WO2015083121A1 - Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification - Google Patents

Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification Download PDF

Info

Publication number
WO2015083121A1
WO2015083121A1 PCT/IB2014/066602 IB2014066602W WO2015083121A1 WO 2015083121 A1 WO2015083121 A1 WO 2015083121A1 IB 2014066602 W IB2014066602 W IB 2014066602W WO 2015083121 A1 WO2015083121 A1 WO 2015083121A1
Authority
WO
WIPO (PCT)
Prior art keywords
library
genome
primer pair
sample
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2014/066602
Other languages
French (fr)
Inventor
Christoph Andreas Klein
Bernhard Michael Polzer
Nicolò Manaresi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fraunhofer Gesellschaft zur Foerderung der Angewandten Forschung eV
Silicon Biosystems SpA
Original Assignee
Fraunhofer Gesellschaft zur Foerderung der Angewandten Forschung eV
Silicon Biosystems SpA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fraunhofer Gesellschaft zur Foerderung der Angewandten Forschung eV, Silicon Biosystems SpA filed Critical Fraunhofer Gesellschaft zur Foerderung der Angewandten Forschung eV
Priority to CA2932524A priority Critical patent/CA2932524C/en
Priority to CN201480074845.3A priority patent/CN106030307B/en
Priority to US15/101,299 priority patent/US10392657B2/en
Priority to KR1020167017659A priority patent/KR102275752B1/en
Priority to JP2016536851A priority patent/JP6543253B2/en
Publication of WO2015083121A1 publication Critical patent/WO2015083121A1/en
Anticipated expiration legal-status Critical
Priority to US16/455,470 priority patent/US20190316194A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00Methods of screening libraries
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/122Massive parallel sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2545/00Reactions characterised by their quantitative nature
    • C12Q2545/10Reactions characterised by their quantitative nature the purpose being quantitative analysis
    • C12Q2545/101Reactions characterised by their quantitative nature the purpose being quantitative analysis with an internal standard/control

