WO2015060547A1 - 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 - Google Patents
조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 Download PDFInfo
- Publication number
- WO2015060547A1 WO2015060547A1 PCT/KR2014/008874 KR2014008874W WO2015060547A1 WO 2015060547 A1 WO2015060547 A1 WO 2015060547A1 KR 2014008874 W KR2014008874 W KR 2014008874W WO 2015060547 A1 WO2015060547 A1 WO 2015060547A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- c8orf4
- cells
- hematopoiesis
- protein
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3015—Breast
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to the use of hematopoietic progenitor cells and gene TC1 (C8orf4) to regulate hematopoietic action.
- Hematopoiesis is a well-organized, complex process under strict control. Numerous mature blood cells of various lines are produced daily from small amounts of hematopoietic stem cells (HSCs), which respond to internal demands and external stimuli. Differentiation into each line is regulated by the division of a set of transcription factors according to whether they can function independently or in combination. In addition, bone marrow cytokines play a positionally important role in hematopoietic regulation. Hematopoietic stem / progenitor cells (HSPC) and the regulation of hematopoietic activity have been studied extensively in the biomedical arts, including several animal in vivo studies. However, the understanding of complex control processes is limited, and much remains unknown.
- HSCs hematopoietic stem cells
- TC1 ( C8orf4 ) is a vertebrate gene and is well conserved among other species. In zebrafish embryos, two homologues are expressed in association with hematopoietic cells and blood vessels, respectively. TC1 ( C8orf4 ) is associated with several cancers. Copy number variation is associated with acute myeloid leukemia and several hematologic cancers, which has been shown to play a potential role in the regulation of hematopoietic action.
- TC1 The biological function of TC1 has begun to emerge, which is naturally a disordered protein and undergoes rapid proteosomal degradation. Heat shock, cellular stress, and inflammatory cytokines such as IL-1 ⁇ and TNF- ⁇ promote expression and nuclear translocation. TC1 enhances Wnt / ⁇ -catenin signaling in cancer cells. It also enhances NF-kB signaling in endothelial cells that induce inflammatory activation.
- TC1 has been shown to be a novel regulator of hematopoietic action.
- Korean Patent Publication No. 2010-0062737 relates to a pharmaceutical composition for preventing and treating atherosclerosis comprising a TC1 protein inhibitor as an active ingredient, more specifically, TC1 protein plays an important role as an inflammation regulator of endothelial cells in atherosclerosis.
- TC1 protein plays an important role as an inflammation regulator of endothelial cells in atherosclerosis.
- a kit for diagnosing atherosclerosis can be developed by analyzing the expression level of TC1 protein and screening for atherosclerosis treatment.
- hematopoietic progenitor cells There is no mention of hematopoietic progenitor cells and the regulatory use of hematopoietic action of the TC1 (C8orf4) protein of the present invention.
- the present inventors produced TC1 (C8orf4) -deficient mice, and confirmed that the results of the increase of white blood cells, especially bone marrow cells, and small amount of red blood cells in the blood cells of the TC1 (C8orf4) -deficient mice.
- TC1 (C8orf4) -deficient mice were found to downregulate latexin expression. Therefore, TC1 (C8orf4) was confirmed that the hematopoietic inhibitory regulator and completed the present invention.
- TC1 C8orf4
- Another object of the present invention is to provide a mouse deficient in TC1 (C8orf4) gene that promotes hematopoiesis.
- the present invention provides a pharmaceutical composition for promoting hematopoiesis comprising a TC1 (C8orf4) protein expression or activity inhibitor as an active ingredient.
- the present invention comprises the steps of contacting a test substance to a cell comprising a TC1 ( C8orf4 ) gene or TC1 (C8orf4) protein; Measuring the expression or activity of TC1 (C8orf4) protein in cells in contact with the test substance; And selecting a test substance having reduced expression or activity of the TC1 (C8orf4) protein as compared to the control sample.
- the present invention also provides a mouse deficient in TC1 (C8orf4) gene that promotes hematopoiesis.
- the present invention relates to the use of hematopoietic progenitor cells and gene TC1 (C8orf4) for regulating hematopoietic activity, which has produced TC1 (C8orf4) -deficient mice and leukocytes, especially bone marrow in the blood cells of TC1 (C8orf4) -deficient mice Cells increased, and red blood cells also increased in small amounts.
- TC1 (C8orf4) -deficient mice were found to downregulate latexin expression. Therefore, TC1 (C8orf4) is considered to be a very useful target for the development of drugs for promoting hematopoiesis as a hematopoietic inhibitor.
- 1A shows the TC1 -targeting process. Restriction maps of wild type genes, targeting constructs and targeted genes are shown. Probes used for Southern blot analysis are indicated. The upper line shows the structure of the wild type gene of TC1 and some restriction enzyme maps. The middle and lower lines represent the targeting construct and the predictive construct of the targeted gene, respectively.
- 1B shows TC1 -targeted mouse screening results by Southern blotting. TC1 +/- ⁇ TC1 +/- using mouse tail DNA treated with ScaI Genotype of offspring through mating. The 8.5- and 4.6-kb bands represent wild type and mutant TC1 ( C8orf4 ) traits, respectively.
- FIG. 2 shows the results of an increase in blood cells in TC1 ⁇ / ⁇ mice.
- WBC white blood cells
- lym lymphocytes
- Neutrophils Neut
- b the percentage of lymphocytes and neutrophils per total WBC
- monocytes Mono
- Eos eosinophils
- RRC red blood cells
- FIG. 3 shows that TC1 regulates bone marrow cells.
- TREM-1 expression in TC1 -transfected HL-60 cells and vector-transfected controls was analyzed by qPCR. Expression data were expressed as mean ⁇ sd through three independent experiments.
- FIG. 4 shows the results of in vitro colony-forming unit (CFU) analysis.
- TC1 ⁇ / ⁇ and wild type mouse derived bone marrow cells were cultured in methyl cellulose plates and colonies were counted under a microscope. Data show the mean ⁇ sd of colonies per 10 5 cultured cells in at least 3 independent experiments with 8 male, 8 week old TC1 ⁇ / ⁇ mice and 8 control mice gender- and age-combined.
- CFU-granulocyte-macrophage CFU-GM.
- CFU-granulocyte-erythrocyte-monocyte-megakaryocytes granulocyte-erythroid-monocyte-megakaryocyte; GEMM.
- CFU-erythroid CFU-E
- Burst-forming unit-erythroid BFU-E. *** P ⁇ 0.001
- FIG. 5 shows representative CFUs from TC1 -deficient and wild type control mice. Bone marrow cells were cultured in methyl cellulose plates and colonies were counted under reversed phase microscopy.
- FIG. 6 shows TC1 expression in bone marrow.
- SSC side-scatter
- FSC forward scatter
- the present invention provides a pharmaceutical composition for promoting hematopoiesis comprising TC1 (C8orf4) protein expression or activity inhibitor as an active ingredient.
- TC1 (C8orf4) protein is characterized by SEQ ID NO: 1 (NCBI accession no. NP_064515.1).
- the TC1 (C8orf4) gene is characterized in that represented by SEQ ID NO: 2 (NCBI accession no. NM_020130.4).
- the TC1 (C8orf4) protein expression inhibitors include antisense nucleotides, small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) that complementarily bind to mRNA of the TC1 (C8orf4) gene. Characterized in that it is any one selected from the group consisting of, TC1 (C8orf4) protein activity inhibitor is composed of compounds, peptides, peptide mimetics, aptamers, antibodies and natural products that specifically bind to TC1 (C8orf4) protein It is characterized in that any one selected from the group.
- the hematopoietic action promotion is characterized by promoting the proliferation or differentiation of hematopoietic progenitor cells.
- the pharmaceutical composition is characterized by down-regulating the expression of latexin (latexin; Lxn), wherein the latexin (latexin; Lxn) is characterized in that the negative regulator of hematopoietic progenitor cells.
- antisense nucleotide refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a sequence of a particular mRNA, and binds to a complementary sequence in the mRNA to inhibit translation of the mRNA into a protein. It works.
- small interfering RNA refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing. siRNA is provided as an efficient gene knockdown method or gene therapy method because it can inhibit the expression of the target gene.
- shRNA short hairpin RNA
- shRNA refers to a oligo DNA linking 3-10 base linkers between the sense of the target gene siRNA and complementary nonsense, and then cloned into a plasmid vector. Or expressing by inserting shRNA into the retroviruses lentivirus and adenovirus, a looped hairpin structured shRNA (short hairpin RNA) is produced and converted into siRNA by Dicer in the cell Say what it represents.
- the shRNA has a relatively long RNAi effect compared to siRNA.
- peptide mimetics is a peptide or nonpeptide that inhibits the binding domain of TC1 (C8orf4) protein leading to TC1 (C8orf4) activity.
- the term "Aptamer” is a single-stranded nucleic acid (DNA, RNA or modified nucleic acid) having a stable tertiary structure by itself and having a characteristic that can bind with high affinity and specificity to a target molecule. Aptamers are compared to single antibodies because of their inherent high affinity (usually pM levels) and their specificity to bind to target molecules, and thus have high potential as alternative antibodies, particularly as "chemical antibodies.”
- the "antibody” of the present invention can be used both prepared by the injection of TC1 (C8orf4) or purchased commercially.
- the antibodies include polyclonal antibodies, monoclonal antibodies, fragments capable of binding epitopes, and the like.
- Polyclonal antibodies can be produced by conventional methods of injecting the above TC1 (C8orf4) into an animal and collecting blood from the animal to obtain serum containing the antibody.
- Such polyclonal antibodies can be purified by any method known in the art and can be made from any animal species host, such as goats, rabbits, sheep, monkeys, horses, pigs, cattle, dogs and the like.
- Monoclonal antibodies can be prepared using any technique that provides for the production of antibody molecules through the culture of continuous cell lines. Such techniques include, but are not limited to, hybridoma technology, human B-cell line hybridoma technology, and EBV-hybridoma technology.
- the pharmaceutical composition is aplastic anemia, malignant lymphoma or leukemia, chronic liver disorders, renal failure, severe infectious disease, myeloid thrombocytopenia, idiopathic thrombocytopenic purpura (ITP), thrombocytopenia, lymphopenia, neutropenia, mononucleosis , Granulocytopenia and myeloproliferative diseases can be treated, but are not limited thereto.
- the pharmaceutical composition of the present invention may include chemicals, nucleotides, antisenses, siRNA oligonucleotides, and natural extracts as active ingredients.
- the pharmaceutical composition for promoting hematopoiesis or the hematopoietic-promoting complex preparation of the present invention may be prepared using a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient, and the adjuvant may include an excipient, a disintegrant, a sweetener, and a binder.
- Solubilizers such as coatings, expanding agents, lubricants, lubricants, or flavoring agents can be used.
- the pharmaceutical composition for promoting hematopoiesis according to the present invention can be preferably formulated into a pharmaceutical composition including one or more pharmaceutically acceptable carriers in addition to the active ingredient for administration.
- Acceptable pharmaceutical carriers in compositions formulated in liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary.
- Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
- compositions of the present invention may be granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions and sustained release formulations of the active compounds, and the like.
- the pharmaceutical compositions of the present invention may be administered in a conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, sternum, transdermal, nasal, inhalation, topical, rectal, oral, intraocular or intradermal routes.
- An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required to prevent or treat a disease.
- the type of disease the severity of the disease, the type and amount of the active and other ingredients contained in the composition, the type of formulation and the age, weight, general health, sex and diet, sex and diet, time of administration, route of administration and composition of the patient. It can be adjusted according to various factors including the rate of secretion, the duration of treatment, and the drug used concurrently.
