WO2015042354A1 - Mechanical bone loading to reduce arthritic pain - Google Patents
Mechanical bone loading to reduce arthritic pain Download PDFInfo
- Publication number
- WO2015042354A1 WO2015042354A1 PCT/US2014/056483 US2014056483W WO2015042354A1 WO 2015042354 A1 WO2015042354 A1 WO 2015042354A1 US 2014056483 W US2014056483 W US 2014056483W WO 2015042354 A1 WO2015042354 A1 WO 2015042354A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- joint
- loading
- racl
- ngf
- cartilage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4706—4-Aminoquinolines; 8-Aminoquinolines, e.g. chloroquine, primaquine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61H—PHYSICAL THERAPY APPARATUS, e.g. DEVICES FOR LOCATING OR STIMULATING REFLEX POINTS IN THE BODY; ARTIFICIAL RESPIRATION; MASSAGE; BATHING DEVICES FOR SPECIAL THERAPEUTIC OR HYGIENIC PURPOSES OR SPECIFIC PARTS OF THE BODY
- A61H2205/00—Devices for specific parts of the body
- A61H2205/10—Leg
- A61H2205/102—Knee
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61H—PHYSICAL THERAPY APPARATUS, e.g. DEVICES FOR LOCATING OR STIMULATING REFLEX POINTS IN THE BODY; ARTIFICIAL RESPIRATION; MASSAGE; BATHING DEVICES FOR SPECIAL THERAPEUTIC OR HYGIENIC PURPOSES OR SPECIFIC PARTS OF THE BODY
- A61H9/00—Pneumatic or hydraulic massage
- A61H9/005—Pneumatic massage
- A61H9/0078—Pneumatic massage with intermittent or alternately inflated bladders or cuffs
Definitions
- the novel technology herein pertains to methods for treating conditions associated with joint diseases, including arthritis-related diseases.
- the novel technology herein also pertains to enhancing joint bone formation, accelarating joint wound healing, and preventing joint pain perception.
- knee loading was employed to explore potential effects on neuronal signaling, in particular pain perception.
- Massage therapy is believed to be a unique form of mechanical stimuli for treating a variety of health conditions, including joint disorders as a regimen to relieve pain for those with osteoarthritis of the knee.
- joint disorders including joint disorders as a regimen to relieve pain for those with osteoarthritis of the knee.
- a growing body of evidence is believed to support the efficacy of massage therapy, little is known about the mechanism of its pain relieving action. It has been suggested that the origin of chronic pain in osteoarthritic joint is less clear whether it is due primarily to damage of sensory nerves in bone and inflammation in synovium or due in part to innervation from mesenchyme into the aneural entity, cartilage.
- a surrogate target to block for relieving pain in the articular cartilage of joints is described.
- Nerve growth factor (NGF) particularly, ⁇ -subunit (NGF )
- NGF nerve growth factor
- the level of NGF has been reported to be low in normal
- chondrocytes increased in mild osteoarthritic cartilage and further enhanced in severe osteoarthritic cartilage.
- the active component of NGF protein is believed to be 118-amino-acid sequence of the ⁇ subunit.
- the most studied class of trophic factors that are involved in trophic function or survival of neuron is believed to be the neurotrophins.
- three major neurotrophins have been isolated from mammals. Unlike tyrosine kinases receptors (Trk), each neurotrophin has been reported to bind to p75 with similar affinity thus p75 has also been called 'a common receptor'.
- the activation of the p75 receptor has been shown to promote neuronal cell death thus suggested a therapeutic target for neuropsychiatric disease. It was also suggested that NGF and p75 causes the pathogenesis of discogenic pain in intervertebral discs.
- NGF neurotrophic factor
- a basal expression level of NGF is believed to be high in embryos undergoing skeletal morphogenesis and low in mature cartilage. It is reported that its expression is linked to pain perception and increased in arthritic joints.
- the downregulation of expression of NGF in cartilage and chondrocytes by mechanical stimulation is described. Since load-driven downregulation of MMPs is in part believed to be mediated by p38 mitogen activated protein kinase (MAPK) signaling and GTPases, without being bound by theory, it was hypothesized herein that gentle mechanical loading reduces the mRNA levels of NGF and p75 through p38 MAPK.
- MAPK mitogen activated protein kinase
- knee loading was applied to mice to determine a potential loading modality effective for downregulation of NGF and receptor genes in the cartilage.
- In vitro fluid flow experiments are also described using C28/I2 chondrocyte cells.
- the mRNA levels of NGF and p75 were determined using quantitative PCR and the phosphorylation level of p38. Focusing on the role of Racl GTPase, its expression and activity were determined using immunoprecipitation of an active form of Racl, RNA interference with siRNA specific to Racl, and a fluorescence resonance energy transfer (FRET) technique with a Racl biosensor.
- FRET fluorescence resonance energy transfer
- salubrinal has been reported to protect against neurotoxicity in the central nervous system.
- the present technology relates to mechanical loading of the knee to downregulate nerve growth factor beta (NGFb), which is believed to be a major cause of pain in arthritic joints.
- NGFb nerve growth factor beta
- the present technology also relates to mechanical loading of the knee to reduce inflammation and progression of osteoarthritis.
- joint loading and fluid flow can attenuate mRNA expression of NGF mediated by Racl.
- the joint loading may be performed at between 0.5 N and IO N, preferably at 1 N, and the fluid flow may be performed at, for example, 5 dyn/cm 2 .
- the results described herein suggest that gentle knee loading analogous to massage therapy is beneficial not only to enhancing bone formation and accelerating wound healing but also to preventing NGFP-induced nerve growth and pain perception in cartilage.
- the effects of gentle loads applied to a joint, illustratively, the knee, on mRNA expression of nerve growth factor, particularly, the active beta subunit (NGF ) in cartilage and chondrocyte are described.
- mRNA expression of nerve growth factor particularly, the active beta subunit (NGF ) in cartilage and chondrocyte
- cyclic compressive loads in vivo and fluid flow in vitro were used to determine the mRNA levels.
- Alteration of Racl GTPase as well as effect of salubrinal, a specific inhibitor of eIF2a phosphatase, are described, using fluorescence resonance energy transfer (FRET)-based Racl biosensor.
- FRET fluorescence resonance energy transfer
- joint loading illustratively, of a knee at 1 N, reduced mRNA levels of NGF and its low affinity receptor, p75 in cartilage and subchondral bone. Additionally, it was discovered that, in cartilage, joint loading,
- SB203580 which decreases p38-p, reduced the mRNA levels of NGFP and p75.
- Silencing Racl by siRNA decreased the levels of p38-p and NGF mRNA but not p75.