Definitions

  • the present invention relates to a method and a kit for determining the integrity of the genome of a sample, in particular a single cell, and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample.
  • DRS-WGA deterministic restriction site whole genome amplification
  • WGA Whole Genome Amplification
  • CTC single circulating tumour cells
  • CTCs have been described as being frequently apoptotic (Mehes, G. , et al . , Circulating breast cancer cells are frequently apoptotic. Am J Pathol, 2001. 159 (1) : p.17-20) .
  • genomic DNA is fragmented into small pieces of 180 bp to 200 bp length (Wyllie, AH., Glucocorticoid- induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature, 1980. 284(5756): p.555-6).
  • DNA crosslinking and/or fragmentation occur with chemical treatment (e.g. fixation) applied on patient- derived cells and tissues for needed sample conservation after biopsy.
  • chemical treatment e.g. fixation
  • Available single cell WGA kits assess quality of whole genome amplification by measuring the concentration of the WGA product only.
  • protocols for these methods include at least one random step during the procedure of single cell DNA amplification, specific assays to evaluate genome integrity of the input sample (in general a single cell) such as apoptotic or non-apoptotic status, or the quality of the output of the WGA product, such as the suitability for further genetic analysis, are difficult.
  • DRS-WGA deterministic restriction site whole genome amplification
  • DRS-WGA has been shown to be better for the amplification of single cells (see for example: Lee YS , et al : Comparison of whole genome amplification methods for further quantitative analysis with microarray-based comparative genomic hybridization. Taiwan J Obstet Gynecol. 2008, 47(1) : 32-41) and also more tolerant to DNA degradation due to fixative treatment (see for example: Stoecklein N.H. et al : SCOMP is Superior to Degenerated Oligonucleotide Primed-PCR for Global Amplification of Minute Amounts of DNA from Microdissected Archival Samples. American Journal of Pathology 2002, Vol. 161, No. 1; Arneson N. et al .
  • An object of the present invention is therefore to provide a method for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by DRS-WGA that provides robust and reliable results and allows in particular to assess the biological status of a cell/ cells of the sample and/or predict the performance of molecular assays downstream of the DRS-WGA.
  • sample there is intended a sample comprising at least one particle of a biological entity, said particle comprising at least a DNA sequence representing the genome or a substantial subset of the genome of that biological entity.
  • said entity may be a human
  • said at least one particle may be a set of 5 cells or less, a single cell, or a single-cell nucleus, or a haploid germ cell, or a chromosome.
  • genome there is intended the entire genome or said substantial subset of the genome.
  • quality of a library of DNA sequences there is intended the suitability of the library of DNA sequences to be used for the genetic characterization of certain features such as, by way of non- limiting example, the presence of point mutations, deletions, insertions, copy number variations .
  • Figure 1 shows an agarose gel picture of single marker PCRs, and of a 4 -multiplex assay and a 3 -multiplex assay according to preferred embodiments of the present invention
  • Figure 3 shows an agarose gel picture of 8 samples tested by the preferred 4 -multiplex assay of Figure 1.
  • Figure 4 shows a histogram of the distribution of the
  • CTCs Circulating Tumour Cells
  • WBCs single leukocytes
  • the method according to the present invention for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprises steps (a) to (d) .
  • the method By allowing the determination of the integrity of the genome of a sample and/or the quality of a library of sequences obtained by DRS-WGA of the genome of the sample, the method also allows to assess the biological status of of a cell cells of the sample and/or predict the success rate of genetic analysis assays on the library of DNA sequences .
  • the sample preferably consists of 5 cells or less , more preferably the sample is a single cell .
  • the single cell is preferably a circulating tumour cell (CTC) , a circulating fetal cell, a circulating endothelial cell (CEC) , an oocyte, a cumulus cell, a sperm, a blastomere, or a trophectoderm cell.
  • step (a) the library of DNA sequences is provided.
  • step (b) the library of DNA sequences is amplified by PGR using at least one first primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a first chromosome arm, the step of amplifying giving rise to a first PGR product from 50 bp to 1000 bp.
  • the DNA sequence of the library to which the first primer pair hybridises encompasses the D5S2117 region of chromosome 5q.
  • the forward primer of the first primer pair is SEQ ID NO : 4 and the reverse primer of the f irst primer pair is SEQ ID NO : 3.
  • step (c) the first PCR product is detected.
  • Agarose gel electrophoresis may be used to separate and detect the PCR product as well as other methods known in the art.
  • step (d) the presence of the first PCR product is correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences.
  • step (b) at least one second primer pair is used which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, more preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a second chromosome arm other than the first chromosome arm, the step of amplifying giving rise to a second PCR product from 50 bp to 1000 bp having a size other than the first PCR product .
  • the second PCR product is also detected in step (c) and the presence of the second PCR product is also correlated with the integrity of the genome of the sam le and/or the quality of the library of DNA sequences in step (d) .
  • the DNA sequence of the library to which the second primer pair hybridises encompasses exons 2 and 3 of the TRP53 gene.
  • the forward primer of the second primer pair is SEQ ID NO: 6 and the reverse primer of second primer pair is SEQ ID NO : 5.
  • step (b) at least one third primer pair is used which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, more preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a third chromosome arm other than the first and second chromosome arms, the step of amplifying giving rise to a third PCR product from 50 bp to 1000 bp having a size other than the first and second PCR products.
  • the third PCR product is also detected in step (c) and the presence of the third PCR product is also correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences in step (d) .
  • the DNA sequence of the library to which the third primer pair hybridises encompasses the KRT19 pseudo-gene 1 (indicated for short as CK19) .
  • the forward primer of the third primer pair is SEQ ID NO : 8 and the reverse primer of the third primer pair is SEQ ID NO : 7.
  • step (b) at least one fourth primer pair is used which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, the step of amplifying giving rise to a fourth PCR product from 50 bp to 200 bp having a size other than the first, the second and the third PCR products .
  • step (b) uses at least one fourth primer pair
  • the fourth PCR product is also detected in step (c) and the presence of the fourth PCR product is also correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences in step (d) .
  • the DNA sequence of the library to which the fourth primer pair hybridises encompasses codons 12 and 13 of the RAS gene.
  • the forward primer of the fourth primer pair is SEQ ID NO: 17 and the reverse primer of the fourth primer pair is SEQ ID NO: 18.
  • kits for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprising :
  • DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a first chromosome arm
  • the first, second and third primer pairs give rise, when amplified by PCR, to PCR products having different size from one another.
  • the kit further comprises at least one fourth primer pair which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, wherein the first, second, third and fourth primer pairs give rise, when amplified by PCR, to PCR products having different size from one another.
  • the kit comprises the first, second, third and fourth primer pairs.
  • the kit may be used for predicting the success of a genetic analysis assay after amplification of single cell genomic DNA by DRS-WGA.
  • the genetic analysis assay is Sanger sequencing for mutation analysis, assessment of specific copy number changes, quantitative PCR for gene amplification, metaphase Comparative Genomic Hybridisation (CGH) , or array Comparative Genomic Hybridisation ( CGH) .
  • samples with at least 1-2 out of 4 PCR products can be used. Positivity to at least 3 out of 4 PCR products is predictive of successful genome-wide analysis with metaphase CGH . For array CGH it is advisable to use samples with 4 out of 4 positive PCR products.
  • the kit may also be used to determine the integrity of the genome of a sample and thus determine the biological status of the cell/cells of the sample.
  • the sample preferably consists of 5 cells or less, more preferably the sample is a single cell.
  • PGR amplification reactions including several primer pairs designed to determine the integrity of the genome of a sample and/or the quality of the library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS -WGA) of the genome of the sample are also referred to as “quality control assays” or “QC assays” .
  • CGH metaphase comparative genomic hybridization
  • Step 11 4 °C forever
  • This primer pair amplifies a microsatellite sequence. Therefore the actual fragment length can vary slightly between alleles of one patient and between different patients.
  • PCR markers 72 single cell genomes from different types of human cancers (24 breast disseminated cancer cells (DCCs) 24 prostate DCCs, 24 melanoma DCCs) were re-amplified. For each of the three groups, 12 cells were included which resulted in successful metaphase hybridization in a previous CGH experiment and 12 cells which resulted in a failed metaphase hybridization in a previous CGH experiment. Specific PCRs for all selected markers were performed and the assay was evaluated for accuracy in predicting the outcome of metaphase CGH.
  • DCCs breast disseminated cancer cells
  • 24 melanoma DCCs 24 melanoma DCCs
  • PCRs on the long Mse- fragments D5S2117 , TRP53-Ex2/3 and KRT19 pseudogene 1 provided best separation between amplified genomes with successful and failed metaphase CGH.
  • An assay of these three fragments showed high assay accuracy in predicting the success of metaphase CGH.
  • the addition of the PCR on the shortest Mse- fragment PHACTR2 slightly increased the assay accuracy in the collective of 72 DCC genomes.
  • Step 2 95.0°C 30 s
  • Step 6 4.0°C forever 5 ⁇ of each PCR product were loaded on a 1.2% agarose gel. The results were checked by comparing the obtained amplicons bp length with the expected ones, as shown in table 4.
  • PCR products may be:
  • Figure 3 shows an example of an agarose gel electrophoresis of PCR products obtained from different samples by using the above disclosed 4 multiplex assay.
  • Sample 1 in Figure 3 for example displays 3/4 positive markers.
  • Marker B heterozygosity or homozigosity one or two bands must be counted as one in the evaluation of the positivity for marker B.
  • Samples 2 and 8 for example display 4/4 positive markers.
  • the KRAS 91bp amplicon was detected in all 38 samples that showed one or more bands in the currently used 3 -multiplex. Additionally, 15 samples were identified that were negative for D5S2117 , CK19 and TP53-Exon2/3 but positive for KRAS91bp, only. Finally 18 samples were negative for all four tested amplicons.
  • PIK3CA sequence analysis 4 breast DCC samples, 3 prostate DCC samples, and 3 melanoma DCC samples.
  • PIK3CA PCRs were performed for HS1 and HS2 fragments, using A plilTM PIK3CA Seq Kit (Silicon Biosystems SpA, Italy) , according to the manufacturer instructions . After PGR all samples were loaded on a 1.5% agarose gel and amplicons visualized after electrophoresis.
  • a Gil with a value of 0 corresponds to a situation in which none of the first, second, third or fourth PCR products is amplified
  • a Gil with a value of 1 corresponds to a situation in which only the fourth PCR product is amplified
  • a Gil with a value of 2 corresponds to a situation in which one among the first, second and third PCR products and the fourth PCR product are amplified
  • a Gil with a value of 3 corresponds to a situation in which two among the first, second and third PGR products and the fourth PGR product are amplified
  • a GII with a value of 4 corresponds to a situation in which the first, second, third and fourth PCR products are amplified .
  • the GII was further used to assess the success rate of targeted Sanger sequencing for PIK3CA exon 9 and exon 20 mutation hotspots, of a custom qPCR assay to determine the amplification of ERBB2 gene, and of array CGH .
  • Table 5 shows a synopsis of the results.
  • the method according to the present invention allows to determine the integrity of the genome of a sample and the quality of a library of DNA sequences obtained by DRS-WGA of the genome of the sample with robust and reliable results and allows in particular to predict the performance of molecular assays, such as metaphase and array comparative genomic hybridization (CGH) , Sanger sequencing and qPCR, downstream of the DRS- WGA.
  • CGH metaphase and array comparative genomic hybridization
  • DRS-WGA is based on specific restriction digestion of double stranded DNA at Msel site (TTAA) and ligation of one universal adaptor for amplification
  • TTAA Msel site
  • all fragments generated during amplification that represent the WGA library are known.
  • first, second and third primer pairs have been specifically selected in target regions of the genome corresponding to long amp1icons of the DRS-WGA DNA digestion enzyme, Msel, which are more difficult to amplify in case of DNA fragmentation, their amplification is indicative of good overall success of the DRS-WGA on a given sample .
  • the method allows to assess the integrity of the genome of a sample and/or the quality of the library of DNA sequences obtained over the broadest region of the genome.
  • first, second, third and fourth PGR products have different size
  • the fourth primer pair hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp
  • the success rate in e.g. targeted Sanger sequencing of the PIK3CA exon 9 (30%) and exon 20 (34%) or qPCR for Her2 CNV analysis (25%) of cells for which not even this fourth PGR product is amplified and those cells for which at least this is amplifiable , for which the success rate roughly doubles (56%, 72%, 50% respectively).
  • the two populations would otherwise be indistinguishable when using only the 3 primer pairs hybridizing to long amplicons of the DRS-WGA .
  • the method may be multiplexed by using further pairs of primers which do not interfere with the PCR amplification with the first, second, third and possibly fourth primer.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

