, administration of an antisense compound targeted to a SOD-1 nucleic acid results in reduction of SOD-1 expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or a range defined by any two of these values. In certain embodiments, administration of an antisense compound targeted to a SOD-1 nucleic acid results in improved motor function in an animal. In certain embodiments, administration of a SOD-1 antisense compound improves motor function by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or a range defined by any two of these values.

In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to SOD-1 are used for the preparation of a medicament for treating a patient suffering or susceptible to a neurodegenerative disease including amyotrophic lateral sclerosis (ALS).

Certain Comparator Compositions

Antisense oligonucleotides targeting human SOD-1 were described in an earlier publication (see WO 2005/040180, incorporated by reference herein, in its entirety). Several oligonucleotides (ISIS 333611, ISIS 146144, ISIS 146145, ISIS 150437, ISIS 150441, ISIS 150443, ISIS 150444, ISIS 150445, ISIS 150446, ISIS 150447, ISIS 150448, ISIS 150449, ISIS 150452, ISIS 150454, ISIS 150458, ISIS 150460, ISIS 150462-150467, ISIS 150470, ISIS 150472, ISIS 150474, ISIS 150475, ISIS 150476, ISIS 150479-150483, ISIS 150488, ISIS 150489, ISIS 150490, ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609-333617, ISIS 333619, ISIS 333620-333636, ISIS 333638, and ISIS 333640) described therein, were used as comparator compounds throughout select screens for new antisense compounds described herein.

In certain embodiments, ISIS 333611, a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') CCGTCGCCCTTCAGCACGCA (incorporated herein as SEQ ID NO: 21), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 (from 5' to 3') comprise a 2'-0-methoxyethyl moiety was used as a comparator compound. ISIS

333611 was selected as a comparator compound because it exhibited high levels of dose-dependent inhibition in various studies as described in WO 2005/040180. Additionally, phase 1 human clinical trials were completed using ISIS 333611. See, MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in- man study" Lancet Neurol. (2013) 12(5): 435-442. Thus, ISIS 333611 was deemed a highly efficacious and potent compound with an acceptable safety profile (such that it was tested in human patients).

In certain embodiments, the compounds described herein benefit from one or more improved properties relative to the antisense compounds described in WO 2005/040180. Some of the improved properties are demonstrated in the examples provided herein. In certain embodiments, compounds described herein are more efficacious, potent, and/or tolerable in various in vitro and in vivo studies than comparator compounds described herein, including ISIS 333611. In certain embodiments, ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870, and ISIS 666867 are more efficacious and/or potent in various in vitro and in vivo studies than comparator compounds described herein, including ISIS 333611. In certain embodiments, ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870, and ISIS 666867 are more tolerable in one or more tolerability assays in animals than comparator compounds described herein, including ISIS 333611. This is despite 333611 being sufficiently well tolerated to progress to human clinical trials.

In certain embodiments, certain compounds described herein are more efficacious than comparator compounds by virtue of an in vitro IC50 of less than 2 μΜ, less than 1.9 μΜ, less than 1.8 μΜ, less than 1.7μΜ, less than 1.6 μΜ, less than 1.5 μΜ, less than 1.4 μΜ, less than 1.3 μΜ, less than 1.2 μΜ, less than 1.1 μΜ, less than 1 μΜ, less than 0.9 μΜ, less than 0.8 μΜ, less than 0.7 μΜ, less than 0.6 μΜ, or less than 0.5 μΜ less than 0.4 μΜ, less than 0.3 μΜ, less than 0.2 μΜ, less than 0.1 μΜ, when tested in human cells, for example, in the HepG2 A431 or SH-SY5Y cell lines (For example, see Examples 6-11).

In certain embodiments, certain compounds described herein are more efficacious than comparator compounds by virtue of their ability to inhibit SOD-1 expression in vivo. In certain embodiments, the compounds inhibit SOD-1 in lumbar spinal cord and cervical spinal cord by at least 60%, at least 65%, at least 70%), at least 75%, at least 80%, at least 85%, at least 90% or at least 95% in, for example, a transgenic animal model.

In certain embodiments, certain compounds described herein are more tolerable than comparator compounds on the basis of reduced microglial marker levels (e.g.,IBAl), reduced astrocytic marker levels (e.g., GFAP), and/or FOB scores in rats, mice, and/or monkeys. See, for example, Examples 14, 15, 18, and 19.

ISIS 666853

For example, as provided in Example 12 (hereinbelow), ISIS 666853 achieved 81% inhibition in lumbar spinal cord and 74% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 μΐ, of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 33361 1 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

For example, as provided in Example 14 (hereinbelow), ISIS 666853 achieved a FOB score of 0 whereas ISIS 33361 1 achieved a FOB score of 4 in Sprague-Dawley rats after 3 hours when treated with 3 mg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666853 treated rats as compared to ISIS 33361 1 treated rats.

For example, as provided in Example 15 (hereinbelow), ISIS 666853 achieved an ED50 of

81.3 and 242.6 in lumbar tissue and cervical tissue (respectively) in SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. ED5o in lumbar and cervical tissues could not be calculated in ISIS 33361 1 treated transgenic rats because the highest concentration tested (3000 μg) filed to inhibit human SOD-1 mRNA greater than 55-65%. For example, as provided in Example 16 (hereinbelow), at doses of 1 mg and 3 mg ISIS 666853 achieved 3 hour FOB scores of 0.0 and 0.5 (respectively) whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). At doses of 1 mg and 3 mg ISIS 666853 achieved 8 week FOB scores of 0.0 and 0.0 (respectively) whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

For example, as provided in Example 17 (hereinbelow), ISIS 666853 achieved an ED5o of 136 and 188 in lumbar tissue and cortex tissue (respectively) whereas ISIS 333611 achieved an ED5o of 401 and 786 in lumbar tissue and cortex tissue (respectively) in SOD-1 transgenic mice when treated with an intracerebral ventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide.

For example, as provided in Example 18 (hereinbelow), ISIS 666853 achieved a FOB score of 1.25 whereas ISIS 333611 achieved a FOB score of 6.5 in C57bl6 mice after 3 hours when treated with 700 μg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666853 treated mice as compared to ISIS 333611 treated mice.

ISIS 666859

For example, as provided in Example 12 (hereinbelow), ISIS 666859 achieved 79% inhibition in lumbar spinal cord and 64% inhibition in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

For example, as provided in Example 14 (hereinbelow), ISIS 666859 achieved a FOB score of 1 whereas ISIS 33361 1 achieved a FOB score of 4 in Sprague-Dawley rats after 3 hours when treated with 3 mg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666859 treated rats as compared to ISIS 333611 treated rats.

For example, as provided in Example 15 (hereinbelow), ISIS 666859 achieved an ED5o of 74.0 and 358.8 in lumbar tissue and cervical tissue (respectively) in SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. ED50 in lumbar and cervical tissues could not be calculated in ISIS 333611 treated transgenic rats because the highest concentration tested (3000 μg) filed to inhibit human SOD-1 mRNA greater than 55-65%. For example, as provided in Example 16 (hereinbelow), at doses of 1 mg and 3 mg ISIS 666859 achieved 3 hour FOB scores of 0.0 and 2.1 (respectively) whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). At doses of 1 mg and 3 mg ISIS 666859 achieved 8 week FOB scores of 0.0 and 0.3 (respectively) whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

For example, as provided in Example 17 (hereinbelow), ISIS 666859 achieved an ED5o of 106 and 206 in lumbar tissue and cortex tissue (respectively) whereas ISIS 333611 achieved an ED5o of 401 and 786 in lumbar tissue and cortex tissue (respectively) in SOD-1 transgenic mice when treated with an intracerebral ventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide.

For example, as provided in Example 18 (hereinbelow), ISIS 666859 achieved a FOB score of 1.75 whereas ISIS 333611 achieved a FOB score of 6.5 in C57bl6 mice after 3 hours when treated with 700 μg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666859 treated mice as compared to ISIS 333611 treated mice.

ISIS 666919

For example, as provided in Example 12 (hereinbelow), ISIS 666919 achieved 76% inhibition in lumbar spinal cord and 68% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

For example, as provided in Example 14 (hereinbelow), ISIS 666919 achieved a FOB score of 2 whereas ISIS 33361 1 achieved a FOB score of 4 in Sprague-Dawley rats after 3 hours when treated with 3 mg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666919 treated rats as compared to ISIS 333611 treated rats.

For example, as provided in Example 15 (hereinbelow), ISIS 666919 achieved an ED5o of 104.1 and 613.5 in lumbar tissue and cervical tissue (respectively) in SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. ED50 in lumbar and cervical tissues could not be calculated in ISIS 333611 treated transgenic rats because the highest concentration tested (3000 μg) filed to inhibit human SOD-1 mRNA greater than 55-65%. For example, as provided in Example 16 (hereinbelow), at doses of 1 mg and 3 mg ISIS 666919 achieved 3 hour FOB scores of 1.3 and 3.5 (respectively) whereas ISIS 333611 achieved FOB scores of 3.0 and 4.9 (respectively). At doses of 1 mg and 3 mg ISIS 666919 achieved 8 week FOB scores of 0.0 and 0.1 (respectively) whereas ISIS 333611 achieved FOB scores of 0.0 and 1.2 (respectively).

For example, as provided in Example 17 (hereinbelow), ISIS 666919 achieved an ED5o of 168 in lumbar tissue whereas ISIS 333611 achieved an ED50 of 401 in lumbar tissue in SOD-1 transgenic mice when treated with an intracerebral ventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide.

For example, as provided in Example 18 (hereinbelow), ISIS 666919 achieved a FOB score of 0.0 whereas ISIS 333611 achieved a FOB score of 6.5 in C57bl6 mice after 3 hours when treated with 700 μg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666919 treated mice as compared to ISIS 333611 treated mice.

ISIS 666921

For example, as provided in Example 12 (hereinbelow), ISIS 66621 achieved 71% inhibition in lumbar spinal cord and 65% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

For example, as provided in Example 14 (hereinbelow), ISIS 666921 achieved a FOB score of 2 whereas ISIS 33361 1 achieved a FOB score of 4 in Sprague-Dawley rats after 3 hours when treated with 3 mg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666919 treated rats as compared to ISIS 333611 treated rats.

ISIS 666922

For example, as provided in Example 12 (hereinbelow), ISIS 666922 achieved 67% inhibition in lumbar spinal cord and 62% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 μΐ, of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord. For example, as provided in Example 14 (hereinbelow), ISIS 666922 achieved a FOB score of 3 whereas ISIS 33361 1 achieved a FOB score of 4 in Sprague-Dawley rats after 3 hours when treated with 3 mg of oligonucleotide. Microglial marker (IBA1) levels and astrocytic marker (GFAP) levels were also reduced in ISIS 666919 treated rats as compared to ISIS 333611 treated rats.

ISIS 666869

For example, as provided in Example 12 (hereinbelow), ISIS 666869 achieved 82% inhibition in lumbar spinal cord and 81% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

ISIS 666870

For example, as provided in Example 12 (hereinbelow), ISIS 666870 achieved 76% inhibition in lumbar spinal cord and 68% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

For example, as provided in Example 15 (hereinbelow), ISIS 666870 achieved an ED50 of 139.4 and 1111 in lumbar tissue and cervical tissue (respectively) in SOD-1 transgenic rats when treated intrathecally with 10, 30, 100, 300, or 3000 μg of oligonucleotide. ED5o in lumbar and cervical tissues could not be calculated in ISIS 333611 treated transgenic rats because the highest concentration tested (3000 μg) filed to inhibit human SOD-1 mRNA greater than 55-65%.

For example, as provided in Example 17 (hereinbelow), ISIS 666870 achieved an ED5o of 148 and 409 in lumbar tissue and cortex tissue (respectively) whereas ISIS 333611 achieved an ED5o of 401 and 786 in lumbar tissue and cortex tissue (respectively) in SOD-1 transgenic mice when treated with an intracerebral ventricular bolus of 10, 30, 100, 300, or 700 μg of oligonucleotide.

For example, as provided in Example 18 (hereinbelow), ISIS 666870 achieved a FOB score of 4.75 whereas ISIS 333611 achieved a FOB score of 6.5 in C57bl6 mice after 3 hours when treated with 700 μg of oligonucleotide. ISIS 666867

For example, as provided in Example 12 (hereinbelow), ISIS 666867 achieved 59% inhibition in lumbar spinal cord and 48% in cervical spinal cord of an SOD-1 transgenic rat model when dosed with 30 μΙ_, of 16.67 mg/ml solution of oligonucleotide diluted in PBS (500 μg final dose), whereas ISIS 333611 achieved 51% inhibition in lumbar spinal cord and 47% inhibition in cervical spinal cord.

Certain Compositions

1. ISIS 666853

In certain embodiments, ISIS 666853 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') CAGGATACATTTCTACAGCT (incorporated herein as SEQ ID NO: 725), wherein each of nucleosides 1-5 and 16-20 are 2'-0-methoxyethylribose modified nucleosides, and each of nucleosides 6- 15 are 2'-deoxynucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666853 is described by the following chemical notation: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Figure imgf000067_0001

Structure 1. ISIS 666853

2. ISIS 666859

In certain embodiments, ISIS 666859 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') TTAATGTTTATCAGGAT (incorporated herein as SEQ ID NO: 1351), consisting of seventeen nucleosides, wherein each of nucleosides 1-4 and 15-17 are 2'-0-methoxyethylribose nucleosides, wherein each of nucleosides 13 and 14 are cEt modified nucleosides, wherein each of nucleosides 5-12 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to

3, 3 to 4, 13 to 14, 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666859 is described by the following chemical notation: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te; wherein, A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

In certain embodiments, ISIS 666859 is described by the following chemical structure:

Figure imgf000068_0001

Structure 2. ISIS 666859

3. ISIS 666919

In certain embodiments, ISIS 666919 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5 ' to 3 ') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), consisting of seventeen nucleosides, wherein each of nucleosides 1-4 and 16-17 are 2'-0-methoxyethylribose modified nucleosides, wherein each of nucleosides 14 and 15 are cEt modified nucleosides, wherein each of nucleosides 5-13 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666919 is described by the following chemical notation: Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

In certain embodiments, ISIS 666919 is described by the following chemical structure:

Figure imgf000070_0001

Structure 3. ISIS 666919

4. ISIS 666921

In certain embodiments, ISIS 666921 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), consisting of seventeen nucleosides, wherein each of nucleosides 1-5 and 16-17 are 2'-0-methoxyethylribose modified nucleosides, wherein each of nucleosides 14-15 are cEt modified nucleosides, wherein each of nucleosides 6-13 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666921 is described by the following chemical notation: Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

In certain embodiments, ISIS 666921 is described by the following chemical structure:

Figure imgf000071_0001

Structure 4. ISIS 666921

5. ISIS 666922

In certain embodiments, ISIS 666922 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') GGATACATTTCTACAGC (incorporated herein as SEQ ID NO: 1342), consisting of seventeen nucleosides, wherein each of nucleosides 1-4 and 15-17 are 2'-0-methoxyethylribose modified nucleosides, wherein each of nucleosides 5 and 14 are cEt modified nucleosides, wherein each of nucleosides 6-13 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666922 is described by the following chemical notation: Ges Geo Aeo

Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

In certain embodiments, ISIS 666922 is described by the following chemical structure:

Figure imgf000073_0001

Structure 5. ISIS 666922

6. ISIS 666869

In certain embodiments, ISIS 666869 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') AGTGTTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), consisting of seventeen nucleosides, wherein each of nucleosides 1, 3, 14, and 16-17 are 2'-0- methoxyethylribose modified nucleosides, wherein each of nucleosides 2, 4, 13, and 15 are cEt modified nucleosides, wherein each of nucleosides 5-12 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'- methylcytosine.

In certain embodiments, ISIS 666869 is described by the following chemical notation: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; wherein, A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Figure imgf000074_0001

Structure 6. ISIS 666869

7. ISIS 666870

In certain embodiments, ISIS 666870 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') AGTGTTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), consisting of seventeen nucleosides, wherein each of nucleosides 1, 3, 13-17 are 2'-0-methoxyethylribose modified nucleosides, wherein each of nucleosides 2 and 4 are cEt modified nucleosides, wherein each of nucleosides 5-12 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine.

In certain embodiments, ISIS 666870 is described by the following chemical notation: Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

Figure imgf000076_0001

Structure 7. ISIS 666870

8. ISIS 666867

In certain embodiments, ISIS 666867 is characterized as a modified oligonucleotide having the nucleobase sequence (from 5' to 3') AGTGTTTAATGTTTATC (incorporated herein as SEQ ID NO: 1173), consisting of seventeen nucleosides, wherein each of nucleosides 1-2 and 13-17 are 2'-0-methoxyethylribose modified nucleosides, wherein each of nucleosides 3 and 4 are cEt modified nucleosides, wherein each of nucleosides 5-12 are 2'-deoxyribonucleosides, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, and 14 to 15 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 15 to 16, and 16 to 17 are phosphorothioate linkages, and wherein each cytosine is a 5'-methylcytosine. In certain embodiments, ISIS 666867 is described by the following chemical notation: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,

A = an adenine,

mC = a 5'-methylcytosine

G = a guanine,

T = a thymine,

e = a 2'-0-methoxyethylribose modified sugar,

k = a cEt modified sugar,

d = a 2'-deoxyribose sugar,

s = a phosphorothioate internucleoside linkage, and

o = a phosphodiester internucleoside linkage.

In certain embodiments, ISIS 666867 is described by the following chemical structure:

Figure imgf000077_0001

Structure 8. ISIS 666867 EXAMPLES

Non-limiting disclosure and incorporation by reference

While certain compounds, compositions, and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Inhibition of human superoxide dismutase 1, soluble (SOD-1) in HepG2 cells by MOE gapmers

Modified oligonucleotides were designed targeting a superoxide dismutase 1, soluble (SOD-1) nucleic acid and were tested for their effects on SOD-1 m NA in vitro. ISIS 146144, ISIS 146145, ISIS 150437, ISIS 150441, ISIS 150443, ISIS 150444, ISIS 150445, ISIS 150446, ISIS 150447, ISIS 150448, ISIS 150449, ISIS 150452, ISIS 150454, ISIS 150458, ISIS 150460, ISIS 150462-150467, ISIS 150470, ISIS 150472, ISIS 150474, ISIS 150475, ISIS 150476, ISIS 150479-150483, ISIS 150488, ISIS 150489, ISIS 150490, ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609- 333617, ISIS 333619, ISIS 333620-333636, ISIS 333638, and ISIS 333640, previously disclosed in WO 2005/040180, were also included in this assay. ISIS 333611, previously disclosed in WO 2005/040180, was also designated as a benchmark or comparator oligonucleotide. ISIS 333611 was recently tested in human clinical trials. See, MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study" Lancet Neurol. (2013) 12(5): 435-442.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 7,000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

Human primer probe set RTS3898 (forward sequence CTCTCAGGAGACCATTGCATCA, designated herein as SEQ ID NO: 11 ; reverse sequence TCCTGTCTTTGTACTTTCTTCATTTCC;

designated herein as SEQ ID NO: 12; probe sequence CCGCACACTGGTGGTCCATGAAAA, designated herein as SEQ ID NO: 13) was used to measure mRNA levels. In cases where the oligonucleotide overlapped the amplicon of the primer probe set, an alternative primer probe set, HTS90 (forward sequence CGTGGCCTAGCGAGTTATGG, designated herein as SEQ ID NO: 14; reverse sequence

GAAATTGATGATGCCCTGCA; designated herein as SEQ ID NO: 15; probe sequence ACGAAGGCCGTGTGCGTGCTGX, designated herein as SEQ ID NO: 16), was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by

RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells, 'n.d.' indicates that inhibition levels were not measured using the particular primer probe set.

The newly designed modified oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to

18704000). 'n/a' indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 1

Percent Inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

SEQ SEQ SEQ SEQ ID ID % ID ID

SEQ

ISIS NO: NO: inhibition NO: NO:

Sequence ID NO 1 1 with 2 2

NO

Start Stop RTS3898 Start Stop

Site Site Site Site

590065 1 20 CGCCCACTCTGGCCCCAAAC 7 807 826 118

590066 35 54 CCGCGACTACTTTATAGGCC 5 841 860 119

333611 167 186 CCGTCGCCCTTCAGCACGCA 85 973 992 21

590067 202 221 CCTTCTGCTCGAAATTGATG 74 1008 1027 120

590068 203 222 TCCTTCTGCTCGAAATTGAT 58 n/a n/a 121

590069 204 223 TTCCTTCTGCTCGAAATTGA 50 n/a n/a 122

590070 205 224 TTTCCTTCTGCTCGAAATTG 47 n/a n/a 123

590071 206 225 CTTTCCTTCTGCTCGAAATT 31 n/a n/a 124

590072 207 226 ACTTTCCTTCTGCTCGAAAT 42 n/a n/a 125

590073 208 227 TACTTTCCTTCTGCTCGAAA 38 n/a n/a 126

590074 209 228 TTACTTTCCTTCTGCTCGAA 33 n/a n/a 127

590075 210 229 ATTACTTTCCTTCTGCTCGA 39 n/a n/a 128

590076 211 230 CATTACTTTCCTTCTGCTCG 28 n/a n/a 129 590077 212 231 CCATTACTTTCCTTCTGCTC 58 n/a n/a 130

590078 213 232 TCCATTACTTTCCTTCTGCT 58 n/a n/a 131

590079 214 233 GTCCATTACTTTCCTTCTGC 69 n/a n/a 132

590080 215 234 GGTCCATTACTTTCCTTCTG 68 n/a n/a 133

590081 216 235 TGGTCCATTACTTTCCTTCT 61 n/a n/a 134

590082 217 236 CTGGTCCATTACTTTCCTTC 69 n/a n/a 135

590083 218 237 ACTGGTCCATTACTTTCCTT 54 4972 4991 136

150445 219 238 CACTGGTCCATTACTTTCCT 84 4973 4992 22

590084 220 239 TCACTGGTCCATTACTTTCC 65 4974 4993 137

590085 221 240 TTCACTGGTCCATTACTTTC 45 4975 4994 138

590086 222 241 CTTCACTGGTCCATTACTTT 43 4976 4995 139

590087 223 242 CCTTCACTGGTCCATTACTT 67 4977 4996 140

590088 224 243 ACCTTCACTGGTCCATTACT 59 4978 4997 141

436841 225 244 CACCTTCACTGGTCCATTAC 65 4979 4998 142

150446 226 245 ACACCTTCACTGGTCCATTA 83 4980 4999 23

393336 227 246 CACACCTTCACTGGTCCATT 81 4981 5000 143

150447 228 247 CCACACCTTCACTGGTCCAT 89 4982 5001 24

590089 229 248 CCCACACCTTCACTGGTCCA 82 4983 5002 144

590090 230 249 CCCCACACCTTCACTGGTCC 89 4984 5003 145

590091 231 250 TCCCCACACCTTCACTGGTC 84 4985 5004 146

590092 232 251 TTCCCCACACCTTCACTGGT 61 4986 5005 147

590093 233 252 CTTCCCCACACCTTCACTGG 60 4987 5006 148

590094 234 253 GCTTCCCCACACCTTCACTG 78 4988 5007 149

590095 235 254 TGCTTCCCCACACCTTCACT 72 4989 5008 150

590096 236 255 ATGCTTCCCCACACCTTCAC 76 4990 5009 151

393337 237 256 AATGCTTCCCCACACCTTCA 76 4991 5010 152

590097 238 257 TAATGCTTCCCCACACCTTC 68 4992 5011 153

590098 264 283 TCCATGCAGGCCTTCAGTCA 63 5018 5037 154

590099 265 284 ATCCATGCAGGCCTTCAGTC 64 5019 5038 155

590100 266 285 AATCCATGCAGGCCTTCAGT 52 5020 5039 156

590101 267 286 GAATCCATGCAGGCCTTCAG 53 5021 5040 157

590102 268 287 GGAATCCATGCAGGCCTTCA 65 5022 5041 158

393339 269 288 TGGAATCCATGCAGGCCTTC 43 5023 5042 159

590103 270 289 ATGGAATCCATGCAGGCCTT 56 5024 5043 160

590104 271 290 CATGGAATCCATGCAGGCCT 57 5025 5044 161

590105 272 291 ACATGGAATCCATGCAGGCC 52 5026 5045 162 590106 273 292 AACATGGAATCCATGCAGGC 54 5027 5046 163

590107 274 293 GAACATGGAATCCATGCAGG 51 5028 5047 164

590108 275 294 TGAACATGGAATCCATGCAG 58 5029 5048 165

393340 276 295 ATGAACATGGAATCCATGCA 62 5030 5049 166

590109 316 335 GACCTGCACTGGTACAGCCT 69 7632 7651 167

436847 317 336 GGACCTGCACTGGTACAGCC 74 7633 7652 168

590110 318 337 AGGACCTGCACTGGTACAGC 70 7634 7653 169

590111 319 338 GAGGACCTGCACTGGTACAG 74 7635 7654 170

590112 320 339 TGAGGACCTGCACTGGTACA 68 7636 7655 171

590113 321 340 GTGAGGACCTGCACTGGTAC 80 7637 7656 172

393343 322 341 AGTGAGGACCTGCACTGGTA 79 7638 7657 173

590114 323 342 AAGTGAGGACCTGCACTGGT 65 7639 7658 174

590115 324 343 AAAGTGAGGACCTGCACTGG 48 7640 7659 175

590116 325 344 TAAAGTGAGGACCTGCACTG 51 7641 7660 176

436848 326 345 TTAAAGTGAGGACCTGCACT 59 7642 7661 177

590117 327 346 ATTAAAGTGAGGACCTGCAC 43 7643 7662 178

590118 328 347 GATTAAAGTGAGGACCTGCA 43 7644 7663 179

590119 329 348 GGATTAAAGTGAGGACCTGC 67 7645 7664 180

590120 330 349 AGGATTAAAGTGAGGACCTG 63 7646 7665 181

436849 331 350 GAGGATTAAAGTGAGGACCT 64 7647 7666 182

393344 332 351 AGAGGATTAAAGTGAGGACC 59 7648 7667 183

590121 333 352 TAGAGGATTAAAGTGAGGAC 52 7649 7668 184

590122 334 353 ATAGAGGATTAAAGTGAGGA 36 7650 7669 185

590123 335 354 GATAGAGGATTAAAGTGAGG 25 7651 7670 186

590124 336 355 GGATAGAGGATTAAAGTGAG 34 7652 7671 187

590125 337 356 TGGATAGAGGATTAAAGTGA 49 7653 7672 188

590126 338 357 CTGGATAGAGGATTAAAGTG 34 7654 7673 189

590127 339 358 TCTGGATAGAGGATTAAAGT 39 7655 7674 190

590128 360 379 ATCCTTTGGCCCACCGTGTT 60 7676 7695 191

Table 2

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

SEQ SEQ ID ID NO: NO:

ISIS NO Sequence

1 1

Start Stop

Site Site

333611 167 186 CCGTCGCCCTTCAGCACGCA

Figure imgf000081_0001
393347 361 380 CATCCTTTGGCCCACCGTGT 70 72 7677 7696 192

590129 362 381 TCATCCTTTGGCCCACCGTG 66 68 7678 7697 193

590130 363 382 TTCATCCTTTGGCCCACCGT 53 55 7679 7698 194

590131 364 383 CTTCATCCTTTGGCCCACCG 52 50 7680 7699 195

590132 365 384 TCTTCATCCTTTGGCCCACC 61 64 7681 7700 196

590133 366 385 CTCTTCATCCTTTGGCCCAC 45 54 7682 7701 197

590134 367 386 TCTCTTCATCCTTTGGCCCA 44 34 7683 7702 198

590135 368 387 CTCTCTTCATCCTTTGGCCC 52 49 7684 7703 199

590136 369 388 CCTCTCTTCATCCTTTGGCC 48 47 7685 7704 200

590137 370 389 GCCTCTCTTCATCCTTTGGC 35 44 n/a n/a 201

590138 371 390 TGCCTCTCTTCATCCTTTGG 52 45 n/a n/a 202

590139 372 391 ATGCCTCTCTTCATCCTTTG 50 45 n/a n/a 203

590140 373 392 CATGCCTCTCTTCATCCTTT 49 27 n/a n/a 204

590141 374 393 ACATGCCTCTCTTCATCCTT 34 18 n/a n/a 205

590142 375 394 AACATGCCTCTCTTCATCCT 38 35 n/a n/a 206

333612 376 395 CAACATGCCTCTCTTCATCC 34 33 n/a n/a 25

333613 377 396 CCAACATGCCTCTCTTCATC 46 55 n/a n/a 26

333614 378 397 TCCAACATGCCTCTCTTCAT 42 48 n/a n/a 27

333615 379 398 CTCCAACATGCCTCTCTTCA 42 15 n/a n/a 28

333616 380 399 TCTCCAACATGCCTCTCTTC 35 44 n/a n/a 29

333617 381 400 GTCTCCAACATGCCTCTCTT 42 47 n/a n/a 30

590143 501 520 TGCTTTTTCATGGACCACCA n.d. 65 n/a n/a 207

590144 502 521 CTGCTTTTTCATGGACCACC n.d. 70 n/a n/a 208

590145 503 522 TCTGCTTTTTCATGGACCAC n.d. 64 n/a n/a 209

436860 504 523 ATCTGCTTTTTCATGGACCA n.d. 65 n/a n/a 210

590146 505 524 CATCTGCTTTTTCATGGACC n.d. 68 9655 9674 211

590147 506 525 TCATCTGCTTTTTCATGGAC n.d. 59 9656 9675 212

393359 507 526 GTCATCTGCTTTTTCATGGA n.d. 56 9657 9676 213

590148 508 527 AGTCATCTGCTTTTTCATGG n.d. 45 9658 9677 214

590149 509 528 AAGTCATCTGCTTTTTCATG n.d. 23 9659 9678 215

590150 510 529 CAAGTCATCTGCTTTTTCAT n.d. 43 9660 9679 216

590151 511 530 CCAAGTCATCTGCTTTTTCA n.d. 72 9661 9680 217

489513 512 531 CCCAAGTCATCTGCTTTTTC n.d. 73 9662 9681 218

590152 513 532 GCCCAAGTCATCTGCTTTTT n.d. 74 9663 9682 219

436861 514 533 TGCCCAAGTCATCTGCTTTT n.d. 75 9664 9683 220

590153 515 534 TTGCCCAAGTCATCTGCTTT n.d. 47 9665 9684 221 393360 516 535 TTTGCCCAAGTCATCTGCTT n.d. 57 9666 9685 222

590154 517 536 CTTTGCCCAAGTCATCTGCT n.d. 79 9667 9686 223

590155 518 537 CCTTTGCCCAAGTCATCTGC n.d. 67 9668 9687 224

590156 519 538 ACCTTTGCCCAAGTCATCTG n.d. 57 9669 9688 225

333620 520 539 CACCTTTGCCCAAGTCATCT n.d. 68 9670 9689 31

333621 521 540 CCACCTTTGCCCAAGTCATC n.d. 72 9671 9690 32

333622 522 541 TCCACCTTTGCCCAAGTCAT n.d. 77 9672 9691 33

333623 523 542 TTCCACCTTTGCCCAAGTCA n.d. 73 9673 9692 34

333624 524 543 TTTCCACCTTTGCCCAAGTC n.d. 77 9674 9693 35

333625 525 544 ATTTCCACCTTTGCCCAAGT n.d. 79 9675 9694 36

333626 526 545 CATTTCCACCTTTGCCCAAG n.d. 72 9676 9695 37

333627 527 546 TCATTTCCACCTTTGCCCAA n.d. 55 9677 9696 38

333628 528 547 TTCATTTCCACCTTTGCCCA n.d. 59 9678 9697 39

333629 529 548 CTTCATTTCCACCTTTGCCC n.d. 73 9679 9698 40

333630 530 549 TCTTCATTTCCACCTTTGCC n.d. 76 9680 9699 41

333631 531 550 TTCTTCATTTCCACCTTTGC n.d. 62 9681 9700 42

333632 532 551 TTTCTTCATTTCCACCTTTG n.d. 64 9682 9701 43

333633 533 552 CTTTCTTCATTTCCACCTTT n.d. 69 9683 9702 44

333634 534 553 ACTTTCTTCATTTCCACCTT n.d. 55 9684 9703 45

333635 535 554 TACTTTCTTCATTTCCACCT n.d. 72 9685 9704 46

489517 582 601 CCCAATTACACCACAAGCCA 68 72 9732 9751 226

436863 583 602 TCCCAATTACACCACAAGCC 83 86 9733 9752 227

590157 584 603 ATCCCAATTACACCACAAGC 64 62 9734 9753 228

590158 585 604 GATCCCAATTACACCACAAG 51 61 9735 9754 229

590159 586 605 CGATCCCAATTACACCACAA 60 55 9736 9755 230

590160 587 606 GCGATCCCAATTACACCACA 59 63 9737 9756 231

150463 588 607 GGCGATCCCAATTACACCAC 78 79 9738 9757 47

393363 589 608 GGGCGATCCCAATTACACCA 65 65 9739 9758 232

590161 590 609 TGGGCGATCCCAATTACACC 56 60 9740 9759 233

590162 591 610 TTGGGCGATCCCAATTACAC 48 51 9741 9760 234

489518 592 611 ATTGGGCGATCCCAATTACA 51 59 9742 9761 235

436864 593 612 TATTGGGCGATCCCAATTAC 39 41 9743 9762 236

590163 594 613 TTATTGGGCGATCCCAATTA 35 34 9744 9763 237

590164 595 614 TTTATTGGGCGATCCCAATT 42 44 9745 9764 238

590165 596 615 GTTTATTGGGCGATCCCAAT 58 61 9746 9765 239

393364 597 616 TGTTTATTGGGCGATCCCAA 60 69 9747 9766 240 590166 598 617 ATGTTTATTGGGCGATCCCA 51 54 9748 9767 241

590167 599 618 AATGTTTATTGGGCGATCCC 48 45 9749 9768 242

590168 600 619 GAATGTTTATTGGGCGATCC 60 65 9750 9769 243

150464 601 620 GGAATGTTTATTGGGCGATC 58 63 9751 9770 48

393365 607 626 TCCAAGGGAATGTTTATTGG 50 58 9757 9776 244

Table 3

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000084_0001
489522 652 671 TACAGCTAGCAGGATAACAG 78 9802 9821 268

590187 653 672 CTACAGCTAGCAGGATAACA 88 9803 9822 269

378879 654 673 TCTACAGCTAGCAGGATAAC 86 9804 9823 270

590188 655 674 TTCTACAGCTAGCAGGATAA 85 9805 9824 271

393371 656 675 TTTCTACAGCTAGCAGGATA 84 9806 9825 272

436868 657 676 ATTTCTACAGCTAGCAGGAT 81 9807 9826 273

590189 658 677 CATTTCTACAGCTAGCAGGA 87 9808 9827 274

590190 659 678 ACATTTCTACAGCTAGCAGG 92 9809 9828 275

590191 660 679 TACATTTCTACAGCTAGCAG 88 9810 9829 276

590192 661 680 ATACATTTCTACAGCTAGCA 88 9811 9830 277

489523 662 681 GATACATTTCTACAGCTAGC 93 9812 9831 278

590193 683 702 ACAGTGTTTAATGTTTATCA 74 9833 9852 279

590194 684 703 TACAGTGTTTAATGTTTATC 64 9834 9853 280

590195 685 704 TTACAGTGTTTAATGTTTAT 56 9835 9854 281

590196 686 705 ATTACAGTGTTTAATGTTTA 50 9836 9855 282

590197 687 706 GATTACAGTGTTTAATGTTT 74 9837 9856 283

590198 688 707 AGATTACAGTGTTTAATGTT 37 9838 9857 284

590199 689 708 AAGATTACAGTGTTTAATGT 58 9839 9858 285

393375 690 709 TAAGATTACAGTGTTTAATG 58 9840 9859 286

590200 691 710 TTAAGATTACAGTGTTTAAT 46 9841 9860 287

436876 772 791 CAAATCTTCCAAGTGATCAT 36 9922 9941 288

590201 773 792 ACAAATCTTCCAAGTGATCA 33 9923 9942 289

590202 774 793 TACAAATCTTCCAAGTGATC 34 9924 9943 290

150474 775 794 ATACAAATCTTCCAAGTGAT 47 9925 9944 50

590203 776 795 TATACAAATCTTCCAAGTGA 29 9926 9945 291

393382 777 796 CTATACAAATCTTCCAAGTG 41 9927 9946 292

436877 778 797 ACTATACAAATCTTCCAAGT 45 9928 9947 293

590204 779 798 AACTATACAAATCTTCCAAG 27 9929 9948 294

590205 780 799 AAACTATACAAATCTTCCAA 33 9930 9949 295

590206 781 800 AAAACTATACAAATCTTCCA 35 9931 9950 296

489533 782 801 TAAAACTATACAAATCTTCC 26 9932 9951 297

590207 783 802 ATAAAACTATACAAATCTTC 19 9933 9952 298

590208 784 803 TATAAAACTATACAAATCTT 2 9934 9953 299

590209 785 804 TTATAAAACTATACAAATCT 7 9935 9954 300

590210 786 805 TTTATAAAACTATACAAATC 0 9936 9955 301

590211 787 806 TTTTATAAAACTATACAAAT 4 9937 9956 302 590212 788 807 GTTTTATAAAACTATACAAA 5 9938 9957 303

590213 789 808 AGTTTTATAAAACTATACAA 3 9939 9958 304

436878 790 809 GAGTTTTATAAAACTATACA 7 9940 9959 305

150475 791 810 TGAGTTTTATAAAACTATAC 28 9941 9960 51

489536 812 831 CATTGAAACAGACATTTTAA 28 9962 9981 306

150479 813 832 TCATTGAAACAGACATTTTA 36 9963 9982 52

393385 814 833 GTCATTGAAACAGACATTTT 50 9964 9983 307

590214 815 834 GGTCATTGAAACAGACATTT 45 9965 9984 308

590215 816 835 AGGTCATTGAAACAGACATT 47 9966 9985 309

590216 817 836 CAGGTCATTGAAACAGACAT 39 9967 9986 310

590217 818 837 ACAGGTCATTGAAACAGACA 44 9968 9987 311

590218 819 838 TACAGGTCATTGAAACAGAC 42 9969 9988 312

150480 820 839 ATACAGGTCATTGAAACAGA 46 9970 9989 53

393386 821 840 AATACAGGTCATTGAAACAG 36 9971 9990 313

489537 822 841 AAATACAGGTCATTGAAACA 12 9972 9991 314

590219 823 842 AAAATACAGGTCATTGAAAC 16 9973 9992 315

590220 824 843 CAAAATACAGGTCATTGAAA 21 9974 9993 316

Table 4

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000086_0001
590264 n/a n/a AAATAACTATGTTGTAGACC n.d. 9390 9409 330

590265 n/a n/a AAGAACCTTTTCCAGAAAAT 37 2449 2468 331

590266 n/a n/a GGAACAGAAACAAGTCTATG 25 7458 7477 332

590267 n/a n/a AGAAAGCTATCGCCATTATT 27 7727 7746 333

590268 n/a n/a TTCCCAAATACATTCTAAAA 7 7570 7589 334

590269 n/a n/a AACTGCTCTAGGCCTGTGTC 53 4787 4806 335

590270 n/a n/a AAATGGATCAAATCTGATCA 31 6595 6614 336

590271 n/a n/a GTAGGTGCACATCAAAATCA 58 1928 1947 337

590272 n/a n/a TCTGATATAAAAATCTTGTC 28 8141 8160 338

590273 n/a n/a ACCATATGAACTCCAGAAAG 45 7741 7760 339

590274 n/a n/a AACATCAAGGTAGTTCATGA 10 8379 8398 340

590275 n/a n/a GCAATTACAGAAATGGATCA 42 6605 6624 341

590276 n/a n/a TTTTAAGCATATTCCAAAGT 45 6331 6350 342

590277 n/a n/a TCAACCCCCAGCTCAAACAC 26 6174 6193 343

590278 n/a n/a AGAAAAATAACATTAATCCT n.d. 9541 9560 344

590279 n/a n/a AAGATTTTAAACACGGAATA 31 3085 3104 345

146145 165 184 GTCGCCCTTCAGCACGCACA 82 971 990 54

333611 167 186 CCGTCGCCCTTCAGCACGCA 81 973 992 21

590250 399 418 AGCAGTCACATTGCCCAAGT 75 8454 8473 346

489525 682 701 CAGTGTTTAATGTTTATCAG 69 9832 9851 347

436879 825 844 GCAAAATACAGGTCATTGAA 49 9975 9994 348

590221 826 845 GGCAAAATACAGGTCATTGA 54 9976 9995 349

590222 827 846 TGGCAAAATACAGGTCATTG 52 9977 9996 350

393387 828 847 CTGGCAAAATACAGGTCATT 51 9978 9997 351

590223 829 848 TCTGGCAAAATACAGGTCAT 47 9979 9998 352

590224 830 849 GTCTGGCAAAATACAGGTCA 44 9980 9999 353

590225 831 850 AGTCTGGCAAAATACAGGTC 50 9981 10000 354

489538 832 851 AAGTCTGGCAAAATACAGGT 38 9982 10001 355

590226 833 852 TAAGTCTGGCAAAATACAGG 33 9983 10002 356

590227 834 853 TTAAGTCTGGCAAAATACAG 20 9984 10003 357

150482 853 872 TTTAATACCCATCTGTGATT 29 10003 10022 55

590228 854 873 GTTTAATACCCATCTGTGAT 33 10004 10023 358

150483 855 874 AGTTTAATACCCATCTGTGA 44 10005 10024 56

590229 856 875 AAGTTTAATACCCATCTGTG 51 10006 10025 359

590230 857 876 CAAGTTTAATACCCATCTGT 42 10007 10026 360

590231 858 877 ACAAGTTTAATACCCATCTG 38 10008 10027 361 393389 859 878 GACAAGTTTAATACCCATCT 48 10009 10028 362

590232 860 879 TGACAAGTTTAATACCCATC 55 10010 10029 363

590233 861 880 CTGACAAGTTTAATACCCAT 49 10011 10030 364

489541 862 881 TCTGACAAGTTTAATACCCA 52 10012 10031 365

590234 863 882 TTCTGACAAGTTTAATACCC 39 10013 10032 366

590235 864 883 ATTCTGACAAGTTTAATACC 21 10014 10033 367

590236 865 884 AATTCTGACAAGTTTAATAC 4 10015 10034 368

393390 866 885 AAATTCTGACAAGTTTAATA 7 10016 10035 369

590237 867 886 GAAATTCTGACAAGTTTAAT 5 10017 10036 370

436881 868 887 AGAAATTCTGACAAGTTTAA 33 10018 10037 371

590238 869 888 AAGAAATTCTGACAAGTTTA 20 10019 10038 372

590239 891 910 TTATTCACAGGCTTGAATGA 23 10041 10060 373

489544 892 911 TTTATTCACAGGCTTGAATG 41 10042 10061 374

590240 893 912 TTTTATTCACAGGCTTGAAT 40 10043 10062 375

436884 894 913 TTTTTATTCACAGGCTTGAA 31 10044 10063 376

590241 895 914 GTTTTTATTCACAGGCTTGA 39 10045 10064 377

150488 896 915 GGTTTTTATTCACAGGCTTG 51 10046 10065 57

590242 897 916 GGGTTTTTATTCACAGGCTT 46 10047 10066 378

150489 898 917 AGGGTTTTTATTCACAGGCT 52 10048 10067 58

590243 899 918 CAGGGTTTTTATTCACAGGC 49 10049 10068 379

590244 900 919 ACAGGGTTTTTATTCACAGG 38 10050 10069 380

590245 901 920 TACAGGGTTTTTATTCACAG 34 10051 10070 381

150490 902 921 ATACAGGGTTTTTATTCACA 30 10052 10071 59

590246 903 922 CATACAGGGTTTTTATTCAC 34 10053 10072 382

150491 904 923 CCATACAGGGTTTTTATTCA 34 10054 10073 60

590247 905 924 GCCATACAGGGTTTTTATTC 34 10055 10074 383

590248 906 925 TGCCATACAGGGTTTTTATT 33 10056 10075 384

393393 907 926 GTGCCATACAGGGTTTTTAT 43 10057 10076 385

590249 908 927 AGTGCCATACAGGGTTTTTA 12 10058 10077 386

Table 5

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

SEQ SEQ SEQ SEQ ID ID % ID ID

SEQ

ISIS NO: NO: inhibition NO: NO:

Sequence ID NO 1 1 with 2 2

NO

Start Stop RTS3898 Start Stop Site Site Site Site

333611 167 186 CCGTCGCCCTTCAGCACGCA 86 973 992 21 590280 n/a n/a TGGAAAAACTCAAATGTGAA 51 3422 3441 387

590281 n/a n/a TTTCCCTTTCTTTTCCACAC 76 5738 5757 388

590282 n/a n/a TCTTTCCCTTTCTTTTCCAC 65 5740 5759 389

590283 n/a n/a TACCTTCTCTGCCCTTGCAG 74 1687 1706 390

590284 n/a n/a GCAAGGGCCAAGGCTGCTGC 75 6879 6898 391

590285 n/a n/a AAAGCTAAATTATGAATTAA 12 7592 7611 392

590286 n/a n/a CTAATGAAGGCTCAGTATGA 59 3193 3212 393

590287 n/a n/a GGAGTCAAATGCCAAAGAAC 60 2463 2482 394

590288 n/a n/a TGAATTAAAGTTCCCAAATA 5 7580 7599 395

590289 n/a n/a ACTTGGTGCAGGCAGAATAT 63 6916 6935 396

590290 n/a n/a CCTCTGATATAAAAATCTTG 67 8143 8162 397

590291 n/a n/a AAAGTTGGAGAGAGTTTCTG 8 4940 4959 398

590292 n/a n/a TCTCTGCCCTTGCAGCCCAA 80 1682 1701 399

590293 n/a n/a TTACTTGGTGCAGGCAGAAT 56 6918 6937 400

590294 n/a n/a AATGGAGTCAAATGCCAAAG 66 2466 2485 401

590295 n/a n/a TATGAATTAAAGTTCCCAAA 20 7582 7601 402

590296 n/a n/a AGTTCTATATTCAATAAATG 21 7926 7945 403

590297 n/a n/a TACAAGTAGTATACCATATG 33 7753 7772 404

590298 n/a n/a TAGCCTTAGAGCTGTACAAA 70 1553 1572 405

590299 n/a n/a GTCCCCATTTGTCAATTCCT 71 7882 7901 406

590300 n/a n/a AACCTGCCTACTGGCAGAGC 59 2095 2114 407

590301 n/a n/a CTTGTTCCCACACTCAATGC 56 4747 4766 408

590302 n/a n/a ACAAGTCATGATAACCTGCA 61 8952 8971 409

590303 n/a n/a TGTTTTCCAAACTCAGATCT 52 8796 8815 410

590304 n/a n/a AGAACCTCATAATATTAGAA 9 9557 9576 411

590305 n/a n/a GGTTTTAAACTTAACAAAAT 1 8887 8906 412

590306 n/a n/a CTCTGGTGTATTTTTAGTAA 65 1831 1850 413

590307 n/a n/a TATCTCTGCATATCTGGAAA 71 3034 3053 414

590308 n/a n/a CAGCCTTTTTAACCCAAAAG 68 4407 4426 415

590309 n/a n/a TGGAATGCTCCACTATCCAA 57 3012 3031 416

590310 n/a n/a CGTTCAGAAGTTTGTCTCTG 67 2126 2145 417

590311 n/a n/a CTGCTCAGGGAAGGTGGAAA 53 2922 2941 418

590312 n/a n/a TCAAGAGAAGCTAGGAAAAC 50 3154 3173 419

590313 n/a n/a TCCCTTTCTTTTCCACACCT 74 5736 5755 420

590314 n/a n/a TTGTTCCCACACTCAATGCA 56 4746 4765 421

590315 n/a n/a TCACCAGCACAGCACAACAC 58 5076 5095 422 590316 n/a n/a CCTGGGATCATTACAAAAGT 42 6155 6174 423

590317 n/a n/a AGTAGTATACCATATGAACT 35 7749 7768 424

590318 n/a n/a TCTAATATGGTCAAATGTAA 27 8779 8798 425

590319 n/a n/a GGTTGGGCTCTGGTGTATTT 64 1838 1857 426

590320 n/a n/a TGCCCTTTACTTGGTGCAGG 56 6924 6943 427

590321 n/a n/a AGAGAGTTTCTGAACAAAGA 24 4932 4951 428

590322 n/a n/a GAATTTCAGCAATTACAGAA 33 6613 6632 429

590323 n/a n/a ACAAGTTAAACAAGTCATGA 9 8961 8980 430

590324 n/a n/a TGTGCCCTTTACTTGGTGCA 47 6926 6945 431

590325 n/a n/a TTAGGAGGAGGAAAAGGACC 23 1719 1738 432

590326 n/a n/a ACTGGCAGAGCAATTTTAAA 25 2086 2105 433

590327 n/a n/a AGTCAAATGCCAAAGAACCT 58 2461 2480 434

590328 n/a n/a AAGCATCAGATGGATTAGGG 17 8411 8430 435

590329 n/a n/a GTCCGCGGGACCCTCAGGAA 54 1414 1433 436

590330 n/a n/a CAATTACAGAAATGGATCAA 42 6604 6623 437

590331 n/a n/a GCTGTCAAGTAATCACTACC 27 9606 9625 438

590332 n/a n/a AGTGCAAAGTTGGAGAGAGT 33 4945 4964 439

590333 n/a n/a ACTTGCTTCCAATCCCAAAT 78 6436 6455 440

590334 n/a n/a AACTCAAATGTGAAAGTTGT 51 3416 3435 441

590335 n/a n/a TTTTAGTAAGATCTTCAAAT 14 1820 1839 442

590336 n/a n/a ATTTCAGCAATTACAGAAAT 27 6611 6630 443

590337 n/a n/a TTAAGTGTCCCCATTTGTCA 56 7888 7907 444

590338 n/a n/a TTAGCAACCTGCCTACTGGC 57 2100 2119 445

590339 n/a n/a TATTACAAGAGTTAAGCATC 41 7711 7730 446

590340 n/a n/a ATGTTGAATATACATGTACA 36 4545 4564 447

590341 n/a n/a TTTGTCTCTGACCATCTTAG 74 2116 2135 448

590342 n/a n/a TTTTCCACCAGTTGGTAACT 59 2253 2272 449

590343 n/a n/a CAACAGCTTCCCACAAGTTA 28 8973 8992 450

590344 n/a n/a CAAATGTGAAAGTTGTCCCT 62 3412 3431 451

590345 n/a n/a GCTACCTTCTCTGCCCTTGC 73 1689 1708 452

590346 n/a n/a TCTTAGCAGAACAGTGTTCT 51 8743 8762 453

590347 n/a n/a ATACATTCTAAAAAGAAACA 41 7563 7582 454

590348 n/a n/a GCACATATTTACAAGTAGTA 58 7762 7781 455

590349 n/a n/a GGGTCACCAGCACAGCACAA 35 5079 5098 456

590350 n/a n/a GTGCAAGGGCCAAGGCTGCT 66 6881 6900 457

590351 n/a n/a ACCTGGGTTCATGCATGGAT 72 2902 2921 458 590352 n/a n/a ATCACTATTTGAAACTAAAT 0 6569 6588 459

590353 n/a n/a ATACAATAAAGTTGACCTCT 64 5483 5502 460

590354 n/a n/a TTTTAAACTTAACAAAATGT 10 8885 8904 461

590355 n/a n/a CTCCCCGCGCTCCCGCCACG 15 1268 1287 462

590356 n/a n/a GAAGGCTCAGTATGAAGAGA 65 3188 3207 463

Table 6

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000091_0001
590381 n/a n/a AAAAAAAGGAAAGTGAAAGT n.d. 9279 9298 488

590382 n/a n/a GGTTCATGCATGGATTCTCA 76 2897 2916 489

590383 n/a n/a CTGCAAAGTGTCACACAAAC 76 1630 1649 490

590384 n/a n/a TTCAGAAGTACCAAAGGGTA 53 8227 8246 491

590385 n/a n/a TAAAAGCATTCCAGCATTTG 44 7848 7867 492

590386 n/a n/a TAGTATACCATATGAACTCC 73 7747 7766 493

590387 n/a n/a TGCATATCTGGAAAGCTGGA 59 3028 3047 494

590388 n/a n/a CTTAACTGCTCTAGGCCTGT 54 4790 4809 495

590389 n/a n/a AGGCACCGACCGGGCGGCAC 21 1155 1174 496

590390 n/a n/a TGCAAAGTTGGAGAGAGTTT 32 4943 4962 497

590391 n/a n/a TCCTCAAAAGGGAGATGGTA 37 4769 4788 498

590392 n/a n/a AGTATACCATATGAACTCCA 76 7746 7765 499

590393 n/a n/a TATTTGTACATGTTGAATAT 2 4554 4573 500

590394 n/a n/a ACCCAAAAGGTGTATGTCTC 71 4396 4415 501

590395 n/a n/a CTTTGGAAAAAAAGGAAAGT n.d. 9285 9304 502

590396 n/a n/a GGGAGAAAGGCAGGCAAGTT 20 6697 6716 503

590397 n/a n/a TTAAGCCCAGGAAGTAAAAG 9 7862 7881 504

590398 n/a n/a AGACATTACCTTTAAACATT n.d. 9447 9466 505

590399 n/a n/a GTGGCTTAAGAAATGCTCCG 26 2050 2069 506

590400 n/a n/a GTGAGAAGGGAACAGAAACA 48 7466 7485 507

590401 n/a n/a AAAAGCATCAGATGGATTAG 21 8413 8432 508

590402 n/a n/a TTCCACCAGTTGGTAACTTC 78 2251 2270 509

590403 n/a n/a TTTTTAGTAAGATCTTCAAA 15 1821 1840 510

590404 n/a n/a ATCTGTGTCCAAATCCCAGG 59 4847 4866 511

590405 n/a n/a TAAGATCTTCAAATAAGCTA 33 1814 1833 512

590406 n/a n/a ATCAACTCTTTCCCTTTCTT 63 5746 5765 513

590407 n/a n/a TGTGTCCTCAAAAGGGAGAT 37 4773 4792 514

590408 n/a n/a TACCTCCTCCCAACAATACC n.d. 9590 9609 515

590409 n/a n/a TTCTGCTTTACAACTATGGC n.d. 9133 9152 516

590410 n/a n/a GTACATGTTGAATATACATG 35 4549 4568 517

590411 n/a n/a TTTGTGGCTAATCTTAAGGT 47 5699 5718 518

590412 n/a n/a TCCTGCCTCAGCCTTTTTAA 34 4415 4434 519

590413 n/a n/a CGGTGTCCGCGGGACCCTCA 59 1418 1437 520

590414 n/a n/a GAAATGGATCAAATCTGATC 50 6596 6615 521

590415 n/a n/a GGTAGTTCATGAGCTAAATT 31 8371 8390 522

590416 n/a n/a AATGGAGTCTCGACTAGTTT 62 8072 8091 523 590417 n/a n/a CAAGTATGGGTCACCAGCAC 57 5086 5105 524

590418 n/a n/a GGTGTCCGCGGGACCCTCAG 40 1417 1436 525

590419 n/a n/a CGCCACGCGCAGGCCCAGCC 37 1255 1274 526

590420 n/a n/a TCTAGGCCTGTGTCCTCAAA 75 4781 4800 527

590421 n/a n/a ACTGTCCTGGGCTAATGAAG 36 3204 3223 528

590422 n/a n/a AAGCATCTTGTTACCTCTCT 52 7698 7717 529

590423 n/a n/a GCCCAGGAAGTAAAAGCATT 38 7858 7877 530

590424 n/a n/a GTAAGATCTTCAAATAAGCT 46 1815 1834 531

590425 n/a n/a AAAGGGAGATGGTAATCTTG 48 4763 4782 532

590426 n/a n/a GCCAAGGCTGCTGCCTTACA 66 6873 6892 533

590427 n/a n/a CAGACTAACTGTTCCTGTCC 43 2363 2382 534

590428 n/a n/a TTTGTCAATTCCTTTAAGCC 39 7875 7894 535

590429 n/a n/a ACTACCTCCTCCCAACAATA n.d. 9592 9611 536

590430 n/a n/a TACCTCTCTTCATCCTTTGG 50 7687 7706 537

590431 n/a n/a ACTGCTCTAGGCCTGTGTCC 59 4786 4805 538

590432 n/a n/a CCTCCTCCCAACAATACCCA n.d. 9588 9607 539

590433 n/a n/a GGCAGGCAAGTTACAGGAAG 42 6689 6708 540

Table 7

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000093_0001
592609 28 47 TACTTTATAGGCCAGACCTC 76 834 853 554

592610 30 49 ACTACTTTATAGGCCAGACC 60 836 855 555

592611 32 51 CGACTACTTTATAGGCCAGA 0 838 857 556

592612 34 53 CGCGACTACTTTATAGGCCA 0 840 859 557

592613 36 55 TCCGCGACTACTTTATAGGC 0 842 861 558

592614 38 57 TCTCCGCGACTACTTTATAG 7 844 863 559

592615 40 59 CGTCTCCGCGACTACTTTAT 0 846 865 560

592616 42 61 CCCGTCTCCGCGACTACTTT 0 848 867 561

592617 44 63 ACCCCGTCTCCGCGACTACT 0 850 869 562

592618 46 65 GCACCCCGTCTCCGCGACTA 0 852 871 563

592619 48 67 CAGCACCCCGTCTCCGCGAC 0 854 873 564

592620 50 69 ACCAGCACCCCGTCTCCGCG 0 856 875 565

592621 52 71 AAACCAGCACCCCGTCTCCG 2 858 877 566

592622 54 73 GCAAACCAGCACCCCGTCTC 4 860 879 567

592623 56 75 ACGCAAACCAGCACCCCGTC 0 862 881 568

592624 58 77 CGACGCAAACCAGCACCCCG 0 864 883 569

592625 60 79 TACGACGCAAACCAGCACCC 0 866 885 570

592626 62 81 ACTACGACGCAAACCAGCAC 0 868 887 571

592627 64 83 AGACTACGACGCAAACCAGC 1 870 889 572

592628 66 85 GGAGACTACGACGCAAACCA 0 872 891 573

592629 68 87 CAGGAGACTACGACGCAAAC 0 874 893 574

592630 70 89 TGCAGGAGACTACGACGCAA 0 876 895 575

592631 72 91 GCTGCAGGAGACTACGACGC 1 878 897 576

150511 74 93 ACGCTGCAGGAGACTACGAC 0 880 899 61

592632 90 109 GCAACGGAAACCCCAGACGC 2 896 915 577

592633 92 111 CTGCAACGGAAACCCCAGAC 0 898 917 578

592634 94 113 GACTGCAACGGAAACCCCAG 0 900 919 579

345715 95 114 GGACTGCAACGGAAACCCCA 0 901 920 580

592635 96 115 AGGACTGCAACGGAAACCCC 1 902 921 581

150437 98 117 CGAGGACTGCAACGGAAACC 6 904 923 62

592636 100 119 TCCGAGGACTGCAACGGAAA 6 906 925 582

592637 102 121 GTTCCGAGGACTGCAACGGA 12 908 927 583

592638 104 123 TGGTTCCGAGGACTGCAACG 0 910 929 584

592639 106 125 CCTGGTTCCGAGGACTGCAA 32 912 931 585

592640 108 127 GTCCTGGTTCCGAGGACTGC 68 914 933 586

345717 110 129 AGGTCCTGGTTCCGAGGACT 65 916 935 587 592641 112 131 CGAGGTCCTGGTTCCGAGGA 84 918 937 588

592642 114 133 GCCGAGGTCCTGGTTCCGAG 86 920 939 589

592643 116 135 ACGCCGAGGTCCTGGTTCCG 78 922 941 590

592644 118 137 CCACGCCGAGGTCCTGGTTC 79 924 943 591

345719 120 139 GGCCACGCCGAGGTCCTGGT 63 926 945 592

150441 122 141 TAGGCCACGCCGAGGTCCTG 81 928 947 63

592645 124 143 GCTAGGCCACGCCGAGGTCC 63 930 949 593

592646 126 145 TCGCTAGGCCACGCCGAGGT 56 932 951 594

592647 128 147 ACTCGCTAGGCCACGCCGAG 48 934 953 595

345721 130 149 TAACTCGCTAGGCCACGCCG 63 936 955 596

592648 132 151 CATAACTCGCTAGGCCACGC 38 938 957 597

592649 134 153 GCCATAACTCGCTAGGCCAC 52 940 959 598

592650 136 155 TCGCCATAACTCGCTAGGCC 59 942 961 599

592651 138 157 CGTCGCCATAACTCGCTAGG 55 944 963 600

592652 156 175 CAGCACGCACACGGCCTTCG 56 962 981 601

333605 158 177 TTCAGCACGCACACGGCCTT 85 964 983 64

333606 160 179 CCTTCAGCACGCACACGGCC 82 966 985 65

146144 162 181 GCCCTTCAGCACGCACACGG 58 968 987 66

333609 164 183 TCGCCCTTCAGCACGCACAC 79 970 989 67

146145 165 184 GTCGCCCTTCAGCACGCACA 86 971 990 54

333610 166 185 CGTCGCCCTTCAGCACGCAC 79 972 991 68

333611 167 186 CCGTCGCCCTTCAGCACGCA 83 973 992 21

592653 168 187 GCCGTCGCCCTTCAGCACGC 79 974 993 602

592654 169 188 GGCCGTCGCCCTTCAGCACG 72 975 994 603

592655 170 189 GGGCCGTCGCCCTTCAGCAC 51 976 995 604

592656 172 191 CTGGGCCGTCGCCCTTCAGC 45 978 997 605

592657 174 193 CACTGGGCCGTCGCCCTTCA 33 980 999 606

592658 176 195 TGCACTGGGCCGTCGCCCTT 72 982 1001 607

592659 178 197 CCTGCACTGGGCCGTCGCCC 76 984 1003 608

Table 8

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

SEQ SEQ SEQ SEQ ID ID % ID ID

SEQ

ISIS NO: NO: inhibition NO: NO:

Sequence ID NO 1 1 with 2 2

NO

Start Stop RTS3898 Start Stop Site Site Site Site

333611 167 186 CCGTCGCCCTTCAGCACGCA 87 973 992 21 150443 180 199 GCCCTGCACTGGGCCGTCGC 65 986 1005 69

592660 182 201 ATGCCCTGCACTGGGCCGTC 52 988 1007 609

592661 184 203 TGATGCCCTGCACTGGGCCG 30 990 1009 610

592662 186 205 GATGATGCCCTGCACTGGGC 38 992 1011 611

592663 188 207 TTGATGATGCCCTGCACTGG 36 994 1013 612

150444 190 209 AATTGATGATGCCCTGCACT 48 996 1015 70

592664 192 211 GAAATTGATGATGCCCTGCA 35 998 1017 15

592665 194 213 TCGAAATTGATGATGCCCTG 40 1000 1019 614

592666 196 215 GCTCGAAATTGATGATGCCC 68 1002 1021 615

592667 198 217 CTGCTCGAAATTGATGATGC 63 1004 1023 616

592668 200 219 TTCTGCTCGAAATTGATGAT 47 1006 1025 617

592669 239 258 TTAATGCTTCCCCACACCTT 68 4993 5012 618

592670 241 260 CTTTAATGCTTCCCCACACC 71 4995 5014 619

592671 243 262 TCCTTTAATGCTTCCCCACA 69 4997 5016 620

150448 245 264 AGTCCTTTAATGCTTCCCCA 76 4999 5018 71

592672 247 266 TCAGTCCTTTAATGCTTCCC 75 5001 5020 621

592673 249 268 AGTCAGTCCTTTAATGCTTC 58 5003 5022 622

592674 251 270 TCAGTCAGTCCTTTAATGCT 46 5005 5024 623

592675 253 272 CTTCAGTCAGTCCTTTAATG 41 5007 5026 624

592676 255 274 GCCTTCAGTCAGTCCTTTAA 62 5009 5028 625

150449 257 276 AGGCCTTCAGTCAGTCCTTT 65 5011 5030 72

592677 259 278 GCAGGCCTTCAGTCAGTCCT 69 5013 5032 626

592678 261 280 ATGCAGGCCTTCAGTCAGTC 65 5015 5034 627

592679 263 282 CCATGCAGGCCTTCAGTCAG 53 5017 5036 628

592680 277 296 CATGAACATGGAATCCATGC 63 5031 5050 629

592681 279 298 CTCATGAACATGGAATCCAT 60 5033 5052 630

592682 281 300 AACTCATGAACATGGAATCC 56 5035 5054 631

592683 284 303 CCAAACTCATGAACATGGAA 60 5038 5057 632

592684 286 305 CTCCAAACTCATGAACATGG 69 5040 5059 633

592685 288 307 ATCTCCAAACTCATGAACAT 40 5042 5061 634

592686 290 309 TTATCTCCAAACTCATGAAC 35 5044 5063 635

592687 292 311 TATTATCTCCAAACTCATGA 26 5046 5065 636

592688 294 313 TGTATTATCTCCAAACTCAT 41 5048 5067 637

150452 296 315 GCTGTATTATCTCCAAACTC 51 5050 5069 73

592689 298 317 CTGCTGTATTATCTCCAAAC 43 5052 5071 638

592690 300 319 GCCTGCTGTATTATCTCCAA 37 n/a n/a 639 592691 302 321 CAGCCTGCTGTATTATCTCC 33 n/a n/a 640

592692 304 323 TACAGCCTGCTGTATTATCT 27 n/a n/a 641

592693 306 325 GGTACAGCCTGCTGTATTAT 21 n/a n/a 642

592694 308 327 CTGGTACAGCCTGCTGTATT 23 n/a n/a 643

592695 310 329 CACTGGTACAGCCTGCTGTA 46 n/a n/a 644

592696 312 331 TGCACTGGTACAGCCTGCTG 40 n/a n/a 645

592697 314 333 CCTGCACTGGTACAGCCTGC 62 n/a n/a 646

592698 340 359 TTCTGGATAGAGGATTAAAG 41 7656 7675 647

592699 342 361 TTTTCTGGATAGAGGATTAA 29 7658 7677 648

592700 344 363 TGTTTTCTGGATAGAGGATT 51 7660 7679 649

592701 346 365 CGTGTTTTCTGGATAGAGGA 64 7662 7681 650

592702 348 367 ACCGTGTTTTCTGGATAGAG 44 7664 7683 651

592703 350 369 CCACCGTGTTTTCTGGATAG 62 7666 7685 652

592704 352 371 GCCCACCGTGTTTTCTGGAT 60 7668 7687 653

592705 354 373 TGGCCCACCGTGTTTTCTGG 62 7670 7689 654

592706 356 375 TTTGGCCCACCGTGTTTTCT 49 7672 7691 655

592707 358 377 CCTTTGGCCCACCGTGTTTT 52 7674 7693 656

592708 382 401 AGTCTCCAACATGCCTCTCT 53 n/a n/a 657

592709 384 403 CAAGTCTCCAACATGCCTCT 39 n/a n/a 658

489501 386 405 CCCAAGTCTCCAACATGCCT 75 8441 8460 659

150454 388 407 TGCCCAAGTCTCCAACATGC 86 8443 8462 74

592710 390 409 ATTGCCCAAGTCTCCAACAT 71 8445 8464 660

592711 392 411 ACATTGCCCAAGTCTCCAAC 64 8447 8466 661

592712 394 413 TCACATTGCCCAAGTCTCCA 59 8449 8468 662

489502 396 415 AGTCACATTGCCCAAGTCTC 70 8451 8470 663

592713 398 417 GCAGTCACATTGCCCAAGTC 70 8453 8472 664

592714 400 419 CAGCAGTCACATTGCCCAAG 84 8455 8474 665

592715 402 421 GTCAGCAGTCACATTGCCCA 83 8457 8476 666

592716 404 423 TTGTCAGCAGTCACATTGCC 59 8459 8478 667

489503 406 425 CTTTGTCAGCAGTCACATTG 47 8461 8480 668

592717 408 427 ATCTTTGTCAGCAGTCACAT 54 8463 8482 669

592718 410 429 CCATCTTTGTCAGCAGTCAC 76 8465 8484 670

592719 412 431 CACCATCTTTGTCAGCAGTC 75 8467 8486 671

592720 414 433 CACACCATCTTTGTCAGCAG 66 8469 8488 672

489504 416 435 GCCACACCATCTTTGTCAGC 60 8471 8490 673

592721 418 437 CGGCCACACCATCTTTGTCA 62 8473 8492 674 592722 420 439 ATCGGCCACACCATCTTTGT 57 8475 8494 675

592723 422 441 ACATCGGCCACACCATCTTT 54 8477 8496 676

150458 424 443 ACACATCGGCCACACCATCT 77 8479 8498 75

489505 426 445 AGACACATCGGCCACACCAT 84 8481 8500 677

592724 428 447 ATAGACACATCGGCCACACC 66 8483 8502 678

Table 9

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000098_0001
592743 478 497 TGCGGCCAATGATGCAATGG n.d. 14 8533 8552 702

592744 480 499 TGTGCGGCCAATGATGCAAT n.d. 0 8535 8554 703

592745 482 501 AGTGTGCGGCCAATGATGCA n.d. 7 8537 8556 704

592746 484 503 CCAGTGTGCGGCCAATGATG n.d. 25 8539 8558 705

489511 486 505 CACCAGTGTGCGGCCAATGA n.d. 28 8541 8560 706

150460 488 507 ACCACCAGTGTGCGGCCAAT n.d. 52 8543 8562 77

592747 490 509 GGACCACCAGTGTGCGGCCA n.d. 44 n/a n/a 707

592748 492 511 ATGGACCACCAGTGTGCGGC n.d. 40 n/a n/a 708

150462 494 513 TCATGGACCACCAGTGTGCG n.d. 39 n/a n/a 78

592749 496 515 TTTCATGGACCACCAGTGTG n.d. 35 n/a n/a 709

592750 498 517 TTTTTCATGGACCACCAGTG n.d. 23 n/a n/a 710

592751 500 519 GCTTTTTCATGGACCACCAG n.d. 63 n/a n/a 711

333636 536 555 GTACTTTCTTCATTTCCACC n.d. 65 9686 9705 79

333638 538 557 TTGTACTTTCTTCATTTCCA n.d. 66 9688 9707 80

333640 540 559 CTTTGTACTTTCTTCATTTC n.d. 37 9690 9709 81

592752 543 562 TGTCTTTGTACTTTCTTCAT n.d. 63 9693 9712 712

592753 545 564 CCTGTCTTTGTACTTTCTTC n.d. 74 9695 9714 713

592754 547 566 TTCCTGTCTTTGTACTTTCT n.d. 72 9697 9716 714

592755 549 568 GTTTCCTGTCTTTGTACTTT n.d. 57 9699 9718 715

592756 568 587 AAGCCAAACGACTTCCAGCG 72 66 9718 9737 716

592757 570 589 ACAAGCCAAACGACTTCCAG 72 74 9720 9739 717

489516 572 591 CCACAAGCCAAACGACTTCC 85 82 9722 9741 718

592758 574 593 CACCACAAGCCAAACGACTT 72 73 9724 9743 719

592759 576 595 TACACCACAAGCCAAACGAC 74 68 9726 9745 720

592760 578 597 ATTACACCACAAGCCAAACG 67 61 9728 9747 721

592761 580 599 CAATTACACCACAAGCCAAA 64 56 9730 9749 722

150466 640 659 GATAACAGATGAGTTAAGGG 66 65 9790 9809 82

489521 642 661 AGGATAACAGATGAGTTAAG 79 78 9792 9811 723

592762 663 682 GGATACATTTCTACAGCTAG 91 87 9813 9832 724

592763 665 684 CAGGATACATTTCTACAGCT 92 89 9815 9834 725

592764 667 686 ATCAGGATACATTTCTACAG 88 83 9817 9836 726

592765 669 688 TTATCAGGATACATTTCTAC 77 72 9819 9838 727

592766 671 690 GTTTATCAGGATACATTTCT 90 89 9821 9840 728

592767 673 692 ATGTTTATCAGGATACATTT 82 76 9823 9842 729

592768 675 694 TAATGTTTATCAGGATACAT 80 79 9825 9844 730

592769 677 696 TTTAATGTTTATCAGGATAC 82 78 9827 9846 731 592770 679 698 TGTTTAATGTTTATCAGGAT 79 75 9829 9848 732

592771 681 700 AGTGTTTAATGTTTATCAGG 84 81 9831 9850 733

489526 692 711 TTTAAGATTACAGTGTTTAA 36 38 9842 9861 734

592772 694 713 CTTTTAAGATTACAGTGTTT 46 47 9844 9863 735

592773 696 715 CACTTTTAAGATTACAGTGT 39 42 9846 9865 736

592774 698 717 TACACTTTTAAGATTACAGT 21 24 9848 9867 737

592775 700 719 ATTACACTTTTAAGATTACA 3 0 9850 9869 738

489527 702 721 CAATTACACTTTTAAGATTA 0 0 9852 9871 739

150467 704 723 CACAATTACACTTTTAAGAT 58 73 9854 9873 83

592776 706 725 CACACAATTACACTTTTAAG 29 5 9856 9875 740

592777 708 727 GTCACACAATTACACTTTTA 59 49 9858 9877 741

592778 710 729 AAGTCACACAATTACACTTT 40 34 9860 9879 742

489528 712 731 AAAAGTCACACAATTACACT 31 27 9862 9881 743

592779 714 733 GAAAAAGTCACACAATTACA 21 7 9864 9883 744

592780 716 735 CTGAAAAAGTCACACAATTA 18 13 9866 9885 745

592781 718 737 CTCTGAAAAAGTCACACAAT 32 26 9868 9887 746

592782 720 739 AACTCTGAAAAAGTCACACA 35 20 9870 9889 747

Table 10

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000100_0001
592793 745 764 TTTCTCACTACAGGTACTTT 36 9895 9914 759

592794 747 766 AGTTTCTCACTACAGGTACT 53 9897 9916 760

592795 749 768 TCAGTTTCTCACTACAGGTA 37 9899 9918 761

150470 751 770 AATCAGTTTCTCACTACAGG 30 9901 9920 84

592796 753 772 TAAATCAGTTTCTCACTACA 21 9903 9922 762

150472 755 774 CATAAATCAGTTTCTCACTA 37 9905 9924 85

592797 757 776 ATCATAAATCAGTTTCTCAC 35 9907 9926 763

592798 759 778 TGATCATAAATCAGTTTCTC 35 9909 9928 764

592799 761 780 AGTGATCATAAATCAGTTTC 5 9911 9930 765

592800 763 782 CAAGTGATCATAAATCAGTT 21 9913 9932 766

592801 765 784 TCCAAGTGATCATAAATCAG 41 9915 9934 767

592802 767 786 CTTCCAAGTGATCATAAATC 44 9917 9936 768

592803 769 788 ATCTTCCAAGTGATCATAAA 30 9919 9938 769

592804 771 790 AAATCTTCCAAGTGATCATA 32 9921 9940 770

489534 792 811 CTGAGTTTTATAAAACTATA 4 9942 9961 771

150476 794 813 AACTGAGTTTTATAAAACTA 9 9944 9963 86

592805 796 815 TTAACTGAGTTTTATAAAAC 14 9946 9965 772

592806 798 817 TTTTAACTGAGTTTTATAAA 3 9948 9967 773

592807 800 819 CATTTTAACTGAGTTTTATA 13 9950 9969 774

489535 802 821 GACATTTTAACTGAGTTTTA 34 9952 9971 775

592808 804 823 CAGACATTTTAACTGAGTTT 40 9954 9973 776

592809 806 825 AACAGACATTTTAACTGAGT 36 9956 9975 777

592810 808 827 GAAACAGACATTTTAACTGA 25 9958 9977 778

592811 810 829 TTGAAACAGACATTTTAACT 24 9960 9979 779

592812 835 854 TTTAAGTCTGGCAAAATACA 23 9985 10004 780

592813 837 856 GATTTAAGTCTGGCAAAATA 31 9987 10006 781

592814 839 858 GTGATTTAAGTCTGGCAAAA 41 9989 10008 782

592815 841 860 CTGTGATTTAAGTCTGGCAA 49 9991 10010 783

592816 843 862 ATCTGTGATTTAAGTCTGGC 53 9993 10012 784

150481 845 864 CCATCTGTGATTTAAGTCTG 51 9995 10014 87

592817 847 866 ACCCATCTGTGATTTAAGTC 51 9997 10016 785

592818 849 868 ATACCCATCTGTGATTTAAG 43 9999 10018 786

592819 851 870 TAATACCCATCTGTGATTTA 42 10001 10020 787

592820 870 889 AAAGAAATTCTGACAAGTTT 22 10020 10039 788

489542 872 891 ACAAAGAAATTCTGACAAGT 13 10022 10041 789

592821 874 893 TGACAAAGAAATTCTGACAA 24 10024 10043 790 592822 876 895 AATGACAAAGAAATTCTGAC 25 10026 10045 791

592823 878 897 TGAATGACAAAGAAATTCTG 6 10028 10047 792

592824 880 899 CTTGAATGACAAAGAAATTC 24 10030 10049 793

489543 882 901 GGCTTGAATGACAAAGAAAT 29 10032 10051 794

592825 884 903 CAGGCTTGAATGACAAAGAA 35 10034 10053 795

592826 886 905 CACAGGCTTGAATGACAAAG 32 10036 10055 796

592827 888 907 TTCACAGGCTTGAATGACAA 41 10038 10057 797

592828 890 909 TATTCACAGGCTTGAATGAC 30 10040 10059 798

150492 909 928 AAGTGCCATACAGGGTTTTT 32 10059 10078 88

592829 91 1 930 AT AAGTGC C AT AC AGGGTTT 0 10061 10080 799

150493 913 932 TAATAAGTGCCATACAGGGT 24 10063 10082 89

592830 915 934 CATAATAAGTGCCATACAGG 26 10065 10084 800

150495 917 936 CTCATAATAAGTGCCATACA 35 10067 10086 90

150496 919 938 GCCTCATAATAAGTGCCATA 37 10069 10088 91

592831 921 940 TAGCCTCATAATAAGTGCCA 19 10071 10090 801

592832 923 942 AATAGCCTCATAATAAGTGC 0 10073 10092 802

592833 925 944 TTAATAGCCTCATAATAAGT 19 10075 10094 803

150497 927 946 TTTTAATAGCCTCATAATAA 17 10077 10096 92

592834 929 948 TCTTTTAATAGCCTCATAAT 27 10079 10098 804

592835 931 950 ATTCTTTTAATAGCCTCATA 27 10081 10100 805

150498 933 952 GGATTCTTTTAATAGCCTCA 39 10083 10102 93

592836 935 954 TTGGATTCTTTTAATAGCCT 24 10085 10104 806

592837 937 956 ATTTGGATTCTTTTAATAGC 0 10087 10106 807

592838 939 958 GAATTTGGATTCTTTTAATA 10 10089 10108 808

592839 941 960 TTGAATTTGGATTCTTTTAA 13 10091 101 10 809

592840 943 962 GTTTGAATTTGGATTCTTTT 29 10093 101 12 810

592841 945 964 TAGTTTGAATTTGGATTCTT 31 10095 101 14 81 1

592842 947 966 TTTAGTTTGAATTTGGATTC 8 10097 101 16 812

592843 949 968 TTTTTAGTTTGAATTTGGAT 10 n/a n/a 813

592844 951 970 TTTTTTTAGTTTGAATTTGG 7 n/a n/a 814

Example 2: Inhibition of human SOD-1 in HepG2 cells by MOE gapmers

Modified oligonucleotides were designed targeting a superoxide dismutase 1, soluble (SOD-1) nucleic acid and were tested for their effects on SOD-1 mRNA in vitro. ISIS 146143, ISIS 150438-150440, ISIS 150442, ISIS 150450, ISIS 150455-150457, ISIS 150459, ISIS 150461, ISIS 150469, ISIS 150473, ISIS 150478, ISIS 150484, ISIS 150486, ISIS 150494, ISIS 150508-150510, ISIS 333607, ISIS 333608, ISIS 333611, ISIS 333618, previously disclosed in WO 2005/040180, were also included in this assay. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 5,000 tiM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

Human primer probe set RTS3898 was used to measure mRNA levels. In cases where the oligonucleotide overlapped the amplicon of the primer probe set, an alternative primer probe set, HTS90, was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells, 'n.d.' indicates that inhibition levels were not measured using the particular primer probe set.

The newly designed modified oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1

(GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000). 'n/a' indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 11

Percent inhibition of SOD-1 mRNA b 5-10-5 MOE a mers tar etin SE ID NO: 1 and/or 2

Figure imgf000103_0001
596305 575 594 ACACCACAAGCCAAACGACT 49 9725 9744 819

596306 577 596 TTACACCACAAGCCAAACGA 24 9727 9746 820

596307 641 660 GGATAACAGATGAGTTAAGG 48 9791 9810 821

596308 664 683 AGGATACATTTCTACAGCTA 79 9814 9833 822

596309 666 685 TCAGGATACATTTCTACAGC 70 9816 9835 823

596310 668 687 TATCAGGATACATTTCTACA 58 9818 9837 824

489524 672 691 TGTTTATCAGGATACATTTC 52 9822 9841 825

596311 674 693 AATGTTTATCAGGATACATT 54 9824 9843 826

596312 676 695 TTAATGTTTATCAGGATACA 34 9826 9845 827

596313 678 697 GTTTAATGTTTATCAGGATA 71 9828 9847 828

596314 680 699 GTGTTTAATGTTTATCAGGA 73 9830 9849 829

596315 693 712 TTTTAAGATTACAGTGTTTA 13 9843 9862 830

596316 695 714 ACTTTTAAGATTACAGTGTT 24 9845 9864 831

596317 697 716 ACACTTTTAAGATTACAGTG 15 9847 9866 832

596318 699 718 TTACACTTTTAAGATTACAG 0 9849 9868 833

596319 701 720 AATTACACTTTTAAGATTAC 1 9851 9870 834

596320 705 724 ACACAATTACACTTTTAAGA 0 9855 9874 835

596321 707 726 TCACACAATTACACTTTTAA 15 9857 9876 836

596322 711 730 AAAGTCACACAATTACACTT 15 9861 9880 837

596323 715 734 TGAAAAAGTCACACAATTAC 0 9865 9884 838

596324 717 736 TCTGAAAAAGTCACACAATT 5 9867 9886 839

596325 719 738 ACTCTGAAAAAGTCACACAA 21 9869 9888 840

596326 723 742 AGCAACTCTGAAAAAGTCAC 14 9873 9892 841

596327 730 749 ACTTTAAAGCAACTCTGAAA 0 9880 9899 842

489530 732 751 GTACTTTAAAGCAACTCTGA 22 9882 9901 843

596328 734 753 AGGTACTTTAAAGCAACTCT 36 9884 9903 844

596329 740 759 CACTACAGGTACTTTAAAGC 18 9890 9909 845

150469 742 761 CTCACTACAGGTACTTTAAA 25 9892 9911 94

596330 744 763 TTCTCACTACAGGTACTTTA 28 9894 9913 846

596331 746 765 GTTTCTCACTACAGGTACTT 30 9896 9915 847

596332 748 767 CAGTTTCTCACTACAGGTAC 25 9898 9917 848

596333 750 769 ATCAGTTTCTCACTACAGGT 22 9900 9919 849

489531 752 771 AAATCAGTTTCTCACTACAG 0 9902 9921 850

596334 756 775 TCATAAATCAGTTTCTCACT 21 9906 9925 851

596335 760 779 GTGATCATAAATCAGTTTCT 37 9910 9929 852

489532 762 781 AAGTGATCATAAATCAGTTT 8 9912 9931 853 596336 764 783 CCAAGTGATCATAAATCAGT 39 9914 9933 854

436935 766 785 TTCCAAGTGATCATAAATCA 18 9916 9935 855

596337 768 787 TCTTCCAAGTGATCATAAAT 12 9918 9937 856

150473 770 789 AATCTTCCAAGTGATCATAA 4 9920 9939 95

596338 795 814 TAACTGAGTTTTATAAAACT 0 9945 9964 857

596339 807 826 AAACAGACATTTTAACTGAG 4 9957 9976 858

596340 809 828 TGAAACAGACATTTTAACTG 0 9959 9978 859

150478 811 830 ATTGAAACAGACATTTTAAC 0 9961 9980 96

596341 836 855 ATTTAAGTCTGGCAAAATAC 16 9986 10005 860

596342 840 859 TGTGATTTAAGTCTGGCAAA 34 9990 10009 861

489539 842 861 TCTGTGATTTAAGTCTGGCA 44 9992 10011 862

596343 844 863 CATCTGTGATTTAAGTCTGG 29 9994 10013 863

596344 846 865 CCCATCTGTGATTTAAGTCT 41 9996 10015 864

596345 848 867 TACCCATCTGTGATTTAAGT 50 9998 10017 865

596346 850 869 AATACCCATCTGTGATTTAA 0 10000 10019 866

489540 852 871 TTAATACCCATCTGTGATTT 11 10002 10021 867

150484 871 890 CAAAGAAATTCTGACAAGTT 7 10021 10040 97

596347 873 892 GACAAAGAAATTCTGACAAG 8 10023 10042 868

596348 877 896 GAATGACAAAGAAATTCTGA 0 10027 10046 869

596349 883 902 AGGCTTGAATGACAAAGAAA 27 10033 10052 870

150486 885 904 ACAGGCTTGAATGACAAAGA 19 10035 10054 98

596350 910 929 TAAGTGCCATACAGGGTTTT 13 10060 10079 871

596351 914 933 ATAATAAGTGCCATACAGGG 18 10064 10083 872

150494 916 935 TCATAATAAGTGCCATACAG 0 10066 10085 99

596352 918 937 CCTCATAATAAGTGCCATAC 23 10068 10087 873

596353 920 939 AGCCTCATAATAAGTGCCAT 6 10070 10089 874

596354 922 941 ATAGCCTCATAATAAGTGCC 19 10072 10091 875

596355 928 947 CTTTTAATAGCCTCATAATA 0 10078 10097 876

596356 930 949 TTCTTTTAATAGCCTCATAA 5 10080 10099 877

596357 932 951 GATTCTTTTAATAGCCTCAT 4 10082 10101 878

596358 934 953 TGGATTCTTTTAATAGCCTC 13 10084 10103 879

596359 936 955 TTTGGATTCTTTTAATAGCC 14 10086 10105 880

596360 938 957 AATTTGGATTCTTTTAATAG 14 10088 10107 881

596361 940 959 TGAATTTGGATTCTTTTAAT 0 10090 10109 882

596362 946 965 TTAGTTTGAATTTGGATTCT 0 10096 10115 883

596363 948 967 TTTTAGTTTGAATTTGGATT 0 n/a n/a 884 596364 950 969 n/a n/a 885

Table 12

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000106_0001
150455 393 412 CACATTGCCCAAGTCTCCAA 36 19 8448 8467 101

596257 397 416 CAGTCACATTGCCCAAGTCT 40 27 8452 8471 913

596258 401 420 TCAGCAGTCACATTGCCCAA 52 42 8456 8475 914

596259 403 422 TGTCAGCAGTCACATTGCCC 55 49 8458 8477 915

596260 405 424 TTTGTCAGCAGTCACATTGC 26 16 8460 8479 916

596261 407 426 TCTTTGTCAGCAGTCACATT 20 11 8462 8481 917

596262 409 428 CATCTTTGTCAGCAGTCACA 34 13 8464 8483 918

596263 411 430 ACCATCTTTGTCAGCAGTCA 41 30 8466 8485 919

596264 415 434 CCACACCATCTTTGTCAGCA 39 20 8470 8489 920

596265 417 436 GGCCACACCATCTTTGTCAG 23 5 8472 8491 921

150456 419 438 TCGGCCACACCATCTTTGTC 32 28 8474 8493 102

150457 421 440 CATCGGCCACACCATCTTTG 34 38 8476 8495 103

596266 423 442 CACATCGGCCACACCATCTT 27 13 8478 8497 922

596267 425 444 GACACATCGGCCACACCATC 45 30 8480 8499 923

150459 427 446 TAGACACATCGGCCACACCA 46 36 8482 8501 104

596268 429 448 AATAGACACATCGGCCACAC 30 25 8484 8503 924

596269 431 450 TCAATAGACACATCGGCCAC 35 0 8486 8505 925

596270 433 452 CTTCAATAGACACATCGGCC 39 16 8488 8507 926

596271 435 454 ATCTTCAATAGACACATCGG 16 0 8490 8509 927

596272 437 456 GAATCTTCAATAGACACATC 22 11 8492 8511 928

596273 439 458 CAGAATCTTCAATAGACACA 17 0 8494 8513 929

596274 441 460 CACAGAATCTTCAATAGACA 10 14 8496 8515 930

596275 443 462 ATCACAGAATCTTCAATAGA 11 10 8498 8517 931

596276 445 464 AGATCACAGAATCTTCAATA 14 29 8500 8519 932

596277 447 466 TGAGATCACAGAATCTTCAA n.d. 30 8502 8521 933

596278 449 468 AGTGAGATCACAGAATCTTC n.d. 30 8504 8523 934

596279 453 472 TGAGAGTGAGATCACAGAAT n.d. 18 8508 8527 935

333618 457 476 CTCCTGAGAGTGAGATCACA n.d. 27 8512 8531 105

596281 459 478 GTCTCCTGAGAGTGAGATCA n.d. 23 8514 8533 936

596282 461 480 TGGTCTCCTGAGAGTGAGAT n.d. 24 8516 8535 937

596283 463 482 AATGGTCTCCTGAGAGTGAG n.d. 22 8518 8537 938

596284 465 484 GCAATGGTCTCCTGAGAGTG n.d. 57 8520 8539 939

596285 467 486 ATGCAATGGTCTCCTGAGAG n.d. 0 8522 8541 940

596286 469 488 TGATGCAATGGTCTCCTGAG n.d. 1 8524 8543 941

596287 471 490 AATGATGCAATGGTCTCCTG n.d. 0 8526 8545 942

596288 473 492 CCAATGATGCAATGGTCTCC n.d. 8 8528 8547 943 596289 475 494 GGCCAATGATGCAATGGTCT n.d. 9 8530 8549 944

596290 477 496 GCGGCCAATGATGCAATGGT n.d. 13 8532 8551 945

596291 479 498 GTGCGGCCAATGATGCAATG n.d. 12 8534 8553 946

596292 481 500 GTGTGCGGCCAATGATGCAA n.d. 15 8536 8555 947

596293 483 502 CAGTGTGCGGCCAATGATGC n.d. 0 8538 8557 948

596294 485 504 ACCAGTGTGCGGCCAATGAT n.d. 0 8540 8559 949

596295 487 506 CCACCAGTGTGCGGCCAATG n.d. 22 8542 8561 950

596296 489 508 GACCACCAGTGTGCGGCCAA n.d. 16 n/a n/a 951

596297 491 510 TGGACCACCAGTGTGCGGCC n.d. 28 n/a n/a 952

150461 493 512 CATGGACCACCAGTGTGCGG n.d. 25 n/a n/a 106

596298 495 514 TTCATGGACCACCAGTGTGC n.d. 21 n/a n/a 953

596299 497 516 TTTTCATGGACCACCAGTGT n.d. 17 n/a n/a 954

596300 499 518 CTTTTTCATGGACCACCAGT n.d. 9 n/a n/a 955

Example 3: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE and cEt gapmers

Modified oligonucleotides were designed targeting a superoxide dismutase 1, soluble (SOD-1) nucleic acid and were tested for their effects on SOD-1 mRNA in vitro. ISIS 333611, which was previously described in WO 2005/040180, was included as a benchmark. ISIS 590067, ISIS 590074, ISIS 590082, ISIS 590130, ISIS 590138, and ISIS 590146, which are 5-10-5 MOE gapmers as described above in Example 1, were also included in this assay. ISIS 590512, which has a similar sequence as ISIS 333611 but with deoxy, MOE, and cEt sugar modifications, was also included in this study.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 3,000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells, 'n.d.' indicates that inhibition levels were not measured.

