WO2015058093A1 - Methods and systems for genotyping genetic samples - Google Patents
Methods and systems for genotyping genetic samples Download PDFInfo
- Publication number
- WO2015058093A1 WO2015058093A1 PCT/US2014/061156 US2014061156W WO2015058093A1 WO 2015058093 A1 WO2015058093 A1 WO 2015058093A1 US 2014061156 W US2014061156 W US 2014061156W WO 2015058093 A1 WO2015058093 A1 WO 2015058093A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- construct
- reads
- reference sequence
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/20—Sequence assembly
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
- C12Q2535/122—Massive parallel sequencing
Definitions
- the invention relates to methods and systems for genotyping genetic samples.
- sequence alignment methods use massive computing power to align overlapping reads to a reference to produce an assembled sequence that can be probed for important genetic or structural information (e.g., biomarkers for disease).
- sequence alignment is to combine the set of nucleic acid reads produced by the sequencer to achieve a longer read (i.e., a contig) or even the entire genome of the subject based upon a genetic sample from that subject. Because the sequence data from next generation sequencers often comprises millions of shorter sequences that together represent the totality of the target sequence, aligning the reads is complex and computationally expensive.
- each portion of the probed sequence is sequenced multiple times (e.g., 2 to 100 times, or more) to minimize the influence of any random sequencing errors on the final alignments and output sequences generated.
- the reads are aligned against a single reference sequence, e.g., GRCh37, in order to determine all (or some part of) the subject's sequence.
- GRCh37 a single reference sequence
- sequence alignment is constructed by aggregating pairwise alignments between two linear strings of sequence information.
- two strings S I (SEQ ID NO. 20: AGCTACGTACACTACC) and S2 (SEQ ID NO. 21:
- AGCTATCGTACTAGC can be aligned against each other.
- S 1 typically corresponds to a read and S2 correspond to a portion of the reference sequence.
- S 1 and S2 can include substitutions, deletions, and insertions.
- the terms are defined with regard to transforming string S 1 into string S2: a substitution occurs when a letter or sequence in S2 is replaced by a different letter or sequence of the same length in S I, a deletion occurs when a letter or sequence in S2 is "skipped" in the corresponding section of S I, and an insertion occurs when a letter or sequence occurs in S I between two positions that are adjacent in S2.
- the two sequences S 1 and S2 can be aligned as below. The alignment below represents thirteen matches, a deletion of length one, an insertion of length two, and one substitution:
- SW Smith- Waterman
- the Smith- Waterman (SW) algorithm aligns linear sequences by rewarding overlap between bases in the sequences, and penalizing gaps between the sequences.
- Smith- Waterman also differs from Needleman-Wunsch, in that SW does not require the shorter sequence to span the string of letters describing the longer sequence. That is, SW does not assume that one sequence is a read of the entirety of the other sequence.
- SW is not obligated to find an alignment that stretches across the entire length of the strings, a local alignment can begin and end anywhere within the two sequences.
- Hij max ⁇ i ⁇ j ⁇ + s(a il b j ), H i _ 1 - ⁇ ⁇ , ⁇ _ - W del l 0 ⁇ for 1 ⁇ i ⁇ n and 1 ⁇ j ⁇ m)
- the resulting matrix has many elements that are zero. This representation makes it easier to backtrace from high-to-low, right-to-left in the matrix, thus identifying the alignment.
- the SW algorithm performs a backtrack to determine the alignment.
- the algorithm will backtrack based on which of the three values Hj-ij-i, Hi-ij, or Hjj-i) was used to compute the final maximum value for each cell.
- the backtracking stops when a zero is reached. See, e.g., FIG. 3(B), which does not represent the prior art, but illustrates the concept of a backtrack, and the corresponding local alignment when the backtrack is read.
- the "best alignment,” as determined by the algorithm may contain more than the minimum possible number of insertions and deletions, but will contain far less than the maximum possible number of substitutions.
- the techniques When applied as SW or SW-Gotoh, the techniques use a dynamic programming algorithm to perform local sequence alignment of the two strings, S and A, of sizes m and n, respectively.
- This dynamic programming technique employs tables or matrices to preserve match scores and avoid recomputation for successive cells.
- the optimum alignment can be represented as B ⁇ j,k] in equation (2) below:
- B [ k maxO[/; k , k , ; k , 0) (for 0 ⁇ j ⁇ m , 0 ⁇ k ⁇ n) (2)
- the arguments of the maximum function, B ⁇ j,k] are outlined in equations (3)-(5) below, wherein MISMATCH_PENALTY, MATCH_BONUS, INS ERTION_PEN ALTY ,
- DELETION_PEN ALTY and OPENING_PENALTY are all constants, and all negative except for MATCH_BONUS.
- the match argument, p ⁇ j,k] is given by equation (3), below:
- the scoring parameters are somewhat arbitrary, and can be adjusted to achieve the behavior of the computations.
- One example of the scoring parameter settings (Huang, Chapter 3: Bio-Sequence Comparison and Alignment, ser. Curr Top Comp Mol Biol. Cambridge, Mass.: The MIT Press, 2002) for DNA would be:
- MISMATCH_PENALTY -20
- OPENING_PENALTY and DELETION_PENALTY are possible.
- the aligned sequences can be assembled to produce a sequence that can be compared to a reference (i.e., a genetic standard) to identify variants. Only after the assembled reads are compared to the reference, is it possible to make determinations of the genotype of the sample. After comparing the assembled sequence to the reference sequence, the differences are catalogued and then compared to reference mutation files such as variant call format (VCF) files or a single nucleotide polymorphism database (dbSNP).
- VCF variant call format
- dbSNP single nucleotide polymorphism database
- the entire genotyping process is further complicated by the presence of structural variations in the genetic sample, i.e., longer (250 bp or more, e.g, 1000 bp or more) sequences that are inserted into or deleted from the "regular" genome. There may also be duplications, inversions, or translocations. In many instances, a sample is "called" for one genotype rather because of the presence of such structural variations, mutations, inversions, translocations, etc. In other instances, mutations within the structural variation result in a sample being "called” for yet a different genotype. In other instances, the sequences of interest have moved (relative to the "normal” position) because of their proximity to a structural variation.
- the invention provides methods and systems for efficiently genotyping sequence reads by aligning the reads directly to a reference sequence construct that simultaneously accounts for multiple alleles at multiple loci in the genome of the organism. Furthermore, the methods and systems of the invention make it possible to deal with structural variations in an efficient way, greatly reducing the computing power necessary to genotype genetic samples using next generation sequencing (N.G.S.). Additionally, because the reference sequence construct accounts for the various possible alleles within the construct, it is possible to directly genotype the sample by merely aligning the reads of the sample to the construct. Particular patterns of alignment are only possible for particular genotypes, thus it is not necessary to compare the assembled sequence to a reference sequence and then compare the variations to mutation files associated with that reference.
- the methods and systems of the invention transform linear, local sequence alignment processes such as, for example, Smith-Waterman-Gotoh, into multi-dimensional alignment algorithms that provide increased parallelization, increased speed, increased accuracy, and the ability to align reads through an entire genome.
- Algorithms of the invention provide for a "look- back" type analysis of sequence information (as in Smith- Waterman), however, in contrast to known linear methods, the look back of the invention is conducted through a multi-dimensional space that includes multiple pathways and multiple nodes in order to provide more accurate alignment of complex and lengthy sequence reads, while achieving lower overall rates of mismatches, deletions, and insertions. In many instances several of the pathways represent a particular genotype for the organism. Thus, by aligning reads to a set of alleles representing a particular pathway, the genotype is immediately identified.
- the invention is implemented by aligning sequence reads to a series of directed, acyclic sequences spanning branch points that account for all, or nearly-all, of the possible sequence variation in the alignment, including insertions, deletions, substitutions, and structural variations.
- Such constructs often represented as directed acyclic graphs (DAGs)
- DAGs directed acyclic graphs
- VCF variant call format
- the invention additionally includes methods for constructing a directed acyclic graph data structure (DAG) that represents known variants at positions within the sequence of an organism.
- DAG directed acyclic graph data structure
- the DAG may include multiple sequences at thousands of positions, and may include multiple variants at each position, including deletions, insertions, translations, inversions, single- nucleotide polymorphisms (SNPs), and structural variations.
- SNPs single- nucleotide polymorphisms
- the variants are correlated to provide greater confidence in genotype calls.
- the variants will be scored, weighted, or correlated with other variants to reflect the prevalence of that variant as a marker for disease.
- a system comprises a distributed network of processors and storage capable of comparing a plurality of sequences (i.e., nucleic acid sequences, amino acid sequences) to a reference sequence construct (e.g., a DAG) representing observed variation in a genome or a region of a genome.
- the system is additionally capable of aligning the nucleic acid reads to produce a continuous sequence using an efficient alignment algorithm. Because the reference sequence construct compresses a great deal of redundant information, and because the alignment algorithm is so efficient, the reads can be tagged and assembled on an entire genome using commercially-available resources.
- the system comprises a plurality of processors that simultaneously execute a plurality of comparisons between a plurality of reads and the reference sequence construct.
- the comparison data may be accumulated and provided to a health care provider. Because the comparisons are computationally tractable, analyzing sequence reads will no longer represent a bottleneck between NGS sequencing and a meaningful discussion of a patient's genetic risks.
- FIG. 1 depicts the construction of a directed acyclic graph (DAG) representing genetic variation in a reference sequence.
- DAG directed acyclic graph
- FIG. 1(A) shows the starting reference sequence and the addition of a deletion.
- FIG. 1(B) shows the addition of an insertion and a SNP, thus arriving at the Final DAG used for alignment;
- FIG. 2 depicts three variant call format (VCF) entries represented as directed acyclic graphs
- FIG. 3(A) shows a pictorial representation of aligning a nucleic acid sequence read against a construct that accounts for an insertion event as well as the reference sequence;
- FIG. 3(B) shows the matrices and the backtrack used to identify the proper location of the nucleic acid sequence read "ATCGAA";
- FIG. 4 depicts two alternative alleles at a position in a genome of an organism and a reference sequence construct incorporating both alleles.
- the second allele is different from the first in that it includes a long insertion, i.e., a structural variant.
- One pathway through the reference sequence construct represents the first allele and a second pathway through the construct represents the second allele;
- FIG. 5 shows how four separate reads can be aligned to the reference sequence construct. Upon alignment, some reads can be identified as corresponding to only allele #1 or allele #2, thus removing the need to compare differences between the assembled reads and a reference sequence to mutation files to determine the presence of a particular allele;
- FIG. 6 depicts three alternative alleles at a position in a genome of an organism and a reference sequence construct incorporating all three alleles.
- the second and third alleles are different from the first in that they include long insertions, i.e., structural variants.
- the second and third alleles differ in a single nucleotide polymorphism.
- One pathway through the reference sequence construct represents the first allele
- a second pathway through the construct represents the second allele
- a third pathway through the construct represents the third allele;
- FIG. 7 shows how three separate reads can be aligned to the reference sequence construct. Upon alignment, some reads can be identified as corresponding to only allele #1, allele #2, or allele #3, thus removing the need to compare differences between the assembled reads and a reference sequence to mutation files to determine the presence of a particular allele;
- FIG. 8 depicts an associative computing model for parallel processing
- FIG. 9 depicts an architecture for parallel computation.
- the invention includes methods for aligning nucleic acid sequences to a reference sequence construct, methods for building the reference sequence construct, and systems that use the alignment methods and constructs to produce alignments and assemblies.
- the reference sequence construct may be a directed acyclic graph (DAG), as described below, however the reference sequence can be any representation reflecting genetic variability in the sequences of different organisms within a species, provided the construct is formatted for alignment.
- the reference sequence construct will comprise portions that are identical and portions that vary between different genotypes. Accordingly, the constructs account for varying alleles, i.e., correlating with different genotypes.
- the application additionally discloses methods for identifying a genotype or a risk of a disease based upon alignment of nucleic acid reads to various locations in the construct.
- the invention additionally provides methods to make specific base calls at specific loci using a reference sequence construct, e.g., a DAG, that represents known variants at each locus of the genome. Because the sequence reads are aligned to the DAG during alignment, the subsequent step of comparing a mutation, vis-a-vis the reference genome, to a table of known mutations can be eliminated. Using the disclosed methods, it is merely a matter of identifying a nucleic acid read as being located at a known mutation represented on the DAG and calling that mutation. Alternatively, when a mutation is not known (i.e., not represented in the reference sequence construct), an alignment may be found and the variant identified as a new mutation or genotype. The method also makes it possible to associate additional information, such as specific disease risk or disease progression, with known mutations that are incorporated into the reference sequence construct. Additionally, the reference sequence constructs make it possible to align sequence reads against potential structural variations without requiring massive computing resources.
- a reference sequence construct e.g., a DAG
- the reads are typically at least about 20 base pairs (bp) in length, e.g., at least about 50 bp in length, e.g., at least about 80 bp in length, e.g., at least about 100 bp in length, e.g., at least about 150 bp in length, e.g., at least about 200 bp in length.
- the plurality will include greater than about 1000 sequence reads, e.g., greater than about 10,000 sequence reads, e.g., greater than about 100,000 sequence reads, e.g., greater than about 1,000,000 sequence reads.