The present invention relates to a method for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprising the steps of : (a) providing the library of DNA sequences; (b) amplifying the library of DNA sequences by PGR using at least one first primer pair, one second primer pair and one third primer pair, the primer pairs each hybridising to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located respectively on a first, second and third chromosome arm, the step of amplifying giving rise to a first, second and third PCR product each from 50 bp to 1000 bp and each having a different size from the others; (c) detecting the first, second and third PCR products; (d) correlating the presence of the first, second and third PCR products with the integrity of the genome of the sample and/or the quality of the library of DNA sequences.

Description

METHOD AND KIT FOR DETERMINING THE GENOME INTEGRITY AND/OR
THE QUALITY OF A LIBRARY OF DNA SEQUENCES OBTAINED BY
DETERMINISTIC RESTRICTION SITE WHOLE GENOME AMPLIFICATION
* * *
The present invention relates to a method and a kit for determining the integrity of the genome of a sample, in particular a single cell, and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample.
State of the art
Whole Genome Amplification (WGA) permits detection of somatic mutations and copy alterations in DNA of limited starting material, such as in the case of single circulating tumour cells (CTC) of cancer patients or in preimplantation diagnostics.
For the diagnostic use of WGA for single cell analysis, quality of genomic DNA (i.e. genome integrity) of the single cell sample of interest plays a major role for successful molecular analysis after WGA.
In particular, CTCs have been described as being frequently apoptotic (Mehes, G. , et al . , Circulating breast cancer cells are frequently apoptotic. Am J Pathol, 2001. 159 (1) : p.17-20) .
Moreover, during caspase-mediated apoptosis genomic DNA is fragmented into small pieces of 180 bp to 200 bp length (Wyllie, AH., Glucocorticoid- induced thymocyte apoptosis is associated with endogenous endonuclease activation. Nature, 1980. 284(5756): p.555-6).
It is thus important to assess the Genome Integrity status of a single cell, as this can be linked to the biological status of the cell itself , and give clinically relevant information on the overall status of a cancer patient, which goes beyond the information provided by just counting the CTCs and complements the molecular characterization of those CTCs.
Besides, DNA crosslinking and/or fragmentation occur with chemical treatment (e.g. fixation) applied on patient- derived cells and tissues for needed sample conservation after biopsy.
To predict performance of molecular assays for single cell analysis and evaluation of resulting data derived from such samples, assessing the genomic integrity of single cells is of paramount importance.
Available single cell WGA kits assess quality of whole genome amplification by measuring the concentration of the WGA product only. As protocols for these methods include at least one random step during the procedure of single cell DNA amplification, specific assays to evaluate genome integrity of the input sample (in general a single cell) such as apoptotic or non-apoptotic status, or the quality of the output of the WGA product, such as the suitability for further genetic analysis, are difficult.
A specific kind of WGA is deterministic restriction site whole genome amplification (hereinafter referred to as DRS-WGA) . DRS-WGA, which is known from EP1109938 and is commercialised as Amplil™ by Silicon Biosystems Spa, is based on specific restriction digestion of double stranded DNA at Msel sites (TTAA) and ligation of a universal adaptor for amplification.
DRS-WGA has been shown to be better for the amplification of single cells (see for example: Lee YS , et al : Comparison of whole genome amplification methods for further quantitative analysis with microarray-based comparative genomic hybridization. Taiwan J Obstet Gynecol. 2008, 47(1) : 32-41) and also more tolerant to DNA degradation due to fixative treatment (see for example: Stoecklein N.H. et al : SCOMP is Superior to Degenerated Oligonucleotide Primed-PCR for Global Amplification of Minute Amounts of DNA from Microdissected Archival Samples. American Journal of Pathology 2002, Vol. 161, No. 1; Arneson N. et al . : Comparison of Whole Genome Amplification methods for analysis of DNA extracted from microdissected early breast lesions in formalin-fixed paraffin- embedded tissue. ISRN Oncol. 2012; 2012 ; 710692 ) . To date there are no specific assays to evaluate the genome integrity of an input sample from the DRS-WGA product or the quality of the DRS-WGA product obtained.
A need is therefore felt to develop methods and kits allowing to determine the genome integrity of an input sample and/or the quality of the DRS-WGA product obtained and permitting to predict performance of molecular assays downstream of DRS-WGA for single cell analysis and evaluation of resulting data.
An object of the present invention is therefore to provide a method for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by DRS-WGA that provides robust and reliable results and allows in particular to assess the biological status of a cell/ cells of the sample and/or predict the performance of molecular assays downstream of the DRS-WGA.
This obj ect is achieved by the present invention as it relates to a method as defined in claim 1.
It is a further object of the present invention to provide a kit as defined in claim 8.
Definitions
Unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
By the term "sample", there is intended a sample comprising at least one particle of a biological entity, said particle comprising at least a DNA sequence representing the genome or a substantial subset of the genome of that biological entity. By way of non-limiting example, said entity may be a human, said at least one particle may be a set of 5 cells or less, a single cell, or a single-cell nucleus, or a haploid germ cell, or a chromosome.
By the term "genome" there is intended the entire genome or said substantial subset of the genome.
By the term "integrity" of the genome there is intended the absence of DNA damages such as double strand breaks, or nicks or similar conditions which may hamper the replication of the genome or its normal functionality.
By the term "quality" of a library of DNA sequences there is intended the suitability of the library of DNA sequences to be used for the genetic characterization of certain features such as, by way of non- limiting example, the presence of point mutations, deletions, insertions, copy number variations .
Brief description of the drawings
Figure 1 shows an agarose gel picture of single marker PCRs, and of a 4 -multiplex assay and a 3 -multiplex assay according to preferred embodiments of the present invention;
Figure 2 shows an agarose gel picture of PCRs on PIK3CA hotspot 1 and hotspot2 (M=size marker, 01 breastl3, 02 = breastlB , 03 = breastl? , 04 = breast20 , 05 = prostatel4 , 06 = prostatel6 , 07 = prostate24, 08= melanomal3 , 09 = melanoma14 , 10 = melanomalG } ;
Figure 3 shows an agarose gel picture of 8 samples tested by the preferred 4 -multiplex assay of Figure 1.
Figure 4 shows a histogram of the distribution of the
Genome Integrity Index among single Circulating Tumour Cells (CTCs) and single leukocytes (WBCs) from breast cancer patients.
Detailed description of the invention
The method according to the present invention for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprises steps (a) to (d) .
By allowing the determination of the integrity of the genome of a sample and/or the quality of a library of sequences obtained by DRS-WGA of the genome of the sample, the method also allows to assess the biological status of of a cell cells of the sample and/or predict the success rate of genetic analysis assays on the library of DNA sequences .
