WO2015055558A1 - Protein expression system - Google Patents
Protein expression system Download PDFInfo
- Publication number
- WO2015055558A1 WO2015055558A1 PCT/EP2014/071847 EP2014071847W WO2015055558A1 WO 2015055558 A1 WO2015055558 A1 WO 2015055558A1 EP 2014071847 W EP2014071847 W EP 2014071847W WO 2015055558 A1 WO2015055558 A1 WO 2015055558A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- host cell
- essential
- polypeptide
- mutated
- essential gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/10—Vectors comprising a special translation-regulating system regulates levels of translation
Definitions
- the present invention relates to a novel host cell deficient in an essential gene and comprising a vector containing a mutated essential gene, to a method for producing said host cell, to a method for producing a compound of interest using said host cell, to the use of said host cell and to a vector containing the mutated essential gene.
- Stable expression systems are essential for the production of compounds of interest by recombinant host cells.
- Recombinant hosts cells that are genetically modified to produce e.g. a heterologous protein of interest or higher levels of a homologous protein, have a competitive disadvantage over cells which have not been genetically modified. Wild type cells are fitter than their genetically modified counterparts and will outgrow the producing cells in fermentations leading to loss of yield in protein production.
- Recombinant expression vectors are used to genetically modify host cells and to induce them to the expression of useful compounds, e.g. for expression of heterologous proteins or for the overexpression of homologous proteins.
- Plasmids are autonomously replicating vectors, i.e. circular DNA molecules that replicate independently from the host genome.
- Plasmids have been used in prokaryotes in both fundamental and biotechnological studies aimed to understand cellular processes, or to produce commercially interesting products such as enzymes, metabolites etc. However, unlike some naturally occurring plasmids, recombinant plasmids are inherently unstable in bacteria and require positive selection to be retained in the cell at a satisfactory level.
- Such positive selection can be achieved by expressing an antibiotic resistance marker on the plasmid and supplementing the media with antibiotics.
- adding antibiotics to industrial fermentation is undesirable.
- the presence of antibiotics generally is not accepted in the final product and waste waters and therefore additional purification steps are necessary after the fermentation process, leading to higher production costs.
- auxotrophic markers can be used to achieve positive selection.
- the latter use requires pure and defined media which are costly for the production at an industrial scale.
- the enzyme alanine racemase converts L-alanine into D-alanine.
- D-alanine is an essential building block of peptidoglycan that forms the basic component of the cell wall (Watanabe A, Yoshimura T, Mikami B, Hayashi H, Kagamiyama H, Esaki N. (2002)).
- B. subtilis alanine racemase is encoded by the dal gene. In prokaryotes the gene coding for the enzyme alanine racemase has been used as selectable marker. In B. subtilis the dal gene was deleted from the genome and placed on a multi copy plasmid which resulted in stable maintenance of the plasmid (Ferrari, E. et al. (1985).
- the plasmid was stably maintained within the host cell, however the plasmid copy number was not controlled. Reduction of plasmid copy number in the host cell which is suffering from the burden of producing high levels of proteins of interest will reduce protein productivity even though still allowing the cell to proliferate as only minor levels of alanine racemase are needed for vital cell growth.
- Spreng et al (Vaccine (2005) 23: 2060-2065) describe plasmid maintenance systems suitable for GMO-based bacterial vaccines.
- One of these systems was based on complementation of the asd gene, coding for aspartate-beta-semi-aldehyde dehydrogenase, another enzyme involved in the biosynthesis of bacterial cell peptidoglycans.
- S. typhimurium Aasd mutants were transformed with plasmids carrying the asd gene and a gene coding for an heterologous antigen.
- the asd -35 and -10 promoter region was depleted with the purpose of reducing the level of Asd expression.
- the significantly reduced expression of Asd protein resulted in enhanced immunogenicity and enabled stable expression of the somewhat toxic antigen, the PspA protein of Streptococcus pneumonie.
- Vidal et al J. Biotech. (2008) 134: 127-1366 describes an antibiotic-free plasmid selection system based on glycine auxotrophy for recombinant protein overexpression in Escherichia coli.
- E. coli M15-derivated glycine auxotrophic strains were transformed with complementation plasmid carrying the glyA homologous gene under the control of a constitutive weak promoter.
- This vector-host system allowed overproduction of rhamnulose 1 -phosphate aldolase in antibiotic-free medium.
- auxotrophic marker like pyrG - uracil
- a dominant marker like amdS - N-source or ble R - phleomycine
- WO2012123429 disclosed a vector-host system where the stability of the vector comprising an autonomous replication sequence was substantially increased in filamentous fungi, said vector-host system comprising a filamentous fungal host cell deficient in an essential gene, comprising a vector, said vector comprising at least said essential gene and an autonomous replication sequence.
- a heterologous aurl gene from A. nidulans was used for complementation of an aurl -deficient Penicillium chrysogenum, leading to a higher copy number of this plasmid if compared to the use of the heterologous aurl gene.
- Vasavada (Advances in Applied Microbiology (1995) 41 : 25-54) describes strategies for improving productivity of heterologous proteins in recombinant Saccharomyces cerevisiae fermentations.
- overexpression of heterologous proteins was achieved using multi-copy plasmids, carrying auxotrophic markers complementing a cell deficiency.
- the leucine marker Leu2-d with a defective leucine promoter was used.
- the plasmid copy number increased to supply enough leucine for the host to grow. There still remains a need for stable vector-host systems wherein the vector is maintained in high copy number into the host.
- a host cell deficient in an essential gene coding for an essential polypeptide comprising a vector carrying a mutated essential gene complementing at least in part said deficiency, can be used in the production of a compound of interest with high yield.
- the present invention provides a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene.
- the mutated essential gene is selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- the present invention further provides a method for the production of a host cell according to the invention, which method comprises:
- a vector comprising at least an autonomous replication sequence and a mutated essential gene
- the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide;
- step a) transforming the mutant host cell of step a) with the vector of step b), optionally wherein step a), b) and c) are performed simultaneously.
- the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- the present invention also provides a method for the production of a compound of interest comprising
- the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- Fig. 1 sets out the plasmid map of pGB20.
- Fig. 2 sets out the plasmid map of the dal deletion plasmid pGB23.
- Fig. 3 sets out the plasmid map of the D-alanine racemase Dal plasmid pGBB1 1 comprising a wild-type (unmodified) dal expression cassette.
- Fig. 4 sets out the plasmid map of pGBB1 1AMY1 for expression of amyM and complementation of the dal deletion by a wild-type (unmodified) dal expression cassette of pGBB1 1.
- Fig. 5 sets out the relative plasmid copy number (PCN) (black bars) and relative amyM enzymatic activity (white bars) of fermentations with low and high amyM productivity.
- the low productivity fermentation was set to 100% for both the PCN and amyM expression.
- Fig. 6 sets out glucan 1 ,4-a-maltohydrolase productivity in B. subtilis strains
- AMYB227A1 and AMYB227K1 in shake flasks at 48 hours in SMM medium.
- Fig. 7 sets out the relative dal protein amount of B. subtilis strains BS154,
- SEQ ID NO: 2 sets out the sequence of the reverse cheA primer for qPCR.
- SEQ ID NO: 3 sets out the sequence of the forward amyM primer for qPCR.
- SEQ ID NO: 4 sets out the sequence of the reverse amyM primer for qPCR.
- SEQ ID NO: 5 sets out the sequence of the forward primer to amplify the 5'- dal region.
- SEQ ID NO: 6 sets out the sequence of the reverse primer to amplify the 5'- dal region.
- SEQ ID NO: 7 sets out the sequence of the forward primer to amplify the 3'- dal region.
- SEQ ID NO: 8 sets out the sequence of the reverse primer to amplify the 3'- dal region.
- SEQ ID NO: 9 sets out the sequence of the forward primer to amplify the dal locus outside the 5'-flank.
- SEQ ID NO: 10 sets out the sequence of the reverse primer to amplify the dal locus outside the 3'-flank.
- SEQ ID NO: 1 1 sets out the sequence of the forward primer to amplify the amyM gene and introduce a Nde ⁇ site.
- SEQ ID NO: 12 sets out the sequence of the reverse primer to amplify the amyM gene and introduce a H/ndlM site.
- SEQ ID NO: 13 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp insertion on pGBB1 1AMY1 and to yield pGBB12AMY.
- SEQ ID NO: 14 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp insertion on pGBB1 1AMY1 and to yield pGBB12AMY.
- SEQ ID NO: 15 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp insertion on pGBB1 1AMY1 and to yield pGBB13AMY.
- SEQ ID NO: 16 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp insertion on pGBB1 1AMY1 and to yield pGBB13AMY.
- SEQ ID NO: 17 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp deletion on pGBB1 1AMY1 and to yield pGBB14AMY.
- SEQ ID NO: 18 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp deletion on pGBB1 1AMY1 and to yield pGBB14AMY.
- SEQ ID NO: 19 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp deletion on pGBB1 1AMY1 and to yield pGBB15AMY.
- SEQ ID NO: 20 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp deletion pGBB1 1AMY1 and to yield pGBB15AMY.
- SEQ ID NO: 21 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 4 bp random substitution on pGBB1 1AMY1 and to yield pGBB16AMY.
- SEQ ID NO: 22 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 4 bp random substitution on pGBB1 1AMY1 and to yield pGBB16AMY.
- SEQ ID NO: 23 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp substitution on pGBB1 1AMY1 and to yield pGBB17AMY.
- SEQ ID NO: 24 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp substitution on pGBB1 1AMY1 and to yield pGBB17AMY.
- SEQ ID NO: 25 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp substitution on pGBB1 1AMY1 and to yield pGBB18AMY.
- SEQ ID NO: 26 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp substitution on pGBB1 1AMY1 and to yield pGBB18AMY.
- SEQ ID NO: 27 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 3 bp substitution on pGBB1 1AMY1 and to yield pGBB19AMY.
- SEQ ID NO: 28 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 3 bp substitution on pGBB1 1AMY1 and to yield pGBB19AMY.
- SEQ ID NO: 29 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 4 bp substitution on pGBB1 1AMY1 and to yield pGBB20AMY.
- SEQ ID NO: 30 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 4 bp substitution on pGBB1 1AMY1 and to yield pGBB20AMY.
- SEQ ID NO: 31 sets out the sequence of the forward primer to mutate the dal RBS to introduce a 4 bp substitution and introduce a BglW site on pGBB1 1AMY1 and to yield pGBB21AMY.
- SEQ ID NO: 32 sets out the sequence of the reverse primer to mutate the dal RBS to introduce a 4 bp substitution and introduce a BglW site on pGBB1 1AMY1 and to yield pGBB21AMY.
- SEQ ID NO: 33 sets out the sequence of the native RBS sequence of dal gene directly upstream of the dal AJG start codon.
- SEQ ID NO: 34 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal AJG start codon, comprising an insertion of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 35 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal AJG start codon, comprising an insertion of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 36 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a deletion of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 37 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a deletion of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 38 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a random substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 39 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 40 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 41 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 3 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 42 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 43 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
- SEQ ID NO: 44 sets out the sequence of the dal gene obtained from Bacillus subtilis.
- SEQ ID NO: 45 sets out the sequence of the protein D-alanine racemase encoded by the dal gene (UNIPROT:P10725) obtained from Bacillus subtilis.
- SEQ ID NO: 46 sets out the nucleotide sequence of the amyM gene obtained from Geobacillus stearothermophilus .
- SEQ ID NO: 47 sets out the sequence of the glucan 1 ,4-a-maltohydrolase obtained from Geobacillus stearothermophilus encoded by the amyiW gene. Detailed description of the invention
- a host cell deficient in an essential gene coding for an essential polypeptide comprising a vector carrying a mutated essential gene wherein expression of said mutated essential gene in said host cell is lowered or wherein the expressed polypeptide has the same function but a lower enzymatic activity (or lower specific enzymatic activity) if compared to the polypeptide coded by the essential gene (i.e. the essential polypeptide), can be used in the production of a compound of interest with high yield.
- the present invention provides a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene.
- the mutated essential gene does or does not comprise a mutation in the region of the promoter.
- the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide.
- the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene.
- the mutated essential gene complements the deficiency present in the host cell, but due to a lower expression or activity of the (mutated) essential polypeptide coded by the mutated essential gene present in the vector, will select for cells with an increased copy number of the vector.
- the mutated essential gene is selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; and/or b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity and/or lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and; b) it is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- a "host cell deficient in an essential gene coding for an essential polypeptide” is herein defined as host cell derived from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide and which has been modified, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no enzymatic activity as compared to the parent host cell that has not been modified, when analysed under the same conditions and/or a combination of a) and b).
- a host cell which is deficient in an essential gene coding for an essential polypeptide is a host cell which has been modified, preferably in its genome, and which produces substantially no essential polypeptide encoded by said essential gene.
- Deficiency in an essential gene coding for an essential polypeptide of a host cell as defined herein may be measured by methods known to those skilled in the art, e.g. it can be measured by determining the concentration and/or (specific) activity of the essential polypeptide coded by the essential gene and/or it may be measured by determining the concentration of mRNA transcribed from the essential gene as described herein and/or it may be measured by gene or genome sequencing if compared to the parent host cell which has not been modified. A modification in the genome can be determined by comparing the DNA sequence of the host cell deficient in the essential gene to the DNA sequence of the parent (non- modified) microbial host cell.
- Sequencing of DNA and genome sequencing can be done using standard methods known to the person skilled in the art, for example using Sanger sequencing technology and/or next generation sequencing technologies such as lllumina GA2, Roche 454, etc. as reviewed in Elaine R. Mardis (2008), Next-Generation DNA Sequencing Methods, Annual Review of Genomics and Human Genetics, 9: 387-402. (doi:10.1 146/annurev.genom.9.081307.164359).
- Deficiency in the production of the essential polypeptide coded by the essential gene as described herein can be measured using any assay suitable to the measurement of the biological activity of the polypeptide, e.g. polypeptide enzymatic activity as defined herein available to the skilled person, by e.g. measuring levels, concentrations and/or fluxes of metabolites involved in the enzymatic reaction, by quantitative proteomics techniques such as APEX or iTRAQ tools, by transcriptional profiling, by Northern blotting RT-PCR, by Q- PCR or by Western blotting.
- any assay suitable to the measurement of the biological activity of the polypeptide e.g. polypeptide enzymatic activity as defined herein available to the skilled person, by e.g. measuring levels, concentrations and/or fluxes of metabolites involved in the enzymatic reaction, by quantitative proteomics techniques such as APEX or iTRAQ tools, by transcriptional profiling, by Northern blotting RT-PCR, by Q- PCR or by Western
- quantifying the concentration of mRNA present in a cell may for example be achieved by northern blotting (in Molecular Cloning: A Laboratory Manual, Sambrook et a/., New York: Cold Spring Harbour Press, 1989). Quantifying the concentration of polypeptide present in a cell may for example be achieved by western blotting. The difference in mRNA concentration may also be quantified by DNA array analysis (Eisen, M.B. and Brown, P.O. DNA arrays for analysis of gene expression. Methods Enzymol. 1999, 303:179-205).
- Deficiency of the host cell deficient in the essential gene coding for the essential polypeptide is preferably measured relative to the parent cell that is not deficient in the essential gene.
- a host cell deficient in the essential gene coding for the essential polypeptide produces substantially no essential polypeptide and/or produces a polypeptide encoded by said essential gene which has substantially no biological activity, e.g. substantially no enzymatic activity when said host cell produces at least 80% less of the polypeptide encoded by the essential gene, and/or has an at least 80% reduced expression level of the mRNA transcribed from the essential gene and/or has an at least 80% decreased biological activity, e.g.
- the host cell produces at least 85% less, preferably at least 90% less, even more preferably at least 95% less, at least 96% less, at least 97% less, at least 98% less, at least 99% less, at least 99.5% less, at least 99.9% less of the polypeptide encoded by the essential gene, and/or has an at least 85%, preferably at least 90%, even more preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% reduced expression level of the mRNA transcribed from the essential gene and/or has an at least 85%, preferably at least 90%, even more preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% decreased biological activity, e.g.
- the host cell produces no polypeptide encoded by the essential gene, and/or has no expression level of the mRNA transcribed from the essential gene and/or produces a polypeptide which has no biological activity, e.g. no (specific) enzymatic activity if compared to the essential polypeptide encoded by the essential gene produced by the parent cell which is not deficient in the essential gene.
- the essential gene coding for an essential polypeptide is preferably a gene that has not been shown to be non-essential in the host cell.
- the essential gene is a gene whose deficiency renders the host cell non-viable under certain culture conditions because of lower or no expression in the host cell of the essential polypeptide.
- the essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable unless a specific essential cellular nutrient, e.g. a specific essential cellular nutrient produced by the essential polypeptide is supplied to the host cell with the nutrient medium. Therefore the essential polypeptide may be a polypeptide able to produce a nutrient which is essential for cell viability (e.g.
- the essential polypeptide is an enzyme able to produce the nutrient essential for cell viability) or a polypeptide involved in the production of a nutrient which is essential for cell viability (e.g. wherein the essential polypeptide is an enzyme involved in the metabolic pathway which leads to the production of a nutrient essential for cell viability).
- the essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable under all conditions and in any type of nutrient medium.
- the essential polypeptide may be a polypeptide whose lower or no expression in the host cell renders the host cell non-viable under all conditions and in any nutrient medium, such as minimal or complex medium.
- the essential gene coding for an essential polypeptide is a gene essential in prokaryotes or eukaryotes coding for a polypeptide essential in prokaryotes or eukaryotes.
- suitable examples of classes of essential genes include, but are not limited to, genes involved in DNA synthesis & modification, RNA synthesis & modification, protein synthesis & modification, proteasome function, the secretory pathway, cell wall biogenesis and cell division.
- the essential gene may or may not be an auxotrophic marker (auxotrophic markers are e. g. D-alanine racemase (from Bacillus, Bacillus subtilis or Bacillus licheniformis), pyrF (in P.
- the essential gene may or may not be a dominant growth marker (such as n/ ' aD and amdS) and/or may or may not be a dominant resistance marker, such as resistance to heavy metals, biocide resistance and/or markers that confer antibiotic resistance (such as ble for bleomycin and phleomycin, ampicillin, kanamycin, erythromycin, geneticin, chloramphenicol, tetracycline resistance).
- the essential gene is the tif35 gene encoding the g subunit of translation initiation factor 3, which has an ortholog in all eukaryotes.
- the tif35 gene encoding the g subunit of translation initiation factor 3 from P. chrysogenum is used as the essential gene.
- a further preferred essential gene is the A. nidulans aurl gene encoding the enzyme phosphatidylinositohceramide phosphoinositol transferase, which is required for sphingolipid synthesis.
- the aurl gene encoding the enzyme phosphatidylinositokceramide phosphoinositol transferase from A. nidulans is used as the essential gene.
- Essential genes in Bacillus subtilis are described in Kobayashi K et al Proc Natl Acad Sci U S A. (2003) Apr 15; 100(8):4678-83, which is herewith incorporated by reference in its entirety.
- many genes encoding compounds involved in primary metabolism and metabolic pathways can be essential genes, whose deficiency renders the host cell non-viable.
- an essential gene coding for an essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase and which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- SEQ ID NO: 44 is a polynucleotide sequence representing the gene coding a non- mutated (i.e. native) alanine racemase in Bacillus subtilis.
- SEQ ID NO: 45 represents the amino acid sequence of a non-mutated (i.e. native) alanine racemase in Bacillus subtilis coded by SEQ ID NO: 44.
- the essential gene coding for an alanine racemase in said host cell may be a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase in said host cell, which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- the essential gene coding for an alanine racemase in said host cell may be a gene according to a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- a functional homolog of SEQ ID NO: 44 is herewith defined as a polynucleotide representing the gene coding for non-mutated (i.e. native) alanine racemase in Bacillus subtilis other than SEQ ID NO: 44 or the gene coding for a non-mutated (i.e. native) alanine racemase in a microorganism other than Bacillus subtilis.
- the essential polypeptide in the host cell is preferably a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an alanine racemase, in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
- the essential polypeptide in said host cell may be a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence coding for alanine racemase in said host cell, which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- the essential gene coding for an alanine racemase in said host cell may be a gene according to a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- a functional homolog of SEQ ID NO: 45 is herewith defined as an amino acid sequence being a non-mutated (i.e. native) alanine racemase in Bacillus subtilis other than SEQ ID NO: 45 or a non-mutated (i.e. native) alanine racemase in a microorganism other than Bacillus subtilis.
- sequences are aligned for optimal comparison purposes.
- gaps may be introduced in any of the two sequences that are compared.
- Such alignment can be carried out over the full length of the sequences being compared.
- the alignment may be carried out over a shorter length, for example over about 20, about 50, about 100 or more nucleic acids/based or amino acids.
- sequence identity is the percentage of identical matches between the two sequences over the reported aligned region.
- the percentage of sequence identity is calculated over the full length of the amino acid sequence or over the full length of the nucleotide sequence.
- a comparison of sequences and determination of percentage of sequence identity between two sequences can be accomplished using a mathematical algorithm.
- the skilled person will be aware of the fact that several different computer programs are available to align two sequences and determine the identity between two sequences (Kruskal, J. B. (1983) An overview of sequence comparison In D. Sankoff and J. B. Kruskal, (ed.), Time warps, string edits and macromolecules: the theory and practice of sequence comparison, pp. 1-44 Addison Wesley).
- the percentage of sequence identity between two amino acid sequences or between two nucleotide sequences may be determined using the Needleman and Wunsch algorithm for the alignment of two sequences. (Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol.
- the percentage of sequence identity between a query sequence and a sequence of the invention is calculated as follows: Number of corresponding positions in the alignment showing an identical amino acid or identical nucleotide in both sequences divided by the total length of the alignment after subtraction of the total number of gaps in the alignment.
- the identity defined as herein can be obtained from NEEDLE by using the NOBRIEF option and is labeled in the output of the program as "longest-identity".
- nucleic acid and protein sequences described herein can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
- search can be performed using the N BLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403— 10.
- Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402.
- the default parameters of the respective programs e.g., XBLAST and NBLAST
- a "gene” refers to a nucleic acid molecule coding for a polypeptide chain that includes control sequences as defined herein preceding and following the Open Reading Frame. It will be further appreciated that the definition of gene can include nucleic acids that do not encode polypeptide, but rather provide templates for transcription of functional RNA molecules such as transfer RNAs, ribosomal RNAs, ribozymes, microRNAs, etc. Therefore the present invention encompasses embodiments in which the essential gene codes for an essential non coding RNA molecule, i.e. an essential RNA molecule which is not translated into polypeptide.
- control sequences may be operably linked to one or more genes. Therefore in the context of the present invention a gene may be part of an operon structure. In the context of the present invention the mutated essential gene may also be part of an operon structure.
- the Open Reading Frame is herewith defined as the region of the gene that is transcribed and translated into polypeptide and which starts with a start codon, generally with the start codon ATG, and which does not contain any stop codon (TAA, TAG, TGA).
- Alternative start codons which can be found in e.g. Bacillus host cells are TTG and GTG (Rocha E.P., Danchin A., Viari A. Translation in Bacillus subtilis: roles and trends of initiation and termination, insights from a genome analysis Nucleic Acids Res. 1999 27(17):3567- 3576)
- the Open Reading Frame contains coding sequences (exons) and may or may not contain intervening sequences (introns).
- the host cell deficient in an essential gene coding for an essential polypeptide as defined herein comprises a vector.
- Said vector comprises at least an autonomous replication sequence as defined herein and a mutated essential gene.
- the mutated essential gene is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the second host cell is therefore otherwise identical to the host cell of the invention differing from the latter only in that in the vector present in the second host cell the essential gene is present instead of the mutated essential gene.
- the second host cell is the host cell deficient in the essential gene coding for the essential polypeptide, wherein the second host cell comprises the vector, said vector comprises at least the autonomous replication sequence and the essential gene.
- the essential gene present in the vector complements the deficiency present in the second host cell.
- the mutated essential gene does or does not comprise a mutation in the region of the promoter.
- the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide.
- the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene.
- a mutated essential gene may be a gene derived from the essential gene by insertion, deletion or substitution of one or more nucleotides in the nucleotide sequence of the essential gene. Therefore in one embodiment the mutated essential gene may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene.
- the mutated essential gene is different from the essential gene and that the mutated essential gene may differ from the essential gene in that it may have in its nucleotide sequence at least one nucleotide inserted, deleted or replaced if compared to the nucleotide sequence of the essential gene.
- the mutated essential gene may code for the essential polypeptide but the expression of the essential polypeptide in the host cell may be lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the term "expression” refers to a process by which a polypeptide is produced starting from the nucleic acid sequence of the corresponding gene. This process may include transcription, post-transcriptional modification, translation, post-translational modification and secretion.
- a lower expression of the essential polypeptide in the host cell according to the invention may be due to a lower transcription of the mutated essential gene in the host cell according to the invention leading to a lower amount of mRNA transcribed from the mutated essential gene if compared to the amount of mRNA transcribed from the essential gene in a second host cell which differs from the host cell according to the invention only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the skilled person knows how to achieve a lower transcription of the mutated essential gene in the host cell.
- the latter can be achieved by modifying control sequences in the essential gene which are involved in the transcription of the essential gene into mRNA.
- modifications may or may not include e.g. modifications in the region of the essential gene corresponding to the promoter, more preferably in the regions of the promoter which are responsible for binding to RNA polymerase and which lead to a less strong promoter, i.e.
- a promoter which, if compared with the non-mutated promoter present in the essential gene, less efficiently binds the RNA polymerase, resulting in a lower (rate of) transcription of the mutated essential gene if compared with the (rate of) transcription in the essential gene, when measured under the same conditions.
- a lower expression of the essential polypeptide in the host cell according to the invention may also be due to a lower translation of the mRNA transcribed from the mutated essential gene leading to a lower amount of essential polypeptide in the host cell according to the invention if compared to the amount of essential polypeptide in a second host cell which differs from the host cell according to the invention only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide, when measured under the same conditions.
- the amount of the essential polypeptide in the host cell deficient in an essential gene coding for an essential polypeptide according to the invention is lower if compared to the amount of essential polypeptide produced by a second host cell measured under the same conditions, wherein the second host cell is deficient in the essential gene coding for the essential polypeptide, said second host cell comprising a vector, said vector comprising at least an autonomous replication sequence and the essential gene.
- the skilled person knows how to achieve a lower translation of the mutated essential gene in the host cell. For example the latter can be achieved by modifying control sequences in the essential gene which are related to the translation into essential polypeptide of the mRNA transcribed from the mutated essential gene.
- the latter can be achieved in eukaryotes by modifying the region of the essential gene coding for the translation initiation sequence (also referred to as Kozak sequence) to result in a less functional translation initiation sequence in the mRNA transcribed from the mutated essential gene.