- administration of a specific inhibitor of eIF2a phosphatase illustratively, salubrinal, reduced FRET-based activity of Racl as well as the mRNA levels of NGF and p75.
- mechanical stimulation and administration of a specific inhibitor of eIF2a phosphatase such as salubrinal may attenuate pain perception-linked NGF signaling through Racl -mediated p38 MAPK.
- FIG. 1 shows the effects of mechanical stimulation on the mRNA levels of NGFP and p75.
- FIG. 1 a represents the effects of knee loading on the mRNA levels of NGFP- A, NGFP-B and p75 in the articular cartilage.
- FIG. lb represents the effects of knee loading on the mRNA levels of NGFP-A, NGFP-B and p75 in subchondral bone.
- FIG. lc represents the effects of shear stress on the levels of NGFP mRNA in C28/I2 cells.
- FIG. Id represents the effects of shear stress on the levels of p75 mRNA in C28/I2 cells.
- the dash line represents the level of the control group.
- FIG. 2 shows the p38 MAPK signaling.
- FIG. 2a shows phosphorylation of p38 in mouse cartilage in response to knee loading.
- FIG. 2b shows phosphorylation of p38 in C28/I2 cells in response to fluid flow at 2-20 dyn/cm 2 .
- FIG. 2c shows effects of SB203580 on phosphorylation of p38 in C28/I2 cells.
- FIG. 2d shows effects of SB203580 on the mRNA levels of NGFp and p75 in C28/I2 cells.
- FIG. 3 shows involvement of Racl GTPase.
- FIG. 3 a shows activity of Racl in mouse cartilage in response to knee loading.
- FIG. 3b shows effects of RNA interference with Racl siRNA on phosphorylation of p38 in C28/I2 cells.
- FIG. 3c shows effects of Racl siRNA on the mRNA levels of NGF and p75 in
- NC non-specific control siRNA.
- FIG. 4 shows effects of salubrinal.
- FIG. 4b shows reduction in Racl activity in C28/I2 cells by FRET.
- FIG. 4c shows proposed mechanism of Racl -mediated regulation of NGF through p38 MAPK.
- patients accompanying chronic pain are manifested with an elevated level of NGF and p75.
- knee loading at 1 N reduces the mRNA levels of NGF and p75 in the articular cartilage and subchondral bone of the mice, and shear stress at 5 and 10 dyn/cm 2 on C28/I2 chondrocytes downregulates their mRNA levels.
- Pain of the knee joint is known to be multi-factorial and inflammatory synovium and subchondral bone collapse are suggested in the literature to play a role in osteoarthritic joints.
- it is hypothesized in the literature that the invasion of articular cartilage by vascularized mesenchymal tissues followed by the innervation of sensory nerves is associated with severity of injury as well as chronic pain.
- Nerves are known to exist in trabecular bone of the epiphysis, and are believed to grow in response to NGF .
- healthy cartilage is not believed to consist of vascular or neural tissues, arthritic cartilage is believed to lose its ability to remain aneural and avascular. It has been reported that dynamic loading to cartilage evokes stimulation of matrix synthesis, as well as regulation of enzymatic activities of matrix metalloproteinases.
- results herein point out that mechanical stimuli at moderate amplitudes regulate transcription of NGF and its receptor in cartilage and chondrocytes.
- knee loading induces not only pressure alterations but also pressure driven fluid flow to chondrocytes. Unlike well-studied effects of normal stress on
- chondrocytes it has been recently suggested that a consequence of compressive loading is production of hydrostatic pressure as well as fluid flow to cartilage.
- chondrocytes are known to be exposed to flow shear presumably due primarily to synovial fluid and high amplitude of fluid flow reproduces the hallmarks of osteoarthritis in vitro.
- the frequency of 5 Hz might not be representative of massage to humans by hands but more pertinent to those by vibrator for foot massage.
- the levels of loading in vivo have been optimized herein to produce anabolic response in the bone and cartilage. It has been found that 1 N is relatively optimal than 3 N in suppressing mRNA expression of NGF and p75.
- the culture model was derived from previous report in the art. Unlike the long duration exposure applied in the in vitro OA model, it was found herein that 0.5 h exposure at 5 and 10 dyn/cm 2 appears to lead to comparable effects in cells as in in vivo compressive loading (I N) from tissues.
- RhoA and cdc42 may be involved in the regulation of p75, and possibly of NGF .
- TrkA is believed to be the high affinity receptor for NGF
- the pilot data herein using real time qPCR may be taken to indicate that the basal expression of TrkA in human C28/I2 cells is 6 fold lower than that of p75.
- the in vitro result herein may be taken as showing that salubrinal, a specific inhibitor for dephosphorylation of eukaryotic translation initiation factor
- salubrinal has been reported to protect against excitotoxic neuronal injury induced by Kainic acid.
- Kainic acid- induced brain injury is a long-standing animal model of seizure and is known to stimulate NGF expression in the hippocampus.
- any effect of salubrinal on the peripheral nervous system remains undetermined.
- the response of the Racl biosensor in the FRET analysis appears to present variations among cells. Approximately 40% of the cells (7 out of 17 cells) exhibited a clear decrease in the activity of Racl, while the others did not show a significant change. The observation may be taken to indicate that the result with PCR and Western blotting can only present the average response, and the degree of pain reception may not be necessarily represented by the response of a whole population of cells.
- EXAMPLE Materials and Methods. Animals. Experimental procedures were approved by the Indiana University Animal Care and Use Committee and were in compliance with the Guiding Principles in the Care and Use of Animals endorsed by the American Physiological Society. Three mice were housed per cage, and they were fed with mouse chow and water ad libitum. Two groups of C57/BL/6 female mice (-12 weeks, Harlan Laboratories) were used, in which the group I was for examining effects of time (1 h and 3 h), and the group II for testing effects of loading amplitude (I N and 3 N). Six unloaded knees served as control.
- EXAMPLE Knee Loading. Cyclic compression was applied to the mouse right knee using a custom-made piezoelectric loading device following reported methods. The mouse was mask-anesthetized using 2% isoflurane, and lateral loads to the knee were applied for 5 min at 5 Hz with a peak-to-peak force of 1 and 3 N. The left hindlimb was used as sham- loaded control, with the left knee placed under the loading rod in the same procedure without applying a voltage signal to the loader. The femoral articular cartilage and subchondral bone tissue were harvested from loaded and non-loaded mice 1 h after the loading bout.
