WO2015042308A2 - Rna-based hiv inhibitors - Google Patents

Rna-based hiv inhibitors Download PDF

Info

Publication number
WO2015042308A2
WO2015042308A2 PCT/US2014/056384 US2014056384W WO2015042308A2 WO 2015042308 A2 WO2015042308 A2 WO 2015042308A2 US 2014056384 W US2014056384 W US 2014056384W WO 2015042308 A2 WO2015042308 A2 WO 2015042308A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
sirna
nucleic acid
antiviral
recombinant nucleic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/056384
Other languages
French (fr)
Other versions
WO2015042308A3 (en
Inventor
John Rossi
John DIGIUSTO
Janet Chung
Lisa Scherer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
City of Hope
Original Assignee
City of Hope
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by City of Hope filed Critical City of Hope
Publication of WO2015042308A2 publication Critical patent/WO2015042308A2/en
Publication of WO2015042308A3 publication Critical patent/WO2015042308A3/en
Priority to US15/073,481 priority Critical patent/US20160289681A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/13Decoys
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/51Physical structure in polymeric form, e.g. multimers, concatemers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/50Biochemical production, i.e. in a transformed host cell
    • C12N2330/51Specially adapted vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/20Vector systems having a special element relevant for transcription transcription of more than one cistron
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/20Vector systems having a special element relevant for transcription transcription of more than one cistron
    • C12N2830/205Vector systems having a special element relevant for transcription transcription of more than one cistron bidirectional
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron

Definitions

  • HIV gene expression is a highly regulated process that involves alternative splicing from the full-length 9-kb RNA genome to generate various viral proteins.
  • transcription elongation is inefficient despite having a functional viral promoter, resulting in short or early terminated transcripts until the early regulatory protein Tat is made.
  • Tat functions to vastly increase transcription through the transactivation of RNA Pol II polymerase from the viral promoter (Garber, M.E., and Jones, K.A., Curr Opin Immunol, 1 1, 460-465 (1999); Kao, S.Y.
  • Rev. Rev facilitates the export of partially spliced and unspliced transcripts to the cytoplasm for translation into late structural proteins by interactions with the Rev response element (RRE) present on these transcripts (Cullen, B.R., and Malim, M.H., Trends Biochem Sci, 16, 346-350 (1991); Felber, B.K. et al, Proc Natl Acad Sci USA, 86, 1495-1499 (1989); Krug, R.M., Curr Opin Cell Biol, 5, 944-949 (1993)).
  • RRE Rev response element
  • Tat and Rev exhibit nucleolar-localizing properties with poorly understood functions, hypothesized as part of the transport mechanism or temporal storage [Tat (Li, Y.P., J Virol, 71, 4098-4102 (1997); Luznik, L. et al, J Clin Invest., 95, 328-332 (1995); Ruben, S. et al, J Virol, 63, 1-8 (1989); Siomi, H. et al, J Virol, 64, 1803-1807 (1990);
  • nucleolus during viral replication could be more universal as transcription and replication of Borna disease virus (a negative strand RNA virus) occurs in the nucleolus (Pyper, J.M., Clements, J.E., and Zink, M.C., J Virol, 72, 7697-7702 (1998)).
  • env RNAs from the human T-lymphotropic virus were also detected in the nucleolus (Kalland, K.H. Qt al, New Biol, 3, 389-397 (1991)).
  • nucleolar-localizing TAR and RBE RNA decoys (U16TAR and U16RBE, respectively) that function to trap HIV-1 Tat and Rev proteins inside the nucleolus, and a RNA ribozyme that targets a conserved U5 region of HIV-1 RNA (U16U5RZ) were created by substituting these anti-HIV small RNAs for the apical loop of the C/D box U16 small nucleolar RNA (snoRNA) (Fig. 1).
  • the U16 chimeric RNAs were shown to localize in the nucleolus and each was shown to have strong anti-HIV- 1 activity (Michienzi, A.
  • nucleolar trapping could be a novel avenue for developing anti-HIV therapeutics and support the important functional role of Tat and Rev nucleolar localization in viral replication (Michienzi, A. et al, Proc Natl Acad Sci USA, 99, 14047-14052 (2002)).
  • RNAs small interfering RNAs
  • SI common tat/rev exon
  • S2M rev
  • S3B tat
  • siRNAs are an approach to mitigating viral escape mutants found with a single point mutation in the siRNA target site (Boden, D. et al, J Virol, 77, 1 1531-1 1535 (2003); Das, A.T. et al, J Virol, 78, 2601-2605 (2004); Sabariegos, R. et al, J Virol, 80, 571-577 (2006)), Applicants believe that it is also advantageous to explore the potential for combining different types of small RNA inhibitors to further reduced the likelihood of viral resistance and to exploit the potential synergy between small RNA agents within a single gene therapy construct (Li, M.J., Mol Ther., 8, 196-206
  • the MCM7 platform offers additional advantages and flexibility over multiple small RNA agents expressed with constitutive independent Pol III promoters (e.g., (Li, M.J., Mol Ther., 8, 196-206 (2003))by offering opportunities to engineer tissue specificity by proper promoter choice while reducing toxicity related to over-expression.
  • constitutive independent Pol III promoters e.g., (Li, M.J., Mol Ther., 8, 196-206 (2003)
  • RNA decoy by replacing the S3B subunit as shown by the MCM7-S 1/S2M/U 16TAR construct (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)).
  • the processing ofU16TAR was shown to be independent of Drosha, implicating that the snoRNA was processed independently of the siRNAs via the C/D box small nucleolar ribonucleoprotein (snoRNP) processing pathway (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)).
  • snoRNP small nucleolar ribonucleoprotein
  • RNAs can also be incorporated in this platform where they are effectively processed along with the siRNAs to provide a combinatorial, long-term inhibition of HIV-1 replication in CEM T-lymphocytes.
  • the combinations of si/sno RNAs represent a new paradigm for combinatorial RNA-based gene therapy applications.
  • a recombinant nucleic acid encoding an antiviral polycistronic RNA includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter.
  • a recombinant nucleic acid encoding an antiviral polycistronic RNA includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
  • a mammalian cell including a recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • kits including a recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • compositions including a pharmaceutically acceptable excipient and a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof is provided.
  • a method of treating an infectious disease in a subject in need thereof includes administering to the subject a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof.
  • a method of inhibiting HIV replication in a patient includes administering to the patient a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient.
  • Fig. 1 Construction of small nucleolar anti-HIV RNAs.
  • the C/D box U16 small nucleolar RNA (snoRNA) is used as a scaffold to construct nucleolar-localizing anti-HIV small RNAs.
  • the conserved C/D box of the U16 snoRNA is sufficient for the nucleolar-localizing property with the apical loop replaced with various anti-HIV RNAs including the U5 targeting RNA ribozymes (U 16U5RZ), the Rev binding element RNA decoy (U 16RBE), and the transactivation response RNA decoy (U16TAR).
  • U16U5RZ SEQ ID NO:21
  • U16RBE SEQ ID NO:20
  • U16TAR SEQ ID NO:22.
  • Fig. 2 Overiew of MCM7 intron-based lentiviral vectors.
  • MCM7 refers to a naturally occurring polycistronic miRNA cluster located in an intron of the MCM7 gene. Exons and intron of the MCM7 cassette are drawn as grey boxes and black lines, respectively, with splice donor and acceptors marked as "SD" and "SA”. Promoters are denoted by white boxes with the arrow indicating directionality, while the terminators are denoted by black boxes.
  • shRNA, U16 snoRNA scaffold, and apical loop anti-HIV RNA insert are shown, (a) The MCM7 scaffold allows co-expression of three small RNAs from the single Pol II Ul promoter. SI, S2M, and S3B represent siRNAs targeting the common tat/rev exon, rev, and tat, respectively.
  • U16U5RZ is a nucleolar-localizing ribozyme targeting a conserved U5 region present in all HIV transcripts.
  • U16TAR is a nucleolar-localizing TAR RNA decoy.
  • U16RBE is a nucleolar- localizing Rev binding element RNA decoy.
  • CEM T-lymphocytes were transduced with lentiviruses containing MCM7 cassette in the forward orientation at an MOI of 50. About 20 ⁇ g of total RNA were loaded per lane and electrophoresed in an 8% polyacrylamide gel with 8M urea, blotted onto a nylon membrane, and hybridized with the corresponding 32 P-labelled probes. RNA prepared from untransduced cells and cells transduced with empty vector were used as negative controls. SI, S2M, and S3B siRNAs are approximately 21 nucleotides. The U16 snoRNA chimeras are approximately 132 nucleotides. U6 small nuclear RNA serves as a loading control.
  • Fig. 4 Anti-HIV activity of MCM7-based constructs.
  • One million untransduced and stable CEM T-lymphocytes were challenged in triplicate with NL4-3 strain of HIV- 1 at an MOI of 0.01 and culture supernatants were collected weekly for the HIV-1 p24 antigen ELISA to evaluate viral replication.
  • the dashed line represents the low detection limit of the p24 assay.
  • Three constructs, MCM7-S1/S2M/S3B, MCM7-S 1/S2M/U 16TAR, and MCM7- S1/U16U5RZ/U16TAR showed potent antiviral activity with almost no detectable viral load during the one-month challenge assay.
  • Fig. 5 In vitro viral mediated selection of transduced CEM T-lym hocytes with optimal anti-HIV gene expression, (a) Total RNA was extracted from CEM T-lymphocytes infected with HIV-1 at designated time points (DO, D14, and D28) to evaluate RNA expression. The SI siRNA expression was evaluated by qRT-PCR and normalized by the internal control U6 small nuclear RNA. (b) Total RNA was extracted from CEM T-lymphocytes infected with HTV- 1 at designated time points (DO, D14, and D28) to evaluate RNA expression. The U16 TAR RNA decoy expression was evaluated by qRT-PCR and normalized by the internal control U6 small nuclear RNA. p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, difference compared to uninfected control (DO).
  • Fig. 6 Anti-HIV RNA expression correlates with HIV-1 pNL4-3 luciferase knockdown activity.
  • the pNL4-3 luciferase construct maintains targets for each of the small RNAs in all the transcripts, both spliced and unspliced and therefore luciferase readouts can be utilized as quantitative readouts of viral inhibition.
  • Firefly luciferase output was normalized to the internal control Renilla luciferase to account for differences in transfection efficiency. Data presented consist of two independent experiments. **p ⁇ 0.01.
  • HEK293 cells were transiently transfected at 90% confluency in 6-well plate with 0.334 pmole of either the MCM7 cassette containing three snoRNAs or single snoRNA expressed with U6 promoter (pTZ/U6-U16RBE, pHIV7-U6- U16U5RZ, or pTZ/U6-U16TAR), or their combinations, in total mass of 4 ⁇ g with pBluescript plasmid, complexed with Lipofectamine 2000 (Invitrogen). Total RNA was extracted 48 hours later with STAT-60 reagent according to manufacturer's instructions. About 10 ⁇ g of total RNA were loaded per lane and RNA was detected with 32 P-labelled probes as described in Material and Methods.
  • HEK 293 cells were transiently transfected with constructs carrying the RNA cassettes and total RNA extracted 48 hours post transfection.
  • RNA was loaded per lane and electrophoresed in an 8% polyacrylamide gel with 8 M urea, blotted onto a nylon membrane, and hybridized with the corresponding 32 P-labeled probes.
  • the expression cassette can produce mature siRNA sequences that are approximately 21 nucleotides.
  • U2A small nuclear RNA serves as a loading control. In all cases, cassette in reverse orientation consistently gives more transgene expression.
  • Fig. 9 Psi-check assay to monitor down-regulation of CCR5 and HIV UTR targets.
  • the target sequence is cloned in the 3' UTR of the reporter Renilla luciferase gene and the fusion transcript is subject to gene silencing by RNA interference.
  • the firefly luciferase reporter serves as a mean to normalize for differences in transfection efficiency.
  • the ratio of Renilla and firefly luciferase expression provides a measure of gene silencing.
  • bifunctionality siRNAs expressed as a pre-miRNA or as a shRNA are both capable of mediating HIV and CCR5 target knockdown.
  • Fig. 10 Effect of mature siRNA sequences and CCR5 surface expression.
  • Applicants utilized the U373-MAGI-CCR5E cell line (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH and as published in Vodicka M.A., Virology, 233: 193- 198, (1997)) that over-expresses CCR5 and transiently transfected Applicants' constructs to monitor (A) CCR5 expression and (B) CD4 expression by flow cytometry. Specific decrease in CCR5 expression was only observed with cells transfected with tRNASer-CCR5-12sh cassette. [0024] Fig. 11. Northern analysis of anti-HIV small RNA expression in stably transduced CEM T lymphocytes.
  • RNA prepared from untransduced cells and cells transduced with empty vector were used as negative controls.
  • SI, S2M, S3B, and CCR5-12sh siRNAs are approximately 21 -nt.
  • the Ul 6 snoRNA chimeras are 132-nt.
  • the small nuclear U2A RNA served as a loading control.
  • Northern analysis is shown in the left panel, loading scheme is shown in the right panel. [0025] Fig. 12. Anti-HIV activity of MCM7-based constructs.
  • Second generation MCM7 -based constructs potently inhibited viral replication with 3 to 5-log reduction of p24 production during the 42-day viral challenge.
  • Fig. 13 Overview of strategies to multiplex small RNAs with different classes of promoters, a) pHIV7 lentiviral with MGMT P140K selectable marker (pLV). Applicants utilized a third generation HIV-1 based lentiviral vector (pHIV7) with EGFP marker to label gene modified cells. The chemical resistance MGMT P140K gene is co-expressed with EGFP with a self-cleaving P2A peptide with the CMV promoter, b) First generation lentiviral vector (FGLV) with small RNAs expressed from independent RNA Pol III promoters.
  • pLV pHIV7 lentiviral with MGMT P140K selectable marker
  • pHIV7 third generation HIV-1 based lentiviral vector
  • FGLV First generation lentiviral vector
  • each antiviral small RNA transgene is expressed independently from RNA Pol III promoter
  • the naturally occurring miRNA cluster in the intron of the human MCM7 gene was engineered to co-express different classes of antiviral small RNAs with single Pol II Ul promoter for ubiquitous transgene expression in all hematopoietic lineages.
  • Independent Pol III RNA cassettes can be incorporated for expression of up to five small RNAs.
  • the tRNA Ser -CCR5sh cassette was incorporated into the 3 ' intron of MCM7 in both orientations ("F" Forward and "R” Reverse) with respect to the parental Ul promoter.
  • the U6-U16TAR cassette was cloned downstream of the Ul termination signal.
  • Promoters CMV, cytomegalovirus promoter and enhancer sequence (Pol II); U6, human small nuclear U6 promoter (Pol III); VA1, adenoviral promoter (Pol III); Ul, human small nuclear Ul promoter (Pol II); tRNA Ser , human transfer RNA Serine promoter (Pol III).
  • Small RNA trans genes SI, tat/rev siRNA; S2M; rev siRNA; S3B tat siRNA; CCR5sh, CCR5- targeting shRNA; U16TAR, nucleolar TAR RNA decoy; U16U5RZ, nucleolar U5-targeting ribozyme; CCR5RZ, CCR5 -targeting ribozyme.
  • Fig. 14 Biological activity of tRNA Ser -CCR5sh cassette, a) Potent CCR5 knockdown in U373-MAGI-CCR5E cells. Plasmid with only the tRNA Ser promoter sequence (solid black line) or with the tRNA Ser -CCR5sh cassette (dashed grey line) was transiently transfected into CCR5 over-expressing U373-MAGI-CCR5E cells with knockdown estimated by flow cytometry 72 hours later. Potent and specific down-regulation of CCR5 surface expression was only observed with the construct containing the CCR5sh RNA. b) Potent CCR5 transcript degradation in CD34-derived macrophages.
  • Fig. 15 Optimization of the tRNA Ser -CCR5sh cassette expression in the MCM7 platform, a) Orientation dependence of the tRNA Ser -CCR5sh cassette in MCM7.
  • the tRNA Ser - CCR5sh cassette was cloned in 3 ' intron of MCM7 either in the forward (SGLV3) or reverse (SGLV4) orientation, then transiently transfected into HEK 293 cells to evaluate transgene expression and processing by Northern blotting.
  • Northern blotting distinguishes products in various steps of processing due to difference in size [tRNA Ser -CCR5sh fusion transcript (-130- 140 nt) that requires tRNase Z processing; shRNA ( ⁇ 50-60nt) that requires Dicer processing; siRNA (20-23 nt) represents the completely processed mature siRNA that is capable of mediating silencing].
  • the probe detected the guide strand that mediates CCR5 silencing.
  • Northern blotting demonstrated tRNA Ser -shRNA cassette is efficiently processed by the RNA interference pathway as the mature siRNA is the predominate product.
  • SGLV4 gives 2.4-fold enhancement in transgene expression in comparison with the opposite orientation after normalization with the loading control U2A RNA.
  • tRNA Ser -CCR5sh cassette Placement dependence of the tRNA Ser -CCR5sh cassette. Placement of tRNA Ser -CCR5sh cassette in the lentiviral vector dramatically affects transgene expression in sorted stably expressing CEM T lymphocytes. Although the CCR5sh cassette is driven independently from the tRNA Ser promoter, the expression was much lower in the context of MCM7 platform ("inside of MCM7”) compared to as a separate entity (“outside MCM7"). In the latter scenario, over-expression is evident by the presence of unprocessed products (i.e., bands representing tRNA Ser -CCR5sh fusion transcript and shRNA).
  • Fig. 16 Northern blot of stably expressing CEM T lymphocytes demonstrates efficient processing and expression of small RNAs.
  • CEM T lymphocytes were transduced with indicated lentiviruses carrying the combinational vectors then sorted by EGFP expression to create stably expressing cell lines.
  • Small RNA transgenes were detected by P 32 labeled probes.
  • U2A small nuclear RNA serves as a loading control.
  • S I, S2M, S3B, CCR5sh represent 20-23 nt fully processed siRNAs.
  • U16U5RZ and U16TAR are U16 snoRNA chimeras that are approximately 132 nucleotides.
  • CCR5RZ is approximately 230 nucleotides.
  • Intracellular staining showed a high degree of infection in unprotected macrophages, with some constructs with intermediate protection while differentiating some with excellent protection.
  • Fig. 18 Kinetics of R5 tropic HIV-1 Bal infection in adult CD34+ HSPC derived macrophages monitored by intracellular HIV staining. Kinetics of HIV- 1 Bal infection in macrophages differentiated from gene modified HSPCs were followed by intracellular HIV staining for a total of 42 days to evaluate long term protection and viral breakthrough. Over-expression of therapeutic small RNAs with independent Pol III promoters (FGLV) provided potent protection for up to 28 days but eventual breakthrough. In the long term, SGLV2 provided the longest protection with the incorporation of tRNA Ser -CCR5sh (SGLV4) and U6-U16TAR (SGLV7) cassettes less optimal.
  • FGLV therapeutic small RNAs with independent Pol III promoters
  • Fig. 19 In vitro CFU assay to identify potential vector toxicity on hematopoietic potential. Transduced CD34+ HSPCs were sorted on CD34+/EGFP expression after expansion with SRI . A total of 500 sorted cells per sample were plated on methylcellulose medium in triplicate with number of colonies counted 12 to 13 days later. The absolute number of CFUs was normalized to the respective donor to account for differences in hematopoietic potential in donor viability. Result represented data from at least two independent donors and significant results were shown. * p ⁇ 0.05, *** p ⁇ 0.001, **** p ⁇ 0.0001.
  • Fig. 20 In vivo drug selection enhances the frequency of gene modified cells in the bone marrow and spleen of humanized NSG mice expressing MGMT P140K . Analysis of NSG mice transplanted with gene modified HSPCs expressing MGMT P140K and treated with two or three doses of 0 6 -BG/BCNU as described in text.
  • Fig. 21 Serum viremia in mice infected with HIV-lBai- Mice were transplanted with CD34+ HSPC transduced as described in text and infected with HIV-lBal at 11 weeks after transplant.
  • Fig. 22 Levels of engraftment of cells following HIV challenge of humanized NSG mice.
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, or complements thereof.
  • polynucleotide refers to a linear sequence of nucleotides.
  • nucleotide typically refers to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof.
  • polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including siRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA.
  • the terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, and 2- O-methyl ribonucleotides.
  • complementarity refers to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide.
  • sequence A-G-T is complementary to the sequence T-C-A.
  • Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are near each other, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
  • the term "gene” means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene. Further, a “protein gene product” is a protein expressed from a particular gene. [0044]
  • the terms "transfection”, “transduction”, “transfecting” or “transducing” can be used interchangeably and are defined as a process of introducing a nucleic acid molecule or a protein to a cell. Nucleic acids are introduced to a cell using non-viral or viral-based methods.
  • the nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof.
  • Non-viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell.
  • Exemplary non- viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation.
  • the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art.
  • any useful viral vector may be used in the methods described herein.
  • viral vectors examples include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
  • the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art.
  • the terms "transfection” or “transduction” also refer to introducing proteins into a cell from the external environment. Typically, transduction or transfection of a protein relies on attachment of a peptide or protein capable of crossing the cell membrane to the protein of interest. See, e.g., Ford et al. (2001) Gene Therapy 8: 1-4 and Prochiantz (2007) Nat. Methods 4: 119-20.
  • the word "expression” or “expressed” as used herein in reference to a gene means the transcriptional and/or translational product of that gene.
  • the level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell.
  • the level of expression of non-coding nucleic acid molecules e.g., siRNA
  • transfected gene can occur transiently or stably in a cell.
  • transient expression the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time.
  • stable expression of a transfected gene can occur when the gene is co- transfected with another gene that confers a selection advantage to the transfected cell.
  • selection advantage may be a resistance towards a certain toxin that is presented to the cell.
  • Expression of a transfected gene can further be accomplished by transposon-mediated insertion into to the host genome.
  • the gene is positioned in a predictable manner between two transposon linker sequences that allow insertion into the host genome as well as subsequent excision. Stable expression of a transfected gene can further be accomplished by infecting a cell with a lentiviral vector, which after infection forms part of (integrates into) the cellular genome thereby resulting in stable expression of the gene.
  • plasmid refers to a nucleic acid molecule that encodes for genes and/or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, the gene and the regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids.
  • promoter or "regulatory element” refers to a region or sequence
  • Promoters need not be of viral origin, for example, mammalian cellular promoters, such as the polymerase II promoter Ul and polymerase III promoter tRNA Ser may be used in the present invention.
  • a "siRNA,” “small interfering RNA,” “small RNA,” or “RNAi” as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when expressed in the same cell as the gene or target gene.
  • the complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity.
  • a siRNA or RNAi refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA.
  • the siRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA.
  • the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length).
  • the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
  • siRNAs include ribozymes, RNA decoys, short hairpin RNAs (shRNA), micro RNAs (miRNA) and small nucleolar RNAs (snoRNA).
  • antiviral RNA refers to an RNA that is capable of inhibiting the activity (e.g., transcription, translation, replication, infectivity) of a virus.
  • the antiviral RNA binds to a target viral nucleic and reduces transcription of the target viral nucleic acid or reduces the translation of the target viral nucleic acid (e.g.mRNA) or alters transcript splicing.
  • the antiviral RNA is a nucleic acid that is capable of binding (e.g. hybridizing) to a target viral nucleic acid (e.g. an Rev RNA) and reducing translation of the target viral nucleic acid.
  • the target viral nucleic acid is or includes one or more target nucleic acid sequences to which the antiviral RNA binds (e.g. hybridizes).
  • the antiviral RNA is or includes a sequence that is capable of hybridizing to at least a portion of a target viral nucleic acid at a target viral nucleic acid sequence.
  • Non-limiting examples of an antiviral RNA include siRNAs, ribozymes, RNA decoys, snoRNAs and shRNAs.
