WO2015153357A1 - Compositions and methods for improving cardiac function - Google Patents

Compositions and methods for improving cardiac function Download PDF

Info

Publication number
WO2015153357A1
WO2015153357A1 PCT/US2015/023066 US2015023066W WO2015153357A1 WO 2015153357 A1 WO2015153357 A1 WO 2015153357A1 US 2015023066 W US2015023066 W US 2015023066W WO 2015153357 A1 WO2015153357 A1 WO 2015153357A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
polypeptide
expression vector
cardiac
rrm2
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/023066
Other languages
French (fr)
Inventor
Gregory G. Mahairas
Michael L. KRANDA
Charles E. Murry
Michael REGNIER
Hans REINECKE
Guy L. ODOM
Jeffrey S. Chamberlain
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beat Biotherapeutics Corp
University of Washington
Original Assignee
Beat Biotherapeutics Corp
University of Washington
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beat Biotherapeutics Corp, University of Washington filed Critical Beat Biotherapeutics Corp
Publication of WO2015153357A1 publication Critical patent/WO2015153357A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0093Oxidoreductases (1.) acting on CH or CH2 groups (1.17)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y117/00Oxidoreductases acting on CH or CH2 groups (1.17)
    • C12Y117/04Oxidoreductases acting on CH or CH2 groups (1.17) with a disulfide as acceptor (1.17.3)
    • C12Y117/04001Ribonucleoside-diphosphate reductase (1.17.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y117/00Oxidoreductases acting on CH or CH2 groups (1.17)
    • C12Y117/04Oxidoreductases acting on CH or CH2 groups (1.17) with a disulfide as acceptor (1.17.3)
    • C12Y117/04002Ribonucleoside-triphosphate reductase (1.17.4.2)