- the translation initiation sequence also referred to as Kozak sequence
- a less functional translation initiation sequence in said mRNA is herewith defined as a modification which results in a less efficient binding of said mRNA to the ribosome if compared with the biding of the mRNA transcribed from the essential gene, when measured under the same conditions, resulting in a lower (rate of) translation into protein of the mRNA transcribed from the mutated essential gene if compared with the (rate of) translation into protein of the mRNA transcribed from the essential gene when measured under the same conditions.
- RBS Ribosome Binding Site
- a less functional RBS in said mRNA is herewith defined as a modification which results in a less efficient binding of said mRNA to the ribosome if compared with the biding of the mRNA transcribed from the essential gene, when measured under the same conditions, resulting in a lower (rate of) translation into protein of the mRNA transcribed from the mutated essential gene if compared with the (rate of) translation into protein of the mRNA transcribed from the essential gene when measured under the same conditions.
- lower expression level of the mutated essential gene may be achieved by modifying the region of the gene which codes for the essential polypeptide, by replacing one or more codons in said coding sequence of the essential polypeptide with synonymous codons so as to optimize the codon usage and the codon pair usage in the host cell according to the invention for a lower (rate of) transcription and/or lower (rate of) translation of the mutated essential gene into essential polypeptide.
- the latter can e.g.
- the mutated essential gene a) may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it may be a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide
- the mutated essential gene may code for a mutated essential polypeptide having the same biological function, for example same enzymatic function and/or specific enzymatic function, but a lower biological activity, for example lower enzymatic activity and/or specific enzymatic activity, if compared with the essential polypeptide when measured under the same conditions.
- the mutated essential polypeptide has the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when the mutated essential polypeptide and the essential polypeptide belong to the same enzyme class and catalyzes the same type of chemical reaction but the enzymatic activity of the mutated essential polypeptide is lower if compared with that of the essential polypeptide when measured using one or more suitable assay, preferably using any suitable assay known to the skilled person for the determination of that enzymatic activity and/or specific enzymatic activity.
- enzymatic activity is herewith defined as the amount of substrate converted per unit of time in a reaction catalyzed by a polypeptide, for example catalyzed by the essential polypeptide or the mutated essential polypeptide, measured under specific conditions.
- Specific enzymatic activity is herewith defined as the enzymatic activity per mg of protein, i.e. the amount of substrate converted per unit of time in a reaction catalyzed by a polypeptide, for example catalyzed by the essential polypeptide or the mutated essential polypeptide, measured under specific conditions, per mg of polypeptide catalyzing the reaction.
- the mutated essential gene may be modified in such way that the mutated essential polypeptide may comprise, if compared to the essential polypeptide, the insertion, deletion or substitution of one or more amino acids in the amino acid sequence of the essential polypeptide.
- the mutated essential polypeptide may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and may have the same biological function, for example same enzymatic function, but a lower biological activity, for example lower enzymatic activity and/or lower specific enzymatic activity, if compared with the essential polypeptide when measured under the same conditions.
- the mutated essential polypeptide is different from the essential polypeptide and that the mutated essential polypeptide may differ from the essential polypeptide in that it may have in its amino acid sequence at least one amino acid inserted, deleted or replaced if compared to the amino acid sequence of the essential polypeptide.
- the mutated essential gene may be modified such that the mutated essential polypeptide may contain one or more conservative substitutions in its amino acid sequence if compared with the sequence of the essential polypeptide.
- the mutated essential polypeptide may contain one or more insertions, deletions or substitutions of non-essential amino acid in its amino acid sequence if compared with the amino acid sequence of the essential polypeptide.
- Consservative substitution is a substitution of an amino acid residue with an amino acid residue having a similar side chain. It is known to the skilled person which amino acids have a similar side chain.
- a non-essential amino acid is a residue that can be altered in the amino acid sequence of the essential polypeptide without substantially altering the biological function thereof.
- the mutated essential gene may be modified so as to produce a mutated essential polypeptide comprising site directed mutations and/or random mutations if compared to the essential polypeptide.
- the mutated essential gene may code for a mutated essential polypeptide which is an orthologue of the essential polypeptide, i.e. a polypeptide isolated from another strain either belonging or not to the same species and/or genus, and which possess a similar or preferably the same enzymatic function.
- the mutated essential gene may code a mutated essential polypeptide which is an allelic variant of the essential polypeptide, or the mutated essential polypeptide may be a biologically active fragment of the essential polypeptide. It is known to those skilled in the art how to isolate orthologues, allelic variants and/or biologically active fragments starting from the sequence of the essential gene and/or of the essential polypeptide.
- the mutated essential gene a) may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it may be a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same biological function, for example same enzymatic function, but a lower biological activity, for example lower (specific) enzymatic activity, if compared with the essential polypeptide when measured under the same conditions.
- measured under the same conditions or “analysed under the same conditions” means that the host cell deficient in the essential gene coding for the essential polypeptide and the host cell to which it is compared are cultivated under the same conditions and that the amount and/or biological activity of the essential polypeptide in the host cell deficient in the essential gene coding for the essential polypeptide, if compared to host cell of comparison, is measured in both host cells, using the same conditions, preferably by using the same assay and/or methodology, more preferably within the same experiment.
- the vector comprising at least an autonomous replication sequence and a mutated essential gene according to the invention further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
- the compound of interest can be any biological compound.
- the biological compound may be biomass or a biopolymer or metabolite.
- the biological compound may be encoded by a single polynucleotide or a series of polynucleotides composing a biosynthetic or metabolic pathway or may be the direct result of the product of a single polynucleotide or products of a series of polynucleotides.
- the biological compound may be native to the host cell or heterologous.
- heterologous biological compound is defined herein as a biological compound which is not native to the cell; or a native biological compound in which structural modifications have been made to alter the native biological compound.
- biopolymer is defined herein as a chain (or polymer) of identical, similar, or dissimilar subunits (monomers).
- the biopolymer may be any biopolymer.
- the biopolymer may for example be, but is not limited to, a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide.
- the biopolymer may be a polypeptide.
- the polypeptide may be any polypeptide having a biological activity of interest.
- the term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. Polypeptides further include naturally occurring allelic and engineered variations of the above- mentioned polypeptides and hybrid polypeptides.
- the polypeptide may be native or may be heterologous to the host cell.
- the polypeptide may be a collagen or gelatin, or a variant or hybrid thereof.
- the polypeptide may be an antibody or parts thereof, an antigen, a clotting factor, an enzyme, a hormone or a hormone variant, a receptor or parts thereof, a regulatory protein, a structural protein, a reporter, or a transport protein, protein involved in secretion process, protein involved in folding process, chaperone, peptide amino acid transporter, glycosylation factor, transcription factor, synthetic peptide or oligopeptide, intracellular protein.
- the intracellular protein may be an enzyme such as, a protease, an amylase, ceramidases, epoxide hydrolase, aminopeptidase, acylases, aldolase, hydroxylase, aminopeptidase, lipase.
- the polypeptide may also be an enzyme secreted extracellularly.
- enzymes may belong to the groups of oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, catalase, cellulase, chitinase, cutinase, deoxyribonuclease, dextranase, esterase.
- the enzyme may be a carbohydrase, e.g.
- cellulases such as endoglucanases, ⁇ -glucanases, cellobiohydrolases or ⁇ - glucosidases, hemicellulases or pectinolytic enzymes such as xylanases, xylosidases, mannanases, galactanases, galactosidases, pectin methyl esterases, pectin lyases, pectate lyases, endo polygalacturonases, exopolygalacturonases rhamnogalacturonases, arabanases, arabinofuranosidases, arabinoxylan hydrolases, galacturonases, lyases, or amylolytic enzymes; hydrolase, isomerase, or ligase, phosphatases such as phytases, esterases such as lipases, proteolytic enzymes, oxidoreductases such as oxidases,, transfer
- the enzyme may be a phytase.
- the enzyme may be an aminopeptidase, asparaginase, amylase, a maltogenic amylase, carbohydrase, carboxypeptidase, endo-protease, metallo- protease, serine-protease catalase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha- glucosidase, beta-glucosidase, haloperoxidase, protein deaminase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, galactolipase,
- the compound of interest is an amylase, e.g. an a- or a ⁇ -amylase, e.g. a glucan 1 ,4-a-maltohydrolase such as the enzyme according to SEQ ID NO: 47.
- an amylase e.g. an a- or a ⁇ -amylase, e.g. a glucan 1 ,4-a-maltohydrolase such as the enzyme according to SEQ ID NO: 47.
- a polypeptide or enzyme can also be a product as described in WO2010/102982.
- a polypeptide can also be a fused or hybrid polypeptide to which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof.
- a fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding one polypeptide to a nucleic acid sequence (or a portion thereof) encoding another polypeptide.
- fusion polypeptides include, ligating the coding sequences encoding the polypeptides so that they are in frame and expression of the fused polypeptide is under control of the same promoter (s) and terminator.
- the hybrid polypeptides may comprise a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides wherein one or more may be heterologous to the host cell.
- Example of fusion polypeptides and signal sequence fusions are for example as described in WO2010/121933.
- the biopolymer may be a polysaccharide.
- the polysaccharide may be any polysaccharide, including, but not limited to, a mucopolysaccharide (e. g., heparin and hyaluronic acid) and nitrogen-containing polysaccharide (e.g., chitin).
- a mucopolysaccharide e. g., heparin and hyaluronic acid
- nitrogen-containing polysaccharide e.g., chitin.
- the polysaccharide is hyaluronic acid.
- the polynucleotide coding for the compound of interest or coding for a compound involved in the production of the compound of interest according to the invention may encode an enzyme involved in the synthesis of a primary or secondary metabolite, such as organic acids, carotenoids, (beta-lactam) antibiotics, and vitamins. Such metabolite may be considered as a biological compound according to the present invention.
- metabolite encompasses both primary and secondary metabolites; the metabolite may be any metabolite.
- Preferred metabolites are citric acid, gluconic acid, adipic acid, fumaric acid, itaconic acid, levulinic acid and succinic acid.
- the metabolite may be encoded by one or more genes, such as in a biosynthetic or metabolic pathway.
- Primary metabolites are products of primary or general metabolism of a cell, which are concerned with energy metabolism, growth, and structure.
- Secondary metabolites are products of secondary metabolism (see, for example, R. B. Herbert, The Biosynthesis of Secondary Metabolites, Chapman and Hall, New York, 1981 ).
- the primary metabolite may be, but is not limited to, an amino acid, fatty acid, nucleoside, nucleotide, sugar, triglyceride, or vitamin.
- the secondary metabolite may be, but is not limited to, an alkaloid, coumarin, flavonoid, polyketide, quinine, steroid, peptide, or terpene.
- the secondary metabolite may be an antibiotic, antifeedant, attractant, bacteriocide, fungicide, hormone, insecticide, or rodenticide.
- Preferred antibiotics are cephalosporins and beta-lactams.
- Other preferred metabolites are exo-metabolites.
- exo-metabolites examples include Aurasperone B, Funalenone, Kotanin, Nigragillin, Orlandin, Other naphtho-y-pyrones, Pyranonigrin A, Tensidol B, Fumonisin B2 and Ochratoxin A.
- the biological compound may also be the product of a selectable marker.
- a selectable marker is a product of a polynucleotide of interest which product provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
- Selectable markers include, but are not limited to, amdS (acetamidase), argB (ornithinecarbamoyltransferase), bar (phosphinothricinacetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), ble (phleomycin resistance protein), hyg (hygromycin), NAT or NTC (Nourseothricin), kanamicine, tetracycline, chloramphenicol, neomycin, spectinomycin as well as equivalents thereof.
- amdS acetamidase
- argB ornithinecarbamoyltransferase
- bar
- the compound of interest is preferably a polypeptide as described in the list of compounds of interest.
- the polypeptide is an enzyme as described in the list of compounds of interest.
- a a- or ⁇ -amylase more preferably a glucan 1 ,4-a-maltohydrolase such as the enzyme according to SEQ ID NO: 47.
- the compound of interest is preferably a metabolite.
- operably linked is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the DNA sequence such that the control sequence directs the production of an RNA or an mRNA and optionally of a polypeptide translated from said (m)RNA.
- control sequences is defined herein to include all components, which are necessary or advantageous for the expression of mRNA and / or a polypeptide, either in vitro or in a host cell. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, Shine-Delgarno sequence (also indicated as Ribosome Binding Site), optimal translation initiation sequences (as described in Kozak, 1991 , J. Biol. Chem. 266: 19867- 19870), a polyadenylation sequence, a pro-peptide sequence, a pre-pro-peptide sequence, a promoter, a signal sequence, and a transcription terminator.
- control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
- control sequence may be an appropriate promoter sequence (promoter).
- the control sequence may also be a suitable transcription terminator (terminator) sequence, a sequence recognized by a host cell to terminate transcription.
- the terminator sequence is operably linked to the 3'-terminus of the nucleic acid sequence encoding the polypeptide. Any terminator, which is functional in the cell, may be used in the present invention. The man skilled in the art knows which types of terminators can be used in the host cell as described herein.
- the control sequence may also be an optimal translation initiation sequences (as described in Kozak, 1991 , J. Biol. Chem. 266: 19867-19870), or a 5'-untranslated sequence, a non- translated region of a mRNA which is important for translation by the mutated microbial host cell.
- the translation initiation sequence or 5'-untranslated sequence is operably linked to the 5'-terminus of the coding sequence encoding the polypeptide.
- Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Control sequences may be optimized to their specific purpose.
- the control sequence may also be a non-translated region of a mRNA which is important for translation by the mutated microbial host cell.
- the leader sequence is operably linked to the 5'-terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence, which is functional in the cell, may be used in the present invention.
- Leader sequences may be those originating from bacterial ⁇ -amylase (amyE, amyQ and amyL) and bacterial alkaline protease aprE and neutral protease genes nprE (Bacillus), or signal sequences as described in WO2010/121933, in WO2013007821 and WO2013007820, the fungal amyloglucosidase (AG) gene (glaA-both 18 and 24 amino acid versions e. g. from Aspergillus), or the a-factor gene (yeasts e. g. Saccharomyces and Kluyveromyces). .
- the control sequence may also be a polyadenylation sequence, a sequence which is operably linked to the 3'-terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell (mutated or parent) as a signal to add polyadenosine residues to transcribed mRNA.
- Any polyadenylation sequence, which is functional in the cell, may be used in the present invention.
- promoter is defined herein as a DNA sequence that binds RNA polymerase and directs the polymerase to the correct downstream transcriptional start site of a nucleic acid sequence encoding a biological compound to initiate transcription. RNA polymerase effectively catalyzes the assembly of messenger RNA complementary to the appropriate DNA strand of a coding region.
- promoter will also be understood to include the 5'-non-coding region (between promoter and translation start) for translation after transcription into mRNA, cis-acting transcription control elements such as enhancers, and other nucleotide sequences capable of interacting with transcription factors.
- the promoter may be any appropriate promoter sequence suitable for a eukaryotic or prokaryotic host cell, which shows transcriptional activity, including mutant, truncated, and hybrid promoters, and may be obtained from polynucleotides encoding extra-cellular or intracellular polypeptides either homologous (native) or heterologous (foreign) to the cell.
- the promoter may be a constitutive or inducible promoter. Promoters suitable in filamentous fungi are promoters which may be selected from the group, which includes but is not limited to promoters obtained from the polynucleotides encoding A.
- oryzae TAKA amylase Rhizomucor miehei aspartic proteinase, Aspergillus gpdA promoter, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger or A. awamori glucoamylase (glaA), A. niger or A. awamori endoxylanase (xlnA) or beta- xylosidase (xlnD), T. reesei cellobiohydrolase I (CBHI), R. miehei lipase, A. oryzae alkaline protease, A.
- Trichoderma reesei beta-glucosidase Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endog I ucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma rees
- niger neutral alpha-amylase and A. oryzae triose phosphate isomerase mutant, truncated, and hybrid promoters thereof.
- Other examples of promoters are the promoters described in WO2006/092396 and WO2005/100573, which are herein incorporated by reference. An even other example of the use of promoters is described in WO2008/098933.
- Preferred carbohydrate inducible promoters which can be used in filamentous fungi are the A. oryzae TAKA amylase, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger or A. awamori glucoamylase (glaA), A.
- bacteria may preferably be used as host cells for the expression of a polypeptide of the invention, in particular Bacilli.
- Suitable inducible promoters useful in such host cells include promoters that may be regulated primarily by an ancillary factor such as a repressor or an activator.
- the repressors are sequence-specific DNA binding proteins that repress promoter activity. The transcription can be initiated from this promoter in the presence of an inducer that prevents binding of the repressor to the operator of the promoter.
- promoters from Gram-positive microorganisms include, but are not limited to, gnt (gluconate operon promoter); penP from Bacillus licheniformis; glnA (glutamine synthetase); xylAB (xylose operon); araABD (L-arabinose operon) and P spa c promoter, a hybrid SP01//ac promoter that can be controlled by inducers such as isopropyl- ⁇ -D-thiogalactopyranoside [IPTG] ((Yansura D.G., Henner D.J. Proc Natl Acad Sci U S A. 1984 81 (2):439-443).
- inducers such as isopropyl- ⁇ -D-thiogalactopyranoside [IPTG] ((Yansura D.G., Henner D.J. Proc Natl Acad Sci U S A. 1984 81 (2):439-443).
- Activators are also sequence-specific DNA binding proteins that induce promoter activity.
- promoters from Gram-positive microorganisms include, but are not limited to, two-component systems (PhoP-PhoR, DegU-DegS, SpoOA- Phosphorelay), LevR, Mry and GltC. Production of secondary sigma factors can be primarily responsible for the transcription from specific promoters.
- Examples from Gram-positive microorganisms include, but are not limited to, the promoters activated by sporulation specific sigma factors: ⁇ ⁇ , ⁇ ⁇ , ⁇ ° and ⁇ ⁇ and general stress sigma factor, ⁇ ⁇ .
- ⁇ ⁇ - mediated response is induced by energy limitation and environmental stresses (Hecker M, Volker U. Mol Microbiol. 1998; 29(5):1 129-1 136.). Attenuation and antitermination also regulates transcription. Examples from Gram-positive microorganisms include, but are not limited to, trp operon and sacB gene. Other regulated promoters in expression vectors are based the sacR regulatory system conferring sucrose inducibility (Klier AF, Rapoport G. Annu Rev Microbiol. 1988;42:65-95).
- Suitable inducible promoters useful in bacteria include: promoters from Gram- positive microorganisms such as, but are not limited to, SP01-26, SP01 -15, veg, pyc (pyruvate carboxylase promoter), and amyE.
- promoters from Gram-negative microorganisms include, but are not limited to, tac, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, A-P R , and A-P L .
- promoters useful in bacterial cells include the ⁇ -amylase and SPo2 promoters as well as promoters from extracellular protease genes.
- the promoter sequences may be obtained from a bacterial source.
- the promoter sequences may be obtained from a gram positive bacterium such as a Bacillus strain, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis; or a Streptomyces strain, e.g., Streptomyces lividans or Streptomyces murinus; or from a gram negative bacterium, e.g., E. coli or Pseudomonas sp.
- a Bacillus strain e.g., Bacillus alkalophilus, Bacillus amyloliquefaci
- a suitable promoter for directing the transcription of a polynucleotide sequence in the methods of the present invention is the promoter obtained from the E. coli lac operon.
- Another example is the promoter of the Streptomyces coelicolor agarase gene (dagA).
- dagA Streptomyces coelicolor agarase gene
- Another example is the promoter of the Bacillus lentus alkaline protease gene (aprH).
- Another example is the promoter of the Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene).
- Another example is the promoter of the Bacillus subtilis levansucrase gene (sacB).
- Another example is the promoter of the Bacillus subtilis alphaamylase gene (amyF).
- Another example is the promoter of the Bacillus licheniformis alphaamylase gene (amyL).
- Another example is the promoter of the Geobacillus stearothermophilus glucan 1 ,4-a-maltohydrolase gene (amyM).
- Another example is the promoter of the Bacillus amyloliquefaciens alpha-amylase gene (amyQ).
- Another example is a "consensus” promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region.
- Another example is the promoter of the Bacillus licheniformis penicillinase gene (penP).
- Another example are the promoters of the Bacillus subtilis xylA and xylB genes.
- the promoter sequence is from a highly expressed gene.
- preferred highly expressed genes from which promoters may be selected and/or which are comprised in preferred predetermined target loci for integration of expression constructs include but are not limited to genes encoding glycolytic enzymes such as triose-phosphate isomerases (TPI),glyceraldehyde-phosphate dehydrogenases (GAPDH), phosphoglycerate kinases (PGK), pyruvate kinases (PYK or PKI), alcohol dehydrogenases (ADH), as well as genes encoding amylases, glucoamylases, proteases, xylanases, cellobiohydrolases, ⁇ - galactosidases, alcohol (methanol) oxidases, elongation factors and ribosomal proteins.
- TPI triose-phosphate isomerases
- GPDH glycolytic enzymes
- PGK phosphoglycerate kinases
- suitable highly expressed genes include e. g. the LAC4 gene from Kluyveromyces sp., the methanol oxidase genes (AOX and MOX) from Hansenula and Pichia, respectively, the glucoamylase (glaA) genes from A. niger and A. awamori, the A. oryzae TAKA-amylase gene, the A. nidulans gpdA gene and the T. reesei cellobiohydrolase genes.
- LAC4 gene from Kluyveromyces sp.
- AOX and MOX methanol oxidase genes
- glaA glucoamylase
- Promoters which can be used in yeast include e.g. promoters from glycolytic genes, such as the phosphofructokinase (PFK), triose phosphate isomerase (TPI), glyceraldehyde-3 - phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK) promoters from yeasts or filamentous fungi; more details about such promoters from yeast may be found in (WO 93/03159).
- PFK phosphofructokinase
- TPI triose phosphate isomerase
- GPD glyceraldehyde-3 - phosphate dehydrogenase
- PYK pyruvate kinase
- PGK phosphoglycerate kinase
- promoters are ribosomal protein encoding gene promoters, the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADHI, ADH4, and the like), and the enolase promoter (ENO).
- LAC4 lactase gene promoter
- ADHI, ADH4, and the like alcohol dehydrogenase promoters
- ENO enolase promoter
- Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art.
- the promoters used in the host cells of the invention may be modified, if desired, to affect their control characteristics. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters, which are well known to the person skilled in the art.
- Suitable promoters in eukaryotic host cells may be GAL7, GAL10, or GAL1 , CYC1, HIS3, ADH1, PGL, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, EN01, TPI1, and AOX1.
- Other suitable promoters include PDC1, GPD1, PGK1, TEF1, and TDH3.
- Examples of carbohydrate inducible promoters which can be used are GAL promoters, such as GAL1 or GAL 10 promoters.
- any “host cell” such as a “host cell deficient in an essential gene coding for an essential polypeptide” as defined herein or a parent of said host cell may be any type of host cell.
- the host cell may be a prokaryotic cell.
- the prokaryotic host cell is bacterial cell.
- the term "bacterial cell” includes both Gram-negative and Gram-positive microorganisms. Suitable bacteria may be selected from e.g. Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces.
- the bacterial cell is selected from the group consisting of B. subtilis, B. amyloliquefaciens, B. licheniformis, B. puntis, B. megaterium, B. halodurans, B. pumilus, G. oxydans, Caulobactert crescentus CB 15, Methylobacterium extorquens, Rhodobacter sphaeroides, Pseudomonas zeaxanthinifaciens, Pseudomonas fluorescence, Paracoccus denitrificans, E. coli, C. glutamicum, Staphylococcus carnosus, Streptomyces lividans,
- Sinorhizobium melioti and Rhizobium radiobacter Sinorhizobium melioti and Rhizobium radiobacter.
- the host cell deficient in the essential gene coding for the essential polypeptide is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Bacillus, Escherichia (such as
- Escherichia coli Escherichia coli
- Pseudomonas Lactobacillus
- the bacterial host cell may additionally contain modifications, e.g. the bacterial host cell may be deficient in genes which are detrimental to the production, recovery and/or application of the compound of interest, e.g. a compound of interest being a polypeptide, e.g. an enzyme.
- the bacterial host cell is a protease deficient host cell, more preferably it is a Bacillus host cell deficient in the gene aprE coding for extracellular alkaline protease and deficient in the gene nprE coding for extracellular neutral metalloprotease.
- the bacterial host cell is a protease deficient host cell, more preferably it is a Bacillus host cell deficient in the gene aprE coding for extracellular alkaline protease and deficient in the gene nprE coding for extracellular neutral metalloprotease.
- Bacillus host cell is further deficient in one or more proteases coded by the genes selected from the group consisting of: nprB, vpr, epr, wprA, mpr, bpr.
- the bacterial host cell does not produce spores and or is deficient in a sporulation related gene such as e.g. spoOA, spollSA, sigE, sigF, spollSB, spollE, sigG, spolVCB, spolllC, spollGA, spollAA, spolVFB, spollR, spolllJ.
- Bacillus host cell is deficient in the gene amyE coding for a-amylase.
- Bacillus host cell more preferably a Bacillus subtilis host cell, is deficient in aprE, nprE, amyE and does not produce spores.
- Bacillus host cell is BS154, CBS 136327 or a derivative thereof.
- the host cell according to the invention is a eukaryotic host cell.
- the eukaryotic cell is a mammalian, insect, plant, fungal, or algal cell.
- Preferred mammalian cells include e.g. Chinese hamster ovary (CHO) cells, COS cells, 293 cells, PerC6 cells, and hybridomas.
- Preferred insect cells include e.g. Sf9 and Sf21 cells and derivatives thereof.
- the eukaryotic cell is a fungal cell, i.e. a yeast cell, such as Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain.
- the eukaryotic cell is a filamentous fungal cell.
- Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
- the filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic.
- Filamentous fungal strains include, but are not limited to, strains of Acremonium, Agaricus, Aspergillus, Aureobasidium, Chrysosporium, Coprinus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Panerochaete, Pleurotus, Schizophyllum, Talaromyces, Rasamsonia, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.
- Preferred filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma genus, and most preferably a species of Aspergillus niger, Acremonium alabamense, Aspergillus awamori, Aspergillus foetidus, Aspergillus sojae, Aspergillus fumigatus, Talaromyces emersonii, Rasamsonia emersonii, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium oxysporum, Myceliophthora thermophila, Trichoderma reesei, Thielavia terrestris or Penicillium chrysogenum.
- a more preferred filamentous fungal host cell belongs to the genus Aspergillus, more preferably the host cell belongs to the species Aspergillus niger.
- the host cell according to the invention is an Aspergillus niger host cell, the host cell preferably is CBS 513.88, CBS124.903 or a derivative thereof.