- the plurality of sequence reads are aligned to the reference sequence construct using parallel processing.
- two or more sequence reads may be related in that they are known to originate from the same area of the original sample.
- the sequence reads may be paired mates having an insert of variable length between the reads.
- Techniques for preparing paired mates are known for use with a variety of next generation sequencing techniques, such as IlluminaTM sequencing.
- the invention uses a construct that can account for the variability in genetic sequences within a species, population, or even among different cells in a single organism.
- Representations of the genetic variation can be presented as directed acyclic graphs (DAGs) (discussed above) or row-column alignment matrices, and these constructs can be used with the alignment methods of the invention provided that the parameters of the alignment algorithms are set properly (discussed below).
- DAGs directed acyclic graphs
- row-column alignment matrices row-column alignment matrices
- the construct is a directed acyclic graph (DAG), i.e., having a direction and having no cyclic paths. (That is, a sequence path cannot travel through a position on the reference construct more than once.)
- DAG directed acyclic graph
- genetic variation in a sequence is represented as alternate nodes.
- the nodes can be a section of conserved sequence, or a gene, or simply a nucleic acid.
- the different possible paths through the construct represent known genetic variation.
- a DAG may be constructed for an entire genome of an organism, or the DAG may be constructed only for a portion of the genome, e.g., a chromosome, or smaller segment of genetic information.
- the DAG represents greater than 1000 nucleic acids, e.g., greater than 10,000 nucleic acids, e.g., greater than 100,000 nucleic acids, e.g., greater than 1,000,000 nucleic acids.
- a DAG may represent a species (e.g., homo sapiens) or a selected population (e.g., women having breast cancer), or even smaller subpopulations, such as genetic variation among different tumor cells in the same individual.
- FIG. 1(A) A simple example of DAG construction is shown in FIG. 1. As shown in FIG. 1(A), the DAG begins with a reference sequence, shown in FIG. 1(A) as SEQ ID NO. 1:
- the reference sequence is often much longer, and may be an entire genome.
- the sequence is typically stored as a FASTA or FASTQ file. (FASTQ has become the default format for sequence data produced from next generation sequencers).
- the reference sequence may be a standard reference, such as GRCh37.
- each letter (or symbol) in the sequence actually corresponds to a nucleotide (e.g., a deoxyribonucleotide or a ribonucleotide) or an amino acid (e.g., histidine, leucine, lysine, etc.).
- a variant is added to the reference sequence, as shown in the bottom image of FIG. 1(A).
- the variant is the deletion of the sequence "AG" from the reference between the lines in the figure, i.e., SEQ ID NO. 2.
- this deletion is represented by breaking the reference sequence into nodes before and after the deletion, and connecting the nodes with an edge and also creating a path from one node to the "AG" and then to the other node.
- one path between the nodes represents the reference sequence, while the other path represents the deletion.
- the variants are called to the DAG by applying the entries in a variant call format (VCF) file, such as can be found at the 1000 Genomes Project website.
- VCF variant call format
- each VCF file is keyed to a specific reference genome at a specific location, it is not difficult to identify where the strings should be located.
- each entry in a VCF file can be thought of as combining with the reference to create separate graph, as displayed in FIG. 2. Note the VCF entries in FIG. 2 do not correspond to the VCF entries of FIG. 1.
- a second VCF entry corresponding to an insertion "GG" at a specific position is added to produce an expanded DAG, i.e., including SEQ ID NO. 3 and SEQ ID NO. 4.
- a third VCF entry can be added to the expanded DAG to account for a SNP earlier in the reference sequence, i.e., including SEQ ID NOS. 5-8.
- a DAG has been created against which nucleic acid reads can be aligned (as discussed below.)
- the DAGs are represented in computer memory (hard disk, FLASH, cloud memory, etc.) as a set of nodes, S, wherein each node is defined by a string of characters, a set of parent nodes, and a position.
- the string is the node's "content," i.e., sequence; the parent nodes define the node's position with respect to the other nodes in the graph; and the position of the node is relative to some canonical ordering in the system, e.g., the reference genome. While it is not strictly necessary to define the graph with respect to a reference sequence, it does make manipulation of the output data simpler. Of course, a further constraint on S is that it cannot include loops.
- the nodes comprise a plurality of characters, as shown in FIGS. 1(A) and 1(B), however it is possible that a node may be a single character, e.g., representing a single base, as shown in FIG. 2.
- a node represents a string of characters
- all of the characters in the node can be aligned with a single comparison step, rather than character- by-character calculations, as is done with conventional Smith- Waterman techniques.
- the computational burden is greatly reduced as compared to state-of-the-are methods. The reduced computational burden allows the alignment to be completed quicker, and with fewer resources.
- DAGs that incorporate thousands of VCF entries representing the known variation in genetic sequences for a given region of a reference. Nonetheless, as a DAG becomes bulkier, the computations do take longer, and for many applications a smaller DAG is used that may only represent a portion of the sequence, e.g., a chromosome. In other embodiments, a DAG may be made smaller by reducing the size of the population that is covered by the DAG, for instance going from a DAG
- DAGs can be used that are customized based upon easily identified genetic markers that will typically result in a large portion of the DAG being consistent between samples. For example, aligning a set of nucleic acid reads from an African-ancestry female will be quicker against a DAG created with VCF entries from women of African ancestry as compared to a DAG accounting for all variations known in humans over the same sequence. It is to be recognized that the DAGs of the invention are dynamic constructs in that they can be modified over time to incorporate newly identified mutations. Additionally, algorithms in which the alignment results are recursively added to the DAG are also possible.
- the gap penalties can be adjusted to make gap insertions even more costly, thus favoring an alignment to a sequence rather than opening a new gap in the overall sequence.
- improvements in the DAG discussed above the incidence of gaps should decrease even further because mutations are accounted for in the DAG.
- an algorithm is used to align sequence reads against a directed acyclic graph (DAG).
- DAG directed acyclic graph
- the alignment algorithm identifies the maximum value for Q 7 by identifying the maximum score with respect to each sequence contained at a position on the DAG (e.g., the reference sequence construct). In fact, by looking "backwards" at the preceding positions, it is possible to identify the optimum alignment across a plurality of possible paths.
- the algorithm of the invention is carried out on a read (a.k.a. "string”) and a directed acyclic graph (DAG), discussed above.
- a read a.k.a. "string”
- D directed acyclic graph
- S the string being aligned
- S[l] A
- each letter of the sequence of a node will be represented as a separate element, d.
- a predecessor of d is defined as: (i) If d is not the first letter of the sequence of its node, the letter preceding d in its node is its (only) predecessor;
- the algorithm seeks the value of M ⁇ j,d], the score of the optimal alignment of the first j elements of S with the portion of the DAG preceding (and including) d. This step is similar to finding H ;J in equation 1 in the Background section.
- determining M ⁇ j,d] involves finding the maximum of a, i, e, and 0, as defined below:
- e is the highest of the alignments of the first j characters of S with the portions of the DAG up to, but not including, d, plus an additional DELETE_PENALTY. Accordingly, if d is not the first letter of the sequence of the node, then there is only one predecessor, p, and the alignment score of the first j characters of S with the DAG (up-to-and- including p) is equivalent to M[/,p] + DELETE_PENALTY.
- i is the alignment of the first j-l characters of the string S with the DAG up-to-and-including d, plus an INSERT_PENALTY, which is similar to the definition of the insertion argument in SW (see equation 1).
- a is the highest of the alignments of the first j characters of S with the portions of the DAG up to, but not including d, plus either a MATCH_SCORE (if the j ' th character of S is the same as the character d) or a MISMATCH_PENALTY (if the j ' th character of S is not the same as the character d).
- MATCH_SCORE if the j ' th character of S is the same as the character d
- MISMATCH_PENALTY if the j ' th character of S is not the same as the character d.
- a is the alignment score of the first j- l characters of S with the DAG (up-to-and-including p), i.e., M ⁇ j- l,p], with either a MIS M ATCH_PEN ALT Y or MATCH_SCORE added, depending upon whether d and the jth character of S match.
- d is the first letter of the sequence of its node
- MIS M ATCH_PEN ALT Y or M ATCH_S CORE ⁇ is the same as choosing the predecessor with the highest alignment score with the first j- l characters of S (i.e., the highest of the candidate M ⁇ j- l,p*] arguments) and adding either a MIS M ATCH_PEN ALT Y or a M ATCH_S CORE depending on whether d and the jth character of S match.
- DELETE_PENALTY, INSERT_PENALTY, M ATCH_S CORE and MISMATCH_PENALTY can be adjusted to encourage alignment with fewer gaps, etc.
- the algorithm finds the maximum value for each read by calculating not only the insertion, deletion, and match scores for that element, but looking backward (against the direction of the DAG) to any prior nodes on the DAG to find a maximum score.
- the algorithm is able to traverse the different paths through the DAG, which contain the known mutations. Because the graphs are directed, the backtracks, which move against the direction of the graph, follow the preferred variant sequence toward the origin of the graph, and the maximum alignment score identifies the most likely alignment within a high degree of certainty. While the equations above are represented as “maximum” values, "maximum” is intended to cover any form of optimization, including, for example, switching the signs on all of the equations and solving for a minimum value.
- FIG. 3 shows a pictorial representation of the read being compared to the DAG while FIG. 3(B) shows the actual matrices that correspond to the comparison.
- the algorithm of the invention identifies the highest score and performs a backtrack to identify the proper location of the read.
- 3(A) and (B) also highlights that the invention produces an actual match for the string against the construct, whereas the known methods (e.g., SW) would have been more likely to align the string to the wrong part of the reference, or reject the string as not generating a sufficiently-high alignment score to be included in the alignment.
- the aligned sequence will be reported out with a gap, insertion, etc.
- a reference sequence construct of the invention allows a sequence read to align against one of at least two different sequence paths at a certain position—e.g., a path that follows a sequence equivalent to a reference sequence and another path that follows a known sequence equivalent to the reference sequence including variants (e.g. mutations, polymorphisms, copy number variations, structural variations).
- variants e.g. mutations, polymorphisms, copy number variations, structural variations.
- FIGS. 4-7 Two examples of using directed acyclic graphs (DAG) to genotype reads are shown in FIGS. 4-7.
- Figure 4 shows two potential alleles at a position in the genome of an organism:
- SEQ ID. NO. 12 CCCAGAACGTTGCATCGTAGACGAGTTTCAGCATT
- SEQ ID. NO. 13 CCCAGAACGTTGCTATGCAACAAGGGACATCGTA
- the two alleles differ by a 15 base insertion, i.e., a structural variation.
- the two alleles can be depicted in a single reference sequence construct where the two alleles correspond to different pathways through the construct.
- the reads can be immediately correlated with one or both of the alleles.
- a read either aligns with a path corresponding to allele #1, a path corresponding to allele #2, or a read can align to either because the paths are common in the region aligning with the read.
- Based upon the number of reads aligning to a particular path it is possible to immediately call a set of reads as corresponding to allele #1 or allele #2 without the additional steps of assembling the aligned reads and comparing the assembled reads to a reference sequence.
- the methods efficiently align reads that comprise mostly common sequences, i.e., as shown for Read #4.
- read #4 would likely be aligned to the first allele with a tail sequence that is either discounted or assumed to be a transposition of bases. However, using the disclosed methods, it is clear that read #4 actually correlates to allele #2.
- the alignment of the various reads in FIG. 5 emphasizes how much cleaner and more accurate a DAG-based genotyping process is, when compared to a linear- sequence-based process, especially one in which only a single reference sequence is used and mismatches are handled separately. As soon as the sequences are aligned to the reference DAG, we have good information about where the read is in the genome. It is additionally possible to gain extra information from such a construct by weighting or correlating particular branched sequences, thus allowing instant recognition of the rarity of an allele or the potential consequence of carrying that allele.
- the methods of the invention allow even more versatility when important genetic differences are present within structural variations, as shown in FIGS. 6 and 7. As illustrated in FIG.6, it is possible to incorporate the additional complexity of a third allele having a SNP within the structural variation. Thus, as shown in FIG. 7, when reads are aligned to reference sequence construct #2, the reads can align to a path corresponding to allele #1, a path
- FIGS. 4-7 should not be seen as limiting, however, as a reference sequence construct can include a multitude of different pathways, and the construct may include a series of different alternative sequences corresponding to positions of genetic variability. Statistical analysis and cross-correlation can also be used to assess a confidence level in a genotype call when thousands (or millions) of reads are processed, as is the case with contemporary sequencing.
- the disclosed methods advantageously allow sequence reads that include portions of a structural variations to be aligned and consequently genotyped.
- these reads may be rejected due to a low alignment score, and any variation within the portion of the read corresponding to the structural variation ignored.
- the structural variations are large, typically between 1 Kb to 3Mb in size.
- structural variants may include any variation within a sequence read that deviates from the reference for 3 or more consecutive base pairs.
- the sequence length of the structural variant is about 20 bp, 50 bp, 80 bp, 100 bp, 200, bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800, bp, 1 Kb, 1.1. Kb, 1.2 Kb, 1.3 Kb, 1.4 Kb, 1.5 Kb, 1.6 Kb, 1.7 Kb, 1.8 Kb, 1.9 Kb, 2.0 Kb...2.0 Mb, 2.1 Mb, 2.2 Mb, 2.3 Mb, 2.4 Mb, 2.5 Mb, 2.6 Mb, 2.7 Mb, 2.8 Mb, 2.9 Mb, 3.0 Mb, etc.
