WO2015130931A1

WO2015130931A1 - Root specific expression conferred by chimeric gene regulatory elements

Info

Publication number: WO2015130931A1
Application number: PCT/US2015/017749
Authority: WO
Inventors: Patricia Ann Owens Merlo; Ronnie HAMPTON JR.; Cory LARSEN; Aaron Woosley
Original assignee: Dow Agrosciences Llc
Priority date: 2014-02-28
Filing date: 2015-02-26
Publication date: 2015-09-03
Also published as: RU2016138290A3; CN106062202B; IL247236A0; UY36013A; KR20160125506A; CN106062202A; AR099601A1; CL2016002145A1; US20150247155A1; BR102015004282A2; AU2015222996A1; EP3110955A4; CA2939112A1; MX2016011175A; BR102015004282A8; JP2017506516A; RU2016138290A; BR102015004282B1; PH12016501692A1; US9909133B2

Abstract

Provided are constructs and methods for expressing a trans gene in plant cells and/or plant tissues using chimeric gene regulatory elements. Specifically, a construct includes a gene expression cassette comprising a chimeric polynucleotide sequence comprising an upstream-promoter polynucleotide sequence that was obtained from Zea mays Peroxidase 5 and followed by the Zea mays alcohol dehydrogenase (I) intron 6 and Maize Streak Virus 5' -UTR. The resulting promoter sequence comprises a chimeric gene regulatory element. Further disclosed are methods of growing plants expressing a trans gene using the chimeric gene promoter regulatory element.

Description

ROOT SPECIFIC EXPRESSION CONFERRED BY CHIMERIC GENE REGULATORY

ELEMENTS

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit under 35 USC § 119(e) of U.S. Provisional Application

Serial No. 61/946,066, filed on February 28, 2014, which is expressly incorporated herein by reference.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

The official copy of the sequence listing is submitted electronically via EFS-Web as an

ASCII formatted sequence listed with a filed named "68242_ST25.txt", created on February 26, 2015, and having a size of 49.7 kilobytes and is filed concurrently with the specification. The sequence listing contained in the ASCII formatted document is part of the specification and is herein incorporated by reference in its entirety.

FIELD OF THE INVENTION

This invention is generally related to the field of plant molecular biology, and more specifically, to the field of expression of transgenes in plants.

BACKGROUND

Many plant species are capable of being transformed with transgenes to introduce agronomically desirable traits or characteristics. Plant species are developed and/or modified to have particular desirable traits. Generally, desirable traits include, for example, improving nutritional value quality, increasing yield, conferring pest or disease resistance, increasing drought and stress tolerance, improving horticultural qualities (e.g., pigmentation and growth), imparting herbicide resistance, enabling the production of industrially useful compounds and/or materials from the plant, and/or enabling the production of pharmaceuticals.

Transgenic plant species comprising multiple transgenes stacked at a single genomic locus are produced via plant transformation technologies. Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant that contains the stably integrated copy of the transgene in the plant genome, and subsequent transgene expression via transcription and translation of the plant genome resulting in transgenic plants that possess desirable traits and phenotypes. However, mechanisms that allow the production of transgenic plant species to highly express multiple transgenes engineered as a trait stack are desirable. Likewise, mechanisms that allow the expression of a transgene within particular tissues or organs of a plant are desirable. For example, increased resistance of a plant to infection by soil- borne pathogens might be accomplished by transforming the plant genome with a pathogen- resistance gene such that pathogen-resistance protein is robustly expressed within the roots of the plant. Alternatively, it may be desirable to express a transgene in plant tissues that are in a particular growth or developmental phase such as, for example, cell division or elongation.

Described herein are chimeric promoter regulatory elements (e.g., promoter sequences comprising upstream promoters, introns, and 5' -UTRs). Further described are constructs and methods utilizing chimeric promoter regulatory elements.

SUMMARY

Disclosed herein are constructs and methods for expressing a transgene in plant cells and/or plant tissues. In an embodiment, a construct includes a gene expression cassette comprising a chimeric polynucleotide sequence comprising an upstream-promoter polynucleotide sequence that was obtained from Zea mays Peroxidase 5 and followed by the Zea mays alcohol dehydrogenase (I) intron 6 and Maize Streak Virus 5' -UTR. The resulting chimeric promoter sequence comprises a novel chimeric gene regulatory element.

In an embodiment, a gene expression cassette includes a chimeric gene promoter regulatory element operably linked to a transgene or a heterologous coding sequence. In an embodiment, a gene expression cassette includes at least one, two, three, four, five, six, seven, eight, nine, ten, or more transgenes.

Methods of growing plants expressing a transgene using a chimeric gene promoter regulatory element (e.g., upstream-promoter, intron, and 5' -UTR) are disclosed herein. Methods of culturing plant tissues and cells expressing a transgene using the chimeric gene promoter regulatory element are also disclosed herein. In an embodiment, methods as disclosed herein include tissue- specific gene expression in plant roots. Methods of isolating a polynucleotide sequence comprising the chimeric gene promoter regulatory element are also disclosed herein.

In an embodiment, the subject disclosure relates to a gene expression cassette comprising a promoter operably linked to a transgene, wherein the promoter comprises a polynucleotide that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: l. In an subsequent aspect of the embodiment, the polynucleotide has at least 90% sequence identity to SEQ ID NO: l. In other aspects, the operably linked transgene encodes a polypeptide or a small RNA. In yet further aspects, the transgene is selected from the group consisting of an insecticidal resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, and a selectable marker transgene. In an aspect, the embodiment relates to a gene expression cassette comprising a 3'- untranslated region. In an embodiment, the subject disclosure relates to a recombinant vector comprising the gene expression cassette. In an aspect of the embodiment, the vector is selected from the group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. In other embodiments, the subject disclosure relates to a transgenic cell comprising the gene expression cassette. In another embodiment, the transgenic cell is a transgenic plant cell. In a further embodiment, the subject disclosure relates to a transgenic plant comprising the transgenic plant cell. In an aspect of the embodiment, the transgenic plant is a monocotyledonous or a dicotyledonous plant. In other aspects, the monocotyledonous plant is selected from the group consisting of a maize plant, a rice plant, and a wheat plant. In a further embodiment, the disclosure relates to a transgenic seed from the transgenic plant. In another embodiment, the promoter is a tissue-preferred promoter. In a subsequent embodiment, the tissue-preferred promoter is a root tissue-preferred promoter.

In an embodiment, the subject disclosure relates to a transgenic cell comprising a synthetic polynucleotide that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: l. In an aspect of the embodiment, the polynucleotide has at least 90% sequence identity to SEQ ID NO: l. In a further aspect of the embodiment, the transgenic cell is a transgenic plant cell. In another aspect, the transgenic plant cell is produced by a plant transformation method. In other aspects, the plant transformation method is selected from the group consisting of an Agwbacterium-mediated transformation method, a biolistics transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. In a further embodiment, the subject disclosure relates to a transgenic plant comprising the transgenic plant cell. In an aspect of the embodiment, the transgenic plant is a monocotyledonous or a dicotyledonous plant. In other aspects, the monocotyledonous plant is selected from the group consisting of a maize plant, a rice plant, and a wheat plant. In further embodiments, the subject disclosure relates to a transgenic seed from the transgenic plant. In an additional embodiment, the promoter is a tissue-preferred promoter. In further embodiments, the tissue-preferred promoter is a root tissue-preferred promoter.

In an embodiment, the subject disclosure relates to a chimeric polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: l. In another aspect of the embodiment, the polynucleotide has at least 90% sequence identity to SEQ ID NO: l. In a further aspect, the chimeric polynucleotide sequence is operably linked to a transgene. In another aspect, the operably linked transgene encodes a polypeptide or small RNA. In an aspect, the chimeric polynucleotide sequence is operably linked to the transgene. In further aspects, the transgene is selected from the group consisting of an insecticidal resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, and a selectable marker transgene. In an additional embodiment, the subject disclosure relates to a recombinant vector comprising the gene expression cassette. Further aspects include wherein the vector is selected from the group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. In an embodiment, the subject disclosure relates to a transgenic cell comprising the gene expression cassette. In other aspects the transgenic cell is a transgenic plant cell. In an embodiment, the subject disclosure relates to a transgenic plant comprising the transgenic plant cell. An additional aspect includes, where the transgenic plant is a monocotyledonous plant. Further aspects include, where the monocotyledonous plant is selected from the group consisting of a maize plant, a wheat plant, and a rice plant. In an embodiment, the subject disclosure relates to a transgenic seed from the transgenic plant. In a further aspect of the embodiment, the chimeric polynucleotide sequence promotes root-preferred expression of a transgene.

In an embodiment, the subject disclosure relates to a method for expressing a

heterologous coding sequence in a transgenic plant, the method comprising:

transforming a plant cell with a gene expression cassette comprising a polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: 1 operably linked to the heterologous coding sequence, which is operably linked to a 3'- untranslated region;

isolating the transformed plant cell comprising the gene expression cassette;

regenerating the transformed plant cell into a transgenic plant; and,

obtaining the transgenic plant, wherein the transgenic plant comprises the gene expression cassette comprising the polynucleotide sequence comprising SEQ ID NO: l. In an aspect of the embodiment, the heterologous coding sequence is selected from the group consisting of an insecticidal resistance coding sequence, a herbicide tolerance coding sequence, a nitrogen use efficiency coding sequence, a water use efficiency coding sequence, a nutritional quality coding sequence, a DNA binding coding sequence, and a selectable marker coding sequence. In other aspects, the transforming of a plant cell is a plant transformation method. In subsequent aspects, the plant transformation method is selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistics transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome

transformation method. In other aspects, the transgenic plant is a monocotyledonous or dicotyledonous transgenic plant. Further aspects include wherein the monocotyledonous transgenic plant is selected from the group consisting of a maize plant, a wheat plant, and a rice plant. In an embodiment, the subject disclosure relates to a transgenic seed from the transgenic plant. In additional aspects, the heterologous coding sequence is expressed in a transgenic plant tissue. In subsequent aspects, the transgenic plant tissue is a transgenic plant root tissue.

In an embodiment, the subject disclosure relates to a method for isolating a

polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l, the method comprising:

identifying the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: 1;

producing a plurality of oligonucleotide primer sequences, wherein the oligonucleotide primer sequences bind to the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l;

amplifying the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: lfrom a DNA sample with oligonucleotide primer sequences selected from the plurality of oligonucleotide primer sequences; and,

isolating the polynucleotide sequence comprising a sequence identity of at least 90% to

SEQ ID NO: 1.

In another aspect of the embodiment, the isolated polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: 1 is operably linked to a transgene. In a subsequent aspect of the embodiment the operably linked transgene encodes a polypeptide or a small RNA.

The following numbered embodiments are contemplated and are non-limiting:

1. A gene expression cassette comprising a promoter operably linked to a transgene, wherein the promoter comprises a polynucleotide that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: 1.

2. The gene expression cassette of clause 1, wherein the polynucleotide has at least 90% sequence identity to SEQ ID NO: l. 3. The gene expression cassette of clause 1, wherein the operably linked transgene encodes a polypeptide or a small RNA.

4. The gene expression cassette of clause 1, wherein the transgene is selected from the group consisting of an insecticidal resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, and a selectable marker transgene.

5. The gene expression cassette of clause 1 further comprising a 3'- untranslated region.

6. A recombinant vector comprising the gene expression cassette of clause 1. 7. The recombinant vector of clause 6, wherein the vector is selected from the group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage.

8. A transgenic cell comprising the gene expression cassette of clause 1.

9. The transgenic cell of clause 8, wherein the transgenic cell is a transgenic plant cell.

10. A transgenic plant comprising the transgenic plant cell of clause 9.

11. The transgenic plant of clause 10, wherein the transgenic plant is a monocotyledonous or a dicotyledonous plant.

12. The transgenic plant of clause 11, wherein the monocotyledonous plant is selected from the group consisting of a maize plant, a rice plant, and a wheat plant.

13. A transgenic seed from the transgenic plant of clause 10.

14. The gene expression cassette of clause 1, wherein the promoter is a tissue- preferred promoter.

15. The gene expression cassette of clause 1, wherein the tissue-preferred promoter is a root tissue-preferred promoter.

16. A transgenic cell comprising a synthetic polynucleotide that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: l.

17. The transgenic cell of clause 16, wherein the synthetic polynucleotide has at least 90% sequence identity to SEQ ID NO: 1.

18. The transgenic cell of clause 16, wherein the transgenic cell is a transgenic plant cell.

19. The transgenic cell of clause 18, wherein the transgenic plant cell is produced by a plant transformation method. 20. The transgenic cell of clause 19, wherein the plant transformation method is selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistics transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method.

21. A transgenic plant comprising the transgenic plant cell of clause 18.

22. The transgenic plant of clause 21, wherein the transgenic plant is a monocotyledonous or a dicotyledonous plant.

23. The transgenic plant of clause 22, wherein the monocotyledonous plant is selected from the group consisting of a maize plant, a rice plant, and a wheat plant.

24. A transgenic seed from the transgenic plant of clause 21.

25. The transgenic cell of clause 16, wherein the promoter is a tissue-preferred promoter.

26. The transgenic cell of clause 16, wherein the tissue-preferred promoter is a root tissue-preferred promoter.

27. A chimeric polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: 1.

28. The chimeric polynucleotide sequence of clause 27, wherein the polynucleotide has at least 90% sequence identity to SEQ ID NO: l.

29. The chimeric polynucleotide sequence of clause 27, wherein the chimeric polynucleotide sequence is operably linked to a transgene.

30. The operably linked transgene of clause 29, wherein the operably linked transgene encodes a polypeptide or small RNA.

31. A gene expression cassette comprising the chimeric polynucleotide sequence operably linked to the transgene of clause 27.

32. The gene expression cassette of clause 31, wherein the transgene is selected from the group consisting of an insecticidal resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, and a selectable marker transgene.

33. A recombinant vector comprising the gene expression cassette of clause

31.

34. The recombinant vector of clause 33, wherein the vector is selected from the group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. 35. A transgenic cell comprising the gene expression cassette of clause 31.

36. The transgenic cell of clause 35, wherein the transgenic cell is a transgenic plant cell.

37. A transgenic plant comprising the transgenic plant cell of clause 36.

38. The transgenic plant of clause 37, wherein the transgenic plant is a monocotyledonous plant.

39. The transgenic plant of clause 38, wherein the monocotyledonous plant is selected from the group consisting of a maize plant, a wheat plant, and a rice plant.

40. A transgenic seed from the transgenic plant of clause 37.

41. The chimeric polynucleotide sequence of clause 27, wherein the chimeric polynucleotide sequence promotes root-preferred expression of a transgene.

42. A method for expressing a heterologous coding sequence in a transgenic plant, the method comprising:

a) transforming a plant cell with a gene expression cassette, wherein the gene expression cassette comprises a polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l operably linked to the heterologous coding sequence, which is operably linked to a 3'- untranslated region;

b) isolating the transformed plant cell comprising the gene expression cassette;

c) regenerating the transformed plant cell into a transgenic plant; and, d) obtaining the transgenic plant, wherein the transgenic plant comprises the gene expression cassette comprising the polynucleotide sequence comprising SEQ ID NO: l.

43. The method of clause 42, wherein the heterologous coding sequence is selected from the group consisting of an insecticidal resistance coding sequence, a herbicide tolerance coding sequence, a nitrogen use efficiency coding sequence, a water use efficiency coding sequence, a nutritional quality coding sequence, a DNA binding coding sequence, and a selectable marker coding sequence.

44. The method of clause 42, wherein transforming a plant cell is a plant transformation method.

45. The method of clause 44, wherein the plant transformation method is selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistics transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. 46. The method of clause 42, wherein the transgenic plant is a monocotyledonous or dicotyledonous transgenic plant.

47. The method of clause 46, wherein the monocotyledonous transgenic plant is selected from the group consisting of a maize plant, a wheat plant, and a rice plant.

48. A transgenic seed from the transgenic plant of clause 42.

49. The method of clause 42, wherein the heterologous coding sequence is expressed in a transgenic plant tissue.

50. The method of clause 42, wherein the transgenic plant tissue is a transgenic plant root tissue.

51. A method for isolating a polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l, the method comprising:

a) identifying the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l;

b) producing a plurality of oligonucleotide primer sequences, wherein the oligonucleotide primer sequences bind to the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: l;

c) amplifying the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: lfrom a DNA sample with oligonucleotide primer sequences selected from the plurality of oligonucleotide primer sequences; and,

d) isolating the polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: 1.

52. The method of clause 51, wherein the isolated polynucleotide sequence comprising a sequence identity of at least 90% to SEQ ID NO: 1 is operably linked to a transgene.

53. The method of clause 52, wherein the operably linked transgene encodes a polypeptide or a small RNA.

DETAILED DESCRIPTION

Definitions

As used herein, the articles, "a", "an", and "the" include plural references unless the context clearly and unambiguously dictates otherwise. As used herein, the term"backcrossing" refers to a process in which a breeder crosses hybrid progeny back to one of the parents, for example, a first generation hybrid Fl with one of the parental genotypes of the Fl hybrid.

As used herein, the term "intron" refers to any nucleic acid sequence comprised in a gene (or expressed nucleotide sequence of interest) that is transcribed but not translated. Introns include untranslated nucleic acid sequence within an expressed sequence of DNA, as well as corresponding sequence in RNA molecules transcribed therefrom.

A construct described herein can also contain sequences that enhance translation and/or mRNA stability such as introns. An example of one such intron is the first intron of gene II of the histone variant of Arabidopsis thaliana or any other commonly known intron sequence. Introns can be used in combination with a promoter sequence to enhance translation and/or mRNA stability.

As used herein, the terms "5' untranslated region" or "5'-UTR" refer to an untranslated segment in the 5' terminus of pre-mRNAs or mature mRNAs. For example, on mature mRNAs, a 5'-UTR typically harbors on its 5' end a 7-methylguanosine cap and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5' end of the mRNA by the translational machinery, and protection of the mRNAs against degradation.

As used herein, the term "3' untranslated region" or "3'-UTR" refers to an untranslated segment in a 3' terminus of the pre-mRNAs or mature mRNAs. For example, on mature mRNAs this region harbors the poly- (A) tail and is known to have many roles in mRNA stability, translation initiation, and mRNA export.

As used herein, the term "polyadenylation signal" refers to a nucleic acid sequence present in mRNA transcripts that allows for termination of transcripts, when in the presence of a poly- (A) polymerase, to be polyadenylated on the polyadenylation site, for example, located 10 to 30 bases downstream of the poly-(A) signal. Many polyadenylation signals are known in the art and are useful for the present invention. An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., et al., (2005) Plant Physiology 138(3); 1457-1468.

As used herein, the term "isolated" refers to a biological component (including a nucleic acid or protein) that has been separated from other biological components in the cell of the organism in which the component naturally occurs (i.e., other chromosomal and extra- chromosomal DNA).

As used herein, the term "purified" in reference to nucleic acid molecules does not require absolute purity (such as a homogeneous preparation); instead, it represents an indication that the sequence is relatively more pure than in its native cellular environment (compared to the natural level this level should be at least 2-5 fold greater, e.g., in terms of concentration or gene expression levels). The DNA molecules obtained directly from total DNA or from total RNA. In addition, cDNA clones are not naturally occurring, but rather are preferably obtained via manipulation of a partially purified, naturally occurring substance (messenger RNA). The construction of a cDNA library from mRNA involves the creation of a synthetic substance (cDNA). Individual cDNA clones can be purified from the synthetic library by clonal selection of the cells carrying the cDNA library. Thus, the process which includes the construction of a cDNA library from mRNA and purification of distinct cDNA clones yields an approximately 10⁶-fold purification of the native message. Likewise, a promoter DNA sequence could be cloned into a plasmid. Such a clone is not naturally occurring, but rather is preferably obtained via manipulation of a partially purified, naturally occurring substance such as a genomic DNA library. Thus, purification of at least one order of magnitude, preferably two or three orders, and more preferably four or five orders of magnitude is favored in these techniques.

Similarly, purification represents an indication that a chemical or functional change in the component DNA sequence has occurred. Nucleic acid molecules and proteins that have been "purified" include nucleic acid molecules and proteins purified by standard purification methods. The term "purified" also embraces nucleic acids and proteins prepared by recombinant DNA methods in a host cell (e.g. , plant cells), as well as chemically-synthesized nucleic acid molecules, proteins, and peptides.

The term "recombinant" means a cell or organism in which genetic recombination has occurred. It also includes a molecule (e.g. , a vector, plasmid, nucleic acid, polypeptide, or a small RNA) that has been artificially or synthetically (i.e. , non-naturally) altered by human intervention. The alteration can be performed on the molecule within, or removed from, its natural environment or state.

As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed into mRNA (including small RNA molecules) and/or the process by which the transcribed mRNA (also referred to as "transcript") is subsequently translated into peptides, polypeptides, or proteins. Gene expression can be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression.

Expression of a gene can also be regulated anywhere in the pathway from DNA to RNA to protein.

Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression can be measured at the RNA level or the protein level by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay(s).

As used herein, the terms "homology-based gene silencing" or "HBGS" are generic terms that include both transcriptional gene silencing and post-transcriptional gene silencing. Silencing of a target locus by an unlinked silencing locus can result from transcription inhibition (transcriptional gene silencing; TGS) or mRNA degradation (post-transcriptional gene silencing; PTGS), owing to the production of double- stranded RNA (dsRNA) corresponding to promoter or transcribed sequences, respectively. Involvement of distinct cellular components in each process suggests that dsRNA-induced TGS and PTGS likely result from the diversification of an ancient common mechanism. However, a strict comparison of TGS and PTGS has been difficult to achieve because it generally relies on the analysis of distinct silencing loci. A single transgene locus can be described to trigger both TGS and PTGS, owing to the production of dsRNA corresponding to promoter and transcribed sequences of different target genes.

As used herein, the terms "nucleic acid molecule", "nucleic acid", or "polynucleotide" (all three terms are synonymous with one another) refer to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms, and mixed polymers thereof. "A nucleotide" may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide. A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The terms may refer to a molecule of RNA or DNA of indeterminate length. The terms include single- and double- stranded forms of DNA. A nucleic acid molecule may include either or both naturally-occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.

Nucleic acid molecules may be modified chemically or biochemically, or may contain non- natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications (e.g., uncharged linkages: for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.; charged linkages: for example, phosphorothioates, phosphorodithioates, etc.; pendent moieties: for example, peptides; intercalators: for example, acridine, psoralen, etc.; chelators; alkylators; and modified linkages: for example, alpha anomeric nucleic acids, etc.). The term "nucleic acid molecule" also includes any topological conformation, including single- stranded, double- stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations. Transcription proceeds in a 5' to 3' manner along a DNA strand. This means that RNA is made by sequential addition of ribonucleotide-5' -triphosphates to the 3' terminus of the growing chain (with a requisite elimination of the pyrophosphate). In either a linear or circular nucleic acid molecule, discrete elements (e.g., particular nucleotide sequences) may be referred to as being "upstream" relative to a further element if they are bonded or would be bonded to the same nucleic acid in the 5' direction from that element. Similarly, discrete elements may be "downstream" relative to a further element if they are or would be bonded to the same nucleic acid in the 3' direction from that element.

As used herein, the term "base position" refers to the location of a given base or nucleotide residue within a designated nucleic acid. A designated nucleic acid may be defined by alignment with a reference nucleic acid.

As used herein, the term "hybridization" refers to a process where oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid molecules consist of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and bonding of a pyrimidine to a purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

As used herein, the terms "specifically hybridizable" and "specifically complementary" refer to a sufficient degree of complementarity such that stable and specific binding occurs between an oligonucleotide and the DNA or RNA target. Oligonucleotides need not be 100%

complementary to the target sequence to specifically hybridize. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is sufficient degree of

complementarity to avoid non-specific binding of an oligonucleotide to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the chosen hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially Na⁺ and/or

Mg²⁺ concentration) of a hybridization buffer will contribute to the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989.

As used herein, the term "stringent conditions" encompasses conditions under which hybridization will only occur if there is less than 50% mismatch between the hybridization molecule and the DNA target. "Stringent conditions" include further particular levels of stringency. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 50% sequence mismatch will not hybridize; conditions of "high stringency" are those under which sequences with more than 20% mismatch will not hybridize; and conditions of "very high stringency" are those under which sequences with more than 10% mismatch will not hybridize. In particular embodiments, stringent conditions can include hybridization at 65 °C, followed by washes at 65°C with O.lx SSC/0.1% SDS for 40 minutes. The following are representative, non- limiting hybridization conditions:

• Very High Stringency: hybridization in 5x SSC buffer at 65°C for 16 hours; wash twice in 2x SSC buffer at room temperature for 15 minutes each; and wash twice in 0.5x SSC buffer at 65°C for 20 minutes each.

• High Stringency: Hybridization in 5-6 x SSC buffer at 65-70°C for 16-20 hours; wash twice in 2x SSC buffer at room temperature for 5-20 minutes each; and wash twice in lx SSC buffer at 55-70°C for 30 minutes each.