The sample preferably consists of 5 cells or less , more preferably the sample is a single cell . The single cell is preferably a circulating tumour cell (CTC) , a circulating fetal cell, a circulating endothelial cell (CEC) , an oocyte, a cumulus cell, a sperm, a blastomere, or a trophectoderm cell.
In step (a) , the library of DNA sequences is provided. In step (b) , the library of DNA sequences is amplified by PGR using at least one first primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a first chromosome arm, the step of amplifying giving rise to a first PGR product from 50 bp to 1000 bp.
Preferably, the DNA sequence of the library to which the first primer pair hybridises encompasses the D5S2117 region of chromosome 5q.
More preferably, the forward primer of the first primer pair is SEQ ID NO : 4 and the reverse primer of the f irst primer pair is SEQ ID NO : 3.
In step (c) the first PCR product is detected. Agarose gel electrophoresis may be used to separate and detect the PCR product as well as other methods known in the art. In step (d) the presence of the first PCR product is correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences.
Advantageously, in step (b) at least one second primer pair is used which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, more preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a second chromosome arm other than the first chromosome arm, the step of amplifying giving rise to a second PCR product from 50 bp to 1000 bp having a size other than the first PCR product .
The second PCR product is also detected in step (c) and the presence of the second PCR product is also correlated with the integrity of the genome of the sam le and/or the quality of the library of DNA sequences in step (d) .
Preferably, the DNA sequence of the library to which the second primer pair hybridises encompasses exons 2 and 3 of the TRP53 gene.
More preferably, the forward primer of the second primer pair is SEQ ID NO: 6 and the reverse primer of second primer pair is SEQ ID NO : 5.
Advantageously, in step (b) at least one third primer pair is used which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp, more preferably from 1000 bp to 2000 bp, and corresponding to a sequence of the genome located on a third chromosome arm other than the first and second chromosome arms, the step of amplifying giving rise to a third PCR product from 50 bp to 1000 bp having a size other than the first and second PCR products.
The third PCR product is also detected in step (c) and the presence of the third PCR product is also correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences in step (d) .
Preferably, the DNA sequence of the library to which the third primer pair hybridises encompasses the KRT19 pseudo-gene 1 (indicated for short as CK19) .
More preferably, the forward primer of the third primer pair is SEQ ID NO : 8 and the reverse primer of the third primer pair is SEQ ID NO : 7.
Even more preferably, in step (b) at least one fourth primer pair is used which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, the step of amplifying giving rise to a fourth PCR product from 50 bp to 200 bp having a size other than the first, the second and the third PCR products .
When step (b) uses at least one fourth primer pair, the fourth PCR product is also detected in step (c) and the presence of the fourth PCR product is also correlated with the integrity of the genome of the sample and/or the quality of the library of DNA sequences in step (d) .
Preferably, the DNA sequence of the library to which the fourth primer pair hybridises encompasses codons 12 and 13 of the RAS gene.
Even more preferably, the forward primer of the fourth primer pair is SEQ ID NO: 17 and the reverse primer of the fourth primer pair is SEQ ID NO: 18.
According to the present invention there is also provided a kit for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprising :
- at least one first primer pair which hybridises to a
DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a first chromosome arm,
- at least one second primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a second chromosome arm other than the first chromosome arm,
- at least one third primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a third chromosome arm other than the first and second chromosome arms, wherein the first, second and third primer pairs give rise, when amplified by PCR, to PCR products having different size from one another.
Preferably, the kit further comprises at least one fourth primer pair which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, wherein the first, second, third and fourth primer pairs give rise, when amplified by PCR, to PCR products having different size from one another.
More preferably, the kit comprises the first, second, third and fourth primer pairs.
The kit may be used for predicting the success of a genetic analysis assay after amplification of single cell genomic DNA by DRS-WGA. Preferably the genetic analysis assay is Sanger sequencing for mutation analysis, assessment of specific copy number changes, quantitative PCR for gene amplification, metaphase Comparative Genomic Hybridisation (CGH) , or array Comparative Genomic Hybridisation ( CGH) .
For gene specific assays, such as Sanger sequencing for mutation analysis, samples with at least 1-2 out of 4 PCR products can be used. Positivity to at least 3 out of 4 PCR products is predictive of successful genome-wide analysis with metaphase CGH . For array CGH it is advisable to use samples with 4 out of 4 positive PCR products.
The kit may also be used to determine the integrity of the genome of a sample and thus determine the biological status of the cell/cells of the sample. The sample preferably consists of 5 cells or less, more preferably the sample is a single cell.
As a matter of fact, if there is a large number of cells in the sample, there will be, overall, enough template copies for the first, second, third (and optionally fourth) primer pairs to amplify respectively the first, second, third (and optionally fourth) PCR products even if the DNA of the cells of the sample is highly fragmented. The result is the loss of the discrimination power of the method.
On the other hand, it has been experimentally determined that, even in the case of very damaged DNA cell samples, 5 cells is an amount that allows reliable results with the method, i.e allows to obtain the PCR products of step (d) without them being a results of excess template copies .
Further, for the analysis of very damaged DNA cell samples (for which single cells could result in PCR products not being amplified) , the use of a number of cells greater than one, i.e. two to five, allows to quantify genome integrity thus increasing the power of resolution of the method.
Examples
In brief, several primer pairs designed on Msel fragments located on different chromosomal locations and with varying fragment lengths were tested. Three primer pairs that predict successful whole genome analysis of single cell products with high specificity and sensitivity were selected (Example 1) . A fourth primer pair of a shorter Msel fragment was added to indicate successful DRS - WGA of low quality cells, e.g. apoptotic CTCs (Example 2). In the examples, PGR products are also referred to as "markers" and PGR amplification reactions including several primer pairs are also referred to as "multiplex assays". In particular, PGR amplification reactions including several primer pairs designed to determine the integrity of the genome of a sample and/or the quality of the library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS -WGA) of the genome of the sample are also referred to as "quality control assays" or "QC assays" .