Definitions

  • compositions including vectors, comprising a polynucleotide sequence encoding one or both of a ribonucleotide reductase subunit 1 (Rl) and a ribonucleotide reductase subunit 2 (R2).
  • This invention is also directed to methods for increasing cardiac function, as well as methods of treating or preventing heart disease and other cardiac condition, comprising administering a composition of the invention to a subject in need thereof.
  • Heart disease is the leading cause of mortality and morbidity in the United States and has been rising dramatically around the world.
  • Cardiac diseases of the sarcomere such as HCM and DCM, frequently involve amino acid mutations in one of several myofilament proteins commonly leading to heart failure, and in some cases sudden cardiac death.
  • HCM and DCM Cardiac diseases of the sarcomere, such as HCM and DCM, frequently involve amino acid mutations in one of several myofilament proteins commonly leading to heart failure, and in some cases sudden cardiac death.
  • HCM mutations result in increased Ca 2+ sensitivity of contractile force in demembranated cardiac muscle
  • most DCM variants result in decreased Ca 2+ sensitivity of force.
  • the extent of which these alterations in myofilament Ca 2+ - sensitivity are involved in progression of the diseases is not known. Potential and important interactions between altered myofilament Ca 2+ binding and SR function have not been systematically investigated, nor have interactions with other intracellular Ca 2+ buffers (e
  • Cardiac function is compromised in a number of cardiovascular diseases including myocardial infarction, ischemia/reperfusion injury, diabetes, high blood pressure and hypertrophic and dilated cardiomyopathy. These pathophysiological conditions often alter the Ca 2+ cycle, ⁇ -adrenergic responsiveness, and/or the contractile apparatus of cardiomyocytes.
  • therapeutic efforts have focused primarily on increasing [Ca 2+ ]i, which tend to exert a pro-arrhythmogenic effect, impair ventricular filling by slowing diastolic relaxation-, and cause SR Ca 2+ overload initiating triggered activity.
  • Other approaches involving adrenergic agents can have undesirable long-term side-effects, e.g. significant drug actions in non-target areas, pro-arrythmogenic triggered activity, and potential for accelerated progression into heart failure.
  • new approaches to combat cardiac dysfunction are desirable.
  • the present invention provides such vectors and related methods of increasing cardiac function and treating heart disease.
  • the present invention provide, inter alia, compositions and methods for increasing levels of ribonucleotide reductase subunit 1 (Rl) and/or ribonucleotide reductase subunit 2 (R2) in cells, which may be used to increase cardiac function and treat a variety of cardiac diseases and disorders.
  • Rl ribonucleotide reductase subunit 1
  • R2 ribonucleotide reductase subunit 2
  • the invention includes a polynucleotide sequence comprising in the 5' to 3' direction: (a) a cardiac-specific promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (R M2) polypeptide; (c) an IRES sequence or a sequence encoding a 2A peptide; and (d) a second sequence encoding a RRMl polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRMl polypeptide, the second sequence of (d) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2 polypeptide, the second sequence of (d) encodes a RRMl polypeptide; wherein the cardiac-specific promoter sequence is operably linked to the first sequence of
  • the first sequence of (b) encodes a RRMl polypeptide
  • the second sequence of (d) encodes a RRM2 polypeptide
  • the first sequence of (b) encodes a RRM2 polypeptide
  • the second sequence of (d) encodes a RRMl polypeptide.
  • the cardiac-specific promoter is a cardiac troponin T (cTnT) promoter.
  • the cTnT promoter is the cTnT455 promoter.
  • the polynucleotide sequence comprises the sequence encoding the 2 A peptide.
  • the RRMl polypeptide is a human RRMl polypeptide or a variant thereof.
  • the RRM2 polypeptide is a human RRM2 polypeptide or a variant thereof.
  • the sequence encoding the RRMl polypeptide is codon-optimized.
  • the sequence encoding the RRM2 polypeptide is codon- optimized.
  • both the RRMl polypeptide and the RRM2 polypeptide are codon-optimized.
  • the polynucleotide sequence further comprises: (e) a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence; and (f) a second ITR sequence 3 ' of the second sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
  • the present invention includes a vector, e.g., an expression vector, comprising a polynucleotide sequence of the present invention.
  • the expression vector is a viral vector.
  • the viral vector is an adeno-associated virus (AAV) vector.
  • the AAV is an AAV6.
  • the expression vector comprises the first ITR and the second ITR, wherein the first ITR and the second ITR are AAV2 ITRs.
  • the expression vector further comprises a transduction reporter. In some embodiments, the expression vector further comprises a targeting agent. In certain embodiments, the vector is a cell comprising a polynucleotide sequence of the present invention. In one embodiment, the present invention includes a cell comprising a polynucleotide sequence or expression vector of the present invention. In particular embodiments, the cell is a cardiomyocyte.
  • the present invention includes a pharmaceutical composition comprising a polynucleotide sequence, expression vector, or cell of the present invention, including any of those described herein.
  • the present invention includes a method of improving cardiac function in a mammal in need thereof, the method comprising administering to the mammal a polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition of the present invention, including any of those described herein.
  • a polynucleotide sequence e.g., expression vector
  • cell e.g., cell, or pharmaceutical composition of the present invention, including any of those described herein.
  • the present invention includes a method of improving cardiac function in a mammal in need thereof, the method comprising administering to the mammal a polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition, comprising a polynucleotide sequence comprising in the 5' to 3' direction: (i) a cardiac-specific promoter sequence; and (ii) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide, wherein the polynucleotide sequence does not comprise both the sequence encoding the RRM1 polypeptide and the sequence encoding the RRM2 polypeptide.
  • a polynucleotide sequence e.g., expression vector
  • cell e.g., or pharmaceutical composition
  • the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising the sequence encoding the RRM1 polypeptide is administered to the mammal, the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising a sequence encoding a RRM2 polypeptide is not administered to the mammal.
  • the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising the sequence encoding the RRM2 polypeptide is administered to the mammal, the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising a sequence encoding a RRM1 polypeptide is not administered to the mammal.
  • the polynucleotide sequence further comprises: (iii) a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence; and (iv) a second ITR sequence 3 ' of the sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
  • the first ITR and the second ITR are AAV2 ITRs.
  • the polynucleotide sequence is present in an expression vector, and in particular embodiments, the expression vector is present in a pharmaceutical composition.
  • the polynucleotide sequence is present in a cell, and in certain embodiments, the cell is present in a pharmaceutical composition.
  • the polynucleotide sequence comprises the sequence encoding the RRMl polypeptide. In another embodiment, the polynucleotide sequence comprises the sequence encoding the RRM2 polypeptide.
  • administration of the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition results in an increase in generation of dATP by the mammal.
  • the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition is administered to the myocardium of the mammal.
  • it is administered by grafting cells comprising the polynucleotide sequence or vector (e.g., expression vector) to the myocardium of the mammal.
  • the cells are cardiomyocytes.
  • FIGS 1 A-F present the results of experiments performed to assess vector hemodynamics.
  • Baseline function data was assessed via Langendorff isolated heart preparations. Hearts were perfused with Kreb's Henseleit Buffer enriched with lOmM Glucose and 0.5mM Pyruvate.
  • (A) shows LV function (LVDevP (mmHg));
  • (B) shows heart rate(HR (bpm));
  • C) shows cardiac function (RPP(mmHg*bpm));
  • D) shows rate of pressure change (+dP/dT (mmHg/s));
  • E shows rate of pressure change (-dP/dT (mmHg/s)); and
  • (F) shows coronary flow (CF (ml/min)).
  • Figures 2A-B present Starling curve results.
  • (A) shows LV pressure (LVDevP (mmHg)); and
  • (B) shows end diastolic pressure(LVEDP (mmHg)).
  • Figures 3A-F present the results of experiments performed to assess response to high workload challenge consisting of 4 mM calcium + 50 nM dobutamine (DOB).
  • A shows LV function;
  • B shows heart rate;
  • C shows cardiac function;
  • D shows rate of pressure change;
  • E shows rate of pressure change; and
  • F shows coronary flow.
  • FIG 4 presents the homo sapiens ribonucleotide reductase Ml (RRM1) polynucleotide sequence (NM 001033.3). The open reading frame encoding the RRM1 polypeptide is capitalized.
  • RRM1 ribonucleotide reductase Ml
  • Figure 5 present the homo sapiens ribonucleotide reductase M2 (RRM2) transcript variant 2 polynucleotide sequence (NM 001034). The open reading frame encoding the RRM2 polypeptide is capitalized.
  • RRM2 ribonucleotide reductase M2
  • Figure 6 presents a codon-optimized RRMl polynucleotide sequence.
  • Figure 7 presents a codon-optimized RRM2 polynucleotide sequence.
  • Figure 8 presents a polynucleotide sequence including the homo sapiens ribonucleotide Ml (RRMl) polynucleotide sequence (NM 001033.3), the porcine 2A polynucleotide sequence, and the homo sapiens ribonucleotide reductase M2 (RRM2) transcript variant 2 polynucleotide sequence (NM 001034).
  • the open reading frame encoding the RRMl polypeptide is the first capitalized region of the sequence (lightly shaded)
  • the porcine 2A sequence is the darkly shaded lower case region of the sequence
  • the open reading frame encoding the RRM2 polypeptide is second capitalized region of the sequence (medium shaded).
  • Figure 9 presents a polynucleotide sequence including the homo sapiens ribonucleotide M2 (RRM2) polynucleotide sequence (NM 001034), the porcine 2A polynucleotide sequence, and the homo sapiens ribonucleotide reductase Ml (RRMl) polynucleotide sequence (NM 001033.3).
  • the open reading frame encoding the RRM2 polypeptide is the first capitalized region of the sequence (medium shaded)
  • the porcine 2A sequence is the darkly shaded capitalized region of the sequence
  • the open reading frame encoding the RRM1 polypeptide is the second capitalized region of the sequence (lightly shaded).
  • Figure 10 presents a schematic diagram of four gene cassettes of the present invention.
  • ITR indicates inverted terminal repeat; Rl indicates RRM1; R2 indicates RRM2; and E1E2 TnT indicates the cTnT promoter.
  • the black box indicates the 2A peptide sequence.
  • Figure 11 is a diagram of the experimental design and flow of the study described in Example 2. MI was induced in 28 Yucatan mini-pigs by balloon occlusion of mid-left anterior descending artery. Two weeks later (day 0), 17 surviving pigs received antegrade coronary infusion of dilution buffer (sham), high (1 x 10 13 VRG), medium (5 x
  • Figures 12A-12C provide graphs showing left ventricular ejection fraction
  • FIG. 12A shows the mean LVEF for each dosing group at study time points. *p ⁇ 0.05, **p ⁇ 0.01 for differences vs sham, mixed effects regression model.
  • Figure 12B shows individual and mean changes in LVEF from day 0 (DO) to day 56 (D56).
  • Figure 12C shows mean LVEF for animals with high severity HF (defined as animals in the pooled treated group with LVEF below the median at Day 0 prior to treatment), low severity HF (similarly defined but with LVEF above the median) and sham treatment, ***p
  • Figures 13A-D provide graphs showing left ventricular ejection fraction
  • FIG. 13A shows individual and mean LVEF at study time points for each group.
  • Figure 13B shows mean change ( ⁇ SEM) in LVEF from
  • Figure 13C shows individual and mean LVFS.
  • Figure 13D shows mean change in LVFS from Day 0 to Day 56.
  • Figures 14A-D provide graphs showing left ventricular end-systolic
  • Figure 14A shows individual and mean LVESD at study time points for each group.
  • Figure 14B shows mean change ( ⁇ SEM) in LVESD from Day 0 to Day 56.
  • Figure 14C shows individual and mean LVEDD.
  • Figure 14D shows mean change in LVEDD from Day 0 to Day 56.
  • Figures 15A-F provide graphs showing hemodynamic measurements.
  • Figure 15A shows individual and mean +dP/dt at study time points for each group.
  • Figure 15B shows mean change ( ⁇ SEM) in +dP/dt from Day 0 to Day 56. *p ⁇ 0.05.
  • Figure 15C shows individual and mean -dP/dt.
  • Figure 15D shows mean change in -dP/dt from Day 0 to Day 56
  • Figure 15E shows individual and mean change in left ventricular end-diastolic pressure (LVEDP) at study time points for each group.
  • Figure 15F shows mean change in LVEDP from Day 0 to Day 56.
  • Figure 16 shows the sequence of the BBR12 expression cassette used in Example 2.
  • the sequence includes the cTnT promoter sequence (which is upstream of the RRMl gene), the codon optimized human RRMl gene, the porcine 2A sequence, the codon optimized human RRM2 gene, and the synthetic poly A sequence.
  • a referenced numeric indication means the referenced numeric indication plus or minus up to 10% of that referenced numeric indication.
  • “about 100” means from 90 to 110.
  • antagonist refers to an agent that inhibits, either partially or fully, the activity or production of a target molecule.
  • the term “antagonist,” as applied selectively herein, means an agent capable of decreasing levels of gene expression, mRNA levels, protein levels or protein activity of the target molecule.
  • Illustrative forms of antagonists include, for example, proteins, polypeptides, peptides (such as cyclic peptides), antibodies or antibody fragments, peptide mimetics, nucleic acid molecules, antisense molecules, ribozymes, aptamers, RNAi molecules, and small organic molecules.
  • Illustrative non- limiting mechanisms of antagonist inhibition include repression of ligand synthesis and/or stability (e.g., using, antisense, ribozymes or RNAi compositions targeting the ligand gene/nucleic acid), blocking of binding of the ligand to its cognate receptor (e.g., using anti-ligand aptamers, antibodies or a soluble, decoy cognate receptor or fragment thereof), repression of receptor synthesis and/or stability (e.g., using, antisense, ribozymes or RNAi compositions targeting the ligand receptor gene/nucleic acid), blocking of the binding of the receptor to its cognate receptor (e.g., using receptor antibodies) and blocking of the activation of the receptor by its cognate ligand (e.g., using receptor tyrosine kinase inhibitors).
  • the antagonist may directly or indirectly inhibit the target molecule.
  • compositions can comprise an active agent and a carrier, inert or active.
  • the compositions are useful for diagnostic or therapeutic use in vitro, in vivo or ex vivo.
  • the compositions are sterile, substantially free of endotoxins or non-toxic to recipients at the dosage or concentration employed.
  • nucleic acid refers to a polynucleotide such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • analogs of RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides, expressed sequence tags (ESTs), chromosomes, cDNAs, mRNAs, and rRNAs.
  • ESTs expressed sequence tags
  • mammal includes human and non-human mammals, such as, e.g., monkey, cow, hog, sheep, horse, dog, and cat.
  • protein and polypeptide are used interchangeably and in their broadest sense refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics.
  • the subunits may be linked by peptide bonds.
  • the subunit may be linked by other bonds, e.g., ester, ether, etc.
  • bonds e.g., ester, ether, etc.
  • amino acid refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
  • “Pharmaceutically acceptable salts” include but are not limited to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, lsomcotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dimtrobenzoate, hydroxybenzoate,
  • pharmaceutically acceptable salt also refers to a salt of an antagonist of the present invention having an acidic functional group, such as a carboxylic acid functional group, and a base.
  • Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium, hydroxides of alkaline earth metal such as calcium and magnesium, hydroxides of other metals, such as aluminum and zinc, ammonia, and organic amines, such as unsubstituted or hydroxy- substituted mono-, di-, or tri-alkylamines, dicyclohexylamine, tnbutyl amine, pyridine, N- methyl, N-ethylamine, diethylamine, tnethylamine, mono-, bis-, or tns-(2-OH-lower alkylamines), such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert- butylamine, or tes-(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)-amines, such as N,N-dimethyl-N
  • an effective amount when used in connection with a composition of the invention for improving cardiac function or treating or preventing a cardiac disease or disorder, refers to an amount that is useful for the recited purpose.
  • the “effective amount” can vary depending upon the mode of administration, specific locus of the ophthalmological disease, the age, body weight, and general health of the mammal.
  • a “variant" of polypeptide X refers to a polypeptide having the amino acid sequence of polypeptide X in which is altered in one or more amino acid residues.
  • the variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant can have "nonconservative" changes (e.g., replacement of glycine with tryptophan).
  • Analogous minor variations may also include amino acid deletions or insertions, or both.
  • Guidance in determining which amino acid residues may be substituted, inserted, or deleted without eliminating biological or immunological activity can be determined using computer programs well known in the art, for example, LASERGENE software (DNASTAR).
  • variant when used in the context of a polynucleotide sequence, can encompass a polynucleotide sequence related to that of gene or the coding sequence thereof. This definition also includes, for example, “allelic,” “splice,” “species,” or
  • polymorphic variants can have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternative splicing of exons during mRNA processing.
  • the corresponding polypeptide can possess additional functional domains or an absence of domains.
  • Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity relative to each other.
  • a polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species.
  • the term "excipient” refers to a typically inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent for drugs and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, alanine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.).
  • proteins e.g., serum albumin, etc.
  • amino acids e.g., aspartic acid, glutamic
  • the excipients impart a beneficial physical property to the composition, such as increased protein stability, increased protein solubility and decreased viscosity.
  • buffer denotes a pharmaceutically acceptable excipient, which stabilizes the pH of a pharmaceutical preparation.
  • Suitable buffers are well known in the art and can be found in the literature.
  • Pharmaceutically acceptable buffers comprise but are not limited to histidine-buffers, citrate-buffers, succinate-buffers and phosphate -buffers.
  • the pH can be adjusted at a value from about 4.5 to about 7.0 or alternatively from about 5.5 to about 6.5 or
  • Suitable buffers include, without limitation, histidine buffer, 2-morpholinoethanesulfonic acid (MES), cacodylate, phosphate, acetate, succinate, and citrate.
  • MES 2-morpholinoethanesulfonic acid
  • a "preservative” is a natural or synthetic chemical that is added to products such as foods, pharmaceutical compositions, paints, biological samples, wood, etc. to prevent decomposition by microbial growth or by undesirable chemical changes.
  • Preservative additives can be used alone or in conjunction with other methods of preservation.
  • Preservatives may be antimicrobial preservatives, which inhibit the growth of bacteria and fungi, or antioxidants such as oxygen absorbers, which inhibit the oxidation of constituents.
  • antimicrobial preservatives include, benzalkonium chloride, benzoic acid, cholorohexidine, glycerin, phenol, potassium sorbate, thimerosal, sulfites (sulfur dioxide, sodium bisulfite, potassium hydrogen sulfite, etc.) and disodium EDTA.
  • Other preservatives include those commonly used in patenteral protein compositions such as benzyl alcohol, phenol, m-cresol, chlorobutanol or methylparaben.
  • Cardiac function in the context of the present invention, refers to the function of the heart as reflected by one or more measurable parameters, e.g., myocardial contractility, change in fractional shortening, maximal rate of shortening, myocardial relaxation, maximal rate of myocardial relaxation, relaxation time, effects on Ca 2+ transients, heart rate, end- systolic pressure, end diastolic pressure, end-systolic volume, end-diastolic volume, cardiac output, stroke work, stroke volume, cardiac index, etc. Said parameters may be determined by hemodynamic and/or echocardiographic measurements and/or any other methods known to those of skill in the art. Whether an improvement in cardiac function has taken place is determined on an individual basis.
  • an improvement in myocardial contractility signifies an increase in myocardial contractility.
  • an improvement in myocardial relaxation signifies an increase in myocardial relaxation, e.g., as reflected by increased rate of relaxation.
  • Myocardial contractility used interchangeably herein with the term “inotropy,” refers to the strength of a ventricular contraction during which blood is ejected from the heart. Improvement of myocardial contractility is determined on an individual basis using one or more measurable inotropy parameters. For an individual or patient in need of a positive inotropic effect, an improvement in myocardial contractility entails an increase in myocardial contractility as measured using echocardiography. For an individual or patient in need of a negative inotropic effect, an improvement in myocardial contractility entails a decrease in myocardial contractility. Examples of measurable inotropy parameters include OP/Ot, percent thickening, percent shortening, fractional shortening, and ejection fraction. "Myocardial relaxation,” used interchangeably herein with the term
  • lusitropy refers to the ability of the heart to relax following excitation contraction coupling. Improvement of myocardial relaxation is determined on an individual basis using one or more measurable lusitropy parameters. For an individual or patient in need of a positive lusitropic effect, an improvement in myocardial relaxation entails an increase in the rate of relaxation. For an individual or patient in need of a negative lusitropic effect, an improvement in myocardial contractility entails a decrease in the rate of relaxation.
  • measurable lusitropy parameters include a rate of pressure decline (-dP/dtmin) during diastole as determined from pressure sensor measurements, a rate of force/strain decline (-dF/dt) as determined from force sensor measurements, and isovolumic relaxation time (IVRT) as determined from cardiac impedance measurements or from detected heart sounds.
  • the measuring device may be programmed to compare the lusitropy parameter to a specified threshold in order to determine if diastolic relaxation is impaired and operate the neural stimulation circuitry to deliver sympathetic stimulation to the heart in response to thereto.
  • “Grafting” as used herein refers to the placement of cells into a subject.
  • Cells can be autogeneic (i.e., from the subject to be treated), isogeneic (i.e., a genetically identical but different subject, e.g., from an identical twin), allogeneic (i.e., from a non- genetically identical member of the same species) and/or xenogeneic (i.e., from a member of a different species).
  • Cells may be obtained from a donor (either living or cadaveric) or derived from an established cell line.
  • To obtain cells from a donor e.g., a potential recipient of a bioscaffold graft
  • standard biopsy techniques known in the art may be employed. Representative techniques are described, for example, in U.S. Pat. No.
  • treatment refers to any reduction in the severity of symptoms or amount of amyloid aggregation, or improvement in cognitive function.
  • treat and “prevent” are not intended to be absolute terms.
  • Treatment can refer to any delay in onset, amelioration of symptoms, improvement in patient survival, increase in survival time or rate, etc. The effect of treatment can be compared to an individual or pool of individuals not receiving the treatment.
  • cardiomyocyte is meant a cardiac contractile cell, which is a cardiac muscle cell.
  • the cardiomyocyte cell may be isolated and cultured in vitro or be part of the myocardium of a host.
  • ES cells refers to cells derived from the inner cell mass of blastocysts or morulae that have been serially passaged as cell lines.
  • the ES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with homozygosity in the MHC region.
  • human embryonic stem cells hES cells
  • hES cells refers to cells derived from the inner cell mass of human blastocysts or morulae that have been serially passaged as cell lines.
  • the hES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with homozygosity in the HLA region.
  • induced pluripotent stem cells or "iPSCs, as used herein, refers to a pluripotent stem cell derived from a postnatal somatic cell by any combination of forced expression of reprogramming factors alone or in combination with one or more reprogramming agents.
  • mesenchymal stem cell refers to a cell capable of giving rise to differentiated cells in multiple mesenchymal lineages, specifically to osteoblasts, adipocytes, myoblasts and chondroblasts.
  • mesenchymal stem cells also have one or more of the following properties: an ability to undergo asynchronous, or symmetric replication, that is where the two daughter cells after division can have different phenotypes; extensive self-renewal capacity; and clonal regeneration of the tissue in which they exist, for example, the non-hematopoietic cells of bone marrow.
  • patient refers to any mammalian subject for whom diagnosis or therapy is desired, e.g. primate species, such as humans and chimpanzees; cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.
  • species e.g. primate species, such as humans and chimpanzees; cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.
  • the species is human.
  • subjects having a myocardial associated disorder that is amenable to treatment (e.g., to mitigate symptoms associated with the disorder) by the introduction of a vector, or by the grafting of cells (e.g.
  • ribonucleotide reductase i.e., Rl, R2
  • the hosts are humans.
  • Donor cells in the context of the present invention, refer to cells derived from a mammalian origin, e.g., primate species, such as humans and chimpanzees; cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, etc., which have the capacity to form or establish gap junctions with cardiomyocytes of a host when grafted to the host
  • donor cells include, without limitation, fibroblasts and cardiomyocytes.
  • Other examples of donor cells include, but are not limited to, endothelial cells, smooth muscle cells, nerve cells, and Schwann cells.
  • the donor cells can be autogeneic (i.e., from the host to be treated), isogeneic (i.e., a genetically identical but different subject, e.g., from an identical twin), allogeneic (i.e., from a non-genetically identical member of the same species) and/or xenogeneic (i.e., from a member of a different species).
  • Cells may be obtained from a donor (either living or cadaveric) or derived from an established cell line. To obtain cells from a donor, standard biopsy techniques known in the art may be employed.
  • a donor cell is any cell type capable of synthesizing and delivering dATP within the heart.
  • expression vector refers to a compound (e.g., polynucleotide) and/or composition that transduces, transforms, or infects a host microorganism or cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell.
  • An "expression vector” contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host microorganism or cell.
  • the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host microorganism or cell, such as a virus, liposome, protein coating, or the like.
  • the expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector may be one that can be transferred into a host microorganism or cell and replicated therein. Some expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art. In some embodiments, the expression vector is a viral vector, e.g. an adeno-associated viral vector.
  • a viral vector encompasses both wild-type and recombinant viral vectors.
  • a viral vector is an adenovirus vector, a retroviral vector, an adeno-associated virus vector, a lentiviral vector, a retrovirus, a poliovirus vector, a pox virus vector, a herpes simplex virus vector, a hemaglugglutinatin virus of Japan-liposome (HJV) complex, a Moloney murine leukemia virus, an HIV-virus, or another viral vector, or is based on one of these viruses.
  • HJV Japan-liposome
  • adeno-associated viral vector encompasses both wild-type and recombinant adeno-associated viral vectors, which are nonpathogenic, nonenveloped, DNA virus containing a linear single-stranded genome of about 4.6-4.8 kb that requires coinfection with a helper virus for viral replication.
  • Examples of adeno- associated viral vectors useful in the present invention include, without limitation, an AAV6, AAV2, rAAV2/l, rAAV2/2, rAAV2/3, rAAV2/4, rAAV2/5, rAAV2/6, rAAV2/7 rAAV2/8, rAAV2/9, rAAV2/l 0, AAV1, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV1, AAV12, AAV rhlO, AAV rh39, AAVrh43, rAAVM41, dsAAV, self- complementary AAV (scAAV), etc., and hybrids of any of these different AAVs.
  • gene therapy vectors based on AAV6 can be generated by cloning a DNA expression cassette (e.g., a promoter/enhancer regulating gene expression linked to a complementary DNA (cDNA) sequence encoding a therapeutic protein or RNA, followed by a transcription terminating signal such as a poly-adenylation sequence; in some cases, the cDNA and promoter are separated by an intron) in between two copies of an adeno- associated virus (AAV) inverted terminal repeat (ITR).
  • AAV adeno- associated virus
  • ITR-Expression cassette -ITR genome is referred to as a recombinant AAV (rAAV) genome.
  • the AAV ITR sequences provide a packaging signal for encapsidation into a recombinant AAV particle.
  • the ITR also provides an origin of replication for producing multiple copies of the recombinant AAV genome. DNA containing this recombinant genome can then be co- transfected into a packaging cell line expressing various adenoviral helper proteins
  • AAV does not replicate autonomously, but rather requires the co-infection of a second virus, such as adenovirus, to supply critical helper functions in trans.
  • the AAV ITRs can be derived from a number of different serotypes of wild type AAVs. For example, commonly used ITRs are from AAV serotype 2 (AAV2 ITRs).
  • AAV6 vectors rAAV6
  • the Cap gene from AAV serotype 6 may be used in the co-transfection step.
  • the "AAV6" is a recombinant adeno-associated viral vector carrying AAV2 ITRs flanking an expression cassette, and encapsidated by the AAV6 capsid proteins.
  • promoter is meant a minimal sequence sufficient to direct transcription in a recombinant cell.
  • Promoter is also meant to encompass those elements sufficient for promoter-dependent gene expression controllable for cell-type specific, tissue-specific or inducible by external signals or agents; such elements may be located in the 5 ' or 3' regions of the native gene (e.g., enhancer elements). Examples of promoters include, without limitation, the CK7 promoter, and CMV promoter.
  • cardiac-specific promoter in the context of the present invention, refers to a wild-type or recombinant promoter that selectively drives expression of a gene under its control in cardiac cells.
  • cardiac-specific promoters include the a-MHC5.5 promoter, the a-MHC 86 promoter, the human cardiac actin promoter, a cTnC promoter, a cTnT promoter, and the cTnT455 promoter described herein.
  • operably linked or “operatively linked” is meant that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
  • Percent sequence identity refers to the percentage of residues that are identical in the two sequences when the sequences are optimally aligned. Thus, 80% amino acid sequence identity means that 80% of the amino acids in two optimally aligned polypeptide sequences are identical.
  • a "percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • the identical nucleic acid base e.g., A, T, C, G, I
  • the identical amino acid residue e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg,
  • sequence similarity or sequence identity between sequences can be performed as follows.
  • the sequences can be aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%>, 60%>, and even more preferably at least 70%>, 80%>, 90%>, 100% of the length of the reference sequence.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the percent identity between two amino acid sequences is determined using the Needleman and Wunsch, (1970, J. Mol. Biol. 48: 444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package, using an NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • Another exemplary set of parameters includes a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • the percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller (1989, Cabios, 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the sequences described herein can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al, (1990, J. Mol. Biol, 215: 403-10).
  • Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25:3389-3402, 1997).
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • transformation By “transformation”, “transduction” or “trans fection” is meant a permanent or transient genetic change, preferably a permanent genetic change, induced in a cell following incorporation of new nucleic acid (e.g., DNA or RNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new nucleic acid into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element.
  • new nucleic acid e.g., DNA or RNA exogenous to the cell.
  • transformed cell By “transformed cell”, “transfected cell” or “transduced cell” is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding a protein of interest.
  • overexpressing can be a cumulative effect of protein expression from endogenous and recombinant genes or essentially protein expression from a recombinant gene.
  • Overexpression of Rl or R2 is meant to refer to the expression of the respective ribonucleotide reductase protein subunit within a particular cell which is above the expression level normally associated with a normal or wild-type cell at a particular stage of differentiation.
  • overexpression of a gene product is meant an increase in expression by a factor of at least about 2 fold, in other embodiments at least about 5 fold and yet in still other embodiments, at least about 10 fold.
  • codon-optimized is meant that a polynucleotide sequence is altered from its native sequence in order to enhance or optimize expression of its encoded protein, e.g., when a polynucleotide sequence derived from a human is being used to produce a protein in a recombinant organism, such as a bacterium.
  • Codon-optimization may effect one or more parameters of a polynucleotide sequence, such as, e.g., codon usage bias, GC content, CpG dinucleotide content, mRNA secondary content, cryptic splicing sites, premature polyA sites, internal chi sites and ribosomal binding sites, negative CpG islands, R A instability motif (ARE), repeat sequences (direct repeat, inverse repeat, and Dyad repeat), or restriction sites that may interfere with cloning.
  • codon usage bias e.g., codon usage bias, GC content, CpG dinucleotide content, mRNA secondary content, cryptic splicing sites, premature polyA sites, internal chi sites and ribosomal binding sites, negative CpG islands, R A instability motif (ARE), repeat sequences (direct repeat, inverse repeat, and Dyad repeat), or restriction sites that may interfere with cloning.
  • ARE R A instability motif
  • construct is meant a recombinant nucleic acid, generally recombinant
  • DNA that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.
  • polypeptide refers to an amino acid sequence of a recombinant or non-recombinant polypeptide having an amino acid sequence of i) a native polypeptide, ii) a biologically active fragment of an polypeptide, iii) biologically active polypeptide analogs of an polypeptide, or iv) a biologically active variant of an
  • Polypeptides useful in the invention can be obtained from any species, e.g., mammalian or non-mammalian (e.g., reptiles, amphibians, avian (e.g., chicken)), particularly mammalian, including human, rodenti (e.g., murine or rat), bovine, ovine, porcine, murine, or equine, preferably rat or human, from any source whether natural, synthetic, semi-synthetic or recombinant.
  • mammalian or non-mammalian e.g., reptiles, amphibians, avian (e.g., chicken)
  • rodenti e.g., murine or rat
  • bovine, ovine, porcine, murine, or equine preferably rat or human
  • Rl polypeptide refers to the amino acid sequences of isolated human Rl polypeptide obtained from a human, and is meant to include all naturally-occurring allelic variants, and is not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
  • a "variant" of a polypeptide is defined as an amino acid sequence that is altered by one or more amino acids (e.g., by deletion, addition, insertion and/or
  • substitution refers to nucleotide or amino acid residues added to an end of the molecule
  • insertion refers to nucleotide or amino acid residues between residues of a naturally- occurring molecule.
  • the variant can have "conservative” changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have "nonconservative” changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, added, inserted or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.
  • targeting agent refers to a compound that exhibits selectivity for a particular target organ, tissue, or cell-type.
  • a targeting agent is capable of directing a composition, with which it is operatively associated, to a particular target organ or tissue.
  • a targeting agent can be operatively associated with at least one cationic polymeric carrier and/or other agent.
  • myocardial infarction means a process by which ischemic disease results in a region of the myocardium being replaced by scar tissue.
  • ischemic heart disease means any disorder resulting from an imbalance between the myocardial need for oxygen and the adequacy of the oxygen supply. Most cases of ischemic heart disease result from narrowing of the coronary arteries, as occurs in atherosclerosis or other vascular disorders.
  • heart failure refers to impaired cardiac function.
  • heart failure renders the heart unable to maintain the normal blood output at rest or with exercise, or to maintain a normal cardiac output in the setting of normal cardiac filling pressure.
  • the "heart failure” is systolic heart failure, e.g., systolic heart failure with a depressed ejection fraction, in which the heart has a depressed ejection fraction.
  • a left ventricular ejection fraction of about 40% or less is one indication of heart failure.
  • the "heart failure” is diastolic heart failure, in which the ejection fraction may be normal or nearly normal.
  • Patients with heart failure may display well-known clinical symptoms and signs, such as tachypnea, pleural effusions, fatigue at rest or with exercise, contractile dysfunction, and edema.
  • Relative severity and disease progression are assessed using well known methods, such as physical examination, echocardiography, radionuclide imaging, invasive hemodynamic monitoring, magnetic resonance angiography, and exercise treadmill testing coupled with oxygen uptake studies.
  • cardiomyopathy refers to a a cardiovascular disorder.
  • the cardiomyopathy is selected from a primary
  • the cardiomyopathy may be selected from a genetic cardipoathology, a hypertrophic cardiomyopathy, an ischemic
  • cardiomyopathy a restrictive cardiomyopathy, and a dilated cardiomyopathy.
  • the cardiomyopathy may have resulted from: (a) post- myocardial infarction remodeling, (b) cardiac valve disease; (c) sustained cardiac afterload; (d) myocarditis; or (e) familial hypertrophic cardiomyopathy.
  • Cardiac Troponin C or "cTnC” refers to a polypeptide of the troponin complex having multiple calcium-binding sites.
  • cTnC refers to human cTnC (Entrez Ref: NP 003271), encoded by the TNNC1 gene (Entrez Ref: NM_003280.2), or conservative variants, splice variants, or tagged variants thereof.
  • RNR refers to a heterodimeric tetrameric polypeptide complex containing the RNR1 (also referred to herein as “Rl” or “Rml” or “RRMl”) and RNR2 (also referred to herein as “R2” or “Rm2” or “RRM2”) subunits.
  • the Rl subunit refers to the human ribonucleotide reductase Ml subunit ("hRRMl”; Entrez Ref: AAD37491.1), encoded by the RRM1 gene (Entrez Ref: AF107045.1) or conservative variants, splice variants, or tagged variants thereof.
  • the R2 subunit may refer to either the ribonucleotide reductase M2 subunit or the ribonucleotide reductase M2 B subunit.
  • R2 refers to the human ribonucleotide reductase M2 subunit ("hRRM2"; Entrez Ref:
  • R2 refers to the human ribonucleotide reductase M2 B subunit isoform 1 ("RRM2B"; Entrez Ref: NP 056528.2), encoded by the RRM2B gene (Entrez Ref: NM 015713.4); the human ribonucleotide reductase M2 B subunit isoform 2 (Entrez Ref: NP 001165948.1), encoded by the RRM2B gene (Entrez Ref: NM 001172477); or the human ribonucleotide reductase M2 B subunit isoform 3 (Entrez Ref: NPOOl 165949), encoded by the RRM2B gene (Entrez Ref: NM 001172478.1); or conservative variants, splice variants, or tagged variants thereof of any of the foregoing.
  • RRM2B the human ribonucleotide reductase M2 B subunit isoform 1
  • cTnC cardiac troponin C
  • NRC neonatal rat cardiomyocyte
  • ARC adult rat cardiomyocyte
  • GFP green fluorescent protein
  • RT50, RT90 time to 50% and 90% relaxation
  • RRMl or Rl ribonucleotide reductase subunit Ml
  • RRM2 or Rl ribonucleotide reductase subunit M2
  • Gene therapy is a new option for treatment of heart failure (HF).
  • HF heart failure
  • Several gene therapies have been developed to improve cardiac performance in HF models by targeting calcium and adrenergic signaling, including the overexpression of
  • SERCA2a sarcoplasmic/endoplasmic reticulum calcium ATPase
  • SR sarcoplasmic reticulum
  • 1"3 S100A which modifies SR calcium handling
  • 4 ' 5 ⁇ -adrenergic receptor kinase ( ⁇ -ARKct) which restores ⁇ -adrenergic receptor signaling
  • 6 ' 7 small ubiquitin-related modifier 1 (SUMO-1) which regulates SERCA2a through post transcriptional modification
  • 8 and an inhibitor of protein phosphatase 1 (I-lc) which regulates de-phosphorylation of phospholamban.
  • RNR Ribonucleotide Reductase
  • dATP 2-deoxy-adenosine triphosphate
  • Overexpression of RNR represents an entirely novel gene therapy concept for HF, where the gene product does not, in itself, produce the therapeutic effect.
  • RNR is an essential enzyme that catalyzes the de novo synthesis of deoxyribonucleotide triphosphates (dNTPs), used principally for DNA synthesis and repair. The enzyme is a heterotetramer of two subunits, Rml and Rm2. 13
  • the present invention provides an advantageous gene therapy vectors to deliver human cDNA for Rml and Rm2 from single transgene constructs.
  • one construct designated BB-R12, causes the up-regulation of expression of Rml and Rm2 exclusively in cardiomyocytes under the control of the cardiac troponin T (cTnT) promoter. Transcription occurs via a single mR A with the
  • the composition, e.g., vectors, and methods of the present invention provide advantages for improving cardiac function in a subject in need thereof, e.g., a subject diagnosed with cardiomyopathy or heart failure, e.g., systolic heart failure or diastolic heart failure.
  • the compositions, e.g., vectors, and methods of the present invention provide for improved left ventricle ejection fraction, improved left ventricle fractional shortening, improved left ventricle end-systolic dimension, improved left-ventricle end-diastolic pressure, improved dP/dT and/or improved -dP/dT in treated cells, tissues or subjects.
  • the compositions, e.g., vectors, and methods of the present invention cause no substantial or no significant humoral or cellular immune response in a treated subject.
  • the present invention provides expression cassettes encoding a Rl protein (e.g., a RRMl polypeptide) and/or a R2 protein (e.g., a RRM2 polypeptide).
  • these expression cassettes are provided to a subject in need thereof, e.g., to increase the amount of ribonucleotide reductase (RR) complex in a cardiac tissue of the subject, thus, enhance cardiac function in the subject.
  • RR ribonucleotide reductase
  • the RRMl and/or RRM2 protein may alternatively be a different Rl or R2 protein, respectively, or variants thereof.
  • an expression cassette of the present invention produces both a RRMl protein and a RRM2 protein.
  • the gene cassettes comprise a polynucleotide sequence comprising in the 5' to 3' direction: (a) a promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide; and (c) a second sequence encoding a RRM1 polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRM1 polypeptide, the second sequence of (c) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2
  • the second sequence of (c) encodes a RRM1 polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (c).
  • the first sequence of (b) encodes a RRM1 polypeptide
  • the second sequence of (c) encodes a RRM2 polypeptide