  • a "polycistronic RNA” as provided herein refers to an RNA sequence including more than one (e.g., 2, 3, 4, 5, 6, 7) open reading frame (nucleic acid sequence encoding a polypeptide or an antiviral RNA).
  • a polycistronic RNA as provided herein may include one promoter controlling the expression of all open reading frames encoded by the polycistronic RNA.
  • the polycistronic RNA includes more than one promoter and one or more of the open reading frames included in the polycistronic RNA are expressed by an independent promoter.
  • recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
  • Transgenic cells and plants are those that express a heterologous gene or coding sequence, typically as a result of recombinant methods.
  • exogenous refers to a molecule or substance (e.g., a compound, nucleic acid or protein) that originates from outside a given cell or organism.
  • an "exogenous promoter” as referred to herein is a promoter that does not originate from the plant it is expressed by.
  • endogenous or endogenous promoter refers to a molecule or substance that is native to, or originates within, a given cell or organism.
  • nucleic acid or protein when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid
  • protein that is the predominant species present in a preparation is substantially purified.
  • protein peptide
  • polypeptide are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium.
  • Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • non-naturally occurring amino acid and “unnatural amino acid” refer to amino acid analogs, synthetic amino acids, and amino acid mimetics which are not found in nature.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical
  • Constantly modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site
  • substantially identical This definition also refers to, or may be applied to, the compliment of a test sequence.
  • the definition also includes sequences that have deletions and/or additions, as well as those that have substitutions.
  • the preferred algorithms can account for gaps and the like.
  • identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
  • the named protein includes any of the protein's naturally occurring forms, or variants or homologs that maintain the protein transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein).
  • variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form.
  • the protein is the protein as identified by its NCBI sequence reference. In other embodiments, the protein is the protein as identified by its NCBI sequence reference or functional fragment or homolog thereof.
  • a "MCM7 gene" as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding DNA replication licensing factor MCM7 or variants or homologs thereof that maintain MCM7 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MCM7).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MCM7 polypeptide.
  • the MCM7 gene is substantially identical to the nucleic acid identified by the NCBI reference number Gene ID: 4176 or a variant or homolog having substantial identity thereto.
  • CXCR4" or CXCR4 gene as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the C-X-C chemokine receptor type 4 or variants or homologs thereof that maintain CXCR4 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CXCR4).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g.
  • the CXCR4 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 56790928 or a variant or homolog having substantial identity thereto.
  • CCR5 or CCR5 gene as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the C-C chemokine receptor type 5 or variants or homologs thereof that maintain CCR5 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CCR5).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CCR5 polypeptide.
  • the CCR5 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 154091327 or a variant or homolog having substantial identity thereto.
  • TNP03 or "TNP03 gene” as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the transportin-3 protein or variants or homologs thereof that maintain TNP03 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to TNP03).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring TNP03 polypeptide.
  • the TNP03 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 300934784 or a variant or homolog having substantial identity thereto.
  • Tat or "Tat gene” as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding the HIV-1 trans-activator of transcription or variants or homologs thereof that maintain Tat protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Tat).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Tat polypeptide.
  • the Tat gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 1229009 or a variant or homolog having substantial identity thereto.
  • "Rev” or "Rev gene” as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding the regulator of expression of virion proteins or variants or homologs thereof that maintain Rev protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Rev).
  • the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g.
  • the Rev gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 9629359 or a variant or homolog having substantial identity thereto.
  • a "Rev M10 protein” as referred to herein is a dominant negative mutant of a Rev protein or homolog thereof.
  • the Rev M10 protein is substantially identical to the protein identified by the NCBI reference number ID 238635393.
  • sample includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes.
  • Such samples include blood and blood fractions or products (e.g., bone marrow, serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, other biological fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc.
  • blood and blood fractions or products e.g., bone marrow, serum, plasma, platelets, red blood cells, and the like
  • sputum tissue
  • cultured cells e.g., primary cultures, explants, and transformed cells
  • stool e.g., urine
  • other biological fluids e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like
  • a sample is typically obtained from a "subject" such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
  • a subject such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish.
  • the sample is obtained from a human.
  • a "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample.
  • a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control).
  • a control can also represent an average value gathered from a number of tests or results.
  • controls can be designed for assessment of any number of parameters.
  • a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects).
  • pharmacological data e.g., half-life
  • therapeutic measures e.g., comparison of side effects
  • controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.
  • infectious disease refers to a disease or condition related to the presence of an organism (the agent or infectious agent) within or contacting the subject or patient. Examples include a bacterium, fungus, virus, or other microorganism.
  • a "bacterial infectious disease” is an infectious disease wherein the organism is a bacterium.
  • a "viral infectious disease” is an infectious disease wherein the organism is a virus.
  • associated means that the disease (e.g. HIV infection) is caused by, or a symptom of the disease is caused by, or a symptom of the disease is caused by a virus (e.g., HIV).
  • a disease e.g. an infectious disease
  • the disease e.g. HIV infection
  • a virus e.g., HIV
  • treatment or “treating,” or “palliating” or “ameliorating” are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit.
  • therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated.
  • a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder.
  • the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
  • Treatment includes preventing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition prior to the induction of the disease; suppressing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition after the inductive event but prior to the clinical appearance or reappearance of the disease; inhibiting the disease, that is, arresting the development of clinical symptoms by administration of a protective composition after their initial appearance; preventing re-occurring of the disease and/or relieving the disease, that is, causing the regression of clinical symptoms by administration of a protective composition after their initial appearance.
  • the terms "prevent,” “preventing” or “prevention,” and other grammatical equivalents as used herein, include to keep from developing, occur, hinder or avert a disease or condition symptoms as well as to decrease the occurrence of symptoms.
  • the prevention may be complete (i.e., no detectable symptoms) or partial, so that fewer symptoms are observed than would likely occur absent treatment.
  • the terms further include a prophylactic benefit.
  • the compositions may be administered to a patient at risk of developing a particular disease (e.g. hematological disease), or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
  • the agents described herein may be administered in combination as simple mixtures as well as chemical hybrids.
  • An example of the latter is where the agent is covalently linked to a targeting carrier or to an active pharmaceutical.
  • Covalent binding can be accomplished in many ways, such as, though not limited to, the use of a commercially available cross-linking agent.
  • an "effective amount” is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, reduce one or more symptoms of a disease or condition, reduce viral replication in a cell).
  • An example of an "effective amount” is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a
  • a “reduction” of a symptom or symptoms means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s).
  • a “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms.
  • the full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses.
  • a prophylactically effective amount may be administered in one or more administrations.
  • An “activity decreasing amount,” as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme or protein (e.g. Tat, Rev) relative to the absence of the antagonist.
  • a “function disrupting amount,” as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols.
  • Patient or “subject in need thereof refers to a living organism suffering from or prone to a disease or condition that can be treated by using the methods provided herein.
  • the term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision.
  • Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals.
  • a patient is human.
  • Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including
  • the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture.
  • Contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a recombinant viral particle as described herein and a cell.
  • the term "inhibition”, “inhibit”, “inhibiting” and the like in reference to an siRNA or protein-inhibitor interaction means negatively affecting (e.g., decreasing) the activity or function of the protein (e.g.
  • inhibition refers to reduction of a disease or symptoms of disease (e.g., HIV infection). In embodiments, inhibition refers to a reduction in the activity of a signal transduction pathway or signaling pathway (e.g. reduction of viral replication). Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating transcription, translation, signal transduction or enzymatic activity or the amount of a protein (e.g. a viral protein or a cellular protein). In embodiments, inhibition refers to inhibition of Tat. In embodiments, inhibition refers to inhibition of Rev. In embodiments, inhibition refers to inhibition of CCR5. In embodiments, inhibition refers to inhibition of CXCR4.
  • inhibitor refers to a substance that results in a detectably lower expression or activity level as compared to a control.
  • the inhibited expression or activity can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less than that in a control. In certain instances, the inhibition is 1.5-fold, 2-fold, 3- fold, 4-fold, 5-fold, 10-fold, or more in comparison to a control.
  • an “inhibitor” is a siRNA, (e.g., shRNA, miRNA, snoRNA, RNA decoy, ribozyme), compound or small molecule that inhibits viral infection (e.g., replication) e.g., by binding, partially or totally blocking stimulation, decrease, prevent, or delay activation, or inactivate, desensitize, or down-regulate signal transduction, gene expression or enzymatic activity necessary for protein activity.
  • Inhibition as provided herein may also include decreasing or blocking a protein activity (e.g., activation of viral transcription) by expressing a mutant form of said protein thereby decreasing or blocking its activity.
  • “Pharmaceutically acceptable excipient” and “pharmaceutically acceptable carrier” refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present invention without causing a significant adverse toxicological effect on the patient.
  • Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like.
  • Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention.
  • auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents
  • salts refers to salts derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like.
  • preparation is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
  • administering means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject.
  • a slow-release device e.g., a mini-osmotic pump
  • Parenteral administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal).
  • Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial.
  • Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
  • co-administer it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies, for example cancer therapies such as chemotherapy, hormonal therapy, radiotherapy, or immunotherapy.
  • compositions of the present invention can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
  • aberrant refers to different from normal. When used to described enzymatic activity, aberrant refers to activity that is greater or less than a normal control or the average of normal non-diseased control samples. Aberrant activity may refer to an amount of activity that results in a disease, wherein returning the aberrant activity to a normal or non-disease-associated amount (e.g. by using a method as described herein), results in reduction of the disease or one or more disease symptoms.
  • antiviral recombinant nucleic acid compositions include nucleic acids encoding antiviral polycistronic RNAs, which are capable of inhibiting the activity of viral proteins (e.g., Tat, Rev) as well as the expression of cellular proteins (e.g., CCR5) utilized by the virus during its lifecycle.
  • the antiviral recombinant nucleic acid compositions provided herein are therefore particularly useful for therapeutic applications such as combinational HIV-1 gene therapy.
  • the recombinant nucleic acids provided herein may encode a plurality of antiviral RNAs (e.g., siRNA, miRNA, shRNA, snoRNA).
  • a recombinant nucleic acid encoding an antiviral polycistronic RNA is provided.
  • the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter.
  • RNA promoter refers to a nucleic acid sequence located upstream or downstream from the start of transcription of an RNA (e.g., siRNA, miRNA, shRNA, snoRNA).
  • the RNA promoter provided herein may be a forward promoter or a reverse promoter. Where the RNA promoter is a forward promoter, the RNA polymerase synthesizes RNA from said promoter using the DNA antisense strand as template. Where the RNA promoter is a reverse promoter, the RNA polymerase synthesizes RNA using the DNA sense strand as template.
  • the DNA sense strand corresponds to the mRNA strand or coding strand
  • the DNA antisense strand corresponds to the non-coding strand, which is complementary to the mRNA.
  • the RNA promoter is involved in recognition and binding of RNA polymerase and other proteins to initiate transcription of the RNA.
  • the RNA promoters contemplated for the present invention including embodiments thereof may be polymerase II or polymerase III promoters.
  • RNA promoters include polymerase II promoters such as the Ul promoter, the human elongation factor- 1 alpha (EF-1 alpha) promoter, the cytomegalovirus (CMV) promoter, the human ubiquitin promoter, and the spleen focus- forming virus (SFFV) promoter; and the polymerase III promoters such as the U6 promoter, the HI promoter, the tRNA Lys promoter, the tRNA Ser promoter and the tRNA ⁇ 8 promoter.
  • the first RNA promoter is an RNA polymerase II promoter.
  • the RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a U 1 promoter.
  • the recombinant nucleic acid further includes a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein the second RNA promoter is a reverse promoter.
  • the second RNA promoter is downstream of the third antiviral RNA encoding sequence.
  • the second RNA promoter is a polymerase III promoter.
  • the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a U6 promoter.
  • a viral entry inhibiting RNA encoding sequence as provided herein refers to a nucleic acid, which upon expression in a cell inhibits entry of a virus (e.g., HIV) into the cell.
  • the viral entry inhibiting RNA may be a siRNA or a protein encoding RNA.
  • the viral entry inhibiting RNA encoding sequence encodes a siRNA.
  • the viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
  • the cellular receptor siRNA is a T cell receptor siRNA.
  • the T cell receptor siRNA is a small hairpin (sh) RNA.
  • the shRNA is a CCR5 shRNA.
  • the shRNA is a CXCR4 shRNA.
  • the viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
  • the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • TNP03 transportin 3
  • the recombinant nucleic acid provided herein may form part of a viral expression vector.
  • a "viral vector” or “viral expression vector” is a viral-derived nucleic acid that is capable of transporting another nucleic acid into a cell.
  • a viral vector is capable of directing expression (i.e. transcription and/or translation) of an RNA, a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment.
  • a viral expression vector may include a viral expression vector promoter (e.g., LTR) controlling transcription of an RNA, a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors.
  • the viral expression vector provided herein may include nucleic acid sequences encoding for a selectable marker protein (e.g., the human methylguanine methyltransferase mutant P I 40K/MGMT) to select for cells including the viral expression vector.
  • a selectable marker protein e.g., the human methylguanine methyltransferase mutant P I 40K/MGMT
  • the viral expression vector may include nucleic acid sequences encoding for an antiviral protein (e.g., C46 fusion inhibitor, Rev M10 protein).
  • the viral expression vector may further include regulatory sequences necessary to express the selectable marker and/or the antiviral protein.
  • the promoter controlling expression of the selectable marker protein and the antiviral protein is referred to herein as "protein promoter.”
  • the viral expression marker includes a protein promoter.
  • the protein promoter is a polymerase II promoter.
  • the first RNA promoter may be a forward promoter.
  • the recombinant nucleic acid provided herein including embodiments thereof may form part of a viral expression vector.
  • the first RNA promoter has the same transcriptional direction (direction of mRNA synthesis) as the protein promoter or the viral expression vector promoter.
  • the polymerase synthesizing (transcribing) mRNA from those promoters uses the same template strand (e.g., sense or antisense).
  • the antiviral RNA encoding sequences operably linked to (transcriptionally controlled by) the first RNA promoter are transcribed in the same direction as the genes operably linked to (transcriptionally controlled by) the protein promoter or the viral expression vector promoter, when the first RNA promoter is a forward promoter.
  • the recombinant nucleic acid provided herein including embodiments thereof may further include a second RNA promoter, which promoter may be a reverse promoter.
  • the second RNA promoter has the opposite transcriptional direction relative to the first RNA promoter.
  • the second RNA promoter may have the opposite transcriptional direction relative to the protein promoter or to the viral expression vector promoter, when the second RNA promoter is a reverse promoter.
  • the viral entry inhibiting RNA encoding sequence operably linked to (transcriptionally controlled by) the second RNA promoter is transcribed in the opposite direction relative to the genes operable linked to (transcriptionally controlled by) the protein promoter or the antiviral RNA encoding sequences operably linked to the first RNA promoter.
  • the viral expression vector may further include nucleic acid sequences encoding for viral proteins (e.g, structural proteins, regulatory proteins). Upon expression in a cell these proteins may form a virus-like particle which includes the antiviral polycistronic RNA.
  • the recombinant nucleic acid forms part of a recombinant viral particle.
  • the antiviral polycistronic RNA or the recombinant nucleic acid encoding the same may be delivered to a cell, tissue or organ using the recombinant viral particle.
  • the recombinant nucleic acid provided herein may encode a plurality of different species of siRNAs.
  • the antiviral RNA may be a ribozyme, an RNA decoy, an shRNA, a miRNA, or a snoRNA.
  • the first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA)
  • the second antiviral RNA encoding sequence encodes a second siRNA
  • the third antiviral RNA encoding sequence encodes a third siRNA.
  • the first siRNA, second siRNA and third siRNA may independently be a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • a "ribozyme” as provided herein refers to a ribonucleic acid capable of enzymatically modifying RNA (e.g, cleaving, splicing).
  • An RNA decoy as provided herein is an siRNA, which inhibits the function of a protein (e.g., viral protein or cellular protein) by binding the protein.
  • the RNA decoy may inhibit protein function by preventing the interaction between the protein (e.g., Tat) and its natural interaction partners (e.g., TAR). Further, the binding of an RNA decoy to a protein may alter the subcellular location of the protein thereby inhibiting its activity.
  • the RNA decoy is a U16TAR decoy. In embodiments, the RNA decoy is a U16RBE decoy.
  • the first siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the second siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the third siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • a viral transcription inhibiting siRNA a small RNA inhibiting viral transcription
  • a viral replication inhibiting siRNA a small RNA inhibiting viral replication
  • a viral transcription and replication inhibiting siRNA a small RNA inhibiting viral transcription and replication
  • a ribozyme or an RNA decoy a viral transcription inhibiting siRNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • the siRNA is capable of inhibiting Tat and Rev.
  • the ribozyme is a small nucleolar (sno) RNA.
  • the snoRNA is a U5 ribozyme (e.g., U16U5RZ).
  • the RNA decoy is a snoRNA.
  • the snoRNA is a U16TAR decoy.
  • the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR).
  • the recombinant nucleic acid may further include a transcriptional terminator sequence.
  • a transcriptional terminator sequence as provided herein refers to a nucleic acid sequence capable of abrogating RNA transcription.
  • a transcriptional terminator sequence may disrupt the mRNA-DNA-RNA polymerase ternary complex thereby terminating the transcription process.
  • the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter, and a transcriptional terminator sequence.
  • the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter; a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second promoter is a reverse promoter, and a transcriptional terminator sequence.
  • the transcriptional terminator sequence is an Ul terminator sequence.
  • the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence.
  • the recombinant nucleic acid may further include a first nucleic acid linker connecting the first antiviral RNA encoding sequence to the second antiviral RNA encoding sequence and a second nucleic acid linker connecting the second antiviral RNA encoding sequence to the third antiviral RNA encoding sequence.
  • a nucleic acid linker as provided herein is a nucleic acid molecule connecting two nucleic acid sequences through covalent binding.
  • the nucleic acid linker includes at least 10 nucleotides.
  • the nucleic acid linker includes at least 20 nucleotides.
  • the nucleic acid linker includes at least 30 nucleotides.
  • the nucleic acid linker includes at least 40 nucleotides. In embodiments, the nucleic acid linker includes at least 50 nucleotides. In embodiments, the nucleic acid linker includes at least 60 nucleotides. In embodiments, the nucleic acid linker includes at least 70 nucleotides. In embodiments, the nucleic acid linker includes at least 80 nucleotides. In embodiments, the nucleic acid linker includes at least 90 nucleotides. In embodiments, the nucleic acid linker includes at least 100 nucleotides. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence. In
  • the first nucleic acid linker or the second nucleic acid linker include an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence or an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the first nucleic acid linker and the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the intron sequence is a MCM7 intron sequence. In embodiments, the exon sequence is a MCM7 exon sequence.
  • the recombinant nucleic acid provided herein including embodiments thereof may include an antiviral protein encoding sequence.
  • An antiviral protein encoding sequence refers to a nucleic acid sequence encoding a polypeptide capable of inhibiting viral activity (e.g., replication, transcription, translation, infection).
  • the antiviral protein is an inhibitor of viral replication.
  • the antiviral protein is an inhibitor of viral transcription.
  • the antiviral protein is an inhibitor of viral entry.
  • the antiviral protein is an inhibitor of viral transport. In embodiments, the antiviral protein is an inhibitor of viral packaging. In embodiments, the antiviral protein encoding sequence encodes a C46 fusion inhibitor. In embodiments, the antiviral protein encoding sequence encodes a mutant Rev protein. In embodiments, the mutant Rev protein is a Rev M10 protein. In embodiments, the antiviral protein encoding sequence is downstream of the viral entry inhibiting RNA encoding sequence. In embodiments, the recombinant nucleic acid includes a transcriptional terminator sequence. In embodiments, the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the antiviral protein encoding sequence.
  • the recombinant nucleic acid provided herein including embodiments thereof may include a fourth antiviral RNA encoding sequence.
  • the fourth antiviral RNA encoding sequence encodes a fourth siRNA.
  • the fourth siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • the siRNA is capable of inhibiting Tat and Rev.
  • the ribozyme is a small nucleolar (sno) RNA.
  • the snoRNA is a U5 ribozyme (e.g., U16U5RZ).
  • the RNA decoy is a snoRNA.
  • the snoRNA is a U16TAR decoy.
  • the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR).
  • the RNA decoy is a U16TAR decoy.
  • the RNA decoy is a U16RBE decoy.
  • the fourth siRNA is an RNA decoy.
  • the fourth siRNA is a Tat binding RNA decoy (e.g., U16TAR).
  • the fourth siRNA is a U16TAR decoy.
  • the fourth antiviral RNA encoding sequence is operably linked to a third RNA promoter.
  • the third RNA promoter is a polymerase III promoter.
  • the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a U6 promoter.
  • the third RNA promoter is a forward promoter.
  • the third RNA promoter is located upstream of the protein promoter.
  • compositions provided herein including embodiments thereof may include different combinations of antiviral RNA encoding sequences, viral entry inhibiting RNA encoding sequences and antiviral protein encoding sequences.
  • the recombinant nucleic acid composition includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter and a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second promoter is a reverse promoter.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a Rev siRNA
  • the third antiviral RNA encoding sequence encodes a Tat siRNA
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a Rev siRNA
  • the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR)
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a U5 ribozyme (e.g., U16U5RZ)
  • the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR)
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a U5 ribozyme (e.g., U16U5RZ)
  • the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR)
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA
  • the third RNA promoter is a U6 promoter
  • the fourth antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR).
  • a recombinant nucleic acid encoding an antiviral polycistronic RNA includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
  • the first RNA promoter is a forward promoter.
  • the first RNA promoter is a reverse promoter.
  • the second RNA promoter is a forward promoter.
  • the second RNA promoter is a reverse promoter.
  • the first RNA promoter is a forward promoter and the second RNA promoter is a reverse promoter.
  • the recombinant nucleic acid may form part of a viral expression vector.
  • the viral expression vector provided herein may include nucleic acid sequences encoding for a selectable marker protein (e.g., the human methylguanine methyltransferase mutant P 140K/MGMT) to select for cells including the viral expression vector.
  • the viral expression vector may include nucleic acid sequences encoding for an antiviral protein (e.g., C46 fusion inhibitor, Rev M10 protein).
  • the viral expression vector may further include regulatory sequences necessary to express the selectable marker and/or the antiviral protein.
  • the recombinant nucleic acid forms part of a recombinant viral particle.
  • the first RNA promoter is a RNA polymerase II promoter.
  • the RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a Ul promoter.
  • the first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA)
  • the second antiviral RNA encoding sequence encodes a second siRNA
  • the third antiviral RNA encoding sequence encodes a third siRNA.
  • the first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • the first siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the second siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the third siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA
  • the siRNA is capable of inhibiting Tat and Rev.
  • the ribozyme is a small nucleolar (sno) RNA.
  • the snoRNA is a U5 ribozyme (e.g., U16U5RZ).
  • the RNA decoy is a snoRNA.
  • the snoRNA is a U16TAR decoy.
  • the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR).
  • the second RNA promoter is downstream of the third antiviral RNA encoding sequence.
  • the second RNA promoter is a polymerase III promoter.
  • the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a U6 promoter.
  • the viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
  • the cellular receptor siRNA is a T cell receptor siRNA.
  • the T cell receptor siRNA is a small hairpin (sh) RNA.
  • the shRNA is a CCR5 shRNA.
  • the shRNA is a CXCR4 shRNA.
  • the viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
  • the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • the recombinant nucleic acid provided herein including embodiments thereof may further include a transcriptional terminator sequence.
  • the transcriptional terminator sequence is an Ul terminator sequence.
  • the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence.
  • the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence and a transcriptional terminator sequence.
  • the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence.