The newly designed modified oligonucleotides in the Tables below were designed as deoxy, MOE, and cEt gapmers. The gapmers are 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2'-MOE modified sugar. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site' indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000). 'n/a' indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 13

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000109_0001
GCCGTCGCCCTT

590447 171 187 eeekkdddddddkkeee 33 977 993 970

CAGCA

TCTGCTCGAAAT

590448 202 218 eeekkdddddddkkeee 34 1008 1024 971

TGATG

TTCTGCTCGAAA

590449 203 219 eeekkdddddddkkeee 18 1009 1025 972

TTGAT

CTTCTGCTCGAA

590450 204 220 eeekkdddddddkkeee 13 1010 1026 973

ATTGA

CCTTCTGCTCGA

590451 205 221 eeekkdddddddkkeee 16 1011 1027 974

AATTG

TCCTTCTGCTCG

590452 206 222 eeekkdddddddkkeee 14 n/a n/a 975

AAATT

TTCCTTCTGCTCG

590453 207 223 eeekkdddddddkkeee 13 n/a n/a 976

AAAT

TTTCCTTCTGCTC

590454 208 224 eeekkdddddddkkeee 6 n/a n/a 977

GAAA

CTTTCCTTCTGCT

590455 209 225 eeekkdddddddkkeee 0 n/a n/a 978

CGAA

ACTTTCCTTCTGC

590456 210 226 eeekkdddddddkkeee 0 n/a n/a 979

TCGA

TACTTTCCTTCTG

590457 211 227 eeekkdddddddkkeee n.d. n/a n/a 980

CTCG

TTACTTTCCTTCT

590458 212 228 eeekkdddddddkkeee n.d. n/a n/a 981

GCTC

ATTACTTTCCTTC

590459 213 229 eeekkdddddddkkeee n.d. n/a n/a 982

TGCT

CATTACTTTCCTT

590461 214 230 eeekkdddddddkkeee n.d. n/a n/a 983

CTGC

CCATTACTTTCCT

590462 215 231 eeekkdddddddkkeee n.d. n/a n/a 984

TCTG

TCCATTACTTTCC

590463 216 232 eeekkdddddddkkeee n.d. n/a n/a 985

TTCT

GTCCATTACTTTC

590464 217 233 eeekkdddddddkkeee n.d. n/a n/a 986

CTTC

GGTCCATTACTT

590465 218 234 eeekkdddddddkkeee n.d. 4972 4988 987

TCCTT

TGGTCCATTACT

590466 219 235 eeekkdddddddkkeee 5 4973 4989 988

TTCCT

CTGGTCCATTAC

590467 220 236 eeekkdddddddkkeee 11 4974 4990 989

TTTCC

ACTGGTCCATTA

590468 221 237 eeekkdddddddkkeee 14 4975 4991 990

CTTTC

CACTGGTCCATT

590469 222 238 eeekkdddddddkkeee 12 4976 4992 991

ACTTT

TCACTGGTCCAT

590470 223 239 eeekkdddddddkkeee 15 4977 4993 992

TACTT

TTCACTGGTCCA

590471 224 240 eeekkdddddddkkeee 14 4978 4994 993

TTACT

CTTCACTGGTCC

590472 225 241 eeekkdddddddkkeee 11 4979 4995 994

ATTAC

CCTTCACTGGTC

590473 226 242 eeekkdddddddkkeee 8 4980 4996 995

CATTA ACCTTCACTGGT

590474 227 243 eeekkdddddddkkeee 44 4981 4997 996

CCATT

CACCTTCACTGG

590475 228 244 eeekkdddddddkkeee 53 4982 4998 997

TCCAT

ACACCTTCACTG

590476 229 245 eeekkdddddddkkeee 20 4983 4999 998

GTCCA

CACACCTTCACT

590477 230 246 eeekkdddddddkkeee 12 4984 5000 999

GGTCC

CCACACCTTCAC

590478 231 247 eeekkdddddddkkeee 36 4985 5001 1000

TGGTC

CCCACACCTTCA

590479 232 248 eeekkdddddddkkeee 18 4986 5002 1001

CTGGT

CCCCACACCTTC

590480 233 249 eeekkdddddddkkeee 14 4987 5003 1002

ACTGG

TTCCCCACACCT

590481 235 251 eeekkdddddddkkeee 8 4989 5005 1003

TCACT

CTTCCCCACACC

590482 236 252 eeekkdddddddkkeee 29 4990 5006 1004

TTCAC

GCTTCCCCACAC

590483 237 253 eeekkdddddddkkeee 36 4991 5007 1005

CTTCA

TGCTTCCCCACA

590484 238 254 eeekkdddddddkkeee 43 4992 5008 1006

CCTTC

ATGCTTCCCCAC

590485 239 255 eeekkdddddddkkeee 41 4993 5009 1007

ACCTT

AATGCTTCCCCA

590486 240 256 eeekkdddddddkkeee 35 4994 5010 1008

CACCT

TAATGCTTCCCC

590487 241 257 eeekkdddddddkkeee 52 4995 5011 1009

ACACC

ATGCAGGCCTTC

590488 264 280 eeekkdddddddkkeee 37 5018 5034 1010

AGTCA

CATGCAGGCCTT

590489 265 281 eeekkdddddddkkeee 41 5019 5035 1011

CAGTC

CCATGCAGGCCT

590490 266 282 eeekkdddddddkkeee 21 5020 5036 1012

TCAGT

TCCATGCAGGCC

590491 267 283 eeekkdddddddkkeee 18 5021 5037 1013

TTCAG

ATCCATGCAGGC

590492 268 284 eeekkdddddddkkeee 27 5022 5038 1014

CTTCA

AATCCATGCAGG

590493 269 285 eeekkdddddddkkeee 13 5023 5039 1015

CCTTC

GAATCCATGCAG

590494 270 286 eeekkdddddddkkeee 9 5024 5040 1016

GCCTT

GGAATCCATGCA

590495 271 287 eeekkdddddddkkeee 7 5025 5041 1017

GGCCT

TGGAATCCATGC

590496 272 288 eeekkdddddddkkeee 12 5026 5042 1018

AGGCC

ATGGAATCCATG

590497 273 289 eeekkdddddddkkeee 9 5027 5043 1019

CAGGC

CATGGAATCCAT

590498 274 290 eeekkdddddddkkeee 14 5028 5044 1020

GCAGG

ACATGGAATCCA

590499 275 291 eeekkdddddddkkeee 0 5029 5045 1021

TGCAG AACATGGAATCC

590500 276 292 eeekkdddddddkkeee 10 5030 5046 1022

ATGCA

GAACATGGAATC

590501 277 293 eeekkdddddddkkeee 9 5031 5047 1023

CATGC

TGAACATGGAAT

590502 278 294 eeekkdddddddkkeee 2 5032 5048 1024

CCATG

ATGAACATGGAA

590503 279 295 eeekkdddddddkkeee 8 5033 5049 1025

TCCAT

CTGCACTGGTAC

590504 316 332 eeekkdddddddkkeee 3 7632 7648 1026

AGCCT

CCTGCACTGGTA

590505 317 333 eeekkdddddddkkeee 17 7633 7649 1027

CAGCC

ACCTGCACTGGT

590506 318 334 eeekkdddddddkkeee 12 7634 7650 1028

ACAGC

GACCTGCACTGG

590507 319 335 eeekkdddddddkkeee 7 7635 7651 1029

TACAG

GGACCTGCACTG

590508 320 336 eeekkdddddddkkeee 7 7636 7652 1030

GTACA

AGGACCTGCACT

590509 321 337 eeekkdddddddkkeee 4 7637 7653 1031

GGTAC

GAGGACCTGCAC

590510 322 338 eeekkdddddddkkeee 17 7638 7654 1032

TGGTA

TGAGGACCTGCA

590511 323 339 eeekkdddddddkkeee 8 7639 7655 1033

CTGGT

Table 14

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000112_0001
GGATTAAAGTG

590521 332 348 eeekkdddddddkkeee 30 7648 7664 1042

AGGACC

AGGATTAAAGT

590522 333 349 eeekkdddddddkkeee 23 7649 7665 1043

GAGGAC

GAGGATTAAAG

590523 334 350 eeekkdddddddkkeee 40 7650 7666 1044

TGAGGA

AGAGGATTAAA

590524 335 351 eeekkdddddddkkeee 16 7651 7667 1045

GTGAGG

TAGAGGATTAA

590525 336 352 eeekkdddddddkkeee 21 7652 7668 1046

AGTGAG

ATAGAGGATTA

590526 337 353 eeekkdddddddkkeee 9 7653 7669 1047

AAGTGA

GATAGAGGATT

590527 338 354 eeekkdddddddkkeee 8 7654 7670 1048

AAAGTG

GGATAGAGGAT

590528 339 355 eeekkdddddddkkeee 14 7655 7671 1049

TAAAGT

TGGATAGAGGA

590530 340 356 eeekkdddddddkkeee 23 7656 7672 1050

TTAAAG

CTGGATAGAGG

590531 341 357 eeekkdddddddkkeee 26 7657 7673 1051

ATT AAA

TCTGGATAGAG

590532 342 358 eeekkdddddddkkeee 25 7658 7674 1052

GATTAA

CTTTGGCCCACC

590533 360 376 eeekkdddddddkkeee 41 7676 7692 1053

GTGTT

CCTTTGGCCCAC

590534 361 377 eeekkdddddddkkeee 46 7677 7693 1054

CGTGT

TCCTTTGGCCCA

590535 362 378 eeekkdddddddkkeee 39 7678 7694 1055

CCGTG

ATCCTTTGGCCC

590536 363 379 eeekkdddddddkkeee n.d. 7679 7695 1056

ACCGT

CATCCTTTGGCC

590537 364 380 eeekkdddddddkkeee n.d. 7680 7696 1057

CACCG

TCATCCTTTGGC

590538 365 381 eeekkdddddddkkeee n.d. 7681 7697 1058

CCACC

TTCATCCTTTGG

590539 366 382 eeekkdddddddkkeee n.d. 7682 7698 1059

CCCAC

CTTCATCCTTTG

590540 367 383 eeekkdddddddkkeee n.d. 7683 7699 1060

GCCCA

TCTTCATCCTTT

590541 368 384 eeekkdddddddkkeee n.d. 7684 7700 1061

GGCCC

CTCTTCATCCTT

590542 369 385 eeekkdddddddkkeee n.d. 7685 7701 1062

TGGCC

TCTCTTCATCCT

590543 370 386 eeekkdddddddkkeee n.d. 7686 7702 1063

TTGGC

CTCTCTTCATCC

590544 371 387 eeekkdddddddkkeee 2 7687 7703 1064

TTTGG

TGCCTCTCTTCA

590545 374 390 eeekkdddddddkkeee 6 n/a n/a 1065

TCCTT

ATGCCTCTCTTC

590546 375 391 eeekkdddddddkkeee 0 n/a n/a 1066

ATCCT

CATGCCTCTCTT

590547 376 392 eeekkdddddddkkeee 14 n/a n/a 1067

CATCC ACATGCCTCTCT

590548 377 393 eeekkdddddddkkeee 0 n/a n/a 1068

TCATC

AACATGCCTCTC

590549 378 394 eeekkdddddddkkeee 13 n/a n/a 1069

TTCAT

CAACATGCCTCT

590550 379 395 eeekkdddddddkkeee 3 n/a n/a 1070

CTTCA

CCAACATGCCTC

590551 380 396 eeekkdddddddkkeee 0 n/a n/a 1071

TCTTC

TCCAACATGCCT

590552 381 397 eeekkdddddddkkeee 0 n/a n/a 1072

CTCTT

CTCCAACATGCC

590553 382 398 eeekkdddddddkkeee 5 n/a n/a 1073

TCTCT

TCTCCAACATGC

590554 383 399 eeekkdddddddkkeee 10 n/a n/a 1074

CTCTC

GTCTCCAACATG

590555 384 400 eeekkdddddddkkeee 8 n/a n/a 1075

CCTCT

AGCAGTCACATT

590556 402 418 eeekkdddddddkkeee 18 8457 8473 1076

GCCCA

CAGCAGTCACA

590557 403 419 eeekkdddddddkkeee 7 8458 8474 1077

TTGCCC

AGACACATCGG

590558 429 445 eeekkdddddddkkeee 21 8484 8500 1078

CCACAC

CTTCAATAGACA

590559 436 452 eeekkdddddddkkeee 9 8491 8507 1079

CATCG

GAGATCACAGA

590560 449 465 eeekkdddddddkkeee 13 8504 8520 1080

ATCTTC

590561 501 517 eeekkdddddddkkeee 76 n/a n/a 1081

CACCA

CTTTTTCATGGA

590562 502 518 eeekkdddddddkkeee 87 n/a n/a 1082

CCACC

590563 503 519 eeekkdddddddkkeee 71 n/a n/a 1083

ACCAC

TGCTTTTTCATG

590564 504 520 eeekkdddddddkkeee 51 n/a n/a 1084

GACCA

CTGCTTTTTCAT

590565 505 521 eeekkdddddddkkeee 65 9655 9671 1085

GGACC

590566 506 522 eeekkdddddddkkeee 55 9656 9672 1086

TGGAC

590567 507 523 eeekkdddddddkkeee 42 9657 9673 1087

ATGGA

CATCTGCTTTTT

590568 508 524 eeekkdddddddkkeee 70 9658 9674 1088

CATGG

TCATCTGCTTTT

590569 509 525 eeekkdddddddkkeee 71 9659 9675 1089

TCATG

GTCATCTGCTTT

590570 510 526 eeekkdddddddkkeee 74 9660 9676 1090

TTCAT

AGTCATCTGCTT

590571 511 527 eeekkdddddddkkeee 76 9661 9677 1091

TTTCA

AAGTCATCTGCT

590572 512 528 eeekkdddddddkkeee 83 9662 9678 1092

TTTTC

CAAGTCATCTGC

590573 513 529 eeekkdddddddkkeee 42 9663 9679 1093 CCAAGTCATCTG

590574 514 530 eeekkdddddddkkeee 50 9664 9680 1094

CTTTT

CCCAAGTCATCT

590575 515 531 eeekkdddddddkkeee 72 9665 9681 1095

GCTTT

GCCCAAGTCATC

590576 516 532 eeekkdddddddkkeee 93 9666 9682 1096

TGCTT

TGCCCAAGTCAT

590577 517 533 eeekkdddddddkkeee 90 9667 9683 1097

CTGCT

TTGCCCAAGTCA

590578 518 534 eeekkdddddddkkeee 92 9668 9684 1098

TCTGC

CCACCTTTGCCC

590579 524 540 eeekkdddddddkkeee 91 9674 9690 1099

AAGTC

TCCACCTTTGCC

590580 525 541 eeekkdddddddkkeee 88 9675 9691 1100

CAAGT

TTCCACCTTTGC

590581 526 542 eeekkdddddddkkeee 87 9676 9692 1101

CCAAG

TTTCCACCTTTG

590582 527 543 eeekkdddddddkkeee 78 9677 9693 1102

CCCAA

ATTTCCACCTTT

590583 528 544 eeekkdddddddkkeee 63 9678 9694 1103

GCCCA

CATTTCCACCTT

590584 529 545 eeekkdddddddkkeee 73 9679 9695 1104

TGCCC

TCATTTCCACCT

590585 530 546 eeekkdddddddkkeee 57 9680 9696 1105

TTGCC

TTCATTTCCACC

590586 531 547 eeekkdddddddkkeee 33 9681 9697 1106

TTTGC

TCTTCATTTCCA

590587 533 549 eeekkdddddddkkeee 31 9683 9699 1107

CCTTT

CTTTCTTCATTT

590588 536 552 eeekkdddddddkkeee 11 9686 9702 1108

CCACC

ACTTTCTTCATT

590589 537 553 eeekkdddddddkkeee 15 9687 9703 1109

TCCAC

TACTTTCTTCAT

590590 538 554 eeekkdddddddkkeee 18 9688 9704 1110

TTCCA

Table 15

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

SEQ SEQ SEQ SEQ ID ID ID ID

SEQ

ISIS NO: NO: % NO: NO:

Sequence Chemistry ID NO 1 1 inhibition 2 2

NO

Start Stop Start Stop Site Site Site Site

CGTCGCCCTTCAG

590512 169 185 eeekkdddddddkkeee 21 975 991 968

CACG

AATTACACCACA

590591 582 598 eeekkdddddddkkeee 21 9732 9748 1111

AGCCA

CAATTACACCAC

590592 583 599 eeekkdddddddkkeee 33 9733 9749 1112

AAGCC

CCAATTACACCA

590593 584 600 eeekkdddddddkkeee 29 9734 9750 1113

CAAGC CCCAATTACACC

590594 585 601 eeekkdddddddkkeee 29 9735 9751 1114

ACAAG

GATCCCAATTAC

590595 588 604 eeekkdddddddkkeee 3 9738 9754 1115

ACCAC

CGATCCCAATTAC

590596 589 605 eeekkdddddddkkeee 12 9739 9755 1116

ACCA

GCGATCCCAATT

590597 590 606 eeekkdddddddkkeee 19 9740 9756 1117

ACACC

GGCGATCCCAAT

590598 591 607 eeekkdddddddkkeee 9 9741 9757 1118

TACAC

GGGCGATCCCAA

590599 592 608 eeekkdddddddkkeee 18 9742 9758 1119

TTACA

TGGGCGATCCCA

590600 593 609 eeekkdddddddkkeee 20 9743 9759 1120

ATTAC

TTGGGCGATCCC

590601 594 610 eeekkdddddddkkeee 26 9744 9760 1121

AATTA

ATTGGGCGATCC

590602 595 611 eeekkdddddddkkeee 19 9745 9761 1122

CAATT

TATTGGGCGATCC

590603 596 612 eeekkdddddddkkeee 3 9746 9762 1123

CAAT

TTATTGGGCGATC

590604 597 613 eeekkdddddddkkeee 15 9747 9763 1124

CCAA

TTTATTGGGCGAT

590605 598 614 eeekkdddddddkkeee 20 9748 9764 1125

CCCA

GTTTATTGGGCGA

590606 599 615 eeekkdddddddkkeee 18 9749 9765 1126

TCCC

TGTTTATTGGGCG

590607 600 616 eeekkdddddddkkeee 21 9750 9766 1127

ATCC

ATGTTTATTGGGC

590608 601 617 eeekkdddddddkkeee 28 9751 9767 1128

GATC

AATGTTTATTGGG

590609 602 618 eeekkdddddddkkeee 30 9752 9768 1129

CGAT

GAATGTTTATTGG

590610 603 619 eeekkdddddddkkeee 14 9753 9769 1130

GCGA

GGAATGTTTATTG

590611 604 620 eeekkdddddddkkeee 15 9754 9770 1131

GGCG

AAGGGAATGTTT

590612 607 623 eeekkdddddddkkeee 2 9757 9773 1132

ATTGG

CAAGGGAATGTT

590613 608 624 eeekkdddddddkkeee n.d. 9758 9774 1133

TATTG

CCAAGGGAATGT

590614 609 625 eeekkdddddddkkeee n.d. 9759 9775 1134

TTATT

TCCAAGGGAATG

590615 610 626 eeekkdddddddkkeee n.d. 9760 9776 1135

TTTAT

ATCCAAGGGAAT

590616 611 627 eeekkdddddddkkeee n.d. 9761 9777 1136

GTTTA

CATCCAAGGGAA

590617 612 628 eeekkdddddddkkeee n.d. 9762 9778 1137

TGTTT

ACATCCAAGGGA

590618 613 629 eeekkdddddddkkeee n.d. 9763 9779 1138

ATGTT

TACATCCAAGGG

590619 614 630 eeekkdddddddkkeee n.d. 9764 9780 1139

AATGT CTACATCCAAGG

590620 615 631 eeekkdddddddkkeee n.d. 9765 9781 1140

GAATG

ACTACATCCAAG

590621 616 632 eeekkdddddddkkeee 7 9766 9782 1141

GGAAT

GACTACATCCAA

590622 617 633 eeekkdddddddkkeee 19 9767 9783 1142

GGGAA

AGACTACATCCA

590623 618 634 eeekkdddddddkkeee 39 9768 9784 1143

AGGGA

CAGACTACATCC

590624 619 635 eeekkdddddddkkeee 53 9769 9785 1144

AAGGG

TCAGACTACATCC

590625 620 636 eeekkdddddddkkeee 57 9770 9786 1145

AAGG

CTCAGACTACATC

590626 621 637 eeekkdddddddkkeee 76 9771 9787 1146

CAAG

CCTCAGACTACAT

590627 622 638 eeekkdddddddkkeee 58 9772 9788 1147

CCAA

GCCTCAGACTAC

590628 623 639 eeekkdddddddkkeee 43 9773 9789 1148

ATCCA

GGCCTCAGACTA

590629 624 640 eeekkdddddddkkeee 24 9774 9790 1149

CATCC

GGGCCTCAGACT

590630 625 641 eeekkdddddddkkeee 24 9775 9791 1150

ACATC

GATAACAGATGA

590631 643 659 eeekkdddddddkkeee 11 9793 9809 1151

GTTAA

GGATAACAGATG

590632 644 660 eeekkdddddddkkeee 32 9794 9810 1152

AGTTA

AGGATAACAGAT

590633 645 661 eeekkdddddddkkeee 45 9795 9811 1153

GAGTT

CAGGATAACAGA

590634 646 662 eeekkdddddddkkeee 65 9796 9812 1154

TGAGT

GCAGGATAACAG

590635 647 663 eeekkdddddddkkeee 58 9797 9813 1155

ATGAG

AGCAGGATAACA

590636 648 664 eeekkdddddddkkeee 45 9798 9814 1156

GATGA

TAGCAGGATAAC

590637 649 665 eeekkdddddddkkeee 34 9799 9815 1157

AGATG

CTAGCAGGATAA

590638 650 666 eeekkdddddddkkeee 39 9800 9816 1158

CAGAT

GCTAGCAGGATA

590639 651 667 eeekkdddddddkkeee 10 9801 9817 1159

ACAGA

AGCTAGCAGGAT

590640 652 668 eeekkdddddddkkeee 15 9802 9818 1160

AACAG

CAGCTAGCAGGA

590641 653 669 eeekkdddddddkkeee 21 9803 9819 1161

TAACA

ACAGCTAGCAGG

590642 654 670 eeekkdddddddkkeee 20 9804 9820 1162

ATAAC

TACAGCTAGCAG

590643 655 671 eeekkdddddddkkeee 40 9805 9821 1163

GATAA

CTACAGCTAGCA

590644 656 672 eeekkdddddddkkeee 55 9806 9822 1164

GGATA

TCTACAGCTAGC

590645 657 673 eeekkdddddddkkeee 51 9807 9823 1165

AGGAT TTCTACAGCTAGC

590646 658 674 eeekkdddddddkkeee 31 9808 9824 1166

AGGA

TTTCTACAGCTAG

590647 659 675 eeekkdddddddkkeee 38 9809 9825 1167

CAGG

ATTTCTACAGCTA

590648 660 676 eeekkdddddddkkeee 45 9810 9826 1168

GCAG

CATTTCTACAGCT

590649 661 677 eeekkdddddddkkeee 34 9811 9827 1169

AGCA

ATACATTTCTACA

590650 664 680 eeekkdddddddkkeee 57 9814 9830 1170

GCTA

GATACATTTCTAC

590651 665 681 eeekkdddddddkkeee 40 9815 9831 1171

AGCT

GTGTTTAATGTTT

590652 683 699 eeekkdddddddkkeee 37 9833 9849 1172

ATCA

AGTGTTTAATGTT

590653 684 700 eeekkdddddddkkeee 67 9834 9850 1173

TATC

CAGTGTTTAATGT

590654 685 701 eeekkdddddddkkeee 54 9835 9851 1174

TTAT

ACAGTGTTTAATG

590655 686 702 eeekkdddddddkkeee 56 9836 9852 1175

TTTA

TACAGTGTTTAAT

590656 687 703 eeekkdddddddkkeee 30 9837 9853 1176

GTTT

TTACAGTGTTTAA

590657 688 704 eeekkdddddddkkeee 18 9838 9854 1177

TGTT

ATTACAGTGTTTA

590658 689 705 eeekkdddddddkkeee 24 9839 9855 1178

ATGT

GATTACAGTGTTT

590659 690 706 eeekkdddddddkkeee 10 9840 9856 1179

AATG

AGATTACAGTGTT

590660 691 707 eeekkdddddddkkeee 45 9841 9857 1180

TAAT

AAGATTACAGTG

590661 692 708 eeekkdddddddkkeee 34 9842 9858 1181

TTTAA

TAAGATTACAGT

590662 693 709 eeekkdddddddkkeee 54 9843 9859 1182

GTTTA

TTAAGATTACAGT

590663 694 710 eeekkdddddddkkeee 54 9844 9860 1183

GTTT

ATCTTCCAAGTGA

590664 772 788 eeekkdddddddkkeee 7 9922 9938 1184

TCAT

AATCTTCCAAGTG

590665 773 789 eeekkdddddddkkeee 23 9923 9939 1185

ATCA

AAATCTTCCAAGT

590666 774 790 eeekkdddddddkkeee 4 9924 9940 1186

GATC

CAAATCTTCCAA

590667 775 791 eeekkdddddddkkeee 18 9925 9941 1187

GTGAT Table 16

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000119_0001
TACAGGTCA

590686 822 838 eeekkdddddddkkeee 9 9972 9988 1206

TTGAAACA

ATACAGGTC

590687 823 839 eeekkdddddddkkeee 14 9973 9989 1207

ATTGAAAC

AATACAGGT

590688 824 840 eeekkdddddddkkeee 6 9974 9990 1208

CATTGAAA

AAATACAGG

590689 825 841 eeekkdddddddkkeee 2 9975 9991 1209

TCATTGAA

AAAATACAG

590690 826 842 eeekkdddddddkkeee n.d. 9976 9992 1210

GTCATTGA

CAAAATACA

590691 827 843 eeekkdddddddkkeee n.d. 9977 9993 1211

GGTCATTG

GCAAAATAC

590692 828 844 eeekkdddddddkkeee n.d. 9978 9994 1212

AGGTCATT

GGCAAAATA

590693 829 845 eeekkdddddddkkeee n.d. 9979 9995 1213

CAGGTCAT

TGGCAAAAT

590694 830 846 eeekkdddddddkkeee n.d. 9980 9996 1214

ACAGGTCA

CTGGCAAAA

590695 831 847 eeekkdddddddkkeee n.d. 9981 9997 1215

TACAGGTC

TCTGGCAAA

590696 832 848 eeekkdddddddkkeee n.d. 9982 9998 1216

ATACAGGT

GTCTGGCAA

590697 833 849 eeekkdddddddkkeee n.d. 9983 9999 1217

AATACAGG

AGTCTGGCA

590698 834 850 eeekkdddddddkkeee 1 9984 10000 1218

AAATACAG

AAGTCTGGC

590699 835 851 eeekkdddddddkkeee 10 9985 10001 1219

AAAATACA

TAAGTCTGG

590700 836 852 eeekkdddddddkkeee 4 9986 10002 1220

CAAAATAC

TTAAGTCTGG

590701 837 853 eeekkdddddddkkeee 2 9987 10003 1221

CAAAATA

AATACCCAT

590702 853 869 eeekkdddddddkkeee 7 10003 10019 1222

CTGTGATT

TAATACCCAT

590703 854 870 eeekkdddddddkkeee 4 10004 10020 1223

CTGTGAT

TTAATACCCA

590704 855 871 eeekkdddddddkkeee 2 10005 10021 1224

TCTGTGA

TTTAATACCC

590705 856 872 eeekkdddddddkkeee 0 10006 10022 1225

ATCTGTG

GTTTAATACC

590706 857 873 eeekkdddddddkkeee 17 10007 10023 1226

CATCTGT

AGTTTAATAC

590707 858 874 eeekkdddddddkkeee 10 10008 10024 1227

CCATCTG

AAGTTTAAT

590708 859 875 eeekkdddddddkkeee 12 10009 10025 1228

ACCCATCT CAAGTTTAAT

590709 860 876 eeekkdddddddkkeee 37 10010 10026 1229

ACCCATC

ACAAGTTTA

590710 861 877 eeekkdddddddkkeee 23 10011 10027 1230

ATACCCAT

GACAAGTTT

590711 862 878 eeekkdddddddkkeee 24 10012 10028 1231

AATACCCA

TGACAAGTTT

590712 863 879 eeekkdddddddkkeee 27 10013 10029 1232

AATACCC

CTGACAAGT

590713 864 880 eeekkdddddddkkeee 10 10014 10030 1233

TTAATACC

TCTGACAAG

590714 865 881 eeekkdddddddkkeee 0 10015 10031 1234

TTTAATAC

TTCTGACAA

590715 866 882 eeekkdddddddkkeee 6 10016 10032 1235

GTTTAATA

ATTCTGACA

590716 867 883 eeekkdddddddkkeee 9 10017 10033 1236

AGTTTAAT

AATTCTGAC

590717 868 884 eeekkdddddddkkeee 15 10018 10034 1237

AAGTTTAA

AAATTCTGA

590718 869 885 eeekkdddddddkkeee 21 10019 10035 1238

CAAGTTTA

GAAATTCTG

590719 870 886 eeekkdddddddkkeee 14 10020 10036 1239

ACAAGTTT

AGAAATTCT

590720 871 887 eeekkdddddddkkeee 8 10021 10037 1240

GACAAGTT

AAGAAATTC

590721 872 888 eeekkdddddddkkeee 18 10022 10038 1241

TGACAAGT

TTCACAGGCT

590722 891 907 eeekkdddddddkkeee 9 10041 10057 1242

TGAATGA

ATTCACAGG

590723 892 908 eeekkdddddddkkeee 11 10042 10058 1243

CTTGAATG

TATTCACAG

590724 893 909 eeekkdddddddkkeee 0 10043 10059 1244

GCTTGAAT

TTATTCACAG

590725 894 910 eeekkdddddddkkeee 10 10044 10060 1245

GCTTGAA

TTTATTCACA

590726 895 911 eeekkdddddddkkeee 29 10045 10061 1246

GGCTTGA

TTTTATTCAC

590727 896 912 eeekkdddddddkkeee 28 10046 10062 1247

AGGCTTG

TTTTTATTCA

590728 897 913 eeekkdddddddkkeee 31 10047 10063 1248

CAGGCTT

GTTTTTATTC

590729 898 914 eeekkdddddddkkeee 10 10048 10064 1249

ACAGGCT

590731 899 915 eeekkdddddddkkeee 22 10049 10065 1250

CACAGGC

590732 900 916 eeekkdddddddkkeee 17 10050 10066 1251

TCACAGG AGGGTTTTTA

590733 901 917 eeekkdddddddkkeee 24 10051 10067 1252

TTCACAG

CAGGGTTTTT

590734 902 918 eeekkdddddddkkeee 17 10052 10068 1253

ATTCACA

ACAGGGTTTT

590735 903 919 eeekkdddddddkkeee 10 10053 10069 1254

TATTCAC

TACAGGGTTT

590736 904 920 eeekkdddddddkkeee 11 10054 10070 1255

TTATTCA

ATACAGGGT

590737 905 921 eeekkdddddddkkeee 3 10055 10071 1256

TTTTATTC

CATACAGGG

590738 906 922 eeekkdddddddkkeee 0 10056 10072 1257

TTTTTATT

CCATACAGG

590739 907 923 eeekkdddddddkkeee 1 10057 10073 1258

GCCATACAG

590740 908 924 eeekkdddddddkkeee 11 10058 10074 1259

TGCCATACA

590741 909 925 eeekkdddddddkkeee 9 10059 10075 1260

GGGTTTTT

GTGCCATAC

590742 910 926 eeekkdddddddkkeee 7 10060 10076 1261

AGGGTTTT

AGTGCCATA

590743 911 927 eeekkdddddddkkeee 9 10061 10077 1262

CAGGGTTT

TTGGATTCTT

590744 938 954 eeekkdddddddkkeee 8 10088 10104 1263

TTAATAG

TTTTAGTTTG

590745 951 967 eeekkdddddddkkeee 12 n/a n/a 1264

AATTTGG

Table 17

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000122_0001
CATTACTTTCC

590461 214 230 eeekkdddddddkkeee 28 n/a n/a 983

TTCTGC

CCATTACTTTC

590462 215 231 eeekkdddddddkkeee 37 n/a n/a 984

CTTCTG

TCCATTACTTT

590463 216 232 eeekkdddddddkkeee 18 n/a n/a 985

CCTTCT

CTGGTCCATT

590082 217 236 eeeeeddddddddddeeeee 50 n/a n/a 135

ACTTTCCTTC

GTCCATTACTT

590464 217 233 eeekkdddddddkkeee 33 n/a n/a 986

TCCTTC

GGTCCATTAC

590465 218 234 eeekkdddddddkkeee 18 4972 4988 987

TTTCCTT

TTCATCCTTTG

590130 363 382 eeeeeddddddddddeeeee 30 7679 7698 194

GCCCACCGT

ATCCTTTGGC

590536 363 379 eeekkdddddddkkeee 51 7679 7695 1056

CCACCGT

CATCCTTTGG

590537 364 380 eeekkdddddddkkeee 38 7680 7696 1057

CCCACCG

TCATCCTTTGG

590538 365 381 eeekkdddddddkkeee 27 7681 7697 1058

CCCACC

TTCATCCTTTG

590539 366 382 eeekkdddddddkkeee 26 7682 7698 1059

GCCCAC

CTTCATCCTTT

590540 367 383 eeekkdddddddkkeee 35 7683 7699 1060

GGCCCA

TCTTCATCCTT

590541 368 384 eeekkdddddddkkeee 15 7684 7700 1061

TGGCCC

CTCTTCATCCT

590542 369 385 eeekkdddddddkkeee 26 7685 7701 1062

TTGGCC

TCTCTTCATCC

590543 370 386 eeekkdddddddkkeee 14 7686 7702 1063

TTTGGC

TGCCTCTCTTC

590138 371 390 eeeeeddddddddddeeeee 32 n/a n/a 202

ATCCTTTGG

CATCTGCTTTT

590146 505 524 eeeeeddddddddddeeeee 46 9655 9674 211

TCATGGACC

CAAGGGAATG

590613 608 624 eeekkdddddddkkeee 19 9758 9774 1133

TTTATTG

CCAAGGGAAT

590614 609 625 eeekkdddddddkkeee 36 9759 9775 1134

GTTTATT

TCCAAGGGAA

590615 610 626 eeekkdddddddkkeee 32 9760 9776 1135

TGTTTAT

ATCCAAGGGA

590616 611 627 eeekkdddddddkkeee 42 9761 9777 1136

ATGTTTA

CATCCAAGGG

590617 612 628 eeekkdddddddkkeee 16 9762 9778 1137

AATGTTT

ACATCCAAGG

590618 613 629 eeekkdddddddkkeee 30 9763 9779 1138

GAATGTT TACATCCAAG

590619 614 630 eeekkdddddddkkeee 30 9764 9780 1139

GGAATGT

CTACATCCAA

590620 615 631 eeekkdddddddkkeee 40 9765 9781 1140

GGGAATG

AAAATACAGG

590690 826 842 eeekkdddddddkkeee 28 9976 9992 1210

TCATTGA

CAAAATACAG

590691 827 843 eeekkdddddddkkeee 23 9977 9993 1211

GTCATTG

GCAAAATACA

590692 828 844 eeekkdddddddkkeee 43 9978 9994 1212

GGTCATT

GGCAAAATAC

590693 829 845 eeekkdddddddkkeee 39 9979 9995 1213

AGGTCAT

TGGCAAAATA

590694 830 846 eeekkdddddddkkeee 26 9980 9996 1214

CAGGTCA

CTGGCAAAAT

590695 831 847 eeekkdddddddkkeee 18 9981 9997 1215

ACAGGTC

TCTGGCAAAA

590696 832 848 eeekkdddddddkkeee 0 9982 9998 1216

TACAGGT

GTCTGGCAAA

590697 833 849 eeekkdddddddkkeee 24 9983 9999 1217

ATACAGG

Example 4: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE and cEt gapmers

Modified oligonucleotides were designed targeting a superoxide dismutase 1, soluble (SOD-1) nucleic acid and were tested for their effects on SOD-1 mRNA in vitro. ISIS 333611, a 5-10-5 MOE gapmer which was previously described in WO 2005/040180, was included as a benchmark.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells, 'n.d.' indicates that inhibition levels were not measured.

The newly designed modified oligonucleotides in the Tables below were designed as deoxy, MOE, and cEt gapmers or 5-10-5 gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The deoxy, MOE and cEt oligonucleotides are 17 nucleosides in length wherein the nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2' -MOE modified sugar. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'- most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1

(GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000). 'n/a' indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 18

Percent inhibition of SOD-1 mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000125_0001
596185 45 64 CACCCCGTCTCCGCGACTAC 13 851 870 1282

596186 47 66 AGCACCCCGTCTCCGCGACT 24 853 872 1283

596187 49 68 CCAGCACCCCGTCTCCGCGA 38 855 874 1284

596188 51 70 AACCAGCACCCCGTCTCCGC 11 857 876 1285

596189 53 72 CAAACCAGCACCCCGTCTCC 13 859 878 1286

596190 55 74 CGCAAACCAGCACCCCGTCT 21 861 880 1287

150510 57 76 GACGCAAACCAGCACCCCGT 45 863 882 109

596191 59 78 ACGACGCAAACCAGCACCCC 30 865 884 1288

596192 61 80 CTACGACGCAAACCAGCACC 19 867 886 1289

596193 63 82 GACTACGACGCAAACCAGCA 40 869 888 1290

596194 65 84 GAGACTACGACGCAAACCAG 23 871 890 1291

596195 67 86 AGGAGACTACGACGCAAACC 35 873 892 1292

596196 69 88 GCAGGAGACTACGACGCAAA 33 875 894 1293

596197 71 90 CTGCAGGAGACTACGACGCA 36 877 896 1294

596198 73 92 CGCTGCAGGAGACTACGACG 23 879 898 1295

596199 91 110 TGCAACGGAAACCCCAGACG 21 897 916 1296

596200 93 112 ACTGCAACGGAAACCCCAGA 43 899 918 1297

596201 97 116 GAGGACTGCAACGGAAACCC 24 903 922 1298

596202 99 118 CCGAGGACTGCAACGGAAAC 29 905 924 1299

596203 101 120 TTCCGAGGACTGCAACGGAA 5 907 926 1300

150438 103 122 GGTTCCGAGGACTGCAACGG 35 909 928 110

345716 105 124 CTGGTTCCGAGGACTGCAAC 51 911 930 1301

150439 107 126 TCCTGGTTCCGAGGACTGCA 24 913 932 111

596204 109 128 GGTCCTGGTTCCGAGGACTG 14 915 934 1302

150440 111 130 GAGGTCCTGGTTCCGAGGAC 31 917 936 112

596205 113 132 CCGAGGTCCTGGTTCCGAGG 18 919 938 1303

345718 115 134 CGCCGAGGTCCTGGTTCCGA 24 921 940 1304

596206 117 136 CACGCCGAGGTCCTGGTTCC 23 923 942 1305

596207 119 138 GCCACGCCGAGGTCCTGGTT 38 925 944 1306

596208 123 142 CTAGGCCACGCCGAGGTCCT 39 929 948 1307

345720 125 144 CGCTAGGCCACGCCGAGGTC 52 931 950 1308

596209 127 146 CTCGCTAGGCCACGCCGAGG 46 933 952 1309

596210 129 148 AACTCGCTAGGCCACGCCGA 44 935 954 1310

596211 131 150 ATAACTCGCTAGGCCACGCC 12 937 956 1311

596212 133 152 CCATAACTCGCTAGGCCACG 22 939 958 1312

345722 135 154 CGCCATAACTCGCTAGGCCA 59 941 960 1313 150442 137 156 GTCGCCATAACTCGCTAGGC 40 943 962 113

146143 157 176 TCAGCACGCACACGGCCTTC 52 963 982 114

195753 159 178 CTTCAGCACGCACACGGCCT 57 965 984 115

333607 161 180 CCCTTCAGCACGCACACGGC 37 967 986 116

333608 163 182 CGCCCTTCAGCACGCACACG 23 969 988 117

333611 167 186 CCGTCGCCCTTCAGCACGCA 67 973 992 21

596213 171 190 TGGGCCGTCGCCCTTCAGCA 12 977 996 1314

596214 173 192 ACTGGGCCGTCGCCCTTCAG 26 979 998 1315

596215 175 194 GCACTGGGCCGTCGCCCTTC 14 981 1000 1316

596216 177 196 CTGCACTGGGCCGTCGCCCT 24 983 1002 1317

596217 181 200 TGCCCTGCACTGGGCCGTCG 38 987 1006 1318

596218 183 202 GATGCCCTGCACTGGGCCGT 15 989 1008 1319

596219 185 204 ATGATGCCCTGCACTGGGCC 20 991 1010 1320

596220 189 208 ATTGATGATGCCCTGCACTG 8 995 1014 1321

596221 191 210 AAATTGATGATGCCCTGCAC 14 997 1016 1322

596222 193 212 CGAAATTGATGATGCCCTGC 32 999 1018 1323

596223 195 214 CTCGAAATTGATGATGCCCT 31 1001 1020 1324

596224 197 216 TGCTCGAAATTGATGATGCC 20 1003 1022 1325

596225 199 218 TCTGCTCGAAATTGATGATG 14 1005 1024 1326

596226 201 220 CTTCTGCTCGAAATTGATGA 11 1007 1026 1327

596227 240 259 TTTAATGCTTCCCCACACCT 15 4994 5013 1328

596228 242 261 CCTTTAATGCTTCCCCACAC 1 4996 5015 1329

596229 244 263 GTCCTTTAATGCTTCCCCAC 9 4998 5017 1330

Table 19

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000127_0001
GCCCTTCAGC

596722 165 181 eekkdddddddddkkee 60 971 987 1332

ACGCACA

CGCCCTTCAG

596532 166 182 eekkddddddddkkeee 67 972 988 1333

CACGCAC

CGCCCTTCAG

596723 166 182 eekkdddddddddkkee 73 972 988 1333

CACGCAC

CCGTCGCCCT

333611 167 186 eeeeeddddddddddeeeee 73 973 992 21

TCAGCACGCA

TCGCCCTTCA

596720 167 183 eekkddddddddkkeee 56 973 989 966

GCACGCA

TCGCCCTTCA

596911 167 183 eekkdddddddddkkee 63 973 989 966

GCACGCA

GTCGCCCTTC

596533 168 184 eekkddddddddkkeee 60 974 990 967

AGCACGC

GTCGCCCTTC

596724 168 184 eekkdddddddddkkee 72 974 990 967

AGCACGC

CGTCGCCCTT

596534 169 185 eekkddddddddkkeee 52 975 991 968

CAGCACG

CGTCGCCCTT

596725 169 185 eekkdddddddddkkee 43 975 991 968

CAGCACG

CCGTCGCCCT

596535 170 186 eekkddddddddkkeee 71 976 992 969

TCAGCAC

CCGTCGCCCT

596726 170 186 eekkdddddddddkkee 75 976 992 969

TCAGCAC

GCCGTCGCCC

596536 171 187 eekkddddddddkkeee 64 977 993 970

TTCAGCA

GCCGTCGCCC

596727 171 187 eekkdddddddddkkee 57 977 993 970

TTCAGCA

CACCACAAGC

596537 577 593 eekkddddddddkkeee 48 9727 9743 1334

CAAACGA

CACCACAAGC

596728 577 593 eekkdddddddddkkee 46 9727 9743 1334

CAAACGA

ACACCACAAG

596538 578 594 eekkddddddddkkeee 27 9728 9744 1335

CCAAACG

ACACCACAAG

596729 578 594 eekkdddddddddkkee 45 9728 9744 1335

CCAAACG

TACACCACAA

596539 579 595 eekkddddddddkkeee 56 9729 9745 1336

GCCAAAC

TACACCACAA

596730 579 595 eekkdddddddddkkee 63 9729 9745 1336

GCCAAAC

TTACACCACA

596540 580 596 eekkddddddddkkeee 60 9730 9746 1337

AGCCAAA TTACACCACA

596731 580 596 eekkdddddddddkkee 63 9730 9746 1337

AGCCAAA

ATTACACCAC

596541 581 597 eekkddddddddkkeee 46 9731 9747 1338

AAGCCAA

ATTACACCAC

596732 581 597 eekkdddddddddkkee 63 9731 9747 1338

AAGCCAA

AATTACACCA

596542 582 598 eekkddddddddkkeee 62 9732 9748 1111

CAAGCCA

AATTACACCA

596733 582 598 eekkdddddddddkkee 56 9732 9748 1111

CAAGCCA

CAATTACACC

596543 583 599 eekkddddddddkkeee 58 9733 9749 1112

ACAAGCC

CAATTACACC

596734 583 599 eekkdddddddddkkee 61 9733 9749 1112

ACAAGCC

CCAATTACAC

596544 584 600 eekkddddddddkkeee 66 9734 9750 1113

CACAAGC

CCAATTACAC

596735 584 600 eekkdddddddddkkee 73 9734 9750 1113

CACAAGC

CCCAATTACA

596545 585 601 eekkddddddddkkeee 63 9735 9751 1114

CCACAAG

CCCAATTACA

596736 585 601 eekkdddddddddkkee 74 9735 9751 1114

CCACAAG

GATCCCAATT

596546 588 604 eekkddddddddkkeee 41 9738 9754 1115

ACACCAC

GATCCCAATT

596737 588 604 eekkdddddddddkkee 58 9738 9754 1115

ACACCAC

CGATCCCAAT

596547 589 605 eekkddddddddkkeee 57 9739 9755 1116

TACACCA

CGATCCCAAT

596738 589 605 eekkdddddddddkkee 59 9739 9755 1116

TACACCA

GCGATCCCAA

596548 590 606 eekkddddddddkkeee 31 9740 9756 1117

TTACACC

GCGATCCCAA

596739 590 606 eekkdddddddddkkee 58 9740 9756 1117

TTACACC

GGCGATCCCA

596549 591 607 eekkddddddddkkeee 33 9741 9757 1118

ATTACAC

GGCGATCCCA

596740 591 607 eekkdddddddddkkee 66 9741 9757 1118

ATTACAC

GGGCGATCCC

596550 592 608 eekkddddddddkkeee 30 9742 9758 1119

AATTACA

GGGCGATCCC

596741 592 608 eekkdddddddddkkee 30 9742 9758 1119

AATTACA TGGGCGATCC

596551 593 609 eekkddddddddkkeee 19 9743 9759 1120

CAATTAC

TGGGCGATCC

596742 593 609 eekkdddddddddkkee 46 9743 9759 1120

CAATTAC

TTGGGCGATC

596552 594 610 eekkddddddddkkeee 14 9744 9760 1121

CCAATTA

TTGGGCGATC

596743 594 610 eekkdddddddddkkee 5 9744 9760 1121

CCAATTA

ATTGGGCGAT

596553 595 611 eekkddddddddkkeee 2 9745 9761 1122

CCCAATT

ATTGGGCGAT

596744 595 611 eekkdddddddddkkee 23 9745 9761 1122

CCCAATT

TATTGGGCGA

596554 596 612 eekkddddddddkkeee 19 9746 9762 1123

TCCCAAT

TATTGGGCGA

596745 596 612 eekkdddddddddkkee 6 9746 9762 1123

TCCCAAT

TTATTGGGCG

596555 597 613 eekkddddddddkkeee 41 9747 9763 1124

ATCCCAA

TTATTGGGCG

596746 597 613 eekkdddddddddkkee 41 9747 9763 1124

ATCCCAA

TTTATTGGGC

596556 598 614 eekkddddddddkkeee 34 9748 9764 1125

GATCCCA

TTTATTGGGC

596747 598 614 eekkdddddddddkkee 46 9748 9764 1125

GATCCCA

GTTTATTGGG

596557 599 615 eekkddddddddkkeee 54 9749 9765 1126

CGATCCC

GTTTATTGGG

596748 599 615 eekkdddddddddkkee 68 9749 9765 1126

CGATCCC

TGTTTATTGG

596558 600 616 eekkddddddddkkeee 50 9750 9766 1127

GCGATCC

TGTTTATTGG

596749 600 616 eekkdddddddddkkee 47 9750 9766 1127

GCGATCC

ATGTTTATTG

596559 601 617 eekkddddddddkkeee 76 9751 9767 1128

GGCGATC

ATGTTTATTG

596750 601 617 eekkdddddddddkkee 64 9751 9767 1128

GGCGATC

AATGTTTATT

596560 602 618 eekkddddddddkkeee 61 9752 9768 1129

GGGCGAT

AATGTTTATT

596751 602 618 eekkdddddddddkkee 64 9752 9768 1129

GGGCGAT

GAATGTTTAT

596561 603 619 eekkddddddddkkeee 47 9753 9769 1130

TGGGCGA GAATGTTTAT

596752 603 619 eekkdddddddddkkee 65 9753 9769 1130

TGGGCGA

GGAATGTTTA

596562 604 620 eekkddddddddkkeee 37 9754 9770 1131

TTGGGCG

GGAATGTTTA

596753 604 620 eekkdddddddddkkee 58 9754 9770 1131

TTGGGCG

CAAGGGAATG

596563 608 624 eekkddddddddkkeee 43 9758 9774 1133

TTTATTG

CAAGGGAATG

596754 608 624 eekkdddddddddkkee 38 9758 9774 1133

TTTATTG

CCAAGGGAAT

596564 609 625 eekkddddddddkkeee 57 9759 9775 1134

GTTTATT

CCAAGGGAAT

596755 609 625 eekkdddddddddkkee 52 9759 9775 1134

GTTTATT

TCCAAGGGAA

596565 610 626 eekkddddddddkkeee 27 9760 9776 1135

TGTTTAT

TCCAAGGGAA

596756 610 626 eekkdddddddddkkee 57 9760 9776 1135

TGTTTAT

ATCCAAGGGA

596566 611 627 eekkddddddddkkeee 35 9761 9777 1136

ATGTTTA

ATCCAAGGGA

596757 611 627 eekkdddddddddkkee 39 9761 9777 1136

ATGTTTA

ACTACATCCA

596567 616 632 eekkddddddddkkeee 42 9766 9782 1141

AGGGAAT

ACTACATCCA

596758 616 632 eekkdddddddddkkee 48 9766 9782 1141

AGGGAAT

Table 20

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000131_0001
GACTACATCC

596759 617 633 eekkdddddddddkkee 57 9767 9783 1142

AAGGGAA

AGACTACATC

596569 618 634 eekkddddddddkkeee 53 9768 9784 1143

CAAGGGA

AGACTACATC

596760 618 634 eekkdddddddddkkee 55 9768 9784 1143

CAAGGGA

CAGACTACAT

596570 619 635 eekkddddddddkkeee 81 9769 9785 1144

CCAAGGG

CAGACTACAT

596761 619 635 eekkdddddddddkkee 78 9769 9785 1144

CCAAGGG

TCAGACTACA

596571 620 636 eekkddddddddkkeee 79 9770 9786 1145

TCCAAGG

TCAGACTACA

596762 620 636 eekkdddddddddkkee 78 9770 9786 1145

TCCAAGG

CTCAGACTAC

596572 621 637 eekkddddddddkkeee 85 9771 9787 1146

ATCCAAG

CTCAGACTAC

596763 621 637 eekkdddddddddkkee 76 9771 9787 1146

ATCCAAG

CCTCAGACTA

596573 622 638 eekkddddddddkkeee 73 9772 9788 1147

CATCCAA

CCTCAGACTA

596764 622 638 eekkdddddddddkkee 87 9772 9788 1147

CATCCAA

GCCTCAGACT

596574 623 639 eekkddddddddkkeee 69 9773 9789 1148

ACATCCA

GCCTCAGACT

596765 623 639 eekkdddddddddkkee 82 9773 9789 1148

ACATCCA

GGCCTCAGAC

596575 624 640 eekkddddddddkkeee 70 9774 9790 1149

TACATCC

GGCCTCAGAC

596766 624 640 eekkdddddddddkkee 76 9774 9790 1149

TACATCC

GGGCCTCAGA

596576 625 641 eekkddddddddkkeee 55 9775 9791 1150

CTACATC

GGGCCTCAGA

596767 625 641 eekkdddddddddkkee 58 9775 9791 1150

CTACATC

AACAGATGA

596577 640 656 eekkddddddddkkeee 73 9790 9806 1339

GTTAAGGG

AACAGATGA

596768 640 656 eekkdddddddddkkee 86 9790 9806 1339

GTTAAGGG

TAACAGATGA

596578 641 657 eekkddddddddkkeee 68 9791 9807 1340

GTTAAGG

TAACAGATGA

596769 641 657 eekkdddddddddkkee 80 9791 9807 1340

GTTAAGG ATAACAGATG

596579 642 658 eekkddddddddkkeee 27 9792 9808 1341

AGTTAAG

ATAACAGATG

596770 642 658 eekkdddddddddkkee 42 9792 9808 1341

AGTTAAG

GATAACAGAT

596580 643 659 eekkddddddddkkeee 41 9793 9809 1151

GAGTTAA

GATAACAGAT

596771 643 659 eekkdddddddddkkee 28 9793 9809 1151

GAGTTAA

GGATAACAG

596581 644 660 eekkddddddddkkeee 63 9794 9810 1152

ATGAGTTA

GGATAACAG

596772 644 660 eekkdddddddddkkee 63 9794 9810 1152

ATGAGTTA

AGGATAACA

596582 645 661 eekkddddddddkkeee 84 9795 9811 1153

GATGAGTT

AGGATAACA

596773 645 661 eekkdddddddddkkee 86 9795 9811 1153

GATGAGTT

CAGGATAAC

596583 646 662 eekkddddddddkkeee 95 9796 9812 1154

AGATGAGT

CAGGATAAC

596774 646 662 eekkdddddddddkkee 96 9796 9812 1154

AGATGAGT

GCAGGATAA

596584 647 663 eekkddddddddkkeee 79 9797 9813 1155

CAGATGAG

GCAGGATAA

596775 647 663 eekkdddddddddkkee 86 9797 9813 1155

CAGATGAG

GCTAGCAGG

596585 651 667 eekkddddddddkkeee 19 9801 9817 1159

ATAACAGA

GCTAGCAGG

596776 651 667 eekkdddddddddkkee 43 9801 9817 1159

ATAACAGA

AGCTAGCAG

596586 652 668 eekkddddddddkkeee 57 9802 9818 1160

GATAACAG

AGCTAGCAG

596777 652 668 eekkdddddddddkkee 54 9802 9818 1160

GATAACAG

CAGCTAGCAG

596587 653 669 eekkddddddddkkeee 71 9803 9819 1161

GATAACA

CAGCTAGCAG

596778 653 669 eekkdddddddddkkee 61 9803 9819 1161

GATAACA

ACAGCTAGCA

596588 654 670 eekkddddddddkkeee 79 9804 9820 1162

GGATAAC

ACAGCTAGCA

596779 654 670 eekkdddddddddkkee 83 9804 9820 1162

GGATAAC

TACAGCTAGC

596589 655 671 eekkddddddddkkeee 85 9805 9821 1163

AGGATAA TACAGCTAGC

596780 655 671 eekkdddddddddkkee 86 9805 9821 1163

AGGATAA

CTACAGCTAG

596590 656 672 eekkddddddddkkeee 87 9806 9822 1164

CAGGATA

CTACAGCTAG

596781 656 672 eekkdddddddddkkee 91 9806 9822 1164

CAGGATA

TCTACAGCTA

596591 657 673 eekkddddddddkkeee 75 9807 9823 1165

GCAGGAT

TCTACAGCTA

596782 657 673 eekkdddddddddkkee 83 9807 9823 1165

GCAGGAT

TTCTACAGCT

596592 658 674 eekkddddddddkkeee 74 9808 9824 1166

AGCAGGA

TTCTACAGCT

596783 658 674 eekkdddddddddkkee 79 9808 9824 1166

AGCAGGA

TTTCTACAGC

596593 659 675 eekkddddddddkkeee 76 9809 9825 1167

TAGCAGG

TTTCTACAGC

596784 659 675 eekkdddddddddkkee 84 9809 9825 1167

TAGCAGG

ATTTCTACAG

596594 660 676 eekkddddddddkkeee 66 9810 9826 1168

CTAGCAG

ATTTCTACAG

596785 660 676 eekkdddddddddkkee 75 9810 9826 1168

CTAGCAG

GATACATTTC

596595 665 681 eekkddddddddkkeee 64 9815 9831 1171

TACAGCT

GATACATTTC

596786 665 681 eekkdddddddddkkee 77 9815 9831 1171

TACAGCT

GGATACATTT

596596 666 682 eekkddddddddkkeee 75 9816 9832 1342

CTACAGC

GGATACATTT

596787 666 682 eekkdddddddddkkee 84 9816 9832 1342

CTACAGC

AGGATACATT

596597 667 683 eekkddddddddkkeee 60 9817 9833 1343

TCTACAG

AGGATACATT

596788 667 683 eekkdddddddddkkee 77 9817 9833 1343

TCTACAG

CAGGATACAT

596598 668 684 eekkddddddddkkeee 79 9818 9834 1344

TTCTACA

CAGGATACAT

596789 668 684 eekkdddddddddkkee 85 9818 9834 1344

TTCTACA

TTATCAGGAT

596599 672 688 eekkddddddddkkeee 57 9822 9838 1345

ACATTTC

TTATCAGGAT

596790 672 688 eekkdddddddddkkee 67 9822 9838 1345

ACATTTC GTTTATCAGG

596600 674 690 eekkddddddddkkeee 85 9824 9840 1346

ATACATT

GTTTATCAGG

596791 674 690 eekkdddddddddkkee 88 9824 9840 1346

ATACATT

TGTTTATCAG

596601 675 691 eekkddddddddkkeee 70 9825 9841 1347

GATACAT

TGTTTATCAG

596792 675 691 eekkdddddddddkkee 83 9825 9841 1347

GATACAT

ATGTTTATCA

596602 676 692 eekkddddddddkkeee 85 9826 9842 1348

GGATACA

ATGTTTATCA

596793 676 692 eekkdddddddddkkee 81 9826 9842 1348

GGATACA

AATGTTTATC

596603 677 693 eekkddddddddkkeee 89 9827 9843 1349

AGGATAC

AATGTTTATC

596794 677 693 eekkdddddddddkkee 90 9827 9843 1349

AGGATAC

TAATGTTTAT

596604 678 694 eekkddddddddkkeee 90 9828 9844 1350

CAGGATA

TAATGTTTAT

596795 678 694 eekkdddddddddkkee 85 9828 9844 1350

CAGGATA

TTAATGTTTA

596605 679 695 eekkddddddddkkeee 90 9829 9845 1351

TCAGGAT

TTAATGTTTA

596796 679 695 eekkdddddddddkkee 92 9829 9845 1351

TCAGGAT

Example 5: Inhibition of human SOD-1 in HepG2 cells by deoxy, MOE and cEt gapmers

Modified oligonucleotides were designed targeting an SOD-1 nucleic acid and were tested for their effects on SOD-1 mRNA in vitro. ISIS 333611, a 5-10-5 MOE gapmer, which was previously described in WO 2005/040180, was included as a benchmark.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 5,000 nM modified oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR.

Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells, 'n.d.' indicates that inhibition levels were not measured. The newly designed modified oligonucleotides in the Tables below were designed as deoxy, MOE, and cEt gapmers. The gapmers are 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2' -MOE modified sugar. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to

18704000). 'n/a' indicates that the modified oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 21

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000136_0001
CAGTGTTTAAT

596800 685 701 eekkdddddddddkkee 85 9835 9851 1174

GTTTAT

ACAGTGTTTA

596610 686 702 eekkddddddddkkeee 83 9836 9852 1175

ATGTTTA

ACAGTGTTTA

596801 686 702 eekkdddddddddkkee 84 9836 9852 1175

ATGTTTA

GATTACAGTG

596611 690 706 eekkddddddddkkeee 54 9840 9856 1179

TTTAATG

GATTACAGTG

596802 690 706 eekkdddddddddkkee 61 9840 9856 1179

TTTAATG

AGATTACAGT

596612 691 707 eekkddddddddkkeee 68 9841 9857 1180

GTTTAAT

AGATTACAGT

596803 691 707 eekkdddddddddkkee 63 9841 9857 1180

GTTTAAT

CTTTTAAGATT

596613 697 713 eekkddddddddkkeee 62 9847 9863 1353

ACAGTG

CTTTTAAGATT

596804 697 713 eekkdddddddddkkee 53 9847 9863 1353

ACAGTG

CACTTTTAAG

596614 699 715 eekkddddddddkkeee 37 9849 9865 1354

ATTACAG

CACTTTTAAG

596805 699 715 eekkdddddddddkkee 49 9849 9865 1354

ATTACAG

TCACACAATT

596615 710 726 eekkddddddddkkeee 28 9860 9876 1355

ACACTTT

TCACACAATT

596806 710 726 eekkdddddddddkkee 39 9860 9876 1355

ACACTTT

GTCACACAAT

596616 711 727 eekkddddddddkkeee 28 9861 9877 1356

TACACTT

GTCACACAAT

596807 711 727 eekkdddddddddkkee 35 9861 9877 1356

TACACTT

AAGTCACACA

596617 713 729 eekkddddddddkkeee 41 9863 9879 1357

ATTACAC

AAGTCACACA

596808 713 729 eekkdddddddddkkee 37 9863 9879 1357

ATTACAC

AGGTACTTTA

596618 737 753 eekkddddddddkkeee 35 9887 9903 1358

AAGCAAC

AGGTACTTTA

596809 737 753 eekkdddddddddkkee 42 9887 9903 1358

AAGCAAC

ACAGGTACTT

596619 739 755 eekkddddddddkkeee 14 9889 9905 1359

TAAAGCA

ACAGGTACTT

596810 739 755 eekkdddddddddkkee 20 9889 9905 1359

TAAAGCA TACAGGTACT

596620 740 756 eekkddddddddkkeee 23 9890 9906 1360

TTAAAGC

TACAGGTACT

596811 740 756 eekkdddddddddkkee 26 9890 9906 1360

TTAAAGC

CTACAGGTAC

596621 741 757 eekkddddddddkkeee 2 9891 9907 1361

TTTAAAG

CTACAGGTAC

596812 741 757 eekkdddddddddkkee 16 9891 9907 1361

TTTAAAG

CACTACAGGT

596622 743 759 eekkddddddddkkeee 27 9893 9909 1362

ACTTTAA

CACTACAGGT

596813 743 759 eekkdddddddddkkee 38 9893 9909 1362

ACTTTAA

TCACTACAGG

596623 744 760 eekkddddddddkkeee 27 9894 9910 1363

TACTTTA

TCACTACAGG

596814 744 760 eekkdddddddddkkee 35 9894 9910 1363

TACTTTA

CTCACTACAG

596624 745 761 eekkddddddddkkeee 40 9895 9911 1364

GTACTTT

CTCACTACAG

596815 745 761 eekkdddddddddkkee 54 9895 9911 1364

GTACTTT

TCTCACTACA

596625 746 762 eekkddddddddkkeee 42 9896 9912 1365

GGTACTT

TCTCACTACA

596816 746 762 eekkdddddddddkkee 46 9896 9912 1365

GGTACTT

TTCTCACTACA

596626 747 763 eekkddddddddkkeee 26 9897 9913 1366

GGTACT

TTCTCACTACA

596817 747 763 eekkdddddddddkkee 37 9897 9913 1366

GGTACT

TTTCTCACTAC

596627 748 764 eekkddddddddkkeee 35 9898 9914 1367

AGGTAC

TTTCTCACTAC

596818 748 764 eekkdddddddddkkee 45 9898 9914 1367

AGGTAC

GTTTCTCACTA

596628 749 765 eekkddddddddkkeee 25 9899 9915 1368

CAGGTA

GTTTCTCACTA

596819 749 765 eekkdddddddddkkee 38 9899 9915 1368

CAGGTA

AGTTTCTCACT

596629 750 766 eekkddddddddkkeee 33 9900 9916 1369

ACAGGT

AGTTTCTCACT

596820 750 766 eekkdddddddddkkee 50 9900 9916 1369

ACAGGT

CAGTTTCTCAC

596630 751 767 eekkddddddddkkeee 38 9901 9917 1370

TACAGG CAGTTTCTCAC

596821 751 767 eekkdddddddddkkee 38 9901 9917 1370

TACAGG

TCAGTTTCTCA

596631 752 768 eekkddddddddkkeee 25 9902 9918 1371

CTACAG

TCAGTTTCTCA

596822 752 768 eekkdddddddddkkee 43 9902 9918 1371

CTACAG

ATCAGTTTCTC

596632 753 769 eekkddddddddkkeee 31 9903 9919 1372

ACTACA

ATCAGTTTCTC

596823 753 769 eekkdddddddddkkee 44 9903 9919 1372

ACTACA

AATCAGTTTCT

596633 754 770 eekkddddddddkkeee 34 9904 9920 1373

CACTAC

AATCAGTTTCT

596824 754 770 eekkdddddddddkkee 53 9904 9920 1373

CACTAC

GATCATAAAT

596634 761 777 eekkddddddddkkeee 34 9911 9927 1374

CAGTTTC

GATCATAAAT

596825 761 777 eekkdddddddddkkee 38 9911 9927 1374

CAGTTTC

TGATCATAAA

596635 762 778 eekkddddddddkkeee 49 9912 9928 1375

TCAGTTT

TGATCATAAA

596826 762 778 eekkdddddddddkkee 38 9912 9928 1375

TCAGTTT

GTGATCATAA

596636 763 779 eekkddddddddkkeee 33 9913 9929 1376

ATCAGTT

GTGATCATAA

596827 763 779 eekkdddddddddkkee 48 9913 9929 1376

ATCAGTT

AGTGATCATA

596637 764 780 eekkddddddddkkeee 23 9914 9930 1377

AATCAGT

AGTGATCATA

596828 764 780 eekkdddddddddkkee 32 9914 9930 1377

AATCAGT

CAAGTGATCA

596638 766 782 eekkddddddddkkeee 47 9916 9932 1378

TAAATCA

CAAGTGATCA

596829 766 782 eekkdddddddddkkee 29 9916 9932 1378

TAAATCA

CCAAGTGATC

596639 767 783 eekkddddddddkkeee 40 9917 9933 1379

ATAAATC

CCAAGTGATC

596830 767 783 eekkdddddddddkkee 48 9917 9933 1379

ATAAATC

TCCAAGTGAT

596640 768 784 eekkddddddddkkeee 42 9918 9934 1380

CATAAAT

TCCAAGTGAT

596831 768 784 eekkdddddddddkkee 39 9918 9934 1380

CATAAAT CTTCCAAGTG

596641 770 786 eekkddddddddkkeee 40 9920 9936 1381

ATCATAA

CTTCCAAGTG

596832 770 786 eekkdddddddddkkee 54 9920 9936 1381

ATCATAA

TCTTCCAAGTG

596642 771 787 eekkddddddddkkeee 33 9921 9937 1382

ATCATA

TCTTCCAAGTG

596833 771 787 eekkdddddddddkkee 43 9921 9937 1382

ATCATA

ATCTTCCAAGT

596643 772 788 eekkddddddddkkeee 38 9922 9938 1184

GATCAT

ATCTTCCAAGT

596834 772 788 eekkdddddddddkkee 38 9922 9938 1184

GATCAT

Table 22

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000140_0001
AGACATTTTA

596648 806 822 eekkddddddddkkeee 46 9956 9972 1383

ACTGAGT

AGACATTTTA

596839 806 822 eekkdddddddddkkee 53 9956 9972 1383

ACTGAGT

GTCATTGAAA

596649 817 833 eekkddddddddkkeee 2 9967 9983 1201

CAGACAT

GTCATTGAAA

596840 817 833 eekkdddddddddkkee 15 9967 9983 1201

CAGACAT

AGGTCATTGA

596650 819 835 eekkddddddddkkeee 40 9969 9985 1203

AACAGAC

AGGTCATTGA

596841 819 835 eekkdddddddddkkee 44 9969 9985 1203

AACAGAC

TACAGGTCAT

596651 822 838 eekkddddddddkkeee 26 9972 9988 1206

TGAAACA

TACAGGTCAT

596842 822 838 eekkdddddddddkkee 38 9972 9988 1206

TGAAACA

ATACAGGTCA

596652 823 839 eekkddddddddkkeee 33 9973 9989 1207

TTGAAAC

ATACAGGTCA

596843 823 839 eekkdddddddddkkee 22 9973 9989 1207

TTGAAAC

AAATACAGGT

596653 825 841 eekkddddddddkkeee 28 9975 9991 1209

CATTGAA

AAATACAGGT

596844 825 841 eekkdddddddddkkee 47 9975 9991 1209

CATTGAA

CAAAATACAG

596654 827 843 eekkddddddddkkeee 44 9977 9993 1211

GTCATTG

CAAAATACAG

596845 827 843 eekkdddddddddkkee 56 9977 9993 1211

GTCATTG

TGGCAAAATA

596655 830 846 eekkddddddddkkeee 33 9980 9996 1214

CAGGTCA

TGGCAAAATA

596846 830 846 eekkdddddddddkkee 43 9980 9996 1214

CAGGTCA

CTGGCAAAAT

596656 831 847 eekkddddddddkkeee 25 9981 9997 1215

ACAGGTC

CTGGCAAAAT

596847 831 847 eekkdddddddddkkee 53 9981 9997 1215

ACAGGTC

GTCTGGCAAA

596657 833 849 eekkddddddddkkeee 30 9983 9999 1217

ATACAGG

GTCTGGCAAA

596848 833 849 eekkdddddddddkkee 38 9983 9999 1217

ATACAGG

TAAGTCTGGC

596658 836 852 eekkddddddddkkeee 24 9986 10002 1220

AAAATAC TAAGTCTGGC

596849 836 852 eekkdddddddddkkee 46 9986 10002 1220

AAAATAC

TTAAGTCTGG

596659 837 853 eekkddddddddkkeee 27 9987 10003 1221

CAAAATA

TTAAGTCTGG

596850 837 853 eekkdddddddddkkee 42 9987 10003 1221

CAAAATA

GATTTAAGTC

596660 840 856 eekkddddddddkkeee 19 9990 10006 1384

TGGCAAA

GATTTAAGTC

596851 840 856 eekkdddddddddkkee 35 9990 10006 1384

TGGCAAA

TGATTTAAGT

596661 841 857 eekkddddddddkkeee 52 9991 10007 1385

CTGGCAA

TGATTTAAGT

596852 841 857 eekkdddddddddkkee 52 9991 10007 1385

CTGGCAA

GTGATTTAAG

596662 842 858 eekkddddddddkkeee 54 9992 10008 1386

TCTGGCA

GTGATTTAAG

596853 842 858 eekkdddddddddkkee 69 9992 10008 1386

TCTGGCA

TGTGATTTAA

596663 843 859 eekkddddddddkkeee 45 9993 10009 1387

GTCTGGC

TGTGATTTAA

596854 843 859 eekkdddddddddkkee 58 9993 10009 1387

GTCTGGC

CTGTGATTTA

596664 844 860 eekkddddddddkkeee n.d. 9994 10010 1388

AGTCTGG

CTGTGATTTA

596855 844 860 eekkdddddddddkkee 61 9994 10010 1388

AGTCTGG

TCTGTGATTT

596665 845 861 eekkddddddddkkeee 49 9995 10011 1389

AAGTCTG

TCTGTGATTT

596856 845 861 eekkdddddddddkkee 49 9995 10011 1389

AAGTCTG

ATCTGTGATT

596666 846 862 eekkddddddddkkeee 35 9996 10012 1390

TAAGTCT

ATCTGTGATT

596857 846 862 eekkdddddddddkkee 37 9996 10012 1390

TAAGTCT

CATCTGTGAT

596667 847 863 eekkddddddddkkeee 42 9997 10013 1391

TTAAGTC

CATCTGTGAT

596858 847 863 eekkdddddddddkkee 48 9997 10013 1391

TTAAGTC

CCATCTGTGA

596668 848 864 eekkddddddddkkeee 46 9998 10014 1392

TTTAAGT

CCATCTGTGA

596859 848 864 eekkdddddddddkkee 47 9998 10014 1392

TTTAAGT CCCATCTGTG

596669 849 865 eekkddddddddkkeee 49 9999 10015 1393

ATTTAAG

CCCATCTGTG

596860 849 865 eekkdddddddddkkee 49 9999 10015 1393

ATTTAAG

ACCCATCTGT

596670 850 866 eekkddddddddkkeee 33 10000 10016 1394

GATTTAA

ACCCATCTGT

596861 850 866 eekkdddddddddkkee 44 10000 10016 1394

GATTTAA

TACCCATCTG

596671 851 867 eekkddddddddkkeee 29 10001 10017 1395

TGATTTA

TACCCATCTG

596862 851 867 eekkdddddddddkkee 45 10001 10017 1395

TGATTTA

TAATACCCAT

596672 854 870 eekkddddddddkkeee 25 10004 10020 1223

CTGTGAT

TAATACCCAT

596863 854 870 eekkdddddddddkkee 28 10004 10020 1223

CTGTGAT

TTAATACCCA

596673 855 871 eekkddddddddkkeee 28 10005 10021 1224

TCTGTGA

TTAATACCCA

596864 855 871 eekkdddddddddkkee 26 10005 10021 1224

TCTGTGA

AGTTTAATAC

596674 858 874 eekkddddddddkkeee 29 10008 10024 1227

CCATCTG

AGTTTAATAC

596865 858 874 eekkdddddddddkkee 43 10008 10024 1227

CCATCTG

AAGTTTAATA

596675 859 875 eekkddddddddkkeee 54 10009 10025 1228

CCCATCT

AAGTTTAATA

596866 859 875 eekkdddddddddkkee 59 10009 10025 1228

CCCATCT

CAAGTTTAAT

596676 860 876 eekkddddddddkkeee 52 10010 10026 1229

ACCCATC

CAAGTTTAAT

596867 860 876 eekkdddddddddkkee 62 10010 10026 1229

ACCCATC

ACAAGTTTAA

596677 861 877 eekkddddddddkkeee 58 10011 10027 1230

TACCCAT

ACAAGTTTAA

596868 861 877 eekkdddddddddkkee 61 10011 10027 1230

TACCCAT

GACAAGTTTA

596678 862 878 eekkddddddddkkeee 54 10012 10028 1231

ATACCCA

GACAAGTTTA

596869 862 878 eekkdddddddddkkee 59 10012 10028 1231

ATACCCA

TGACAAGTTT

596679 863 879 eekkddddddddkkeee 43 10013 10029 1232

AATACCC TGACAAGTTT

596870 863 879 eekkdddddddddkkee 52 10013 10029 1232

AATACCC

CTGACAAGTT

596680 864 880 eekkddddddddkkeee 30 10014 10030 1233

TAATACC

CTGACAAGTT

596871 864 880 eekkdddddddddkkee 36 10014 10030 1233

TAATACC

TCTGACAAGT

596681 865 881 eekkddddddddkkeee 33 10015 10031 1234

TTAATAC

TCTGACAAGT

596872 865 881 eekkdddddddddkkee 20 10015 10031 1234

TTAATAC

Table 23

Percent inhibition of SOD-1 mRNA by deoxy, MOE and cEt gapmers targeting SEQ ID NO: 1 and/or 2

Figure imgf000144_0001
TTCACAGGCT

596877 891 907 eekkdddddddddkkee 16 10041 10057 1242

TGAATGA

ATTCACAGGC

596687 892 908 eekkddddddddkkeee 19 10042 10058 1243

TTGAATG

ATTCACAGGC

596878 892 908 eekkdddddddddkkee 29 10042 10058 1243

TTGAATG

TATTCACAGG

596688 893 909 eekkddddddddkkeee 24 10043 10059 1244

CTTGAAT

TATTCACAGG

596879 893 909 eekkdddddddddkkee 11 10043 10059 1244

CTTGAAT

TTATTCACAG

596689 894 910 eekkddddddddkkeee 26 10044 10060 1245

GCTTGAA

TTATTCACAG

596880 894 910 eekkdddddddddkkee 30 10044 10060 1245

GCTTGAA

TTTATTCACA

596690 895 911 eekkddddddddkkeee 44 10045 10061 1246

GGCTTGA

TTTATTCACA

596881 895 911 eekkdddddddddkkee 55 10045 10061 1246

GGCTTGA

TTTTATTCAC

596691 896 912 eekkddddddddkkeee 43 10046 10062 1247

AGGCTTG

TTTTATTCAC

596882 896 912 eekkdddddddddkkee 48 10046 10062 1247

AGGCTTG

GGTTTTTATT

596692 899 915 eekkddddddddkkeee 38 10049 10065 1250

CACAGGC

GGTTTTTATT

596883 899 915 eekkdddddddddkkee 57 10049 10065 1250

CACAGGC

ACAGGGTTTT

596693 903 919 eekkddddddddkkeee 29 10053 10069 1254

TATTCAC

ACAGGGTTTT

596884 903 919 eekkdddddddddkkee 47 10053 10069 1254

TATTCAC

TACAGGGTTT

596694 904 920 eekkddddddddkkeee 13 10054 10070 1255

TTATTCA

TACAGGGTTT

596885 904 920 eekkdddddddddkkee 31 10054 10070 1255

TTATTCA

CCATACAGGG

596695 907 923 eekkddddddddkkeee 13 10057 10073 1258

CCATACAGGG

596886 907 923 eekkdddddddddkkee 34 10057 10073 1258

GCCATACAGG

596696 908 924 eekkddddddddkkeee 13 10058 10074 1259

GTTTTTA

GCCATACAGG

596887 908 924 eekkdddddddddkkee 26 10058 10074 1259

GTTTTTA TGCCATACAG

596697 909 925 eekkddddddddkkeee 21 10059 10075 1260

TGCCATACAG

596888 909 925 eekkdddddddddkkee 22 10059 10075 1260

GTGCCATACA

596698 910 926 eekkddddddddkkeee 20 10060 10076 1261

GGGTTTT

GTGCCATACA

596889 910 926 eekkdddddddddkkee 28 10060 10076 1261

GGGTTTT

AGTGCCATAC

596699 911 927 eekkddddddddkkeee 20 10061 10077 1262

AGGGTTT

AGTGCCATAC

596890 911 927 eekkdddddddddkkee 27 10061 10077 1262

AGGGTTT

AAGTGCCATA

596700 912 928 eekkddddddddkkeee 15 10062 10078 1400

CAGGGTT

AAGTGCCATA

596891 912 928 eekkdddddddddkkee 21 10062 10078 1400

CAGGGTT

TAAGTGCCAT

596701 913 929 eekkddddddddkkeee 26 10063 10079 1401

ACAGGGT

TAAGTGCCAT

596892 913 929 eekkdddddddddkkee 35 10063 10079 1401

ACAGGGT

ATAAGTGCCA

596702 914 930 eekkddddddddkkeee 36 10064 10080 1402

TACAGGG

ATAAGTGCCA

596893 914 930 eekkdddddddddkkee 46 10064 10080 1402

TACAGGG

AATAAGTGCC

596703 915 931 eekkddddddddkkeee 40 10065 10081 1403

ATACAGG

AATAAGTGCC

596894 915 931 eekkdddddddddkkee 36 10065 10081 1403

ATACAGG

TAATAAGTGC

596704 916 932 eekkddddddddkkeee 22 10066 10082 1404

CATACAG

TAATAAGTGC

596895 916 932 eekkdddddddddkkee 30 10066 10082 1404

CATACAG

ATAATAAGTG

596705 917 933 eekkddddddddkkeee 27 10067 10083 1405

CCATACA

ATAATAAGTG

596896 917 933 eekkdddddddddkkee 27 10067 10083 1405

CCATACA

CATAATAAGT

596706 918 934 eekkddddddddkkeee 32 10068 10084 1406

GCCATAC

CATAATAAGT

596897 918 934 eekkdddddddddkkee 34 10068 10084 1406

GCCATAC

TCATAATAAG

596707 919 935 eekkddddddddkkeee 28 10069 10085 1407

TGCCATA TCATAATAAG

596898 919 935 eekkdddddddddkkee 34 10069 10085 1407

TGCCATA

CTCATAATAA

596708 920 936 eekkddddddddkkeee 30 10070 10086 1408

GTGCCAT

CTCATAATAA

596899 920 936 eekkdddddddddkkee 44 10070 10086 1408

GTGCCAT

CCTCATAATA

596709 921 937 eekkddddddddkkeee 29 10071 10087 1409

AGTGCCA

CCTCATAATA

596900 921 937 eekkdddddddddkkee 31 10071 10087 1409

AGTGCCA

GCCTCATAAT

596710 922 938 eekkddddddddkkeee 41 10072 10088 1410

AAGTGCC

GCCTCATAAT

596901 922 938 eekkdddddddddkkee 33 10072 10088 1410

AAGTGCC

AGCCTCATAA

596711 923 939 eekkddddddddkkeee 16 10073 10089 1411

TAAGTGC

AGCCTCATAA

596902 923 939 eekkdddddddddkkee 11 10073 10089 1411

TAAGTGC

TAGCCTCATA

596712 924 940 eekkddddddddkkeee 11 10074 10090 1412

ATAAGTG

TAGCCTCATA

596903 924 940 eekkdddddddddkkee 27 10074 10090 1412

ATAAGTG

ATAGCCTCAT

596713 925 941 eekkddddddddkkeee 20 10075 10091 1413

AATAAGT

ATAGCCTCAT

596904 925 941 eekkdddddddddkkee 27 10075 10091 1413

AATAAGT

AATAGCCTCA

596714 926 942 eekkddddddddkkeee 20 10076 10092 1414

TAATAAG

AATAGCCTCA

596905 926 942 eekkdddddddddkkee 25 10076 10092 1414

TAATAAG

CTTTTAATAG

596715 931 947 eekkddddddddkkeee 45 10081 10097 1415

CCTCATA

CTTTTAATAG

596906 931 947 eekkdddddddddkkee 34 10081 10097 1415

CCTCATA

TCTTTTAATA

596716 932 948 eekkddddddddkkeee 52 10082 10098 1416

GCCTCAT

TCTTTTAATA

596907 932 948 eekkdddddddddkkee 56 10082 10098 1416

GCCTCAT

GGATTCTTTT

596717 936 952 eekkddddddddkkeee 14 10086 10102 1417

AATAGCC

GGATTCTTTT

596908 936 952 eekkdddddddddkkee 19 10086 10102 1417

AATAGCC TTGGATTCTT

596718 938 954 eekkddddddddkkeee 23 10088 10104 1263

TTAATAG

TTGGATTCTT

596909 938 954 eekkdddddddddkkee 8 10088 10104 1263

TTAATAG

TTAGTTTGAA

596719 949 965 eekkddddddddkkeee 31 10099 10115 1418

TTTGGAT

TTAGTTTGAA

596910 949 965 eekkdddddddddkkee 16 10099 10115 1418

TTTGGAT

Example 6: Dose-dependent inhibition of human SOD-1 with modified oligonucleotides in HepG2 cells

Gapmers from the studies described above exhibiting significant in vitro inhibition of SOD-1 mRNA were selected and tested at various doses in HepG2 cells. Benchmark compound ISIS 333611 and other compounds previously disclosed in WO 2005/040180, including ISIS 146144, 146145, 150445, 150446, 150447, 150454, 150463, 150465, 333606, 333609, and 333611 were also tested.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.813 μΜ, 1.625 μΜ, 3.250 μΜ, 6.500 μΜ, and 13.000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in modified oligonucleotide treated cells.

Table 24

Dose-dependent inhibition of SOD-1 mRNA

0.813 1.625 3.250 6.500 13.000

ISIS No IC50

μΜ μΜ μΜ μΜ μΜ (μΜ)

150445 7 21 44 56 82 4.4

150446 15 32 47 71 87 3.2

150447 26 43 68 81 93 2.0

150463 16 38 51 66 85 3.1

333611 18 39 57 66 79 3.0

393336 18 34 53 69 83 3.1

393343 24 32 53 73 42 5.1

436863 18 42 58 72 89 2.6 590089 28 59 70 82 90 1.5

590090 34 56 76 82 51 1.1

590091 30 44 68 84 88 1.9

590094 16 35 57 73 76 3.0

590113 34 35 57 73 84 2.3

Table 25

Dose-dependent inhibition of SOD-1 mRNA

0.813 1.625 3.250 6.500 13.000

ISIS No ICso

μΜ μΜ μΜ μΜ μΜ (μΜ)

150465 42 59 77 82 87 1.0

333611 17 26 40 64 82 3.8

378879 14 35 63 72 86 2.8

393371 28 42 57 74 80 2.3

489520 28 44 64 72 84 2.2

590177 53 59 69 85 88 0.7

590178 40 53 71 73 87 1.3

590180 18 42 51 64 73 3.3

590187 34 51 68 80 92 1.6

590188 30 46 61 76 88 2.0

590189 37 49 68 78 88 1.6

590190 38 58 77 84 89 1.1

590191 29 56 71 77 84 1.6

590192 37 59 72 80 87 1.2

Table 26

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000149_0001
Table 27

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000150_0001

Example 7: Dose-dependent inhibition of human SOD-1 with modified oligonucleotides in HepG2 cells

Gapmers from the studies described above exhibiting significant in vitro inhibition of SOD-1 mRNA were selected and tested at various doses in HepG2 cells. Benchmark compound, ISIS 333611, and ISIS 333625, both of which were previously disclosed in WO 2005/040180 were also tested.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.148 μΜ, 0.444 μΜ, 1.330 μΜ, 4.000 μΜ, and 12.000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe sets RTS3898 or HTS90 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in modified oligonucleotide treated cells. Table 28

Dose res onse assa with rimer robe set RTS3898

Figure imgf000151_0001

Example 8: Dose-dependent inhibition of human SOD-1 with modified oligonucleotides in HepG2 cells

Gapmers from the studies described above exhibiting significant in vitro inhibition of SOD-1 mRNA were selected and tested at various doses in HepG2 cells. Benchmark compound, ISIS 333611, and additional compounds including, ISIS 146143, 150442, 195753, 333607, and 333608, were previously disclosed in WO 2005/040180 were also tested.

The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.1875 μΜ, 0.7500 μΜ, 3.0000 μΜ, and 12.0000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe sets RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

The half maximal inhibitory concentration (IC50) of each oligonucleotide is also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in modified oligonucleotide treated cells.