- Structural variations provide important insight into a subject as they contribute to genetic diversity and disease susceptibility.
- Rare variants include any mutations (such as indel or polymorphism) that are found with low probably in a given population.
- a rare variant may have a minor allele frequency ranging from, for example, 25% or fewer; 20% or fewer; 15% or fewer; 10% or fewer; or 5% or fewer.
- rare variants include variants that have not yet been identified, i.e., the variants aren't represented in the reference to which the read is aligned. In some instances the rare variant has not been cataloged in a VCF file. From the perspective of the alignment mechanism, such variants are effectively never-before-seen regardless of their actual frequency in a population of samples.
- a rare variant located near a structural variant may be separated from the structural variant by about the length of the read, i.e., about 100 bp or fewer. The invention is not limited to this spacing however.
- a rare variant located near a structural variant has a separation between the rare variant and the structural variant may range from about 1 bp to about 1 Mbp, e.g., about 10 bp to about 10,000 bp, e.g., about 100 bp to about 1000 bp. Accordingly, the invention additionally allows for genotyping samples based upon minor alleles nearby structural variations on a large scale, e.g., a chromosome or an entire genome.
- the reference constructs of the invention minimize nonalignment of structural variants and rare variants during the alignment process because references constructs of the invention can account for many different known structural variants.
- the invention allows for sequence reads that include a portion of at least one of the structural variants to align to the reference construct. That is, sequence reads that include a portion of a known structural variant are aligned and accounted for, whereas the same structural variant would fail to align in a linear reference structure.
- the result of the invention is that reads that include structural variants are able to properly align to the DAG with a high degree of reliability and accuracy because the reads are treated as alignable rather than un-alignable.
- sequence data that is part of the sequence read with the structural variant likewise aligns to the reference construct.
- a rare variant that is close to a structural variant (such that a sequence read includes at least portions of the structural variant and the rare variant) will align to the reference construct along with the structural variant.
- a rare variant next to a structural variant will present in a large number of otherwise well-aligned and reliable reads because of the proper alignment of the structural variant in the sequence read to the DAG reference construct.
- the consistent presence of the rare variant causes it to be recognized as a legitimate genetic variant rather than sequencing error, even if the variant is not represented in the reference construct.
- Wozniak used the SIMD registers to store the values parallel to the minor diagonal, reporting a two-fold speedup over a traditional implementation on the same machine.
- a similar way to parallelize code is to use the Streaming SIMD Extension (SSE) set for the x86 architecture.
- SSE Streaming SIMD Extension
- Intel the vector-like operations complete a single operation/instruction on a small number of values (usually four, eight or sixteen) at a time.
- Many AMD and Intel chips support the various versions of SSE, and Intel has continued developing this technology with the Advanced Vector Extensions (AVX) for their modern chipsets.
- AVX Advanced Vector Extensions
- Rognes and Seeberg (Bioinformatics (Oxford, England), 16(8):699-706, 2000) use the Intel Pentium processor with SSE's predecessor, MMX SIMD instructions for their implementation.
- the approach that developed out of the work of Rognes and Seeberg (Bioinformatics, 16(8):699-706, 2000) for ParAlign does not use the wavefront approach (Rognes, Nuc Acids Res, 29(7): 1647-52, 2001; Saebo et al., Nuc Acids Res, 33(suppl 2):W535-W539, 2005). Instead, they align the SIMD registers parallel to the query sequence, computing eight values at a time, using a pre-computed query- specific score matrix.
- small-scale vector parallelization (8, 16 or 32-way parallelism) can be used to make the calculations accessible via GPU implementations that align multiple sequences in parallel.
- the theoretical peak speedup for the calculations is a factor of m, which is optimal.
- ASC Associative Computing
- MIMD multiple-instruction, multiple-data
- ASC extended data-parallel, single-instruction multiple- data
- MIMD Multiple Instruction, Multiple Data
- the multiple-data, multiple-instruction model or MIMD model describes the majority of parallel systems currently available, and include the currently popular cluster of computers.
- the MIMD processors have a full-fledged central processing unit (CPU), each with its own local memory (Quinn, Parallel Computing: Theory and Practice, 2nd ed., New York: McGraw-Hill, 1994).
- CPU central processing unit
- SIMD SIMD
- each of the MIMD processors stores and executes its own program asynchronously.
- the MIMD processors are connected via a network that allows them to communicate but the network used can vary widely, ranging from an Ethernet, Myrinet, and InfiniBand connection between machines (cluster nodes). The communications tend to employ a much looser communications structure than SIMDs, going outside of a single unit.
- the data is moved along the network asynchronously by individual processors under the control of their individual program they are executing.
- communication is handled by one of several different parallel languages that support message-passing.
- a very common library for this is known as the Message Passing Interface (MPI).
- MPI Message Passing Interface
- MIMDs Small Computer Memory Sticks
- Parallel computations by MIMDs usually require extensive communication and frequent synchronizations unless the various tasks being executed by the processors are highly independent (i.e. the so-called “embarrassingly parallel” or “pleasingly parallel” problems).
- the work presented in Section 8 uses an AMD Opteron cluster connected via InfiniBand.
- the worst-case time required for the message-passing is difficult or impossible to predict.
- the message-passing execution time for MIMD software is determined using the average case estimates, which are often determined by trial, rather than by a worst case theoretical evaluation, which is typical for SIMDs. Since the worst case for MIMD software is often very bad and rarely occurs, average case estimates are much more useful.
- the communication time required for a MIMD on a particular problem can be and is usually significantly higher than for a SIMD. This leads to the important goal in MIMD programming (especially when message -pas sing is used) to minimize the number of inter- processor communications required and to maximize the amount of time between processor communications. This is true even at a single card acceleration level, such as using graphics processors or GPUs.
- Data-parallel programming is also an important technique for MIMD programming, but here all the tasks perform the same operation on different data and are only synchronized at various critical points.
- SPMD Single- Program, Multiple-Data
- Each processor has its own copy of the same program, executing the sections of the code specific to that processor or core on its local data.
- the popularity of the SPMD paradigm stems from the fact that it is quite difficult to write a large number of different programs that will be executed concurrently across different processors and still be able to cooperate on solving a single problem.
- Another approach used for memory-intensive but not compute-intensive problems is to create a virtual memory server, as is done with JumboMem, using the work presented in Section 8. This uses MPI in its underlying implementation.
- SIMD Single Instruction, Multiple Data
- the SIMD model consists of multiple, simple arithmetic processing elements called PEs. Each PE has its own local memory that it can fetch and store from, but it does not have the ability to compile or execute a program.
- parallel memory refers to the local memories, collectively, in a computing system.
- a parallel memory can be the collective of local memories in a SIMD computer system (e.g., the local memories of PEs), the collective of local memories of the processors in a MIMD computer system (e.g., the local memories of the central processing units) and the like.
- control unit or front end
- the control unit is connected to all PEs, usually by a bus.
- All active PEs execute the program instructions received from the control unit synchronously in lockstep. "In any time unit, a single operation is in the same state of execution on multiple processing units, each manipulating different data" (Quinn, Parallel Computing: Theory and Practice, 2nd ed., New York: McGraw-Hill, 1994), at page 79. While the same instruction is executed at the same time in parallel by all active PEs, some PEs may be allowed to skip any particular instruction (Baker, SIMD and MASC: Course notes from CS 6/73301: Parallel and Distributed Computing— power point slides, (2004)2004). This is usually accomplished using an "if-else" branch structure where some of the PEs execute the if instructions and the remaining PEs execute the else part. This model is ideal for problems that are "data-parallel” in nature that have at most a small number of if-else branching structures that can occur simultaneously, such as image processing and matrix operations.
- Data can be broadcast to all active PEs by the control unit and the control unit can also obtain data values from a particular PE using the connection (usually a bus) between the control unit and the PEs.
- the set of PE are connected by an interconnection network, such as a linear array, 2-D mesh, or hypercube that provides parallel data movement between the PEs. Data is moved through this network in synchronous parallel fashion by the PEs, which execute the instructions including data movement, in lockstep. It is the control unit that broadcasts the instructions to the PEs.
- the SIMD network does not use the message-passing paradigm used by most parallel computers today. An important advantage of this is that SEVID network communication is extremely efficient and the maximum time required for the communication can be determined by the worst-case time of the algorithm controlling that particular communication.
- the ASsocative Computing (ASC) model is an extended SIMD based on the STARAN associative SIMD computer, designed by Dr. Kenneth Batcher at Goodyear Aerospace and its heavily Navy-utilized successor, the ASPRO.
- ASC is an algorithmic model for associative computing (Potter et al., Computer, 27(11): 19-25, 1994) (Potter, Associative Computing: A Programming Paradigm for Massively Parallel Computers, Plenum Publishing, 1992).
- the ASC model grew out of work on the STARAN and MPP, associative processors built by Goodyear Aerospace. Although it is not currently supported in hardware, current research efforts are being made to both efficiently simulate and design a computer for this model.
- ASC uses synchronous data-parallel programming, avoiding both multi-tasking and asynchronous point-to-point communication routing. Multi- tasking is unnecessary since only one task is executed at any time, with multiple instances of this task executed in lockstep on all active processing elements (PEs).
- PEs active processing elements
- ASC like SIMD programmers, avoid problems involving load balancing, synchronization, and dynamic task scheduling, issues that must be explicitly handled in MPI and other MIMD cluster paradigms.
- FIG. 8 shows a conceptual model of an ASC computer.
- a single control unit also known as an instruction stream (IS)
- PEs processing elements
- the control unit and PE array are connected through a broadcast/reduction network and the PEs are connected together through a PE data interconnection network.
- a PE has access to data located in its own local memory.
- the data remains in place and responding (active) PEs process their local data in parallel.
- the reference to the word associative is related to the use of searching to locate data by content rather than memory addresses.
- the ASC model does not employ associative memory, instead it is an associative processor where the general cycle is to search-process-retrieve. An overview of the model is available in (Potter et al., Computer, 27(11): 19-25, 1994).
- the associative operations are executed in constant time (Jin et al., ⁇ 5th International Parallel and Distributed Processing Symposium (IPDPS'Ol) Workshops, San Francisco, p. 193, 2001), due to additional hardware required by the ASC model. These operations can be performed efficiently (but less rapidly) by any SIMD-like machine, and has been successfully adapted to run efficiently on several SIMD hardware platforms (Yuan et al., Parallel and
- SWAMP and other ASC algorithms can therefore be efficiently implemented on other systems that are closely related to SIMDs including vector machines, which is why the model is used as a paradigm.
- the control unit fetches and decodes program instructions and broadcasts control signals to the PEs.
- the PEs under the direction of the control unit, execute these instructions using their own local data. All PEs execute instructions in a lockstep manner, with an implicit synchronization between instructions.
- ASC has several relevant high-speed global operations: associative search, maximum/minimum search, and responder selection/detection. These are described in the following section.
- the basic operation in an ASC algorithm is the associative search.
- An associative search simultaneously locates the PEs whose local data matches a given search key. Those PEs that have matching data are called responders and those with non-matching data are called non- responders. After performing a search, the algorithm can then restrict further processing to only affect the responders by disabling the non-responders (or vice versa). Performing additional searches may further refine the set of responders.
- Associative search is heavily utilized by SWAMP+ in selecting which PEs are active within a parallel act within a diagonal.
- an associative computer can also perform global searches, where data from the entire PE array is combined together to determine the set of responders.
- the most common type of global search is the
- the responders are those PEs whose data is the maximum or minimum value across the entire PE array.
- the maximum value is used by SWAMP+ in every diagonal it processes to track the highest value calculated so far. Use of the maximum search occurs frequently, once in a logical parallel act, m+n times per alignment.
- An associative search can result in multiple responders and an associative algorithm can process those responders in one of three different modes: parallel, sequential, or single selection.
- Parallel responder processing performs the same set of operations on each responder
- Sequential responder processing selects each responder individually, allowing a different set of operations for each responder.
- Single responder selection also known as pickOne
- pickOne selects one, arbitrarily chosen, responder to undergo processing.
- an associative search it is also possible for an associative search to result in no responders.
- the ASC model can detect whether there were any responders to a search and perform a separate set of actions in that case (known as anyResponders).
- SWAMP multiple responders that contain characters to be aligned are selected and processed in parallel, based on the associative searches mentioned above.
- Single responder selection occurs if and when there are multiple values that have the exact same maximum value when using the maximum/minimum search.
- associative processors include some type of PE interconnection network to allow parallel data movement within the array.
- the ASC model itself does not specify any particular interconnection network and, in fact, many useful associative algorithms do not require one.
- associative processors implement simple networks such as ID linear arrays or 2D meshes. These networks are simple to implement and allow data to be transferred quickly in a synchronous manner.
- the ID linear array is sufficient for the explicit communication between PEs in the SWAMP algorithms, for example.