  • the recombinant nucleic acid provided herein including embodiments thereof may further include a first nucleic acid linker connecting the first antiviral RNA encoding sequence to the second antiviral RNA encoding sequence and a second nucleic acid linker connecting the second antiviral RNA encoding sequence to the third antiviral RNA encoding sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an exon sequence.
  • the first nucleic acid linker or the second nucleic acid linker include an intron sequence or an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the first nucleic acid linker and the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the intron sequence is a MCM7 intron sequence. In embodiments, the exon sequence is a MCM7 exon sequence.
  • compositions provided herein including embodiments thereof may include different combinations of antiviral RNA encoding sequences, viral entry inhibiting RNA encoding sequences and antiviral protein encoding sequences.
  • the recombinant nucleic acid composition includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a Rev siRNA
  • the third antiviral RNA encoding sequence encodes a Tat siRNA
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a Rev siRNA
  • the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the first RNA promoter is a Ul promoter
  • the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • the second antiviral RNA encoding sequence encodes a U5 ribozyme
  • the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy
  • the second RNA promoter is a U6 promoter
  • the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • the recombinant nucleic acid includes a fourth antiviral RNA encoding sequence.
  • the fourth antiviral RNA encoding sequence encodes a fourth siRNA.
  • the fourth siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA
  • the siRNA is capable of inhibiting Tat and Rev.
  • the ribozyme is a small nucleolar (sno) RNA.
  • the snoRNA is a U5 ribozyme (e.g.,
  • the RNA decoy is a snoRNA. In embodiments, the snoRNA is a U16TAR decoy. In embodiments, the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR). In embodiments, the RNA decoy is a U16TAR decoy. In embodiments, the RNA decoy is a U16RBE decoy. In embodiments, the fourth siRNA is a RNA decoy. In embodiments, the fourth siRNA is a Tat binding RNA decoy (e.g., U16TAR).
  • the fourth siRNA is a U16TAR decoy.
  • the fourth antiviral RNA encoding sequence is operably linked to a third RNA promoter.
  • the third RNA promoter is a polymerase III promoter.
  • the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • the snRNA promoter is a U6 promoter.
  • the third RNA promoter is a forward promoter.
  • the third RNA promoter is located upstream of the protein promoter.
  • the recombinant nucleic acid compositions provided herein including embodiments thereof may be expressed by a cell (e.g., mammalian cell), tissue or organ. Upon expression in a cell siRNA molecules as described above are formed, and said siRNA molecules confer antiviral activity to the cell.
  • a mammalian cell including a recombinant antiviral polycistronic RNA is provided.
  • the recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • the first antiviral RNA, the second antiviral RNA and the third antiviral RNA is a small interfering RNA (siRNA).
  • the siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a
  • the ribozyme is a snoRNA.
  • the ribozyme is a U5 ribozyme (e.g., U16U5RZ).
  • the RNA decoy is a snoRNA.
  • the RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
  • the viral entry inhibiting RNA is a cellular receptor siRNA.
  • the cellular receptor siRNA is a T cell receptor siRNA.
  • the T cell receptor siRNA is a small hairpin (sh) RNA.
  • the shRNA is a CCR5 shRNA.
  • the shRNA is a CXCR4 shRNA.
  • the viral entry inhibiting RNA is a nuclear receptor siRNA.
  • the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • the mammalian cell includes an antiviral protein.
  • the antiviral protein is a C46 fusion inhibitor.
  • the antiviral protein is a mutant Rev protein.
  • the mutant Rev protein is a Rev Ml 0 protein.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a Rev siRNA
  • the third antiviral RNA is a Tat siRNA
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a Rev siRNA
  • the third antiviral RNA is a Tat binding RNA decoy
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a U5 ribozyme
  • the third antiviral RNA is a Tat binding RNA decoy
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • kits including a recombinant antiviral polycistronic RNA includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • the kit includes instructions for making a cell expressing the recombinant antiviral polycistronic RNA.
  • the kit includes a recombinant antiviral polycistronic RNA or a recombinant nucleic acid encoding the recombinant antiviral polycistronic RNA described herein, including in any aspect, embodiment, example, claim, or figure.
  • the kit includes a composition or mixture that includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and a viral entry inhibiting RNA.
  • the first antiviral RNA, the second antiviral RNA and the third antiviral RNA is a small interfering RNA (siRNA).
  • the siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • the viral transcription inhibiting siRNA is a Tat siRNA.
  • the viral replication inhibiting siRNA is a Rev siRNA.
  • the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • the ribozyme is a snoRNA.
  • the ribozyme is a U5 ribozyme.
  • the RNA decoy is a snoRNA.
  • the RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
  • the viral entry inhibiting RNA is a cellular receptor siRNA.
  • the cellular receptor siRNA is a T cell receptor siRNA.
  • the T cell receptor siRNA is a small hairpin (sh) RNA.
  • the shRNA is a CCR5 shRNA.
  • the shRNA is a CXCR4 shRNA.
  • the viral entry inhibiting RNA is a nuclear receptor siRNA.
  • the said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a Rev siRNA
  • the third antiviral RNA is a Tat siRNA
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a Rev siRNA
  • the third antiviral RNA is a Tat binding RNA decoy
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • the first antiviral RNA is a Tat/Rev siRNA
  • the second antiviral RNA is a U5 ribozyme
  • the third antiviral RNA is a Tat binding RNA decoy
  • the viral entry inhibiting RNA is a CCR5 shRNA.
  • kits including a recominant viral particle including the recombinant nucleic acid provided herein including embodiments thereof is provided.
  • kits including a recominant viral particle including a recombinant antiviral polycistronic RNA includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • compositions including a pharmaceutically acceptable excipient and a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof is provided.
  • a method of treating an infectious disease in a subject in need thereof includes administering to the subject a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof.
  • the infectious disease is caused by a virus.
  • the virus is HIV.
  • the subject suffers from AIDS.
  • a method of treating an infectious disease in a subject in need thereof includes administering to the subject a mammalian cell including a recombinant antiviral polycistronic RNA as provided herein including embodiments thereof.
  • the mammalian cell is derived from the patient.
  • the mammalian cell is derived from a healthy subject.
  • the mammalian cell is formed by transfection with a recombinant nucleic acid encoding an antiviral polycistronic RNA as provided herein including embodiments thereof.
  • a method of inhibiting HIV replication in a patient includes administering to the patient a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient.
  • a method of inhibiting HIV replication in a patient includes administering to the subject a mammalian cell including a recombinant antiviral polycistronic RNA as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient.
  • the mammalian cell is derived from the patient.
  • the mammalian cell is derived from a healthy subject.
  • the mammalian cell is formed by transfection with a recombinant nucleic acid encoding an antiviral polycistronic RNA as provided herein including embodiments thereof.
  • Combinational therapy with small RNA inhibitory agents against multiple viral targets allows efficient inhibition of viral production by controlling gene expression at critical time points.
  • Applicants explore combinations of different classes of therapeutic anti-HIV-1 RNAs expressed from within the context of an intronic MCM7 platform that naturally harbors three miRNAs.
  • Applicants replaced the endogenous miRNAs with anti-HIV small RNAs, including siRNAs targeting HIV-1 tat and rev messages that function to induce post- transcriptional gene silencing by the RNA interference pathway, a nucleolar-localizing RNA ribozyme that targets the conserved U5 region of HIV-1 transcripts for degradation, and finally nucleolar TAR and RBE RNA decoys designed to sequester HIV-1 Tat and Rev proteins inside the nucleolus.
  • Applicants demonstrate the versatility of the MCM7 platform in expressing and efficient processing of the siRNAs as miRNA mimics along with nucleolar small RNAs.
  • One of the most effective constructs contains an anti-HIV siRNA combined with a nucleolar-localizing U5 ribozyme and TAR decoy.
  • the combinations of si/sno RNAs represent a new paradigm for combinatorial RNA-based gene therapy applications.
  • MCM7-snoRNA constructs [0125] Previously, Applicants engineered and optimized a polycistronic miRNA cluster located in an intron of the protein encoding gene MCM7 as a siRNA multiplexing platform (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). This platform which Applicants refer to as MCM7 was engineered to simultaneously express three anti-HIV siRNAs targeted to the common exon shared by tat/rev (S I), rev (S2M), and tat (S3B), respectively (MCM7- S1/S2M/S3B in Fig. 2a) from a single RNA Pol II human Ul promoter.
  • S I tat/rev
  • S2M rev
  • S3B tat
  • siRNAs and snoRNAs Given the demonstration of co-expression of siRNAs and snoRNAs, Applicants hypothesized that it should be possible to insert the chimeric snoRNAs into any of the three miRNA positions to obtain processing of these small RNAs. If such was the case, Applicants could then examine different combinations of chimeric snoRNAs and siRNAs co-expressed in the same transcript.
  • the HIV-1 Rev protein used in the packaging process suppresses transcript splicing suggesting Applicants could also orient the U1-MCM7 intron in the same transcriptional direction as the CMV packaging promoter.
  • Applicants cloned the MCM7 transgene in both forward and reverse orientations with Ul promoter-specific termination sequence (Fig. 2b) and compared packaging efficiencies.
  • the packaging efficiencies were greater than 100-fold better in constructs with the transgene cloned in the forward orientation (Table 1).
  • RNA expression of each unit within the combinatorial vector was properly transcribed and processed.
  • a Northern blotting analysis was performed on stably transduced CEM T-lymphocytes (Fig. 3). After electrophoresis of the RNA samples, the blots were hybridized with probes specific for each of the RNAs. RNA expression was detected for each unit in the various constructs, with expected sizes of about 21 nt for siRNAs and aboutl32 nt for U16 chimeric snoRNAs, indicating efficient processing of the RNAs from the polycistronic transcript.
  • RNA combinations express lower levels of small RNAs in this platform, implying proper processing of both si- and snoRNA within the same intron is an intricate balance between the Drosha/DGCR8 and the snoRNP pathways and furthermore may be position-dependent (Hirose, T., Shu, M.D., and Steitz, J.A., Mol Cell, 12, 1 13-123 (2003)).
  • S1/U16U5RZ/U16TAR showed extremely potent anti-HIV activity, providing greater than a 5- log reduction in p24 output, with almost non-detectable p24 during this one-month challenge.
  • HIV-1 would provide selective pressure to enrich for transduced cells with levels of anti-HIV RNA gene expression that effectively suppress replication. If this is the case, Applicants would expect selection for cells with optimal RNA expression levels during the time course of the HIV-1 challenge.
  • Applicants utilized a dual luciferase reporter assay in which Applicants transiently co-transfected a replication-deficient pNL4-3 proviral DNA harboring the firefly luciferase gene in the HIV-1 Nef gene (pNL4-3.Luc.R-.E, catalog # 3418 from NIH AIDS reagent and repository, (Connor, R.I. et al, Virology, 206, 935-944 (1995); He, J.
  • pNL4-3 luciferase construct maintains targets for each of the small RNAs in all the transcripts, both spliced and unspliced and therefore luciferase readouts can be utilized as quantitative readouts of viral inhibition.
  • nucleolar-localizing small RNAs can be potent therapeutic agents. For example, Applicants had previously succeeded in inhibiting HIV-1 replication by individually expressing snoRNA chimeras, including the U16TAR and U16RBE RNA decoys that sequester the HIV-1 Tat and Rev proteins in the nucleolus, respectively (Michienzi et al., 2006; Michienzi et al, 2002). In addition, Applicants also demonstrated that a nucleolar-localizing ribozyme targeting a conserved U5 sequence present in all HIV- 1 transcripts had excellent HIV-1 inhibitory function (Michienzi, A.
  • Applicants did not find an advantage to down-regulating Ago2 (data not shown) since the siRNA expression levels are relatively low compared to Pol III transcribed shRNAs and during packaging these are not effectively down-regulating the viral transcripts.
  • Applicants also postulate that the insertion of the MCM7 cassette produces a larger viral transcript (5.4 kb) whose size is closer to the natural HIV- 1 RNA genome (9 kb) and therefore more favorable for packaging compared to the parental empty vector (3.9kb). Indeed Applicants found a 2.5-fold increase in viral titer when the parental MCM7 intron lacking anti-HIV RNAs was incorporated (data not shown) in similarity to Applicants' gene-therapy constructs carrying anti-HIV RNAs.
  • transgene directionality on packaging efficiency, with the forward orientation yielding greater than 100-fold higher production of virus. It is likely the transgene RNA transcript, when expressed from the Ul promoter in the reverse orientation could create an opposing transcript during packaging which negatively impacts on levels of expression from antisense effect.
  • U 16RBE/S2M/U 16TAR and MCM7 -U 16RBE/U 16U5 RZ/U 16T AR constructs did not significantly inhibit HIV replication despite the fact that the small RNAs were actively expressed and readily detectable by Northern blotting.
  • the U16 chimeras in these constructs had demonstrated antiviral activity when individually expressed from the parental vector with the Pol III U6 promoter (Michienzi, A. et al, AIDS Res Ther., 3, 13 (2006; Michienzi, A. et al, Proc Natl Acad Sci US A, 99, 14047-14052 (2002); Unwalla, H.J. et al, Mol Ther., 16, 11 13-11 19 (2008)).
  • RNA expression levels as a determinant for the effectiveness of a RNA- based gene therapy, the nature of the small RNAs should also be considered and carefully balanced between toxicity and therapeutic efficacy. Because RNA decoys act as "sponges" and therefore function in a stoichiometric fashion, the expression level needs to be sufficiently high to achieve therapeutic efficacy, whereas siRNAs and ribozymes are capable of multiple turnover by cleaving their targets in a catalytic manner and should be functional with lower copies per cell.
  • RNA agents that are catalytic in nature such as a siRNA or ribozyme. It is interesting to note that all the constructs that exhibit antiviral activity in the viral challenge assay contain the SI siRNA that targets both the HIV-1 tat and rev messages. Although Applicants' current data cannot demonstrate whether the other two small RNAs in the constructs have additive effects in antiviral activity, the principle of the combinational therapy is to reduce viral escape in a long term setting.
  • these studies represent the first example of incorporating combinations of snoRNA-based agents with siRNA-based agents within a single expression platform driven by a single Pol II promoter.
  • Applicants demonstrated the versatility of the MCM7 platform for expressing a variety of small anti-viral RNAs in addition to miRNAs.
  • Applicants also demonstrated superior packaging of these constructs versus the parental empty pHIV7-EGFP lentiviral vector. The enhanced packaging efficiency was especially pronounced when the transgene was cloned in the forward orientation with respect to the packaging CMV promoter.
  • Protein transgenes can be expressed from Pol II protein promoter.
  • Protein transgene can be antiviral, such as C46 fusion inhibitor or Rev M10 protein or selectable markers to enrich for gene modified cells, such as the P 140K mutant of human methylguanine methyltransferase (P140K MGMT).
  • Protein promoters are typically Pol II, such as human EF1 alpha, CMV, human Ubiquitin, SFFV.
  • Applicants utilized a self-cleaving P2A peptide to express multiple protein transgenes (EGFP and P 140K MGMT) from Applicants' vectors.
  • Endogenous polycistronic miRNA cluster in the intron of the protein encoding MCM7 gene is engineered as a multiplexing platform to co-express three small RNAs (RNAl, RNA2, RNA3).
  • RNAl small RNAs
  • siRNAs small interfering RNAs
  • siRNAs small nucleolar RNAs
  • siRNAs are expressed as primary microRNA (pri-miRNA) that requires endogenous RNA interference machinery for processing then gene silencing.
  • siRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes.
  • dual-targeting siRNA i.e.
  • bifunctional siRNAs that target two separate genes or identical gene at two different locations can also be utilized.
  • endogenous genes important for HIV viral replication include but are not limited to CCR5, CXCR4, and TNP03.
  • viral targets include but are not limited to HIV Tat, HIV Rev, and a common exon region shared between Tat and Rev mRNA.
  • SnoRNAs can also be successfully incorporated and expressed from the MCM7 platform. These are nucleolar localizing anti-HIV small RNAs constructed with the endogenous U16 snoRNA as a scaffold with the apical loop substituted for various anti-HIV elements. The conserved box C/D domain in U16 snoRNA is sufficient for nucleolar properties.
  • U16U5RZ is a nucleolar localizing RNA hammerhead ribozyme that recognizes the target by standard Watson-Crick base pairing and cleaves a conserved U5 region in the HIV UTR.
  • U16RBE and U16TAR are nucleolar RNA decoys that sequester HIV Rev and Tat proteins, respectively, into the nucleolus.
  • Applicants also evaluated antiviral activity of these triple constructs with an in vitro viral challenge assay.
  • One million untransduced and stable CEM T lymphocytes were challenged in triplicate with the NL4-3 strain of HIV- 1 at an MOI of 0.01, and culture supernatants were collected weekly for the HIV-1 p24 antigen ELISA to evaluate viral replication.
  • the MCM7 cassette is driven by single Pol II Ul promoter and terminated by an Ul- specific termination sequence. This configuration allows the MCM7 platform to be expressed in the forward orientation in the pHIV7 lentiviral backbone.
  • Other Pol II promoters can also be utilized, such as human EF1 alpha, CMV, human Ubiquitin, SFFV, and tissue-specific promoters to engineer tissue specific RNA transgene expression, with the termination sequence substituted with SV40 or BGHpA termination sequence and the requirement that MCM7 platform be expressed in the reverse orientation in the pHIV7 lentiviral backbone.
  • RNA transgene is independently expressed from a Pol III promoter and therefore terminated by the Pol III termination sequence (a consecutive series of 5 to 6 uracil nucleotides).
  • Pol III promoters include but not limited to U6, HI, tRNA Lys , tRNA Ser , tRNA ⁇ 8 and examples of small RNA transgene include but not limited to RNA decoys, RNA ribozymes, and siRNAs expressed either as a short hairpin RNA (shRNA) or as a precursor miRNA (pre- miRNA).
  • SiRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes.
  • dual-targeting siRNA i.e. bifunctional siRNAs
  • Applicants optimized the cassette orientation for transgene expression investigated the efficiency of CCR5 and HIV target knockdown and antiviral potency, and evaluated lentiviral packaging efficiency.
  • the target sequence is cloned in the 3 ' UTR of the reporter Renilla luciferase gene and the fusion transcript is subject to gene silencing by RNA interference.
  • the firefly luciferase reporter serves as a mean to normalize for differences in transfection efficiency.
  • the ratio of Renilla and firefly luciferase expression provides a measure of gene silencing.
  • bifunctionality siRNAs expressed as a pre- miRNA or as a shRNA are both capable of mediating HIV and CCR5 target knockdown (Fig. 9). Knowing Applicants' mature siRNA sequences can down-regulate target mRNA, Applicants investigated whether this can directly translate to a decrease in CCR5 surface expression.
  • Applicants utilized a cell line that over-expresses CCR5 and transiently transfected Applicants' constructs to monitor CCR5 expression by flow cytometry. Specific decrease in CCR5 expression was only observed with cells transfected with tRNA Ser -CCR5-12sh cassette (Fig. 10).
  • MCM7 vectors have potent antiviral activity with similar activity to the first generation lentiviral construct (Shl-TAR- CCR5RZ) with at least 3-logs reduction in viral replication (Fig. 12).
  • RNA transgene is incorporated downstream of the MCM7 platform in the multiple cloning site before the protein promoter.
  • This additional small RNA transgene is independently expressed from a Pol III promoter and therefore terminated by the Pol III termination sequence (a consecutive series of 5 to 6 uracil nucleotides).
  • Pol III promoters include but not limited to U6, HI, tRNA Lys , tRNA Ser , tRNA ⁇ 8 and examples of small RNA transgene include but not limited to
  • RNA decoys RNA ribozymes, and siRNAs expressed either as a short hairpin RNA (shRNA) or as a precursor miRNA (pre-miRNA).
  • siRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes.
  • dual-targeting siRNA i.e. bifunctional siRNAs
  • Applicants have successfully incorporated and expressed a Pol III U6-driven TAR RNA decoy (U16TAR) in this configuration.
  • Lentiviral vector design to incorporate a polycinstronic MCM7 platform and a drug selection marker (MGMT P140K ) for combinatorial RNA-based gene therapy
  • Lentiviral vectors are efficient gene delivery vehicles with the ability to transduce non- dividing cells such as HSPCs resulting in long-term expression of the therapeutic transgenes in differentiated progeny.
  • Applicants modified a third generation, self inactivating lentiviral vector, pHIV7, that previously demonstrated high efficiency in transducing primary CD4+ T
  • lymphocytes and HSPCs Yam, PY et al. (2002). Design of HIV vectors for efficient gene delivery into human hematopoietic cells. Molecular therapy : the journal of the American
  • MGMT P140K from a CMV promoter
  • the MCM7 platofrm is designed to co-express three small RNAs within the polycistronic cluster using a single Pol II promoter.
  • any Pol II promoter can be utilized to engineer tissue-specific transgene expression in this platform
  • Applicants selected the Ul promoter for ubiquitous and persistent transgene expression in all hematopoietic cells derived from HPSCs.
  • Applicants previously demonstrated combinations of both si- and snoRNAs can be multiplexed in this format with antiviral functionality (Chung, J, et al. (2012). Endogenous MCM7 microRNA cluster as a novel platform to multiplex small interfering and nucleolar RNAs for combinational HIV-1 gene therapy. Human gene therapy 23 : 1200-1208).
  • RNA Ser tRNA Ser -CCR5sh cassette
  • RNA cassette the nucleolar TAR RNA decoy driven by the independent Pol III U6 promoter (U6- U16TAR cassette) to increase antiviral potency by inhibiting Tat-dependent viral transcription.
  • This cassette was cloned outside of the MCM7 transgene to reduce the possibility of promoter interference that could negatively impact gene expression.
  • novel lentiviral vectors express up to five antiviral small RNAs to block both viral entry and replication of both tropisms of HIV with cassettes driven by both Pol II and III promoters.
  • tRNA transfer RNA
  • T his (Pol III) expression strategy utilizes the endogenous transfer RNA biogenesis pathway to express a primary tRNA-shRNA chimeric transcript and then release the mature shRNA by tRNAse Z cleavage (Scherer, LJ, et al. (2007). Optimization and characterization of tRNA-shRNA expression constructs. Nucleic acids research 35: 2620-2628) for further processing into mature siRNA.
  • Applicants utilized a Serine tR A promoter (tRNA Ser ) to express a CCR5 shRNA as an entry inhibitor against R5 -tropic HIV.
  • tRNA Ser Serine tR A promoter
  • Applicants transiently transfected plasmids containing either the promoter sequence only (the endogenous tRNA Ser gene) or with the tR A Ser -CCR5sh cassette into a CCR5 over-expressing U373 -MAGI- CCR5E cells (Vodicka, MA, et al. (1997). Indicator cell lines for detection of primary strains of human and simian immunodeficiency viruses. Virology 233 : 193-198).
  • this analysis further distinguishes products in various stages of processing including the primary tRNA Ser -shRNA chimeric transcript, the released shRNA, and the mature Dicer-processed siRNA sequence capable of gene silencing.
  • the siRNA is the dominate product suggesting efficient processing but some saturation of the processing pathway due to over-expression from the transient transfection is also evident (Fig. 15a).
  • pHIV7 containing only the tRNA Ser - CCR5sh RNA cassette (no MCM7) drives dramatically higher expression levels in stably transduced CEM T lymphocytes than the above vector where the transgenes is inside the MCM7
  • Flexible MCM7 platform expresses up to five antiviral small RNAs at
  • Combinatorial therapy has inherent challenges including various types of interference or competition between the individual elements that can negatively impact the potential therapeutic outcome.
