WO2015145388A2 - Methods of treating colorectal cancers harboring upstream wnt pathway mutations - Google Patents

Methods of treating colorectal cancers harboring upstream wnt pathway mutations Download PDF

Info

Publication number
WO2015145388A2
WO2015145388A2 PCT/IB2015/052245 IB2015052245W WO2015145388A2 WO 2015145388 A2 WO2015145388 A2 WO 2015145388A2 IB 2015052245 W IB2015052245 W IB 2015052245W WO 2015145388 A2 WO2015145388 A2 WO 2015145388A2
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
colorectal cancer
treatment
wnt
braf
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2015/052245
Other languages
French (fr)
Other versions
WO2015145388A3 (en
Inventor
Linda BAGDASARIAN
Feng Cong
Savina JAEGER
Margaret Elise CLAUGHLIN
Ronald Meyer
Andrea MYERS
Michael Ross PALMER
Youzhen Wang
Stephen David WOOLFENDEN
Ana VIVANCOS
Héctor PALMER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Publication of WO2015145388A2 publication Critical patent/WO2015145388A2/en
Publication of WO2015145388A3 publication Critical patent/WO2015145388A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965Non-condensed pyrazines
    • A61K31/497Non-condensed pyrazines containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators

Definitions

  • the present invention relates to a method of treating patients suffering from BRAF -mutant and BRAF wild-type colorectal cancer by using a Wnt pathway inhibitor or combinations comprising a Wnt pathway inhibitor and another inhibitor.
  • the disclosure also relates to corresponding pharmaceutical formulations, uses, methods, combinations, and related disclosure embodiments.
  • Colorectal cancer is the fourth most frequently diagnosed cancer and the second leading cause of cancer death in the United States and the European Union. I n the last 15 years, the median overall survival (OS) for patients with metastatic CRC has markedly improved from approximately 8-12 months to 18-24 months (Kopetz, S. et al., J. Clin. Oncol. 2009, 27:3677-82). The improvement is attributed to two factors: 1) the increased utilization of hepatic resection and 2) the addition of new medical therapies (irinotecan, oxaliplatin, bevacizumab, cetuximab, and pantiumumab) to the standard treatment with 5-fluorouracil plus leucovorin.
  • new medical therapies irinotecan, oxaliplatin, bevacizumab, cetuximab, and pantiumumab
  • a Wnt inhibitor, or a combination of Wnt inhibitor and either a BRAF inhibitor, or EGFR inhibitor, or both are especially useful for treatment of a patient with a BRAF V600E -mutant colorectal cancer, particularly the cancer with a mutated Wnt pathway.
  • a Wnt inhibitor or a combination of a Wnt inhibitor and an EGFR inhibitor, can be useful for the treatment of patients with microsatellite-unstable BRAF wild-type (BRAF ⁇ ) colorectal cancer with a mutated Wnt pathway, particularly upstream Wnt pathway mutation.
  • the colorectal cancer can be KRAS wild-type (KRAS WT ).
  • CRCs colorectal cancers
  • MAPK pathway activation not Wnt pathway activation, was thought to be the dominant oncogenic driver. It has been unexpectedly found that activation of the Wnt pathway has an important role in the pathogenesis of serrated CRC.
  • Molecular epidemiology data showed that patient BRAF V600E -mu an CRC samples are enriched for genetic alterations in upstream Wnt pathway regulators (e.g. RNF43, ZNRF3, RSP02 and RSP03), strongly confirming this notion.
  • RNF43 mutations are enriched in BRAF V600E CRC. But BRAF V600E CRCs are also frequently microsatellite unstable due to hypermethylation of DNA repair genes (Lubomierski, N. et al., Cancer 2005, 104:952-61). The mismatch repair deficiency in these tumors may directly contribute to RNF43 mutagenesis, as RNF43 mutations tend to be small insertions/deletions in homopolymeric tracts.
  • BRAF 7 , KRASTM 7 CRCs with RNF43 mutations may also benefit from COM POU N D A and/or COM POU N D A+cetuximab
  • a Wnt inhibitor or a combination of a Wnt inhibitor and an EGFR inhibitor, can be useful for the treatment of patients with microsatellite-unstable, BRAF wild-type (BRAF ⁇ ), KRAS wild-type (KRAS ⁇ ) colorectal cancer harboring upstream Wnt pathway mutations.
  • BRAF ⁇ microsatellite-unstable, BRAF wild-type
  • KRAS ⁇ KRAS wild-type
  • microsatellite unstable colorectal cancer is expected to be BRAF mutant.
  • BRAF wild-type colorectal cancer was found to be sensitive to a Wnt inhibitor, either alone or in combination with another drug.
  • Wnt inhibitor either alone or in combination with another drug.
  • RN F43 mutation it would be possible to treat BRAF wt colorectal cancer as long it harbors RN F43 or other WNT upstream pathway mutation.
  • ZNRF3 and RN F43 are both homologous cell surface transmembrane E3 ubiquitin ligases for Wnt receptor Frizzled it is expected that the Wnt inhibitor could be effectively applied in the treatment of colorectal cancer, BRAF V600E mutated or BRAF wt, which is ZN RF3 mutated (but not RN F43 mutated).
  • BRAF V600E mutated or BRAF wt which is ZN RF3 mutated (but not RN F43 mutated).
  • the cancer is BRAF wt, there is no need to use a BRAF inhibitor together with the Wnt inhibitor.
  • the present disclosure provides the following aspects, advantageous features and specific embodiments, respectively alone or in combination, as listed in the following items:
  • a Wnt inhibitor for use in the treatment of BRAF V600E -mutant colorectal cancer 1.
  • a Wnt inhibitor for use in the treatment of BRAF V600E -mutant colorectal cancer according to any one of items 1 to 3 in combination with a BRAF inhibitor.
  • a Wnt inhibitor for use in the treatment of microsatellite-unstable, BRAF wild-type and KRAS wild-type colorectal cancer 5.
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
  • colorectal cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03.
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 8, wherein the colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRPl-3, WI F-1, DKKl, DKK4, LKBl/STKll, Keap-1 and/or N RF2, preferably ZNRF3.
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 4 to
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 4 to
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
  • a Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 19 in a form of a pharmaceutical composition is provided.
  • a pharmaceutical combination comprising (i) a Wnt inhibitor and (ii) a BRAF inhibitor.
  • the pharmaceutical combination according to item 21 further comprising an EGFR inhibitor.
  • 23 A pharmaceutical combination comprising a Wnt inhibitor and an EGFR inhibitor.
  • colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRP1- 3, WI F-1, DKK1, DKK4, LKB1/STK11, Keap-1 and/or N RF2, preferably ZN RF3.
  • a Wnt inhibitor for use in the treatment of BRAF V600E -mutant colorectal cancer according to any one of items 4, 6 to 20, 49 or 50, or a pharmaceutical combination according to any one of items 21, 22, 24 to 29, 31 to 36 or 39 to 50, wherein the BRAF inhibitor is (S)-methyl-l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate, methyl N-[(2S)-l-( ⁇ 4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl ⁇ amino)propan-2-yl]carbamate or vemurafenib
  • a Wnt inhibitor for use in the treatment of BRAF V600E -mutant colorectal cancer according to any one of items 4, 6 to 20, 49 or 50, or a pharmaceutical combination according to any one of items 21, 22, 24 to 29, 31 to 36 or 39 to 50, wherein the BRAF inhibitor is (S)-methyl-l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate.
  • a method of treating a patient having colorectal cancer further defined as in any one of items 1 to 20, or 49 to 57, wherein the amount of the inhibitor administered to a patient is therapeutically effective.
  • Colorectal cancer as used herein means a neoplasm arising from the colon and/or rectum, particularly from the epithelium of the colon and/or rectum.
  • “Mutated” or “mutation” denots herein an alteration from a normal functional or wild type protein, cDNA, gene or mRNA, which results in changed activity, or loss thereof. It includes changed mutation status like for example frame-shift mutation, deletion, translocation, insertion, duplication, inversion, functional mutation; or combinations thereof. It includes also DNA modification, cDNA modification, mRNA modification, protein modification, DNA function, cDNA function, mRNA function, protein function, DNA mutation, cDNA mutation, mRNA mutation, protein mutation, or combinations thereof; preferably is DNA mutation.
  • DNA modification includes DNA alkylation or acylation.
  • methylation is a biochemical process involving the addition of a methyl group to the cytosine or adenine DNA nucleotides.
  • mRNA modification includes RNA editing, which is a biochemical process involving the change of nucleotides after they have been generated by RNA polymerase to form a sequence.
  • cDNA modification includes any modification that was made at the mRNA level will be translated into cDNA modification.
  • Protein modification includes a biochemical process involving the change of amino acids after they have been translated. Protein function is understood for proteins to carry out the duties specified by the information encoded in genes, including facilitation of signaling transduction, enzymatic reactions etc.
  • Gene expression or “expression” are both used herein interchangeably and refer to the nucleic acids or amino acids (e.g., peptide or polypeptide) generated when a gene is transcribed and translated.
  • gene expression or “expression” denote DNA expression, mRNA expression, cDNA expression, transcription, protein transcription or protein expression.
  • Detection of gene expression can be by any appropriate method, including for example, detecting the quantity of mRNA transcribed from the gene or the quantity of cDNA produced from the reverse transcription of the mRNA transcribed from the gene or the quantity of the polypeptide or protein encoded by the gene. Transcription or translation can be determined using known techniques. For example, an amplification method such as PCR may be useful. The same principles apply to "overexpression”.
  • Control denotes herein to the sequence, parameter or level measured for comparison in a noncancerous, healthy, wild-type tissue or cell.
  • the control can be the sequence, parameter or level measured in a normal colonic epithelium.
  • a Wnt pathway in the colorectal cancer can be activated (increased Wnt signaling) or inactivated (decreased Wnt signaling) compared to a control. This refers to the increased or decreased, respectively, expression or functional effect of Wnt pathway genes, corresponding mRNA and equally to transcription or functional effect of proteins encoded by said genes or mRNA.
  • “Mutated Wnt pathway” or “upstream Wnt pathway mutation” as used herein means any mutation in a gene encoding a protein in the Wnt pathway that increases Wnt signaling in colorectal cancer relative to a control, in a Wnt ligand-dependent manner.
  • the control can be Wnt signaling in normal colonic epithelium.
  • mutations in the following genes may increase Wnt signaling in a Wnt ligand-dependent manner: ZNRF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRP1-3, WI F-1, DKK1, DKK4,
  • “Microsatellite-unstable tumor” is a tumor that is hypermutable due to inactivation of one or more mismatch repair system genes, for example MLH1, MSH2, MSH6, and PMS2.
  • FIG. 1 RNF43 mutations and RSPO fusions co-occur with BRAF V600E mutations in patient CRC samples.
  • APC mutations show a strong tendency to be non-overlapping with RNF43 mutations and RSPO fusions.
  • JHOM-2B cell line is derived from a lower Gl adenocarcinoma.
  • A Representative images of CK7 staining (Left) or CK20 staining (Right) of a JHOM-2B tumor xenograft.
  • B DNA sequence of the fusion breakpoint between exonl of PTPRK and exon 2 of RSP03 in JHOM-2B.
  • JHOM-2B tumor cells are sensitive to COMPOUND A; however, COMPOUND A antagonizes the tumor growth inhibition of COMPOUND B plus cetuximab in vitro.
  • COMPOUND A In a foci formation assay, decreased JHOM-2B colonies are seen after treatment with COMPOUND A.
  • COMPOUND A inhibits the proliferation of JHOM-2B tumor cells in a 7-day CTG assay, with an EC 50 of 0.06 ⁇ xM.
  • C Addition of COMPOUND A to COMPOUND B+cet has an antagonistic effect on tumor growth inhibition in vitro.
  • FIG. 5 Effects of COMPOUND A, COMPOUND B, cetuximab and combination treatments on Wnt and MAPK signaling pathways in JHOM-2B tumor cells.
  • JHOM-2B tumor cells were treated with 100 nM COMPOUND A, 100 nM COMPOUND B, and/or 50 nM cetuximab for 72 hours prior to collection of protein lysates and immunoblotting.
  • FIG. 7 COMPOUND A induces cell cycle arrest in JHOM-2B tumor xenografts, as a single agent and in combination.
  • A Representative images of pHH3 staining by immunohistochemistry after 14 days of treatment (the COMPOUND A and COMPOUND A+cet treatment groups were collected after 11 days of treatment).
  • Figure 8. COMPOUND A induces mucinous differentiation of JHOM-2B tumor xenografts, as a single agent and in combination.
  • FIG. 9 The triple combination of COMPOUND A+COMPOUND B+cet is efficacious in HCOX1329 patient-derived xenografts in vivo.
  • A HCOX1329-tumor-bearing mice were treated with 10 ml/kg vehicle, p.o., BID (filled circles); 5 mg/kg COMPOUND A, p.o.
  • COMPOUND A and COMPOUND B modestly induce cell cycle arrest in HCOX1329 patient- derived tumor xenografts; additional cell cycle arrest is seen with combination treatments.
  • FIG. 11 The combinations of COMPOUND A+COMPOUND B and COMPOUND A+COMPOUND B+cet induce mucinous differentiation of HCOX1329 tumor xenografts.
  • A Representative images of Alcian blue staining after 10 days of treatment. In contrast to JHOM-2B xenografts that accumulate intra- and extracellular mucin upon treatment, treatment of HCOX1329 xenografts results in a selective increase in intracellular mucin (arrows).
  • FIG. 12 No statistically significant decrease in tumor volume is seen in T70 patient-derived xenografts treated with COMPOUND A, cetuximab, or COMPOUND A+cetuximab in vivo.
  • A T70-tumor-bearing mice were treated with 10 ml/kg vehicle, p.o., BID (filled circles); 5 mg/kg COMPOUND A, p.o. BID (open squares); 20 mg/kg cetuximab, i.p., 2x/wk (filled upside down triangles); or COMPOUND A+cetuximab (open circles) for 14 days.
  • B Scatter plot of individual tumor volumes.
  • COMPOUND A and COMPOUND A+cetuximab induce cell cycle arrest in T70 patient-derived tumor xenografts.
  • A Representative images of Ki67 staining by immunohistochemistry after 14 days of treatment.
  • FIG. 14 COMPOUND A and COMPOUND A+cetuximab induce mucinous differentiation of T70 tumor xenografts.
  • A Representative images of Alcian blue staining after 14 days of treatment.
  • a Wnt inhibitor, or a combination of Wnt inhibitor and either a BRAF inhibitor, or EGFR inhibitor, or both are especially useful for treatment of a patient with a BRAF V600E -mutant colorectal cancer and microsatellite-unstable, BRAF wild-type (BRAF ⁇ ), KRAS wild- type (KRAS WT ) colorectal cancer harboring, particularly the cancer with a mutated Wnt pathway.
  • Wnt/P-catenin signaling promotes cell survival in various cell types (Orford et al., J Cell Biol, 146:855-868 (1999); Cox et al., Genetics, 155:1725-1740 (2000); Reya et al., Immunity, 13:15-24 (2000); Satoh et al., Nat Genet, 24:245-250 (2000); Shin et al., Journal of Biological Chemistry, 274:2780-2785 (1999); Chen et al., J Cell Biol, 152:87-96 (2001); Loannidis et al., Nat Immunol, 2:691-697 (2001)).
  • a Wnt inhibitor can be any compound which targets and decreases or inhibits the Wnt pathway.
  • a Wnt inhibitor can be a compound, protein or antibody that reduces the beta-catenin target gene expression of AXIN2 by at least 50% with an EC 50 of 10 ⁇ or less, preferably less than ⁇ , in a tumor cell line with autocrine Wnt signaling (H PAF-I I).
  • Gene expression is measured against a control, which can be either gene expression of AXIN2 in an untreated cell sample, and/or against the gene expression of housekeeping genes in the treated sample, such as gene expression of for example GAPDH, HSP90, 6- actin, ACTB and 62 M.
  • the Wnt inhibitor is particularly a compound, protein or an antibody which inhibit members of the Wnt pathway, for example inhibits or reduces activity of Porcupine, RSP02, RSP03, Frizzled, LRP6 or Tankyrase.
  • the inhibitor can be for example XAV939, IWR1, IWP-1, IWP-2, JW74, JW55, Tautomycin, SB239063, SB203580, ADP-H PD, 2-[4-(4-fluorophenyl)piperazin-l-yl]-6-methylpyrimidin-4(3H)-one, PJ34, Niclosamide, Cambinol, Sulindac, 3289-8625, J01-017a, NSC668036, Filipin, IC261 or other Wnt inhibitors disclosed herein.
  • a Wnt inhibitor can especially be a compound that inhibits Frizzled or Porcupine, most preferably Porcupine.
  • the Wnt inhibitor according to the present disclosure is 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide (compound A).
  • the compound A can be prepared as described in WO2010/101849 and has a structure of formula
  • Mitogen-activated protein kinase (MAPK) hyper-activation is a common property of human cancers and is often due to activating mutations in the BRAF and RAS genes.
  • BRAF kinase domain mutations result in the production of a constitutively activated form of the protein and occur in approximately 8% of human tumors (Davies et al., 2002; Wan et al., 2004).
  • BRAF mutation stimulates extracellular signal-regulated kinase (ERK) signaling, induces proliferation and is capable of promoting transformation.
  • BRAF inhibitors are compounds, especially compounds, proteins or antibodies which target BRAF, particularly mutant BRAF, and its downstream effectors.
  • BRAF inhibitor can be selected from the group consisting of: ((S)- methyl-l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin- 2-ylamino)propan-2-ylcarbamate;
  • the BRAF inhibitor is (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate of formula (I I ) (compound B).
  • the BRAF inhibitors can be obtained by the processes disclosed in WO2011/025927. Where the colorectal cancer is BRAF wild-type, like for example in the microsatellite-unstable BRAF wild- type and KRAS wild-type colorectal cancer, the BRAF inhibitor may not be used in combination with the Wnt inhibitor.
  • EGFR inhibitor can be any compound that targets, decreases or inhibits the activity of the epidermal growth factor family of receptor tyrosine kinases (EGFR, ErbB2, ErbB3, ErbB4 as homo- or heterodimers) and their mutants.
  • Such compounds which target, decrease or inhibit the activity of the epidermal growth factor receptor family are especially compounds, proteins or antibodies which inhibit members of the EGF receptor tyrosine kinase family, e.g. EGF receptor, ErbB2, ErbB3 and ErbB4 or bind to EGF or EGF related ligands, and are in particular those compounds, proteins or monoclonal antibodies generically and specifically disclosed in WO 97/02266, e.g. the compound of ex.
  • trastuzumab (HerceptinTM), cetuximab (ErbituxTM), Iressa, Tarceva, OSI-774, CI-1033, EKB-569, GW-2016, El.l, E2.4, E2.5, E6.2, E6.4, E2.ll, E6.3 or E7.6.3, and 7H-pyrrolo-[2,3-d]pyrimidine derivatives which are disclosed in WO 03/013541, gefitinib, erlotinib, lapatinib, XL-647, HKI-272 (Neratinib), BIBW2992 (Afatinib), EKB-569 (Pelitinib), AV-412, canertinib, PF00299804, BMS 690514, HM781-36b, WZ4002, AP- 26113, panitumumab, matuzumab, pertuzumab, or (R,E)-N-(7-chloro-l-(
  • the EGFR inhibitor is cetuximab.
  • the EGFR inhibitor is (/?,f)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2- enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2-methylisonicotinamide.
  • the EGFR inhibitor is (/?,f)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2- enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6-dimethylisonicotinamide.
  • the combination partners are 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2- yl)pyridin-2-yl)acetamide, (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l- isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate and/or cetuximab.
  • the combination partners are 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5- (pyrazin-2-yl)pyridin-2-yl)acetamide, (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-
  • the present disclosure embodiments also include pharmaceutically acceptable salts of the compounds useful according to the disclosure described herein.
  • pharmaceutically acceptable salt refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form.
  • pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • the pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
  • the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred.
  • Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2 (1977), each of which is incorporated herein by reference in its entirety.
  • the salt is sulphate salt, or bisulphate salt.
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • treating comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease.
  • treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer.
  • the term “treat” also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease.
  • protecting is used herein to mean prevent delay or treat, or all, as appropriate, development or continuance or aggravation of a disease in a subject, e.g., a mammal or human.
  • the compounds useful according to the disclosure can also be present as tautomers, N-oxides or solvates, e.g. hydrates. All these variants, as well as any single one thereof or combination of two or more to less than all such variants, are encompassed and to be read herein where a compound included in the inventive combination products, e.g. a Wnt inhibitor and/or a BRAF inhibitor, is mentioned.
  • the present disclosure relates to a pharmaceutical combination, especially a pharmaceutical combination product, comprising the mentioned combination partners and at least one pharmaceutically acceptable carrier.
  • “Pharmaceutical combination” refers to use, application or formulations of the separate partners with or without, preferably with, instructions for combined use or to combination products.
  • the combination partners may thus administered entirely separately or be entirely separate pharmaceutical dosage forms.
  • the combination partners may be pharmaceutical compositions that are also sold independently of each other and where just instructions for their combined use are provided in the package equipment, e.g. leaflet or the like, or in other information e.g. provided to physicians and medical staff (e.g. oral communications, communications in writing or the like), for simultaneous or sequential use for being jointly active, especially as defined below.
  • the effect is synergistic.
  • the selected combination partner are to be administered to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration and/or at the same time.
  • pharmaceutical combination as used herein thus means a pharmaceutical product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients (which may also be combined).
  • the compounds of the present disclosure can be used as a fixed or non-fixed combination.
  • the term "fixed combination” means that the active ingredients, e.g. a Wnt inhibitor and a BRAF inhibitor, are both administered to a patient simultaneously in the form of a single entity or dosage.
  • the active ingredients are present in one dosage form, e.g. in one tablet or in one capsule.
  • non-fixed combination means that the active ingredients are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient.
  • cocktail therapy e.g. the administration of three or more active ingredients.
  • non-fixed combination thus defines especially administration, use, composition or formulation in the sense that the combination partners (i) Wnt inhibitor and either (ii) BRAF inhibitor or (iii) EGFR inhibitor, or both (and if present further one or more co-agents); for example (i) Wnt inhibitor and EGFR inhibitor alone; as defined herein can be dosed independently of each other or by use of different fixed combinations with distinguished amounts of the combination partners, i.e.
  • the combination partners may also be used as entirely separate pharmaceutical dosage forms or pharmaceutical formulations that are also sold independently of each other and just instructions of the possibility of their combined use is or are provided in the package equipment, e.g. leaflet or the like, or in other information e.g. provided to physicians and medical staff.
  • the independent formulations or the parts of the formulation, product, or composition can then, e.g. be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts.
  • the time intervals are chosen such that the effect on the treated disease in the combined use of the parts is larger than the effect which would be obtained by use of only any one of the combination partners (i), (ii) and (iii), thus being jointly active.
  • the total amounts of the combination partners to be administered in the combined preparation can be varied, e.g. in order to cope with the needs of a patient sub-population to be treated or the needs of the single patient which different needs can be due to age, sex, body weight, etc. of the patients.
  • the combination partners, a Wnt inhibitor, a BRAF inhibitor and a EGFR inhibitor in any disclosed embodiment are preferably formulated or used to be jointly (prophylactically or especially
  • beneficial effect e.g. a mutual enhancing of the effect of the combination partners, in particular a synergism, e.g. a more than additive effect, additional advantageous effects (e.g. a further therapeutic effect not found for any of the single compounds), less side effects, a combined therapeutic effect in a non-effective dosage of one, both or all three combination partners, and very preferably a clear synergism of the combination partners.
  • beneficial effect e.g. a mutual enhancing of the effect of the combination partners, in particular a synergism, e.g. a more than additive effect, additional advantageous effects (e.g. a further therapeutic effect not found for any of the single compounds), less side effects, a combined therapeutic effect in a non-effective dosage of one, both or all three combination partners, and very preferably a clear synergism of the combination partners.
  • the term "jointly (therapeutically) active” may mean that the compounds may be given separately or sequentially (in a chronically staggered manner, especially a sequence-specific manner) in such time intervals that they preferably, in the warm-blooded animal, especially human, to be treated, and still show a (preferably synergistic) interaction (joint therapeutic effect).
  • a joint therapeutic effect can, inter alia, be determined by following the blood levels, showing that both compounds are present in the blood of the human to be treated at least during certain time intervals, but this is not to exclude the case where the compounds are jointly active although they are not present in blood simultaneously.
  • the present disclosure thus pertains to a combination product for simultaneous or sequential use, such as a combined preparation or a pharmaceutical fixed combination, or a combination of such preparation and combination.
  • the compounds useful according to the disclosure may be manufactured and/or formulated by the same or different manufacturers.
  • the combination partners may be brought together into a combination therapy: (a) prior to release of the combination product to physicians (e.g. in the case of a kit comprising the compound of the disclosure and the other therapeutic agent); (b) by the physician themselves (or under the guidance of a physician) shortly before administration; (c) in the patient themselves, e.g. during sequential administration of the compound of the disclosure and the other therapeutic agent.
  • the combination partners form ing a corresponding combination according to the disclosure may be mixed to form a fixed pharmaceutical composition or they may be administered separately or pairwise (i.e. before, simultaneously with or after the other drug substance(s)).
  • pharmaceutically effective preferably relates to an amount that is effective against the progression of a disease or disorder as disclosed herein.