- Useful strains in the context of the present invention may be Aspergillus niger CBS 513.88, CBS124.903, Aspergillus oryzae ATCC 20423, IFO 4177, ATCC 101 1 , CBS205.89, ATCC 9576, ATCC14488-14491 , ATCC 1 1601 , ATCC12892, P. chrysogenum CBS 455.95, P.
- the host cell deficient in the essential gene coding for the essential polypeptide may be a recombinant cell.
- recombinant when used in reference to a host cell, nucleic acid, protein or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
- recombinant cells may express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
- the term “recombinant” is synonymous with "genetically modified”.
- the host cell deficient in an essential gene coding for an essential polypeptide comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as described herein.
- the vector may be any vector (e.g. a plasmid or a virus), which can be conveniently subjected to recombinant DNA procedures.
- the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
- the vector is a plasmid.
- the vector may be a linear or a closed circular plasmid.
- the vector may further comprise a, preferably non-selective, marker that allows for easy determination of the vector in the host cell. Suitable markers include GFP and DsRed. The chance of gene conversion or integration of the vector into the host genome is preferably minimized.
- the vector according to the invention is preferably an extra-chromosomal vector.
- the vector preferably lacks significant regions of homology with the genome of the host to minimize the chance of integration into the host genome by homologous recombination.
- the person skilled in the art knows how to construct a vector with minimal chance of integration into the genome. This may be achieved by using control sequences, such as promoters and terminators, which originate from another species than the host species. Other ways of reducing homology are by modifying codon usage and introduction of silent mutations.
- the person skilled in the art knows that the type of host cell, the length of the regions of homology to the host cell genome present in the vector, and the percentage of homology between said regions of homology in the vector and the host chromosome will determine whether and in which amount the vector will integrate into the host cell genome.
- the autonomous replication sequence may be any suitable sequence available to the person skilled in the art that allows for plasmid replication that is independent of chromosomal replication.
- the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
- the term "origin of replication" or "plasmid replicator” is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo.
- Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, RSF1010 permitting replication in Pseudomonas is described, e.g., by F. Heffron et al., in Proc. Nat'l Acad. Sci. USA 72(9):3623-27 (Sep 1975), and pUB1 10, pE194, pTA1060, and ⁇ permitting replication in Bacillus.
- the autonomous replication sequence used in filamentous fungi is the AMA 1 replicon (Gems et al., 1991 Gene. 98(1 ):61-7). Telomeric repeats may also result in autonomous replication (In vivo linearization and autonomous replication of plasmids containing human telomeric DNA in Aspergillus nidulans, Aleksenko et al. Molecular and General Genetics MGG, 1998 - Volume 260, Numbers 2-3, 159-164, DOI: 10.1007/s004380050881 ). CEN/ARS sequences and 3 ⁇ vector sequences from yeast may also be suitable.
- a vector or expression construct for a given host cell may thus comprise the following elements operably linked to each other in a consecutive order from the 5'-end to 3'-end relative to the coding strand of the sequence encoding the compound of interest or encoding a compound involved in the synthesis of the compound of interest: (1 ) a promoter sequence capable of directing transcription of the nucleotide sequence encoding the polypeptide in the given host cell; (2) optionally a sequence to facilitate the translation of the transcribed RNA, for example a ribosome binding site (also indicated as Shine Delgarno sequence) in prokaryotes, or a Kozak sequence in eukaryotes (3) optionally, a signal sequence capable of directing secretion of the compound of interest or a compound involved in the synthesis of a compound of interest from the given host cell into a culture medium; (4) a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the
- the origin of the terminator is not critical.
- the terminator can, for example, be native to the DNA sequence encoding the polypeptide. However, preferably a bacterial terminator is used in bacterial host cells and a filamentous fungal terminator is used in filamentous fungal host cells.
- the terminator is endogenous to the host cell (in which the nucleotide sequence encoding the polypeptide is to be expressed).
- a ribosome binding site for translation may be present.
- the coding portion of the mature transcripts expressed by the constructs will include a start codon, usually AUG (or ATG), but there are also alternative start codons, such as for example GUG (or GTG) and UUG (or TTG), which are used in prokaryotes.
- start codons usually AUG (or ATG)
- start codons such as for example GUG (or GTG) and UUG (or TTG)
- a stop or translation termination codon is appropriately positioned at the end of the polypeptide to be translated.
- Enhanced expression of a polynucleotide compound of interest or a compound involved in the synthesis of a compound of interest may also be achieved by the selection of homologous and heterologous regulatory regions, e. g. promoter, secretion leader and/or terminator regions, which may serve to increase expression and, if desired, secretion levels of the protein of interest from the expression host and/or to provide for the inducible control of the expression of a compound of interest or a compound involved in the synthesis of a compound of interest.
- homologous and heterologous regulatory regions e. g. promoter, secretion leader and/or terminator regions
- the vector comprising at least an autonomous replication sequence and the mutated essential gene as described herein, also referred to herein as "vector of the invention” can be designed for expression of the polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest in prokaryotic or eukaryotic cells.
- the compound of interest or the compound involved in the synthesis of a compound of interest can be produced in bacterial cells such as E. coli and Bacilli, insect cells (using baculovirus expression vectors), fungal cells, yeast cells or mammalian cells.
- telomeres Suitable host cells are discussed herein and further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
- the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
- a gene that encodes a selectable marker is optionally introduced into the vector and/or host cells along with the polynucleotide coding for a compound of interest or for a compound involved in the synthesis of a compound of interest.
- selectable markers include, but are not limited to those which confer resistance to drugs or which complement a defect in the host cell.
- Such markers include ATP synthetase, subunit 9 (oliC), orotidine-5'- phosphatedecarboxylase (pvrA), the bacterial G418 resistance gene (this may also be used in yeast, but not in fungi), the ampicillin resistance gene (E. coli), resistance genes for neomycin, kanamycin, tetracycline, spectinomycin, erythromycin, chloramphenicol, phleomycin (Bacillus) and the E. coli uidA gene, coding for ⁇ -glucuronidase (GUS).
- Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.
- fungi and yeasts include e. g. versatile marker genes that can be used for transformation of most filamentous fungi and yeasts such as acetamidase genes or cDNAs (the amdS, niaD, facA genes or cDNAs from A. nidulans, A. oryzae or A. niger), or genes providing resistance to antibiotics like G418, hygromycin, bleomycin, kanamycin, methotrexate, phleomycin orbenomyl resistance (benA).
- specific selection markers can be used such as auxotrophic markers which require corresponding mutant host strains: e. g. D- alanine racemase (from Bacillus), URA3 (from S.
- the selection marker is deleted from the transformed host cell after introduction of the expression construct so as to obtain transformed host cells capable of producing the compound of interest or a compound involved in the synthesis of a compound of interest which are free of selection marker genes.
- Fusion vectors add a number of amino acids to a protein encoded therein, e.g. to the amino terminus of the recombinant protein.
- Such fusion vectors typically serve three purposes: 1 ) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
- a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
- the mutated essential gene in the vector comprised in the host cell deficient in the essential gene coding for the essential polypeptide according to the invention is a mutated essential gene which comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non-mutated promoter present in the essential gene, when measured under the same conditions. Therefore in one embodiment, the non-mutated promoter (naturally) present in the essential gene can be replaced by a mutated less strong promoter.
- the strength of a promoter if compared with another promoter is determined by comparing the rates of transcription of a gene into mRNA from both promoters when compared under identical conditions.
- the mutated less strong promoter has a lower rate of transcription of the gene if compared to the non-mutated promoter, when compared under identical conditions.
- Compared under identical conditions means that the rate of transcription of a gene into mRNA, is measured in both promoters, using the same conditions, preferably by using the same assay and/or methodology, more preferably within the same experiment.
- Promoter strength can be determined by measuring mRNA concentration via RNAseq, RT-PCR, Northern blotting analysis or promoter fusion with a reporter protein and other methods known to those skilled in the art.
- the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site
- the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when
- a Ribosome Binding Site is a sequence present on the mRNA that is bound by the ribosome when initiating protein translation.
- a mutated, less functional RBS is herewith defined as a RBS which has lower ability to bind to the ribosome if compared to the unmutated RBS measured under the same conditions, and which results in a lower (rate of) translation of the mRNA into the essential polypeptide.
- the lower rate of translation of the mRNA into the essential polypeptide will lead to a lower expression of the essential polypeptide in the host cell comprising the mutated essential gene when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the host cell according to the invention is a prokaryotic host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and;
- b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- the mutated essential gene comprises an insertion, deletion, or substitution of one or more nucleotides in the region of the essential gene coding for the RBS, preferably in the region of the essential gene coding for the RBS which is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions, wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8
- the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene.
- the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 15.
- the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
- the host cell according to the invention is a prokaryotic host cell deficient in an essential gene coding for an essential polypeptide, wherein the essential polypeptide is a polypeptide according to SEQ ID NO: 45, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 by an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44, wherein preferably the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 is selected from any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ
- the host cell deficient in the essential gene coding for the essential polypeptide wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the ORF of SEQ ID NO: 44, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
- the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 preferably corresponds to SEQ ID NO: 33.
- the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 preferably corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
- the translational initiator consensus sequence (6-12 nucleotides) before the ATG is often called Kozak consensus sequence due to the initial work on this topic (Kozak, M. (1987): an analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucl. Acid Res. 15(20): 8125-47).
- translational initiator sequence is defined as the ten nucleotides immediately upstream of the initiator or start codon of the open reading frame of a DNA sequence coding for a polypeptide.
- the initiator or start codon encodes for the amino acid methionine.
- the initiator codon is typically ATG, but may also be any functional start codon such as GTG. It is well known in the art that uracil, U, replaces the deoxyribonucleotide thymine, T, in RNA.
- the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
- the invention provides a method for the production of a host cell, preferably a host cell according to the invention, which method comprises:
- a vector comprising at least an autonomous replication sequence and a mutated essential gene
- the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide;
- step a) comprises providing a parent host cell and modifying the parent host cell to make it deficient in an essential gene.
- the host cell deficient in an essential gene coding for an essential polypeptide as herein defined may be produced starting from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide by modifying said parent host cell, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no activity or substantially no specific activity and combinations of one or more of these possibilities as compared to the parent host cell that has not been modified, when analysed under the same conditions.
- a modification, preferably in the genome is construed as one or more modifications.
- the modification preferably in the genome, can either be effected by
- Modification of a genome of a host cell is herein defined as any event resulting in a change in a polynucleotide sequence in the genome of the cell.
- the host cell deficient in an essential gene coding for an essential polypeptide as herein defined is a host cell having a modification, preferably in its genome comprising:
- Modification can be introduced by classical strain improvement, random mutagenesis followed by selection. Modification can also be introduced by site-directed mutagenesis. Modification may be accomplished by the insertion (introduction), substitution (replacement) or deletion (removal) of one or more nucleotides in a polynucleotide sequence. A full or partial deletion of the essential gene coding for the essential polypeptide as defined herein may be achieved. In alterative the essential gene coding for the essential polypeptide as defined herein may be partially or fully replaced with a polynucleotide sequence which does not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide as defined herein.
- one or more nucleotides can be inserted into the essential gene coding for the essential polypeptide as defined herein resulting in the disruption of said gene and consequent full inactivation of the essential polypeptide as defined herein coded by the disrupted polynucleotide.
- the host cell deficient in the essential gene coding for the essential polypeptide as defined herein comprises a modification in its genome selected from a) a full or partial deletion of the essential gene,
- This modification may for example be in a coding sequence or a regulatory element required for the transcription or translation of the essential gene.
- nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of a start codon or a change or a frame-shift of the open reading frame of a coding sequence.
- the modification of a coding sequence or a regulatory element thereof may be accomplished by site-directed or random mutagenesis, DNA shuffling methods, DNA reassembly methods, gene synthesis (see for example Young and Dong, (2004), Nucleic Acids Research 32, (7) electronic access http://nar.oupjournals.Org/cgi/reprint/32/7/e59 or Gupta et al.
- site-directed mutagenesis procedures are the QuickChangeTM site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla, CA), the The Altered Sites ® II in vitro Mutagenesis Systems' (Promega Corporation) or by overlap extension using PCR as described in Gene. 1989 Apr 15;77(1 ):51 -9. (Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR "Site-directed mutagenesis by overlap extension using the polymerase chain reaction") or using PCR as described in Molecular Biology: Current Innovations and Future Trends. (Eds. A.M. Griffin and H.G. Griffin. ISBN 1 -898486- 01-8;1995 Horizon Scientific Press, PO Box 1 , Wymondham, Norfolk, U.K.).
- Preferred methods of modification are based on recombinant genetic manipulation techniques such as partial or complete gene substitution or partial or complete gene deletion.
- an appropriate DNA sequence may be introduced at the target locus to be replaced.
- the appropriate DNA sequence is preferably present on a cloning vector.
- Preferred integrative cloning vectors comprise a DNA fragment, which is homologous to the polynucleotide and / or has homology to the polynucleotides flanking the locus to be replaced for targeting the integration of the cloning vector to this pre-determined locus.
- the cloning vector is preferably linearized prior to transformation of the cell.
- linearization is performed such that at least one but preferably either end of the cloning vector is flanked by sequences homologous to the DNA sequence (or flanking sequences) to be replaced.
- This process is called homologous recombination and this technique may also be used in order to achieve (partial) gene deletion.
- the essential gene may be replaced by a defective polynucleotide, that is a polynucleotide that fails to produce a (fully functional) essential polypeptide.
- a defective polynucleotide replaces the endogenous polynucleotide (essential gene). It may be desirable that the defective polynucleotide also encodes a marker, which may be used for selection of transformants in which the nucleic acid sequence has been modified.
- a technique based on in vivo recombination of cosmids in E. coli can be used, as described in: A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans (2000) Chaveroche, M-K., Ghico, J-M. and dEnfert C; Nucleic acids Research, vol 28, no 22.
- modification wherein said host cell produces no essential polypeptide as defined herein and encoded by an essential gene as described herein, may be performed by established anti-sense techniques using a nucleotide sequence complementary to the nucleic acid sequence of the essential gene. More specifically, expression of the essential gene by a host cell may be reduced or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the polynucleotide, which may be transcribed in the cell and is capable of hybridizing to the mRNA produced in the cell. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated.
- the provision of a host cell deficient in an essential gene coding for an essential polypeptide can be achieved by eliminating production of the mRNA encoding said polypeptide if compared with a parent host cell which is not deficient in the essential gene and measured under the same conditions.
- the host cell is inducibly deficient in the essential gene coding for the essential polypeptide.
- the provision of a host cell inducibly deficient in the essential gene can be achieved by placing the essential gene in the host genome under the control of an inducible promoter.
- the inducible promoter may be any inducible promoter suitable for the purpose, be it a chemically or physically induced promoter (such as by temperature or light). The person skilled in the art knows how to select such promoter. Suitable inducible promoters which can be used in a host cell according to the invention have been herein described.
- RNA interference FEMS Microb. Lett. 237 (2004): 317-324.
- RNAi RNA interference
- this method identical sense and antisense parts of the nucleotide sequence, which expression is to be affected, are cloned behind each other with a nucleotide spacer in between, and inserted into an expression vector. After such a molecule is transcribed, formation of small nucleotide fragments will lead to a targeted degradation of the mRNA, which is to be affected.
- the elimination of the specific mRNA can be to various extents.
- a modification which results in an essential polypeptide with no (enzymatic) activity as defined herein can be obtained by different methods, for example by an antibody directed against such a polypeptide or a chemical inhibitor or a protein inhibitor or a physical inhibitor (Tour O. et al, (2003) Nat. Biotech: Genetically targeted chromophore-assisted light inactivation. Vol.21 , no. 12: 1505-1508) or peptide inhibitor or an anti-sense molecule or RNAi molecule (R.S. Kamath_et al, (2003) Nature: Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. vol. 421 , 231-237).
- the foldase CYPB is a component of the secretory pathway of Aspergillus niger and contains the endoplasmic reticulum retention signal HEEL. Mol. Genet. Genomics. 2001 Dec;266(4):537-545.), or by targeting the essential polypeptide in filamentous fungi to a peroxisome which is capable of fusing with a membrane-structure of the cell involved in the secretory pathway of the cell, leading to secretion outside the cell of the polypeptide (e.g. as described in WO2006/040340).
- Re-localization of the essential polypeptide may occur to a cell compartment wherein the essential peptide cannot perform its biological function, also leading to a cell which in fact is deficient in the (function of) the essential polypeptide.
- a host cell wherein the essential polypeptide is re-localized to a compartment wherein it cannot perform its biological function is a host cell deficient in the essential polypeptide.
- inhibition of polypeptide enzymatic activity as defined herein can also be obtained, e.g. by UV or chemical mutagenesis (Mattern, I.E., van Noort J.M., van den Berg, P., Archer, D. B., Roberts, I.N. and van den Hondel, C. A., Isolation and characterization of mutants of Aspergillus niger deficient in extracellular proteases. Mol Gen Genet. 1992 Aug;234(2):332- 6.) or by the use of inhibitors inhibiting enzymatic activity of a polypeptide as described herein (e.g.
- nojirimycin which function as inhibitor for ⁇ -glucosidases (Carrel F.L.Y. and Canevascini G. Canadian Journal of Microbiology (1991 ) 37(6): 459-464; Reese E.T., Parrish F.W. and Ettlinger M. Carbohydrate Research (1971 ) 381 -388)).
- the parent host cell is modified in its genome by one of the following methods: a) fully or partially deleting the essential gene; b) fully or partially replacing the essential gene with a polynucleotide sequence which does not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide; c) disrupting the essential gene by insertion of one or more nucleotides in the polynucleotide sequence of said gene and consequent full inactivation of the polypeptide coded by the disrupted polynucleotide; d) placing the essential gene in the host cell genome under the control of an inducible promoter and culturing the host cell under conditions which repress transcription of the essential gene into mRNA.
- step b) according to the method for the production of a host cell deficient in the essential gene coding for the essential polypeptide according to the invention, it is provided a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- the mutated essential gene does or does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
- the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
- the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon of the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon of the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon of the open reading frame of the essential gene.
- the vector may be a vector as herein defined and may be produced according to methods known to those skilled in the art.
- step c) according to the method for the production of a host cell deficient in the essential gene coding for the essential polypeptide according to the invention, the host cell obtained in step a) is transformed with the vector of step b).
- Vector DNA can be introduced into prokaryotic or eukaryotic cells via natural competence, conventional transformation or transfection techniques.
- transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign polynucleotide (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, transduction, infection, lipofection, cationic lipidmediated transfection or electroporation.
- Suitable methods for transforming or transfecting host cells can be found in Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., CSHL Press, Cold Spring Harbor, NY, 2001 , and other laboratory manuals and are well known to those skilled in the art.
- sequence of the method steps in the method to produce a host cell deficient in an essential gene coding for an essential polypeptide wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein may vary depending on the circumstances.
- the method steps a), b) and c) are performed simultaneously, separately or sequentially.
- step a) may be followed by step b) and step b) may be followed by step c).
- step b) may be followed by step a) and step a) may be followed by step c).
- the essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable under all conditions and in any type of nutrient medium.
- the essential polypeptide may be a polypeptide whose lower or no expression in the host cell renders the host cell non-viable under all conditions and in any nutrient medium, such as minimal or complex medium. It will be evident to the skilled person that in the latter case the host cell deficient in the essential gene coding for the essential polypeptide can be viable only when having being transformed with the vector carrying the mutated essential polypeptide as described herein.
- steps a), b) and c) of the method to produce a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein may be performed simultaneously.
- Embodiments of the invention which are applicable to the host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene according to the invention are equally applicable to the method for the production of said host cell as described herein.
- the invention provides a method for the production of a compound of interest comprising
- the compound of interest may be any compound of interest as herein defined.
- the host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene has been herein described. All embodiments of said host cell as herein described are equally applicable to the method for the production of a compound of interest as described herein. Furthermore a vector comprising at least an autonomous replication sequence and a mutated essential gene has also been herein described and the embodiments relative to this vector are equally applicable to the method for the production of a compound of interest as described herein.
- Step a) of the method of production of a compound of interest comprises culturing the host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell, under conditions conducive to the production of the compound of interest.
- the host cells may be cultivated in a nutrient medium suitable for production of the compound of interest using methods known in the art.
- the cells may be cultivated by shake flask cultivation, small-scale or large- scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the compound of interest to be produced and/or isolated.
- the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art (see, e. g., Bennett, J. W. and LaSure, L, eds., More Gene Manipulations in Fungi, Academic Press, CA, 1991).
- Suitable media are available from commercial suppliers or may be prepared using published compositions (e. g., in catalogues of the American Type Culture Collection). If the compound of interest is secreted into the nutrient medium, the compound can be isolated directly from the medium. If the compound of interest is not secreted, it can be isolated from cell lysates.
- the method of production of a compound of interest according to the invention may comprise prior to step a) providing a a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein.
- Methods to produce a host cell deficient in an essential gene coding for an essential polypeptide may be those herein described.
- Step b) of the method of production of a compound of interest according to the invention may comprise isolating the compound of interest from the culture broth.
- the compound of interest as described herein may be isolated by methods known in the art.
- the compound of interest may be isolated from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.
- the isolated compound of interest may then be further purified by a variety of procedures known in the art including, but not limited to, chromatography (e. g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.
- the compound of interest may be used without substantial isolation from the culture broth; separation of the culture medium from the biomass may be adequate.
- the yield of the compound of interest is improved if compared to a method wherein a second host cell is used, wherein said second host cell differs from the host cell only in that the vector comprising the essential (unmodified) gene coding for the essential polypeptide instead of the mutated essential gene, wherein the two methods are performed under the same conditions.
- the yield increases with at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%, more preferably, with at least 1 10%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190% or at least 200%, even more preferably with at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%.
- the invention provides the use of a host cell deficient in an essential gene, coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene codes for the essential polypeptide according to the invention, in a method for producing a compound of interest.
- the invention provides a vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein preferably the mutated essential gene is selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function and/or specific enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- a vector comprising at least an autonomous replication sequence and a mutated essential gene and its embodiments have been herein described and are applicable to this aspect of the invention.
- Embodiments of the invention 1 A host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene.
- a host cell according to any one of embodiments 1 to 3 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and; b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- a host cell according to any one of embodiments 1 to 4 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- the essential gene coding for the essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene in said host cell, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- a host cell according to any one of the preceding embodiments wherein the essential polypeptide is a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an enzyme alanine racemase in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
- the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
- a host cell according to embodiment 9 wherein the host cell is a eukaryotic cell, preferably a fungal cell, more preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain, or a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma.
- a host cell is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces, even more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
- mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non-mutated promoter present in the essential gene, when measured under the same conditions.
- a host cell which is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present in
- a host cell according to any one of embodiments 1 1 to 14 wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of
- a host cell according to embodiment 15 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
- a host cell according to any one of embodiments 1 1 to 16 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
- a host cell according to embodiment 10 or 12 which is an eukaryotic host cell wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
- a host cell according to embodiment any one of embodiments 8 to 19 wherein the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
- Method for the production of a host cell according to any one of embodiments 1 to 20, which method comprises:
- a vector comprising at least an autonomous replication sequence and a mutated essential gene
- the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide;
- step c transforming the host cell of step a) with the vector of step b).
- step a) comprises a1 ) providing a parent host cell and a2) modifying the parent host cell to make it deficient in an essential gene.
- Method according to any one of embodiments 21 to 24 wherein the host cell deficient in an essential gene coding for an essential polypeptide is produced starting from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide, by modifying said parent host cell, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no activity or substantially no specific activity and combinations of one or more of these possibilities as compared to the parent host cell that has not been modified, when analysed under the same conditions.
- Method according to any one of embodiment 21 to 25 wherein the parent host cell is modified in its genome by one of the following methods: a) fully or partially deleting the essential gene; b) fully or partially replacing the essential gene with a polynucleotide sequence which does not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide; c) disrupting the essential gene by insertion of one or more nucleotides in the polynucleotide sequence of said gene and consequent full inactivation of the polypeptide coded by the disrupted polynucleotide; d) placing the essential gene in the host cell genome under the control of an inducible promoter and culturing the host cell under conditions which repress transcription of the essential gene into mRNA.
- Method according to embodiment 27 wherein the process steps a), b) and c) are performed simultaneously.
- the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and; b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
- mutated essential gene a has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
- the essential gene coding for the essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene in said host cell, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
- the essential polypeptide is a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an enzyme alanine racemase in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
- the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
- the host cell is a eukaryotic cell, preferably a fungal cell, more preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain, or a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma.
- the host cell is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces, even more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
- mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non- mutated promoter present in the essential gene, when measured under the same conditions.
- the host cell is a prokaryotic host cell
- the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present
- mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
- the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44
- Method according to embodiment 42 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
- Method according to any one of embodiments 40 to 43 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
- the host cell is an eukaryotic host cell
- the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
- Method for the production of a compound of interest comprising culturing a host cell according to any one of embodiments 1 to 20 or a host cell produced according to the method for the production of a host cell according to any one of embodiments 21 to 46, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell under conditions conducive to the production of the compound of interest, and
- Method according to embodiment 47 comprising, prior to step a), providing a host cell according to any one of embodiments 1 to 20 or a host cell produced according to the method of any one of embodiments 21 to 46.
- Method according to embodiments 46 or 48 wherein the yield of the compound of interest is improved if compared to a method wherein a second host cell is used, wherein said second host cell differs from the host cell only in that the vector comprises the essential (unmodified) gene coding for the essential polypeptide instead of the mutated essential gene, wherein the two methods are performed under the same conditions.
- the yield increases with at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%, more preferably, with at least 1 10%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190% or at least 200%, even more preferably with at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%.
- the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
- biopolymer is an enzyme, preferably an amylase, more preferably an a-amylase or a ⁇ - amylase.
- an enzyme preferably an amylase, more preferably an a-amylase or a ⁇ - amylase.
- a vector comprising at least an autonomous replication sequence and a mutated essential gene.
- a fungal cell preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain
- a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to
- a vector according to any one of embodiments 56 to 60 suitable to transform a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
- mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
- a vector according to embodiment 65 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
- a vector according to any one of embodiments 61 to 66 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase
- a vector according to embodiment 67 which is suitable to transform an eukaryotic host cell wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
- Bacillus subtilis strain BS154 (deposited on 9 October 2013 as CBS136327 at the Centraalbureau voor Schimmelcultures (Fungal Biodiversity Centre), Uppsalalaan 8, 3584CT Utrecht, The Netherlands) ( aprE, nprE, amyE, spo ) is described in Quax and Broekhuizen 1994 Appl. Microbiol. Biotechnol. 41 : 425-431.
- the E. colli B. subtilis shuttle vector pBHA12 is described in WO2008/000632.