Example 1
Two alternative marker combinations were shown to predict the success of metaphase comparative genomic hybridization (CGH) after amplification of single cell genomic DNA with DRS-WGA (Resolution 10-20 Mb) on both cancer cell samples and samples of diploid cells with normal karyotype .
A. Characteristics of the 8 tested PCR markers
PCRs on 8 different Msel- fragments covering an Msel- fragment length from 239-1936 bp were tested (Table 1) . Sequences located on 7 different chromosome arms were selected to minimize the chance of a negative assay result because of genomic DNA loss in a single cancer cell.
Pipetting 1.0 μΐ Buffer +dNTPs
scheme (lx) (lOmM MgCl, lOOmM Tris (pH 8.5),
500 mM KC1, ImM dNTPs )
0.5 μΐ Primer (8 μΜ)
0.5 μΐ Primer 5' (8 μ )
0.25 μΐ (for molecular biology)
Figure imgf000015_0001
0.1 μΐ Taq polymerase (5ϋ/μ1)
Amplil product (test sample)
Thermal
profile
Step 1 94.0°C 2 min
Step 2 Annealing Temp 30 s
Step 3 72.0°C 2 min
Step 4 94.0°C 15 s
Step 5 Annealing Temp 30 s
Step 6 72.0°C 20 s
14 additional cycles (steps 4-6)
Step 7 94.0°C 15 s
Step 8 Annealing Temp 30 s
Step 9 72.0°C 30 s
24 additional cycles (steps 7-9)
Step 10 72.0°C 2 min
Step 11 4 °C forever
Table 1. Features of the 8 selected PCR primer pairs tested for the QC assay to assess DRS-
WGA quality
Figure imgf000017_0001
* This primer pair amplifies a microsatellite sequence. Therefore the actual fragment length can vary slightly between alleles of one patient and between different patients.
Continued
Figure imgf000018_0001
B. Selection of PGR markers for the QC assay
To select the best possible combination of PCR markers, 72 single cell genomes from different types of human cancers (24 breast disseminated cancer cells (DCCs) 24 prostate DCCs, 24 melanoma DCCs) were re-amplified. For each of the three groups, 12 cells were included which resulted in successful metaphase hybridization in a previous CGH experiment and 12 cells which resulted in a failed metaphase hybridization in a previous CGH experiment. Specific PCRs for all selected markers were performed and the assay was evaluated for accuracy in predicting the outcome of metaphase CGH.
As single markers, PCRs on the long Mse- fragments D5S2117 , TRP53-Ex2/3 and KRT19 pseudogene 1 (hereinafter also referred to as CK1S) provided best separation between amplified genomes with successful and failed metaphase CGH. An assay of these three fragments showed high assay accuracy in predicting the success of metaphase CGH. The addition of the PCR on the shortest Mse- fragment PHACTR2 slightly increased the assay accuracy in the collective of 72 DCC genomes.
In summary, two alternative QC assays for the QC kit for Amplil were developed (Table 2) .
Alternative 1: QC assay with 3 markers (D5S2117, TRP53 -Ex2/ 3 and CK19) . Alternative 2: QC assay with 4 markers (D5S2117, TRP53-EX2/3, CK19 and PHACTR2 ) .
Table 2. Assay accuracy of two alternative marker combinations for the QC assay (72 DCC samples)
Figure imgf000020_0001
If possible, only samples that are of the highest quality and that are positive for all selected markers (for both alternative assays 100% specificity) should be used. However, the trade-off for applying this high standard of quality control is a high rate of false negatives (7/36 = 19.4%) . If the number of test samples with the highest quality standard is limited, DRS-WGA amplified genomes with 2/3 or 3/4 positive PCRs still predict a high success rate for metaphase CGH ( specificity 0.94 for assay with 3 markers and 0.97 for assay with 4 markers, respectively) . C. Testing of PGR markers on a set of 100 diploid cells with normal karyotype
To further test the set of PCR markers for the QC assay, 100 single cell genomes from diploid cells with normal karyotypes were re-amplified. All samples were tested for the 8 different PCR markers. Additionally, metaphase CGH success was checked for 22 genomes with predicted good quality and 10 genomes with predicted bad quality . The results of the statistical evaluation of assay accuracy are shown in Table 3.
Table 3. Assay accuracy of two alternative marker combinations for the Amplil QC kit (32 normal samples)
Statistical Alternative 1 Alternative 2
measurement 2/3 PCRs + 3/3 PCRs + 3/4 PCRs + 4/4 PCRs +
True + 22 21 22 21
False - 0 1 0 1
True - 10 10 10 10 False + 0 0 0 0
Sensitivity 1.0 0.95 1.0 0.95
Specificity 1.0 1.0 1.0 1.0
Positive 1.0 1.0 1.0 1.0 predictive
value
Negative 1.0 0.91 1.0 0.91 predictive
value
D. Further validation of selected QC markers on DRS-WGA amplified samples
As the tested samples in B and C were taken from an existing biobank of single cell genomes, they were amplified with DRS-WGA customized reagents of the related labs (provided by different suppliers) . To validate the performance of the proposed QC assay with samples amplified by Amplil kit (as provided by Silicon Biosystems) , single mononuclear PBLs and cell pools of a healthy donor and single cells and cell pools of the breast cancer cell line SKBR3 were isolated. The markers proposed in B and C for the QC assay were used to predict quality of the amplified genomes. Then, metaphase CGH experiments for a set of samples (5 single cells, 1 cell pool and 1 Amplil negative control) for diploid blood cells as well as SKBR3 cells were performed to validate the predictive accuracy of the QC assay.
SKBR : 10/11 single cells and both cell pools showed 4/4 positive bands marker PCRs
1/11 cells was negative for all tested markers negative control clean in all tested PCRs PBL : 11/11 single cells and both cell pools showed 4/4 positive bands marker PCRs
negative control clean in all tested PCRs Exam le 2
As other downstream analyses , e.g. Sanger sequencing for specific fragments , are not dependent on a quantitatively and qualitatively very high amplification of the single cell DNA, a fourth fragment was included . Experiments were carried out to test whether a successful amplification of this sequence only is enough to predict success of Sanger sequencing of comparable Mse fragments (here PIK3CA hotspots 1 and 2) .
A. Protocol for 4-Multiplex assay
In order to have compatibility with the already established 3 -multiplex assay, new primers were designed for the KRAS Mse - fragment encompassing the frequently mutated nucleotides encoding for codons 12 and 13. These primers amplify a PCR fragment of 91 bp length clearly distinguishable from the other three bands (D5S2117, CK19 and TP53 -Exon2/3 , see Figure 1) .
The following pipetting scheme and thermal profile were used adding the following ERAS primers in a concentration of 4 μΜ to the primer mix.
KRAS91bp-F ATAAGGCCTGCTGAAAATGAC (SEQ ID NO: 17)
KRAS91bp-R CTGAATTAGCTGTATCGTCAAGG (SEQ ID NO: 18)
Pipetting 1.0 μΐ Amplil™ PCR Reaction Buffer scheme (lx) (20mM MgCl2 included)
0.2 μΐ dNTPs (lOmM)
1.0 μΐ Primer mix (8 primers, each 4 μΜ)
0.2 μΐ BSA (20 mg/ml)
6.5 μΐ PCR-H20
0.1 μΐ Amplil™ Taq polymerase (5υ/μ1)
1.0 μΐ Amplil™ product (test sample)
Thermal
profile
Step 1 95.0°C 4 min
Step 2 95.0°C 30 s
Step 3 58.0°C 30 s
Step 4 72.0°C 90 s
32 cycles (steps 2-4)
Step 5 72.0°C 7 min
Step 6 4.0°C forever 5 μΐ of each PCR product were loaded on a 1.2% agarose gel. The results were checked by comparing the obtained amplicons bp length with the expected ones, as shown in table 4.
Table 4
Figure imgf000025_0001
As already noted above, marker B maps on a polymorphic region, therefore the PCR products may be:
homozygous, and show one band of a bp comprised in the described range (108-166);
heterozygous and show two bands of different bp comprised in the described range (108-166).
Figure 3 shows an example of an agarose gel electrophoresis of PCR products obtained from different samples by using the above disclosed 4 multiplex assay.