  • the first sequence of (b) encodes a RRM2 polypeptide
  • the second sequence of (c) encodes a RRMl polypeptide.
  • the polynucleotide sequence also comprises an internal ribosome entry site (IRES) sequence or a sequence encoding a 2A peptide between the first sequence and the second sequence.
  • IRES sequences and 2 A peptides are typically used to enhance expression of multiple proteins from the same vector.
  • IRES sequences are known and available in the art and may be used in the expression cassettes, including, e.g., the encephalomyocarditis virus IRES.
  • 2A peptides are known and available in the art and may be used, including e.g., the foot and mouth disease virus (FMDV) 2A peptide, the equine rhinitis A virus 2A peptide, the Thosea asigna virus 2A peptide, and the porcine teschovirus-1 2A peptide.
  • FMDV foot and mouth disease virus
  • 2A peptides are used by several viruses to generate two proteins from one transcript by ribosome-skipping, such that a normal peptide bond is impaired at the 2A peptide sequence, resulting in two discontinuous proteins being produced from one translation event.
  • a 2A peptide is encoded by the following sequence: 5'-
  • a 2A peptide is encoded by a variant having at least 90%, at least 95%, at least 98% or at least 9% identity to this sequence.
  • the 2A peptide is encoded by the indicated sequence shown in Figure 16, or a variant thereof having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the indicated sequence of Figure 16.
  • an expression cassette of the present invention produces either a RRM1 protein or a RRM2 protein (but not both).
  • the gene cassettes comprise a polynucleotide sequence comprising in the 5 ' to 3' direction: (a) a promoter sequence; and (b) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide or a ribonucleotide reductase subunit M2
  • (RRM2) polypeptide wherein the promoter sequence is operably linked to the sequence of (b).
  • the sequence of (b) encodes a RRM1 polypeptide.
  • the sequence of (b) encodes a RRM2 polypeptide.
  • expression cassettes of the present invention comprise a cardiac-specific promoter, such as a cardiac troponin T (cTnT) promoter or a cardiac troponin C (cTnC) promoter.
  • the cTnT promoter has been characterized as having a minimal promoter about 99 nucleotides upstream of the transcription initiation site, including two tandem copies of a conserved hexanucleotide sequence (5'-CATTCCT-3') termed the "M-CAT motif and an additional about 48 nucleotide region approximately 100 nucleotides upstream from the minimal promoter termed the "cardiac element.”
  • a third regulatory region located about 500 to 268 nucleotides upstream of the transcription initiation site enhances activity of the cTnT promoter by three- to five-fold.
  • the cardiac-specific promoter is a cTnT promoter and includes the El and E2 enhancer sequences.
  • the cTnT promoter is the cTnT455 promoter.
  • the promoter is located upstream or 5 ' to the polynucleotide sequences encoding the RRM1 and/or RRM2 polypeptides.
  • the promoter is operably linked to the polynucleotide sequences encoding the RRMl and/or RRM2 polypeptides, such that it drives expression of the polypeptides, e.g., in human cardiac cells, such as cardiomyocytes.
  • the nucleic acid encoding Rl and/or R2 subunits of the RR complex further comprises a cardiac- specific promoter operably linked to the nucleotide sequence encoding the Rl and/or R2 subunits.
  • the cTnT promoter comprises or consists of the cTnT sequence shown in Figure 16, or has at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity to the cTnT promoter sequence shown in Figure 16 or SEQ ID NO:8.
  • the cTNT promoter comprises or consists of the region of the cTnT sequence shown in Figure 16 or SEQ ID NO: 8 corresponding to about nucleotides 1-585, nucleotides 1-645, nucleotides 16-145, nucleotides 150-311, 478-582, or has at least 85%, at least 90%>, at least 95%, at least 98%>, or at least 99% sequence identity to the any of these regions of the cTnT promoter sequence shown in Figure 16 or SEQ ID NO:8.
  • the expression cassette further comprises a polyadenylation sequence, e.g., a polyA tail.
  • the polyadenylation sequence is located at the 3' end of the sequence encoding the RRMl polypeptide and/or the RRM2 polypeptide.
  • the polyA sequence is the indicated polyA sequence shown in Figure 16, or is a variant having at least 85%, at least 90%, at least 95%), at least 98%, or at least 99% sequence identity to the polyA sequence shown in Figure 16.
  • the RRMl polypeptide is a human RRMl polypeptide or a variant thereof.
  • the RRM2 polypeptide is a human RRM2 polypeptide or a variant thereof.
  • the sequence encoding the RRMl polypeptide and/or the RRM2 polypeptide is codon-optimized.
  • the RRMl polypeptide and/or RRM2 polypeptide is codon-optimized to enhance or increase expression in a human cell, e.g., a human cardiac cell, such as a cardiomyocyte.
  • the RRMl polypeptide comprises, consists essentially of, or consists of the polypeptide sequence set forth in Entrez Ref:
  • the RRM2 polypeptide comprises, consists essentially of, or consists of the polypeptide sequence set forth in Entrez Ref: AAK51163, Entrez Ref: NP 056528.2, Entrez Ref: NP 001165948.1, or Entrez Ref:
  • the RRM1 polypeptide is encoded by a polynucleotide that comprises, consists essentially of, or consists of the polynucleotide sequence set forth in Entrez Ref: AF 107045.1 or a variant thereof having at least 90%>, at least 95%, at least 98%, or at least 99% sequence identity.
  • the RRM2 polypeptide is encoded by a polynucleotide that comprises, consists essentially of, or consists of the polynucleotide sequence set forth in Entrez Ref: AY032750.1, Entrez Ref: NM_015713.4, Entrez Ref:NM_0011724779, or Entrez Ref: NM_001172478.1, or a variant thereof having at least 90%, at least 95%, at least 98%), or at least 99% sequence identity to any one of these sequences.
  • a polynucleotide encoding an RRMl polypeptide comprises, consists essentially of, or consists of the polynucleotide sequence set forth in SEQ ID NO: 1 or Figure 4 (or the shaded region thereof), or SEQ ID NO:5 or Figure 8 (as identified therein), SEQ ID NO:6 or Figure 9 (as identified therein), SEQ ID NO: 8 or Figure 16 (as identified therein), or a variant thereof having at least 90%, at least 95%), at least 98%, or at least 99% sequence identity to any one of these sequences.
  • a polynucleotide encoding an RRM2 polypeptide comprises, consists essentially of, or consists of the polynucleotide sequence set forth in SEQ ID NO:2 or Figure 5 (or the shaded region thereof), SEQ ID NO:5 or Figure 8 (as identified therein), SEQ ID NO: 6 or Figure 9 (as identified therein), or SEQ ID NO: 8 or Figure 16 (as identified thereof), or a variant thereof having at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity to any one of these sequences.
  • a codon-optimized sequence encoding an RRMl polypeptide comprises, consists essentially of, or consists of the sequence set forth in Figure 6 or SEQ ID NO: 3.
  • a codon-optimized sequence encoding an RRM2 polypeptide comprises, consists essentially of, or consists of the sequence set forth in Figure 7 or SEQ ID NO:4.
  • a gene cassette is flanked by an inverted terminal repeat (ITR) sequence.
  • the gene cassette is flanked by a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence, and a second ITR sequence 3' of the a second sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
  • a gene cassette flanked by ITRs has any of the various structures schematically illustrated in Figure 10.
  • the ITRs are AAV2 ITR sequences.
  • an expression cassette comprises, consists of, or consists essentially of, the sequence provided in SEQ ID NO:8.
  • the present invention further comprises isolated polynucleotides comprising any of the gene cassettes described herein, with or without flanking ITR sequences.
  • the polynucleotides may be single-stranded.
  • the polynucleotides are double-stranded, e.g., they further comprise a complementary strand.
  • the polynucleotides are RNA or DNA.
  • the present invention includes a polynucleotide comprising, consisting essentially of, or consisting of the sequence set forth in Figure 8 or Figure 9.
  • the polynucleotide consists of, or consists essentially of, the sequence provided in SEQ ID NO:8.
  • the present invention also includes vectors, e.g., expression vectors comprising one or more of the gene cassettes described herein, with or without flanking ITR sequences.
  • the vector comprises a transposon, a plasmid, or a viral vector.
  • the present invention includes a vector comprising, consisting essentially of, or consisting of the sequence set forth in Figure 8 or Figure 9.
  • the polynucleotide consists of, or consists essentially of, the sequence provided in SEQ ID NO :8.
  • Suitable viral delivery systems include, but are not limited to, adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, herpes simplex virus, lentivirus, poxvirus, hemagglutinatin virus of Japan-liposome (HVJ) complex, Moloney murine leukemia virus, and HIV-based virus.
  • Viral vectors may be engineered to be optimized for use with the compositions and methods of the disclosure.
  • viral vectors derived from adenovirus (Ad) or adeno-associated virus (AAV) may be used. Both human and non-human viral vectors can be used and the recombinant viral vector can be altered such that it may be replication-defective in humans.
  • hybrid viral vectors may be used to deliver a nucleic acid to a target cell or tissue.
  • Standard techniques for the construction of hybrid vectors are well-known to those skilled in the art. Such techniques can be found, for example, in Sambrook, et al., In Molecular Cloning: A laboratory manual. Cold Spring Harbor, N. Y. or any number of laboratory manuals that discuss recombinant DNA technology.
  • Double-stranded AAV genomes in adenoviral capsids containing a combination of AAV and adenoviral ITRs may be used to transduce cells.
  • an AAV vector may be placed into a "gutless", "helper- dependent” or "high-capacity" adenoviral vector.
  • Retroviral genomes contained within an adenovirus may integrate within the target cell genome and effect stable gene expression. Replication-defective recombinant adenoviral vectors can be produced in accordance with known techniques.
  • retroviral vectors examples include Moloney murine leukemia viruses and HIV -based viruses. Retroviruses, such as C-type retroviruses and lentiviruses, may also be used in the disclosure. For example, retroviral vectors may be based on murine leukemia virus (MLV). MLV-based vectors may contain up to 8 kb of heterologous (therapeutic) DNA in place of the viral genes. Additional retroviral vectors may be used including but not limited to replication-defective lentivirus-based vectors, including human
  • Lentiviral vectors may be advantageous in that they are capable of infecting both actively dividing and non-dividing cells. They may also be highly efficient at transducing human epithelial cells.
  • HIV-based viral vector may be used, e.g., wherein the HIV- based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus.
  • DNA viral vectors may be used. These vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector.
  • pox vectors such as orthopox or avipox vectors
  • herpesvirus vectors such as a herpes simplex I virus (HSV) vector.
  • HSV herpes simplex I virus
  • HSV herpes simplex virus
  • IE immediate early genes
  • Recombinant HSV vectors can incorporate approximately 30 kb of heterologous nucleic acid.
  • Lentiviral vectors for use in the disclosure may be derived from human and non-human (including SIV) lentiviruses.
  • lentiviral vectors include nucleic acid sequences required for vector propagation as well as a tissue-specific promoter operably linked to an anti-VEGF protein gene.
  • Nucleic acid sequences may include the viral LTRs, a primer binding site, a polypurine tract, att sites, and an encapsidation site.
  • a lentiviral vector may be packaged into any suitable lentiviral capsid. The substitution of one particle protein with another from a different virus is referred to as "pseudotyping".
  • the vector capsid may contain viral envelope proteins from other viruses, including murine leukemia virus (MLV) or vesicular stomatitis virus (VSV).
  • MMV murine leukemia virus
  • VSV vesicular stomatitis virus
  • MMV murine leukemia virus
  • VSV G-protein yields a high vector titer and results in greater stability of the vector virus particles.
  • Alphavirus-based vectors such as those made from semliki forest virus
  • SSV Sindbis virus
  • SI Sindbis virus
  • Recombinant, replication-defective alphavirus vectors may be advantageous because they are capable of high-level heterologous (therapeutic) gene expression, and can infect a wide target cell range.
  • Alphavirus replicons may be targeted to specific cell types by displaying on their virion surface a functional heterologous ligand or binding domain that would allow selective binding to target cells expressing a cognate binding partner.
  • Alphavirus replicons may establish latency, and therefore long-term heterologous nucleic acid expression in a target cell. The replicons may also exhibit transient heterologous nucleic acid expression in the target cell.
  • the viral vector is an adenovirus vector, a retroviral vector, an adeno-associated virus vector, a lentiviral vector, a retrovirus, a poliovirus vector, a pox virus vector, a herpes simplex virus vector, a hemaglugglutinatin virus of Japan-liposome (HJV) complex, a Moloney murine leukemia virus, an HIV-virus, or another viral vector, or is based on one of these viruses.
  • HJV Japan-liposome
  • the vector is an AAV vector, e.g., AAV6, AAV2, rAAV2/l, rAAV2/2, rAAV2/3, rAAV2/4, rAAV2/5, rAAV2/6, rAAV2/7 rAAV2/8, rAAV2/9, rAAV2/l 0, AAV1, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV1, AAV 12, AAV rhlO, AAV rh39, AAVrh43, rAAVM41, a dsAAV, a self-complementary AAV (scAAV), etc., and hybrids of any of these different AAVs.
  • a viral vector further comprises a CMV promoter operably linked to the sequence encoding the R M1 polypeptide and/or RRM2 polypeptide.
  • the viral vector of the disclosure may be measured as pfu (plaque forming units). In some cases, the pfu of recombinant virus, or viral vector of the compositions and methods of the disclosure may be about 10 8 to about 5xl0 10 pfu.
  • recombinant viruses of this disclosure are about, at least about, or at most about lxlO 8 , 2xl0 8 , 3xl0 8 , 4xl0 8 , 5xl0 8 , 6xl0 8 , 7xl0 8 , 8xl0 8 , 9xl0 8 , lxlO 9 , 2xl0 9 , 3xl0 9 , 4xl0 9 , 5xl0 9 , 6xl0 9 , 7 xlO 9 , 8 xlO 9 , 9 xlO 9 , lxlO 10 , 2 xlO 10 , 3 xlO 10 , 4 xlO 10 , and 5 xlO 10 pfu.
  • the viral vector of the disclosure may be measured as vector genomes.
  • recombinant viruses of this disclosure are lxlO 10 to 3xl0 12 vector genomes.
  • recombinant viruses of this disclosure are lxlO 9 to 3xl0 13 vector genomes.
  • recombinant viruses of this disclosure are 1x108 to 3xl0 14 vector genomes.
  • recombinant viruses of the disclosure are about, at least about, or at most about 1x101, lxlO 2 , 1x103, 1x104, lxlO 5 , 1x106, lxlO 7 , lxlO 8 , 1x109, lxlO 10 , lxlO 11 , lxlO 12 , lxlO ⁇ , lxlO 14 , lxlO 15 , lxlO 16 , 1x10 ⁇ , and lxlO 18 vector genomes.
  • recombinant viruses of this disclosure are lxl0 8 to 3xl0 14 vector genomes.
  • the viral vector of the disclosure may be measured using multiplicity of infection (MOI).
  • MOI may refer to the ratio, or multiple of vector or viral genomes to the cells to which the nucleic may be delivered.
  • the MOI may be lxlO 6 .
  • the MOI may be Ixl0 5 -lxl0 7 .
  • the MOI may be Ixl0 4 -lxl0 8 .
  • recombinant viruses of the disclosure are about, at least about, or at most about lxlO 1 , lxlO 2 , lxlO 3 , lxlO 4 , lxlO 5 , lxlO 6 , lxlO 7 , lxlO 8 , lxlO 9 , lxl 010 , 1x1011, 1x10 ⁇ , lxlO 13 , lxlO 14 , lxlO 15 , lxlO 16 , 1x10 ⁇ , and lxlO 18 MOI.
  • recombinant viruses of this disclosure are Ixl0 8 to 3xl0 14 MOI.
  • the vector is a viral vector (e.g., an AAV6 vector) that comprises a polynucleotide sequence comprising in the 5' to 3' direction: (a) an AAV2 ITR; (b) a cardiac promoter (e.g., a cTnT promoter) sequence; (c) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide; (d) a sequence encoding a 2 A peptide; (e) a sequence encoding a ribonucleotide reductase M2 (RRM2) polypeptide; and (f) an AAV2 ITR.
  • the vector comprises the sequence set forth in Figure 8.
  • the vector is a viral vector (e.g., an AAV6 vector) that comprises a polynucleotide sequence comprising in the 5' to 3' direction: (a) an AAV2 ITR; (b) a cardiac promoter (e.g., a cTnT promoter) sequence; (c) a sequence encoding a ribonucleotide reductase subunit M2 (RRM2) polypeptide; (d) a sequence encoding a 2A peptide; (e) a sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide; and (f) an AAV2 ITR.
  • the vector comprises the sequence set forth in Figure 9.
  • a polynucleotide sequence, cassette, or vector of the present invention comprises a sequence provided in Figure 8, Figure, or Figure 16, or a variant thereof having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of these sequences.
  • a vector comprises a nanoparticle associated with a gene cassette described herein.
  • a vector comprises a cell comprising a gene cassette described herein, e.g., a nucleic acid encoding a RRMl polypeptide and/or a RRM2 polypeptide.
  • the cell is a cardiomyocyte.
  • the cardiomyocyte is derived from a pluripotent embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), or a mesenchymal stem cell.
  • the (iPSC) is derived from a cell harvested from the individual to whom the vector is to be administered.
  • the cell harvested from the individual is a skin fibroblast.
  • the vector further comprises a sequence encoding a transduction reporter, or a targeting agent having affinity for a cardiac tissue-specific marker.
  • the targeting agent is selected from the group consisting of an antibody, an antibody fragment, and an aptamer.
  • the present invention comprises a pharmaceutical composition
  • a pharmaceutical composition comprising a vector or gene cassette comprising a polynucleotide encoding a R M1 polypeptide and/or a RRM2 polypeptide, including any of those described herein, and a pharmaceutically acceptable carrier, diluent or excipient.
  • the vector is a viral vector.
  • the vector is a cell.
  • the pharmaceutical composition is for improving the cardiac function in an individual in need thereof
  • the present invention further includes methods for recombinantly producing the polynucleotides, expression cassettes, vectors, and cells of the present invention.
  • Methods for producing gene cassettes and polynucleotides of the invention are well known in the art and employ standard molecular biology techniques.
  • the methods comprise subcloning the various sequences of the polynucleotides in the specific order described herein into a vector.
  • kits comprising a polynucleotide sequence, vector, cell or pharmaceutical composition of the present invention, which may further comprise instructions regarding the use of the polynucleotide sequence, vector, cell or pharmaceutical composition to increase cardiac function or treat a cardiac disease or disorder in a subject in need thereof.
  • the kit further comprises a reagent for detection of the vector or polypeptides expressed therefrom, such as, e.g., an antibody that binds to a Rl or R2 polypeptide or to a RR complex, or an antibody that binds to a marker protein (e.g., transduction reporter) expressed from the vector.
  • a marker protein e.g., transduction reporter
  • the present invention further provides methods of improving cardiac function and/or treating a variety of cardiac diseases and disorders using the gene cassettes, vectors and pharmaceutical compositions described herein.
  • the compositions and methods of the invention are used to improve cardiac function, myocardial contractility and relaxation in a subject, e.g., a mammal, in need thereof.
  • a subject is a mammal, e.g., a human.
  • they improve left ventricle ejection fraction, left ventricle fractional shortening, left ventricle end-systolic dimension, left-ventricle end-diastolic pressure, dP/dT and/or -dP/dT in treated cells, tissues or subjects.
  • dATP ribonucleotide reductase
  • R1R2 ribonucleotide reductase
  • dATP 2 deoxy-ATP
  • RR ribonucleotide reductase
  • transfection limited to a small area of the left ventricular (LV) wall results in a substantial increase in LV function.
  • the present invention provides a method for delivering dATP to failing myocardium by transplanting a second cell type that has been genetically modified to overexpress Rl and/or R2 and is capable of forming gap junction connections with the target host myocardium. Because of their amenability to such genetic modification, tremendous capacity for expansion, and ability to form stable intra-cardiac implants that express the appropriate connexin isoforms, cardiomyocytes derived from human ESCs or iPSCs represent an ideal dATP donor.
  • skin fibroblasts are obtained from a heart failure patient, reprogramed into iPSCs, and then modified by inserting a construct in which a cardiac- specific promoter drives expression of Rl and/or R2.
  • this method uses zinc finger nuclease-mediated transgenesis (which allows targeting of a well-characterized, "safe -harbor" locus in the genome) to insert the construct. After screening and expansion of the appropriately targeted iPSC clones, these cells are differentiated into cardiomyocytes and then implanted (e.g., by use a catheter) into the failing heart.
  • this strategy does not require the formation of a large cardiac graft, nor does the graft need to be implanted within the hostile environment of an infarct scar. Instead, because the purpose of the graft is to deliver dATP, and not to produce force, a modest graft implanted in the well- vascularized distant myocardium might suffice.
  • other donor cell types e.g., mesenchymal stem cells
  • transgenesis e.g., transposon, plasmid, or viral delivery
  • Advantages of the present invention can be achieved by overexpression of Rl and/or R2, which form the ribonucleotide reductase complex, resulting ultimately in the production of dATP in situ.
  • the expression of both Rl and R2 from a single expression construct or vector is associated with greater increases in RR complexes in cells or tissues of the subject, as compared to when Rl is expressed from a first expression construct or vector and R2 is expressed from a second construct or vector.
  • the increase in RR complexes is at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater when both Rl and R2 are expressed from the single expression construct or vector as compared to from two different expression constructs or vectors.
  • the polynucleotides of the present invention that comprise sequences encoding both Rl and R2 subunits, e.g., RRMl and RRM2, and further comprising a sequence encoding a 2A peptide or IRES, result in increased transfection or transduction efficiency as compared to when separate expression constructs are used for Rl and R2.
  • the transfection or transduction is at least at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater.
  • transfection or transduction efficiency, and/or expression of the encoded subunit is greater than when both Rl and R2 subunits are expressed, either from the same vector or two different vectors.
  • the transfection or transduction efficiency, and/or expression level is at least 5%, at least 10%>, at least 20%>, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater.
  • Methods of the present invention that utilize only one expression construct or vector also offer cost and efficiency advantages over methods that require the production and transfection/transduction of two separate expression constructs or vectors.
  • a vector for expressing a RRMl polypeptide and/or a RRM2 polypeptide is administered to the subject directly.
  • cells e.g., cardiomyocytes, fibroblasts, endothelial cells, smooth muscle cells, nerve cells, or Schwann cells, transfected with a vector for expressing a RRMl polypeptide and/or a RRM2 polypeptide is grafted to a mammalian myocardium.
  • Rl and R2 subunits leads to formation of the RR complex, which in turn generates dATP.
  • overexpression of the Rl subunit leads to increased RR complex through the overexpressed Rl
  • the subject being treated has a heart condition resulting in reduced contraction.
  • the subject has been diagnosed with ischemic heart disease, a cardiomyopathy, or a myocardial infarction.
  • the cardiomyopathy is a primary cardiomyopathy, a genetic variant thereof, or a genetic variant thereof.
  • cardiomyopathy a dilated cardiomyopathy, or a hypertrophic cardiomyopathy.
  • the subject has been diagnosed with reduced systolic function.
  • the subject has an infarcted heart.
  • the subject has been diagnosed or considered at risk for a cardiovascular disease, such as, e.g., myocardial infarction, ischemia/reperfusion injury, diabetes, high blood pressure, or hypertrophic and dilated cardiomyopathy
  • the present invention provides a method for improving cardiac function in a subject in need thereof, comprising administering a vector encoding a RRMl polypeptide and/or a RRM2 polypeptide to the subject.
  • the vector is any of the vectors described herein.
  • the vector is administered to cardiac tissue of the subject.
  • the vector administered to the subject expresses both a RRMl polypeptide and a RRM2 polypeptide. In particular embodiments, both
  • polypeptides are expressed from the same promoter, e.g., a cardiac-specific promoter.
  • the vector expresses both a RRMl polypeptide and a RRM2 polypeptide
  • the vector comprises an IRES or sequence encoding a 2A peptide between the regions encoding the RRMl polypeptide and the RRM2 polypeptide.
  • the vector comprises a polynucleotide sequence having in the 5 ' to 3 ' orientation (a) a promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide; and (c) a second sequence encoding a RRMl polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRMl polypeptide, the second sequence of (c) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2 polypeptide, the second sequence of (c) encodes a RRMl polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (c).
  • the first sequence of (b) encodes a RRMl polypeptide or
  • the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); (b) a first sequence encoding a ribonucleotide reductase subunit Ml (e.g., RRMl) polypeptide; (c) a sequence encoding a 2A peptide; and (d) a second sequence encoding a ribonucleotide reductase subunit M2 (e.g., RRM2) polypeptide , wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d).
  • a cardiac-specific promoter sequence e.g., a cTnT or a cTnCl promoter sequence
  • Ml e.g., RRMl
  • M2 ribonucleotide reductas
  • the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); (b) a first sequence encoding a ribonucleotide reductase subunit M2 (RRM2) polypeptide; (c) a sequence encoding a 2A peptide; and (d) a second sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d).
  • a cardiac-specific promoter sequence e.g., a cTnT or a cTnCl promoter sequence
  • RRM2 ribonucleotide reductase subunit M2
  • RRMl ribonucleotide reductase
  • the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); and (b) a sequence encoding a ribonucleotide reductase subunit Ml (e.g., RRMl) polypeptide, wherein the promoter sequence is operably linked to the sequence of (b).
  • a cardiac-specific promoter sequence e.g., a cTnT or a cTnCl promoter sequence
  • a ribonucleotide reductase subunit Ml e.g., RRMl
  • the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); and (b) a sequence encoding a ribonucleotide reductase subunit M2 (e.g., RRM2) polypeptide, wherein the promoter sequence is operably linked to the sequence of (b).
  • a cardiac-specific promoter sequence e.g., a cTnT or a cTnCl promoter sequence
  • RRM2 ribonucleotide reductase subunit
  • the vector is a viral vector, e.g., an AAV vector, and the polynucleotide sequence further comprising 5' and 3' flanking ITR sequences, e.g., AAV2 ITR sequences.
  • the vector e.g., the viral vector
  • the vector is administered systemically, e.g. intravenously, or locally, e.g. via intra-myo cardial injection.
  • the vector is administered by lipofectin, coating on a stent, or direct injection, e.g., via a catheter.
  • the vector may further encode a targeting agent that specifically binds to a cardiac-specific marker.
  • the vector further comprises a transduction reporter.
  • the vector comprises a cell, e.g., a donor cell, containing an expression construct of the invention, e.g., fibroblasts or
  • the method comprises grafting the cells to the myocardium of the subject in need of treatment, e.g. a mammal having an infarcted myocardium.
  • the method involves prior to grafting of the cells, e.g., cardiomyocytes, transducing said cells, e.g.,
  • cardiomyocytes with the Rl and/or R2-encoding expression vector ex vivo.
  • the grafting of cardiomyocytes is effected via delivery through a catheter.
  • the cells e.g., cardiomyocytes
  • the cells are delivered to a region of the myocardium containing live cells, e.g. a non-infarct zone of the myocardium.
  • the cells e.g.,
  • cardiomyocytes are derived from stem cells, e.g. pluripotent ESC, iPSC, mesenchymal stem cells, selected from an origin compatible with the host organism.
  • the iPSCs are derived from a cell, e.g. fibroblast, harvested from the mammalian host (i.e., mammalian subject being treated).
  • the route of delivery and amount of vector to be delivered to a subject may be determined by a physician based, in part, on the subject's physical condition. Examples
  • FIG. 10 A schematic diagram of these vectors is provided in Figure 10. These vectors included the cardiac-specific promoter cTnT455 and a sequence encoding a 2A peptide between the Rl and R2 sequences, e.g., as shown in Figures 8-10. These AAV6 vectors were produced in a similar manner as the vectors previously described in PCT patent application publication no.WO2012162705. Experiments were performed the same as or similarly to those described in PCT patent application publication no.WO2012162705.
  • MI myocardial infarction
  • left ventricular (LV) ejection fraction and systolic LV dimension were improved significantly in the high-dose group, despite further deterioration in the saline controls.
  • Hemodynamic parameters including LV end-diastolic pressure, +dP/dt, and -dP/dt all trended toward improvement in the high-dose group. No difference in the
  • BB-R12 cardiac-specific gene therapy using constructs of the present invention, such as BB-R12, may reverse cardiac dysfunction by myosin activation in a large-animal heart failure model with no observed safety concerns, and support the use of similar vectors for the treatment of subjects with chronic heart failure.
  • MI Myocardial infarction
  • Amiodarone 1000 mg, PO, SID was administered daily 1-5 days prior to MI induction. Solid food was withheld for approximately 12-24 hours prior to treatment and animals were weighed and given an intramuscular (IM) injection of the antibiotic enrofloxacin at 2-8 mg/kg, 30 minutes prior to surgery. Each animal was subcutaneously (SC) injected with the analgesic buprenorphine at .01-0.1 mg/kg. General anesthesia was induced with an IM injection of Telazol® at 6mg/kg followed by mask administration of isoflurane (0.5-3%), and Propofol (2 mg/kg-10 mg/kg [3-5ml], to effect; ensuring the animal maintain normal breathing during administration.
  • IM intramuscular
  • Ophthalmic ointment was applied to both eyes to prevent corneal drying.
  • Intravenous catheter(s) where placed in a peripheral ear vein and amiodarone (150 mg IV over 10 minutes) and lidocaine (1 mg/kg IV) slowly administered during induction to prevent arrhythmia.
  • amiodarone 150 mg IV over 10 minutes
  • lidocaine 1 mg/kg IV
  • an endotracheal tube was placed and each animal was attached to an anesthesia machine. Each animal was maintained on isoflurane anesthesia for the remainder of the preparation and surgical procedure.
  • the surgical incision site(s) was cleaned of debris and hair and scrubbed with a germicidal soap, wiped with 70% alcohol, painted with povidone iodine and draped.
  • Surgical incision sites included the left or right femoral/inguinal regions, and the left or right ventral neck area. Animals were placed in a dorsal recumbent position and monitoring leads placed (EKG, pulse oximeter, temperature probe, etc.).
  • Isoflurane (0.5-3.0%, inhalant) was administered to maintain the anesthetic plane, and LRS, or an equivalent, was given at 1-10 ml/kg/hr, IV for fluid maintenance.
  • MI induction was performed by inducing a myocardial infarction of a selected area of the left ventricle, performed by a temporary (at least 75 minutes) 100% occlusion of LAD just past the first diagonal branch and was performed via the arterial access site used in the hemodynamic data collection.
  • an appropriately sized guide catheter (5-6 Fr JR, MPA1, AL1-LBT or HS, Cordis, Bridgewater, NJ) was advanced to the left main coronary artery with the use of a 0.035" guidewire.
  • a coronary angiogram was performed to visualize the major branches of the left coronary circuit and its tributaries. The target site for occlusion was identified and recorded.
  • a balloon catheter (2.5-4.0 x 15 mm, Cordis EMPIRA) was then advanced to the occlusion site, with the aid of a 0.014" guidewire (Cho ICE Floppy, Boston Scientific, Marlborough, MA). The balloon was inflated for 75 minutes. Upon inflation, an angiogram was performed to ensure 100% occlusion of the target site.
  • the balloon was slowly deflated over up to three minutes (if tolerated), and the balloon and guide catheters removed from the left main coronary artery. Upon confirming the animal was stable, a final angiogram was performed. All catheters and introducers were then removed, and the access site closed using standard technique.
  • Post-operative analgesia (buprenorphine at 0.01-0.02 mg/kg) and antiarrhythmics (Amiodarone 1000 mg, PO, SID) were administered at the discretion of the test site veterinary staff.
  • the animals were injected IM with the antibiotic enrofloxacin at 2-8 mg/kg for the first 2 post-operative days.
  • AAV6 cTnT455 Rml Rm2 contains a 4,431 base pair (bp) transgene cassette consisting of the 585 bp upstream promoter region of cTnT containing a duplication of the El enhancer element fused to 2379 bp Rml of human RNR codon optimized from GENBANK NM 001033.3 followed sequentially by a 63 bp porcine 2 A sequence fused to the 1170 bp Rm2 of RNR codon optimized from GENBANK
  • BB-R12 was produced in insect cells. ' High titer BB-R12 stocks (1.5 X 10 Viral genome (VG)/ml) was formulated in PBS containing 5 mM Ca and 5 mM MgCl 2 and further supplemented with 35mM MgCl 2 .
  • test & Control Article Preparation Two weeks after induction of MI, survived animals received intracoronary infusions of BB-R12. Antegrade coronary infusion of BB-R12 was performed based on the previous reports. 28 ' 29 To administer the test or control article, femoral access was via percutaneous puncture or surgical cutdown for the placement of a 6/7-Fr sheath. After sheath insertion, heparin (100-200 units/kg) was administered IV to maintain an activated coagulation time (ACT) of 250-300 seconds.
  • ACT activated coagulation time
  • a 5/6-Fr guiding catheter was advanced to the left coronary artery and after angiogram, two 0.014-inch guide wires advanced, one into the left anterior descending (LAD) artery and one into the left circumflex (LCX) artery to fix the position of the catheter.
  • LAD left anterior descending
  • LCX left circumflex
  • arterial blood ( ⁇ 10 ml) was drawn into a second 20 ml syringe from the femoral sheath or catheter and diluted with 10 ml of 0.9% sodium chloride solution (saline).
  • the tubing and catheter was primed with 4 ml of diluted blood from the flushing syringe.
  • Intravenous nitroglycerin ( ⁇ g/kg/min) was initiated through the ear vein.
  • Control or test article was administered through the guide catheter which was placed at the proximal left main tract and the test or control article solution (12-15 ml) injected at a rate of 1 mL/min through the guide over 12-15 minutes using an infusion pump into the left coronary artery. This was followed by injection of the flush solution (5 ml for 5 minutes).
  • a wire and a catheter was then fixed to right coronary artery the same way as left coronary artery.
  • test or control article solution (5-8 ml) was injected into the right coronary artery for 5-8 minutes and followed by injection of the flush solution (5 mL over 5 minutes). After completing the administration of the test or control article, the guide catheter and introducer was removed. Before removal of the sheath, ACT was allowed to return to baseline.
  • Clinical pathology samples were analyzed for clinical chemistry panel (electrolytes, hepatic, renal, metabolic), CBC and coagulation panel. At necropsy, all macroscopic alterations in the examined tissues and organs were recorded and selected organs weighed.
  • Fresh specimens for the biodistribution analysis were collected from the heart, liver, kidney, spleen, lungs, brain, skeletal muscle and testes. Microscopic analyses of the following tissues were performed: Adrenals, aorta, brain, heart, kidneys, liver, lungs and bronchi, lymph nodes, ovaries, spleen, testes and thymus.
  • the heart ventricles were trimmed by serially slicing the ventricles in a plane parallel to the atrioventricular groove.
  • the ventricular slice that incorporated the central area of the infarct was further subdivided to provide sections of infarct border, central infarct and uninfarcted left ventricular free wall, interventricular septum and right ventricular free wall for microscopic evaluation.
  • sections of the left and right coronary groove were collected.
  • Heart ventricular tissues were routinely processed, embedded in paraffin, and sectioned at approximately 5 ⁇ .
  • Heart ventricular tissues were stained with H&E and Masson's Trichrome for evaluation.
  • Transthoracic echocardiography (Acuson Cypress, Siemens Medical Solutions, Malvern, PA) was performed on anesthetized animals prior to beginning the surgical procedure, and at each of the specified follow-up timepoints. Images were obtained of multiple heart cycles in orthogonal long axis views, as well as short axis views of the left ventricle. End systolic and end diastolic images were captured for measurement of left ventricular volumes and quantification of ejection fractions. Echocardiography data was blinded for analysis.
  • a Millar Mikro- Tip catheter (Millar Inc., Houston TX) was advanced through the arterial circuit via an appropriately sized guide catheter (Wiseguide, Boston Scientific) for data collection of AoP and LVP. For each of the pressure endpoints, a minimum of 5 heart cycles was recorded with PowerLab data acquisition platform (ADInstruments, Colorado Springs, CO).
  • Frozen mini-pig tissue plugs of liver, lung, right ventricle, left atrium, and 3 samples from the left ventricle were obtained.
  • Tissue samples were homogenized in Qiagen Buffer ATL containing proteinase K using the Omni Bead Ruptor homogenizer with 2.8 mm ceramic beads. The homogenized sample was incubated at 56 C for 10 minutes.
  • DNA was extracted from the homogenized tissue using the Qiagen QIAamp 96 DNA QIAcube HT Kit. Blood samples were incubated in Buffer ATL containing proteinase K at 56 C for 10 minutes. DNA was extracted from lysed blood samples using the Qiagen 96 QIAamp QIAcube HT Kit.
  • Ligands and probes specific for the transgene, rml, inserted in the AAV vector were designed, qualified, and shown to be fit for purpose.
  • qPCR was performed using the Qiagen QuantiFast Pathogen PCR plus IC kit and the AAV specific primers and probes.
  • the QuantiFast Pathogen PCR plus IC kit contained internal amplification control (IAC) primers, probes, and control IAC DNA that was added to each PCR reaction.
  • the IAC assay was used to monitor each PCR reaction for inhibition.
  • the IAC DNA was added to the reaction at a low level to prevent competition with the Rml assay, but at a level to monitor for inhibitors in the extracted DNA samples.
  • PCR analysis was conducted in an Applied Biosystems 7900HT Fast Real- Time PCR System (Applied Biosystems, Foster City CA) with software SDS 2.2.2, using the following PCR run conditions: activation at 95°C for 5 minutes, 45 cycles of denaturing at 95°C for 15 seconds and annealing and elongation at 60°C for 30 seconds. Fluorescence was monitored during the annealing and elongation portion of the 45 cycles.
  • the DNA samples were analyzed in triplicate.
  • the copy number for each DNA sample was calculated from the average cycle threshold (Ct) values for each sample using the linear regression analysis of the standard curve for each PCR plate.
  • the DNA concentration was measured for each sample and the quantity of AAV was reported as copy number per microgram of DNA.
  • the assay has a limit of detection of 10 copies. The lower limit of quantification for the assay was 40 copies per ⁇ g of DNA.
  • a 6-point standard curve was prepared fresh on the day of analysis. These standards were run in duplicate on each PCR plate. The copy number of the standards ranged from 9.95 x 10 6 per reaction to 99.5 copies per reaction.
  • Ekuseru-Toukei 2010 Social Survey Research Information Co., Ltd, Japan
  • Student's t test was used to test for differences between two groups if normal distribution was assumed. Normal distribution was examined with frequency histograms. In case of nonparametric distribution, Mann- Whitney U test was used.
  • ANOVA Analysis of variance
  • Yucatan minipigs (35-45 kg) were screened for neutralizing antibodies to AAV6, and a total of 28 seronegative animals were enrolled in this study and underwent myocardial infarction (MI) induction (day -14). Eight pigs died from ventricular fibrillation during the MI induction procedure, and an additional 3 pigs died after MI induction but prior to administration of BB-R12 gene therapy or placebo. A total of 17 pigs received intracoronary infusions of BB-R12 or formulation buffer (sham) as shown in Table 1. All treated animals survived until euthanasia at 56 days post-treatment. Table 1. Mean values of echocardiography and hemodynamics
  • LVFS in high-dose group was significantly higher than the sham at 56 days after treatment
  • LV end-systolic dimension increased from preinfarction to the time of treatment at day 0 ( Figure 14A).
  • LVESD increased progressively and peaked at 56 days post-saline injection ( Figure 14B).
  • the, LVESD at 56 days post-treatment was similar or smaller to that at Day 0.
  • left ventricular end-diastolic dimension (LVEDD) showed progressive dilation during 56 days after gene delivery for all groups ( Figure 14C). There was no significant difference in LVEDD between sham and treated groups at 56 days after treatment.
  • the mean values for hemodynamic measurements are shown in Table 1.
  • Table 1 The mean values of maximum rate of pressure rise (+dP/dt), a parameter of systolic function, maximum rate of pressure decline (-dP/dt), a parameter of early diastolic function, and LV end-diastolic pressure (LVEDP) showed changes consistent with the onset of HF in all groups and these changes persisted in the sham group.
  • LVEDP LV end-diastolic pressure
  • BB-R12 does not evoke a significant humoral or cellular immune response
  • RNR The increase in dATP is achieved through the enhanced expression of RNR, which is normally down regulated in mature cardiac muscle cells, and the increased expression of which results in the synthesis of dATP in cardiomyocytes.
  • up-regulation of RNR has been linked to increased dATP levels and these, in turn, to enhanced cardiac performance.
  • Expression of RNR using a cardiac specific promoter e.g., the cTnT promoter, facilitates cardiomyocyte- specific transcription and minimizes possible off target effects with a level of therapeutic specificity not achievable using small molecule drugs or gene therapies using constitutively expressed regulatory elements.
  • chemo-mechanical modeling suggests the weaker hydrostatic interaction between dATP and myosin in the binding pocket (vs. ATP) may result in a faster release of the hydrolysis product dADP, thus myosin detachment rate and relaxation is also faster. 20 Consequently the kinetics of cell, tissue and organ relaxation appear matched to the enhanced
  • Direct targeting of the contraction machinery of the cardiac muscle cell by intracellular production of a superior myosin substrate is a new therapeutic paradigm to treat HF and is independent of both calcium and adrenergic signaling.
  • Omecamtiv a small molecule drug in clinical development, represents a new class of inotropic agents, cardiac myosin activators. 21 Omecamtiv works directly on myosin and stimulates myocardial ATPase by strengthening myosin/actin crossbridge formation, thus increasing left ventricular systolic function independent of calcium while decreasing filling pressure without increasing heart rate or oxygen consumption. 22 ' 23
  • Omecamtiv has reached later-stage clinical testing, which validates myosin activation as a target for inotropic therapy.
  • omecamtiv is delivered by repeated intravenous infusions or chronic oral dosing, does not appear to affect the rate of ventricular pressure development and increases systolic ejection time in a dose dependent manner, leading to the prolongation of systole. 22
  • dATP and BB-R12 requires a one-time administration and appears to increase left ventricular function with no prolongation of systolic ejection time or shortening of diastole.
  • Gene therapy using a gene therapy vector of the present invention increases cardiac function by turning a small number of transduced cardiomyocytes into cellular factories that generate dATP.
  • dATP increases the contraction of both the transduced cell and adjacent cardiac muscle cells by passive diffusion of the nucleotide throughout the heart via gap junctions.
  • Lundy et al. showed that small numbers of ex-vivo RNR-infected cardiomyocytes directly injected into 3 loci in rat hearts had positive overall effects on cardiac function, demonstrating that a small proportion of transduced cells distributed in a limited number of sites can increase cardiac function.
  • AAV6.betaARKct cardiac gene therapy ameliorates cardiac function and normalizes the catecholaminergic axis in a clinically relevant large animal heart failure model. European heart journal 2013;34(19): 1437-47.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