  • a Wnt inhibitor, the combinations according to the present disclosure, pharmaceutical compositions or combination product of the present disclosure is especially suitable for treatment of a patient suffering from a proliferative disorder, in particular a solid tumor, BRAF V600E -mutant colorectal cancer, which can be microsatellite-unstable, or microsatellite-unstable BRAF wild-type and KRAS wild-type colorectal cancer.
  • a Wnt pathway in the BRAF V600E -mutant colorectal cancer or microsatellite- unstable BRAF wild-type and KRAS wild-type colorectal cancer is activated compared to a control.
  • AXIN2 expression in the colorectal cancer is higher compared to a control.
  • the cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03, particularly mutated RNF43. Because RNF43 and ZN RF3 are two homologous Zinc/RI NG finger cell surface transmembrane E3 ubiquitin ligases for Wnt receptor Frizzled that inhibit the cell surface levels of Wnt receptor complex composing Frizzled and LRP6, a Wnt inhibitor can also be used in ZN FR43 mutated colorectal cancer.
  • the cancer can alternatively or in addition comprise RSPO fusion.
  • a therapeutically effective amount of a compound of the present disclosure refers to an amount of the compound of the present disclosure that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc.
  • a therapeutically effective amount refers to the amount of the compound of the present disclosure that, when administered to a subject, is effective to (1) at least partially alleviating, inhibiting, preventing and/or ameliorating a condition, or a disorder or a disease (i) mediated by a Wnt pathway, or mediated by BRAF activity and/or EGFR activity, or (ii) characterized by activity (normal or abnormal) of Wnt pathway, EGFR and/or BRAF; or (2) reducing or inhibiting the activity of Wnt pathway, EGFR and/or of BRAF.
  • the term "subject" refers to an animal. Typically the animal is a mammal. A subject also refers to for example, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds and the like. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.
  • primates e.g., humans
  • the subject is a primate.
  • the subject is a human.
  • Wnt inhibitor can be for example administered in unit dosage of about 1-5000 mg of active ingredient(s) for a subject of about 50-70 kg, or about lmg - 3g or about 1-250 mg or about 1-150 mg or about 0.5- 100 mg, or about 1-50 mg of active ingredients.
  • the therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof, is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.
  • BRAF inhibitor of the present disclosure can be administered in therapeutically effective amounts via any of the usual and acceptable modes known in the art.
  • a therapeutically effective amount may vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the compound used and other factors. In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0.03 to 30mg/kg per body weight.
  • An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0.5mg to about 2000mg, conveniently administered, e.g. in divided doses up to four times a day or in retard form.
  • Suitable unit dosage forms for oral administration comprise from about 1 to 500mg active ingredient.
  • an indicated daily dosage in the larger mammal e.g. humans, is in the range from about 0.5 mg to about 100 mg, conveniently administered, e.g. in divided doses up to four times a day or in retard form.
  • Suitable unit dosage forms for oral administration comprise from ca. 1 to 50 mg active ingredient.
  • a therapeutic amount or dose of the compounds of the present disclosure may range from about 0.1 mg/kg to about 500 mg/kg, alternatively from about 1 to about 50 mg/kg.
  • treatment regimens according to the present invention comprise administration to a patient in need of such treatment from about 10 mg to about 1000 mg of the compound(s) of this invention per day in single or multiple doses (such as two, three, or four times daily).
  • Therapeutic amounts or doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.
  • the dosage of the active ingredient to be applied to a warm-blooded animal depends upon a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound employed.
  • a physician, clinician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition.
  • Optimal precision in achieving concentration of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug.
  • carrier or “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
  • the pharmaceutical combination product according to the disclosure (as fixed combination, or as kit, e.g. as combination of a fixed combination and individual formulations for one or both combination partners or as kit of individual formulations of the combination partners) comprises the combination of the present disclosure and one or more pharmaceutically acceptable carrier materials (carriers, excipi- ents).
  • the pharmaceutical combination or the combination partners constituting it can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal administration, etc.
  • the combination products of the present disclosure can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
  • the combination products and/or their combination partners can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifers and buffers, etc.
  • the pharmaceutical compositions are tablets or gelatin capsules comprising the active ingredient together with one or more commonly known carriers, e.g. one or more carriers selected from the group consisting of a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or
  • carriers e.g., one or more carriers selected from the group consisting of a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine
  • lubricants e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or
  • binders e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth,
  • methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone if desired d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and e) absorbents, colorants, flavors and sweeteners.
  • disintegrants e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures
  • absorbents, colorants, flavors and sweeteners e.g., sodium carboxymethylcellulose and/or polyvinylpyrrolidone
  • Tablets may be either film coated or enteric coated according to methods known in the art.
  • compositions for oral administration especially include an effective amount of one or more or in case of fixed combination formulations each of the combination partners (active ingredients) in the form of tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets may contain the active ingredient(s) in admixture with nontoxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets are uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monostearate or glyceryl distearate can be employed.
  • Formulations for oral use can be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water or an oil medium for example, peanut oil, liquid paraffin or olive oil.
  • Parenteral compositions, transdermal, topical compositions and other can be prepared by known methods in the art.
  • Example 1 Co-occurrence of BRAF V600E and upstream Wnt pathway mutations in patient CRC samples
  • CRCs There are at least two distinct molecular pathways that underlie the pathogenesis of sporadic CRC: the conventional pathway and the serrated pathway. Approximately 70% of CRCs arise via the conventional pathway. These tumors are characterized by mutational activation of the Wnt pathway through inactivating mutations in APC or AXIN2 or mutations in the GSK3-target residues in beta-catenin (Jin, L.H., et al. Int. J. Cancer. 2003, 107:696-99; Korinek, V., et ai, Science. 1997, 275:1784-7; Morin, P.J., et ai, Science.
  • APC associates with AXI N, GSK-3beta and casein kinase 1 to form the beta-catenin destruction complex. This complex phosphorylates beta-catenin, resulting in its ubiquitylation and subsequent degradation by the proteasome (Polakis, P. Curr. Biol. 2002, 12:R499-R501).
  • TNF/LEF T-cell factor/lymphoid enhancer factor
  • Serrated pathway CRCs contain either BRAF or KRAS mutations, and lack APC mutations (Bettington, M., et al., Histopathol. 2013, 62:367-86).
  • Wnt pathway activation was identified as an important step in the progression from intestinal hyperplasia to carcinoma (Rad, R., et al., Cancer Cell. 2013, 24:15-29).
  • BRAF-mutant CRCs tend to have minimal chromosomal instability and exhibit hypermethylation of CpG islands, which can decrease the expression of DNA repair genes and cell cycle regulators.
  • the mutant BRAF inhibitor vemurafenib achieves a response rate of approximately 80% in BRAF V600E -mutant melanoma
  • the response rate in BRAF V600E -mutant CRC is approximately 5% (Kopetz, S. et al. J. Clin. Oncol, abstr. 2010, 28:3534; Corcoran, R.B., et al., J. Clin. Oncol. Suppl. abstr. 2012, 3528).
  • RSPOl-4 secreted glycoproteins R-spondins 1-4
  • RSPOs bind to LGR4-6 receptors and the transmembrane E3 ubiquitin ligases RNF43 and ZNRF3, forming a ternary complex (Chen, P-H., et al., Genes Dev. 2013, 27:1345-50; Xie, Y., et al., EMBO Rep. 2013, 14:1120-6; Zebisch, M., et al., Nature Com. 2013, 4:1-12).
  • RNF43/ZNRF3 antagonize Wnt signaling by promoting the turnover of the Wnt receptors, Frizzled and LRP6 (Hao, H.X., et al., Nature. 2012, 485:195-200; Koo, B.K., et al., Nature. 2012, 488:665-9). Binding of RSPO induces the endocytosis of RNF43/ZNRF3, thereby increasing levels of membrane-bound Frizzled and LRP6 and enhancing Wnt signaling.
  • RSPO fusions that elevate expression of RSP02 or RSP03 have been identified in colon cancer (Seshagiri, S., et al., Nature. 2012, 488:660-4), and inactivating mutations in RNF43 have been reported in mucinous tumors of the pancreas, mucinous ovarian carcinoma, and
  • BRAF -mutant CRC resection specimens Forty-five BRAF -mutant CRC resection specimens were purchased from Asterand, PLC. The FFPE blocks were sent to Foundation Medicine, Inc. for genetic analysis using the T5b NGS panel. Complete characterization was received, and BRAF/Wnt pathway genetic mutation annotation was performed manually. Tabularization and graphical representation was performed using EXCEL.
  • Threshold setting was automatically set by ABI7900 software (SDS2.4), and all samples were normalized to a UBC control gene. Samples with expression higher than 30 Ct's in the fusion assays are considered positive for the corresponding RSPO fusion.
  • the frequency of RSPO fusions may also be enriched in the BRAF V600E -mutant CRCs, with a frequency of RSP02 plus RSP03 fusions of 13.3% in BRAF V600E -mutant CRC samples versus 2% when 430 unselected CRC samples in the TCGA database are analyzed with a trial version of OmicSoft.
  • This molecular epidemiology data strongly suggests that Wnt pathway activation, via genetic alterations in upstream Wnt pathway regulators, is important for BRAF V600E -mutant CRC tumorigenesis.
  • Example 2 Efficacy of a Wnt pathway inhibitor and combinations comprising (i) a Wnt pathway inhibitor, (ii) a mutant BRAF inhibitor, and/or (iii) an EGFR inhibitor in a BRAF V600E ;RSPO3 fusion + lower Gl adenocarcinoma cell line model and a patient-derived BRAF V600E ;RNF43-mutant CRC xenograft model
  • Genomic DNA of J HOM-2B cells was isolated .
  • the DNA fragment containing PTPRK-RSP03 fusion was amplified by PCR using HH3 and HH4 primers, and analyzed by electrophoresis. DNA sequence of PCR fragment was determined by Sanger sequencing. Sequence of HH3 and HH4 primers are following. HH3: AAACTCGGCATGGATACGAC. HH4: G CTTCATG CC AATTCTTTCC .
  • JHOM-2B cells were cultured in DMEM:F-12 (ATCC, Cat# 30-2006), supplemented with 10% fetal bovine serum (5% C02 at 37°C).
  • JHOM-2B cells For foci formation assay, approximately 12,000 JHOM-2B cells were seeded in a 6-well tissue culture plate with 2 mL of growth media. After overnight culture for cell attachment, media was replaced with fresh growth media containing 1 ⁇ of COM POUND A and/or DMSO. When cell colonies reached a desirable size (24 days), cells were fixed with 10% (vol/vol) buffered formalin and stained with crystal violet solution. After several washes, the plate was dried and imaged.
  • Cell proliferation and EC 50 values were determined through the use of CellTiter-Glo ® (CTG), a method based on luminescent detection of mitochondrial ATP (Promega, Cat# G7573).
  • CCG CellTiter-Glo ®
  • CTG was determined at day 0 and day 7 of treatment as follows: 100 ⁇ of the CTG reagent was added to each well of the 96 well plates, and placed on a shaker for 30-45 minutes at room temperature. Luminescence was measured using the Perkin Elmer-VictorTM X4. Raw luminescent readings were entered into an Excel spread sheet that was formulated to determine the EC 50 value for each PDAC cell lines (day 7 - day 0).
  • the combination assay was set-up in the same manner as the growth assay, with several exceptions.
  • Compound was added in an 8 x 8 dose-matrix fashion, with COMPOUND A dilutions added to one axis, and COMPOUND B added to the other axis.
  • a CTG assay was performed on the plates after 7 days of compound treatment.
  • Raw luminescent readings were entered into an Excel spread sheet that was formulated to determine inhibition values, which were then entered into an Excel spread sheet that was used uploaded to the Chalice Analyzer server.
  • the final inhibition grid was visualized using the Chalice Analyzer Client program.
  • JHOM-2B cells were plated onto 10 cm tissue culture dishes at approximately 1.5 e+6 cells per dish, and treated with COMPOUND A (100 nM) or DMSO for 72 hours.
  • Total RNA from COMPOUND A treated and untreated JHOM-2B cells was extracted using the RNeasy Plus Mini Kit (Qiagen, Cat# 74134) and reverse transcribed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat# 4368814), according to the manufacture's protocol. Gene transcript expression levels were determined using the Applied Biosystems 7900HT Fast Real-time PCR System.
  • Quantitative real-time polymerase chain reactions were performed in 12 ⁇ reactions, consisting of 0.6 ⁇ of 20x TaqMan ® Gene Expression Assay, 6 ⁇ TaqMan ® 2x Universal PCR Master Mix (Applied Biosystems, Cat# 4304437), 0.4 ⁇ DNase/RNase free distilled water and 5 ⁇ cDNA template (1 ng/ ⁇ ). Thermocycling conditions were as follows: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. All experimental reactions were carried out in quadruplicate. Gene expression was quantified using the ⁇ 2 cycle threshold method, with 18s serving as an internal control.
  • Applied Biosystems TaqMan ® Gene Expression Assay reagents used were as follows: AXIN2 (Hs00610344_ml), CCND1 (CyclinDl) (Hs0076553_ml), LGR5 (Hs00969418_ml), MYC (Hs00153408_ml) and 18s (4319413E). Statistical analysis was performed using a Student's t-test.
  • JHOM-2B cells were plated onto 8-10 cm tissue culture dishes at approximately 1.5 e+6 cells per dish, and treated for 72 hours under the following conditions: DMSO; COM POUND A (100 nM); NVP- COMPOUND B-NX-12 (COMPOUND B) (100 nM); cetuximab (50 nM); COMPOUND A (100 nM) +
  • COMPOUND B (100 nM); COMPOUND A (100 nM) + cetuximab (50 nM); COMPOUND B (100 nM) + cetuximab (50 nM); and COMPOUND A (100 nM) + COMPOUND B (100 nM) + cetuximab (50 nM).
  • Phospho-LRP6 Cell Signaling Technology (CST), Cat# 2568, 2% milk
  • LRP6 CST, Cat# 3395, 2 % milk
  • Phospho-EGFR Tyrl068
  • CST Cell Signaling Technology
  • Phospho-EGFR Tyrl068
  • CST Cell Signaling Technology
  • EGFR CST, Cat#2232 , 5 % BSA
  • Phospho-p44/42 MAPK Erkl/2)(Thr202/Tyr204)
  • p44/42 MAPK Erkl/2
  • Cleaved Caspase-8 CST, Cat# 9496, 5 % BSA
  • c-Myc Abeam, Cat# ab32072, 2% milk
  • p21/Wafl/Cipl CST, Cat# 2947, 5% milk
  • ⁇ -Myc Abeam,
  • Blocking reagents were prepared fresh in phosphate buffered saline 0.1% (vol/vol) Tween-20 (PBS-T), and membranes were blocked for 1 hr on a shaker at room temperature.
  • Primary antibodies were added at 1:1000 dilutions (p44/42 MAPK (Erkl/2) 1:5000, and ⁇ -Tubulin 1:10,000), and incubated overnight with gentle rocking at 4° C. Immunoblots were washed 3 times, 5 min each with PBS-T, and secondary antibody was added at 1:10,000 dilution into PBS-T milk for 1 hour on a shaker at room temperature. After several washes, enhanced chemiluminescence (ECL) reactions were performed according to manufacture recommendations (SuperSignal ® West Dura Extended Duration Substrate; Thermo Scientific, Cat# 34076).
  • IHC was performed on the Ventana DISCOVERY XT automated I HC platform (Tuscon, AZ), using optimized protocols described below.
  • FFPE slides were cut at 3.5 ⁇ thickness, attached to charged slides (Thermo-Scientific Colormark Plus Cat # CM-5951PLUS BLUE), baked at 60°C for 1 hour and loaded on the DISCOVERY XT Staining System. Slides were deparaffinized using Ventana EZ Prep (Cat # 950- 100). Antigen retrival was performed using Ventana Cell Conditioning #1 reagent (Cat # 950-124).
  • a rabbit monoclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding C-terminus of human keratin 7 protein (Catalog # M3522, Lot# 121022C) was obtained from Spring Bioscience (Pleasanton, CA.). The antibody was stored at 4°C until use.
  • Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent (Cat # S0809), manually applied during the antibody titration step in 100 ⁇ volume, and incubated for 60 minutes at 37°C. Subsequently, incubation with Ventana OmniMap prediluted HRP-conjugated anti-rabbit antibody (Cat # 760-4311) was performed for 4 minutes.
  • a rabbit monoclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding C-terminus of human keratin 20 protein (Catalog # M3332, Lot# 121218CD) was obtained from Spring Bioscience (Pleasanton, CA.). The antibody was stored at 4°C until use.
  • a rabbit polyclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding SerlO of phospho-Histone H3 was obtained from Cell Signaling Technology (Danvers, MA). The antibody was stored at -20°C until use.
  • the optimal IHC protocol included Heat and Ventana "Standard- Cell Conditioning 1" setting for antigen retrieval.
  • a rabbit polyclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Ki67 was obtained from Cell Signaling
  • the antibody was stored at -20°C until use.
  • the optimal I HC protocol included Ventana "Standard- Cell Conditioning 1" setting for antigen retrieval.
  • Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent (Cat # S0809), manually applied during the antibody titration step in 100 ⁇ volume, and incubated for 60 minutes at RT.
  • FFPE slides were cut at 3.5 ⁇ thickness, attached to charged slides (Thermo-Scientific Colormark Plus Cat # CM-5951PLUS BLUE), baked at 60°C for 1 hour. Slides were then placed in a rack and
  • Alcian Blue pH2.5 staining kit (Cat# k066) was obtained from Poly Scientific R&D Corp (Bayshore, NY). Alcian Blue pH 1.0 (Cat# s2412) was obtained and used in place of Alcian Blue pH2.5. Slides were transferred from distilled water and placed in 3% aqueous acidic acid for 3 minutes RT. Slides were then directly placed in Alcian Blue pHl.O for 30 minutes.
  • slides are washed in running tap water for 10 minutes, rinsed in distilled water, and placed in 0.1% Nuclear Fast Red Kernechtrot for 5 minutes. Slides were removed and then washed in running water for 1 minute. After wash slides are dehydrated in 95% alcohol, 100% alcohol, and cleared in xylene, 2 changes each. Slides were then mounted in xylene based mounting media.
  • Necrotic regions and stroma were manually excluded from HCOX1329 xenograft Ki67 image analysis, and the tumor tissues were segmented using TissuemorphDP module. Staining was quantified as percent blue pixels for Alcian blue, percent positive pixels for pHH3, or percent positive nuclei for Ki67. Unpaired t tests were used to determine statistical significance. Symbols used: *P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001; ns, not significant.
  • JHOM-2B human lower Gl tumor cells were obtained from RIKEN (Japan) and a working stock was frozen at passage 14. The line was shown to be free of Mycoplasma sp. and murine viruses in the IMPACT VIII PCR assay panel (RADIL, University of Missouri, Columbia, MO). These cells were maintained in
  • DMEM HAM's F12 1:1 (ATCC #30-2006) plus 10% FBS (Omega Scientific Inc. #FB-09) at 37°C in a humidified atmosphere containing 5% carbon dioxide.
  • JHOM-2B cells were harvested at 95-100% confluency, washed, and resuspended in a 1:1 mixture of cold DPBS and MatrigelTM (Becton-Dickinson #354234) at a concentration of 1 X 108 cells/1.5 ml. Finally, 1x107 cells in a total volume of 150 ⁇ . were implanted subcutaneously into the right axillary region of female nu/nu mice.
  • HCOX1329 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma, which was implanted and passaged. HCOX1329 contains a Sff ⁇ F ⁇ mutation and several mutations/variants in RNF43 (P192fs, G659fs, and C272R) (Korn, J., et a ⁇ ., Manuscript in preparation).
  • mice Female nu/nu mice were implanted subcutaneously with 3x3x3mm tumor fragment containing 50% phenol red-free matrigel (BD Biosciences) in DMEM.
  • mice were anesthetized with continuous flow of 1.5-3.5% isoflurane/oxygen mixture using the integrated multi chambers anesthesia center (I MCAC).
  • I MCAC integrated multi chambers anesthesia center
  • mice with average tumor volume of 200 mm 3 were randomized into 8 experimental groups on day 21 (JHOM-2B) or day 17 (HCOX1329) post implantation. Tumors were measured with digital calipers twice a week during active dosing period. Tumor volumes were calculated using the ellipsoid formula: (length x width 2 )/2. Body weights were recorded twice a week at the time of tumor measurement. After 11 days (Groups 2 and 6) or 14 days of treatment, the dosing of mice harboring JHOM-2B xenografts was terminated, and animals euthanized. After 10 days of treatment, the dosing of mice harboring
  • HCOX1329 xenografts was terminated, and animals euthanized. Plasma and tumors were collected at 7hr post last dose for pharmacokinetic (PK) and pharmacodynamic (PD) analysis. All data were expressed as mean ⁇ standard error of the mean (SEM). Delta tumor volume and body weight were used for statistical analysis. Between group comparisons were carried out using the Kruskal-Wallis ANOVA followed by a post hoc Dunn's test. For all statistical evaluations, the level of significance was set at p ⁇ 0.05. Significance compared to the vehicle control group is reported unless otherwise stated. The standard protocols used in pharmacology studies are not pre-powered to demonstrate statistically significant superiority of a combination over the respective single agent treatment. The statistical power is often limited by potent single agent response and/or model variability.
  • JHOM-2B is a human cancer cell line that is reported to be derived from a mucinous ovarian carcinoma (Riken Bioresource Center). However, it can be extremely challenging to clinically differentiate a mucinous tumor of the ovary from a colorectal or appendiceal tumor, because all of these tumor types disseminate widely throughout the abdomen. Recently, it has become clear that the expression pattern of CK7 and CK20 is very useful in determining the site of origin of such tumors (Vang, R., USCAP presentation. 2013). JHOM-2B xenografts have rare cells that stain positively for CK7, whereas CK20 is diffusely positive (Fig. 2A). This expression pattern is consistent with lower Gl, not ovarian, origin.
  • JHOM-2B contains a BRAF V600E mutation (Barretina, J., et al., Nature. 2012, 492:603-7), which has not been reported in appendiceal cancer (Shen, J. P., et al., J. Clin. Oncol. 2012, suppl 34; abstr 397), strongly suggesting the JHOM-2B is of colorectal origin.
  • a survey for genetic alterations in upstream Wnt pathway regulators revealed that JHOM-2B also harbors a fusion between exonl of PTPRK and exon2 of RSP03 (Fig. 2B).
  • HCOX1329 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma. HCOX1329 contains a Sff ⁇ F ⁇ mutation and several mutations/variants in RNF43 (P192fs, G659fs, and C272R) (Korn, J., et al., Manuscript in prepartation).
  • JHOM-2B tumor cells are sensitive to treatment with COMPOUND A in vitro, as assessed by both a foci formation assay (Fig. 3A) and a 7-day CTG assay (Fig. 3B), with an EC 50 of approximately 0.06 ⁇ .
  • Treatment with the triple combination of COM POU N D A+COM POU ND B+cet caused regression (T/TO -26%), which although statistically not superior to COM POUN D B+cet, showed a trend toward greater anti-tumor activity (Fig. 6).
  • Treatment with COM POU ND A as a single agent or in combination decreased cell proliferation (Fig. 7) and induced mucinous differentiation of J HOM-2B tumor cells (Fig. 8).
  • the accumulation of mucin in xenografts treated with COM POUN D A may affect tumor volume
  • HCOX1329 is also microsatellite unstable (I HC of the patient's tumor sample at the time of diagnosis was reported as M LH1, negative; PMS2, negative; MSH2, positive; MSH6, positive) and harbors two mutations/variants in ZNRF3 (H537R and E383fs).
  • Example 3 Phase 1, open-label, dose escalation and dose expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in patients with BRAF V600E - mutant CRC harboring upstream Wnt pathway mutations
  • Dose expansion cohort Additional molecular pre-selection for RNF43 mutations or RSPO fusions
  • Example 4 Phase lb, open label, multicenter, dose escalation and expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in combination with the BRAF inhibitor COMPOUND B and the EGFR inhibitor cetuximab in patients with BRAF V600E -mutant CRC harboring upstream Wnt pathway mutations Inclusion criteria:
  • Dose expansion cohort Additional molecular pre-selection for RNF43 mutations or RSPO fusions
  • Dose escalation cohorts Prior treatment with chemotherapy permitted; prior treatment with RAF inhibitors and EGFR monoclonal antibodies permitted.
  • Dose expansion cohort Prior treatment with chemotherapy permitted; prior treatment with RAF inhibitors and EGFR monoclonal antibodies not allowed.
  • Example 5 Efficacy of a Wnt pathway inhibitor and combinations comprising (i) a Wnt pathway inhibitor, (ii) a BRAF inhibitor, and/or (iii) an EGFR inhibitor in additional patient-derived,
  • Example 6 Decreased cell proliferation and mucinous differentiation induced by a Wnt pathway inhibitor and a combination comprising (i) a Wnt pathway inhibitor and (ii) an EGFR inhibitor in a patient-derived microsatellite-unstable, RNF43 and ZNRF3-mutant CRC xenograft model that is wild type for BRAF and KRAS
  • T70 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma, which was implanted and passaged in nu/nu mice.
  • T70 is microsatellite unstable, BRAF 7 , KRAS 7 , and harbors mutations/variants in RNF43 (W200L, E278delE) and ZNRF3 (Q226*,C230fs) (as determined by Haloplex custom cancer panel).
  • Female nu/nu mice were implanted subcutaneously with 100,000 tumor cells containing 50% phenol red-free matrigel (BD Biosciences) in DMEM.
  • mice were anesthetized with continuous flow of 1.5-3.5% isoflurane/oxygen mixture using the integrated multi chambers anesthesia center (I MCAC).
  • I MCAC integrated multi chambers anesthesia center
  • a 12G trocar was used to take tumor cells with 0.1 ml of the diluted matrigel and implant them subcutaneously into the right axillary region of nude mice, and this was repeated in the left axillary region.
  • mice with average tumor volume of 200 mm 3 were randomized into 4 experimental groups on day 21 post implantation. Tumors were measured with digital calipers twice a week during active dosing period. Tumor volumes were calculated using the ellipsoid formula: (length x width 2 )/2. Body weights were recorded twice a week at the time of tumor measurement. After 14 days the dosing of mice harboring T70 xenografts was terminated, and animals euthanized. Plasma and tumors were collected at 7hr post last dose for pharmacokinetic (PK) and pharmacodynamic (PD) analysis.
  • PK pharmacokinetic
  • PD pharmacodynamic
  • Example 7 Phase 1, open-label, dose escalation and dose expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in patients with
  • Dose expansion cohort Additional molecular pre-selection for RNF43 mutations, RSPO fusions, or other upstream Wnt pathway mutations
  • Example 8 Phase lb, open label, multicenter, dose escalation and expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in combination with the EGFR inhibitor cetuximab in patients with microsatellite-unstable, BRA ", KRAS WT CRC harboring upstream Wnt pathway mutations
  • Dose expansion cohort Additional molecular pre- selection for RNF43 mutations, RSPO fusions, or other upstream Wnt pathway mutations