- EXAMPLE In vitro experiments. Human chondrocytes, C28/I2 cells, were cultured in DMEM (Lonza) containing 10% FBS (Hyclone) and antibiotics (Life Technologies). For mechanical stimulation, cells were grown on glass slides treated with 1 % rat-tail collagen (BD Biosciences). Twenty four hours before flow application, cells were incubated in DMEM containing 0.5% FBS. The slides were loaded into a Streamer Gold flow device chamber (Flexcell International). For inhibition of p38 phosphorylation, cells were incubated with 10, 20 and 40 ⁇ SB203580 (Calbiochem) for 15 min. Salubrinal, an agent reported to act as an inhibitor of eIF2ot phosphatase (Tocris Bioscience), was administered at 2, 10, and 50 ⁇ .
- Rhode Activity Assay The activity level of Racl was detected with a Racl activation assay kit (Millipore) using the procedure provided by the manufacturer. In brief, the protein sample was lysed in a magnesium lysis/wash buffer containing 10 ⁇ g/ml leupeptin and 10 ⁇ g/ml aprotinin. The cell lysate was incubated with a Racl assay reagent (agarose beads) to precipitate Racl-GTP. The level of Racl-GTP was detected with anti- Racl antibody using a standard Western blot procedure.
- AGGGUCUAGCCAUGGCUAAGGAGAU-3 ' while a negative siRNA (StealthTM siRNA negative control High, Invitrogen) was used as a nonspecific control.
- C28/I2 cells were transiently transfected with Racl siRNA or control siRNA in Opti-MEM I medium with Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's instructions. Six hours later, the medium was replaced by regular culture medium. The efficiency of silencing Racl was assessed with immunoblotting 48 h after the transfection.
- EXAMPLE Real-time PCR.
- the mRNA expressions of NGF and p75 were determined using quantitative real-time PCR with the following primers: human ⁇ - TCAGCATTCCCTTGACACTG (forward), TGCTCCTGTGAGTCCTGTTG (backward); human p75- GTGGGACAGAGTCTGGGTGT (forward), AAGGAGGGGAGGTGATAGGA (backward); human GAPDH- GCACCGTCAAGGCT GAGAAC (forward),
- ATGGTGGTGAAGAC GCCAGT backward
- mouse ⁇ - ⁇ - CCAGTGAAATTAGGCTCCCTG forward
- Reverse transcription was performed, and real-time PCR was carried out using ABI 7500 with SYBR green PCR kits (Applied Biosystems). The mRNA level of GAPDH was used as an internal control. Data were further normalized with respect to unloaded controls in the in vivo and in vitro experiments following methods known in the art.
- EXAMPLE Western Blot Analysis. Samples isolated from cartilage were dissociated with a mortar and pestle in a lysis buffer containing the following: 20 ⁇ phosphotase inhibitor, 5 ⁇ proteinase inhibitor, 5 ⁇ phenylmethanesulfonylfluoride, and 5 ⁇ sodium orthovanadate (Calbiochem) in 500 ⁇ RIPA (Santa Cruz). BSA assay (Thermo scientific) was conducted for quantification of proteins extracted from tissues and 1 : 10 dilution of the initial extract in RIPA is applied to be in the working range (125-2,000 ⁇ g/ml). Samples isolated from C28/I2 chondrocytes were transferred to the RIPA lysis buffer containing inhibitors for proteases and phosphatases. Isolated proteins in the working range (125-2,000 ⁇ g/ml) were
- FRET Fluorescence Resonance Energy Transfer
- CFP cyan fluorescent protein
- YFP yellow fluorescent protein
- the filter sets (Semrock) were chosen for CFP excitation at 438 + 24 nm (center wavelength + bandwidth), CFP emission at 483 + 32 nm, and YFP emission at 542 + 27 nm.
- Time-lapse images were acquired at an interval of 5 min using a fluorescence microscope (Nikon).
- the level of Racl activity was determined by computing an emission ratio of YFP/CFP for individual cells using NIS -Elements software (Nikon).
- EXAMPLE Results. Mechanical stimulation appears to downregulate NGF signaling. Compared to the non-loaded controls, knee loading at 1 N significantly reduced the mRNA levels of NGF and p75 in the cartilage and subchondral bone. Such load-induced downregulation of NGF and p75 mRNA persisted 3 h following the application of loading except for the mRNA level of NGF variant A in subchondral bone (FIGS, la and lb). Fluid shear at 5 and 10 dyn/cm 2 also downregulated the mRNA levels of NGFP and p75 in C28/I2 cells as compared to the no-flow controls (FIGS, lc and Id).
- EXAMPLE Phosphorylation of p38 appears to be involved in loading effects on NGF signaling. Knee loading at 1 N but not at 3 N decreased the phosphorylation level of p38 (p- p38) in the cartilage (FIG. 2a). Consistent with this reduction of p-p38 at relatively low amplitude in vivo, fluid flow at 5 dyn/cm 2 in vitro also reduced p-p38. At 2, 10, and 20 dyn/cm 2 , however, flow-driven reduction of p-p38 was not observed, leading to biphasic response over different flow shear (FIG. 2b).
- SB203580 suppressed p38 phosphorylation within 15 min in C28/I2 cells (FIG. 2c).
- EXAMPLE Salubrinal appears to induce attenuation of NGF mRNA expression and Racl in chondrocytes.
- administration of salubrinal at 10 ⁇ significantly decreased activity of Racl GTPase in C28/I2 cells within 15 min and sustained its decrease more than 60 min (FIG. 4b).
- described herein is a method for treating one or more conditions associated with joint diseases, the method comprising the step of administering to a patient in need of relief from the one or more conditions mechanical stimulation of the diseased joint.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint diseases comprise osteoarthritis-related diseases.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint diseases further comprise disorders of the joint cartilage.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint results in at least one of enhancing bone formation, accelerating wound healing, and prevention of pain perception.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint comprises cyclic compression.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint comprises joint loading.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading induces at least one of pressure alterations and pressure driven fluid flow to the joint chondrocytes.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading is performed at between 0.5 N and 3 N.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading is performed at 1 N.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the diseased joint is a knee.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation downregulates NGF signaling in the cartilage and subchondral bone of the joint.
- described herein is a method for treating one or more conditions associated with joint diseases, as described above, further comprising the step of administering a specific inhibitor of eIF2a phosphatase. In another embodiment, described herein is a method for treating one or more
- the inhibitor is a salubrinal, or an analog or derivative thereof.
- described herein is a method for treating one or more
- salubrinal or an analog or derivative thereof, is administered at between 2 ⁇ and 50 ⁇ .
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Described herein is a novel technology pertaining to methods for treating conditions associated with joint diseases, including arthritis-related diseases. The novel technology herein also pertains to enhancing joint bone formation, accelerating joint wound healing, and preventing joint pain perception.