- FIG. 9 A generalized parallel processing architecture is shown in FIG. 9. While each component is shown as having a direct connection, it is to be understood that the various elements may be geographically separated but connected via a network, e.g., the internet. While hybrid configurations are possible, the main memory in a parallel computer is typically either shared between all processing elements in a single address space, or distributed, i.e., each processing element has its own local address space. (Distributed memory refers to the fact that the memory is logically distributed, but often implies that it is physically distributed as well.) Distributed shared memory and memory virtualization combine the two approaches, where the processing element has its own local memory and access to the memory on non-local processors. Accesses to local memory are typically faster than accesses to non-local memory.
- UMA Uniform Memory Access
- NUMA Non-Uniform Memory Access
- Distributed memory systems have non-uniform memory access.
- Processor-processor and processor-memory communication can be implemented in hardware in several ways, including via shared (either multiported or multiplexed) memory, a crossbar switch, a shared bus or an interconnect network of a myriad of topologies including star, ring, tree, hypercube, fat hypercube (a hypercube with more than one processor at a node), or n- dimensional mesh.
- shared either multiported or multiplexed
- crossbar switch a shared bus or an interconnect network of a myriad of topologies including star, ring, tree, hypercube, fat hypercube (a hypercube with more than one processor at a node), or n- dimensional mesh.
- Parallel computers based on interconnected networks must incorporate routing to enable the passing of messages between nodes that are not directly connected.
- the medium used for communication between the processors is likely to be hierarchical in large multiprocessor machines. Such resources are commercially available for purchase for dedicated use, or these resources can be accessed via "the cloud," e.g., Amazon Cloud Computing.
- a computer generally includes a processor coupled to a memory via a bus.
- Memory can include RAM or ROM and preferably includes at least one tangible, non-transitory medium storing instructions executable to cause the system to perform functions described herein.
- systems of the invention include one or more processors (e.g., a central processing unit (CPU), a graphics processing unit (GPU), etc.), computer-readable storage devices (e.g., main memory, static memory, etc.), or combinations thereof which communicate with each other via a bus.
- processors e.g., a central processing unit (CPU), a graphics processing unit (GPU), etc.
- computer-readable storage devices e.g., main memory, static memory, etc.
- a processor may be any suitable processor known in the art, such as the processor sold under the trademark XEON E7 by Intel (Santa Clara, CA) or the processor sold under the trademark OPTERON 6200 by AMD (Sunnyvale, CA).
- Memory may refer to a computer-readable storage device and can include any machine- readable medium on which is stored one or more sets of instructions (e.g., software embodying any methodology or function found herein), data (e.g., embodying any tangible physical objects such as the genetic sequences found in a patient's chromosomes), or both. While the computer- readable storage device can in an exemplary embodiment be a single medium, the term
- “computer-readable storage device” should be taken to include a single medium or multiple media (e.g., a centralized or distributed database, and/or associated caches and servers) that store the one or more sets of instructions or data.
- the term “computer-readable storage device” shall accordingly be taken to include, without limit, solid-state memories (e.g., subscriber identity module (SIM) card, secure digital card (SD card), micro SD card, or solid-state drive (SSD)), optical and magnetic media, and any other tangible storage media.
- SIM subscriber identity module
- SD card secure digital card
- SSD solid-state drive
- a computer- readable storage device includes a tangible, non-transitory medium. Such non-transitory media excludes, for example, transitory waves and signals.
- “Non-transitory memory” should be interpreted to exclude computer readable transmission media, such as signals, per se.
- Input/output devices may include a video display unit (e.g., a liquid crystal display (LCD) or a cathode ray tube (CRT) monitor), an alphanumeric input device (e.g., a keyboard), a cursor control device (e.g., a mouse or trackpad), a disk drive unit, a signal generation device (e.g., a speaker), a touchscreen, an accelerometer, a microphone, a cellular radio frequency antenna, and a network interface device, which can be, for example, a network interface card (NIC), Wi-Fi card, or cellular modem.
- a video display unit e.g., a liquid crystal display (LCD) or a cathode ray tube (CRT) monitor
- an alphanumeric input device e.g., a keyboard
- a cursor control device e.g., a mouse or trackpad
- a disk drive unit e.g., a disk drive unit
- a signal generation device
- the invention includes methods for producing sequences (e.g., nucleic acid sequences, amino acid sequences) corresponding to nucleic acids recovered from biological samples.
- sequences e.g., nucleic acid sequences, amino acid sequences
- the resulting information can be used to identify mutations present in nucleic acid material obtained from a subject.
- a sample i.e., nucleic acids (e.g. DNA or RNA) are obtained from a subject, the nucleic acids are processed (lysed, amplified, and/or purified) and the nucleic acids are sequenced using a method described below.
- the result of the sequencing is not a linear nucleic acid sequence, but a collection of thousands or millions of individual short nucleic acid reads that must be re-assembled into a sequence for the subject.
- the aligned sequence can be compared to reference sequences to identify mutations that may be indicative of disease, for example.
- the subject may be identified with particular mutations based upon the alignment of the reads against a reference sequence construct, i.e., a directed acyclic graph ("DAG”) as described above.
- DAG directed acyclic graph
- the biological samples may, for example, comprise samples of blood, whole blood, blood plasma, tears, nipple aspirate, serum, stool, urine, saliva, circulating cells, tissue, biopsy samples, hair follicle or other samples containing biological material of the patient.
- One issue in conducting tests based on such samples is that, in most cases only a tiny amount of DNA or RNA containing a mutation of interest may be present in a sample. This is especially true in non-invasive samples, such as a buccal swab or a blood sample, where the mutant nucleic acids are present in very small amounts.
- the nucleic acid fragments may be naturally short, that is, random shearing of relevant nucleic acids in the sample can generate short fragments.
- the nucleic acids are purposely fragmented for ease of processing or because the sequencing techniques can only sequence reads of less than 1000 bases, e.g., less than 500 bases, e.g., less than 200 bases, e.g., less than 100 bases, e.g., less than 50 bases. While the methods described herein can be used to align sequences of varying length, in some
- the majority of the plurality of nucleic acid reads will follow from the sequencing method and comprise less than 1000 bases, e.g., less than 500 bases, e.g., less than 200 bases, e.g., less than 100 bases, e.g., less than 50 bases.
- Nucleic acids may be obtained by methods known in the art. Generally, nucleic acids can be extracted from a biological sample by a variety of techniques such as those described by Maniatis, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., pp. 280- 281, (1982), the contents of which is incorporated by reference herein in its entirety.
- Extracts may be prepared using standard techniques in the art, for example, by chemical or mechanical lysis of the cell. Extracts then may be further treated, for example, by filtration and/or centrifugation and/or with chaotropic salts such as guanidinium isothiocyanate or urea or with organic solvents such as phenol and/or HCC1 3 to denature any contaminating and potentially interfering proteins.
- chaotropic salts such as guanidinium isothiocyanate or urea
- organic solvents such as phenol and/or HCC1 3
- the sample may comprise RNA, e.g., mRNA, collected from a subject sample, e.g., a blood sample.
- RNA e.g., mRNA
- a subject sample e.g., a blood sample.
- RNA e.g., mRNA
- Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andres et al., BioTechniques 18:42044 (1995). The contents of each of these references is incorporated by reference herein in their entirety.
- RNA isolation can be performed using a purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions.
- a purification kit such as Qiagen
- Qiagen RNeasy mini-columns.
- Other commercially available RNA isolation kits include MASTERPURE Complete DNA and RNA Purification Kit
- RNA from tissue samples can be isolated using RNA Stat-60 (Tel-Test).
- RNA prepared from tumor can be isolated, for example, by cesium chloride density gradient centrifugation.
- Sequencing may be by any method known in the art.
- DNA sequencing techniques include classic dideoxy sequencing reactions (Sanger method) using labeled terminators or primers and gel separation in slab or capillary, sequencing by synthesis using reversibly terminated labeled nucleotides, pyrosequencing, 454 sequencing, allele specific hybridization to a library of labeled oligonucleotide probes, sequencing by synthesis using allele specific hybridization to a library of labeled clones that is followed by ligation, real time monitoring of the incorporation of labeled nucleotides during a polymerization step, polony sequencing, and SOLiD sequencing.
- nucleic acids are amplified using polymerase chain reactions (PCR) techniques known in the art.
- Alumina sequencing e.g., the MiSeqTM platform
- Illumina sequencing for DNA is based on the amplification of DNA on a solid surface using fold-back PCR and anchored primers. Genomic DNA is fragmented, and adapters are added to the 5' and 3' ends of the fragments. DNA fragments that are attached to the surface of flow cell channels are extended and bridge amplified. The fragments become double stranded, and the double stranded molecules are denatured. Multiple cycles of the solid-phase amplification followed by denaturation can create several million clusters of approximately 1,000 copies of single- stranded DNA molecules of the same template in each channel of the flow cell. Primers, DNA
- RNA fragments are being isolated and amplified in order to determine the RNA expression of the sample.
- sequences may be output in a data file, such as a FASTQ file, which is a text-based format for storing biological sequence and quality scores (see discussion above).
- Ion TorrentTM sequencing Another example of a DNA sequencing technique that may be used in the methods of the provided invention is Ion TorrentTM sequencing, offered by Life Technologies. See U.S. patent application numbers 2009/0026082, 2009/0127589, 2010/0035252, 2010/0137143,
- Ion Torrent data may also be output as a FASTQ file.
- 454TM sequencing is a sequencing-by- synthesis technology that utilizes also utilizes pyrosequencing. 454TM sequencing of DNA involves two steps. In the first step, DNA is sheared into fragments of approximately 300-800 base pairs, and the fragments are blunt ended. Oligonucleotide adaptors are then ligated to the ends of the fragments. The adaptors serve as primers for amplification and sequencing of the fragments.
- the fragments can be attached to DNA capture beads, e.g., streptavidin-coated beads using, e.g., Adaptor B, which contains 5'- biotin tag.
- the fragments attached to the beads are PCR amplified within droplets of an oil- water emulsion. The result is multiple copies of clonally amplified DNA fragments on each bead.
- the beads are captured in wells (pico-liter sized). Pyrosequencing is performed on each DNA fragment in parallel. Addition of one or more nucleotides generates a light signal that is recorded by a CCD camera in a sequencing instrument. The signal strength is proportional to the number of nucleotides incorporated.
- Pyrosequencing makes use of pyrophosphate (PPi) which is released upon nucleotide addition.
- PPi is converted to ATP by ATP sulfurylase in the presence of adenosine 5' phosphosulfate.
- Luciferase uses ATP to convert luciferin to
- pyrosequencing is used to measure gene expression. Pyrosequecing of RNA applies similar to pyrosequencing of DNA, and is accomplished by attaching applications of partial rRNA gene sequencings to microscopic beads and then placing the attachments into individual wells. The attached partial rRNA sequence are then amplified in order to determine the gene expression profile. Sharon Marsh, Pyrosequencing® Protocols in Methods in
- SOLiDTM technology is a ligation based sequencing technology that may utilized to run massively parallel next generation sequencing of both DNA and RNA.
- genomic DNA is sheared into fragments, and adaptors are attached to the 5' and 3' ends of the fragments to generate a fragment library.
- internal adaptors can be introduced by ligating adaptors to the 5' and 3' ends of the fragments, circularizing the fragments, digesting the circularized fragment to generate an internal adaptor, and attaching adaptors to the 5' and 3' ends of the resulting fragments to generate a mate-paired library.
- clonal bead populations are prepared in microreactors containing beads, primers, template, and PCR components. Following PCR, the templates are denatured and beads are enriched to separate the beads with extended templates. Templates on the selected beads are subjected to a 3' modification that permits bonding to a glass slide.
- the sequence can be determined by sequential hybridization and ligation of partially random oligonucleotides with a central determined base (or pair of bases) that is identified by a specific fluorophore. After a color is recorded, the ligated oligonucleotide is cleaved and removed and the process is then repeated.
- SOLiDTM Serial Analysis of Gene Expression is used to measure gene expression.
- Serial analysis of gene expression is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript.
- a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript.
- many transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously.
- the expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484 487 (1995); and Velculescu et al., Cell 88:243 51 (1997, the contents of each of which are incorporated by reference herein in their entirety).
- tSMS Helicos True Single Molecule Sequencing
- a DNA sample is cleaved into strands of approximately 100 to 200 nucleotides, and a polyA sequence is added to the 3' end of each DNA strand.
- Each strand is labeled by the addition of a fluorescently labeled adenosine nucleotide.
- the DNA strands are then hybridized to a flow cell, which contains millions of oligo-T capture sites that are immobilized to the flow cell surface.
- the templates can be at a density of about 100 million templates/cm .
- the flow cell is then loaded into an instrument, e.g., HeliScope.TM. sequencer, and a laser illuminates the surface of the flow cell, revealing the position of each template.
- a CCD camera can map the position of the templates on the flow cell surface.
- the template fluorescent label is then cleaved and washed away.
- the sequencing reaction begins by introducing a DNA polymerase and a fluorescently labeled nucleotide.
- the oligo-T nucleic acid serves as a primer.
- the polymerase incorporates the labeled nucleotides to the primer in a template directed manner. The polymerase and unincorporated nucleotides are removed.