- the inhibitor of the present invention when administered once or several times a day, is administered once or several times a day, when the compound is 0.1ng / kg to 10g / kg, a polypeptide,
- 0.1ng / kg ⁇ 10g / kg antisense nucleotides, siRNA, shRNAi, miRNA can be administered at a dose of 0.01ng / kg ⁇ 10g / kg.
- the present invention comprises the steps of contacting a test substance to a cell comprising a TC1 ( C8orf4 ) gene or TC1 (C8orf4) protein; Measuring the expression or activity of TC1 (C8orf4) protein in cells in contact with the test substance; And selecting a test substance having reduced expression or activity of the TC1 (C8orf4) protein as compared to the control sample.
- the expression or activity level of the TC1 (C8orf4) protein is Reverse Transcription-Polymerase Chain Reaction (RT-PCR), enzyme immunoassay (ELISA), immunohistochemistry, Western Blotting Or by flow cytometry (FACS), but is not limited thereto.
- RT-PCR Reverse Transcription-Polymerase Chain Reaction
- ELISA enzyme immunoassay
- FACS Western Blotting Or by flow cytometry
- test material refers to an unknown candidate used in screening to examine whether it affects the expression level of a gene or affects the expression or activity of a protein. do.
- the sample includes, but is not limited to, chemicals, nucleotides, antisense-RNAs, small interference RNAs (siRNAs), and natural extracts.
- the present invention provides a hematopoiesis-promoted TC1 (C8orf4) gene deficient mouse, preferably using a neomycin R insertion target construct transfected into 129 strain ES cells It became. It can be produced by backcrossing with C57BL / 6 mice for 10 generations in specific pathogen-free animal facilities.
- TC1 -deficient mice were constructed using neomycin R insertion target constructs transfected into 129 strain ES cells. NCBI accession numbers of target TC1 genes and proteins are NP_081207.1, NM_026931.2. The animals were backcrossed with C57BL / 6 mice for 10 generations in a specific pathogen-free (SPF) animal facility at Asan Life Science Research Institute (Seoul, Korea). All animal studies were performed after approval according to the guidelines for breeding and using experimental animals. In all experiments, 7- to 9-week old TC1 -deficient mice and sex- and age-combined control mice were used.
- SPF pathogen-free
- Peripheral blood samples were anesthetized via an inferior vena cava puncture using a 26-gauge needle and a 1 mL syringe containing heparin sodium (Sigma Aldrich, St. Louis, USA) as an anticoagulant. Obtained from mouse. Complete blood counts (CBC) and white blood cell (WBC) differential calculations were analyzed using the ADVIA 2120i Hematology System (Siemens Healthcare, Er Weg, Germany) in a pathology laboratory in Asan Hospital. Blood smears were made and stained with diffQuick (Merck, Darmstadt, Germany).
- CBC Complete blood counts
- WBC white blood cell
- TC1 -deficient mice were constructed (FIGS. 1A and 1B) and backcrossed with C57BL / 6 mice for 10 generations.
- TC1 -deficient homozygotes grew well without particular differences in external or behavioral phenotypes under specific pathogen-free (SPF) environments. However, the hematological profile has changed significantly.
- SPF pathogen-free
- Total red blood cells increased 6.86% in TC1 -deficient mice on average compared to controls ( p ⁇ 0.001, FIG. 2D).
- mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH) were significantly reduced and hematocrit (HCT) remained unchanged (FIG. 2D).
- Mean corpuscular hemoglobin concentration (MCHC) also did not change.
- the red cell distribution width (RDW) which indicates the extent of the size difference of RBCs, was higher in TC1 -deficient mice than in the control (FIG. 2D). The results indicate that the size of RBCs in TC1 -deficient mice is smaller and there are more changes in size.
- Single cell suspensions were prepared by dissolving in ice-cold FACS buffer (PBS with 5% FBS) and assaying with a FACSCantoII (Becton Dickinson, San Jose, CA) flow cytometer with at least 10 6 cells with 1 ug of antibody per assay. It was. FITC-conjugated anti-Cd11b, PE-conjugated F4 / 80 (BD Pharmingen, San Jose, CA), FITC-conjugated Sca-1, PE-conjugated c-Kit, APC-Cy7-conjugated Cd45 (BioLegend, San Diego, CA ) And Alexa Fluor 647-junction Pu. 1 (Cell Signaling Technology, Danvers, MA).
- FACSCantoII Becton Dickinson, San Jose, CA
- HBSS Hank's Balanced Salt Solution
- DHR123 Dihydrorhodamine123
- LPS lipopolysaccharide
- Human promyelocytic leukemia cell line HL-60 was cultured at 37 ° C., 5% CO 2 conditions in RPMI medium supplemented with 10% FBS, 100U / ml penicillin and 100ug / ml streptomycin (Gibco, Carlsbad, CA). It became. Experiments were performed using cells of passages 4-8. For low levels of expression, HL-60 was transfected with pCAGGS mammalian expression vector (Addgene, Cambridge, Mass.) Containing TC1. 1x10 7 HL-60 cells were harvested during exponential growth and resuspended in Gene Pulser Electroporation buffer (Bio-Rad, Hercules, CA). The cells were mixed with DNA and shocked at 175V, 1000uF using a 4mm cuvette from Gene Pulser Xcell TM Electroporation Systems (Bio-Rad, Hercules, Calif.).
- TC1 is a regulator mainly for hematopoietic action in bone marrow cells.
- Flow cytometry showed that the expression of a broad range of myeloid markers, Cd11b, was increased in blood mononuclear cells of TC1 ⁇ / ⁇ mice compared to wild type controls (FIG. Support the role. Cd11b-positive cells had increased numbers in TC1 ⁇ / ⁇ mice, but fluorescence intensity appeared similar to wild type controls.
- cells that simultaneously express Cd11b and the macrophage / monocyte marker F4 / 80 also increased similarly (FIG. 3B).
- Trem-1 is an Ig superfamily group receptor that is selectively expressed in activated neutrophils and monocytes and amplified in the inflammatory response. Expression of Trem-1 according to qPCR analysis is up-regulated in blood mononuclear cells of TC1 ⁇ / ⁇ mice compared to the control (FIG. 3C), indicating that it is functionally active as well as the wild type counterpart under normal conditions.
- human promyelocytic leukemia cell line HL-60 was transiently transfected using a TC1 expression vector. HL-60 cells expressed minimal TC1 under culture conditions.
- TREM-1 was down-regulated in TC1 -transfected HL-60 cells compared to vector-transfected controls (FIG. 3C), indicating that TC1 plays a potential role in regulating bone marrow cell activity.
- ROS reactive oxygen species
- Example 3 TC1 Of colony forming units (CFUs) in deficient mice
- Bone marrow samples were prepared from 6- to 8-week old TC1 -deficient mice and gender- and age-combined control mice. Bone marrow cells were obtained from femurs and tibias using a 26 gauge needle and filtered through a cell strainer of 100-um nylon mesh (BD Biosciences, San Jose, Calif.). Monocytes were isolated by Ficoll-Plaque Plus density solution (GE Healthcare, Piscataway Township, NJ). To obtain lineage-negative fractions, the cells were isolated from mononuclear cells using a Lineage Cell Depletion Kit (Miltenyi Biotec, Gladbach, Germany) including Ter119, Gr-1, CD11b, CD41, CD3e and B220.
- Lineage Cell Depletion Kit Miltenyi Biotec, Gladbach, Germany
- Mature hematopoietic cells were removed.
- HSC markers antibodies to FITC-conjugated Sca-1 (D7) and PE-conjugated c-Kit (2B8) were used (BD Pharmingen, San Jose, Calif.).
- FACSCalibur Becton Dickinson, San Jose, Calif.
- Lin ⁇ Sca-1 + cells were isolated from Sca-1 stained Lin ⁇ fractions.
- bone marrow cells were obtained from femurs and tibias washed using Iscove's Modified Dulbecco's Medium (Life Technologies, Carlsbad, Calif.) With 2% FBS. Each experiment was performed with bone marrow cells from 8-week-old TC1 -deficient mice and gender- and age-combined control mice. Three independent experiments were performed in two replicates and incubated on dual-chamber slides. For each experiment, according to manufacturer's instructions (StemCell Technologies, Vancouver, BC, Canada), recombinant mouse SCF, rmIL-3, recombinant human IL-6 and rhEpo were analyzed for CFU-GM, CFU-GEMM and BFU-E analysis.
- TC1 is systematically expressed in humans and mice, but expression in blood leukocytes is not easily detectable by Northern and / or dot blots. In comparison, expression can be confirmed in hematopoietic cells developed in human bone marrow and zebrafish embryos.
- the inventors have determined whether bone marrow cell hyperplasia in TC1 -deficient mice indicates an improvement in hematopoietic activity in bone marrow through colony forming unit (CFU) analysis in methyl cellulose plates.
- CFU colony forming unit
- CFU- granulocyte-macrophage granulocyte-macrophage
- CFU- granulocyte-erythrocyte-monocyte-megakaryocytes granulocyte-erythroid-megakaryocyte-monocyte; GEMM
- GM granulocyte-macrophage
- GEMM granulocyte-erythroid-megakaryocyte-monocyte
- Burst-forming unit (BFU) -E which exhibits erythrocyte hematopoietic activity in the upper layer than CFU-E, did not increase compared to the control (FIG. 4D).
- TC1 plays a role as a regulator of hematopoietic action in mice.
- Vertebral bones were fixed in 10% buffered formalin and decalcified. Tissue sections were made and stained with H & E.
- 1.2 ⁇ 10 5 cells suspended in PBS were plated on glass slides and centrifuged for 1 minute at 1,000 rpm. Cytospinned slides were air-dried at room temperature and fixed in 100% methanol at ⁇ 20 ° C. for 10 minutes. Cells were immunostained for 3 hours using anti-TC1 antibody (1:50 dilution). After washing with PBS, Alexa Fluor 594-conjugated anti-rabbit IgG secondary antibody was diluted 1: 200 and reacted for 1 hour. Nuclear staining was performed using Hoechst 33342 (Sigma-Aldrich, St. Louis, Mo.). Cells were observed using inverted zeiss LSM 710 confocal microscopy (Carl Zeiss, Thornwood, NY).
- Bone marrow of TC1 -deficient mice showed normal cytoplasm, composition and bone formation similar to wild type controls (FIG. 6A).
- TC1 mRNA was lowly expressed in myeloid mononuclear cells.
- TC1 was expressed at various staining intensities mainly in primitive bone marrow cells (FIG. 6B).
- cytoplasmic granule staining was hardly observed in the bone marrow cells having a small cytoplasm of 6-8 ⁇ m in diameter, consistent with hematopoietic stem cells (top of FIG. 6B).
- the large undifferentiated cells showed strong cytoplasmic staining as well as weak nuclear staining (bottom of FIG. 6b).
- Nuclear translocation of TC1 with various cellular stimuli in cancer cells has already been reported.
- cells with ring-type nuclei were also immunostained in the bone marrow of wild-type mice. Bone marrow cells with ring-type nuclei have been reported in mice but not in humans. Most differentiated bone marrow cells with segmented nuclei were not immunostained.