Sample 1 in Figure 3 for example displays 3/4 positive markers. Marker B heterozygosity or homozigosity (one or two bands) must be counted as one in the evaluation of the positivity for marker B. Samples 2 and 8 for example display 4/4 positive markers.
B. Comparison of 4 -Multiplex assay with results of single fragment PGR reactions and established 3 -Multiplex
72 DRS-WGA libraries of breast, prostate and melanoma DCC that had already been tested by the 3 -multiplex assay of Example 1 were selected. Unfortunately the sample Breast 01 was lost due to a fissure in the reaction tube. All other 71 DRS-WGA products were additionally tested with KRAS 91bp single PCR and the new -multiplex assay. In summary, 53/71 samples showed the expected band at 91bp in single marker PCR, and all of them but one (Breast 24) showed the same band in the 4 -multiplex assay. All the other bands for D5S2117, CK19 and TP53-Exon2/3 were detected in the same samples than with 3 -multiplex assay. Moreover, the KRAS 91bp amplicon was detected in all 38 samples that showed one or more bands in the currently used 3 -multiplex. Additionally, 15 samples were identified that were negative for D5S2117 , CK19 and TP53-Exon2/3 but positive for KRAS91bp, only. Finally 18 samples were negative for all four tested amplicons.
C. PIK3CA sequencing of ten selected samples
Out of the 15 samples which showed the KRAS 91bp amplicon only, ten samples were selected for PIK3CA sequence analysis (4 breast DCC samples, 3 prostate DCC samples, and 3 melanoma DCC samples) . PIK3CA PCRs were performed for HS1 and HS2 fragments, using A plil™ PIK3CA Seq Kit (Silicon Biosystems SpA, Italy) , according to the manufacturer instructions . After PGR all samples were loaded on a 1.5% agarose gel and amplicons visualized after electrophoresis. Strong bands were obtained only for HS1 in four DCC samples (prostate DCC 16, melanoma DCCs 13, 14, and 16) and for HS2 in five DCC samples (prostate DCCs 14, and 16, melanoma DCCs 13, 14, and 16) . Additionally, weak but visible bands were detected for an additional two (breast DCC 13, prostate DCC 24) and three samples (breast DCCs 13, and 15, prostate DCC 24), respectively (Figure 2) . One sample (melanoma DCC 16) showed a strong smear for DNA fragment > lkb, whi ch wa s also visible in all previous gels of this sample. Nevertheless, the PCR amplicon was purified for all samples and sequenced.
Sanger sequencing for PIK3CA mutational hotspots resulted in very strong and clean sequences for the samples showing strong amplification in gel electrophoresis (see Figure 2), including sample melanoma DCC 16. Most of the other samples with lower amplicon concentration showed high background noise, although sequences could easily be edited for two additional samples for HS1 (breast DCC 13 , prostate DCC 24) and four additional samples for HS2 (breast DCCs 13, 15, and 20, prostate DCC 24) . For the remaining samples background signal was too high for a secure editing of the complete sequence (breast DCCs 15, 17, and 20, prostate DCC 14 for HSl; breast DCC 15 for HS2) .
On a collective of CTCs and White Blood Cells (WBCs) harvested with DEPArray™ (Silicon Biosystems SpA) from breast cancer patients peripheral blood enriched with CellSearch® (Jannsen Diagnostics LLC) , the Genome Integrity was assessed by analysing the quality of Amplil™ WGA product according to the invention. The resulting number of PCR products detected following the multiplex PCR reaction (Genome Integrity Index or Gil) was found to be significantly skewed, as shown in Figure 4, toward lower values of Gil in CTCs with respect to normal WBCs collected from the same patients, undergoing the same process of enrichment sorting and Amplil™ WGA.
By way of explanation, a Gil with a value of 0 corresponds to a situation in which none of the first, second, third or fourth PCR products is amplified, a Gil with a value of 1 corresponds to a situation in which only the fourth PCR product is amplified, a Gil with a value of 2 corresponds to a situation in which one among the first, second and third PCR products and the fourth PCR product are amplified, a Gil with a value of 3 corresponds to a situation in which two among the first, second and third PGR products and the fourth PGR product are amplified, and a GII with a value of 4 corresponds to a situation in which the first, second, third and fourth PCR products are amplified .
The GII was further used to assess the success rate of targeted Sanger sequencing for PIK3CA exon 9 and exon 20 mutation hotspots, of a custom qPCR assay to determine the amplification of ERBB2 gene, and of array CGH . Table 5 shows a synopsis of the results.
Table 5
Figure imgf000030_0001
The above examples show that the method according to the present invention allows to determine the integrity of the genome of a sample and the quality of a library of DNA sequences obtained by DRS-WGA of the genome of the sample with robust and reliable results and allows in particular to predict the performance of molecular assays, such as metaphase and array comparative genomic hybridization (CGH) , Sanger sequencing and qPCR, downstream of the DRS- WGA.
From an analysis of the features of the method and kit of the present invention, the resulting advantages are apparent .
In particular, in virtue of the fact that DRS-WGA is based on specific restriction digestion of double stranded DNA at Msel site (TTAA) and ligation of one universal adaptor for amplification, in principle all fragments generated during amplification that represent the WGA library are known. Thus, by the identification of specific Msel fragments having a length of > 1000 bp in a single cell WGA library, the genomic integrity of the DNA of an isolated cell can be measured, and thus the quality of the sample for different kinds of successful molecular analysis determined.
Since the first, second and third primer pairs have been specifically selected in target regions of the genome corresponding to long amp1icons of the DRS-WGA DNA digestion enzyme, Msel, which are more difficult to amplify in case of DNA fragmentation, their amplification is indicative of good overall success of the DRS-WGA on a given sample .
Further , in virtue of the fact that the first , second and third primer pairs are designed on different chromosome arms, the method allows to assess the integrity of the genome of a sample and/or the quality of the library of DNA sequences obtained over the broadest region of the genome.
Further, in virtue of the fact that the first, second, third and fourth PGR products have different size, it is possible to use the first, second, third and fourth primer pairs together in a multiplex reaction.
Moreover, in virtue of the fact that the fourth primer pair hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, it is possible to predict the performance of molecular assays downstream of the DRS-WGA also for low quality cells, for example apoptotic CTCs . In act there is a significant difference in performance between the success rate in e.g. targeted Sanger sequencing of the PIK3CA exon 9 (30%) and exon 20 (34%) or qPCR for Her2 CNV analysis (25%) of cells for which not even this fourth PGR product is amplified and those cells for which at least this is amplifiable , for which the success rate roughly doubles (56%, 72%, 50% respectively). The two populations would otherwise be indistinguishable when using only the 3 primer pairs hybridizing to long amplicons of the DRS-WGA .
Finally, it is clear that modifications and variants to the method and kit disclosed and shown may be made without because of this departing from the scope of protection of the appended claims.
In particular, the method may be multiplexed by using further pairs of primers which do not interfere with the PCR amplification with the first, second, third and possibly fourth primer.