• Moderate Stringency: Hybridization in 6x SSC buffer at room temperature to 55°C for 16-20 hours; wash at least twice in 2-3x SSC buffer at room temperature to 55°C for 20-30 minutes each.

In an embodiment, specifically hybridizable nucleic acid molecules can remain bound under very high stringency hybridization conditions. In an embodiment, specifically hybridizable nucleic acid molecules can remain bound under high stringency hybridization conditions. In an embodiment, specifically hybridizable nucleic acid molecules can remain bound under moderate stringency hybridization conditions.

As used herein, the term "oligonucleotide" refers to a short nucleic acid polymer.

Oligonucleotides may be formed by cleavage of longer nucleic acid segments, or by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Because oligonucleotides may bind to a complementary nucleotide sequence, they may be used as probes for detecting DNA or RNA. Oligonucleotides composed of DNA (oligodeoxyribonucleotides) may be used in polymerase chain reaction, a technique for the amplification of small DNA sequences. In polymerase chain reaction, an oligonucleotide is typically referred to as a "primer" which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.

As used herein, the terms "Polymerase Chain Reaction" or "PCR" refer to a procedure or technique in which minute amounts of nucleic acid, RNA and/or DNA, are amplified as described in U.S. Pat. No. 4,683,195. Generally, sequence information from the ends of the region of interest or beyond needs to be available, such that oligonucleotide primers can be designed; these primers will be identical or similar in sequence to opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA, bacteriophage or plasmid sequences, etc. See generally Mullis et ah, Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).

As used herein, the term "primer" refers to an oligonucleotide capable of acting as a point of initiation of synthesis along a complementary strand when conditions are suitable for synthesis of a primer extension product. The synthesizing conditions include the presence of four different deoxyribonucleotide triphosphates and at least one polymerization-inducing agent such as reverse transcriptase or DNA polymerase. These are present in a suitable buffer, that may include constituents which are co-factors or which affect conditions such as pH and the like at various suitable temperatures. A primer is preferably a single strand sequence, such that amplification efficiency is optimized, but double stranded sequences can be utilized.

As used herein, the term "probe" refers to an oligonucleotide or polynucleotide sequence that hybridizes to a target sequence. In the TaqMan^® or TaqMan^®-style assay procedure, the probe hybridizes to a portion of the target situated between the annealing site of the two primers. A probe includes about eight nucleotides, about ten nucleotides, about fifteen nucleotides, about twenty nucleotides, about thirty nucleotides, about forty nucleotides, or about fifty nucleotides. In some embodiments, a probe includes from about eight nucleotides to about fifteen

nucleotides.

In the Southern blot assay procedure, the probe hybridizes to a DNA fragment that is attached to a membrane. A probe includes about ten nucleotides, about 100 nucleotides, about 250 nucleotides, about 500 nucleotides, about 1,000 nucleotides, about 2,500 nucleotides, or about 5,000 nucleotides. In some embodiments, a probe includes from about 500 nucleotides to about 2,500 nucleotides.

A probe can further include a detectable label, e.g. , a radioactive label, a biotinylated label, a fluorophore (Texas-Red^®, fluorescein isothiocyanate, etc.,). The detectable label can be covalently attached directly to the probe oligonucleotide, e.g., located at the probe's 5' end or at the probe's 3' end. A probe including a fluorophore may also further include a quencher, e.g., Black Hole Quencher™, Iowa Black™, etc.

As used herein, the terms "sequence identity" or "identity" can be used interchangeably and refer to nucleic acid residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window.

As used herein, the term "percentage of sequence identity" refers to a value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences or amino acid sequences) over a comparison window, wherein the portion of a sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to a reference sequence (that does not comprise additions or deletions) for optimal alignment of the two sequences. A percentage is calculated by determining the number of positions at which an identical nucleic acid or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. Methods for aligning sequences for comparison are well known. Various programs and alignment algorithms are described in, for example: Smith and Waterman (1981) Adv. Appl. Math. 2:482; Needleman and Wunsch (1970) J. Mol. Biol. 48:443; Pearson and Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85:2444; Higgins and Sharp (1988) Gene 73:237 '-44; Higgins and Sharp (1989) CABIOS 5:151-3; Corpet et al. (1988) Nucleic Acids Res. 16: 10881-90; Huang et al. (1992) Comp. Appl. Biosci. 8: 155-65; Pearson et al. (1994) Methods Mol. Biol. 24:307-31; Tatiana et al. (1999) FEMS Microbiol. Lett. 174:247-50.

The National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST™; Altschul et al. (1990) J. Mol. Biol. 215:403-10) is available from several sources, including the National Center for Biotechnology Information (Bethesda, MD), and on the internet, for use in connection with several sequence analysis programs. A description of how to determine sequence identity using this program is available on the internet under the "help" section for BLAST™. For comparisons of nucleic acid sequences, the "Blast 2 sequences" function of the BLAST™ (Blastn) program may be employed using the default parameters. Nucleic acid sequences with even greater similarity to the reference sequences will show increasing percentage identity when assessed by this method.

As used herein, the term "operably linked" refers to a nucleic acid placed into a functional relationship with another nucleic acid. Generally, "operably linked" can mean that linked nucleic acids are contiguous. Linking can be accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are ligated or annealed to the nucleic acid and used to link the contiguous polynucleotide fragment. However, elements need not be contiguous to be operably linked.

As used herein, the term "promoter" refers to a region of DNA that generally is located upstream (towards the 5' region of a gene) of a gene and is needed to initiate and drive transcription of the gene. A promoter may permit proper activation or repression of a gene that it controls. A promoter may contain specific sequences that are recognized by transcription factors. These factors may bind to a promoter DNA sequence, which results in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. The promoter generally refers to all gene regulatory elements located upstream of the gene, including, upstream promoters, 5'-UTR, introns, and leader sequences.

As used herein, the term "upstream-promoter" refers to a contiguous polynucleotide sequence that is sufficient to direct initiation of transcription. As used herein, an upstream- promoter encompasses the site of initiation of transcription with several sequence motifs, which include TATA Box, initiator sequence, TFIIB recognition elements and other promoter motifs (Jennifer, E.F. et al, (2002) Genes & Dev., 16: 2583-2592). The upstream promoter provides the site of action to RNA polymerase II which is a multi-subunit enzyme with the basal or general transcription factors like, TFIIA, B, D, E, F and H. These factors assemble into a transcription pre initiation complex that catalyzes the synthesis of RNA from DNA template.

The activation of the upstream-promoter is done by the additional sequence of regulatory DNA sequence elements to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression. These gene regulatory elements sequences interact with specific DNA-binding factors. These sequence motifs may sometimes referred to as ds-elements. Such ds-elements, to which tissue-specific or development- specific transcription factors bind, individually or in combination, may determine the spatiotemporal expression pattern of a promoter at the transcriptional level. These ds-elements vary widely in the type of control they exert on operably linked genes. Some elements act to increase the transcription of operably-linked genes in response to environmental responses (e.g., temperature, moisture, and wounding). Other ds-elements may respond to developmental cues (e.g. , germination, seed maturation, and flowering) or to spatial information (e.g., tissue specificity). See, for example, Langridge et al. (1989) Proc. Natl. Acad. Sci. USA 86:3219-23. These ds-elements are located at a varying distance from transcription start point, some cis- elements (called proximal elements) are adjacent to a minimal core promoter region while other elements can be positioned several kilobases upstream or downstream of the promoter (enhancers). A "DNA binding transgene" is a polynucleotide coding sequence that encodes a DNA binding protein. The DNA binding protein is subsequently able to bind to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA- binding, RNA-binding and protein-binding activity.

Examples of DNA binding proteins include; meganucleases, zinc fingers, CRISPRs and TALE binding domains that can be "engineered" to bind to a predetermined nucleotide sequence. Typically, the engineered DNA binding proteins (e.g., zinc fingers, CRISPRs, or TALEs) are proteins that are non-naturally occurring. Non-limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design/composition results principally from rational criteria.

Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP, CRISPR, and/or TALE designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and

WO 03/016496 and U.S. Publication Nos. 20110301073, 20110239315 and 20119145940.

A "zinc finger DNA binding protein" (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be "engineered" to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for engineering zinc finger proteins are design and selection. A designed zinc finger protein is a protein not occurring in nature whose design/composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also

WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496.

In other examples, the DNA-binding domain of one or more of the nucleases comprises a naturally occurring or engineered (non-naturally occurring) TAL effector DNA binding domain.

See, e.g., U.S. Patent Publication No. 20110301073, incorporated by reference in its entirety herein. The plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. Pathogenicity of Xanthomonas depends on a conserved type III secretion (T3S) system which injects more than different effector proteins into the plant cell. Among these injected proteins are transcription activator-like (TALEN) effectors which mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al (2007) Science 318:648-651). These proteins contain a DNA binding domain and a transcriptional activation domain. One of the most well characterized TAL-effectors is AvrBs3 from

Xanthomonas campestgris pv. Vesicatoria (see Bonas et al (1989) Mol Gen Genet 218: 127-136 and WO2010079430). TAL-effectors contain a centralized domain of tandem repeats, each repeat containing approximately 34 amino acids, which are key to the DNA binding specificity of these proteins. In addition, they contain a nuclear localization sequence and an acidic transcriptional activation domain (for a review see Schornack S, et al (2006) J Plant Physiol 163(3): 256-272). In addition, in the phytopathogenic bacteria Ralstonia solanacearum two genes, designated brgll and hpxl7 have been found that are homologous to the AvrBs3 family of Xanthomonas in the R. solanacearum biovar strain GMI1000 and in the biovar 4 strain

RS1000 (See Heuer et al (2007) Appl and Enviro Micro 73(13): 4379-4384). These genes are 98.9% identical in nucleotide sequence to each other but differ by a deletion of 1,575 bp in the repeat domain of hpxl7. However, both gene products have less than 40% sequence identity with AvrBs3 family proteins of Xanthomonas. See, e.g., U.S. Patent Publication No. 20110301073, incorporated by reference in its entirety.

Specificity of these TAL effectors depends on the sequences found in the tandem repeats. The repeated sequence comprises approximately 102 bp and the repeats are typically 91-100% homologous with each other (Bonas et al, ibid). Polymorphism of the repeats is usually located at positions 12 and 13 and there appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the TAL-effector' s target sequence (see Moscou and Bogdanove, (2009) Science 326: 1501 and Boch et al (2009) Science 326: 1509-1512). Experimentally, the natural code for DNA recognition of these TAL-effectors has been determined such that an HD sequence at positions 12 and 13 leads to a binding to cytosine (C), NG binds to T, NI to A, C, G or T, NN binds to A or G, and ING binds to T. These DNA binding repeats have been assembled into proteins with new combinations and numbers of repeats, to make artificial transcription factors that are able to interact with new sequences and activate the expression of a non-endogenous reporter gene in plant cells (Boch et al, ibid). Engineered TAL proteins have been linked to a Fokl cleavage half domain to yield a TAL effector domain nuclease fusion (TALEN) exhibiting activity in a yeast reporter assay (plasmid based target).

The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas (CRISPR Associated) nuclease system is a recently engineered nuclease system based on a bacterial system that can be used for genome engineering. It is based on part of the adaptive immune response of many bacteria and Archea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNAs (crRNA) by the 'immune' response. This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a "protospacer". Cas9 cleaves the DNA to generate blunt ends at the DSB at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript. Cas9 requires both the crRNA and the tracrRNA for site specific DNA recognition and cleavage. This system has now been engineered such that the crRNA and tracrRNA can be combined into one molecule (the "single guide RNA"), and the crRNA equivalent portion of the single guide RNA can be engineered to guide the Cas9 nuclease to target any desired sequence (see Jinek et al (2012) Science 337, p. 816-821, Jinek et al, (2013), eLife 2:e00471, and David Segal, (2013) eLife 2:e00563). Thus, the CRISPR/Cas system can be engineered to create a double- stranded break (DSB) at a desired target in a genome, and repair of the DSB can be influenced by the use of repair inhibitors to cause an increase in error prone repair.

In other examples, the DNA binding transgene is a site specific nuclease that comprises an engineered (non-naturally occurring) Meganuclease (also described as a homing

endonuclease). The recognition sequences of homing endonucleases or meganucleases such as I- Scel, l-Ceul, Pl-Pspl, Pl-Sce, 1-SceW, l-Csml, I-Panl, I-Scell, l-Ppol, l-Scelll, l-Crel, l-Tevl, I- Tevll and l-Tevlll are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al. (1997) Nucleic Acids Res. 25:3379-30 3388; Dujon et al. (1989) Gene 82: 115-118; Perler et al. (1994) Nucleic Acids Res. 22, 11127; Jasin (1996) Trends Genet. ΙΙ-.ΙΙ -ΙΙ^;

Gimble et al. (1996) /. Mol. Biol. 263: 163-180; Argast et al. (1998) /. Mol. Biol. 280:345-353 and the New England Biolabs catalogue. In addition, the DNA-binding specificity of homing endonucleases and meganucleases can be engineered to bind non-natural target sites. See, for example, Chevalier et al. (2002) Molec. Cell 10:895-905; Epinat et al. (2003) Nucleic Acids Res. 5 31:2952-2962; Ashworth et al. (2006) Nature 441:656-659; Paques et al. (2007) Current Gene Therapy 7:49-66; U.S. Patent Publication No. 20070117128. The DNA-binding domains of the homing endonucleases and meganucleases may be altered in the context of the nuclease as a whole (i.e., such that the nuclease includes the cognate cleavage domain) or may be fused to a heterologous cleavage domain.

As used herein, the term "transformation" encompasses all techniques that a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; lipofection; microinjection (Mueller et al. (1978) Cell 15:579-85); Agwbacterium-mediated transfer; direct DNA uptake;

WHISKERS™-mediated transformation; and microprojectile bombardment. These techniques may be used for both stable transformation and transient transformation of a plant cell. "Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation. Host organisms containing the transformed nucleic acid fragments are referred to as "transgenic" organisms. "Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.

As used herein, the term "transduce" refers to a process where a virus transfers nucleic acid into a cell.

As used herein, the term "transgene" refers to an exogenous nucleic acid sequence. In one example, a transgene is a gene sequence (e.g., an herbicide-resistance gene), a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desirable agricultural trait. In yet another example, a transgene is a small RNA, such as an antisense nucleic acid sequence, wherein expression of the small RNA sequence inhibits expression of a target nucleic acid sequence. A transgene may contain regulatory sequences operably linked to the transgene (e.g., a promoter, intron, or 3' -UTR). In some embodiments, a nucleic acid of interest is a transgene. However, in other embodiments, a nucleic acid of interest is an endogenous nucleic acid, wherein additional genomic copies of the endogenous nucleic acid are desired, or a nucleic acid that is in the antisense orientation with respect to the sequence of a target nucleic acid in a host organism.

As used herein, the term "small RNA" refers to several classes of non-coding ribonucleic acid (ncRNA). The term small RNA describes the short chains of ncRNA produced in bacterial cells, animals, plants, and fungi. These short chains of ncRNA may be produced naturally within the cell or may be produced by the introduction of an exogenous sequence that expresses the short chain or ncRNA. The small RNA sequences do not directly code for a protein, and differ in function from other RNA in that small RNA sequences are only transcribed and not translated.

The small RNA sequences are involved in other cellular functions, including gene expression and modification. Small RNA molecules are usually made up of about 20 to 30 nucleotides. The small RNA sequences may be derived from longer precursors. The precursors form structures that fold back on each other in self-complementary regions; they are then processed by the nuclease Dicer in animals or DCL1 in plants.

Many types of small RNA exist either naturally or produced artificially, including microRNAs (miRNAs), short interfering RNAs (siRNAs), antisense RNA, short hairpin RNA (shRNA), and small nucleolar RNAs (snoRNAs). Certain types of small RNA, such as microRNA and siRNA, are important in gene silencing and RNA interference (RNAi). Gene silencing is a process of genetic regulation in which a gene that would normally be expressed is "turned off by an intracellular element, in this case, the small RNA. The protein that would normally be formed by this genetic information is not formed due to interference, and the information coded in the gene is blocked from expression.

As used herein, the term "small RNA" encompasses RNA molecules described in the literature as "tiny RNA" (Storz, (2002) Science 296: 1260-3; Illangasekare et al., (1999) RNA 5: 1482-1489); prokaryotic "small RNA" (sRNA) (Wassarman et al., (1999) Trends Microbiol. 7:37-45); eukaryotic "noncoding RNA (ncRNA)"; "micro-RNA (miRNA)"; "small non-mRNA (snmRNA)"; "functional RNA (fRNA)"; "transfer RNA (tRNA)"; "catalytic RNA" [e.g., ribozymes, including self-acylating ribozymes (Illangaskare et al., (1999) RNA 5: 1482-1489); "small nucleolar RNAs (snoRNAs)"; "tmRNA" (a.k.a. "10S RNA", Muto et al., (1998) Trends Biochem Sci. 23:25-29; and Gillet et al., (2001) Mol Microbiol. 42:879-885); RNAi molecules including without limitation "small interfering RNA (siRNA)", "endoribonuclease-prepared siRNA (e-siRNA)", "short hairpin RNA (shRNA)", and "small temporally regulated RNA (stRNA)"; "diced siRNA (d-siRNA)", and aptamers, oligonucleotides and other synthetic nucleic acids that comprise at least one uracil base.

As used herein, the term "vector" refers to a nucleic acid molecule as introduced into a cell, thereby producing a transformed cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC), or virus that carries exogenous DNA into a cell. A vector can also include one or more genes, antisense molecules, and/or selectable marker genes and other genetic elements known in the art. A vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and/or proteins encoded by the vector. A vector may optionally include materials to aid in achieving entry of the nucleic acid molecule into the cell (e.g., a liposome). As used herein, the terms "cassette", "expression cassette", and "gene expression cassette" refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination. A segment of DNA comprises a polynucleotide containing a gene of interest that encodes a small RNA or a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation. In an embodiment, an expression cassette can include a polynucleotide that encodes a small RNA or a polypeptide of interest and having elements in addition to the polynucleotide that facilitate transformation of a particular host cell. In an embodiment, a gene expression cassette may also include elements that allow for enhanced expression of a small RNA or a polynucleotide encoding a polypeptide of interest in a host cell. These elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, an intron, a 5' untranslated, a 3' untranslated region sequence, a terminator sequence, a polyadenylation sequence, and the like.

As used herein, the term "heterologous coding sequence" is used to indicate any polynucleotide that codes for, or ultimately codes for, a peptide or protein or its equivalent amino acid sequence, e.g., an enzyme, that is not normally present in the host organism and can be expressed in the host cell under proper conditions. As such, "heterologous coding sequences" may include one or additional copies of coding sequences that are not normally present in the host cell, such that the cell is expressing additional copies of a coding sequence that are not normally present in the cells. The heterologous coding sequences can be RNA or any type thereof, e.g., mRNA, DNA or any type thereof, e.g., cDNA, or a hybrid of RNA/DNA. Examples of coding sequences include, but are not limited to, full-length transcription units that comprise such features as the coding sequence, introns, promoter regions, 5'-UTR, 3'-UTRs and enhancer regions.

"Heterologous coding sequences" also includes the coding portion of the peptide or enzyme, i.e., the cDNA or mRNA sequence, of the peptide or enzyme, as well as the coding portion of the full-length transcriptional unit, i.e., the gene comprising introns and exons, as well as "codon optimized" sequences, truncated sequences or other forms of altered sequences that code for the enzyme or code for its equivalent amino acid sequence, provided that the equivalent amino acid sequence produces a functional protein. Such equivalent amino acid sequences can have a deletion of one or more amino acids, with the deletion being N-terminal, C-terminal or internal. Truncated forms are envisioned as long as they have the catalytic capability indicated herein. As used herein, the term "control" refers to a sample used in an analytical procedure for comparison purposes. A control can be "positive" or "negative". For example, where the purpose of an analytical procedure is to detect a differentially expressed transcript or polypeptide in cells or tissue, it is generally preferable to include a positive control, such as a sample from a known plant exhibiting the desired expression, and a negative control, such as a sample from a known plant lacking the desired expression.

As used herein, the term "plant" includes plants and plant parts including but not limited to plant cells and plant tissues such as leaves, stems, roots, flowers, pollen, and seeds. A class of plant that can be used in the present invention is generally as broad as the class of higher and lower plants amenable to mutagenesis including angiosperms, gymnosperms, ferns and multicellular algae. Thus, "plant" includes dicot and monocot plants. Examples of

dicotyledonous plants include tobacco, Arabidopsis, soybean, tomato, papaya, canola, sunflower, cotton, alfalfa, potato, grapevine, pigeon pea, pea, Brassica, chickpea, sugar beet, rapeseed, watermelon, melon, pepper, peanut, pumpkin, radish, spinach, squash, broccoli, cabbage, carrot, cauliflower, celery, Chinese cabbage, cucumber, eggplant, and lettuce. Examples of

monocotyledonous plants include corn, rice, wheat, sugarcane, barley, rye, sorghum, orchids, bamboo, banana, cattails, lilies, oat, onion, millet, and triticale.

As used herein, the term "plant material" refers to leaves, stems, roots, flowers or flower parts, fruits, pollen, egg cells, zygotes, seeds, cuttings, cell or tissue cultures, or any other part or product of a plant. In an embodiment, plant material includes cotyledon and leaf. In an embodiment, plant material includes root tissues and other plant tissues located underground.

As used herein, the term "selectable marker gene" refers to a gene that is optionally used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance/tolerance to a selective agent. In addition, "selectable marker gene" is meant to encompass reporter genes. Only those cells or plants that receive a functional selectable marker are capable of dividing or growing under conditions having a selective agent. Examples of selective agents can include, for example, antibiotics, including spectinomycin, neomycin, kanamycin, paromomycin, gentamicin, and hygromycin. These selectable markers include neomycin phosphotransferase (npt II), which expresses an enzyme conferring resistance to the antibiotic kanamycin, and genes for the related antibiotics neomycin, paromomycin, gentamicin, and G418, or the gene for hygromycin phosphotransferase (hpt), which expresses an enzyme conferring resistance to hygromycin. Other selectable marker genes can include genes encoding herbicide resistance including bar or pat (resistance against glufosinate ammonium or phosphinothricin), acetolactate synthase (ALS, resistance against inhibitors such as sulfonylureas (SUs), imidazolinones (IMIs), triazolopyrimidines (TPs), pyrimidinyl oxybenzoates (POBs), and sulfonylamino carbonyl triazolinones that prevent the first step in the synthesis of the branched-chain amino acids), glyphosate, 2,4-D, and metal resistance or sensitivity. Examples of "reporter genes" that can be used as a selectable marker gene include the visual observation of expressed reporter gene proteins such as proteins encoding β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), DsRed, β- galactosidase, chloramphenicol acetyltransferase (CAT), alkaline phosphatase, and the like. The phrase "marker-positive" refers to plants that have been transformed to include a selectable marker gene.

As used herein, the term "detectable marker" refers to a label capable of detection, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a

chemiluminescent compound, metal chelator, or enzyme. Examples of detectable markers include, but are not limited to, the following: fluorescent labels (e.g. , FITC, rhodamine, lanthanide phosphors), enzymatic labels (e.g. , horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g. , leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags). In an embodiment, a detectable marker can be attached by spacer arms of various lengths to reduce potential steric hindrance.

As used herein, the term "detecting" is used in the broadest sense to include both qualitative and quantitative measurements of a specific molecule, for example, measurements of a specific polypeptide.

Unless otherwise specifically explained, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art that this disclosure belongs. Definitions of common terms in molecular biology can be found in, for example: Lewin, Genes V, Oxford University Press, 1994; Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994; and Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995.

Regulatory Elements

Plant promoters used for basic research or biotechnological applications are generally unidirectional, directing the expression of transgene that has been fused at its 3' end (downstream).

It is often necessary to robustly express transgenes within plants for metabolic engineering and trait stacking. In addition, multiple novel promoters are typically required in transgenic crops to drive the expression of multiple genes. Disclosed herein is a chimeric promoter that can direct the expression of a transgene that has been fused at its 3' end (downstream). Development of transgenic products is becoming increasingly complex, which requires robustly expressing transgenes and stacking multiple transgenes into a single locus. Traditionally, each transgene requires a unique promoter for expression wherein multiple promoters are required to express different transgenes within one gene stack. With an increasing size of gene stacks, this frequently leads to repeated use of the same promoter to obtain similar levels of expression pattems of different transgenes for expression of a single polygenic trait. Multi-gene constructs driven by the same promoter are known to cause gene silencing resulting in less efficacious transgenic products in the field. Excess of transcription factor (TF)-binding sites due to promoter repetition can cause depletion of endogenous TFs leading to transcriptional inactivation. The silencing of transgenes will likely undesirably affect performance of a transgenic plant produced to express transgenes. Repetitive sequences within a transgene may lead to gene intra locus homologous recombination resulting in polynucleotide rearrangements.