- Example 5 TC1-positive bone marrow cells expressing Sca-1, c-Kit and Lxn simultaneously
- TC1-expressing cells were found to be low in frequency (FIG. 5C), which is seen to be less than 1% of the total lineage negative cells (FIG. 5D). Most of the TC1 + cells co-express c-Kit and / or Sca-1 (FIG. 5C), which supports that most belong to the HSPC group. Interestingly, the Lin - TC1 + group consists of two different subgroups, Sca-1 hi and Sca-1 int , depending on the level of Sca-1 expression (FIG. 5C).
- TC1 + Sca-1 hi cells tend to have less forward- and side-scatter than TC1 + Sca-1 int cells, which is TC1 + Shows that the average size of Sca-1 hi cells is smaller.
- TC1 + Sca-1 hi cells express Cd45, which is more abundant in HSPC than non-hematopoietic primitive bone marrow cells, such as endothelial progenitor cells or very small embryonic-like (VSEL) cells. Supports that.
- Lxn latexin
- TC1 latexin
- TC1 TC1 + TC1 + cells than the cells were expressing the Sca-1 at high frequency, which is TC1 Lin - indicates that the specifically expressed in Sca-1 + hematopoietic cells of Lxn + cells.
- Lxn + TC1 + cells consisted of Sca-1 hi and Sca-1 int subpopulations (FIG. 5E), which express both TC1, Lxn and Sca-1. Indicates HSPC. Conversely, TC1 + Sca-1 hi and TC1 + Sca-1 int cells expressed Lxn with high frequency.
- Example 6 TC1 TC1 Regulates Lxn in HSPC and Expansion of HSPC Group in Deficient Mice
- CD150 - CD48 + cells expanded proportionally, whereas CD150 + CD48 ⁇ / CD150 + CD48 + / CD150 ⁇ CD48 ⁇ cells were not, which means that the population of cells expanded in Tc1 ⁇ / ⁇ mice was HSC or Rather than multipotent progenitor (MPP) levels, the majority indicate lineage restricted hematopoietic progenitor cells (FIG. 7C).
- MPP multipotent progenitor
- Lxn-expressing groups were significantly reduced in Lin - c-Kit + and Lin - Sca-1 + cells of TC1 ⁇ / ⁇ mice.
- qPCR analysis Lxn expression than the control group TC1 - / - mouse strain-I significantly lower in the negative bone marrow cells (Fig. 7d), control mice within, Lin-c-Kit + and Lin - Sca-1 + cell number of Lxn was expressed in the fractions (FIG. 7E). This supports the TC1-dependent regulatory action on Lxn expression.
- the results support that Lxn is a lower regulator of TC1 in HSPC regulation.
- Wnt signaling is usually required for the regulation of HSPC and hematopoiesis.
- TC1 regulates Wnt / ⁇ -catenin signaling in cancer cells.
- c-Myc was up-regulated compared to control in lineage-negative bone marrow cells of TC1 ⁇ / ⁇ mice (FIG. 8B).
- Ccnd1 was constantly up-regulated, but there was no statistical significance in the difference.
- HSPC amplification in TC1 -deficient mice has been shown to play a potential regulator of Wnt signaling.
- TC1 up-regulated Wnt signaling in transformed epithelial cells. This indicates that TC1 -mediated regulation of Wnt signaling is dependent on the cell context.
- c-Myc is involved in the regulation of pluripotent stem cells (PSC).
- PSC pluripotent stem cells
- Klf4 another regulator of PSC
- Lin ⁇ cells of TC1 ⁇ / ⁇ mice compared to wild type controls
- FIG. 8C shows that expression of Sox2 and Pou5f1 (known as Oct4) was not clearly detected in repeated qPCR assays, indicating that TC1-dependent stem cell regulation is specific for myeloid hematopoietic cells.
- Cytokine assay staining was performed as previously reported ( J. Immunol. 183, 3996-4002 (2009)). Extracted bone marrow cells were carefully washed with serum-free RPMI 1640 (Gibco, Carlsbad, Calif.) Media for 10 minutes at room temperature. The medium was then recovered by cell centrifugation at 300 ⁇ g. 250 ug of total protein measured by Bradford assay was used for mouse cytokine analysis (Raybiotech, Norcross, GA) according to the manufacturer's instructions.
- cytokines including colony stimulating factors (CSF).
- CSF colony stimulating factors
- G-CSF Granulocyte-CSF
- GM-CSF granulocyte / monocyte-CSF
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본 발명은 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도에 관한 것이다. 본 발명은 TC1(C8orf4) 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물을 제공한다. 또한, 본 발명은 TC1(C8orf4) 유전자 또는 TC1(C8orf4) 단백질을 포함하는 세포에 시험물질을 접촉시키는 단계; 상기 시험물질을 접촉한 세포에서 TC1(C8orf4) 단백질의 발현 또는 활성 정도를 측정하는 단계; 및 대조구 시료와 비교하여 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도가 감소한 시험물질을 선별하는 단계를 포함하는 항진균제 스크리닝 방법을 제공한다. 본 발명의 TC1(C8orf4) 단백질은 조혈작용 억제 조절자로서 조혈 촉진용 약물 개발에 매우 유용한 타겟으로 활용될 것으로 사료된다.
Description
본 발명은 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도에 관한 것이다.
조혈작용(Hematopoiesis)은 잘 조직된 복합 공정으로 엄격한 조절하에서 이루어진다. 소량의 조혈모세포(hematopoietic stem cells; HSC)로부터 다양한 여러 계통의 수많은 성숙 혈액 세포가 매일 생산되는데, 이는 내부적 요구 및 외부적 자극에 반응하는 것이다. 독립적으로 또는 조합에 의해 기능할 수 있는지에 따른 전사 인자 세트의 구분에 의해 각 계통으로의 분화가 조절된다. 또한, 골수 사이토카인은 조혈 조절에 있어서 위치적으로 중요한 역할을 한다. 조혈모세포/조혈전구세포(hematopoietic stem/progenitor cells; HSPC) 및 조혈작용의 조절은 여러 동물 생체 내(in vivo) 연구를 포함하는 생의학 분야에서는 매우 광범위하게 연구되었다. 하지만, 복잡한 조절과정에 대한 이해는 한계가 있고, 여전히 많은 부분이 밝혀지지 않고 있다.
TC1(C8orf4)은 척추동물의 유전자로서, 다른 종들 사이에서 잘 보존되어 있다. 제브라피시(zebrafish) 배아에서는, 두 개의 상동체(homologues)가 각각 조혈세포 및 혈관에 연관되어 발현된다. TC1(C8orf4)은 여러 암과 관련되어 있다. 복제수 변이는 급성 골수성 백혈병 및 여러 혈액암과 관련되어 있는데, 이는 조혈작용의 조절에 잠재적인 역할을 하는 것으로 나타났다.
TC1의 생물학적 기능이 밝혀지기 시작했는데, 이는 천연적으로 비정형 단백질(disordered protein)이고, 급격한 프로테아좀 분해(proteosomal degradation)을 겪는다. 열 충격, 세포 스트레스 및 IL-1β 및 TNF-α와 같은 염증 사이토카인은 발현 및 핵 전좌(translocation)를 촉진한다. TC1은 암세포에서 Wnt/β-카테닌 신호전달을 향상시킨다. 또한 염증 활성화를 유도하는 내피세포에서의 NF-kB 신호전달을 향상시킨다.
생체 내(in vivo)에서의 생물학적 역할을 연구하기 위해서, 본 발명자들은 유전자-표적 마우스 라인을 제작하였다. TC1은 조혈작용에 대한 신규 조절자인 것으로 밝혀졌다.
한편, 한국공개특허 제2010-0062737호는 TC1 단백질 억제제를 유효성분으로 포함하는 동맥경화증 예방 및 치료용 약학조성물에 관한 것으로, 보다 상세하게는 TC1 단백질은 동맥경화증에서 내피세포의 염증 조절제로서 중요한 역할을 수행함으로써 TC1 단백질의 하향 조절에 의해 동맥경화증을 예방하거나 치료할 수 있을 뿐 아니라, TC1 단백질의 발현 수준을 분석함으로써 동맥경화증 진단용 키트를 개발할 수 있고, 동맥경화증 치료제를 스크리닝할 수 있다고 개시하고 있지만, 본원발명의 TC1(C8orf4) 단백질의 조혈전구세포 및 조혈작용의 조절 용도에 대한 언급은 없다.
따라서, 본 발명자들은 TC1(C8orf4)-결핍 마우스를 제작하였고, 상기 TC1(C8orf4)-결핍 마우스의 혈구에서 백혈구 세포, 특히 골수세포가 증가하고, 적혈구 세포도 소량 증가한다는 결과를 확인하였다. 또한, TC1(C8orf4)-결핍 마우스는 라테신(latexin) 발현을 하향 조절한다는 것을 밝혀냈다. 따라서 TC1(C8orf4)은 조혈작용 억제 조절자라는 사실을 확인하고 본 발명을 완성하였다.
본 발명의 목적은 TC1(C8orf4) 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물 및 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법을 제공하는 데에 있다.
본 발명의 다른 목적은 조혈작용(Hematopoiesis)이 촉진된 TC1(C8orf4) 유전자 결핍 마우스를 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 TC1(C8orf4) 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물을 제공한다.
또한, 본 발명은 TC1(C8orf4) 유전자 또는 TC1(C8orf4) 단백질을 포함하는 세포에 시험물질을 접촉시키는 단계; 상기 시험물질을 접촉한 세포에서 TC1(C8orf4) 단백질의 발현 또는 활성 정도를 측정하는 단계; 및 대조구 시료와 비교하여 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도가 감소한 시험물질을 선별하는 단계를 포함하는 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법을 제공한다.
또한, 본 발명은 조혈작용(Hematopoiesis)이 촉진된 TC1(C8orf4) 유전자 결핍 마우스를 제공한다.
본 발명은 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도에 관한 것으로서, TC1(C8orf4)-결핍 마우스를 제작하였고, 상기 TC1(C8orf4)-결핍 마우스의 혈구에서 백혈구 세포, 특히 골수세포가 증가하고, 적혈구 세포도 소량 증가한다는 결과를 확인하였다. 또한, TC1(C8orf4)-결핍 마우스는 라테신(latexin) 발현을 하향 조절한다는 것을 밝혀냈다. 따라서 TC1(C8orf4)는 조혈작용 억제 조절자로서 조혈 촉진용 약물 개발에 매우 유용한 타겟으로 활용될 것으로 사료된다.
도 1a는 TC1-표적화 과정을 나타낸다. 야생형 유전자, 표적화 구조체 및 표적화된 유전자의 제한효소 지도를 나타낸다. 서던 블랏(Southern blot) 분석에 사용된 프로브(probe)를 표시하였다. 상부 라인은 TC1의 야생형 유전자의 구조 및 일부 제한효소 지도를 나타낸다. 중간 및 하부 라인은 표적화 구조체 및 표적화된 유전자의 예측 구조를 각각 나타낸다. 도 1b는 서던 블랏팅(Southern blotting)에 의한 TC1-표적화 마우스 스크리닝 결과를 나타낸다. ScaI으로 처리된 마우스 꼬리 DNA를 이용하여, TC1
+/-×TC1
+/-
교배를 통한 새끼의 유전자형을 나타낸다. 8.5- 및 4.6-kb 밴드는 야생형 및 돌연변이 TC1(C8orf4) 형질을 각각 나타낸다.