Description
MECHANICAL BONE LOADING TO REDUCE ARTHRITIC PAIN
GOVERNMENT RIGHTS
This invention was made with government support under AR052144 awarded by The National Institutes of Health. The U.S. Government has certain rights in the invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional
Application Serial No. 61/880,422, filed September 20, 2013, the disclosure of which is incorporated herein by reference.
TECHNICAL FIELD
The novel technology herein pertains to methods for treating conditions associated with joint diseases, including arthritis-related diseases. The novel technology herein also pertains to enhancing joint bone formation, accelarating joint wound healing, and preventing joint pain perception.
BACKGROUND
Mechanical stimuli have been reported to play a critical role in homeostasis of musculoskeletal tissues including bone and articular cartilage. Physical exercises, for instance, have been reported to enhance new bone formation, while gentle mobilization of synovial joints is believed to reduce activities of degenerative enzymes such as matrix
metalloproteinases (MMPs). Knee loading has been reported to be a modality that applies gentle, lateral loads to the knee, providing a model system for understanding loading effects on preventing bone loss and cartilage degradation. Animal studies have been reported to suggest that knee loading not only stimulates bone formation in the tibia and femur but also to reduce activities of MMPs in articular cartilage.
In one embodiment herein, knee loading was employed to explore potential effects on neuronal signaling, in particular pain perception. Massage therapy is believed to be a unique form of mechanical stimuli for treating a variety of health conditions, including joint disorders as a regimen to relieve pain for those with osteoarthritis of the knee. Although a growing body of evidence is believed to support the efficacy of massage therapy, little is known about the mechanism of its pain relieving action. It has been suggested that the origin of chronic pain in osteoarthritic joint is less clear whether it is due primarily to damage of sensory nerves in bone and inflammation in synovium or due in part to innervation from mesenchyme into the aneural entity, cartilage.
In one embodiment herein, a surrogate target to block for relieving pain in the articular cartilage of joints is described. Nerve growth factor (NGF), particularly, β-subunit (NGF ), was considered, as well as its low affinity receptor, p75 as potential markers for pain perception in the joint. The level of NGF has been reported to be low in normal
chondrocytes, increased in mild osteoarthritic cartilage and further enhanced in severe osteoarthritic cartilage. Among three subunits, the active component of NGF protein is believed to be 118-amino-acid sequence of the β subunit. The most studied class of trophic factors that are involved in trophic function or survival of neuron is believed to be the neurotrophins. Other than NGF, three major neurotrophins have been isolated from mammals. Unlike tyrosine kinases receptors (Trk), each neurotrophin has been reported to bind to p75 with similar affinity thus p75 has also been called 'a common receptor'. In particular, the activation of the p75 receptor has been shown to promote neuronal cell death thus suggested a
therapeutic target for neuropsychiatric disease. It was also suggested that NGF and p75 causes the pathogenesis of discogenic pain in intervertebral discs.
Although cartilage is not believed to be an innervated tissue, the expression of NGF and its receptors has been reported to be developmentally regulated. A basal expression level of NGF is believed to be high in embryos undergoing skeletal morphogenesis and low in mature cartilage. It is reported that its expression is linked to pain perception and increased in arthritic joints.
In another embodiment herein, the downregulation of expression of NGF in cartilage and chondrocytes by mechanical stimulation is described. Since load-driven downregulation of MMPs is in part believed to be mediated by p38 mitogen activated protein kinase (MAPK) signaling and GTPases, without being bound by theory, it was hypothesized herein that gentle mechanical loading reduces the mRNA levels of NGF and p75 through p38 MAPK.
In one embodiment herein, knee loading was applied to mice to determine a potential loading modality effective for downregulation of NGF and receptor genes in the cartilage. In vitro fluid flow experiments are also described using C28/I2 chondrocyte cells. The mRNA levels of NGF and p75 were determined using quantitative PCR and the phosphorylation level of p38. Focusing on the role of Racl GTPase, its expression and activity were determined using immunoprecipitation of an active form of Racl, RNA interference with siRNA specific to Racl, and a fluorescence resonance energy transfer (FRET) technique with a Racl biosensor.
In another embodiment, the effect on expression of NGF by the synthetic chemical agent, salubrinal, is described herein; salubrinal has been reported to protect against neurotoxicity in the central nervous system.
In another embodiment, described herein is Racl mediated load-driven attenuation of mRNA expression of nerve growth factor beta in cartilage and chondrocytes.
SUMMARY OF THE INVENTION
The present technology relates to mechanical loading of the knee to downregulate nerve growth factor beta (NGFb), which is believed to be a major cause of pain in arthritic joints. The present technology also relates to mechanical loading of the knee to reduce inflammation and progression of osteoarthritis.
In one embodiment, it has been discovered herein that joint loading and fluid flow can attenuate mRNA expression of NGF mediated by Racl. Illustratively, the joint loading may be performed at between 0.5 N and IO N, preferably at 1 N, and the fluid flow may be performed at, for example, 5 dyn/cm2. In one aspect, the results described herein suggest that gentle knee loading analogous to massage therapy is beneficial not only to enhancing bone formation and accelerating wound healing but also to preventing NGFP-induced nerve growth and pain perception in cartilage.
In another embodiment, the effects of gentle loads applied to a joint, illustratively, the knee, on mRNA expression of nerve growth factor, particularly, the active beta subunit (NGF ) in cartilage and chondrocyte, are described. In one aspect, cyclic compressive loads in vivo and fluid flow in vitro were used to determine the mRNA levels. Alteration of Racl GTPase as well as effect of salubrinal, a specific inhibitor of eIF2a phosphatase, are described, using fluorescence resonance energy transfer (FRET)-based Racl biosensor.
In another embodiment, it was discovered herein that joint loading, illustratively, of a knee at 1 N, reduced mRNA levels of NGF and its low affinity receptor, p75 in cartilage and subchondral bone. Additionally, it was discovered that, in cartilage, joint loading,
illustratively, of a knee at 1 N, reduced the phosphorylation level of p38 MAPK (p38-p) and activity of Racl GTPase. Additionally, it was discovered that, fluid flow at, for example, 5 and 10 dyn/cm2, reduced mRNA levels of NGFP and p75 in C28/I2 human chondrocytes.
In another embodiment, it is described herein that SB203580, which decreases p38-p, reduced the mRNA levels of NGFP and p75. Silencing Racl by siRNA decreased the levels
of p38-p and NGF mRNA but not p75. Furthermore, administration of a specific inhibitor of eIF2a phosphatase, illustratively, salubrinal, reduced FRET-based activity of Racl as well as the mRNA levels of NGF and p75.