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a method of treating patients suffering from colorectal cancer, more specifically BRAF V600E -mutant or BRAF wild type, but KRAS wild type and microsatellite-unstable colorectal cancer by using a Wnt pathway inhibitor or a combination comprising a Wnt pathway inhibitor and either a BRAF inhibitor, or an EGFR inhibitor, or both. The disclosure also relates to corresponding pharmaceutical formulations, uses, methods, combinations, and related disclosure embodiments.

Description

Methods of treating colorectal cancers harboring upstream Wnt pathway mutations
Field of the Disclosure
The present invention relates to a method of treating patients suffering from BRAF -mutant and BRAF wild-type colorectal cancer by using a Wnt pathway inhibitor or combinations comprising a Wnt pathway inhibitor and another inhibitor. The disclosure also relates to corresponding pharmaceutical formulations, uses, methods, combinations, and related disclosure embodiments.
Background of the Disclosure
Colorectal cancer (CRC) is the fourth most frequently diagnosed cancer and the second leading cause of cancer death in the United States and the European Union. I n the last 15 years, the median overall survival (OS) for patients with metastatic CRC has markedly improved from approximately 8-12 months to 18-24 months (Kopetz, S. et al., J. Clin. Oncol. 2009, 27:3677-82). The improvement is attributed to two factors: 1) the increased utilization of hepatic resection and 2) the addition of new medical therapies (irinotecan, oxaliplatin, bevacizumab, cetuximab, and pantiumumab) to the standard treatment with 5-fluorouracil plus leucovorin. However, this survival benefit has not extended to all subtypes of the disease. Approximately 5-10% of CRCs harbor an oncogenic mutation at position V600 of the BRAF protein (Fearon, E.R., Annu. Rev. Pathol. Mech. Dis. 2011, 6:479-507). Patients with metastatic BRAFV600E-mutant CRC have a very poor prognosis, with a median OS of only 10 months (Kopetz, S. et al., J. Clin. Oncol. 2009, 27:3677-82). Thus, there remains a critical need for more effective therapies for this subset of patients.
Summary of the Invention
Surprisingly it has been found that a Wnt inhibitor, or a combination of Wnt inhibitor and either a BRAF inhibitor, or EGFR inhibitor, or both, according to the present disclosure, pharmaceutical compositions or combination product of the present disclosure, are especially useful for treatment of a patient with a BRAFV600E-mutant colorectal cancer, particularly the cancer with a mutated Wnt pathway.
In addition, it has been determined that a Wnt inhibitor, or a combination of a Wnt inhibitor and an EGFR inhibitor, can be useful for the treatment of patients with microsatellite-unstable BRAF wild-type (BRAF^) colorectal cancer with a mutated Wnt pathway, particularly upstream Wnt pathway mutation. The colorectal cancer can be KRAS wild-type (KRASWT).
Unlike colorectal cancers that develop via the conventional pathway, colorectal cancers (CRCs) that arise via the serrated pathway harbor BRAF or KRAS mutations but generally lack mutations in the Wnt pathway component APC. Therefore, in serrated CRCs MAPK pathway activation, not Wnt pathway activation, was thought to be the dominant oncogenic driver. It has been unexpectedly found that activation of the Wnt pathway has an important role in the pathogenesis of serrated CRC. Molecular epidemiology data showed that patient BRAFV600E -mu an CRC samples are enriched for genetic alterations in upstream Wnt pathway regulators (e.g. RNF43, ZNRF3, RSP02 and RSP03), strongly confirming this notion. In vivo experiments in two preclinical tumor xenograft models of BRAFV600E- mutant CRC (one with an RNF43 mutation and the other with a RSP03 fusion) demonstrate anti-tumor activity with the Wnt pathway inhibitor 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2- yl)acetamide (compound A), as a single agent and in combination with other targeted therapies. I n both models, regression of tumor xenografts was achieved with the novel combination of (i) a Wnt pathway inhibitor 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide, (ii) a BRAF inhibitor (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4- yl)pyrimidin-2-ylamino)propan-2-ylcarbamate (compound B), and (iii) an EGFR inhibitor cetuximab. This data allows one to deduce a general concept and teaching that a combination of a Wnt inhibitor, and either a mutant BRAF inhibitor or an EGFR inhibitor, or both, will enable the effective treatment of BRAFV600E-mutant CRCs, particularly those that harbor Wnt pathway mutations, especially upstream Wnt pathway mutations.
As mentioned, RNF43 mutations are enriched in BRAFV600E CRC. But BRAFV600E CRCs are also frequently microsatellite unstable due to hypermethylation of DNA repair genes (Lubomierski, N. et al., Cancer 2005, 104:952-61). The mismatch repair deficiency in these tumors may directly contribute to RNF43 mutagenesis, as RNF43 mutations tend to be small insertions/deletions in homopolymeric tracts. By testing if microsatellite-unstable, BRAF 7, KRAS™7 CRCs with RNF43 mutations may also benefit from COM POU N D A and/or COM POU N D A+cetuximab, we selected a pre-clinical microsatellite-unstable, BRAF 1, KRAS™7, RNF43W2∞L- E27*"IE, ZNRF3Q226'-C230fs CRC model (T70) for testing and further found that Wnt inhibitor compound A, optionally in combination with an EGFR inhibitor cetuximab significantly decrease cell proliferation in a patient-derived microsatellite-unstable, upstream Wnt mutant CRC xenograft model that is wild type for BRAF and KRAS. This is a good indication that a Wnt inhibitor, or a combination of a Wnt inhibitor and an EGFR inhibitor, can be useful for the treatment of patients with microsatellite-unstable, BRAF wild-type (BRAF^), KRAS wild-type (KRAS^) colorectal cancer harboring upstream Wnt pathway mutations.
Majority of microsatellite unstable colorectal cancer is expected to be BRAF mutant. However, also BRAF wild-type colorectal cancer was found to be sensitive to a Wnt inhibitor, either alone or in combination with another drug. Particularly as microsatellite instable tumors cause RN F43 mutation it would be possible to treat BRAF wt colorectal cancer as long it harbors RN F43 or other WNT upstream pathway mutation. Because ZNRF3 and RN F43 are both homologous cell surface transmembrane E3 ubiquitin ligases for Wnt receptor Frizzled it is expected that the Wnt inhibitor could be effectively applied in the treatment of colorectal cancer, BRAFV600E mutated or BRAF wt, which is ZN RF3 mutated (but not RN F43 mutated). In the event that the cancer is BRAF wt, there is no need to use a BRAF inhibitor together with the Wnt inhibitor.
Specifically, the present disclosure provides the following aspects, advantageous features and specific embodiments, respectively alone or in combination, as listed in the following items:
1. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer.
2. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to item 1, wherein the cancer is microsatellite-unstable. 3. A Wnt inhibitor for use in the treatment of BRAF -mutant colorectal cancer according to item 1 or 2, wherein the cancer is KRAS wild-type.
4. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to any one of items 1 to 3 in combination with a BRAF inhibitor.
5. A Wnt inhibitor for use in the treatment of microsatellite-unstable, BRAF wild-type and KRAS wild-type colorectal cancer.
6. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 5 in combination with an EGFR inhibitor.
7. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
6, wherein a Wnt pathway in the colorectal cancer is activated compared to a control.
8. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
7, wherein AXIN2 expression in the colorectal cancer is higher compared to a control.
9. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
8, wherein the colorectal cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03.
10. A Wnt inhibitor for use in the treatment of colorectal cancer according to item 9, wherein the colorectal cancer comprises mutated RNF43.
11. A Wnt inhibitor for use in the treatment of colorectal cancer according to item 9, wherein the colorectal cancer comprises RSPO fusion.
12. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 8, wherein the colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRPl-3, WI F-1, DKKl, DKK4, LKBl/STKll, Keap-1 and/or N RF2, preferably ZNRF3.
13. A Wnt inhibitor for use in the treatment of microsatellite-unstable colorectal cancer according to any one of items 2 to 12, wherein at least one mismatch repair system gene is inactivated in the colorectal cancer compared to a control.
14. A Wnt inhibitor for use in the treatment of microsatellite-unstable colorectal cancer according to item 13, wherein the mismatch repair system gene is M LH 1, MSH2, MSH6 or PMS2.
15. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of previous items, wherein the Wnt inhibitor is the inhibitor of Porcupine or Frizzled.
16. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of previous items, wherein the Wnt inhibitor is a Porcupine inhibitor.
17. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 4 to
16, wherein the Wnt inhibitor and the inhibitor in the combination are to be administered
simultaneously or sequentially.
18. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 4 to
17, wherein the Wnt inhibitor and the inhibitor in the combination are used in the form of a fixed combination.
19. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to
18, further comprising at least one pharmaceutically acceptable carrier.
20. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 19 in a form of a pharmaceutical composition.
21. A pharmaceutical combination comprising (i) a Wnt inhibitor and (ii) a BRAF inhibitor.
22. The pharmaceutical combination according to item 21 further comprising an EGFR inhibitor. 23. A pharmaceutical combination comprising a Wnt inhibitor and an EGFR inhibitor.
24. The pharmaceutical combination according to any one of items 21 to 23, wherein the pharmaceutical combination comprises the inhibitors separately or together.
25. The pharmaceutical combination according to any one of items 21 to 24 for simultaneous or sequential use of the inhibitors.
26. The pharmaceutical combination according to any one of items 21 to 25, further comprising at least one pharmaceutically acceptable carrier.
27. The pharmaceutical combination according to any one of items 21 to 26 in the form of a fixed combination.
28. The pharmaceutical combination according to any one of items 21, 22, or 24 to 27, in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the BRAF inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the BRAF inhibitor to be jointly active.
29. The pharmaceutical combination according to any one of items 21 to 27 in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the BRAF inhibitor and/or EGFR inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the BRAF inhibitor and/or EGFR inhibitor to be jointly active.
30. The pharmaceutical combination according to any one of items 23 to 27 in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the EGFR inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the EGFR inhibitor to be jointly active.
31. The pharmaceutical combination according to any one of items 21 to 30, wherein the inhibitors are in a quantity which is jointly therapeutically effective for the treatment of cancer.
32. The pharmaceutical combination according to any one of items 21 to 30 for use in the treatment of cancer.
33. The pharmaceutical combination according to items 31 or 32, wherein the cancer is colorectal cancer.
34. The pharmaceutical combination according to any one of items 31 to 33, wherein the cancer is microsatellite-unstable.
35. The pharmaceutical combination according to any one of items 33 or 34, wherein the cancer is KRAS wild-type.
36. The pharmaceutical combination according to any one of items 31 or 35, wherein the cancer is BRAFV600E-mutant colorectal cancer.
37. The pharmaceutical combination according to any one of items 33 or 35, wherein the cancer is BRAF wild-type.
38. The pharmaceutical combination according to any one of items 31 to 35 or 37, wherein the cancer is microsatellite-unstable, BRAF wild-type and KRAS wild-type colorectal cancer.
39. The pharmaceutical combination according to any one of items 33 to 38, wherein a Wnt pathway in the colorectal cancer is activated compared to a control.
40. The pharmaceutical combination according to any one of items 33 to 39, wherein AXIN2 expression in the colorectal cancer is higher compared to a control. 41. The pharmaceutical combination according to any one of items 33 to 40, wherein the colorectal cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03.
42. The pharmaceutical combination according to any one of items 33 to 41, wherein the colorectal cancer comprises mutated RNF43.
43. The pharmaceutical combination according to any one of items 33 to 41, wherein the colorectal cancer comprises RSPO fusion.
44. The pharmaceutical combination according to any one of items 33 to 43, wherein the colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRP1- 3, WI F-1, DKK1, DKK4, LKB1/STK11, Keap-1 and/or N RF2, preferably ZN RF3.
45. The pharmaceutical combination for use in the treatment of microsatellite-unstable colorectal cancer according to any one of items 34 to 44, wherein at least one mismatch repair system gene is inactivated in the colorectal cancer compared to a control.
46. The pharmaceutical combination for use in the treatment of microsatellite-unstable colorectal cancer according to item 45, wherein the mismatch repair system gene is M LH 1, MSH2, MSH6 or PMS2.
47. The pharmaceutical combination according to any one of items 21 to 46, wherein the Wnt inhibitor is an inhibitor of Porcupine or Frizzled.
48. The pharmaceutical combination according to any one of items 21 to 47, wherein the Wnt inhibitor is the inhibitor of Porcupine.
49. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 20 or a pharmaceutical combination according to any one of items 21 to 48, wherein the Wnt inhibitor is a compound selected from the group consisting of: tert-butyl 4-(5-{2-[4-(2-methylpyridin-4- yl)phenyl]acetamido}pyridin-2-yl)-l,2,3,6-tetrahydropyridine-l-carboxylate; N-[6-(3- fluorophenyl)pyridin-3-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-(6-methoxy-l,3-benzothiazol- 2-yl)-2-[4-(pyridin-4-yl)phenyl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[6-(morpholin-4- yl)pyridin-3-yl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[4-(quinolin-4-yl)phenyl]acetamide; N- (6-methoxy-l,3-benzothiazol-2-yl)-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-(6-methoxy-l,3- benzothiazol-2-yl)-2-[6-(quinolin-4-yl)pyridin-3-yl]acetamide; N-(6-methanesulfonyl-l,3-benzothiazol-2- yl)-2-[4-(pyridin-4-yl)phenyl]acetamide; N-(6-fluoro-l,3-benzothiazol-2-yl)-2-[4-(pyridin-4- yl)phenyl]acetamide; N-(l,3-benzothiazol-2-yl)-2-[4-(pyridin-4-yl)phenyl]acetamide; N-(6-methoxy-l,3- benzothiazol-2-yl)-2-[6-(pyridin-4-yl)pyridin-3-yl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[3- methyl-4-(2-methylpyridin-4-yl)phenyl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[6-(2- methylpyridin-4-yl)pyridin-3-yl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[4-(2- methylpyrimidin-4-yl)phenyl]acetamide; N-[4-(pyridin-2-yl)-l,3-thiazol-2-yl]-2-[4-(pyridin-4- yl)phenyl]acetamide; N-[4-(pyridin-4-yl)-l,3-thiazol-2-yl]-2-[4-(pyridin-4-yl)phenyl]acetamide; N-(6- methoxy-l,3-benzothiazol-2-yl)-2-[2-methyl-4-(2-methylpyridin-4-yl)phenyl]acetamide; 2-[6-(2- methylpyridin-4-yl)pyridin-3-yl]-N-(4-phenyl-l,3-thiazol-2-yl)acetamide; N-(isoquinolin-3-yl)-2-[4- (pyridin-4-yl)phenyl]acetamide; N-(6-fluoro-l,3-benzothiazol-2-yl)-2-[6-(2-methylpyridin-4-yl)pyridin-3- yl]acetamide; 2-[4-(pyridin-4-yl)phenyl]-N-(quinolin-2-yl)acetamide; N-(6-methoxy-l,3-benzothiazol-2- yl)-2-[5-(2-methylpyridin-4-yl)pyrimidin-2-yl]acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[5-(2- methylpyridin-4-yl)pyridin-2-yl]acetamide; 2-[3-methyl-4-(2-methylpyridin-4-yl)phenyl]-N-(4-phenyl-l,3- thiazol-2-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-(4-phenyl-l,3-thiazol-2-yl)acetamide; 2-[4- (2-methylpyridin-4-yl)phenyl]-N-(5-phenylpyridin-2-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N- (4-phenylpyridin-2-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[6-(trifluoromethoxy)-l,3- benzothiazol-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-(5-phenyl-l,3-thiazol-2-yl)acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)-2-[4-(2-methoxypyridin-4-yl)phenyl]acetamide; 2-[4-(2- ethylpyridin-4-yl)phenyl]-N-(6-methoxy-l,3-benzothiazol-2-yl)acetamide; 2-[2-methyl-4-(2- methylpyridin-4-yl)phenyl]-N-(4-phenyl-l,3-thiazol-2-yl)acetamide; N-[4-(4-methoxyphenyl)-l,3-thiazol- 2-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-[4-(4-fluorophenyl)-l,3-thiazol-2-yl]-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; N-[4-(3,4-difluorophenyl)-l,3-thiazol-2-yl]-2-[4-(2-methylpyridin-
4- yl)phenyl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-(6-phenylpyridin-3-yl)acetamide; N-(5- phenylpyridin-2-yl)-2-[4-(pyridazin-4-yl)phenyl]acetamide; N-[5-(4-methylphenyl)pyridin-2-yl]-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; N-[5-(3-methoxyphenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4- yl)phenyl]acetamide; N-[5-(2-methoxyphenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-[5-(4-methoxyphenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; 2-[4-(2- methylpyridin-4-yl)phenyl]-N-(5-phenylpyrazin-2-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[5- (pyridin-2-yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)-3-(trifluoromethyl)phenyl]-N-(4-phenyl- l,3-thiazol-2-yl)acetamide; N-[5-(3-methylphenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4- yl)phenyl]acetamide; 2-[4-(2-methylpyridin-4-yl)-3-(trifluoromethyl)phenyl]-N-(5-phenylpyridin-2- yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[5-(pyridin-3-yl)pyridin-2-yl]acetamide; 2-[4-(2- methylpyridin-4-yl)phenyl]-N-[5-(pyridin-4-yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]- N-(6-phenylpyridazin-3-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-(4-phenylphenyl)acetamide; 2-[6-(2-methylpyridin-4-yl)pyridin-3-yl]-N-(5-phenylpyridin-2-yl)acetamide; 2-[4-(2-methylpyridin-4- yl)phenyl]-N-(2-phenylpyrimidin-5-yl)acetamide; 2-[4-(lH-imidazol-l-yl)phenyl]-N-(5-phenylpyridin-2- yl)acetamide; N-(6-phenylpyridin-3-yl)-2-[4-(pyridazin-4-yl)phenyl]acetamide; N-[5-(4- fluorophenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-[5-(3-fluorophenyl)pyridin-2- yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-[5-(4-ethylpiperazin-l-yl)pyridin-2-yl]-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; N-{5-[(2R,6S)-2,6-dimethylmorpholin-4-yl]pyridin-2-yl}-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[4-(pyridin-3- yl)phenyl]acetamide; N-(6-fluoro-l,3-benzothiazol-2-yl)-2-[4-(pyridazin-4-yl)phenyl]acetamide; 2-[4-(2- methylpyridin-4-yl)phenyl]-N-(5-phenylpyrimidin-2-yl)acetamide; N-(6-methoxy-l,3-benzothiazol-2-yl)- N-methyl-2-[4-(pyridin-4-yl)phenyl]acetamide; 2-[4-(pyridazin-4-yl)phenyl]-N-[4-(pyridin-3- yl)phenyl]acetamide; N-(6-phenylpyridazin-3-yl)-2-[4-(pyridazin-4-yl)phenyl]acetamide; 2-[4-(2- methylpyridin-4-yl)phenyl]-N-[5-(lH-pyrazol-4-yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4- yl)phenyl]-N-[5-(pyrazin-2-yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[5-(pyrimidin-
5- yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[4-(pyridazin-4-yl)phenyl]acetamide; 2- [4-(2-methylpyridin-4-yl)phenyl]-N-[5-(l,2 ,6-tetrahydropyridin-4-yl)pyridin-2-yl]acetamide; 2-[4-(2- methylpyridin-4-yl)phenyl]-N-[5-(pyridazin-3-yl)pyridin-2-yl]acetamide; 2-[5-methyl-6-(2-methylpyridin- 4-yl)pyridin-3-yl]-N-(6-phenylpyridin-3-yl)acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[5-(pyridazin- 4-yl)pyridin-2-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[6-(morpholin-4-yl)pyridin-3- yl]acetamide; N-[5-(3-fluorophenyl)pyridin-2-yl]-2-[5-methyl-6-(pyridazin-4-yl)pyridin-3-yl]acetamide; 2- [3-methyl-4-(2-methylpyridin-4-yl)phenyl]-N-[5-(pyridin-2-yl)pyridin-2-yl]acetamide; 2-[3-methyl-4- (pyridazin-4-yl)phenyl]-N-[5-(pyridin-2-yl)pyridin-2-yl]acetamide; 2-[6-(2-methylpyridin-4-yl)pyridin-3- yl]-N-[5-(pyridazin-3-yl)pyridin-2-yl]acetamide; N-[5-(pyridazin-3-yl)pyridin-2-yl]-2-[6-(pyridazin-4- yl)pyridin-3-yl]acetamide; 2-[4-(2-methylpyridin-4-yl)-3-(trifluoromethyl)phenyl]-N-[5-(pyrazin-2- yl)pyridin-2-yl]acetamide; N-[5-(3-fluorophenyl)pyridin-2-yl]-2-[5-methyl-6-(2-methylpyridin-4- yl)pyridin-3-yl]acetamide; N-[5-(3-fluorophenyl)pyridin-2-yl]-2-[4-(2-methylpyridin-4-yl)-3- (trifluoromethyl)phenyl]acetamide; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[5-(pyridazin-4-yl)pyridin-2- yl]acetamide; N-[5-(3-fluorophenyl)pyridin-2-yl]-2-[6-(2-methylpyridin-4-yl)pyridin-3-yl]acetamide; N-[6- (3-fluorophenyl)pyridin-3-yl]-2-[6-(2-methylpyridin-4-yl)pyridin-3-yl]acetamide; 2-[4-(2-methylpyridin-4- yl)phenyl]-N-[6-(pyridazin-4-yl)pyridin-3-yl]acetamide; 2-[5-methyl-6-(2-methylpyridin-4-yl)pyridin-3-yl]- N-[5-(pyrazin-2-yl)pyridin-2-yl]acetamide; 2-[5-methyl-6-(pyridazin-4-yl)pyridin-3-yl]-N-(6-phenylpyridin-
3- yl)acetamide; 2-[6-(2-methylpyridin-4-yl)pyridin-3-yl]-N-(6-phenylpyridin-3-yl)acetamide; N-(6- phenylpyridin-3-yl)-2-[6-(pyridazin-4-yl)pyridin-3-yl]acetamide; N-[6-(l-acetyl-l,2,3,6-tetrahydropyridin-