  • competition can arise between different RNAi triggers for RNAi pathway components and incorporation into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • Applicants performed Northern blotting analysis with CEM T lymphocytes that stably express the transgenes. To ensure the expression level resembles the optimum physiological condition of one to two copies of integrated vectors in HSPCs,
  • RNAi triggers precursors SI, S2M, S3B, and CCR5sh
  • RNAi triggers precursors SI, S2M, S3B, and CCR5sh
  • MCM7 serves as a versatile tool in a
  • SGLVs with Pol II driven MCM7 platform express transgenes at a lower level compared to expression from FGLV with independent Pol III promoters (lanes 3-5 versus lane 6 in Fig. 16). While the lower levels resulting from the Ul promoter may reduce toxicity, Applicants questioned whether these levels were sufficient for efficacy. Therefore, Applicants next turned to assessing the anti-HIV activity of the current combinations.
  • the MCM7 platform produces sufficient small RNAs to protect gene modified cells from R5 tropic HIV
  • Applicants first assessed the antiviral functionality by viral challenge of gene modified CEM T lymphocytes with R5 tropic HIV- 1 JR-FL for 42 days, monitoring viral replication by p24 capsid levels in the culture supernatant (Fig. 12). All the therapeutic constructs (FGLV, SGLV4, SGLV5, and SGLV6) provided long-term protection, with up to a 5-log reduction in p24 capsid production in comparison to pLV and untransduced (unprotected) cells.
  • SGLV4 and SGLV5 had almost no detectable levels of p24 capsid during this long term challenge, providing evidence that the MCM7 platform indeed expresses sufficient amount of small RNAs for functionality.
  • CD34+ HPSCs are the substrate for gene modification as they are the eventual clinical target cell population for a stem cell based gene therapy approach.
  • CD34+ HPSCs can be induced into differentiating into the myeloid cells in vitro and efficacy of the candidate constructs evaluated by challenge with R5-tropic Bal HIV virus.
  • Applicants developed a novel single cell flow cytometric assay of intracellular staining with an antibody specific to HIV- 1 core antigens (55, 39, 33, and 24 kD proteins) to monitor viral replication.
  • the 55 kD protein is the primary precursor, while the 39 and 33 kD proteins are the intermediates of the mature 24 kD core protein (Chassagne, J, et al. (1986).
  • a monoclonal antibody against LAV gag precursor use for viral protein analysis and antigenic expression in infected cells. Journal of immunology 136: 1442-1445).
  • Applicants used uninfected macrophages to establish non-specific staining and background signal in the flow cytometric assay. Using this novel method, Applicants were able to follow the kinetics of HIV infection on the cellular basis during the 42-day challenge in primary macrophages.
  • FIG. 17 Representative intracellular HIV staining results at D 18 of the viral challenge are shown in Fig. 17.
  • Applicants observed a 2-log difference in fluorescence intensity comparing unspecific background staining of uninfected cells (Fig. 17a) to an actual HIV infected culture (Fig. 17b) validating that Applicants' novel flow cytometric assay has excellent sensitivity for
  • this flow cytometric assay can distinguish constructs with intermediate protection [31.7% HIV infection in SGLV1 (Fig. 17d) and 56.4% in SGLV6 (Fig. 17h)] from constructs with the best protection [16.7% HIV infection in FGLV (Fig. 17c); 1.6% in SGLV2 (Fig. 17e); 3.9% in SGLV4 (Fig. 17f); 3.9% in SGLV5 (Fig. 17g); 8.9% in SGLV7 (Fig. 17i)].
  • SGLV2 had better antiviral activity (1.6% infection, Fig. 17e) compared to small RNAs expressed from independent strong Pol III promoters such as in FGLV (16.7% infection, Fig. 17c).
  • FGLV (16.7% infection, Fig. 17c)
  • the antiviral protection also increase in constructs containing at least 2 anti-HIV siRNAs (i.e., SGLV4 and SGLV5). This could be due to the additive nature and efficiency of multiple siRNAs in cleaving HIV targets to inhibit HIV replication.
  • SGLV5 D28
  • FGLV D35
  • SGLV4 SGLV7 (D35)
  • SGLV2 had no significant increase in viral infection though 42 days of culture.
  • Applicants' long term results further confirm that over-expression of small RNA is not a guarantee of long term antiviral protection and that the MCM7 platform does provide lower but sufficient level of RNA expression for functionality.
  • CFU colony forming unit
  • the small RNA expression is lowered with the MCM7 platform (e.g., SGLV4), Applicants observed a recovery of hematopoietic potential to a similar level as the empty vector (77 ⁇ 5% vs. 83 ⁇ 5%, respectively, Fig. 19).
  • U6-U16TAR cassette that expresses the nucleolar TAR RNA decoy (SGLV7) created a sharp decline in CFU formation (from 77 ⁇ 5% to 59 ⁇ 4%, Fig. 19). It is therefore possible that the U6-U16TAR RNA cassette alone may be responsible for the reduction in hematopoietic potential in the independent Pol III driven FGLV observed in this assay. Further experiments, including the assessment of each individual RNA cassette on CFU potential is required to establish the relative roles of the higher levels of the RNA antiviral expression levels versus the specific inclusion of the U6-U16TAR moiety on the loss CFU potential observed with FGLV.
  • 0 6 -BG deactivates endogenous MGMT so that cells cannot repair BCNU-induced DNA damages resulting in cell death.
  • gene modified cells that express a modified MGMT MGMT P140K
  • MGMT P140K modified MGMT
  • the net result of the 0 6 -BG/BCNU selection is increased frequency of gene modified cells. Therefore, Applicants included this drug resistance gene in Applicants' anti-HIV constructs and developed a protocol to test for enrichment of gene modified HSPC and CD4+ progeny in vivo.
  • CD34+ HSPCs were transduced with an MGMT expressing vector (FGLV) and used to transplant immunodeficient NSG mice as described in Experimental Procedures.
  • Animals were treated with 0 6 -BG and BCNU at 7 th and 8 th weeks (2X treatment cohort) or at 7 th , 8 th and 9 th weeks (3X treatment cohort) following transplantation.
  • Two or three weeks after completion of the 0 6 -BG/BCNU treatment i.e., 1 1 weeks following transplantation
  • animals were necropsied and the level of engraftment and frequency of gene modified cells in the spleen and bone marrow were evaluated.
  • Applicants' results demonstrate that engraftment of the bone marrow and spleen with human (CD45+) cells was significantly reduced in treated animal cohorts relative to the control cohort (p ⁇ 0.001) (Figs. 20a and 20c, respectively) but the frequency of GFP+/CD45+ cells in the bone marrow and spleen was enriched 10 and 15-fold in the 2X and 3X treated cohorts respectively (Fig. 20b and 20d).
  • the average frequency of GFP+/CD3+/CD4+ T lymphocytes in the spleen increased 3-fold only when 0 6 -BG/BCNU treatment was performed three times (Fig. 20e).
  • RNA intron is a flexible and versatile platform for co-expressing combinations of up to three si- and snoRNAs within the MCM7 sequence and the ability to add additional independent RNA cassettes (both inside and outside of MCM7) for a total of five small RNAs.
  • this is the first example of multiplexing both classes of RNA promoters in a combinatorial approach. Applicants observed expression and complete processing of all small RNA transgenes into functional forms without saturation of processing pathways or promoter interference that could negatively impact transcription.
  • tRNA Ser -CCR5sh cassette is expressed at high levels in the pLV without MCM7, its expression is much weaker in the context of MCM7. This result may be related to the requirement of splicing of the intronic MCM7 cluster prior to trans gene expression. Moreover, expression is also related to orientation of the cassette in MCM7 highlighting the importance of optimal placement in multiplexing strategies. The level of small RNA expression from the MCM7 platform driven by a single Pol II Ul promoter is much weaker compared to the amounts driven by independent Pol III promoters.
  • RNA decoys Applicants established that sufficient amounts of antiviral small RNA were produced from the MCM7 platform to protect gene modified CEM T lymphocytes and primary macrophages derived from gene modified HSPCs from R5 tropic HIV, with the duration and level of protection highly dependent on RNA combination. This suggests that the optimal level of RNA expression is more important than achieving maximal levels of RNA expression for a given modality. It is likely that the overall amount of small RNA processing that can occur in a cell at any given time is limited. In theory, because of the catalytic nature of siRNAs and ribozymes in turning over multiple substrates, it should take less to achieve the same therapeutic effect compared to agents that sequester their target in stoichoimetric ratio such as TAR RNA decoys.
  • Applicants' results show that the multiple siRNAs in the MCM7 platform provided better protection against HIV, e.g., three siRNAs targeting tat and rev (SGLV2) was better than single tat/rev siRNA (SGLV1). This could be due to the additive nature and efficiency of multiple siRNAs in cleaving HIV targets, while increasing the selective pressure against viral escape.
  • the addition of two other potent anti-HIV RNAs, tRNA ser CCR5sh entry inhibitor and a U6-driven nucleolar TAR RNA decoy (SGLV4 and SGLV7, respectively), to the parental triple siRNA construct (SGLV2) did not provide additional benefit in inhibiting viral replication or preventing viral breakthrough.
  • RNA cassettes actually negatively impacted potency with the observation of viral breakthrough at 35 days with the parental construct observed limited breakthrough through the 42 day culture. It is unclear why addition of the entry inhibitor and the nucleolar TAR RNA decoy was less optimal in inhibiting HIV, although it is possible that CCR5 siRNA may compete with other anti-HIV siRNAs (i.e., SI, S2M, S3B siRNAs) for RISC factors in gene silencing. Furthermore, TAR RNA has been reported as a pri-miRNA that is processed into functional miRNAs (Ouellet, et al. (2008).
  • Applicants performed an in vitro CFU assay to identify any vector-related myelo- erythroid toxicity.
  • Applicants' data demonstrates that the MCM7 platform has the capacity to safely express four siRNAs with complete processing without reducing in vitro hematopoietic potential of gene modified HSPCs.
  • Applicants observed a reduction of CFU potential with incorporation of additional U6-U16TAR cassette making the first report of toxicity related to over-expression of RNA decoys. It is possible that the U6-U16TAR cassette is responsible for the observed toxicity in FGLV, but further experiments including assessment of each individual Pol III RNA cassette on CFU potential are likely required.
  • MGMT P140K drug resistance gene
  • FGLV first generation lentiviral vector
  • SGLV2 and SGLV4 See table 7 for construct identity
  • mice were challenged with HIV-l Ba i virus (41580 IU/mouse) and mice were followed for serum viremia every two weeks by RT-PCR. Some mice died during the 5 weeks following HIV challenge for undetermined reasons and so all animals were necroposied 6 weeks after infection.
  • serum viremia was reduced > 1 log by SGLV4 at 5 weeks after infection ( Figure 21).
  • the U16RBE and U16U5RZ snoRNA molecules were amplified by PCR from pTZ/U6-U16RBE and pTZ/U6-C36U5 DNA vectors (Michienzi, A. et al, AIDS Res Ther., 3, 13 (2006); Unwalla, H.J. et al., Mol Ther., 16, 11 13-1 119 (2008)), using primer sets A, and B, as Xhol/Hindlll and EcoRllBamHl fragments, respectively. The fragments were digested with appropriate enzymes followed by cloning into the pcDNA3-CMV-MCM7-Sl/S2/U16TAR plasmid (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)).
  • transcriptional terminator along with a new Notl site was introduced at the terminus of the common 3' region of the MCM7 cassette by replacing the original DNA sequence with a PCR product generated with primer set C.
  • the CMV promoter was replaced by the Ul promoter flanked by Mlul and Kpnl sites generated from amplification from a Ul plasmid (pKS-Ul, unpublished data) with primer set D.
  • the Ul-MCM7-Ult fragments were excised by Mlul and Notl digestion and ligated into the pHIV7-EGFP lentiviral vector in both forward and reverse orientations (i.e., the Ul promoter is in the same or opposite orientation as the packaging CMV promoter, respectively) depending on the directionality of the multiple cloning site. ,.
  • Primer sequences are given below with restriction sites underlined and Ul -specific terminator in bold: A: Forward: 5'-CCC CCC CCTC GAG CTT GCA ATG ATG TCG TAA TTT G-3' (SEQ ID NO: l)
  • Bifunctional siRNA (bi-CCR5-5) as pre-miRNA sequence:
  • the MGMT P140K transgene was co-expressed with the EGFP marker from a polycistronic message utilizing a self-cleaving P2A peptide sequence from the CMV promoter.
  • the MGMT P140K gene was first PCR amplified from pRSC-SMPGW2 plasmid (Trobridge, GD, et al. (2009). Protection of stem cell-derived lymphocytes in a primate AIDS gene therapy model after in vivo selection.
  • PloS one 4 e7693
  • primers Forward: 5'-GGG TCT AGA ATG GAC AAG GAT TGT GAA ATG AAA CGC-3' [SEQ ID NO: 13] and Reverse: 5'- GGG GAA TTC CGT ACG TCA GTT TCG GCC AGC AGG CG-3' [SEQ ID NO: 14] flanked by Xbal and EcoRI sites.
  • the fragment was digested with appropriate enzymes then subcloned into Nhel and EcoRI sites of the pFUG-P2A-WPRE vector (John Burnett, unpublished) just downstream of the P2A peptide sequence to generate pFUG-P2A-MGMT pl40K -WPRE.
  • the P2A- MGMT P140K fragment was then excised by BsrGI and BsiWI digestion then subclone into the BsrGI site of pHIV7-GFP vector (Yam, PY, et al. (2002). Design of HIV vectors for efficient gene delivery into human hematopoietic cells. Molecular therapy : the journal of the American Society of Gene Therapy 5: 479-484) to generate a modified lentiviral vector pHIV7-GFP-P2A- MGMT P140K The same strategy was utilized to introduce the P2A-MGMT P140K fragment into FGLV (Li, MJ, et al. (2005).
  • the CCR5 -targeting siRNA is expressed from the Pol III tRNA Ser promoter.
  • the tRNA Ser -CCR5sh cassette was amplified from pi 133-2 with the following primers (Forward: 5 '-ATGC GCCGGC ATCGAT GAA AAT GAC TTT GCC ACG CTT AGC ATG TGA CGA GGT GGC CGA GT-3' [SEQ ID NO: 15] and Reverse: ATGC GGCGCC ATTTAAAT AAA AAA GTG TCA AGT CCA ATC TAT GAT CTC TTG AAT CAT AGA-3' [SEQ ID NO: 16]) flanked by Nael and Swal sites on the 5' end and Narl and Clal sites on the 3' end.
  • SGLV7 was generated by inserting the U6-U16TAR fragment into SGLV4.
  • the U6- U16TAR fragment was generated from linearization of the pTZ/U6-U16TAR plasmid
  • Lentiviral vectors with appropriate inserts were packaged in 293T cells using calcium phosphate precipitation as previously described (Li, M.J., and Rossi, J.J., Methods EnzymoL, 392, 218-226 (2005b) with the addition of 1.5 ⁇ g of pAgo2sh plasmid (Harris Soifer, unpublished) that expresses a short hairpin RNA (shRNA) transcribed from the human U6 promoter to down-regulate Argonaute 2 (Ago2) protein expression to reduce post-transcriptional gene silencing induced by anti-HIV siRNA within constructs during packaging.
  • shRNA short hairpin RNA
  • Viral titers were determined by transduction of HT 1080 cells and analyzed for EGFP expression with flow cytometry. In embodiments, 15 ⁇ g of transfer plasmid were co-transfected with helper plasmids (15 ⁇ g pCMV-Pol/Gag, 5 ⁇ g pCMV-Rev, and 5 ⁇ g pCMV-VSVG) into HEK 293T cells with 90-95% confluency per 10cm dish. Viral supernatant was harvested 48 hours post-transfection, concentrated by ultracentrifugation, and stored in -80 °C until use. Viral titers were determined by transduction of HT 1080 cells and analyzed for EGFP expression with FACS analysis. [0190] Cell culture and vector transduction
  • HEK 293T and HT1080 cells were purchased from ATCC (Manassas, VA, USA) and maintained in high glucose (4.5 g/1) DMEM supplemented with 2 mM glutamine and 10% FBS.
  • the human CEM T-lymphocytes was cultured in RPMI 1640 medium supplemented with 10% FBS.
  • CEM T lymphocytes were transduced with lentiviral vectors at MOI of 0.5 and 2.5 in the presence of 4 ⁇ g/ml polybrene (EMD Millipore, Billerica, MA) enhanced by centrifugation. Cells with around 30% EGFP expression were expanded and sorted to purity for further experiments.
  • CEM T-lymphocytes were transduced with lentiviral vectors as previously described (Li, M.J., and Rossi, J. J., Methods Enzymol, 392, 218-226 (2005b)), with the exception of the multiplicity of infection (MOI) utilized.
  • MOI multiplicity of infection
  • U373 -MAGI-CCR5E cells were obtained through the NIH AIDS Reagent Program (Vodicka, MA, et al. (1997). Indicator cell lines for detection of primary strains of human and simian immunodeficiency viruses. Virology 233 : 193-198) and maintained in complete DMEM, supplemented with 0.2 mg/ml G418, 0.1 mg/ml hygromycin B, and 1.0 ⁇ g/ml puromycin.
  • Adult CD34+ HSPCs were isolated from G-CSF mobilized peripheral blood (purchased from
  • HSPCs were thawed and pre-stimulated in StemSpan-SFT6 media [StemSpan (Stem Cell Technologies, Vancouver, British Columbia, Canada)
  • Lentiviral vectors adjusted to MOI of 20 were added to 6.4x10 4 pre-stimulated HSPCs in 250 ⁇ StemSpan-SFT6 media in the presence of 20 ⁇ g/ml rapamycin (Sigm-Aldrich, St. Louis, MO) on RetroNectin (Takara, Mountain View, CA)-coated 96-well plate.
  • HSPCs were cultured in 1.3 ml StemSpan-SFT6 media supplemented with 0.75 ⁇ SRI (Cellagen Technologies, San Diego, CA) for 5 days prior to sorting.
  • HSPCs were sorted on CD34 marker, in addition to EGFP expression for the transduced population. Only CD34+ (untransduced) or CD34+/GFP+ (transduced) cells were used for subsequent colony forming assay set up and macrophage differentiation for HIV challenge experiments.
  • Sorted HSPCs were cultured in Iscove's modified Dulbeco's media (IMDM) with 20% FBS supplemented with 2mM glutamine, 25 ng/ml SCF (Gibco, Grand Island, NY), 30 ng/ml Flt-3L (CellGenix, Freiburg, Germany), 30 ng/ml IL3 (Gibco, Grand Island, NY), 30 ng/ml M- CSF (PeptroTech, Rocky Hill, NJ) for 10 days for guided differentiation to monoctyes, then switched to DMEM with 10% FBS supplemented with 2 mM glutamine, 10 ng/ml GM-CSF (Leukine, Sanofi US, Bridgewater, NJ), 10 ng/ml M-CSF (PeptroTech, Rocky Hill, NJ) for 5 days for activation into macrophages.
  • Adherent macrophage cells were collected for HIV challenge experiments. The purity of cells was typically greater than 90% CD 14+ based on FACS analysis.
  • the EGFP marker from the co-transfected pHIV7-EGFP plasmid serves as an internal control for transfection efficiency.
  • Cells were detached 72 hours later and stained with CCR5-APC antibody (clone 2D7, BD Pharmingen, San Jose, CA) to estimate CCR5 knockdown by flow cytometry. Data were collected on Gallios flow cytometer (Beckman Coulter, Brea, CA) and analyzed by FCS express version 4 software (De Novo software, Los Angeles, CA).
  • Small nuclear U2A RNA serves as internal control. Total RNA from sorted CEM T lymphocytes were isolated similarly and Northern blotting analysis was performed as described above, with the exception of 20 ⁇ g of total RNA used as input. The U6 small nuclear RNA was used as a loading control. [0202] The small RNA probe sequences are given below:
  • HIV-1 challenge, p24 antigen assays and intracellular HIV staining for monitor viral replica [0204] One million untransduced or stably transduced CEM-T lymphocytes were infected in triplicate with the NL4-3 strain of HIV- 1 at an MOI of 0.01. After overnight incubation, cells were washed three times with Hank's balanced salts solution and cultured in RPMI 1640 with 10% FBS. At designated time points, culture supernatants were collected and analyzed for HIV- 1 replication by a p24 ELISA assay (Perkin Elmer, USA) according to the manufacturer's protocol.
  • Viral replication was analyzed by intracellular staining of HIV core proteins at indicated time points.
  • Cells were detached with Accutase solution (Sigma-Aldrich, St. Louis, MO), viability estimated by LIVE/DEAD fixable aqua dead cell stain (Sigma-Aldrich, St. Louis, MO), fixed and permeabilized with intracellular fixation and permeabilization buffer set (eBioscience, San Diego, CA) before staining with KC57-RD antibody (KC57-RD1 antibody, clone FH190-1-1, Beckman Coulter, Brea, CA) that recognizes HIV-1 core proteins and finally analyzed by flow cytometry. Data were collected on Gallios flow cytometer and analyzed by FCS express version 4 software.
  • RNA from stably transduced CEM T-lymphocytes challenged with HIV-1 was extracted with STAT-60 reagent (Tel-Test, Friendswood, TX, USA) according to the manufacturer's instructions then resuspended in nuclease-free water. Residual DNA was digested using Turbo DNase (Ambion, USA) with 1 ⁇ g of total RNA in a 10 ⁇ reaction following the manufacturer's instructions.
  • SI siRNA and U16TAR RNA decoy expression were analyzed by real time qRT-PCR with the CFX96 Real-Time Detection System (Bio-Rad, Hercules, CA, USA) and expression levels were normalized to the U6 small nuclear RNA.
  • S 1 siRNA was reverse transcribed into cDNA using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) with 100 ng DNase-treated total RNA and stem-loop RT primer according to the manufacturer's instruction.
  • Real time PCR was carried out with 1.3 ⁇ of RT reaction, 0.2 ⁇ SI -specific probe, 1.5 ⁇ forward primer, 0.7 ⁇ reverse primer in TaqMan Universal PCR Master Mix diluted to IX concentration (Applied Biosystems, Foster City, CA, USA) in a final volume of 20 ⁇ .
  • PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 30s, 64 °C for 30s, 72 °C for 30s (DiGiusto, D.L. et al, Sci Transl Med., 2, 36-43 (2010)).
  • the exact copy number of S I siRNA was determined using a standard curve constructed with known concentrations of synthetic S 1 RNA oligo (Integrated DNA Technology).
  • the U16TAR RNA decoy and the internal control small nuclear U6 RNA were reverse transcribed using 200 ng of DNase-treated total RNA with 50 ng of random primers (Invitrogen, USA) and Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen, USA) in a 20 ⁇ reaction according to the manufacturer's instructions.
  • Real time PCR for the U16TAR RNA decoy was carried out with 1 ⁇ of the RT reaction, 0.2 ⁇ TAR-specific probe, 0.5 ⁇ of each U16-specific forward and reverse primers in TaqMan Universal PCR Master Mix diluted to IX concentrations (Applied Biosystems, Foster City, CA, USA) in a final volume of 20 ⁇ .
  • PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 30s, and 64 °C for 1 min.
  • the exact copy of RNA molecules were determined with a standard curve constructed with known concentrations of U16TAR plasmid. Quantification of the U6 internal control was accomplished using 2 ⁇ of the RT reaction with 0.4 ⁇ of each U6-specific forward and reverse primers utilizing iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) in a final volume of 25 ⁇ .
  • the PCR conditions were 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30s.
  • a standard curve with known amounts of total RNA input was utilized to determine the precise RNA input to account for sample-to-sample variability.
  • Quantitative RT -PCR primer sequences are given below:
  • S 1 Stem-loop RT primer: 5 ' -GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GCG GA-3 ' (SEQ ID NO:27)
  • Probe 5'-(6-FAM)-TCG CAC TGG ATA CGA CAG CGG AGA CA-(BHQl)-3 ' (SEQ ID NO:28)) Forward: 5'-GCC TCT TCG TCG CTG TCT-3 ' (SEQ ID NO:29)
  • U16TAR Probe: 5'-(6-FAM)-ATC TGA GCC TGG GAG CTC TCT GGC T-(BHQl)-3'
  • RNA from CD34-derived macrophages were extracted with STAT-60 reagent (Tel-Test, Friendswood, TX) with manufacturer's protocol then resuspended in nuclease-free water. Residual DNA was digested with Ambion TURBO DNase (Life Technologies, Carlsbed, CA) with 2 ⁇ g of total RNA in a 15- ⁇ 1 reaction, in accordance with manufacturer's instructions.