도 2는 TC1
-/- 마우스에서 혈액 세포가 증가된 것을 나타내는 결과이다. (a) 백혈구(white blood cell; WBC), 림프구(lymphocytes; Lym) 및 호중구(Neutrophils; Neut)의 수, (b) 전체 WBC 당 림프구 및 호중구의 백분율, (c) 단핵구(monocytes; Mono) 및 호산구(eosinophils; Eos)의 수, (d) 대조군 및 TC1-결핍 마우스 유래 말초 혈액에서의 적혈구(red blood cells; RBC) 수, 평균 적혈구 용적(mean corpuscular volume; MCV), 평균 적혈구 헤모글로빈(mean corpuscular hemoglobin; MCH), 적혈구 용적율(hematocrit; HCT) 및 적혈구 분포 계수(red cell distribution width; RDW). 데이터는 수컷 14 마리, 7-9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 14 마리 대조군 마우스로 5번 이상 독립적 실험을 통해 평균 ± s.d.로 나타냈다. *p<0.05; **p< 0.01; ***p< 0.001
도 3은 TC1이 골수 세포를 조절한다는 것을 나타낸다. (a) 야생형 및 TC1
-/- 마우스에서 Cd11b 발현을 비교한 마우스 혈액 단핵 세포의 대표적인 유세포 분석 결과이다. (b) 야생형 및 TC1
-/- 마우스에서 Cd11b 및 F4/80 발현을 비교한 마우스 혈액 단핵 세포의 대표적인 유세포 분석 결과이다. (c) 왼쪽: 마우스 혈액 단핵 세포(PBMC)에서 Trem-1 발현을 qPCR로 분석한 결과이다. 데이터는 수컷 6 마리, 8 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 평균 ± s.d.로 나타냈다. 오른쪽: TC1-형질감염된 HL-60 세포 및 벡터-형질감염된 대조군에서의 TREM-1 발현을 qPCR로 분석한 결과이다. 발현 데이터는 3번 독립적 실험을 통해 평균 ± s.d.로 나타냈다. (d) 1시간 동안의 지질다당체(lipopolysaccharide; LPS) 자극 유무에 따른 TC1
-/- 및 야생형 마우스 유래 혈액 호중구(Neutrophils)에서 산화-특이적 DHR123 형광 염료를 이용하여 측정된 상대적 활성산소종(reactive oxygen species; ROS)의 대표적인 유세포 분석 결과이다. 어두운 부분은 LPS 자극이 없는 대조군을 나타낸다. *p<0.05; **p< 0.01. (e) 전기천공법(electroporation)을 이용한 HL-60 세포의 TC1-형질감염 결과이다. 전기천공법은 4mm cuvette을 이용하여 175V, 1000uF 조건에서 수행하였다. qPCR 측정 결과는 3번 독립적 실험을 통해 평균 ± s.d.로 나타냈다.
도 4는 세포 내(In vitro) 콜로니-형성 단위(colony-forming unit; CFU) 분석 결과이다. TC1
-/- 및 야생형 마우스 유래 골수 세포를 메틸 셀룰로스 플레이트(methyl cellulose plates)에 배양하였고, 콜로니들은 현미경 하에서 계수하였다. 데이터는 수컷 8 마리, 8 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 8 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 105 배양된 세포 당 콜로니 수를 평균 ± s.d.로 나타냈다. (a) CFU-과립구-대식세포(CFU-granulocyte-macrophage; CFU-GM). (b) CFU-과립구-적혈구-단핵구-거핵구(granulocyte-erythroid-monocyte-megakaryocyte; GEMM). (c) CFU-적혈구(CFU-erythroid; CFU-E). (d) 버스트-형성 단위-적혈구(Burst-forming unit-erythroid; BFU-E). ***P < 0.001
도 5는 TC1-결핍 및 야생형 대조군 마우스 유래 대표적인 CFUs를 나타낸다. 골수 세포는 메틸 셀룰로스 플레이트에서 배양되었고, 콜로니들은 역상 현미경 하에서 계수되었다.
도 6은 골수에서의 TC1 발현을 나타낸다. (a) 척추뼈(Vertebral bones)의 대표적인 조직학 이미지를 나타낸다. (b) 야생형 마우스의 골수에서 TC1-양성 세포의 공초점 현미경 이미지를 나타낸다. DNA 염색은 Hoechst 33342를 사용하여 수행하였다. 흰색 스케일 바는 10um를 나타낸다. (c) 야생형 C57BL/6 마우스 유래 Lin- 골수 세포의 TC1, c-Kit 및 Sca-1 발현에 대한 대표적인 유세포 분석 결과이다. Gated TC1+Sca-1hi (R1) 및 TC1+Sca-1int (R2) 세포는 사이드-스캐터(side-scatter; SSC)/포워드-스캐터(forward scatter; FSC) 및 Cd45/Sca-1 발현에 대해 각각 플롯팅하였다. (d) Lin-Sca-1+, Lin-c-Kit+ 및 총 Lin- 세포에서 TC1-발현 세포의 백분율을 계산한 결과이다. 데이터는 수컷 6 마리, 8 주령 C57BL/6 마우스로 3번 이상 독립적 실험을 통해 평균 ± s.d.로 나타냈다. (e) C57BL/6 마우스 유래 Lin- 골수 세포의 Lxn, TC1 및 Sca-1 발현에 대한 대표적인 유세포 분석 결과이다. Gated Lyn+TC1- (Q1) 및 Lyn+TC1+ (Q2) 세포는 TC1/Scal-1 발현에 대해 각각 플롯팅하였다.
도 7은 TC1
-/-
마우스의 골수에서 Lxn 발현 감소와 함께 HSPC 군이 확대되는 것을 나타낸 결과이다. (a) TC1
-/- 및 야생형 마우스 유래 계통-음성 세포의 c-Kit 및 Sca-1에 대한 대표적인 유세포 분석 결과이다. LSK 군의 총 Lin- 세포 당 백분율을 R1으로 표시하였다. (b) 2개의 대퇴골(femurs) 및 경골(tibias) 유래 마우스 당 총 LSK 세포의 수를 계산한 결과이다. 데이터는 수컷 4 마리, 6-7 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 4 마리 대조군 마우스로 2번 이상 독립적 실험을 통해 평균 ± s.d.로 나타냈다. (c) Tc1
-/- 및 야생형 마우스 유래 gated LSK 세포 (R1)의 CD150 및 CD48 발현에 대한 대표적인 유세포 분석 결과이다. (d) 대조군 및 TC1-녹아웃 마우스의 Lin- 분획에서의 Lxn 발현을 qPCR로 분석한 결과이다. 데이터는 수컷 6 마리, 9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 평균 ± s.d.로 나타냈다. *p<0.05 (e) TC1
-/- 및 야생형 마우스 유래 gated LSK 세포 (R1)의 Lxn, c-Kit 및 Sca-1 동시-발현에 대한 대표적인 유세포 분석 결과이다.
도 8은 조혈작용에 대한 주요 전사 인자의 발현에 대해 나타냈다. (a) TC1
-/- 및 야생형 마우스의 전체 Lin- 세포(왼쪽) 또는 분리된 Lin-Sca-1+ 분획(오른쪽)에 있어서 Pu.1 발현에 대한 qPCR 분석결과이다. 데이터는 전체 Lin- 세포 분석에 대해서 수컷 6 마리, 8 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 하였고, 분리된 Lin-Sca-1+ 분획 분석에 대해서 수컷 10 마리, 8-9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 10 마리 대조군 마우스로 2번 이상 독립적 실험을 통해 각각 평균 ± s.d.로 나타냈다. (b) Lin- 세포에서의 c-Myc 및 Ccnd1 발현에 대한 qPCR 분석결과이다. 데이터는 수컷 6 마리, 9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 각각 평균 ± s.d.로 나타냈다. (c) Lin- 세포에서의 Klf4 발현에 대한 qPCR 분석결과이다. 데이터는 수컷 6 마리, 9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 각각 평균 ± s.d.로 나타냈다. **p< 0.01; ***p< 0.001. (d) 및 (e) TC1
-/- 및 야생형 마우스의 계통-음성 골수 세포의 qPCR 분석 결과이다. (d) Cebp. (e) Gata-1. 데이터는 수컷 6 마리, 9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 각각 평균 ± s.d.로 나타냈다.
도 9는 TC1
-/- 및 야생형 마우스 유래 전체 골수 세포의 G-CSF, GM-CSF 및 M-CSF에 대한 qPCR 분석 결과이다. 데이터는 수컷 6 마리, 9 주령 TC1
-/- 마우스와 성별- 및 나이-조합된 6 마리 대조군 마우스로 3번 이상 독립적 실험을 통해 각각 평균 ± s.d.로 나타냈다.
본 발명은 TC1(C8orf4) 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물을 제공한다. 상세하게는 상기 TC1(C8orf4) 단백질은 서열번호 1로 표시된 것을 특징으로 한다(NCBI accession no. NP_064515.1). 한편, 상기 TC1(C8orf4) 유전자는 서열번호 2로 표시된 것을 특징으로 한다(NCBI accession no. NM_020130.4).
상세하게는, 상기 TC1(C8orf4) 단백질 발현 억제제는 TC1(C8orf4) 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오타이드, 작은 간섭 RNA(small interfering RNA; siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA; shRNA)로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하고, 상기 TC1(C8orf4) 단백질 활성 억제제는 TC1(C8orf4) 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머, 항체 및 천연물로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 한다.
상세하게는, 상기 조혈작용 촉진은 조혈전구세포(hematopoietic progenitor cells)의 증식 또는 분화를 촉진하는 것을 특징으로 한다.
상세하게는, 약학 조성물은 라테신(latexin; Lxn)의 발현을 하향 조절하는 것을 특징으로 하고, 상기 라테신(latexin; Lxn)은 조혈전구세포의 음성조절자인 것을 특징으로 한다.
본 발명에서 용어 "안티센스 뉴클레오타이드"란 특정 mRNA의 서열에 상보적인 핵산 서열을 함유하고 있는 DNA 또는 RNA 또는 이들의 유도체를 의미하고, mRNA내의 상보적인 서열에 결합하여 mRNA의 단백질로의 번역을 저해하는 작용을 한다.
본 발명에서 용어 "작은 간섭 RNA(small interfering RNA; siRNA)"는 RNA 방해 또는 유전자 사일런싱을 매개할 수 있는 핵산 분자를 의미한다. siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법으로서 또는 유전자치료 방법으로 제공된다.
본 발명에서 용어 "짧은 헤어핀 RNA(short hairpin RNA; shRNA)"는 목적유전자 siRNA 염기서열의 sense와 상보적인 nonsense 사이에 3-10개의 염기 linker를 연결하는 올리고 DNA를 합성한 후 프라스미드 벡터에 클로닝하거나 또는 shRNA를 레트로바이러스인 렌티바이러스(lentivirus) 및 아데노바이러스(adenovirus)에 삽입하여 발현시키면 loop가 있는 헤어핀 구조의 shRNA (short hairpin RNA)가 만들어지고 세포 내의 Dicer에 의해 siRNA로 전환되어 RNAi 효과를 나타내는 것을 말한다. 상기 shRNA는 siRNA에 비해 비교적 장기간 RNAi 효과를 나타낸다.
본 발명에서 용어 "펩티드 미메틱스(Peptide Mimetics)"는 TC1(C8orf4) 활성을 이끄는 TC1(C8orf4) 단백질의 결합 도메인을 억제하는 펩티드 또는 비펩티드이다.
본 발명에서 용어 "앱타머(Aptamer)"는 그 자체로 안정된 삼차구조를 가지면서 표적분자에 높은 친화성과 특이성으로 결합할 수 있는 특징을 가진 단일가닥 핵산(DNA, RNA 또는 변형핵산)이다. 앱타머는 고유의 높은 친화성(보통 pM 수준)과 특이성으로 표적분자에 결합할 수 있다는 특성 때문에 단일 항체와 비교가 되고, 특히 "화학 항체"라고 할 만큼 대체 항체로서의 높은 가능성이 있다.