4- yl)pyridin-3-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; methyl 4-(5-{2-[4-(2-methylpyridin-4- yl)phenyl]acetamido}pyridin-2-yl)-l,2,3,6-tetrahydropyridine-l-carboxylate; N-[6-(l-methanesulfonyl- l,2 ,6-tetrahydropyridin-4-yl)pyridin-3-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; N-[6-(l- methylpiperidin-4-yl)pyridin-3-yl]-2-[4-(2-methylpyridin-4-yl)phenyl]acetamide; 2-[5-methyl-6- (pyridazin-4-yl)pyridin-3-yl]-N-[5-(pyridin-2-yl)pyridin-2-yl]acetamide; 2-[6-(pyridazin-4-yl)pyridin-3-yl]- N-[5-(pyridin-2-yl)pyridin-2-yl]acetamide; 2-[6-(2-methylpyridin-4-yl)pyridin-3-yl]-N-(5-phenylpyrimidin- 2-yl)acetamide; N-[5-(3-fluorophenyl)pyrimidin-2-yl]-2-[6-(pyridazin-4-yl)pyridin-3-yl]acetamide; ethyl 4- (5-{2-[4-(2-methylpyridin-4-yl)phenyl]acetamido}pyridin-2-yl)-l,2,3,6-tetrahydropyridine-l-carboxylate; propan-2-yl 4-(5-{2-[4-(2-methylpyridin-4-yl)phenyl]acetamido}pyridin-2-yl)-l,2,3,6-tetrahydropyridine- 1-carboxylate; 1-methylcyclopropyl 4-(5-{2-[4-(2-methylpyridin-4-yl)phenyl]acetamido}pyridin-2-yl)- 1,2,3,6-tetrahydropyridine-l-carboxylate; 2-[4-(2-methylpyridin-4-yl)phenyl]-N-[6-(l,2,3,6- tetrahydropyridin-4-yl)pyridin-3-yl]acetamide; N-[6-(3-fluorophenyl)pyridin-3-yl]-2-[5-methyl-6-(2- methylpyridin-4-yl)pyridin-3-yl]acetamide; N-[6-(3-fluorophenyl)pyridin-3-yl]-2-[5-methyl-6-(pyridazin-4- yl)pyridin-3-yl]acetamide; N-[6-(3-fluorophenyl)pyridin-3-yl]-2-[4-(2-methylpyridin-4-yl)-3- (trifluoromethyl)phenyl]acetamide; N-[6-(3-fluorophenyl)pyridin-3-yl]-2-[4-(pyridazin-4-yl)-3- (trifluoromethyl)phenyl]acetamide; N-[6-(l-methyl-l,2,3,6-tetrahydropyridin-4-yl)pyridin-3-yl]-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; N-[6-(l-ethyl-l,2,3,6-tetrahydropyridin-4-yl)pyridin-3-yl]-2-[4-(2- methylpyridin-4-yl)phenyl]acetamide; N-[6-(3-fluorophenyl)pyridin-3-yl]-2-[6-(2-methylpyridin-4- yl)pyridin-3-yl]acetamide; N-(6-phenylpyridazin-3-yl)-2-[6-(pyridazin-4-yl)pyridin-3-yl]acetamide; 2-[6-(2- methylpyridin-4-yl)pyridin-3-yl]-N-(6-phenylpyridazin-3-yl)acetamide; N-(5-(4-acetylpiperazin-l- yl)pyridin-2-yl)-2-(3-cyano-4-(2-methylpyridin-4-yl)phenyl)acetamide; N-(2,3'-bipyridin-6'-yl)-2-(4- (pyridazin-4-yl)-3-(trifluoromethyl)phenyl)acetamide; N-(5-(pyridazin-3-yl)pyridin-2-yl)-2-(4-(pyridazin-4- yl)phenyl)acetamide; N-(5-(3-fluorophenyl)pyridin-2-yl)-2-(6-(pyridazin-4-yl)pyridin-3-yl)acetamide; N- (6-(3-fluorophenyl)pyridin-3-yl)-2-(6-(pyridazin-4-yl)pyridin-3-yl)acetamide; N-(6-(l-(2-amino-2- oxoethyl)-l,2 ,6-tetrahydropyridin-4-yl)pyridin-3-yl)-2-(4-(2-methylpyridin-4-yl)phenyl)acetamide; N-(6- (3-fluorophenyl)pyridin-3-yl)-2-(4-(pyridazin-4-yl)phenyl)acetamide; N-(5-(pyrazin-2-yl)pyridin-2-yl)-2-(4- (pyridazin-4-yl)-3-(trifluoromethyl)phenyl)acetamide; tert-butyl 4-(5-(2-(4-(2-methylpyridin-4- yl)phenyl)acetamido)pyridin-2-yl)piperazine- 1-carboxylate; N-(5-(3-fluorophenyl)pyridin-2-yl)-2-(4- (pyridazin-4-yl)phenyl)acetamide; N-(2,3'-bipyridin-6'-yl)-2-(4-(2-methylpyridin-4-yl)-3- (trifluoromethyl)phenyl)acetamide; N-(5-(pyridazin-3-yl)pyridin-2-yl)-2-(4-(pyridazin-4-yl)-3- (trifluoromethyl)phenyl)acetamide; N-(2-(3-fluorophenyl)pyrimidin-5-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; N-(2,3'-bipyridin-6'-yl)-2-(2',3-dimethyl-2,4'-bipyridin-5-yl)acetamide; tert-butyl 4- (6-(2-(4-(2-methylpyridin-4-yl)phenyl)acetamido)pyridin-3-yl)piperazine-l-carboxylate; N-(2,3'-bipyridin- 6'-yl)-2-(2'-methyl-2,4'-bipyridin-5-yl)acetamide; N-(6-(l-acetylpiperidin-4-yl)pyridin-3-yl)-2-(4-(2- methylpyridin-4-yl)phenyl)acetamide; 2-(2'-methyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2- yl)acetamide; N-(5-(pyrazin-2-yl)pyridin-2-yl)-2-(6-(pyridazin-4-yl)pyridin-3-yl)acetamide; 2-(5-methyl-6- (pyridazin-4-yl)pyridin-3-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-l- yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4-yl)phenyl)acetamide; methyl 4-(6-(2-(4-(2-methylpyridin-4- yl)phenyl)acetamido)pyridin-3-yl)piperazine-l-carboxylate; 2-(3-methyl-4-(pyridazin-4-yl)phenyl)-N-(5- (pyrazin-2-yl)pyridin-2-yl)acetamide; 2-(3-methyl-4-(pyridazin-4-yl)phenyl)-N-(5-(pyridazin-4-yl)pyridin- 2-yl)acetamide; 2-(2^3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyridazin-4-yl)pyridin-2-yl)acetamide; 2-(2',3- dimethyl-2,4'-bipyridin-5-yl)-N-(6-(pyridazin-4-yl)pyridin-3-yl)acetamide; 2-(3-methyl-4-(pyridazin-4- yl)phenyl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; tert-butyl 4-(6-(2-(4-(2-methylpyridin-4- yl)phenyl)acetamido)pyridin-3-yl)piperidine-l-carboxylate; 2-(3-methyl-4-(pyridazin-4-yl)phenyl)-N-(6- (pyridazin-4-yl)pyridin-3-yl)acetamide; 2-(6-(4-acetylpiperazin-l-yl)pyridin-3-yl)-N-(5-(3- fluorophenyl)pyridin-2-yl)acetamide; 2-(4-(2-methylpyridin-4-yl)phenyl)-N-(5-(3-oxopiperazin-l- yl)pyridin-2-yl)acetamide; 4-(6-(2-(4-(2-methylpyridin-4-yl)phenyl)acetamido)pyridin-3-yl)piperazine-l- carboxamide; N-(5-(4-methyl-lH-imidazol-l-yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; 2-(4-(4-methyl-lH-imidazol-l-yl)phenyl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide;
2- (2^3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; 2-(5-methyl-6- (pyridazin-4-yl)pyridin-3-yl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; 2-(5-methyl-6-(pyridazin-4- yl)pyridin-3-yl)-N-(5-(pyridazin-4-yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2- (2',3-dimethyl-2,4'-bipyridin-5-yl)acetamide; N-(5-((3S,5R)-4-acetyl-3,5-dimethylpiperazin-l-yl)pyridin-2- yl)-2-(4-(2-methylpyridin-4-yl)phenyl)acetamide; N-(4-(l-acetylpiperidin-4-yl)phenyl)-2-(4-(2- methylpyridin-4-yl)phenyl)acetamide; N-(6-(4-(2-hydroxyethyl)piperazin-l-yl)pyridin-3-yl)-2-(4-(2- methylpyridin-4-yl)phenyl)acetamide; N-(6-(3-fluorophenyl)pyridin-3-yl)-2-(5-methyl-6-(pyridazin-4- yl)pyridin-3-yl)acetamide; 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(4-(pyrazin-2-yl)phenyl)acetamide; 2- (2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(4-(pyridazin-3-yl)phenyl)acetamide; 2-(2-(2',3-dimethyl-2,4'- bipyridin-5-yl)acetamido)-5-(pyrazin-2-yl)pyridine 1-oxide; 2',3-dimethyl-5-(2-oxo-2-(5-(pyrazin-2- yl)pyridin-2-ylamino)ethyl)-2,4'-bipyridine l'-oxide; 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(6-(pyrazin-2- yl)pyridin-3-yl)acetamide; N-(5-(4-isobutyrylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-methyl-4-(2-methylpyridin-4- yl)phenyl)acetamide; N-(6-(4-acetylpiperazin-l-yl)pyridin-3-yl)-2-(2',3-dimethyl-2,4'-bipyridin-5- yl)acetamide; (R)-N-(6-(4-acetyl-3-methylpiperazin-l-yl)pyridin-3-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; (S)-N-(6-(4-acetyl-3-methylpiperazin-l-yl)pyridin-3-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; (S)-N-(6-(4-acetyl-3-methylpiperazin-l-yl)pyridin-3-yl)-2-(2',3-dimethyl-2,4'- bipyridin-5-yl)acetamide; (R)-N-(6-(4-acetyl-3-methylpiperazin-l-yl)pyridin-3-yl)-2-(2',3-dimethyl-2,4'- bipyridin-5-yl)acetamide; N-(5-((3S,5R)-4-acetyl-3,5-dimethylpiperazin-l-yl)pyridin-2-yl)-2-(2',3- dimethyl-2,4'-bipyridin-5-yl)acetamide; methyl 4-(6-(2-(2',3-dimethyl-2,4'-bipyridin-5- yl)acetamido)pyridin-3-yl)piperazine-l-carboxylate; methyl 4-(6-(2-(3-methyl-4-(2-methylpyridin-4- yl)phenyl)acetamido)pyridin-3-yl)piperazine-l-carboxylate; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2- (3-fluoro-4-(2-methylpyridin-4-yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(2'- methyl-2,4'-bipyridin-5-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-chloro-4-(2- methylpyridin-4-yl)phenyl)acetamide; ethyl 4-(6-(2-(2',3-dimethyl-2,4'-bipyridin-5-yl)acetamido)pyridin-
3- yl)piperazine-l-carboxylate; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4-yl)-3- (trifluoromethyl)phenyl)acetamide; 2-(3-cyano-4-(2-methylpyridin-4-yl)phenyl)-N-(6-phenylpyridin-3- yl)acetamide; 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(4-propionylpiperazin-l-yl)pyridin-2- yl)acetamide; N-(5-(4-(cyanomethyl)piperazin-l-yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; N-(5-(4-cyanopiperazin-l-yl)pyridin-2-yl)-2-(4-(2-methylpyridin-4- yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-chloropyridin-4- yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-fluoropyridin-4- yl)phenyl)acetamide; 2-(3-cyano-4-(2-methylpyridin-4-yl)phenyl)-N-(5-(pyrazin-2-yl)pyridin-2- yl)acetamide; 2-(3-cyano-4-(2-methylpyridin-4-yl)phenyl)-N-(6-(pyrazin-2-yl)pyridin-3-yl)acetamide; 2-(3- cyano-4-(2-methylpyridin-4-yl)phenyl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-methoxy-4-(2-methylpyridin-4-yl)phenyl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-chloro-2'-methyl-2,4'-bipyridin-5-yl)acetamide; (S)-N-(5-(4-acetyl- 3-methylpiperazin-l-yl)pyridin-2-yl)-2-(3-cyano-4-(2-methylpyridin-4-yl)phenyl)acetamide; (R)-N-(5-(4- acetyl-3-methylpiperazin-l-yl)pyridin-2-yl)-2-(2^3-dimethyl-2,4'-bipyridin-5-yl)acetamide; isopropyl 4-(6- (2-(2^3-dimethyl-2,4'-bipyridin-5-yl)acetamido)pyridin-3-yl)piperazine-l-carboxylate; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-cyano-2'-methyl-2,4'-bipyridin-5-yl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(2'-methyl-3-(trifluoromethyl)-2,4'-bipyridin-5-yl)acetam N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-fluoro-2'-methyl-2,4'-bipyridin-5-yl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(2-fluoro-5-methyl-4-(2-methylpyridin-4-yl)phenyl)aceta N-(5- (4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-methylpyrimidin-4-yl)-3-(trifluoromethyl)^
N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(2'-fluoro-3-methyl-2,4'-bipyridin-5-yl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(2',3-difluoro-2,4'-bipyridin-5-yl)acetamide; N-(5-(4-acetylpiperazin- l-yl)pyridin-2-yl)-2-(4-(2-methylpyrimidin-4-yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2- yl)-2-(4-(5-fluoropyrimidin-4-yl)phenyl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(2'- methyl-3-(methylsulfonyl)-2,4'-bipyridin-5-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4- (6-methylpyrimidin-4-yl)phenyl)acetamide; 2-(2'-fluoro-3-methyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2- yl)pyridin-2-yl)acetamide; 2-(4-(2-fluoropyridin-4-yl)phenyl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(4-(2-(difluoromethyl)pyridin-4-yl)phenyl)acetam N-(6-(4- acetylpiperazin-l-yl)pyridin-3-yl)-2-(4-(2-(difluoromethyl)pyridin-4-yl)phenyl)acetamide; 2-(4-(2- (difluoromethyl)pyridin-4-yl)phenyl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-
1- yl)pyridin-2-yl)-2-(4-(5-fluoropyrimidin-4-yl)-3-methylphenyl)acetamide; 2-(2',3-difluoro-2,4'-bipyridin- 5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide; 2-(3-cyano-4-(2-fluoropyridin-4-yl)phenyl)-N-(5-(pyrazin-
2- yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(3-fluoro-4-(2-fluoropyridin-4- yl)phenyl)acetamide; 2-(2'-fluoro-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide; N-(5-(4- acetylpiperazin-l-yl)pyridin-2-yl)-2-(2'-fluoro-2,4'-bipyridin-5-yl)acetamide; 2-(2',3-difluoro-2,4'- bipyridin-5-yl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; N-(5-(4-acetylpiperazin-l-yl)pyridin-2-yl)-2-(3- cyano-4-(2-fluoropyridin-4-yl)phenyl)acetamide; 2-(3-fluoro-4-(2-fluoropyridin-4-yl)phenyl)-N-(5- (pyrazin-2-yl)pyridin-2-yl)acetamide; 2-(3-fluoro-4-(2-fluoropyridin-4-yl)phenyl)-N-(5-(pyridazin-3- yl)pyridin-2-yl)acetamide; 2-(3-cyano-4-(2-fluoropyridin-4-yl)phenyl)-N-(5-(pyridazin-3-yl)pyridin-2- yl)acetamide; 2-(4-(2-fluoropyridin-4-yl)phenyl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide; and 2-(2'- fluoro-3-methyl-2,4'-bipyridin-5-yl)-N-(5-(pyridazin-3-yl)pyridin-2-yl)acetamide, or a physiogically acceptable salt thereof. 50. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 20 or a pharmaceutical combination according to any one of items 21 to 48, wherein the Wnt inhibitor is 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide.
51. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to any one of items 4, 6 to 20, 49 or 50, or a pharmaceutical combination according to any one of items 21, 22, 24 to 29, 31 to 36 or 39 to 50, wherein the BRAF inhi bitor is selected from the group consisting of: (S)- methyl-l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin- 2-ylamino)propan-2-ylcarbamate;
methyl N-[(2S)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2,5-difluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-ethyl-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-fluoro-3-methanesulfonamido-5-methylphenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-chloro-3-methanesulfonamido-5-methylphenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-chloro-5-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2R)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2,5-dichloro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate; and
vemurafenib.
52. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to any one of items 4, 6 to 20, 49 or 50, or a pharmaceutical combination according to any one of items 21, 22, 24 to 29, 31 to 36 or 39 to 50, wherein the BRAF inhibitor is (S)-methyl-l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate, methyl N-[(2S)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate or vemurafenib.
53. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to any one of items 4, 6 to 20, 49 or 50, or a pharmaceutical combination according to any one of items 21, 22, 24 to 29, 31 to 36 or 39 to 50, wherein the BRAF inhibitor is (S)-methyl-l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate.
54. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 6 to 20, or 49 to 53, or a pharmaceutical combination according to any one of items 22 to 53, wherein the EGFR inhibitor is selected from a group consisting of gefitinib, erlotinib, lapatinib, XL-647, HKI-272 (Neratinib), BI BW2992 (Afatinib), EKB-569 (Pelitinib), AV-412, canertinib, PF00299804, BMS 690514, HM781-36b, WZ4002, AP-26113, cetuximab, panitumumab, matuzumab, trastuzumab, or pertuzumab, (R,E)-N-(7-chloro-l-(l-(4-(pyrrolidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d] imidazol-2-yl)-2- methylisonicotinamide; N-(7 hloro-l-(l-(4-(pyrrolidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(7 hloro-l-(l-(4-(3-fluoroazetidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2 methylisonicotinamide;
N-(7 hloro-l-(l-(4-(3-fluoroazetidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(S)-N-(l-(l-acryloylpiperidin-3-yl)-5-methyl-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl) benzamide N-(l-(l-acryloylpiperidin-3-yl)-5-methyl-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl) benzamide; (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
(R,E)-N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- (trifluoromethyl)isonicotinamide;
N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- (trifluoromethyl)isonicotinamide;
(R)-N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-methoxy-lH-benzo[d]imidazol-2-yl)pyridazine-4- carboxamide;
N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-methoxy-lH-benzo[d]imidazol-2-yl)pyridazine-4-carboxamid N-(7-methyl-l-(l-(vinylsulfonyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl)benzamid N-(l-(l-acryloylazepan-3-yl)-7-(pyrrolidin-l-ylmethyl)-lH-benzo[d]imidazol-2-yl)-3- (trifluoromethyl)benzamide;
tert-butyl 4-acryloyl-6-(7-chloro-2-(2-methylisonicotinamido)-lH-benzo[d]imidazol-l-yl)-l,4-diazepa 1-carboxylate;
N-(l-(l-acryloyl-l,4-diazepan-6-yl)-7-chloro-lH-benzo[d]imidazol-2-yl)-2-methylisonicotinamide;
N-(l-(l-acetyl-4-acryloyl-l,4-diazepan-6-yl)-7-chloro-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R)-N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-(2-(pyrrolidin-l-yl)ethoxy)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-(2-(pyrrolidin-l-yl)ethoxy)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
(R,E)-N-(7-chloro-l-(l-(4-(dicyclopropylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide; N-(7-chloro-l-(l-(4-(dicyclopropylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R)-l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxyli acid;
l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5 arboxyli acid; (R)-l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxam l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxam and l-(l-acryloylazepan-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-7-carboxylic acid.
55. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 6 to 20, or 49 to 53, or a pharmaceutical combination according to any one of items 22 to 53, wherein the EGFR inhibitor is (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH- benzo[d]imidazol-2-yl)-2-methylisonicotinamide
or (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide.
56. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 6 to 20, or 49 to 53, or a pharmaceutical combination according to any one of items 22 to 53, wherein the EGFR inhibitor is (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH- benzo[d]imidazol-2-yl)-2-methylisonicotinamide.
57. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 6 to 20, or 49 to 53, or a pharmaceutical combination according to any one of items 22 to 53, wherein the EGFR inhibitor is cetuximab.
58. The pharmaceutical combination according to any one of items 21 to 57 in a form of a pharmaceutical composition.
59. A method of treating a patient having colorectal cancer further defined as in any one of items 1 to 20, or 49 to 57, wherein the amount of the inhibitor administered to a patient is therapeutically effective.
60. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of items 1 to 20 or 49 to 57, for use in vivo.
"Colorectal cancer" as used herein means a neoplasm arising from the colon and/or rectum, particularly from the epithelium of the colon and/or rectum.
"Mutated" or "mutation" denots herein an alteration from a normal functional or wild type protein, cDNA, gene or mRNA, which results in changed activity, or loss thereof. It includes changed mutation status like for example frame-shift mutation, deletion, translocation, insertion, duplication, inversion, functional mutation; or combinations thereof. It includes also DNA modification, cDNA modification, mRNA modification, protein modification, DNA function, cDNA function, mRNA function, protein function, DNA mutation, cDNA mutation, mRNA mutation, protein mutation, or combinations thereof; preferably is DNA mutation. DNA modification includes DNA alkylation or acylation. For example, methylation is a biochemical process involving the addition of a methyl group to the cytosine or adenine DNA nucleotides. mRNA modification includes RNA editing, which is a biochemical process involving the change of nucleotides after they have been generated by RNA polymerase to form a sequence. cDNA modification includes any modification that was made at the mRNA level will be translated into cDNA modification. Protein modification includes a biochemical process involving the change of amino acids after they have been translated. Protein function is understood for proteins to carry out the duties specified by the information encoded in genes, including facilitation of signaling transduction, enzymatic reactions etc.
"Gene expression" or "expression" are both used herein interchangeably and refer to the nucleic acids or amino acids (e.g., peptide or polypeptide) generated when a gene is transcribed and translated. In a particular embodiment "gene expression" or "expression" denote DNA expression, mRNA expression, cDNA expression, transcription, protein transcription or protein expression. Detection of gene expression can be by any appropriate method, including for example, detecting the quantity of mRNA transcribed from the gene or the quantity of cDNA produced from the reverse transcription of the mRNA transcribed from the gene or the quantity of the polypeptide or protein encoded by the gene. Transcription or translation can be determined using known techniques. For example, an amplification method such as PCR may be useful. The same principles apply to "overexpression".
"Control" denotes herein to the sequence, parameter or level measured for comparison in a noncancerous, healthy, wild-type tissue or cell. For example, the control can be the sequence, parameter or level measured in a normal colonic epithelium. A Wnt pathway in the colorectal cancer can be activated (increased Wnt signaling) or inactivated (decreased Wnt signaling) compared to a control. This refers to the increased or decreased, respectively, expression or functional effect of Wnt pathway genes, corresponding mRNA and equally to transcription or functional effect of proteins encoded by said genes or mRNA.
"Mutated Wnt pathway" or "upstream Wnt pathway mutation" as used herein means any mutation in a gene encoding a protein in the Wnt pathway that increases Wnt signaling in colorectal cancer relative to a control, in a Wnt ligand-dependent manner. The control can be Wnt signaling in normal colonic epithelium. In addition to inactivating mutations in RNF43 and fusions involving RSP02 or RSP03, mutations in the following genes may increase Wnt signaling in a Wnt ligand-dependent manner: ZNRF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRP1-3, WI F-1, DKK1, DKK4,
LKBl/STKll, Keap-1, and NRF2. Mutations in the Wnt pathway or upstream Wnt pathway mutations can be detected by using Next-Generation DNA/RNA sequencing, RT-PCR or Nanostring technology.
Additional DNA/RNA platforms could also be employed.
"Microsatellite-unstable tumor" is a tumor that is hypermutable due to inactivation of one or more mismatch repair system genes, for example MLH1, MSH2, MSH6, and PMS2.
Description of the Figures
Compounds mentioned in the figures:
Compound A (Wnt inhibitor): 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin- 2-yl)acetamide Compound B (BRAF inhibitor): (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-
(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2- ylcarbamate
Cetuximab
Figure 1. RNF43 mutations and RSPO fusions co-occur with BRAFV600E mutations in patient CRC samples. APC mutations show a strong tendency to be non-overlapping with RNF43 mutations and RSPO fusions. Quilt plot of mutations and fusions in BRAFV600E-mutant CRC samples acquired from Asterand (n = 45). Dark gray boxes = mutations/variants that alter the amino acid sequence. Black boxes = fusions.
Figure 2. JHOM-2B cell line is derived from a lower Gl adenocarcinoma. (A) Representative images of CK7 staining (Left) or CK20 staining (Right) of a JHOM-2B tumor xenograft. (B) DNA sequence of the fusion breakpoint between exonl of PTPRK and exon 2 of RSP03 in JHOM-2B.
Figure 3. JHOM-2B tumor cells are sensitive to COMPOUND A; however, COMPOUND A antagonizes the tumor growth inhibition of COMPOUND B plus cetuximab in vitro. (A) In a foci formation assay, decreased JHOM-2B colonies are seen after treatment with COMPOUND A. (B) COMPOUND A inhibits the proliferation of JHOM-2B tumor cells in a 7-day CTG assay, with an EC50 of 0.06 <xM. (C) Addition of COMPOUND A to COMPOUND B+cet has an antagonistic effect on tumor growth inhibition in vitro.
Figure 4. JHOM-2B tumor cells exhibit autocrine Wnt signaling. Quantitative RT-PCR of beta-catenin- target genes (AXIN2, LGR5, c-MYC, and CCNDl) after 72 hours of treatment with 100 nM COMPOUND A. ***P< 0.001.