- the templates that have directed incorporation of the fluorescently labeled nucleotide are detected by imaging the flow cell surface. After imaging, a cleavage step removes the fluorescent label, and the process is repeated with other fluorescently labeled nucleotides until the desired read length is achieved. Sequence information is collected with each nucleotide addition step. Further description of tSMS is shown for example in Lapidus et al. (U.S. patent number 7,169,560), Lapidus et al. (U.S. patent application number 2009/0191565), Quake et al. (U.S. patent number 6,818,395), Harris (U.S. patent number 7,282,337), Quake et al. (U.S. patent application number 2002/0164629), and Braslavsky, et al., PNAS (USA), 100: 3960-3964 (2003), the contents of each of these references is incorporated by reference herein in its entirety.
- SMRT single molecule, real-time
- each of the four DNA bases is attached to one of four different fluorescent dyes. These dyes are phospholinked.
- a single DNA polymerase is immobilized with a single molecule of template single stranded DNA at the bottom of a zero-mode waveguide (ZMW).
- ZMW zero-mode waveguide
- a ZMW is a confinement structure which enables observation of incorporation of a single nucleotide by DNA polymerase against the background of fluorescent nucleotides that rapidly diffuse in an out of the ZMW (in microseconds).
- a nanopore is a small hole, of the order of 1 nanometer in diameter. Immersion of a nanopore in a conducting fluid and application of a potential across it results in a slight electrical current due to conduction of ions through the nanopore. The amount of current which flows is sensitive to the size of the nanopore. As a DNA molecule passes through a nanopore, each nucleotide on the DNA molecule obstructs the nanopore to a different degree. Thus, the change in the current passing through the nanopore as the DNA molecule passes through the nanopore represents a reading of the DNA sequence.
- chemFET chemical-sensitive field effect transistor
- DNA molecules can be placed into reaction chambers, and the template molecules can be hybridized to a sequencing primer bound to a polymerase. Incorporation of one or more triphosphates into a new nucleic acid strand at the 3' end of the sequencing primer can be detected by a change in current by a chemFET.
- An array can have multiple chemFET sensors.
- single nucleic acids can be attached to beads, and the nucleic acids can be amplified on the bead, and the individual beads can be transferred to individual reaction chambers on a chemFET array, with each chamber having a chemFET sensor, and the nucleic acids can be sequenced.
- Another example of a sequencing technique that can be used in the methods of the provided invention involves using an electron microscope (Moudrianakis E. N. and Beer M. Proc Natl Acad Sci USA. 1965 March; 53:564-71).
- individual DNA molecules are labeled using metallic labels that are distinguishable using an electron microscope. These molecules are then stretched on a flat surface and imaged using an electron microscope to measure sequences.
- Additional detection methods can utilize binding to microarrays for subsequent fluorescent or non-fluorescent detection, barcode mass detection using a mass spectrometric methods, detection of emitted radiowaves, detection of scattered light from aligned barcodes, fluorescence detection using quantitative PCR or digital PCR methods.
- a comparative nucleic acid hybridization array is a technique for detecting copy number variations within the patient's sample DNA.
- the sample DNA and a reference DNA are differently labeled using distinct fluorophores, for example, and then hybridized to numerous probes. The fluorescent intensity of the sample and reference is then measured, and the fluorescent intensity ratio is then used to calculate copy number variations.
- Microarray detection may not produce a FASTQ file directly, however programs are available to convert the data produced by the microarray sequencers to a FASTQ, or similar, format.
- FISH fluorescent in situ hybridization
- In Situ Hybridization Protocols Ian Darby ed., 2000.
- FISH is a molecular cytogenetic technique that detects specific chromosomal rearrangements such as mutations in a DNA sequence and copy number variances.
- a DNA molecule is chemically denatured and separated into two strands.
- a single stranded probe is then incubated with a denatured strand of the DNA.
- the signals stranded probe is selected depending target sequence portion and has a high affinity to the complementary sequence portion.
- Probes may include a repetitive sequence probe, a whole chromosome probe, and locus-specific probes.
- a Mass ARRAY -based gene expression profiling method is used to measure gene expression.
- the Mas s ARRA YTM-based gene expression profiling method developed by Sequenom, Inc. (San Diego, Calif.) following the isolation of RNA and reverse transcription, the obtained cDNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard.
- the cDNA/competitor mixture is PCR amplified and is subjected to a post- PCR shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the
- the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derives PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with components needed for analysis with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis.
- MALDI-TOF MS matrix-assisted laser desorption ionization time-of-flight mass spectrometry
- the cDNA present in the reaction is then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g. Ding and Cantor, Proc. Natl. Acad. Sci. USA 100:3059 3064 (2003).
- PCR-based techniques include, for example, differential display (Liang and Pardee, Science 257:967 971 (1992)); amplified fragment length polymorphism (iAFLP) (Kawamoto et al., Genome Res. 12: 1305 1312 (1999)); BeadArrayTM technology (Illumina, San Diego, Calif.; Oliphant et al., Discovery of Markers for Disease (Supplement to Biotechniques), June 2002; Ferguson et al., Analytical Chemistry 72:5618 (2000)); Beads Array for Detection of Gene Expression (BADGE), using the commercially available LuminexlOO LabMAP system and multiple color-coded microspheres (Luminex Corp., Austin, Tex.) in a rapid assay for gene expression (Yang et al., Genome Res.
- iAFLP amplified fragment length polymorphism
- BeadArrayTM technology Illumina, San Diego, Calif.; Oliphant et al., Discovery of
- variances in gene expression can also be identified, or confirmed using a microarray techniques, including nylon membrane arrays, microchip arrays and glass slide arrays, e.g., such as available commercially from Affymetrix (Santa Clara, CA).
- a microarray technique including nylon membrane arrays, microchip arrays and glass slide arrays, e.g., such as available commercially from Affymetrix (Santa Clara, CA).
- RNA samples are isolated and converted into labeled cDNA via reverse transcription.
- the labeled cDNA is then hybridized onto either a nylon membrane, microchip, or a glass slide with specific DNA probes from cells or tissues of interest.
- the hybridized cDNA is then detected and quantified, and the resulting gene expression data may be compared to controls for analysis.
- the methods of labeling, hybridization, and detection vary depending on whether the microarray support is a nylon membrane, microchip, or glass slide.
- Nylon membrane arrays are typically hybridized with P-dNTP labeled probes.
- Glass slide arrays typically involve labeling with two distinct fluorescently labeled nucleotides.
- Methods for making microarrays and determining gene product expression are shown in Yeatman et al. (U.S. patent application number 2006/0195269), the content of which is incorporated by reference herein in its entirety.
- mass spectrometry (MS) analysis can be used alone or in combination with other methods (e.g., immunoassays or RNA measuring assays) to determine the presence and/or quantity of the one or more biomarkers disclosed herein in a biological sample.
- MS analysis includes matrix-assisted laser
- MS analysis comprises electrospray ionization (ESI) MS, such as for example liquid chromatography (LC) ESTMS.
- ESI electrospray ionization
- MS analysis can be accomplished using commercially- available spectrometers.
- Methods for utilizing MS analysis, including MALDI-TOF MS and ESI-MS, to detect the presence and quantity of biomarker peptides in biological samples are known in the art. See for example U.S. Pat. Nos. 6,925,389; 6,989,100; and 6,890,763 for further guidance, each of which is incorporated by reference herein in their entirety.
- Protein sequences for use with the methods, sequence constructs, and systems of the invention can be determined using a number of techniques known to those skilled in the relevant art.
- amino acid sequences and amino acid sequence reads may be produced by analyzing a protein or a portion of a protein with mass spectrometry or using Edman degradation.
- Mass spectrometry may include, for example, matrix-assisted laser desorption/ionization
- MALDI time-of-flight
- TOF time-of-flight
- MALDI-TOF time-of-flight
- ESI electrospray ionization
- LC liquid chromatography
- MS- MS MS- MS.
- Edman degradation analysis may be performed using commercial instruments such as the Model 49X Procise protein/peptide sequencer (Applied Biosystems/Life Technologies).
- the sequenced amino acid sequences, i.e., polypeptides, i.e., proteins may be at least 10 amino acids in length, e.g., at least 20 amino acids in length, e.g., at least 50 amino acids in length.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Analytical Chemistry (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Theoretical Computer Science (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Medical Informatics (AREA)
- Evolutionary Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2016523194A JP2017500004A (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping gene samples |
| EP14854801.9A EP3058332B1 (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
| CA2927102A CA2927102C (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
| KR1020167012613A KR20160062763A (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
| CN201480066185.4A CN105793689B (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
| AU2014337089A AU2014337089B2 (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
| SG11201602903XA SG11201602903XA (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361892662P | 2013-10-18 | 2013-10-18 | |
| US61/892,662 | 2013-10-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015058093A1 true WO2015058093A1 (en) | 2015-04-23 |
Family
ID=52828742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/061156 Ceased WO2015058093A1 (en) | 2013-10-18 | 2014-10-17 | Methods and systems for genotyping genetic samples |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US10078724B2 (en) |
| EP (1) | EP3058332B1 (en) |
| JP (1) | JP2017500004A (en) |
| KR (1) | KR20160062763A (en) |
| CN (1) | CN105793689B (en) |
| AU (1) | AU2014337089B2 (en) |
| CA (1) | CA2927102C (en) |
| SG (1) | SG11201602903XA (en) |
| WO (1) | WO2015058093A1 (en) |
Cited By (44)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016201215A1 (en) * | 2015-06-11 | 2016-12-15 | Seven Bridges Genomics Inc. | Systems and methods for identifying microorganisms |
| WO2017123316A1 (en) | 2016-01-15 | 2017-07-20 | Ventana Medical Systems, Inc. | Deep sequencing profiling of tumors |
| JP2017146928A (en) * | 2016-02-19 | 2017-08-24 | 富士通株式会社 | Variant information processing device, method, and program |
| US9898575B2 (en) | 2013-08-21 | 2018-02-20 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences |
| US9904763B2 (en) | 2013-08-21 | 2018-02-27 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US10055539B2 (en) | 2013-10-21 | 2018-08-21 | Seven Bridges Genomics Inc. | Systems and methods for using paired-end data in directed acyclic structure |
| US10053736B2 (en) | 2013-10-18 | 2018-08-21 | Seven Bridges Genomics Inc. | Methods and systems for identifying disease-induced mutations |
| US10078724B2 (en) | 2013-10-18 | 2018-09-18 | Seven Bridges Genomics Inc. | Methods and systems for genotyping genetic samples |
| WO2018189040A1 (en) | 2017-04-14 | 2018-10-18 | Ventana Medical Systems, Inc. | Size-based separation of dissociated fixed tissues |
| US10192026B2 (en) | 2015-03-05 | 2019-01-29 | Seven Bridges Genomics Inc. | Systems and methods for genomic pattern analysis |