- Bacillus subtilus 168 (ATCC 23857) (trpC2) is described in Anagnostopoulos C. and Spizizen J. (1961 ) J. Bacteriol. (1961 ) 81 (5): 741-746.
- NCIMB1 1873 Bacillus stearothermophilus C599 (NCIMB1 1873) is described in WO91/04669.
- PCR Polymerase chain reaction
- the glucan 1 ,4-a-maltohydrolase productivity in the culture broth of B. subtilis was quantified by measuring activity using a Megazyme CERALPHA alpha amylase assay kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland) according to the manufacturer's instruction.
- PCN plasmid copy number
- the qPCR reaction was performed with 12.5 ⁇ 2x iQTM SYBR® Green supermix
- the pGB20 vector (Fig. 1 ) was made synthetically and contains the pE194 ori including oripE, palA and repE, for replication in B. subtilis below 37°C and integration at 48°C (Byeon W.H., Weisblum B. Replication genes of plasmid pE194-cop and repF: transcripts and encoded proteins. J Bacteriol. 1990 172(10):5892-5900), the bleomycin (bleo) antibiotic marker from pUB1 10 gives resistance to phleomycin in B. subtilis (McKenzie T, Hoshino T, Tanaka T, Sueoka N. The nucleotide sequence of pUB1 10: some salient features in relation to replication and its regulation.
- This pGB20 vector was used to construct a dal deletion vector pGBB23 (Fig. 2).
- the 5'- and 3'- flanking regions of the dal gene from B. subtilis 168 were amplified by polymerase chain reaction (PCR) with the following primers.
- PCR polymerase chain reaction
- a forward primer to amplify the 3'- dal region A forward primer to amplify the 3'- dal region:
- PCR was performed on a thermocycler with Phusion High-Fidelity DNA polymerase (Finnzymes OY, Aspoo, Finland) according to the instructions of the manufacturer.
- the vector pGB20 was digested with AatW and Xho ⁇ .
- the digested vector and the PCR products of the 5'- region and 3'-region were assembled using In-Fusion cloning (Takara Bio Europe/Clontech, France).
- the reaction mixture was transformed to E. coli TOP10 cells.
- a clone was selected and this dal deletion vector was named pGBB23 (Fig. 2).
- the sequence of the plasmid was confirmed by DNA sequencing.
- the plasmid was isolated from E. coli and transformed to B. subtilis BS154.
- pGBB23 contains the thermosensitive origin of replication from pE194 this plasmid is subsequently integrated into the chromosome of BS154 by elevating the growth temperature to 48°C and maintaining antibiotic selection pressure (4 ⁇ g/ml phleomycin). Homologous recombination directed by the dal flanking regions allowed for integration into the dal locus. The integrated clones were used for excision of the integrated plasmid by growth at a permissive temperature in the absence of antibiotic pressure. The dal deletion was confirmed by PCR using the following primers.
- a forward primer to amplify the dal locus outside the 5'-flank A forward primer to amplify the dal locus outside the 5'-flank:
- Example 2 Construction of an expression plasmid with a dal selection marker and transformation of the D-alanine racemase deletion mutant with said plasmid.
- kanamycine neo
- phleomycine bleo
- pBHA12 kanamycine and phleomycine (bleo) markers on pBHA12 (described in WO2008/000632) were replaced by a dal gene-encoding synthetic fragment as follows.
- the vector pBHA12 was digested with Mun ⁇ and Not ⁇ and a synthetic fragment containing the dal gene with its native promoter and the ydcC terminator (SEQ ID NO: 44) was used to replace the reppUB terminator.
- This vector was named pGBB1 1 (Fig. 3).
- the dal selection plasmid pGBB1 1 was transformed to the dal deletion strain BS227 and transformants containing pGBB11 were able to grow in the absence of D-alanine, thereby demonstrating the functionality of this vector and the dal selection marker.
- amyM gene including its native terminator sequence was amplified by PCR with the following primers.
- a forward primer to amplify the amyM gene and introduce a Afctel site A forward primer to amplify the amyM gene and introduce a Afctel site:
- the resulting PCR fragment was digested with the restriction enzymes Ndel and Hind ⁇ and ligated with T4 DNA ligase into Ndel and Hind ⁇ digested pGBB11 plasmid.
- the ligation mixture was transformed into B. subtilis strain BS227.
- a clone was selected and the amyM expression plasmid was named pGBB1 1AMY1 (Fig. 4).
- the sequence of the plasmid was confirmed by DNA sequencing.
- B. subtilis strain BS227 was transformed with pGBB1 1AMY1 and this strain was named AMYB227A1.
- Proteomics analyses learned that the expression of dal was increased in the BS227 containing pGBB11AMY1 (see Example 3 and Fig. 7). Furthermore reduction of glucan 1 ,4- a-maltohydrolase productivity was found to be correlated with the plasmid copy number and amyM productivity (see Fig. 5).
- Example 3 Construction of an expression plasmid with a dal selection marker and transformation of the D-alanine racemase deletion mutant with said plasmid.
- ribosome binding site (RBS) of the dal gene on plasmid pGBB1 1 AMY1 was mutated with the Quick Change II site directed mutagenesis' kit (Stratagene, California, USA).
- plasmid pGBB12AMY1 yielded AMYB227B1.
- Plasmid pGBB13AMY1 yielded AMYB227C1
- plasmid pGBB14AMY1 yielded AMYB227D1
- plasmid pGBB15AMY1 yielded AMYB227E1
- plasmid pGBB16AMY1 yielded AMYB227F1
- plasmid pGBB17AMY1 yielded AMYB227G1
- Example 3 Expression of amyM with pGBB11AMY-1 and pGBB12AMY-1.
- the B. subtilis strain AMYB227A1 containing the pGBB1 1AMY1 expression plasmid with the native dal RBS sequence and the AMYB227B1-AMYB227K1 containing pGBB12AMY1-pGBB21AMY with the mutated dal RBS sequences were tested in a shake flask fermentation experiments. These shake flasks contained 20 ml 2xTY medium composed of 1.6% Bacto tryptone, 1 % Yeast extract and 0.5% NaCI. The cultures were shaken vigorously at 37 ° C and 250 rpm for 16 hours and 0.2 ml culture medium was used to inoculate 20 ml SMM medium.
- SMM pre-medium contains 1.25% (w/w) yeast extract, 00.5% (w/w) CaCI 2 , 0.075% (w/w) MgCI 2 .6H 2 0, 15 pg/l MnS0 4 .4H 2 0, 10 pg/l CoCI 2 .6H 2 0, 0.05% (w/w) citric acid, 0.025% (w/w) antifoam 86/013 (Basildon Chemicals, Abingdon, UK).
- glucan 1 ,4-a-maltohydrolase production was increased with 34% in strain AMYB227K1 compared to strain AMYB227A1 . This result is clearly demonstrating the beneficial effect of the dal RBS mutation on enzyme productivity.
- Quantitative proteomics was used for protein identification and quantification of the intracellular protein fraction of B. subtilis strains BS154, AMYB227A1 and AMYB227K1. Strains were grown as explained in example three and equal amounts of cells were harvested to normalize the total protein amount between different samples. BSA spiking was performed as an internal standard and quality control of the performed experiments. BPER (Pierce, Rockford, Illinois, USA) was used for protein solubilisation and TCA precipitation was performed for protein purification.
- strain AMYB227A1 The data showed alanine racemase expression in strain AMYB227A1 , with the genomic dal deletion complemented with plasmid pGBB1 1AMY1 , was higher than in strain BS154.
- strain AMYB227K1 containing the mutated dal RBS on pGBB21AMY-1 the dal expression was severely reduced compared to strain AMYB227A1 and strain BS154.
- dal expression is essential for the cells viability, cells are forced to maintain high plasmid copy numbers that results in higher glucan 1 ,4-a- maltohydrolase production (Fig. 7).
- Fig. 7 show how the method of the invention reduces dal expression from the expression plasmid and increases enzyme production using a plasmid expression system free from antibiotic selection markers.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene. The essential gene preferably codes for an alanine racemase (dal or alr). The mutated essential gene in the vector is the same or similar to the essential gene, but the ribosome binding site is mutated to be less functional. This results in a system for the maintenance of a vector or plasmid in the host cell, preferably Bacillus. Said host cell can advantageously be used in a method of production of a compound of interest.
Description
PROTEIN EXPRESSION SYSTEM
Field of the invention
The present invention relates to a novel host cell deficient in an essential gene and comprising a vector containing a mutated essential gene, to a method for producing said host cell, to a method for producing a compound of interest using said host cell, to the use of said host cell and to a vector containing the mutated essential gene.
Background of the invention
Stable expression systems are essential for the production of compounds of interest by recombinant host cells. Recombinant hosts cells that are genetically modified to produce e.g. a heterologous protein of interest or higher levels of a homologous protein, have a competitive disadvantage over cells which have not been genetically modified. Wild type cells are fitter than their genetically modified counterparts and will outgrow the producing cells in fermentations leading to loss of yield in protein production.
Recombinant expression vectors are used to genetically modify host cells and to induce them to the expression of useful compounds, e.g. for expression of heterologous proteins or for the overexpression of homologous proteins. Plasmids are autonomously replicating vectors, i.e. circular DNA molecules that replicate independently from the host genome.
Plasmids have been used in prokaryotes in both fundamental and biotechnological studies aimed to understand cellular processes, or to produce commercially interesting products such as enzymes, metabolites etc. However, unlike some naturally occurring plasmids, recombinant plasmids are inherently unstable in bacteria and require positive selection to be retained in the cell at a satisfactory level.
Such positive selection can be achieved by expressing an antibiotic resistance marker on the plasmid and supplementing the media with antibiotics. However adding
antibiotics to industrial fermentation is undesirable. The presence of antibiotics generally is not accepted in the final product and waste waters and therefore additional purification steps are necessary after the fermentation process, leading to higher production costs. Alternatively auxotrophic markers can be used to achieve positive selection. However the latter use requires pure and defined media which are costly for the production at an industrial scale.
The enzyme alanine racemase converts L-alanine into D-alanine. D-alanine is an essential building block of peptidoglycan that forms the basic component of the cell wall (Watanabe A, Yoshimura T, Mikami B, Hayashi H, Kagamiyama H, Esaki N. (2002)). In B. subtilis alanine racemase is encoded by the dal gene. In prokaryotes the gene coding for the enzyme alanine racemase has been used as selectable marker. In B. subtilis the dal gene was deleted from the genome and placed on a multi copy plasmid which resulted in stable maintenance of the plasmid (Ferrari, E. et al. (1985). Isolation of an Alanine Racemase Gene from Bacillus subtilis and Its Use for Plasmid Maintenance in B. Subtilis" Biotechnology, 3:1003-1007; GB 2177097 (A); EP 0185512 (A1 )). In Lactococcus lactis and Lactobacillus plantarumis plasmids were stabilized in a similar manner. The alanine racemase encoding genes in lactic acid bacteria (air) were deleted form the genome and placed on a plasmid which was stably maintained for 200 generations (Bron P.A. et al, (2002) Use of the air Gene as a Food-Grade Selection Marker in Lactic Acid Bacteria. Appl. Environ. Microbiol., 68: 5663-5670).
In both examples the plasmid was stably maintained within the host cell, however the plasmid copy number was not controlled. Reduction of plasmid copy number in the host cell which is suffering from the burden of producing high levels of proteins of interest will reduce protein productivity even though still allowing the cell to proliferate as only minor levels of alanine racemase are needed for vital cell growth.
Spreng et al (Vaccine (2005) 23: 2060-2065) describe plasmid maintenance systems suitable for GMO-based bacterial vaccines. One of these systems was based on complementation of the asd gene, coding for aspartate-beta-semi-aldehyde dehydrogenase, another enzyme involved in the biosynthesis of bacterial cell peptidoglycans. S. typhimurium Aasd mutants were transformed with plasmids carrying the asd gene and a gene coding for an heterologous antigen. In one case the asd -35 and -10 promoter region was depleted with the purpose of reducing the level of Asd expression. In that example the significantly
reduced expression of Asd protein resulted in enhanced immunogenicity and enabled stable expression of the somewhat toxic antigen, the PspA protein of Streptococcus pneumonie.
Vidal et al (J. Biotech. (2008) 134: 127-136) describes an antibiotic-free plasmid selection system based on glycine auxotrophy for recombinant protein overexpression in Escherichia coli. E. coli M15-derivated glycine auxotrophic strains were transformed with complementation plasmid carrying the glyA homologous gene under the control of a constitutive weak promoter. This vector-host system allowed overproduction of rhamnulose 1 -phosphate aldolase in antibiotic-free medium.
Autonomously replicating vectors have so far been utilized with some success for a limited number of eukaryotes, mainly yeast species. Only limited use was made of replicating plasmids in filamentous fungi.
The most utilized plasmid replicon in the ascomycete Aspergillus nidulans that has been shown to function also in other Aspergilli, various Penicillium species as well as in Gibberella fujikuroi and Trichoderma reesei, is the /AiW/ 7 replicon (Gems et al., 1991 Gene. 98(1 ):61-7). This replicon represents a rearranged chromosomal A. nidulans DNA fragment that enables plasmids carrying an auxotrophic marker (like pyrG - uracil) or a dominant marker (like amdS - N-source or bleR - phleomycine) to replicate at multiple copies per chromosome (Fierro et al., 1996 Curr Genet. 29(5):482-9). However, similar to bacterial plasmids, AMA 1 -based vectors are mitotically notoriously unstable, and growth on rich media (in case of pyrG and amdS) or growth on antibiotic-free medium (in case of bleR) results in rapid loss of the plasmid from the cells.
WO2012123429 disclosed a vector-host system where the stability of the vector comprising an autonomous replication sequence was substantially increased in filamentous fungi, said vector-host system comprising a filamentous fungal host cell deficient in an essential gene, comprising a vector, said vector comprising at least said essential gene and an autonomous replication sequence. In one comparative example a heterologous aurl gene from A. nidulans was used for complementation of an aurl -deficient Penicillium chrysogenum, leading to a higher copy number of this plasmid if compared to the use of the heterologous aurl gene.
Vasavada (Advances in Applied Microbiology (1995) 41 : 25-54) describes strategies for improving productivity of heterologous proteins in recombinant Saccharomyces cerevisiae fermentations. In some example overexpression of heterologous proteins was
achieved using multi-copy plasmids, carrying auxotrophic markers complementing a cell deficiency. In one example the leucine marker Leu2-d with a defective leucine promoter was used. The plasmid copy number increased to supply enough leucine for the host to grow. There still remains a need for stable vector-host systems wherein the vector is maintained in high copy number into the host.
Summary of the invention It has been surprisingly found that a host cell deficient in an essential gene coding for an essential polypeptide, comprising a vector carrying a mutated essential gene complementing at least in part said deficiency, can be used in the production of a compound of interest with high yield.
The present invention provides a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene. Preferably the mutated essential gene is selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions. In one embodiment the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell
is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
The present invention further provides a method for the production of a host cell according to the invention, which method comprises:
a. providing a host cell deficient in an essential gene coding for an essential polypeptide;
b. providing a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity and/or specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions;
c. transforming the mutant host cell of step a) with the vector of step b), optionally wherein step a), b) and c) are performed simultaneously.
In one embodiment the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or
substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
The present invention also provides a method for the production of a compound of interest comprising
a) culturing a host cell according to the invention or produced according to a method according to the invention under conditions conducive to the production of the compound of interest, and
b) optionally isolating the compound of interest from the culture broth.
In one embodiment the mutated essential gene does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the
second host cell comprises the (unmodified) essential gene coding for the essential polypeptide.
The use of a host cell according to the invention for the production of a compound of interest is also provided by the present invention.
Brief description of the Figures
Fig. 1 sets out the plasmid map of pGB20.
Fig. 2 sets out the plasmid map of the dal deletion plasmid pGB23.
Fig. 3 sets out the plasmid map of the D-alanine racemase Dal plasmid pGBB1 1 comprising a wild-type (unmodified) dal expression cassette.
Fig. 4 sets out the plasmid map of pGBB1 1AMY1 for expression of amyM and complementation of the dal deletion by a wild-type (unmodified) dal expression cassette of pGBB1 1.
Fig. 5 sets out the relative plasmid copy number (PCN) (black bars) and relative amyM enzymatic activity (white bars) of fermentations with low and high amyM productivity.
The low productivity fermentation was set to 100% for both the PCN and amyM expression.
Fig. 6 sets out glucan 1 ,4-a-maltohydrolase productivity in B. subtilis strains
AMYB227A1 and AMYB227K1 in shake flasks at 48 hours in SMM medium.
Fig. 7 sets out the relative dal protein amount of B. subtilis strains BS154,
AMYB227A1 and AMYB227K1.
Description of the sequence listing SEQ ID NO: 1 sets out the sequence of the forward cheA primer for qPCR.
SEQ ID NO: 2 sets out the sequence of the reverse cheA primer for qPCR.
SEQ ID NO: 3 sets out the sequence of the forward amyM primer for qPCR.
SEQ ID NO: 4 sets out the sequence of the reverse amyM primer for qPCR.
SEQ ID NO: 5 sets out the sequence of the forward primer to amplify the 5'- dal region.
SEQ ID NO: 6 sets out the sequence of the reverse primer to amplify the 5'- dal region.
SEQ ID NO: 7 sets out the sequence of the forward primer to amplify the 3'- dal region.
SEQ ID NO: 8 sets out the sequence of the reverse primer to amplify the 3'- dal region.
SEQ ID NO: 9 sets out the sequence of the forward primer to amplify the dal locus outside the 5'-flank.
SEQ ID NO: 10 sets out the sequence of the reverse primer to amplify the dal locus outside the 3'-flank.
SEQ ID NO: 1 1 sets out the sequence of the forward primer to amplify the amyM gene and introduce a Nde\ site.
SEQ ID NO: 12 sets out the sequence of the reverse primer to amplify the amyM gene and introduce a H/ndlM site.
SEQ ID NO: 13 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp insertion on pGBB1 1AMY1 and to yield pGBB12AMY.
SEQ ID NO: 14 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp insertion on pGBB1 1AMY1 and to yield pGBB12AMY.
SEQ ID NO: 15 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp insertion on pGBB1 1AMY1 and to yield pGBB13AMY.
SEQ ID NO: 16 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp insertion on pGBB1 1AMY1 and to yield pGBB13AMY.
SEQ ID NO: 17 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp deletion on pGBB1 1AMY1 and to yield pGBB14AMY.
SEQ ID NO: 18 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp deletion on pGBB1 1AMY1 and to yield pGBB14AMY.
SEQ ID NO: 19 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp deletion on pGBB1 1AMY1 and to yield pGBB15AMY.
SEQ ID NO: 20 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp deletion pGBB1 1AMY1 and to yield pGBB15AMY.
SEQ ID NO: 21 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 4 bp random substitution on pGBB1 1AMY1 and to yield pGBB16AMY.
SEQ ID NO: 22 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 4 bp random substitution on pGBB1 1AMY1 and to yield pGBB16AMY.
SEQ ID NO: 23 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 1 bp substitution on pGBB1 1AMY1 and to yield pGBB17AMY.
SEQ ID NO: 24 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 1 bp substitution on pGBB1 1AMY1 and to yield pGBB17AMY.
SEQ ID NO: 25 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 2 bp substitution on pGBB1 1AMY1 and to yield pGBB18AMY.
SEQ ID NO: 26 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 2 bp substitution on pGBB1 1AMY1 and to yield pGBB18AMY.
SEQ ID NO: 27 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 3 bp substitution on pGBB1 1AMY1 and to yield pGBB19AMY.
SEQ ID NO: 28 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 3 bp substitution on pGBB1 1AMY1 and to yield pGBB19AMY.
SEQ ID NO: 29 sets out the sequence of the forward primer to mutate the dal RBS and introduce a 4 bp substitution on pGBB1 1AMY1 and to yield pGBB20AMY.
SEQ ID NO: 30 sets out the sequence of the reverse primer to mutate the dal RBS and introduce a 4 bp substitution on pGBB1 1AMY1 and to yield pGBB20AMY.
SEQ ID NO: 31 sets out the sequence of the forward primer to mutate the dal RBS to introduce a 4 bp substitution and introduce a BglW site on pGBB1 1AMY1 and to yield pGBB21AMY.
SEQ ID NO: 32 sets out the sequence of the reverse primer to mutate the dal RBS to introduce a 4 bp substitution and introduce a BglW site on pGBB1 1AMY1 and to yield pGBB21AMY.
SEQ ID NO: 33 sets out the sequence of the native RBS sequence of dal gene directly upstream of the dal AJG start codon.
SEQ ID NO: 34 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal AJG start codon, comprising an insertion of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 35 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal AJG start codon, comprising an insertion of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 36 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a deletion of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 37 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a deletion of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 38 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a random substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 39 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 1 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 40 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 2 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 41 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 3 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 42 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 43 sets out the sequence of a mutated RBS sequence of dal gene directly upstream of the dal ATG start codon, comprising a substitution of 4 bp in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene.
SEQ ID NO: 44 sets out the sequence of the dal gene obtained from Bacillus subtilis.
SEQ ID NO: 45 sets out the sequence of the protein D-alanine racemase encoded by the dal gene (UNIPROT:P10725) obtained from Bacillus subtilis.
SEQ ID NO: 46 sets out the nucleotide sequence of the amyM gene obtained from Geobacillus stearothermophilus .
SEQ ID NO: 47 sets out the sequence of the glucan 1 ,4-a-maltohydrolase obtained from Geobacillus stearothermophilus encoded by the amyiW gene.
Detailed description of the invention
Throughout the present specification and the accompanying claims, the words "comprise", "include" and "having" and variations such as "comprises", "comprising", "includes" and "including" are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to one or at least one) of the grammatical object of the article. By way of example, "an element" may mean one element or more than one element.
A reference herein to a patent document or other matter which is given as prior art is not to be taken as an admission that that document or matter was known or that the information it contains was part of the common general knowledge as at the priority date of any of the claims.
The disclosure of each reference set forth herein is incorporated herein by reference in its entirety.
It has been surprisingly found that a host cell deficient in an essential gene coding for an essential polypeptide, comprising a vector carrying a mutated essential gene wherein expression of said mutated essential gene in said host cell is lowered or wherein the expressed polypeptide has the same function but a lower enzymatic activity (or lower specific enzymatic activity) if compared to the polypeptide coded by the essential gene (i.e. the essential polypeptide), can be used in the production of a compound of interest with high yield.
Therefore the present invention provides a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene. In one embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a
prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide. Preferably the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene.
The mutated essential gene complements the deficiency present in the host cell, but due to a lower expression or activity of the (mutated) essential polypeptide coded by the mutated essential gene present in the vector, will select for cells with an increased copy number of the vector.
Preferably the mutated essential gene is selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; and/or b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity and/or lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
In one embodiment the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%
sequence identity to the essential gene and; b) it is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
In another embodiment the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
In the context of the present invention a "host cell deficient in an essential gene coding for an essential polypeptide" is herein defined as host cell derived from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide and which has been modified, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no enzymatic activity as compared to the parent host cell that has not been modified, when analysed under the same conditions and/or a combination of a) and b). In one embodiment a host cell which is deficient in an essential gene coding for an essential polypeptide is a host cell which has been modified, preferably in its genome, and which produces substantially no essential polypeptide encoded by said essential gene.
Deficiency in an essential gene coding for an essential polypeptide of a host cell as defined herein may be measured by methods known to those skilled in the art, e.g. it can be measured by determining the concentration and/or (specific) activity of the essential polypeptide coded by the essential gene and/or it may be measured by determining the concentration of mRNA transcribed from the essential gene as described herein and/or it may be measured by gene or genome sequencing if compared to the parent host cell which has not been modified.
A modification in the genome can be determined by comparing the DNA sequence of the host cell deficient in the essential gene to the DNA sequence of the parent (non- modified) microbial host cell. Sequencing of DNA and genome sequencing can be done using standard methods known to the person skilled in the art, for example using Sanger sequencing technology and/or next generation sequencing technologies such as lllumina GA2, Roche 454, etc. as reviewed in Elaine R. Mardis (2008), Next-Generation DNA Sequencing Methods, Annual Review of Genomics and Human Genetics, 9: 387-402. (doi:10.1 146/annurev.genom.9.081307.164359).
Deficiency in the production of the essential polypeptide coded by the essential gene as described herein can be measured using any assay suitable to the measurement of the biological activity of the polypeptide, e.g. polypeptide enzymatic activity as defined herein available to the skilled person, by e.g. measuring levels, concentrations and/or fluxes of metabolites involved in the enzymatic reaction, by quantitative proteomics techniques such as APEX or iTRAQ tools, by transcriptional profiling, by Northern blotting RT-PCR, by Q- PCR or by Western blotting. In particular quantifying the concentration of mRNA present in a cell may for example be achieved by northern blotting (in Molecular Cloning: A Laboratory Manual, Sambrook et a/., New York: Cold Spring Harbour Press, 1989). Quantifying the concentration of polypeptide present in a cell may for example be achieved by western blotting. The difference in mRNA concentration may also be quantified by DNA array analysis (Eisen, M.B. and Brown, P.O. DNA arrays for analysis of gene expression. Methods Enzymol. 1999, 303:179-205).
Deficiency of the host cell deficient in the essential gene coding for the essential polypeptide is preferably measured relative to the parent cell that is not deficient in the essential gene. A host cell deficient in the essential gene coding for the essential polypeptide produces substantially no essential polypeptide and/or produces a polypeptide encoded by said essential gene which has substantially no biological activity, e.g. substantially no enzymatic activity when said host cell produces at least 80% less of the polypeptide encoded by the essential gene, and/or has an at least 80% reduced expression level of the mRNA transcribed from the essential gene and/or has an at least 80% decreased biological activity, e.g. 80% decreased (specific) enzymatic activity of the essential polypeptide encoded by the essential gene as compared to the parent cell which is not deficient in the essential gene. Preferably the host cell produces at least 85% less,
preferably at least 90% less, even more preferably at least 95% less, at least 96% less, at least 97% less, at least 98% less, at least 99% less, at least 99.5% less, at least 99.9% less of the polypeptide encoded by the essential gene, and/or has an at least 85%, preferably at least 90%, even more preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% reduced expression level of the mRNA transcribed from the essential gene and/or has an at least 85%, preferably at least 90%, even more preferably at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9% decreased biological activity, e.g. decreased (specific) enzymatic activity of the essential polypeptide encoded by the essential gene as compared to the parent cell which is not deficient in the essential gene. Most preferably the host cell produces no polypeptide encoded by the essential gene, and/or has no expression level of the mRNA transcribed from the essential gene and/or produces a polypeptide which has no biological activity, e.g. no (specific) enzymatic activity if compared to the essential polypeptide encoded by the essential gene produced by the parent cell which is not deficient in the essential gene.