Figure 5. Effects of COMPOUND A, COMPOUND B, cetuximab and combination treatments on Wnt and MAPK signaling pathways in JHOM-2B tumor cells. JHOM-2B tumor cells were treated with 100 nM COMPOUND A, 100 nM COMPOUND B, and/or 50 nM cetuximab for 72 hours prior to collection of protein lysates and immunoblotting.
Figure 6. The triple combination of COMPOUND A+COMPOUND B+cet is efficacious in JHOM-2B tumor xenografts in vivo. (A) JHOM-2B-tumor-bearing mice were treated with 10 ml/kg vehicle, p.o., BID (filled circles); 5 mg/kg COMPOUND A, p.o. BID (open squares); 20 mg/kg COMPOUND B, p.o., qd (filled stars); 20 mg/kg cetuximab, i.p., 2x/wk (filled upside down triangles); COMPOUND A+COMPOUND B (filled diamonds); COMPOUND A+cet (open circles); COMPOUND B+cet (filled squares); or COMPOUND A+COMPOUND B+cet (open triangles) for 11 days. The tumor volume is plotted as the mean ± SEM (n = 5-6 per treatment group). (B) Scatter plot of individual tumor volumes.
Figure 7. COMPOUND A induces cell cycle arrest in JHOM-2B tumor xenografts, as a single agent and in combination. (A) Representative images of pHH3 staining by immunohistochemistry after 14 days of treatment (the COMPOUND A and COMPOUND A+cet treatment groups were collected after 11 days of treatment). (B) Percentage of pHH3-positive pixels. Graphs represent mean ± SEM (n = 5-6 per treatment group). **P < 0.01; ***P < 0.001. Figure 8. COMPOUND A induces mucinous differentiation of JHOM-2B tumor xenografts, as a single agent and in combination. (A) Representative images of Alcian blue staining after 14 days of treatment (the COMPOUND A and COMPOUND A+cet treatment groups were collected after 11 days of treatment). (B) Percentage of blue-positive pixels. Graphs represent mean ± SEM (n = 5-6 per treatment group). ***p< 0.001.
Figure 9. The triple combination of COMPOUND A+COMPOUND B+cet is efficacious in HCOX1329 patient-derived xenografts in vivo. (A) HCOX1329-tumor-bearing mice were treated with 10 ml/kg vehicle, p.o., BID (filled circles); 5 mg/kg COMPOUND A, p.o. BID (open squares); 20 mg/kg COMPOUND B, p.o., qd (filled stars); 20 mg/kg cetuximab, i.p., 2x/wk (filled upside down triangles); COMPOUND A+COMPOUND B (filled diamonds); COMPOUND A+cet (open circles); COMPOUND B+cet (filled squares); or COMPOUND A+COMPOUND B+cet (open triangles) for 10 days. The tumor volume is plotted as the mean ± SEM (n = 4-5 per treatment group). (B) Scatter plot of individual tumor volumes.
Figure 10. COMPOUND A and COMPOUND B modestly induce cell cycle arrest in HCOX1329 patient- derived tumor xenografts; additional cell cycle arrest is seen with combination treatments. (A)
Representative images of Ki67 staining by immunohistochemistry after 10 days of treatment. (B) Percentage of Ki67-positive nuclei. Graphs represent mean ± SEM (n = 4-5 per treatment group). *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 11. The combinations of COMPOUND A+COMPOUND B and COMPOUND A+COMPOUND B+cet induce mucinous differentiation of HCOX1329 tumor xenografts. (A) Representative images of Alcian blue staining after 10 days of treatment. In contrast to JHOM-2B xenografts that accumulate intra- and extracellular mucin upon treatment, treatment of HCOX1329 xenografts results in a selective increase in intracellular mucin (arrows). (B) Percentage of blue-positive pixels. Graphs represent mean ± SEM (n = 4- 5 per treatment group). *P < 0.05; **P < 0.01.
Figure 12. No statistically significant decrease in tumor volume is seen in T70 patient-derived xenografts treated with COMPOUND A, cetuximab, or COMPOUND A+cetuximab in vivo. (A) T70-tumor-bearing mice were treated with 10 ml/kg vehicle, p.o., BID (filled circles); 5 mg/kg COMPOUND A, p.o. BID (open squares); 20 mg/kg cetuximab, i.p., 2x/wk (filled upside down triangles); or COMPOUND A+cetuximab (open circles) for 14 days. The tumor volume is plotted as the mean ± SEM (n = 16 per treatment group). (B) Scatter plot of individual tumor volumes.
Figure 13. COMPOUND A and COMPOUND A+cetuximab induce cell cycle arrest in T70 patient-derived tumor xenografts. (A) Representative images of Ki67 staining by immunohistochemistry after 14 days of treatment. (B) Percentage of Ki67-positive nuclei. Graphs represent mean ± SEM (n = 16 per treatment group). *P < 0.05; **P < 0.01; ***P < 0.001.
Figure 14. COMPOUND A and COMPOUND A+cetuximab induce mucinous differentiation of T70 tumor xenografts. (A) Representative images of Alcian blue staining after 14 days of treatment. (B) Percentage of blue-positive pixels. Graphs represent mean ± SEM (n = 16 per treatment group). *P < 0.05; **P < 0.01; ***p< 0.001. Detailed Description of the Invention
Surprisingly it has been found that a Wnt inhibitor, or a combination of Wnt inhibitor and either a BRAF inhibitor, or EGFR inhibitor, or both, according to the present disclosure, pharmaceutical compositions or combination product of the present disclosure, are especially useful for treatment of a patient with a BRAFV600E-mutant colorectal cancer and microsatellite-unstable, BRAF wild-type (BRAF^), KRAS wild- type (KRASWT) colorectal cancer harboring, particularly the cancer with a mutated Wnt pathway.
Wnt/P-catenin signaling promotes cell survival in various cell types (Orford et al., J Cell Biol, 146:855-868 (1999); Cox et al., Genetics, 155:1725-1740 (2000); Reya et al., Immunity, 13:15-24 (2000); Satoh et al., Nat Genet, 24:245-250 (2000); Shin et al., Journal of Biological Chemistry, 274:2780-2785 (1999); Chen et al., J Cell Biol, 152:87-96 (2001); Loannidis et al., Nat Immunol, 2:691-697 (2001)). Wnt signaling pathway is also thought to be associated with tumor development and/or progression (Polakis et al., Genes Dev, 14:1837-1851 (2000); Cox et al., Genetics, 155). According to the present disclosure, a Wnt inhibitor can be any compound which targets and decreases or inhibits the Wnt pathway.
A Wnt inhibitor can be a compound, protein or antibody that reduces the beta-catenin target gene expression of AXIN2 by at least 50% with an EC50 of 10 μΜ or less, preferably less than ΙμΜ, in a tumor cell line with autocrine Wnt signaling (H PAF-I I). Gene expression is measured against a control, which can be either gene expression of AXIN2 in an untreated cell sample, and/or against the gene expression of housekeeping genes in the treated sample, such as gene expression of for example GAPDH, HSP90, 6- actin, ACTB and 62 M.
The Wnt inhibitor is particularly a compound, protein or an antibody which inhibit members of the Wnt pathway, for example inhibits or reduces activity of Porcupine, RSP02, RSP03, Frizzled, LRP6 or Tankyrase. The inhibitor can be for example XAV939, IWR1, IWP-1, IWP-2, JW74, JW55, Tautomycin, SB239063, SB203580, ADP-H PD, 2-[4-(4-fluorophenyl)piperazin-l-yl]-6-methylpyrimidin-4(3H)-one, PJ34, Niclosamide, Cambinol, Sulindac, 3289-8625, J01-017a, NSC668036, Filipin, IC261 or other Wnt inhibitors disclosed herein. A Wnt inhibitor can especially be a compound that inhibits Frizzled or Porcupine, most preferably Porcupine. In one embodiment, the Wnt inhibitor according to the present disclosure is 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin-2-yl)acetamide (compound A). The compound A can be prepared as described in WO2010/101849 and has a structure of formula
Figure imgf000017_0001
Mitogen-activated protein kinase (MAPK) hyper-activation is a common property of human cancers and is often due to activating mutations in the BRAF and RAS genes. BRAF kinase domain mutations result in the production of a constitutively activated form of the protein and occur in approximately 8% of human tumors (Davies et al., 2002; Wan et al., 2004). BRAF mutation stimulates extracellular signal-regulated kinase (ERK) signaling, induces proliferation and is capable of promoting transformation. BRAF inhibitors are compounds, especially compounds, proteins or antibodies which target BRAF, particularly mutant BRAF, and its downstream effectors. BRAF inhibitor can be selected from the group consisting of: ((S)- methyl-l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin- 2-ylamino)propan-2-ylcarbamate;
methyl N-[(2S)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2,5-difluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-ethyl-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-fluoro-3-methanesulfonamido-5-methylphenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-chloro-3-methanesulfonamido-5-methylphenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2-chloro-5-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2R)-l-({4-[3-(5-chloro-2-fluoro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate;
methyl N-[(2S)-l-({4-[3-(2,5-dichloro-3-methanesulfonamidophenyl)-l-(propan-2-yl)-lH-pyrazol-4- yl] pyrimidin-2-yl}amino)propan-2-yl]carbamate; and
vemurafenib.
In one embodiment, the BRAF inhibitor is (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3- (methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate of formula (I I ) (compound B).
Figure imgf000018_0001
formula (I I)
The BRAF inhibitors can be obtained by the processes disclosed in WO2011/025927. Where the colorectal cancer is BRAF wild-type, like for example in the microsatellite-unstable BRAF wild- type and KRAS wild-type colorectal cancer, the BRAF inhibitor may not be used in combination with the Wnt inhibitor.
EGFR inhibitor can be any compound that targets, decreases or inhibits the activity of the epidermal growth factor family of receptor tyrosine kinases (EGFR, ErbB2, ErbB3, ErbB4 as homo- or heterodimers) and their mutants. Such compounds which target, decrease or inhibit the activity of the epidermal growth factor receptor family are especially compounds, proteins or antibodies which inhibit members of the EGF receptor tyrosine kinase family, e.g. EGF receptor, ErbB2, ErbB3 and ErbB4 or bind to EGF or EGF related ligands, and are in particular those compounds, proteins or monoclonal antibodies generically and specifically disclosed in WO 97/02266, e.g. the compound of ex. 39, or in EP 0 564 409, WO 99/03854, EP 0520722, EP 0 566 226, EP 0 787 722, EP 0 837 063, US 5,747,498, WO 98/10767, WO 97/30034, WO 97/49688, WO 97/38983 and, especially, WO 96/30347 (e.g. compound known as CP 358774), WO 96/33980 (e.g. compound ZD 1839) and WO 95/03283 (e.g. compound ZM105180); e.g. trastuzumab (Herceptin™), cetuximab (Erbitux™), Iressa, Tarceva, OSI-774, CI-1033, EKB-569, GW-2016, El.l, E2.4, E2.5, E6.2, E6.4, E2.ll, E6.3 or E7.6.3, and 7H-pyrrolo-[2,3-d]pyrimidine derivatives which are disclosed in WO 03/013541, gefitinib, erlotinib, lapatinib, XL-647, HKI-272 (Neratinib), BIBW2992 (Afatinib), EKB-569 (Pelitinib), AV-412, canertinib, PF00299804, BMS 690514, HM781-36b, WZ4002, AP- 26113, panitumumab, matuzumab, pertuzumab, or (R,E)-N-(7-chloro-l-(l-(4-(pyrrolidin-l-yl)but-2- enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2-methylisonicotinamide;
N-(7-chloro-l-(l-(4-(pyrrolidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(7-chloro-l-(l-(4-(3-fluoroazetidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(7-chloro-l-(l-(4-(3-fluoroazetidin-l-yl)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(S)-N-(l-(l-acryloylpiperidin-3-yl)-5-methyl-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl) benzamide; N-(l-(l-acryloylpiperidin-3-yl)-5-methyl-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl) benzamide; (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
(R,E)-N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R,E)-N-(l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-7-methyl-lH-benzo[d]imidazol-2-yl)-2- (trifluoromethyl)isonicotinamide; N-(l-(l-(4-(dimethylamino)but-2-enoyl)a^
(trifluoromethyl)isonicotinamide;
(R)-N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-methoxy-lH-benzo[d]imidazol-2-yl)pyridazine-4- carboxamide;
N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-methoxy-lH-benzo[d]imidazol-2-yl)pyridazine-4 arboxamide; N-(7-methyl-l-(l-(vinylsulfonyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-3-(trifluoromethyl)ben
N-(l-(l-acryloylazepan-3-yl)-7-(pyrrolidin-l-ylmethyl)-lH-benzo[d]imidazol-2-yl)-3- (trifluoromethyl)benzamide;
tert-butyl 4-acryloyl-6-(7-chloro-2-(2-methylisonicotinamido)-lH-benzo[d]imidazol-l-yl)-l,4-diazepane- 1-carboxylate;
N-(l-(l-acryloyl-l,4-diazepan-6-yl)-7-chloro-lH-benzo[d]imidazol-2-yl)-2-methylisonicotinamide;
N-(l-(l-acetyl-4-acryloyl-l,4-diazepan-6-yl)-7-chloro-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R)-N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-(2-(pyrrolidin-l-yl)ethoxy)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
N-(l-(l-acryloylazepan-3-yl)-7-chloro-6-(2-(pyrrolidin-l-yl)ethoxy)-lH-benzo[d]imidazol-2-yl)-2,6- dimethylisonicotinamide;
(R,E)-N-(7-chloro-l-(l-(4-(dicyclopropylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
N-(7-chloro-l-(l-(4-(dicyclopropylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide;
(R)-l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxylic acid;
l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxylic acid; (R)-l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxamide; l-(l-acryloylpiperidin-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-5-carboxamide; and l-(l-acryloylazepan-3-yl)-2-(3-(trifluoromethyl)benzamido)-lH-benzo[d]imidazole-7-carboxylic acid, which are disclosed in WO2013184757.
In one embodiment the EGFR inhibitor is cetuximab.
In another embodiment the EGFR inhibitor is (/?,f)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2- enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2-methylisonicotinamide.
In yet another embodiment the EGFR inhibitor is (/?,f)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2- enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2,6-dimethylisonicotinamide.
In one embodiment, the combination partners are 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2- yl)pyridin-2-yl)acetamide, (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-(methylsulfonamido)phenyl)-l- isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate and/or cetuximab. In yet another embodiment the combination partners are 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5- (pyrazin-2-yl)pyridin-2-yl)acetamide, (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-
(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2-ylcarbamate and/or (R,E)-N-(7-chloro-l-(l-(4-(dimethylamino)but-2-enoyl)azepan-3-yl)-lH-benzo[d]imidazol-2-yl)-2- methylisonicotinamide.
The present disclosure embodiments also include pharmaceutically acceptable salts of the compounds useful according to the disclosure described herein. As used herein, "pharmaceutically acceptable salt" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418 and Journal of Pharmaceutical Science, 66, 2 (1977), each of which is incorporated herein by reference in its entirety. For example, the salt is sulphate salt, or bisulphate salt.
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The term "treating" or "treatment" as used herein comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease. For example, treatment can be the diminishment of one or several symptoms of a disorder or complete eradication of a disorder, such as cancer. Within the meaning of the present disclosure, the term "treat" also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease. The term "protect" is used herein to mean prevent delay or treat, or all, as appropriate, development or continuance or aggravation of a disease in a subject, e.g., a mammal or human. The term "prevent", "preventing" or "prevention" as used herein comprises the prevention of at least one symptom associated with or caused by the state, disease or disorder being prevented.
The compounds useful according to the disclosure (= being included in a combination, especially a pharmaceutical combination, according to the disclosure, respectively, or being used according to the disclosure, optionally also including further co-agents as defined below, that is, all active ingredients), as well as their pharmaceutically acceptable salts, can also be present as tautomers, N-oxides or solvates, e.g. hydrates. All these variants, as well as any single one thereof or combination of two or more to less than all such variants, are encompassed and to be read herein where a compound included in the inventive combination products, e.g. a Wnt inhibitor and/or a BRAF inhibitor, is mentioned.
In one embodiment the present disclosure relates to a pharmaceutical combination, especially a pharmaceutical combination product, comprising the mentioned combination partners and at least one pharmaceutically acceptable carrier.
"Pharmaceutical combination" refers to use, application or formulations of the separate partners with or without, preferably with, instructions for combined use or to combination products. The combination partners may thus administered entirely separately or be entirely separate pharmaceutical dosage forms. The combination partners may be pharmaceutical compositions that are also sold independently of each other and where just instructions for their combined use are provided in the package equipment, e.g. leaflet or the like, or in other information e.g. provided to physicians and medical staff (e.g. oral communications, communications in writing or the like), for simultaneous or sequential use for being jointly active, especially as defined below. It can refer to either a fixed combination in one dosage unit form, or a kit of parts for the combined administration where a Wnt inhibitor and either a BRAF inhibitor or EGFR inhibitor, or both (and optionally yet a further combination partner (e.g. an other drug, also referred to as "co-agent")) may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative (= joint) effect. In one embodiment the effect is synergistic. The selected combination partner are to be administered to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration and/or at the same time. The term "pharmaceutical combination" as used herein thus means a pharmaceutical product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients (which may also be combined).
The compounds of the present disclosure can be used as a fixed or non-fixed combination. The term "fixed combination" means that the active ingredients, e.g. a Wnt inhibitor and a BRAF inhibitor, are both administered to a patient simultaneously in the form of a single entity or dosage. In other terms: the active ingredients are present in one dosage form, e.g. in one tablet or in one capsule.
The term "non-fixed combination" means that the active ingredients are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more active ingredients. The term "non-fixed combination" thus defines especially administration, use, composition or formulation in the sense that the combination partners (i) Wnt inhibitor and either (ii) BRAF inhibitor or (iii) EGFR inhibitor, or both (and if present further one or more co-agents); for example (i) Wnt inhibitor and EGFR inhibitor alone; as defined herein can be dosed independently of each other or by use of different fixed combinations with distinguished amounts of the combination partners, i.e.
simultaneously or at different time points, where the combination partners may also be used as entirely separate pharmaceutical dosage forms or pharmaceutical formulations that are also sold independently of each other and just instructions of the possibility of their combined use is or are provided in the package equipment, e.g. leaflet or the like, or in other information e.g. provided to physicians and medical staff. The independent formulations or the parts of the formulation, product, or composition, can then, e.g. be administered simultaneously or chronologically staggered, that is at different time points and with equal or different time intervals for any part of the kit of parts. Particularly, the time intervals are chosen such that the effect on the treated disease in the combined use of the parts is larger than the effect which would be obtained by use of only any one of the combination partners (i), (ii) and (iii), thus being jointly active. The total amounts of the combination partners to be administered in the combined preparation can be varied, e.g. in order to cope with the needs of a patient sub-population to be treated or the needs of the single patient which different needs can be due to age, sex, body weight, etc. of the patients.
The combination partners, a Wnt inhibitor, a BRAF inhibitor and a EGFR inhibitor in any disclosed embodiment are preferably formulated or used to be jointly (prophylactically or especially
therapeutically) active. This means in particular that there is at least one beneficial effect, e.g. a mutual enhancing of the effect of the combination partners, in particular a synergism, e.g. a more than additive effect, additional advantageous effects (e.g. a further therapeutic effect not found for any of the single compounds), less side effects, a combined therapeutic effect in a non-effective dosage of one, both or all three combination partners, and very preferably a clear synergism of the combination partners.
For example, the term "jointly (therapeutically) active" may mean that the compounds may be given separately or sequentially (in a chronically staggered manner, especially a sequence-specific manner) in such time intervals that they preferably, in the warm-blooded animal, especially human, to be treated, and still show a (preferably synergistic) interaction (joint therapeutic effect). A joint therapeutic effect can, inter alia, be determined by following the blood levels, showing that both compounds are present in the blood of the human to be treated at least during certain time intervals, but this is not to exclude the case where the compounds are jointly active although they are not present in blood simultaneously.
The present disclosure thus pertains to a combination product for simultaneous or sequential use, such as a combined preparation or a pharmaceutical fixed combination, or a combination of such preparation and combination.