Tissue specific (i.e., tissue-preferred) or organ specific promoters drive gene expression in a certain tissue such as in the kernel, root, leaf or tapetum of the plant. Tissue and

developmental stage specific promoters derive the expression of genes, which are expressed in particular tissues or at particular time periods during plant development. Tissue specific promoters are required for certain applications in the transgenic plants industry and are desirable as they permit specific expression of heterologous genes in a tissue and/or developmental stage selective manner, indicating expression of the heterologous gene differentially at a various organs, tissues and/or times, but not in other. For example, increased resistance of a plant to infection by soil-borne pathogens might be accomplished by transforming the plant genome with a pathogen-resistance gene such that pathogen-resistance protein is robustly expressed within the roots of the plant. Alternatively, it may be desirable to express a transgene in plant tissues that are in a particular growth or developmental phase such as, for example, cell division or elongation. Another application is the desirability of using tissue specific promoters, e.g. such that would confine the expression of the transgenes encoding an agronomic trait in developing xylem. One particular problem remaining in the identification of tissue specific promoters is how to identify the potentially most important genes and their corresponding promoters, and to relate these to specific developmental properties of the cell. Another problem is to clone all relevant cis-acting transcriptional control elements so that the cloned DNA fragment drives transcription in the wanted specific expression pattern. A particular problem is to identify tissue- specific promoters, related to specific cell types, developmental stages and/or functions in the plant that are not expressed in other plant tissues. Transgene expression may also be regulated by an intron and 5' -UTR region located downstream of the promoter sequence. A chimeric promoter comprising an upstream-promoter from operably linked to an intron, and 5' -UTR can regulate transgene expression. While an upstream-promoter is necessary to drive transcription, the presence of an intron and 5' -UTR can increase expression levels resulting in mRNA transcript for translation and protein synthesis.

Addition of an intron and 5' -UTR to an upstream-promoter polynucleotide sequence can aid stable expression of a transgene.

Provided are methods and constructs using a chimeric promoter gene regulatory element comprising an upstream-promoter from Zea mays Peroxidase 5 followed by the Zea mays alcohol dehydrogenase (I), intron 6 and Maize Streak Virus 5' -UTR (e.g., leader) to express transgenes in plant. In an embodiment, a chimeric promoter can be a promoter of:

ACCACTGTTGTAACTTGTAAGCCACTAGCTCACGTTCTCCATGAGCTCTTCTC TCTGCTGTTTCTTCCTCTGCTAACTGCGTTATGATATGACGTCGTATAAATAAT CTCACAATACTTCCTTATTTTCAGCATGGCCTCTTTTATGTTTATTTAACAGTA GCAACCAACGCCGCTCGATGTTTCCTTCAAGAAACGGCCACTCACTATGTGG TGTGCAGAAGAACAAATGTAAGCAGCTCCTACAGGTACCAGTAGTCATGTCA GTGTGGAAGCTTTCCAACCAACGCCTCCTTCGAGGAACCTGGTCGTGCTGAC ATGAATGTAGGCCATGCAAGCACAAGCACCTAACGCGAATCATCACGACGCG CCGTGTACTGGGCGTTGGTACATCACACCCCGCGTTTGACCTGATCGGAAGC ATGCGTGTGTGTTGGCTGCAGGACCGGCTATAGGTTTCCTGCATTGGACAGCA GAAGCCAGTCATGTTAGGCACTCACGCGCTCCTGCCGTTTGATGAATCATCCG GTCTTTCGTATTGATCACTAGTTCACTACGCTGATATAGCAAATTTTAAGATG TGAAACCACGAGACGAGCGATAAATCTTAGACGTTACCTATCCATATGAAGC TTGTGCGAAAAAAAGGCGTGCCGCTGTAGCATCATTCGTATACACTTTTGTCC CCAAAGACAGGGATACGAATCCATGCTCGACAGAACCCTCCCTTCCCTGCAG ATAACGACACTTAAGTATAACAAAAGTAGTTGGATTATTTCAGAAGCAAAAT CTCACTTTTCGCTGGCCTTTTTGTACTTTGGTTACTTGAGTTCAGACAGTGTAT GCTATATTGTCATGTGCTGCGTAAGGTTTAAATATGGTTCGACAAATATATCA GTATATCACTACTTTGTTATGGGTGGGGCCTAGCACAAACTTGATACAGCTAG GATAAAGTTAGAACGATGACTGATCTACTGTAAAGCGACACCTGTCCTGTTA TGGTAGTTTAAGTCCATTCCTGGACGACTCCAGATCCAGGATATGATGCTGTT ACATAATGCGATTGTTCACAATAAAATTGCATGATGTTCTTCTACTCTTTAGG CAGTTTTGTTCAACAGGCAAGTTGCATAATGCATGTGCATATATGAGCAGCAT AATCATCAATTAATCATAGGTTCGTCATTTTAGTTTCACTCCTTCACATTATTC CAGCCCTTGAAGAAAAATGTAGCAGTGCTTGCTGTTTAATAAGTGGCAGAGC TGTTTTCACTCCACCTACGCTTGTCTAGGACCAAAATTTTAATCTGTCACTTTG AGCTAAAACTGAAGCACCAAACCGCTACAAAAGAACGTAGGAGCTGAATTG TAACTTGATGGGATTACTATAGCAGTTGCTACAGTTCTAGCTAGCTACCTTAT TCTATACGCATCACCCTAACAACCCGGCTGACTGCTGCATCTGACCCCACCGT CCCCTGCTCCAAACCAACTCTCCTTTCCTTGCATGCACTACACCCACTTCCTG CAGCTATATATACCACCATATGCCCATCTTATGAAACCATCCACAAGAGGAG AAGAAACAATCAACCAGCAACACTCTTCTCTTATAACATAGTACAGCGAAGG TAACTCACGGTACCCTGAAGGCTCGACAAGGCAGTCCACGGAGGAGCTGATA TTTGGTGGACAAGCTGTGGATAGGAGCAACCCTATCCCTAATATACCAGCAC CACCAAGTCAGGGCAATCCCCAGATCACCCCAGCAGATTCGAAGAAGGTACA GTACACACACATGTATATATGTATGATGTATCCCTTCGATCGAAGGCATGCCT TGGTATAATCACTGAGTAGTCATTTTATTACTTTGTTTTGACAAGTCAGTAGTT CATCCATTTGTCCCATTTTTTCAGCTTGGAAGTTTGGTTGCACTGGCCTTGGTC TAATAACTGAGTAGTCATTTTATTACGTTGTTTCGACAAGTCAGTAGCTCATC CATCTGTCCCATTTTTTCAGCTAGGAAGTTTGGTTGCACTGGCCTTGGACTAA TAACTGATTAGTCATTTTATTACATTGTTTCGACAAGTCAGTAGCTCATCCAT CTGTCCCATTTTTCAGCTAGGAAGTTCGGATCTGGGGCCATTTGTTCCAGGCA CGGGATAAGCATTCAG (SEQ ID NO: 1 )

In an embodiment, a gene expression cassette comprises a promoter. In an embodiment, a promoter can be a chimeric promoter of the subject disclosure. In an embodiment, a gene expression cassette comprises a promoter, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: l. In an embodiment, a gene expression cassette comprises a chimeric promoter that is operably linked to a transgene. In an embodiment, a gene expression cassette comprising the chimeric promoter may drive expression of two or more transgenes. In an illustrative embodiment, a gene expression cassette comprises a chimeric promoter that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.

Selectable Markers

Various selectable markers also described as reporter genes can be incorporated into a chosen expression vector to allow for identification and selection of transformed plants ("transformants"). Many methods are available to confirm expression of selectable markers in transformed plants, including for example DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for detection of a protein expressed from the vector, e g., precipitated protein that mediates phosphinothricin resistance, or visual observation of other proteins such as reporter genes encoding β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), DsRed, β- galactosidase, chloramphenicol acetyltransferase (CAT), alkaline phosphatase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, N.Y., 2001, the content is incorporated herein by reference in its entirety).

Selectable marker genes are utilized for selection of transformed cells or tissues.

Selectable marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT) as well as genes conferring resistance to herbicidal compounds. Herbicide resistance genes generally code for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, resistance to glyphosate has been obtained by using genes coding for mutant target enzymes, 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known, and further described below. Resistance to glufosinate ammonium, bromoxynil, and 2,4- dichlorophenoxyacetate (2,4-D) have been obtained by using bacterial genes encoding pat or DSM-2, a nitrilase, an aad-l or an aad-Yl gene, which detoxifies the respective herbicides.

In an embodiment, herbicides can inhibit the growing point or meristem, including imidazolinone or sulfonylurea, and genes for resistance/tolerance of acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS) for these herbicides are well known. Glyphosate resistance genes include mutant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPs) and dgt- 28 genes (via the introduction of recombinant nucleic acids and/or various forms of in vivo mutagenesis of native EPSPs genes), aroA genes and glyphosate acetyl transferase (GAT) genes, respectively). Resistance genes for other phosphono compounds include bar genes from

Streptomyces species, including Streptomyces hygroscopicus and Streptomyces

viridichromogenes, and pyridinoxy or phenoxy proprionic acids and cyclohexones (ACCase inhibitor-encoding genes). Exemplary genes conferring resistance to cyclohexanediones and/or aryloxyphenoxypropanoic acid (including Haloxyfop, Diclofop, Fenoxyprop, Fluazifop, Quizalofop) include genes of acetyl coenzyme A carboxylase (ACCase)— Accl-Sl, Accl-S2 and Accl-S3. In an embodiment, herbicides can inhibit photosynthesis, including triazine (psbA and ls+ genes) or benzonitrile (nitrilase gene). In an embodiment, selectable marker genes include, but are not limited to genes encoding: neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; dihydrodipicolinate synthase and desensitized aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid dehalogenase; acetohydroxyacid synthase; 5- enolpyruvyl-shikimate-phosphate synthase (aroA); haloarylnitrilase; acetyl-coenzyme A carboxylase; dihydropteroate synthase (sul I); and 32 kD photosystem II polypeptide (psbA).

An embodiment also includes genes encoding resistance to: chloramphenicol;

methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin.

The above list of selectable marker genes is not meant to be limiting. Any reporter or selectable marker gene are encompassed by the present invention.

Selectable marker genes are synthesized for optimal expression in a plant. For example, in an embodiment, a coding sequence of a gene has been modified by codon optimization to enhance expression in plants. A selectable marker gene can be optimized for expression in a particular plant species or alternatively can be modified for optimal expression in dicotyledonous or monocotyledonous plants. Plant preferred codons may be determined from the codons of highest frequency in the proteins expressed in the largest amount in the particular plant species of interest. In an embodiment, a selectable marker gene is designed to be expressed in plants at a higher level resulting in higher transformation efficiency. Methods for plant optimization of genes are well known. Guidance regarding the optimization and manufacture of synthetic polynucleotide sequences can be found in, for example, WO2013016546, WO2011146524, WO1997013402, US Patent No. 6166302, and US Patent No. 5,380,831, herein incorporated by reference.

Transgenes

The disclosed methods and compositions can be used to express polynucleotide gene sequences within the plant genome. Accordingly, expression of genes encoding herbicide tolerance, insect resistance, nutrients, antibiotics or therapeutic molecules can be driven by a plant promoter.

In one embodiment the chimeric regulatory element of the subject disclosure is combined or operably linked with gene encoding polynucleotide sequences that provide resistance or tolerance to glyphosate or another herbicide, and/or provides resistance to select insects or diseases and/or nutritional enhancements, and/or improved agronomic characteristics, and/or proteins or other products useful in feed, food, industrial, pharmaceutical or other uses. The transgenes can be "stacked" with two or more nucleic acid sequences of interest within a plant genome. Stacking can be accomplished, for example, via conventional plant breeding using two or more events, transformation of a plant with a construct which contains the sequences of interest, re-transformation of a transgenic plant, or addition of new traits through targeted integration via homologous recombination.

Such polynucleotide sequences of interest include, but are not limited to, those examples provided below:

1. Genes or Coding Sequence (e.g. iRNA) That Confer Resistance to Pests or Disease

(A) Plant Disease Resistance Genes. Plant defenses are often activated by specific interaction between the product of a disease resistance gene (R) in the plant and the product of a corresponding avirulence (Avr) gene in the pathogen. A plant variety can be transformed with cloned resistance gene to engineer plants that are resistant to specific pathogen strains. Examples of such genes include, the tomato Cf-9 gene for resistance to Cladosporium fulvum (Jones et al., 1994 Science 266:789), tomato Pto gene, which encodes a protein kinase, for resistance to Pseudomonas syringae pv. tomato (Martin et al., 1993 Science 262: 1432), and Arabidopsis RSSP2 gene for resistance to Pseudomonas syringae (Mindrinos et al., 1994 Cell 78: 1089).

(B) A Bacillus thuringiensis protein, a derivative thereof or a synthetic polypeptide modeled thereon, such as, a nucleotide sequence of a Bt δ-endotoxin gene (Geiser et al., 1986 Gene 48: 109), and a vegetative insecticidal (VJP) gene (see, e.g., Estruch et al. (1996) Proc. Natl. Acad. Sci. 93:5389-94). Moreover, DNA molecules encoding δ-endotoxin genes can be purchased from American Type Culture Collection (Rockville, Md.), under ATCC accession numbers 40098, 67136, 31995 and 31998.

(C) A lectin, such as, nucleotide sequences of several Clivia miniata mannose-binding lectin genes (Van Damme et al., 1994 Plant Molec. Biol. 24:825).

(D) A vitamin binding protein, such as avidin and avidin homologs which are useful as larvicides against insect pests. See U.S. Pat. No. 5,659,026.

(E) An enzyme inhibitor, e.g., a protease inhibitor or an amylase inhibitor. Examples of such genes include a rice cysteine proteinase inhibitor (Abe et al., 1987 J. Biol. Chem.

262: 16793), a tobacco proteinase inhibitor I (Huub et al., 1993 Plant Molec. Biol. 21:985), and an a-amylase inhibitor (Sumitani et al., 1993 Biosci. Biotech. Biochem. 57: 1243).

(F) An insect- specific hormone or pheromone such as an ecdysteroid and juvenile hormone a variant thereof, a mimetic based thereon, or an antagonist or agonist thereof, such as baculovirus expression of cloned juvenile hormone esterase, an inactivator of juvenile hormone (Hammock et al., 1990 Nature 344:458). (G) An insect-specific peptide or neuropeptide which, upon expression, disrupts the physiology of the affected pest (J. Biol. Chem. 269:9). Examples of such genes include an insect diuretic hormone receptor (Regan, 1994), an allostatin identified in Diploptera punctata (Pratt, 1989), and insect-specific, paralytic neurotoxins (U.S. Pat. No. 5,266,361).

(H) An insect-specific venom produced in nature by a snake, a wasp, etc., such as a scorpion insectotoxic peptide (Pang, 1992 Gene 116: 165).

(I) An enzyme responsible for a hyperaccumulation of monoterpene, a sesquiterpene, a steroid, hydroxamic acid, a phenylpropanoid derivative or another non-protein molecule with insecticidal activity.

(J) An enzyme involved in the modification, including the post-translational

modification, of a biologically active molecule; for example, glycolytic enzyme, a proteolytic enzyme, a lipolytic enzyme, a nuclease, a cyclase, a transaminase, an esterase, a hydrolase, a phosphatase, a kinase, a phosphorylase, a polymerase, an elastase, a chitinase and a glucanase, whether natural or synthetic. Examples of such genes include, a callas gene (PCT published application WO93/02197), chitinase-encoding sequences (which can be obtained, for example, from the ATCC under accession numbers 3999637 and 67152), tobacco hookworm chitinase (Kramer et al., 1993 Insect Molec. Biol. 23:691), and parsley ubi4-2 polyubiquitin gene

(Kawalleck et al., 1993 Plant Molec. Biol. 21:673).

(K) A molecule that stimulates signal transduction. Examples of such molecules include nucleotide sequences for mung bean calmodulin cDNA clones (Botella et al., 1994 Plant Molec. Biol. 24:757) and a nucleotide sequence of a maize calmodulin cDNA clone (Griess et al., 1994 Plant Physiol. 104: 1467).

(L) A hydrophobic moment peptide. See U.S. Pat. Nos. 5,659,026 and 5,607,914; the latter teaches synthetic antimicrobial peptides that confer disease resistance.

(M) A membrane permease, a channel former or a channel blocker, such as a cecropin-β lytic peptide analog (Jaynes et al., 1993 Plant Sci. 89:43) which renders transgenic tobacco plants resistant to Pseudomonas solanacearum.

(N) A viral-invasive protein or a complex toxin derived therefrom. For example, the accumulation of viral coat proteins in transformed plant cells imparts resistance to viral infection and/or disease development effected by the virus from which the coat protein gene is derived, as well as by related viruses. Coat protein-mediated resistance has been conferred upon transformed plants against alfalfa mosaic virus, cucumber mosaic virus, tobacco streak virus, potato virus X, potato virus Y, tobacco etch virus, tobacco rattle virus and tobacco mosaic virus. See, for example, Beachy et al. (1990) Ann. Rev. Phytopathol. 28:451. (O) An insect-specific antibody or an immunotoxin derived therefrom. Thus, an antibody targeted to a critical metabolic function in the insect gut would inactivate an affected enzyme, killing the insect. For example, Taylor et al. (1994) Abstract #497, Seventh Int'l. Symposium on Molecular Plant- Microbe Interactions shows enzymatic inactivation in transgenic tobacco via production of single-chain antibody fragments.

(P) A virus-specific antibody. See, for example, Tavladoraki et al. (1993) Nature

266:469, which shows that transgenic plants expressing recombinant antibody genes are protected from virus attack.

(Q) A developmental-arrestive protein produced in nature by a pathogen or a parasite. Thus, fungal endo a-l,4-D polygalacturonases facilitate fungal colonization and plant nutrient release by solubilizing plant cell wall homo-a-l,4-D-galacturonase (Lamb et al., 1992)

Bio/Technology 10: 1436. The cloning and characterization of a gene which encodes a bean endopolygalacturonase-inhibiting protein is described by Toubart et al. (1992 Plant J. 2:367).

(R) A developmental-arrestive protein produced in nature by a plant, such as the barley ribosome-inactivating gene that provides an increased resistance to fungal disease (Longemann et al., 1992). Bio/Technology 10:3305.

(S) RNA interference, in which an RNA molecule is used to inhibit expression of a target gene. An RNA molecule in one example is partially or fully double stranded, which triggers a silencing response, resulting in cleavage of dsRNA into small interfering RNAs, which are then incorporated into a targeting complex that destroys homologous mRNAs. See, e.g., Fire et al., US Patent 6,506,559; Graham et al.6,573,099.

2. Genes That Confer Resistance to a Herbicide

(A) Genes encoding resistance or tolerance to a herbicide that inhibits the growing point or meristem, such as an imidazalinone, sulfonanilide or sulfonylurea herbicide. Exemplary genes in this category code for mutant acetolactate synthase (ALS) (Lee et al., 1988 EMBOJ. 7: 1241) also known as acetohydroxyacid synthase (AHAS) enzyme (Miki et al., 1990 Theor. Appl.

Genet. 80:449).

(B) One or more additional genes encoding resistance or tolerance to glyphosate imparted by mutant EPSP synthase and aroA genes, or through metabolic inactivation by genes such as DGT-28, 2mEPSPS, GAT (glyphosate acetyltransferase) or GOX (glyphosate oxidase) and other phosphono compounds such as glufosinate (pat,bar, and dsm-2 genes), and

aryloxyphenoxypropionic acids and cyclohexanediones (ACCase inhibitor encoding genes). See, for example, U.S. Pat. No. 4,940,835, which discloses the nucleotide sequence of a form of

EPSP which can confer glyphosate resistance. A DNA molecule encoding a mutant aroA gene can be obtained under ATCC Accession Number 39256, and the nucleotide sequence of the mutant gene is disclosed in U.S. Pat. No. 4,769,061. European patent application No. 0 333 033 and U.S. Pat. No. 4,975,374 disclose nucleotide sequences of glutamine synthetase genes which confer resistance to herbicides such as L-phosphinothricin. The nucleotide sequence of a phosphinothricinacetyl-transferase gene is provided in European application No. 0 242 246. De Greef et al. (1989) Bio/Technology 7:61 describes the production of transgenic plants that express chimeric bar genes coding for phosphinothricin acetyl transferase activity. Exemplary of genes conferring resistance to aryloxyphenoxypropionic acids and cyclohexanediones, such as sethoxydim and haloxyfop, are the Accl-Sl, Accl-S2 and Accl-S3 genes described by Marshall et al. (1992) Theor. Appl. Genet. 83:435.

(C) Genes encoding resistance or tolerance to a herbicide that inhibits photosynthesis, such as a triazine (psbA and gs+ genes) and a benzonitrile (nitrilase gene). PrzibiUa et al. (1991) Plant Cell 3: 169 describe the use of plasmids encoding mutant psbA genes to transform

Chlamydomonas. Nucleotide sequences for nitrilase genes are disclosed in U.S. Pat. No.

4,810,648, and DNA molecules containing these genes are available under ATCC accession numbers 53435, 67441 and 67442. Cloning and expression of DNA coding for a glutathione S- transferase is described by Hayes et al. (1992) Biochem. J. 285: 173.

(D) Genes encoding resistance or tolerance to a herbicide that bind to

hydroxyphenylpyruvate dioxygenases (HPPD), enzymes which catalyze the reaction in which para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate. This includes herbicides such as isoxazoles (EP418175, EP470856, EP487352, EP527036, EP560482, EP682659, U.S. Pat. No. 5,424,276), in particular isoxaflutole, which is a selective herbicide for maize, diketonitriles (EP496630, EP496631), in particular 2-cyano-3-cyclopropyl-l-(2-S02CH3-4-CF3 phenyl)propane-l,3-dione and 2-cyano-3-cyclopropyl-l-(2-S02CH3-4-2,3C12phenyl)propane- 1,3-dione, triketones (EP625505, EP625508, U.S. Pat. No. 5,506,195), in particular sulcotrione, and pyrazolinates. A gene that produces an overabundance of HPPD in plants can provide tolerance or resistance to such herbicides, including, for example, genes described in U.S. Patent Nos. 6,268,549 and 6,245,968 and U.S. Patent Application, Publication No. 20030066102.

(E) Genes encoding resistance or tolerance to phenoxy auxin herbicides, such as 2,4- dichlorophenoxyacetic acid (2,4-D) and which may also confer resistance or tolerance to aryloxyphenoxypropionate (AOPP) herbicides. Examples of such genes include the a- ketoglutarate-dependent dioxygenase enzyme (aad-1) gene, described in U.S. Patent No.

7,838,733. (F) Genes encoding resistance or tolerance to phenoxy auxin herbicides, such as 2,4- dichlorophenoxyacetic acid (2,4-D) and which may also confer resistance or tolerance to pyridyloxy auxin herbicides, such as fluroxypyr or triclopyr. Examples of such genes include the a-ketoglutarate-dependent dioxygenase enzyme gene (aad-12), described in WO 2007/053482 A2.

(G) Genes encoding resistance or tolerance to dicamba (see, e.g., U.S. Patent

Publication No. 20030135879).

(H) Genes providing resistance or tolerance to herbicides that inhibit protoporphyrinogen oxidase (PPO) (see U.S. Pat. No. 5,767,373).

(I) Genes providing resistance or tolerance to triazine herbicides (such as atrazine) and urea derivatives (such as diuron) herbicides which bind to core proteins of photosystem II reaction centers (PS II) (See Brussian et al., (1989) EMBO J. 1989, 8(4): 1237-1245.

3. Genes That Confer or Contribute to a Value-Added Trait

(A) Modified fatty acid metabolism, for example, by transforming maize or Brassica with an antisense gene or stearoyl-ACP desaturase to increase stearic acid content of the plant

(Knultzon et al., 1992) Proc. Nat. Acad. Sci. USA 89:2624.

(B) Decreased phytate content

(I) Introduction of a phytase-encoding gene, such as the Aspergillus niger phytase gene (Van Hartingsveldt et al., 1993 Gene 127:87), enhances breakdown of phytate, adding more free phosphate to the transformed plant.

(2) A gene could be introduced that reduces phytate content. In maize, this, for example, could be accomplished by cloning and then reintroducing DNA associated with the single allele which is responsible for maize mutants characterized by low levels of phytic acid (Raboy et al., 1990 Maydica 35:383).

(C) Modified carbohydrate composition effected, for example, by transforming plants with a gene coding for an enzyme that alters the branching pattern of starch. Examples of such enzymes include, Streptococcus mucus fructosyltransferase gene (Shiroza et al., 1988) J.

Bacteriol. 170:810, Bacillus subtilis levansucrase gene (Steinmetz et al., 1985 Mol. Gen. Genel. 200:220), Bacillus licheniformis a-amylase (Pen et al., 1992 Bio/Technology 10:292), tomato invertase genes (Elliot et al., 1993), barley amylase gene (Sogaard et al., 1993 J. Biol. Chem.

268:22480), and maize endosperm starch branching enzyme II (Fisher et al., 1993 Plant Physiol. 102: 10450). Transformation

Suitable methods for transformation of plants include any method that DNA can be introduced into a cell, for example and without limitation: electroporation {see, e.g., U.S. Patent 5,384,253); micro-projectile bombardment {see, e.g., U.S. Patents 5,015,580; 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,403,865); Agwbacterium-mediated transformation {see, e.g., U.S. Patents 5,635,055; 5,824,877; 5,591,616; 5,981,840; and 6,384,301); and protoplast transformation {see, e.g., U.S. Patent 5,508,184). These methods may be used to stably transform or transiently transform a plant.

A DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as agitation with silicon carbide fibers {See, e.g., U.S. Patents 5,302,523 and 5,464,765), or the DNA constructs can be introduced directly to plant tissue using biolistic methods, such as DNA particle bombardment (see, e.g., Klein et ah, (1987) Nature 327:70-73). Alternatively, the DNA construct can be introduced into the plant cell via nanoparticle transformation (see, e.g., U.S. Patent Publication No. 2009/0104700, incorporated herein by reference in its entirety).

In addition, gene transfer may be achieved using non-Agrobacterium bacteria or viruses such as Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus and/or tobacco mosaic virus, see, e.g., Chung et al. (2006) Trends Plant Sci. 11(1): 1-4.

Through the application of transformation techniques, cells of virtually any plant species may be stably transformed, and these cells may be developed into transgenic plants by well-known techniques. For example, techniques that may be particularly useful in the context of cotton transformation are described in U.S. Patents 5,846,797; 5,159,135; 5,004,863; and 6,624,344;

techniques for transforming Brassica plants in particular are described, for example, in U.S. Patent 5,750,871; techniques for transforming soy bean are described, for example, in U.S. Patent

6,384,301; and techniques for transforming maize are described, for example, in U.S. Patents 7,060,876 and 5,591,616, and International PCT Publication WO 95/06722.

After effecting delivery of an exogenous nucleic acid to a recipient cell, a transformed cell is generally identified for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable marker gene with the transformation vector used to generate the transformant. In an illustrative embodiment, a transformed cell population can be assayed by exposing the cells to a selective agent or agents, or the cells can be screened for the desired marker gene trait. Cells that survive exposure to a selective agent, or cells that have been scored positive in a screening assay, may be cultured in media that supports regeneration of plants. In an embodiment, any suitable plant tissue culture media may be modified by including further substances, such as growth regulators. Tissue may be maintained on a basic media with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g. , at least 2 weeks), then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturity.

To confirm the presence of a desired nucleic acid comprising constructs provided in regenerating plants, a variety of assays may be performed. Such assays may include: molecular biological assays, such as Southern and Northern blotting and PCR; biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISA, western blots, and/or LC-MS MS spectrophotometry) or by enzymatic function; plant part assays, such as leaf or root assays; and/or analysis of the phenotype of the whole regenerated plant.

Transgenic events may be screened, for example, by PCR amplification using, e.g., oligonucleotide primers specific for nucleic acid molecules of interest. PCR genotyping is understood to include, but not be limited to, polymerase-chain reaction (PCR) amplification of genomic DNA derived from isolated host plant callus tissue predicted to contain a nucleic acid molecule of interest integrated into the genome, followed by standard cloning and sequence analysis of PCR amplification products. Methods of PCR genotyping have been well described (see, e.g., Rios et al. (2002) Plant J. 32:243-53), and may be applied to genomic DNA derived from any plant species or tissue type, including cell cultures. Combinations of oligonucleotide primers that bind to both target sequence and introduced sequence may be used sequentially or multiplexed in PCR amplification reactions. Oligonucleotide primers designed to anneal to the target site, introduced nucleic acid sequences, and/or combinations of the two may be produced. Thus, PCR genotyping strategies may include, for example and without limitation: amplification of specific sequences in the plant genome; amplification of multiple specific sequences in the plant genome; amplification of non-specific sequences in the plant genome; and combinations of any of the foregoing. One skilled in the art may devise additional combinations of primers and amplification reactions to interrogate the genome. For example, a set of forward and reverse oligonucleotide primers may be designed to anneal to nucleic acid sequence(s) specific for the target outside the boundaries of the introduced nucleic acid sequence. Forward and reverse oligonucleotide primers may be designed to anneal specifically to an introduced nucleic acid molecule, for example, at a sequence corresponding to a coding region within a nucleotide sequence of interest comprised therein, or other parts of the nucleic acid molecule. Primers may be used in conjunction with primers described herein. Oligonucleotide primers may be synthesized according to a desired sequence and are commercially available (e.g., from Integrated DNA Technologies, Inc., Coralville, IA). Amplification may be followed by cloning and sequencing, or by direct sequence analysis of amplification products. In an

embodiment, oligonucleotide primers specific for the gene target are employed in PCR

amplifications.

Method of Expressing a Transgene

In an embodiment, a method of expressing at least one transgene in a plant comprises growing a plant comprising a chimeric promoter operably linked to at least one transgene. In an embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant comprising a chimeric promoter operably linked to at least one transgene. In an embodiment, a method of expressing at least one transgene in a plant comprises growing a plant tissue or plant cell comprising a chimeric promoter operably linked to at least one transgene. In an embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a chimeric promoter operably linked to at least one transgene.

In an embodiment, a method of expressing at least one transgene in a plant comprises growing a plant comprising a gene expression cassette comprising a chimeric promoter operably linked to at least one transgene.

In an embodiment, a method of expressing at least one transgene in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette a chimeric promoter operably linked to at least one transgene.

In an embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a chimeric promoter operably linked to a transgene. Wherein, the chimeric promoter is comprised of an upstream-promoter, intron and 5' -UTR. In an embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising an upstream-promoter, intron, and 5'- UTR. In an embodiment, the upstream-promoter, intron, and 5' -UTR is a polynucleotide of SEQ ID NO: 1. In an embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a upstream-promoter, intron, and 5' -UTR, wherein the upstream-promoter, intron, and 5'-UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID NO: 1. In an illustrative embodiment, a plant, plant tissue, or plant cell comprising a gene expression cassette comprising a upstream-promoter, intron, and 5'- UTR that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.

In an embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a chimeric promoter operably linked to a transgene. Wherein, the chimeric promoter is comprised of an upstream-promoter, intron and 5' -UTR. The upstream-promoter, intron, and 5' - UTR can be operably linked to different transgenes within a gene expression cassette when a gene expression cassette includes two or more transgenes. In an illustrative embodiment, a gene expression cassette comprises an upstream-promoter, intron and 5' -UTR that is operably linked to a transgene, wherein the transgene can be an insecticidal resistance transgene, an herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA binding transgene, a selectable marker transgene, or combinations thereof.

In an embodiment, transgene expression using methods described herein is preferably expressed within a plant's root tissues. In an embodiment, transgene expression includes more than one transgene expressed in the plant's root tissues. In an embodiment, a method of growing a transgenic plant as described herein includes root-preferred transgene expression. In an

embodiment, a method of expressing a transgene in a plant tissue or plant cell includes root- preferred tissues and root-preferred cells. In an embodiment, the root-preferred expression includes maize root-preferred expression.

In an embodiment, a plant, plant tissue, or plant cell comprises a vector comprising a chimeric gene promoter regulatory element as disclosed herein. In an embodiment, a plant, plant tissue, or plant cell comprises a vector comprising a chimeric gene promoter regulatory element as disclosed herein operably linked to a transgene. In an embodiment, a plant, plant tissue, or plant cell comprises a vector comprising a gene expression cassette as disclosed herein. In an embodiment, a vector can be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, or a virus fragment.

In an embodiment, a plant, plant tissue, or plant cell according to the methods disclosed herein can be monocotyledons. The monocotyledon plant, plant tissue, or plant cell can be, but not limited to corn, rice, wheat, sugarcane, barley, rye, sorghum, orchids, bamboo, banana, cattails, lilies, oat, onion, millet, and triticale. In an embodiment, a plant, plant tissue, or plant cell according to the methods disclosed herein can be dicotyledons. The dicotyledon plant, plant tissue, or plant cell can be, but not limited to rapeseed, canola, Indian mustard, Ethiopian mustard, soybean, sunflower, and cotton.

With regard to the production of genetically modified plants, methods for the genetic engineering of plants are well known in the art. For instance, numerous methods for plant transformation have been developed, including biological and physical transformation protocols for dicotyledonous plants as well as monocotyledonous plants (e.g., Goto-Fumiyuki et al., Nature Biotech 77:282-286 (1999); Miki et al., Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 67-88 (1993)). In addition, vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available, for example, in Gruber et al., Methods in Plant

Molecular Biology and Biotechnology, Glick, B. R. and Thompson, J. E. Eds., CRC Press, Inc., Boca Raton, pp. 89-119 (1993).

One of skill in the art will recognize that after the exogenous sequence is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed.

A transformed plant cell, callus, tissue or plant may be identified and isolated by selecting or screening the engineered plant material for traits encoded by the marker genes present on the transforming DNA. For instance, selection can be performed by growing the engineered plant material on media containing an inhibitory amount of the antibiotic or herbicide to which the transforming gene construct confers resistance. Further, transformed cells can also be identified by screening for the activities of any visible marker genes (e.g., the yfp, gfp, β- glucuronidase, luciferase, B or CI genes) that may be present on the recombinant nucleic acid constructs. Such selection and screening methodologies are well known to those skilled in the art.

Physical and biochemical methods also may be used to identify plant or plant cell transformants containing inserted gene constructs. These methods include but are not limited to:

1) Southern analysis or PCR amplification for detecting and determining the structure of the recombinant DNA insert; 2) Northern blot, S 1 RNase protection, primer-extension or reverse transcriptase-PCR amplification for detecting and examining RNA transcripts of the gene constructs; 3) enzymatic assays for detecting enzyme or ribozyme activity, where such gene products are encoded by the gene construct; 4) next generation sequencing (NGS) analysis; 5) protein gel electrophoresis, western blot techniques, immunoprecipitation, or enzyme-linked immunosorbent assay (ELISA), where the gene construct products are proteins. Additional techniques, such as in situ hybridization, enzyme staining, and immunostaining, also may be used to detect the presence or expression of the recombinant construct in specific plant organs and tissues. The methods for doing all these assays are well known to those skilled in the art.

Effects of gene manipulation using the methods disclosed herein can be observed by, for example, Northern blots of the RNA (e.g., mRNA) isolated from the tissues of interest.

Typically, if the mRNA is present or the amount of mRNA has increased, it can be assumed that the corresponding transgene is being expressed. Other methods of measuring gene and/or encoded polypeptide activity can be used. Different types of enzymatic assays can be used, depending on the substrate used and the method of detecting the increase or decrease of a reaction product or by-product. In addition, the levels of polypeptide expressed can be measured immunochemically, i.e., ELISA, RIA, EIA and other antibody based assays well known to those of skill in the art, such as by electrophoretic detection assays (either with staining or western blotting). As one non-limiting example, the detection of the AAD-1 (aryloxyalkanoate dioxygenase; see WO 2005/107437) and PAT (phosphinothricin-N-acetyl-transferase) proteins using an ELISA assay is described in U.S. Patent Publication No. 20090093366 which is herein incorporated by reference in its entirety. The transgene may be selectively expressed in some cell types or tissues of the plant or at some developmental stages, or the transgene may be expressed in substantially all plant tissues, substantially along its entire life cycle. However, any combinatorial expression mode is also applicable.

The present disclosure also encompasses seeds of the transgenic plants described above wherein the seed comprises the transgene or gene expression cassette. The present disclosure further encompasses the progeny, clones, cell lines or cells of the transgenic plants described above wherein said progeny, clone, cell line or cell comprise the transgene or gene construct.

While the invention has been described with reference to specific methods and embodiments, it will be appreciated that various modifications and changes may be made without departing from the invention.

EXAMPLES

Example 1: Novel chimeric gene promoter regulatory elements

The chimeric promoter sequences are made up of an up stream-promoter polynucleotide sequence that was obtained from Zea mays Peroxidase 5 followed by the Zea mays alcohol dehydrogenase (I) intron 6 and Maize Streak Virus 5' -UTR. The 1,642 bp Zea mays Peroxidase

5 upstream promoter sequence (SEQ ID NO:2), is shown with underlining. The 117 bp Maize Streak Virus 5' -UTR (also referred to as a leader sequence) sequence (SEQ ID NO:3) is show in lower case font. The 341 bp Zea mays alcohol dehydrogenase (I) intron 6 sequence (SEQ ID NO:4) is italicized.

ACCACTGTTGTAACTTGTAAGCCACTAGCTCACGTTCTCCATGAGCTCTTCTC TCTGCTGTTTCTTCCTCTGCTAACTGCGTTATGATATGACGTCGTATAAATAAT CTCACAATACTTCCTTATTTTCAGCATGGCCTCTTTTATGTTTATTTAACAGTA GCAACCAACGCCGCTCGATGTTTCCTTCAAGAAACGGCCACTCACTATGTGG TGTGCAGAAGAACAAATGTAAGCAGCTCCTACAGGTACCAGTAGTCATGTCA GTGTGGAAGCTTTCCAACCAACGCCTCCTTCGAGGAACCTGGTCGTGCTGAC ATGAATGTAGGCCATGCAAGCACAAGCACCTAACGCGAATCATCACGACGCG CCGTGTACTGGGCGTTGGTACATCACACCCCGCGTTTGACCTGATCGGAAGC ATGCGTGTGTGTTGGCTGCAGGACCGGCTATAGGTTTCCTGCATTGGACAGCA GAAGCCAGTCATGTTAGGCACTCACGCGCTCCTGCCGTTTGATGAATCATCCG GTCTTTCGTATTGATCACTAGTTCACTACGCTGATATAGCAAATTTTAAGATG TGAAACCACGAGACGAGCGATAAATCTTAGACGTTACCTATCCATATGAAGC TTGTGCGAAAAAAAGGCGTGCCGCTGTAGCATCATTCGTATACACTTTTGTCC CCAAAGACAGGGATACGAATCCATGCTCGACAGAACCCTCCCTTCCCTGCAG ATAACGACACTTAAGTATAACAAAAGTAGTTGGATTATTTCAGAAGCAAAAT CTCACTTTTCGCTGGCCTTTTTGTACTTTGGTTACTTGAGTTCAGACAGTGTAT GCTATATTGTCATGTGCTGCGTAAGGTTTAAATATGGTTCGACAAATATATCA GTATATCACTACTTTGTTATGGGTGGGGCCTAGCACAAACTTGATACAGCTAG GATAAAGTTAGAACGATGACTGATCTACTGTAAAGCGACACCTGTCCTGTTA TGGTAGTTTAAGTCCATTCCTGGACGACTCCAGATCCAGGATATGATGCTGTT ACATAATGCGATTGTTCACAATAAAATTGCATGATGTTCTTCTACTCTTTAGG CAGTTTTGTTCAACAGGCAAGTTGCATAATGCATGTGCATATATGAGCAGCAT AATCATCAATTAATCATAGGTTCGTCATTTTAGTTTCACTCCTTCACATTATTC CAGCCCTTGAAGAAAAATGTAGCAGTGCTTGCTGTTTAATAAGTGGCAGAGC TGTTTTCACTCCACCTACGCTTGTCTAGGACCAAAATTTTAATCTGTCACTTTG AGCTAAAACTGAAGCACCAAACCGCTACAAAAGAACGTAGGAGCTGAATTG TAACTTGATGGGATTACTATAGCAGTTGCTACAGTTCTAGCTAGCTACCTTAT TCTATACGCATCACCCTAACAACCCGGCTGACTGCTGCATCTGACCCCACCGT CCCCTGCTCCAAACCAACTCTCCTTTCCTTGCATGCACTACACCCACTTCCTG CAGCTATATATACCACCATATGCCCATCTTATGAAACCATCCACAAGAGGAG

AAGAAACAATCAACCAGCAACACTCTTCTCTTATAACATAGTACAGCGAAGG TAACTCACGGTACCctgaaggctcgacaaggcagtccacggaggagctgatatttggtggacaagctgtggatag gagcaaccctatccctaatataccagcaccaccaagtcagggcaatccccagatcaCCCCAGCAGATTCGAAG A AGG A CA GTA CA CA CA CA TGTA TA TA TGTA TGA TGTA TCCCTTCGA TCGAA GGCA TGCCTTGGTA TAA TCA CTGA GTA GTCA TTTTA TTA CTTTGTTTTGA CAA GTCA GTAGT

A TAA CTGA GTA GTCA TTTTA TTA CGTTGTTTCGA CAA GTCA GTA GCTCA TCCA TCTGT CCCA TTTTTTCA GCTA GGAA GTTTGGTTGCA CTGGCCTTGGA CTAA TAA CTGA TTA G TCA TTTTA TTA CA TTGTTTCGA CAA GTCA GTA GCTCA TCCA TCTGTCCCA TTTTTCA G CTAGGAAGTTCGGATCTGGGGCCATTTGTTCCAGGCACGGGATAAGCATTCA

G (SEQ ID NO: 1)

Example 2: Construct design

Unless otherwise indicated, molecular biological and biochemical manipulations described in this and subsequent Examples were performed by standard methodologies as disclosed in, for example, Ausubel et al. (1995), and Sambrook et al. (1989), and updates thereof. The constructs used in the experiments (TABLE 1) are described in greater detail below.

Construct pDAS5144 (e.g. pDAB3620) was built containing two gene expression cassettes. The first gene expression cassette (SEQ ID NO:5) contained the Zea mays Peroxidase 5 up stream-promoter (International Patent App. No. 1998/056921) followed by the Zea mays alcohol dehydrogenase (I) intron 6 (Dennis et al., (1984) Nucleic Acids Res. 12:3983-4000) and Maize Streak Virus 5' -UTR (Mullineaux et al., (1984) EMBO J. 3:3063-3068) operably linked to the tcdA transgene (U.S. Patent App. No. 2009/0221501) and flanked by the Zea mays

Peroxidase 5 3' -UTR (International Patent App. No. 1998/056921). The second gene expression cassette contained a selectable marker gene and was made up of the Oryza sativa Actin promoter (U.S. Patent No. 6,429,357) operably linked to a phosphinothricin acetyl transferase (Wohlleben et al., (1988) Gene 70: 25-37) transgene and terminated by the Zea mays Lipase 3' -UTR (U.S. Patent No. 7,179,902). This construct was mobilized into the Superbinary pSBl binary vector

(Japan Tobacco, Tokyo, JP). The constructs used to complete pDAS5144 were molecularly confirmed via restriction enzyme digestion and DNA sequencing.