In yet another embodiment, it is described herein that mechanical stimulation and administration of a specific inhibitor of eIF2a phosphatase such as salubrinal may attenuate pain perception-linked NGF signaling through Racl -mediated p38 MAPK.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the effects of mechanical stimulation on the mRNA levels of NGFP and p75.
FIG. 1 a represents the effects of knee loading on the mRNA levels of NGFP- A, NGFP-B and p75 in the articular cartilage.
FIG. lb represents the effects of knee loading on the mRNA levels of NGFP-A, NGFP-B and p75 in subchondral bone.
FIG. lc represents the effects of shear stress on the levels of NGFP mRNA in C28/I2 cells.
FIG. Id represents the effects of shear stress on the levels of p75 mRNA in C28/I2 cells. The dash line represents the level of the control group.
FIG. 2 shows the p38 MAPK signaling.
FIG. 2a shows phosphorylation of p38 in mouse cartilage in response to knee loading. FIG. 2b shows phosphorylation of p38 in C28/I2 cells in response to fluid flow at 2-20 dyn/cm2.
FIG. 2c shows effects of SB203580 on phosphorylation of p38 in C28/I2 cells.
FIG. 2d shows effects of SB203580 on the mRNA levels of NGFp and p75 in C28/I2 cells..
FIG. 3 shows involvement of Racl GTPase.
FIG. 3 a shows activity of Racl in mouse cartilage in response to knee loading.
FIG. 3b shows effects of RNA interference with Racl siRNA on phosphorylation of p38 in C28/I2 cells.
FIG. 3c shows effects of Racl siRNA on the mRNA levels of NGF and p75 in
C28/I2 cells. The dash lines represent the level of the control group. NC: non-specific control siRNA.
FIG. 4 shows effects of salubrinal.
FIG. 4a shows mRNA levels of NGF and p75 by 10 μΜ salubrinal in C28/I2 cells. n=6.
FIG. 4b shows reduction in Racl activity in C28/I2 cells by FRET. The arrow
indicates the commencement time (t=0) for salubrinal administration at 10 μΜ to C28/I2 cells. The color bar represents emission ratio of YFP/CFP, an index of Racl activation. Ratio images were scaled according to the corresponding color bar. Scale bar=10 μιη.
FIG. 4c shows proposed mechanism of Racl -mediated regulation of NGF through p38 MAPK. In osteoarthritic joints, patients accompanying chronic pain are manifested with an elevated level of NGF and p75.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the purposes of promoting an understanding of the principles of the invention and presenting its currently understood best mode of operation, reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, with such alterations and further modifications in the illustrated device and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates.
It is reported that the expression of NGF is elevated in osteoarthritic cartilage. In one embodiment of the invention herein, it is demonstrated that knee loading at 1 N reduces the mRNA levels of NGF and p75 in the articular cartilage and subchondral bone of the mice, and shear stress at 5 and 10 dyn/cm2 on C28/I2 chondrocytes downregulates their mRNA levels. Pain of the knee joint is known to be multi-factorial and inflammatory synovium and subchondral bone collapse are suggested in the literature to play a role in osteoarthritic joints. Alternatively, it is hypothesized in the literature that the invasion of articular cartilage by vascularized mesenchymal tissues followed by the innervation of sensory nerves is associated with severity of injury as well as chronic pain. Nerves are known to exist in trabecular bone of the epiphysis, and are believed to grow in response to NGF . Although healthy cartilage is not believed to consist of vascular or neural tissues, arthritic cartilage is believed to lose its ability to remain aneural and avascular. It has been reported that dynamic loading to cartilage evokes stimulation of matrix synthesis, as well as regulation of enzymatic activities of matrix metalloproteinases. In addition to the reported regulatory role in matrix homeostasis, in one embodiment of the invention herein the results herein point out that mechanical stimuli at moderate amplitudes regulate transcription of NGF and its receptor in cartilage and chondrocytes.
It is believed that knee loading induces not only pressure alterations but also pressure driven fluid flow to chondrocytes. Unlike well-studied effects of normal stress on
chondrocytes, it has been recently suggested that a consequence of compressive loading is production of hydrostatic pressure as well as fluid flow to cartilage. In osteoarthritis, chondrocytes are known to be exposed to flow shear presumably due primarily to synovial fluid and high amplitude of fluid flow reproduces the hallmarks of osteoarthritis in vitro. The frequency of 5 Hz might not be representative of massage to humans by hands but more pertinent to those by vibrator for foot massage. In another embodiment as described herein, the levels of loading in vivo have been optimized herein to produce anabolic response in the
bone and cartilage. It has been found that 1 N is relatively optimal than 3 N in suppressing mRNA expression of NGF and p75. The culture model was derived from previous report in the art. Unlike the long duration exposure applied in the in vitro OA model, it was found herein that 0.5 h exposure at 5 and 10 dyn/cm2 appears to lead to comparable effects in cells as in in vivo compressive loading (I N) from tissues.
The immunoblot results described herein were limited to p38, which appear to show biphasic effects, as the lower load/fluid shear levels applied were inhibitory. As shown in wider force range, however, the mRNA data on load- and shear-driven alteration of NGF and p75 appear to more convincingly demonstrate the same biphasic responses, it is suggested herein that a more thorough study may be warranted to address load-driven suppression of NGF at protein level.
In another embodiment, the role of Racl in load-driven downregulation of NGF is described. Racl has been shown in the literature to activate p38 MAPK, and laminar fluid shear has been reported to induce transient alteration of p-p38 and Racl. In another embodiment, it was observed herein that Racl siRNA in C28/I2 cells may reduce p-p38. In the siRNA experiment, however, load-driven downregulation of p75 appears to not be affected by RNA interference. Without being bound by theory, it is possible that other GTPases such as RhoA and cdc42 may be involved in the regulation of p75, and possibly of NGF . For instance, it has been previously reported that the activity of RhoA alters in response to fluid flow in a flow-intensity dependent manner. Although TrkA is believed to be the high affinity receptor for NGF , the pilot data herein using real time qPCR may be taken to indicate that the basal expression of TrkA in human C28/I2 cells is 6 fold lower than that of p75.