Claims

1. A method for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprising the steps of:
(a) providing the library of DNA sequences,
(b) amplifying the library of DNA sequences by PGR using :
- at least one first primer pair which hybridises to a
DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a first chromosome arm,
- at least one second primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a second chromosome arm other than the first chromosome arm, and
- at least one third primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to
5000 bp and corresponding to a sequence of the genome located on a third chromosome arm other than the first and second chromosome arms ,
the step of amplifying giving rise to a first PGR product from 50 bp to 1000 bp, a second PCR product from 50 bp to 1000 bp having a size other than the first PGR product, and a third PCR product from 50 bp to 1000 bp having a size other than the first and second PCR products;
(c) de ec ing the first , second and third PCR products ;
(d) correlating the presence of the first , second and third PCR products with the integrity of the genome of the sample and/or the quality of the library of DNA sequences.
2. The method according to claim 1, wherein the forward primer of the at least one first primer pair is SEQ
ID NO: 4 and the reverse primer of the at least one first primer pair is SEQ ID NO: 3.
3. The method according to claim 1 or 2, wherein the forward primer of the at least one second primer pair is SEQ ID NO: 6 and the reverse primer of the at least one second primer pair is SEQ ID NO : 5.
4. The method according to any of claims 1 to 3 , wherein the forward primer of the at least one third primer pair is SEQ ID NO : 8 and the reverse primer of the at least one third primer pair is SEQ ID NO : 7.
5. The method according to any of claims 2 to 4 , wherein step (b) further uses at least one fourth primer pair which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp, the step of amplifying giving rise to a fourth PCR product from 50 bp to 200 bp having a size other than the first, the second and the third PCR products ;
- step (c) further comprises detecting the fourth PCR product ;
- step (d) further comprises correlating the presence of the fourth PCR product with the integrity of the genome of the sample and/or the quality of the library of DNA sequences .
6. The method according to claim 5, wherein the DNA sequence of the library to which the at least one fourth primer pair hybridises encompasses Codon 12/13 of the KRAS gene .
7. The method according to claim 6 , wherein the forward primer of the at least one fourth primer pair is SEQ ID NO: 17 and the reverse primer of the at least one irst primer pair is SEQ ID NO : 18.
8. A kit for determining the integrity of the genome of a sample and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification (DRS-WGA) of the genome of the sample comprising :
- at least one first primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a first chromosome arm, - at least one second primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a second chromosome arm other than the first chromosome arm, and
- at least one third primer pair which hybridises to a DNA sequence of the library having a length from 1000 bp to 5000 bp and corresponding to a sequence of the genome located on a third chromosome arm other than the first and second chromosome arms,
wherein the first, second and third primer pairs give rise, when amplified by PGR, to PGR products having different size from one another.
9. The kit according to claim 8, further comprising at least one fourth primer pair which hybridises to a DNA sequence of the library having a length from 80 bp to 300 bp,
wherein the first , second, third and fourth primer pairs give rise, when amplified by PGR, to PGR products having different size from one another.
10. Use of the kit according to claim 8 or 9 in predicting the success of a genetic analysis assay after amplification of single cell genomic DNA by DRS-WGA.
11. Use according to claim 10 , wherein the genetic analysis assay is selected from the group consisting of Sanger sequencing for mutation analysis, assessment of specific copy number changes, quantitative PGR for gene amplification, metaphase Comparative Genomic Hybridisation (CGH) , and array Comparative Genomic Hybridisation (CGH) .
12. Kit according to claim 8 or 9 for use in determining the integrity of the genome of a sample.
13. Kit for use according to claim 12, wherein the sample consists of 5 cells or less.
14. Kit for use according to claim 13, wherein the sample is a single cell.
15. Kit for use according to claim 13 or 14, wherein determining the integrity of the genome of the sample allows to determine the biological status of the cell/cells of the sample .
PCT/IB2014/066602 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification Ceased WO2015083121A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CA2932524A CA2932524C (en) 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification
CN201480074845.3A CN106030307B (en) 2013-12-04 2014-12-04 For determining the method and kit of the Library Quality of genomic integrity and/or the DNA sequence dna for passing through the acquisition of certainty restriction site whole genome amplification
US15/101,299 US10392657B2 (en) 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification
KR1020167017659A KR102275752B1 (en) 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification
JP2016536851A JP6543253B2 (en) 2013-12-04 2014-12-04 Methods and kits for determining the quality of a library of DNA sequences obtained by genomic integrity and / or deterministic restriction enzyme site whole genome amplification
US16/455,470 US20190316194A1 (en) 2013-12-04 2019-06-27 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13195770.6 2013-12-04
EP13195770.6A EP2881739B1 (en) 2013-12-04 2013-12-04 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US15/101,299 A-371-Of-International US10392657B2 (en) 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of DNA sequences obtained by deterministic restriction site whole genome amplification
US16/455,470 Division US20190316194A1 (en) 2013-12-04 2019-06-27 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification

Publications (1)

Publication Number Publication Date
WO2015083121A1 true WO2015083121A1 (en) 2015-06-11

Family

ID=49680939

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2014/066602 Ceased WO2015083121A1 (en) 2013-12-04 2014-12-04 Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification

Country Status (10)

Country Link
US (2) US10392657B2 (en)
EP (1) EP2881739B1 (en)
JP (1) JP6543253B2 (en)
KR (1) KR102275752B1 (en)
CN (1) CN106030307B (en)
CA (1) CA2932524C (en)
DK (1) DK2881739T3 (en)
ES (1) ES2637385T3 (en)
PT (1) PT2881739T (en)
WO (1) WO2015083121A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017178655A1 (en) 2016-04-15 2017-10-19 Menarini Silicon Biosystems S.P.A. Method and kit for the generation of dna libraries for massively parallel sequencing
CN116883308A (en) * 2022-03-28 2023-10-13 深圳华大生命科学研究院 Method and system for determining nucleic acid integrity
US11859249B2 (en) 2017-07-21 2024-01-02 Menarini Silicon Biosystems S.P.A. Method and kit for the generation of DNA libraries for massively parallel sequencing