In the combination therapies of the disclosure, the compounds useful according to the disclosure may be manufactured and/or formulated by the same or different manufacturers. Moreover, the combination partners may be brought together into a combination therapy: (a) prior to release of the combination product to physicians (e.g. in the case of a kit comprising the compound of the disclosure and the other therapeutic agent); (b) by the physician themselves (or under the guidance of a physician) shortly before administration; (c) in the patient themselves, e.g. during sequential administration of the compound of the disclosure and the other therapeutic agent. Also in this case, the combination partners form ing a corresponding combination according to the disclosure may be mixed to form a fixed pharmaceutical composition or they may be administered separately or pairwise (i.e. before, simultaneously with or after the other drug substance(s)).
The term "pharmaceutically effective" preferably relates to an amount that is effective against the progression of a disease or disorder as disclosed herein.
A Wnt inhibitor, the combinations according to the present disclosure, pharmaceutical compositions or combination product of the present disclosure is especially suitable for treatment of a patient suffering from a proliferative disorder, in particular a solid tumor, BRAFV600E-mutant colorectal cancer, which can be microsatellite-unstable, or microsatellite-unstable BRAF wild-type and KRAS wild-type colorectal cancer. I n one embodiment a Wnt pathway in the BRAFV600E -mutant colorectal cancer or microsatellite- unstable BRAF wild-type and KRAS wild-type colorectal cancer is activated compared to a control. In a further embodiment AXIN2 expression in the colorectal cancer is higher compared to a control. In yet another embodiment, the cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03, particularly mutated RNF43. Because RNF43 and ZN RF3 are two homologous Zinc/RI NG finger cell surface transmembrane E3 ubiquitin ligases for Wnt receptor Frizzled that inhibit the cell surface levels of Wnt receptor complex composing Frizzled and LRP6, a Wnt inhibitor can also be used in ZN FR43 mutated colorectal cancer. The cancer can alternatively or in addition comprise RSPO fusion.
The term "a therapeutically effective amount" of a compound of the present disclosure refers to an amount of the compound of the present disclosure that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. In one non-limiting embodiment, the term "a therapeutically effective amount" refers to the amount of the compound of the present disclosure that, when administered to a subject, is effective to (1) at least partially alleviating, inhibiting, preventing and/or ameliorating a condition, or a disorder or a disease (i) mediated by a Wnt pathway, or mediated by BRAF activity and/or EGFR activity, or (ii) characterized by activity (normal or abnormal) of Wnt pathway, EGFR and/or BRAF; or (2) reducing or inhibiting the activity of Wnt pathway, EGFR and/or of BRAF.
As used herein, the term "subject" refers to an animal. Typically the animal is a mammal. A subject also refers to for example, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds and the like. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.
Wnt inhibitor can be for example administered in unit dosage of about 1-5000 mg of active ingredient(s) for a subject of about 50-70 kg, or about lmg - 3g or about 1-250 mg or about 1-150 mg or about 0.5- 100 mg, or about 1-50 mg of active ingredients. The therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof, is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.
BRAF inhibitor of the present disclosure can be administered in therapeutically effective amounts via any of the usual and acceptable modes known in the art. A therapeutically effective amount may vary widely depending on the severity of the disease, the age and relative health of the subject, the potency of the compound used and other factors. In general, satisfactory results are indicated to be obtained systemically at daily dosages of from about 0.03 to 30mg/kg per body weight. An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0.5mg to about 2000mg, conveniently administered, e.g. in divided doses up to four times a day or in retard form. Suitable unit dosage forms for oral administration comprise from about 1 to 500mg active ingredient.
In general, satisfactory results are indicated to be obtained systemically at daily dosages of an EGFR inhibitor according to the present disclosure from about 0.03 to 2.5 mg/kg per body weight. An indicated daily dosage in the larger mammal, e.g. humans, is in the range from about 0.5 mg to about 100 mg, conveniently administered, e.g. in divided doses up to four times a day or in retard form.
Suitable unit dosage forms for oral administration comprise from ca. 1 to 50 mg active ingredient.
In certain embodiments, a therapeutic amount or dose of the compounds of the present disclosure may range from about 0.1 mg/kg to about 500 mg/kg, alternatively from about 1 to about 50 mg/kg. In general, treatment regimens according to the present invention comprise administration to a patient in need of such treatment from about 10 mg to about 1000 mg of the compound(s) of this invention per day in single or multiple doses (such as two, three, or four times daily). Therapeutic amounts or doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.
In general, the dosage of the active ingredient to be applied to a warm-blooded animal depends upon a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound employed. A physician, clinician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition. Optimal precision in achieving concentration of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug.
As used herein, the term "carrier" or "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
The pharmaceutical combination product according to the disclosure (as fixed combination, or as kit, e.g. as combination of a fixed combination and individual formulations for one or both combination partners or as kit of individual formulations of the combination partners) comprises the combination of the present disclosure and one or more pharmaceutically acceptable carrier materials (carriers, excipi- ents). The pharmaceutical combination or the combination partners constituting it can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal administration, etc. In addition, the combination products of the present disclosure can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions). The combination products and/or their combination partners can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifers and buffers, etc.
In one embodiment, the pharmaceutical compositions are tablets or gelatin capsules comprising the active ingredient together with one or more commonly known carriers, e.g. one or more carriers selected from the group consisting of a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or
polyethyleneglycol; for tablets also c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth,
methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone; if desired d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and e) absorbents, colorants, flavors and sweeteners.
Tablets may be either film coated or enteric coated according to methods known in the art.
Suitable compositions for oral administration especially include an effective amount of one or more or in case of fixed combination formulations each of the combination partners (active ingredients) in the form of tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets may contain the active ingredient(s) in admixture with nontoxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets are uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed. Formulations for oral use can be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.
Parenteral compositions, transdermal, topical compositions and other can be prepared by known methods in the art.
Examples
The following examples serve to illustrate the invention and provide specific embodiments; however, they do not limit the scope of the invention.
Compounds described in the examples:
Compound A (Wnt inhibitor): 2-(2',3-dimethyl-2,4'-bipyridin-5-yl)-N-(5-(pyrazin-2-yl)pyridin- 2-yl)acetamide
Compound B (BRAF inhibitor): (S)-methyl l-(4-(3-(5-chloro-2-fluoro-3-
(methylsulfonamido)phenyl)-l-isopropyl-lH-pyrazol-4-yl)pyrimidin-2-ylamino)propan-2- ylcarbamate
Cetuximab
Example 1: Co-occurrence of BRAFV600E and upstream Wnt pathway mutations in patient CRC samples
Molecular characterization of patient BRAFV600E -mutant CRC samples
There are at least two distinct molecular pathways that underlie the pathogenesis of sporadic CRC: the conventional pathway and the serrated pathway. Approximately 70% of CRCs arise via the conventional pathway. These tumors are characterized by mutational activation of the Wnt pathway through inactivating mutations in APC or AXIN2 or mutations in the GSK3-target residues in beta-catenin (Jin, L.H., et al. Int. J. Cancer. 2003, 107:696-99; Korinek, V., et ai, Science. 1997, 275:1784-7; Morin, P.J., et ai, Science. 1997, 275:1787-90; Rubinfeld, B., et ai, Science. 1997, 275:1790-2; Liu, W., et ai, Nat. Genet. 2000, 26:146-7 ). In normal intestinal cells, APC associates with AXI N, GSK-3beta and casein kinase 1 to form the beta-catenin destruction complex. This complex phosphorylates beta-catenin, resulting in its ubiquitylation and subsequent degradation by the proteasome (Polakis, P. Curr. Biol. 2002, 12:R499-R501). In contrast, in cells harboring mutations in APC, AXIN2 or beta-catenin, beta- catenin accumulates and upon its translocation to the nucleus, interacts with the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to activate specific Wnt target genes (Tetsu, O., McCormick, F. Nature. 1999, 398:422-6; He, T.C., et al., Science. 1998, 281:1509-12). Considerable evidence from human genetic studies and mouse genetic models suggests that mutational activation of the Wnt pathway can initiate colon tumorigenesis. Inherited APC mutations cause familial adenomatous polyposis, and acquired APC mutations represent the earliest genetic alteration so far detected in sporadic CRC (Powell, S.M., et al., Nature. 1992, 359:235-7). Studies in PC-mutant CRC tumor xenografts indicate that Wnt signaling is also required for tumor maintenance, as inducible knockdown of beta-catenin in established xenografts inhibits tumor growth in vivo (Scholer-Dahirel, A., et al., Proc. Natl. Acad. Sci. 2011, 108:17135-40).
The role of Wnt pathway activation in CRCs that develop via the serrated pathway is largely unknown. Serrated pathway CRCs contain either BRAF or KRAS mutations, and lack APC mutations (Bettington, M., et al., Histopathol. 2013, 62:367-86). In a mouse model of Sff^F^^-induced colon tumorigenesis, Wnt pathway activation was identified as an important step in the progression from intestinal hyperplasia to carcinoma (Rad, R., et al., Cancer Cell. 2013, 24:15-29). In contrast to conventional CRCs, BRAF-mutant CRCs tend to have minimal chromosomal instability and exhibit hypermethylation of CpG islands, which can decrease the expression of DNA repair genes and cell cycle regulators.
Curiously, while the mutant BRAF inhibitor vemurafenib achieves a response rate of approximately 80% in BRAFV600E-mutant melanoma, the response rate in BRAFV600E-mutant CRC is approximately 5% (Kopetz, S. et al. J. Clin. Oncol, abstr. 2010, 28:3534; Corcoran, R.B., et al., J. Clin. Oncol. Suppl. abstr. 2012, 3528).
Prahallad and co-workers demonstrated in CRC cell line and xenograft models that the unresponsiveness of eff^F^^-mutant CRC to mutant BRAF inhibitors is due to feedback activation of EGFR (Prahallad, A. et al., Nature. 2012, 483:100-3). Treating eff^F^^-mutant CRC cells with a combination of a mutant BRAF inhibitor and an EGFR inhibitor synergistically inhibited tumor growth in vitro and in vivo. This data was the impetus to initiate clinical trials with combinations of mutant BRAF inhibitors and EGFR inhibitors in BRAFV600E-mutant CRC. If in addition to the MAPK and PI3K pathways, the Wnt pathway also contributes to the maintenance of BRAFV600E-mutant CRC, then patients may derive additional benefit from a combination therapy that also includes a Wnt pathway inhibitor.
Recently, the secreted glycoproteins R-spondins 1-4 (RSPOl-4) have emerged as important activators of the Wnt pathway. RSPOs bind to LGR4-6 receptors and the transmembrane E3 ubiquitin ligases RNF43 and ZNRF3, forming a ternary complex (Chen, P-H., et al., Genes Dev. 2013, 27:1345-50; Xie, Y., et al., EMBO Rep. 2013, 14:1120-6; Zebisch, M., et al., Nature Com. 2013, 4:1-12). RNF43/ZNRF3 antagonize Wnt signaling by promoting the turnover of the Wnt receptors, Frizzled and LRP6 (Hao, H.X., et al., Nature. 2012, 485:195-200; Koo, B.K., et al., Nature. 2012, 488:665-9). Binding of RSPO induces the endocytosis of RNF43/ZNRF3, thereby increasing levels of membrane-bound Frizzled and LRP6 and enhancing Wnt signaling. RSPO fusions that elevate expression of RSP02 or RSP03 have been identified in colon cancer (Seshagiri, S., et al., Nature. 2012, 488:660-4), and inactivating mutations in RNF43 have been reported in mucinous tumors of the pancreas, mucinous ovarian carcinoma, and
cholangiocarcinoma (Wu, J., et al., Proc. Natl. Acad. Sci. 2011, 108:21188-93; Ryland, G.L., et al., J.
Pathol. 2013, 229:469-76; Ong, C.K., et al., Nature Genet. 2012, 44:690-3). As RSPO fusions and RNF43 mutations enhance Wnt ligand-dependent signaling, we hypothesize that Wnt pathway inhibitors, such as a porcupine inhibitor that exerts its effects upstream in the Wnt pathway, will be efficacious in tumors harboring these genetic alterations.
Forty-five BRAF -mutant CRC resection specimens were purchased from Asterand, PLC. The FFPE blocks were sent to Foundation Medicine, Inc. for genetic analysis using the T5b NGS panel. Complete characterization was received, and BRAF/Wnt pathway genetic mutation annotation was performed manually. Tabularization and graphical representation was performed using EXCEL.
Presence or absence of RSPO fusions in the 45 patient BRAFV600E-mutant CRC samples obtained from Asterand, PLC was determined by qPCR assays with either primer or probe spanning published junctions (Seshagiri, S., et al., Nature. 2012, 488:660-4). Assays were ordered and synthesized by I DT with FAM labeled probes. The four targeted assays were: EI F3Eel-RSP02e2 Forward
(TTG G ATCG G C ATCTAGTCTTTC ) Probe (TCTGTAAAGGAGGTTCGTGGCGG) reverse
(TCAGTTCAGCGCGATCAG), EI F3Eel-RSP02e3 Forward (TTCTCTCTGTAAAG G AG CTAGTTATG ) Probe (TCCCATTTGCAAGGGTTGTTTGTCTTG) reverse (ACAATGGGTGTAGCCGATG), PTPRKel_RSP03e2 Forward (G CTTTTGTG G CG CTCTTG ) Probe (AGTTCTCCG CAGTGCATCCTAACG ) reverse
(GGGCTTACATGACAAACATCC), and PTPRKe7_RSP03e2del Forward (TTACAAGACCTGGTGAAGGTG) Probe ( CTAATC ACCAG AACAAAATGTG C AGTG CATCCTAACGTTAGTC ) reverse
( AGTCTG G G CTTAC ATG AC AAA) . RNA was extracted from macrodissected FFPE tissue using Qiagen's RNeasy FFPE kit (Cat# 73504) and subsequently quantified using Nanodrop. 500ngs of total RNA was used for cDNA synthesis using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat# 4368814) and cDNA was diluted five-fold for a final concentration of 10 ngs/μΙ. 2 μΙ of diluted cDNA (total input of 20ngs) in a 10 μΙ reaction was run in triplicate for each sample for all fusion assays using an ABI7900 in a 384 well format, according to Life Technologies protocol. Threshold setting was automatically set by ABI7900 software (SDS2.4), and all samples were normalized to a UBC control gene. Samples with expression higher than 30 Ct's in the fusion assays are considered positive for the corresponding RSPO fusion.
Results
A total of 45 patient BRAFV600E -mutant CRC samples were analyzed for Wnt pathway mutations (Fig. l). Mutations were screened for by Foundation Medicine, I nc., using their T5b NGS panel, and RSPO fusions were separately detected using qPCR methods. We found a striking co-occurrence of RNF43 mutations with the BRAFV600E mutation (64.4% of BRAFV600E-mutant CRCs contained RNF43 mutations). This compares to a RNF43 mutation frequency of 13.1% when 430 unselected CRC samples in the TCGA database are analyzed with a trial version of OmicSoft. The frequency of RSPO fusions may also be enriched in the BRAFV600E-mutant CRCs, with a frequency of RSP02 plus RSP03 fusions of 13.3% in BRAFV600E-mutant CRC samples versus 2% when 430 unselected CRC samples in the TCGA database are analyzed with a trial version of OmicSoft. This molecular epidemiology data strongly suggests that Wnt pathway activation, via genetic alterations in upstream Wnt pathway regulators, is important for BRAFV600E-mutant CRC tumorigenesis. Example 2: Efficacy of a Wnt pathway inhibitor and combinations comprising (i) a Wnt pathway inhibitor, (ii) a mutant BRAF inhibitor, and/or (iii) an EGFR inhibitor in a BRAFV600E;RSPO3 fusion+ lower Gl adenocarcinoma cell line model and a patient-derived BRAFV600E;RNF43-mutant CRC xenograft model
DNA sequencing of RSP03 fusion
Genomic DNA of J HOM-2B cells was isolated . The DNA fragment containing PTPRK-RSP03 fusion was amplified by PCR using HH3 and HH4 primers, and analyzed by electrophoresis. DNA sequence of PCR fragment was determined by Sanger sequencing. Sequence of HH3 and HH4 primers are following. HH3: AAACTCGGCATGGATACGAC. HH4: G CTTCATG CC AATTCTTTCC .
Cell culture
JHOM-2B cells were cultured in DMEM:F-12 (ATCC, Cat# 30-2006), supplemented with 10% fetal bovine serum (5% C02 at 37°C).
Foci formation assay
For foci formation assay, approximately 12,000 JHOM-2B cells were seeded in a 6-well tissue culture plate with 2 mL of growth media. After overnight culture for cell attachment, media was replaced with fresh growth media containing 1 μΜ of COM POUND A and/or DMSO. When cell colonies reached a desirable size (24 days), cells were fixed with 10% (vol/vol) buffered formalin and stained with crystal violet solution. After several washes, the plate was dried and imaged.
Growth assay
Cell proliferation and EC50 values were determined through the use of CellTiter-Glo® (CTG), a method based on luminescent detection of mitochondrial ATP (Promega, Cat# G7573). JHOM-2B cells were plated in 96 well-clear bottom culture plates (Corning, Cat# 3904) at approximately 9500 cells per well, with 2 identical plates created for a 'time=0' read and 'day 7' read. On day 0, COMPOUND A was added to one plate in the following concentrations (μΜ); DMSO (vehicle), 0.0015, 0.0046, 0.014, 0.041, 0.123, 0.37, 1.11, 3.33, and 10. The duplicate plate was used for a time=0 CTG read. CTG was determined at day 0 and day 7 of treatment as follows: 100 μΙ of the CTG reagent was added to each well of the 96 well plates, and placed on a shaker for 30-45 minutes at room temperature. Luminescence was measured using the Perkin Elmer-Victor™ X4. Raw luminescent readings were entered into an Excel spread sheet that was formulated to determine the EC50 value for each PDAC cell lines (day 7 - day 0).
Combination Assay
The combination assay was set-up in the same manner as the growth assay, with several exceptions. Compound was added in an 8 x 8 dose-matrix fashion, with COMPOUND A dilutions added to one axis, and COMPOUND B added to the other axis. The dilution series used for both COMPOUND A and COMPOUND B was as follows (μΜ): 0.0015, 0.0046, 0.0137, 0.0412, 0.1235, 0.3704, and 1.11. Cetuximab was added to all of these wells in a single dose of 50 nM, and 16 wells per plate were reserved for the DMSO control. The experiment was run in triplicate, as well as an extra plate for a time=0 CTG read. A CTG assay was performed on the plates after 7 days of compound treatment. Raw luminescent readings were entered into an Excel spread sheet that was formulated to determine inhibition values, which were then entered into an Excel spread sheet that was used uploaded to the Chalice Analyzer server. The final inhibition grid was visualized using the Chalice Analyzer Client program.
Quantitative real-time polymerase chain reaction
JHOM-2B cells were plated onto 10 cm tissue culture dishes at approximately 1.5 e+6 cells per dish, and treated with COMPOUND A (100 nM) or DMSO for 72 hours. Total RNA from COMPOUND A treated and untreated JHOM-2B cells was extracted using the RNeasy Plus Mini Kit (Qiagen, Cat# 74134) and reverse transcribed with High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat# 4368814), according to the manufacture's protocol. Gene transcript expression levels were determined using the Applied Biosystems 7900HT Fast Real-time PCR System. Quantitative real-time polymerase chain reactions were performed in 12 μΙ reactions, consisting of 0.6 μΙ of 20x TaqMan® Gene Expression Assay, 6 μΙ TaqMan® 2x Universal PCR Master Mix (Applied Biosystems, Cat# 4304437), 0.4 μΙ DNase/RNase free distilled water and 5 μΙ cDNA template (1 ng/μΙ). Thermocycling conditions were as follows: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. All experimental reactions were carried out in quadruplicate. Gene expression was quantified using the Δ2 cycle threshold method, with 18s serving as an internal control. Applied Biosystems TaqMan® Gene Expression Assay reagents used were as follows: AXIN2 (Hs00610344_ml), CCND1 (CyclinDl) (Hs0076553_ml), LGR5 (Hs00969418_ml), MYC (Hs00153408_ml) and 18s (4319413E). Statistical analysis was performed using a Student's t-test.
Immunoblots
JHOM-2B cells were plated onto 8-10 cm tissue culture dishes at approximately 1.5 e+6 cells per dish, and treated for 72 hours under the following conditions: DMSO; COM POUND A (100 nM); NVP- COMPOUND B-NX-12 (COMPOUND B) (100 nM); cetuximab (50 nM); COMPOUND A (100 nM) +
COMPOUND B (100 nM); COMPOUND A (100 nM) + cetuximab (50 nM); COMPOUND B (100 nM) + cetuximab (50 nM); and COMPOUND A (100 nM) + COMPOUND B (100 nM) + cetuximab (50 nM).
Western blots were performed as follows: Cell lysates were prepared using NP40 Cell Lysis Buffer (Invitrogen, Cat# FNN0021), supplemented with lx Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific, Cat# 1861281). Thirty micrograms of total cell lysates were separated by SDS-PAGE and electrotransfered to nitrocellulose membrane (Invitrogen, Cat# LC2007). The following primary antibodies and blocking reagents were used: Phospho-LRP6 (Serl490) (Cell Signaling Technology (CST), Cat# 2568, 2% milk), LRP6 (CST, Cat# 3395, 2 % milk), Phospho-EGFR (Tyrl068) (CST, Cat#3777 , 5 % BSA), EGFR (CST, Cat#2232 , 5 % BSA), Phospho-p44/42 MAPK (Erkl/2)(Thr202/Tyr204) (CST, Cat# 4376, 5 % BSA), p44/42 MAPK (Erkl/2) (CST, Cat# 4695, 5 % BSA), Cleaved Caspase-8 (CST, Cat# 9496, 5 % BSA), c-Myc (Abeam, Cat# ab32072, 2% milk), p21/Wafl/Cipl (CST, Cat# 2947, 5% milk), and β-Tubulin (CST, Cat# 2146, 5 % BSA). Blocking reagents were prepared fresh in phosphate buffered saline 0.1% (vol/vol) Tween-20 (PBS-T), and membranes were blocked for 1 hr on a shaker at room temperature. Primary antibodies were added at 1:1000 dilutions (p44/42 MAPK (Erkl/2) 1:5000, and β-Tubulin 1:10,000), and incubated overnight with gentle rocking at 4° C. Immunoblots were washed 3 times, 5 min each with PBS-T, and secondary antibody was added at 1:10,000 dilution into PBS-T milk for 1 hour on a shaker at room temperature. After several washes, enhanced chemiluminescence (ECL) reactions were performed according to manufacture recommendations (SuperSignal® West Dura Extended Duration Substrate; Thermo Scientific, Cat# 34076).