TACAAAAAAGCAGGCTCCGCAAGCTTGCATGCCTGCAGATCCCCGGGGATCT

CCGCGGGGGCCCACCACTGTTGTAACTTGTAAGCCACTAGCTCACGTTCTCCA TGAGCTCTTCTCTCTGCTGTTTCTTCCTCTGCTAACTGCGTTATGATATGACGT CGTATAAATAATCTCACAATACTTCCTTATTTTCAGCATGGCCTCTTTTATGTT TATTTAACAGTAGCAACCAACGCCGCTCGATGTTTCCTTCAAGAAACGGCCA CTCACTATGTGGTGTGCAGAAGAACAAATGTAAGCAGCTCCTACAGGTACCA GTAGTCATGTCAGTGTGGAAGCTTTCCAACCAACGCCTCCTTCGAGGAACCTG GTCGTGCTGACATGAATGTAGGCCATGCAAGCACAAGCACCTAACGCGAATC ATCACGACGCGCCGTGTACTGGGCGTTGGTACATCACACCCCGCGTTTGACCT GATCGGAAGCATGCGTGTGTGTTGGCTGCAGGACCGGCTATAGGTTTCCTGC ATTGGACAGCAGAAGCCAGTCATGTTAGGCACTCACGCGCTCCTGCCGTTTG ATGAATCATCCGGTCTTTCGTATTGATCACTAGTTCACTACGCTGATATAGCA AATTTTAAGATGTGAAACCACGAGACGAGCGATAAATCTTAGACGTTACCTA TCCATATGAAGCTTGTGCGAAAAAAAGGCGTGCCGCTGTAGCATCATTCGTA TACACTTTTGTCCCCAAAGACAGGGATACGAATCCATGCTCGACAGAACCCT CCCTTCCCTGCAGATAACGACACTTAAGTATAACAAAAGTAGTTGGATTATTT CAGAAGCAAAATCTCACTTTTCGCTGGCCTTTTTGTACTTTGGTTACTTGAGTT CAGACAGTGTATGCTATATTGTCATGTGCTGCGTAAGGTTTAAATATGGTTCG ACAAATATATCAGTATATCACTACTTTGTTATGGGTGGGGCCTAGCACAAACT TGATACAGCTAGGATAAAGTTAGAACGATGACTGATCTACTGTAAAGCGACA CCTGTCCTGTTATGGTAGTTTAAGTCCATTCCTGGACGACTCCAGATCCAGGA TATGATGCTGTTACATAATGCGATTGTTCACAATAAAATTGCATGATGTTCTT CTACTCTTTAGGCAGTTTTGTTCAACAGGCAAGTTGCATAATGCATGTGCATA TATGAGCAGCATAATCATCAATTAATCATAGGTTCGTCATTTTAGTTTCACTC CTTCACATTATTCCAGCCCTTGAAGAAAAATGTAGCAGTGCTTGCTGTTTAAT AAGTGGCAGAGCTGTTTTCACTCCACCTACGCTTGTCTAGGACCAAAATTTTA ATCTGTCACTTTGAGCTAAAACTGAAGCACCAAACCGCTACAAAAGAACGTA GGAGCTGAATTGTAACTTGATGGGATTACTATAGCAGTTGCTACAGTTCTAGC TAGCTACCTTATTCTATACGCATCACCCTAACAACCCGGCTGACTGCTGCATC TGACCCCACCGTCCCCTGCTCCAAACCAACTCTCCTTTCCTTGCATGCACTAC ACCCACTTCCTGCAGCTATATATACCACCATATGCCCATCTTATGAAACCATC CACAAGAGGAGAAGAAACAATCAACCAGCAACACTCTTCTCTTATAACATAG TACAGCGAAGGTAACTCACGGTACCCTGAAGGCTCGACAAGGCAGTCCACGG AGGAGCTGATATTTGGTGGACAAGCTGTGGATAGGAGCAACCCTATCCCTAA TATACCAGCACCACCAAGTCAGGGCAATCCCCAGATCACCCCAGCAGATTCG AAGAAGGTACAGTACACACACATGTATATATGTATGATGTATCCCTTCGATC GAAGGCATGCCTTGGTATAATCACTGAGTAGTCATTTTATTACTTTGTTTTGA CAAGTCAGTAGTTCATCCATTTGTCCCATTTTTTCAGCTTGGAAGTTTGGTTGC ACTGGCACTTGGTCTAATAACTGAGTAGTCATTTTATTACGTTGTTTCGACAA GTCAGTAGCTCATCCATCTGTCCCATTTTTTCAGCTAGGAAGTTTGGTTGCAC TGGCCTTGGACTAATAACTGATTAGTCATTTTATTACATTGTTTCGACAAGTC AGTAGCTCATCCATCTGTCCCATTTTTCAGCTAGGAAGTTCGGATCTGGGGCC ATTTGTTCCAGGCACGGGATAAGCATTCAGCCATGGCTAATGAGTCAGTCAA GGAGATCCCGGATGTTCTCAAATCCCAGTGTGGTTTCAACTGCCTCACGGACA TCTCCCACAGCTCATTCAATGAGTTCCGCCAGCAAGTCTCTGAGCACCTCTCA TGGTCGGAGACGCATGACCTCTACCACGATGCTCAGCAAGCCCAGAAAGACA ACCGGCTGTATGAGGCACGGATCCTCAAGAGGGCCAACCCGCAGCTCCAGAA TGCGGTCCACCTCGCCATCCTTGCTCCAAATGCGGAATTGATTGGCTACAATA ACCAATTCTCGGGAAGGGCCTCACAGTATGTTGCGCCTGGCACAGTTTCGTCC ATGTTCAGCCCAGCAGCGTACCTCACAGAGCTGTACAGAGAGGCGAGGAACC TTCATGCGTCTGACTCCGTGTACTATCTGGACACACGCAGACCGGACCTGAA GTCAATGGCCCTCAGCCAGCAAAACATGGACATTGAACTGTCCACCCTTTCCT TGAGCAATGAGCTTCTGTTGGAATCCATCAAGACTGAGAGCAAGCTGGAAAA CTACACAAAGGTGATGGAGATGCTGTCCACCTTCAGACCATCTGGAGCGACT CCATACCACGATGCCTATGAGAATGTGAGGGAGGTCATTCAGCTTCAAGACC CTGGCCTTGAGCAGCTCAATGCCAGCCCAGCCATTGCGGGACTGATGCACCA AGCCTCCCTGCTTGGGATCAATGCCTCCATCAGCCCTGAGCTGTTCAACATCT TGACTGAAGAGATCACTGAGGGCAATGCGGAGGAACTGTACAAGAAAAACT TCGGCAACATTGAGCCTGCCAGCCTTGCAATGCCGGAATACCTGAAACGCTA TTACAACTTGTCGGATGAGGAACTTTCGCAGTTCATTGGCAAAGCCTCAAACT TTGGGCAGCAAGAGTACAGCAACAATCAGCTCATCACACCTGTTGTGAACTC ATCTGATGGCACTGTGAAGGTTTACCGCATCACAAGGGAGTACACCACAAAT GCCTACCAGATGGATGTTGAACTGTTCCCGTTTGGAGGTGAAAACTACCGGC TTGACTACAAGTTCAAGAACTTCTACAATGCATCCTACCTGTCGATCAAGCTG AACGACAAACGGGAGCTTGTGAGGACGGAAGGTGCTCCCCAAGTGAACATT GAATACTCTGCCAACATCACACTCAACACAGCGGACATCAGCCAGCCGTTTG AAATTGGCTTGACCAGAGTGCTTCCCTCGGGCTCCTGGGCCTATGCGGCAGC CAAGTTTACGGTTGAGGAGTACAACCAGTACAGCTTCCTCCTGAAGCTCAAC AAGGCAATCCGGCTGAGCAGAGCCACTGAGCTGTCACCCACCATCCTGGAGG GCATTGTGAGGTCTGTCAACCTTCAGCTTGACATCAACACTGATGTGCTTGGC AAGGTGTTCCTGACCAAGTATTACATGCAGCGCTATGCCATCCATGCGGAGA CGGCACTGATCCTCTGCAATGCACCCATATCGCAGCGCTCGTATGACAACCA GCCCAGCCAGTTCGACAGACTCTTCAACACTCCCCTTCTGAACGGCCAGTACT TCAGCACTGGAGATGAAGAGATTGACCTGAACTCTGGCTCGACGGGTGACTG GAGGAAAACCATCTTGAAGAGGGCCTTCAACATTGATGACGTTTCCCTCTTCC GCCTTTTGAAGATCACAGATCACGACAACAAGGATGGCAAGATCAAGAACA ATCTCAAGAACCTTTCCAACCTCTACATTGGCAAACTGCTTGCAGACATCCAC CAGCTGACCATTGATGAGTTGGACCTGTTGCTGATTGCAGTTGGTGAGGGCA AGACCAACCTCTCTGCAATCTCAGACAAACAGTTGGCAACCCTCATCCGCAA GCTGAACACGATCACAAGCTGGCTTCACACGCAGAAGTGGTCTGTTTTCCAA CTGTTCATCATGACCAGCACGTCCTACAACAAGACCCTGACTCCGGAGATCA AGAACCTTTTGGATACAGTCTATCATGGTCTCCAAGGCTTTGACAAGGACAA GGCGGACCTGCTTCATGTCATGGCACCCTACATTGCAGCCACACTCCAGCTCT CCTCTGAAAATGTTGCCCACTCAGTGCTGTTGTGGGCTGACAAGCTCCAGCCT GGGGATGGAGCCATGACTGCTGAGAAGTTCTGGGACTGGCTCAACACGAAGT ACACACCTGGCTCCTCTGAGGCAGTTGAGACTCAAGAACACATTGTGCAGTA CTGCCAAGCGCTTGCACAGTTGGAGATGGTTTACCACTCAACTGGCATCAAC GAGAATGCCTTCCGCCTCTTTGTCACAAAGCCTGAGATGTTTGGTGCTGCCAC TGGAGCCGCTCCTGCCCATGATGCCCTGTCACTCATCATGTTGACGAGGTTTG CAGACTGGGTCAACGCCCTTGGTGAGAAAGCCTCGTCTGTCCTGGCAGCCTTT GAAGCCAACTCCCTGACTGCGGAACAGCTTGCGGATGCCATGAACCTTGATG CCAACTTGCTCCTGCAAGCTTCGATCCAAGCCCAGAACCATCAGCATTTGCCA CCTGTCACGCCTGAAAATGCGTTCTCATGCTGGACCTCCATCAACACCATACT CCAGTGGGTGAACGTGGCGCAACAGCTCAATGTGGCACCTCAAGGAGTGTCA GCGCTGGTTGGGCTTGACTACATCCAGTCCATGAAGGAGACACCGACCTACG CGCAGTGGGAGAATGCAGCTGGCGTCTTGACAGCTGGTCTGAACTCACAGCA AGCCAACACGCTGCATGCGTTCTTGGATGAGAGCCGCTCTGCTGCCCTCAGC ACGTACTATATCCGGCAAGTTGCCAAGGCAGCGGCTGCCATCAAGTCTCGGG ATGACCTCTACCAGTACTTGCTCATTGACAATCAGGTTTCTGCTGCCATCAAA ACGACCCGGATTGCTGAGGCCATAGCCAGCATCCAGCTCTACGTCAACAGAG CGCTTGAGAACGTTGAAGAGAATGCCAACTCTGGAGTGATTTCTCGCCAGTTT TTCATAGACTGGGACAAGTACAACAAGCGCTACTCCACCTGGGCTGGGGTCT CTCAGCTTGTCTACTATCCTGAGAACTACATAGATCCGACGATGCGGATTGGC CAGACCAAGATGATGGATGCCCTCCTTCAGTCGGTGTCCCAGAGCCAGCTCA ATGCTGACACTGTGGAGGATGCCTTCATGAGCTACCTCACCTCCTTCGAGCAA GTTGCCAACCTCAAGGTCATCTCTGCTTACCACGACAACATCAACAATGACC AAGGGCTCACCTACTTCATTGGCCTGTCTGAAACTGATGCGGGTGAGTATTAC TGGCGCTCAGTGGACCACAGCAAGTTCAACGATGGCAAGTTTGCTGCAAATG CCTGGTCTGAGTGGCACAAGATTGACTGCCCCATCAACCCGTACAAGTCCAC CATCAGACCTGTCATCTACAAGAGCCGCTTGTACTTGCTCTGGCTTGAGCAGA AGGAAATCACGAAGCAGACTGGCAACTCCAAAGATGGCTACCAGACTGAGA CGGACTACCGCTATGAGTTGAAACTTGCTCACATCCGCTATGATGGTACATGG AACACTCCGATAACGTTTGATGTGAACAAGAAGATTTCGGAGCTGAAACTGG AGAAGAACAGAGCGCCTGGGCTCTACTGTGCTGGCTACCAAGGGGAAGATAC GCTGTTGGTGATGTTCTACAACCAGCAAGACACCCTTGACTCGTACAAGAAC GCTTCCATGCAAGGCCTCTACATCTTTGCTGACATGGCTTCCAAAGACATGAC TCCGGAGCAGAGCAATGTCTACCGGGACAACTCCTACCAGCAATTTGACACC AACAATGTTCGGAGGGTCAATAACCGCTATGCGGAAGATTATGAGATCCCAA GCTCAGTGTCTAGCCGCAAGGACTATGGCTGGGGAGACTACTATCTCAGCAT GGTGTACAATGGTGACATACCCACGATCAACTACAAGGCTGCCTCCTCAGAC CTGAAGATATACATCAGCCCCAAGCTCCGCATCATTCACAATGGCTATGAGG GCCAGAAGAGGAACCAGTGCAACTTGATGAACAAGTATGGCAAACTTGGGG ACAAGTTCATTGTCTACACCTCGCTTGGTGTGAACCCGAACAATTCCTCGAAC AAGCTCATGTTCTACCCGGTCTACCAGTACAGCGGCAACACCTCTGGCTTGA ACCAAGGGAGGCTCCTGTTCCACAGAGACACCACGTACCCGAGCAAGGTGG AGGCGTGGATTCCTGGTGCCAAAAGGTCACTCACCAACCAGAATGCAGCCAT TGGTGATGACTATGCCACAGACAGCCTGAACAAGCCTGATGACCTGAAGCAG TACATCTTCATGACTGACTCCAAGGGCACAGCCACTGATGTGTCTGGTCCGGT GGAGATCAACACTGCAATCAGCCCAGCCAAGGTCCAAATCATTGTCAAAGCT GGTGGCAAGGAACAGACCTTCACAGCTGACAAAGATGTGAGCATCCAGCCA AGCCCCTCCTTTGATGAGATGAACTACCAGTTCAACGCTCTTGAAATTGATGG CTCGGGACTCAACTTCATCAACAATTCGGCTTCAATTGATGTGACGTTCACTG CCTTTGCGGAGGATGGGAGGAAATTGGGCTATGAGAGCTTCTCAATACCAGT CACCTTGAAGGTTTCCACTGACAATGCACTCACGCTTCATCACAACGAGAAT GGAGCGCAGTACATGCAATGGCAGAGCTACCGCACAAGGTTGAACACCCTCT TTGCAAGGCAACTTGTGGCCAGAGCCACGACTGGCATTGACACCATACTCAG CATGGAAACGCAGAACATCCAAGAGCCACAGTTGGGCAAGGGTTTCTATGCC ACCTTTGTGATCCCACCCTACAACCTGTCAACGCATGGTGATGAGCGCTGGTT CAAGCTGTACATCAAGCACGTGGTTGACAACAATTCCCACATCATATACTCG GGTCAGCTCACTGACACGAACATCAACATCACCCTGTTCATCCCACTTGATGA CGTTCCCCTGAACCAAGACTACCATGCCAAGGTCTACATGACCTTCAAGAAA TCACCGTCAGATGGCACCTGGTGGGGACCGCACTTCGTTCGGGATGACAAAG GCATTGTCACAATCAACCCCAAGTCCATACTCACCCACTTTGAGTCTGTGAAT GTTCTGAATAACATCTCCTCAGAGCCGATGGACTTCTCGGGTGCCAACTCCCT GTACTTCTGGGAGTTGTTCTATTACACGCCGATGCTTGTGGCGCAGAGGTTGC TCCATGAACAGAACTTTGATGAGGCCAACCGCTGGCTCAAGTATGTCTGGAG CCCCTCGGGTTACATTGTGCATGGCCAGATCCAGAACTACCAATGGAATGTTC GCCCATTGCTTGAGGACACCTCCTGGAACTCTGACCCCCTTGACTCGGTGGAC CCTGATGCGGTGGCTCAGCATGACCCCATGCACTACAAGGTCTCAACCTTCAT GAGGACCCTGGACCTTCTGATTGCCAGAGGAGACCATGCTTACCGCCAATTG GAACGGGACACACTGAATGAGGCAAAGATGTGGTACATGCAAGCTCTGCACC TCTTGGGAGACAAGCCGTACCTCCCGCTCAGCACCACATGGTCAGACCCAAG GTTGGACAGAGCAGCTGACATCACAACTCAGAATGCTCATGACTCTGCCATT GTGGCTCTGAGGCAGAACATCCCAACACCTGCGCCACTGTCGCTGAGATCTG CGAACACCCTGACAGACCTGTTCCTCCCCCAGATCAATGAGGTCATGATGAA CTACTGGCAAACCTTGGCGCAGCGGGTCTACAACCTCCGCCACAACCTCTCC ATTGATGGGCAGCCGCTGTACCTCCCAATCTATGCCACACCAGCTGACCCAA AGGCGCTTCTCAGCGCAGCTGTGGCCACGAGCCAAGGGGGAGGCAAGCTCCC TGAGAGCTTCATGTCGCTCTGGAGGTTTCCCCACATGTTGGAGAATGCCAGA GGCATGGTGAGCCAACTGACTCAGTTTGGCTCGACGCTCCAGAACATCATTG AGAGGCAAGATGCAGAGGCTCTGAATGCGTTGCTCCAGAATCAAGCAGCTGA GTTGATCCTGACGAACCTGTCAATCCAAGACAAGACCATTGAGGAACTTGAT GCGGAAAAGACAGTCCTTGAAAAGAGCAAGGCTGGAGCCCAAAGCCGGTTC GACTCATATGGCAAGCTGTATGATGAGAACATCAATGCTGGGGAGAATCAAG CCATGACCCTGAGGGCTTCAGCAGCGGGTCTGACCACGGCAGTGCAAGCGTC TCGCTTGGCTGGGGCTGCGGCTGACCTCGTTCCCAACATCTTTGGGTTTGCTG GTGGCGGATCAAGGTGGGGAGCCATTGCAGAAGCAACGGGCTATGTGATGG AGTTCTCTGCCAATGTCATGAACACTGAGGCAGACAAAATCAGCCAATCGGA GACCTACAGACGGAGACGGCAAGAATGGGAGATACAAAGGAACAATGCAGA GGCAGAACTGAAGCAAATAGATGCCCAACTGAAGTCCTTGGCTGTCAGAAGG GAGGCTGCGGTCCTCCAAAAGACCTCCCTCAAGACCCAGCAAGAGCAAACCC AGTCCCAGTTGGCGTTCCTCCAGAGGAAGTTCTCGAACCAAGCGCTGTACAA CTGGCTGAGGGGAAGGTTGGCAGCCATCTACTTCCAGTTCTATGACCTTGCTG TGGCCAGATGCCTCATGGCGGAACAAGCCTACCGCTGGGAACTGAATGATGA CTCTGCCAGATTCATCAAACCGGGTGCATGGCAAGGCACATATGCTGGACTC CTTGCTGGGGAGACACTCATGCTCTCATTGGCCCAGATGGAGGATGCTCACCT CAAACGGGACAAGAGGGCTCTGGAAGTGGAGCGGACAGTCAGCCTTGCGGA GGTCTATGCGGGACTGCCCAAAGACAATGGACCATTTTCGTTGGCGCAAGAG ATAGACAAGTTGGTCAGCCAAGGGTCTGGATCAGCGGGTTCTGGAAACAACA ATCTGGCGTTCGGTGCTGGCACTGACACCAAGACGTCCCTCCAAGCCTCAGT CTCCTTTGCTGACCTGAAGATAAGGGAGGACTACCCAGCGTCCCTTGGGAAG ATCAGACGCATCAAGCAGATTTCAGTGACCCTGCCAGCTCTTCTGGGTCCATA CCAAGATGTTCAAGCGATCCTCTCCTATGGGGACAAGGCTGGTTTGGCGAAT GGCTGTGAGGCCCTTGCTGTGTCACATGGCATGAATGACTCTGGGCAGTTCCA GCTTGATTTCAACGATGGCAAGTTCCTGCCATTCGAGGGCATAGCCATTGATC AAGGCACCCTGACCCTCTCCTTCCCCAATGCTTCGATGCCAGAGAAGGGAAA ACAAGCCACCATGCTCAAGACCCTGAATGATATCATACTCCACATCCGCTAC ACCATCAAGTGAGTAGTTAGCTTAATCACCTAGAGCTCGTTTAAACTGAGGG CACTGAAGTCGCTTGATGTGCTGAATTGTTTGTGATGTTGGTGGCGTATTTTG TTTAAATAAGTAAGCATGGCTGTGATTTTATCATATGATCGATCTTTGGGGTT TTATTTAACACATTGTAAAATGTGTATCTATTAATAACTCAATGTATAAGATG TGTTCATTCTTCGGTTGCCATAGATCTGCTTATTTGACCTGTGATGTTTTGACT CCAAAAACCAAAATCACAACTCAATAAACTCATGGAATATGTCCACCTGTTT CTTGAAGAGTTCATCTACCATTCCAGTTGGCATTTATCAGTGTTGCAGCGGCG CTGTGCTTTGTAACATAACAATTGTTACGGCATATATCCAACGGCCGGCCTAG GCCACGGTGGCCAGATCCACTAGAGGCGCGCCTCTAGTTCTAGAGCGGCCGC TTAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCAAATGGCGCGCCGA CCCAGCTTTC (SEQ ID NO:5)

Construct pDAS5128 (e.g. pDAB3619) was built containing two gene expression cassettes. The first gene expression cassette (SEQ ID NO:6) contained the Zea mays Ubiquitin 1 promoter (Christensen et al., (1992) Plant Molecular Biology 18; 675-689) followed by the Zea mays alcohol dehydrogenase (I) intron 6 (Dennis et al., (1984) Nucleic Acids Res. 12:3983-4000) and Maize Streak Virus 5' -UTR (Mullineaux et al., (1984) EMBO J. 3:3063-3068) operably linked to the tcdA transgene (U.S. Patent App. No. 2009/0221501) and flanked by the Zea mays

Peroxidase 5 3' -UTR (International Patent App. No. 1998/056921). The second gene expression cassette contained a selectable marker gene and was made up of the Oryza sativa Actin promoter

(U.S. Patent No. 6,429,357) operably linked to a phosphinothricin acetyl transferase (Wohlleben et al., (1988) Gene 70: 25-37) transgene and terminated by the Zea mays Lipase 3' -UTR (U.S.

Patent No. 7,179,902). This construct was mobilized into the Superbinary pSBl binary vector

(Japan Tobacco, Tokyo, JP). The constructs used to complete pDAS5128 were molecularly confirmed via restriction enzyme digestion and DNA sequencing. The novel Zea mays Ubiquitin

1 promoter followed by the Zea mays alcohol dehydrogenase (I) intron 6 and Maize Streak Virus 5' -UTR is disclosed herein as SEQ ID NO:7.

GTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGATAATGAGCATTGCATGTC

TAAGTTATAAAAAATTACCACATATTTTTTTTGTCACACTTGTTTGAAGTGCA

GTTTATCTATCTTTATACATATATTTAAACTTTACTCTACGAATAATATAATCT

ATAGTACTACAATAATATCAGTGTTTTAGAGAATCATATAAATGAACAGTTA GACATGGTCTAAAGGACAATTGAGTATTTTGACAACAGGACTCTACAGTTTT

ATCTTTTTAGTGTGCATGTGTTCTCCTTTTTTTTTGCAAATAGCTTCACCTATA

TAATACTTCATCCATTTTATTAGTACATCCATTTAGGGTTTAGGGTTAATGGTT

TTTATAGACTAATTTTTTTAGTACATCTATTTTATTCTATTTTAGCCTCTAAATT

AAGAAAACTAAAACTCTATTTTAGTTTTTTTATTTAATAGTTTAGATATAAAA TAGAATAAAATAAAGTGACTAAAAATTAAACAAATACCCTTTAAGAAATTAA

AAAAACTAAGGAAACATTTTTCTTGTTTCGAGTAGATAATGCCAGCCTGTTAA

ACGCCGTCGACGAGTCTAACGGACACCAACCAGCGAACCAGCAGCGTCGCGT

CGGGCCAAGCGAAGCAGACGGCACGGCATCTCTGTCGCTGCCTCTGGACCCC

TCTCGAGAGTTCCGCTCCACCGTTGGACTTGCTCCGCTGTCGGCATCCAGAAA TTGCGTGGCGGAGCGGCAGACGTGAGCCGGCACGGCAGGCGGCCTCCTCCTC

CTCTCACGGCACCGGCAGCTACGGGGGATTCCTTTCCCACCGCTCCTTCGCTT

TCCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCTCCACACCCTCTTTCCC

CAACCTCGTGTTGTTCGGAGCGCACACACACACAACCAGATCTCCCCCAAAT

CCACCCGTCGGCACCTCCGCTTCAAGGGTACCCTGAAGGCTCGACAAGGCAG TCCACGGAGGAGCTGATATTTGGTGGACAAGCTGTGGATAGGAGCAACCCTA

TCCCTAATATACCAGCACCACCAAGTCAGGGCAATCCCCAGATCACCCCAGC

AGATTCGAAGAAGGTACAGTACACACACATGTATATATGTATGATGTATCCC

TTCGATCGAAGGCATGCCTTGGTATAATCACTGAGTAGTCATTTTATTACTTT

GTTTTGACAAGTCAGTAGTTCATCCATTTGTCCCATTTTTTCAGCTTGGAAGTT TGGTTGCACTGGCACTTGGTCTAATAACTGAGTAGTCATTTTATTACGTTGTTT CGACAAGTCAGTAGCTCATCCATCTGTCCCATTTTTTCAGCTAGGAAGTTTGG TTGCACTGGCCTTGGACTAATAACTGATTAGTCATTTTATTACATTGTTTCGAC AAGTCAGTAGCTCATCCATCTGTCCCATTTTTCAGCTAGGAAGTTCGGATCTG GGGCCATTTGTTCCAGGCACGGGATAAGCATTCAGCCATGGCTAATGAGTCA GTCAAGGAGATCCCGGATGTTCTCAAATCCCAGTGTGGTTTCAACTGCCTCAC GGACATCTCCCACAGCTCATTCAATGAGTTCCGCCAGCAAGTCTCTGAGCAC CTCTCATGGTCGGAGACGCATGACCTCTACCACGATGCTCAGCAAGCCCAGA AAGACAACCGGCTGTATGAGGCACGGATCCTCAAGAGGGCCAACCCGCAGC TCCAGAATGCGGTCCACCTCGCCATCCTTGCTCCAAATGCGGAATTGATTGGC TACAATAACCAATTCTCGGGAAGGGCCTCACAGTATGTTGCGCCTGGCACAG TTTCGTCCATGTTCAGCCCAGCAGCGTACCTCACAGAGCTGTACAGAGAGGC GAGGAACCTTCATGCGTCTGACTCCGTGTACTATCTGGACACACGCAGACCG GACCTGAAGTCAATGGCCCTCAGCCAGCAAAACATGGACATTGAACTGTCCA CCCTTTCCTTGAGCAATGAGCTTCTGTTGGAATCCATCAAGACTGAGAGCAAG CTGGAAAACTACACAAAGGTGATGGAGATGCTGTCCACCTTCAGACCATCTG GAGCGACTCCATACCACGATGCCTATGAGAATGTGAGGGAGGTCATTCAGCT TCAAGACCCTGGCCTTGAGCAGCTCAATGCCAGCCCAGCCATTGCGGGACTG ATGCACCAAGCCTCCCTGCTTGGGATCAATGCCTCCATCAGCCCTGAGCTGTT CAACATCTTGACTGAAGAGATCACTGAGGGCAATGCGGAGGAACTGTACAAG AAAAACTTCGGCAACATTGAGCCTGCCAGCCTTGCAATGCCGGAATACCTGA AACGCTATTACAACTTGTCGGATGAGGAACTTTCGCAGTTCATTGGCAAAGC CTCAAACTTTGGGCAGCAAGAGTACAGCAACAATCAGCTCATCACACCTGTT GTGAACTCATCTGATGGCACTGTGAAGGTTTACCGCATCACAAGGGAGTACA CCACAAATGCCTACCAGATGGATGTTGAACTGTTCCCGTTTGGAGGTGAAAA CTACCGGCTTGACTACAAGTTCAAGAACTTCTACAATGCATCCTACCTGTCGA TCAAGCTGAACGACAAACGGGAGCTTGTGAGGACGGAAGGTGCTCCCCAAGT GAACATTGAATACTCTGCCAACATCACACTCAACACAGCGGACATCAGCCAG CCGTTTGAAATTGGCTTGACCAGAGTGCTTCCCTCGGGCTCCTGGGCCTATGC GGCAGCCAAGTTTACGGTTGAGGAGTACAACCAGTACAGCTTCCTCCTGAAG CTCAACAAGGCAATCCGGCTGAGCAGAGCCACTGAGCTGTCACCCACCATCC TGGAGGGCATTGTGAGGTCTGTCAACCTTCAGCTTGACATCAACACTGATGTG CTTGGCAAGGTGTTCCTGACCAAGTATTACATGCAGCGCTATGCCATCCATGC GGAGACGGCACTGATCCTCTGCAATGCACCCATATCGCAGCGCTCGTATGAC AACCAGCCCAGCCAGTTCGACAGACTCTTCAACACTCCCCTTCTGAACGGCC AGTACTTCAGCACTGGAGATGAAGAGATTGACCTGAACTCTGGCTCGACGGG TGACTGGAGGAAAACCATCTTGAAGAGGGCCTTCAACATTGATGACGTTTCC CTCTTCCGCCTTTTGAAGATCACAGATCACGACAACAAGGATGGCAAGATCA AGAACAATCTCAAGAACCTTTCCAACCTCTACATTGGCAAACTGCTTGCAGA CATCCACCAGCTGACCATTGATGAGTTGGACCTGTTGCTGATTGCAGTTGGTG AGGGCAAGACCAACCTCTCTGCAATCTCAGACAAACAGTTGGCAACCCTCAT CCGCAAGCTGAACACGATCACAAGCTGGCTTCACACGCAGAAGTGGTCTGTT TTCCAACTGTTCATCATGACCAGCACGTCCTACAACAAGACCCTGACTCCGG AGATCAAGAACCTTTTGGATACAGTCTATCATGGTCTCCAAGGCTTTGACAAG GACAAGGCGGACCTGCTTCATGTCATGGCACCCTACATTGCAGCCACACTCC AGCTCTCCTCTGAAAATGTTGCCCACTCAGTGCTGTTGTGGGCTGACAAGCTC CAGCCTGGGGATGGAGCCATGACTGCTGAGAAGTTCTGGGACTGGCTCAACA CGAAGTACACACCTGGCTCCTCTGAGGCAGTTGAGACTCAAGAACACATTGT GCAGTACTGCCAAGCGCTTGCACAGTTGGAGATGGTTTACCACTCAACTGGC ATCAACGAGAATGCCTTCCGCCTCTTTGTCACAAAGCCTGAGATGTTTGGTGC TGCCACTGGAGCCGCTCCTGCCCATGATGCCCTGTCACTCATCATGTTGACGA GGTTTGCAGACTGGGTCAACGCCCTTGGTGAGAAAGCCTCGTCTGTCCTGGC AGCCTTTGAAGCCAACTCCCTGACTGCGGAACAGCTTGCGGATGCCATGAAC CTTGATGCCAACTTGCTCCTGCAAGCTTCGATCCAAGCCCAGAACCATCAGC ATTTGCCACCTGTCACGCCTGAAAATGCGTTCTCATGCTGGACCTCCATCAAC ACCATACTCCAGTGGGTGAACGTGGCGCAACAGCTCAATGTGGCACCTCAAG GAGTGTCAGCGCTGGTTGGGCTTGACTACATCCAGTCCATGAAGGAGACACC GACCTACGCGCAGTGGGAGAATGCAGCTGGCGTCTTGACAGCTGGTCTGAAC TCACAGCAAGCCAACACGCTGCATGCGTTCTTGGATGAGAGCCGCTCTGCTG CCCTCAGCACGTACTATATCCGGCAAGTTGCCAAGGCAGCGGCTGCCATCAA GTCTCGGGATGACCTCTACCAGTACTTGCTCATTGACAATCAGGTTTCTGCTG CCATCAAAACGACCCGGATTGCTGAGGCCATAGCCAGCATCCAGCTCTACGT CAACAGAGCGCTTGAGAACGTTGAAGAGAATGCCAACTCTGGAGTGATTTCT CGCCAGTTTTTCATAGACTGGGACAAGTACAACAAGCGCTACTCCACCTGGG CTGGGGTCTCTCAGCTTGTCTACTATCCTGAGAACTACATAGATCCGACGATG CGGATTGGCCAGACCAAGATGATGGATGCCCTCCTTCAGTCGGTGTCCCAGA GCCAGCTCAATGCTGACACTGTGGAGGATGCCTTCATGAGCTACCTCACCTCC TTCGAGCAAGTTGCCAACCTCAAGGTCATCTCTGCTTACCACGACAACATCA ACAATGACCAAGGGCTCACCTACTTCATTGGCCTGTCTGAAACTGATGCGGG TGAGTATTACTGGCGCTCAGTGGACCACAGCAAGTTCAACGATGGCAAGTTT GCTGCAAATGCCTGGTCTGAGTGGCACAAGATTGACTGCCCCATCAACCCGT ACAAGTCCACCATCAGACCTGTCATCTACAAGAGCCGCTTGTACTTGCTCTGG CTTGAGCAGAAGGAAATCACGAAGCAGACTGGCAACTCCAAAGATGGCTAC CAGACTGAGACGGACTACCGCTATGAGTTGAAACTTGCTCACATCCGCTATG ATGGTACATGGAACACTCCGATAACGTTTGATGTGAACAAGAAGATTTCGGA GCTGAAACTGGAGAAGAACAGAGCGCCTGGGCTCTACTGTGCTGGCTACCAA GGGGAAGATACGCTGTTGGTGATGTTCTACAACCAGCAAGACACCCTTGACT CGTACAAGAACGCTTCCATGCAAGGCCTCTACATCTTTGCTGACATGGCTTCC AAAGACATGACTCCGGAGCAGAGCAATGTCTACCGGGACAACTCCTACCAGC AATTTGACACCAACAATGTTCGGAGGGTCAATAACCGCTATGCGGAAGATTA TGAGATCCCAAGCTCAGTGTCTAGCCGCAAGGACTATGGCTGGGGAGACTAC TATCTCAGCATGGTGTACAATGGTGACATACCCACGATCAACTACAAGGCTG CCTCCTCAGACCTGAAGATATACATCAGCCCCAAGCTCCGCATCATTCACAAT GGCTATGAGGGCCAGAAGAGGAACCAGTGCAACTTGATGAACAAGTATGGC AAACTTGGGGACAAGTTCATTGTCTACACCTCGCTTGGTGTGAACCCGAACA ATTCCTCGAACAAGCTCATGTTCTACCCGGTCTACCAGTACAGCGGCAACAC CTCTGGCTTGAACCAAGGGAGGCTCCTGTTCCACAGAGACACCACGTACCCG AGCAAGGTGGAGGCGTGGATTCCTGGTGCCAAAAGGTCACTCACCAACCAGA ATGCAGCCATTGGTGATGACTATGCCACAGACAGCCTGAACAAGCCTGATGA CCTGAAGCAGTACATCTTCATGACTGACTCCAAGGGCACAGCCACTGATGTG TCTGGTCCGGTGGAGATCAACACTGCAATCAGCCCAGCCAAGGTCCAAATCA TTGTCAAAGCTGGTGGCAAGGAACAGACCTTCACAGCTGACAAAGATGTGAG CATCCAGCCAAGCCCCTCCTTTGATGAGATGAACTACCAGTTCAACGCTCTTG AAATTGATGGCTCGGGACTCAACTTCATCAACAATTCGGCTTCAATTGATGTG ACGTTCACTGCCTTTGCGGAGGATGGGAGGAAATTGGGCTATGAGAGCTTCT CAATACCAGTCACCTTGAAGGTTTCCACTGACAATGCACTCACGCTTCATCAC AACGAGAATGGAGCGCAGTACATGCAATGGCAGAGCTACCGCACAAGGTTG AACACCCTCTTTGCAAGGCAACTTGTGGCCAGAGCCACGACTGGCATTGACA CCATACTCAGCATGGAAACGCAGAACATCCAAGAGCCACAGTTGGGCAAGG GTTTCTATGCCACCTTTGTGATCCCACCCTACAACCTGTCAACGCATGGTGAT GAGCGCTGGTTCAAGCTGTACATCAAGCACGTGGTTGACAACAATTCCCACA TCATATACTCGGGTCAGCTCACTGACACGAACATCAACATCACCCTGTTCATC CCACTTGATGACGTTCCCCTGAACCAAGACTACCATGCCAAGGTCTACATGA CCTTCAAGAAATCACCGTCAGATGGCACCTGGTGGGGACCGCACTTCGTTCG GGATGACAAAGGCATTGTCACAATCAACCCCAAGTCCATACTCACCCACTTT GAGTCTGTGAATGTTCTGAATAACATCTCCTCAGAGCCGATGGACTTCTCGGG TGCCAACTCCCTGTACTTCTGGGAGTTGTTCTATTACACGCCGATGCTTGTGG CGCAGAGGTTGCTCCATGAACAGAACTTTGATGAGGCCAACCGCTGGCTCAA GTATGTCTGGAGCCCCTCGGGTTACATTGTGCATGGCCAGATCCAGAACTACC AATGGAATGTTCGCCCATTGCTTGAGGACACCTCCTGGAACTCTGACCCCCTT GACTCGGTGGACCCTGATGCGGTGGCTCAGCATGACCCCATGCACTACAAGG TCTCAACCTTCATGAGGACCCTGGACCTTCTGATTGCCAGAGGAGACCATGCT TACCGCCAATTGGAACGGGACACACTGAATGAGGCAAAGATGTGGTACATGC AAGCTCTGCACCTCTTGGGAGACAAGCCGTACCTCCCGCTCAGCACCACATG GTCAGACCCAAGGTTGGACAGAGCAGCTGACATCACAACTCAGAATGCTCAT GACTCTGCCATTGTGGCTCTGAGGCAGAACATCCCAACACCTGCGCCACTGT CGCTGAGATCTGCGAACACCCTGACAGACCTGTTCCTCCCCCAGATCAATGA GGTCATGATGAACTACTGGCAAACCTTGGCGCAGCGGGTCTACAACCTCCGC CACAACCTCTCCATTGATGGGCAGCCGCTGTACCTCCCAATCTATGCCACACC AGCTGACCCAAAGGCGCTTCTCAGCGCAGCTGTGGCCACGAGCCAAGGGGG AGGCAAGCTCCCTGAGAGCTTCATGTCGCTCTGGAGGTTTCCCCACATGTTGG AGAATGCCAGAGGCATGGTGAGCCAACTGACTCAGTTTGGCTCGACGCTCCA GAACATCATTGAGAGGCAAGATGCAGAGGCTCTGAATGCGTTGCTCCAGAAT CAAGCAGCTGAGTTGATCCTGACGAACCTGTCAATCCAAGACAAGACCATTG AGGAACTTGATGCGGAAAAGACAGTCCTTGAAAAGAGCAAGGCTGGAGCCC AAAGCCGGTTCGACTCATATGGCAAGCTGTATGATGAGAACATCAATGCTGG GGAGAATCAAGCCATGACCCTGAGGGCTTCAGCAGCGGGTCTGACCACGGCA GTGCAAGCGTCTCGCTTGGCTGGGGCTGCGGCTGACCTCGTTCCCAACATCTT TGGGTTTGCTGGTGGCGGATCAAGGTGGGGAGCCATTGCAGAAGCAACGGGC TATGTGATGGAGTTCTCTGCCAATGTCATGAACACTGAGGCAGACAAAATCA GCCAATCGGAGACCTACAGACGGAGACGGCAAGAATGGGAGATACAAAGGA ACAATGCAGAGGCAGAACTGAAGCAAATAGATGCCCAACTGAAGTCCTTGGC TGTCAGAAGGGAGGCTGCGGTCCTCCAAAAGACCTCCCTCAAGACCCAGCAA GAGCAAACCCAGTCCCAGTTGGCGTTCCTCCAGAGGAAGTTCTCGAACCAAG CGCTGTACAACTGGCTGAGGGGAAGGTTGGCAGCCATCTACTTCCAGTTCTAT GACCTTGCTGTGGCCAGATGCCTCATGGCGGAACAAGCCTACCGCTGGGAAC TGAATGATGACTCTGCCAGATTCATCAAACCGGGTGCATGGCAAGGCACATA TGCTGGACTCCTTGCTGGGGAGACACTCATGCTCTCATTGGCCCAGATGGAG GATGCTCACCTCAAACGGGACAAGAGGGCTCTGGAAGTGGAGCGGACAGTC AGCCTTGCGGAGGTCTATGCGGGACTGCCCAAAGACAATGGACCATTTTCGT TGGCGCAAGAGATAGACAAGTTGGTCAGCCAAGGGTCTGGATCAGCGGGTTC TGGAAACAACAATCTGGCGTTCGGTGCTGGCACTGACACCAAGACGTCCCTC CAAGCCTCAGTCTCCTTTGCTGACCTGAAGATAAGGGAGGACTACCCAGCGT CCCTTGGGAAGATCAGACGCATCAAGCAGATTTCAGTGACCCTGCCAGCTCT TCTGGGTCCATACCAAGATGTTCAAGCGATCCTCTCCTATGGGGACAAGGCT GGTTTGGCGAATGGCTGTGAGGCCCTTGCTGTGTCACATGGCATGAATGACTC TGGGCAGTTCCAGCTTGATTTCAACGATGGCAAGTTCCTGCCATTCGAGGGCA TAGCCATTGATCAAGGCACCCTGACCCTCTCCTTCCCCAATGCTTCGATGCCA GAGAAGGGAAAACAAGCCACCATGCTCAAGACCCTGAATGATATCATACTCC ACATCCGCTACACCATCAAGTGAGTAGTTAGCTTAATCACCTAGAGCTCGTTT AAACTGAGGGCACTGAAGTCGCTTGATGTGCTGAATTGTTTGTGATGTTGGTG GCGTATTTTGTTTAAATAAGTAAGCATGGCTGTGATTTTATCATATGATCGAT CTTTGGGGTTTTATTTAACACATTGTAAAATGTGTATCTATTAATAACTCAAT GTATAAGATGTGTTCATTCTTCGGTTGCCATAGATCTGCTTATTTGACCTGTG ATGTTTTGACTCCAAAAACCAAAATCACAACTCAATAAACTCATGGAATATG TCCACCTGTTTCTTGAAGAGTTCATCTACCATTCCAGTTGGCATTTATCAGTGT TGCAGCGGCGCTGTGCTTTGTAACATAACAATTGTTACGGCATATATCCAA

(SEQ ID NO:6)

GTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGATAATGAGCATTGCATGTC TAAGTTATAAAAAATTACCACATATTTTTTTTGTCACACTTGTTTGAAGTGCA

GTTTATCTATCTTTATACATATATTTAAACTTTACTCTACGAATAATATAATCT

ATAGTACTACAATAATATCAGTGTTTTAGAGAATCATATAAATGAACAGTTA

GACATGGTCTAAAGGACAATTGAGTATTTTGACAACAGGACTCTACAGTTTT

ATCTTTTTAGTGTGCATGTGTTCTCCTTTTTTTTTGCAAATAGCTTCACCTATA TAATACTTCATCCATTTTATTAGTACATCCATTTAGGGTTTAGGGTTAATGGTT

TTTATAGACTAATTTTTTTAGTACATCTATTTTATTCTATTTTAGCCTCTAAATT

AAGAAAACTAAAACTCTATTTTAGTTTTTTTATTTAATAGTTTAGATATAAAA

TAGAATAAAATAAAGTGACTAAAAATTAAACAAATACCCTTTAAGAAATTAA

AAAAACTAAGGAAACATTTTTCTTGTTTCGAGTAGATAATGCCAGCCTGTTAA ACGCCGTCGACGAGTCTAACGGACACCAACCAGCGAACCAGCAGCGTCGCGT CGGGCCAAGCGAAGCAGACGGCACGGCATCTCTGTCGCTGCCTCTGGACCCC TCTCGAGAGTTCCGCTCCACCGTTGGACTTGCTCCGCTGTCGGCATCCAGAAA TTGCGTGGCGGAGCGGCAGACGTGAGCCGGCACGGCAGGCGGCCTCCTCCTC CTCTCACGGCACCGGCAGCTACGGGGGATTCCTTTCCCACCGCTCCTTCGCTT TCCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCTCCACACCCTCTTTCCC CAACCTCGTGTTGTTCGGAGCGCACACACACACAACCAGATCTCCCCCAAAT CCACCCGTCGGCACCTCCGCTTCAAGGGTACCCTGAAGGCTCGACAAGGCAG TCCACGGAGGAGCTGATATTTGGTGGACAAGCTGTGGATAGGAGCAACCCTA TCCCTAATATACCAGCACCACCAAGTCAGGGCAATCCCCAGATCACCCCAGC AGATTCGAAGAAGGTACAGTACACACACATGTATATATGTATGATGTATCCC TTCGATCGAAGGCATGCCTTGGTATAATCACTGAGTAGTCATTTTATTACTTT GTTTTGACAAGTCAGTAGTTCATCCATTTGTCCCATTTTTTCAGCTTGGAAGTT TGGTTGCACTGGCACTTGGTCTAATAACTGAGTAGTCATTTTATTACGTTGTTT CGACAAGTCAGTAGCTCATCCATCTGTCCCATTTTTTCAGCTAGGAAGTTTGG TTGCACTGGCCTTGGACTAATAACTGATTAGTCATTTTATTACATTGTTTCGAC AAGTCAGTAGCTCATCCATCTGTCCCATTTTTCAGCTAGGAAGTTCGGATCTG GGGCCATTTGTTCCAGGCACGGGATAAGCATTCAGCC (SEQ ID NO:7) Construct pDAS5143 (e.g. pDAB3924) was built containing two gene expression cassettes. The first gene expression cassette (SEQ ID NO:8) contained the Sugar Cane

Bacilliform Virus upstream-promoter (U.S. Patent No. 6,489,462) followed by the Zea mays alcohol dehydrogenase (I) intron 6 (Dennis et al., (1984) Nucleic Acids Res. 12:3983-4000) and Maize Streak Virus 5' -UTR (Mullineaux et al., (1984) EMBO J. 3:3063-3068) operably linked to the tcdA transgene (U.S. Patent App. No. 2009/0221501) and flanked by the Zea mays

(Japan Tobacco, Tokyo, JP). The constructs used to complete pDAS5143 were molecularly confirmed via restriction enzyme digestion and DNA sequencing. The novel Sugar Cane

Bacilliform Virus promoter followed by the Zea mays alcohol dehydrogenase (I) intron 6 and