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITTO20120962A1 (en) * 2012-10-31 2014-05-01 Silicon Biosystems Spa METHOD AND KIT TO REVEAL A SEQUENCE OF WILD-TYPE AND / OR MUTATE TARGET DNA
IT201900002777A1 (en) * 2019-02-26 2020-08-26 Menarini Silicon Biosystems Spa METHOD AND MICROFLUIDIC SYSTEM FOR THE ISOLATION OF PARTICLES
CN112662748B (en) * 2019-10-15 2023-02-17 骏实生物科技(上海)有限公司 Primer pair combination, method and kit for single cell DNA sequencing library quality identification
IT201900024159A1 (en) * 2019-12-16 2021-06-16 Menarini Silicon Biosystems Spa METHOD AND KIT FOR TOTAL AMPLIFICATION OF THE GENOME AND ANALYSIS OF TARGET MOLECULES IN A BIOLOGICAL SAMPLE

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010093465A1 (en) * 2009-02-11 2010-08-19 Caris Mpi, Inc. Molecular profiling of tumors

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1109938B1 (en) * 1998-09-18 2002-02-27 Micromet AG Dna amplification of a single cell
WO2009051842A2 (en) * 2007-10-18 2009-04-23 The Johns Hopkins University Detection of cancer by measuring genomic copy number and strand length in cell-free dna
CN102533960B (en) * 2010-12-31 2014-04-30 深圳华大基因科技有限公司 Single-cell genome analysis method and kit

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010093465A1 (en) * 2009-02-11 2010-08-19 Caris Mpi, Inc. Molecular profiling of tumors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BUFFART TINEKE E ET AL: "DNA quality assessment for array CGH by isothermal whole genome amplification", CELLULAR ONCOLOGY, IOS PRESS, LONDON, GB, vol. 29, no. 4, 1 January 2007 (2007-01-01), pages 351 - 359, XP009175704, ISSN: 1570-5870 *
E H VAN BEERS ET AL: "A multiplex PCR predictor for aCGH success of FFPE samples", BRITISH JOURNAL OF CANCER, vol. 94, no. 2, 30 January 2006 (2006-01-30), pages 333 - 337, XP055098207, ISSN: 0007-0920, DOI: 10.1038/sj.bjc.6602889 *
LEE Y S ET AL: "Comparison of Whole Genome Amplification Methods for Further Quantitative Analysis with Microarray-based Comparative Genomic Hybridization", TAIWANESE JOURNAL OF OBSTETRICS AND GYNECOLOGY, ELSEVIER (SINGAPORE) PTE LTD, HONG KONG BRANCH, HONG KONG, HK, vol. 47, no. 1, 1 March 2008 (2008-03-01), pages 32 - 41, XP025480394, ISSN: 1028-4559, [retrieved on 20080301], DOI: 10.1016/S1028-4559(08)60052-2 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017178655A1 (en) 2016-04-15 2017-10-19 Menarini Silicon Biosystems S.P.A. Method and kit for the generation of dna libraries for massively parallel sequencing
CN109477245A (en) * 2016-04-15 2019-03-15 美纳里尼硅生物系统股份公司 Methods and kits for generating DNA libraries for massively parallel sequencing
US11859249B2 (en) 2017-07-21 2024-01-02 Menarini Silicon Biosystems S.P.A. Method and kit for the generation of DNA libraries for massively parallel sequencing
US12601010B2 (en) 2017-07-21 2026-04-14 Menarini Silicon Biosystems S.P.A. Method and kit for the generation of DNA libraries for massively parallel sequencing
CN116883308A (en) * 2022-03-28 2023-10-13 深圳华大生命科学研究院 Method and system for determining nucleic acid integrity

Also Published As

Publication number Publication date
DK2881739T3 (en) 2017-08-21
US20180187254A1 (en) 2018-07-05
EP2881739A1 (en) 2015-06-10
CN106030307A (en) 2016-10-12
JP2016538872A (en) 2016-12-15
US10392657B2 (en) 2019-08-27
US20190316194A1 (en) 2019-10-17
ES2637385T3 (en) 2017-10-13
PT2881739T (en) 2017-08-11
EP2881739B1 (en) 2017-05-17
CA2932524C (en) 2022-12-13
CN106030307B (en) 2018-06-01
JP6543253B2 (en) 2019-07-10
CA2932524A1 (en) 2015-06-11
KR102275752B1 (en) 2021-07-12
KR20160115913A (en) 2016-10-06

Similar Documents

Publication Publication Date Title
US20190316194A1 (en) Method and kit for determining the genome integrity and/or the quality of a library of dna sequences obtained by deterministic restriction site whole genome amplification
JP5415963B2 (en) New cancer marker
CN108699553B (en) Compositions and methods for screening for mutations in thyroid cancer
EP3034624A1 (en) Method for the prognosis of hepatocellular carcinoma
Herreros-Villanueva et al. KRAS mutations: analytical considerations
WO2018009702A1 (en) Leukemia methylation markers and uses thereof
Stigt et al. Pyrosequencing analysis of EGFR and KRAS mutations in EUS and EBUS-derived cytologic samples of adenocarcinomas of the lung
WO2017004599A1 (en) Method for high sensitivity detection of myd88 mutations
Abou Daya et al. Circulating tumor DNA, liquid biopsy, and next generation sequencing: A comprehensive technical and clinical applications review
WO2022157764A1 (en) Non-invasive cancer detection based on dna methylation changes
CN101883864B (en) Mitochondrial DNA deletion between about 12317-16254 residues used in cancer detection
WO2018186687A1 (en) Method for determining nucleic acid quality of biological sample
US20180223367A1 (en) Assays, methods and compositions for diagnosing cancer
JP5776051B2 (en) Kit and method for predicting prognosis of patients with gastrointestinal stromal tumor
KR102236717B1 (en) Method of providing the information for predicting of hematologic malignancy prognosis after peripheral blood stem cell transplantation
US20080213781A1 (en) Methods of detecting methylation patterns within a CpG island
CA3233741A1 (en) Microsatellite markers
US12247258B2 (en) Epigenetic method to detect and distinguish IPEX and IPEX-like syndromes, in particular in newborns
Albitar et al. Wild-type blocking PCR combined with direct sequencing as a highly sensitive method for detection of low-frequency somatic mutations
Garza et al. Development of a high-resolution melting curve analysis screening test for SRSF2 splicing factor gene mutations in myelodysplastic syndromes
WO2008005559A2 (en) A strategy for detecting low abundance mutations
WO2009113888A2 (en) Method for determining reduced predisposition to cancer based on genetic profile
CN113684266A (en) Nucleic acid composition and method for quality evaluation of single cell whole genome DNA amplification product
Bergfors Evaluation of Microsatellite Instability Analysis as a Diagnostic Tool to Identify Lynch Syndrome in Endometrial Cancer Patients
EP2496710A1 (en) Determination of 17q gain in neuroblastoma patients by analysis of circulating dna

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14812660

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2932524

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2016536851

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20167017659

Country of ref document: KR

Kind code of ref document: A

122 Ep: pct application non-entry in european phase

Ref document number: 14812660

Country of ref document: EP

Kind code of ref document: A1