본 발명의 "항체"는 TC1(C8orf4) 주입을 통해 제조된 것 또는 시판되어 구입한 것이 모두 사용 가능하다. 또한, 상기 항체는 다클론 항체, 단클론 항체 및 에피토프와 결합할 수 있는 단편 등을 포함한다.
다클론 항체는 상기 TC1(C8orf4)을 동물에 주사하고, 해당 동물로부터 채혈하여 항체를 포함하는 혈청을 수득하는 종래의 방법에 의해 생산할 수 있다. 이러한 다클론 항체는 당업계에 알려진 어떠한 방법에 의해서든 정제될 수 있고, 염소, 토끼, 양, 원숭이, 말, 돼지, 소, 개 등의 임의의 동물 종 숙주로부터 만들어질 수 있다.
단클론 항체는 연속 세포주의 배양을 통한 항체 분자의 생성을 제공하는 어떠한 기술을 사용하여도 제조할 수 있다. 이러한 기술로는 이들로 한정되는 것은 아니지만 하이브리도마 기술, 사람 B-세포주 하이브리도마 기술 및 EBV-하이브리도마 기술이 포함된다.
또한, 상기 약학 조성물은 재생 불량성 빈혈, 악성 림프종 또는 백혈병, 만성 간 장애, 신부전, 중증 감염증, 골수 장애성 혈소판 감소증, 특발성 혈소판 감소성 자반병(ITP), 혈소판 무력증, 림프구감소증, 호중구감소증, 단핵구감소증, 과립구감소증 및 골수 증식성 질환으로 이루어진 군에서 선택되는 질환을 치료할 수 있지만, 이에 제한되는 것은 아니다.
본 발명의 약학 조성물은 화학물질, 뉴클레오타이드, 안티센스, siRNA 올리고뉴클레오타이드 및 천연물 추출물을 유효성분으로 포함할 수 있다. 본 발명의 조혈작용 촉진용 의약 조성물 또는 조혈작용 촉진 복합 제제는 유효 성분 이외에 약제학적으로 적합하고 생리학적으로 허용되는 보조제를 사용하여 제조될 수 있으며, 상기 보조제로는 부형제, 붕해제, 감미제, 결합제, 피복제, 팽창제, 윤활제, 활택제 또는 향미제 등의 가용화제를 사용할 수 있다. 본 발명의 조혈작용 촉진용 의약 조성물은 투여를 위해서 유효 성분 이외에 추가로 약제학적으로 허용 가능한 담체를 1 종 이상 포함하여 의약 조성물로 바람직하게 제제화할 수 있다. 액상 용액으로 제제화되는 조성물에 있어서 허용 가능한 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.
본 발명의 의약 조성물의 약제 제제 형태는 과립제, 산제, 피복정, 정제, 캡슐제, 좌제, 시럽, 즙, 현탁제, 유제, 점적제 또는 주사 가능한 액제 및 활성 화합물의 서방출형 제제 등이 될 수 있다. 본 발명의 의약 조성물은 정맥내, 동맥내, 복강내, 근육내, 동맥내, 복강내, 흉골내, 경피, 비측내, 흡입, 국소, 직장, 경구, 안구내 또는 피내 경로를 통해 통상적인 방식으로 투여할 수 있다. 본 발명의 의약 조성물의 유효성분의 유효량은 질환의 예방 또는 치료 요구되는 양을 의미한다. 따라서, 질환의 종류, 질환의 중증도, 조성물에 함유된 유효 성분 및 다른 성분의 종류 및 함량, 제형의 종류 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료 기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다. 이에 제한되는 것은 아니나, 예컨대, 성인의 경우, 1일 1회 내지 수회 투여시, 본 발명의 저해제는 1일 1회 내지 수회 투여시, 화합물일 경우 0.1ng/kg~10g/kg, 폴리펩타이드, 단백질 또는 항체일 경우 0.1ng/kg~10g/kg, 안티센스 뉴클레오타이드, siRNA, shRNAi, miRNA일 경우 0.01ng/kg~10g/kg의 용량으로 투여할 수 있다.
또한, 본 발명은 TC1(C8orf4) 유전자 또는 TC1(C8orf4) 단백질을 포함하는 세포에 시험물질을 접촉시키는 단계; 상기 시험물질을 접촉한 세포에서 TC1(C8orf4) 단백질의 발현 또는 활성 정도를 측정하는 단계; 및 대조구 시료와 비교하여 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도가 감소한 시험물질을 선별하는 단계를 포함하는 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법을 제공한다.
바람직하게는 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도는 역전사 중합효소 연쇄반응(Reverse Transcription-Polymerase chain Reaction, RT-PCR), 효소면역분석법(ELISA), 면역조직화학, 웨스턴 블랏(Western Blotting) 또는 유세포 분석법(FACS)으로 측정할 수 있지만, 이에 제한되는 것은 아니다.
본 발명의 스크리닝 방법을 언급하면서 사용되는 용어 "시험물질"은 유전자의 발현량에 영향을 미치거나, 단백질의 발현 또는 활성에 영향을 미치는지 여부를 검사하기 위하여 스크리닝에서 이용되는 미지의 후보 물질을 의미한다. 상기 시료는 화학물질, 뉴클레오타이드, 안티센스-RNA, siRNA(small interference RNA) 및 천연물 추출물을 포함하나, 이에 한정되는 것은 아니다.
또한, 본 발명은 조혈작용(Hematopoiesis)이 촉진된 TC1(C8orf4) 유전자 결핍 마우스를 제공하는데, 바람직하게는 129 strain ES cell에 형질감염된 네오마이신R(neomycinR) 삽입 표적 구조체(construct)를 이용하여 제작되었다. 특정 병원체 부재(specific pathogen-free; SPF) 동물 시설에서 C57BL/6 마우스와 10세대 동안 역교배하여 제작할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1 :
TC1
-결핍 마우스에서의 골수 세포 과형성
1. 마우스
TC1-결핍 마우스는 129 strain ES cell에 형질감염된 네오마이신R(neomycinR) 삽입 표적 구조체(construct)를 이용하여 제작되었다. 표적 TC1 유전자 및 단백질의 NCBI accession number는 NP_081207.1, NM_026931.2이다. 아산생명과학연구원(서울, 대한민국)의 특정 병원체 부재(specific pathogen-free; SPF) 동물 시설에서 C57BL/6 마우스와 10세대 동안 역교배하였다. 모든 동물 연구는 실험동물 사육 및 사용에 대한 가이드라인에 따른 승인 후 수행되었다. 모든 실험에서, 7- 내지 9-주령 TC1-결핍 마우스와 성별- 및 나이-조합 대조군 마우스를 사용하였다.
2. 말초 혈액 세포 분석
말초 혈액 샘플은 26 게이지 바늘과 혈액응고방지제로서 헤파린 나트륨(heparin sodium, Sigma Aldrich, St. Louis, USA)이 함유된 1mL 실린지를 이용하여 하대 정맥(inferior vena cava) 천자(puncture)를 통해 마취시킨 마우스로부터 얻었다. 일반 혈액 검사(complete blood counts; CBC) 및 백혈구(white blood cell; WBC) 감별 계산은 아산병원 내 병리검사실에서 ADVIA 2120i Hematology System (Siemens Healthcare, Erlangen, Germany)을 사용하여 분석하였다. 혈액 도말(Blood smears)을 하였고, diffQuick (Merck, Darmstadt, Germany)으로 염색하였다.
3. 결과
TC1-결핍 마우스는 제작되었고(도 1a 및 도 1b), C57BL/6 마우스와 10세대 동안 역교배하였다. TC1-결핍 동형접합체(homozygotes)는 특정 병원체 부재(specific pathogen-free; SPF) 환경 하에서 외부 또는 행동상 표현형에 특별한 차이 없이 잘 자랐다. 하지만, 혈액학적 프로파일은 현저하게 변했다.
백혈구(white blood cell; WBC) 감별 계산에 따른 일반 혈액 검사(complete blood counts; CBC)에서, 나이- 및 성별-조합된 야생형 대조군과 비교하여 총 WBC는 다 자란 TC1-결핍 마우스에서 평균 56.3% 증가했다(p<0.001, 도 2a). 호중구(Neutrophils)는 야생형 대조군 평균에 비해 2.8 배나 크게 증가하였다. 또한, 림프구는 평균 44.1% 증가하였다. 하지만, 총 WBC 내의 림프구 백분율은 대조군과 비교해서 11.1% 더 감소하였는데(p<0.001, 도 2b), 이는 호중구(neutrophils), 단핵구(monocytes) 및 호산구(eosinophils)가 더 급격히 증가했다는 것을 나타낸다(도 2a, c).
총 적혈구(red blood cells; RBC)는 대조군과 비교하여 TC1-결핍 마우스에서 평균 6.86% 증가하였다(p<0.001, 도 2d). 하지만, 평균 적혈구 용적(mean corpuscular volume; MCV) 및 평균 적혈구 헤모글로빈(mean corpuscular hemoglobin; MCH)은 상당히 감소하였고, 적혈구 용적율(hematocrit; HCT)은 변화가 없었다(도 2d). 평균 적혈구 헤모글로빈 농도(mean corpuscular hemoglobin concentration; MCHC) 역시 변화가 없었다. RBC의 크기 차이 정도를 나타내는 적혈구 분포 계수(red cell distribution width; RDW)는 대조군보다 TC1-결핍 마우스에서 더 높았다(도 2d). 상기 결과는 TC1-결핍 마우스의 RBCs 크기가 더 작고, 크기에 있어 변화가 더 많다는 것을 나타낸다.
실시예 2 : 기능적으로 활성화된
TC1
-결핍 마우스 내의 골수세포
1. 유세포 분석
단일 세포 현탁액을 얼음에 차갑게 만든 FACS buffer (5% FBS 포함된 PBS)에 녹여 제조하였고, 분석 당 1ug의 항체와 함께 106 세포 이상으로 하여 FACSCantoII (Becton Dickinson, San Jose, CA) 유세포 분석기로 분석하였다. FITC-접합 항-Cd11b, PE-접합 F4/80 (BD Pharmingen, San Jose, CA), FITC-접합 Sca-1, PE-접합 c-Kit, APC-Cy7-접합 Cd45 (BioLegend, San Diego, CA) 및 Alexa Fluor 647-접합 Pu.1 (Cell Signaling Technology, Danvers, MA)이 사용되었다. 세포 내 염색을 위해, 세포들을 Cytofix/Cytoperm kit (BD Biosciences, San Jose, CA)을 사용하여 4℃, 20분 동안 고정시켰다. Alexa Fluor 594-접합 항-rabbit IgG (Life Technologies, Calsbad, CA) 또는 PerCP-접합 항-rabbit IgG 2차 항체 (Santa Cruz Biotechnology, Santa Cruz, CA)는 항-TC1 (anti-TC1, Santa Cruz Biotechnology, Santa Cruz, CA)에 대해 사용되었고, PerCP-접합 항-goat IgG 2차 항체(Santa Cruz Biotechnology, Santa Cruz, CA)는 항-Lxn (Everest Biotech, Oxfordshire, UK)에 대해 사용되었다. FACSDiva software (BD) 및 FlowJo (Tree Star)는 데이터 수집 및 분석을 위해 각각 사용되었다.