The essential gene coding for an essential polypeptide is preferably a gene that has not been shown to be non-essential in the host cell. In one embodiment, the essential gene is a gene whose deficiency renders the host cell non-viable under certain culture conditions because of lower or no expression in the host cell of the essential polypeptide. The essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable unless a specific essential cellular nutrient, e.g. a specific essential cellular nutrient produced by the essential polypeptide is supplied to the host cell with the nutrient medium. Therefore the essential polypeptide may be a polypeptide able to produce a nutrient which is essential for cell viability (e.g. wherein the essential polypeptide is an enzyme able to produce the nutrient essential for cell viability) or a polypeptide involved in the production of a nutrient which is essential for cell viability (e.g. wherein the essential polypeptide is an enzyme involved in the metabolic pathway which leads to the production of a nutrient essential for cell viability). The essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable under all conditions and in any type of nutrient medium. The essential polypeptide may be a polypeptide whose lower or no expression in the host cell renders the host cell non-viable under all conditions and in any nutrient medium, such as minimal or complex medium.
Preferably, the essential gene coding for an essential polypeptide is a gene essential in prokaryotes or eukaryotes coding for a polypeptide essential in prokaryotes or eukaryotes. Suitable examples of classes of essential genes include, but are not limited to, genes involved in DNA synthesis & modification, RNA synthesis & modification, protein synthesis & modification, proteasome function, the secretory pathway, cell wall biogenesis and cell division. In the context of the present application, the essential gene may or may not be an auxotrophic marker (auxotrophic markers are e. g. D-alanine racemase (from Bacillus, Bacillus subtilis or Bacillus licheniformis), pyrF (in P. fluorescens, Davison J BioTechniques (2002) 32(2): 386-401 ), URA3 (from S. cerevisiae or analogous genes from other yeasts), pyrG or pyrA (from A. nidulans or A. niger), argB (from A. nidulans or A. niger), trpC2, his, metB (from bacteria)). The essential gene may or may not be a dominant growth marker (such as n/'aD and amdS) and/or may or may not be a dominant resistance marker, such as resistance to heavy metals, biocide resistance and/or markers that confer antibiotic resistance (such as ble for bleomycin and phleomycin, ampicillin, kanamycin, erythromycin, geneticin, chloramphenicol, tetracycline resistance). In one embodiment the essential gene is the tif35 gene encoding the g subunit of translation initiation factor 3, which has an ortholog in all eukaryotes. In one embodiment, the tif35 gene encoding the g subunit of translation initiation factor 3 from P. chrysogenum is used as the essential gene. A further preferred essential gene is the A. nidulans aurl gene encoding the enzyme phosphatidylinositohceramide phosphoinositol transferase, which is required for sphingolipid synthesis. Thus, in one embodiment, the aurl gene encoding the enzyme phosphatidylinositokceramide phosphoinositol transferase from A. nidulans is used as the essential gene. Essential genes in Bacillus subtilis are described in Kobayashi K et al Proc Natl Acad Sci U S A. (2003) Apr 15; 100(8):4678-83, which is herewith incorporated by reference in its entirety. In addition it is known that many genes encoding compounds involved in primary metabolism and metabolic pathways can be essential genes, whose deficiency renders the host cell non-viable.
In one embodiment of the invention an essential gene coding for an essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase and which is at
least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
SEQ ID NO: 44 is a polynucleotide sequence representing the gene coding a non- mutated (i.e. native) alanine racemase in Bacillus subtilis. SEQ ID NO: 45 represents the amino acid sequence of a non-mutated (i.e. native) alanine racemase in Bacillus subtilis coded by SEQ ID NO: 44. When the host cell is a Bacillus host cell, preferably a Bacillus subtilis host cell, the essential gene coding for an alanine racemase in said host cell may be a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase in said host cell, which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
When the host cell is a prokaryotic host cell other than Bacillus, the essential gene coding for an alanine racemase in said host cell may be a gene according to a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
A functional homolog of SEQ ID NO: 44 is herewith defined as a polynucleotide representing the gene coding for non-mutated (i.e. native) alanine racemase in Bacillus subtilis other than SEQ ID NO: 44 or the gene coding for a non-mutated (i.e. native) alanine racemase in a microorganism other than Bacillus subtilis.
In one embodiment, the essential polypeptide in the host cell is preferably a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an alanine racemase, in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
When the host cell is a Bacillus host cell, preferably a Bacillus subtilis host cell, the essential polypeptide in said host cell may be a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence coding for alanine racemase in said host cell, which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
When the host cell is a prokaryotic host cell other than Bacillus, the essential gene coding for an alanine racemase in said host cell may be a gene according to a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
A functional homolog of SEQ ID NO: 45 is herewith defined as an amino acid sequence being a non-mutated (i.e. native) alanine racemase in Bacillus subtilis other than SEQ ID NO: 45 or a non-mutated (i.e. native) alanine racemase in a microorganism other than Bacillus subtilis.
For the purpose of this invention, it is defined here that in order to determine the percentage of sequence identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes. In order to optimize the alignment between the two sequences gaps may be introduced in any of the two sequences that are compared. Such alignment can be carried out over the full length of the sequences being compared. Alternatively, the alignment may be carried out over a shorter length, for example over about 20, about 50, about 100 or more nucleic acids/based or amino acids. The sequence identity is the percentage of identical matches between the two sequences over the reported aligned region. Preferably the percentage of sequence identity is calculated over the full length of the amino acid sequence or over the full length of the nucleotide sequence.
A comparison of sequences and determination of percentage of sequence identity between two sequences can be accomplished using a mathematical algorithm. The skilled person will be aware of the fact that several different computer programs are available to align two sequences and determine the identity between two sequences (Kruskal, J. B. (1983) An overview of sequence comparison In D. Sankoff and J. B. Kruskal, (ed.), Time warps, string edits and macromolecules: the theory and practice of sequence comparison, pp. 1-44 Addison Wesley). The percentage of sequence identity between two amino acid sequences or between two nucleotide sequences may be determined using the Needleman and Wunsch algorithm for the alignment of two sequences. (Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453). Both amino acid sequences and nucleotide sequences can be aligned by the algorithm. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purpose of this invention the
NEEDLE program from the EMBOSS package was used (version 2.8.0 or higher, EMBOSS: The European Molecular Biology Open Software Suite (2000) Rice, P. Longden.l. and Bleasby.A. Trends in Genetics 16, (6) pp276— 277, http://emboss.bioinformatics.nl/). For protein sequences EBLOSUM62 is used for the substitution matrix. For nucleotide sequence, EDNAFULL is used. The optional parameters used are a gap-open penalty of 10 and a gap extension penalty of 0.5. The skilled person will appreciate that all these different parameters will yield slightly different results but that the overall percentage identity of two sequences is not significantly altered when using different algorithms.
After alignment by the program NEEDLE as described above the percentage of sequence identity between a query sequence and a sequence of the invention is calculated as follows: Number of corresponding positions in the alignment showing an identical amino acid or identical nucleotide in both sequences divided by the total length of the alignment after subtraction of the total number of gaps in the alignment. The identity defined as herein can be obtained from NEEDLE by using the NOBRIEF option and is labeled in the output of the program as "longest-identity".
The nucleic acid and protein sequences described herein can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the N BLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403— 10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules described herein. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See the homepage of the National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov/.
In the context of the present invention a "gene" refers to a nucleic acid molecule coding for a polypeptide chain that includes control sequences as defined herein preceding and following the Open Reading Frame. It will be further appreciated that the definition of
gene can include nucleic acids that do not encode polypeptide, but rather provide templates for transcription of functional RNA molecules such as transfer RNAs, ribosomal RNAs, ribozymes, microRNAs, etc. Therefore the present invention encompasses embodiments in which the essential gene codes for an essential non coding RNA molecule, i.e. an essential RNA molecule which is not translated into polypeptide.
In the context of the invention the control sequences may be operably linked to one or more genes. Therefore in the context of the present invention a gene may be part of an operon structure. In the context of the present invention the mutated essential gene may also be part of an operon structure.
The Open Reading Frame is herewith defined as the region of the gene that is transcribed and translated into polypeptide and which starts with a start codon, generally with the start codon ATG, and which does not contain any stop codon (TAA, TAG, TGA). Alternative start codons which can be found in e.g. Bacillus host cells are TTG and GTG (Rocha E.P., Danchin A., Viari A. Translation in Bacillus subtilis: roles and trends of initiation and termination, insights from a genome analysis Nucleic Acids Res. 1999 27(17):3567- 3576) The Open Reading Frame contains coding sequences (exons) and may or may not contain intervening sequences (introns).
The host cell deficient in an essential gene coding for an essential polypeptide as defined herein comprises a vector. Said vector comprises at least an autonomous replication sequence as defined herein and a mutated essential gene. In one embodiment the mutated essential gene is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide. The second host cell is therefore otherwise identical to the host cell of the invention differing from the latter only in that in the vector present in the second host cell the essential gene is present instead of the mutated essential gene. In other words, the second host cell is the host cell deficient in the essential gene coding for the essential polypeptide, wherein the second host cell comprises the vector, said vector comprises at least the autonomous replication sequence and the essential gene. In the second host cell the essential gene present in the vector complements the deficiency present in the second host cell. In one embodiment the mutated
essential gene does or does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide. Preferably the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene.
In the context of the present invention a mutated essential gene may be a gene derived from the essential gene by insertion, deletion or substitution of one or more nucleotides in the nucleotide sequence of the essential gene. Therefore in one embodiment the mutated essential gene may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene. It will be clear to those skilled in the art that the mutated essential gene is different from the essential gene and that the mutated essential gene may differ from the essential gene in that it may have in its nucleotide sequence at least one nucleotide inserted, deleted or replaced if compared to the nucleotide sequence of the essential gene.
The mutated essential gene may code for the essential polypeptide but the expression of the essential polypeptide in the host cell may be lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
In the context of the present invention the term "expression" refers to a process by which a polypeptide is produced starting from the nucleic acid sequence of the corresponding gene. This process may include transcription, post-transcriptional modification, translation, post-translational modification and secretion. A lower expression of the essential polypeptide in the host cell according to the invention may be due to a lower transcription of the mutated essential gene in the host cell according to the invention leading to a lower amount of mRNA transcribed from the mutated essential gene if compared to the amount of mRNA transcribed from the essential gene in a second host cell which differs from the host cell according to the invention only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide. The skilled person knows how to achieve a lower transcription of the mutated essential gene in the host cell. For example the latter can be achieved by modifying control sequences in the essential gene which are involved in the transcription of the essential gene into mRNA. These modifications may or may not include e.g. modifications in the region of the essential gene corresponding to the promoter, more preferably in the regions of the promoter which are responsible for binding to RNA polymerase and which lead to a less strong promoter, i.e. a promoter which, if compared with the non-mutated promoter present in the essential gene, less efficiently binds the RNA polymerase, resulting in a lower (rate of) transcription of the mutated essential gene if compared with the (rate of) transcription in the essential gene, when measured under the same conditions.
A lower expression of the essential polypeptide in the host cell according to the invention may also be due to a lower translation of the mRNA transcribed from the mutated essential gene leading to a lower amount of essential polypeptide in the host cell according to the invention if compared to the amount of essential polypeptide in a second host cell which differs from the host cell according to the invention only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide, when measured under the same conditions. In one embodiment the amount of the essential
polypeptide in the host cell deficient in an essential gene coding for an essential polypeptide according to the invention is lower if compared to the amount of essential polypeptide produced by a second host cell measured under the same conditions, wherein the second host cell is deficient in the essential gene coding for the essential polypeptide, said second host cell comprising a vector, said vector comprising at least an autonomous replication sequence and the essential gene. The skilled person knows how to achieve a lower translation of the mutated essential gene in the host cell. For example the latter can be achieved by modifying control sequences in the essential gene which are related to the translation into essential polypeptide of the mRNA transcribed from the mutated essential gene. For example the latter can be achieved in eukaryotes by modifying the region of the essential gene coding for the translation initiation sequence (also referred to as Kozak sequence) to result in a less functional translation initiation sequence in the mRNA transcribed from the mutated essential gene. A less functional translation initiation sequence in said mRNA is herewith defined as a modification which results in a less efficient binding of said mRNA to the ribosome if compared with the biding of the mRNA transcribed from the essential gene, when measured under the same conditions, resulting in a lower (rate of) translation into protein of the mRNA transcribed from the mutated essential gene if compared with the (rate of) translation into protein of the mRNA transcribed from the essential gene when measured under the same conditions.
In prokaryotes one can modify the region of the essential gene coding for the
Ribosome Binding Site (i.e. RBS, also referred to as Shine-Delgarno sequence) to result in a less functional RBS in the mRNA transcribed from the mutated essential gene. A less functional RBS in said mRNA is herewith defined as a modification which results in a less efficient binding of said mRNA to the ribosome if compared with the biding of the mRNA transcribed from the essential gene, when measured under the same conditions, resulting in a lower (rate of) translation into protein of the mRNA transcribed from the mutated essential gene if compared with the (rate of) translation into protein of the mRNA transcribed from the essential gene when measured under the same conditions.
Alternatively lower expression level of the mutated essential gene may be achieved by modifying the region of the gene which codes for the essential polypeptide, by replacing one or more codons in said coding sequence of the essential polypeptide with synonymous codons so as to optimize the codon usage and the codon pair usage in the host cell
according to the invention for a lower (rate of) transcription and/or lower (rate of) translation of the mutated essential gene into essential polypeptide. The latter can e.g. be achieved by replacing one or more codons present in the coding sequence of the essential gene with synonymous codons which are less frequent according to the codon usage of the host cell according to the invention and/or by replacing one or more codon pairs in said coding sequence of the essential genes with synonymous codon pairs which are less preferred in the host cell according to the invention.
Therefore in one embodiment the mutated essential gene a) may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it may be a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide
Alternatively the mutated essential gene may code for a mutated essential polypeptide having the same biological function, for example same enzymatic function and/or specific enzymatic function, but a lower biological activity, for example lower enzymatic activity and/or specific enzymatic activity, if compared with the essential polypeptide when measured under the same conditions.
In the context of the invention the mutated essential polypeptide has the same enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when the mutated essential polypeptide and the essential polypeptide belong to the same enzyme class and catalyzes the same type of chemical reaction but the enzymatic activity of the mutated essential polypeptide is lower if compared with that of the essential polypeptide when measured using one or more suitable assay, preferably using any suitable assay known to the skilled person for the determination of that enzymatic activity and/or specific enzymatic activity. In the context of the present invention enzymatic activity is herewith defined as the amount of substrate converted per unit of time in a reaction catalyzed by a polypeptide, for example catalyzed by the essential polypeptide or the mutated essential polypeptide, measured under specific conditions. Specific enzymatic activity is herewith defined as the enzymatic activity per mg of protein,
i.e. the amount of substrate converted per unit of time in a reaction catalyzed by a polypeptide, for example catalyzed by the essential polypeptide or the mutated essential polypeptide, measured under specific conditions, per mg of polypeptide catalyzing the reaction.
The mutated essential gene may be modified in such way that the mutated essential polypeptide may comprise, if compared to the essential polypeptide, the insertion, deletion or substitution of one or more amino acids in the amino acid sequence of the essential polypeptide. As a result of the modification in the mutated essential gene, the mutated essential polypeptide may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and may have the same biological function, for example same enzymatic function, but a lower biological activity, for example lower enzymatic activity and/or lower specific enzymatic activity, if compared with the essential polypeptide when measured under the same conditions. It will be clear to those skilled in the art that the mutated essential polypeptide is different from the essential polypeptide and that the mutated essential polypeptide may differ from the essential polypeptide in that it may have in its amino acid sequence at least one amino acid inserted, deleted or replaced if compared to the amino acid sequence of the essential polypeptide.
The mutated essential gene may be modified such that the mutated essential polypeptide may contain one or more conservative substitutions in its amino acid sequence if compared with the sequence of the essential polypeptide. The mutated essential polypeptide may contain one or more insertions, deletions or substitutions of non-essential amino acid in its amino acid sequence if compared with the amino acid sequence of the essential polypeptide. "Conservative substitution" is a substitution of an amino acid residue with an amino acid residue having a similar side chain. It is known to the skilled person which amino acids have a similar side chain. A non-essential amino acid is a residue that can be altered in the amino acid sequence of the essential polypeptide without substantially altering the biological function thereof.
The mutated essential gene may be modified so as to produce a mutated essential polypeptide comprising site directed mutations and/or random mutations if compared to the essential polypeptide. The mutated essential gene may code for a mutated essential polypeptide which is an orthologue of the essential polypeptide, i.e. a polypeptide isolated
from another strain either belonging or not to the same species and/or genus, and which possess a similar or preferably the same enzymatic function. Alternatively the mutated essential gene may code a mutated essential polypeptide which is an allelic variant of the essential polypeptide, or the mutated essential polypeptide may be a biologically active fragment of the essential polypeptide. It is known to those skilled in the art how to isolate orthologues, allelic variants and/or biologically active fragments starting from the sequence of the essential gene and/or of the essential polypeptide.
Therefore in another embodiment the mutated essential gene a) may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) it may be a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same biological function, for example same enzymatic function, but a lower biological activity, for example lower (specific) enzymatic activity, if compared with the essential polypeptide when measured under the same conditions. Within the context of the present invention "measured under the same conditions" or "analysed under the same conditions" means that the host cell deficient in the essential gene coding for the essential polypeptide and the host cell to which it is compared are cultivated under the same conditions and that the amount and/or biological activity of the essential polypeptide in the host cell deficient in the essential gene coding for the essential polypeptide, if compared to host cell of comparison, is measured in both host cells, using the same conditions, preferably by using the same assay and/or methodology, more preferably within the same experiment.
In one embodiment of the invention, the vector comprising at least an autonomous replication sequence and a mutated essential gene according to the invention further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
The compound of interest can be any biological compound. The biological compound may be biomass or a biopolymer or metabolite. The biological compound may be encoded by a single polynucleotide or a series of polynucleotides composing a biosynthetic or metabolic
pathway or may be the direct result of the product of a single polynucleotide or products of a series of polynucleotides. The biological compound may be native to the host cell or heterologous.
The term "heterologous biological compound" is defined herein as a biological compound which is not native to the cell; or a native biological compound in which structural modifications have been made to alter the native biological compound.
The term "biopolymer" is defined herein as a chain (or polymer) of identical, similar, or dissimilar subunits (monomers). The biopolymer may be any biopolymer. The biopolymer may for example be, but is not limited to, a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide.
The biopolymer may be a polypeptide. The polypeptide may be any polypeptide having a biological activity of interest. The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. Polypeptides further include naturally occurring allelic and engineered variations of the above- mentioned polypeptides and hybrid polypeptides. The polypeptide may be native or may be heterologous to the host cell. The polypeptide may be a collagen or gelatin, or a variant or hybrid thereof. The polypeptide may be an antibody or parts thereof, an antigen, a clotting factor, an enzyme, a hormone or a hormone variant, a receptor or parts thereof, a regulatory protein, a structural protein, a reporter, or a transport protein, protein involved in secretion process, protein involved in folding process, chaperone, peptide amino acid transporter, glycosylation factor, transcription factor, synthetic peptide or oligopeptide, intracellular protein. The intracellular protein may be an enzyme such as, a protease, an amylase, ceramidases, epoxide hydrolase, aminopeptidase, acylases, aldolase, hydroxylase, aminopeptidase, lipase. The polypeptide may also be an enzyme secreted extracellularly. Such enzymes may belong to the groups of oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, catalase, cellulase, chitinase, cutinase, deoxyribonuclease, dextranase, esterase. The enzyme may be a carbohydrase, e.g. cellulases such as endoglucanases, β-glucanases, cellobiohydrolases or β- glucosidases, hemicellulases or pectinolytic enzymes such as xylanases, xylosidases, mannanases, galactanases, galactosidases, pectin methyl esterases, pectin lyases, pectate lyases, endo polygalacturonases, exopolygalacturonases rhamnogalacturonases, arabanases, arabinofuranosidases, arabinoxylan hydrolases, galacturonases, lyases, or amylolytic
enzymes; hydrolase, isomerase, or ligase, phosphatases such as phytases, esterases such as lipases, proteolytic enzymes, oxidoreductases such as oxidases,, transferases, or isomerases. The enzyme may be a phytase. The enzyme may be an aminopeptidase, asparaginase, amylase, a maltogenic amylase, carbohydrase, carboxypeptidase, endo-protease, metallo- protease, serine-protease catalase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha- glucosidase, beta-glucosidase, haloperoxidase, protein deaminase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, galactolipase, chlorophyllase, polyphenoloxidase, ribonuclease, transglutaminase, chlorophyllase, pheophytinase, or glucose oxidase, hexose oxidase, monooxygenase.
Preferably the compound of interest is an amylase, e.g. an a- or a β-amylase, e.g. a glucan 1 ,4-a-maltohydrolase such as the enzyme according to SEQ ID NO: 47.
According to the present invention, a polypeptide or enzyme can also be a product as described in WO2010/102982. According to the present invention, a polypeptide can also be a fused or hybrid polypeptide to which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding one polypeptide to a nucleic acid sequence (or a portion thereof) encoding another polypeptide.
Techniques for producing fusion polypeptides are known in the art, and include, ligating the coding sequences encoding the polypeptides so that they are in frame and expression of the fused polypeptide is under control of the same promoter (s) and terminator. The hybrid polypeptides may comprise a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides wherein one or more may be heterologous to the host cell. Example of fusion polypeptides and signal sequence fusions are for example as described in WO2010/121933.
The biopolymer may be a polysaccharide. The polysaccharide may be any polysaccharide, including, but not limited to, a mucopolysaccharide (e. g., heparin and hyaluronic acid) and nitrogen-containing polysaccharide (e.g., chitin). In a more preferred option, the polysaccharide is hyaluronic acid.
The polynucleotide coding for the compound of interest or coding for a compound involved in the production of the compound of interest according to the invention may encode
an enzyme involved in the synthesis of a primary or secondary metabolite, such as organic acids, carotenoids, (beta-lactam) antibiotics, and vitamins. Such metabolite may be considered as a biological compound according to the present invention.
The term "metabolite" encompasses both primary and secondary metabolites; the metabolite may be any metabolite. Preferred metabolites are citric acid, gluconic acid, adipic acid, fumaric acid, itaconic acid, levulinic acid and succinic acid.
The metabolite may be encoded by one or more genes, such as in a biosynthetic or metabolic pathway. Primary metabolites are products of primary or general metabolism of a cell, which are concerned with energy metabolism, growth, and structure. Secondary metabolites are products of secondary metabolism (see, for example, R. B. Herbert, The Biosynthesis of Secondary Metabolites, Chapman and Hall, New York, 1981 ).
The primary metabolite may be, but is not limited to, an amino acid, fatty acid, nucleoside, nucleotide, sugar, triglyceride, or vitamin.
The secondary metabolite may be, but is not limited to, an alkaloid, coumarin, flavonoid, polyketide, quinine, steroid, peptide, or terpene. The secondary metabolite may be an antibiotic, antifeedant, attractant, bacteriocide, fungicide, hormone, insecticide, or rodenticide. Preferred antibiotics are cephalosporins and beta-lactams. Other preferred metabolites are exo-metabolites. Examples of exo-metabolites are Aurasperone B, Funalenone, Kotanin, Nigragillin, Orlandin, Other naphtho-y-pyrones, Pyranonigrin A, Tensidol B, Fumonisin B2 and Ochratoxin A.
The biological compound may also be the product of a selectable marker. A selectable marker is a product of a polynucleotide of interest which product provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Selectable markers include, but are not limited to, amdS (acetamidase), argB (ornithinecarbamoyltransferase), bar (phosphinothricinacetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), ble (phleomycin resistance protein), hyg (hygromycin), NAT or NTC (Nourseothricin), kanamicine, tetracycline, chloramphenicol, neomycin, spectinomycin as well as equivalents thereof.
According to the invention, the compound of interest is preferably a polypeptide as described in the list of compounds of interest.
Preferably, the polypeptide is an enzyme as described in the list of compounds of interest. Preferably a a- or β-amylase, more preferably a glucan 1 ,4-a-maltohydrolase such as the enzyme according to SEQ ID NO: 47.
According to another embodiment of the invention, the compound of interest is preferably a metabolite.
The term "operably linked" is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the DNA sequence such that the control sequence directs the production of an RNA or an mRNA and optionally of a polypeptide translated from said (m)RNA.
The term "control sequences" is defined herein to include all components, which are necessary or advantageous for the expression of mRNA and / or a polypeptide, either in vitro or in a host cell. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, Shine-Delgarno sequence (also indicated as Ribosome Binding Site), optimal translation initiation sequences (as described in Kozak, 1991 , J. Biol. Chem. 266: 19867- 19870), a polyadenylation sequence, a pro-peptide sequence, a pre-pro-peptide sequence, a promoter, a signal sequence, and a transcription terminator.
The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
The control sequence may be an appropriate promoter sequence (promoter).
The control sequence may also be a suitable transcription terminator (terminator) sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3'-terminus of the nucleic acid sequence encoding the polypeptide. Any terminator, which is functional in the cell, may be used in the present invention. The man skilled in the art knows which types of terminators can be used in the host cell as described herein.
The control sequence may also be an optimal translation initiation sequences (as described in Kozak, 1991 , J. Biol. Chem. 266: 19867-19870), or a 5'-untranslated sequence, a non- translated region of a mRNA which is important for translation by the mutated microbial host cell. The translation initiation sequence or 5'-untranslated sequence is operably linked to the
5'-terminus of the coding sequence encoding the polypeptide. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Control sequences may be optimized to their specific purpose.
The control sequence may also be a non-translated region of a mRNA which is important for translation by the mutated microbial host cell. The leader sequence is operably linked to the 5'-terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence, which is functional in the cell, may be used in the present invention.
Leader sequences may be those originating from bacterial α-amylase (amyE, amyQ and amyL) and bacterial alkaline protease aprE and neutral protease genes nprE (Bacillus), or signal sequences as described in WO2010/121933, in WO2013007821 and WO2013007820, the fungal amyloglucosidase (AG) gene (glaA-both 18 and 24 amino acid versions e. g. from Aspergillus), or the a-factor gene (yeasts e. g. Saccharomyces and Kluyveromyces). .
The control sequence may also be a polyadenylation sequence, a sequence which is operably linked to the 3'-terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell (mutated or parent) as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence, which is functional in the cell, may be used in the present invention.