The invention described herein relates to compositions, including vectors, comprising a polynucleotide sequence encoding one or both of a ribonucleotide reductase subunit M1 (RRM1) and a ribonucleotide reductase subunit M2 (RRM2), and their use to increase cardiac function, and treat or prevent heart disease and other cardiac conditions.

Description

COMPOSITIONS AND METHODS FOR IMPROVING CARDIAC FUNCTION
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 61/972,248, filed March 29, 2014, which is incorporated by reference in its entirety.
SEQUENCE LISTING
The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the
specification. The name of the text file containing the Sequence Listing is
BEAT_001_01WO_ST25.txt. The text file is 31 KB, was created on March 27, 2015, and is being submitted electronically via EFS-Web.
BACKGROUND OF THE INVENTION Field of the Invention
This invention relates to compositions, including vectors, comprising a polynucleotide sequence encoding one or both of a ribonucleotide reductase subunit 1 (Rl) and a ribonucleotide reductase subunit 2 (R2). This invention is also directed to methods for increasing cardiac function, as well as methods of treating or preventing heart disease and other cardiac condition, comprising administering a composition of the invention to a subject in need thereof.
Description of the Related Art
Heart disease is the leading cause of mortality and morbidity in the United States and has been rising dramatically around the world. Cardiac diseases of the sarcomere, such as HCM and DCM, frequently involve amino acid mutations in one of several myofilament proteins commonly leading to heart failure, and in some cases sudden cardiac death. As the number of identified mutants with functional characterization has grown, some patterns have emerged that demonstrate potential similarities in altered contractile properties. For example, most HCM mutations result in increased Ca2+ sensitivity of contractile force in demembranated cardiac muscle, while most DCM variants result in decreased Ca2+ sensitivity of force. However, the extent of which these alterations in myofilament Ca2+- sensitivity are involved in progression of the diseases is not known. Potential and important interactions between altered myofilament Ca2+ binding and SR function have not been systematically investigated, nor have interactions with other intracellular Ca2+ buffers (e.g., mitochondria) or gene regulation.
Many cardiopathologies, as well as ischemia-reperfusion injury and myocardial infarct result in reduced systolic function due to damage and/or death to a portion of the myocardium that significantly compromises cardiac function. Infarcted hearts often do not meet the cardiovascular demands of the body and attempt to
compensate by increasing β- adrenergic activation. Chronic β-adrenergic stimulation, however, exhausts contractile reserves, can elevate diastolic Ca2+ levels, and eventually results in down-regulation of adrenergic responsiveness leading to end-stage heart failure. Importantly, a number of studies in both animal models and patients have noted alterations in both myofilament and sarcoplasmic reticulum (SR) and sarcolemmal protein content and phosphorylation following infarction, which would alter myofilament Ca2+ sensitivity of force and Ca2+ transient release/reuptake. Similar changes have been observed in hearts expressing mutations associated with DCM and HCM. Although global alterations in hormone levels (such as β-adrenergic agonists) have often been implicated in these adaptations, the mechanism(s) may be due (at least in part) to intracellular interplay between SR and myofilament proteins.
Cardiac function is compromised in a number of cardiovascular diseases including myocardial infarction, ischemia/reperfusion injury, diabetes, high blood pressure and hypertrophic and dilated cardiomyopathy. These pathophysiological conditions often alter the Ca2+ cycle, β-adrenergic responsiveness, and/or the contractile apparatus of cardiomyocytes. To date, therapeutic efforts have focused primarily on increasing [Ca2+]i, which tend to exert a pro-arrhythmogenic effect, impair ventricular filling by slowing diastolic relaxation-, and cause SR Ca2+ overload initiating triggered activity. Other approaches involving adrenergic agents can have undesirable long-term side-effects, e.g. significant drug actions in non-target areas, pro-arrythmogenic triggered activity, and potential for accelerated progression into heart failure. Thus, new approaches to combat cardiac dysfunction are desirable.
Recently, it has been shown that increasing overall cellular levels of dATP using vectors expressing Rl (ribonucleotide reductase subunit 1) and R2 (ribonucleotide reductase subunit 2) yields substantial improvements in cardiac contractility and cardiac function, as evidenced by an increase in left ventricular fractional shortening and increased extent and rate of shortening and relaxation of isolated cardiomyocytes (PCT patent application publication no. WO 2012/162705). In addition, animal studies showed that increased dATP levels had the effect of increasing pre-load responsiveness in Langendorf- working heart studies and rescuing heart failure.
Given this observation, there is clearly a need in the art for new and improved vectors and methods to deliver Rl and/or R2 to patients suffering from heart failure or other cardiac conditions in order to improve cardiac function. The present invention provides such vectors and related methods of increasing cardiac function and treating heart disease.
BRIEF SUMMARY OF THE INVENTION
The present invention provide, inter alia, compositions and methods for increasing levels of ribonucleotide reductase subunit 1 (Rl) and/or ribonucleotide reductase subunit 2 (R2) in cells, which may be used to increase cardiac function and treat a variety of cardiac diseases and disorders.
In one embodiment, the invention includes a polynucleotide sequence comprising in the 5' to 3' direction: (a) a cardiac-specific promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (R M2) polypeptide; (c) an IRES sequence or a sequence encoding a 2A peptide; and (d) a second sequence encoding a RRMl polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRMl polypeptide, the second sequence of (d) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2 polypeptide, the second sequence of (d) encodes a RRMl polypeptide; wherein the cardiac-specific promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d). In one embodiment, the first sequence of (b) encodes a RRMl polypeptide, and the second sequence of (d) encodes a RRM2 polypeptide. In one embodiment, the first sequence of (b) encodes a RRM2 polypeptide, and the second sequence of (d) encodes a RRMl polypeptide. In particular embodiments, the cardiac-specific promoter is a cardiac troponin T (cTnT) promoter. In one embodiment, the cTnT promoter is the cTnT455 promoter. In one embodiment, the polynucleotide sequence comprises the sequence encoding the 2 A peptide. In particular embodiments, the RRMl polypeptide is a human RRMl polypeptide or a variant thereof. In particular embodiments, the RRM2 polypeptide is a human RRM2 polypeptide or a variant thereof. In certain embodiments, the sequence encoding the RRMl polypeptide is codon-optimized. In particular embodiments, the sequence encoding the RRM2 polypeptide is codon- optimized. In particular embodiments, both the RRMl polypeptide and the RRM2 polypeptide are codon-optimized. In particular embodiments, the polynucleotide sequence further comprises: (e) a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence; and (f) a second ITR sequence 3 ' of the second sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
In a related embodiment, the present invention includes a vector, e.g., an expression vector, comprising a polynucleotide sequence of the present invention. In certain embodiments, the expression vector is a viral vector. In certain embodiments, the viral vector is an adeno-associated virus (AAV) vector. In one embodiment, the AAV is an AAV6. In certain embodiments, the expression vector comprises the first ITR and the second ITR, wherein the first ITR and the second ITR are AAV2 ITRs. In some
embodiments, the expression vector further comprises a transduction reporter. In some embodiments, the expression vector further comprises a targeting agent. In certain embodiments, the vector is a cell comprising a polynucleotide sequence of the present invention. In one embodiment, the present invention includes a cell comprising a polynucleotide sequence or expression vector of the present invention. In particular embodiments, the cell is a cardiomyocyte.
In a further embodiment, the present invention includes a pharmaceutical composition comprising a polynucleotide sequence, expression vector, or cell of the present invention, including any of those described herein.
In another related embodiment, the present invention includes a method of improving cardiac function in a mammal in need thereof, the method comprising administering to the mammal a polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition of the present invention, including any of those described herein.
In a related embodiment, the present invention includes a method of improving cardiac function in a mammal in need thereof, the method comprising administering to the mammal a polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition, comprising a polynucleotide sequence comprising in the 5' to 3' direction: (i) a cardiac-specific promoter sequence; and (ii) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide, wherein the polynucleotide sequence does not comprise both the sequence encoding the RRM1 polypeptide and the sequence encoding the RRM2 polypeptide. In particular embodiments, if the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising the sequence encoding the RRM1 polypeptide is administered to the mammal, the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising a sequence encoding a RRM2 polypeptide is not administered to the mammal. In particular embodiments, if the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising the sequence encoding the RRM2 polypeptide is administered to the mammal, the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition comprising a sequence encoding a RRM1 polypeptide is not administered to the mammal. In particular embodiments, the polynucleotide sequence further comprises: (iii) a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence; and (iv) a second ITR sequence 3 ' of the sequence encoding the RRMl polypeptide or the RRM2 polypeptide. In certain embodiments, the first ITR and the second ITR are AAV2 ITRs. In certain embodiments, the polynucleotide sequence is present in an expression vector, and in particular embodiments, the expression vector is present in a pharmaceutical composition. In particular embodiments, the polynucleotide sequence is present in a cell, and in certain embodiments, the cell is present in a pharmaceutical composition. In one embodiment, the polynucleotide sequence comprises the sequence encoding the RRMl polypeptide. In another embodiment, the polynucleotide sequence comprises the sequence encoding the RRM2 polypeptide.
In particular embodiments of any of the methods of the present invention, administration of the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition results in an increase in generation of dATP by the mammal.
In particular embodiments of any of the methods of the present invention, the polynucleotide sequence, vector (e.g., expression vector), cell, or pharmaceutical composition is administered to the myocardium of the mammal. In particular embodiments, it is administered by grafting cells comprising the polynucleotide sequence or vector (e.g., expression vector) to the myocardium of the mammal. In certain embodiments, the cells are cardiomyocytes.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 A-F present the results of experiments performed to assess vector hemodynamics. Baseline function data was assessed via Langendorff isolated heart preparations. Hearts were perfused with Kreb's Henseleit Buffer enriched with lOmM Glucose and 0.5mM Pyruvate. (A) shows LV function (LVDevP (mmHg)); (B) shows heart rate(HR (bpm)); (C) shows cardiac function (RPP(mmHg*bpm)); (D) shows rate of pressure change (+dP/dT (mmHg/s)); (E) shows rate of pressure change (-dP/dT (mmHg/s)); and (F) shows coronary flow (CF (ml/min)). Control: n=3; R groups: n=4 each; * P< 0.05 vs. control.
Figures 2A-B present Starling curve results. (A) shows LV pressure (LVDevP (mmHg)); and (B) shows end diastolic pressure(LVEDP (mmHg)).
Figures 3A-F present the results of experiments performed to assess response to high workload challenge consisting of 4 mM calcium + 50 nM dobutamine (DOB). (A) shows LV function; (B) shows heart rate; (C) shows cardiac function; (D) shows rate of pressure change; (E) shows rate of pressure change; and (F) shows coronary flow.
Figure 4 presents the homo sapiens ribonucleotide reductase Ml (RRM1) polynucleotide sequence (NM 001033.3). The open reading frame encoding the RRM1 polypeptide is capitalized.
Figure 5 present the homo sapiens ribonucleotide reductase M2 (RRM2) transcript variant 2 polynucleotide sequence (NM 001034). The open reading frame encoding the RRM2 polypeptide is capitalized.
Figure 6 presents a codon-optimized RRMl polynucleotide sequence.
Figure 7 presents a codon-optimized RRM2 polynucleotide sequence.
Figure 8 presents a polynucleotide sequence including the homo sapiens ribonucleotide Ml (RRMl) polynucleotide sequence (NM 001033.3), the porcine 2A polynucleotide sequence, and the homo sapiens ribonucleotide reductase M2 (RRM2) transcript variant 2 polynucleotide sequence (NM 001034). The open reading frame encoding the RRMl polypeptide is the first capitalized region of the sequence (lightly shaded), the porcine 2A sequence is the darkly shaded lower case region of the sequence, and the open reading frame encoding the RRM2 polypeptide is second capitalized region of the sequence (medium shaded).
Figure 9 presents a polynucleotide sequence including the homo sapiens ribonucleotide M2 (RRM2) polynucleotide sequence (NM 001034), the porcine 2A polynucleotide sequence, and the homo sapiens ribonucleotide reductase Ml (RRMl) polynucleotide sequence (NM 001033.3). The open reading frame encoding the RRM2 polypeptide is the first capitalized region of the sequence (medium shaded), the porcine 2A sequence is the darkly shaded capitalized region of the sequence, and the open reading frame encoding the RRM1 polypeptide is the second capitalized region of the sequence (lightly shaded).
Figure 10 presents a schematic diagram of four gene cassettes of the present invention. ITR indicates inverted terminal repeat; Rl indicates RRM1; R2 indicates RRM2; and E1E2 TnT indicates the cTnT promoter. The black box indicates the 2A peptide sequence.
Figure 11 is a diagram of the experimental design and flow of the study described in Example 2. MI was induced in 28 Yucatan mini-pigs by balloon occlusion of mid-left anterior descending artery. Two weeks later (day 0), 17 surviving pigs received antegrade coronary infusion of dilution buffer (sham), high (1 x 1013 VRG), medium (5 x
1012 VRG) or low (1 x 1012 VRG)-dose of BB-R12. The listed parameters were measured serially at the time points as shown.
Figures 12A-12C provide graphs showing left ventricular ejection fraction
(LVEF) vs time. Figure 12A shows the mean LVEF for each dosing group at study time points. *p < 0.05, **p<0.01 for differences vs sham, mixed effects regression model.
Figure 12B shows individual and mean changes in LVEF from day 0 (DO) to day 56 (D56).
Figure 12C shows mean LVEF for animals with high severity HF (defined as animals in the pooled treated group with LVEF below the median at Day 0 prior to treatment), low severity HF (similarly defined but with LVEF above the median) and sham treatment, ***p
< 0.005 for differences vs sham, mixed effects regression model.
Figures 13A-D provide graphs showing left ventricular ejection fraction
(LVEF) and fractional shortening (FS). Figure 13A shows individual and mean LVEF at study time points for each group. Figure 13B shows mean change (± SEM) in LVEF from
Day 0 to Day 56. *p<0.05. Figure 13C shows individual and mean LVFS. Figure 13D shows mean change in LVFS from Day 0 to Day 56.
Figures 14A-D provide graphs showing left ventricular end-systolic
(LVESD) and end-diastolic dimensions (LVEDD). Figure 14A shows individual and mean LVESD at study time points for each group. Figure 14B shows mean change (± SEM) in LVESD from Day 0 to Day 56. Figure 14C shows individual and mean LVEDD. Figure 14D shows mean change in LVEDD from Day 0 to Day 56.
Figures 15A-F provide graphs showing hemodynamic measurements.
Figure 15A shows individual and mean +dP/dt at study time points for each group. Figure 15B shows mean change (± SEM) in +dP/dt from Day 0 to Day 56. *p<0.05. Figure 15C shows individual and mean -dP/dt. Figure 15D shows mean change in -dP/dt from Day 0 to Day 56Figure 15E shows individual and mean change in left ventricular end-diastolic pressure (LVEDP) at study time points for each group. Figure 15F shows mean change in LVEDP from Day 0 to Day 56.
Figure 16 shows the sequence of the BBR12 expression cassette used in Example 2. The sequence includes the cTnT promoter sequence (which is upstream of the RRMl gene), the codon optimized human RRMl gene, the porcine 2A sequence, the codon optimized human RRM2 gene, and the synthetic poly A sequence. DETAILED DESCRIPTION OF THE INVENTION
Definitions and Abbreviations
As used herein, the following terms and phrases shall have the meanings set forth below.
The term "about" a referenced numeric indication means the referenced numeric indication plus or minus up to 10% of that referenced numeric indication. For example, "about 100" means from 90 to 110.
The term "antagonist" refers to an agent that inhibits, either partially or fully, the activity or production of a target molecule. In particular, the term "antagonist," as applied selectively herein, means an agent capable of decreasing levels of gene expression, mRNA levels, protein levels or protein activity of the target molecule. Illustrative forms of antagonists include, for example, proteins, polypeptides, peptides (such as cyclic peptides), antibodies or antibody fragments, peptide mimetics, nucleic acid molecules, antisense molecules, ribozymes, aptamers, RNAi molecules, and small organic molecules.
Illustrative non- limiting mechanisms of antagonist inhibition include repression of ligand synthesis and/or stability (e.g., using, antisense, ribozymes or RNAi compositions targeting the ligand gene/nucleic acid), blocking of binding of the ligand to its cognate receptor (e.g., using anti-ligand aptamers, antibodies or a soluble, decoy cognate receptor or fragment thereof), repression of receptor synthesis and/or stability (e.g., using, antisense, ribozymes or RNAi compositions targeting the ligand receptor gene/nucleic acid), blocking of the binding of the receptor to its cognate receptor (e.g., using receptor antibodies) and blocking of the activation of the receptor by its cognate ligand (e.g., using receptor tyrosine kinase inhibitors). In addition, the antagonist may directly or indirectly inhibit the target molecule.
A "composition" can comprise an active agent and a carrier, inert or active. The compositions are useful for diagnostic or therapeutic use in vitro, in vivo or ex vivo. In particular embodiments, the compositions are sterile, substantially free of endotoxins or non-toxic to recipients at the dosage or concentration employed.
The term "nucleic acid" refers to a polynucleotide such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The term also includes analogs of RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides, expressed sequence tags (ESTs), chromosomes, cDNAs, mRNAs, and rRNAs.
The term "mammal" includes human and non-human mammals, such as, e.g., monkey, cow, hog, sheep, horse, dog, and cat.
The term "protein" and "polypeptide" are used interchangeably and in their broadest sense refer to a compound of two or more subunit amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In another embodiment, the subunit may be linked by other bonds, e.g., ester, ether, etc. No limitation is placed on the maximum number of amino acids which may comprise a protein's or peptide's sequence. As used herein the term "amino acid" refers to either natural and/or unnatural or synthetic amino acids, including glycine and both the D and L optical isomers, amino acid analogs and peptidomimetics.
"Pharmaceutically acceptable salts" include but are not limited to sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, lsomcotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dimtrobenzoate, hydroxybenzoate,
methoxybenzoate, methylbenzoate, o-acetoxybenzoate, naphthalene-2-benzoate, isobutyrate, phenylbutyrate, alpha -hydroxybutyrate, butyne-l,4-dicarboxylate, hexyne-1,4- dicarboxylate, caprate, caprylate, cinnamate, glycollate, heptanoate, hippurate, malate, hydroxymaleate, malonate, mandelate, mesylate, mcotinate, phthalate, teraphthalate, propiolate, propionate, phenylpropionate, sebacate, suberate, p-bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-hydroxyethylsulfonate, methylsulfonate, naphthalene- 1 -sulfonate, naphthalene-2-sulfonate, naphthalene-1,5 -sulfonate,
xylenesulfonate, and tartarate salts. The term "pharmaceutically acceptable salt" also refers to a salt of an antagonist of the present invention having an acidic functional group, such as a carboxylic acid functional group, and a base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium, hydroxides of alkaline earth metal such as calcium and magnesium, hydroxides of other metals, such as aluminum and zinc, ammonia, and organic amines, such as unsubstituted or hydroxy- substituted mono-, di-, or tri-alkylamines, dicyclohexylamine, tnbutyl amine, pyridine, N- methyl, N-ethylamine, diethylamine, tnethylamine, mono-, bis-, or tns-(2-OH-lower alkylamines), such as mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert- butylamine, or tes-(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)-amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine or ίπ-(2- hydroxyethyl)amine, N-methyl-D-glucamine, and amino acids such as arginine, lysine, and the like. The term "pharmaceutically acceptable salt" also includes a hydrate of a compound of the invention.
The term "effective amount," when used in connection with a composition of the invention for improving cardiac function or treating or preventing a cardiac disease or disorder, refers to an amount that is useful for the recited purpose. The "effective amount" can vary depending upon the mode of administration, specific locus of the ophthalmological disease, the age, body weight, and general health of the mammal.
A "variant" of polypeptide X refers to a polypeptide having the amino acid sequence of polypeptide X in which is altered in one or more amino acid residues. The variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). More rarely, a variant can have "nonconservative" changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without eliminating biological or immunological activity can be determined using computer programs well known in the art, for example, LASERGENE software (DNASTAR).
The term "variant," when used in the context of a polynucleotide sequence, can encompass a polynucleotide sequence related to that of gene or the coding sequence thereof. This definition also includes, for example, "allelic," "splice," "species," or
"polymorphic" variants. A splice variant can have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternative splicing of exons during mRNA processing. The corresponding polypeptide can possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species. As used herein, the term "excipient" refers to a typically inert substance which is commonly used as a diluent, vehicle, preservative, binder, or stabilizing agent for drugs and includes, but is not limited to, proteins (e.g., serum albumin, etc.), amino acids (e.g., aspartic acid, glutamic acid, lysine, arginine, glycine, histidine, alanine, etc.), fatty acids and phospholipids (e.g., alkyl sulfonates, caprylate, etc.), surfactants (e.g., SDS, polysorbate, nonionic surfactant, etc.), saccharides (e.g., sucrose, maltose, trehalose, etc.) and polyols (e.g., mannitol, sorbitol, etc.). Also see Remington's Pharmaceutical Sciences (by Joseph P. Remington, 18th ed., Mack Publishing Co., Easton, Pa.) and Handbook of Pharmaceutical Excipients (by Raymond C. Rowe, 5th ed., APhA Publications,
Washington, D.C.) which are hereby incorporated in its entirety. Preferably, the excipients impart a beneficial physical property to the composition, such as increased protein stability, increased protein solubility and decreased viscosity.
The term "buffer" as used herein denotes a pharmaceutically acceptable excipient, which stabilizes the pH of a pharmaceutical preparation. Suitable buffers are well known in the art and can be found in the literature. Pharmaceutically acceptable buffers comprise but are not limited to histidine-buffers, citrate-buffers, succinate-buffers and phosphate -buffers. Independently from the buffer used, the pH can be adjusted at a value from about 4.5 to about 7.0 or alternatively from about 5.5 to about 6.5 or
alternatively about 6.0 with an acid or a base known in the art, e.g., succinic acid, hydrochloric acid, acetic acid, phosphoric acid, sulfuric acid and citric acid, sodium hydroxide and potassium hydroxide. Suitable buffers include, without limitation, histidine buffer, 2-morpholinoethanesulfonic acid (MES), cacodylate, phosphate, acetate, succinate, and citrate.
A "preservative" is a natural or synthetic chemical that is added to products such as foods, pharmaceutical compositions, paints, biological samples, wood, etc. to prevent decomposition by microbial growth or by undesirable chemical changes.
Preservative additives can be used alone or in conjunction with other methods of preservation. Preservatives may be antimicrobial preservatives, which inhibit the growth of bacteria and fungi, or antioxidants such as oxygen absorbers, which inhibit the oxidation of constituents. Examples of antimicrobial preservatives include, benzalkonium chloride, benzoic acid, cholorohexidine, glycerin, phenol, potassium sorbate, thimerosal, sulfites (sulfur dioxide, sodium bisulfite, potassium hydrogen sulfite, etc.) and disodium EDTA. Other preservatives include those commonly used in patenteral protein compositions such as benzyl alcohol, phenol, m-cresol, chlorobutanol or methylparaben.
"Cardiac function," in the context of the present invention, refers to the function of the heart as reflected by one or more measurable parameters, e.g., myocardial contractility, change in fractional shortening, maximal rate of shortening, myocardial relaxation, maximal rate of myocardial relaxation, relaxation time, effects on Ca2+ transients, heart rate, end- systolic pressure, end diastolic pressure, end-systolic volume, end-diastolic volume, cardiac output, stroke work, stroke volume, cardiac index, etc. Said parameters may be determined by hemodynamic and/or echocardiographic measurements and/or any other methods known to those of skill in the art. Whether an improvement in cardiac function has taken place is determined on an individual basis. For instance, for an individual in need of a positive inotropic effect, an improvement in myocardial contractility signifies an increase in myocardial contractility. Alternatively, for an individual in need of a positive lusitropic effect, an improvement in myocardial relaxation signifies an increase in myocardial relaxation, e.g., as reflected by increased rate of relaxation.
"Myocardial contractility," used interchangeably herein with the term "inotropy," refers to the strength of a ventricular contraction during which blood is ejected from the heart. Improvement of myocardial contractility is determined on an individual basis using one or more measurable inotropy parameters. For an individual or patient in need of a positive inotropic effect, an improvement in myocardial contractility entails an increase in myocardial contractility as measured using echocardiography. For an individual or patient in need of a negative inotropic effect, an improvement in myocardial contractility entails a decrease in myocardial contractility. Examples of measurable inotropy parameters include OP/Ot, percent thickening, percent shortening, fractional shortening, and ejection fraction. "Myocardial relaxation," used interchangeably herein with the term
"lusitropy," refers to the ability of the heart to relax following excitation contraction coupling. Improvement of myocardial relaxation is determined on an individual basis using one or more measurable lusitropy parameters. For an individual or patient in need of a positive lusitropic effect, an improvement in myocardial relaxation entails an increase in the rate of relaxation. For an individual or patient in need of a negative lusitropic effect, an improvement in myocardial contractility entails a decrease in the rate of relaxation.
Examples of measurable lusitropy parameters include a rate of pressure decline (-dP/dtmin) during diastole as determined from pressure sensor measurements, a rate of force/strain decline (-dF/dt) as determined from force sensor measurements, and isovolumic relaxation time (IVRT) as determined from cardiac impedance measurements or from detected heart sounds. For instance, the measuring device may be programmed to compare the lusitropy parameter to a specified threshold in order to determine if diastolic relaxation is impaired and operate the neural stimulation circuitry to deliver sympathetic stimulation to the heart in response to thereto.
"Grafting" as used herein refers to the placement of cells into a subject. Cells can be autogeneic (i.e., from the subject to be treated), isogeneic (i.e., a genetically identical but different subject, e.g., from an identical twin), allogeneic (i.e., from a non- genetically identical member of the same species) and/or xenogeneic (i.e., from a member of a different species). Cells may be obtained from a donor (either living or cadaveric) or derived from an established cell line. To obtain cells from a donor (e.g., a potential recipient of a bioscaffold graft), standard biopsy techniques known in the art may be employed. Representative techniques are described, for example, in U.S. Pat. No.
6,536,567.
The terms "therapy," "treatment," and "amelioration" refer to any reduction in the severity of symptoms or amount of amyloid aggregation, or improvement in cognitive function. As used herein, the terms "treat" and "prevent" are not intended to be absolute terms. Treatment can refer to any delay in onset, amelioration of symptoms, improvement in patient survival, increase in survival time or rate, etc. The effect of treatment can be compared to an individual or pool of individuals not receiving the treatment.
By "cardiomyocyte" is meant a cardiac contractile cell, which is a cardiac muscle cell. The cardiomyocyte cell may be isolated and cultured in vitro or be part of the myocardium of a host.
The term "embryonic stem cells" (ES cells) refers to cells derived from the inner cell mass of blastocysts or morulae that have been serially passaged as cell lines. The ES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with homozygosity in the MHC region. The term "human embryonic stem cells" (hES cells) refers to cells derived from the inner cell mass of human blastocysts or morulae that have been serially passaged as cell lines. The hES cells may be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate hES cells with homozygosity in the HLA region.
The term "induced pluripotent stem cells" or "iPSCs, as used herein, refers to a pluripotent stem cell derived from a postnatal somatic cell by any combination of forced expression of reprogramming factors alone or in combination with one or more reprogramming agents.
The term "mesenchymal stem cell," as used herein, refers to a cell capable of giving rise to differentiated cells in multiple mesenchymal lineages, specifically to osteoblasts, adipocytes, myoblasts and chondroblasts. Generally, mesenchymal stem cells also have one or more of the following properties: an ability to undergo asynchronous, or symmetric replication, that is where the two daughter cells after division can have different phenotypes; extensive self-renewal capacity; and clonal regeneration of the tissue in which they exist, for example, the non-hematopoietic cells of bone marrow.
The terms "patient," "host," and "individual" are used interchangeably herein to refer to any mammalian subject for whom diagnosis or therapy is desired, e.g. primate species, such as humans and chimpanzees; cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on. In preferred embodiments, the species is human. Of particular interest are subjects having a myocardial associated disorder that is amenable to treatment (e.g., to mitigate symptoms associated with the disorder) by the introduction of a vector, or by the grafting of cells (e.g. cardiomyocytes, fibroblasts, endothelial cells, smooth muscle cells, nerve cells, Schwann cells, etc.), that express both subunits of a ribonucleotide reductase (i.e., Rl, R2) into the subject. In many embodiments, the hosts are humans.
"Donor cells," in the context of the present invention, refer to cells derived from a mammalian origin, e.g., primate species, such as humans and chimpanzees; cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, etc., which have the capacity to form or establish gap junctions with cardiomyocytes of a host when grafted to the host