2. 호중구에서의 활성 산소종 측정
마우스 전체 혈액 100ul는 최종 부피 600ul이 되도록 Hank's Balanced Salt Solution (HBSS, Sigma-Aldrich, St. Louis, MO)과 혼합하였고, 37℃, 5분 동안 수조에서 미리 따뜻하게 하였다. 다하이드로로다민123(Dihydrorhodamine123; DHR123, Sigma-Aldrich, St. Louis, MO) 및 지질다당체(lipopolysaccharide; LPS, Sigma-Aldrich, St. Louis, MO)는 100ng/ml 농도로 첨가되었다. 세포들은 60분 동안 수조에서 반응시켰고, 반응을 중단시키기 위해서 얼음으로 옮겨 10분 동안 두었다. 세포들은 425xg, 5분 동안 원심분리시켰고, 1ml RBC lysis buffer (Sigma-Aldrich, St. Louis, MO)를 첨가하였으며, 적혈구(erythrocyte) 용해를 위해 얼음에서 유지시켰다. 세포들은 HBSS로 두번 씻어냈고, 0.5% 포름알데히드(formaldehyde)가 포함된 300ul FACS 고정 용액으로 재현탁하였다. 상대적인 로다민(rhodamine) 형광 세기를 측정하기 위해서, 세포들을 유세포 분석기(FL-1 channel with 488-nm Laser)에 의해 분석하였다.
3. 정량 RT-PCR
Trizol reagent (Invitrogen, Carlsbad, CA)를 사용하여 총 RNA를 추출하였고, cDNA는 Premium reverse transcriptase (Thermo Scientific, Marietta, OH)를 사용하여 합성하였다. 연속적인 형광을 검출할 수 있는 thermal cycler ABI PRISM® 7000 Sequence Detection System (ABI, Foster city, CA) 및 SYBR® Green real-time PCR master mix (Toyobo, Osaka, Japan)를 사용하여 정량 PCR을 수행하였다. 내부 대조군으로 β-액틴을 사용하여 3번 반복하여 측정하였다. PCR 프라이머의 서열은 표 1과 같다.
표 1
| Genes | sequences (5' to 3') | Amplicon | ||
| Forward | Reverse | (bp) | ||
| Human | ACTB | GGCACCCAGCACAATGAAG(서열번호3) | GCCGATCCACACGGAGTACT(서열번호4) | 67 |
| TC1 | CAAGCCATCATCATGTCCAC(서열번호5) | GTTGCCCACGGCTTTCTTAC(서열번호6) | 86 | |
| PU.1 | GACACGGATCTATACCAACGCC(서열번호7) | CCGTGAAGTTGTTCTCGGCGAA(서열번호8) | 145 | |
| TREM-1 | AAGGAGCCTCACATGCTGTT(서열번호9) | CACAGTTCTGGGGCTGGTAT(서열번호10) | 160 | |
| Mouse | Actb | GATCATTGCTCCTCCTGAGC(서열번호11) | ACATCTGCTGGAAGGTGGAC(서열번호12) | 83 |
| Ccnd-1 | CCCAACAACTTCCTCTCCT(서열번호13) | TCCAGAAGGGCTTCAATCTG(서열번호14) | 110 | |
| Cebpα | TTACAACAGGCCAGGTTT(서열번호15) | CTCTGGGATGGATCGATT(서열번호16) | 232 | |
| Flt3l | CGCTGGATAGAGCAACTGAAGA(서열번호17) | TGTTGGTCTGGACGAATCGCAG(서열번호18) | 138 | |
| Gata-1 | ACTGTGGAGCAACGGCTA(서열번호19) | TTCCTCGTCTGGATTCCA(서열번호20) | 301 | |
| G-CSF | ATGCCGAAGGCTTCCCTG(서열번호21) | AGGAGACCTTGGTAGAGG(서열번호22) | 98 | |
| GM-CSF | AACCTCCTGGATGACATG(서열번호23) | AAATTGCCCCGTAGACCC(서열번호24) | 133 | |
| TC1 | ACCAGCATGTCCTCGTCTCT(서열번호25) | ATGTTGCCCACAGCTTTCTT(서열번호26) | 89 | |
| Klf4 | CTATGCAGGCTGTGGCAAAACC(서열번호27) | TTGCGGTAGTGCCTGGTCAGTT(서열번호28) | 150 | |
| Lxn | GCCTGCGGTTATGTAATGTGGC(서열번호29) | CTGCGATGCAATGTCGTGGAGT(서열번호30) | 144 | |
| M-CSF | GCCTCCTGTTCTACAAGT(서열번호31) | ACTGGCAGTTCCACCTGT(서열번호32) | 125 | |
| Myc | AGTGCTGCATGAGGAGACAC(서열번호33) | GGTTTGCCTCTTCTCCACAG(서열번호34) | 103 | |
| Pou5f1 | CAGCAGATCACTCACATCGCC(서열번호35) | GCCTCATACTCTTCTCGTTGGG(서열번호36) | 128 | |
| Pu.1 | TACCAACGTCCAATGCATGA(서열번호37) | GCTGGGGACAAGGTTTGATA(서열번호38) | 302 | |
| Sox2 | AACGGCAGCTACAGCATGATGC(서열번호39) | CGAGCTGGTCATGGAGTTGTAC(서열번호40) | 138 | |
| Trem-1 | TTTCCTCTCCTGGTCTTGGA(서열번호41) | TCATCCAAATGTCCTCTTTGTG(서열번호42) | 155 | |
4. TC1-형질감염된 HL-60 세포
인간 전골수성 백혈병(promyelocytic leukemia) 세포주 HL-60은 10% FBS, 100U/ml 페니실린 및 100ug/ml 스트렙토마이신(Gibco, Carlsbad, CA)이 첨가된 RPMI 배지에서 37℃, 5% CO2 조건에서 배양되었다. 패시지(passages) 4-8의 세포를 사용하여 실험을 수행하였다. 낮은 수준의 발현을 위하여, HL-60은 TC1를 포함하는 pCAGGS 포유류 발현 벡터(Addgene, Cambridge, MA)로 형질감염되었다. 1x107의 HL-60 세포는 지수성장기에 수확되었고, Gene Pulser Electroporation buffer (Bio-Rad, Hercules, CA)에 재현탁되었다. 세포들은 DNA와 함께 혼합되었고, Gene Pulser Xcell™ Electroporation Systems (Bio-Rad, Hercules, CA)의 4mm cuvette을 이용하여 175V, 1000uF 조건으로 충격을 주었다.
5. 통계 처리
모든 측정 결과는 평균 +/- s.d로 나타냈다. 통계 분석은 SPSS version 20 (SPSS Inc., Chicago, IL)에 의한 two-tailed t -tests로 수행하였다.
6. 결과
본 발명의 결과는 TC1이 주로 골수세포에서의 조혈작용에 대한 조절자라고 밝혀졌다. 유세포 분석결과, 넓은 범위의 골수세포 마커인, Cd11b의 발현이 야생형 대조군과 비교하여 TC1
-/- 마우스의 혈액 단핵 세포(blood mononuclear cells)에서 증가되었는데(도 3a), 이는 골수 조절에 대한 TC1의 역할을 뒷받침한다. Cd11b-양성 세포는 TC1
-/- 마우스에서 수가 증가하였으나, 형광 세기는 야생형 대조군과 유사하게 나타났다. 또한, Cd11b 및 대식세포/단핵구 마커인 F4/80을 동시에 발현하는 세포도 유사하게 증가하였다(도 3b).
본 발명자들은 TC1-결핍 마우스에서 WBCs가 기능적으로 활성화되는지 확인하였다. Trem-1은 활성화된 호중구(neutrophils) 및 단핵구에서 선택적으로 발현되고 염증 반응에서 증폭되는 Ig 수퍼패밀리 그룹 수용체이다. qPCR 분석에 따른 Trem-1의 발현은 대조군과 비교하여 TC1
-/- 마우스의 혈액 단핵 세포에서 상향-조절되는데(도 3c), 이는 정상 조건 하의 야생형 상대만큼이나 기능적으로 활성화되어 있다는 것을 나타낸다. 조혈 세포 내 TREM-1 발현에 대한 TC1의 역할을 확인하기 위해서, 인간 전골수성 백혈병(promyelocytic leukemia) 세포주 HL-60을 TC1 발현 벡터를 사용하여 일시적으로 형질감염시켰다. HL-60 세포는 배양 조건하에서는 최소한으로 TC1을 발현했다. 전기천공법(electroporation) 24시간 후에, 형질감염된 TC1은 HL-60 세포 내에서 잘 발현되었다(도 3e). TREM-1은 TC1-형질감염된 HL-60 세포에서 벡터-형질감염된 대조군에 비해 하향-조절되었는데(도 3c), 이는 TC1이 골수 세포 활성을 조절하는데 잠재적인 역할을 한다는 것을 나타낸다.
호중구(neutrophils)는 활성화에 따라 활성 산소종(reactive oxygen species; ROS)을 기하급수적으로 발현한다. 본 발명자들은 산화-특이적 형광 염료인 DHR123을 사용하여 TC1
-/- 및 야생형 마우스의 호중구에서 ROS 생성을 측정하였다. 60분 동안 박테리아 지질다당체(lipopolysaccharide; LPS)를 이용하여 활성화시킨 결과, TC1
-/- 마우스 내의 호중구는 ROS를 대조군 마우스만큼 생성하였는데(도 3d), 이는 TC1-결핍 마우스의 골수 세포가 기능적으로 활성화되어 있다는 것을 뒷받침한다.
실시예 3 :
TC1
-결핍 마우스에서 콜로니 형성 단위(CFU)의 증가
1. 골수세포 분리
골수 샘플은 6- 내지 8-주령 TC1-결핍 마우스와 성별- 및 나이-조합된 대조군 마우스로부터 준비되었다. 골수 세포는 26 게이지 바늘을 이용하여 대퇴골(femurs) 및 경골(tibias)로부터 얻었고, 100-um nylon mesh (BD Biosciences, San Jose, CA)의 세포 여과기(strainer)을 통하여 여과하였다. 단핵세포는 Ficoll-Plaque Plus density solution (GE Healthcare, Piscataway Township, NJ)으로 분리하였다. 계통-음성 분획(lineage-negative fractions)을 얻기 위해서, Ter119, Gr-1, CD11b, CD41, CD3e 및 B220을 포함하는 Lineage Cell Depletion Kit (Miltenyi Biotec, Gladbach, Germany)을 이용하여 분리된 단핵세포로부터 성숙 조혈 세포를 제거하였다. HSC 마커들로는, FITC-접합 Sca-1 (D7) 및 PE-접합 c-Kit (2B8)에 대한 항체들이 사용되었다(BD Pharmingen, San Jose, CA). FACSCalibur (Becton Dickinson, San Jose, CA) 유세포 분석기를 이용하여, Lin-Sca-1+ 세포는 Sca-1 염색된 Lin- 분획으로부터 분리되었다.