  • Complementary DNA was then synthesized with 1 ⁇ g of DNase-treated RNA with 100 ng of random primers (Invitrogen, Carlsbad, CA) and Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) in a 27- ⁇ 1 reaction according to manufacturer's instructions.
  • Real time PCR was carried out with CFX96 real-time detection system with 10 ng of cDNA, 0.4 ⁇ of each gene specific (CCR5 or GAPDH) primers with iQ SYBR green supermix (Bio-Rad, Hercules, CA) in a final volume of 25 ⁇ .
  • the PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s, 62 °C for 1 min.
  • a standard curve with known serial dilutions of total RNA input was utilized to calculate the ratio between CCR5 and GAPDH to estimate percentage of CCR5 down-regulation.
  • Primer sequences for PCR were as follows:
  • CCR5-F 5'-TTC ATT ACA CCT GCA GCT CTC-3' (SEQ ID NO:36); CCR5-R: 5'-CCT GTT AGA GCT ACT GCA ATT AT-3 ' (SEQ ID NO:37); GAPDH-F: 5'-CGC TCT CTG CTC CTC CTG TT-3 ' (SEQ ID NO:38); GAPDH-R: 5'-CCA TGG TGT CTG AGC GAT GT-3 ' (SEQ ID NO:39). [0213] In Vitro CFU assay for adult CD34+ HSPCs
  • a total of 500 sorted CD34+ cells were plated in triplicate in MethoCult H4435- enriched methylcellulose media (Stem Cell Technologies, Vancouver, British Columbia, Canada) according to manufacturer's protocol. Cells were cultured for 12 to 13 days before colony scoring under inverted microscope.
  • Fc/IL-7 protein production Fc/IL-7 was cloned into an OptiVect- TOPO (Invitrogen, Carlsbad, CA) vector and protein was produced from a cloned transfected DG44 CHO cell line as per the methods of Lo et al ((1998). High level expression and secretion of Fc-X fusion proteins in mammalian cells. Protein engineering 1 1 : 495-500).
  • Humanized NSG mouse model Humanized NSG mouse model
  • NOD.Cg- r c scid IL2rg tmlwjl /SzJ (NSG) mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and bred at the City of Hope Animal Resources Center according to protocols approved by the Institutional Animal Care and Use Committee of the City of Hope.
  • Adult (8-10 week old) NSG mice were irradiated at 270 cGy 24 hours prior to transplantation.
  • Each animal was transplanted with lxlO 6 HSPCs following transduction as described via intravenous injection.
  • 20 ⁇ g Fc/IL7 protein was administered per animal intravenously weekly for 11 weeks.
  • mice were necropsied 1 1 weeks after transplantation for analysis of engraftment and enrichment of gene modified cells.
  • Single cell suspensions of bone marrow (femurs) and spleen were prepared by mechanical dissociation and red cells lysed using ACK lysis Buffer (Sigma- Aldrich, St. Louis, MO). All cell suspensions were pre-treated with human immunoglobulin (GammaGard, Baxter Healthcare Corp. Deerfield, IL) for 30 minutes to block nonspecific antibody staining.
  • Spleenocytes were stained with a human pan-leukocyte antibody to CD45- PC5 (BioLegend, San Diego, CA), and lineage specific anti-human antibodies, CD3-ECD, CD4- APC, and CD14-APC-Alexa-750 (Invitrogen, Carlsbad, CA) for 20 minutes and washed 2 times with 1 mL of PBS containing 0.1% BSA (Sigma-Aldrich, St Louis, MO). Bone marrow cells were stained with antibodies to human CD45-PC5 (Beckman Coulter, Brea, CA), for 20 minutes and washed 2 times with 1 mL of PBS containing 0.1% BSA. To establish analytical gates and background staining, bone marrow and spleen samples from two to three untransplanted mice were stained with the same antibody panel. Data were collected on Gallios flow cytometer and analyzed by FCS express version 4 software.
  • Table 1 Packaging efficiencies of lentiviral vectors with MCM7 transgene.
  • a Viral titer is determined by transducing HT1080 cells with unconcentrated viral supernatant and reported in transduction units per milliliter (TU/ml). Samples with -30-40% EGFP+ cells, determined from flow cytometry, were used for calculation. The values are averages of two independent experiments.
  • Table 2 Examples of si-/snoRNA combinations constructed and analyzed.
  • MCM7-S1/S2M/S3B 4.01 ⁇ 1 .23*10 6 4.20 ⁇ 0.50*10 4 MCM7-S1/S2M/U16TAR 4.1 1 ⁇ 1 .24*10 6 3.00 ⁇ 0.42*10 4 MCM7-S1/U16U5RZ/U16TAR 4.34 ⁇ 1 .46*10 6 1 .44 ⁇ 0.34*10 4 MCM7-U16RBE/S2M/U16TAR 4.66 ⁇ 1 .72*10 6 2.41 ⁇ 0.45x10 4 MCM7-U16RBE/U16U5RZ/U16TAR 4.12 ⁇ 1 .58*10 6 4.18 ⁇ 0.22*10 4
  • MCM7-S1/S2M/S3B 8.01 x 10 8 5.70 x 10 7 MCM7-S1/S2M/TAR 8.61 x 10 8 5.88 x 10 7 MCM7-S 1 /U 16U5RZ/U 16TAR 6.31 x 10° 7.96 x 10 b
  • siRNA as pre- miRNA as pre- miRNA
  • siRNA as pre- miRNA as pre- miRNA
  • Table 7 Lentiviral Vector Constructs used in this study.
  • sh indicates short hairpin RNA
  • decoy indicates RNA decoy
  • Rx indicates ribozyme
  • tat HIV tat RNA
  • rev HIV rev RNA
  • tat/rev the shared sequence between HIV rev and tat RNAs
  • CCR5 is the cellular co-receptor for R5 tropic HIV.
  • Embodiment 1 A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein said first RNA promoter is a forward promoter.
  • Embodiment 2 The recombinant nucleic acid of claim 1, further comprising a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second RNA promoter is a reverse promoter.
  • Embodiment 3 The recombinant nucleic acid of claim 2, wherein said recombinant nucleic acid forms part of a viral expression vector.
  • Embodiment 4 The recombinant nucleic acid of claims 1 or 2, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
  • Embodiment 5 The recombinant nucleic acid of any one of claims 1-3, wherein said first RNA promoter is a RNA polymerase II promoter.
  • Embodiment 6 The recombinant nucleic acid of claim 5, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
  • snRNA small nuclear RNA
  • Embodiment 7 The recombinant nucleic acid of claim 6, wherein said snRNA promoter is a Ul promoter.
  • Embodiment 8 The recombinant nucleic acid of any one of claims 2-7, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA.
  • Embodiment 9. The recombinant nucleic acid of claim 8, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • Embodiment 10 The recombinant nucleic acid of claim 9, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
  • Embodiment 11 The recombinant nucleic acid of claims 9 or 10, wherein said viral replication inhibiting siRNA is a Rev siRNA.
  • Embodiment 12 The recombinant nucleic acid of any one of claims 9-1 1, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • Embodiment 13 The recombinant nucleic acid of any one of claims 9-12, wherein said ribozyme is a small nucleolar (sno) RNA.
  • Embodiment 14 The recombinant nucleic acid of claim 13, wherein said snoRNA is a U5 ribozyme.
  • Embodiment 15 The recombinant nucleic acid of any one of claims 9-14, wherein said RNA decoy is a snoRNA.
  • Embodiment 16 The recombinant nucleic acid of claim 15, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
  • Embodiment 17 The recombinant nucleic acid of any one of claims 2-16, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
  • Embodiment 18 The recombinant nucleic acid of any one of claims 2-16, wherein said second RNA promoter is a polymerase III promoter.
  • Embodiment 19 The recombinant nucleic acid of claim 18, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • snRNA small nuclear RNA
  • Embodiment 20 The recombinant nucleic acid of claim 19, wherein said snRNA promoter is a U6 promoter.
  • Embodiment 21 The recombinant nucleic acid of any one of claims 2-20, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
  • Embodiment 22 The recombinant nucleic acid of claim 21, wherein said cellular receptor siRNA is a T cell receptor siRNA.
  • Embodiment 23 The recombinant nucleic acid of claim 22, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
  • Embodiment 24 The recombinant nucleic acid of claim 23, wherein said shRNA is a CCR5 shRNA.
  • Embodiment 25 The recombinant nucleic acid of claim 23, wherein said shRNA is a CXCR4 shRNA.
  • Embodiment 26 The recombinant nucleic acid of any one of claims 2-25, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
  • Embodiment 27 The recombinant nucleic acid of claim 26, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • TNP03 transportin 3
  • Embodiment 28 The recombinant nucleic acid of any one of claims 1-27, further comprising a transcriptional terminator sequence.
  • Embodiment 29 The recombinant nucleic acid of any one of claims 2-28, further comprising a transcriptional terminator sequence.
  • Embodiment 30 The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is an Ul terminator sequence.
  • Embodiment 31 The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
  • Embodiment 32 The recombinant nucleic acid of any one of claims 1-31, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence.
  • Embodiment 33 The recombinant nucleic acid of claim 32, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
  • Embodiment 34 The recombinant nucleic acid of claim 32, wherein said intron sequence is a MCM7 intron sequence.
  • Embodiment 35 The recombinant nucleic acid of any one of claims 2-34, further comprising an antiviral protein encoding sequence.
  • Embodiment 36 The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence is downstream of said viral entry inhibiting RNA encoding sequence.
  • Embodiment 37 The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a C46 fusion inhibitor.
  • Embodiment 38 The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a mutant Rev protein.
  • Embodiment 39 The recombinant nucleic acid of claim 38, wherein said mutant Rev protein is a Rev M10 protein.
  • Embodiment 40 The recombinant nucleic acid of claim 35, further comprising a transcriptional terminator sequence.
  • Embodiment 41 The recombinant nucleic acid of claim 40, wherein said transcriptional terminator sequence is an Ul terminator sequence.
  • Embodiment 42 The recombinant nucleic acid of claims 40 or 41, wherein said transcriptional terminator sequence is downstream of said antiviral protein encoding sequence.
  • Embodiment 43 The recombinant nucleic acid of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • said first RNA promoter is a Ul promoter
  • said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • said second antiviral RNA encoding sequence encodes a Rev siRNA
  • said third antiviral RNA encoding sequence encodes a Tat siRNA
  • said second RNA promoter is a U6 promoter
  • said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • Embodiment 44 The recombinant nucleic of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • said first RNA promoter is a Ul promoter
  • said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • said second antiviral RNA encoding sequence encodes a Rev siRNA
  • said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy
  • said second RNA promoter is a U6 promoter
  • said viral entry inhibiting RNA encoding sequence encodes a CCR5 sh
  • Embodiment 45 The recombinant nucleic acid of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a U5 ribozyme, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • said first RNA promoter is a Ul promoter
  • said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • said second antiviral RNA encoding sequence encodes a U5 ribozyme
  • said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy
  • said second RNA promoter is a U6 promoter
  • Embodiment 46 A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising: (i) a first RNA promoter operably linked to: a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
  • Embodiment 47 The recombinant nucleic acid of claim 46, wherein said recombinant nucleic acid forms part of a viral expression vector.
  • Embodiment 48 The recombinant nucleic acid of claims 46 or 47, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
  • Embodiment 49 The recombinant nucleic acid of any one of claims 46-48, wherein said first RNA promoter is a RNA polymerase II promoter.
  • Embodiment 50 The recombinant nucleic acid of claim 49, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
  • snRNA small nuclear RNA
  • Embodiment 51 The recombinant nucleic acid of claim 50, wherein said snRNA promoter is a Ul promoter.
  • Embodiment 52 The recombinant nucleic acid of any one of claims 46-51, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA.
  • siRNA small interfering RNA
  • Embodiment 53 The recombinant nucleic acid of claim 52, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • Embodiment 54 The recombinant nucleic acid of claim 53, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
  • Embodiment 55 The recombinant nucleic acid of claim 53, wherein said viral replication inhibiting siRNA is a Rev siRNA.
  • Embodiment 56 The recombinant nucleic acid of claim 53, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • Embodiment 57 The recombinant nucleic acid of claim 53, wherein said ribozyme is a small nucleolar (sno) RNA.
  • Embodiment 58 The recombinant nucleic acid of claim 57, wherein said snoRNA is a U5 ribozyme.
  • Embodiment 59 The recombinant nucleic acid of claim 53, wherein said RNA decoy is a snoRNA.
  • Embodiment 60 The recombinant nucleic acid of claim 59, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
  • Embodiment 61 The recombinant nucleic acid of any one of claims 46-60, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
  • Embodiment 62 The recombinant nucleic acid of any one of claims 46-61, wherein said second RNA promoter is a polymerase III promoter.
  • Embodiment 63 The recombinant nucleic acid of claim 62, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
  • snRNA small nuclear RNA
  • Embodiment 64 The recombinant nucleic acid of claim 63, wherein said snRNA promoter is a U6 promoter.
  • Embodiment 65 The recombinant nucleic acid of any one of claims 46-64, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
  • Embodiment 66 The recombinant nucleic acid of claim 65, wherein said cellular receptor siRNA is a T cell receptor siRNA.
  • Embodiment 67 The recombinant nucleic acid of claim 66, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
  • Embodiment 68 The recombinant nucleic acid of claim 67, wherein said shRNA is a CCR5 shRNA.
  • Embodiment 69 The recombinant nucleic acid of claim 67, wherein said shRNA is a CXCR4 shRNA.
  • Embodiment 70 The recombinant nucleic acid of any one of claims 46-69, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
  • Embodiment 71 The recombinant nucleic acid of claim 70, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • Embodiment 72 The recombinant nucleic acid of any one of claims 46-71, further comprising a transcriptional terminator sequence.
  • Embodiment 73 The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is an Ul terminator sequence.
  • Embodiment 74 The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
  • Embodiment 75 The recombinant nucleic acid of any one of claims 46-74, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence.
  • Embodiment 76 The recombinant nucleic acid of claim 75, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
  • Embodiment 77 The recombinant nucleic acid of claim 76, wherein said intron sequence is a MCM7 intron sequence.
  • Embodiment 78 The recombinant nucleic acid of any one of claims 46-77, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • Embodiment 79 The recombinant nucleic acid of any one of claims 46-77, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • Embodiment 80 Embodiment 80.
  • RNA promoter is a Ul promoter
  • said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA
  • said second antiviral RNA encoding sequence encodes a U5 ribozyme
  • said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy
  • said second RNA promoter is a U6 promoter
  • said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
  • Embodiment 81 A mammalian cell comprising a recombinant antiviral polycistronic RNA comprising: (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • Embodiment 82 The mammalian cell of claim 81, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
  • siRNA small interfering RNA
  • Embodiment 83 The mammalian cell of claim 82, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • Embodiment 84 The mammalian cell of claim 83, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
  • Embodiment 85 The mammalian cell of claims 83 or 84, wherein said viral replication inhibiting siRNA is a Rev siRNA.
  • Embodiment 86 The mammalian cell of any one of claims 83, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • Embodiment 87 The mammalian cell of any one of claims 83-86, wherein said ribozyme is a snoRNA.
  • Embodiment 88 The mammalian cell of claim 87, wherein said ribozyme is a U5 ribozyme.
  • Embodiment 89 The mammalian cell of any one of claims 83-88, wherein said RNA decoy is a snoRNA.
  • Embodiment 90 The mammalian cell of any one of claims 83-88, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy
  • Embodiment 91 The mammalian cell of any one of claims 81-90, wherein said viral entry inhibiting RNA is a cellular receptor siRNA.
  • Embodiment 92 The mammalian cell of claim 91, wherein said cellular receptor siRNA is a T cell receptor siRNA.
  • Embodiment 93 The mammalian cell of claim 92, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
  • Embodiment 94 The mammalian cell of claim 93, wherein said shRNA is a CCR5 shRNA.
  • Embodiment 95 The mammalian cell of claim 93, wherein said shRNA is a CXCR4 shRNA.
  • Embodiment 96 The mammalian cell of any one of claims 81-90, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
  • Embodiment 97 The mammalian cell of claim 96, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • TNP03 transportin 3
  • Embodiment 98 The mammalian cell of any one of claims 81-97, further comprising an antiviral protein.
  • Embodiment 99 The mammalian cell of claim 98, wherein said antiviral protein is a C46 fusion inhibitor.
  • Embodiment 100 The mammalian cell of claim 98, wherein said antiviral protein is a mutant Rev protein.
  • Embodiment 101 The mammalian cell of claim 100, wherein said mutant Rev protein is a Rev M10 protein.
  • Embodiment 102 The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat siRNA, and said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 103 The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 104 The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 105 A kit comprising a recombinant antiviral polycistronic RNA comprising, (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
  • Embodiment 106 The kit of claim 105, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
  • siRNA small interfering RNA
  • Embodiment 107 The kit of claims 105 or 106, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
  • Embodiment 108 The kit of claim 107, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
  • Embodiment 109 The kit of any one of claims 105-108, wherein said viral replication inhibiting siRNA is a Rev siRNA.
  • Embodiment 110 The kit of claim 107, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
  • Embodiment 11 1. The kit of claim 107, wherein said ribozyme is a snoRNA.
  • Embodiment 112. The kit of claim 107, wherein said ribozyme is a U5 ribozyme.
  • Embodiment 113 The kit of claim 107, wherein said RNA decoy is a snoRNA.
  • Embodiment 114 The kit of claim 107, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
  • Embodiment 115 The kit of claim 105, wherein said viral entry inhibiting RNA is a cellular receptor siRNA.
  • Embodiment 116 The kit of claim 1 15, wherein said cellular receptor siRNA is a T cell receptor siRNA.
  • Embodiment 117 The kit of claim 116, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
  • Embodiment 118 The kit of claim 117, wherein said shRNA is a CCR5 shRNA.
  • Embodiment 119 The kit of claim 117, wherein said shRNA is a CXCR4 shRNA.
  • Embodiment 120 The kit of any one of claims 105-119, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
  • Embodiment 121 The kit of claim 120, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
  • Embodiment 122 The kit of any one of claims 105-121, wherein said first antiviral
  • RNA is a Tat/Rev siRNA
  • said second antiviral RNA is a Rev siRNA
  • said third antiviral RNA is a Tat siRNA
  • said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 123 The kit of any one of claims 105-121, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 124 The kit of any one of claims 105-121, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
  • Embodiment 125 A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45.
  • Embodiment 126 A method of treating an infectious disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45.
  • Embodiment 127 The method of claim 126, wherein said infectious disease is caused by a virus.
  • Embodiment 128 The method of claim 127, wherein said virus is HIV.
  • Embodiment 129 The method of claim 126, wherein said subject suffers from AIDS.
  • Embodiment 130 A method of inhibiting HIV replication in a patient, said method comprising administering to said patient a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45, thereby inhibiting HIV replication in said patient.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • AIDS & HIV (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Provided herein are, inter alia, antiviral recombinant nucleic acid compositions and methods of using the same. The recombinant nucleic acid compositions include nucleic acids encoding antiviral polycistronic RNAs, which are capable of inhibiting viral replication. The antiviral recombinant nucleic acid compositions provided herein are therefore particularly useful for therapeutic applications such as combinational HIV-1 gene therapy.

Description

RNA-BASED HIV INHIBITORS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Application No. 61/879,617 filed September 18, 2013, which is hereby incorporated in its entirety and for all purposes.
REFERENCE TO A "SEQUENCE LISTING," A TABLE, OR A COMPUTER
PROGRAM LISTING APPENDIX SUBMITTED AS AN ASCII FILE [0002] The Sequence Listing written in file 95058_918244_ST25.TXT, created September 18, 2014, 8,445 bytes, machine format IBM-PC, MS-Windows operating system, is hereby incorporated herein by reference in its entirety and for all purposes.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT [0003] This invention was made with government support under AI 42552, AI29329 and
HL07470 awarded by the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION
[0004] HIV gene expression is a highly regulated process that involves alternative splicing from the full-length 9-kb RNA genome to generate various viral proteins. Early in the replication cycle, transcription elongation is inefficient despite having a functional viral promoter, resulting in short or early terminated transcripts until the early regulatory protein Tat is made. Tat functions to vastly increase transcription through the transactivation of RNA Pol II polymerase from the viral promoter (Garber, M.E., and Jones, K.A., Curr Opin Immunol, 1 1, 460-465 (1999); Kao, S.Y. et al, Nature, 330, 489-493 (1987); Laspia, M.F., Wendel, P., and Mathews, M.B., JMol Biol, 232, 732-746 (1993); Marciniak, R.A., and Sharp, P.A., Embo J., 10, 4189- 4196 (1991); Toohey, M.G., and Jones, K.A., Genes Dev., 3, 265-282 (1989)) via interaction with the transactivation response (TAR) element in the 5' untranslated region (UTR) of the viral RNAs (Kao, S.Y. et al, Nature, 330, 489-493 (1987)). Once Tat is available, transcription becomes processive and multiply spliced transcripts are produced that encode the other regulatory proteins, including Rev. Rev facilitates the export of partially spliced and unspliced transcripts to the cytoplasm for translation into late structural proteins by interactions with the Rev response element (RRE) present on these transcripts (Cullen, B.R., and Malim, M.H., Trends Biochem Sci, 16, 346-350 (1991); Felber, B.K. et al, Proc Natl Acad Sci USA, 86, 1495-1499 (1989); Krug, R.M., Curr Opin Cell Biol, 5, 944-949 (1993)). In addition to their known functions in the nucleus, Tat and Rev exhibit nucleolar-localizing properties with poorly understood functions, hypothesized as part of the transport mechanism or temporal storage [Tat (Li, Y.P., J Virol, 71, 4098-4102 (1997); Luznik, L. et al, J Clin Invest., 95, 328-332 (1995); Ruben, S. et al, J Virol, 63, 1-8 (1989); Siomi, H. et al, J Virol, 64, 1803-1807 (1990);
Stauber, R.H., and Pavlakis, G.N., Virology, 252, 126-136 (1998); Rev (Dundr, M. et al, J Cell Sci., 108, 2811-2823 (1995); Nosaka, T. et al, Exp Cell Res., 209, 89-102 (1993)]. Similarly, full-length and partially spliced HIV transcripts have also been detected by electron microscopy in situ hybridization (Canto-Nogues, C. et al, Micron, 32, 579-589 (2001)). Taken together, these results suggest HIV-1 RNAs traffic through the nucleolus as part of the replication cycle. The importance of the nucleolus during viral replication could be more universal as transcription and replication of Borna disease virus (a negative strand RNA virus) occurs in the nucleolus (Pyper, J.M., Clements, J.E., and Zink, M.C., J Virol, 72, 7697-7702 (1998)). Interestingly, env RNAs from the human T-lymphotropic virus were also detected in the nucleolus (Kalland, K.H. Qt al, New Biol, 3, 389-397 (1991)).