In another embodiment, the in vitro result herein may be taken as showing that salubrinal, a specific inhibitor for dephosphorylation of eukaryotic translation initiation factor
2a (eIF2a), can attenuate transcription of NGF and activity of Racl. The result herein may
suggest that suppression of both NGF and p75 mRNA expression is achievable at 10 μΜ but not necessarily at the higher dose at 50 μΜ. In the central nervous system, salubrinal has been reported to protect against excitotoxic neuronal injury induced by Kainic acid. Kainic acid- induced brain injury is a long-standing animal model of seizure and is known to stimulate NGF expression in the hippocampus. However, any effect of salubrinal on the peripheral nervous system remains undetermined. The in vitro results herein may suggest that both gentle mechanical loading and salubrinal share the Racl -mediated signaling pathway for - mRNA expression of NGF (FIG. 4c). In myocardial remodeling, it is reported that deficiency of Racl reduces stress to the endoplasmic reticulum. Since the elevated phosphorylation level of eIF2ot by salubrinal also suppresses stress to the endoplasmic reticulum, the observed linkage of salubrinal to Racl appears to be consistent with downregulation of NGF .
In another embodiment of the invention herein, in response to administration of 10 μΜ salubrinal, the response of the Racl biosensor in the FRET analysis appears to present variations among cells. Approximately 40% of the cells (7 out of 17 cells) exhibited a clear decrease in the activity of Racl, while the others did not show a significant change. The observation may be taken to indicate that the result with PCR and Western blotting can only present the average response, and the degree of pain reception may not be necessarily represented by the response of a whole population of cells.
EXAMPLES
The following illustrative examples describe particular embodiments of the invention. However, these examples are illustrative only, and should not be construed to limit the scope of either the specification or the claims.
EXAMPLE: Materials and Methods. Animals. Experimental procedures were approved by the Indiana University Animal Care and Use Committee and were in compliance with the Guiding Principles in the Care and Use of Animals endorsed by the American Physiological Society. Three mice were housed per cage, and they were fed with mouse chow and water ad libitum. Two groups of C57/BL/6 female mice (-12 weeks, Harlan Laboratories) were used, in which the group I was for examining effects of time (1 h and 3 h), and the group II for testing effects of loading amplitude (I N and 3 N). Six unloaded knees served as control.
EXAMPLE: Knee Loading. Cyclic compression was applied to the mouse right knee using a custom-made piezoelectric loading device following reported methods. The mouse was mask-anesthetized using 2% isoflurane, and lateral loads to the knee were applied for 5 min at 5 Hz with a peak-to-peak force of 1 and 3 N. The left hindlimb was used as sham- loaded control, with the left knee placed under the loading rod in the same procedure without applying a voltage signal to the loader. The femoral articular cartilage and subchondral bone tissue were harvested from loaded and non-loaded mice 1 h after the loading bout.
EXAMPLE: In vitro experiments. Human chondrocytes, C28/I2 cells, were cultured in DMEM (Lonza) containing 10% FBS (Hyclone) and antibiotics (Life Technologies). For mechanical stimulation, cells were grown on glass slides treated with 1 % rat-tail collagen (BD Biosciences). Twenty four hours before flow application, cells were incubated in DMEM containing 0.5% FBS. The slides were loaded into a Streamer Gold flow device chamber (Flexcell International). For inhibition of p38 phosphorylation, cells were incubated with 10, 20 and 40 μΜ SB203580 (Calbiochem) for 15 min. Salubrinal, an agent reported to act as an inhibitor of eIF2ot phosphatase (Tocris Bioscience), was administered at 2, 10, and 50 μΜ.
EXAMPLE: Racl Activity Assay. The activity level of Racl was detected with a Racl activation assay kit (Millipore) using the procedure provided by the manufacturer. In brief, the protein sample was lysed in a magnesium lysis/wash buffer containing 10 μg/ml
leupeptin and 10 μg/ml aprotinin. The cell lysate was incubated with a Racl assay reagent (agarose beads) to precipitate Racl-GTP. The level of Racl-GTP was detected with anti- Racl antibody using a standard Western blot procedure.
EXAMPLE: Silencing Racl GTPase using siRNA. To evaluate the role of Racl GTPase in regulation of p38 MAPK and NGF, cells were treated with siRNA specific to Racl GTPase (Invitrogen). The targeted Racl sequence was 5'-
AGGGUCUAGCCAUGGCUAAGGAGAU-3 ' , while a negative siRNA (Stealth™ siRNA negative control High, Invitrogen) was used as a nonspecific control. C28/I2 cells were transiently transfected with Racl siRNA or control siRNA in Opti-MEM I medium with Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's instructions. Six hours later, the medium was replaced by regular culture medium. The efficiency of silencing Racl was assessed with immunoblotting 48 h after the transfection.
EXAMPLE: Real-time PCR. The mRNA expressions of NGF and p75 were determined using quantitative real-time PCR with the following primers: human ΝΟΕβ- TCAGCATTCCCTTGACACTG (forward), TGCTCCTGTGAGTCCTGTTG (backward); human p75- GTGGGACAGAGTCTGGGTGT (forward), AAGGAGGGGAGGTGATAGGA (backward); human GAPDH- GCACCGTCAAGGCT GAGAAC (forward),
ATGGTGGTGAAGAC GCCAGT (backward); mouse ΝΟΕβ-Α- CCAGTGAAATTAGGCTCCCTG (forward), CCTTGGCAAAACCTTTATTGG
(backward); mouse ΝΟΕβ-Β- TGATCGGCGTACAGGCAGA (forward),
GCTGAAGTTTAGTCCAGTGGG (backward); mouse p75-
CTAGGGGTGTCCTTTGGAGGT (forward), CAGGGTTCACACACGGTCT (backward); mouse GAPDH- TGCACCACCAACTGCTTAG (forward), GGATGCAGAGAAGATGTTC
(backward). Total RNA was extracted using an RNeasy Plus mini kit with Qiazol (Qiagen) for cartilage and β-mercaptoethanol-based reagent for chondrocyte as starting buffer, respectively.
Reverse transcription was performed, and real-time PCR was carried out using ABI 7500 with
SYBR green PCR kits (Applied Biosystems). The mRNA level of GAPDH was used as an internal control. Data were further normalized with respect to unloaded controls in the in vivo and in vitro experiments following methods known in the art.
EXAMPLE: Western Blot Analysis. Samples isolated from cartilage were dissociated with a mortar and pestle in a lysis buffer containing the following: 20 μΐ phosphotase inhibitor, 5 μΐ proteinase inhibitor, 5 μΐ phenylmethanesulfonylfluoride, and 5 μΐ sodium orthovanadate (Calbiochem) in 500 μΐ RIPA (Santa Cruz). BSA assay (Thermo scientific) was conducted for quantification of proteins extracted from tissues and 1 : 10 dilution of the initial extract in RIPA is applied to be in the working range (125-2,000 μg/ml). Samples isolated from C28/I2 chondrocytes were transferred to the RIPA lysis buffer containing inhibitors for proteases and phosphatases. Isolated proteins in the working range (125-2,000 μg/ml) were
fractionated using 10% SDS gels and electro-transferred to Immobilon-P membranes
(Millipore). Immunoblots were carried out using antibodies specific to p38 MAPK, phospho p38 MAPK, and β-actin (Sigma). After incubation with secondary antibodies conjugated with HRP, signals were detected with ECL chemiluminescence. Images were captured using an image analyzer (LAS-3000, Fuji Photo Film) and analyzed using Multi Gauge V 3.0 software.