| US10262102B2 (en) | 2016-02-24 | 2019-04-16 | Seven Bridges Genomics Inc. | Systems and methods for genotyping with graph reference |
| WO2019092269A1 (en) | 2017-11-13 | 2019-05-16 | F. Hoffmann-La Roche Ag | Devices for sample analysis using epitachophoresis |
| US10319465B2 (en) | 2016-11-16 | 2019-06-11 | Seven Bridges Genomics Inc. | Systems and methods for aligning sequences to graph references |
| US10364468B2 (en) | 2016-01-13 | 2019-07-30 | Seven Bridges Genomics Inc. | Systems and methods for analyzing circulating tumor DNA |
| US10460829B2 (en) | 2016-01-26 | 2019-10-29 | Seven Bridges Genomics Inc. | Systems and methods for encoding genetic variation for a population |
| US10584380B2 (en) | 2015-09-01 | 2020-03-10 | Seven Bridges Genomics Inc. | Systems and methods for mitochondrial analysis |
| US10600499B2 (en) | 2016-07-13 | 2020-03-24 | Seven Bridges Genomics Inc. | Systems and methods for reconciling variants in sequence data relative to reference sequence data |
| WO2020074742A1 (en) | 2018-10-12 | 2020-04-16 | F. Hoffmann-La Roche Ag | Detection methods for epitachophoresis workflow automation |
| WO2020112566A1 (en) | 2018-11-29 | 2020-06-04 | Ventana Medical Systems, Inc. | Personalized ctdna disease monitoring via representative dna sequencing |
| WO2020136133A1 (en) | 2018-12-23 | 2020-07-02 | F. Hoffmann-La Roche Ag | Tumor classification based on predicted tumor mutational burden |
| US10726110B2 (en) | 2017-03-01 | 2020-07-28 | Seven Bridges Genomics, Inc. | Watermarking for data security in bioinformatic sequence analysis |
| US10724110B2 (en) | 2015-09-01 | 2020-07-28 | Seven Bridges Genomics Inc. | Systems and methods for analyzing viral nucleic acids |
| US10790044B2 (en) | 2016-05-19 | 2020-09-29 | Seven Bridges Genomics Inc. | Systems and methods for sequence encoding, storage, and compression |
| US10793895B2 (en) | 2015-08-24 | 2020-10-06 | Seven Bridges Genomics Inc. | Systems and methods for epigenetic analysis |
| US10832797B2 (en) | 2013-10-18 | 2020-11-10 | Seven Bridges Genomics Inc. | Method and system for quantifying sequence alignment |
| WO2020229437A1 (en) | 2019-05-14 | 2020-11-19 | F. Hoffmann-La Roche Ag | Devices and methods for sample analysis |
| US10878938B2 (en) | 2014-02-11 | 2020-12-29 | Seven Bridges Genomics Inc. | Systems and methods for analyzing sequence data |
| US11049587B2 (en) | 2013-10-18 | 2021-06-29 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences in the presence of repeating elements |
| WO2021148488A2 (en) | 2020-01-22 | 2021-07-29 | F. Hoffmann-La Roche Ag | Microfluidic bead trapping devices and methods for next generation sequencing library preparation |
| WO2021249825A1 (en) | 2020-06-08 | 2021-12-16 | F. Hoffmann-La Roche Ag | Methods and compositions for detecting structural rearrangements in a genome |
| WO2022008578A1 (en) | 2020-07-08 | 2022-01-13 | F. Hoffmann-La Roche Ag | Targeted depletion of non-target library molecules using poison primers during target capture of next-generation sequencing libraries |
| US11250931B2 (en) | 2016-09-01 | 2022-02-15 | Seven Bridges Genomics Inc. | Systems and methods for detecting recombination |
| US11289177B2 (en) | 2016-08-08 | 2022-03-29 | Seven Bridges Genomics, Inc. | Computer method and system of identifying genomic mutations using graph-based local assembly |
| WO2022081741A1 (en) | 2020-10-15 | 2022-04-21 | Roche Sequencing Solutions, Inc. | Electrophoretic devices and methods for next-generation sequencing library preparation |
| US11347844B2 (en) | 2017-03-01 | 2022-05-31 | Seven Bridges Genomics, Inc. | Data security in bioinformatic sequence analysis |
| US11347704B2 (en) | 2015-10-16 | 2022-05-31 | Seven Bridges Genomics Inc. | Biological graph or sequence serialization |
| WO2022194764A1 (en) | 2021-03-15 | 2022-09-22 | F. Hoffmann-La Roche Ag | Targeted next-generation sequencing via anchored primer extension |
| WO2022200485A1 (en) | 2021-03-26 | 2022-09-29 | F. Hoffmann-La Roche Ag | Hybridization buffer formulations |
| US11810648B2 (en) | 2016-01-07 | 2023-11-07 | Seven Bridges Genomics Inc. | Systems and methods for adaptive local alignment for graph genomes |
| US11959838B2 (en) | 2015-11-06 | 2024-04-16 | Ventana Medical Systems, Inc. | Representative diagnostics |
| US12046325B2 (en) | 2018-02-14 | 2024-07-23 | Seven Bridges Genomics Inc. | System and method for sequence identification in reassembly variant calling |
| US12431217B2 (en) | 2014-01-10 | 2025-09-30 | Seven Bridges Genomics Inc. | Systems and methods for use of known alleles in read mapping |
| WO2026082489A1 (en) | 2024-10-18 | 2026-04-23 | F. Hoffmann-La Roche Ag | Universal pcr to boost molecule recovery in cell free dna library preparation and target enrichment workflows |
| US12633378B2 (en) | 2024-08-22 | 2026-05-19 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9670530B2 (en) * | 2014-01-30 | 2017-06-06 | Illumina, Inc. | Haplotype resolved genome sequencing |
| US10395759B2 (en) | 2015-05-18 | 2019-08-27 | Regeneron Pharmaceuticals, Inc. | Methods and systems for copy number variant detection |
| US10229519B2 (en) | 2015-05-22 | 2019-03-12 | The University Of British Columbia | Methods for the graphical representation of genomic sequence data |
| EP3414691A1 (en) | 2016-02-12 | 2018-12-19 | Regeneron Pharmaceuticals, Inc. | Methods and systems for detection of abnormal karyotypes |
| MX2020002664A (en) * | 2017-09-07 | 2020-09-25 | Regeneron Pharma | Systems and methods for leveraging relatedness in genomic data analysis. |
| EP3467690A1 (en) * | 2017-10-06 | 2019-04-10 | Emweb bvba | Improved alignment method for nucleic acid sequences |
| JP7054133B2 (en) * | 2017-11-09 | 2022-04-13 | 国立研究開発法人国立がん研究センター | Sequence analysis method, sequence analysis device, reference sequence generation method, reference sequence generator, program, and recording medium |
| US11848073B2 (en) * | 2019-04-03 | 2023-12-19 | University Of Central Florida Research Foundation, Inc. | Methods and system for efficient indexing for genetic genealogical discovery in large genotype databases |
| CN110033829B (en) * | 2019-04-11 | 2021-07-23 | 北京诺禾心康基因科技有限公司 | Fusion detection method of homologous genes based on differential SNP markers |
| CN110060737B (en) * | 2019-04-30 | 2023-04-18 | 上海诚明融鑫科技有限公司 | STR (short tandem repeat) quick comparison method and system based on maximum frequency virtual individuals |
| CA3140458A1 (en) * | 2019-06-27 | 2020-12-30 | Christopher Bremner | Laboratory automation system implementing efficient path for material and labware transfers |
| IL317959A (en) * | 2022-06-27 | 2025-02-01 | Illumina Inc | Generating and implementing a structural variation graph genome |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080003571A1 (en) * | 2005-02-01 | 2008-01-03 | Mckernan Kevin | Reagents, methods, and libraries for bead-based sequencing |
| US20090325145A1 (en) * | 2006-10-20 | 2009-12-31 | Erwin Sablon | Methodology for analysis of sequence variations within the hcv ns5b genomic region |
| WO2012096579A2 (en) * | 2011-01-14 | 2012-07-19 | Keygene N.V. | Paired end random sequence based genotyping |
| US20130073214A1 (en) * | 2011-09-20 | 2013-03-21 | Life Technologies Corporation | Systems and methods for identifying sequence variation |
| WO2013106737A1 (en) * | 2012-01-13 | 2013-07-18 | Data2Bio | Genotyping by next-generation sequencing |
Family Cites Families (137)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5242794A (en) | 1984-12-13 | 1993-09-07 | Applied Biosystems, Inc. | Detection of specific sequences in nucleic acids |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US5583024A (en) | 1985-12-02 | 1996-12-10 | The Regents Of The University Of California | Recombinant expression of Coleoptera luciferase |
| US4988617A (en) | 1988-03-25 | 1991-01-29 | California Institute Of Technology | Method of detecting a nucleotide change in nucleic acids |
| US5234809A (en) | 1989-03-23 | 1993-08-10 | Akzo N.V. | Process for isolating nucleic acid |
| US5494810A (en) | 1990-05-03 | 1996-02-27 | Cornell Research Foundation, Inc. | Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease |
| US5511158A (en) | 1994-08-04 | 1996-04-23 | Thinking Machines Corporation | System and method for creating and evolving directed graphs |
| US5750341A (en) | 1995-04-17 | 1998-05-12 | Lynx Therapeutics, Inc. | DNA sequencing by parallel oligonucleotide extensions |
| US5701256A (en) | 1995-05-31 | 1997-12-23 | Cold Spring Harbor Laboratory | Method and apparatus for biological sequence comparison |
| GB9620209D0 (en) | 1996-09-27 | 1996-11-13 | Cemu Bioteknik Ab | Method of sequencing DNA |
| US6054278A (en) | 1997-05-05 | 2000-04-25 | The Perkin-Elmer Corporation | Ribosomal RNA gene polymorphism based microorganism identification |
| JP2001516731A (en) | 1997-09-17 | 2001-10-02 | ジエントラ・システムズ・インコーポレーテツド | Apparatus and method for isolating nucleic acids |
| US6054276A (en) | 1998-02-23 | 2000-04-25 | Macevicz; Stephen C. | DNA restriction site mapping |
| US6223128B1 (en) | 1998-06-29 | 2001-04-24 | Dnstar, Inc. | DNA sequence assembly system |
| US6787308B2 (en) | 1998-07-30 | 2004-09-07 | Solexa Ltd. | Arrayed biomolecules and their use in sequencing |
| GB9901475D0 (en) | 1999-01-22 | 1999-03-17 | Pyrosequencing Ab | A method of DNA sequencing |
| US6818395B1 (en) | 1999-06-28 | 2004-11-16 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences |
| WO2001023610A2 (en) | 1999-09-29 | 2001-04-05 | Solexa Ltd. | Polynucleotide sequencing |
| US6582938B1 (en) | 2001-05-11 | 2003-06-24 | Affymetrix, Inc. | Amplification of nucleic acids |
| US6448717B1 (en) | 2000-07-17 | 2002-09-10 | Micron Technology, Inc. | Method and apparatuses for providing uniform electron beams from field emission displays |
| AU2001280581A1 (en) | 2000-07-18 | 2002-01-30 | Correlogic Systems, Inc. | A process for discriminating between biological states based on hidden patterns from biological data |
| NO20004869D0 (en) | 2000-09-28 | 2000-09-28 | Torbjoern Rognes | Method for fast optimal local sequence alignment using parallel processing |
| WO2002072892A1 (en) | 2001-03-12 | 2002-09-19 | California Institute Of Technology | Methods and apparatus for analyzing polynucleotide sequences by asynchronous base extension |
| US6890763B2 (en) | 2001-04-30 | 2005-05-10 | Syn X Pharma, Inc. | Biopolymer marker indicative of disease state having a molecular weight of 1350 daltons |
| US7809509B2 (en) | 2001-05-08 | 2010-10-05 | Ip Genesis, Inc. | Comparative mapping and assembly of nucleic acid sequences |
| US7577554B2 (en) | 2001-07-03 | 2009-08-18 | I2 Technologies Us, Inc. | Workflow modeling using an acyclic directed graph data structure |
| US20040023209A1 (en) | 2001-11-28 | 2004-02-05 | Jon Jonasson | Method for identifying microorganisms based on sequencing gene fragments |
| US6989100B2 (en) | 2002-05-09 | 2006-01-24 | Ppd Biomarker Discovery Sciences, Llc | Methods for time-alignment of liquid chromatography-mass spectrometry data |
| US7321623B2 (en) | 2002-10-01 | 2008-01-22 | Avocent Corporation | Video compression system |
| US7225324B2 (en) | 2002-10-31 | 2007-05-29 | Src Computers, Inc. | Multi-adaptive processing systems and techniques for enhancing parallelism and performance of computational functions |
| US8843356B2 (en) | 2002-12-27 | 2014-09-23 | Merck Sharp & Dohme Corp. | Computer systems and methods for associating genes with traits using cross species data |
| US7885840B2 (en) | 2003-01-07 | 2011-02-08 | Sap Aktiengesellschaft | System and method of flexible workflow management |
| US7575865B2 (en) | 2003-01-29 | 2009-08-18 | 454 Life Sciences Corporation | Methods of amplifying and sequencing nucleic acids |
| US7953891B2 (en) | 2003-03-18 | 2011-05-31 | Microsoft Corporation | Systems and methods for scheduling data flow execution based on an arbitrary graph describing the desired data flow |
| JP2005092719A (en) | 2003-09-19 | 2005-04-07 | Nec Corp | Haplotype estimation method, estimation device, and program |
| EP1682680B2 (en) | 2003-10-31 | 2018-03-21 | AB Advanced Genetic Analysis Corporation | Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof |
| US7169560B2 (en) | 2003-11-12 | 2007-01-30 | Helicos Biosciences Corporation | Short cycle methods for sequencing polynucleotides |
| US20060195266A1 (en) | 2005-02-25 | 2006-08-31 | Yeatman Timothy J | Methods for predicting cancer outcome and gene signatures for use therein |