2. 콜로니-형성 단위 분석
콜로니 형성 분석을 위해, 2% FBS가 첨가된 Iscove's Modified Dulbecco's Medium(Life Technologies, Carlsbad, CA)을 사용하여 씻어낸 대퇴골(femurs) 및 경골(tibias)에서 골수 세포를 얻었다. 8-주령 TC1-결핍 마우스와 성별- 및 나이-조합된 대조군 마우스 유래 골수 세포로 각 실험을 수행하였다. 3번의 독립적인 실험을 2번 반복하여 수행하였고, 듀얼-챔버 슬라이드에서 배양하였다. 각 실험에 있어서 제조사의 지시에 따라(StemCell Technologies, Vancouver, BC, Canada), CFU-GM, CFU-GEMM 및 BFU-E 분석을 위해 재조합 마우스 SCF, rmIL-3, 재조합 인간 IL-6 및 rhEpo가 포함된 조건에서 MethoCult GF M3434의 35-mm dish cell에 4x104 세포를 배양하였고, CFU-E 분석을 위해 rhEpo가 포함된 조건에서 MethoCult M3334에 2x105 세포를 배양하였다. 37℃, 5% CO2 및 95% 습도 조건에서 CFU-E 분석을 위해서는 배양 2일 후에, CFU-GM, CFU-GEMM 및 BFU-E 분석을 위해서는 7-12일 후에 현미경을 이용하여 콜로니들을 계수하였다.
3. 결과
TC1은 인간 및 마우스에서 체계적으로 발현되지만, 혈액 백혈구(leukocytes)에서의 발현은 노던(Northern) 및/또는 닷 블랏(dot blot)으로 쉽게 검출할 수는 없다. 이에 비해, 인간 골수 및 제브라피시 배아에서 개발된 조혈세포에서는 발현을 확인할 수 있다. 본 발명자들은 TC1-결핍 마우스에서의 골수세포 과형성이 골수에서의 조혈 활성 향상을 나타내는 것인지 메틸 셀룰로오스(methyl cellulose) 플레이트에서의 콜로니 형성 단위(colony forming unit; CFU) 분석을 통해 알아보았다.
CFU-과립구-대식세포(granulocyte-macrophage; GM) 및 CFU-과립구-적혈구-단핵구-거핵구(granulocyte-erythroid-monocyte-megakaryocyte; GEMM)는 TC1
-/- 마우스에서 야생형 대조군에 비해 각각 3배 및 2배 더 증가하였다(도 4a,b 및 도 5). 또한, CFU-E도 TC1
-/- 마우스에서 상당히 증가하였으나(도 4c), CFU-GM 또는 CFU-GEMM 만큼은 아니었다. CFU-E 보다 상부 계층에서 적혈구 조혈 활성을 나타내는 버스트-형성 단위(Burst-forming unit;BFU)-E는 대조군에 비해 증가하지 않았다(도 4d). 따라서, 본 발명의 결과는 TC1이 마우스에서 조혈 작용의 조절자로서 역할을 수행한다는 것을 뒷받침한다.
실시예 4 : 원시 조혈세포에서의 TC1 특이적 발현
1. 골수 조직
가공 및 파라핀 포매(paraffin embedding) 전에, 척추뼈(Vertebral bones)는 10% 완충된 포르말린(formalin)에 고정하였고, 석회질을 제거하였다. 조직 절편을 만들었고, H&E로 염색하였다.
2. 공초점 면역형광 현미경
공초점 현미경 분석을 위해, PBS에 현탁된 1.2x105의 세포들을 유리 슬라이드에 도말하고, 1,000rpm으로 1분 동안 세포원심분리하였다. 사이토스핀(Cytospin)된 슬라이드를 상온에서 공기-건조하였고, 100% 메탄올에 -20℃, 10분 동안 고정하였다. 세포들은 항-TC1 항체 (1:50 희석)를 사용하여 3시간 동안 면역염색되었다. PBS로 세척 후에, Alexa Fluor 594-접합 항-rabbit IgG 2차 항체를 1:200으로 희석하여 1시간 동안 반응시켰다. Hoechst 33342 (Sigma-Aldrich, St. Louis, MO)을 사용하여 핵 염색을 수행하였다. inverted zeiss LSM 710 confocal microscopy (Carl Zeiss, Thornwood, NY)을 사용하여 세포들을 관찰하였다.
3. 결과
TC1-결핍 마우스의 골수는 야생형 대조군과 유사한 정상 세포질, 조성 및 골 형성을 나타냈다(도 6a). 본 발명자들은 야생형 C57BL/6 마우스의 골수에서 TC1의 정상적인 발현을 관찰하였다. TC1 mRNA은 골수 단핵 세포에서 낮게 발현되었다. 면역 형광 현미경 분석 결과, TC1은 주로 원시 골수 세포에서 여러 염색 세기로 발현되었다(도 6b). 형태에 있어서는 조혈모세포와 일치하는, 지름 6-8um의 원형 핵과 적은 세포질을 가진 골수세포에서는 세포질 과립 염색은 거의 보이지 않았다(도 6b 상단). 크기가 큰 미분화세포는 약한 핵 염색 뿐만 아니라 강한 세포질 염색도 나타냈다(도 6b 하단). 암세포에서 다양한 세포 자극에 따른 TC1의 핵 전좌(translocation)는 이미 보고되어 있다. 또한, 링-형태의 핵을 가진 세포는 야생형 마우스의 골수에서도 면역염색되었다. 링-형태의 핵을 가진 골수 세포는 마우스에서 보고되었으나 인간에서는 보고되지 않았다. 분절핵(segmented nuclei)을 가진 분화된 골수 세포는 대부분 면역염색되지 않았다.
실시예 5 : Sca-1, c-Kit 및 Lxn을 동시에 발현하는 TC1-양성 골수 세포
TC1의 발현은 C57BL/6 마우스 골수의 계통-음성 세포에서 유세포 분석기를 이용하여 더 연구되었다. TC1-발현 세포는 빈도가 낮은 것으로 나타났는데(도 5c), 이는 전체 계통 음성 세포의 1% 미만으로 보여진다(도 5d). TC1+ 세포의 대부분은 c-Kit 및/또는 Sca-1을 동시-발현하는데(도 5c), 이는 대부분이 HSPC 군에 속한다는 것을 뒷받침한다. 흥미롭게도, Lin-TC1+ 군은 2개의 다른 서브그룹인 Sca-1hi 및 Sca-1int으로 구성되는데, 이는 Sca-1 발현 수준에 따라 달라진다(도 5c). 스캐터 플롯팅(scatter plotting)에 의하면, TC1+Sca-1hi 세포는 TC1+Sca-1int 세포에 비해 포워드(forward)- 및 사이드(side)-스캐터가 덜 나타나는 경향이 있는데, 이는 TC1+Sca-1hi 세포의 평균 크기가 더 작다는 것을 보여준다. TC1+Sca-1hi 세포는 Cd45를 발현하는데, 이는 내피전구세포(endothelial progenitor cells) 또는 초소형 배아 유사(very small embryonic-like; VSEL) 세포와 같은 비조혈 원시 골수 세포에 비해 HSPC에 더 많이 속한다는 것을 뒷받침한다.
그 후, 본 발명자들은 HSPC의 음성 조절자인 라테신(latexin; Lxn)과 TC1의 발현을 함께 조사하였다. Lxn은 Lin- 세포의 소수 부분에서 발현되었는데, 이는 많은 소집단이 TC1을 동시-발현한다는 것이다(도 5e). Lxn+TC1- 세포가 아닌 Lxn+TC1+ 세포는 Sca-1를 높은 빈도로 발현하였는데, 이는 TC1이 Lin-Lxn+ 세포 중 Sca-1+ 조혈 세포에 있어 특이적으로 발현된다는 것을 나타낸다. 또한, TC1/Sca-1 플롯에 의하면(도 5c), Lxn+TC1+ 세포는 Sca-1hi 및 Sca-1int 소집단으로 이루어졌는데(도 5e), 이는 TC1, Lxn 및 Sca-1을 모두 발현하는 HSPC이라는 것을 나타낸다. 역으로, TC1+Sca-1hi 및 TC1+Sca-1int 세포는 Lxn을 높은 빈도로 발현시켰다.
실시예 6 :
TC1
-결핍 마우스에서 HSPC 군의 확대 및 HSPC에서 Lxn을 조절하는 TC1
본 발명자들은 Lin-c-Kit+Sca-1+ (LSK) 세포군을 조사하였는데, 이는 TC1
-/- 및 야생형 마우스에서 전형적으로 HSPC인 것으로 나타났다. TC1
-/- 마우스의 계통-음성 골수 세포에 있어서, c-Kit+Sca-1+ 이중 양성군은 야생형 대조군에 비해 명백하게 확대되었는데(도 7a), 이는 생체 내(in vivo) HSPC 상에서 TC1이 조절자 역할을 한다는 것을 뒷받침한다. 계산된 마우스 전체 LSK 세포의 수는 대조군 보다 TC1
-/- 마우스에서 상당히 높았다(도 7b). 본 발명자들은 CD150 및 CD48 항체를 이용하여 LSK 세포의 부분 모집단(subpopulation)을 분석하였다. gated LSK 세포에서, CD150-CD48+ 세포는 비례하여 확대된 반면, CD150+CD48-/CD150+CD48+/CD150-CD48- 세포는 그렇지 않았는데, 이는 Tc1
-/- 마우스에서 확대된 상기 세포군이 HSC 또는 다분화능 전구세포(multipotent progenitor; MPP) 수준이라기보다는 대다수가 계통제한 조혈전구세포(lineage restricted hematopoietic progenitor cells) 수준이라는 것을 나타낸다(도 7c). TC1-결핍 마우스 및 야생형 대조군에 있어서, Lin-c-Kit+Sca-1+ 세포군에서의 Lxn의 발현이 분석되었다. TC1
-/- 마우스의 Lin-c-Kit+ 및 Lin-Sca-1+ 세포에서는 Lxn-발현군이 크게 감소하였다. qPCR 분석 결과, Lxn 발현은 대조군에 비하여 TC1
-/- 마우스의 계통-음성 골수 세포에서 상당히 낮았는데(도 7d), 대조군 마우스 내, Lin-c-Kit+ 및 Lin-Sca-1+ 세포의 많은 분획들에서 Lxn이 발현되었다(도 7e). 이는 Lxn 발현에 대한 TC1-의존적 조절 작용을 뒷받침하는 것이다. 따라서, 상기 결과는 HSPC 조절에 있어서, Lxn이 TC1의 하위 조절자라는 것을 뒷받침한다.
실시예 7 :
TC1
-결핍 마우스에서의 조혈 전사 조절자들
본 발명자들은 TC1-결핍 마우스의 골수에서 계통 분화에 관여하는 주요 전사 조절자들의 발현에 대해 조사하였다. 유세포 분석을 통해 측정한, LSK 세포에서 골수세포형성(myelopoiesis)과 관련된 전사 조절자인 Pu.1의 발현은 TC1
-/- 및 야생형 마우스 사이에 큰 변화가 없었다. qPCR 결과, TC1
-/- 마우스로부터 분리된 Lin-Sca-1+ 세포 뿐만 아니라 전체 계통-음성 세포에서도 Pu.1 발현은 야생형 마우스 대조군에 비해 하향-조절되었다(도 8a). PU.1 발현은 TC1-형질감염된 HL-60 세포에서도 벡터-형질전환된 대조군에 비해 크게 변하지 않았다. 또한 qPCR 결과, 골수세포형성(myelopoiesis)에 또 다른 주요 조절자인 Cebpα도 TC1
-/- 마우스의 계통-음성 골수 세포에서 대조군에 비해 약간 하향-조절되었다(p<0.07)(도 8d). 따라서, 상기 결과는 TC1-결핍 마우스에서의 골수세포 과형성이 Pu.1 또는 Cebpα의 기능이 상향 조절되어 나타나는 것이 아니라는 것을 뒷받침한다. 적혈구 세포 운명에 관여하는 주요 조절자인 Gata-1의 발현은 TC1
-/- 마우스에서 상향-조절되는 것으로 나타났으나, 그 차이에 통계학적 유의성은 없었다(도 8e).