myocardium. Examples of donor cells include, without limitation, fibroblasts and cardiomyocytes. Other examples of donor cells include, but are not limited to, endothelial cells, smooth muscle cells, nerve cells, and Schwann cells. The donor cells can be autogeneic (i.e., from the host to be treated), isogeneic (i.e., a genetically identical but different subject, e.g., from an identical twin), allogeneic (i.e., from a non-genetically identical member of the same species) and/or xenogeneic (i.e., from a member of a different species). Cells may be obtained from a donor (either living or cadaveric) or derived from an established cell line. To obtain cells from a donor, standard biopsy techniques known in the art may be employed. In particular embodiments, a donor cell is any cell type capable of synthesizing and delivering dATP within the heart.
The terms "expression vector" or "vector" refer to a compound (e.g., polynucleotide) and/or composition that transduces, transforms, or infects a host microorganism or cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell, or in a manner not native to the cell. An "expression vector" contains a sequence of nucleic acids (ordinarily RNA or DNA) to be expressed by the host microorganism or cell. Optionally, the expression vector also comprises materials to aid in achieving entry of the nucleic acid into the host microorganism or cell, such as a virus, liposome, protein coating, or the like. The expression vectors contemplated for use in the present invention include those into which a nucleic acid sequence can be inserted, along with any preferred or required operational elements. Further, the expression vector may be one that can be transferred into a host microorganism or cell and replicated therein. Some expression vectors are plasmids, particularly those with restriction sites that have been well documented and that contain the operational elements preferred or required for transcription of the nucleic acid sequence. Such plasmids, as well as other expression vectors, are well known to those of ordinary skill in the art. In some embodiments, the expression vector is a viral vector, e.g. an adeno-associated viral vector.
The term "viral vector," as used herein, encompasses both wild-type and recombinant viral vectors. In particular embodiments, a viral vector is an adenovirus vector, a retroviral vector, an adeno-associated virus vector, a lentiviral vector, a retrovirus, a poliovirus vector, a pox virus vector, a herpes simplex virus vector, a hemaglugglutinatin virus of Japan-liposome (HJV) complex, a Moloney murine leukemia virus, an HIV-virus, or another viral vector, or is based on one of these viruses.
The term "adeno-associated viral vector," as used herein, encompasses both wild-type and recombinant adeno-associated viral vectors, which are nonpathogenic, nonenveloped, DNA virus containing a linear single-stranded genome of about 4.6-4.8 kb that requires coinfection with a helper virus for viral replication. Examples of adeno- associated viral vectors useful in the present invention include, without limitation, an AAV6, AAV2, rAAV2/l, rAAV2/2, rAAV2/3, rAAV2/4, rAAV2/5, rAAV2/6, rAAV2/7 rAAV2/8, rAAV2/9, rAAV2/l 0, AAV1, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV1, AAV12, AAV rhlO, AAV rh39, AAVrh43, rAAVM41, dsAAV, self- complementary AAV (scAAV), etc., and hybrids of any of these different AAVs. Adeno- associated viral vectors and their use in gene transfer applications are reviewed in: Pacak et al. (2011) Molecular Therapy 19(9): 1582-1590; Hansruedi Biieler, Biol. Chem. (June 1999) 380:612 622; Robbins et al, TIBTECH (January 1998) 16:35 40; and Patjin & Kay, Semin. Liver. Dis. (1999) 19: 61 69. Other references of interest include: Burton, et al, Proc Natl Acad Sci USA (1999) 96: 12725 12730; Fan, et al, Hum. Gene Ther. (1998) 9: 2527 2535; Miao et al, Nat. Genet. (May 1998) 19: 13 15; Nakai et al, J. Virol. (July 1999) 73: 5438 5447; and Rendahl, et al, Nat Biotechnol (1998) 16, 757 761; Gregorevic et al. (2004) Systemic delivery of genes to striated muscles using adeno-associated viral vectors. Nature Med 10:828-834; Blankinship et al. (2004) Efficient transduction of skeletal muscle using vectors based on adeno- associated virus serotype 6. Mol Ther 10:671-678;
Blankinship et al (2006) Gene therapy strategies for Duchenne muscular dystrophy utilizing recombinant adeno-associated virus vectors. Mol Ther 13:241-249. and Salva et al. (2007) Design of tissue-specific regulatory cassettes for high-level rAAV-mediated expression in skeletal and cardiac muscle. Mol Ther 15:320-329.
As an illustration, gene therapy vectors based on AAV6 can be generated by cloning a DNA expression cassette (e.g., a promoter/enhancer regulating gene expression linked to a complementary DNA (cDNA) sequence encoding a therapeutic protein or RNA, followed by a transcription terminating signal such as a poly-adenylation sequence; in some cases, the cDNA and promoter are separated by an intron) in between two copies of an adeno- associated virus (AAV) inverted terminal repeat (ITR). This ITR-Expression cassette -ITR genome is referred to as a recombinant AAV (rAAV) genome. The AAV ITR sequences provide a packaging signal for encapsidation into a recombinant AAV particle. The ITR also provides an origin of replication for producing multiple copies of the recombinant AAV genome. DNA containing this recombinant genome can then be co- transfected into a packaging cell line expressing various adenoviral helper proteins
(commonly HEK293 cells) along with plasmid(s) containing the Rep/Cap genes from a wild-type AAV genome as well as additional adenoviral helper functions. AAV does not replicate autonomously, but rather requires the co-infection of a second virus, such as adenovirus, to supply critical helper functions in trans. The AAV ITRs can be derived from a number of different serotypes of wild type AAVs. For example, commonly used ITRs are from AAV serotype 2 (AAV2 ITRs). When generating recombinant AAV6 vectors (rAAV6), the Cap gene from AAV serotype 6 may be used in the co-transfection step. Thus, in certain embodiments, the "AAV6" is a recombinant adeno-associated viral vector carrying AAV2 ITRs flanking an expression cassette, and encapsidated by the AAV6 capsid proteins.
By "promoter" is meant a minimal sequence sufficient to direct transcription in a recombinant cell. "Promoter" is also meant to encompass those elements sufficient for promoter-dependent gene expression controllable for cell-type specific, tissue-specific or inducible by external signals or agents; such elements may be located in the 5 ' or 3' regions of the native gene (e.g., enhancer elements). Examples of promoters include, without limitation, the CK7 promoter, and CMV promoter.
A "cardiac-specific promoter," in the context of the present invention, refers to a wild-type or recombinant promoter that selectively drives expression of a gene under its control in cardiac cells. Examples of cardiac-specific promoters include the a-MHC5.5 promoter, the a-MHC86 promoter, the human cardiac actin promoter, a cTnC promoter, a cTnT promoter, and the cTnT455 promoter described herein.
By "operably linked" or "operatively linked" is meant that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
"Percent sequence identity," "percent amino acid sequence identity," "percent gene sequence identity," and/or "percent nucleic acid/polynucleotide sequence identity," with respect to two amino acids, polynucleotide and/or gene sequences (as appropriate), refer to the percentage of residues that are identical in the two sequences when the sequences are optimally aligned. Thus, 80% amino acid sequence identity means that 80% of the amino acids in two optimally aligned polypeptide sequences are identical. Thus, a "percentage of sequence identity" may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
Calculations of sequence similarity or sequence identity between sequences (the terms are used interchangeably herein) can be performed as follows. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences can be aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In certain embodiments, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%>, 60%>, and even more preferably at least 70%>, 80%>, 90%>, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In some
embodiments, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch, (1970, J. Mol. Biol. 48: 444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package, using an NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. Another exemplary set of parameters includes a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller (1989, Cabios, 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The sequences described herein can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al, (1990, J. Mol. Biol, 215: 403-10). BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25:3389-3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.
By "transformation", "transduction" or "trans fection" is meant a permanent or transient genetic change, preferably a permanent genetic change, induced in a cell following incorporation of new nucleic acid (e.g., DNA or RNA exogenous to the cell). Genetic change can be accomplished either by incorporation of the new nucleic acid into the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element.
By "transformed cell", "transfected cell" or "transduced cell" is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding a protein of interest.
By "overexpressing" or "overexpression" of a gene product (such as a Rl or R2) is meant an increased level of protein expression over a normal level of protein expression for a particular cell or cell type at, for example, a particular developmental stage or stage of differentiation. In certain instances, overexpressing can be a cumulative effect of protein expression from endogenous and recombinant genes or essentially protein expression from a recombinant gene. Overexpression of Rl or R2 is meant to refer to the expression of the respective ribonucleotide reductase protein subunit within a particular cell which is above the expression level normally associated with a normal or wild-type cell at a particular stage of differentiation. In certain embodiments overexpression of a gene product is meant an increase in expression by a factor of at least about 2 fold, in other embodiments at least about 5 fold and yet in still other embodiments, at least about 10 fold.
By "codon-optimized" is meant that a polynucleotide sequence is altered from its native sequence in order to enhance or optimize expression of its encoded protein, e.g., when a polynucleotide sequence derived from a human is being used to produce a protein in a recombinant organism, such as a bacterium. Codon-optimization may effect one or more parameters of a polynucleotide sequence, such as, e.g., codon usage bias, GC content, CpG dinucleotide content, mRNA secondary content, cryptic splicing sites, premature polyA sites, internal chi sites and ribosomal binding sites, negative CpG islands, R A instability motif (ARE), repeat sequences (direct repeat, inverse repeat, and Dyad repeat), or restriction sites that may interfere with cloning. A variety of methods for determining codon optimizing and preparing codon-optimized sequences are known and available in the art.
By "construct" is meant a recombinant nucleic acid, generally recombinant
DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.
As used herein, "polypeptide" refers to an amino acid sequence of a recombinant or non-recombinant polypeptide having an amino acid sequence of i) a native polypeptide, ii) a biologically active fragment of an polypeptide, iii) biologically active polypeptide analogs of an polypeptide, or iv) a biologically active variant of an
polypeptide. Polypeptides useful in the invention can be obtained from any species, e.g., mammalian or non-mammalian (e.g., reptiles, amphibians, avian (e.g., chicken)), particularly mammalian, including human, rodenti (e.g., murine or rat), bovine, ovine, porcine, murine, or equine, preferably rat or human, from any source whether natural, synthetic, semi-synthetic or recombinant. For example, an "Rl polypeptide" refers to the amino acid sequences of isolated human Rl polypeptide obtained from a human, and is meant to include all naturally-occurring allelic variants, and is not meant to limit the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule.
A "variant" of a polypeptide is defined as an amino acid sequence that is altered by one or more amino acids (e.g., by deletion, addition, insertion and/or
substitution). Generally, "addition" refers to nucleotide or amino acid residues added to an end of the molecule, while "insertion" refers to nucleotide or amino acid residues between residues of a naturally- occurring molecule. The variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, added, inserted or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.
The term "targeting agent" refers to a compound that exhibits selectivity for a particular target organ, tissue, or cell-type. A targeting agent is capable of directing a composition, with which it is operatively associated, to a particular target organ or tissue. A targeting agent can be operatively associated with at least one cationic polymeric carrier and/or other agent.
The term "myocardial infarction," as used herein, means a process by which ischemic disease results in a region of the myocardium being replaced by scar tissue.
The term, "ischemic heart disease," as used herein, means any disorder resulting from an imbalance between the myocardial need for oxygen and the adequacy of the oxygen supply. Most cases of ischemic heart disease result from narrowing of the coronary arteries, as occurs in atherosclerosis or other vascular disorders.
The term "heart failure," as used herein, refers to impaired cardiac function. In particular embodiments, "heart failure" renders the heart unable to maintain the normal blood output at rest or with exercise, or to maintain a normal cardiac output in the setting of normal cardiac filling pressure. In particular embodiments, the "heart failure" is systolic heart failure, e.g., systolic heart failure with a depressed ejection fraction, in which the heart has a depressed ejection fraction. A left ventricular ejection fraction of about 40% or less is one indication of heart failure. In particular embodiments, the "heart failure" is diastolic heart failure, in which the ejection fraction may be normal or nearly normal.
Patients with heart failure may display well-known clinical symptoms and signs, such as tachypnea, pleural effusions, fatigue at rest or with exercise, contractile dysfunction, and edema. Relative severity and disease progression are assessed using well known methods, such as physical examination, echocardiography, radionuclide imaging, invasive hemodynamic monitoring, magnetic resonance angiography, and exercise treadmill testing coupled with oxygen uptake studies.
The term "cardiomyopathy," as used herein, refers to a a cardiovascular disorder. In some embodiments, the cardiomyopathy is selected from a primary
cardiopathology or a secondary cardiopathology. The cardiomyopathy may be selected from a genetic cardipoathology, a hypertrophic cardiomyopathy, an ischemic
cardiomyopathy, a restrictive cardiomyopathy, and a dilated cardiomyopathy. In
embodiments involving the improvement of cardiac function in an individual with hypertrophic cardiomyopathy, the cardiomyopathy may have resulted from: (a) post- myocardial infarction remodeling, (b) cardiac valve disease; (c) sustained cardiac afterload; (d) myocarditis; or (e) familial hypertrophic cardiomyopathy.
As used herein, the term "Cardiac Troponin C" or "cTnC" refers to a polypeptide of the troponin complex having multiple calcium-binding sites. In a preferred embodiment, cTnC refers to human cTnC (Entrez Ref: NP 003271), encoded by the TNNC1 gene (Entrez Ref: NM_003280.2), or conservative variants, splice variants, or tagged variants thereof.
As used herein, the term "Ribonucleotide Reductase Complex," "RR," or
"RNR" refers to a heterodimeric tetrameric polypeptide complex containing the RNR1 (also referred to herein as "Rl" or "Rml" or "RRMl") and RNR2 (also referred to herein as "R2" or "Rm2" or "RRM2") subunits. In certain embodiments, the Rl subunit refers to the human ribonucleotide reductase Ml subunit ("hRRMl"; Entrez Ref: AAD37491.1), encoded by the RRM1 gene (Entrez Ref: AF107045.1) or conservative variants, splice variants, or tagged variants thereof. The R2 subunit may refer to either the ribonucleotide reductase M2 subunit or the ribonucleotide reductase M2 B subunit. In one embodiment, R2 refers to the human ribonucleotide reductase M2 subunit ("hRRM2"; Entrez Ref:
AAK51163), encoded by the RRM2 gene (Entrez Ref: AY032750.1). In other
embodiments, R2 refers to the human ribonucleotide reductase M2 B subunit isoform 1 ("RRM2B"; Entrez Ref: NP 056528.2), encoded by the RRM2B gene (Entrez Ref: NM 015713.4); the human ribonucleotide reductase M2 B subunit isoform 2 (Entrez Ref: NP 001165948.1), encoded by the RRM2B gene (Entrez Ref: NM 001172477); or the human ribonucleotide reductase M2 B subunit isoform 3 (Entrez Ref: NPOOl 165949), encoded by the RRM2B gene (Entrez Ref: NM 001172478.1); or conservative variants, splice variants, or tagged variants thereof of any of the foregoing.
Abbreviations
cTnC = cardiac troponin C
cTnT = cardiac troponin T
koff = rate of calcium dissociation
NRC = neonatal rat cardiomyocyte
ARC = adult rat cardiomyocyte
GFP = green fluorescent protein
RT50, RT90 = time to 50% and 90% relaxation
DT50, DT90 = time to 50% and 90% Ca2+ decay
WT = wild-type
RRMl or Rl = ribonucleotide reductase subunit Ml
RRM2 or Rl = ribonucleotide reductase subunit M2
Gene therapy is a new option for treatment of heart failure (HF). Several gene therapies have been developed to improve cardiac performance in HF models by targeting calcium and adrenergic signaling, including the overexpression of
sarcoplasmic/endoplasmic reticulum calcium ATPase (SERCA2a) which regulates calcium movement between the cytoplasm and the sarcoplasmic reticulum (SR),1"3 S100A which modifies SR calcium handling,4' 5 β-adrenergic receptor kinase (β-ARKct) which restores β-adrenergic receptor signaling,6' 7 small ubiquitin-related modifier 1 (SUMO-1) which regulates SERCA2a through post transcriptional modification,8 and an inhibitor of protein phosphatase 1 (I-lc) which regulates de-phosphorylation of phospholamban.9' 10 All of these gene therapies have employed adeno-associated virus (AAV) vectors to deliver their respective transgene. SERCA2a (Mydicar) is the most advanced of these gene therapies, and a clinical trial has shown it mediates beneficial effects on cardiac function as well as a decrease in hospitalizations.11' 12
Certain aspects of the present invention relate to Ribonucleotide Reductase (RNR) gene therapy, which, in contrast, is independent of calcium and adrenergic signaling and instead, works to directly increase contractility by producing 2-deoxy-adenosine triphosphate (dATP) for myosin activity. Overexpression of RNR represents an entirely novel gene therapy concept for HF, where the gene product does not, in itself, produce the therapeutic effect. RNR is an essential enzyme that catalyzes the de novo synthesis of deoxyribonucleotide triphosphates (dNTPs), used principally for DNA synthesis and repair. The enzyme is a heterotetramer of two subunits, Rml and Rm2.13
It has been demonstrated that small elevations of cytoplasmic levels of dATP increase force generation, cross bridge cycling and calcium sensitivity in skinned rat cardiomyocytes,14' 15 and in myocardium from failing human hearts.16 These results were obtained with increases in dATP concentration as small as ~1.5% of the total adenosine triphosphate nucleotide pool. In addition, it has been shown that overexpression of RNR in rat cardiomyocytes,17 transgenic mice18 and human-derived cardiomyocytes19 enhanced cardiac contraction via the increase of dATP. dATP is minimally available as a contractile substrate in mature cardiomyocytes because RNR transcription is down-regulated in non- replicating cells.
The present invention provides an advantageous gene therapy vectors to deliver human cDNA for Rml and Rm2 from single transgene constructs. As shown in the accompanying Examples, one construct, designated BB-R12, causes the up-regulation of expression of Rml and Rm2 exclusively in cardiomyocytes under the control of the cardiac troponin T (cTnT) promoter. Transcription occurs via a single mR A with the
incorporation of a 2 A sequence, resulting in the independent translation of both proteins that form the active heterotetrameric enzymes. By expressing the transgene restricted to the heart tissue via a cardiac specific promoter, the potential for non-cardiac effects is minimized and direct targeting of the cardiac muscle myofibrils is achieved.
In particular embodiments, the composition, e.g., vectors, and methods of the present invention provide advantages for improving cardiac function in a subject in need thereof, e.g., a subject diagnosed with cardiomyopathy or heart failure, e.g., systolic heart failure or diastolic heart failure. In particular embodiments, the compositions, e.g., vectors, and methods of the present invention provide for improved left ventricle ejection fraction, improved left ventricle fractional shortening, improved left ventricle end-systolic dimension, improved left-ventricle end-diastolic pressure, improved dP/dT and/or improved -dP/dT in treated cells, tissues or subjects. In particular embodiments, the compositions, e.g., vectors, and methods of the present invention cause no substantial or no significant humoral or cellular immune response in a treated subject.
Rl and R2 Polynucleotide Cassettes and Vectors
In certain embodiments, the present invention provides expression cassettes encoding a Rl protein (e.g., a RRMl polypeptide) and/or a R2 protein (e.g., a RRM2 polypeptide). In certain embodiments, these expression cassettes are provided to a subject in need thereof, e.g., to increase the amount of ribonucleotide reductase (RR) complex in a cardiac tissue of the subject, thus, enhance cardiac function in the subject. It is understood that in each illustrative embodiment described herein, the RRMl and/or RRM2 protein may alternatively be a different Rl or R2 protein, respectively, or variants thereof.
In certain embodiments, an expression cassette of the present invention produces both a RRMl protein and a RRM2 protein. In particular embodiments, the gene cassettes comprise a polynucleotide sequence comprising in the 5' to 3' direction: (a) a promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide; and (c) a second sequence encoding a RRM1 polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRM1 polypeptide, the second sequence of (c) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2
polypeptide, the second sequence of (c) encodes a RRM1 polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (c). In one embodiment, the first sequence of (b) encodes a RRM1 polypeptide, and the second sequence of (c) encodes a RRM2 polypeptide. In another embodiment, the first sequence of (b) encodes a RRM2 polypeptide, and the second sequence of (c) encodes a RRMl polypeptide.
In particular embodiments, the polynucleotide sequence also comprises an internal ribosome entry site (IRES) sequence or a sequence encoding a 2A peptide between the first sequence and the second sequence. IRES sequences and 2 A peptides are typically used to enhance expression of multiple proteins from the same vector. A variety of IRES sequences are known and available in the art and may be used in the expression cassettes, including, e.g., the encephalomyocarditis virus IRES. A variety of 2A peptides are known and available in the art and may be used, including e.g., the foot and mouth disease virus (FMDV) 2A peptide, the equine rhinitis A virus 2A peptide, the Thosea asigna virus 2A peptide, and the porcine teschovirus-1 2A peptide. 2A peptides are used by several viruses to generate two proteins from one transcript by ribosome-skipping, such that a normal peptide bond is impaired at the 2A peptide sequence, resulting in two discontinuous proteins being produced from one translation event. In one illustrative embodiment, a 2A peptide is encoded by the following sequence: 5'-
TCCGGACTCAGATCCGGGGATCTCAAAATTGTCGCTCCTGTCAAACAAACTCTT AACTTTGATTTACTCAAACTGGCTGGGGATGTAGAAAGCAATCCAGGTCCACT
C-3'(SEQ ID NO:7). In related embodiments, a 2A peptide is encoded by a variant having at least 90%, at least 95%, at least 98% or at least 9% identity to this sequence. In another embodiment, the 2A peptide is encoded by the indicated sequence shown in Figure 16, or a variant thereof having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the indicated sequence of Figure 16. In certain embodiments, an expression cassette of the present invention produces either a RRM1 protein or a RRM2 protein (but not both). In particular embodiments, the gene cassettes comprise a polynucleotide sequence comprising in the 5 ' to 3' direction: (a) a promoter sequence; and (b) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide or a ribonucleotide reductase subunit M2
(RRM2) polypeptide, wherein the promoter sequence is operably linked to the sequence of (b). In one embodiment, the sequence of (b) encodes a RRM1 polypeptide. In another embodiment, the sequence of (b) encodes a RRM2 polypeptide.
In certain embodiments, expression cassettes of the present invention comprise a cardiac-specific promoter, such as a cardiac troponin T (cTnT) promoter or a cardiac troponin C (cTnC) promoter. The cTnT promoter has been characterized as having a minimal promoter about 99 nucleotides upstream of the transcription initiation site, including two tandem copies of a conserved hexanucleotide sequence (5'-CATTCCT-3') termed the "M-CAT motif and an additional about 48 nucleotide region approximately 100 nucleotides upstream from the minimal promoter termed the "cardiac element." In addition, a third regulatory region located about 500 to 268 nucleotides upstream of the transcription initiation site enhances activity of the cTnT promoter by three- to five-fold. This region is thought to include two distinct enhancer sequences located about 335-289 (module D) and 249-209 (module F) nucleotides upstream of the transcription initiation site, respectively, and referred to herein as El and E2. In particular embodiments, the cardiac-specific promoter is a cTnT promoter and includes the El and E2 enhancer sequences. In one embodiment, the cTnT promoter is the cTnT455 promoter. In particular embodiments, the promoter is located upstream or 5 ' to the polynucleotide sequences encoding the RRM1 and/or RRM2 polypeptides. In particular embodiments, the promoter is operably linked to the polynucleotide sequences encoding the RRMl and/or RRM2 polypeptides, such that it drives expression of the polypeptides, e.g., in human cardiac cells, such as cardiomyocytes. In certain embodiments provided herein, the nucleic acid encoding Rl and/or R2 subunits of the RR complex further comprises a cardiac- specific promoter operably linked to the nucleotide sequence encoding the Rl and/or R2 subunits. In particular embodiments, the cTnT promoter comprises or consists of the cTnT sequence shown in Figure 16, or has at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity to the cTnT promoter sequence shown in Figure 16 or SEQ ID NO:8. In particular embodiments, the cTNT promoter comprises or consists of the region of the cTnT sequence shown in Figure 16 or SEQ ID NO: 8 corresponding to about nucleotides 1-585, nucleotides 1-645, nucleotides 16-145, nucleotides 150-311, 478-582, or has at least 85%, at least 90%>, at least 95%, at least 98%>, or at least 99% sequence identity to the any of these regions of the cTnT promoter sequence shown in Figure 16 or SEQ ID NO:8.
In particular embodiments, the expression cassette further comprises a polyadenylation sequence, e.g., a polyA tail. In certain embodiments, the polyadenylation sequence is located at the 3' end of the sequence encoding the RRMl polypeptide and/or the RRM2 polypeptide. In certain embodiments, the polyA sequence is the indicated polyA sequence shown in Figure 16, or is a variant having at least 85%, at least 90%, at least 95%), at least 98%, or at least 99% sequence identity to the polyA sequence shown in Figure 16.
In particular embodiments, the RRMl polypeptide is a human RRMl polypeptide or a variant thereof. In particular embodiments, the RRM2 polypeptide is a human RRM2 polypeptide or a variant thereof. In certain embodiments the sequence encoding the RRMl polypeptide and/or the RRM2 polypeptide is codon-optimized. In certain embodiments, the RRMl polypeptide and/or RRM2 polypeptide is codon-optimized to enhance or increase expression in a human cell, e.g., a human cardiac cell, such as a cardiomyocyte. In particular embodiments, the RRMl polypeptide comprises, consists essentially of, or consists of the polypeptide sequence set forth in Entrez Ref:
AAD37491.1 , or a variant thereof having at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity. In particular embodiments, the RRM2 polypeptide comprises, consists essentially of, or consists of the polypeptide sequence set forth in Entrez Ref: AAK51163, Entrez Ref: NP 056528.2, Entrez Ref: NP 001165948.1, or Entrez Ref:
NP001165949, or a variant thereof having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of these sequences. In certain embodiments, the RRM1 polypeptide is encoded by a polynucleotide that comprises, consists essentially of, or consists of the polynucleotide sequence set forth in Entrez Ref: AF 107045.1 or a variant thereof having at least 90%>, at least 95%, at least 98%, or at least 99% sequence identity. In certain embodiments, the RRM2 polypeptide is encoded by a polynucleotide that comprises, consists essentially of, or consists of the polynucleotide sequence set forth in Entrez Ref: AY032750.1, Entrez Ref: NM_015713.4, Entrez Ref:NM_0011724779, or Entrez Ref: NM_001172478.1, or a variant thereof having at least 90%, at least 95%, at least 98%), or at least 99% sequence identity to any one of these sequences.
In particular embodiments, a polynucleotide encoding an RRMl polypeptide comprises, consists essentially of, or consists of the polynucleotide sequence set forth in SEQ ID NO: 1 or Figure 4 (or the shaded region thereof), or SEQ ID NO:5 or Figure 8 (as identified therein), SEQ ID NO:6 or Figure 9 (as identified therein), SEQ ID NO: 8 or Figure 16 (as identified therein), or a variant thereof having at least 90%, at least 95%), at least 98%, or at least 99% sequence identity to any one of these sequences. In particular embodiments, a polynucleotide encoding an RRM2 polypeptide comprises, consists essentially of, or consists of the polynucleotide sequence set forth in SEQ ID NO:2 or Figure 5 (or the shaded region thereof), SEQ ID NO:5 or Figure 8 (as identified therein), SEQ ID NO: 6 or Figure 9 (as identified therein), or SEQ ID NO: 8 or Figure 16 (as identified thereof), or a variant thereof having at least 90%, at least 95%, at least 98%, or at least 99%) sequence identity to any one of these sequences. In particular embodiments, a codon-optimized sequence encoding an RRMl polypeptide comprises, consists essentially of, or consists of the sequence set forth in Figure 6 or SEQ ID NO: 3. In particular embodiments, a codon-optimized sequence encoding an RRM2 polypeptide comprises, consists essentially of, or consists of the sequence set forth in Figure 7 or SEQ ID NO:4.
In particular embodiments, a gene cassette is flanked by an inverted terminal repeat (ITR) sequence. In one embodiment, the gene cassette is flanked by a first inverted terminal repeat (ITR) sequence 5' of the cardiac specific promoter sequence, and a second ITR sequence 3' of the a second sequence encoding the RRMl polypeptide or the RRM2 polypeptide. In certain embodiments, a gene cassette flanked by ITRs has any of the various structures schematically illustrated in Figure 10. In particular embodiments, the ITRs are AAV2 ITR sequences. In certain embodiments, an expression cassette comprises, consists of, or consists essentially of, the sequence provided in SEQ ID NO:8.
The present invention further comprises isolated polynucleotides comprising any of the gene cassettes described herein, with or without flanking ITR sequences. In particular embodiments, the polynucleotides may be single-stranded. In other
embodiments, the polynucleotides are double-stranded, e.g., they further comprise a complementary strand. In certain embodiments, the polynucleotides are RNA or DNA. In certain embodiments, the present invention includes a polynucleotide comprising, consisting essentially of, or consisting of the sequence set forth in Figure 8 or Figure 9. In certain embodiments, the polynucleotide, consists of, or consists essentially of, the sequence provided in SEQ ID NO:8.
The present invention also includes vectors, e.g., expression vectors comprising one or more of the gene cassettes described herein, with or without flanking ITR sequences. In certain embodiments, the vector comprises a transposon, a plasmid, or a viral vector. In certain embodiments, the present invention includes a vector comprising, consisting essentially of, or consisting of the sequence set forth in Figure 8 or Figure 9. In certain embodiments, the polynucleotide, consists of, or consists essentially of, the sequence provided in SEQ ID NO :8.