Immunohistochemistry
IHC was performed on the Ventana DISCOVERY XT automated I HC platform (Tuscon, AZ), using optimized protocols described below. FFPE slides were cut at 3.5μιη thickness, attached to charged slides (Thermo-Scientific Colormark Plus Cat # CM-5951PLUS BLUE), baked at 60°C for 1 hour and loaded on the DISCOVERY XT Staining System. Slides were deparaffinized using Ventana EZ Prep (Cat # 950- 100). Antigen retrival was performed using Ventana Cell Conditioning #1 reagent (Cat # 950-124).
Primary antibody diluted in DAKO Cytomation Antibody Diluent (Cat # S0809) or DAKO Cytomation Antibody Diluent with background reducing components (Cat # S3022), was manually applied during the antibody titration step in 100 μΙ volume. Ventana OmniMap HRP-conjugated anti-rabbit antibody (Cat # 760-4311) was used at the provided pre-dilute concentrations. Ventana ChromoMap DAB detection kit (Cat # 760-159) was used for chromogenic detection. Slides were counterstained for 4 minutes with Ventana Hematoxylin (Cat # 760-2021), followed by Ventana Bluing Reagent (Cat # 760-2037) for 4 minutes. Coverslipped slides were evaluated by light microscopy. Slides were scanned by Aperio ScanScope slide scanner (Vista, CA). Digital images were then viewed by Aperio ImageScope (Vista, CA) and snapshots were taken by TechSmith Snagit (Okemos, Ml).
A rabbit monoclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding C-terminus of human keratin 7 protein (Catalog # M3522, Lot# 121022C) was obtained from Spring Bioscience (Pleasanton, CA.). The antibody was stored at 4°C until use. The optimal IHC protocol included Heat and Ventana "Mild- Cell Conditioning 1" setting for antigen retrieval. Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent (Cat # S0809), manually applied during the antibody titration step in 100 μΙ volume, and incubated for 60 minutes at 37°C. Subsequently, incubation with Ventana OmniMap prediluted HRP-conjugated anti-rabbit antibody (Cat # 760-4311) was performed for 4 minutes.
A rabbit monoclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding C-terminus of human keratin 20 protein (Catalog # M3332, Lot# 121218CD) was obtained from Spring Bioscience (Pleasanton, CA.). The antibody was stored at 4°C until use. The optimal IHC protocol included Ventana "Mild- Cell Conditioning 1" setting for antigen retrieval. Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent with background reducing components (Cat # S3022), manually applied during the antibody titration step in 100 μΙ volume, and incubated for 60 minutes at RT. Subsequently, incubation with Ventana OmniMap prediluted HRP- conjugated anti-rabbit antibody (Cat # 760-4311) was performed for 4 minutes.
A rabbit polyclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding SerlO of phospho-Histone H3 (Catalog # 9701, Lot# 13) was obtained from Cell Signaling Technology (Danvers, MA). The antibody was stored at -20°C until use. The optimal IHC protocol included Heat and Ventana "Standard- Cell Conditioning 1" setting for antigen retrieval.
Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent (Cat # S0809), manually applied during the antibody titration step in 100 μΙ volume, and incubated for 60 minutes at 37°C. Subsequently, incubation with Ventana OmniMap prediluted HRP-conjugated anti- rabbit antibody (Cat # 760-4311) was performed for 4 minutes.
A rabbit polyclonal antibody produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Ki67 (Catalog # VP-RM04, Lot# 20425) was obtained from Cell Signaling
Technology (Burlingame, Ca.). The antibody was stored at -20°C until use. The optimal I HC protocol included Ventana "Standard- Cell Conditioning 1" setting for antigen retrieval. Primary antibody was diluted at a concentration of 1:100 in DAKO Cytomation Antibody Diluent (Cat # S0809), manually applied during the antibody titration step in 100 μΙ volume, and incubated for 60 minutes at RT.
Subsequently, incubation with Ventana OmniMap prediluted HRP-conjugated anti-rabbit antibody (Cat # 760-4311) was performed for 4 minutes.
Alcian blue staining
FFPE slides were cut at 3.5μιη thickness, attached to charged slides (Thermo-Scientific Colormark Plus Cat # CM-5951PLUS BLUE), baked at 60°C for 1 hour. Slides were then placed in a rack and
deparaffinized with 3 changes of xylene 5 minutes each, 2 changes of 100% alcohol 1 minute each and 2 changes of 95% alcohol 1 minute each. Then slides were rinsed thoroughly in distilled water to let stand until staining procedure is ready to be performed. Alcian Blue pH2.5 staining kit (Cat# k066) was obtained from Poly Scientific R&D Corp (Bayshore, NY). Alcian Blue pH 1.0 (Cat# s2412) was obtained and used in place of Alcian Blue pH2.5. Slides were transferred from distilled water and placed in 3% aqueous acidic acid for 3 minutes RT. Slides were then directly placed in Alcian Blue pHl.O for 30 minutes. Then slides are washed in running tap water for 10 minutes, rinsed in distilled water, and placed in 0.1% Nuclear Fast Red Kernechtrot for 5 minutes. Slides were removed and then washed in running water for 1 minute. After wash slides are dehydrated in 95% alcohol, 100% alcohol, and cleared in xylene, 2 changes each. Slides were then mounted in xylene based mounting media.
Image analysis
Images were captured using the Aperio Scanscope AT Turbo scanner (Leica Microsystems Inc, Buffalo Grove, IL). Whole tumor sections were analyzed using Visiopharm Integrator System (V.4.5.6.580; Visiopharm, H0rsholm, Denmark). Necrotic regions were manually excluded from Alcian blue staining image analysis using the drawing tools provided by the analysis software. Necrotic regions and stroma were excluded from JHOM-2B xenograft pHH3 image analysis by applying tumor masks generated from CK20-stained adjacent tissue sections using the Tissue Align module. Tumor tissues were segmented using the VisiomorphDP module. Necrotic regions and stroma were manually excluded from HCOX1329 xenograft Ki67 image analysis, and the tumor tissues were segmented using TissuemorphDP module. Staining was quantified as percent blue pixels for Alcian blue, percent positive pixels for pHH3, or percent positive nuclei for Ki67. Unpaired t tests were used to determine statistical significance. Symbols used: *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.
In vivo efficacy studies
JHOM-2B human lower Gl tumor cells were obtained from RIKEN (Japan) and a working stock was frozen at passage 14. The line was shown to be free of Mycoplasma sp. and murine viruses in the IMPACT VIII PCR assay panel (RADIL, University of Missouri, Columbia, MO). These cells were maintained in
DMEM:HAM's F12 1:1 (ATCC #30-2006) plus 10% FBS (Omega Scientific Inc. #FB-09) at 37°C in a humidified atmosphere containing 5% carbon dioxide.
JHOM-2B cells were harvested at 95-100% confluency, washed, and resuspended in a 1:1 mixture of cold DPBS and Matrigel™ (Becton-Dickinson #354234) at a concentration of 1 X 108 cells/1.5 ml. Finally, 1x107 cells in a total volume of 150 μί. were implanted subcutaneously into the right axillary region of female nu/nu mice.
HCOX1329 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma, which was implanted and passaged. HCOX1329 contains a Sff^F^^mutation and several mutations/variants in RNF43 (P192fs, G659fs, and C272R) (Korn, J., et a\., Manuscript in preparation).
Female nu/nu mice were implanted subcutaneously with 3x3x3mm tumor fragment containing 50% phenol red-free matrigel (BD Biosciences) in DMEM. For tumor implantation, mice were anesthetized with continuous flow of 1.5-3.5% isoflurane/oxygen mixture using the integrated multi chambers anesthesia center (I MCAC). Use a 12G trocar to take one fragment with 0.1 ml of the diluted matrigel and implant subcutaneously into the right axillary region of nude mice.
Mice with average tumor volume of 200 mm3 were randomized into 8 experimental groups on day 21 (JHOM-2B) or day 17 (HCOX1329) post implantation. Tumors were measured with digital calipers twice a week during active dosing period. Tumor volumes were calculated using the ellipsoid formula: (length x width2)/2. Body weights were recorded twice a week at the time of tumor measurement. After 11 days (Groups 2 and 6) or 14 days of treatment, the dosing of mice harboring JHOM-2B xenografts was terminated, and animals euthanized. After 10 days of treatment, the dosing of mice harboring
HCOX1329 xenografts was terminated, and animals euthanized. Plasma and tumors were collected at 7hr post last dose for pharmacokinetic (PK) and pharmacodynamic (PD) analysis. All data were expressed as mean ± standard error of the mean (SEM). Delta tumor volume and body weight were used for statistical analysis. Between group comparisons were carried out using the Kruskal-Wallis ANOVA followed by a post hoc Dunn's test. For all statistical evaluations, the level of significance was set at p < 0.05. Significance compared to the vehicle control group is reported unless otherwise stated. The standard protocols used in pharmacology studies are not pre-powered to demonstrate statistically significant superiority of a combination over the respective single agent treatment. The statistical power is often limited by potent single agent response and/or model variability.
Results
Two pre-clinical CRC models with the appropriate genetic background (JHOM-2B and HCOX1329) were identified for testing the porcupine inhibitor COMPOUND A as a single agent and in combination with the mutant BRAF inhibitor COMPOUND B and the EGFR inhibitor cetuximab.
JHOM-2B is a human cancer cell line that is reported to be derived from a mucinous ovarian carcinoma (Riken Bioresource Center). However, it can be extremely challenging to clinically differentiate a mucinous tumor of the ovary from a colorectal or appendiceal tumor, because all of these tumor types disseminate widely throughout the abdomen. Recently, it has become clear that the expression pattern of CK7 and CK20 is very useful in determining the site of origin of such tumors (Vang, R., USCAP presentation. 2013). JHOM-2B xenografts have rare cells that stain positively for CK7, whereas CK20 is diffusely positive (Fig. 2A). This expression pattern is consistent with lower Gl, not ovarian, origin.
Furthermore, JHOM-2B contains a BRAFV600E mutation (Barretina, J., et al., Nature. 2012, 492:603-7), which has not been reported in appendiceal cancer (Shen, J. P., et al., J. Clin. Oncol. 2012, suppl 34; abstr 397), strongly suggesting the JHOM-2B is of colorectal origin. A survey for genetic alterations in upstream Wnt pathway regulators revealed that JHOM-2B also harbors a fusion between exonl of PTPRK and exon2 of RSP03 (Fig. 2B).
HCOX1329 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma. HCOX1329 contains a Sff^F^^mutation and several mutations/variants in RNF43 (P192fs, G659fs, and C272R) (Korn, J., et al., Manuscript in prepartation).
JHOM-2B tumor cells are sensitive to treatment with COMPOUND A in vitro, as assessed by both a foci formation assay (Fig. 3A) and a 7-day CTG assay (Fig. 3B), with an EC50 of approximately 0.06 μΜ.
Treatment of J HOM-2B tumor cells with COMPOUND A results in a robust decrease in beta-catenin- target genes (AXIN2, LGR5, c-MYC and CCND1), indicating that JHOM-2B cells exhibit autocrine Wnt signaling (Fig. 4). In vitro by 7-day CTG assay, the addition of COMPOUND A to COMPOUND B plus cetuximab leads to antagonism of the growth inhibitory effects of COMPOUND B+cet (Fig. 3C). This is likely because the cell cycle arrest induced by COMPOUND A protects JHOM-2B cells from apoptosis (Fig. 5, cleaved CASP8, an apoptotic marker, decreases upon COMPOUND A treatment). Immunoblotting of JHOM-2B tumor cells confirms that i) COMPOUND A inhibits phosphorylation of the Wnt co-receptor LRP6 and induces cell cycle arrest (increased c-MYC and decreased p21); and ii) inhibition of both mutant BRAF and EGFR is required to inhibit the MAPK pathway (decreased pERK) (Fig.5). In vivo treatment of J HOM-2B xenografts with 5 mg/kg COM POU N D A BI D resulted in modest but significant tumor growth inhibition (T/C 48%) (Fig. 6). Treatment with the triple combination of COM POU N D A+COM POU ND B+cet caused regression (T/TO -26%), which although statistically not superior to COM POUN D B+cet, showed a trend toward greater anti-tumor activity (Fig. 6). Treatment with COM POU ND A as a single agent or in combination decreased cell proliferation (Fig. 7) and induced mucinous differentiation of J HOM-2B tumor cells (Fig. 8). The accumulation of mucin in xenografts treated with COM POUN D A (as a single agent or in combination) may affect tumor volume
measurements and lead to an underestimate of anti-tumor activity.
Treatment of HCOX1329 xenografts with 5 mg/kg COM POU N D A BI D did not statistically inhibit tumor growth in vivo (Fig. 9). Strong trends toward combination activity were observed, resulting in tumor stasis in the COM POUN D A+COM POUN D B treatment group (T/TO -12%) and tumor regression in the COM POUN D A+COM POU ND B+cet treatment group (T/TO -36%) (Fig. 9). Anti-tumor combination activity correlated well with decreased tumor cell proliferation (Fig. 10). Accumulation of intracellular mucin, consistent with differentiation, was seen in the COM POU ND A+COM POU ND B and COM POU N D A+COM POU N D B+cet treatment groups (Fig.11).
Review of the genetic profile of HCOX1329 revealed that it is also microsatellite unstable (I HC of the patient's tumor sample at the time of diagnosis was reported as M LH1, negative; PMS2, negative; MSH2, positive; MSH6, positive) and harbors two mutations/variants in ZNRF3 (H537R and E383fs).
Example 3: Phase 1, open-label, dose escalation and dose expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in patients with BRAFV600E- mutant CRC harboring upstream Wnt pathway mutations
Inclusion criteria:
1. Male or female patients > 18 years of age
2. WHO performance status (PS) of 0-2
3. Histologically confirmed diagnosis of colorectal adenocarcinoma that has progressed despite standard therapy or for which no effective standard therapy exists
4. Molecular confirmation that the tumor contains BRAFV600E mutation
• Dose escalation cohorts: No additional molecular pre-selection
• Dose expansion cohort: Additional molecular pre-selection for RNF43 mutations or RSPO fusions
Example 4: Phase lb, open label, multicenter, dose escalation and expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in combination with the BRAF inhibitor COMPOUND B and the EGFR inhibitor cetuximab in patients with BRAFV600E-mutant CRC harboring upstream Wnt pathway mutations Inclusion criteria:
1. Male or female patients > 18 years of age
2. WHO performance status (PS) of 0-2
3. Histologically confirmed diagnosis of colorectal adenocarcinoma that has progressed despite standard therapy or for which no effective standard therapy exists
4. Molecular confirmation that the tumor contains BRAFV600E mutation
• Dose escalation cohorts: No additional molecular pre-selection
• Dose expansion cohort: Additional molecular pre-selection for RNF43 mutations or RSPO fusions
5. Failed prior therapy for unresectable or metastatic BRAFV600E -mutant CRC
• Dose escalation cohorts: Prior treatment with chemotherapy permitted; prior treatment with RAF inhibitors and EGFR monoclonal antibodies permitted.
• Dose expansion cohort: Prior treatment with chemotherapy permitted; prior treatment with RAF inhibitors and EGFR monoclonal antibodies not allowed.
Example 5: Efficacy of a Wnt pathway inhibitor and combinations comprising (i) a Wnt pathway inhibitor, (ii) a BRAF inhibitor, and/or (iii) an EGFR inhibitor in additional patient-derived,
microsatellite-unstable, BRAFV600E, /?/VF43-mutant CRC xenograft models
In vivo studies in two additional patient-derived, microsatellite-unstable, BRAFV600E CRC xenograft models [HCOX1167 (RNF43G659fs; ZNRF3R146H- R246H- R393fs) and HCOX2239 (RNF43A1697- G659fs; ZNRF3L780M)] were performed. In both models statistically significant anti-tumor activity versus vehicle was observed upon treatment with COM POUN D A, COM POU N D A+COM POU ND B, AN D COM POU N D A+COM POUN D B+cetuximab. An in vivo study in a third additional patient-derived, microsatellite-unstable, BRAFV600E CRC xenograft model [HCOX2761 (RNF43G659fs)] showed no statistically significant decrease in tumor volume with any of the treatments.
Example 6: Decreased cell proliferation and mucinous differentiation induced by a Wnt pathway inhibitor and a combination comprising (i) a Wnt pathway inhibitor and (ii) an EGFR inhibitor in a patient-derived microsatellite-unstable, RNF43 and ZNRF3-mutant CRC xenograft model that is wild type for BRAF and KRAS
In vivo efficacy study
T70 is a human primary xenograft model derived from a poorly differentiated colonic adenocarcinoma, which was implanted and passaged in nu/nu mice. T70 is microsatellite unstable, BRAF 7, KRAS 7, and harbors mutations/variants in RNF43 (W200L, E278delE) and ZNRF3 (Q226*,C230fs) (as determined by Haloplex custom cancer panel). Female nu/nu mice were implanted subcutaneously with 100,000 tumor cells containing 50% phenol red-free matrigel (BD Biosciences) in DMEM. For tumor implantation, mice were anesthetized with continuous flow of 1.5-3.5% isoflurane/oxygen mixture using the integrated multi chambers anesthesia center (I MCAC). A 12G trocar was used to take tumor cells with 0.1 ml of the diluted matrigel and implant them subcutaneously into the right axillary region of nude mice, and this was repeated in the left axillary region.
Mice with average tumor volume of 200 mm3 were randomized into 4 experimental groups on day 21 post implantation. Tumors were measured with digital calipers twice a week during active dosing period. Tumor volumes were calculated using the ellipsoid formula: (length x width2)/2. Body weights were recorded twice a week at the time of tumor measurement. After 14 days the dosing of mice harboring T70 xenografts was terminated, and animals euthanized. Plasma and tumors were collected at 7hr post last dose for pharmacokinetic (PK) and pharmacodynamic (PD) analysis.
All data were expressed as mean ± standard error of the mean (SEM). Delta tumor volume and body weight were used for statistical analysis. Between group comparisons were carried out using the Kruskal-Wallis ANOVA followed by a post hoc Dunn's test. For all statistical evaluations, the level of significance was set at p < 0.05. Significance compared to the vehicle control group is reported unless otherwise stated. The standard protocols used in pharmacology studies are not pre-powered to demonstrate statistically significant superiority of a combination over the respective single agent treatment. The statistical power is often limited by potent single agent response and/or model variability.
Immunohistochemistry and Alcian blue staining
IHC and Alcian blue staining was performed as described above.
Image analysis
Image analysis was performed as described above. Results
Treatment of T70 xenografts with 5 mg/kg COMPOUND A BID, 20 mg/kg cetuximab, i.p., 2x/wk, or COMPOUND A+cetuximab did not statistically decrease tumor volume in vivo (Fig. 12). The lack of a statistically significant decrease in tumor volume was due to extensive variability in the growth of this patient-derived xenograft model. However, a marked decrease in cell proliferation was observed upon treatment with COM POUND A or COMPOUND A+cetuximab (Fig. 13). The decrease in cell proliferation was accompanied by mucinous differentiation (Fig. 14). These findings show that COMPOUND A or COMPOUND A+cetuximab can have anti-tumor activity in CRCs with this genetic background. Example 7: Phase 1, open-label, dose escalation and dose expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in patients with
microsatellite-unstable CRC harboring upstream Wnt pathway mutations
Inclusion criteria:
1. Male or female patients > 18 years of age
2. WHO performance status (PS) of 0-2
3. Histologically confirmed diagnosis of colorectal adenocarcinoma that has progressed despite standard therapy or for which no effective standard therapy exists
4. Molecular and/or immunohistochemical confirmation that the tumor is microsatellite unstable
• Dose escalation cohorts: No additional molecular pre-selection
• Dose expansion cohort: Additional molecular pre-selection for RNF43 mutations, RSPO fusions, or other upstream Wnt pathway mutations
Example 8: Phase lb, open label, multicenter, dose escalation and expansion study, to evaluate the safety, pharmacokinetics, and activity of the porcupine inhibitor COMPOUND A in combination with the EGFR inhibitor cetuximab in patients with microsatellite-unstable, BRA ", KRASWT CRC harboring upstream Wnt pathway mutations
Inclusion criteria:
1. Male or female patients > 18 years of age
2. WHO performance status (PS) of 0-2
3. Histologically confirmed diagnosis of colorectal adenocarcinoma that has progressed despite standard therapy or for which no effective standard therapy exists
• Dose escalation cohorts: Prior treatment with chemotherapy permitted; prior treatment with EGFR monoclonal antibodies permitted
• Dose expansion cohort: Prior treatment with chemotherapy permitted; prior treatment with EGFR monoclonal antibodies not allowed
4. Molecular and/or immunohistochemical confirmation that the tumor is microsatellite unstable; and molecular confirmation that the tumor is wild type for BRAF and KRAS
• Dose escalation cohorts: No additional molecular pre-selection
• Dose expansion cohort: Additional molecular pre- selection for RNF43 mutations, RSPO fusions, or other upstream Wnt pathway mutations