EXAMPLE: Fluorescence Resonance Energy Transfer (FRET). To visualize Racl activity in response to salubrinal, FRET imaging was conducted using a cyan fluorescent protein (CFP)-yellow fluorescent protein (YFP) Racl biosensor. The filter sets (Semrock) were chosen for CFP excitation at 438 + 24 nm (center wavelength + bandwidth), CFP emission at 483 + 32 nm, and YFP emission at 542 + 27 nm. Time-lapse images were acquired at an interval of 5 min using a fluorescence microscope (Nikon). The level of Racl activity was determined by computing an emission ratio of YFP/CFP for individual cells using NIS -Elements software (Nikon).
EXAMPLE: Statistical Analysis. The in vivo experiment was conducted with n = 6 per group. The in vitro experiment was independently carried out three times. Statistical
significance was calculated using independent t test for two group comparison, and one-way ANOVA followed by Dunnett's post hoc test for more than two groups. Data are reported with S.E., and the asterisks (*, **, and ***) denote p < 0.05, p < 0.01, and p < 0.001, respectively.
EXAMPLE: Results. Mechanical stimulation appears to downregulate NGF signaling. Compared to the non-loaded controls, knee loading at 1 N significantly reduced the mRNA levels of NGF and p75 in the cartilage and subchondral bone. Such load-induced downregulation of NGF and p75 mRNA persisted 3 h following the application of loading except for the mRNA level of NGF variant A in subchondral bone (FIGS, la and lb). Fluid shear at 5 and 10 dyn/cm2 also downregulated the mRNA levels of NGFP and p75 in C28/I2 cells as compared to the no-flow controls (FIGS, lc and Id).
EXAMPLE: Phosphorylation of p38 appears to be involved in loading effects on NGF signaling. Knee loading at 1 N but not at 3 N decreased the phosphorylation level of p38 (p- p38) in the cartilage (FIG. 2a). Consistent with this reduction of p-p38 at relatively low amplitude in vivo, fluid flow at 5 dyn/cm2 in vitro also reduced p-p38. At 2, 10, and 20 dyn/cm2, however, flow-driven reduction of p-p38 was not observed, leading to biphasic response over different flow shear (FIG. 2b). Administration of 10 and 20 μΜ SB203580 suppressed p38 phosphorylation within 15 min in C28/I2 cells (FIG. 2c). As compared to the controls, SB203580 (10 μΜ) significantly reduced the level of NGFP mRNA (p=0.0014) and p75 mRNA (p=0.007) in 60 min in C28/I2 cells (FIG. 2d).
EXAMPLE: Knee loading appears to suppress Racl and siRNA for Racl
downregulates NGF. It was further investigated whether Racl may be involved in regulation of NGF mRNA through p38 MAPK. In the mouse cartilage, knee loading suppressed Racl GTPase at 1 N but not at 3 N (FIG. 3a). Silencing of Racl GTPase by siRNA abolished production of Racl protein as compared to the negative control siRNA. The cells transfected
with Racl siRNA showed a reduced level of p38 phosphorylation (FIG. 3b). Subsequently, gene expression of NGF was significantly downregulated by 2-fold (p=0.0048) in human C28/I2 chondrocytes transfected with Racl siRNA, while mRNA level of p75 did not show statistical difference (FIG. 3c).
EXAMPLE: Salubrinal appears to induce attenuation of NGF mRNA expression and Racl in chondrocytes. Salubrinal administration (10 μΜ) led to downregulation of the mRNA levels of NGF (p=0.002) and p75 (p=0.019) as compared to the vehicle control, 24 h following treatment to human C28/I2 cells. Salubrinal at 50 μΜ also gave rise to a reduction of mRNA levels for NGF (p=0.001) but not p75 (FIG. 4a). In the FRET-based assay, administration of salubrinal at 10 μΜ significantly decreased activity of Racl GTPase in C28/I2 cells within 15 min and sustained its decrease more than 60 min (FIG. 4b).
In one embodiment, described herein is a method for treating one or more conditions associated with joint diseases, the method comprising the step of administering to a patient in need of relief from the one or more conditions mechanical stimulation of the diseased joint.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint diseases comprise osteoarthritis-related diseases.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint diseases further comprise disorders of the joint cartilage.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint results in at least one of enhancing bone formation, accelerating wound healing, and prevention of pain perception.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint comprises cyclic compression.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation of the diseased joint comprises joint loading.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading induces at least one of pressure alterations and pressure driven fluid flow to the joint chondrocytes.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading is performed at between 0.5 N and 3 N.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the joint loading is performed at 1 N.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the diseased joint is a knee.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, wherein the mechanical stimulation downregulates NGF signaling in the cartilage and subchondral bone of the joint.
In another embodiment, described herein is a method for treating one or more conditions associated with joint diseases, as described above, further comprising the step of administering a specific inhibitor of eIF2a phosphatase.
In another embodiment, described herein is a method for treating one or more
conditions associated with joint diseases, as described above, wherein the inhibitor is a salubrinal, or an analog or derivative thereof.
In another embodiment, described herein is a method for treating one or more
conditions associated with joint diseases, as described above, wherein the salubrinal, or an analog or derivative thereof, is administered at between 2 μΜ and 50 μΜ.
While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character. It is understood that the embodiments have been shown and described in the foregoing specification in satisfaction of the best mode and enablement requirements. It is understood that one of ordinary skill in the art could readily make a nigh-infinite number of insubstantial changes and modifications to the above -described embodiments and that it would be impractical to attempt to describe all such embodiment variations in the present specification. Accordingly, it is understood that all changes and modifications that come within the spirit of the invention are desired to be protected.
Claims
1. A method for treating one or more conditions associated with joint diseases, the method comprising the step of administering to a patient in need of relief from the one or more conditions mechanical stimulation of the diseased joint.
2. The method of claim 1 wherein the joint diseases comprise osteoarthritis- related diseases.
3. The method of claim 1 wherein the joint diseases further comprise disorders of the joint cartilage.
4. The method of claim 1 wherein the mechanical stimulation of the diseased joint results in at least one of enhancing bone formation, accelerating wound healing, and prevention of pain perception.