[0005] To investigate whether the nucleolus plays an important role in HIV replication, nucleolar-localizing TAR and RBE RNA decoys (U16TAR and U16RBE, respectively) that function to trap HIV-1 Tat and Rev proteins inside the nucleolus, and a RNA ribozyme that targets a conserved U5 region of HIV-1 RNA (U16U5RZ) were created by substituting these anti-HIV small RNAs for the apical loop of the C/D box U16 small nucleolar RNA (snoRNA) (Fig. 1). The U16 chimeric RNAs were shown to localize in the nucleolus and each was shown to have strong anti-HIV- 1 activity (Michienzi, A. et al, Proc Natl Acad Sci USA, 99, 14047- 14052 (2002); Michienzi, A. et al, AIDS Res Then, 3, 13 (2006; Unwalla, H.J. et al, Mol Ther., 16, 11 13-11 19 (2008)). It was also noted in these studies that the nucleolar-localizing TAR RNA decoy was a far more potent inhibitor than a nuclear-localizing counterpart. These results strengthened the importance of the nucleolar trafficking of Tat during viral replication
(Michienzi, A. et al, Proc Natl Acad Sci USA, 99, 14047-14052 (2002)). Taken together, these findings suggest nucleolar trapping could be a novel avenue for developing anti-HIV therapeutics and support the important functional role of Tat and Rev nucleolar localization in viral replication (Michienzi, A. et al, Proc Natl Acad Sci USA, 99, 14047-14052 (2002)).
[0006] Applicants previously chose the naturally occurring polycistronic miR-106b cluster located in intron 13 of the protein encoding MCM7 gene on chromosome 7 (termed MCM7) as the scaffold to co-express three anti-HIV small interfering RNAs (siRNAs) from a single RNA Pol II human Ul promoter (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). These studies demonstrated efficient expression and processing of three siRNAs that target the common tat/rev exon (SI), rev (S2M), and tat (S3B), respectively, as miRNA mimics (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). Although multiplexing siRNAs is an approach to mitigating viral escape mutants found with a single point mutation in the siRNA target site (Boden, D. et al, J Virol, 77, 1 1531-1 1535 (2003); Das, A.T. et al, J Virol, 78, 2601-2605 (2004); Sabariegos, R. et al, J Virol, 80, 571-577 (2006)), Applicants believe that it is also advantageous to explore the potential for combining different types of small RNA inhibitors to further reduced the likelihood of viral resistance and to exploit the potential synergy between small RNA agents within a single gene therapy construct (Li, M.J., Mol Ther., 8, 196-206
(2003)). The MCM7 platform offers additional advantages and flexibility over multiple small RNA agents expressed with constitutive independent Pol III promoters (e.g., (Li, M.J., Mol Ther., 8, 196-206 (2003))by offering opportunities to engineer tissue specificity by proper promoter choice while reducing toxicity related to over-expression. Applicants previously demonstrated that the MCM7 platform could also be used for co-expression of the U16TAR
RNA decoy by replacing the S3B subunit, as shown by the MCM7-S 1/S2M/U 16TAR construct (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). The processing ofU16TAR was shown to be independent of Drosha, implicating that the snoRNA was processed independently of the siRNAs via the C/D box small nucleolar ribonucleoprotein (snoRNP) processing pathway (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). Here Applicants demonstrate that multiple small nucleolar RNAs can also be incorporated in this platform where they are effectively processed along with the siRNAs to provide a combinatorial, long-term inhibition of HIV-1 replication in CEM T-lymphocytes. The combinations of si/sno RNAs represent a new paradigm for combinatorial RNA-based gene therapy applications. BRIEF SUMMARY OF THE INVENTION
[0007] In one aspect, a recombinant nucleic acid encoding an antiviral polycistronic RNA is provided. The recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter.
[0008] In another aspect, a recombinant nucleic acid encoding an antiviral polycistronic RNA is provided. The recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
[0009] In another aspect, a mammalian cell including a recombinant antiviral polycistronic RNA is provided. The recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
[0010] In another aspect, a kit including a recombinant antiviral polycistronic RNA is provided, The recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
[0011] In another aspect, a pharmaceutical composition including a pharmaceutically acceptable excipient and a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof is provided.
[0012] In another aspect, a method of treating an infectious disease in a subject in need thereof is provided. The method includes administering to the subject a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof.
[0013] In another aspect, a method of inhibiting HIV replication in a patient is provided. The method includes administering to the patient a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Fig. 1. Construction of small nucleolar anti-HIV RNAs. The C/D box U16 small nucleolar RNA (snoRNA) is used as a scaffold to construct nucleolar-localizing anti-HIV small RNAs. The conserved C/D box of the U16 snoRNA is sufficient for the nucleolar-localizing property with the apical loop replaced with various anti-HIV RNAs including the U5 targeting RNA ribozymes (U 16U5RZ), the Rev binding element RNA decoy (U 16RBE), and the transactivation response RNA decoy (U16TAR). Sequence legend: U16U5RZ (SEQ ID NO:21); U16RBE (SEQ ID NO:20); U16TAR (SEQ ID NO:22).
[0015] Fig. 2. Overiew of MCM7 intron-based lentiviral vectors. The name "MCM7" refers to a naturally occurring polycistronic miRNA cluster located in an intron of the MCM7 gene. Exons and intron of the MCM7 cassette are drawn as grey boxes and black lines, respectively, with splice donor and acceptors marked as "SD" and "SA". Promoters are denoted by white boxes with the arrow indicating directionality, while the terminators are denoted by black boxes. shRNA, U16 snoRNA scaffold, and apical loop anti-HIV RNA insert are shown, (a) The MCM7 scaffold allows co-expression of three small RNAs from the single Pol II Ul promoter. SI, S2M, and S3B represent siRNAs targeting the common tat/rev exon, rev, and tat, respectively.
U16U5RZ is a nucleolar-localizing ribozyme targeting a conserved U5 region present in all HIV transcripts. U16TAR is a nucleolar-localizing TAR RNA decoy. U16RBE is a nucleolar- localizing Rev binding element RNA decoy. (b)The MCM7 cassette with the Ul -specific termination sequence (Ult) was cloned into the pHIV7-EGFP lentiviral vector in the forward orientation with respect to the CMV packaging promoter, denoted as "Forward-Ult", while the cassette in the opposite orientation is denoted as "Reverse-Ult." RRE, Rev response element; MCS, multiple cloning site; EGFP, enhanced green fluorescent protein; WPRE, woodchuck hepatitis virus post-transcription regulation element; AU3, deleted U3 region to generate a self- inactivating lentiviral vector after integration in targeted cells. [0016] Fig. 3. Expression of the small RNAs in stably transduced CEM T-lymphocytes.
CEM T-lymphocytes were transduced with lentiviruses containing MCM7 cassette in the forward orientation at an MOI of 50. About 20 μg of total RNA were loaded per lane and electrophoresed in an 8% polyacrylamide gel with 8M urea, blotted onto a nylon membrane, and hybridized with the corresponding 32P-labelled probes. RNA prepared from untransduced cells and cells transduced with empty vector were used as negative controls. SI, S2M, and S3B siRNAs are approximately 21 nucleotides. The U16 snoRNA chimeras are approximately 132 nucleotides. U6 small nuclear RNA serves as a loading control.
[0017] Fig. 4. Anti-HIV activity of MCM7-based constructs. One million untransduced and stable CEM T-lymphocytes were challenged in triplicate with NL4-3 strain of HIV- 1 at an MOI of 0.01 and culture supernatants were collected weekly for the HIV-1 p24 antigen ELISA to evaluate viral replication. The dashed line represents the low detection limit of the p24 assay. Three constructs, MCM7-S1/S2M/S3B, MCM7-S 1/S2M/U 16TAR, and MCM7- S1/U16U5RZ/U16TAR showed potent antiviral activity with almost no detectable viral load during the one-month challenge assay.
[0018] Fig. 5. In vitro viral mediated selection of transduced CEM T-lym hocytes with optimal anti-HIV gene expression, (a) Total RNA was extracted from CEM T-lymphocytes infected with HIV-1 at designated time points (DO, D14, and D28) to evaluate RNA expression. The SI siRNA expression was evaluated by qRT-PCR and normalized by the internal control U6 small nuclear RNA. (b) Total RNA was extracted from CEM T-lymphocytes infected with HTV- 1 at designated time points (DO, D14, and D28) to evaluate RNA expression. The U16 TAR RNA decoy expression was evaluated by qRT-PCR and normalized by the internal control U6 small nuclear RNA. p<0.05, **p<0.01, ***p<0.001, difference compared to uninfected control (DO).
[0019] Fig. 6. Anti-HIV RNA expression correlates with HIV-1 pNL4-3 luciferase knockdown activity. Left panel: HEK293 cells were transfected at 80% confluency in 48-well plate with 20 ng of replication-deficient pNL4-3 proviral DNA harboring the firefly luciferase gene (pNL4-3.Luc.R-.E, NIH AIDS reagent and repository) and 3.17xl0~2 pmole of plasmids with the anti-HIV RNAs driven either by the Ul or U6 promoter (in 300 ng total mass with pBluescript plasmid) complexed with Lipofectamine 2000 (Invitrogen). The pNL4-3 luciferase construct maintains targets for each of the small RNAs in all the transcripts, both spliced and unspliced and therefore luciferase readouts can be utilized as quantitative readouts of viral inhibition. Firefly luciferase output was normalized to the internal control Renilla luciferase to account for differences in transfection efficiency. Data presented consist of two independent experiments. **p<0.01. Right panel: HEK293 cells were transiently transfected at 90% confluency in 6-well plate with 0.334 pmole of either the MCM7 cassette containing three snoRNAs or single snoRNA expressed with U6 promoter (pTZ/U6-U16RBE, pHIV7-U6- U16U5RZ, or pTZ/U6-U16TAR), or their combinations, in total mass of 4 μg with pBluescript plasmid, complexed with Lipofectamine 2000 (Invitrogen). Total RNA was extracted 48 hours later with STAT-60 reagent according to manufacturer's instructions. About 10 μg of total RNA were loaded per lane and RNA was detected with 32P-labelled probes as described in Material and Methods.
[0020] Fig. 7. Second generation RNA-based gene therapy constructs. Schematic MCM7 transgene expression is shown. [0021] Fig. 8. Northern blotting experiment to investigate transgene expression level with cassette orientation. HEK 293 cells were transiently transfected with constructs carrying the RNA cassettes and total RNA extracted 48 hours post transfection. Left panel: Bifunctional siRNAs (CCR5-5) targeting UTR regions of CCR5 and HIV were expressed as a pre-miRNA ("NTS") or as a shRNA ("19sh"). Right panel: siRNA against coding region of CCR5 ("CCR5- 12sh") was expressed as from the Pol III tRNASer promoter in forward ("F") or reverse ("R") orientations. About 20 μg of total RNA was loaded per lane and electrophoresed in an 8% polyacrylamide gel with 8 M urea, blotted onto a nylon membrane, and hybridized with the corresponding 32P-labeled probes. The expression cassette can produce mature siRNA sequences that are approximately 21 nucleotides. U2A small nuclear RNA serves as a loading control. In all cases, cassette in reverse orientation consistently gives more transgene expression.
[0022] Fig. 9. Psi-check assay to monitor down-regulation of CCR5 and HIV UTR targets. In this experiment the target sequence is cloned in the 3' UTR of the reporter Renilla luciferase gene and the fusion transcript is subject to gene silencing by RNA interference. The firefly luciferase reporter serves as a mean to normalize for differences in transfection efficiency. The ratio of Renilla and firefly luciferase expression provides a measure of gene silencing. In this context, bifunctionality siRNAs expressed as a pre-miRNA or as a shRNA are both capable of mediating HIV and CCR5 target knockdown.
[0023] Fig. 10. Effect of mature siRNA sequences and CCR5 surface expression.
Applicants utilized the U373-MAGI-CCR5E cell line (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH and as published in Vodicka M.A., Virology, 233: 193- 198, (1997)) that over-expresses CCR5 and transiently transfected Applicants' constructs to monitor (A) CCR5 expression and (B) CD4 expression by flow cytometry. Specific decrease in CCR5 expression was only observed with cells transfected with tRNASer-CCR5-12sh cassette. [0024] Fig. 11. Northern analysis of anti-HIV small RNA expression in stably transduced CEM T lymphocytes. CEM T lymphocytes were transduced and sorted based on GFP expression. Northern analysis was performed to validate correct small RNA transgene expression and processing. RNA prepared from untransduced cells and cells transduced with empty vector were used as negative controls. SI, S2M, S3B, and CCR5-12sh siRNAs are approximately 21 -nt. The Ul 6 snoRNA chimeras are 132-nt. The small nuclear U2A RNA served as a loading control. Northern analysis is shown in the left panel, loading scheme is shown in the right panel. [0025] Fig. 12. Anti-HIV activity of MCM7-based constructs. One million untransduced and stably transduced CEM T-cells were challenged with JR-FL strain of HIV- 1 at MOI of 0.01 and culture supernatants were collected weekly for the HIV-1 p24 ELISA to evaluate viral replication. Second generation MCM7 -based constructs potently inhibited viral replication with 3 to 5-log reduction of p24 production during the 42-day viral challenge.
[0026] Fig. 13. Overview of strategies to multiplex small RNAs with different classes of promoters, a) pHIV7 lentiviral with MGMTP140K selectable marker (pLV). Applicants utilized a third generation HIV-1 based lentiviral vector (pHIV7) with EGFP marker to label gene modified cells. The chemical resistance MGMTP140K gene is co-expressed with EGFP with a self-cleaving P2A peptide with the CMV promoter, b) First generation lentiviral vector (FGLV) with small RNAs expressed from independent RNA Pol III promoters. In the first generation lentiviral vector, each antiviral small RNA transgene is expressed independently from RNA Pol III promoter, c) Second generation lentiviral vector (SGLV) with small RNAs expressed in the MCM7 polycistronic platform with single RNA Pol II promoter. The naturally occurring miRNA cluster in the intron of the human MCM7 gene was engineered to co-express different classes of antiviral small RNAs with single Pol II Ul promoter for ubiquitous transgene expression in all hematopoietic lineages. Independent Pol III RNA cassettes can be incorporated for expression of up to five small RNAs. The tRNASer-CCR5sh cassette was incorporated into the 3 ' intron of MCM7 in both orientations ("F" Forward and "R" Reverse) with respect to the parental Ul promoter. The U6-U16TAR cassette was cloned downstream of the Ul termination signal. Promoters: CMV, cytomegalovirus promoter and enhancer sequence (Pol II); U6, human small nuclear U6 promoter (Pol III); VA1, adenoviral promoter (Pol III); Ul, human small nuclear Ul promoter (Pol II); tRNASer, human transfer RNA Serine promoter (Pol III). Small RNA trans genes: SI, tat/rev siRNA; S2M; rev siRNA; S3B tat siRNA; CCR5sh, CCR5- targeting shRNA; U16TAR, nucleolar TAR RNA decoy; U16U5RZ, nucleolar U5-targeting ribozyme; CCR5RZ, CCR5 -targeting ribozyme.
[0027] Fig. 14. Biological activity of tRNASer-CCR5sh cassette, a) Potent CCR5 knockdown in U373-MAGI-CCR5E cells. Plasmid with only the tRNASer promoter sequence (solid black line) or with the tRNASer-CCR5sh cassette (dashed grey line) was transiently transfected into CCR5 over-expressing U373-MAGI-CCR5E cells with knockdown estimated by flow cytometry 72 hours later. Potent and specific down-regulation of CCR5 surface expression was only observed with the construct containing the CCR5sh RNA. b) Potent CCR5 transcript degradation in CD34-derived macrophages. Adult CD34+ HSPCs were transduced with the indicated lentiviral vectors, sorted based on EGFP expression, then differentiated into macrophages as described in Methods and Materials. CCR5 transcript knockdown was measured by qRT-PCR with normalization with GAPDH housekeeping gene then to the untransduced control. tRNASer-CCR5sh cassette in the context of MCM7 platform induced potent silencing in gene modified macrophages.
[0028] Fig. 15. Optimization of the tRNASer-CCR5sh cassette expression in the MCM7 platform, a) Orientation dependence of the tRNASer-CCR5sh cassette in MCM7. The tRNASer- CCR5sh cassette was cloned in 3 ' intron of MCM7 either in the forward (SGLV3) or reverse (SGLV4) orientation, then transiently transfected into HEK 293 cells to evaluate transgene expression and processing by Northern blotting. Northern blotting distinguishes products in various steps of processing due to difference in size [tRNASer-CCR5sh fusion transcript (-130- 140 nt) that requires tRNase Z processing; shRNA (~50-60nt) that requires Dicer processing; siRNA (20-23 nt) represents the completely processed mature siRNA that is capable of mediating silencing]. In this case, the probe detected the guide strand that mediates CCR5 silencing. Northern blotting demonstrated tRNASer-shRNA cassette is efficiently processed by the RNA interference pathway as the mature siRNA is the predominate product. Furthermore, SGLV4 gives 2.4-fold enhancement in transgene expression in comparison with the opposite orientation after normalization with the loading control U2A RNA. b) Placement dependence of the tRNASer-CCR5sh cassette. Placement of tRNASer-CCR5sh cassette in the lentiviral vector dramatically affects transgene expression in sorted stably expressing CEM T lymphocytes. Although the CCR5sh cassette is driven independently from the tRNASer promoter, the expression was much lower in the context of MCM7 platform ("inside of MCM7") compared to as a separate entity ("outside MCM7"). In the latter scenario, over-expression is evident by the presence of unprocessed products (i.e., bands representing tRNASer-CCR5sh fusion transcript and shRNA).
[0029] Fig. 16. Northern blot of stably expressing CEM T lymphocytes demonstrates efficient processing and expression of small RNAs. CEM T lymphocytes were transduced with indicated lentiviruses carrying the combinational vectors then sorted by EGFP expression to create stably expressing cell lines. Small RNA transgenes were detected by P32 labeled probes. U2A small nuclear RNA serves as a loading control. S I, S2M, S3B, CCR5sh represent 20-23 nt fully processed siRNAs. U16U5RZ and U16TAR are U16 snoRNA chimeras that are approximately 132 nucleotides. CCR5RZ is approximately 230 nucleotides. [0030] Fig. 17. Intracellular HIV-1 staining demonstrates potent antiviral protection for macrophages derived from gene modified CD34+ HSPCs. Macrophages differentiated from adult CD34+ HSPCs transduced with indicated lentiviral vectors (a) uninfected; b) untransduced; c) FGLV; d) SGLVl ; e) SGLV2; f) SGLV4; g) SGLV5; h) SGLV6; i) SGLV 7) were challenged with HIV-1 Bal at MOI = 0.01. Viral infection was monitored by intracellular staining by flow cytometry with an antibody specific to HIV-1 core proteins. Data from 18 days post infections are shown. Background signal for intracellular staining was established with an uninfected control with identical culture and staining protocol. Intracellular staining showed a high degree of infection in unprotected macrophages, with some constructs with intermediate protection while differentiating some with excellent protection.
[0031] Fig. 18. Kinetics of R5 tropic HIV-1 Bal infection in adult CD34+ HSPC derived macrophages monitored by intracellular HIV staining. Kinetics of HIV- 1 Bal infection in macrophages differentiated from gene modified HSPCs were followed by intracellular HIV staining for a total of 42 days to evaluate long term protection and viral breakthrough. Over- expression of therapeutic small RNAs with independent Pol III promoters (FGLV) provided potent protection for up to 28 days but eventual breakthrough. In the long term, SGLV2 provided the longest protection with the incorporation of tRNASer-CCR5sh (SGLV4) and U6-U16TAR (SGLV7) cassettes less optimal.
[0032] Fig. 19. In vitro CFU assay to identify potential vector toxicity on hematopoietic potential. Transduced CD34+ HSPCs were sorted on CD34+/EGFP expression after expansion with SRI . A total of 500 sorted cells per sample were plated on methylcellulose medium in triplicate with number of colonies counted 12 to 13 days later. The absolute number of CFUs was normalized to the respective donor to account for differences in hematopoietic potential in donor viability. Result represented data from at least two independent donors and significant results were shown. * p<0.05, *** p<0.001, **** p < 0.0001.
[0033] Fig. 20. In vivo drug selection enhances the frequency of gene modified cells in the bone marrow and spleen of humanized NSG mice expressing MGMTP140K. Analysis of NSG mice transplanted with gene modified HSPCs expressing MGMTP140K and treated with two or three doses of 06-BG/BCNU as described in text. Each mouse received lxlO6 CD34+ HSPCs following transduction at the date of transplantation and 20μg Fc/IL7 protein for 11 weeks, (a) Frequency of CD45+ cells in the bone marrow of treated mice, (b) Frequency of CD45+/GFP+ cells in the bone marrow of treated mice, (c) Frequency of CD45+ cells in the spleens of treated mice, (d) Frequency of CD45+/GFP+ cells in the spleen of treated mice, (e) Frequency of CD3+/CD4+/GFP+ cells in the spleen of treated mice (gated on CD45+ population), (f) Frequency of CD14+/CD4+/GFP+ cells in the spleen of treated mice (gated on CD45+ population). **p<0.01, ***p<0.001, **** pO.0001.
[0034] Fig. 21. Serum viremia in mice infected with HIV-lBai- Mice were transplanted with CD34+ HSPC transduced as described in text and infected with HIV-lBal at 11 weeks after transplant. UTDX = untransduced controls, TDX transduced with indicated vector. Mice analyzed for FGLV UTDX N= 7, TDX N=6 (left panel); for SGLV2, UTDX N=7, TDX N=8 (mid panel); for SGLV4 UTDX N=7, TDX N=3 (right panel).
[0035] Fig. 22. Levels of engraftment of cells following HIV challenge of humanized NSG mice. A) Overall CD3+/CD4+ T-cell levels among the CD45+ human cells in the spleen of humanized NSG mice 6 weeks after saline or HlV- leai challenge. B) Level of CD45+/GFP+ cells in the same animals. C) Level of CD3+/CD4+/GFP+ T-cells among the CD45+ cells in same animals. D) Level of CD4+/CD14+/GFP+ monocytes among the CD45+ cells in same animals. DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS
[0036] While various embodiments and aspects of the present invention are shown and described herein, it will be obvious to those skilled in the art that such embodiments and aspects are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.
[0037] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, without limitation, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.
[0038] The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. [0039] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. See, e.g., Singleton et al, DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed., J. Wiley & Sons (New York, NY 1994); Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL, Cold Springs Harbor Press (Cold Springs Harbor, NY 1989). Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of this invention. The following definitions are provided to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
[0040] "Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, or complements thereof. The term "polynucleotide" refers to a linear sequence of nucleotides. The term "nucleotide" typically refers to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including siRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA. The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, and 2- O-methyl ribonucleotides.
[0041] The words "complementary" or "complementarity" refer to the ability of a nucleic acid in a polynucleotide to form a base pair with another nucleic acid in a second polynucleotide. For example, the sequence A-G-T is complementary to the sequence T-C-A. Complementarity may be partial, in which only some of the nucleic acids match according to base pairing, or complete, where all the nucleic acids match according to base pairing.
[0042] Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are near each other, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
[0043] The term "gene" means the segment of DNA involved in producing a protein; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The leader, the trailer as well as the introns include regulatory elements that are necessary during the transcription and the translation of a gene. Further, a "protein gene product" is a protein expressed from a particular gene. [0044] The terms "transfection", "transduction", "transfecting" or "transducing" can be used interchangeably and are defined as a process of introducing a nucleic acid molecule or a protein to a cell. Nucleic acids are introduced to a cell using non-viral or viral-based methods. The nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. Non-viral methods of transfection include any appropriate transfection method that does not use viral DNA or viral particles as a delivery system to introduce the nucleic acid molecule into the cell. Exemplary non- viral transfection methods include calcium phosphate transfection, liposomal transfection, nucleofection, sonoporation, transfection through heat shock, magnetifection and electroporation. In some embodiments, the nucleic acid molecules are introduced into a cell using electroporation following standard procedures well known in the art. For viral-based methods of transfection any useful viral vector may be used in the methods described herein. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors. In some embodiments, the nucleic acid molecules are introduced into a cell using a retroviral vector following standard procedures well known in the art. The terms "transfection" or "transduction" also refer to introducing proteins into a cell from the external environment. Typically, transduction or transfection of a protein relies on attachment of a peptide or protein capable of crossing the cell membrane to the protein of interest. See, e.g., Ford et al. (2001) Gene Therapy 8: 1-4 and Prochiantz (2007) Nat. Methods 4: 119-20.