Claims

What is claimed is:
1. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer.
2. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to claim 1, wherein the cancer is microsatellite-unstable.
3. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to claim 1 or 2, wherein the cancer is KRAS wild-type.
4. A Wnt inhibitor for use in the treatment of BRAFV600E -mutant colorectal cancer according to any one of claims 1 to 3 in combination with a BRAF inhibitor.
5. A Wnt inhibitor for use in the treatment of microsatellite-unstable, BRAF wild-type and KRAS wild- type colorectal cancer.
6. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 5 in combination with an EGFR inhibitor.
7. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 6, wherein a Wnt pathway in the colorectal cancer is activated compared to a control.
8. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 7, wherein AXIN2 expression in the colorectal cancer is higher compared to a control.
9. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 8, wherein the colorectal cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03.
10. A Wnt inhibitor for use in the treatment of colorectal cancer according to claim 9, wherein the colorectal cancer comprises mutated RNF43.
11. A Wnt inhibitor for use in the treatment of colorectal cancer according to claim 9, wherein the colorectal cancer comprises RSPO fusion.
12. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 8, wherein the colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzled l-10, LRP5, LRP6, WISP3, Wise, SFRP1-3, WI F-1, DKK1, DKK4, LKB1/STK11, Keap-1 and/or N RF2.
13. A Wnt inhibitor for use in the treatment of microsatellite-unstable colorectal cancer according to any one of claims 2 to 12, wherein at least one mismatch repair system gene is inactivated in the colorectal cancer compared to a control.
14. A Wnt inhibitor for use in the treatment of microsatellite-unstable colorectal cancer according to claim 13, wherein the mismatch repair system gene is M LH 1, MSH2, MSH6 or PMS2.
15. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of previous claims, wherein the Wnt inhibitor is the inhibitor of Porcupine or Frizzled.
16. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of previous claims, wherein the Wnt inhibitor is a Porcupine inhibitor.
17. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 4 to 16, wherein the Wnt inhibitor and the inhibitor in the combination are to be administered simultaneously or sequentially.
18. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 4 to 17, wherein the Wnt inhibitor and the inhibitor in the combination are used in the form of a fixed combination.
19. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 18, further comprising at least one pharmaceutically acceptable carrier.
20. A Wnt inhibitor for use in the treatment of colorectal cancer according to any one of claims 1 to 19 in a form of a pharmaceutical composition.
21. A pharmaceutical combination comprising (i) a Wnt inhibitor and (ii) a BRAF inhibitor.
22. The pharmaceutical combination according to claim 21 further comprising an EGFR inhibitor.
23. A pharmaceutical combination comprising a Wnt inhibitor and an EGFR inhibitor.
24. The pharmaceutical combination according to any one of claims 21 to 23, wherein the
pharmaceutical combination comprises the inhibitors separately or together.
25. The pharmaceutical combination according to any one of claims 21 to 24 for simultaneous or sequential use of the inhibitors.
26. The pharmaceutical combination according to any one of claims 21 to 25, further comprising at least one pharmaceutically acceptable carrier.
27. The pharmaceutical combination according to any one of claims 21 to 26 in the form of a fixed combination.
28. The pharmaceutical combination according to any one of claims 21, 22, or 24 to 27, in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the BRAF inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the BRAF inhibitor to be jointly active.
29. The pharmaceutical combination according to any one of claims 21 to 27 in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the BRAF inhibitor and/or EGFR inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the BRAF inhibitor and/or EGFR inhibitor to be jointly active.
30. The pharmaceutical combination according to any one of claims 23 to 27 in the form or a kit of parts for the combined administration, wherein the Wnt inhibitor and the EGFR inhibitor are administered independently at the same time or separately within time intervals, and the time intervals allow the Wnt inhibitor and the EGFR inhibitor to be jointly active.
31. The pharmaceutical combination according to any one of claims 21 to 30, wherein the inhibitors are in a quantity which is jointly therapeutically effective for the treatment of cancer.
32. The pharmaceutical combination according to any one of claims 21 to 30 for use in the treatment of cancer.
33. The pharmaceutical combination according to claims 31 or 32, wherein the cancer is colorectal cancer.
34. The pharmaceutical combination according to any one of claims 31 to 33, wherein the cancer is microsatellite-unstable.
35. The pharmaceutical combination according to any one of claims 33 or 34, wherein the cancer is KRAS wild-type.
36. The pharmaceutical combination according to any one of claims 31 or 35, wherein the cancer is BRAFV600E-mutant colorectal cancer.
37. The pharmaceutical combination according to any one of claims 33 or 35, wherein the cancer is BRAF wild-type.
38. The pharmaceutical combination according to any one of claims 31 to 35 or 37, wherein the cancer is microsatellite-unstable, BRAF wild-type and KRAS wild-type colorectal cancer.
39. The pharmaceutical combination according to any one of claims 33 to 38, wherein a Wnt pathway in the colorectal cancer is activated compared to a control.
40. The pharmaceutical combination according to any one of claims 33 to 39, wherein AXIN2 expression in the colorectal cancer is higher compared to a control.
41. The pharmaceutical combination according to any one of claims 33 to 40, wherein the colorectal cancer comprises mutated RNF43, mutated RSP02 or mutated RSP03.
42. The pharmaceutical combination according to any one of claims 33 to 41, wherein the colorectal cancer comprises mutated RNF43.
43. The pharmaceutical combination according to any one of claims 33 to 41, wherein the colorectal cancer comprises RSPO fusion.
44. The pharmaceutical combination according to any one of claims 33 to 43, wherein the colorectal cancer comprises mutated ZN RF3, RSPOl, RSP04, LGR4-6, Frizzledl-10, LRP5, LRP6, WISP3, Wise, SFRP1- 3, WI F-1, DKK1, DKK4, LKB1/STK11, Keap-1 and/or N RF2.
45. The pharmaceutical combination for use in the treatment of microsatellite-unstable colorectal cancer according to any one of claims 34 to 44, wherein at least one mismatch repair system gene is inactivated in the colorectal cancer compared to a control.
46. The pharmaceutical combination for use in the treatment of microsatellite-unstable colorectal cancer according to claim 45, wherein the mismatch repair system gene is MLHl, MSH2, MSH6 or PMS2.
47. The pharmaceutical combination according to any one of claims 21 to 46, wherein the Wnt inhibitor is an inhibitor of Porcupine or Frizzled.
48. The pharmaceutical combination according to any one of claims 21 to 47, wherein the Wnt inhibitor is the inhibitor of Porcupine.
PCT/IB2015/052245 2014-03-27 2015-03-26 Methods of treating colorectal cancers harboring upstream wnt pathway mutations Ceased WO2015145388A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201461971162P 2014-03-27 2014-03-27
US61/971,162 2014-03-27
US201562119939P 2015-02-24 2015-02-24
US62/119,939 2015-02-24

Publications (2)

Publication Number Publication Date
WO2015145388A2 true WO2015145388A2 (en) 2015-10-01
WO2015145388A3 WO2015145388A3 (en) 2016-01-28

Family

ID=52815064

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2015/052245 Ceased WO2015145388A2 (en) 2014-03-27 2015-03-26 Methods of treating colorectal cancers harboring upstream wnt pathway mutations

Country Status (2)

Country Link
TW (1) TW201620548A (en)
WO (1) WO2015145388A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017221142A1 (en) * 2016-06-22 2017-12-28 Novartis Ag Wnt inhibitors for use in the treatment of fibrosis
WO2019245460A1 (en) * 2018-06-21 2019-12-26 National University Of Singapore Stratifying cancer patients harbouring oncogenic mutations in the e3 ubiquitin ligase rnf43

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113307882B (en) * 2021-05-12 2022-12-20 东北大学 Fusion protein SZ1 and its conjugated nanomedicine for targeted therapy of colorectal cancer caused by Rspo overactivation

Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0520722A1 (en) 1991-06-28 1992-12-30 Zeneca Limited Therapeutic preparations containing quinazoline derivatives
EP0564409A1 (en) 1992-04-03 1993-10-06 Ciba-Geigy Ag Pyrimidin derivatives and process for their preparation
EP0566226A1 (en) 1992-01-20 1993-10-20 Zeneca Limited Quinazoline derivatives
WO1995003283A1 (en) 1993-07-19 1995-02-02 Zeneca Limited Quinazoline derivatives and their use as anti-cancer agents
WO1996030347A1 (en) 1995-03-30 1996-10-03 Pfizer Inc. Quinazoline derivatives
WO1996033980A1 (en) 1995-04-27 1996-10-31 Zeneca Limited Quinazoline derivatives
WO1997002266A1 (en) 1995-07-06 1997-01-23 Novartis Ag Pyrrolopyrimidines and processes for the preparation thereof
EP0787722A1 (en) 1996-02-05 1997-08-06 American Cyanamid Company Substituted quinazoline derivatives
WO1997030034A1 (en) 1996-02-14 1997-08-21 Zeneca Limited Quinazoline derivatives as antitumor agents
WO1997038983A1 (en) 1996-04-12 1997-10-23 Warner-Lambert Company Irreversible inhibitors of tyrosine kinases
WO1997049688A1 (en) 1996-06-24 1997-12-31 Pfizer Inc. Phenylamino-substituted tricyclic derivatives for treatment of hyperproliferative diseases
WO1998010767A2 (en) 1996-09-13 1998-03-19 Sugen, Inc. Use of quinazoline derivatives for the manufacture of a medicament in the treatment of hyperproliferative skin disorders
EP0837063A1 (en) 1996-10-17 1998-04-22 Pfizer Inc. 4-Aminoquinazoline derivatives
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
WO1999003854A1 (en) 1997-07-18 1999-01-28 Novartis Ag Crystal modification of a n-phenyl-2-pyrimidineamine derivative, processes for its manufacture and its use
WO2003013541A1 (en) 2001-08-07 2003-02-20 Novartis Ag 4-amino-6-phenyl-pyrrolo[2,3-d]pyrimidine derivatives
WO2010101849A1 (en) 2009-03-02 2010-09-10 Irm Llc N- (hetero)aryl, 2- (hetero)aryl-substituted acetamides for use as wnt signaling modulators
WO2011025927A1 (en) 2009-08-28 2011-03-03 Irm Llc Compounds and compositions as protein kinase inhibitors
WO2013184757A1 (en) 2012-06-06 2013-12-12 Irm Llc Compounds and compositions for modulating egfr activity

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120059021A1 (en) * 2008-11-11 2012-03-08 University Of Washington Compositions and methods for treating cancer and methods for predicting a response to such treatments
US20150132301A1 (en) * 2011-12-09 2015-05-14 Oncomed Pharmaceuticals, Inc. Combination Therapy for Treatment of Cancer
AU2013226323B2 (en) * 2012-02-28 2016-07-14 Irm Llc Cancer patient selection for administration of Wnt signaling inhibitors using RNF43 mutation status
JP6342396B2 (en) * 2012-08-07 2018-06-13 ノバルティス アーゲー Combination medicine comprising B-Raf inhibitor, EGFR inhibitor and optionally PI3K-α inhibitor

Patent Citations (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0520722A1 (en) 1991-06-28 1992-12-30 Zeneca Limited Therapeutic preparations containing quinazoline derivatives
EP0566226A1 (en) 1992-01-20 1993-10-20 Zeneca Limited Quinazoline derivatives
EP0564409A1 (en) 1992-04-03 1993-10-06 Ciba-Geigy Ag Pyrimidin derivatives and process for their preparation
WO1995003283A1 (en) 1993-07-19 1995-02-02 Zeneca Limited Quinazoline derivatives and their use as anti-cancer agents
WO1996030347A1 (en) 1995-03-30 1996-10-03 Pfizer Inc. Quinazoline derivatives
WO1996033980A1 (en) 1995-04-27 1996-10-31 Zeneca Limited Quinazoline derivatives
WO1997002266A1 (en) 1995-07-06 1997-01-23 Novartis Ag Pyrrolopyrimidines and processes for the preparation thereof
EP0787722A1 (en) 1996-02-05 1997-08-06 American Cyanamid Company Substituted quinazoline derivatives
WO1997030034A1 (en) 1996-02-14 1997-08-21 Zeneca Limited Quinazoline derivatives as antitumor agents
WO1997038983A1 (en) 1996-04-12 1997-10-23 Warner-Lambert Company Irreversible inhibitors of tyrosine kinases
US5747498A (en) 1996-05-28 1998-05-05 Pfizer Inc. Alkynyl and azido-substituted 4-anilinoquinazolines
WO1997049688A1 (en) 1996-06-24 1997-12-31 Pfizer Inc. Phenylamino-substituted tricyclic derivatives for treatment of hyperproliferative diseases
WO1998010767A2 (en) 1996-09-13 1998-03-19 Sugen, Inc. Use of quinazoline derivatives for the manufacture of a medicament in the treatment of hyperproliferative skin disorders
EP0837063A1 (en) 1996-10-17 1998-04-22 Pfizer Inc. 4-Aminoquinazoline derivatives
WO1999003854A1 (en) 1997-07-18 1999-01-28 Novartis Ag Crystal modification of a n-phenyl-2-pyrimidineamine derivative, processes for its manufacture and its use
WO2003013541A1 (en) 2001-08-07 2003-02-20 Novartis Ag 4-amino-6-phenyl-pyrrolo[2,3-d]pyrimidine derivatives
WO2010101849A1 (en) 2009-03-02 2010-09-10 Irm Llc N- (hetero)aryl, 2- (hetero)aryl-substituted acetamides for use as wnt signaling modulators
WO2011025927A1 (en) 2009-08-28 2011-03-03 Irm Llc Compounds and compositions as protein kinase inhibitors
WO2013184757A1 (en) 2012-06-06 2013-12-12 Irm Llc Compounds and compositions for modulating egfr activity

Non-Patent Citations (41)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING COMPANY, pages: 1418
"Remington's Pharmaceutical Sciences", 1990, MACK PRINTING COMPANY, pages: 1289 - 1329
BARRETINA, J. ET AL., NATURE, vol. 492, 2012, pages 603 - 7
BETTINGTON, M. ET AL., HISTOPATHOL, vol. 62, 2013, pages 367 - 86
CHEN ET AL., J CELL BIOL, vol. 152, 2001, pages 87 - 96
CHEN, P-H. ET AL., GENES DEV., vol. 27, 2013, pages 1345 - 50
CORCORAN, R.B. ET AL., J. CLIN. ONCOL., 2012, pages 3528
COX ET AL., GENETICS, pages 155
COX ET AL., GENETICS, vol. 155, 2000, pages 1725 - 1740
FEARON, E.R., ANNU. REV. PATHOL. MECH. DIS., vol. 6, 2011, pages 479 - 507
HAO, H.X. ET AL., NATURE, vol. 485, 2012, pages 195 - 200
HE, T.C. ET AL., SCIENCE, vol. 281, 1998, pages 1509 - 12
JIN, L.H. ET AL., INT. J. CANCER, vol. 107, 2003, pages 696 - 99
JOURNAL OF PHARMACEUTICAL SCIENCE, vol. 66, 1977, pages 2
KOO, B.K. ET AL., NATURE, vol. 488, 2012, pages 665 - 9
KOPETZ, S. ET AL., J. CLIN. ONCOL., vol. 27, 2009, pages 3677 - 82
KOPETZ, S. ET AL., J. CLIN. ONCOL., vol. 28, 2010, pages 3534
KORINEK, V. ET AL., SCIENCE, vol. 275, 1997, pages 1784 - 7
LIU, W. ET AL., NOT. GENET., vol. 26, 2000, pages 146 - 7
LOANNIDIS ET AL., NAT IMMUNOL, vol. 2, 2001, pages 691 - 697
LUBOMIERSKI, N. ET AL., CANCER, vol. 104, 2005, pages 952 - 61
MORIN, P.J. ET AL., SCIENCE, vol. 275, 1997, pages 1787 - 90
ONG, C.K. ET AL., NATURE GENET., vol. 44, 2012, pages 690 - 3
ORFORD ET AL., J CELL BIOL, vol. 146, 1999, pages 855 - 868
POLAKIS ET AL., GENES DEV, vol. 14, 2000, pages 1837 - 1851
POLAKIS, P., CURR. BIOL., vol. 12, 2002, pages R499 - R501
POWELL, S.M. ET AL., NATURE, vol. 359, 1992, pages 235 - 7
PRAHALLAD, A. ET AL., NATURE, vol. 483, 2012, pages 100 - 3
RAD, R. ET AL., CANCER CELL, vol. 24, 2013, pages 15 - 29
REYA ET AL., IMMUNITY, vol. 13, 2000, pages 15 - 24
RUBINFELD, B. ET AL., SCIENCE, vol. 275, 1997, pages 1790 - 2
RYLAND, G.L. ET AL., J. PATHOL., vol. 229, 2013, pages 469 - 76
SATOH ET AL., NAT GENET, vol. 24, 2000, pages 245 - 250
SCHOLER-DAHIREL, A. ET AL., PROC. NATL. ACAD. SCI., vol. 108, 2011, pages 17135 - 40
SESHAGIRI, S. ET AL., NATURE, vol. 488, 2012, pages 660 - 4
SHEN, J.P ET AL., J. CLIN. ONCOL., 2012, pages 397
SHIN ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 274, 1999, pages 2780 - 2785
TETSU, O.; MCCORMICK, F, NATURE, vol. 398, 1999, pages 422 - 6
WU, J. ET AL., PROC. NATL. ACAD. SCI., vol. 108, 2011, pages 21188 - 93
XIE, Y ET AL., EMBO REP., vol. 14, 2013, pages 1120 - 6
ZEBISCH, M. ET AL., NATURE COM., vol. 4, 2013, pages 1 - 12

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017221142A1 (en) * 2016-06-22 2017-12-28 Novartis Ag Wnt inhibitors for use in the treatment of fibrosis
CN109415342A (en) * 2016-06-22 2019-03-01 诺华股份有限公司 For treating the WNT inhibitor of fibrosis
AU2017281980B2 (en) * 2016-06-22 2020-05-21 Novartis Ag Wnt inhibitors for use in the treatment of fibrosis
WO2019245460A1 (en) * 2018-06-21 2019-12-26 National University Of Singapore Stratifying cancer patients harbouring oncogenic mutations in the e3 ubiquitin ligase rnf43

Also Published As

Publication number Publication date
TW201620548A (en) 2016-06-16
WO2015145388A3 (en) 2016-01-28

Similar Documents

Publication Publication Date Title
AU2019202674B2 (en) Combination therapy for the treatment of cancer
JP6742391B2 (en) Combination therapy
JP7427212B2 (en) Methods and compositions for treating non-ERK MAPK pathway inhibitor-resistant cancers
CN117561057A (en) Treating cancer with RAF inhibitors
US20040106605A1 (en) Synergistic methods and compositions for treating cancer
US20220280523A1 (en) Combination of pi3k inhibitor and c-met inhibitor
AU2016314082A1 (en) Mdm2 inhibitors and combinations thereof
WO2012068487A1 (en) Preselection of subjects for therapeutic treatment with oxygen sensitive agents based on hypoxic status
TW202332431A (en) Methods and dosing regimens comprising a cdk2 inhibitor and a cdk4 inhibitor for treating cancer
KR20120096869A (en) Combination of a pbospboinositkle 3-kinase inhibitor and an antidiabetic compound
WO2018092064A1 (en) Combinations of mdm2 inhibitors and bcl-xl inhibitors
WO2014191938A1 (en) Combination therapy containing a pi3k-alpha inhibitor and fgfr kinase inhibitor for treating cancer
TW201620548A (en) Methods of treating colorectal cancers harboring upstream Wnt pathway mutations
Azanza et al. Comparative pharmacology of tyrosine kinase inhibitors for the treatment of chronic myeloid leukemia
WO2023049363A1 (en) Sotorasib and afatinib for treating cancer comprising a kras g12c mutation
RU2774612C2 (en) Therapeutic combinations containing raf inhibitor and erk inhibitor
WO2025103408A1 (en) Method for treating alk-positive or ros1-positive non-small cell lung cancer
TW202532065A (en) Combination therapies for treatment of breast cancer
HK40102675A (en) Sotorasib dosing regimen
HK1214135B (en) Combination therapy comprising a b-raf inhibitor and a second inhibitor
EA040191B1 (en) COMBINATION THERAPY
NZ622155A (en) Method of treating gastrointestinal stromal tumors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15714960

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15714960

Country of ref document: EP

Kind code of ref document: A2