| WO2005107412A2 (en) | 2004-04-30 | 2005-11-17 | Rosetta Inpharmatics Llc | Systems and methods for reconstruction gene networks in segregating populations |
| US7642511B2 (en) | 2004-09-30 | 2010-01-05 | Ut-Battelle, Llc | Ultra high mass range mass spectrometer systems |
| US8340914B2 (en) | 2004-11-08 | 2012-12-25 | Gatewood Joe M | Methods and systems for compressing and comparing genomic data |
| US7483585B2 (en) | 2004-12-01 | 2009-01-27 | Ati Technologies Ulc | Image compression using variable bit size run length encoding |
| CN101189345A (en) * | 2005-02-01 | 2008-05-28 | Ab先进基因分析公司 | Reagents, Methods, and Libraries for Bead-Based Sequencing |
| CA2615323A1 (en) | 2005-06-06 | 2007-12-21 | 454 Life Sciences Corporation | Paired end sequencing |
| US7329860B2 (en) | 2005-11-23 | 2008-02-12 | Illumina, Inc. | Confocal imaging methods and apparatus |
| KR100722504B1 (en) | 2006-01-18 | 2007-05-29 | 학교법인 포항공과대학교 | Nonlinear Process Plan Generation Method and Internet-based STEP-NC System |
| US7580918B2 (en) | 2006-03-03 | 2009-08-25 | Adobe Systems Incorporated | System and method of efficiently representing and searching directed acyclic graph structures in databases |
| GB2436564A (en) | 2006-03-31 | 2007-10-03 | Plant Bioscience Ltd | Prediction of heterosis and other traits by transcriptome analysis |
| US7282337B1 (en) | 2006-04-14 | 2007-10-16 | Helicos Biosciences Corporation | Methods for increasing accuracy of nucleic acid sequencing |
| US7702468B2 (en) | 2006-05-03 | 2010-04-20 | Population Diagnostics, Inc. | Evaluating genetic disorders |
| US7754429B2 (en) | 2006-10-06 | 2010-07-13 | Illumina Cambridge Limited | Method for pair-wise sequencing a plurity of target polynucleotides |
| EP2639578B1 (en) | 2006-12-14 | 2016-09-14 | Life Technologies Corporation | Apparatus for measuring analytes using large scale fet arrays |
| US8349167B2 (en) | 2006-12-14 | 2013-01-08 | Life Technologies Corporation | Methods and apparatus for detecting molecular interactions using FET arrays |
| US8262900B2 (en) | 2006-12-14 | 2012-09-11 | Life Technologies Corporation | Methods and apparatus for measuring analytes using large scale FET arrays |
| ATE521948T1 (en) | 2007-01-26 | 2011-09-15 | Illumina Inc | SYSTEM AND METHOD FOR NUCLEIC ACID SEQUENCING |
| US8165821B2 (en) | 2007-02-05 | 2012-04-24 | Applied Biosystems, Llc | System and methods for indel identification using short read sequencing |
| US8718951B2 (en) * | 2007-03-12 | 2014-05-06 | New York University | Methods, computer-accessible medium, and systems for generating a genome wide haplotype sequence |
| US8146099B2 (en) | 2007-09-27 | 2012-03-27 | Microsoft Corporation | Service-oriented pipeline based architecture |
| US20090119313A1 (en) | 2007-11-02 | 2009-05-07 | Ioactive Inc. | Determining structure of binary data using alignment algorithms |
| US8478544B2 (en) | 2007-11-21 | 2013-07-02 | Cosmosid Inc. | Direct identification and measurement of relative populations of microorganisms with direct DNA sequencing and probabilistic methods |
| US20090233809A1 (en) | 2008-03-04 | 2009-09-17 | Affymetrix, Inc. | Resequencing methods for identification of sequence variants |
| US8271206B2 (en) | 2008-04-21 | 2012-09-18 | Softgenetics Llc | DNA sequence assembly methods of short reads |
| US20100010992A1 (en) | 2008-07-10 | 2010-01-14 | Morris Robert P | Methods And Systems For Resolving A Location Information To A Network Identifier |
| KR100992169B1 (en) | 2008-07-25 | 2010-11-04 | 한국생명공학연구원 | Information Analysis Process Recommendation Design System and Method |
| US20100041048A1 (en) | 2008-07-31 | 2010-02-18 | The Johns Hopkins University | Circulating Mutant DNA to Assess Tumor Dynamics |
| US20100035252A1 (en) | 2008-08-08 | 2010-02-11 | Ion Torrent Systems Incorporated | Methods for sequencing individual nucleic acids under tension |
| WO2010033818A2 (en) | 2008-09-19 | 2010-03-25 | Immune Disease Institute, Inc. | Mirna targets |
| US20100301398A1 (en) | 2009-05-29 | 2010-12-02 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| US8546128B2 (en) | 2008-10-22 | 2013-10-01 | Life Technologies Corporation | Fluidics system for sequential delivery of reagents |
| US20100137143A1 (en) | 2008-10-22 | 2010-06-03 | Ion Torrent Systems Incorporated | Methods and apparatus for measuring analytes |
| US8691510B2 (en) | 2008-11-07 | 2014-04-08 | Sequenta, Inc. | Sequence analysis of complex amplicons |
| WO2010059235A2 (en) | 2008-11-20 | 2010-05-27 | Pacific Biosciences Of California, Inc. | Algorithms for sequence determination |
| US10839940B2 (en) | 2008-12-24 | 2020-11-17 | New York University | Method, computer-accessible medium and systems for score-driven whole-genome shotgun sequence assemble |
| AU2010210666C1 (en) | 2009-02-03 | 2016-01-28 | Ande Corporation | Nucleic acid purification |
| US8352195B2 (en) | 2009-03-20 | 2013-01-08 | Siemens Corporation | Methods and systems for identifying PCR primers specific to one or more target genomes |
| EP2430441B1 (en) | 2009-04-29 | 2018-06-13 | Complete Genomics, Inc. | Method and system for calling variations in a sample polynucleotide sequence with respect to a reference polynucleotide sequence |
| US8673627B2 (en) | 2009-05-29 | 2014-03-18 | Life Technologies Corporation | Apparatus and methods for performing electrochemical reactions |
| US8574835B2 (en) | 2009-05-29 | 2013-11-05 | Life Technologies Corporation | Scaffolded nucleic acid polymer particles and methods of making and using |
| US9524369B2 (en) | 2009-06-15 | 2016-12-20 | Complete Genomics, Inc. | Processing and analysis of complex nucleic acid sequence data |
| US20110098193A1 (en) | 2009-10-22 | 2011-04-28 | Kingsmore Stephen F | Methods and Systems for Medical Sequencing Analysis |
| CN102918536A (en) | 2010-01-14 | 2013-02-06 | 氟石科技公司 | 3D plant modeling systems and methods |
| US20130210645A1 (en) | 2010-02-18 | 2013-08-15 | The Johns Hopkins University | Personalized tumor biomarkers |
| US20110257889A1 (en) | 2010-02-24 | 2011-10-20 | Pacific Biosciences Of California, Inc. | Sequence assembly and consensus sequence determination |
| US9165109B2 (en) | 2010-02-24 | 2015-10-20 | Pacific Biosciences Of California, Inc. | Sequence assembly and consensus sequence determination |
| US20120053845A1 (en) | 2010-04-27 | 2012-03-01 | Jeremy Bruestle | Method and system for analysis and error correction of biological sequences and inference of relationship for multiple samples |
| US20120030566A1 (en) | 2010-07-28 | 2012-02-02 | Victor B Michael | System with touch-based selection of data items |
| EP2614161B1 (en) | 2010-09-09 | 2020-11-04 | Fabric Genomics, Inc. | Variant annotation, analysis and selection tool |
| RU2565550C2 (en) | 2010-09-24 | 2015-10-20 | Те Борд Оф Трастиз Оф Те Лилэнд Стэнфорд Джуниор Юниверсити | Direct capture, amplification and sequencing of target dna using immobilised primers |
| RU2013138422A (en) | 2011-01-19 | 2015-02-27 | Конинклейке Филипс Электроникс Н.В. | METHOD FOR PROCESSING GENOMIC DATA |
| US20120239706A1 (en) | 2011-03-18 | 2012-09-20 | Los Alamos National Security, Llc | Computer-facilitated parallel information alignment and analysis |
| AU2012242525B2 (en) | 2011-04-14 | 2015-09-17 | Complete Genomics, Inc. | Processing and analysis of complex nucleic acid sequence data |
| US9506167B2 (en) | 2011-07-29 | 2016-11-29 | Ginkgo Bioworks, Inc. | Methods and systems for cell state quantification |
| WO2013035904A1 (en) | 2011-09-08 | 2013-03-14 | 한국과학기술정보연구원 | System and method for processing bio information analysis pipeline |
| KR101282798B1 (en) | 2011-09-08 | 2013-07-04 | 한국과학기술정보연구원 | System and method for processing bio information analysis pipeline |
| EP2608096B1 (en) | 2011-12-24 | 2020-08-05 | Tata Consultancy Services Ltd. | Compression of genomic data file |
| WO2013097257A1 (en) | 2011-12-31 | 2013-07-04 | 深圳华大基因科技有限公司 | Method and system for testing fusion gene |
| US9047133B2 (en) | 2012-03-02 | 2015-06-02 | Vmware, Inc. | Single, logical, multi-tier application blueprint used for deployment and management of multiple physical applications in a cloud environment |
| US9552458B2 (en) | 2012-03-16 | 2017-01-24 | The Research Institute At Nationwide Children's Hospital | Comprehensive analysis pipeline for discovery of human genetic variation |
| US8209130B1 (en) * | 2012-04-04 | 2012-06-26 | Good Start Genetics, Inc. | Sequence assembly |
| US20130345066A1 (en) | 2012-05-09 | 2013-12-26 | Life Technologies Corporation | Systems and methods for identifying sequence variation |
| US20130324417A1 (en) | 2012-06-04 | 2013-12-05 | Good Start Genetics, Inc. | Determining the clinical significance of variant sequences |
| US9104656B2 (en) | 2012-07-03 | 2015-08-11 | International Business Machines Corporation | Using lexical analysis and parsing in genome research |
| US10777301B2 (en) | 2012-07-13 | 2020-09-15 | Pacific Biosciences For California, Inc. | Hierarchical genome assembly method using single long insert library |
| CN104756445A (en) | 2012-11-06 | 2015-07-01 | 惠普发展公司,有限责任合伙企业 | Enhanced graph traversal |
| US20140129201A1 (en) | 2012-11-07 | 2014-05-08 | Good Start Genetics, Inc. | Validation of genetic tests |
| WO2014113204A1 (en) | 2013-01-17 | 2014-07-24 | Personalis, Inc. | Methods and systems for genetic analysis |
| US10346551B2 (en) | 2013-01-24 | 2019-07-09 | New York University | Systems, methods and computer-accessible mediums for utilizing pattern matching in stringomes |
| US10032195B2 (en) | 2013-03-13 | 2018-07-24 | Airline Tariff Publishing Company | System, method and computer program product for providing a fare analytic engine |
| US9087007B2 (en) | 2013-03-14 | 2015-07-21 | International Business Machines Corporation | Generating fault tolerant connectivity API |
| WO2014170762A2 (en) | 2013-03-15 | 2014-10-23 | James Webber | Graph database devices and methods for partitioning graphs |
| US9189224B2 (en) | 2013-07-11 | 2015-11-17 | Oracle International Corporation | Forming an upgrade recommendation in a cloud computing environment |
| US9898575B2 (en) | 2013-08-21 | 2018-02-20 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences |
| US9116866B2 (en) | 2013-08-21 | 2015-08-25 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US20150066383A1 (en) | 2013-09-03 | 2015-03-05 | Seven Bridges Genomics Inc. | Collapsible modular genomic pipeline |
| EP3053073B1 (en) | 2013-09-30 | 2019-07-03 | Seven Bridges Genomics Inc. | Methods and system for detecting sequence variants |
| WO2015050919A1 (en) | 2013-10-01 | 2015-04-09 | Life Technologies Corporation | Systems and methods for detecting structural variants |
| CN106103736B (en) | 2013-10-15 | 2020-03-03 | 瑞泽恩制药公司 | High resolution allele identification |
| US10832797B2 (en) | 2013-10-18 | 2020-11-10 | Seven Bridges Genomics Inc. | Method and system for quantifying sequence alignment |
| US11049587B2 (en) | 2013-10-18 | 2021-06-29 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences in the presence of repeating elements |
| CN105793689B (en) | 2013-10-18 | 2020-04-17 | 七桥基因公司 | Methods and systems for genotyping genetic samples |
| EP3058093B1 (en) | 2013-10-18 | 2019-07-17 | Seven Bridges Genomics Inc. | Methods and systems for identifying disease-induced mutations |
| US9063914B2 (en) | 2013-10-21 | 2015-06-23 | Seven Bridges Genomics Inc. | Systems and methods for transcriptome analysis |
| AU2015204819B2 (en) | 2014-01-10 | 2021-05-06 | Seven Bridges Genomics Inc. | Systems and methods for use of known alleles in read mapping |
| US9817944B2 (en) | 2014-02-11 | 2017-11-14 | Seven Bridges Genomics Inc. | Systems and methods for analyzing sequence data |
| US10192026B2 (en) | 2015-03-05 | 2019-01-29 | Seven Bridges Genomics Inc. | Systems and methods for genomic pattern analysis |
| US20160364523A1 (en) | 2015-06-11 | 2016-12-15 | Seven Bridges Genomics Inc. | Systems and methods for identifying microorganisms |
| US10793895B2 (en) | 2015-08-24 | 2020-10-06 | Seven Bridges Genomics Inc. | Systems and methods for epigenetic analysis |
| US10584380B2 (en) | 2015-09-01 | 2020-03-10 | Seven Bridges Genomics Inc. | Systems and methods for mitochondrial analysis |
| US10724110B2 (en) | 2015-09-01 | 2020-07-28 | Seven Bridges Genomics Inc. | Systems and methods for analyzing viral nucleic acids |
| US11347704B2 (en) | 2015-10-16 | 2022-05-31 | Seven Bridges Genomics Inc. | Biological graph or sequence serialization |
| US20170193351A1 (en) | 2015-12-30 | 2017-07-06 | Micron Technology, Inc. | Methods and systems for vector length management |