[0045] The word "expression" or "expressed" as used herein in reference to a gene means the transcriptional and/or translational product of that gene. The level of expression of a DNA molecule in a cell may be determined on the basis of either the amount of corresponding mRNA that is present within the cell or the amount of protein encoded by that DNA produced by the cell. The level of expression of non-coding nucleic acid molecules (e.g., siRNA) may be detected by standard PCR or Northern blot methods well known in the art. See, Sambrook et ah, 1989 Molecular Cloning: A Laboratory Manual, 18.1-18.88.
[0046] Expression of a transfected gene can occur transiently or stably in a cell. During "transient expression" the transfected gene is not transferred to the daughter cell during cell division. Since its expression is restricted to the transfected cell, expression of the gene is lost over time. In contrast, stable expression of a transfected gene can occur when the gene is co- transfected with another gene that confers a selection advantage to the transfected cell. Such a selection advantage may be a resistance towards a certain toxin that is presented to the cell. Expression of a transfected gene can further be accomplished by transposon-mediated insertion into to the host genome. During transposon-mediated insertion, the gene is positioned in a predictable manner between two transposon linker sequences that allow insertion into the host genome as well as subsequent excision. Stable expression of a transfected gene can further be accomplished by infecting a cell with a lentiviral vector, which after infection forms part of (integrates into) the cellular genome thereby resulting in stable expression of the gene. [0047] The term "plasmid" refers to a nucleic acid molecule that encodes for genes and/or regulatory elements necessary for the expression of genes. Expression of a gene from a plasmid can occur in cis or in trans. If a gene is expressed in cis, the gene and the regulatory elements are encoded by the same plasmid. Expression in trans refers to the instance where the gene and the regulatory elements are encoded by separate plasmids. [0048] The term "promoter" or "regulatory element" refers to a region or sequence
determinants located upstream or downstream from the start of transcription and which are involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. Promoters need not be of viral origin, for example, mammalian cellular promoters, such as the polymerase II promoter Ul and polymerase III promoter tRNASer may be used in the present invention.
[0049] A "siRNA," "small interfering RNA," "small RNA," or "RNAi" as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when expressed in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In one
embodiment, a siRNA or RNAi refers to a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. In embodiments, the siRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. Non-limiting examples of siRNAs include ribozymes, RNA decoys, short hairpin RNAs (shRNA), micro RNAs (miRNA) and small nucleolar RNAs (snoRNA).
[0050] The term "antiviral RNA" as provided herein refers to an RNA that is capable of inhibiting the activity (e.g., transcription, translation, replication, infectivity) of a virus. In embodiments, the antiviral RNA binds to a target viral nucleic and reduces transcription of the target viral nucleic acid or reduces the translation of the target viral nucleic acid (e.g.mRNA) or alters transcript splicing. In embodiments, the antiviral RNA is a nucleic acid that is capable of binding (e.g. hybridizing) to a target viral nucleic acid (e.g. an Rev RNA) and reducing translation of the target viral nucleic acid. The target viral nucleic acid is or includes one or more target nucleic acid sequences to which the antiviral RNA binds (e.g. hybridizes). In embodiments, the antiviral RNA is or includes a sequence that is capable of hybridizing to at least a portion of a target viral nucleic acid at a target viral nucleic acid sequence. Non-limiting examples of an antiviral RNA include siRNAs, ribozymes, RNA decoys, snoRNAs and shRNAs. [0051] A "polycistronic RNA" as provided herein refers to an RNA sequence including more than one (e.g., 2, 3, 4, 5, 6, 7) open reading frame (nucleic acid sequence encoding a polypeptide or an antiviral RNA). A polycistronic RNA as provided herein may include one promoter controlling the expression of all open reading frames encoded by the polycistronic RNA. In embodiments, the polycistronic RNA includes more than one promoter and one or more of the open reading frames included in the polycistronic RNA are expressed by an independent promoter.
[0052] The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all. Transgenic cells and plants are those that express a heterologous gene or coding sequence, typically as a result of recombinant methods.
[0053] The term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid or protein) that originates from outside a given cell or organism. For example, an "exogenous promoter" as referred to herein is a promoter that does not originate from the plant it is expressed by. Conversely, the term "endogenous" or "endogenous promoter" refers to a molecule or substance that is native to, or originates within, a given cell or organism.
[0054] The term "isolated", when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It can be, for example, in a homogeneous state and may be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid
chromatography. A protein that is the predominant species present in a preparation is substantially purified. [0055] The terms "protein", "peptide", and "polypeptide" are used interchangeably to denote an amino acid polymer or a set of two or more interacting or bound amino acid polymers. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. [0056] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. The terms "non-naturally occurring amino acid" and "unnatural amino acid" refer to amino acid analogs, synthetic amino acids, and amino acid mimetics which are not found in nature.
[0057] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical
Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0058] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence with respect to the expression product, but not with respect to actual probe sequences.
[0059] The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site
http://www.ncbi.nlm.nih.gov/BLAST/ or the like). Such sequences are then said to be
"substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length. [0060] For specific proteins described herein (e.g., CXCR4, CCR5, TNP03, C46 fusion inhibitor, RevMlO), the named protein includes any of the protein's naturally occurring forms, or variants or homologs that maintain the protein transcription factor activity (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein). In some embodiments, variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form. In other embodiments, the protein is the protein as identified by its NCBI sequence reference. In other embodiments, the protein is the protein as identified by its NCBI sequence reference or functional fragment or homolog thereof. [0061] A "MCM7 gene" as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding DNA replication licensing factor MCM7 or variants or homologs thereof that maintain MCM7 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to MCM7). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MCM7 polypeptide. In embodiments, the MCM7 gene is substantially identical to the nucleic acid identified by the NCBI reference number Gene ID: 4176 or a variant or homolog having substantial identity thereto. [0062] "CXCR4" or "CXCR4 gene" as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the C-X-C chemokine receptor type 4 or variants or homologs thereof that maintain CXCR4 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CXCR4). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CXCR4 polypeptide. In embodiments, the CXCR4 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 56790928 or a variant or homolog having substantial identity thereto.
[0063] "CCR5" or "CCR5 gene" as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the C-C chemokine receptor type 5 or variants or homologs thereof that maintain CCR5 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to CCR5). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CCR5 polypeptide. In embodiments, the CCR5 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 154091327 or a variant or homolog having substantial identity thereto.
[0064] "TNP03 " or "TNP03 gene" as referred to herein includes any of the recombinant or naturally-occurring forms of the gene encoding the transportin-3 protein or variants or homologs thereof that maintain TNP03 protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to TNP03). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring TNP03 polypeptide. In embodiments, the TNP03 gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 300934784 or a variant or homolog having substantial identity thereto.
[0065] "Tat" or "Tat gene" as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding the HIV-1 trans-activator of transcription or variants or homologs thereof that maintain Tat protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Tat). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Tat polypeptide. In embodiments, the Tat gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 1229009 or a variant or homolog having substantial identity thereto. [0066] "Rev" or "Rev gene" as referred to herein includes any of the recombinant or naturally- occurring forms of the gene encoding the regulator of expression of virion proteins or variants or homologs thereof that maintain Rev protein activity (e.g. within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to Rev). In some aspects, the variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring Rev polypeptide. In embodiments, the Rev gene is substantially identical to the nucleic acid identified by the NCBI reference number GI: 9629359 or a variant or homolog having substantial identity thereto.
[0067] A "Rev M10 protein" as referred to herein is a dominant negative mutant of a Rev protein or homolog thereof. In embodiments, the Rev M10 protein is substantially identical to the protein identified by the NCBI reference number ID 238635393. [0068] The term "sample" includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histological purposes. Such samples include blood and blood fractions or products (e.g., bone marrow, serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, other biological fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc. A sample is typically obtained from a "subject" such as a eukaryotic organism, most preferably a mammal such as a primate, e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish. In some embodiments, the sample is obtained from a human.
[0069] A "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample. For example, a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control). A control can also represent an average value gathered from a number of tests or results. One of skill in the art will recognize that controls can be designed for assessment of any number of parameters. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects). One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant. [0070] As used herein, the term "infectious disease" refers to a disease or condition related to the presence of an organism (the agent or infectious agent) within or contacting the subject or patient. Examples include a bacterium, fungus, virus, or other microorganism. A "bacterial infectious disease" is an infectious disease wherein the organism is a bacterium. A "viral infectious disease" is an infectious disease wherein the organism is a virus.
[0071] The term "associated" or "associated with" as used herein to describe a disease (e.g. an infectious disease) means that the disease (e.g. HIV infection) is caused by, or a symptom of the disease is caused by, or a symptom of the disease is caused by a virus (e.g., HIV).
[0072] As used herein, "treatment" or "treating," or "palliating" or "ameliorating" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder. For prophylactic benefit, the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
Treatment includes preventing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition prior to the induction of the disease; suppressing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition after the inductive event but prior to the clinical appearance or reappearance of the disease; inhibiting the disease, that is, arresting the development of clinical symptoms by administration of a protective composition after their initial appearance; preventing re-occurring of the disease and/or relieving the disease, that is, causing the regression of clinical symptoms by administration of a protective composition after their initial appearance.
[0073] The terms "prevent," "preventing" or "prevention," and other grammatical equivalents as used herein, include to keep from developing, occur, hinder or avert a disease or condition symptoms as well as to decrease the occurrence of symptoms. The prevention may be complete (i.e., no detectable symptoms) or partial, so that fewer symptoms are observed than would likely occur absent treatment. The terms further include a prophylactic benefit. For a disease or condition to be prevented, the compositions may be administered to a patient at risk of developing a particular disease (e.g. hematological disease), or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made.
[0074] Where combination treatments are contemplated, it is not intended that the agents (i.e. viral expression vectors, recombinant viral particles) described herein be limited by the particular nature of the combination. For example, the agents described herein may be administered in combination as simple mixtures as well as chemical hybrids. An example of the latter is where the agent is covalently linked to a targeting carrier or to an active pharmaceutical. Covalent binding can be accomplished in many ways, such as, though not limited to, the use of a commercially available cross-linking agent.
[0075] An "effective amount" is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, reduce one or more symptoms of a disease or condition, reduce viral replication in a cell). An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a
"therapeutically effective amount." A "reduction" of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A "prophylactically effective amount" of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. An "activity decreasing amount," as used herein, refers to an amount of antagonist required to decrease the activity of an enzyme or protein (e.g. Tat, Rev) relative to the absence of the antagonist. A "function disrupting amount," as used herein, refers to the amount of antagonist required to disrupt the function of an enzyme or protein relative to the absence of the antagonist. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins). [0076] "Patient" or "subject in need thereof refers to a living organism suffering from or prone to a disease or condition that can be treated by using the methods provided herein. The term does not necessarily indicate that the subject has been diagnosed with a particular disease, but typically refers to an individual under medical supervision. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. In embodiments, a patient is human.
[0077] "Contacting" is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including
biomolecules, or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated, however, that the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents which can be produced in the reaction mixture. Contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a recombinant viral particle as described herein and a cell. [0078] As defined herein, the term "inhibition", "inhibit", "inhibiting" and the like in reference to an siRNA or protein-inhibitor interaction means negatively affecting (e.g., decreasing) the activity or function of the protein (e.g. decreasing gene transcription or translation) relative to the activity or function of the protein in the absence of the inhibitor. In embodiments, inhibition refers to reduction of a disease or symptoms of disease (e.g., HIV infection). In embodiments, inhibition refers to a reduction in the activity of a signal transduction pathway or signaling pathway (e.g. reduction of viral replication). Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating transcription, translation, signal transduction or enzymatic activity or the amount of a protein (e.g. a viral protein or a cellular protein). In embodiments, inhibition refers to inhibition of Tat. In embodiments, inhibition refers to inhibition of Rev. In embodiments, inhibition refers to inhibition of CCR5. In embodiments, inhibition refers to inhibition of CXCR4.
[0079] The terms "inhibitor," "repressor" or "antagonist" or "downregulator" interchangeably refer to a substance that results in a detectably lower expression or activity level as compared to a control. The inhibited expression or activity can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less than that in a control. In certain instances, the inhibition is 1.5-fold, 2-fold, 3- fold, 4-fold, 5-fold, 10-fold, or more in comparison to a control. An "inhibitor" is a siRNA, (e.g., shRNA, miRNA, snoRNA, RNA decoy, ribozyme), compound or small molecule that inhibits viral infection (e.g., replication) e.g., by binding, partially or totally blocking stimulation, decrease, prevent, or delay activation, or inactivate, desensitize, or down-regulate signal transduction, gene expression or enzymatic activity necessary for protein activity. Inhibition as provided herein may also include decreasing or blocking a protein activity (e.g., activation of viral transcription) by expressing a mutant form of said protein thereby decreasing or blocking its activity.
[0080] "Pharmaceutically acceptable excipient" and "pharmaceutically acceptable carrier" refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions of the present invention without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds of the invention. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present invention. [0081] The term "pharmaceutically acceptable salt" refers to salts derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like. [0082] The term "preparation" is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it.
Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration. [0083] As used herein, the term "administering" means oral administration, administration as a suppository, topical contact, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. By "co-administer" it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies, for example cancer therapies such as chemotherapy, hormonal therapy, radiotherapy, or immunotherapy. The compounds of the invention can be administered alone or can be coadministered to the patient. Coadministration is meant to include simultaneous or sequential administration of the compounds individually or in combination (more than one compound). Thus, the preparations can also be combined, when desired, with other active substances (e.g. to reduce metabolic degradation). The compositions of the present invention can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
[0084] The term "aberrant" as used herein refers to different from normal. When used to described enzymatic activity, aberrant refers to activity that is greater or less than a normal control or the average of normal non-diseased control samples. Aberrant activity may refer to an amount of activity that results in a disease, wherein returning the aberrant activity to a normal or non-disease-associated amount (e.g. by using a method as described herein), results in reduction of the disease or one or more disease symptoms.
RECOMBINANT NUCLEIC ACIDS
[0085] Provided herein are, inter alia, antiviral recombinant nucleic acid compositions and methods of using the same. The recombinant nucleic acid compositions include nucleic acids encoding antiviral polycistronic RNAs, which are capable of inhibiting the activity of viral proteins (e.g., Tat, Rev) as well as the expression of cellular proteins (e.g., CCR5) utilized by the virus during its lifecycle. The antiviral recombinant nucleic acid compositions provided herein are therefore particularly useful for therapeutic applications such as combinational HIV-1 gene therapy. [0086] The recombinant nucleic acids provided herein may encode a plurality of antiviral RNAs (e.g., siRNA, miRNA, shRNA, snoRNA). Thus, in one aspect, a recombinant nucleic acid encoding an antiviral polycistronic RNA is provided. The recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter.
[0087] An RNA promoter as provided herein refers to a nucleic acid sequence located upstream or downstream from the start of transcription of an RNA (e.g., siRNA, miRNA, shRNA, snoRNA). The RNA promoter provided herein may be a forward promoter or a reverse promoter. Where the RNA promoter is a forward promoter, the RNA polymerase synthesizes RNA from said promoter using the DNA antisense strand as template. Where the RNA promoter is a reverse promoter, the RNA polymerase synthesizes RNA using the DNA sense strand as template. The DNA sense strand corresponds to the mRNA strand or coding strand, whereas the DNA antisense strand corresponds to the non-coding strand, which is complementary to the mRNA. As provided herein the RNA promoter is involved in recognition and binding of RNA polymerase and other proteins to initiate transcription of the RNA. The RNA promoters contemplated for the present invention including embodiments thereof may be polymerase II or polymerase III promoters. Non-limiting examples of RNA promoters include polymerase II promoters such as the Ul promoter, the human elongation factor- 1 alpha (EF-1 alpha) promoter, the cytomegalovirus (CMV) promoter, the human ubiquitin promoter, and the spleen focus- forming virus (SFFV) promoter; and the polymerase III promoters such as the U6 promoter, the HI promoter, the tRNALys promoter, the tRNASer promoter and the tRNA^8 promoter. Thus, in embodiments, the first RNA promoter is an RNA polymerase II promoter. In embodiments, the RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a U 1 promoter.
[0088] In embodiments, the recombinant nucleic acid further includes a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein the second RNA promoter is a reverse promoter. In embodiments, the second RNA promoter is downstream of the third antiviral RNA encoding sequence. In embodiments, the second RNA promoter is a polymerase III promoter. In embodiments, the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a U6 promoter.
[0089] A viral entry inhibiting RNA encoding sequence as provided herein refers to a nucleic acid, which upon expression in a cell inhibits entry of a virus (e.g., HIV) into the cell. The viral entry inhibiting RNA may be a siRNA or a protein encoding RNA. Thus, in embodiments, the viral entry inhibiting RNA encoding sequence encodes a siRNA. In embodiments, the viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA. In embodiments, the cellular receptor siRNA is a T cell receptor siRNA. In embodiments, the T cell receptor siRNA is a small hairpin (sh) RNA. In embodiments, the shRNA is a CCR5 shRNA. In embodiments, the shRNA is a CXCR4 shRNA. In embodiments, the viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA. In embodiments, the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA. [0090] The recombinant nucleic acid provided herein may form part of a viral expression vector. A "viral vector" or "viral expression vector" is a viral-derived nucleic acid that is capable of transporting another nucleic acid into a cell. A viral vector is capable of directing expression (i.e. transcription and/or translation) of an RNA, a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. A viral expression vector may include a viral expression vector promoter (e.g., LTR) controlling transcription of an RNA, a protein or proteins encoded by one or more genes carried by the vector when it is present in the appropriate environment. Antisense constructs or sense constructs that are not or cannot be translated are expressly included by this definition. Examples for viral vectors include, but are not limited to retroviral, adenoviral, lentiviral and adeno-associated viral vectors. The viral expression vector provided herein may include nucleic acid sequences encoding for a selectable marker protein (e.g., the human methylguanine methyltransferase mutant P I 40K/MGMT) to select for cells including the viral expression vector. The viral expression vector may include nucleic acid sequences encoding for an antiviral protein (e.g., C46 fusion inhibitor, Rev M10 protein). The viral expression vector may further include regulatory sequences necessary to express the selectable marker and/or the antiviral protein. The promoter controlling expression of the selectable marker protein and the antiviral protein is referred to herein as "protein promoter." In embodiments, the viral expression marker includes a protein promoter. In embodiments, the protein promoter is a polymerase II promoter.
[0091] As described above the first RNA promoter may be a forward promoter. The recombinant nucleic acid provided herein including embodiments thereof may form part of a viral expression vector. Where the recombinant nucleic acid provided herein including embodiments thereof forms part of a viral expression vector and where the first RNA promoter is a forward promoter, the first RNA promoter has the same transcriptional direction (direction of mRNA synthesis) as the protein promoter or the viral expression vector promoter. Where two promoters have the same transcriptional direction, the polymerase synthesizing (transcribing) mRNA from those promoters uses the same template strand (e.g., sense or antisense). Thus, the antiviral RNA encoding sequences operably linked to (transcriptionally controlled by) the first RNA promoter, are transcribed in the same direction as the genes operably linked to (transcriptionally controlled by) the protein promoter or the viral expression vector promoter, when the first RNA promoter is a forward promoter. The recombinant nucleic acid provided herein including embodiments thereof may further include a second RNA promoter, which promoter may be a reverse promoter. Thus, the second RNA promoter has the opposite transcriptional direction relative to the first RNA promoter. Further, where the second RNA promoter forms part of a viral expression vector, the second RNA promoter may have the opposite transcriptional direction relative to the protein promoter or to the viral expression vector promoter, when the second RNA promoter is a reverse promoter. Thus, in embodiments, the viral entry inhibiting RNA encoding sequence operably linked to (transcriptionally controlled by) the second RNA promoter is transcribed in the opposite direction relative to the genes operable linked to (transcriptionally controlled by) the protein promoter or the antiviral RNA encoding sequences operably linked to the first RNA promoter.
[0092] The viral expression vector may further include nucleic acid sequences encoding for viral proteins (e.g, structural proteins, regulatory proteins). Upon expression in a cell these proteins may form a virus-like particle which includes the antiviral polycistronic RNA. Thus, in embodiments, the recombinant nucleic acid forms part of a recombinant viral particle. The antiviral polycistronic RNA or the recombinant nucleic acid encoding the same may be delivered to a cell, tissue or organ using the recombinant viral particle.
[0093] The recombinant nucleic acid provided herein may encode a plurality of different species of siRNAs. The antiviral RNA may be a ribozyme, an RNA decoy, an shRNA, a miRNA, or a snoRNA. Thus, in embodiments, the first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), the second antiviral RNA encoding sequence encodes a second siRNA and the third antiviral RNA encoding sequence encodes a third siRNA. The first siRNA, second siRNA and third siRNA may independently be a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. A "ribozyme" as provided herein refers to a ribonucleic acid capable of enzymatically modifying RNA (e.g, cleaving, splicing). An RNA decoy as provided herein is an siRNA, which inhibits the function of a protein (e.g., viral protein or cellular protein) by binding the protein. The RNA decoy may inhibit protein function by preventing the interaction between the protein (e.g., Tat) and its natural interaction partners (e.g., TAR). Further, the binding of an RNA decoy to a protein may alter the subcellular location of the protein thereby inhibiting its activity. In embodiments, the RNA decoy is a U16TAR decoy. In embodiments, the RNA decoy is a U16RBE decoy.
[0094] In embodiments, the first siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the second siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the third siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In
embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In embodiments, the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA. Where the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA, the siRNA is capable of inhibiting Tat and Rev. In embodiments, the ribozyme is a small nucleolar (sno) RNA. In embodiments, the snoRNA is a U5 ribozyme (e.g., U16U5RZ). In embodiments, the RNA decoy is a snoRNA. In
embodiments, the snoRNA is a U16TAR decoy. In embodiments, the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR).
[0095] The recombinant nucleic acid may further include a transcriptional terminator sequence. A transcriptional terminator sequence as provided herein refers to a nucleic acid sequence capable of abrogating RNA transcription. A transcriptional terminator sequence may disrupt the mRNA-DNA-RNA polymerase ternary complex thereby terminating the transcription process. In embodiments, the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter, and a transcriptional terminator sequence. In other embodiments, the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter; a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second promoter is a reverse promoter, and a transcriptional terminator sequence. In embodiments, the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence. [0096] The recombinant nucleic acid may further include a first nucleic acid linker connecting the first antiviral RNA encoding sequence to the second antiviral RNA encoding sequence and a second nucleic acid linker connecting the second antiviral RNA encoding sequence to the third antiviral RNA encoding sequence. A nucleic acid linker as provided herein is a nucleic acid molecule connecting two nucleic acid sequences through covalent binding. In embodiments, the nucleic acid linker includes at least 10 nucleotides. In embodiments, the nucleic acid linker includes at least 20 nucleotides. In embodiments, the nucleic acid linker includes at least 30 nucleotides. In embodiments, the nucleic acid linker includes at least 40 nucleotides. In embodiments, the nucleic acid linker includes at least 50 nucleotides. In embodiments, the nucleic acid linker includes at least 60 nucleotides. In embodiments, the nucleic acid linker includes at least 70 nucleotides. In embodiments, the nucleic acid linker includes at least 80 nucleotides. In embodiments, the nucleic acid linker includes at least 90 nucleotides. In embodiments, the nucleic acid linker includes at least 100 nucleotides. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence. In
embodiments, the first nucleic acid linker or the second nucleic acid linker include an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence or an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the first nucleic acid linker and the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the intron sequence is a MCM7 intron sequence. In embodiments, the exon sequence is a MCM7 exon sequence.