The term "promoter" is defined herein as a DNA sequence that binds RNA polymerase and directs the polymerase to the correct downstream transcriptional start site of a nucleic acid sequence encoding a biological compound to initiate transcription. RNA polymerase effectively catalyzes the assembly of messenger RNA complementary to the appropriate DNA strand of a coding region. The term "promoter" will also be understood to include the 5'-non-coding region (between promoter and translation start) for translation after transcription into mRNA, cis-acting transcription control elements such as enhancers, and other nucleotide sequences capable of interacting with transcription factors. The promoter may be any appropriate promoter sequence suitable for a eukaryotic or prokaryotic host cell, which shows transcriptional activity, including mutant, truncated, and hybrid promoters, and may be obtained from polynucleotides encoding extra-cellular or intracellular polypeptides either homologous (native) or heterologous (foreign) to the cell. The promoter may be a constitutive or inducible promoter.
Promoters suitable in filamentous fungi are promoters which may be selected from the group, which includes but is not limited to promoters obtained from the polynucleotides encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus gpdA promoter, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger or A. awamori glucoamylase (glaA), A. niger or A. awamori endoxylanase (xlnA) or beta- xylosidase (xlnD), T. reesei cellobiohydrolase I (CBHI), R. miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase, A. nidulans acetamidase, Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Dania (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Fusarium oxysporum trypsin-like protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endog I ucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta- xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the polynucleotides encoding A. niger neutral alpha-amylase and A. oryzae triose phosphate isomerase), and mutant, truncated, and hybrid promoters thereof. Other examples of promoters are the promoters described in WO2006/092396 and WO2005/100573, which are herein incorporated by reference. An even other example of the use of promoters is described in WO2008/098933. Preferred carbohydrate inducible promoters which can be used in filamentous fungi are the A. oryzae TAKA amylase, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger or A. awamori glucoamylase (glaA), A. niger or A. awamori endoxylanase (xlnA) or beta-xylosidase (xlnD), T, Trichoderma reesei beta- glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a hybrid of the promoters from the polynucleotides encoding A. niger neutral alpha-amylase and A. oryzae triose phosphate isomerase) as defined above.
In the invention, bacteria may preferably be used as host cells for the expression of a polypeptide of the invention, in particular Bacilli. Suitable inducible promoters useful in such
host cells include promoters that may be regulated primarily by an ancillary factor such as a repressor or an activator. The repressors are sequence-specific DNA binding proteins that repress promoter activity. The transcription can be initiated from this promoter in the presence of an inducer that prevents binding of the repressor to the operator of the promoter. Examples of such promoters from Gram-positive microorganisms include, but are not limited to, gnt (gluconate operon promoter); penP from Bacillus licheniformis; glnA (glutamine synthetase); xylAB (xylose operon); araABD (L-arabinose operon) and Pspac promoter, a hybrid SP01//ac promoter that can be controlled by inducers such as isopropyl- β-D-thiogalactopyranoside [IPTG] ((Yansura D.G., Henner D.J. Proc Natl Acad Sci U S A. 1984 81 (2):439-443). Activators are also sequence-specific DNA binding proteins that induce promoter activity. Examples of such promoters from Gram-positive microorganisms include, but are not limited to, two-component systems (PhoP-PhoR, DegU-DegS, SpoOA- Phosphorelay), LevR, Mry and GltC. Production of secondary sigma factors can be primarily responsible for the transcription from specific promoters. Examples from Gram-positive microorganisms include, but are not limited to, the promoters activated by sporulation specific sigma factors: σρ, σΕ, σ° and σκ and general stress sigma factor, σΒ. The σΒ- mediated response is induced by energy limitation and environmental stresses (Hecker M, Volker U. Mol Microbiol. 1998; 29(5):1 129-1 136.). Attenuation and antitermination also regulates transcription. Examples from Gram-positive microorganisms include, but are not limited to, trp operon and sacB gene. Other regulated promoters in expression vectors are based the sacR regulatory system conferring sucrose inducibility (Klier AF, Rapoport G. Annu Rev Microbiol. 1988;42:65-95).
Strong constitutive promoters are well known and an appropriate one may be selected according to the specific sequence to be controlled in the host cell. Suitable inducible promoters useful in bacteria, such as Bacilli, include: promoters from Gram- positive microorganisms such as, but are not limited to, SP01-26, SP01 -15, veg, pyc (pyruvate carboxylase promoter), and amyE. Examples of promoters from Gram-negative microorganisms include, but are not limited to, tac, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc, ara, SP6, A-PR, and A-PL.
Additional examples of promoters useful in bacterial cells, such as Bacilli, include the α-amylase and SPo2 promoters as well as promoters from extracellular protease genes.
In a preferred embodiment, the promoter sequences may be obtained from a bacterial source. In a more preferred embodiment, the promoter sequences may be obtained from a gram positive bacterium such as a Bacillus strain, e.g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis; or a Streptomyces strain, e.g., Streptomyces lividans or Streptomyces murinus; or from a gram negative bacterium, e.g., E. coli or Pseudomonas sp.
An example of a suitable promoter for directing the transcription of a polynucleotide sequence in the methods of the present invention is the promoter obtained from the E. coli lac operon. Another example is the promoter of the Streptomyces coelicolor agarase gene (dagA). Another example is the promoter of the Bacillus lentus alkaline protease gene (aprH). Another example is the promoter of the Bacillus licheniformis alkaline protease gene (subtilisin Carlsberg gene). Another example is the promoter of the Bacillus subtilis levansucrase gene (sacB). Another example is the promoter of the Bacillus subtilis alphaamylase gene (amyF). Another example is the promoter of the Bacillus licheniformis alphaamylase gene (amyL). Another example is the promoter of the Geobacillus stearothermophilus glucan 1 ,4-a-maltohydrolase gene (amyM). Another example is the promoter of the Bacillus amyloliquefaciens alpha-amylase gene (amyQ). Another example is a "consensus" promoter having the sequence TTGACA for the "-35" region and TATAAT for the "-10" region. Another example is the promoter of the Bacillus licheniformis penicillinase gene (penP). Another example are the promoters of the Bacillus subtilis xylA and xylB genes.
Preferably the promoter sequence is from a highly expressed gene. Examples of preferred highly expressed genes from which promoters may be selected and/or which are comprised in preferred predetermined target loci for integration of expression constructs, include but are not limited to genes encoding glycolytic enzymes such as triose-phosphate isomerases (TPI),glyceraldehyde-phosphate dehydrogenases (GAPDH), phosphoglycerate kinases (PGK), pyruvate kinases (PYK or PKI), alcohol dehydrogenases (ADH), as well as genes encoding amylases, glucoamylases, proteases, xylanases, cellobiohydrolases, β- galactosidases, alcohol (methanol) oxidases, elongation factors and ribosomal proteins.
Specific examples of suitable highly expressed genes include e. g. the LAC4 gene from Kluyveromyces sp., the methanol oxidase genes (AOX and MOX) from Hansenula and Pichia, respectively, the glucoamylase (glaA) genes from A. niger and A. awamori, the A. oryzae TAKA-amylase gene, the A. nidulans gpdA gene and the T. reesei cellobiohydrolase genes.
Promoters which can be used in yeast include e.g. promoters from glycolytic genes, such as the phosphofructokinase (PFK), triose phosphate isomerase (TPI), glyceraldehyde-3 - phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK) promoters from yeasts or filamentous fungi; more details about such promoters from yeast may be found in (WO 93/03159). Other useful promoters are ribosomal protein encoding gene promoters, the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADHI, ADH4, and the like), and the enolase promoter (ENO). Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art. The promoters used in the host cells of the invention may be modified, if desired, to affect their control characteristics. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters, which are well known to the person skilled in the art. Suitable promoters in eukaryotic host cells may be GAL7, GAL10, or GAL1 , CYC1, HIS3, ADH1, PGL, PH05, GAPDH, ADC1, TRP1, URA3, LEU2, EN01, TPI1, and AOX1. Other suitable promoters include PDC1, GPD1, PGK1, TEF1, and TDH3. Examples of carbohydrate inducible promoters which can be used are GAL promoters, such as GAL1 or GAL 10 promoters.
All of the above-mentioned promoters are readily available in the art.
In the context of the present invention any "host cell" such as a "host cell deficient in an essential gene coding for an essential polypeptide" as defined herein or a parent of said host cell may be any type of host cell.
The host cell may be a prokaryotic cell. Preferably, the prokaryotic host cell is bacterial cell. The term "bacterial cell" includes both Gram-negative and Gram-positive microorganisms. Suitable bacteria may be selected from e.g. Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter,
Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces.
Preferably, the bacterial cell is selected from the group consisting of B. subtilis, B. amyloliquefaciens, B. licheniformis, B. puntis, B. megaterium, B. halodurans, B. pumilus, G. oxydans, Caulobactert crescentus CB 15, Methylobacterium extorquens, Rhodobacter sphaeroides, Pseudomonas zeaxanthinifaciens, Pseudomonas fluorescence, Paracoccus denitrificans, E. coli, C. glutamicum, Staphylococcus carnosus, Streptomyces lividans,
Sinorhizobium melioti and Rhizobium radiobacter.
In one preferred embodiment of the invention the host cell deficient in the essential gene coding for the essential polypeptide is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Bacillus, Escherichia (such as
Escherichia coli), Pseudomonas, Lactobacillus.
In a preferred embodiment of the invention the bacterial host cell may additionally contain modifications, e.g. the bacterial host cell may be deficient in genes which are detrimental to the production, recovery and/or application of the compound of interest, e.g. a compound of interest being a polypeptide, e.g. an enzyme. In a preferred aspect the bacterial host cell is a protease deficient host cell, more preferably it is a Bacillus host cell deficient in the gene aprE coding for extracellular alkaline protease and deficient in the gene nprE coding for extracellular neutral metalloprotease. In another preferred aspect the
Bacillus host cell is further deficient in one or more proteases coded by the genes selected from the group consisting of: nprB, vpr, epr, wprA, mpr, bpr. In another preferred aspect the bacterial host cell does not produce spores and or is deficient in a sporulation related gene such as e.g. spoOA, spollSA, sigE, sigF, spollSB, spollE, sigG, spolVCB, spolllC, spollGA, spollAA, spolVFB, spollR, spolllJ. In yet another preferred aspect the Bacillus host cell is deficient in the gene amyE coding for a-amylase. In yet another preferred aspect the Bacillus host cell, more preferably a Bacillus subtilis host cell, is deficient in aprE, nprE, amyE and does not produce spores. In a more preferred embodiment the Bacillus host cell is BS154, CBS 136327 or a derivative thereof.
According to an embodiment, the host cell according to the invention is a eukaryotic host cell. Preferably, the eukaryotic cell is a mammalian, insect, plant, fungal, or algal cell. Preferred mammalian cells include e.g. Chinese hamster ovary (CHO) cells, COS cells, 293 cells, PerC6 cells, and hybridomas. Preferred insect cells include e.g. Sf9 and Sf21 cells
and derivatives thereof. More preferably, the eukaryotic cell is a fungal cell, i.e. a yeast cell, such as Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain. More preferably from Kluyveromyces lactis, S. cerevisiae, Hansenula polymorpha, Yarrowia lipolytica and Pichia pastoris, or a filamentous fungal cell. Most preferably, the eukaryotic cell is a filamentous fungal cell.
Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. Filamentous fungal strains include, but are not limited to, strains of Acremonium, Agaricus, Aspergillus, Aureobasidium, Chrysosporium, Coprinus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Panerochaete, Pleurotus, Schizophyllum, Talaromyces, Rasamsonia, Thermoascus, Thielavia, Tolypocladium, and Trichoderma.
Preferred filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma genus, and most preferably a species of Aspergillus niger, Acremonium alabamense, Aspergillus awamori, Aspergillus foetidus, Aspergillus sojae, Aspergillus fumigatus, Talaromyces emersonii, Rasamsonia emersonii, Aspergillus oryzae, Chrysosporium lucknowense, Fusarium oxysporum, Myceliophthora thermophila, Trichoderma reesei, Thielavia terrestris or Penicillium chrysogenum. A more preferred filamentous fungal host cell belongs to the genus Aspergillus, more preferably the host cell belongs to the species Aspergillus niger. When the host cell according to the invention is an Aspergillus niger host cell, the host cell preferably is CBS 513.88, CBS124.903 or a derivative thereof.
Several strains of filamentous fungi are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL), and All-Russian Collection of Microorganisms of
Russian Academy of Sciences, (abbreviation in Russian - VKM, abbreviation in English - RCM), Moscow, Russia. Useful strains in the context of the present invention may be Aspergillus niger CBS 513.88, CBS124.903, Aspergillus oryzae ATCC 20423, IFO 4177, ATCC 101 1 , CBS205.89, ATCC 9576, ATCC14488-14491 , ATCC 1 1601 , ATCC12892, P. chrysogenum CBS 455.95, P. chrysogenum Wisconsin54-1255(ATCC28089), Penicillium citrinum ATCC 38065, Penicillium chrysogenum P2, Thielavia terrestris NRRL8126, Talaromyces emersonii CBS 124.902, Acremonium chrysogenum ATCC 36225 or ATCC 48272, Trichoderma reesei ATCC 26921 or ATCC 56765 or ATCC 26921 , Aspergillus sojae ATCC1 1906, Myceliophthora thermophila C1, Garg 27K, VKM-F 3500 D, Chrysosporium lucknowense C1 , Garg 27K, VKM-F 3500 D, ATCC44006 and derivatives thereof.
The host cell deficient in the essential gene coding for the essential polypeptide may be a recombinant cell.
The term "recombinant" when used in reference to a host cell, nucleic acid, protein or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells may express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all. The term "recombinant" is synonymous with "genetically modified".
According to the invention the host cell deficient in an essential gene coding for an essential polypeptide comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as described herein.
The vector may be any vector (e.g. a plasmid or a virus), which can be conveniently subjected to recombinant DNA procedures. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. Preferably, the vector is a plasmid. The vector may be a linear or a closed circular plasmid. The vector may further comprise a, preferably non-selective, marker that allows for easy determination of the vector in the host cell. Suitable markers include GFP and DsRed. The chance of gene conversion or integration of the vector into the host genome is preferably minimized. The vector according to the invention is preferably an extra-chromosomal vector. The vector preferably lacks significant regions of homology with the genome of the host to
minimize the chance of integration into the host genome by homologous recombination. The person skilled in the art knows how to construct a vector with minimal chance of integration into the genome. This may be achieved by using control sequences, such as promoters and terminators, which originate from another species than the host species. Other ways of reducing homology are by modifying codon usage and introduction of silent mutations. The person skilled in the art knows that the type of host cell, the length of the regions of homology to the host cell genome present in the vector, and the percentage of homology between said regions of homology in the vector and the host chromosome will determine whether and in which amount the vector will integrate into the host cell genome.
The autonomous replication sequence may be any suitable sequence available to the person skilled in the art that allows for plasmid replication that is independent of chromosomal replication.
The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" is defined herein as a nucleotide sequence that enables a plasmid or vector to replicate in vivo. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, RSF1010 permitting replication in Pseudomonas is described, e.g., by F. Heffron et al., in Proc. Nat'l Acad. Sci. USA 72(9):3623-27 (Sep 1975), and pUB1 10, pE194, pTA1060, and ρΑΜβΙ permitting replication in Bacillus.
Preferably, the autonomous replication sequence used in filamentous fungi is the AMA 1 replicon (Gems et al., 1991 Gene. 98(1 ):61-7). Telomeric repeats may also result in autonomous replication (In vivo linearization and autonomous replication of plasmids containing human telomeric DNA in Aspergillus nidulans, Aleksenko et al. Molecular and General Genetics MGG, 1998 - Volume 260, Numbers 2-3, 159-164, DOI: 10.1007/s004380050881 ). CEN/ARS sequences and 3μ vector sequences from yeast may also be suitable.
A vector or expression construct for a given host cell may thus comprise the following elements operably linked to each other in a consecutive order from the 5'-end to 3'-end relative to the coding strand of the sequence encoding the compound of interest or encoding a compound involved in the synthesis of the compound of interest: (1 ) a promoter sequence capable of directing transcription of the nucleotide sequence encoding the
polypeptide in the given host cell; (2) optionally a sequence to facilitate the translation of the transcribed RNA, for example a ribosome binding site (also indicated as Shine Delgarno sequence) in prokaryotes, or a Kozak sequence in eukaryotes (3) optionally, a signal sequence capable of directing secretion of the compound of interest or a compound involved in the synthesis of a compound of interest from the given host cell into a culture medium; (4) a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, as defined herein; and preferably also (5) a transcription termination region (terminator) capable of terminating transcription downstream of the nucleotide sequence encoding the compound of interest or a compound involved in the synthesis of a compound of interest. The vector may comprise these and/or other control sequences as defined herein.
Downstream of the polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest there may be a 3'-untranslated region containing one or more transcription termination sites (e. g. a terminator, herein also referred to as a stop codon). The origin of the terminator is not critical. The terminator can, for example, be native to the DNA sequence encoding the polypeptide. However, preferably a bacterial terminator is used in bacterial host cells and a filamentous fungal terminator is used in filamentous fungal host cells. More preferably, the terminator is endogenous to the host cell (in which the nucleotide sequence encoding the polypeptide is to be expressed). In the transcribed region, a ribosome binding site for translation may be present. The coding portion of the mature transcripts expressed by the constructs will include a start codon, usually AUG (or ATG), but there are also alternative start codons, such as for example GUG (or GTG) and UUG (or TTG), which are used in prokaryotes. Also a stop or translation termination codon is appropriately positioned at the end of the polypeptide to be translated.
Enhanced expression of a polynucleotide compound of interest or a compound involved in the synthesis of a compound of interest may also be achieved by the selection of homologous and heterologous regulatory regions, e. g. promoter, secretion leader and/or terminator regions, which may serve to increase expression and, if desired, secretion levels of the protein of interest from the expression host and/or to provide for the inducible control of the expression of a compound of interest or a compound involved in the synthesis of a compound of interest.
The vector comprising at least an autonomous replication sequence and the mutated essential gene as described herein, also referred to herein as "vector of the invention" can be designed for expression of the polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest in prokaryotic or eukaryotic cells. For example, the compound of interest or the compound involved in the synthesis of a compound of interest can be produced in bacterial cells such as E. coli and Bacilli, insect cells (using baculovirus expression vectors), fungal cells, yeast cells or mammalian cells. Suitable host cells are discussed herein and further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
In order to identify and select cells which harbour a vector of the invention and/or a vector, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is optionally introduced into the vector and/or host cells along with the polynucleotide coding for a compound of interest or for a compound involved in the synthesis of a compound of interest. Preferred selectable markers include, but are not limited to those which confer resistance to drugs or which complement a defect in the host cell.
Such markers include ATP synthetase, subunit 9 (oliC), orotidine-5'- phosphatedecarboxylase (pvrA), the bacterial G418 resistance gene (this may also be used in yeast, but not in fungi), the ampicillin resistance gene (E. coli), resistance genes for neomycin, kanamycin, tetracycline, spectinomycin, erythromycin, chloramphenicol, phleomycin (Bacillus) and the E. coli uidA gene, coding for β-glucuronidase (GUS). Vectors may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.
They also include e. g. versatile marker genes that can be used for transformation of most filamentous fungi and yeasts such as acetamidase genes or cDNAs (the amdS, niaD, facA genes or cDNAs from A. nidulans, A. oryzae or A. niger), or genes providing resistance to antibiotics like G418, hygromycin, bleomycin, kanamycin, methotrexate, phleomycin orbenomyl resistance (benA). Alternatively, specific selection markers can be used such as auxotrophic markers which require corresponding mutant host strains: e. g. D- alanine racemase (from Bacillus), URA3 (from S. cerevisiae or analogous genes from other yeasts), pyrG or pyrA (from A. nidulans or A. niger), argB (from A. nidulans or A. niger) or
trpC. In a preferred embodiment the selection marker is deleted from the transformed host cell after introduction of the expression construct so as to obtain transformed host cells capable of producing the compound of interest or a compound involved in the synthesis of a compound of interest which are free of selection marker genes.
Expression of proteins in prokaryotes is often carried out in with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, e.g. to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1 ) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
In one embodiment the mutated essential gene in the vector comprised in the host cell deficient in the essential gene coding for the essential polypeptide according to the invention is a mutated essential gene which comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non-mutated promoter present in the essential gene, when measured under the same conditions. Therefore in one embodiment, the non-mutated promoter (naturally) present in the essential gene can be replaced by a mutated less strong promoter. The strength of a promoter if compared with another promoter is determined by comparing the rates of transcription of a gene into mRNA from both promoters when compared under identical conditions. Therefore the mutated less strong promoter has a lower rate of transcription of the gene if compared to the non-mutated promoter, when compared under identical conditions. Compared under identical conditions" means that the rate of transcription of a gene into mRNA, is measured in both promoters, using the same conditions, preferably by using the same assay and/or methodology, more preferably within the same experiment. Promoter strength can be determined by measuring mRNA concentration via RNAseq, RT-PCR, Northern blotting analysis or promoter fusion with a reporter protein and other methods known to those skilled in the art.
According to another embodiment when the host cell is preferably a prokaryotic cell the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions.
In the contest of the invention a Ribosome Binding Site (RBS) is a sequence present on the mRNA that is bound by the ribosome when initiating protein translation. A mutated, less functional RBS is herewith defined as a RBS which has lower ability to bind to the ribosome if compared to the unmutated RBS measured under the same conditions, and which results in a lower (rate of) translation of the mRNA into the essential polypeptide. The lower rate of translation of the mRNA into the essential polypeptide will lead to a lower expression of the essential polypeptide in the host cell comprising the mutated essential gene when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
Therefore in one embodiment the host cell according to the invention is a prokaryotic host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the mutated essential gene
a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and;
b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
A genome analysis of B. subtilis learns that about 90% of the RBS are located between -5 and -1 1 and most frequently at -8 from the start codon and strong RBS are close to the consensus sequence AAAGGAGG. (Rocha E.P., Danchin A., Viari A. Translation in Bacillus subtilis: roles and trends of initiation and termination, insights from a genome analysis Nucleic Acids Res. 1999 27(17):3567-3576).Analyses of 30 prokaryotic genomes demonstrated that most RBS sequences harbored at least four bases of the AGGAGG core motif (Ma J., Campbell A., Karlin S.J. Correlations between Shine-Dalgarno sequences and gene features such as predicted expression levels and operon structures. Bacteriol. 2002 184(20):5733-45).
In a preferred embodiment the mutated essential gene comprises an insertion, deletion, or substitution of one or more nucleotides in the region of the essential gene coding for the RBS, preferably in the region of the essential gene coding for the RBS which is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions, wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon a nucleotide sequence selected from the group consisting of:
AGGAXX, AGGXGX, AGXAGX, AXGAGX, XGGAGX, AGGXXG, AGXAXG, AXGAXG, XGGAXG, AGXXGG, AXGXGG, XGGXGG, AXXAGG, XGXAGG, XXGAGG, XGGAGG,
AXGAGG, AGXAGG, AGGXGG, AGGAXG, AGGAGX, AGGAGG, wherein X is selected from A, G, T or C.
In a preferred embodiment the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene. Preferably the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 15. Preferably the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
Therefore in one preferred embodiment the host cell according to the invention is a prokaryotic host cell deficient in an essential gene coding for an essential polypeptide, wherein the essential polypeptide is a polypeptide according to SEQ ID NO: 45, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 by an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44, wherein preferably the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 is selected from any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
In a preferred embodiment the host cell deficient in the essential gene coding for the essential polypeptide, wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the ORF of SEQ ID NO: 44, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase. In said Bacillus host cell the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 preferably corresponds to SEQ ID NO: 33. In said Bacillus host cell the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 preferably corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
In eukaryotes, the translational initiator consensus sequence (6-12 nucleotides) before the ATG is often called Kozak consensus sequence due to the initial work on this topic (Kozak, M. (1987): an analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucl. Acid Res. 15(20): 8125-47). The original Kozak consensus sequence CCCGCCGCCrCC(ATG)G, (r= A or G) including a +4 nucleotide derived by Kozak is associated with the initiation of translation in higher eukaryotes. In the context of this invention, the term "translational initiator sequence" is defined as the ten nucleotides immediately upstream of the initiator or start codon of the open reading frame of a DNA sequence coding for a polypeptide. The initiator or start codon encodes for the amino acid methionine. The initiator codon is typically ATG, but may also be any functional start codon such as GTG. It is well known in the art that uracil, U, replaces the deoxyribonucleotide thymine, T, in RNA.
When the host cell is a eukaryote preferably the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
In a further aspect the invention provides a method for the production of a host cell, preferably a host cell according to the invention, which method comprises:
a. providing a host cell deficient in an essential gene coding for an essential polypeptide;
b. providing a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions;
c. transforming the mutant host cell of step a) with the vector of step b). In one embodiment of the invention step a) comprises providing a parent host cell and modifying the parent host cell to make it deficient in an essential gene.
Provision of a host cell deficient in an essential gene coding for an essential polypeptide in step a) of the invention may be affected with methods known to those skilled in the art.
The host cell deficient in an essential gene coding for an essential polypeptide as herein defined may be produced starting from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide by modifying said parent host cell, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no activity or substantially no specific activity and combinations of one or more of these possibilities as compared to the parent host cell that has not been modified, when analysed under the same conditions. A modification, preferably in the genome, is construed as one or more modifications.
The modification, preferably in the genome, can either be effected by
a) subjecting the parent host cell to recombinant genetic manipulation techniques; and/or
b) subjecting the parent host cell to (classical) mutagenesis; and/or
c) subjecting the parent host cell to an inhibiting compound or composition.
Modification of a genome of a host cell is herein defined as any event resulting in a change in a polynucleotide sequence in the genome of the cell. In a preferred embodiment the host cell deficient in an essential gene coding for an essential polypeptide as herein defined is a host cell having a modification, preferably in its genome comprising:
a) a modification which results in substantially no production of the essential polypeptide as defined herein if compared to the parent host cell that has not been modified, when analysed under the same conditions and/or
b) a modification which results in a mutated essential polypeptide derived from an essential polypeptide as defined herein with substantially no (enzymatic) activity as defined herein if compared to the parent host cell that has not been modified, when analysed under the same conditions.
Modification can be introduced by classical strain improvement, random mutagenesis followed by selection. Modification can also be introduced by site-directed mutagenesis. Modification may be accomplished by the insertion (introduction), substitution (replacement) or deletion (removal) of one or more nucleotides in a polynucleotide sequence. A full or partial deletion of the essential gene coding for the essential polypeptide as defined herein may be achieved. In alterative the essential gene coding for the essential polypeptide as defined herein may be partially or fully replaced with a polynucleotide sequence which does
not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide as defined herein. In yet another alternative one or more nucleotides can be inserted into the essential gene coding for the essential polypeptide as defined herein resulting in the disruption of said gene and consequent full inactivation of the essential polypeptide as defined herein coded by the disrupted polynucleotide.