Maize Streak Virus 5' -UTR is disclosed herein as SEQ ID NO:9. ATCGGAAGTTGAAGACAAAGAAGGTCTTAAATCCTGGCTAGCAACACTGAAC TATGCCAGAAACCACATCAAAGATATCGGCAAGCTTCTTGGCCCATTATATCC AAAGACCTCAGAGAAAGGTGAGCGAAGGCTCAATTCAGAAGATTGGAAGCT GATCAATAGGATCAAGACAATGGTGAGAACGCTTCCAAATCTCACTATTCCA CCAGAAGATGCATACATTATCATTGAAACAGATGCATGTGCAACTGGATGGG GAGCAGTATGCAAGTGGAAGAAAAACAAGGCAGACCCAAGAAATACAGAGC AAATCTGTAGGTATGCCAGTGGAAAATTTGATAAGCCAAAAGGAACCTGTGA TGCAGAAATCTATGGGGTTATGAATGGCTTAGAAAAGATGAGATTGTTCTAC TTGGACAAAAGAGAGATCACAGTCAGAACTGACAGTAGTGCAATCGAAAGG TTCTACAACAAGAGTGCTGAACACAAGCCTTCTGAGATCAGATGGATCAGGT TCATGGACTACATCACTGGTGCAGGACCAGAGATAGTCATTGAACACATAAA AGGGAAGAGCAATGGTTTAGCTGACATCTTGTCCAGGCTCAAAGCCAAATTA GCTCAGAATGAACCAACGGAAGAGATGATCCTGCTTACACAAGCCATAAGGG AAGTAATTCCTTATCCAGATCATCCATACACTGAGCAACTCAGAGAATGGGG AAACAAAATTCTGGATCCATTCCCCACATTCAAGAAGGACATGTTCGAAAGA ACAGAGCAAGCTTTTATGCTAACAGAGGAACCAGTTCTACTCTGTGCATGCA GGAAGCCTGCAATTCAGTTAGTGTCCAGAACATCTGCCAACCCAGGAAGGAA ATTCTTCAAGTGCGCAATGAACAAATGCCATTGCTGGTACTGGGCAGATCTC ATTGAAGAACACATTCAAGACAGAATTGATGAATTTCTCAAGAATCTTGAAG TTCTGAAGACCGGTGGCGTGCAAACAATGGAGGAGGAACTTATGAAGGAAG TCACCAAGCTGAAGATAGAAGAGCAGGAGTTCGAGGAATACCAGGCCACAC CAAGGGCTATGTCGCCAGTAGCCGCAGAAGATGTGCTAGATCTCCAAGACGT AAGCAATGACGATTGAGGAGGCATTGACGTCAGGGATGACCGCAGCGGAGA GTACTGGGCCCATTCAGTGGATGCTCCACTGAGTTGTATTATTGTGTGCTTTT CGGACAAGTGTGCTGTCCACTTTCTTTTGGCACCTGTGCCACTTTATTCCTTGT CTGCCACGATGCCTTTGCTTAGCTTGTAAGCAAGGATCGCAGTGCGTGTGTGA CACCACCCCCCTTCCGACGCTCTGCCTATATAAGGCACCGTCTGTAAGCTCTT ACGATCATCGGTAGTTCACCAAGGTACCCGGGGTCGACCTCGAGGGGGGGCC CGGTACCCTGAAGGCTCGACAAGGCAGTCCACGGAGGAGCTGATATTTGGTG GACAAGCTGTGGATAGGAGCAACCCTATCCCTAATATACCAGCACCACCAAG TCAGGGCAATCCCCAGATCACCCCAGCAGATTCGAAGAAGGTACAGTACACA CACATGTATATATGTATGATGTATCCCTTCGATCGAAGGCATGCCTTGGTATA ATCACTGAGTAGTCATTTTATTACTTTGTTTTGACAAGTCAGTAGTTCATCCAT TTGTCCCATTTTTTCAGCTTGGAAGTTTGGTTGCACTGGCACTTGGTCTAATAA CTGAGTAGTCATTTTATTACGTTGTTTCGACAAGTCAGTAGCTCATCCATCTG TCCCATTTTTTCAGCTAGGAAGTTTGGTTGCACTGGCCTTGGACTAATAACTG ATTAGTCATTTTATTACATTGTTTCGACAAGTCAGTAGCTCATCCATCTGTCCC ATTTTTCAGCTAGGAAGTTCGGATCTGGGGCCATTTGTTCCAGGCACGGGATA AGCATTCAGCCATGGCTAATGAGTCAGTCAAGGAGATCCCGGATGTTCTCAA ATCCCAGTGTGGTTTCAACTGCCTCACGGACATCTCCCACAGCTCATTCAATG AGTTCCGCCAGCAAGTCTCTGAGCACCTCTCATGGTCGGAGACGCATGACCT CTACCACGATGCTCAGCAAGCCCAGAAAGACAACCGGCTGTATGAGGCACG GATCCTCAAGAGGGCCAACCCGCAGCTCCAGAATGCGGTCCACCTCGCCATC CTTGCTCCAAATGCGGAATTGATTGGCTACAATAACCAATTCTCGGGAAGGG CCTCACAGTATGTTGCGCCTGGCACAGTTTCGTCCATGTTCAGCCCAGCAGCG TACCTCACAGAGCTGTACAGAGAGGCGAGGAACCTTCATGCGTCTGACTCCG TGTACTATCTGGACACACGCAGACCGGACCTGAAGTCAATGGCCCTCAGCCA GCAAAACATGGACATTGAACTGTCCACCCTTTCCTTGAGCAATGAGCTTCTGT TGGAATCCATCAAGACTGAGAGCAAGCTGGAAAACTACACAAAGGTGATGG AGATGCTGTCCACCTTCAGACCATCTGGAGCGACTCCATACCACGATGCCTAT GAGAATGTGAGGGAGGTCATTCAGCTTCAAGACCCTGGCCTTGAGCAGCTCA ATGCCAGCCCAGCCATTGCGGGACTGATGCACCAAGCCTCCCTGCTTGGGAT CAATGCCTCCATCAGCCCTGAGCTGTTCAACATCTTGACTGAAGAGATCACTG AGGGCAATGCGGAGGAACTGTACAAGAAAAACTTCGGCAACATTGAGCCTG CCAGCCTTGCAATGCCGGAATACCTGAAACGCTATTACAACTTGTCGGATGA GGAACTTTCGCAGTTCATTGGCAAAGCCTCAAACTTTGGGCAGCAAGAGTAC AGCAACAATCAGCTCATCACACCTGTTGTGAACTCATCTGATGGCACTGTGA AGGTTTACCGCATCACAAGGGAGTACACCACAAATGCCTACCAGATGGATGT TGAACTGTTCCCGTTTGGAGGTGAAAACTACCGGCTTGACTACAAGTTCAAG AACTTCTACAATGCATCCTACCTGTCGATCAAGCTGAACGACAAACGGGAGC TTGTGAGGACGGAAGGTGCTCCCCAAGTGAACATTGAATACTCTGCCAACAT CACACTCAACACAGCGGACATCAGCCAGCCGTTTGAAATTGGCTTGACCAGA GTGCTTCCCTCGGGCTCCTGGGCCTATGCGGCAGCCAAGTTTACGGTTGAGGA GTACAACCAGTACAGCTTCCTCCTGAAGCTCAACAAGGCAATCCGGCTGAGC AGAGCCACTGAGCTGTCACCCACCATCCTGGAGGGCATTGTGAGGTCTGTCA ACCTTCAGCTTGACATCAACACTGATGTGCTTGGCAAGGTGTTCCTGACCAAG TATTACATGCAGCGCTATGCCATCCATGCGGAGACGGCACTGATCCTCTGCA ATGCACCCATATCGCAGCGCTCGTATGACAACCAGCCCAGCCAGTTCGACAG ACTCTTCAACACTCCCCTTCTGAACGGCCAGTACTTCAGCACTGGAGATGAA GAGATTGACCTGAACTCTGGCTCGACGGGTGACTGGAGGAAAACCATCTTGA AGAGGGCCTTCAACATTGATGACGTTTCCCTCTTCCGCCTTTTGAAGATCACA GATCACGACAACAAGGATGGCAAGATCAAGAACAATCTCAAGAACCTTTCCA ACCTCTACATTGGCAAACTGCTTGCAGACATCCACCAGCTGACCATTGATGA GTTGGACCTGTTGCTGATTGCAGTTGGTGAGGGCAAGACCAACCTCTCTGCA ATCTCAGACAAACAGTTGGCAACCCTCATCCGCAAGCTGAACACGATCACAA GCTGGCTTCACACGCAGAAGTGGTCTGTTTTCCAACTGTTCATCATGACCAGC ACGTCCTACAACAAGACCCTGACTCCGGAGATCAAGAACCTTTTGGATACAG TCTATCATGGTCTCCAAGGCTTTGACAAGGACAAGGCGGACCTGCTTCATGTC ATGGCACCCTACATTGCAGCCACACTCCAGCTCTCCTCTGAAAATGTTGCCCA CTCAGTGCTGTTGTGGGCTGACAAGCTCCAGCCTGGGGATGGAGCCATGACT GCTGAGAAGTTCTGGGACTGGCTCAACACGAAGTACACACCTGGCTCCTCTG AGGCAGTTGAGACTCAAGAACACATTGTGCAGTACTGCCAAGCGCTTGCACA GTTGGAGATGGTTTACCACTCAACTGGCATCAACGAGAATGCCTTCCGCCTCT TTGTCACAAAGCCTGAGATGTTTGGTGCTGCCACTGGAGCCGCTCCTGCCCAT GATGCCCTGTCACTCATCATGTTGACGAGGTTTGCAGACTGGGTCAACGCCCT TGGTGAGAAAGCCTCGTCTGTCCTGGCAGCCTTTGAAGCCAACTCCCTGACTG CGGAACAGCTTGCGGATGCCATGAACCTTGATGCCAACTTGCTCCTGCAAGC TTCGATCCAAGCCCAGAACCATCAGCATTTGCCACCTGTCACGCCTGAAAAT GCGTTCTCATGCTGGACCTCCATCAACACCATACTCCAGTGGGTGAACGTGG CGCAACAGCTCAATGTGGCACCTCAAGGAGTGTCAGCGCTGGTTGGGCTTGA CTACATCCAGTCCATGAAGGAGACACCGACCTACGCGCAGTGGGAGAATGCA GCTGGCGTCTTGACAGCTGGTCTGAACTCACAGCAAGCCAACACGCTGCATG CGTTCTTGGATGAGAGCCGCTCTGCTGCCCTCAGCACGTACTATATCCGGCAA GTTGCCAAGGCAGCGGCTGCCATCAAGTCTCGGGATGACCTCTACCAGTACT TGCTCATTGACAATCAGGTTTCTGCTGCCATCAAAACGACCCGGATTGCTGAG GCCATAGCCAGCATCCAGCTCTACGTCAACAGAGCGCTTGAGAACGTTGAAG AGAATGCCAACTCTGGAGTGATTTCTCGCCAGTTTTTCATAGACTGGGACAAG TACAACAAGCGCTACTCCACCTGGGCTGGGGTCTCTCAGCTTGTCTACTATCC TGAGAACTACATAGATCCGACGATGCGGATTGGCCAGACCAAGATGATGGAT GCCCTCCTTCAGTCGGTGTCCCAGAGCCAGCTCAATGCTGACACTGTGGAGG ATGCCTTCATGAGCTACCTCACCTCCTTCGAGCAAGTTGCCAACCTCAAGGTC ATCTCTGCTTACCACGACAACATCAACAATGACCAAGGGCTCACCTACTTCAT TGGCCTGTCTGAAACTGATGCGGGTGAGTATTACTGGCGCTCAGTGGACCAC AGCAAGTTCAACGATGGCAAGTTTGCTGCAAATGCCTGGTCTGAGTGGCACA AGATTGACTGCCCCATCAACCCGTACAAGTCCACCATCAGACCTGTCATCTAC AAGAGCCGCTTGTACTTGCTCTGGCTTGAGCAGAAGGAAATCACGAAGCAGA CTGGCAACTCCAAAGATGGCTACCAGACTGAGACGGACTACCGCTATGAGTT GAAACTTGCTCACATCCGCTATGATGGTACATGGAACACTCCGATAACGTTTG ATGTGAACAAGAAGATTTCGGAGCTGAAACTGGAGAAGAACAGAGCGCCTG GGCTCTACTGTGCTGGCTACCAAGGGGAAGATACGCTGTTGGTGATGTTCTAC AACCAGCAAGACACCCTTGACTCGTACAAGAACGCTTCCATGCAAGGCCTCT ACATCTTTGCTGACATGGCTTCCAAAGACATGACTCCGGAGCAGAGCAATGT CTACCGGGACAACTCCTACCAGCAATTTGACACCAACAATGTTCGGAGGGTC AATAACCGCTATGCGGAAGATTATGAGATCCCAAGCTCAGTGTCTAGCCGCA AGGACTATGGCTGGGGAGACTACTATCTCAGCATGGTGTACAATGGTGACAT ACCCACGATCAACTACAAGGCTGCCTCCTCAGACCTGAAGATATACATCAGC CCCAAGCTCCGCATCATTCACAATGGCTATGAGGGCCAGAAGAGGAACCAGT GCAACTTGATGAACAAGTATGGCAAACTTGGGGACAAGTTCATTGTCTACAC CTCGCTTGGTGTGAACCCGAACAATTCCTCGAACAAGCTCATGTTCTACCCGG TCTACCAGTACAGCGGCAACACCTCTGGCTTGAACCAAGGGAGGCTCCTGTT CCACAGAGACACCACGTACCCGAGCAAGGTGGAGGCGTGGATTCCTGGTGCC AAAAGGTCACTCACCAACCAGAATGCAGCCATTGGTGATGACTATGCCACAG ACAGCCTGAACAAGCCTGATGACCTGAAGCAGTACATCTTCATGACTGACTC CAAGGGCACAGCCACTGATGTGTCTGGTCCGGTGGAGATCAACACTGCAATC AGCCCAGCCAAGGTCCAAATCATTGTCAAAGCTGGTGGCAAGGAACAGACCT TCACAGCTGACAAAGATGTGAGCATCCAGCCAAGCCCCTCCTTTGATGAGAT GAACTACCAGTTCAACGCTCTTGAAATTGATGGCTCGGGACTCAACTTCATCA ACAATTCGGCTTCAATTGATGTGACGTTCACTGCCTTTGCGGAGGATGGGAG GAAATTGGGCTATGAGAGCTTCTCAATACCAGTCACCTTGAAGGTTTCCACTG ACAATGCACTCACGCTTCATCACAACGAGAATGGAGCGCAGTACATGCAATG GCAGAGCTACCGCACAAGGTTGAACACCCTCTTTGCAAGGCAACTTGTGGCC AGAGCCACGACTGGCATTGACACCATACTCAGCATGGAAACGCAGAACATCC AAGAGCCACAGTTGGGCAAGGGTTTCTATGCCACCTTTGTGATCCCACCCTAC AACCTGTCAACGCATGGTGATGAGCGCTGGTTCAAGCTGTACATCAAGCACG TGGTTGACAACAATTCCCACATCATATACTCGGGTCAGCTCACTGACACGAA CATCAACATCACCCTGTTCATCCCACTTGATGACGTTCCCCTGAACCAAGACT ACCATGCCAAGGTCTACATGACCTTCAAGAAATCACCGTCAGATGGCACCTG GTGGGGACCGCACTTCGTTCGGGATGACAAAGGCATTGTCACAATCAACCCC AAGTCCATACTCACCCACTTTGAGTCTGTGAATGTTCTGAATAACATCTCCTC AGAGCCGATGGACTTCTCGGGTGCCAACTCCCTGTACTTCTGGGAGTTGTTCT ATTACACGCCGATGCTTGTGGCGCAGAGGTTGCTCCATGAACAGAACTTTGA TGAGGCCAACCGCTGGCTCAAGTATGTCTGGAGCCCCTCGGGTTACATTGTGC ATGGCCAGATCCAGAACTACCAATGGAATGTTCGCCCATTGCTTGAGGACAC CTCCTGGAACTCTGACCCCCTTGACTCGGTGGACCCTGATGCGGTGGCTCAGC ATGACCCCATGCACTACAAGGTCTCAACCTTCATGAGGACCCTGGACCTTCTG ATTGCCAGAGGAGACCATGCTTACCGCCAATTGGAACGGGACACACTGAATG AGGCAAAGATGTGGTACATGCAAGCTCTGCACCTCTTGGGAGACAAGCCGTA CCTCCCGCTCAGCACCACATGGTCAGACCCAAGGTTGGACAGAGCAGCTGAC ATCACAACTCAGAATGCTCATGACTCTGCCATTGTGGCTCTGAGGCAGAACA TCCCAACACCTGCGCCACTGTCGCTGAGATCTGCGAACACCCTGACAGACCT GTTCCTCCCCCAGATCAATGAGGTCATGATGAACTACTGGCAAACCTTGGCG CAGCGGGTCTACAACCTCCGCCACAACCTCTCCATTGATGGGCAGCCGCTGT ACCTCCCAATCTATGCCACACCAGCTGACCCAAAGGCGCTTCTCAGCGCAGC TGTGGCCACGAGCCAAGGGGGAGGCAAGCTCCCTGAGAGCTTCATGTCGCTC TGGAGGTTTCCCCACATGTTGGAGAATGCCAGAGGCATGGTGAGCCAACTGA CTCAGTTTGGCTCGACGCTCCAGAACATCATTGAGAGGCAAGATGCAGAGGC TCTGAATGCGTTGCTCCAGAATCAAGCAGCTGAGTTGATCCTGACGAACCTGT CAATCCAAGACAAGACCATTGAGGAACTTGATGCGGAAAAGACAGTCCTTGA AAAGAGCAAGGCTGGAGCCCAAAGCCGGTTCGACTCATATGGCAAGCTGTAT GATGAGAACATCAATGCTGGGGAGAATCAAGCCATGACCCTGAGGGCTTCAG CAGCGGGTCTGACCACGGCAGTGCAAGCGTCTCGCTTGGCTGGGGCTGCGGC TGACCTCGTTCCCAACATCTTTGGGTTTGCTGGTGGCGGATCAAGGTGGGGAG CCATTGCAGAAGCAACGGGCTATGTGATGGAGTTCTCTGCCAATGTCATGAA CACTGAGGCAGACAAAATCAGCCAATCGGAGACCTACAGACGGAGACGGCA AGAATGGGAGATACAAAGGAACAATGCAGAGGCAGAACTGAAGCAAATAGA TGCCCAACTGAAGTCCTTGGCTGTCAGAAGGGAGGCTGCGGTCCTCCAAAAG ACCTCCCTCAAGACCCAGCAAGAGCAAACCCAGTCCCAGTTGGCGTTCCTCC AGAGGAAGTTCTCGAACCAAGCGCTGTACAACTGGCTGAGGGGAAGGTTGGC AGCCATCTACTTCCAGTTCTATGACCTTGCTGTGGCCAGATGCCTCATGGCGG AACAAGCCTACCGCTGGGAACTGAATGATGACTCTGCCAGATTCATCAAACC GGGTGCATGGCAAGGCACATATGCTGGACTCCTTGCTGGGGAGACACTCATG

CTCTCATTGGCCCAGATGGAGGATGCTCACCTCAAACGGGACAAGAGGGCTC

TGGAAGTGGAGCGGACAGTCAGCCTTGCGGAGGTCTATGCGGGACTGCCCAA

AGACAATGGACCATTTTCGTTGGCGCAAGAGATAGACAAGTTGGTCAGCCAA

GGGTCTGGATCAGCGGGTTCTGGAAACAACAATCTGGCGTTCGGTGCTGGCA

CTGACACCAAGACGTCCCTCCAAGCCTCAGTCTCCTTTGCTGACCTGAAGATA

AGGGAGGACTACCCAGCGTCCCTTGGGAAGATCAGACGCATCAAGCAGATTT

CAGTGACCCTGCCAGCTCTTCTGGGTCCATACCAAGATGTTCAAGCGATCCTC

TCCTATGGGGACAAGGCTGGTTTGGCGAATGGCTGTGAGGCCCTTGCTGTGTC

ACATGGCATGAATGACTCTGGGCAGTTCCAGCTTGATTTCAACGATGGCAAG

TTCCTGCCATTCGAGGGCATAGCCATTGATCAAGGCACCCTGACCCTCTCCTT

CCCCAATGCTTCGATGCCAGAGAAGGGAAAACAAGCCACCATGCTCAAGACC

CTGAATGATATCATACTCCACATCCGCTACACCATCAAGTGAGTAGTTAGCTT

AATCACCTAGAGCTCGTTTAAACTGAGGGCACTGAAGTCGCTTGATGTGCTG

AATTGTTTGTGATGTTGGTGGCGTATTTTGTTTAAATAAGTAAGCATGGCTGT

GATTTTATCATATGATCGATCTTTGGGGTTTTATTTAACACATTGTAAAATGT

GTATCTATTAATAACTCAATGTATAAGATGTGTTCATTCTTCGGTTGCCATAG

ATCTGCTTATTTGACCTGTGATGTTTTGACTCCAAAAACCAAAATCACAACTC

AATAAACTCATGGAATATGTCCACCTGTTTCTTGAAGAGTTCATCTACCATTC

CAGTTGGCATTTATCAGTGTTGCAGCGGCGCTGTGCTTTGTAACATAACAATT

GTTACGGCATATATCCAA (SEQ ID NO: 8)

ATCGGAAGTTGAAGACAAAGAAGGTCTTAAATCCTGGCTAGCAACACTGAAC TATGCCAGAAACCACATCAAAGATATCGGCAAGCTTCTTGGCCCATTATATCC AAAGACCTCAGAGAAAGGTGAGCGAAGGCTCAATTCAGAAGATTGGAAGCT GATCAATAGGATCAAGACAATGGTGAGAACGCTTCCAAATCTCACTATTCCA CCAGAAGATGCATACATTATCATTGAAACAGATGCATGTGCAACTGGATGGG GAGCAGTATGCAAGTGGAAGAAAAACAAGGCAGACCCAAGAAATACAGAGC AAATCTGTAGGTATGCCAGTGGAAAATTTGATAAGCCAAAAGGAACCTGTGA TGCAGAAATCTATGGGGTTATGAATGGCTTAGAAAAGATGAGATTGTTCTAC

TTGGACAAAAGAGAGATCACAGTCAGAACTGACAGTAGTGCAATCGAAAGG

TTCTACAACAAGAGTGCTGAACACAAGCCTTCTGAGATCAGATGGATCAGGT

TCATGGACTACATCACTGGTGCAGGACCAGAGATAGTCATTGAACACATAAA

AGGGAAGAGCAATGGTTTAGCTGACATCTTGTCCAGGCTCAAAGCCAAATTA GCTCAGAATGAACCAACGGAAGAGATGATCCTGCTTACACAAGCCATAAGGG AAGTAATTCCTTATCCAGATCATCCATACACTGAGCAACTCAGAGAATGGGG AAACAAAATTCTGGATCCATTCCCCACATTCAAGAAGGACATGTTCGAAAGA ACAGAGCAAGCTTTTATGCTAACAGAGGAACCAGTTCTACTCTGTGCATGCA GGAAGCCTGCAATTCAGTTAGTGTCCAGAACATCTGCCAACCCAGGAAGGAA ATTCTTCAAGTGCGCAATGAACAAATGCCATTGCTGGTACTGGGCAGATCTC ATTGAAGAACACATTCAAGACAGAATTGATGAATTTCTCAAGAATCTTGAAG TTCTGAAGACCGGTGGCGTGCAAACAATGGAGGAGGAACTTATGAAGGAAG TCACCAAGCTGAAGATAGAAGAGCAGGAGTTCGAGGAATACCAGGCCACAC CAAGGGCTATGTCGCCAGTAGCCGCAGAAGATGTGCTAGATCTCCAAGACGT AAGCAATGACGATTGAGGAGGCATTGACGTCAGGGATGACCGCAGCGGAGA GTACTGGGCCCATTCAGTGGATGCTCCACTGAGTTGTATTATTGTGTGCTTTT CGGACAAGTGTGCTGTCCACTTTCTTTTGGCACCTGTGCCACTTTATTCCTTGT CTGCCACGATGCCTTTGCTTAGCTTGTAAGCAAGGATCGCAGTGCGTGTGTGA CACCACCCCCCTTCCGACGCTCTGCCTATATAAGGCACCGTCTGTAAGCTCTT ACGATCATCGGTAGTTCACCAAGGTACCCGGGGTCGACCTCGAGGGGGGGCC CGGTACCCTGAAGGCTCGACAAGGCAGTCCACGGAGGAGCTGATATTTGGTG GACAAGCTGTGGATAGGAGCAACCCTATCCCTAATATACCAGCACCACCAAG TCAGGGCAATCCCCAGATCACCCCAGCAGATTCGAAGAAGGTACAGTACACA CACATGTATATATGTATGATGTATCCCTTCGATCGAAGGCATGCCTTGGTATA ATCACTGAGTAGTCATTTTATTACTTTGTTTTGACAAGTCAGTAGTTCATCCAT TTGTCCCATTTTTTCAGCTTGGAAGTTTGGTTGCACTGGCACTTGGTCTAATAA CTGAGTAGTCATTTTATTACGTTGTTTCGACAAGTCAGTAGCTCATCCATCTG TCCCATTTTTTCAGCTAGGAAGTTTGGTTGCACTGGCCTTGGACTAATAACTG ATTAGTCATTTTATTACATTGTTTCGACAAGTCAGTAGCTCATCCATCTGTCCC ATTTTTCAGCTAGGAAGTTCGGATCTGGGGCCATTTGTTCCAGGCACGGGATA AGCATTCAGCC (SEQ ID NO:9)

Construct pDAB1405, a control construct, was built containing two gene expression cassettes, both of which were flanked by the RB7 Matrix Attachment Regions (MAR;

International Patent App. No. WO9727207). The first gene expression cassette contained the

Zea mays Ubiquitin 1 promoter operably linked to the green fluorescent protein transgene (U.S.

Patent No. 6,172,188) and flanked by the Zea mays Peroxidase 5 3' -UTR. The second gene expression cassette contained a selectable marker gene and was made up of the Oryza sativa Actin promoter (U.S. Patent No. 6,429,357) operably linked to a phosphinothricin acetyl transferase (Wohlleben et al., (1988) Gene 70: 25-37) transgene and terminated by the Zea mays Lipase 3' -UTR (U.S. Patent No. 7,179,902). This construct was mobilized into the Superbinary pSBl binary vector (Japan Tobacco, Tokyo, JP). The constructs used to complete pDAB1405 were molecularly confirmed via restriction enzyme digestion and DNA sequencing.

TABLE 1 : Constructs are designated by pDAS number with a brief description of regulatory elements and selectable marker used in each construct.

Example 3: Plant transformation and molecular confirmation

Plant Material. Zea mays c.v. Hi-II was used for all transformation experiments. Plants were grown in the greenhouse and ears were harvested at about 9-11 days after pollination, when immature zygotic embryos were between 1-2 mm in length. Ears were dehusked, rinsed, and stored at 4°C for up to 1 day prior to use.

Agrobacterium Culture Initiation. Agrobacterium tumefaciens strain LBA4404 harboring the constructs described above were maintained as glycerol stocks at -80°C. Prior to the initiation of the transformation experiments, bacteria were streaked from the glycerol stocks onto YEP plates containing 250 mg/L streptomycin, 100 mg/L spectinomycin and 10 mg/L

tetracycline. The plates were incubated at 28°C for 24 hours then transferred to 19°C for 2 days until a lawn of cells developed on each plate.

Cocultivation of Immature Embryos. One to two loops of Agrobacterium were taken from each YEP plate and suspended in 45 ml of N6-inf medium (N6 salts and vitamins, 1.5 mg/L 2,4-D, 700 mg/L L-Proline, 6.84% sucrose, 3.6% glucose, pH adjusted to 5.2) supplemented with 100 μΜ acetosyringone, and vortexed until a uniform suspension was obtained. Bacteria were transferred to Nephelo™ flasks and the culture density was adjusted to approximately 200 Klett units using the blue filter. Flasks were shaken at 75 rpm on a rotary shaker for 2-4 hours at room temperature while immature embryos were isolated. Maize ears were sterilized by rinsing in 70% ethanol for 5 minutes followed by 20-30 minute immersion in a 20% bleach solution containing several drops of Liquinox^®. The ears were triple rinsed in sterile deionized water and wrapped in sterile paper towels and foil until use. The cocultivation and selection protocol closely followed that outlined by Frame et al. {Plant Physiol. 129: 12-22, 2005). Immature zygotic embryos were excised from maize kernels and placed in Eppendorf tubes containing 2 ml of N6-inf medium with 100 μΜ acetosyringone. Embryos from multiple ears were either pooled in tubes or kept separate. Embryos were washed in infection medium 1-2 times and the solution was replaced with approximately 1ml of bacterial suspension. The tube was gently inverted a few times and incubated at room temperature for 5 minutes. Embryos were transferred to N6-AS (KW) medium (N6 Salts and vitamins, 1.5 mg/L 2,4-D, 700 mg/L L-proline, 0.85 mg/L silver nitrate, 300 mg/L L-cysteine, 3% sucrose, 3 g/L Gelrite™, 100 μΜ acetosyringone and pH adjusted to 5.8) in 100 x 15 mm plates. After excess liquid was removed from the plate, embryos were oriented with the scutellar side up using a microscope.

Plates were sealed with 3M^® tape or Parafilm^®, and incubated for 3 to 4 days at 20°C in the dark. For TcdA constructs 50-120 embryos were treated per construct, and approximately SO- SO embryos were treated for the positive control construct (pDAB1405). To monitor

transformation efficiency putative positive control isolates were evaluated for GFP expression after 2 weeks. The remaining Agwbacterium suspension was spun down at 5000 rpm in a tabletop centrifuge, and the pellet was resuspended in 100 μΐ of liquid, and then streaked on a YEP +strep/spec/tet plate, and allowed to incubate for 3 days at 28°C, then used for revalidation. As a positive control to assess tissue culture response of the maize donor material, approximately 5 embryos per ear were plated on 15Ag medium (N6 salts and vitamins, 100 mg/L Enzymatic casein hydrolysate, 1 mg/L 2,4D, 2% sucrose, 2.5 g/L Gelrite™, pH 5.8, supplemented with 10 mg/L silver nitrate and 25 mM L-proline) and incubated at 28°C in the dark for 2 weeks. Control embryos were scored for embryogenic response at 2 and 4 weeks and then discarded.

Isolation, Selection, and Regeneration. After 3-4 days of cocultivation, surviving embryos were transferred to KW- Resting medium (N6 salts and vitamins, 1.5 mg/L 2,4-D, 700 mg/L L-proline, 500 mg/L MES, 0.85 mg/L silver nitrate, 100 mg/L vancomycin, 100 mg/L cefotaxime, 3 % sucrose, 8 g/L TC agar and pH adjusted to 5.8). Ten embryos were placed on each 60 x 20 mm plate and sealed with 3M^® tape or Parafilm^®. Plates were incubated in a dark culture room at 28°C for 7 days. Because all constructs contained the PAT gene as the selectable marker, the bialaphos-based formulation Herbiace^® was used as the selective agent. Embryos were transferred to N6 (1.5H) KW medium (N6 salts and vitamins, 1.5 mg/L 2,4-D, 700 mg/L L- proline, 500 mg/L MES, 0.85 mg/L silver nitrate, 100 mg/L vancomycin, 100 mg/liter

cefotaxime, 1.5 mg/L Herbiace^®, 3% sucrose, 8 g/L TC agar and pH adjusted to 5.8). After approximately two weeks embryos were transferred to medium with a doubled level of

Herbiace®, and subsequent transfers were to N6 (3. OH) KW medium (N6 salts and vitamins, 1.5 mg/L 2,4-D, 700 mg/L L-proline, 500 mg/L MES, 0.85 mg/L silver nitrate, 100 mg/L

vancomycin, 100 mg/L cefotaxime, 3.0 mg/L Herbiace^®, 3% sucrose, 8 g/L TC agar and pH adjusted to 5.8. After the first transfer to N6 (3. OH) KW medium, any fast growing embryogenic tissue was subcultured to a separate plate of N6 (3. OH) KW medium to bulk up putative transgenic isolates. When sufficient quantities of embryogenic callus material were obtained, samples were taken for zygosity and expression assays. Events meeting copy number and expression criteria were transferred to 28(1H) regeneration medium (MS salts and vitamins, 5 mg/L BAP, 25 μg/L 2,4-D, 3% sucrose, 1 mg/L Herbiace^®, 2.5 g/L Gelrite™ and pH adjusted to 5.7) and cultured for seven days in low light (13 μΕιη-28-ι) with 16:8 hour photoperiod, followed by seven days in high light (40 μΕιη-28-ι). Emerging shoots were transferred to 36(1H) medium (MS salts and vitamins, 3% sucrose, 1 mg/L Herbiace^®, 2.5 g/L Gelrite™, pH 5.7) in 100 x 25 mm plates. When shoots reached about 3-5 mm in length they were transferred to SHGA rooting medium (SH salts and vitamins, 1 g/L myo-inositol, 1% sucrose, 2.5 g/L Gelrite™, pH 5.8) in 25 x 150 mm glass tubes. Plantlets were transferred to the greenhouse after adequate root

development was observed.

Transfer and Establishment of TO Plants in the Greenhouse. Transgenic plants were assigned unique identifiers and transferred to the greenhouse. Plants were transplanted from tubes to small pots (3.5" SVD) and covered with a Humidome™ for one week to help acclimate the plants to the greenhouse environment (-28 °C day temp/~26°C night temp/16: 8 supplemental lighting). Plants were then transplanted from small pots to root trainers for insect-bioassay

(Spencer-Lemaire Industries, Edmonton, Alberta Canada; style Tinus 350-4). Three plants per event were placed in root trainers while the remaining three plants per event were transferred to 5- gallon pots by the greenhouse staff for hand pollinations and Tl seed production. Approximately four days after transplanting to root trainers, plants were infested for bioassay.