Table 30

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000152_0001
Table 31

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000153_0001

Table 32

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000153_0002
596766 4 50 68 86 1.3

596785 10 47 77 91 1.1

596786 0 45 75 97 1.3

596788 9 52 81 95 1

Table 33

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000154_0001

Table 34

Dose-dependent inhibition of SOD-1 mRNA

Figure imgf000154_0002
590655 35 71 79 82 0.3

596530 25 22 72 79 2.0

596531 8 38 74 96 1.2

596559 15 36 79 95 1.1

596721 14 47 82 97 0.9

596723 12 47 79 94 1.0

596726 24 42 80 94 0.9

596735 7 32 77 96 1.3

596736 25 52 82 97 0.7

Example 9: Dose-dependent inhibition of human SOD-1 in HepG2 cells by gapmers with mixed backbone chemistry

Additional gapmers were designed based on the sequences of the oligonucleotides disclosed in studies described above. The oligonucleotides were designed as 5-10-5 MOE, 5-8-5 MOE, and deoxy, MOE and cEt oligonucleotides. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment is comprised of eight 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The deoxy, MOE and cEt oligonucleotides are 16 or 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2' -MOE modified sugar. The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate linkages. The internucleoside linkages of each oligonucleotide are denoted in the Backbone Chemistry column, where Ό' indicates a phosphodiester linkage and 's' denotes a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 m NA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000). Table 35

Modified oligonucleotides targeting human SOD-1 with mixed backbone chemistry

Figure imgf000156_0001
ATACATTTCT

654323 665 680 kekeddddddddekek sooossssssssoss 9815 9830 1433

ACAGCT

ATACATTTCT

654341 665 680 ekddddddddekekee sossssssssoooss 9815 9830 1433

ACAGCT

TCAGGATACA

611500 666 685 eeeeeddddddddddeeeee sooosssssssssssooos 9816 9835 823

TTTCTACAGC

GGATACATTT

612941 666 682 eekkdddddddddkkee sooosssssssssoss 9816 9832 1342

CTACAGC

AGGATACATT

654307 666 683 eeeeeddddddddeeeee sooosssssssssooss 9816 9833 1434

TCTACAGC

GATACATTTC

654324 666 681 kekeddddddddekek sooossssssssoss 9816 9831 1435

TACAGC

GATACATTTC

654342 666 681 ekddddddddekekee sossssssssoooss 9816 9831 1435

TACAGC

CAGGATACAT

654308 667 684 eeeeeddddddddeeeee sooosssssssssooss 9817 9834 1436

TTCTACAG

ATGTTTATCA

612925 676 692 eekkddddddddkkeee soosssssssssooss 9826 9842 1348

GGATACA

ATGTTTATCA

612944 676 692 eekkdddddddddkkee sooosssssssssoss 9826 9842 1348

GGATACA

ATGTTTATCA

654343 677 692 ekddddddddekekee sossssssssoooss 9827 9842 1437

GGATAC

TAATGTTTAT

612927 678 694 eekkddddddddkkeee soosssssssssooss 9828 9844 1350

CAGGATA

TTAATGTTTA

654309 678 695 eeeeeddddddddeeeee sooosssssssssooss 9828 9845 1438

TCAGGATA

TTAATGTTTA

612928 679 695 eekkddddddddkkeee soosssssssssooss 9829 9845 1351

TCAGGAT

TTTAATGTTT

654310 679 696 eeeeeddddddddeeeee sooosssssssssooss 9829 9846 1439

ATCAGGAT

GTTTAATGTT

654311 680 697 eeeeeddddddddeeeee sooosssssssssooss 9830 9847 1440

TATCAGGA

TTAATGTTTA

654327 680 695 kekeddddddddekek sooossssssssoss 9830 9845 1441

TCAGGA

TTAATGTTTA

654346 680 695 ekddddddddekekee sossssssssoooss 9830 9845 1441

TCAGGA

AGTGTTTAAT

611497 681 700 eeeeeddddddddddeeeee sooosssssssssssooos 9831 9850 733

GTTTATCAGG

GTTTAATGTT

612948 681 697 eekkdddddddddkkee sooosssssssssoss 9831 9847 1352

TATCAGG

TGTTTAATGT

654312 681 698 eeeeeddddddddeeeee sooosssssssssooss 9831 9848 1442

TTATCAGG

TTTAATGTTT

654328 681 696 kekeddddddddekek sooossssssssoss 9831 9846 1443

ATCAGG TTTAATGTTT

654347 681 696 ekddddddddekekee sossssssssoooss 9831 9846 1443

ATCAGG

GTGTTTAATG

654313 682 699 eeeeeddddddddeeeee sooosssssssssooss 9832 9849 1444

TTTATCAG

GTTTAATGTT

654329 682 697 kekeddddddddekek sooossssssssoss 9832 9847 1445

TATCAG

GTTTAATGTT

654348 682 697 ekddddddddekekee sossssssssoooss 9832 9847 1445

TATCAG

GTGTTTAATG

612949 683 699 eekkdddddddddkkee sooosssssssssoss 9833 9849 1172

TTTATCA

AGTGTTTAAT

654314 683 700 eeeeeddddddddeeeee sooosssssssssooss 9833 9850 1446

GTTTATCA

TGTTTAATGT

654330 683 698 kekeddddddddekek sooossssssssoss 9833 9848 1447

TTATCA

AGTGTTTAAT

612931 684 700 eekkddddddddkkeee soosssssssssooss 9834 9850 1173

GTTTATC

CAGTGTTTAA

654315 684 701 eeeeeddddddddeeeee sooosssssssssooss 9834 9851 1448

TGTTTATC

GTGTTTAATG

654331 684 699 kekeddddddddekek sooossssssssoss 9834 9849 1449

TTTATC

GTGTTTAATG

654350 684 699 ekddddddddekekee sossssssssoooss 9834 9849 1449

TTTATC

ACAGTGTTTA

654316 685 702 eeeeeddddddddeeeee sooosssssssssooss 9835 9852 1450

ATGTTTAT

ACAGTGTTTA

612918 686 702 eeekkdddddddkkeee soosssssssssooss 9836 9852 1175

ATGTTTA

ACAGTGTTTA

612932 686 702 eekkddddddddkkeee soosssssssssooss 9836 9852 1175

ATGTTTA

TACAGTGTTT

654317 686 703 eeeeeddddddddeeeee sooosssssssssooss 9836 9853 1451

AATGTTTA

CAGTGTTTAA

654333 686 701 kekeddddddddekek sooossssssssoss 9836 9851 1452

TGTTTA

CAGTGTTTAA

654352 686 701 ekddddddddekekee sossssssssoooss 9836 9851 1452

TGTTTA

TTACAGTGTT

654318 687 704 eeeeeddddddddeeeee sooosssssssssooss 9837 9854 1453

TAATGTTT

ACAGTGTTTA

654334 687 702 kekeddddddddekek sooossssssssoss 9837 9852 1454

ATGTTT

The newly designed oligonucleotides were tested at various doses in HepG2 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.222 μΜ, 0.667 μΜ, 2.000 μΜ, and 6.000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe sets RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

The half maximal inhibitory concentration (IC5o) of each oligonucleotide is also presented. SOD-1 mRNA levels were significantly reduced in a dose-dependent manner in modified oligonucleotide treated cells.

Table 36

Dose response assay

0.222 0.667 2.000 6.000 IC50

ISIS No

μΜ μΜ μΜ μΜ μΜ

333611 0 28 53 77 1.9

611458 0 21 50 79 2.0

611460 24 34 55 79 1.3

611474 14 32 55 79 1.5

611475 0 16 35 70 3.0

611492 38 70 88 95 0.3

611497 28 55 80 89 0.6

611500 25 50 73 92 0.7

612918 51 70 74 80 <0.2

612925 53 73 90 89 <0.2

612927 64 89 92 94 <0.2

612928 67 90 94 97 <0.2

612931 68 76 84 86 <0.2

612932 61 73 88 91 <0.2

612941 62 78 91 95 <0.2

612944 47 71 82 92 0.2

612948 76 90 93 94 <0.2

612949 58 68 83 96 <0.2

654301 7 4 17 42 >6.0

Table 37

E >ose response assay

0.222 0.667 2.000 6.000 IC50

ISIS No

μΜ μΜ μΜ μΜ μΜ

333611 14 20 35 69 3.0

611458 11 27 36 68 2.9

654302 0 8 38 48 6.2

654303 8 29 46 76 1.9

654304 7 28 54 79 1.7 654305 28 59 73 85 0.6

654306 38 62 82 94 0.4

654307 9 43 65 86 1.1

654308 14 31 54 84 1.4

654309 0 17 47 72 2.4

654310 10 24 28 53 6.6

654311 45 73 78 87 0.2

654312 14 39 59 77 1.3

654313 20 43 56 81 1.2

654314 33 58 74 86 0.5

654315 21 47 64 84 0.9

654316 19 30 46 70 2.0

654317 13 46 57 70 1.4

654318 17 42 54 76 1.4

Table 38

E >ose response assay

0.222 0.667 2.000 6.000 IC50

ISIS No

μΜ μΜ μΜ μΜ μΜ

333611 14 19 50 73 2.1

611458 9 22 39 72 2.5

654319 19 9 31 61 5.1

654320 6 16 20 59 5.9

654321 8 14 51 76 2.1

654323 55 73 89 95 <0.2

654324 54 78 89 96 <0.2

654327 53 82 91 96 <0.2

654328 73 90 93 97 <0.2

654329 58 78 86 94 <0.2

654330 42 54 69 86 0.4

654331 53 78 82 90 <0.2

654333 50 67 81 86 0.2

654334 55 68 78 88 <0.2

654335 15 31 58 81 1.4

654336 21 36 60 75 1.3

654337 16 34 58 80 1.4

654340 36 69 83 95 0.4

654341 43 58 79 91 0.3

Table 39

Dose response assay

0.222 0.667 2.00 6.00 IC50

ISIS No

μΜ μΜ μΜ μΜ μΜ

333611 0 6 38 64 3.6 611458 3 14 36 63 3.6

654342 40 60 80 93 0.4

654343 64 81 90 94 <0.2

654346 52 73 84 93 <0.2

654347 21 38 58 81 1.2

654348 44 63 82 94 0.3

654350 40 63 76 86 0.3

654352 54 79 84 88 <0.2

Example 10: Dose-dependent inhibition of human SOD-1 by gapmers with mixed backbone chemistry

Additional gapmers were designed based on the sequences of the oligonucleotides disclosed in studies described above. The oligonucleotides were designed as deoxy, MOE and cEt oligonucleotides. The deoxy, MOE and cEt oligonucleotides are 16 or 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each

oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2'-MOE modified sugar. The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate linkages. The internucleoside linkages of each oligonucleotide are denoted in the Backbone Chemistry column, where Ό' indicates a phosphodiester linkage and 's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5- methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000).

Table 40

Modified oligonucleotides targeting human SOD-1 with mixed backbone chemistry

Figure imgf000161_0001
TACATTTCTAC

654322 664 679 kekeddddddddekek sooossssssssoss 9814 9829 1431

AGCTA

GGATACATTT

654325 667 682 kekeddddddddekek sooossssssssoss 9817 9832 1455

CTACAG

TAATGTTTATC

654326 679 694 kekeddddddddekek sooossssssssoss 9829 9844 1456

AGGAT

AGTGTTTAAT

654332 685 700 kekeddddddddekek sooossssssssoss 9835 9850 1457

GTTTAT

CATTTCTACAG

654338 662 677 ekddddddddekekee sossssssssoooss 9812 9827 1458

CTAGC

ACATTTCTACA

654339 663 678 ekddddddddekekee sossssssssoooss 9813 9828 1459

GCTAG

AATGTTTATCA

654344 678 693 ekddddddddekekee sossssssssoooss 9828 9843 1460

GGATA

TAATGTTTATC

654345 679 694 ekddddddddekekee sossssssssoooss 9829 9844 1456

AGGAT

TGTTTAATGTT

654349 683 698 ekddddddddekekee sossssssssoooss 9833 9848 1447

TATCA

AGTGTTTAAT

654351 685 700 ekddddddddekekee sossssssssoooss 9835 9850 1457

GTTTAT

The newly designed oligonucleotides were tested at various doses in A431 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 5,000 cells per well and modified oligonucleotides were added to the media at 0.12 μΜ, 0.60 μΜ, 3.00 μΜ, and 15.00 μΜ concentrations of modified oligonucleotide for free uptake by the cells, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe sets RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

Table 41

Dose res onse assa

Figure imgf000162_0001
654306 0 25 29 50

654313 1 15 36 50

654314 2 35 52 67

654321 0 8 8 18

654322 0 13 36 59

654329 7 7 41 66

654330 6 14 15 32

654337 0 0 7 21

654338 3 3 2 11

654345 1 9 22 46

654346 0 7 21 46

Table 42 Dose response assay

0.12 0.60 3.00 15.00

ISIS No

μΜ μΜ μΜ μΜ

333611 0 0 0 2

611460 0 0 0 30

611474 0 0 11 0

612925 2 4 12 52

612927 0 38 54 68

612948 25 69 89 95

612949 22 57 73 84

654307 42 23 26 45

654308 2 31 9 18

654315 0 8 39 52

654316 0 18 26 45

654323 15 14 16 52

654324 12 22 21 34

654331 7 35 66 78

654332 2 31 47 61

654339 1 27 32 47

654340 37 0 22 12

654347 20 5 12 33

654348 2 19 33 62

Table 43 Dose response assay

0.12 0.60 3.00 15.00

ISIS No

μΜ μΜ μΜ μΜ

333611 0 0 0 1

611475 0 17 0 16

611492 13 24 41 62 612928 12 36 49 72

612931 31 68 83 86

654301 2 0 0 9

654302 0 8 3 0

654309 18 7 1 1 9

654310 13 19 22 7

654317 3 0 1 20

654318 4 0 33 17

654325 0 0 0 14

654326 0 15 17 48

654333 19 18 36 55

654334 0 0 0 6

654341 0 9 0 25

654342 0 0 0 18

654349 0 13 31 49

654350 10 32 66 79

Table 44 Dose response assay

0.12 0.60 3.00 15.00

ISIS No

μΜ μΜ μΜ μΜ

33361 1 5 0 7 3

61 1497 16 49 60 75

61 1500 9 8 21 49

612932 17 8 26 37

612941 4 12 36 51

654303 0 1 0 5

654304 9 10 27 43

65431 1 15 51 68 84

654312 6 26 29 33

654319 3 44 2 8

654320 4 12 5 12

654327 3 45 65 81

654328 15 44 73 85

654335 2 0 0 12

654336 0 0 0 0

654343 0 7 26 59

654344 10 30 51 72

654351 10 22 48 77

654352 8 26 57 76 Example 11: Dose-dependent inhibition of human SOD-1 by gapmers with mixed backbone chemistry

Additional gapmers were designed based on the sequences of the oligonucleotides disclosed in studies described above. The oligonucleotides were designed as 5-10-5 MOE gapmers, 4-8-5 MOE gapmers, 5-8-5 MOE gapmers, 5-8-7 MOE gapmers, 6-8-6 MOE gapmers, 6-9-5 MOE gapmers, or deoxy, MOE and cEt oligonucleotides.

The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. The 4-8-5 MOE gapmers are 17 nucleosides in length, wherein the central gap segment is comprised of eight 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising four and five nucleosides respectively. The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment is comprised of eight 2'- deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. The 5-8-7 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five and seven nucleosides respectively. The 6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising six nucleosides each. The 6-9-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of nine 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising six and five nucleosides respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'- MOE modification.

The deoxy, MOE and cEt oligonucleotides are 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety. The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'-deoxyribose; and 'e' indicates a 2'-MOE modified sugar.

The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate linkages. The internucleoside linkages of each oligonucleotide are denoted in the Backbone Chemistry column, where Ό' indicates a phosphodiester linkage and 's' indicates a phosphorothioate linkage. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human SOD-1 m NA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000). Table 45

Modified oligonucleotides targeting human SOD-1 with mixed backbone chemistry

Figure imgf000166_0001
GTCGCCCTTC 5-8-5

684088 167 184 eeeeeddddddddeeeee sooosssssssssooss 973 990 1419

AGCACGCA MOE

CCGTCGCCCT 5-10-5

684095 167 186 eeeeeddddddddddeeeee soooossssssssssooss 973 992 21

TCAGCACGCA MOE

CCGTCGCCCT 5-8-7

684097 167 186 eeeeeddddddddeeeeeee sooossssssssssoooss 973 992 21

TCAGCACGCA MOE

GGCGATCCCA 6-8-6

684101 588 607 eeeeeeddddddddeeeeee sooossssssssssoooss 9738 9757 47

ATTACACCAC MOE

GGCGATCCCA 5-8-7

684102 588 607 eeeeeddddddddeeeeeee sooossssssssssoooss 9738 9757 47

ATTACACCAC MOE

GGCGATCCCA 6-9-5

684104 588 607 eeeeeedddddddddeeeee soooossssssssssooss 9738 9757 47

ATTACACCAC MOE

The newly designed oligonucleotides were tested at various doses in A431 cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 5,000 cells per well and modified oligonucleotides were added to the media at 0.062 μΜ, 0.185 μΜ, 0.556 μΜ, 1.667 μΜ, 5.000 μΜ, and 15.000 μΜ concentrations of modified oligonucleotide for free uptake by the cells, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe sets RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

Table 46

Dose response assay

Figure imgf000167_0001
Table 47

Dose response assay

Figure imgf000168_0001

The newly designed oligonucleotides were also tested at various doses in SH-SY5Y cells. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and modified oligonucleotides transfected using electroporation at 0.062 μΜ, 0.185 μΜ, 0.556 μΜ, 1.667 μΜ, 5.000 μΜ, and 15.000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3898 was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells.

Table 48

Dose response assay

Figure imgf000168_0002
Table 49

Dose response assay

Figure imgf000169_0001

Example 12: Inhibition of human SOD-1 in a transgenic rat model

Gapmers from the studies described above, including benchmark compound ISIS 333611, which was previously disclosed in WO 2005/040180, were tested in an SOD-1 transgenic rat model (Taconic, Cat# 2148-F and 2148-M). These hemizygous rats express mutant human SOD-1 in the spinal cord.

Additional gapmers were designed based on the sequences of the oligonucleotides disclosed in studies described above. The oligonucleotides were designed as 5-9-5 MOE gapmers, 5-10-5 MOE gapmers or deoxy, MOE and cEt oligonucleotides. The 5-9-5 MOE gapmers are 19 nucleosides in length, wherein the central gap segment is comprised of nine 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of ten 2'-deoxyribonucleosides and is flanked by wing segments on the 5' direction and the 3' directions comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The deoxy, MOE and cEt oligonucleotides are 17 nucleosides in length wherein each nucleoside has a MOE sugar modification, a cEt sugar modification, or a deoxy moiety The sugar chemistry of each oligonucleotide is denoted as in the Chemistry column, where 'k' indicates a cEt modified sugar; 'd' indicates a 2'- deoxyribose; and 'e' indicates a 2'-MOE modified sugar. The internucleoside linkages throughout each gapmer are either phosphodiester or phosphorothioate linkages. The internucleoside linkages of each oligonucleotide is denoted in the Backbone Chemistry column, where Ό' indicates a phosphodiester linkage and 's' indicates a phosphorothioate linkage. All cytosine residues throughout each oligonucleotide are 5- methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Table below is targeted to either the human SOD-1 mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 000454.4) or the human SOD-1 genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 011512.10 truncated from nucleotides 18693000 to 18704000).

Table 50

Modified oligonucleotides targeting human SOD-1 with mixed backbone chemistry

Figure imgf000170_0001
AGGATACATTT 5-10-5

611499 664 683 eeeeeddddddddddeeeee sooosssssssssssooos 9814 9833 822

CTACAGCTA MOE

Deoxy,

CTCAGACTACA

612912 621 637 MOE, eeekkdddddddkkeee soosssssssssooss 9771 9787 1146

TCCAAG

and cEt

Deoxy,

CTACAGCTAGC

612915 656 672 MOE, eeekkdddddddkkeee soosssssssssooss 9806 9822 1164

AGGATA

and cEt

Deoxy,

AGTGTTTAATG

612917 684 700 MOE, eeekkdddddddkkeee soosssssssssooss 9834 9850 1173

TTTATC

and cEt

Deoxy,

CTCAGACTACA

612919 621 637 MOE, eekkddddddddkkeee soosssssssssooss 9771 9787 1146

TCCAAG

and cEt

Deoxy,

CTACAGCTAGC

612923 656 672 MOE, eekkddddddddkkeee soosssssssssooss 9806 9822 1164

AGGATA

and cEt

Deoxy,

GTTTATCAGGA

612924 674 690 MOE, eekkddddddddkkeee soosssssssssooss 9824 9840 1346

TACATT

and cEt

Deoxy,

CCGTCGCCCTT

612934 170 186 MOE, eekkdddddddddkkee sooosssssssssoss 976 992 969

CAGCAC

and cEt

Deoxy,

CCCAATTACAC

612935 585 601 MOE, eekkdddddddddkkee sooosssssssssoss 9735 9751 1114

CACAAG

and cEt

Deoxy,

TTTCTACAGCT

612940 659 675 MOE, eekkdddddddddkkee sooosssssssssoss 9809 9825 1167

AGCAGG

and cEt

Deoxy,

CAGGATACATT

612942 668 684 MOE, eekkdddddddddkkee sooosssssssssoss 9818 9834 1344

TCTACA

and cEt

Deoxy,

GTTTATCAGGA

612943 674 690 MOE, eekkdddddddddkkee sooosssssssssoss 9824 9840 1346

TACATT

and cEt

AGGATACATTT 5-9-5

666854 665 681 eeeeedddddddddeeeee sooossssssssssooss 9815 9831 1428

CTACAGCT MOE

CAGGATACATT 5-9-5

666855 666 682 eeeeedddddddddeeeee sooossssssssssooss 9816 9832 1461

TCTACAGC MOE

Deoxy,

TTAATGTTTAT

666857 679 695 MOE, eeekddddddddkeeee soosssssssssooss 9829 9845 1351

CAGGAT

and cEt

Deoxy,

TTAATGTTTAT

666858 679 695 MOE, eekkddddddddeeeee soosssssssssooss 9829 9845 1351

CAGGAT

and cEt

Deoxy,

TTAATGTTTAT

666864 679 695 MOE, kekeddddddddeeeee soosssssssssooss 9829 9845 1351

CAGGAT

and cEt Deoxy,

TTAATGTTTAT

666865 679 695 MOE, eeeeddddddddekeke soosssssssssooss 9829 9845 1351

CAGGAT

and cEt

Deoxy,

AGTGTTTAATG

666866 684 700 MOE, eeekddddddddkeeee soosssssssssooss 9834 9850 1173

TTTATC

and cEt

Deoxy,

ACAGTGTTTAA

666908 686 702 MOE, eeeekdddddddkeeee sooossssssssooss 9836 9852 1175

TGTTTA

and cEt

Deoxy,

GGATACATTTC

666923 666 682 MOE, eeekddddddddkeeee sooossssssssooss 9816 9832 1342

TACAGC

and cEt

The modified oligonucleotides were tested in a series of experiments that had similar conditions. The results for each experiment are presented in separate tables shown below. Rats were injected intrathecally with 30μΙ of a 16.67mg/ml solution of modified oligonucleotide diluted in PBS (500 μg final dose). A control group of rats was injected intrathecally with PBS. Inhibition levels of SOD-1 in the lumbar spinal cord, thoracic spinal cord and cervical spinal cord were assessed. The data is presented below and indicate that several modified oligonucleotides inhibited human SOD-1 levels in this model.

Table 51

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000172_0001
Table 52

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000173_0001

Table 53

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000173_0002
5-10-5 MOE with

611498 mixed 30 43 27 816 backbone chemistry

5-10-5 MOE with

611499 mixed 45 56 40 822 backbone chemistry

5-10-5 MOE with

611500 mixed 56 58 52 823 backbone chemistry

Table 54

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000174_0001
Deoxy, MOE, and cEt

612916 with mixed 72 69 69 1170 backbone chemistry

Deoxy, MOE, and cEt

612931 with mixed 81 79 72 1173 backbone chemistry

Deoxy, MOE, and cEt

612932 with mixed 21 26 24 1175 backbone chemistry

Table 56

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000175_0001
Table 57

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000176_0001

Table 58

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000176_0002

Table 59

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000176_0003
5-9-5 MOE with mixed

666855 37 17 1461

backbone chemistry

Deoxy, MOE, and cEt

666857 with mixed 59 39 1351

backbone chemistry

Deoxy, MOE, and cEt

666858 with mixed 38 22 1351

backbone chemistry

Deoxy, MOE, and cEt

666859 with mixed 79 64 1351

backbone chemistry

Deoxy, MOE, and cEt

666864 with mixed 50 40 1351

backbone chemistry

Deoxy, MOE, and cEt

666865 with mixed 73 44 1351

backbone chemistry

Deoxy, MOE, and cEt

666866 with mixed 67 56 1173

backbone chemistry

Deoxy, MOE, and cEt

666908 with mixed 38 13 1175

backbone chemistry

Deoxy, MOE, and cEt

666923 with mixed 45 26 1342

backbone chemistry

Table 60

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000177_0001
Deoxy, MOE, and cEt

666867 with mixed 59 48 1173

backbone chemistry

Deoxy, MOE, and cEt

666869 with mixed 82 81 1173

backbone chemistry

Deoxy, MOE, and cEt

666870 with mixed 76 68 1173

backbone chemistry

Deoxy, MOE, and cEt

666919 with mixed 76 68 1342

backbone chemistry

Deoxy, MOE, and cEt

666921 with mixed 71 65 1342

backbone chemistry

Deoxy, MOE, and cEt

666922 with mixed 67 62 1342

backbone chemistry

Table 61

Percent inhibition of human SOD-1 in the spinal cord regions of transgenic rats

Figure imgf000178_0001
Example 13: Dose-dependent inhibition of human SOD-1 with modified oligonucleotides in LLC-MK2 cells

Gapmers from the studies described above, including benchmark compound ISIS 333611, exhibiting significant in vitro inhibition of SOD-1 mRNA were selected and tested at various doses in LLC-MK2 cells. The cross-reactivity of the human modified oligonucleotides tested in this study with the rhesus monkey genomic sequence (the complement of GENBANK Accession No. NW 001114168.1 truncated from nucleotides 2258000 to 2271000, designated herein as SEQ ID NO: 3) is shown in the Table below.

Table 62

Cross-reactivity of antisense oligonucleotides targeting human SODlwith SEQ ID NO: 3

Figure imgf000179_0001

Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.078 μΜ, 0.156 μΜ, 0.313 μΜ, 0.625 μΜ, 1.25 μΜ, 2.50 μΜ, 5.00 μΜ, and 10.000 μΜ concentrations of modified oligonucleotide, as specified in the Tables below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and SOD-1 mRNA levels were measured by quantitative real-time PCR Primer probe set RTS3121 (forward sequence TGGAGATAATACACAAGGCTGTACCA, designated herein as SEQ ID NO: 17; reverse sequence CAACATGCCTCTCTTCATCCTTT, designated herein as SEQ ID NO: 18; probe sequence ATCCTCTATCCAGACAACACGGTGGGC, designated herein as SEQ ID NO: 19) was used to measure mRNA levels. SOD-1 mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of SOD-1, relative to untreated control cells. The half maximal inhibitory concentration (IC5o) of each oligonucleotide is also presented. As presented in the Table, several of the newly designed oligonucleotides were more potent than the benchmark, ISIS 336611. Table 63

Dose-dependent inhibition of SOD-1 rhesus monkey mRNA

Figure imgf000180_0001

Example 14: Tolerability of SOD-1 modified oligonucleotides in a rat model

Gapmers from the studies described above, including benchmark compound ISIS 333611, which was previously disclosed in WO 2005/040180, were tested for tolerability in Sprague-Dawley rats.

The modified oligonucleotides were tested in a series of experiments that had similar conditions. Rats were injected intrathecally with3 mg of a single dose of ISIS oligonucleotide. A control group of rats was injected intrathecally with PBS. Acute tolerability was assessed 3 hours post-dose using a functional observational battery (FOB) . This score is used to evaluate the acute tolerability of a compound with lower scores denoting better tolerated compounds. Control animals usually have a score of '0' or Ί '. At 3 hours post injection, the rats are observed by placing each rat on the cage top and evaluating certain functions, assigning a number of '0' or Ί ' depending on whether the rat exhibits normal function in the region of interest (0) or does not (1) for each function, and then adding the total scores. Seven regions are assessed, including tail, hind paws, hind legs, hind end, front posture, fore paws, and head. The results of the scoring are presented in the Table below. As presented in the Table, several newly designed oligonucleotides demonstrated more acute tolerability compared to the benchmark, ISIS 333611.

Table 64

FOB scores in Sprague-Dawley rats

Figure imgf000180_0002
5-8-5 MOE with mixed

684088 167 0 backbone

5-9-5 MOE with mixed

684093 167 0 backbone

5-10-5 MOE with mixed

684095 167 0 backbone

6-8-6 MOE with mixed

684096 167 0 backbone

5-8-7 MOE with mixed

684097 167 0 backbone

7-8-5 MOE with mixed

684098 167 0 backbone

6-9-5 MOE with mixed

684099 167 0 backbone

Deoxy, MOE, and cEt with

684074 168 0 mixed backbone

Deoxy, MOE, and cEt with

684082 168 1 mixed backbone

5-8-5 MOE with mixed

684089 168 0 backbone

5-9-5 MOE with mixed

684094 168 1 backbone

Deoxy, MOE, and cEt with

684075 169 3 mixed backbone

Deoxy, MOE, and cEt with

684083 169 3 mixed backbone

5-8-5 MOE with mixed

684090 169 2 backbone

Deoxy, MOE, and cEt with

684076 170 2 mixed backbone

Deoxy, MOE, and cEt with

684084 170 4 mixed backbone

5-10-5 MOE with mixed

611474 234 4 backbone

5-8-5 MOE with mixed

654301 234 3 backbone

5-8-5 MOE with mixed

654302 235 1 backbone

5-8-5 MOE with mixed

654303 236 0 backbone

Deoxy, MOE, and cEt with

684069 588 0 mixed backbone

Deoxy, MOE, and cEt with

684077 588 1 mixed backbone

5-8-5 MOE with mixed

684085 588 0 backbone 5-9-5 MOE with mixed

684091 588 0 backbone

5-10-5 MOE with mixed

684100 588 0 backbone

6-8-6 MOE with mixed

684101 588 0 backbone

5-8-7 MOE with mixed

684102 588 0 backbone

7-8-5 MOE with mixed

684103 588 0 backbone

6-9-5 MOE with mixed

684104 588 0 backbone

Deoxy, MOE, and cEt with

684070 589 0 mixed backbone

Deoxy, MOE, and cEt with

684078 589 0 mixed backbone

5-8-5 MOE with mixed

684086 589 0 backbone

5-9-5 MOE with mixed

684092 589 0 backbone

Deoxy, MOE, and cEt with

684071 590 0 mixed backbone

Deoxy, MOE, and cEt with

684079 590 0 mixed backbone

5-8-5 MOE with mixed

684087 590 0 backbone

Deoxy, MOE, and cEt with

684072 591 1 mixed backbone

Deoxy, MOE, and cEt with

684080 591 1 mixed backbone

5-8-5 MOE with mixed

654304 663 3 backbone

Deoxy, MOE, and cEt with

612916 664 0 mixed backbone

5-8-5 MOE with mixed

654305 664 2 backbone

5-10-5 MOE with mixed

611492 665 0 backbone

5-8-5 MOE with mixed

654306 665 3 backbone

Deoxy, MOE, and cEt with

654323 665 0 mixed backbone

Deoxy, MOE, and cEt with

654341 665 0 mixed backbone

5-10-5 MOE with mixed

666846 665 0 backbone 5-10-5 MOE with mixed

666849 665 0 backbone

5-10-5 MOE with mixed

666851 665 1 backbone

5-10-5 MOE with mixed

666853 665 0 backbone

5-9-5 MOE with mixed

666854 665 1 backbone

5-10-5 MOE with mixed

611500 666 0 backbone

Deoxy, MOE, and cEt with

612941 666 3 mixed backbone

5-8-5 MOE with mixed

654307 666 2 backbone

Deoxy, MOE, and cEt with

654342 666 2 mixed backbone

5-10-5 MOE with mixed

666845 666 0 backbone

5-10-5 MOE with mixed

666848 666 1 backbone

5-10-5 MOE with mixed

666850 666 0 backbone

5-10-5 MOE with mixed

666852 666 1 backbone

5-9-5 MOE with mixed

666855 666 1 backbone

Deoxy, MOE, and cEt with

666917 666 3 mixed backbone

Deoxy, MOE, and cEt with

666918 666 3 mixed backbone

Deoxy, MOE, and cEt with

666919 666 2 mixed backbone

Deoxy, MOE, and cEt with

666920 666 1 mixed backbone

Deoxy, MOE, and cEt with

666921 666 2 mixed backbone

Deoxy, MOE, and cEt with

666922 666 3 mixed backbone

Deoxy, MOE, and cEt with

666923 666 2 mixed backbone

5-9-5 MOE with mixed

666856 667 3 backbone

Deoxy, MOE, and cEt with

612925 676 4 mixed backbone

Deoxy, MOE, and cEt with

684059 676 4 mixed backbone Deoxy, MOE, and cEt with

684060 676 3 mixed backbone

Deoxy, MOE, and cEt with

684061 676 4 mixed backbone

Deoxy, MOE, and cEt with

684062 676 4 mixed backbone

Deoxy, MOE, and cEt with

684063 676 5 mixed backbone

Deoxy, MOE, and cEt with

684064 676 4 mixed backbone

Deoxy, MOE, and cEt with

684065 676 4 mixed backbone

Deoxy, MOE, and cEt with

684066 676 4 mixed backbone

Deoxy, MOE, and cEt with

684067 676 5 mixed backbone

4-8-5 MOE with mixed

684068 676 4 backbone

Deoxy, MOE, and cEt with

612927 678 4 mixed backbone

5-8-5 MOE with mixed

654309 678 4 backbone

Deoxy, MOE, and cEt with

612928 679 2 mixed backbone

Deoxy, MOE, and cEt with

612947 679 7 mixed backbone

5-8-5 MOE with mixed

654310 679 3 backbone

Deoxy, MOE, and cEt with

666857 679 1 mixed backbone

Deoxy, MOE, and cEt with

666858 679 1 mixed backbone

Deoxy, MOE, and cEt with

666859 679 1 mixed backbone

Deoxy, MOE, and cEt with

666860 679 0 mixed backbone

Deoxy, MOE, and cEt with

666861 679 5 mixed backbone

Deoxy, MOE, and cEt with

666862 679 1 mixed backbone

Deoxy, MOE, and cEt with

666863 679 4 mixed backbone

Deoxy, MOE, and cEt with

666864 679 4 mixed backbone

Deoxy, MOE, and cEt with

666865 679 5 mixed backbone 5-10-5 MOE with mixed

611497 681 5 backbone

Deoxy, MOE, and cEt with

612948 681 3 mixed backbone

5-10-5 MOE with mixed

666847 681 7 backbone

Deoxy, MOE, and cEt with

612949 683 4 mixed backbone

Deoxy, MOE, and cEt with

612931 684 4 mixed backbone

Deoxy, MOE, and cEt with

666866 684 6 mixed backbone

Deoxy, MOE, and cEt with

666867 684 6 mixed backbone

Deoxy, MOE, and cEt with

666868 684 6 mixed backbone

Deoxy, MOE, and cEt with

666869 684 6 mixed backbone

Deoxy, MOE, and cEt with

666870 684 6 mixed backbone

Deoxy, MOE, and cEt with

666871 684 6 mixed backbone

Deoxy, MOE, and cEt with

666872 684 6 mixed backbone

Deoxy, MOE, and cEt with

666873 684 6 mixed backbone

Deoxy, MOE, and cEt with

666874 684 5 mixed backbone

Deoxy, MOE, and cEt with

612918 686 4 mixed backbone

Deoxy, MOE, and cEt with

612932 686 2 mixed backbone

Deoxy, MOE, and cEt with

666906 686 2 mixed backbone

Deoxy, MOE, and cEt with

666907 686 3 mixed backbone

Deoxy, MOE, and cEt with

666908 686 1 mixed backbone

Deoxy, MOE, and cEt with

666909 686 0 mixed backbone

Deoxy, MOE, and cEt with

666910 686 2 mixed backbone

Deoxy, MOE, and cEt with

666911 686 0 mixed backbone

Deoxy, MOE, and cEt with

666912 686 0 mixed backbone Deoxy, MOE, and cEt with

666913 686 0

mixed backbone

Deoxy, MOE, and cEt with

666914 686 0

mixed backbone

Deoxy, MOE, and cEt with

666915 686 1

mixed backbone

Deoxy, MOE, and cEt with

666916 686 1

mixed backbone

5-8-5 MOE with mixed

654318 687 1

backbone

Deoxy, MOE, and cEt with

654334 687 3

mixed backbone

Tolerability was also assessed 8 weeks post-dose by measuring the levels of IBA1, a microglial marker, and GFAP, an astrocytic marker, in the lumbar spinal cord region. Both IBA1 and GFAP are markers of CNS inflammation (Frank, MG, Brain Behav. Immun. 2007, 21, 47-59), hence the higher the level of either marker, the less tolerable the antisense oligonucleotide is deemed to be in this rat model.