| US20170199960A1 (en) | 2016-01-07 | 2017-07-13 | Seven Bridges Genomics Inc. | Systems and methods for adaptive local alignment for graph genomes |
| US20170199959A1 (en) | 2016-01-13 | 2017-07-13 | Seven Bridges Genomics Inc. | Genetic analysis systems and methods |
| US10364468B2 (en) | 2016-01-13 | 2019-07-30 | Seven Bridges Genomics Inc. | Systems and methods for analyzing circulating tumor DNA |
| US10262102B2 (en) | 2016-02-24 | 2019-04-16 | Seven Bridges Genomics Inc. | Systems and methods for genotyping with graph reference |
| US10832979B2 (en) * | 2018-02-22 | 2020-11-10 | Lam Research Corporation | Feedback control system for iterative etch process |
-
2014
- 2014-10-17 CN CN201480066185.4A patent/CN105793689B/en not_active Expired - Fee Related
- 2014-10-17 CA CA2927102A patent/CA2927102C/en active Active
- 2014-10-17 US US14/517,406 patent/US10078724B2/en active Active
- 2014-10-17 AU AU2014337089A patent/AU2014337089B2/en active Active
- 2014-10-17 EP EP14854801.9A patent/EP3058332B1/en active Active
- 2014-10-17 JP JP2016523194A patent/JP2017500004A/en active Pending
- 2014-10-17 WO PCT/US2014/061156 patent/WO2015058093A1/en not_active Ceased
- 2014-10-17 KR KR1020167012613A patent/KR20160062763A/en not_active Withdrawn
- 2014-10-17 SG SG11201602903XA patent/SG11201602903XA/en unknown
-
2018
- 2018-09-18 US US16/134,619 patent/US12040051B2/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080003571A1 (en) * | 2005-02-01 | 2008-01-03 | Mckernan Kevin | Reagents, methods, and libraries for bead-based sequencing |
| US20090325145A1 (en) * | 2006-10-20 | 2009-12-31 | Erwin Sablon | Methodology for analysis of sequence variations within the hcv ns5b genomic region |
| WO2012096579A2 (en) * | 2011-01-14 | 2012-07-19 | Keygene N.V. | Paired end random sequence based genotyping |
| US20130073214A1 (en) * | 2011-09-20 | 2013-03-21 | Life Technologies Corporation | Systems and methods for identifying sequence variation |
| WO2013106737A1 (en) * | 2012-01-13 | 2013-07-18 | Data2Bio | Genotyping by next-generation sequencing |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP3058332A4 * |
Cited By (63)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11211146B2 (en) | 2013-08-21 | 2021-12-28 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences |
| US11488688B2 (en) | 2013-08-21 | 2022-11-01 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US11837328B2 (en) | 2013-08-21 | 2023-12-05 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US9898575B2 (en) | 2013-08-21 | 2018-02-20 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences |
| US9904763B2 (en) | 2013-08-21 | 2018-02-27 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US10325675B2 (en) | 2013-08-21 | 2019-06-18 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US12106826B2 (en) | 2013-08-21 | 2024-10-01 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US10078724B2 (en) | 2013-10-18 | 2018-09-18 | Seven Bridges Genomics Inc. | Methods and systems for genotyping genetic samples |
| US11447828B2 (en) | 2013-10-18 | 2022-09-20 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| US10832797B2 (en) | 2013-10-18 | 2020-11-10 | Seven Bridges Genomics Inc. | Method and system for quantifying sequence alignment |
| US11049587B2 (en) | 2013-10-18 | 2021-06-29 | Seven Bridges Genomics Inc. | Methods and systems for aligning sequences in the presence of repeating elements |
| US10053736B2 (en) | 2013-10-18 | 2018-08-21 | Seven Bridges Genomics Inc. | Methods and systems for identifying disease-induced mutations |
| US12040051B2 (en) | 2013-10-18 | 2024-07-16 | Seven Bridges Genomics Inc. | Methods and systems for genotyping genetic samples |
| US10055539B2 (en) | 2013-10-21 | 2018-08-21 | Seven Bridges Genomics Inc. | Systems and methods for using paired-end data in directed acyclic structure |
| US10204207B2 (en) | 2013-10-21 | 2019-02-12 | Seven Bridges Genomics Inc. | Systems and methods for transcriptome analysis |
| US12431217B2 (en) | 2014-01-10 | 2025-09-30 | Seven Bridges Genomics Inc. | Systems and methods for use of known alleles in read mapping |
| US10878938B2 (en) | 2014-02-11 | 2020-12-29 | Seven Bridges Genomics Inc. | Systems and methods for analyzing sequence data |
| US11756652B2 (en) | 2014-02-11 | 2023-09-12 | Seven Bridges Genomics Inc. | Systems and methods for analyzing sequence data |
| US10192026B2 (en) | 2015-03-05 | 2019-01-29 | Seven Bridges Genomics Inc. | Systems and methods for genomic pattern analysis |
| WO2016201215A1 (en) * | 2015-06-11 | 2016-12-15 | Seven Bridges Genomics Inc. | Systems and methods for identifying microorganisms |
| US12365933B2 (en) | 2015-08-24 | 2025-07-22 | Seven Bridges Genomics Inc. | Systems and methods for epigenetic analysis |
| US10793895B2 (en) | 2015-08-24 | 2020-10-06 | Seven Bridges Genomics Inc. | Systems and methods for epigenetic analysis |
| US11697835B2 (en) | 2015-08-24 | 2023-07-11 | Seven Bridges Genomics Inc. | Systems and methods for epigenetic analysis |
| US10724110B2 (en) | 2015-09-01 | 2020-07-28 | Seven Bridges Genomics Inc. | Systems and methods for analyzing viral nucleic acids |
| US11649495B2 (en) | 2015-09-01 | 2023-05-16 | Seven Bridges Genomics Inc. | Systems and methods for mitochondrial analysis |
| US11702708B2 (en) | 2015-09-01 | 2023-07-18 | Seven Bridges Genomics Inc. | Systems and methods for analyzing viral nucleic acids |
| US10584380B2 (en) | 2015-09-01 | 2020-03-10 | Seven Bridges Genomics Inc. | Systems and methods for mitochondrial analysis |
| US12173374B2 (en) | 2015-09-01 | 2024-12-24 | Seven Bridges Genomics Inc. | Systems and methods for analyzing viral nucleic acids |
| US11347704B2 (en) | 2015-10-16 | 2022-05-31 | Seven Bridges Genomics Inc. | Biological graph or sequence serialization |
| US11959838B2 (en) | 2015-11-06 | 2024-04-16 | Ventana Medical Systems, Inc. | Representative diagnostics |
| US11810648B2 (en) | 2016-01-07 | 2023-11-07 | Seven Bridges Genomics Inc. | Systems and methods for adaptive local alignment for graph genomes |
| US10364468B2 (en) | 2016-01-13 | 2019-07-30 | Seven Bridges Genomics Inc. | Systems and methods for analyzing circulating tumor DNA |
| US11560598B2 (en) | 2016-01-13 | 2023-01-24 | Seven Bridges Genomics Inc. | Systems and methods for analyzing circulating tumor DNA |
| WO2017123316A1 (en) | 2016-01-15 | 2017-07-20 | Ventana Medical Systems, Inc. | Deep sequencing profiling of tumors |
| US10460829B2 (en) | 2016-01-26 | 2019-10-29 | Seven Bridges Genomics Inc. | Systems and methods for encoding genetic variation for a population |
| JP2017146928A (en) * | 2016-02-19 | 2017-08-24 | 富士通株式会社 | Variant information processing device, method, and program |
| US10262102B2 (en) | 2016-02-24 | 2019-04-16 | Seven Bridges Genomics Inc. | Systems and methods for genotyping with graph reference |
| US10790044B2 (en) | 2016-05-19 | 2020-09-29 | Seven Bridges Genomics Inc. | Systems and methods for sequence encoding, storage, and compression |
| US12412640B2 (en) | 2016-07-13 | 2025-09-09 | Seven Bridges Genomics Uk, Ltd. | Systems and methods for reconciling variants in sequence data relative to reference sequence data |
| US10600499B2 (en) | 2016-07-13 | 2020-03-24 | Seven Bridges Genomics Inc. | Systems and methods for reconciling variants in sequence data relative to reference sequence data |
| US11289177B2 (en) | 2016-08-08 | 2022-03-29 | Seven Bridges Genomics, Inc. | Computer method and system of identifying genomic mutations using graph-based local assembly |
| US12580046B2 (en) | 2016-08-08 | 2026-03-17 | Seven Bridges Genomics Inc. | Computer method and system of identifying genomic mutations using graph-based local assembly |
| US11250931B2 (en) | 2016-09-01 | 2022-02-15 | Seven Bridges Genomics Inc. | Systems and methods for detecting recombination |
| US12482535B2 (en) | 2016-09-01 | 2025-11-25 | Seven Bridges Genomics Inc. | Systems and methods for detecting recombination |
| US11062793B2 (en) | 2016-11-16 | 2021-07-13 | Seven Bridges Genomics Inc. | Systems and methods for aligning sequences to graph references |
| US10319465B2 (en) | 2016-11-16 | 2019-06-11 | Seven Bridges Genomics Inc. | Systems and methods for aligning sequences to graph references |
| US11347844B2 (en) | 2017-03-01 | 2022-05-31 | Seven Bridges Genomics, Inc. | Data security in bioinformatic sequence analysis |
| US10726110B2 (en) | 2017-03-01 | 2020-07-28 | Seven Bridges Genomics, Inc. | Watermarking for data security in bioinformatic sequence analysis |
| WO2018189040A1 (en) | 2017-04-14 | 2018-10-18 | Ventana Medical Systems, Inc. | Size-based separation of dissociated fixed tissues |
| WO2019092269A1 (en) | 2017-11-13 | 2019-05-16 | F. Hoffmann-La Roche Ag | Devices for sample analysis using epitachophoresis |
| US12046325B2 (en) | 2018-02-14 | 2024-07-23 | Seven Bridges Genomics Inc. | System and method for sequence identification in reassembly variant calling |
| WO2020074742A1 (en) | 2018-10-12 | 2020-04-16 | F. Hoffmann-La Roche Ag | Detection methods for epitachophoresis workflow automation |
| WO2020112566A1 (en) | 2018-11-29 | 2020-06-04 | Ventana Medical Systems, Inc. | Personalized ctdna disease monitoring via representative dna sequencing |
| WO2020136133A1 (en) | 2018-12-23 | 2020-07-02 | F. Hoffmann-La Roche Ag | Tumor classification based on predicted tumor mutational burden |
| WO2020229437A1 (en) | 2019-05-14 | 2020-11-19 | F. Hoffmann-La Roche Ag | Devices and methods for sample analysis |
| WO2021148488A2 (en) | 2020-01-22 | 2021-07-29 | F. Hoffmann-La Roche Ag | Microfluidic bead trapping devices and methods for next generation sequencing library preparation |
| WO2021249825A1 (en) | 2020-06-08 | 2021-12-16 | F. Hoffmann-La Roche Ag | Methods and compositions for detecting structural rearrangements in a genome |
| WO2022008578A1 (en) | 2020-07-08 | 2022-01-13 | F. Hoffmann-La Roche Ag | Targeted depletion of non-target library molecules using poison primers during target capture of next-generation sequencing libraries |
| WO2022081741A1 (en) | 2020-10-15 | 2022-04-21 | Roche Sequencing Solutions, Inc. | Electrophoretic devices and methods for next-generation sequencing library preparation |
| WO2022194764A1 (en) | 2021-03-15 | 2022-09-22 | F. Hoffmann-La Roche Ag | Targeted next-generation sequencing via anchored primer extension |
| WO2022200485A1 (en) | 2021-03-26 | 2022-09-29 | F. Hoffmann-La Roche Ag | Hybridization buffer formulations |
| US12633378B2 (en) | 2024-08-22 | 2026-05-19 | Seven Bridges Genomics Inc. | Methods and systems for detecting sequence variants |
| WO2026082489A1 (en) | 2024-10-18 | 2026-04-23 | F. Hoffmann-La Roche Ag | Universal pcr to boost molecule recovery in cell free dna library preparation and target enrichment workflows |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2017500004A (en) | 2017-01-05 |
| CN105793689A (en) | 2016-07-20 |
| US20150199472A1 (en) | 2015-07-16 |
| US12040051B2 (en) | 2024-07-16 |
| EP3058332B1 (en) | 2019-08-28 |
| CA2927102C (en) | 2022-08-30 |
| SG11201602903XA (en) | 2016-05-30 |
| EP3058332A1 (en) | 2016-08-24 |
| US10078724B2 (en) | 2018-09-18 |
| AU2014337089A1 (en) | 2016-05-05 |
| AU2014337089B2 (en) | 2019-08-08 |
| KR20160062763A (en) | 2016-06-02 |
| CA2927102A1 (en) | 2015-04-23 |
| US20190272891A1 (en) | 2019-09-05 |
| EP3058332A4 (en) | 2017-05-10 |
| CN105793689B (en) | 2020-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12106826B2 (en) | Methods and systems for detecting sequence variants | |
| US12040051B2 (en) | Methods and systems for genotyping genetic samples | |
| US11211146B2 (en) | Methods and systems for aligning sequences | |
| US20210280272A1 (en) | Methods and systems for quantifying sequence alignment | |
| US20210398616A1 (en) | Methods and systems for aligning sequences in the presence of repeating elements | |
| AU2014324438B2 (en) | Methods and system for detecting sequence variants | |
| US12633378B2 (en) | Methods and systems for detecting sequence variants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14854801 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2927102 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2016523194 Country of ref document: JP Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2014854801 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2014854801 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2014337089 Country of ref document: AU Date of ref document: 20141017 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20167012613 Country of ref document: KR Kind code of ref document: A |