Wnt 신호전달은 HSPC 및 조혈작용의 조절에 보통 필요하다. TC1은 암세포에서 Wnt/β-카테닌(catenin) 신호전달을 조절한다. Wnt 신호전달의 전형적인 하위 유전자인 c-Myc 및 cyclin d1(Ccnd1)의 발현을 qPCR을 이용하여 조사하였다. c-Myc는 TC1
-/- 마우스의 계통-음성 골수 세포에서 대조군에 비해 상향-조절되었다(도 8b). 또한, Ccnd1은 일정하게 상향-조절되었으나, 그 차이에 통계학적 유의성은 없었다. 세포 증식에 있어 c-Myc 및 Ccnd1의 필요성을 고려해 볼 때, TC1-결핍 마우스에서의 HSPC 확대가 Wnt 신호전달의 잠재 조절자 역할을 할 것으로 나타났다. TC1은 형질전환된 상피세포에서 Wnt 신호전달을 상향-조절하였다. 이는 Wnt 신호전달에 대한 TC1-매개 조절이 세포 문맥(cell context)에 의존적이라는 것을 나타낸다.
또한, c-Myc는 만능줄기세포(pluripotent stem cells; PSC)의 조절에 관여한다. qPCR 결과, PSC의 또 다른 조절자인 Klf4는 야생형 대조군에 비해 TC1
-/- 마우스의 Lin- 세포에서 상향-조절되었다(도 8c). 그러나, Sox2 및 Pou5f1(Oct4로 알려짐)의 발현은 반복적인 qPCR 분석에서도 분명하게 검출되지는 않았는데, 이는 TC1-의존 줄기 세포 조절이 골수 조혈 세포에 특이적이라는 것을 나타낸다.
실시예 8 : 골수에서의 사이토카인 발현
1. 사이토카인 분석
사이토카인 분석 염색은 이전에 보고한 대로 수행하였다(J. Immunol. 183, 3996-4002 (2009)). 추출된 골수 세포는 serum-free RPMI 1640 (Gibco, Carlsbad, CA) media로 상온에서 10분 동안 조심스럽게 씻어냈다. 그 후, 300xg에서 세포 원심분리에 의해 배지를 회수하였다. Bradford 분석에 의해 측정된 250ug의 총 단백질을 제조사의 지시에 따라 마우스 사이토카인 분석 (Raybiotech, Norcross, GA)에 사용하였다.
2. 결과
조혈 계통 결정(Hematopoietic lineage commitment)은 콜로니 자극 인자(colony stimulating factors; CSF)를 포함하는 사이토카인에 의해 크게 영향을 받는다. 골수에서 다양한 사이토카인의 발현을 사이토카인 분석을 이용하여 측정하였다. 대조군 마우스와 비교하여 TC1
-/- 마우스에서 발현된 사이토카인은 큰 차이가 없었다. 과립구-CSF(Granulocyte-CSF; G-CSF) 및 과립구/단핵구-CSF(granulocyte/monocyte-CSF; GM-CSF)는 사이토카인 분석에 의해 검출 가능한 수준으로 발현되지 않았다. 총 골수 세포의 qPCR 분석에 따르면, G-CSF, GM-CSF 또는 단핵구-CSF(monocyte-CSF; M-CSF)의 발현은 야생형 대조군과 비교하여 TC1
-/- 마우스에서 차이를 보이지 않았다(도 9).
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
Claims (12)
- TC1(C8orf4) 단백질 발현 또는 활성 억제제를 유효성분으로 포함하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 TC1(C8orf4) 단백질 발현 억제제는 TC1(C8orf4) 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오타이드, 작은 간섭 RNA(small interfering RNA; siRNA) 및 짧은 헤어핀 RNA(short hairpin RNA; shRNA)로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 TC1(C8orf4) 단백질 활성 억제제는 TC1(C8orf4) 단백질에 특이적으로 결합하는 화합물, 펩티드, 펩티드 미메틱스, 앱타머, 항체 및 천연물로 구성된 군으로부터 선택된 어느 하나인 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 조혈작용 촉진은 조혈전구세포(hematopoietic progenitor cells)의 증식 또는 분화를 촉진하는 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 약학 조성물은 라테신(latexin; Lxn)의 발현을 하향 조절하는 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제5항에 있어서, 상기 라테신(latexin; Lxn)은 조혈전구세포의 음성조절자인 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 TC1(C8orf4) 단백질은 서열번호 1로 표시된 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- 제1항에 있어서, 상기 약학 조성물은 재생 불량성 빈혈, 악성 림프종 또는 백혈병, 만성 간 장애, 신부전, 중증 감염증, 골수 장애성 혈소판 감소증, 특발성 혈소판 감소성 자반병(ITP), 혈소판 무력증, 림프구감소증, 호중구감소증, 단핵구감소증, 과립구감소증 및 골수 증식성 질환으로 이루어진 군에서 선택되는 질환을 치료하기 위한 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진용 약학 조성물.
- TC1(C8orf4) 유전자 또는 TC1(C8orf4) 단백질을 포함하는 세포에 시험물질을 접촉시키는 단계;상기 시험물질을 접촉한 세포에서 TC1(C8orf4) 단백질의 발현 또는 활성 정도를 측정하는 단계; 및대조구 시료와 비교하여 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도가 감소한 시험물질을 선별하는 단계를 포함하는 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법.
- 제9항에 있어서, 상기 TC1(C8orf4) 단백질의 발현 또는 활성 정도는 역전사 중합효소 연쇄반응(Reverse Transcription-Polymerase chain Reaction, RT-PCR), 효소면역분석법(ELISA), 면역조직화학, 웨스턴 블랏(Western Blotting) 및 유세포 분석법(FACS)으로 구성된 군으로부터 선택된 어느 하나로 측정하는 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법.
- 제9항에 있어서, 상기 조혈작용(Hematopoiesis) 촉진제는 재생 불량성 빈혈, 악성 림프종 또는 백혈병, 만성 간 장애, 신부전, 중증 감염증, 골수 장애성 혈소판 감소증, 특발성 혈소판 감소성 자반병(ITP), 혈소판 무력증, 림프구감소증, 호중구감소증, 단핵구감소증, 과립구감소증 및 골수 증식성 질환으로 이루어진 군에서 선택되는 질환을 치료하기 위한 것을 특징으로 하는 조혈작용(Hematopoiesis) 촉진제 스크리닝 방법.
- 조혈작용(Hematopoiesis)이 촉진된 TC1(C8orf4) 유전자 결핍 마우스.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2013-0125959 | 2013-10-22 | ||
| KR20130125959 | 2013-10-22 | ||
| KR1020140027707A KR101590248B1 (ko) | 2013-10-22 | 2014-03-10 | 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 |
| KR10-2014-0027707 | 2014-03-10 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015060547A1 true WO2015060547A1 (ko) | 2015-04-30 |
Family
ID=52993106
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2014/008874 Ceased WO2015060547A1 (ko) | 2013-10-22 | 2014-09-24 | 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015060547A1 (ko) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100062737A (ko) * | 2008-12-02 | 2010-06-10 | 울산대학교 산학협력단 | Tc1 단백질 억제제를 유효성분으로 포함하는 동맥경화증예방 및 치료용 약학조성물 |
-
2014
- 2014-09-24 WO PCT/KR2014/008874 patent/WO2015060547A1/ko not_active Ceased
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100062737A (ko) * | 2008-12-02 | 2010-06-10 | 울산대학교 산학협력단 | Tc1 단백질 억제제를 유효성분으로 포함하는 동맥경화증예방 및 치료용 약학조성물 |
Non-Patent Citations (4)
| Title |
|---|
| JUNG, YUSUN ET AL.: "TC1(C8orf4) regulates hematopoietic stem/progenitor cells and hematopoiesis", PLOS ONE, vol. 9, no. 6, 17 June 2014 (2014-06-17) * |
| KIM, JUNGTAE ET AL.: "TC1(C8orf4) is a novel endothelial inflammatory regulator enhancing NF-kB activity", THE JOURNAL OF IMMUNOLOGY, vol. 183, 2009, pages 3996 - 4002 * |
| KIM, YOUNGMI ET AL.: "TC1(C8orf4) is upregulated by IL -1beta/TNF-alpha and enhances proliferation of human follicular dendritic cells", FEBS LETTERS, vol. 580, 2006, pages 3519 - 3524 * |
| WANG, YI-DONG ET AL.: "TC1(C8orf4) is involved in ERK1/2 pathway-regulated G1- to S-phase transition", BMB REPORTS, vol. 41, no. 10, 2008, pages 733 - 738 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| He et al. | Inflammatory signaling regulates hematopoietic stem and progenitor cell emergence in vertebrates | |
| Ye et al. | Tumor-associated microglia/macrophages enhance the invasion of glioma stem-like cells via TGF-β1 signaling pathway | |
| MacNamara et al. | Infection-induced myelopoiesis during intracellular bacterial infection is critically dependent upon IFN-γ signaling | |
| Swann et al. | IL-33 promotes anemia during chronic inflammation by inhibiting differentiation of erythroid progenitors | |
| Murakami et al. | OGT regulates hematopoietic stem cell maintenance via PINK1-dependent mitophagy | |
| Miyamoto et al. | FoxO3a regulates hematopoietic homeostasis through a negative feedback pathway in conditions of stress or aging | |
| EP3374497B1 (en) | Modified macrophages for use in the treatment of cancer | |
| Mittal et al. | Mesenchymal stem cells augment regulatory T cell function via CD80-mediated interactions and promote allograft survival | |
| Bae et al. | Phc2 controls hematopoietic stem and progenitor cell mobilization from bone marrow by repressing Vcam1 expression | |
| Shi et al. | Sonic hedgehog signaling regulates hematopoietic stem/progenitor cell activation during the granulopoietic response to systemic bacterial infection | |
| Suresh et al. | MIF confers survival advantage to pancreatic CAFs by suppressing interferon pathway‐induced p53‐dependent apoptosis | |
| Chen et al. | IRF7 suppresses hematopoietic regeneration under stress via CXCR4 | |
| TW202421780A (zh) | T細胞的製造方法 | |
| JP6532653B2 (ja) | 造血幹細胞の増殖方法 | |
| US9199028B2 (en) | Use of entrained neutrophils to treat metastatic and micrometastatic disease in at risk patients | |
| Ueno et al. | Transcription factor Tlx1 marks a subset of lymphoid tissue organizer-like mesenchymal progenitor cells in the neonatal spleen | |
| KR101590248B1 (ko) | 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 | |
| WO2015060547A1 (ko) | 조혈전구세포 및 조혈작용을 조절하는 유전자 TC1(C8orf4)의 용도 | |
| US20240301353A1 (en) | Method for improving proliferative properties of common myeloid progenitor cells (cmp) or myelocytic progenitor cells | |
| Roy et al. | Inhibition of SRC-mediated integrin signaling in bone marrow niche enhances hematopoietic stem cell function | |
| US10544460B2 (en) | Homeobox transcription factor ventx regulates differentiation and maturation of human dendritic cells | |
| EP2893005B1 (en) | Method for generating immunomodulatory cells, the cells prepared therefrom, and use thereof | |
| JP5210303B2 (ja) | 幹細胞を操作する方法 | |
| US20190328791A1 (en) | Enhanced hetatopoietic stem cell transplantation | |
| Resop et al. | HIV-1 infection results in upregulation of Sphingosine-1-phosphate receptor 1 in the human thymus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14855208 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14855208 Country of ref document: EP Kind code of ref document: A1 |