IBA1 mRNA levels were measured with primer probe set rAIFl_LTS00219 (forward sequence AGGAGAAAAACAAAGAACACCAGAA, designated herein as SEQ ID NO: 5; reverse sequence CAATTAGGGCAACTCAGAAATAGCT, designated herein as SEQ ID NO: 6; probe sequence CCAACTGGTCCCCCAGCCAAGA, designated herein as SEQ ID NO: 7). GFAP mRNA levels were measured with primer probe set mGFAP_LTS00370 (forward sequence GAAACCAGCCTGGACACCAA, designated herein as SEQ ID NO: 8; reverse sequence TCCACAGTCTTTACCACGATGTTC, designated herein as SEQ ID NO: 9; probe sequence TCCGTGTCAGAAGGCCACCTCAAGA, designated herein as SEQ ID NO: 10).

The results are presented in the Table below. As presented in the Table, several newly designed oligonucleotides were more tolerable compared to the benchmark, ISIS 333611.

Table 65

IBA1 and GFAP mRNA levels (% control) in the lumbar regions of Sprague-Dawley rats

ISIS No. IBA1 GFAP

333611 341 314

654301 149 137

654302 261 129

654303 110 80

654304 143 130

654305 185 158 654306 110 106

654307 152 144

654309 195 169

654310 119 141

654318 93 81

654323 125 113

654334 114 75

654341 209 224

654342 473 485

666845 389 416

666846 173 171

666847 271 297

666848 399 377

666849 140 150

666850 246 252

666851 246 199

666852 282 266

666853 168 147

666854 135 123

666855 238 221

666856 253 209

666857 242 182

666858 169 134

666859 185 162

666861 161 152

666862 254 285

666863 216 185

666864 174 154

666865 251 232

666866 281 135

666867 132 112

666868 199 211

666869 262 207

666870 201 189

666871 192 214

666872 441 136

666873 340 277

666874 204 199

666917 292 244

666919 115 85

666920 155 102 666921 108 82

666922 123 82

666923 118 93

684059 168 162

684060 158 141

684061 335 263

684062 218 265

684064 191 168

684065 245 304

684066 313 376

684067 171 151

684068 157 135

684085 459 586

684086 187 227

684087 215 263

684088 151 183

684089 507 667

684090 130 170

684091 350 426

684092 366 333

684093 412 264

684094 294 373

684095 213 215

684096 404 335

684097 217 206

684098 378 438

684099 534 473

684100 276 259

684101 153 125

684102 237 242

684103 588 416

684104 221 193

Example 15: Dose dependent inhibition of human SOD-1 in a transgenic rat model

Gapmers from the studies described above, including benchmark compound ISIS 333611, were tested in an SOD-1 transgenic rat model (Taconic, Cat# 2148-F and 2148-M). These hemizygous rats express mutant human SOD-1 in the spinal cord, many brain regions, and peripheral organs.

Rats were injected intrathecally with 10, 30, 100, 300, 1000, or 3000 μg of a gapmer listed in the table below or with only PBS. Two weeks later, the animals were sacrificed. Inhibition of SOD-1 mRNA in the lumbar spinal cord, cervical spinal cord, rostral cortex, and caudal cortex was assessed by RT-PCR using primer probe set RTS3898, described in Example 1. The data is presented below as ED50 values, and indicates that the oligonucleotides inhibited SOD1 mRNA in multiple CNS tissues more potently than Isis 333611. Indeed, ED50 values for Isis No. 333611 could not even be calculated, as indicated by an entry of "n/a," because even the highest concentration tested (3000 μg) did not inhibit SOD-1 mRNA greater than 55- 65%. "n.d." indicates that there is no data available for the indicated sample.

Table 66

Inhibition of human SOD1 in transgenic rats

Figure imgf000189_0001
Example 16: Tolerability of SOD-1 modified oligonucleotides in rats

Gapmers from the studies described above, including benchmark compound ISIS 333611, were tested for tolerability in Sprague-Dawley rats. Groups of 4 to 6 rats were injected intrathecally with 1 mg or 3 mg of a single dose of an ISIS oligonucleotide. A control group of rats was injected intrathecally with PBS. Acute tolerability was assessed 3 hours post-dose, as described in Example 14. The results for the 1 mg dose are the averages for each group following one experiment. The results for the 3 mg dose are the averages for each group across two replicate experiments. The results of the study, presented in the table below, indicate that several newly designed oligonucleotides were more tolerable than the benchmark, ISIS 333611.

Table 67

FOB values

Figure imgf000189_0002
Example 17: Dose dependent inhibition of human SOD-1 in a transgenic mouse model

In order to confirm the results obtained in transgenic rats in another species, gapmers from the studies described above were tested in an SOD-1 transgenic mouse model that expresses the same G93A human mutant SOD1 gene that the transgenic rat expresses (see Examples 12 and 15).

Mice received an intracerebral ventricular bolus (ICVB) of 10, 30, 100, 300, or 700 μg of a gapmer listed in the table below, or PBS. Two weeks later, the animals were sacrificed. Inhibition of SOD-1 mRNA in the lumbar spinal cord and cortex was assessed by RT-PCR using primer probe set RTS3898, described in Example 1. The data is presented below as ED50 values, and indicates that the oligonucleotides inhibited SOD1 mRNA more potently than Isis 333611 in both rats and mice.

Table 68

Inhibition of human SOD1 in transgenic mice

Figure imgf000190_0001

Example 18: Tolerability of SOD-1 modified oligonucleotides in mice

Gapmers from the studies described above, including benchmark compound ISIS 333611, were tested for tolerability in C57bl6 mice. Mice were injected stereotaxically into the cerebral ventricles with 700ug of a single dose of ISIS oligonucleotide. A control group of mice was injected into the cerebral ventricle with PBS. Acute tolerability was assessed at 3 hours post injection using a functional observation battery (FOB) different from that used for the rats. Each mouse was evaluated according to 7 different criteria. The 7 criteria are (1) the mouse was bright, alert, and responsive; (2) the mouse was standing or hunched without stimuli; (3) the mouse shows any movement without stimuli (4) the mouse demonstrates forward movement after its lifted; (5) the mouse demonstrates any movement after its lifted; (6) the mouse responds to a tail pinch; (7) regular breathing. For each of the 7 different criteria, each mouse was given a sub-score of 0 if it met the criteria or 1 if it did not. After all of the 7 criteria were evaluated, the sub-scores were summed for each mouse and then averaged for each group. For example, if a mouse was bright, alert, and responsive 3 hours after the 700 μg ICV dose, and met all other other criteria, it would get a summed score of 0. If another mouse was not bright, alert, and responsive 3 hours after the 700 μg ICV dose but met all other criteria, it would receive a score of 1. Saline treated mice generally receive a score of 0. A score at the top end of the range would be suggestive of acute toxicity.

Body weights were measured throughout the study and are reported below as percent change at 8 weeks relative to baseline. Long term tolerability was assessed 8 weeks post-dose by measuring the levels of IBA1 and GFAP, as described in Example 14. IBA1 and GFAP mRNA levels are reported relative to PBS treated animals. The results of the study, presented in the tables below, indicate that several newly designed oligonucleotides were more tolerable, in rats and mice, compared to the benchmark, ISIS 333611.

Table 69

FOB values and body weight change

Figure imgf000191_0001

Table 70

Inflammation markers

Figure imgf000191_0002

Example 19: Dose dependent inhibition of monkey SOD-1 in cynomolgus monkey

Isis No. 666853 was tested in cynomolgus monkey. There is one mismatch between Isis No. 666853 and cynomolgus monkey SOD-1, and there are 17 contiguous bases in Isis No. 666853 that are 100% complementary to cynomolgus monkey SOD-1.

Groups of 6-10 male and female monkeys received an intrathecal lumbar bolus of PBS or 4, 12, or 35 mg of Isis No. 666853 on days 1, 14, 28, 56, and 84 of the study. Each group received the same dose on all five dosing days. On day 91, the animals were sacrificed. Inhibition of SOD-1 mRNA in the lumbar, thoracic, and cervical spinal cord and frontal cortex, motor cortex, hippocampus, pons, and cerebellum was assessed by RT-PCR using primer probe set RTS3898. The data is presented below as the average percent inhibition for each treatment group, relative to the PBS treated group. The results indicate that Isis No. 666853 inhibited SOD-1 mRNA in multiple target tissues in cynomolgus monkey.

Treatment with 666853 was well tolerated for the duration of the 13 week study and there were no clinical observations of adverse reactions in monkeys.

Table 71

Inhibition of SOD-1 mRNA in monkeys

Figure imgf000192_0001

Claims

What is claimed is:
1. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 118-1461.
2. A compound, comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 15, 21, 23, 47, 54, and 67, wherein at least one internucleoside linkage is a phosphodiester linkage.
3. The compound of claim 1, wherein the modified oligonucleotide has a mixed backbone.
4. The compound of claim 3, wherein the mixed backbone motif is selected from the following: sossssssssoooss,
sooossssssssoss,
sooosssssssssoss,
soosssssssssooss,
sooossssssssooss,
sooosssssssssooss,
sooossssssssssooss,
sooosssssssssssooos,
soooossssssssssooss,
sooosssssssssssooss,
sososssssssssssosos, and
sooossssssssssoooss, wherein
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
5. The compound of any preceding claim, wherein the modified oligonucleotide has a sugar chemistry motif of any of the following:
abddddddddababaa,
babaddddddddabab, aaaadddddddddbbaa,
aaaaddddddddababa,
aaaaddddddddbabaa,
aaaaddddddddbbaaa,
aaaaaddddddddbbaa,
aaaabddddddddbaaa,
aaaabdddddddbaaaa,
aaabddddddddbaaaa,
aaabbdddddddbbaaa,
aabbdddddddddbbaa,
aabbddddddddaaaaa,
aabbddddddddbbaaa,
ababddddddddaaaaa,
ababddddddddbabaa, and
babaddddddddaaaaa, wherein
e = any 2'non-bicyclic modified sugar,
b = any bicyclic modified sugar,
d = a 2'-deoxyribose sugar.
6. The compound of claim 5, wherein the modified oligonucleotide has a sugar chemistry motif of any of the following:
ekddddddddekekee,
kekeddddddddekek,
eeeedddddddddkkee,
eeeeddddddddekeke,
eeeeddddddddkekee,
eeeeddddddddkkeee,
eeeeeddddddddkkee,
eeeekddddddddkeee,
eeeekdddddddkeeee,
eeekddddddddkeeee,
eeekkdddddddkkeee,
eekkdddddddddkkee,
eekkddddddddeeeee,
eekkddddddddkkeee, ekekddddddddeeeee,
ekekddddddddkekee, and
kekeddddddddeeeee, wherein
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
7. The compound of any preceding claim, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO: 1 or SEQ ID NO: 2.
8. The compound of any preceding claim, wherein the modified oligonucleotide is a single- stranded modified oligonucleotide.
9. The compound claims 1, 2, and 5-8 wherein at least one internucleoside linkage is a modified internucleoside linkage.
10. The compound of claim 9, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
11. The compound of claim 10, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
12. The compound of claims 1, 2, and 5-9, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.
13. The compound of claims 1, 2, 5-8, wherein at least one internucleoside linkage is a phosphorothioate linkage and at least one internucleoside linkage is a phosphodiester linkage.
14. The compound of any preceding claim, wherein at least one nucleoside comprises a modified nucleobase.
15. The compound of claim 14, wherein the modified nucleobase is a 5-methylcytosine.
16. The compound of claims 1-4 and 7-15, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
17. The compound of claim 16, wherein the at least one modified sugar is a bicyclic sugar.
18. The compound of claim 17, wherein the bicyclic sugar comprises a 4'-CH(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
19. The compound of claim 18, wherein R is methyl.
20. The compound of claim 18, wherein R is H.
21. The compound of claim 16, wherein the at least one modified sugar comprises a 2'-0- methoxyethyl group.
22. The compound of claims 1-4 and 7-21, wherein the modified oligonucleotide comprises: a gap segment consisting of 8-10 linked deoxynucleosides;
a 5' wing segment consisting of 4-6 linked nucleosides; and
a 3' wing segment consisting of 5-7 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
23. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 10 linked deoxynucleosides;
a 5' wing segment consisting of 5 linked nucleosides; and
a 3' wing segment consisting of 5 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
24. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 9 linked deoxynucleosides;
a 5' wing segment consisting of 5 linked nucleosides; and
a 3' wing segment consisting of 5 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
25. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 8 linked deoxynucleosides;
a 5' wing segment consisting of 5 linked nucleosides; and
a 3' wing segment consisting of 5 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
26. The compound of claim 22, wherein the modified oligonucleotide comprises: a gap segment consisting of 8 linked deoxynucleosides;
a 5' wing segment consisting of 4 linked nucleosides; and
a 3' wing segment consisting of 5 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
27. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 8 linked deoxynucleosides;
a 5' wing segment consisting of 5 linked nucleosides; and
a 3' wing segment consisting of 7 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
28. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 8 linked deoxynucleosides;
a 5' wing segment consisting of 6 linked nucleosides; and
a 3' wing segment consisting of 6 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
29. The compound of claim 22, wherein the modified oligonucleotide comprises:
a gap segment consisting of 9 linked deoxynucleosides;
a 5' wing segment consisting of 6 linked nucleosides; and
a 3' wing segment consisting of 5 linked nucleosides;
wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
30. The compound of claims 1 -3 and 7-21, wherein the modified oligonucleotide consists of 12, 13, 14, 15, 16, 17, 18, 19, or 20 linked nucleosides.
31. A compound consisting of a modified oligonucleotide according to the following formula:
Figure imgf000198_0001
197 A compound consisting of a modified oligonucleotide according to the following formula:
Figure imgf000199_0001
Figure imgf000200_0001
199
Figure imgf000201_0001
200
Figure imgf000202_0001
201 A compound consisting of a modified oligonucleotide according to the following formula:
Figure imgf000203_0001
A compound consisting of a modified oligonucleotide according to the following formula:
Figure imgf000204_0001
A compound consisting of a modified oligonucleotide according to the following formula:
Figure imgf000205_0001
39. A compound comprising of a modified oligonucleotide according to the following formula: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; wherein, A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
40. A compound comprising of a modified oligonucleotide according to the following formula: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Te; wherein, A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
41. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Geo Aeo Teo Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein, A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
42. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Geo Aeo Teo Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
43. A compound comprising of a modified oligonucleotide according to the following formula: Ges Geo Aeo Teo Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; wherein, A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
44. A compound comprising of a modified oligonucleotide according to the following formula:
Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
45. A compound comprising of a modified oligonucleotide according to the following formula:
Aes Gko Teo Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
46. A compound comprising of a modified oligonucleotide according to the following formula: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
k = a cEt modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
47. A compound comprising of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCeo Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Ges mCes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
48. A compound comprising of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Ges mCeo Aeo mCeo Ges mCes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
49. A compound comprising of a modified oligonucleotide according to the following formula: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Geo mCes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
50. A compound comprising of a modified oligonucleotide according to the following formula:
Aes mCeo Aeo mCeo mCes Tds Tds mCds Ads mCds Tds Gds Gds Tds mCds mCeo Aeo Teo Tes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
51. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCeo Aes mCe, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
52. A compound comprising of a modified oligonucleotide according to the following formula: Ges Geo mCeo Geo Aes Tes mCds mCds mCds Ads Ads Tds Tds Ads mCeo Aeo mCeo mCes Aes mCe, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
53. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Aes mCeo Aeo mCeo mCes Aes mCe, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
54. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Geo mCeo Geo Aeo Tes mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCes Aes mCe, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
55. A compound comprising of a modified oligonucleotide according to the following formula: Ges Teo mCeo Geo mCes mCds mCds Tds Tds mCds Ads Gds mCds Ads mCds Geo mCeo Aeo mCes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
56. A compound comprising of a modified oligonucleotide according to the following formula:
Tes mCeo Geo mCeo mCes mCds Tds Tds mCds Ads Gds mCds Ads mCds Gds mCeo Aeo mCeo Aes mCe, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar,
s = a phosphorothioate internucleoside linkage, and
o = a phosphodiester internucleoside linkage.
57. A compound comprising of a modified oligonucleotide according to the following formula:
Ges Aes Aes Aes Tes Tds Gds Ads Tds Gds Ads Tds Gds mCds mCds mCes Tes Ges mCes Ae, wherein,
A = an adenine,
mC = a 5'-methylcytosine
G = a guanine,
T = a thymine,
e = a 2'-0-methoxyethylribose modified sugar,
d = a 2'-deoxyribose sugar, and
s = a phosphorothioate internucleoside linkage.
58. A composition comprising the compound of any preceding claim or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
59. A method comprising administering to an animal the compound or composition of any preceding claim.
60. The method of claim 59, wherein the animal is a human.
61. The method of claim 59, wherein administering the compound prevents, treats, ameliorates, or slows progression of a symptom of a SOD-1 associated disease.
62. The method of claim 59, wherein the SOD-1 associated disease is a neurodegenerative disease.
63. The method of claim 62, wherein the SOD-1 associated disease is ALS.
64. Use of the compound or composition of any preceding claim for the manufacture of a medicament for treating a neurodegenerative disorder.
65. Use of the compound or composition of any preceding claim for the manufacture of a medicament for treating ALS.
66. The compound or composition of any preceding claim wherein the modified oligonucleotide does not have the nucleobase sequence of SEQ ID NO: 21.
67. The compound or composition of any preceding claim wherein the modified oligonucleotide does not have the nucleobase sequence of any of SEQ ID NOs: 21-118.
68. A compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence, wherein the nucleobase sequence comprises an at least 12 consecutive nucleobase portion complementary to an equal number of nucleobases of nucleotides 665 to 684 of SEQ ID NO: 1, wherein the modified oligonucleotide is at least 80% complementary to SEQ ID NO: 1.
69. The compound of claim 68, wherein the modified oligonucleotide is 100% complementary to SEQ ID NO: 1.
70. The compound of claim 68, wherein the modified oligonucleotide is a single-stranded modified oligonucleotide.
71. The compound of claims 68-70 wherein at least one internucleoside linkage is a modified internucleoside linkage.
72. The compound of claim 71, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
73. The compound of claim 72, wherein each modified internucleoside linkage is a phosphorothioate internucleoside linkage.
74. The compound of claims 68-71, wherein at least one internucleoside linkage is a phosphodiester intemucleoside linkage.
75. The compound of claims 68-73 and 74-75, wherein at least one intemucleoside linkage is a phosphorothioate linkage and at least one intemucleoside linkage is a phosphodiester linkage.
76. The compound of claims 68-75, wherein at least one nucleoside comprises a modified nucleobase.
77. The compound of claim 76, wherein the modified nucleobase is a 5-methylcytosine.
78. The compound of claims 68-77, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
79. The compound of claim 78, wherein the at least one modified sugar is a bicyclic sugar.
80. The compound of claim 79, wherein the bicyclic sugar comprises a 4'-CH(R)-0-2' bridge wherein R is, independently, H, C1-C12 alkyl, or a protecting group.
81. The compound of claim 80, wherein R is methyl.
82. The compound of claim 80, wherein R is H.
83. The compound of claim 78, wherein the at least one modified sugar comprises a 2'-0- methoxyethyl group.
PCT/US2015/023934 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression WO2015153800A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US201461973803P true 2014-04-01 2014-04-01
US61/973,803 2014-04-01

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
EP15773965.7A EP3126499A4 (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression
CA2942394A CA2942394A1 (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression
CN201580024405.1A CN106459972A (en) 2014-04-01 2015-04-01 Compositions for modulating SOD-1 expression
JP2016560543A JP2017513469A (en) 2014-04-01 2015-04-01 Compositions for modulating Sod-1 expression
US15/301,004 US10385341B2 (en) 2015-04-01 Compositions for modulating SOD-1 expression
AU2015240761A AU2015240761A1 (en) 2014-04-01 2015-04-01 Compositions for modulating SOD-1 expression
MX2016012922A MX2016012922A (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression.
RU2016142532A RU2016142532A3 (en) 2014-04-01 2015-04-01
SG11201608109TA SG11201608109TA (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression
KR1020167030062A KR20170012207A (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression
IL247714A IL247714D0 (en) 2014-04-01 2016-09-08 Compositions for modulating sod-1 expression

Publications (2)

Publication Number Publication Date
WO2015153800A2 true WO2015153800A2 (en) 2015-10-08
WO2015153800A3 WO2015153800A3 (en) 2015-12-03

Family

ID=54241435

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/023934 WO2015153800A2 (en) 2014-04-01 2015-04-01 Compositions for modulating sod-1 expression

Country Status (12)

Country Link
EP (1) EP3126499A4 (en)
JP (1) JP2017513469A (en)
KR (1) KR20170012207A (en)
CN (1) CN106459972A (en)
AU (1) AU2015240761A1 (en)
CA (1) CA2942394A1 (en)
CL (2) CL2016002509A1 (en)
IL (1) IL247714D0 (en)
MX (1) MX2016012922A (en)
RU (1) RU2016142532A3 (en)
SG (1) SG11201608109TA (en)
WO (1) WO2015153800A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017218454A1 (en) 2016-06-14 2017-12-21 Biogen Ma Inc. Hydrophobic interaction chromatography for purification of oligonucleotides
WO2017223258A1 (en) 2016-06-24 2017-12-28 Biogen Ma Inc. Synthesis of thiolated oligonucleotides without a capping step
US10385341B2 (en) 2015-04-01 2019-08-20 Biogen Ma Inc. Compositions for modulating SOD-1 expression

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050019915A1 (en) * 2001-06-21 2005-01-27 Bennett C. Frank Antisense modulation of superoxide dismutase 1, soluble expression
EP2270024B1 (en) * 2001-06-21 2018-10-24 Ionis Pharmaceuticals, Inc. Antisense modulation of superoxide dismutase 1, soluble expression
US20060229268A1 (en) * 2004-12-16 2006-10-12 Alsgen, Llc Small interference RNA (siRNA) molecules for modulating superoxide dismutase (SOD)
CA2638906A1 (en) * 2006-01-26 2007-08-16 University Of Massachusetts Rna interference agents for therapeutic use
US20090130195A1 (en) * 2007-10-17 2009-05-21 Mildred Acevedo-Duncan Prostate carcinogenesis predictor
AU2009213147A1 (en) * 2008-02-11 2009-08-20 Rxi Pharmaceuticals Corp. Modified RNAi polynucleotides and uses thereof
EP2556159A1 (en) * 2010-04-07 2013-02-13 Isis Pharmaceuticals, Inc. Modulation of cetp expression
US9725479B2 (en) * 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
EP2699583A4 (en) * 2011-04-21 2015-04-15 Isis Pharmaceuticals Inc Modulation of hepatitis b virus (hbv) expression

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10385341B2 (en) 2015-04-01 2019-08-20 Biogen Ma Inc. Compositions for modulating SOD-1 expression
WO2017218454A1 (en) 2016-06-14 2017-12-21 Biogen Ma Inc. Hydrophobic interaction chromatography for purification of oligonucleotides
WO2017223258A1 (en) 2016-06-24 2017-12-28 Biogen Ma Inc. Synthesis of thiolated oligonucleotides without a capping step

Also Published As

Publication number Publication date
CN106459972A (en) 2017-02-22
IL247714D0 (en) 2016-11-30
EP3126499A4 (en) 2017-11-08
RU2016142532A3 (en) 2018-12-03
KR20170012207A (en) 2017-02-02
WO2015153800A3 (en) 2015-12-03
CL2018001897A1 (en) 2018-11-16
EP3126499A2 (en) 2017-02-08
US20170037410A1 (en) 2017-02-09
AU2015240761A1 (en) 2016-09-22
MX2016012922A (en) 2017-01-26
CL2016002509A1 (en) 2017-06-09
RU2016142532A (en) 2018-05-10
CA2942394A1 (en) 2015-10-08
JP2017513469A (en) 2017-06-01
SG11201608109TA (en) 2016-10-28

Similar Documents

Publication Publication Date Title
EP2410054B1 (en) Antisense compounds
AU2007210038B2 (en) Compositions and their uses directed to huntingtin
US7622455B2 (en) Methods for slowing familial ALS disease progression
JP5981428B2 (en) Myotonic dystrophy protein kinase (dmpk) Adjustment of expression
US20130035366A1 (en) Modulation of hepatitis b virus (hbv) expression
DK2521556T3 (en) Modulating angiopoietin-like 3 expression
AU2011213562B2 (en) Selective reduction of allelic variants
DK2321356T3 (en) Monoclonal antibodies against Tissue factor pathway inhibitor (TFPI)
AU2010292003B2 (en) Modulation of Huntingtin expression
US9683235B2 (en) Compositions for modulating Tau expression
JP5896175B2 (en) Regulation of transthyretin expression
AU2011213563B2 (en) Selective reduction of allelic variants
AU2012236206B2 (en) Modulation of signal transducer and activator of transcription 3 (STAT3) expression
EP2812342B1 (en) Modulation of rna by repeat targeting
CN104968783A (en) Compositions for modulating C9ORF72 expression
US20130053430A1 (en) Modulation of cetp expression
US20120270929A1 (en) Modulation of ttc39 expression to increase hdl
US9963699B2 (en) Methods for modulating C9ORF72 expression
US20160024496A1 (en) Methods for monitoring c9orf72 expression
US20110237646A1 (en) Modulation of transthyretin expression for the treatment of cns related disorders
WO2011127175A1 (en) Modulation of cd130 (gp130) expression
AU2013202595B2 (en) Methods for modulating Tau expression for reducing seizure and modifying a neurodegenerative syndrome
US9175291B2 (en) Modulation of androgen receptor expression
JP6126009B2 (en) Regulation of α- synuclein expression
US10221414B2 (en) Compositions for modulating C9ORF72 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15773965

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 247714

Country of ref document: IL

ENP Entry into the national phase in:

Ref document number: 2942394

Country of ref document: CA

ENP Entry into the national phase in:

Ref document number: 2015240761

Country of ref document: AU

Date of ref document: 20150401

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 15301004

Country of ref document: US

Ref document number: MX/A/2016/012922

Country of ref document: MX

ENP Entry into the national phase in:

Ref document number: 2016560543

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase in:

Ref country code: DE

ENP Entry into the national phase in:

Ref document number: 20167030062

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2016/0003727

Country of ref document: CO

Ref document number: 2015773965

Country of ref document: EP

ENP Entry into the national phase in:

Ref document number: 2016142532

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112016021848

Country of ref document: BR

REEP

Ref document number: 2015773965

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15773965

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase in:

Ref document number: 112016021848

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20160922