Production of Tl Seed. Plants that passed the bioassay and the corresponding three plants per event that were not bioassayed were transplanted to 5 gallon pots. Observations were taken on a weekly basis to track any abnormal phenotypes. As ears emerged, shoot bags were placed over the shoot prior to silk emergence to ensure no cross-contamination by stray pollen. If any shoots produced silk before covering, notes were made and the shoot was removed. The second shoot was covered to use for pollinations. Plants that produced abnormal or no shoots were recorded in the database. Tassels from the TO plants were removed prior to shedding to eliminate transgenic pollen flow in the greenhouse. Silks were cut back to provide an even brush to accept pollen during pollinations. Pollen from the inbred Zea mays c.v. 5XH751 was used for all pollinations.

After the pollinations had been completed, the plants were placed in the greenhouse and allowed to grow and develop. Ears were peeled back at 21 days after pollination to enhance dry down followed by complete harvest (ear removed from plant) at 42 days after pollination. Ears were placed in a drier for 1 week followed by seed processing (shelling, counting, packaging in pre-printed envelopes, and seed count entry into database).

Example 4: Protein expression of transgenic plants/events

Protein Expression by Western Blot in Callus Plant Material. Maize callus samples were analyzed for the presence of TcdA by western blots. In preparation for analysis, 200 mg of callus sample was collected into 96 well cluster tube boxes (Corning, Corning, NY) and stored at -80°C. At the time of analysis, the samples were extracted by adding 4 steel beads (3.5mm, Bio Spec

Products , BartlesviUe, OK) plus 200 μΐ of extraction buffer (IX Phosphate Buffered Saline (PBS) + 0.1% Triton-X -100). Samples were beat using beads in the Kleco bead mill™ (Garcia

Machine, Visalia, CA) for 3 minutes at the maximum setting. After processing, the samples were centrifuged at 3000 rcf for 5 minutes in a plate centrifuge (Qiagen). The resulting supernatant was transferred by pipetting to new tubes. Western samples were prepared by mixing extract with an appropriate amount of sample buffer (NuPage LDS™ 4X Sample buffer (Invitrogen, Carlsbad, CA) with 40 mM dithiothreitol). A purified protein positive control (PA1, 0.4mg/ml) was prepared in sample buffer as above to a concentration of 6.25 ng/μΐ. Forty microliters of each prepared sample and standard were placed in PCR tubes (Thermo Scientific) and heated in a thermocycler (Applied BioSystems, Foster City, CA) for 5 minutes at 90°C. Samples were resolved on 3-8% Tris- Acetate gels (Invitrogen EA0375) with Tris-Acetate-SDS running buffer (Invitrogen).

In addition, the inner gel chamber had antioxidant (Invitrogen) added to the running buffer. Samples were loaded according to gel specifications with 25

of sample loaded for callus samples, 4 μΐ loaded for the purified protein control (25 ng) and 15 μΐ of a molecular weight marker (SeeBlue Marker™, Invitrogen, Carlsbad, CA). Gels were run at a constant 150 V for 75 minutes. Meanwhile, transfer pads and 0.2 μιη nitrocellulose membranes (Invitrogen) were prepared by soaking in transfer buffer (IX NuPage Transfer Buffer™ (Invitrogen) + 10-20% methanol). After resolving the proteins on the gel, the blot module (Invitrogen) and gels to be transferred were assembled according to the manufacturer's instructions. Gels were then transferred at a constant 45 V for at least 1.5 hours (2 hours for 2 gels per blot module). Early callus Western blots were run using the Bio-Rad Criterion™ system (4-20% Tris-HCl gels [Bio- Rad, Hercules, CA] and IX Tris/Glycine/SDS running buffer). However, due to poor gel to gel quality the decision was made to switch to the above specified Invitrogen system. Post transfer, the membranes were blocked for 30 minutes at room temperature in Western Breeze Blocking buffer (Invitrogen). The blocking solution was removed and the primary antibodies (MAB anti- TcdA 148G4.1 and MAB anti-TcdA 148D11.1) were added at a concentration of 1.0 μg/ml in blocking buffer. The membranes were incubated for at least 1 hour at room temperature. The membranes were washed 3 times for 5 minutes each with Western Breeze™ wash solution (Invitrogen). The secondary antibody (Anti-Mouse HRP [Sigma, St. Louis, MO]) was prepared in blocking solution at a 1:3000 dilution. The membranes were incubated for 1 hour at room temperature before washing as above. Excess wash buffer was removed from the membranes by gently blotting the edge of the membrane to paper towels. The membranes were exposed to chemiluminescent substrate (Thermo Scientific) for 5 minutes. Excess substrate was removed as above and the membranes were wrapped in plastic wrap. In a darkroom, X-ray film (Thermo Scientific, Waltham, MA) was exposed to the membranes to visualize bands. Films were developed for 5 minute and 2 hour film exposures.

Protein Expression by ELISA in TO Plant Material. Maize leaf material was analyzed for the presence of TcdA using a mono-mono ELISA. Leaves from greenhouse grown plants were sampled by cutting a 2 cm leaf piece from the tip of the first fully expanded leaf, one week after plants were infested with rootworm eggs. Samples were collected into 96 well cluster tube boxes (Corning) and frozen at -80°C. Samples were prepared for extraction by adding 3 steel beads (3.5mm, Bio Spec Products, Bartlesville, OK),l steel bead (4.5 mm Daisy) and 100 μΐ of PBEX extraction buffer (19 mM NaH₂P(X 31 mM Na₂HP04, 10 mM 0.5M EDTA , and 0.1% Triton^®-X 100). The samples were pulverized using the Kleco Beadmill™ (Garcia Machine) for 3 minutes at the maximum setting. An additional 300 μΐ of PBEX extraction buffer was added to the samples and the samples were processed for an additional 1 minute. After processing, the samples were centrifuged at 3000 rcf for 5 minutes in a plate centrifuge (Qiagen). The resulting supernatant was transferred to new tubes. ELISA plates were prepared by Beacon Analytical Systems (Portland,

ME) as follows: Maxisorb plates™ (Thermo Fisher Scientific) were coated with an anti-TcdA monoclonal antibody (MAB anti-TcdA 148G4.1) at a concentration of 1.0 μ^ηύ in IX PBS.

Following overnight incubation at 4°C, plates were blocked with 1% cold water fish gelatin (Sigma) in PBST (PBS + 0.5% Tween -20). Plates were dried and individually wrapped for storage. At the time of analysis, plates are warmed to room temperature and washed 4 times in a plate washer (TomTec) using 350 μΐ of PBST per wash prior to loading samples. A purified protein reference antigen (PA1, 0.4 mg/ml) was diluted in PBEX buffer tol50 ng/ml and used to generate a standard curve of serial dilutions from 150 ng/ml to 2.34 ng/ml. Samples were diluted in PBEX buffer to a starting dilution of 1:8 and serial diluted 3 additional times. Next, 100 μΐ of all standards and sample dilutions were loaded in duplicate onto the ELISA plate. Samples were incubated on the ELISA plates at room temperature for 1 hour. Following incubation, the plates were washed as above. A horseradish peroxidase conjugated monoclonal antibody (MAB anti- TcdA 148D11.1 -- HRP) (prepared by Covance, Denver, PA) was diluted to 1 μ^πύ in PBS and added to plates at 100 μΐ per well. The plates were incubated at room temperature for 1 hour. After incubation the plates were washed. The stack of plates was rotated 180° and the wash step was repeated. Next, 1 -Step Ultra TMB substrate™ (Thermo Scientific) was added to the plates at 100 μΐ per well. As the wells with the lowest dilution of the standard curve began to show blue color, the reaction was stopped by adding 50 μΐ of stop solution (0.4 N H2SO4). The plates were read in a plate reader (Molecular Devices) using SoftMax^® Pro v5 (Molecular Devices) at a wavelength of 450 nm minus a 650 nm reference. The TcdA concentration of test samples was calculated by linear regression of a quadratic standard curve.

Total soluble protein in leaf extracts was determined by Bradford assay. Maize leaf samples were diluted using Milli-Q^® water in a 96 well polypropylene plate (Corning). A protein standard (Pre-diluted Protein Assay Standards: BSA [Thermo Scientific]) was diluted to a starting concentration of 0.5 mg/ml and serial diluted down the plate to 0.0625 mg/ml leaving the bottom wells as a water blank. Samples were transferred to a Maxisorb^® plate (Thermo Fisher Scientific) and prepared protein dye (BioRad) was added to the wells. The plates were read in a plate reader (Molecular Devices) using SoftMax^® Pro v5 (Molecular Devices) at a wavelength of 595 nm. The total soluble protein concentration was calculated by linear regression of a quadratic standard curve. Statistical analysis was conducted using JMP software (version 7.0.2, SAS Industries, Inc., Cary, NC). Protein expression (parts per million of TcdA) values were transformed using a log+1 transformation.

The ELISA herein used two monoclonal antibodies that could only recognize one epitope per antibody thus reducing the ability of the assay to recognize truncated TcdA. Because of this specificity, there is confidence that the expression levels determined by the ELISA represent full length TcdA. Since the lowest dilution of the leaf sample extract is 1:8, this results in a lower limit of detection of 16 ng/ml and a lower limit of quantitation (lowest dilution factor x lowest standard that has an O.D. of 2 times the background) of 36 ng/ml. Thus any results between 36 ng/ml and zero should not be considered accurate.

Protein Expression by ELISA in Tl Plant Material. As a non-destructive screening method, maize plants were analyzed for the presence of the selectable marker Phosphinothrincin Acetyltransferase (PAT) by a qualitative enzyme linked immunosorbent assay (ELISA). Leaves from greenhouse grown plants were sampled by cutting a 2 cm leaf piece from the tip of the first fully expanded leaf. Samples were collected into 96 well cluster tube boxes (Corning) and frozen at -80°C. Samples were prepared for extraction by adding two steel beads (4.5 mm, Daisy, Rogers AR) and 100 μΐ of phosphate buffered saline with 0.5% Tween^®- 20 (PBST) extraction buffer. The samples were pulverized using the Kleco Beadmill™ (Garcia Machine) for three minutes at the maximum setting. An additional 300 μΐ of PBST extraction buffer was added to the samples and the samples were processed for an additional one minute. After bead beating, the samples were centrifuged at 3,000 rcf for five minutes in a plate centrifuge (Qiagen). The resulting supernatant was transferred to new tubes. ELISA plates from PAT kit AP014 (EnviroLogix, Portland, ME) were warmed to room temperature in preparation for use. A purified protein reference antigen (PAT Standard, TSN 104799, 63 μ^πύ) was diluted in PBST buffer to 10 ng/ml and used to generate a standard curve of the following dilutions: 5 ng/ml, 0.625 ng/ml, and 0.156 ng/ml. To prepare the plates for use, 50 μΐ of enzyme conjugate (EnviroLogix, Portland, ME) was added to each well followed by 50 μΐ of PBST. Next, 50 μΐ of the standards and samples were loaded onto the ELISA plate in their respective wells and allowed to incubate at room temperature for one hour. Following incubation, the plates were washed four times in a plate washer

(TomTec) using 350 μΐ of PBST per wash. EnviroLogix TMB substrate™ was added to the plates at 100 μΐ per well and allowed to incubate for 15 minutes. The reaction was stopped by adding 100 μΐ of stop solution. The plates were read in a plate reader (Molecular Devices) using

SoftMax^® Pro v5 (Molecular Devices) at a wavelength of O.D. 450, the subtracted OD was greater than 0.7 nm.

Plants selected for insect bioassay were analyzed for the presence of TcdA by a

Mono/Mono ELISA. Leaf samples were collected at two time points: one week post infestation with rootworm eggs and at the end of bioassay (21 days post infestation). Leaves were sampled by cutting a 2 cm leaf piece from the tip of the first fully expanded leaf. Samples were collected into 96 well cluster tube boxes (Corning) and frozen at -80°C. Samples were prepared for extraction by adding two steel beads (4.5mm, Daisy) and 100 μΐ of PBEX extraction buffer (19 mM NaH₂P04, 31mM Na₂HP04, 10 mM 0.5M EDTA , and 0.1% Triton^®-X 100). The samples were pulverized using the Kleco Beadmill™ (Garcia Machine) for three minutes at the maximum setting. An additional 300 μΐ of PBEX extraction buffer was added to the samples and the samples were processed for an additional 1 minute. After bead beating, the samples were centrifuged at 3000 rcf for five minutes in a plate centrifuge (Qiagen). Root samples for each plant were collected at the end of bioassay. Root samples (200 mg per plant) were prepared for extraction by adding four steel beads (4.5mm, Daisy) and 400 μΐ of PBEX extraction buffer to a 2 ml tube. The samples were pulverized using the Kleco Beadmill™ (Garcia Machine) for 3 minutes at the maximum setting. After bead beating, the samples were centrifuged at 3000 rcf for five minutes in a plate centrifuge (Qiagen). The resulting supernatant was transferred to new tubes. ELISA plates were prepared by Beacon Analytical Systems (Portland, ME) as follows: MaxiSorb plates (Thermo Fisher Scientific) were coated with an anti-TcdA monoclonal antibody (MAB anti-TcdA 148G4.1) at a concentration of 1.0 μg/ml in IX PBS. Following overnight incubation at 4°C, plates were blocked with 1% cold water fish gelatin (Sigma) in PBST (PBS + 0.5% Tween^®-20). Plates were dried and individually wrapped for storage. At the time of analysis, plates were warmed to room temperature and washed four times in a plate washer (TomTec) using 350μ1 of PBST per wash prior to loading samples.

A purified protein reference antigen (PA1, 0.4 mg/ml) was diluted in PBEX buffer to 150 ng/ml and used to generate a standard curve of serial dilutions from 150 ng/ml to 2.344 ng/ml. Samples were diluted in PBEX buffer to a starting dilution of 1:8 and serial diluted 3 additional times (1:8, 1: 16, 1:32, 1:64). Next, 100 μΐ of the standards and sample dilutions were loaded in duplicate onto the ELISA plate. Samples were incubated on the ELISA plates at room

temperature for one hour. Following incubation, the plates were washed as above. A horseradish peroxidase conjugated monoclonal antibody (MAB anti-TcdA 148D11- HRP) was diluted to 1 μg/ml in PBS and added to plates at 100 μΐ per well. The plates were incubated at room

temperature for 1 hour. After incubation the plates were washed with Step Ultra TMB™ substrate (Thermo Scientific). This wash solution was added to the plates at 100 μΐ per well. As the wells with the lowest dilution of the standard curve began to show blue color, the reaction was stopped by adding 50 μΐ of stop solution (0.4 N H₂S0₄). The plates were read in a plate reader (Molecular Devices) using SoftMax^® Pro v5 (Molecular Devices) at a wavelength of O.D. 450 nm, with a subtraction of a 650 nm reference. The TcdA concentration of test samples was calculated by quadratic regression analysis.

After the bioassay, a subset of leaf and root samples were analyzed for the presence of

TcdA by Western blots. Western samples were prepared by mixing extract with an appropriate amount of sample buffer (NuPage LDS™ 4X Sample buffer [Invitrogen] with 40 mM

Dithiothreitol). A purified protein positive control (PA1, 0.4mg/ml) was prepared in sample buffer as above to a concentration of 6.25 ng/μΐ. Next, 40 μΐ of each prepared sample and standard were placed in PCR tubes (Thermo Scientific) and heated in a thermocycler (Applied

BioSystems) for 5 minutes at 90° C. Samples were resolved on 3-8% Tris-Acetate gels

(Invitrogen) with Tris-Acetate-SDS running buffer (Invitrogen). In addition, the inner gel chamber had antioxidant (Invitrogen) added to the running buffer. Samples were loaded according to gel specifications with 25 μΐ of sample loaded for each of the leaf and root samples, 4 μΐ loaded for the purified protein control (25 ng) and 15 μΐ of a molecular weight marker (SeeBlue

Marker™, Invitrogen). Gels were run at a constant 150 V for 75 minutes. While the gels ran, transfer pads and 0.2 μιη nitrocellulose membranes (Invitrogen) were prepared by soaking in transfer buffer (IX NuPage^® Transfer Buffer (Invitrogen) + 10-20% methanol). After resolving the proteins on the gel, the blot module (Invitrogen) and gels to be transferred were assembled according to the manufacturer's instructions. Gels were then transferred at a constant 45 V for at least 1.5 hours (2 hours for 2 gels per blot module). Post transfer, the membranes were blocked for 30 minutes at room temperature in Western Breeze^® blocking buffer (Invitrogen). The blocking solution was removed and the primary antibodies (MAB anti-TcdA 148G4.1 and MAB anti-TcdA 148D11.1) were added at a concentration of 1.0 μg/ml in blocking buffer. The membranes were incubated for at least 1 hour at room temperature. The membranes were washed 3 times for 5 minutes each with Western Breeze^® wash solution (Invitrogen). The secondary antibody (Anti-Mouse HRP (Sigma)) was prepared in blocking solution at a 1:3000 dilution. The membranes were incubated for 1 hour at room temperature before washing as above. Excess wash buffer was removed from the membranes by gently blotting the edge of the membrane to paper towels. The membranes were exposed to chemiluminescent substrate (Thermo Scientific) for 5 minutes. Excess substrate was removed as above and the membranes were wrapped in plastic wrap. In a darkroom, X-ray film (Thermo Scientific) was exposed to the membranes to visualize bands. Films were developed for 5 minute and 2 hour film exposures.

Total soluble protein in leaf and root extracts was determined by Bradford assay. Maize leaf and root samples were diluted using Milli-Q^® water in a 96 well polypropylene plate

(Corning). A protein standard (Pre-diluted Protein Assay Standards: BSA™ (Thermo Scientific)) was diluted to a starting concentration of 0.5 mg/ml and serial diluted down the plate to 0.0625 mg/ml leaving the bottom wells as a water blank. Samples were transferred to a MaxiSorb plate™ (Thermo Fisher Scientific) and prepared protein dye (BioRad) was added to the wells. The plates were read in a plate reader (Molecular Devices) using SoftMax^® Pro v5 (Molecular Devices) at a wavelength of O.D. 595 nm. The total soluble protein concentration was calculated by quadratic regression analysis. Statistical analysis was conducted using JMP software (version 7.0.2, SAS Industries, Inc., Cary, NC). Protein expression (parts per million of TcdA) values were transformed using a log transformation. Example 5: To Transgenic plant expression screening

Protein Expression Analysis in TO Plants. The Western blot and ELISA data showed that the transgenic pDAS5144 events specifically expressed the TcdA protein in root tissues. The expression of TcdA in both callus and TO leaf samples for the pDAS5144 events was surprisingly low as shown in TABLE 2. The maize leaf expression profile of TcdA for the various constructs is reported in parts per million (PPM). The expression of TcdA in the pDAS5144 construct was significantly less than the other constructs. The average expression of TcdA in the pDAS5144 constructs was 14 PPM. The range of expression for leaf material from this construct was 0-200 PPM. The lower expression level in leaf tissue is a result of the promoter tissue specificity. TABLE 2: Expression of TcdA protein in TO maize leaves and callus by construct.

Levels not connected by the same letter are significantly different.

Protein Expression Analysis in Tl Plants. TABLE 3 lists the results of quantitative ELISA analysis for the TcdA protein isolated from Tl maize leaves one week post infestation during an insect bioassay. The Tl maize leaves for the various events were harvested and submitted for insect bioassay to test the efficacy of the expressed TcdA protein. The average TcdA expression (PPM) was recorded by construct, with range and top quartile results. In addition, the Tukey- Kramer means separation analysis results for average TcdA expression in maize leaves is reported for each set of events. The TcdA protein expression of plants containing construct pDAS5144 was negligible in the leaf tissues. Despite negligible expression of TcdA in maize leaves, bioassay results indicated that the pDAS5144 events provided tolerance to insect infestation (e.g., rootworm infestation). Analyzing the combination of the bioassay data and protein expression data (from the leaves) showed no correlation between protein expression in leaves and root damage levels by the rootworms. The lower TcdA expression level in leaf tissue combined with the expression of TcdA in roots suggests that the novel chimeric gene promoter regulatory element express the tcda transgene in a root- tissue specific manner. TABLE 3: Average TcdA protein expression levels (ppm) in maize leaves, by construct, for samples collected during insect bioassay.

Levels not connected by the same letter are significantly different.

Protein Expression Analysis after Insect Bioassay. ELISA and Western blots were used to analyze a subset of leaf and root material after completion of insect bioassay experiments.

TABLES 4 and 5 list the average TcdA protein expression in leaf and root material, respectively. While there were significant differences in expression levels of TcdA protein in Tl maize leaves between constructs, the differences between constructs were less distinguished in roots analyzed following the insect bioassay as compared to leaves. The pDAS5144 events produced the greatest range of TcdA protein expression, resulting in expression of TcdA protein in the transgenic events that were assayed. Comparatively, from the total protein recovered, noTcdA protein was detectable in the leaf tissues. These results further suggest that the transgene expression from construct pDAS5144, in which TcdA is driven by the novel chimeric gene promoter regulatory elements, is root specific. TABLE 4: Expression of TcdA protein (PPM) in maize leaves, by construct, after the completion of the insect bioassay.

^? Levels not connected by the same letter are significant y different.

TABLE 5: Expression of TcdA protein (PPM) in maize roots, by construct, after the completion of the insect bioassay.

Protein Expression at V6 and VT Stages of Development. Further studies were performed to assess the expression levels of TcdA by the novel chimeric gene promoter regulatory elements at the V6 and VT stages of corn plant development. Maize plants were grown expressing the transgene TcdA from each of the constructs 5116, 5117, and 5144. Protein was isolated for the Tl leaf tissue and quantitated, these results were compared to total protein isolated from the whole plant. These results as shown in TABLE 6 further confirm that the tcda transgene expression from the novel chimeric gene promoter regulatory elements of construct pDAS5144 is root specific. The TcdA protein was detected from total protein isolated from whole plants, but there was no TcdA protein detected in the leaves. Additionally, the novel chimeric gene promoter regulatory elements of construct pDAS5144 expressed the tcda transgene at both theV6 and VT stages of maize growth and development. TABLE 6: Total TcdA protein from Tl maize leaves harvested at the V6 and VT stages of plant growth and development.

As such a novel chimeric gene promoter regulatory elements were operably linked and used to express a transgene as a gene expression cassette, and the resulting expression profile was characterized. Disclosed for the first time is a chimeric promoter comprising an upstream- promoter polynucleotide sequence that was obtained from Zea mays Peroxidase 5 followed by the Zea mays alcohol dehydrogenase (I) intron 6 and Maize Streak Virus 5' -UTR for use in gene expression constructs. Constructs expressing the novel chimeric gene promoter regulatory elements were shown to express a transgene in a root tissue specific manner. The tissue specificity results are surprising, given that a chimeric promoter comprising an up stream-promoter polynucleotide sequence that was obtained from Zea mays Peroxidase 5 followed by the Zea mays alcohol dehydrogenase intron 1, expressed a transgene in both leaf and root tissues, see Table 22 of U.S. Pat. No. 6,384,207.

Claims

WHAT IS CLAIMED IS:

I . A chimeric polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: 1.

2. The chimeric polynucleotide sequence of claim 1, wherein the

polynucleotide has at least 90% sequence identity to SEQ ID NO: l.

3. The chimeric polynucleotide sequence of claim 1, wherein the

polynucleotide comprises SEQ ID NO: l.

4. The chimeric polynucleotide sequence of claim 1, wherein the

polynucleotide consists of SEQ ID NO: 1.

5. The chimeric polynucleotide sequence of claim 1, wherein the chimeric polynucleotide sequence is operably linked to a transgene.

6. The chimeric polynucleotide sequence of claim 5, wherein the transgene is tcdA.

7. The chimeric polynucleotide sequence of claim 1, wherein the operably linked transgene encodes a polypeptide or small RNA.

8. The chimeric polynucleotide sequence of claim 1, wherein the chimeric polynucleotide sequence promotes root-preferred expression of a transgene.

9. The chimeric polynucleotide sequence of claim 8, wherein the root- preferred expression includes maize root-preferred expression.

10. A transgenic cell comprising a synthetic polynucleotide that hybridizes under stringent conditions to a polynucleotide probe comprising a sequence identity of at least 90% to a complement of SEQ ID NO: l.

I I. The transgenic cell of claim 10, wherein the synthetic polynucleotide has at least 90% sequence identity to SEQ ID NO: 1.

12. The transgenic cell of claim 10, wherein the synthetic polynucleotide comprises SEQ ID NO: l.

13. The transgenic cell of claim 10, wherein the transgenic cell is produced by a plant transformation method.

14. The transgenic cell of claim 13, wherein the plant transformation method is selected from the group consisting of an Agrobacterium-mediated transformation method, a biolistics transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method.

15. The transgenic cell of claim 10, wherein the synthetic polynucleotide is a tissue-preferred promoter.

16. The transgenic cell of claim 15, wherein the tissue -preferred promoter is a root tissue-preferred promoter.

17. A transgenic plant comprising the transgenic cell of claim 10.

18. The transgenic plant of claim 17, wherein the transgenic plant is a monocotyledonous or a dicotyledonous plant.

19. The transgenic plant of claim 18, wherein the monocotyledonous plant is selected from the group consisting of a maize plant, a rice plant, and a wheat plant.

20. A transgenic seed from the transgenic plant of claim 17.