Examples of suitable viral delivery systems include, but are not limited to, adeno-associated virus (AAV), adenovirus, helper-dependent adenovirus, retrovirus, herpes simplex virus, lentivirus, poxvirus, hemagglutinatin virus of Japan-liposome (HVJ) complex, Moloney murine leukemia virus, and HIV-based virus. Viral vectors may be engineered to be optimized for use with the compositions and methods of the disclosure. For example, viral vectors derived from adenovirus (Ad) or adeno-associated virus (AAV) may be used. Both human and non-human viral vectors can be used and the recombinant viral vector can be altered such that it may be replication-defective in humans. To combine advantageous properties of two viral vector systems, hybrid viral vectors may be used to deliver a nucleic acid to a target cell or tissue. Standard techniques for the construction of hybrid vectors are well-known to those skilled in the art. Such techniques can be found, for example, in Sambrook, et al., In Molecular Cloning: A laboratory manual. Cold Spring Harbor, N. Y. or any number of laboratory manuals that discuss recombinant DNA technology. Double-stranded AAV genomes in adenoviral capsids containing a combination of AAV and adenoviral ITRs may be used to transduce cells. In another variation, an AAV vector may be placed into a "gutless", "helper- dependent" or "high-capacity" adenoviral vector. Retroviral genomes contained within an adenovirus may integrate within the target cell genome and effect stable gene expression. Replication-defective recombinant adenoviral vectors can be produced in accordance with known techniques.
Examples of retroviral vectors include Moloney murine leukemia viruses and HIV -based viruses. Retroviruses, such as C-type retroviruses and lentiviruses, may also be used in the disclosure. For example, retroviral vectors may be based on murine leukemia virus (MLV). MLV-based vectors may contain up to 8 kb of heterologous (therapeutic) DNA in place of the viral genes. Additional retroviral vectors may be used including but not limited to replication-defective lentivirus-based vectors, including human
immunodeficiency (HlV)-based vectors. Lentiviral vectors may be advantageous in that they are capable of infecting both actively dividing and non-dividing cells. They may also be highly efficient at transducing human epithelial cells.
In some cases a HIV -based viral vector may be used, e.g., wherein the HIV- based viral vector comprises at least two vectors wherein the gag and pol genes are from an HIV genome and the env gene is from another virus.
In certain embodiments, DNA viral vectors may be used. These vectors include pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as a herpes simplex I virus (HSV) vector.
Examples of some other viral vectors that can be used in accordance with the present disclosure include herpes simplex virus (HSV)-based vectors. HSV vectors deleted of one or more immediate early genes (IE) are advantageous because they are generally non-cytotoxic, persist in a state similar to latency in the target cell, and afford efficient target cell transduction. Recombinant HSV vectors can incorporate approximately 30 kb of heterologous nucleic acid.
Lentiviral vectors for use in the disclosure may be derived from human and non-human (including SIV) lentiviruses. Examples of lentiviral vectors include nucleic acid sequences required for vector propagation as well as a tissue-specific promoter operably linked to an anti-VEGF protein gene. Nucleic acid sequences may include the viral LTRs, a primer binding site, a polypurine tract, att sites, and an encapsidation site. A lentiviral vector may be packaged into any suitable lentiviral capsid. The substitution of one particle protein with another from a different virus is referred to as "pseudotyping". The vector capsid may contain viral envelope proteins from other viruses, including murine leukemia virus (MLV) or vesicular stomatitis virus (VSV). The use of the VSV G-protein yields a high vector titer and results in greater stability of the vector virus particles.
Alphavirus-based vectors, such as those made from semliki forest virus
(SFV) and sindbis virus (SIN), may also be used.
Recombinant, replication-defective alphavirus vectors may be advantageous because they are capable of high-level heterologous (therapeutic) gene expression, and can infect a wide target cell range. Alphavirus replicons may be targeted to specific cell types by displaying on their virion surface a functional heterologous ligand or binding domain that would allow selective binding to target cells expressing a cognate binding partner. Alphavirus replicons may establish latency, and therefore long-term heterologous nucleic acid expression in a target cell. The replicons may also exhibit transient heterologous nucleic acid expression in the target cell.
In some embodiments, the viral vector is an adenovirus vector, a retroviral vector, an adeno-associated virus vector, a lentiviral vector, a retrovirus, a poliovirus vector, a pox virus vector, a herpes simplex virus vector, a hemaglugglutinatin virus of Japan-liposome (HJV) complex, a Moloney murine leukemia virus, an HIV-virus, or another viral vector, or is based on one of these viruses. In some embodiments, the vector is an AAV vector, e.g., AAV6, AAV2, rAAV2/l, rAAV2/2, rAAV2/3, rAAV2/4, rAAV2/5, rAAV2/6, rAAV2/7 rAAV2/8, rAAV2/9, rAAV2/l 0, AAV1, AAV3, AAV4, AAV5, AAV7, AAV8, AAV9, AAV10, AAV1, AAV 12, AAV rhlO, AAV rh39, AAVrh43, rAAVM41, a dsAAV, a self-complementary AAV (scAAV), etc., and hybrids of any of these different AAVs. In some embodiments, a viral vector further comprises a CMV promoter operably linked to the sequence encoding the R M1 polypeptide and/or RRM2 polypeptide.
In some cases, the viral vector of the disclosure may be measured as pfu (plaque forming units). In some cases, the pfu of recombinant virus, or viral vector of the compositions and methods of the disclosure may be about 108 to about 5xl010 pfu. In some cases, recombinant viruses of this disclosure are about, at least about, or at most about lxlO8, 2xl08, 3xl08, 4xl08, 5xl08, 6xl08, 7xl08, 8xl08, 9xl08, lxlO9, 2xl09, 3xl09, 4xl09, 5xl09, 6xl09, 7 xlO9, 8 xlO9, 9 xlO9, lxlO10, 2 xlO10, 3 xlO10, 4 xlO10, and 5 xlO10 pfu.
In some cases, the viral vector of the disclosure may be measured as vector genomes. In some cases, recombinant viruses of this disclosure are lxlO10 to 3xl012 vector genomes. In some cases, recombinant viruses of this disclosure are lxlO9 to 3xl013 vector genomes. In some cases, recombinant viruses of this disclosure are 1x108 to 3xl014 vector genomes. In some cases, recombinant viruses of the disclosure are about, at least about, or at most about 1x101, lxlO2, 1x103, 1x104, lxlO5, 1x106, lxlO7, lxlO8, 1x109, lxlO10, lxlO11, lxlO12, lxlO^, lxlO14, lxlO15, lxlO16, 1x10^, and lxlO18 vector genomes. In some cases, recombinant viruses of this disclosure are lxl08 to 3xl014 vector genomes.
In some cases, the viral vector of the disclosure may be measured using multiplicity of infection (MOI). In some cases, MOI may refer to the ratio, or multiple of vector or viral genomes to the cells to which the nucleic may be delivered. In some cases, the MOI may be lxlO6. In some cases, the MOI may be Ixl05-lxl07. In some cases, the MOI may be Ixl04-lxl08. In some cases, recombinant viruses of the disclosure are about, at least about, or at most about lxlO1, lxlO2, lxlO3, lxlO4, lxlO5, lxlO6, lxlO7, lxlO8, lxlO9, lxl010, 1x1011, 1x10^, lxlO13, lxlO14, lxlO15, lxlO16, 1x10^, and lxlO18 MOI. In some cases, recombinant viruses of this disclosure are Ixl08 to 3xl014 MOI. In one embodiment, the vector is a viral vector (e.g., an AAV6 vector) that comprises a polynucleotide sequence comprising in the 5' to 3' direction: (a) an AAV2 ITR; (b) a cardiac promoter (e.g., a cTnT promoter) sequence; (c) a sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide; (d) a sequence encoding a 2 A peptide; (e) a sequence encoding a ribonucleotide reductase M2 (RRM2) polypeptide; and (f) an AAV2 ITR. In one embodiment, the vector comprises the sequence set forth in Figure 8.
In one embodiment, the vector is a viral vector (e.g., an AAV6 vector) that comprises a polynucleotide sequence comprising in the 5' to 3' direction: (a) an AAV2 ITR; (b) a cardiac promoter (e.g., a cTnT promoter) sequence; (c) a sequence encoding a ribonucleotide reductase subunit M2 (RRM2) polypeptide; (d) a sequence encoding a 2A peptide; (e) a sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide; and (f) an AAV2 ITR. In one embodiment, the vector comprises the sequence set forth in Figure 9.
In particular embodiment, a polynucleotide sequence, cassette, or vector of the present invention comprises a sequence provided in Figure 8, Figure, or Figure 16, or a variant thereof having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of these sequences.
In certain embodiments, a vector comprises a nanoparticle associated with a gene cassette described herein.
In certain embodiments, a vector comprises a cell comprising a gene cassette described herein, e.g., a nucleic acid encoding a RRMl polypeptide and/or a RRM2 polypeptide. In one embodiment, the cell is a cardiomyocyte. In a specific embodiment, the cardiomyocyte is derived from a pluripotent embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC), or a mesenchymal stem cell. In one embodiment, the (iPSC) is derived from a cell harvested from the individual to whom the vector is to be administered. In a specific embodiment, the cell harvested from the individual is a skin fibroblast. In one embodiment, the vector further comprises a sequence encoding a transduction reporter, or a targeting agent having affinity for a cardiac tissue-specific marker. In a specific embodiment, the targeting agent is selected from the group consisting of an antibody, an antibody fragment, and an aptamer.
In other embodiments, the present invention comprises a pharmaceutical composition comprising a vector or gene cassette comprising a polynucleotide encoding a R M1 polypeptide and/or a RRM2 polypeptide, including any of those described herein, and a pharmaceutically acceptable carrier, diluent or excipient. In particular embodiments, the vector is a viral vector. In particular embodiments, the vector is a cell. In one aspect, the pharmaceutical composition is for improving the cardiac function in an individual in need thereof
In particular embodiment, the present invention further includes methods for recombinantly producing the polynucleotides, expression cassettes, vectors, and cells of the present invention. Methods for producing gene cassettes and polynucleotides of the invention are well known in the art and employ standard molecular biology techniques. In particular embodiments, the methods comprise subcloning the various sequences of the polynucleotides in the specific order described herein into a vector.
In particular embodiments, the present invention also comprises kits comprising a polynucleotide sequence, vector, cell or pharmaceutical composition of the present invention, which may further comprise instructions regarding the use of the polynucleotide sequence, vector, cell or pharmaceutical composition to increase cardiac function or treat a cardiac disease or disorder in a subject in need thereof. In particular embodiments, the kit further comprises a reagent for detection of the vector or polypeptides expressed therefrom, such as, e.g., an antibody that binds to a Rl or R2 polypeptide or to a RR complex, or an antibody that binds to a marker protein (e.g., transduction reporter) expressed from the vector.
Methods of Treating and Preventing Cardiac Diseases and Disorders The present invention further provides methods of improving cardiac function and/or treating a variety of cardiac diseases and disorders using the gene cassettes, vectors and pharmaceutical compositions described herein. In certain embodiments, the compositions and methods of the invention are used to improve cardiac function, myocardial contractility and relaxation in a subject, e.g., a mammal, in need thereof. In particular embodiments, a subject is a mammal, e.g., a human. In particular embodiments, they improve left ventricle ejection fraction, left ventricle fractional shortening, left ventricle end-systolic dimension, left-ventricle end-diastolic pressure, dP/dT and/or -dP/dT in treated cells, tissues or subjects.
Cellular production of dATP normally proceeds in mammalian cells by action of the ribonucleotide reductase (R1R2) enzyme, which removes a hydroxyl moiety from the 2- position on the ribose ring of ADP to produce dADP. dADP is then rapidly converted to dATP. Elevated cytosolic levels of 2 deoxy-ATP (dATP) increase crossbridge binding and cyclic kinetics, resulting in greatly increased contractile properties without perturbations in intracellular calcium. dATP concentration can be increased in failing cardiomyocytes by the forced overexpression of ribonucleotide reductase (RR), the rate- limiting enzyme in its production, using gene therapy approaches. As demonstrated, transfection limited to a small area of the left ventricular (LV) wall (by direct viral vector injection) results in a substantial increase in LV function.
Furthermore, because dATP readily passes through gap junctions and only low concentrations are required for enhanced force (<1% of the cellular adenine nucleotide pool), the present invention provides a method for delivering dATP to failing myocardium by transplanting a second cell type that has been genetically modified to overexpress Rl and/or R2 and is capable of forming gap junction connections with the target host myocardium. Because of their amenability to such genetic modification, tremendous capacity for expansion, and ability to form stable intra-cardiac implants that express the appropriate connexin isoforms, cardiomyocytes derived from human ESCs or iPSCs represent an ideal dATP donor. For example, in one embodiment, skin fibroblasts are obtained from a heart failure patient, reprogramed into iPSCs, and then modified by inserting a construct in which a cardiac- specific promoter drives expression of Rl and/or R2. In one embodiment, this method uses zinc finger nuclease-mediated transgenesis (which allows targeting of a well-characterized, "safe -harbor" locus in the genome) to insert the construct. After screening and expansion of the appropriately targeted iPSC clones, these cells are differentiated into cardiomyocytes and then implanted (e.g., by use a catheter) into the failing heart. Advantageously, this strategy does not require the formation of a large cardiac graft, nor does the graft need to be implanted within the hostile environment of an infarct scar. Instead, because the purpose of the graft is to deliver dATP, and not to produce force, a modest graft implanted in the well- vascularized distant myocardium might suffice. This is just one of many potential approaches and in no way limits the scope of the present invention. For example, in certain embodiments, other donor cell types (e.g., mesenchymal stem cells) may be used in the methods provided herein. Similarly, in certain embodiments, other methods of transgenesis (e.g., transposon, plasmid, or viral delivery) may be used. Advantages of the present invention can be achieved by overexpression of Rl and/or R2, which form the ribonucleotide reductase complex, resulting ultimately in the production of dATP in situ.
In certain embodiments, the expression of both Rl and R2 from a single expression construct or vector, e.g., which expresses a peptide 2A sequence between Rl and R2, is associated with greater increases in RR complexes in cells or tissues of the subject, as compared to when Rl is expressed from a first expression construct or vector and R2 is expressed from a second construct or vector. In particular embodiments, the increase in RR complexes is at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater when both Rl and R2 are expressed from the single expression construct or vector as compared to from two different expression constructs or vectors.
In certain embodiments, the polynucleotides of the present invention that comprise sequences encoding both Rl and R2 subunits, e.g., RRMl and RRM2, and further comprising a sequence encoding a 2A peptide or IRES, result in increased transfection or transduction efficiency as compared to when separate expression constructs are used for Rl and R2. In particular embodiments, the transfection or transduction is at least at least 2%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater.
In particular embodiments wherein methods of the present invention are practiced using polynucleotide sequences, e.g., expression vectors, that express only one of Rl or R2 (e.g., RRMl or RRM2), transfection or transduction efficiency, and/or expression of the encoded subunit is greater than when both Rl and R2 subunits are expressed, either from the same vector or two different vectors. In particular embodiments, the transfection or transduction efficiency, and/or expression level is at least 5%, at least 10%>, at least 20%>, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% greater.
Methods of the present invention that utilize only one expression construct or vector also offer cost and efficiency advantages over methods that require the production and transfection/transduction of two separate expression constructs or vectors.
In certain embodiments, a vector for expressing a RRMl polypeptide and/or a RRM2 polypeptide is administered to the subject directly. In other embodiments, cells, e.g., cardiomyocytes, fibroblasts, endothelial cells, smooth muscle cells, nerve cells, or Schwann cells, transfected with a vector for expressing a RRMl polypeptide and/or a RRM2 polypeptide is grafted to a mammalian myocardium. Without wishing to be bound to any particular theory, it is believed that overexpression of Rl and R2 subunits leads to formation of the RR complex, which in turn generates dATP. Furthermore, overexpression of the Rl subunit leads to increased RR complex through the overexpressed Rl
polypeptide forming a complex with endogenous R2 polypeptide, particularly when the endogenous R2 polypeptide exists in excess of the endogenous Rl polypeptide. Similarly, overexpression of the R2 subunit leads to increased RR complex through the overexpressed R2 subunit forming a complex with endogenous Rl polypeptide, particularly when the endogenous Rl polypeptide exists in excess of the endogenous R2 polypeptide. In certain embodiments of the methods described herein, the subject being treated has a heart condition resulting in reduced contraction. In one embodiment, the subject has been diagnosed with ischemic heart disease, a cardiomyopathy, or a myocardial infarction. In one embodiment, the cardiomyopathy is a primary cardiomyopathy, a genetic
cardiomyopathy, a dilated cardiomyopathy, or a hypertrophic cardiomyopathy. In one embodiment, the subject has been diagnosed with reduced systolic function. In one embodiment, the subject has an infarcted heart. In certain embodiments, the subject has been diagnosed or considered at risk for a cardiovascular disease, such as, e.g., myocardial infarction, ischemia/reperfusion injury, diabetes, high blood pressure, or hypertrophic and dilated cardiomyopathy
In one aspect, the present invention provides a method for improving cardiac function in a subject in need thereof, comprising administering a vector encoding a RRMl polypeptide and/or a RRM2 polypeptide to the subject. In various embodiments, the vector is any of the vectors described herein. In particular embodiments, the vector is administered to cardiac tissue of the subject.
In one embodiment, the vector administered to the subject expresses both a RRMl polypeptide and a RRM2 polypeptide. In particular embodiments, both
polypeptides are expressed from the same promoter, e.g., a cardiac-specific promoter. In particular embodiments wherein the vector expresses both a RRMl polypeptide and a RRM2 polypeptide, the vector comprises an IRES or sequence encoding a 2A peptide between the regions encoding the RRMl polypeptide and the RRM2 polypeptide.
In one particular embodiment, the vector comprises a polynucleotide sequence having in the 5 ' to 3 ' orientation (a) a promoter sequence; (b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide; and (c) a second sequence encoding a RRMl polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRMl polypeptide, the second sequence of (c) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2 polypeptide, the second sequence of (c) encodes a RRMl polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (c). In one embodiment, the first sequence of (b) encodes a RRMl polypeptide, and the second sequence of (c) encodes a RRM2 polypeptide. In another embodiment, the first sequence of (b) encodes a RRM2
polypeptide, and the second sequence of (c) encodes a RRMl polypeptide.
In one particular embodiment, the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); (b) a first sequence encoding a ribonucleotide reductase subunit Ml (e.g., RRMl) polypeptide; (c) a sequence encoding a 2A peptide; and (d) a second sequence encoding a ribonucleotide reductase subunit M2 (e.g., RRM2) polypeptide , wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d).
In one particular embodiment, the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); (b) a first sequence encoding a ribonucleotide reductase subunit M2 (RRM2) polypeptide; (c) a sequence encoding a 2A peptide; and (d) a second sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide, wherein the promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d).
In one particular embodiment, the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); and (b) a sequence encoding a ribonucleotide reductase subunit Ml (e.g., RRMl) polypeptide, wherein the promoter sequence is operably linked to the sequence of (b).
In one particular embodiment, the vector comprises a polynucleotide sequence having in the 5' to 3' orientation: (a) a cardiac-specific promoter sequence (e.g., a cTnT or a cTnCl promoter sequence); and (b) a sequence encoding a ribonucleotide reductase subunit M2 (e.g., RRM2) polypeptide, wherein the promoter sequence is operably linked to the sequence of (b).
In particular embodiments, the vector is a viral vector, e.g., an AAV vector, and the polynucleotide sequence further comprising 5' and 3' flanking ITR sequences, e.g., AAV2 ITR sequences. In certain embodiments, the vector, e.g., the viral vector, is administered systemically, e.g. intravenously, or locally, e.g. via intra-myo cardial injection. In certain embodiments, the vector is administered by lipofectin, coating on a stent, or direct injection, e.g., via a catheter.
The vector may further encode a targeting agent that specifically binds to a cardiac-specific marker. In some embodiments, the vector further comprises a transduction reporter.
In certain aspects of the invention, the vector comprises a cell, e.g., a donor cell, containing an expression construct of the invention, e.g., fibroblasts or
cardiomyocytes, containing an expression vector comprising a first nucleic acid sequence encoding a ribonucleotide reductase subunit Rl and/or a second nucleic acid sequence encoding a ribonucleotide reductase subunit R2. In particular embodiments, the method comprises grafting the cells to the myocardium of the subject in need of treatment, e.g. a mammal having an infarcted myocardium. In some embodiments, the method involves prior to grafting of the cells, e.g., cardiomyocytes, transducing said cells, e.g.,
cardiomyocytes, with the Rl and/or R2-encoding expression vector ex vivo. In particular embodiments, the grafting of cardiomyocytes is effected via delivery through a catheter. In certain embodiments involving treatment of an infarcted myocardium, the cells, e.g., cardiomyocytes, are delivered to a region of the myocardium containing live cells, e.g. a non-infarct zone of the myocardium. In certain embodiments, the cells, e.g.,
cardiomyocytes, are derived from stem cells, e.g. pluripotent ESC, iPSC, mesenchymal stem cells, selected from an origin compatible with the host organism. For instance, the iPSCs are derived from a cell, e.g. fibroblast, harvested from the mammalian host (i.e., mammalian subject being treated).
The route of delivery and amount of vector to be delivered to a subject may be determined by a physician based, in part, on the subject's physical condition. Examples
EXAMPLE 1
HEMODYNAMIC ACTIVITY OF RRMl AND/OR RRM2 VECTORS The hemodynamic effects associated with the administration of different Rl and/or R2 vectors was examined in Langendorff isolated heart preparations using AAV6 vectors expressing Rl and/or R2. The effect of introducing two vectors, one expressing Rl (pAAVRlcTnT455) and one expressing R2 (pAAVR2cTnT455), was compared to the effect of introducing a single vector that expresses both Rl and R2, with either Rl
(pAAVRl R2cTnT455) or R2 (pAAVR2RlcTnT455) being located upstream of the other. A schematic diagram of these vectors is provided in Figure 10. These vectors included the cardiac-specific promoter cTnT455 and a sequence encoding a 2A peptide between the Rl and R2 sequences, e.g., as shown in Figures 8-10. These AAV6 vectors were produced in a similar manner as the vectors previously described in PCT patent application publication no.WO2012162705. Experiments were performed the same as or similarly to those described in PCT patent application publication no.WO2012162705.
As shown in Figure 1, expression of both Rl and R2 enhanced baseline function as compared to control. Of note, the pAAVRlR2cTnT455 construct had a greater effect than the pAAVR2RlcTnT455 construct.
The effect of the vectors was also examined by Starling curve analysis, the results of which are provided in Figure 2.
The hemodynamic activity of the vectors under high workload challenge was also examined. The results of these experiments are provided in Figure 3. EXAMPLE 2
RRM1/RRM2 VECTORS IMPROVE CARDIAC PERFORMANCE IN A LARGE ANIMAL MODEL OF
HEART FAILURE
A swine model of myocardial infarction (MI) was used to demonstrate the usefulness of gene therapy vectors of the present invention for treating heart failure. The vector used in this study delivered the human RNR enzyme complex under the control of a cardiac specific promoter via an adeno-associated virus serotype 6 vector, and was designated BB-R12. Briefly, heart failure was induced following MI in Yucatan minipigs by balloon occlusion of the left anterior descending artery. Two weeks later, pigs received BB-R12 at one of three doses via antegrade coronary infusion. Echocardiography, hemodynamics, animal wellness, pathology, immune response and biomarkers were assessed as shown in Figure 11. At two months post-treatment, left ventricular (LV) ejection fraction and systolic LV dimension (measured by echocardiography) was improved significantly in the high-dose group, despite further deterioration in the saline controls. Hemodynamic parameters including LV end-diastolic pressure, +dP/dt, and -dP/dt all trended toward improvement in the high-dose group. No difference in the
histopathologic appearance of hearts or other organs from treated animals versus controls was observed, and no safety or tolerability concerns were encountered following BB-R12 delivery. These studies established that cardiac-specific gene therapy using constructs of the present invention, such as BB-R12, may reverse cardiac dysfunction by myosin activation in a large-animal heart failure model with no observed safety concerns, and support the use of similar vectors for the treatment of subjects with chronic heart failure. METHODS
Swine MI/HF model
Myocardial infarction (MI) was induced in Yucatan mini-pigs (aged 7-11 months, weight 31-50 kgs) by 75 minutes of occlusion with a balloon catheter of the mid- left anterior descending artery.
Pre-Treatment and Anesthesia Prior to Myocardial Infarct Procedure.
Amiodarone (1000 mg, PO, SID) was administered daily 1-5 days prior to MI induction. Solid food was withheld for approximately 12-24 hours prior to treatment and animals were weighed and given an intramuscular (IM) injection of the antibiotic enrofloxacin at 2-8 mg/kg, 30 minutes prior to surgery. Each animal was subcutaneously (SC) injected with the analgesic buprenorphine at .01-0.1 mg/kg. General anesthesia was induced with an IM injection of Telazol® at 6mg/kg followed by mask administration of isoflurane (0.5-3%), and Propofol (2 mg/kg-10 mg/kg [3-5ml], to effect; ensuring the animal maintain normal breathing during administration. Ophthalmic ointment was applied to both eyes to prevent corneal drying. Intravenous catheter(s) where placed in a peripheral ear vein and amiodarone (150 mg IV over 10 minutes) and lidocaine (1 mg/kg IV) slowly administered during induction to prevent arrhythmia. When a sufficient level of anesthesia was reached, an endotracheal tube was placed and each animal was attached to an anesthesia machine. Each animal was maintained on isoflurane anesthesia for the remainder of the preparation and surgical procedure.
Procedural Preparation and Peri-Procedural Medications
The surgical incision site(s) was cleaned of debris and hair and scrubbed with a germicidal soap, wiped with 70% alcohol, painted with povidone iodine and draped. Surgical incision sites included the left or right femoral/inguinal regions, and the left or right ventral neck area. Animals were placed in a dorsal recumbent position and monitoring leads placed (EKG, pulse oximeter, temperature probe, etc.).
Isoflurane (0.5-3.0%, inhalant) was administered to maintain the anesthetic plane, and LRS, or an equivalent, was given at 1-10 ml/kg/hr, IV for fluid maintenance.
MI Induction
MI induction was performed by inducing a myocardial infarction of a selected area of the left ventricle, performed by a temporary (at least 75 minutes) 100% occlusion of LAD just past the first diagonal branch and was performed via the arterial access site used in the hemodynamic data collection.
Under fluoroscopy, an appropriately sized guide catheter (5-6 Fr JR, MPA1, AL1-LBT or HS, Cordis, Bridgewater, NJ) was advanced to the left main coronary artery with the use of a 0.035" guidewire. A coronary angiogram was performed to visualize the major branches of the left coronary circuit and its tributaries. The target site for occlusion was identified and recorded. A balloon catheter (2.5-4.0 x 15 mm, Cordis EMPIRA) was then advanced to the occlusion site, with the aid of a 0.014" guidewire (Cho ICE Floppy, Boston Scientific, Marlborough, MA). The balloon was inflated for 75 minutes. Upon inflation, an angiogram was performed to ensure 100% occlusion of the target site. After the ischemic period was complete, the balloon was slowly deflated over up to three minutes (if tolerated), and the balloon and guide catheters removed from the left main coronary artery. Upon confirming the animal was stable, a final angiogram was performed. All catheters and introducers were then removed, and the access site closed using standard technique.
Management of Critical Reactions to Model Creation
Critical reaction to the model induction procedure was anticipated and treated if necessary by the veterinary staff. Expected adverse events included
electrocardiographic changes resulting in asystole and ventricular fibrillation. These instances were treated with immediate defibrillation and administration of appropriate medications.
Infarct Recovery Phase
Once the animal was observed to be stable (extubated and sternal), it was transferred to its individual pen. Post-operative analgesia (buprenorphine at 0.01-0.02 mg/kg) and antiarrhythmics (Amiodarone 1000 mg, PO, SID) were administered at the discretion of the test site veterinary staff. The animals were injected IM with the antibiotic enrofloxacin at 2-8 mg/kg for the first 2 post-operative days.
Vector design and Production
AAV6 cTnT455 Rml Rm2 (BB-R12) contains a 4,431 base pair (bp) transgene cassette consisting of the 585 bp upstream promoter region of cTnT containing a duplication of the El enhancer element fused to 2379 bp Rml of human RNR codon optimized from GENBANK NM 001033.3 followed sequentially by a 63 bp porcine 2 A sequence fused to the 1170 bp Rm2 of RNR codon optimized from GENBANK
NM 001034 followed by a 163 bp synthetic poly A sequence. The entire transgene cassette is 4,431 bp in size and is cloned between the ITR sequences of AAV2. BB-R12 was produced in insect cells. ' High titer BB-R12 stocks (1.5 X 10 Viral genome (VG)/ml) was formulated in PBS containing 5 mM Ca and 5 mM MgCl2 and further supplemented with 35mM MgCl2.
Test & Control Article Preparation Two weeks after induction of MI, survived animals received intracoronary infusions of BB-R12. Antegrade coronary infusion of BB-R12 was performed based on the previous reports.28' 29 To administer the test or control article, femoral access was via percutaneous puncture or surgical cutdown for the placement of a 6/7-Fr sheath. After sheath insertion, heparin (100-200 units/kg) was administered IV to maintain an activated coagulation time (ACT) of 250-300 seconds. A 5/6-Fr guiding catheter was advanced to the left coronary artery and after angiogram, two 0.014-inch guide wires advanced, one into the left anterior descending (LAD) artery and one into the left circumflex (LCX) artery to fix the position of the catheter. To prepare the control article or BB-R12 test material, arterial blood (~10 ml) was drawn into a 20 ml syringe from the femoral sheath or catheter and diluted with 10 ml of 0.9% sodium chloride solution (saline) and the appropriate amount of PBS or BB-R12 added and mixed into the syringe using a needle. For flushing the residual test or control article from the catheter lumen, arterial blood (~10 ml) was drawn into a second 20 ml syringe from the femoral sheath or catheter and diluted with 10 ml of 0.9% sodium chloride solution (saline).