In one embodiment the host cell deficient in the essential gene coding for the essential polypeptide as defined herein comprises a modification in its genome selected from a) a full or partial deletion of the essential gene,
b) a full or partial substitution of the essential gene with a polynucleotide sequence which does not code for an essential polypeptide as defined herein or which codes for a fully inactive form of the essential polypeptide as defined herein
c) a disruption of the essential gene as defined herein by the insertion of one or more nucleotides in the polynucleotide sequence of said gene and consequent full inactivation of the polypeptide as defined herein coded by the disrupted polynucleotide.
This modification may for example be in a coding sequence or a regulatory element required for the transcription or translation of the essential gene. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of a start codon or a change or a frame-shift of the open reading frame of a coding sequence. The modification of a coding sequence or a regulatory element thereof may be accomplished by site-directed or random mutagenesis, DNA shuffling methods, DNA reassembly methods, gene synthesis (see for example Young and Dong, (2004), Nucleic Acids Research 32, (7) electronic access http://nar.oupjournals.Org/cgi/reprint/32/7/e59 or Gupta et al. (1968), Proc. Natl. Acad. Sci USA, 60: 1338-1344; Scarpulla et al. (1982), Anal. Biochem. 121: 356-365; Stemmer et al. (1995), Gene 164: 49-53), or PCR generated mutagenesis in accordance with methods known in the art. Examples of random mutagenesis procedures are well known in the art, such as for example chemical (NTG for example) mutagenesis or physical (UV for example) mutagenesis. Examples of site-directed mutagenesis procedures are the QuickChange™ site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla, CA), the The Altered Sites® II in vitro Mutagenesis Systems' (Promega Corporation) or by overlap extension using PCR as described in Gene. 1989 Apr 15;77(1 ):51 -9. (Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR "Site-directed mutagenesis by overlap extension
using the polymerase chain reaction") or using PCR as described in Molecular Biology: Current Innovations and Future Trends. (Eds. A.M. Griffin and H.G. Griffin. ISBN 1 -898486- 01-8;1995 Horizon Scientific Press, PO Box 1 , Wymondham, Norfolk, U.K.).
Preferred methods of modification are based on recombinant genetic manipulation techniques such as partial or complete gene substitution or partial or complete gene deletion.
For example, in case of substitution of a polynucleotide, nucleic acid construct or expression cassette, an appropriate DNA sequence may be introduced at the target locus to be replaced. The appropriate DNA sequence is preferably present on a cloning vector. Preferred integrative cloning vectors comprise a DNA fragment, which is homologous to the polynucleotide and / or has homology to the polynucleotides flanking the locus to be replaced for targeting the integration of the cloning vector to this pre-determined locus. In order to promote targeted integration, the cloning vector is preferably linearized prior to transformation of the cell. Preferably, linearization is performed such that at least one but preferably either end of the cloning vector is flanked by sequences homologous to the DNA sequence (or flanking sequences) to be replaced. This process is called homologous recombination and this technique may also be used in order to achieve (partial) gene deletion.
For example, the essential gene may be replaced by a defective polynucleotide, that is a polynucleotide that fails to produce a (fully functional) essential polypeptide. By homologous recombination, the defective polynucleotide replaces the endogenous polynucleotide (essential gene). It may be desirable that the defective polynucleotide also encodes a marker, which may be used for selection of transformants in which the nucleic acid sequence has been modified.
Alternatively or in combination with other mentioned techniques, a technique based on in vivo recombination of cosmids in E. coli can be used, as described in: A rapid method for efficient gene replacement in the filamentous fungus Aspergillus nidulans (2000) Chaveroche, M-K., Ghico, J-M. and dEnfert C; Nucleic acids Research, vol 28, no 22.
Alternatively, modification, wherein said host cell produces no essential polypeptide as defined herein and encoded by an essential gene as described herein, may be performed by established anti-sense techniques using a nucleotide sequence complementary to the nucleic acid sequence of the essential gene. More specifically, expression of the essential gene by a
host cell may be reduced or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the polynucleotide, which may be transcribed in the cell and is capable of hybridizing to the mRNA produced in the cell. Under conditions allowing the complementary anti-sense nucleotide sequence to hybridize to the mRNA, the amount of protein translated is thus reduced or eliminated. An example of expressing an antisense-RNA in filamentous fungi is shown in Appl. Environ. Microbiol. 2000 Feb; 66(2):775-82. (Characterization of a foldase, protein disulfide isomerase A, in the protein secretory pathway of Aspergillus niger. Ngiam C, Jeenes DJ, Punt PJ, Van Den Hondel CA, Archer DB) or (Zrenner R, Willmitzer L, Sonnewald U. Analysis of the expression of potato uridinediphosphate-glucose pyrophosphorylase and its inhibition by antisense RNA. Planta. (1993); 190(2):247-52.).
In one embodiment the provision of a host cell deficient in an essential gene coding for an essential polypeptide can be achieved by eliminating production of the mRNA encoding said polypeptide if compared with a parent host cell which is not deficient in the essential gene and measured under the same conditions. In another embodiment the host cell is inducibly deficient in the essential gene coding for the essential polypeptide. The provision of a host cell inducibly deficient in the essential gene can be achieved by placing the essential gene in the host genome under the control of an inducible promoter. The inducible promoter may be any inducible promoter suitable for the purpose, be it a chemically or physically induced promoter (such as by temperature or light). The person skilled in the art knows how to select such promoter. Suitable inducible promoters which can be used in a host cell according to the invention have been herein described.
A modification which results in no amount of the mRNA transcribed from the essential gene encoding for the essential as described herein may be obtained via the RNA interference (RNAi) technique (FEMS Microb. Lett. 237 (2004): 317-324). In this method identical sense and antisense parts of the nucleotide sequence, which expression is to be affected, are cloned behind each other with a nucleotide spacer in between, and inserted into an expression vector. After such a molecule is transcribed, formation of small nucleotide fragments will lead to a targeted degradation of the mRNA, which is to be affected. The elimination of the specific mRNA can be to various extents. The RNA interference techniques described in WO2008/053019, WO2005/05672A1 , WO2005/026356A1 , Oliveira et al, "Efficient cloning system for construction of gene silencing vectors in Aspergillus
niger" (2008) Appl. Microbiol, and Biotechnol. 80 (5): 917-924 and/or Barnes et al., "siRNA as a molecular tool for use in Aspergillus niger" (2008) Biotechnology Letters 30 (5): 885- 890 may be used at this purpose.
A modification which results in an essential polypeptide with no (enzymatic) activity as defined herein can be obtained by different methods, for example by an antibody directed against such a polypeptide or a chemical inhibitor or a protein inhibitor or a physical inhibitor (Tour O. et al, (2003) Nat. Biotech: Genetically targeted chromophore-assisted light inactivation. Vol.21 , no. 12: 1505-1508) or peptide inhibitor or an anti-sense molecule or RNAi molecule (R.S. Kamath_et al, (2003) Nature: Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. vol. 421 , 231-237).
In addition of the above-mentioned techniques or as an alternative, it is also possible to inhibiting the activity of the essential polypeptide as defined herein, or to re-localize the essential polypeptide as defined herein by means of alternative signal sequences in filamentous fungi (Ramon de Lucas, J., Martinez O, Perez P., Isabel Lopez, M., Valenciano, S. and Laborda, F. The Aspergillus nidulans carnitine carrier encoded by the acuH gene is exclusively located in the mitochondria. FEMS Microbiol Lett. 2001 Jul 24;201 (2):193-8.) or retention signals in filamentous fungi (Derkx, P. M. andMadrid, S. M. The foldase CYPB is a component of the secretory pathway of Aspergillus niger and contains the endoplasmic reticulum retention signal HEEL. Mol. Genet. Genomics. 2001 Dec;266(4):537-545.), or by targeting the essential polypeptide in filamentous fungi to a peroxisome which is capable of fusing with a membrane-structure of the cell involved in the secretory pathway of the cell, leading to secretion outside the cell of the polypeptide (e.g. as described in WO2006/040340). Re-localization of the essential polypeptide may occur to a cell compartment wherein the essential peptide cannot perform its biological function, also leading to a cell which in fact is deficient in the (function of) the essential polypeptide. In the context of the present invention a host cell wherein the essential polypeptide is re-localized to a compartment wherein it cannot perform its biological function is a host cell deficient in the essential polypeptide.
Alternatively or in combination with above-mentioned techniques, inhibition of polypeptide enzymatic activity as defined herein can also be obtained, e.g. by UV or chemical mutagenesis (Mattern, I.E., van Noort J.M., van den Berg, P., Archer, D. B., Roberts, I.N. and van den Hondel, C. A., Isolation and characterization of mutants of
Aspergillus niger deficient in extracellular proteases. Mol Gen Genet. 1992 Aug;234(2):332- 6.) or by the use of inhibitors inhibiting enzymatic activity of a polypeptide as described herein (e.g. nojirimycin, which function as inhibitor for β-glucosidases (Carrel F.L.Y. and Canevascini G. Canadian Journal of Microbiology (1991 ) 37(6): 459-464; Reese E.T., Parrish F.W. and Ettlinger M. Carbohydrate Research (1971 ) 381 -388)).
In one embodiment of the method for the production of a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, the parent host cell is modified in its genome by one of the following methods: a) fully or partially deleting the essential gene; b) fully or partially replacing the essential gene with a polynucleotide sequence which does not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide; c) disrupting the essential gene by insertion of one or more nucleotides in the polynucleotide sequence of said gene and consequent full inactivation of the polypeptide coded by the disrupted polynucleotide; d) placing the essential gene in the host cell genome under the control of an inducible promoter and culturing the host cell under conditions which repress transcription of the essential gene into mRNA.
In step b) according to the method for the production of a host cell deficient in the essential gene coding for the essential polypeptide according to the invention, it is provided a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
In one embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter. In one other embodiment the mutated essential gene codes for the essential (i.e. un-mutated) polypeptide. In yet another embodiment the mutated essential gene does or does not comprise a mutation in the region of the promoter and the mutated essential gene codes for the essential polypeptide. In one embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site. In another embodiment the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the (unmodified) essential gene coding for the essential polypeptide. Preferably the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon of the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon of the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon of the open reading frame of the essential gene.
The vector may be a vector as herein defined and may be produced according to methods known to those skilled in the art.
In step c) according to the method for the production of a host cell deficient in the essential gene coding for the essential polypeptide according to the invention, the host cell obtained in step a) is transformed with the vector of step b).
Vector DNA can be introduced into prokaryotic or eukaryotic cells via natural competence, conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing foreign polynucleotide (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, transduction, infection, lipofection, cationic lipidmediated transfection or
electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., CSHL Press, Cold Spring Harbor, NY, 2001 , and other laboratory manuals and are well known to those skilled in the art.
It will be evident to the skilled person that the sequence of the method steps in the method to produce a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein may vary depending on the circumstances.
In one embodiment of the invention the method steps a), b) and c) are performed simultaneously, separately or sequentially.
When the essential gene is a gene whose deficiency renders the host cell non-viable under specific culture conditions the host cell deficient in the essential gene coding for an essential polypeptide can be viable without having being transformed with the vector carrying the mutated essential gene as described herein when these culture conditions are met. Therefore in one embodiment step a) may be followed by step b) and step b) may be followed by step c). In another embodiment step b) may be followed by step a) and step a) may be followed by step c).
The essential gene coding for the essential polypeptide may be a gene whose deficiency renders the host cell non-viable under all conditions and in any type of nutrient medium. The essential polypeptide may be a polypeptide whose lower or no expression in the host cell renders the host cell non-viable under all conditions and in any nutrient medium, such as minimal or complex medium. It will be evident to the skilled person that in the latter case the host cell deficient in the essential gene coding for the essential polypeptide can be viable only when having being transformed with the vector carrying the mutated essential polypeptide as described herein. In the latter case steps a), b) and c) of the method to produce a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein may be performed simultaneously.
Embodiments of the invention which are applicable to the host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene according to the invention are equally applicable to the method for the production of said host cell as described herein.
In a further aspect the invention provides a method for the production of a compound of interest comprising
a) culturing a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, as defined herein or a host cell produced according to the method for the production of a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell under conditions conducive to the production of a compound of interest, and
b) optionally isolating the compound of interest from the culture broth.
The compound of interest may be any compound of interest as herein defined.
The host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene has been herein described. All embodiments of said host cell as herein described are equally applicable to the method for the production of a compound of interest as described herein. Furthermore a vector comprising at least an autonomous replication sequence and a mutated essential gene has also been herein described and the embodiments relative to this vector are equally applicable to the method for the production of a compound of interest as described herein.
Step a) of the method of production of a compound of interest according to the invention comprises culturing the host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell, under conditions conducive to the production of the compound of interest. The host cells may be cultivated in a nutrient medium suitable for production of the compound of interest using methods known in the art. For example, the cells may be cultivated by shake flask cultivation, small-scale or large- scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the compound of interest to be produced and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art (see, e. g., Bennett, J. W. and LaSure, L, eds., More Gene Manipulations in Fungi, Academic Press, CA, 1991). Suitable media are available from commercial suppliers or may be prepared using published compositions (e. g., in catalogues of the American Type Culture Collection). If the compound of interest is secreted into the nutrient medium, the compound can be isolated directly from the medium. If the compound of interest is not secreted, it can be isolated from cell lysates.
In one embodiment the method of production of a compound of interest according to the invention may comprise prior to step a) providing a a host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene as defined herein. Methods to produce a host cell deficient in an essential gene coding for an essential polypeptide may be those herein described.
Step b) of the method of production of a compound of interest according to the invention may comprise isolating the compound of interest from the culture broth. The compound of interest as described herein may be isolated by methods known in the art. For example, the compound of interest may be isolated from the nutrient medium by conventional procedures
including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. The isolated compound of interest may then be further purified by a variety of procedures known in the art including, but not limited to, chromatography (e. g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e. g., ammonium sulfate precipitation), or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989). In some applications the compound of interest may be used without substantial isolation from the culture broth; separation of the culture medium from the biomass may be adequate.
In preferred embodiment of the method for the production of a compound of interest according to the invention, the yield of the compound of interest is improved if compared to a method wherein a second host cell is used, wherein said second host cell differs from the host cell only in that the vector comprising the essential (unmodified) gene coding for the essential polypeptide instead of the mutated essential gene, wherein the two methods are performed under the same conditions.
Preferably the yield increases with at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%, more preferably, with at least 1 10%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190% or at least 200%, even more preferably with at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%.
In a further embodiment, the invention provides the use of a host cell deficient in an essential gene, coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene codes for the essential polypeptide according to the invention, in a method for producing a compound of interest.
In yet a further embodiment the invention provides a vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein preferably the mutated essential gene is selected from the group consisting of: a) a mutated essential
gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function and/or specific enzymatic function but a lower enzymatic activity and/or a lower specific enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
A vector comprising at least an autonomous replication sequence and a mutated essential gene and its embodiments have been herein described and are applicable to this aspect of the invention.
Embodiments of the invention 1 A host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene.
2 A host cell according to embodiment 1 , wherein the mutated essential gene does not comprise a mutation in the region of the essential gene coding for the promoter.
3 A host cell according to embodiment 1 or 2 wherein the mutated essential gene codes for the essential polypeptide.
4 A host cell according to any one of embodiments 1 to 3 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and; b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential
polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
A host cell according to any one of embodiments 1 to 4 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
A host cell according to any one of the preceding embodiments wherein the essential gene coding for the essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene in said host cell, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
A host cell according to any one of the preceding embodiments wherein the essential polypeptide is a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an enzyme alanine racemase in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
A host cell according to any one of the preceding embodiments, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
A host cell according to any one of the preceding embodiments wherein the host cell is an eukaryotic or a prokaryotic cell.
A host cell according to embodiment 9 wherein the host cell is a eukaryotic cell, preferably a fungal cell, more preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain, or a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma.
A host cell according to any one of embodiments 1 to 9, wherein the host cell is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces, even more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
A host cell according to any one of the preceding embodiments wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared
with the non-mutated promoter present in the essential gene, when measured under the same conditions.
A host cell according to any one of embodiments 9 or 12 which is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions.
A host cell according to embodiment 13 wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
AGGAXX, AGGXGX, AGXAGX, AXGAGX, XGGAGX, AGGXXG, AGXAXG, AXGAXG, XGGAXG, AGXXGG, AXGXGG, XGGXGG, AXXAGG, XGXAGG, XXGAGG, XGGAGG, AXGAGG, AGXAGG, AGGXGG, AGGAXG, AGGAGX, AGGAGG, wherein X is selected from A, G, T or C.
A host cell according to any one of embodiments 1 1 to 14 wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region
coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 33.
A host cell according to embodiment 15 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
A host cell according to any one of embodiments 1 1 to 16 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
A host cell according to embodiment 10 or 12 which is an eukaryotic host cell wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
A host cell according to any one of embodiments 8 to 18 wherein the compound of interest is biomass, a biopolymer or a metabolite.
A host cell according to embodiment any one of embodiments 8 to 19 wherein the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
Method for the production of a host cell according to any one of embodiments 1 to 20, which method comprises:
a. providing a host cell deficient in an essential gene coding for an essential polypeptide;
b. providing a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions;
c. transforming the host cell of step a) with the vector of step b).
Method according to embodiment 21 wherein step a) comprises a1 ) providing a parent host cell and a2) modifying the parent host cell to make it deficient in an essential gene.
Method according to embodiments 21 or 22 wherein the mutated essential gene does not comprise a mutation in the region of the essential gene coding for the promoter.
Method according to any one of embodiments 21 to 23 wherein the mutated essential gene codes for the essential polypeptide.
Method according to any one of embodiments 21 to 24 wherein the host cell deficient in an essential gene coding for an essential polypeptide is produced starting from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide, by modifying said parent host cell, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no activity or substantially no specific activity and combinations of one or more of these possibilities as compared to the parent host cell that has not been modified, when analysed under the same conditions.
Method according to any one of embodiment 21 to 25 wherein the parent host cell is modified in its genome by one of the following methods: a) fully or partially deleting the essential gene; b) fully or partially replacing the essential gene with a polynucleotide sequence which does not code for the essential polypeptide or which code for a fully inactive form of the essential polypeptide; c) disrupting the essential gene by insertion of one or more nucleotides in the polynucleotide sequence of said gene and consequent full inactivation of the polypeptide coded by the disrupted polynucleotide; d) placing the essential gene in the host cell genome under the control of an inducible promoter and culturing the host cell under conditions which repress transcription of the essential gene into mRNA.
Method according to any one of embodiments 21 to 26 wherein the method steps a), b), c), are performed simultaneously, separately or sequentially.
Method according to embodiment 27 wherein the process steps a), b) and c) are performed simultaneously.
Method according to any one of embodiments 21 to 28, wherein the mutated essential gene does not comprise a mutation in the region of the essential gene coding for the promoter.
Method according to any one of embodiments 21 to 29, wherein the mutated essential gene codes for the essential polypeptide.
Method according to any one of embodiments 21 to 30 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and; b) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide.
Method according to any one of embodiments 21 to 31 wherein the mutated essential gene a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene; and b) is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
Method according to any one of embodiments 21 to 32 wherein the essential gene coding for the essential polypeptide is a gene coding for a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene in said host cell, even more preferably a
gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
Method according to any one of embodiments 21 to 33 wherein the essential polypeptide is a polypeptide involved in the synthesis of microbial cell walls in said host cell, preferably an enzyme alanine racemase in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
Method according to any one of embodiments 21 to 34 wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
Method according to any one of embodiments 21 to 35 wherein the host cell is an eukaryotic or a prokaryotic cell.
Method according to any one of embodiments 21 to 36 wherein the host cell is a eukaryotic cell, preferably a fungal cell, more preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain, or a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma.
Method according to any one of embodiments 21 to 36 wherein the host cell is a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces, even more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
Method according to any one of embodiments 21 to 38 wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non- mutated promoter present in the essential gene, when measured under the same conditions.
Method according to any one of embodiments 21 to 39 wherein the host cell is a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably wherein the insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site is in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions.
Method according to embodiment 40 wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
AGGAXX, AGGXGX, AGXAGX, AXGAGX, XGGAGX, AGGXXG, AGXAXG, AXGAXG, XGGAXG, AGXXGG, AXGXGG, XGGXGG, AXXAGG, XGXAGG, XXGAGG, XGGAGG, AXGAGG, AGXAGG, AGGXGG, AGGAXG, AGGAGX, AGGAGG, wherein X is selected from A, G, T or C.
Method according to any one of embodiments 38 to 41 wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the region coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 33.
Method according to embodiment 42 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
Method according to any one of embodiments 40 to 43 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
Method according to embodiment 37 wherein the host cell is an eukaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
Method according to any one of embodiments 35 to 45 wherein the compound of interest is biomass, a biopolymer or a metabolite.
Method for the production of a compound of interest comprising culturing a host cell according to any one of embodiments 1 to 20 or a host cell produced according to the method for the production of a host cell according to any one of embodiments 21 to 46, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell under conditions conducive to the production of the compound of interest, and
optionally isolating the compound of interest from the culture broth.
Method according to embodiment 47 comprising, prior to step a), providing a host cell according to any one of embodiments 1 to 20 or a host cell produced according to the method of any one of embodiments 21 to 46.
Method according to embodiments 46 or 48 wherein the yield of the compound of interest is improved if compared to a method wherein a second host cell is used, wherein said second host cell differs from the host cell only in that the vector comprises the essential (unmodified) gene coding for the essential polypeptide instead of the mutated essential gene, wherein the two methods are performed under the same conditions.
The method according to any one of embodiments 46 to 49, wherein the yield increases with at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%, more preferably, with at least 1 10%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190% or at least 200%, even more preferably with at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%.
Method according to any one of embodiment 46 to 50 wherein the compound of interest is biomass, a biopolymer or a metabolite.
Method according to any one of embodiment 46 to 51 wherein the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
Method according to embodiment 52 wherein the metabolite is selected from a primary or secondary metabolite.
Method according to embodiment 53 wherein the biopolymer is an enzyme, preferably an amylase, more preferably an a-amylase or a β- amylase.
Use of the host cell according to any one of embodiments 8 to 20 or a host cell produced according to the method of any one of embodiments 21 to 46 for the production of a compound of interest.
A vector comprising at least an autonomous replication sequence and a mutated essential gene.
A vector according to embodiment 56 wherein the mutated essential gene does not comprise a mutation in the region of the essential gene coding for the promoter.
A vector according to embodiment 56 or 57 wherein the mutated essential gene codes for the essential polypeptide.
A vector according to any one of embodiments 56 to 58, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
A vector according to any one of embodiments 56 to 59 suitable to transform a eukaryotic host cell, preferably a fungal cell, more preferably a yeast cell selected from the group consisting of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain, or a filamentous fungal cell selected from the group consisting of filamentous fungal cells belong to a species of an Acremonium, Aspergillus, Chrysosporium, Myceliophthora, Penicillium, Talaromyces, Rasamsonia, Thielavia, Fusarium or Trichoderma.
A vector according to any one of embodiments 56 to 60 suitable to transform a prokaryotic cell, preferably a bacterial cell, more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
A vector according to any one of embodiments 56 to 61 wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the promoter region of the essential gene, to result in a mutated less strong promoter if compared with the non- mutated promoter present in the essential gene, when measured under the same conditions.
A vector according to any one of embodiments 56 or 62 suitable to transform a prokaryotic host cell, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site, preferably in region of the essential gene coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions.
A vector according to embodiment 63 wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
AGGAXX, AGGXGX, AGXAGX, AXGAGX, XGGAGX, AGGXXG, AGXAXG, AXGAXG, XGGAXG, AGXXGG, AXGXGG, XGGXGG, AXXAGG, XGXAGG, XXGAGG, XGGAGG, AXGAGG, AGXAGG, AGGXGG, AGGAXG, AGGAGX, AGGAGG, wherein X is selected from A, G, T or C.
A vector according to any one of embodiments 56 to 64 wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 11 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 33.
A vector according to embodiment 65 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
A vector according to any one of embodiments 61 to 66 wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase
A vector according to embodiment 67 which is suitable to transform an eukaryotic host cell wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the translation initiator sequence, preferably in the polynucleotide sequence situated 1 to 10 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional translation initiation sequence
if compared to the translation initiation sequence present in the essential gene, when measured under the same conditions.
A vector according to any one of embodiments 56 to 68 wherein the compound of interest is biomass, a biopolymer or a metabolite.
A vector according to embodiment 69 wherein the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
A vector according to embodiment 69 wherein the metabolite is selected from a primary or secondary metabolite.
The present invention is further illustrated by the following Examples:
Examples
It should be understood that these Examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. MATERIALS AND METHODS
Strain construction
Bacillus subtilis strain BS154 (deposited on 9 October 2013 as CBS136327 at the Centraalbureau voor Schimmelcultures (Fungal Biodiversity Centre), Uppsalalaan 8,
3584CT Utrecht, The Netherlands) ( aprE, nprE, amyE, spo ) is described in Quax and Broekhuizen 1994 Appl. Microbiol. Biotechnol. 41 : 425-431. The E. colli B. subtilis shuttle vector pBHA12 is described in WO2008/000632.
Bacillus subtilus 168 (ATCC 23857) (trpC2) is described in Anagnostopoulos C. and Spizizen J. (1961 ) J. Bacteriol. (1961 ) 81 (5): 741-746.
Bacillus stearothermophilus C599 (NCIMB1 1873) is described in WO91/04669.
Molecular biology techniques
Molecular biology techniques used are known to the skilled person and described in Sambrook & Russell, Molecular Cloning: A Laboratory Manual, 3rd Ed., CSHL Press, Cold Spring Harbor, NY, 2001 ). B. subtilis transformations were performed as described by Anagnostopolous, C, and J. Spizizen. (1961 ) "Requirements for transformation in Bacillus subtilis." J. Bacteriol. 81 (5): 741 -746.
Polymerase chain reaction (PCR) was performed on a thermocycler with Phusion High-Fidelity DNA polymerase (Finnzymes OY, Aspoo, Finland) according to the instructions of the manufacturer.
Glucan 1 ,4-a-maltohydrolase productivity
The glucan 1 ,4-a-maltohydrolase productivity in the culture broth of B. subtilis was quantified by measuring activity using a Megazyme CERALPHA alpha amylase assay kit (Megazyme International Ireland Ltd., Co. Wicklow, Ireland) according to the manufacturer's instruction.
Plasmid copy number determination by qPCR
For plasmid copy number (PCN) determination total DNA was isolated in duplicate from the samples with the 'Masterpure gram positive DNA purification kit' (Epicentre/lllumina, Madison, Wisconsin, USA). One primer pair was designed on the B. subtilis control gene cheA.
Forward cheA primer for qPCR.
5'- TTGGCGGTTCAGTCAGTGTG -3' (SEQ ID NO: 1 )
Reverse cheA primer for qPCR.