5. The method of claim 1 wherein the mechanical stimulation of the diseased joint comprises cyclic compression.
6. The method of claim 1 wherein the mechanical stimulation of the diseased joint comprises joint loading.
7. The method of the preceding claim wherein the joint loading induces at least one of pressure alterations and pressure driven fluid flow to the joint chondrocytes.
8. The method of the preceding claim wherein the joint loading is performed at between 0.5 N and 3 N.
9. The method of the preceding claim wherein the joint loading is performed at 1
N.
10. The method of claim 1 wherein the diseased joint is a knee.
11. The method of claim 1 wherein the mechanical stimulation downregulates NGF signaling in the cartilage and subchondral bone of the joint.
12. The method of claim 1, further comprising the step of administering a specific inhibitor of eIF2a phosphatase.
13. The method of the preceding claim wherein the inhibitor is a salubrinal, or an analog or derivative thereof.
14. The method of the preceding claim wherein the salubrinal, or an analog or derivative thereof, is administered at between 2 μΜ and 50 μΜ.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361880422P | 2013-09-20 | 2013-09-20 | |
| US61/880,422 | 2013-09-20 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015042354A1 true WO2015042354A1 (en) | 2015-03-26 |
Family
ID=52689429
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/056483 Ceased WO2015042354A1 (en) | 2013-09-20 | 2014-09-19 | Mechanical bone loading to reduce arthritic pain |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015042354A1 (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040142345A1 (en) * | 2002-09-06 | 2004-07-22 | David Ron | Methods of screening test compounds using GADD34L, an eIF2alpha-specific phosphatase subunit |
| US20080294269A1 (en) * | 2005-06-14 | 2008-11-27 | Fell Barry M | System and Method for Joint Restoration by Extracapsular Means |
| WO2011002511A1 (en) * | 2009-06-30 | 2011-01-06 | Kensey Nash Corporation | Multi-phasic implant device for the repair or replacement of cartilage tissue |
| US20110224801A1 (en) * | 1999-04-06 | 2011-09-15 | Mansmann Kevin A | Semi-permeable membranes for use in surgical repairs |
-
2014
- 2014-09-19 WO PCT/US2014/056483 patent/WO2015042354A1/en not_active Ceased
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110224801A1 (en) * | 1999-04-06 | 2011-09-15 | Mansmann Kevin A | Semi-permeable membranes for use in surgical repairs |
| US20040142345A1 (en) * | 2002-09-06 | 2004-07-22 | David Ron | Methods of screening test compounds using GADD34L, an eIF2alpha-specific phosphatase subunit |
| US20080294269A1 (en) * | 2005-06-14 | 2008-11-27 | Fell Barry M | System and Method for Joint Restoration by Extracapsular Means |
| WO2011002511A1 (en) * | 2009-06-30 | 2011-01-06 | Kensey Nash Corporation | Multi-phasic implant device for the repair or replacement of cartilage tissue |
Non-Patent Citations (1)
| Title |
|---|
| SHIM ET AL.: "Rac1 Mediates Load-Driven Attenuation of mRNA Expression of Nerve Growth Factor Beta in Cartilage and Chondrocytes", J MUSCULOSKELET NEURONAL INTERACT., vol. 13, 5 September 2013 (2013-09-05), pages 372 - 379 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wood et al. | The genesis of pain in osteoarthritis: inflammation as a mediator of osteoarthritis pain | |
| Peng et al. | Irisin protects against neuronal injury induced by oxygen-glucose deprivation in part depends on the inhibition of ROS-NLRP3 inflammatory signaling pathway | |
| Lee et al. | A current review of molecular mechanisms regarding osteoarthritis and pain | |
| Zhang et al. | WNT signaling underlies the pathogenesis of neuropathic pain in rodents | |
| Zhang et al. | Osteoarthritis pain mechanisms: basic studies in animal models | |
| Omoigui | The biochemical origin of pain: the origin of all pain is inflammation and the inflammatory response. Part 2 of 3–inflammatory profile of pain syndromes | |
| Levy et al. | Mast cell degranulation activates a pain pathway underlying migraine headache | |
| Wang et al. | Dexmedetomidine prevents excessive γ-aminobutyric acid type A receptor function after anesthesia | |
| Mezzasoma et al. | Atrial natriuretic peptide down-regulates LPS/ATP-mediated IL-1β release by inhibiting NF-kB, NLRP3 inflammasome and caspase-1 activation in THP-1 cells | |
| Wang et al. | Prostaglandin E2 induces interleukin-6 expression in human chondrocytes via cAMP/protein kinase A-and phosphatidylinositol 3-kinase-dependent NF-κB activation | |
| Wang et al. | TGFβ1-modified MSC-derived exosome attenuates osteoarthritis by inhibiting PDGF-BB secretion and H-type vessel activity in the subchondral bone | |
| Svensson et al. | Spinal astrocytes in pain processing: non-neuronal cells as therapeutic targets | |
| Shirazi et al. | Involvement of central TRPV1 receptors in pentylenetetrazole and amygdala-induced kindling in male rats | |
| Ji et al. | Extracorporeal shockwave therapy as a novel and potential treatment for degenerative cartilage and bone disease: Osteoarthritis. A qualitative analysis of the literature | |
| Chen et al. | Chemokine CXCL10/CXCR3 signaling contributes to neuropathic pain in spinal cord and dorsal root ganglia after chronic constriction injury in rats | |
| Karagyaur et al. | Non-viral transfer of BDNF and uPA stimulates peripheral nerve regeneration | |
| KR20210050493A (en) | Methods of treatment of spinal cord injury | |
| Lin et al. | TNF promotes M1 polarization through mitochondrial metabolism in injured spinal cord | |
| Castelli et al. | Antagonism of the prokineticin system prevents and reverses allodynia and inflammation in a mouse model of diabetes | |
| JP2018521112A (en) | Use of PI4KIIIα protein and related membrane protein complexes in the treatment of Alzheimer's disease | |
| Zhou et al. | Largazole, an inhibitor of class I histone deacetylases, attenuates inflammatory corneal neovascularization | |
| Ding et al. | Electroacupuncture alleviates postoperative pain through inhibiting neuroinflammation via stimulator of interferon genes/type-1 interferon pathway | |
| US8372817B2 (en) | Small interfering RNA for gene knockdown of the subcutaneous N-methyl-D-aspartate receptor NR1 subunit, and it's application on pharmaceutics | |
| Wu et al. | Baicalin alleviates intervertebral disc degeneration by inhibiting the p38 MAPK signaling pathway | |
| WO2015042354A1 (en) | Mechanical bone loading to reduce arthritic pain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14845346 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14845346 Country of ref document: EP Kind code of ref document: A1 |