Test & Control Article Delivery
The tubing and catheter was primed with 4 ml of diluted blood from the flushing syringe. Intravenous nitroglycerin (^g/kg/min) was initiated through the ear vein. Control or test article was administered through the guide catheter which was placed at the proximal left main tract and the test or control article solution (12-15 ml) injected at a rate of 1 mL/min through the guide over 12-15 minutes using an infusion pump into the left coronary artery. This was followed by injection of the flush solution (5 ml for 5 minutes). A wire and a catheter was then fixed to right coronary artery the same way as left coronary artery. The remaining test or control article solution (5-8 ml) was injected into the right coronary artery for 5-8 minutes and followed by injection of the flush solution (5 mL over 5 minutes). After completing the administration of the test or control article, the guide catheter and introducer was removed. Before removal of the sheath, ACT was allowed to return to baseline.
Pathology Animal wellness was monitored through daily observations, adverse events and body weight. Clinical pathology samples were analyzed for clinical chemistry panel (electrolytes, hepatic, renal, metabolic), CBC and coagulation panel. At necropsy, all macroscopic alterations in the examined tissues and organs were recorded and selected organs weighed. Fresh specimens for the biodistribution analysis were collected from the heart, liver, kidney, spleen, lungs, brain, skeletal muscle and testes. Microscopic analyses of the following tissues were performed: Adrenals, aorta, brain, heart, kidneys, liver, lungs and bronchi, lymph nodes, ovaries, spleen, testes and thymus.
The heart ventricles were trimmed by serially slicing the ventricles in a plane parallel to the atrioventricular groove. The ventricular slice that incorporated the central area of the infarct was further subdivided to provide sections of infarct border, central infarct and uninfarcted left ventricular free wall, interventricular septum and right ventricular free wall for microscopic evaluation. In addition, sections of the left and right coronary groove were collected. Heart ventricular tissues were routinely processed, embedded in paraffin, and sectioned at approximately 5 μιη. Heart ventricular tissues were stained with H&E and Masson's Trichrome for evaluation.
Echocardiography
Transthoracic echocardiography (Acuson Cypress, Siemens Medical Solutions, Malvern, PA) was performed on anesthetized animals prior to beginning the surgical procedure, and at each of the specified follow-up timepoints. Images were obtained of multiple heart cycles in orthogonal long axis views, as well as short axis views of the left ventricle. End systolic and end diastolic images were captured for measurement of left ventricular volumes and quantification of ejection fractions. Echocardiography data was blinded for analysis.
Hemodynamics
Hemodynamic data collection was performed prior to infarct creation and during scheduled follow-up procedures to obtain information on cardiac performance. Arterial and venous pressure monitoring catheters were introduced via the left or right femoral vein and artery, or the left or right carotid artery and right jugular vein. These access sites were exposed through surgical cut-down and instrumented with a 6-9F vascular introducer (Avanti+, Cordis). Under fluoroscopy, a Swan-Ganz CCO catheter (Edwards LifeSciences, Irvine, CA) was advanced to various locations of the right heart for data collection, including pulmonary capillary wedge pressure (PCWP), pulmonary artery pressure (PAP), central venous pressure (CVP), and cardiac output (CO). A Millar Mikro- Tip catheter (Millar Inc., Houston TX) was advanced through the arterial circuit via an appropriately sized guide catheter (Wiseguide, Boston Scientific) for data collection of AoP and LVP. For each of the pressure endpoints, a minimum of 5 heart cycles was recorded with PowerLab data acquisition platform (ADInstruments, Colorado Springs, CO).
PCR
Frozen mini-pig tissue plugs of liver, lung, right ventricle, left atrium, and 3 samples from the left ventricle were obtained. Tissue samples were homogenized in Qiagen Buffer ATL containing proteinase K using the Omni Bead Ruptor homogenizer with 2.8 mm ceramic beads. The homogenized sample was incubated at 56 C for 10 minutes. DNA was extracted from the homogenized tissue using the Qiagen QIAamp 96 DNA QIAcube HT Kit. Blood samples were incubated in Buffer ATL containing proteinase K at 56 C for 10 minutes. DNA was extracted from lysed blood samples using the Qiagen 96 QIAamp QIAcube HT Kit.
Primers and probes specific for the transgene, rml, inserted in the AAV vector were designed, qualified, and shown to be fit for purpose. qPCR was performed using the Qiagen QuantiFast Pathogen PCR plus IC kit and the AAV specific primers and probes. The QuantiFast Pathogen PCR plus IC kit contained internal amplification control (IAC) primers, probes, and control IAC DNA that was added to each PCR reaction. The IAC assay was used to monitor each PCR reaction for inhibition. The IAC DNA was added to the reaction at a low level to prevent competition with the Rml assay, but at a level to monitor for inhibitors in the extracted DNA samples. Samples that had lower levels of AAV amplification (30 Ct or higher), and a Ct difference between the IAC amplification of the negative control and the sample of 2 Cts or more were considered inhibitory and diluted for reanalysis. The use of the I AC mitigates false negative reporting due to inhibitors in the extracted sample.
PCR analysis was conducted in an Applied Biosystems 7900HT Fast Real- Time PCR System (Applied Biosystems, Foster City CA) with software SDS 2.2.2, using the following PCR run conditions: activation at 95°C for 5 minutes, 45 cycles of denaturing at 95°C for 15 seconds and annealing and elongation at 60°C for 30 seconds. Fluorescence was monitored during the annealing and elongation portion of the 45 cycles. The DNA samples were analyzed in triplicate. The copy number for each DNA sample was calculated from the average cycle threshold (Ct) values for each sample using the linear regression analysis of the standard curve for each PCR plate. The DNA concentration was measured for each sample and the quantity of AAV was reported as copy number per microgram of DNA. The assay has a limit of detection of 10 copies. The lower limit of quantification for the assay was 40 copies per μg of DNA.
A 6-point standard curve was prepared fresh on the day of analysis. These standards were run in duplicate on each PCR plate. The copy number of the standards ranged from 9.95 x 106 per reaction to 99.5 copies per reaction.
Blood Sampling and testing
Whole blood and serum (5 ml ea.) was collected at baseline, treatment, and days 14, 28 and 56 post treatment and subjected to a full hematology, coagulation and clinical chemistry panel (Antec GLP, Morrisville, NC).
Statistical analysis
All values are reported as mean ± standard error of the mean (SEM).
Ekuseru-Toukei 2010 (Social Survey Research Information Co., Ltd, Japan) was used for all statistical analyses. Student's t test was used to test for differences between two groups if normal distribution was assumed. Normal distribution was examined with frequency histograms. In case of nonparametric distribution, Mann- Whitney U test was used.
Analysis of variance (ANOVA) was used to test for differences among at least three groups. A P value of <0.05 was considered statistically significant.
RESULTS Swine MI model
Yucatan minipigs (35-45 kg) were screened for neutralizing antibodies to AAV6, and a total of 28 seronegative animals were enrolled in this study and underwent myocardial infarction (MI) induction (day -14). Eight pigs died from ventricular fibrillation during the MI induction procedure, and an additional 3 pigs died after MI induction but prior to administration of BB-R12 gene therapy or placebo. A total of 17 pigs received intracoronary infusions of BB-R12 or formulation buffer (sham) as shown in Table 1. All treated animals survived until euthanasia at 56 days post-treatment. Table 1. Mean values of echocardiography and hemodynamics
Sham High dose Medium dose Low dose
N=4 N=5 N=4 N=4
Echocardiography
Left Ventricular Ejection Fraction: LVEF (%)
Day - 14 58.3 ±1.7 62.4±3.4 54.0±2.5 56.8±0.8
Day O 46.3±1.8 44.0±3.3 44.3±4.8 48.5±2.2
Day 28 38.5±3.4 50.0±1.7* 37.8±5.1 45.8±4.1
Day 56 36.8±2.8 51.2±2.0* 47.8±3.3* 44.5±5.7 Left Ventricular Fractional Shortening: LVFS (%)
Day - 14 30.6±4.8 31.2±3.3 26.3±3.7 33.0±8.0
Day O 17.7±5.6 25.1±4.9 17.7±4.9 30.1±1.0
Day 28 23.5±3.8 25.4±4.0 19.1±2.4 22.3±5.3
Day 56 12.4±2.0 31.8±3.5* 22.6±4.4 23.8±4.0* Left Ventricular End- Systolic Dimension: LVESD (mm)
Day - 14 29.4±2.0 26.3±1.0 27.8±1.9 23.7±3.9
Day O 38.7±3.1 33.9±2.4 40.7±6.9 29.8±2.7* Day 28 39.2±2.7 36.8±2.8 42.0±2.4 35.7±4.9
Day 56 46.3±1.8 33.4±1.5* 37.7±3.6 35.0±3.1 * Left Ventricular End-diastolic Dimension: LVEDD (mm)
Day - 14 42.4±1.0 38.5±1.9 37.9±3.2 35.2±3.6
Day O 47.0±1.7 45.7±2.4 48.7±5.5 42.8±4.5
Day 28 51.1±1.2 49.3±2.1 52.1±3.3 45.4±3.8
Day 56 52.8±1.9 49.2±1.8 48.6±3.5 45.8±2.5
Hemodynamics
+dP/dt (mmHg/sec)
Day - 14 989.0±64.1 1026.8±175.6 1 104.5±160.7 1000.9±198.3
Day 0 846.8±84.7 644.2±46.3 876.8±209.8 978.0±52.7 Day 56 818.8±105.5 1 159.8±139.3 963.1±151.7 1 192.8±83.9* -dP/dt (mmHg/sec)
Day - 14 -762.7±259.5 -870.8±223.2 -1040.2±364.4 - 1064.7±128.2
Day O -614.2±132.9 -686.2±1 13.9 -716.7±113.5 -762.9±76.4 Day 56 -666.6±86.3 - 1546.7±270.9* -1045.0±221.2 -925.4±130.8
Left Ventricular End-Diastolic Pressure: LVEDP (mmHg)
Day - 14 16.0±4.8 17.8±3.7 7.3±2.5 16.8±4.5 Day O 23.0±4.0 21.8±2.5 20.0±7.8 21.3±10.3 Day 56 21.3±3.0 1 1.0±2.5 12.0±1.6* 21.8±4.6
Heart Rate (beats per minute)
Day - 14 73.5±10.6 74.4±7.6 84.8±7.4 66.3±3.8 Day 0 66.0±2.0 78.8±4.0* 80.0±8.7 73.5±2.9 Day 56 94.0±18.1 94.2±8.3 103.5±10.4 95.0±4.3
Aortic Pressure-Systolic (mmHg)
Day - 14 73.5±10.9 73.2±7.5 80.3±6.1 87.5±9.9
Day O 75.5±1 1.2 69.6±2.2 81.3±5.5 78.0±10.2
Day 56 82.0±3.2 77.6±2.7 76.3±7.4 89.3±5.9
Aortic Pressure-Diastolic (mmHg)
Day - 14 43.3±12.0 45.6±8.4 52.3±5.2 60.5±1 1.0
Day O 50.8±10.8 46.0±3.3 55.3±6.2 51.3±9.6
Day 56 55.3±2.6 51.8±2.1 52.5±7.4 61.5±3.7
Aortic Pressure-Mean (mmHg)
Day - 14 54.5±10.8 54.8±7.8 61.5±5.5 69.0±10.5
Day O 57.8±10.3 53.8±2.6 63.7±6.1 59.8±9.9
Day 56 64.0±2.7 59.4±1.9 59.5±7.0 68.8±4.3
Data are shown mean ± SEM. *P < 0.05, for differences between the sham group and each of the other groups, Mann- Whitney U test.
BB-R12 improved cardiac systolic function
The mean values for each group and time point are shown in Table 1. All four groups had comparable left ventricular ejection fraction (LVEF) prior to infarction. By 14 days post-MI, mean LVEF had declined significantly in all groups, although the magnitude of decline was variable. In the sham group, LVEF continued to decline at 56 days post saline treatment. In contrast, LVEF in the high-dose group recovered after BB- R12 treatment at 28 and 56 days post-treatment (p = 0.04 and p=0.006 vs. control at each time, respectively). Interestingly, the medium-dose group did not respond at 28 days, but recovered at 56 days post-treatment and was then significantly higher than sham (P=0.04). The low-dose group showed no improvement from the time of gene delivery to 56 days. The change of LVEF from day 0 to 56 was +7% for the high dose group compared to -10% for the sham group )p<0.05) (Figure 12B and 13B).
An exploratory post-hoc analysis took into account the model variability in infarct size. All active-treated animals were pooled, then divided into two groups by the median decline in LVEF from Day -14 to Day 0 (high severity HF vs. low severity HF) and compared to the sham-treated group (Figure 12C). The sham-treated group showed significant deterioration of LVEF from Day 0 to Day 56 (p=0.02). The group with high severity HF showed significant improvement in LVEF at Day 56 (p=0.001) and a trend towards improvement at Day 28 (p=0.08), as well as a significant improvement compared to the sham-treated group (p=0.02), while the low severity HF group showed no change from Day 0 to Day 56 and no difference from control.
Similar findings occurred for the related measures of LV fractional shortening (LVFS). While the sham and low-dose groups showed a decline in LVFS at 56 days post-administration, both the high- and medium-dose groups showed increases (Figure 13C). At 56 days post-treatment, LVFS for the high-dose group showed a 7% increase, which was over the Day 0 function, compared with a -5% decrease in the sham.
LVFS in high-dose group was significantly higher than the sham at 56 days after treatment
(P=0.01).
BB-R12 effect on LV end- systolic dimension
In all groups, LV end-systolic dimension (LVESD) increased from preinfarction to the time of treatment at day 0 (Figure 14A). In the sham group, LVESD increased progressively and peaked at 56 days post-saline injection (Figure 14B). In the high- and medium-dose treated groups, however, the, LVESD at 56 days post-treatment was similar or smaller to that at Day 0. In the high-dose treated group, LVESD at 56 days post-treatment was significantly shorter than the sham (P=0.01, Table 1), reflecting enhanced contractility. In contrast, left ventricular end-diastolic dimension (LVEDD) showed progressive dilation during 56 days after gene delivery for all groups (Figure 14C). There was no significant difference in LVEDD between sham and treated groups at 56 days after treatment. BB-R12 effects on +dP/dt, -dP/dt and end-diastolic pressure
The mean values for hemodynamic measurements are shown in Table 1. At 14 days following MI (Day 0), the mean values of maximum rate of pressure rise (+dP/dt), a parameter of systolic function, maximum rate of pressure decline (-dP/dt), a parameter of early diastolic function, and LV end-diastolic pressure (LVEDP) showed changes consistent with the onset of HF in all groups and these changes persisted in the sham group. At 56 days after treatment, there was improvement in these measures in the high- and medium-dose treated groups compared to the sham, although there was no difference in blood pressure and heart rates (Figure 15). The mean change in +dP/dt from day 0 to 56 was significantly increased in high-dose group compared to sham group, reflecting the positive inotropic effect of BB-R12 (P=0.04, Figures 15 A and 15B). There were similar improvements in the negative rate of pressure change (-dP/dt) in response to BB-R12 treatment (Figures 15C and 15D). The mean LVEDP increased at 14 days following MI in all groups, which persisted in the sham and low-dose treated groups. In the high- and medium-dose treated groups, Mi-induced increases in LVEDP were reversed at Day 56 following treatment with BB-R12 (Figures 15E and 15F). The LVEDP change from day 0 to 56 was significantly improved in high-dose group compared to sham group (P=0.04, Figure 15F).
Other measured hemodynamic parameters, such as pulmonary capillary wedge pressure, pulmonary arterial pressure, central venous pressure and cardiac output, in the treated groups were not significantly different from the sham group after 56 days (data not shown).
BB-R12 does not evoke a significant humoral or cellular immune response
The development of a humoral immune response was monitored using an ELISA for the viral capsid protein. Most samples contained no appreciable antibody levels above the minimum detectable level (<1 :800). In some treated animals at some time points, there was a transient and unremarkable titer of 1 :800 (data not shown). All samples from sham animals showed a titer of <1 :800 (data not shown). The cellular immune response was measured using a γ-interferon ELISPOT assay. Cytotoxic T lymphocyte (CTL) response to both viral capsid protein and Rml transgene were negative or unequivocal at 2 weeks post-administration of BB-R12 (data not shown). Both controls, phorbol ester stimulated CTLs cells and cells from animals immunized with peptide libraries, showed significant positive responses (data not shown).
Effects of BB-R12 on blood counts, chemistries or biomarkers
There were no significant difference between sham and treated groups in the clinical pathology at 14, 28 or 56 days after gene delivery. The results of this analysis suggest no adverse effects on blood composition, blood chemistry, or liver enzymes following BB-R12 treatment. Sporadic elevations of serum troponin were observed between Day 14 and Day 56 in multiple groups, including the sham-treated animals (data not shown).
Pathology and biodistribution
Overall, myocardial infarction led to similar lesions in the heart in all of the test groups and the sham control group. The percentage of fibrosis in the central infarct area in the sham and treated groups were similar (data not shown). The severity, frequency and distribution of the lesions in the treated hearts were similar to that seen in the sham group. There were no organ lesions or histopathologic changes in the treatment groups attributed to the BB-R12 therapy. No significant findings were observed by animal wellness monitoring across all treatment groups from the gene delivery to the endpoint. There was no significant difference in the mean AAV copy number per μg of DNA in the heart (left ventricle, left atrium and right ventricle), lung and liver between the treated groups, though the number of tissue samples analyzed was small (data not shown). No viral DNA was detected in the sham group.
DISCUSSION
This study demonstrates persistent improvement in cardiac performance following a single anterograde coronary infusion of BB-R12 in a swine MI/HF model. Findings at 2 months following therapy included: 1) improvements in LVEF, LVFS and LVESD; 2) improvement in hemodynamic measurements including +dP/dt, -dP/dt and LVEDP, and 3) no safety or toxicological concerns were observed. The small number of study animals and inherent variability of the porcine MI-HF model limit the conclusions that can be drawn, but consistent improvements across multiple measures of cardiac performance, especially in the animals with the most severe HF were encouraging. Thus, these finds extend previous observations in rodent and ex vivo experiments to a standard large-animal model of HF.
Gene therapies previously in development involve manipulation of either calcium handling (e.g. SERCA2a) or calcium indirectly via adrenergic signaling, and have been reported to improve HF in large-animal models.1"10 However, this study demonstrates improvement in multiple key contractile parameters in a large-animal MI/HF model using a gene therapy that works via a very different mechanism, cardiac myosin activation via cardiac-specific elevation of cytosolic dATP. It was also shown that small amounts of dATP catalyze enhances cardiac performance through myosin activation. The mechanism involves facilitation of actin-myosin cross-bridge cycling.14"16 Faster cycling allows more myosin heads (the force generators) to interact with actin during each cardiac contraction. Enhanced contractility has been seen across the range of physiologic levels of calcium (enhanced calcium sensitivity) but dATP has no effect on calcium transients.15' 17
The increase in dATP is achieved through the enhanced expression of RNR, which is normally down regulated in mature cardiac muscle cells, and the increased expression of which results in the synthesis of dATP in cardiomyocytes. Though not measured directly in this experiment, up-regulation of RNR has been linked to increased dATP levels and these, in turn, to enhanced cardiac performance. Expression of RNR using a cardiac specific promoter, e.g., the cTnT promoter, facilitates cardiomyocyte- specific transcription and minimizes possible off target effects with a level of therapeutic specificity not achievable using small molecule drugs or gene therapies using constitutively expressed regulatory elements. Interestingly, even though contraction is stronger and faster, chemo-mechanical modeling suggests the weaker hydrostatic interaction between dATP and myosin in the binding pocket (vs. ATP) may result in a faster release of the hydrolysis product dADP, thus myosin detachment rate and relaxation is also faster.20 Consequently the kinetics of cell, tissue and organ relaxation appear matched to the enhanced
contractility.
Direct targeting of the contraction machinery of the cardiac muscle cell by intracellular production of a superior myosin substrate is a new therapeutic paradigm to treat HF and is independent of both calcium and adrenergic signaling.
Omecamtiv, a small molecule drug in clinical development, represents a new class of inotropic agents, cardiac myosin activators.21 Omecamtiv works directly on myosin and stimulates myocardial ATPase by strengthening myosin/actin crossbridge formation, thus increasing left ventricular systolic function independent of calcium while decreasing filling pressure without increasing heart rate or oxygen consumption.22' 23
Omecamtiv has reached later-stage clinical testing, which validates myosin activation as a target for inotropic therapy. However, omecamtiv is delivered by repeated intravenous infusions or chronic oral dosing, does not appear to affect the rate of ventricular pressure development and increases systolic ejection time in a dose dependent manner, leading to the prolongation of systole.22 In contrast dATP and BB-R12 requires a one-time administration and appears to increase left ventricular function with no prolongation of systolic ejection time or shortening of diastole.
Gene therapy using a gene therapy vector of the present invention, e.g., BB- R12, increases cardiac function by turning a small number of transduced cardiomyocytes into cellular factories that generate dATP. dATP increases the contraction of both the transduced cell and adjacent cardiac muscle cells by passive diffusion of the nucleotide throughout the heart via gap junctions. Lundy et al. showed that small numbers of ex-vivo RNR-infected cardiomyocytes directly injected into 3 loci in rat hearts had positive overall effects on cardiac function, demonstrating that a small proportion of transduced cells distributed in a limited number of sites can increase cardiac function.19 This amplification of the effect of RNR up-regulation may indicate that the number of transduced cells required to produce a therapeutic effect may be lower than for other gene therapies. It is thought that the delayed time-course of improvement of cardiac performance observed in the medium-dose treated group may be consistent with the gradual accumulation of cytosolic dATP over time. In prior rodent and ex vivo experiments, observed increases in contractility affected the entire heart.
In this small study, no adverse effects of BB-R12 therapy were observed. No treatment-related deaths or adverse events were observed, and gross pathology and histopathology showed no difference from sham treated animals. Blood chemistry was unremarkable and no elevation of liver enzymes was observed. A low level, transient humoral response to AAV6 capsid protein was observed in a minority of animals in response to therapy. Cellular immune responses showed no appreciable CTL response to either the capsid protein or transgene product. It should be noted that the amino acid sequences of the transgene are identical between pigs and humans and therefore these results are reassuring that a cellular immune response to the transgene product was unlikely.
Nowakowski et al. studied transgenic mice that expressed RNR constitutively in all cells, and observed no documentable cardiac pathology (hypertrophy, fibrosis etc.), but found a marked, lifelong increase in cardiac performance.18 Based on this work, it was expected that cardiac-specific transgene expression would likely produce a safe therapeutic. The study observations are consistent with this expectation. It should be noted that RNR is regulated allosterically by dATP, and additional post-translational regulatory mechanisms also play a role, working collectively to keep dATP levels low.13' 24 The buildup of abnormal levels of dATP is further limited by the passive diffusion out of the producer cells and into adjacent coupled cells through gap junctions. However, small amounts of dATP (<10% of the total ATP pool) show increases in force development and cell contraction at the myofibril level.25
The results from transgenic animals and small animal studies show that over-expression of RNR in the heart leads to improved cardiac performance via synthesis of dATP. The studye described in this Example extends these observations to a relevant, standard large-animal model of HF with encouraging preliminary results. Persistent improvement in multiple measures of HF severity after treatment with BB-R12 was recorded with no observed adverse effects. As the first gene therapy with a mechanism of action that is independent of calcium regulation, these findings support the therapeutic potential of BB-R12 to treat HF.
REFERENCES
1. Kawase Y, Ly HQ, Prunier F, Lebeche D, Shi Y, Jin H, Hadri L, Yoneyama R, Hoshino K, Takewa Y, Sakata S, Peluso R, Zsebo K, Gwathmey JK, Tardif JC, Tanguay JF, Hajjar RJ. Reversal of cardiac dysfunction after long-term expression of SERCA2a by gene transfer in a pre-clinical model of heart failure. Journal of the American College of Cardiology 2008;51(11): 1112-9.
2. Beeri R, Chaput M, Guerrero JL, Kawase Y, Yosefy C, Abedat S, Karakikes I, Morel C, Tisosky A, Sullivan S, Handschumacher MD, Gilon D, Vlahakes GJ, Hajjar RJ, Levine RA. Gene delivery of sarcoplasmic reticulum calcium ATPase inhibits ventricular remodeling in ischemic mitral regurgitation. Circulation Heart failure 2010;3(5):627-34.
3. Katz MG, Fargnoli AS, Williams RD, Steuerwald NM, Isidro A, Ivanina AV, Sokolova IM, Bridges CR. Safety and efficacy of high-dose adeno-associated virus 9 encoding sarcoplasmic reticulum Ca(2+) adenosine triphosphatase delivered by molecular cardiac surgery with recirculating delivery in ovine ischemic cardiomyopathy. The Journal of thoracic and cardiovascular surgery 2014;148(3): 1065-1073. e2.
4. Pleger ST, Shan C, Ksienzyk J, Bekeredjian R, Boekstegers P, Hinkel R, Schinkel S, Leuchs B, Ludwig J, Qiu G, Weber C, Raake P, Koch WJ, Katus HA, MuUer OJ, Most
P. Cardiac AAV9-S100A1 gene therapy rescues post-ischemic heart failure in a preclinical large animal model. Science translational medicine 201 l;3(92):92ra64.
5. Weber C, Neacsu I, Krautz B, Schlegel P, Sauer S, Raake P, Ritterhoff J, Jungmann A, Remppis AB, Stangassinger M, Koch WJ, Katus HA, Muller OJ, Most P, Pleger ST. Therapeutic safety of high myocardial expression levels of the molecular inotrope S100A1 in a preclinical heart failure model. Gene therapy 2014;21(2): 131-8.
6. Katz MG, Fargnoli AS, Swain JD, Tomasulo CE, Ciccarelli M, Huang ZM, Rabinowitz JE, Bridges CR. AAV6-betaARKct gene delivery mediated by molecular cardiac surgery with recirculating delivery (MCARD) in sheep results in robust gene expression and increased adrenergic reserve. The Journal of thoracic and cardiovascular surgery 2012;143(3):720-726.e3.
7. Raake PW, Schlegel P, Ksienzyk J, Reinkober J, Barthelmes J, Schinkel S, Pleger S, Mier W, Haberkorn U, Koch WJ, Katus HA, Most P, Muller OJ. AAV6.betaARKct cardiac gene therapy ameliorates cardiac function and normalizes the catecholaminergic axis in a clinically relevant large animal heart failure model. European heart journal 2013;34(19): 1437-47.
8. Tilemann L, Lee A, Ishikawa K, Aguero J, Rapti K, Santos-Gallego C, Kohlbrenner E, Fish KM, Kho C, Hajjar RJ. SUMO-1 gene transfer improves cardiac function in a large-animal model of heart failure. Science translational medicine 2013;5(211):21 lral59.
9. Fish KM, Ladage D, Kawase Y, Karakikes I, Jeong D, Ly H, Ishikawa K, Hadri L, Tilemann L, Muller-Ehmsen J, Samulski RJ, Kranias EG, Hajjar RJ. AAV9.I-lc delivered via direct coronary infusion in a porcine model of heart failure improves contractility and mitigates adverse remodeling. Circulation Heart failure 2013;6(2):310-7.
10. Ishikawa K, Fish KM, Tilemann L, Rapti K, Aguero J, Santos-Gallego CG, Lee A, Karakikes I, Xie C, Akar FG, Shimada YJ, Gwathmey JK, Asokan A, McPhee S, Samulski J, Samulski RJ, Sigg DC, Weber T, Kranias EG, Hajjar RJ. Cardiac I-lc Overexpression With Reengineered AAV Improves Cardiac Function in Swine Ischemic Heart Failure. Molecular therapy : the journal of the American Society of Gene Therapy
2014;22(12):2038-45.
11. Jessup M, Greenberg B, Mancini D, Cappola T, Pauly DF, Jaski B, Yaroshinsky A, Zsebo KM, Dittrich H, Hajjar RJ. Calcium Upregulation by Percutaneous Administration of Gene Therapy in Cardiac Disease (CUPID): a phase 2 trial of intracoronary gene therapy of sarcoplasmic reticulum Ca2+-ATPase in patients with advanced heart failure.
Circulation 201 1;124(3):304-13.
12. Zsebo K, Yaroshinsky A, Rudy JJ, Wagner K, Greenberg B, Jessup M, Hajjar RJ. Long-term effects of AAVl/SERCA2a gene transfer in patients with severe heart failure: analysis of recurrent cardiovascular events and mortality. Circulation research
2014;114(l): 101-8. 13. Kashlan OB, Cooperman BS. Comprehensive model for allosteric regulation of mammalian ribonucleotide reductase: refinements and consequences. Biochemistry 2003;42(6): 1696-706.
14. Regnier M, Rivera AJ, Chen Y, Chase PB. 2-deoxy-ATP enhances contractility of rat cardiac muscle. Circulation research 2000;86(12): 1211-7.
15. Regnier M, Martin H, Barsotti RJ, Rivera AJ, Martyn DA, Clemmens E. Cross- bridge versus thin filament contributions to the level and rate of force development in cardiac muscle. Biophysical journal 2004;87(3): 1815-24.
16. Moussavi-Harami F, Razumova MV, Racca AW, Cheng Y, Stempien-Otero A, Regnier M. 2-Deoxy adenosine triphosphate improves contraction in human end-stage heart failure. Journal of molecular and cellular cardiology 2014;79c:256-263.
17. Korte FS, Dai J, Buckley K, Feest ER, Adamek N, Geeves MA, Murry CE, Regnier M. Upregulation of cardiomyocyte ribonucleotide reductase increases intracellular 2 deoxy-ATP, contractility, and relaxation. Journal of molecular and cellular cardiology 2011;51(6):894-901.
18. Nowakowski SG, Kolwicz SC, Korte FS, Luo Z, Robinson-Hamm JN, Page JL, Brozovich F, Weiss RS, Tian R, Murry CE, Regnier M. Transgenic overexpression of ribonucleotide reductase improves cardiac performance. Proceedings of the National Academy of Sciences of the United States of America 2013;110(15):6187-92.
19. Lundy SD, Murphy SA, Dupras SK, Dai J, Murry CE, Laflamme MA, Regnier M. Cell-based delivery of dATP via gap junctions enhances cardiac contractility. Journal of molecular and cellular cardiology 2014;72:350-9.
20. Nowakowski SG, Adamek N, Geeves MA, Gay E, Kolwicz SC, Murry CE, Daggett V, Regnier M. 2-deoxy-ATP Alters Myosin Structure to Enhance Cross-Bridge Cycling and Improve Cardiac Function. Biophysical journal 2013;104(2): 17a.
21. Teerlink JR. A novel approach to improve cardiac performance: cardiac myosin activators. Heart failure reviews 2009;14(4):289-98.
22. Teerlink JR, Clarke CP, Saikali KG, Lee JH, Chen MM, Escandon RD, Elliott L, Bee R, Habibzadeh MR, Goldman JH, Schiller NB, Malik FI, Wolff AA. Dose-dependent augmentation of cardiac systolic function with the selective cardiac myosin activator, omecamtiv mecarbil: a first-in-man study. Lancet 2011;378(9792):667-75.
23. Morgan BP, Muci A, Lu PP, Qian X, Tochimoto T, Smith WW, Garard M, Kraynack E, Collibee S, Suehiro I, Tomasi A, Valdez SC, Wang W, Jiang H, Hartman J, Rodriguez HM, Kawas R, Sylvester S, Elias KA, Godinez G, Lee K, Anderson R, Sueoka S, Xu D, Wang Z, Djordjevic N, Malik FI, Morgans DJ, Jr. Discovery of omecamtiv mecarbil the first, selective, small molecule activator of cardiac Myosin. ACS medicinal chemistry letters 2010;l(9):472-7.
24. Fairman JW, Wijerathna SR, Ahmad MF, Xu H, Nakano R, Jha S, Prendergast J, Welin RM, Flodin S, Roos A, Nordlund P, Li Z, Walz T, Dealwis CG. Structural basis for allosteric regulation of human ribonucleotide reductase by nucleotide -induced
oligomerization. Nature structural & molecular biology 2011;18(3):316-22.
25. Schoffstall B, Clark A, Chase PB. Positive inotropic effects of low dATP/ATP ratios on mechanics and kinetics of porcine cardiac muscle. Biophysical journal
2006;91(6):2216-26.
26. Smith RH, Levy JR, Kotin RM. A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Molecular therapy : the journal of the American Society of Gene Therapy 2009;17(l l): 1888-96.
27. Li L, Dimitriadis EK, Yang Y, Li J, Yuan Z, Qiao C, Beley C, Smith RH, Garcia L, Kotin RM. Production and characterization of novel recombinant adeno-associated virus replicative-form genomes: a eukaryotic source of DNA for gene transfer. PloS one
2013;8(8):e69879.
28. Ishikawa K, Aguero J, Nairn C, Fish K, Hajjar RJ. Percutaneous approaches for efficient cardiac gene delivery. Journal of cardiovascular translational research
2013;6(4):649-59.
29. Ishikawa K, Fish KM, Tilemann L, Rapti K, Aguero J, Santos-Gallego CG, Lee A, Karakikes I, Xie C, Akar FG, Shimada YJ, Gwathmey JK, Asokan A, McPhee S, Samulski J, Samulski RJ, Sigg DC, Weber T, Kranias EG, Hajjar RJ. Cardiac I-lc Overexpression With Reengineered AAV Improves Cardiac Function in Swine Ischemic Heart Failure. Molecular therapy : the journal of the American Society of Gene Therapy
2014;22(12):2038-45.
All of the above U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety.
From the foregoing it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.