5'- GAAGAAATCGGAATGGCAAATGTC -3' (SEQ ID NO: 2)
and a second primer pair was designed on the amyM gene obtained from Geobacillus stearothermophilus on plasmid pGBB1 1AMY1 and its derivatives.
Forward amyM primer for qPCR.
5'- GATTGTTGTTCGTCGTGTCC -3' (SEQ ID NO: 3)
Reverse amyM primer for qPCR.
5'- TGTTCAGCGGTTCTCTTCC -3' (SEQ ID NO: 4)
The qPCR reaction was performed with 12.5 μΙ 2x iQ™ SYBR® Green supermix
(BIO-RAD, Eke, Belgium), 1 μΙ primer (10 pmol/μΙ) and bringing the volume to 20 μΙ with MilliQ water. The 5 μΙ template was added to this 20 μΙ. The transparent PCR MTP was analysed in the Biorad iQ5 (BIO-RAD, Eke, Belgium) real time PCR detection system. PCN was measured using qPCR by determining the ratio between plasmid and genomic DNA content of the cells, according to the method described in: Lee, 2006, Lee CL, Ow DS, Oh
SK. (2006) Quantitative real-time polymerase chain reaction for determination of plasmid copy number in bacteria. J Microbiol Methods. 65(2):258-267.)
Example 1. Construction of a D-alanine racemase deletion mutant
The pGB20 vector (Fig. 1 ) was made synthetically and contains the pE194 ori including oripE, palA and repE, for replication in B. subtilis below 37°C and integration at 48°C (Byeon W.H., Weisblum B. Replication genes of plasmid pE194-cop and repF: transcripts and encoded proteins. J Bacteriol. 1990 172(10):5892-5900), the bleomycin (bleo) antibiotic marker from pUB1 10 gives resistance to phleomycin in B. subtilis (McKenzie T, Hoshino T, Tanaka T, Sueoka N. The nucleotide sequence of pUB1 10: some salient features in relation to replication and its regulation. Plasmid. 1986 15(2):93-103), the pUC ori. of pMB1 for replication in E. coli (Matteuzzi D., Brigidi P., Rossi M., Di D. Characterization and molecular cloning of Bifidobacterium longum cryptic plasmid pMB1. Lett Appl Microbiol. 1990 Oct;1 1 (4):220-3) and the kanamycin resistance gene for selection in E. coli (Nakano M.M., Mashiko H., Ogawara H.J. Cloning of the kanamycin resistance gene from a kanamycin-producing Streptomyces species. Bacteriol. 1984 157(1 ):79-83). This pGB20 vector was used to construct a dal deletion vector pGBB23 (Fig. 2). The 5'- and 3'- flanking regions of the dal gene from B. subtilis 168 were amplified by polymerase chain reaction (PCR) with the following primers.
A forward primer to amplify the 5'- dal region:
5'- CGCCAAAGGCCTAAGACCATCGAGACAGGGAGTGAG -3' (SEQ ID NO: 5)
A reverse primer to amplify the 5'- dal region
5'- TGGTACCTCTAGAGCGGCCGCTACGACACTTCCTAGCTTTTATTC -3' (SEQ ID NO: 6)
A forward primer to amplify the 3'- dal region:
5'- G CTCTAG AG GTACCAAGCTTCTTACCTAAATG G AG AATTCATAAAAC -3' (SEQ ID NO: 7)
A reverse primer to amplify the 3'- dal region
5'- TTACGCGTTTCTCGAGCTGATAGGATTCTTGCTCG -3' (SEQ ID NO: 8)
PCR was performed on a thermocycler with Phusion High-Fidelity DNA polymerase (Finnzymes OY, Aspoo, Finland) according to the instructions of the manufacturer. The vector pGB20 was digested with AatW and Xho\. The digested vector and the PCR products of the 5'- region and 3'-region were assembled using In-Fusion cloning (Takara Bio Europe/Clontech, France). The reaction mixture was transformed to E. coli TOP10 cells. A clone was selected and this dal deletion vector was named pGBB23 (Fig. 2). The sequence of the plasmid was confirmed by DNA sequencing. The plasmid was isolated from E. coli and transformed to B. subtilis BS154. Since pGBB23 contains the thermosensitive origin of replication from pE194 this plasmid is subsequently integrated into the chromosome of BS154 by elevating the growth temperature to 48°C and maintaining antibiotic selection pressure (4 μg/ml phleomycin). Homologous recombination directed by the dal flanking regions allowed for integration into the dal locus. The integrated clones were used for excision of the integrated plasmid by growth at a permissive temperature in the absence of antibiotic pressure. The dal deletion was confirmed by PCR using the following primers.
A forward primer to amplify the dal locus outside the 5'-flank:
5'- TAACGGGACTGCTTGCTGTTC-3' (SEQ ID NO: 9)
A reverse primer to amplify the dal locus outside the 3'-flank
5'- AGCGCCAGTTCGCTGATTTG -3' (SEQ ID NO: 10)
Mutants in which the dal gene had been deleted generated a 2.2 kb fragment whereas colonies of cells with the dal gene still present in the generated a 3.4 kb PCR fragment. The dal mutation was confirmed as the mutants did not grow in the absence of 0.2 mg/ml D-alanine, whereas the BS154 parent strain grows in the absence of D-alanine. The B. subtilis dal deletion strain was named BS227 and has the following genotype aprE, AnprE, amyE, spo~, Adal).
Example 2. Construction of an expression plasmid with a dal selection marker and transformation of the D-alanine racemase deletion mutant with said plasmid.
For the construction of a dal selection plasmid the kanamycine (neo) and phleomycine (bleo) markers on pBHA12 (described in WO2008/000632) were replaced by a dal gene-encoding synthetic fragment as follows. The vector pBHA12 was digested with Mun\ and Not\ and a synthetic fragment containing the dal gene with its native promoter and the ydcC terminator (SEQ ID NO: 44) was used to replace the reppUB terminator. This vector was named pGBB1 1 (Fig. 3). The dal selection plasmid pGBB1 1 was transformed to the dal deletion strain BS227 and transformants containing pGBB11 were able to grow in the absence of D-alanine, thereby demonstrating the functionality of this vector and the dal selection marker.
To express the glucan 1 ,4-a-maltohydrolase protein from Geobacillus stearothermophilus C599 the amyM gene including its native terminator sequence (SEQ ID NO: 46) was amplified by PCR with the following primers.
A forward primer to amplify the amyM gene and introduce a Afctel site:
5'-GTGATAATCATATGAAAAAGAAAACGCTTTCTTTATTTGTGG-3' (SEQ ID NO: 1 1 ) A reverse primer to amplify the amyM gene and introduce a Hind\\\ site
5'-TAAATATAAAAGCTTGCAAGCAAGTGCATATCCTG-3' (SEQ ID NO: 12)
The resulting PCR fragment was digested with the restriction enzymes Ndel and Hind\\\ and ligated with T4 DNA ligase into Ndel and Hind\\\ digested pGBB11 plasmid. The ligation mixture was transformed into B. subtilis strain BS227. A clone was selected and the amyM expression plasmid was named pGBB1 1AMY1 (Fig. 4). The sequence of the plasmid was confirmed by DNA sequencing. B. subtilis strain BS227 was transformed with pGBB1 1AMY1 and this strain was named AMYB227A1.
Proteomics analyses learned that the expression of dal was increased in the BS227 containing pGBB11AMY1 (see Example 3 and Fig. 7). Furthermore reduction of glucan 1 ,4- a-maltohydrolase productivity was found to be correlated with the plasmid copy number and amyM productivity (see Fig. 5).
Example 3. Construction of an expression plasmid with a dal selection marker and transformation of the D-alanine racemase deletion mutant with said plasmid.
The inventors hypothised that because dal expression is essential for the cells viability, by reducing the expression of the dal gene in the host cell containing the plasmid, cells are forced to maintain high plasmid copy numbers that results in higher glucan 1 ,4-a- maltohydrolase production.
To test this hypothesis the following experiment was performed.
In order to reduce the expression of the dal gene the ribosome binding site (RBS) of the dal gene on plasmid pGBB1 1 AMY1 was mutated with the Quick Change II site directed mutagenesis' kit (Stratagene, California, USA).
Ten sets of primers (Table 1 ) were designed to mutate the dal RBS by
Inserting one base pair
Inserting two base pairs
Deleting one base pair
Deleting two base pairs
Randomly substituting 4 base pairs
Substituting one base pair
Substituting two base pairs
Substituting three base pairs
Substituting four base pairs
in the region situated 1 to 15 nucleotides upstream of the START codon of the dal gene
Table 1
The native RBS sequence of c a/ directly upstream to the dal ATG start codon '- CTAGGAAGTGTCGTA -3' (SEQ ID NO: 33)
Was mutated into
5'- CTAGGAAGTGTTCGTA -3' (SEQ ID NO: 34) in plasmid pGBB12AMY1
5'- CTAGGAAGTGTTGCGTA -3' (SEQ ID NO: 35) in plasmid pGBB13AMY1
5'- CTAGGAAGTGTGTA -3' (SEQ ID NO: 36) in plasmid pGBB14AMY1
5'- CTAGGAAGTGGTA -3' (SEQ ID NO: 37) in plasmid pGBB15AMY1
5'- CTANNNNGTGTCGTA -3' (SEQ ID NO: 38) in plasmid pGBB16AMY1
5'- CTATGAAGTGTCGTA -3' (SEQ ID NO: 39) in plasmid pGBB17AMY1
5'- CTATCAAGTGTCGTA -3' (SEQ ID NO: 40 in plasmid pGBB18AMY1
5'- CTATCCAGTGTCGTA -3' (SEQ ID NO: 41 ) in plasmid pGBB19AMY1
5'- CTATCCTGTGTCGTA -3' (SEQ ID NO: 42) in plasmid pGBB20AMY1
5'- CTAGATCTTGTCGTA -3' (SEQ ID NO: 43) in plasmid pGBB21AMY1
The mutations in the dal RBS was confirmed by isolation of the plasmid and DNA sequencing. A clones were selected and the modified plasmids were named pGBB12AMY1 until pGBB21AMY1. B. subtilis strain BS227 was transformed with plasmids pGBB12AMY1 through pGBB21AMY1 to yield the corresponding strains as indicated hereafter: plasmid pGBB12AMY1 yielded AMYB227B1.plasmid pGBB13AMY1 yielded AMYB227C1 , plasmid pGBB14AMY1 yielded AMYB227D1 , plasmid pGBB15AMY1 yielded AMYB227E1 , plasmid pGBB16AMY1 yielded AMYB227F1 , plasmid pGBB17AMY1 yielded AMYB227G1 , plasmid pGBB18AMY1 yielded AMYB227H1 , plasmid pGBB19AMY1 yielded AMYB227I 1 , plasmid pGBB20AMY1 yielded AMYB227J1 , plasmid pGBB21AMY1 AMYB227K1 , respectively.
Example 3. Expression of amyM with pGBB11AMY-1 and pGBB12AMY-1.
The B. subtilis strain AMYB227A1 containing the pGBB1 1AMY1 expression plasmid with the native dal RBS sequence and the AMYB227B1-AMYB227K1 containing pGBB12AMY1-pGBB21AMY with the mutated dal RBS sequences were tested in a shake flask fermentation experiments. These shake flasks contained 20 ml 2xTY medium composed of 1.6% Bacto tryptone, 1 % Yeast extract and 0.5% NaCI. The cultures were shaken vigorously at 37 °C and 250 rpm for 16 hours and 0.2 ml culture medium was used to inoculate 20 ml SMM medium. SMM pre-medium contains 1.25% (w/w) yeast extract, 00.5% (w/w) CaCI2, 0.075% (w/w) MgCI2.6H20, 15 pg/l MnS04 .4H20, 10 pg/l CoCI2.6H20, 0.05% (w/w) citric acid, 0.025% (w/w) antifoam 86/013 (Basildon Chemicals, Abingdon, UK). To complete SMM medium, 20 ml of 5% (w/v) maltose and 20 ml of a 200 mM Na-
phosphate buffer stock solution (pH 6.8), both prepared and sterilized separately, were added to 60 ml SMM pre-medium. These cultures were incubated for 48 hours at 37 °C and 250 rpm. The supernatants were harvested and analysed for enzyme productivity. The glucan 1 ,4-a-maltohydrolase productivity of strain AMYB227A1 was compared to strains AMYB227B1 -AMYB227K1. Changing the dal RBS improved the production of glucan 1 ,4-a- maltohydrolase. This improvement was most pronounced by mutating nucleotides between 8 and 1 1 base pairs upstream of the dal ATG start codon.
As shown in Fig. 6, glucan 1 ,4-a-maltohydrolase production was increased with 34% in strain AMYB227K1 compared to strain AMYB227A1 . This result is clearly demonstrating the beneficial effect of the dal RBS mutation on enzyme productivity.
Example 4. Determination of the relative D-alanine racemase protein abundance.
Quantitative proteomics was used for protein identification and quantification of the intracellular protein fraction of B. subtilis strains BS154, AMYB227A1 and AMYB227K1. Strains were grown as explained in example three and equal amounts of cells were harvested to normalize the total protein amount between different samples. BSA spiking was performed as an internal standard and quality control of the performed experiments. BPER (Pierce, Rockford, Illinois, USA) was used for protein solubilisation and TCA precipitation was performed for protein purification. Digestion with trypsin (Sequencing grade, Roche applied science, Penzberg, Germany) generated the peptides that were analyzed with the nanoLC-MS/MS system consisted of EASY-nLC from Proxeon (Odense, Denmark) and a LTQ from Thermo Fisher (San Jose, CA, USA). Identifications were performed using the Sorcerer 2 (SageN, San Diego, CA, USA) and the search results were quantified, using APEX (Lu et al, Nature Biotech 2007, 25, 1 ). Relative expression levels of alanine racemase of B. subtilis strain BS154, AMYB227A1 and AMYB227K1 is shown in Fig. 7. The data showed alanine racemase expression in strain AMYB227A1 , with the genomic dal deletion complemented with plasmid pGBB1 1AMY1 , was higher than in strain BS154. In strain AMYB227K1 containing the mutated dal RBS on pGBB21AMY-1 the dal expression was severely reduced compared to strain AMYB227A1 and strain BS154. These results demonstrate that mutating the dal RBS on the plasmid pGBB21AMY-1 results in
reduced expression of dal. Because dal expression is essential for the cells viability, cells are forced to maintain high plasmid copy numbers that results in higher glucan 1 ,4-a- maltohydrolase production (Fig. 7). Clearly, these examples show how the method of the invention reduces dal expression from the expression plasmid and increases enzyme production using a plasmid expression system free from antibiotic selection markers.
Claims
A prokaryotic host cell deficient in an essential gene coding for an essential polypeptide, wherein the host cell comprises a vector, said vector comprises at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site.
A host cell according to claim 1 wherein the mutated essential gene
a) has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential gene and;
b1 ) is a gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; and/or b2) is a gene coding for a mutated essential polypeptide having at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the essential polypeptide and having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions.
A host cell according to claims 1 or 2 wherein the essential gene coding for the essential polypeptide is a gene coding for an alanine racemase in said host cell, more preferably a dal or air gene in said host cell, even more preferably a gene according to SEQ ID NO: 44 or according to a polynucleotide sequence coding for alanine racemase which is preferably a functional homolog of SEQ ID NO: 44, which is at least 60%, at least 70%,
at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 44.
A host cell according to any one of claims 1 to 3 wherein the essential polypeptide is an enzyme alanine racemase in said host cell, more preferably a polypeptide according to SEQ ID NO: 45 or according to an amino acid sequence, which is preferably a functional homolog of SEQ ID NO: 45, which is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to SEQ ID NO: 45.
A host cell according to any one of the preceding claim, wherein the vector further comprises a polynucleotide encoding a compound of interest or a polynucleotide encoding a compound involved in the synthesis of a compound of interest, wherein said polynucleotide is preferably operably linked to control sequences which allow for expression of the polynucleotide in the host cell.
A host cell according to claim 5, wherein the host cell is a bacterial cell, more preferably a bacterial cell belonging to the genus Escherichia, Anabaena, Caulobactert, Gluconobacter, Rhodobacter, Pseudomonas, Paracoccus, Bacillus, Brevibacterium, Corynebacterium, Rhizobium (Sinorhizobium), Flavobacterium, Klebsiella, Enterobacter, Lactobacillus, Lactococcus, Methylobacterium, Staphylococcus or Streptomyces, even more preferably a bacterial cell belonging to the genus Bacillus, Escherichia, Pseudomonas, Lactobacillus.
A host cell according to claim 6 wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the open reading frame of the essential gene, more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more
preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, to result in a mutated, less functional Ribosome Binding Site if compared to the ribosome binding site present in the essential gene, when measured under the same conditions.
A host cell according to claim 7 wherein the mutated, less functional RBS is a mutated version of a non-mutated RBS comprising, in the region situated 8 to 13 nucleotides upstream of the start codon, a nucleotide sequence selected from the group consisting of:
AGGAXX, AGGXGX, AGXAGX, AXGAGX, XGGAGX, AGGXXG, AGXAXG, AXGAXG, XGGAXG, AGXXGG, AXGXGG, XGGXGG, AXXAGG, XGXAGG, XXGAGG, XGGAGG, AXGAGG, AGXAGG, AGGXGG, AGGAXG, AGGAGX, AGGAGG, wherein X is selected from A, G, T or C.
A host cell according to any one of claims 6 to 8 wherein the mutated essential gene coding for the essential polypeptide is a polynucleotide sequence derived from SEQ ID NO: 44 and comprising an insertion, deletion or substitution of one or more nucleotides in the region coding for the ribosome binding site, preferably in the polynucleotide sequence situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 more preferably in the polynucleotide sequence situated 5 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, even more preferably in the polynucleotide sequence situated 8 to 1 1 nucleotides upstream of the start codon in the open reading frame of the essential gene, wherein the non-mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream of the start codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to SEQ ID NO: 33, preferably wherein the host cell deficient in an essential gene coding for an essential polypeptide is a Bacillus host cell deficient in a gene according to SEQ ID NO: 44 coding for the enzyme alanine racemase.
A host cell according to claim 9 wherein the mutated Ribosomal Binding site situated 1 to 15 nucleotides upstream the starting codon in the Open Reading Frame of SEQ ID NO: 44 corresponds to any one of SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, preferably it corresponds to SEQ ID NO: 43.
A host cell according to any one of claims 5 to 10 wherein the compound of interest is a biopolymer selected from a nucleic acid, polyamine, polyol, polypeptide (or polyamide), or polysaccharide, preferably the polypeptide may be an enzyme.
Method for the production of a host cell according to any one of claims 1 to 1 1 , which method comprises:
a. providing a host cell deficient in an essential gene coding for an essential polypeptide;
b. providing a vector, said vector comprising at least an autonomous replication sequence and a mutated essential gene, wherein the mutated essential gene comprises an insertion, deletion or substitution of one or more nucleotides in the region of the essential gene coding for the ribosome binding site and wherein the mutated essential gene is preferably selected from the group consisting of: a) a mutated essential gene coding for the essential polypeptide but wherein expression of the essential polypeptide in the host cell is lower, when measured under the same conditions, if compared to the expression of the essential polypeptide in a second host cell which differs from the host cell only in that the vector in the second host cell comprises the essential gene coding for the essential polypeptide; and/or b) a mutated essential gene coding for a mutated essential polypeptide having the same enzymatic function but a lower enzymatic activity if compared with the essential polypeptide when measured under the same conditions;
c. transforming the host cell of step a) with the vector of step b).
Method according to claim 12 wherein the host cell deficient in an essential gene coding for an essential polypeptide is produced starting from a parent host cell which parent host cell contains the essential gene and expresses the essential polypeptide, by modifying said parent host cell, preferably in its genome, to result in a phenotypic feature wherein the cell: a) produces substantially no essential polypeptide and/or b) produces a polypeptide encoded by said essential gene which has substantially no activity or substantially no specific activity and combinations of one or more of these possibilities as compared to the parent host cell that has not been modified, when analysed under the same conditions.
Method according to any one of claims 12 or 13 wherein the method steps a), b), c), are performed simultaneously, separately or sequentially.
Method for the production of a compound of interest comprising
a) culturing a host cell according to any one of claims 5 to 11 or a host cell produced according to the method for the production of a host cell according to any one of claims 12 to 14, under conditions conducive to the production of the compound of interest, and
b) optionally isolating the compound of interest from the culture broth.
Method according to claim 15 wherein the yield of the compound of interest is improved if compared to a method wherein a second host cell is used, wherein said second host cell differs from the host cell only in that the vector comprising the essential (unmodified) gene coding for the essential polypeptide instead of the mutated essential gene, wherein the two methods are performed under the same conditions, preferably wherein the yield increases with at least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 100%, more preferably, with at least 1 10%, at least 120%, at least 130%, at least 140%, at least 150%, at least 160%, at least 170%, at least 180%, at least 190% or at least 200%, even more
preferably with at least 210%, at least 220%, at least 230%, at least 240%, at least 250%, at least 260%, at least 270%, at least 280%, at least 290% or at least 300%.
Use of the host cell according to any one of claims 1 to 1 1 or a host cell produced according to the method of any one of claims 12 to 14 for the production of a compound of interest.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13189152.5 | 2013-10-17 | ||
| EP13189152 | 2013-10-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015055558A1 true WO2015055558A1 (en) | 2015-04-23 |
Family
ID=49447976
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2014/071847 Ceased WO2015055558A1 (en) | 2013-10-17 | 2014-10-13 | Protein expression system |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015055558A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022018260A1 (en) | 2020-07-24 | 2022-01-27 | Basf Se | Alanine racemase single deletion and transcomplementation |
| WO2022269084A1 (en) | 2021-06-24 | 2022-12-29 | Basf Se | Improved bacillus host cell with altered rema/remb protein |
| WO2024169804A1 (en) * | 2023-02-15 | 2024-08-22 | 北京康乐卫士生物技术股份有限公司 | Tac promoter-based plasmid expression vector construction and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010020589A1 (en) * | 2008-08-21 | 2010-02-25 | Novozymes A/S | Microfluidic device screening method |
| WO2012123429A1 (en) * | 2011-03-11 | 2012-09-20 | Dsm Ip Assets B.V. | Vector-host system |
| US20120237987A1 (en) * | 2009-10-28 | 2012-09-20 | The Arizona Board Of Regents For And On Behalf Of Arizona State University | Bacterium for production of fatty acids |
-
2014
- 2014-10-13 WO PCT/EP2014/071847 patent/WO2015055558A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010020589A1 (en) * | 2008-08-21 | 2010-02-25 | Novozymes A/S | Microfluidic device screening method |
| US20120237987A1 (en) * | 2009-10-28 | 2012-09-20 | The Arizona Board Of Regents For And On Behalf Of Arizona State University | Bacterium for production of fatty acids |
| WO2012123429A1 (en) * | 2011-03-11 | 2012-09-20 | Dsm Ip Assets B.V. | Vector-host system |
Non-Patent Citations (7)
| Title |
|---|
| BRON P A ET AL: "USE OF THE ALR GENE AS A FOOD-GRADE SELECTION MARKER IN LACTIC ACID BACTERIA", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 68, no. 11, 1 November 2002 (2002-11-01), pages 5663 - 5670, XP009003609, ISSN: 0099-2240 * |
| SPRENG S ET AL: "Plasmid maintenance systems suitable for GMO-based bacterial vaccines", VACCINE, ELSEVIER LTD, GB, vol. 23, no. 17-18, 18 March 2005 (2005-03-18), pages 2060 - 2065, XP027652152, ISSN: 0264-410X, [retrieved on 20050318] * |
| VASAVADA A: "Improving productivity of heterologous proteins in recombinant Saccharomyces cerevisiae fermentations", ADVANCES IN APPLIED MICROBIOLOGY, ACADEMIC PRESS, UNITED STATES, vol. 41, 1 January 1995 (1995-01-01), pages 25 - 54, XP009109726, ISSN: 0065-2164, DOI: 10.1016/S0065-2164(08)70307-1 * |
| VIDAL ET AL: "Development of an antibiotic-free plasmid selection system based on glycine auxotrophy for recombinant protein overproduction in Escherichia coli", JOURNAL OF BIOTECHNOLOGY, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 134, no. 1-2, 24 January 2008 (2008-01-24), pages 127 - 136, XP022500135, ISSN: 0168-1656, DOI: 10.1016/J.JBIOTEC.2008.01.011 * |
| WILSON ET AL: "Increased Protein Expression Through Improved Ribosome-Binding Sites Obtained by Library Mutagenesis", BIOTECHNIQUES, INFORMA HEALTHCARE, US, vol. 17, no. 5, 1 January 1994 (1994-01-01), pages 944 - 953, XP002161835, ISSN: 0736-6205 * |
| YIJIAN YAN ET AL: "Asd-based balanced-lethal system in attenuated Edwardsiella tarda to express a heterologous antigen for a multivalent bacterial vaccine", FISH & SHELLFISH IMMUNOLOGY, vol. 34, no. 5, 27 February 2013 (2013-02-27), pages 1188 - 1194, XP055161565, ISSN: 1050-4648, DOI: 10.1016/j.fsi.2013.01.027 * |
| YU XIA ET AL: "Construction of a new food-grade expression system for Bacillus subtilis based on theta replication plasmids and auxotrophic complementation", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 76, no. 3, 30 June 2007 (2007-06-30), pages 643 - 650, XP019538696, ISSN: 1432-0614, DOI: 10.1007/S00253-007-1068-8 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022018260A1 (en) | 2020-07-24 | 2022-01-27 | Basf Se | Alanine racemase single deletion and transcomplementation |
| WO2022018268A1 (en) | 2020-07-24 | 2022-01-27 | Basf Se | Alanine racemase double deletion and transcomplementation |
| WO2022269084A1 (en) | 2021-06-24 | 2022-12-29 | Basf Se | Improved bacillus host cell with altered rema/remb protein |
| WO2024169804A1 (en) * | 2023-02-15 | 2024-08-22 | 北京康乐卫士生物技术股份有限公司 | Tac promoter-based plasmid expression vector construction and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10100344B2 (en) | AgsE-deficient strain | |
| US9745563B2 (en) | Amylase-deficient strain | |
| US8945898B2 (en) | Recombinant host cell with deficiency in non-ribosomal peptide synthase production | |
| US10287592B2 (en) | Bacillus host | |
| EP2683732B1 (en) | Vector-host system | |
| EP3293264A1 (en) | Improved host cell for the production of a compound of interest | |
| EP2825651A1 (en) | Recombination system | |
| US20200063166A1 (en) | Zinc binuclear cluster transcriptional regulator-deficient strain | |
| WO2015055558A1 (en) | Protein expression system | |
| JP2008516594A (en) | Homologous AMDS genes as selectable markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14790026 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14790026 Country of ref document: EP Kind code of ref document: A1 |