Claims

1. A polynucleotide sequence comprising in the 5' to 3' direction:
(a) a cardiac-specific promoter sequence;
(b) a first sequence encoding a ribonucleotide reductase subunit Ml (RRM1) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide;
(c) an IRES sequence or a sequence encoding a 2A peptide; and
(d) a second sequence encoding a RRM1 polypeptide or a RRM2 polypeptide, wherein if the first sequence of (b) encodes a RRMl polypeptide, the second sequence of (d) encodes a RRM2 polypeptide, and wherein if the first sequence of (b) encodes a RRM2 polypeptide, the second sequence of (d) encodes a RRMl polypeptide;
wherein the cardiac-specific promoter sequence is operably linked to the first sequence of (b) and the second sequence of (d).
2. The polynucleotide sequence of claim 1, wherein the first sequence of (b) encodes a RRMl polypeptide, and the second sequence of (d) encodes a RRM2 polypeptide.
3. The polynucleotide sequence of claim 1, wherein the first sequence of (b) encodes a RRM2 polypeptide, and the second sequence of (d) encodes a RRMl polypeptide.
4. The polynucleotide sequence of any one of claims 1-3, wherein said cardiac- specific promoter is a cardiac troponin T (cTnT) promoter.
5. The polynucleotide sequence of claim 4, wherein the cTnT promoter is the cTnT455 promoter.
6. The polynucleotide sequence of any one of claims 1-5, comprising the sequence encoding the 2A peptide.
7. The polynucleotide sequence of any one of claims 1-6, wherein the RRM1 polypeptide is a human RRM1 polypeptide or a variant thereof.
8. The polynucleotide sequence of any one of claims 1-6, wherein the RRM2 polypeptide is a human RRM2 polypeptide or a variant thereof.
9. The polynucleotide sequence of any one of claims 1-8, wherein the sequence encoding the RRM1 polypeptide is codon-optimized.
10. The polynucleotide sequence of any one of claims 1-9, wherein the sequence encoding the RRM2 polypeptide is codon-optimized.
11. The polynucleotide sequence of any one of claims 1-10, further comprising:
(e) a first inverted terminal repeat (ITR) sequence 5 ' of the cardiac specific promoter sequence; and
(f) a second ITR sequence 3' of the a second sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
12. An expression vector comprising the polynucleotide sequence of any one of claims 1-11.
13. The expression vector of claim 12, wherein the expression vector is a viral vector.
14. The expression vector of claim 13, wherein the viral vector is an adeno- associated virus (AAV) vector.
15. The expression vector of claim 14, wherein the AAV is an AAV6.
16. The expression vector of claim 14 or claim 15, comprising the first ITR and the second ITR, wherein the first ITR and the second ITR are AAV2 ITRs.
17. The expression vector of any one of claims 11-16, wherein said expression vector further comprises a transduction reporter.
18. The expression vector of any one of claims 11-17, wherein said expression vector further comprises a targeting agent.
19. A cell comprising an expression vector of any one of claims 12-18.
20. The cell of claim 19, wherein the cell is a cardiomyocyte.
21. A pharmaceutical composition comprising the expression vector of any one of claims 12-16 or the cell of claim 19 or claim 20.
22. A method of improving cardiac function in a mammal in need thereof, the method comprising administering to the mammal a pharmaceutical composition comprising:
(a) the expression vector of any one of claims 12-18;
(b) the cell of claim 19 or claim 20;
(c) an expression vector comprising a polynucleotide sequence comprising in the 5' to 3' direction:
(i) a cardiac-specific promoter sequence; and
(ii) a sequence encoding a ribonucleotide reductase subunit Ml (RRMl) polypeptide or a ribonucleotide reductase subunit M2 (RRM2) polypeptide,
wherein the expression vector of (c) does not comprise both the sequence encoding the RRMl polypeptide and the sequence encoding the RRM2 polypeptide, wherein if the expression vector of (c) comprising the sequence encoding the RRMl polypeptide is administered to the mammal, an expression vector comprising a sequence encoding a RRM2 polypeptide is not administered to the mammal, and wherein if the expression vector of (c) comprising the sequence encoding the RRM2 polypeptide is administered to the mammal, an expression vector comprising a sequence encoding a RRM1 polypeptide is not administered to the mammal; or
(d) a cell comprising the expression vector of (c).
23. The method of claim 22, wherein the expression vector of (c) further comprises:
(iii) a first inverted terminal repeat (ITR) sequence 5 ' of the cardiac specific promoter sequence; and
(iv) a second ITR sequence 3' of the sequence encoding the RRMl polypeptide or the RRM2 polypeptide.
24. The method of claim 23, wherein the first ITR and the second ITR are AAV2
ITRs.
25. The method of claim 22, wherein the pharmaceutical composition comprises the expression vector of (a).
26. The method of claim 22, wherein the pharmaceutical composition comprises the cell of (b).
27. The method of claim 22, wherein pharmaceutical composition comprises the expression vector of (c).
28. The method of claim 22, wherein the pharmaceutical composition comprises the cell of (d).
29. The method of claim 22, wherein the expression vector of (c) comprises the sequence encoding the R M1 polypeptide.
30. The method of claim 22, wherein the expression vector of (c) comprises the sequence encoding the R M2 polypeptide.
31. The method of any one of claims 22-30, wherein administration of the expression vector results in an increase in generation of dATP by the mammal.
32. The method of any one of claims 22-30, wherein the expression vector is administered to the myocardium of the mammal.
33. The method of any one of claims 32, wherein the expression vector is administered by grafting cells comprising the expression vector to the myocardium of the mammal.
34. The method of claim 33, wherein the cells are cardiomyocytes.
PCT/US2015/023066 2014-03-29 2015-03-27 Compositions and methods for improving cardiac function Ceased WO2015153357A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201461972248P 2014-03-29 2014-03-29
US61/972,248 2014-03-29

Publications (1)

Publication Number Publication Date
WO2015153357A1 true WO2015153357A1 (en) 2015-10-08

Family

ID=54241141

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/023066 Ceased WO2015153357A1 (en) 2014-03-29 2015-03-27 Compositions and methods for improving cardiac function

Country Status (1)

Country Link
WO (1) WO2015153357A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12478691B2 (en) 2020-02-13 2025-11-25 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090215178A1 (en) * 2008-02-22 2009-08-27 Zequn Tang Methods to enhance the stability and homogeneity of transgene expression in clonal cell lines
WO2012162705A2 (en) * 2011-05-26 2012-11-29 University Of Washington Cell and gene based methods to improve cardiac function
US20120301919A1 (en) * 2011-05-24 2012-11-29 Agency For Science, Technology And Research Ires mediated multicistronic vectors

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090215178A1 (en) * 2008-02-22 2009-08-27 Zequn Tang Methods to enhance the stability and homogeneity of transgene expression in clonal cell lines
US20120301919A1 (en) * 2011-05-24 2012-11-29 Agency For Science, Technology And Research Ires mediated multicistronic vectors
WO2012162705A2 (en) * 2011-05-26 2012-11-29 University Of Washington Cell and gene based methods to improve cardiac function

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MIELKE ET AL.: "Stabilized, long-term expression of heterodimeric proteins from tricistronic mRNA", GENE, vol. 254, no. 1-2, 22 August 2000 (2000-08-22), pages 1 - 8, XP004208775 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12478691B2 (en) 2020-02-13 2025-11-25 Tenaya Therapeutics, Inc. Gene therapy vectors for treating heart disease

Similar Documents

Publication Publication Date Title
US20230220421A1 (en) Gene-therapy vectors for treating cardiomyopathy
JP6767483B2 (en) Modified Friedreich&#39;s ataxia genes and vectors for gene therapy
TWI897882B (en) Gene therapy composition and treatment of right ventricular arrhythmogenic cardiomyopathy
KR102526616B1 (en) Nucleic acid constructs and gene therapy vectors for use in the treatment of wilson disease
US20150139952A1 (en) Methods, compositions, cells, and kits for treating ischemic injury
JP2004313198A (en) Adenovirus-mediated gene transfer into myocardial and vascular smooth muscle
KR20210009317A (en) Gene therapy for diseases caused by unbalanced nucleotide pools, including mitochondrial DNA depletion syndrome
JP2015503924A (en) Methods and compositions for gene transfer
HK1222884A1 (en) Cycle adenosine monophosphate-incompetent adenylyl cyclase and compositions and methods for treating heart failure and increasing cardiac function
US20180099029A9 (en) Serca2 therapeutic compositions and methods of use
WO2021076600A1 (en) Compositions comprising novel prokaryotic sodium channels and associated methods
KR20210086638A (en) Codon-optimized transgene for the treatment of progressive familial intrahepatic cholestasis type 3 (PFIC3)
US20170065685A1 (en) Serca2 therapeutic compositions and methods of use
WO2020176732A1 (en) TREATMENT OF PULMONARY FIBROSIS WITH SERCA2a GENE THERAPY
WO2015153357A1 (en) Compositions and methods for improving cardiac function
ES2432082T3 (en) Use of the MGF splicing variant of insulin-like growth factor I for the prevention of myocardial damage
TW202337476A (en) Gene therapy composition and treatment for dystrophin-related cardiomyopathy
US20240050591A1 (en) Cardiomyocyte-derived nucleic acid regulatory elements and methods and use thereof
WO2002046220A2 (en) Sequences upstream of the carp gene, vectors containing them and uses thereof
AU2002226400A1 (en) Sequences upstream of the carp gene, vectors containing them and uses thereof
Bowles et al. Prospects for gene therapy for inherited cardiomyopathies
US20250360171A1 (en) Chemogenetically gated ion channels and use thereof
CN114736924B (en) Regeneration of cochlear outer hair cells by ectopic combined overexpression of Atoh1 and Ikzf2 and its application
CA2944186C (en) Gene-therapy vectors for treating cardiomyopathy
JP2020505375A (en) Compositions and methods for reducing sarcolipin expression and preventing and treating muscular dystrophy and cardiomyopathy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15772942

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase
122 Ep: pct application non-entry in european phase

Ref document number: 15772942

Country of ref document: EP

Kind code of ref document: A1