[0097] The recombinant nucleic acid provided herein including embodiments thereof may include an antiviral protein encoding sequence. An antiviral protein encoding sequence refers to a nucleic acid sequence encoding a polypeptide capable of inhibiting viral activity (e.g., replication, transcription, translation, infection). Thus, in embodiments the antiviral protein is an inhibitor of viral replication. In embodiments, the antiviral protein is an inhibitor of viral transcription. In embodiments, the antiviral protein is an inhibitor of viral entry. In
embodiments, the antiviral protein is an inhibitor of viral transport. In embodiments, the antiviral protein is an inhibitor of viral packaging. In embodiments, the antiviral protein encoding sequence encodes a C46 fusion inhibitor. In embodiments, the antiviral protein encoding sequence encodes a mutant Rev protein. In embodiments, the mutant Rev protein is a Rev M10 protein. In embodiments, the antiviral protein encoding sequence is downstream of the viral entry inhibiting RNA encoding sequence. In embodiments, the recombinant nucleic acid includes a transcriptional terminator sequence. In embodiments, the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the antiviral protein encoding sequence.
[0098] The recombinant nucleic acid provided herein including embodiments thereof may include a fourth antiviral RNA encoding sequence. The fourth antiviral RNA encoding sequence encodes a fourth siRNA. In embodiments, the fourth siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In
embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In embodiments, the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA. Where the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA, the siRNA is capable of inhibiting Tat and Rev. In embodiments, the ribozyme is a small nucleolar (sno) RNA. In embodiments, the snoRNA is a U5 ribozyme (e.g., U16U5RZ). In embodiments, the RNA decoy is a snoRNA. In
embodiments, the snoRNA is a U16TAR decoy. In embodiments, the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR). In embodiments, the RNA decoy is a U16TAR decoy. In embodiments, the RNA decoy is a U16RBE decoy. In embodiments, the fourth siRNA is an RNA decoy. In embodiments, the fourth siRNA is a Tat binding RNA decoy (e.g., U16TAR). In embodiments, the fourth siRNA is a U16TAR decoy. In embodiments, the fourth antiviral RNA encoding sequence is operably linked to a third RNA promoter. In embodiments, the third RNA promoter is a polymerase III promoter. In embodiments, the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a U6 promoter. In embodiments, the third RNA promoter is a forward promoter. In embodiments, the third RNA promoter is located upstream of the protein promoter.
[0099] The compositions provided herein including embodiments thereof may include different combinations of antiviral RNA encoding sequences, viral entry inhibiting RNA encoding sequences and antiviral protein encoding sequences. Thus, in embodiments, the recombinant nucleic acid composition includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein the first RNA promoter is a forward promoter and a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second promoter is a reverse promoter. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a Rev siRNA, the third antiviral RNA encoding sequence encodes a Tat siRNA, the second RNA promoter is a U6 promoter, and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a Rev siRNA, the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR), the second RNA promoter is a U6 promoter and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a U5 ribozyme (e.g., U16U5RZ), the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR), the second RNA promoter is a U6 promoter, and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. In
embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a U5 ribozyme (e.g., U16U5RZ), the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR), the second RNA promoter is a U6 promoter, the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA, the third RNA promoter is a U6 promoter and the fourth antiviral RNA encoding sequence encodes a Tat binding RNA decoy (e.g., U16TAR).
[0100] In another aspect, a recombinant nucleic acid encoding an antiviral polycistronic RNA is provided. The recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence. In embodiments, the first RNA promoter is a forward promoter. In embodiments, the first RNA promoter is a reverse promoter. In embodiments, the second RNA promoter is a forward promoter. In embodiments, the second RNA promoter is a reverse promoter. In embodiments, the first RNA promoter is a forward promoter and the second RNA promoter is a reverse promoter. [0101] As described above, the recombinant nucleic acid may form part of a viral expression vector. The viral expression vector provided herein may include nucleic acid sequences encoding for a selectable marker protein (e.g., the human methylguanine methyltransferase mutant P 140K/MGMT) to select for cells including the viral expression vector. The viral expression vector may include nucleic acid sequences encoding for an antiviral protein (e.g., C46 fusion inhibitor, Rev M10 protein). The viral expression vector may further include regulatory sequences necessary to express the selectable marker and/or the antiviral protein. In
embodiments, the recombinant nucleic acid forms part of a recombinant viral particle.
[0102] In embodiments, the first RNA promoter is a RNA polymerase II promoter. In embodiments, the RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a Ul promoter.
[0103] In embodiments, the first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), the second antiviral RNA encoding sequence encodes a second siRNA and the third antiviral RNA encoding sequence encodes a third siRNA. In embodiments, the first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy. In embodiments, the first siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the second siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the third siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In
embodiments, the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
Where the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA, the siRNA is capable of inhibiting Tat and Rev. In embodiments, the ribozyme is a small nucleolar (sno) RNA. In embodiments, the snoRNA is a U5 ribozyme (e.g., U16U5RZ). In embodiments, the RNA decoy is a snoRNA. In embodiments, the snoRNA is a U16TAR decoy. In embodiments, the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR).
[0104] In embodiments, the second RNA promoter is downstream of the third antiviral RNA encoding sequence. In embodiments, the second RNA promoter is a polymerase III promoter. In embodiments, the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a U6 promoter.
[0105] In embodiments, the viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA. In embodiments, the cellular receptor siRNA is a T cell receptor siRNA. In embodiments, the T cell receptor siRNA is a small hairpin (sh) RNA. In embodiments, the shRNA is a CCR5 shRNA. In embodiments, the shRNA is a CXCR4 shRNA. In embodiments, the viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA. In embodiments, the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
[0106] The recombinant nucleic acid provided herein including embodiments thereof may further include a transcriptional terminator sequence. In embodiments, the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence. In embodiments, the recombinant nucleic acid includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence and a transcriptional terminator sequence. In embodiments, the transcriptional terminator sequence is an Ul terminator sequence. In embodiments, the transcriptional terminator sequence is downstream of the viral entry inhibiting RNA encoding sequence. [0107] The recombinant nucleic acid provided herein including embodiments thereof may further include a first nucleic acid linker connecting the first antiviral RNA encoding sequence to the second antiviral RNA encoding sequence and a second nucleic acid linker connecting the second antiviral RNA encoding sequence to the third antiviral RNA encoding sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence or an exon sequence. In embodiments, the first nucleic acid linker or the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the first nucleic acid linker and the second nucleic acid linker include an intron sequence and an exon sequence. In embodiments, the intron sequence is a MCM7 intron sequence. In embodiments, the exon sequence is a MCM7 exon sequence.
[0108] The compositions provided herein including embodiments thereof may include different combinations of antiviral RNA encoding sequences, viral entry inhibiting RNA encoding sequences and antiviral protein encoding sequences. Thus, in some embodiments, the recombinant nucleic acid composition includes a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a Rev siRNA, the third antiviral RNA encoding sequence encodes a Tat siRNA, the second RNA promoter is a U6 promoter and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a Rev siRNA, the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, the second RNA promoter is a U6 promoter, and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. In embodiments, the first RNA promoter is a Ul promoter, the first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, the second antiviral RNA encoding sequence encodes a U5 ribozyme, the third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, the second RNA promoter is a U6 promoter and the viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0109] In embodiments, the recombinant nucleic acid includes a fourth antiviral RNA encoding sequence. The fourth antiviral RNA encoding sequence encodes a fourth siRNA. In embodiments, the fourth siRNA is a viral transcription inhibiting siRNA (a small RNA inhibiting viral transcription), a viral replication inhibiting siRNA (a small RNA inhibiting viral replication), a viral transcription and replication inhibiting siRNA (a small RNA inhibiting viral transcription and replication), a ribozyme or an RNA decoy. In embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In embodiments, the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA. Where the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA, the siRNA is capable of inhibiting Tat and Rev. In embodiments, the ribozyme is a small nucleolar (sno) RNA. In embodiments, the snoRNA is a U5 ribozyme (e.g.,
U16U5RZ). In embodiments, the RNA decoy is a snoRNA. In embodiments, the snoRNA is a U16TAR decoy. In embodiments, the snoRNA is a rev binding RNA decoy (e.g., U16RBE) or a Tat binding RNA decoy (e.g., U16TAR). In embodiments, the RNA decoy is a U16TAR decoy. In embodiments, the RNA decoy is a U16RBE decoy. In embodiments, the fourth siRNA is a RNA decoy. In embodiments, the fourth siRNA is a Tat binding RNA decoy (e.g., U16TAR). In embodiments, the fourth siRNA is a U16TAR decoy. In embodiments, the fourth antiviral RNA encoding sequence is operably linked to a third RNA promoter. In embodiments, the third RNA promoter is a polymerase III promoter. In embodiments, the RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter. In embodiments, the snRNA promoter is a U6 promoter. In embodiments, the third RNA promoter is a forward promoter. In embodiments, the third RNA promoter is located upstream of the protein promoter.
CELLULAR COMPOSITIONS
[0110] The recombinant nucleic acid compositions provided herein including embodiments thereof may be expressed by a cell (e.g., mammalian cell), tissue or organ. Upon expression in a cell siRNA molecules as described above are formed, and said siRNA molecules confer antiviral activity to the cell. Thus, in another aspect, a mammalian cell including a recombinant antiviral polycistronic RNA is provided. The recombinant antiviral polycistronic RNA includes (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA. In embodiments, the first antiviral RNA, the second antiviral RNA and the third antiviral RNA is a small interfering RNA (siRNA). In embodiments, the siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy. In embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In embodiments, the viral transcription and replication inhibiting siRNA is a
Tat/Rev siRNA. In embodiments, the ribozyme is a snoRNA. In embodiments, the ribozyme is a U5 ribozyme (e.g., U16U5RZ). In embodiments, the RNA decoy is a snoRNA. In
embodiments, the RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
[0111] In embodiments, the viral entry inhibiting RNA is a cellular receptor siRNA. In embodiments, the cellular receptor siRNA is a T cell receptor siRNA. In embodiments, the T cell receptor siRNA is a small hairpin (sh) RNA. In embodiments, the shRNA is a CCR5 shRNA. In embodiments, the shRNA is a CXCR4 shRNA. In embodiments, the viral entry inhibiting RNA is a nuclear receptor siRNA. In embodiments, the nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
[0112] In embodiments, the mammalian cell includes an antiviral protein. In embodiments, the antiviral protein is a C46 fusion inhibitor. In embodiments, the antiviral protein is a mutant Rev protein. In embodiments, the mutant Rev protein is a Rev Ml 0 protein. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a Rev siRNA, the third antiviral RNA is a Tat siRNA, and the viral entry inhibiting RNA is a CCR5 shRNA. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a Rev siRNA, the third antiviral RNA is a Tat binding RNA decoy, and the viral entry inhibiting RNA is a CCR5 shRNA. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a U5 ribozyme, the third antiviral RNA is a Tat binding RNA decoy, and the viral entry inhibiting RNA is a CCR5 shRNA.
KITS
[0113] In another aspect, a kit including a recombinant antiviral polycistronic RNA is provided. The recombinant antiviral polycistronic RNA includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA. In embodiments, the kit includes instructions for making a cell expressing the recombinant antiviral polycistronic RNA. In embodiments the kit includes a recombinant antiviral polycistronic RNA or a recombinant nucleic acid encoding the recombinant antiviral polycistronic RNA described herein, including in any aspect, embodiment, example, claim, or figure. In embodiments, the kit includes a composition or mixture that includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and a viral entry inhibiting RNA.
[0114] In embodiments, the first antiviral RNA, the second antiviral RNA and the third antiviral RNA is a small interfering RNA (siRNA). In embodiments, the siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy. In embodiments, the viral transcription inhibiting siRNA is a Tat siRNA. In embodiments, the viral replication inhibiting siRNA is a Rev siRNA. In embodiments, the viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA. In embodiments, the ribozyme is a snoRNA. In embodiments, the ribozyme is a U5 ribozyme. In embodiments, the RNA decoy is a snoRNA. In embodiments, the RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy. In embodiments, the viral entry inhibiting RNA is a cellular receptor siRNA. In embodiments, the cellular receptor siRNA is a T cell receptor siRNA. In embodiments, the T cell receptor siRNA is a small hairpin (sh) RNA. In embodiments, the shRNA is a CCR5 shRNA. In embodiments, the shRNA is a CXCR4 shRNA.
[0115] In embodiments, the viral entry inhibiting RNA is a nuclear receptor siRNA. In embodiments, the said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a Rev siRNA, the third antiviral RNA is a Tat siRNA, and the viral entry inhibiting RNA is a CCR5 shRNA. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a Rev siRNA, the third antiviral RNA is a Tat binding RNA decoy, and the viral entry inhibiting RNA is a CCR5 shRNA. In embodiments, the first antiviral RNA is a Tat/Rev siRNA, the second antiviral RNA is a U5 ribozyme, the third antiviral RNA is a Tat binding RNA decoy, and the viral entry inhibiting RNA is a CCR5 shRNA.
[0116] In another aspect, a kit including a recominant viral particle including the recombinant nucleic acid provided herein including embodiments thereof is provided.
[0117] In another aspect, a kit including a recominant viral particle including a recombinant antiviral polycistronic RNA is provided. The recombinant antiviral polycistronic RNA includes a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
PHARMACEUTICAL COMPOSITIONS AND METHODS OF TREATMENT
[0118] In another aspect, a pharmaceutical composition including a pharmaceutically acceptable excipient and a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof is provided.
[0119] In another aspect, a method of treating an infectious disease in a subject in need thereof is provided. The method includes administering to the subject a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof. In embodiments, the infectious disease is caused by a virus. In embodiments, the virus is HIV. In embodiments, the subject suffers from AIDS.
[0120] In another aspect, a method of treating an infectious disease in a subject in need thereof is provided. The method includes administering to the subject a mammalian cell including a recombinant antiviral polycistronic RNA as provided herein including embodiments thereof. In embodiments, the mammalian cell is derived from the patient. In embodiments, the mammalian cell is derived from a healthy subject. In embodiments, the mammalian cell is formed by transfection with a recombinant nucleic acid encoding an antiviral polycistronic RNA as provided herein including embodiments thereof.
[0121] In another aspect, a method of inhibiting HIV replication in a patient is provided. The method includes administering to the patient a therapeutically effective amount of a recombinant viral particle including a recombinant nucleic acid as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient.
[0122] In another aspect, a method of inhibiting HIV replication in a patient is provided. The method includes administering to the subject a mammalian cell including a recombinant antiviral polycistronic RNA as provided herein including embodiments thereof, thereby inhibiting HIV replication in the patient. In embodiments, the mammalian cell is derived from the patient. In embodiments, the mammalian cell is derived from a healthy subject. In embodiments, the mammalian cell is formed by transfection with a recombinant nucleic acid encoding an antiviral polycistronic RNA as provided herein including embodiments thereof.
EXAMPLES EXAMPLE 1
[0123] Combinational therapy with small RNA inhibitory agents against multiple viral targets allows efficient inhibition of viral production by controlling gene expression at critical time points. Here Applicants explore combinations of different classes of therapeutic anti-HIV-1 RNAs expressed from within the context of an intronic MCM7 platform that naturally harbors three miRNAs. Applicants replaced the endogenous miRNAs with anti-HIV small RNAs, including siRNAs targeting HIV-1 tat and rev messages that function to induce post- transcriptional gene silencing by the RNA interference pathway, a nucleolar-localizing RNA ribozyme that targets the conserved U5 region of HIV-1 transcripts for degradation, and finally nucleolar TAR and RBE RNA decoys designed to sequester HIV-1 Tat and Rev proteins inside the nucleolus. Applicants demonstrate the versatility of the MCM7 platform in expressing and efficient processing of the siRNAs as miRNA mimics along with nucleolar small RNAs.
Furthermore, three of the combinatorial constructs tested potently suppressed viral replication during a one-month HIV challenge, with greater than 5-logs inhibition compared to
untransduced, HIV-1 infected CEM T-lymphocytes. One of the most effective constructs contains an anti-HIV siRNA combined with a nucleolar-localizing U5 ribozyme and TAR decoy. This represents the first efficacious example of combining Drosha processed siRNAs with snoRNP processed nucleolar RNA chimeras from a single intron platform for effective inhibition of viral replication. Moreover, Applicants demonstrated an enrichment/selection for cells expressing levels of the anti-viral RNAs which provide optimal inhibition under the selective pressure of HIV. The combinations of si/sno RNAs represent a new paradigm for combinatorial RNA-based gene therapy applications.
[0124] Generation of the MCM7-snoRNA constructs [0125] Previously, Applicants engineered and optimized a polycistronic miRNA cluster located in an intron of the protein encoding gene MCM7 as a siRNA multiplexing platform (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). This platform which Applicants refer to as MCM7 was engineered to simultaneously express three anti-HIV siRNAs targeted to the common exon shared by tat/rev (S I), rev (S2M), and tat (S3B), respectively (MCM7- S1/S2M/S3B in Fig. 2a) from a single RNA Pol II human Ul promoter. Moreover, Applicants demonstrated the potential versatility of this platform by co-expressing an U16TAR snoRNA inserted in the position of the S3B subunit. Given the demonstration of co-expression of siRNAs and snoRNAs, Applicants hypothesized that it should be possible to insert the chimeric snoRNAs into any of the three miRNA positions to obtain processing of these small RNAs. If such was the case, Applicants could then examine different combinations of chimeric snoRNAs and siRNAs co-expressed in the same transcript. To test this hypothesis Applicants inserted the U16RBE and U16U5RZ snoRNAs into the MCM7-S 1/S2M/U16TAR construct by replacing either the S I or S2M units. This resulted in the creation of three novel constructs harboring multiple snoRNA chimeras with different targets and mechanisms of action as shown in Fig. 2a. [0126] The original MCM7-S 1/S2M/S3B and MCM7-S 1/S2M/U 16TAR constructs were sub- cloned into the ptflV7-EGFP lentiviral vector (Yam, P.Y. et al, Mol Ther., 5, 479-484 (2002)) in the reverse orientation with respect to the packaging CMV promoter to prevent splicing of the MCM7 intron during vector packaging (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). Alternatively, the HIV-1 Rev protein used in the packaging process suppresses transcript splicing suggesting Applicants could also orient the U1-MCM7 intron in the same transcriptional direction as the CMV packaging promoter. To test these possibilities, Applicants cloned the MCM7 transgene in both forward and reverse orientations with Ul promoter-specific termination sequence (Fig. 2b) and compared packaging efficiencies. Interestingly the packaging efficiencies were greater than 100-fold better in constructs with the transgene cloned in the forward orientation (Table 1). Applicants therefore used the forward orientations for transduction of CEM T-lymphocytes to produce cell lines that stably expressed the various combinations of anti-HIV RNAs. [0127] Proper processing and expression of the functional small RNAs in target cells
[0128] To determine and verify whether the RNA expression of each unit within the combinatorial vector was properly transcribed and processed, a Northern blotting analysis was performed on stably transduced CEM T-lymphocytes (Fig. 3). After electrophoresis of the RNA samples, the blots were hybridized with probes specific for each of the RNAs. RNA expression was detected for each unit in the various constructs, with expected sizes of about 21 nt for siRNAs and aboutl32 nt for U16 chimeric snoRNAs, indicating efficient processing of the RNAs from the polycistronic transcript. It is interesting to note that certain RNA combinations express lower levels of small RNAs in this platform, implying proper processing of both si- and snoRNA within the same intron is an intricate balance between the Drosha/DGCR8 and the snoRNP pathways and furthermore may be position-dependent (Hirose, T., Shu, M.D., and Steitz, J.A., Mol Cell, 12, 1 13-123 (2003)).
[0129] Suppression of viral replication in CEM T-lymphocytes expressing the MCM7 intron containing anti-HIV small RNAs. [0130] Applicants next addressed the issue of functionality of the small RNAs as measured by antiviral activity. Long term inhibition of viral replication in CEM T-lymphocytes stably expressing the MCM7 constructs was evaluated by viral challenge assays using the NL4-3 strain of HIV- 1 at an MOI of 0.01. Virus replication was followed for 28 days by monitoring viral capsid p24 levels in the culture supernatant at the indicated time points (Fig. 4). Three out of the five constructs, MCM7-S1/S2M/S3B, MCM7-S 1/S2M/U 16TAR, and MCM7-
S1/U16U5RZ/U16TAR, showed extremely potent anti-HIV activity, providing greater than a 5- log reduction in p24 output, with almost non-detectable p24 during this one-month challenge.
[0131] Having achieved strong suppression of viral replication during the challenge assay in CEM T-lymphocytes, Applicants were interested in correlating gene expression to functionality. Applicants hypothesized that HIV-1 would provide selective pressure to enrich for transduced cells with levels of anti-HIV RNA gene expression that effectively suppress replication. If this is the case, Applicants would expect selection for cells with optimal RNA expression levels during the time course of the HIV-1 challenge. Applicants utilized qRT-PCR to measure SI siRNA and U16TAR decoy RNA expression (Fig. 5a and 5b, respectively). Cells transduced with the MCM7-S 1/U5RZ/TAR construct had a significant 2-fold enrichment for S 1 siRNA expression (p<0.001), while interestingly, cells transduced with the MCM7-S1/S2M/TAR construct had a significant 20% reduction for S I siRNA expression (p<0.01). Significant enrichment for the U16 TAR RNA decoy was observed only in constructs that did not inhibit HIV. These data are consistent with the mechanism of action for each of the small RNAs with siRNA being catalytic and the decoys being stoichiometric in sequestering their targets. Taken together, these data suggest that under the selective pressure of HIV, there is an enrichment/selection for cells expressing levels of the anti-viral RNAs which provide optimal inhibition in the absence of toxicity.
[0132] To investigate whether combinations of the various inhibitory RNAs were more efficacious as inhibitors than single antiviral RNAs, Applicants utilized a dual luciferase reporter assay in which Applicants transiently co-transfected a replication-deficient pNL4-3 proviral DNA harboring the firefly luciferase gene in the HIV-1 Nef gene (pNL4-3.Luc.R-.E, catalog # 3418 from NIH AIDS reagent and repository, (Connor, R.I. et al, Virology, 206, 935-944 (1995); He, J. et al, J Virol, 69, 6705-6711 (1995)) and the anti-HIV RNAs driven either by the Ul or U6 promoter. The pNL4-3 luciferase construct maintains targets for each of the small RNAs in all the transcripts, both spliced and unspliced and therefore luciferase readouts can be utilized as quantitative readouts of viral inhibition. Applicants observed a general trend correlating knockdown activity with small RNA expression (Fig. 6), consistent with their mechanism of action by increasing target cleavage in the case of U16U5RZ or by sequestering the Tat protein in the case of U16TAR. Applicants were surprised to see that the U16RBE did not exhibit any antiviral activity in this reporter assay, possibly because of overwhelming production of luciferase-labeled viral transcripts during transient transfection and the fact that it is non-catalytic. Overall, these observations suggest that the gene expression level is one of the determinants of an efficient RNA-based therapy.
[0133] The use of combinations of small molecule drugs in the highly active anti-retroviral therapy (HAART) to stop or thwart HIV propagation has had a major impact on delaying the progression from HIV-1 infection to the development of AIDS. Despite this progress, there are problems associated with a lifelong use of antiviral drug therapy, including toxicity, the emergence of virus resistant to multiple drugs, and the cost of a daily medication. Gene therapy of human T-lymphocytes and/or hematopoietic progenitor cells can be considered as a potential replacement or supplement to the current anti-HIV- 1 therapies. In similarity to small molecule therapies where combinations of drugs targeting different steps in the viral replication cycle have been most effective, Applicants believe that therapeutic RNAs must also be used in
combinations to block various stages of the viral replication cycle to mitigate viral escape.
Based on recent findings of both HIV-1 viral RNA transcripts and proteins localize in the nucleolus, Applicants have previously demonstrated that nucleolar-localizing small RNAs can be potent therapeutic agents. For example, Applicants had previously succeeded in inhibiting HIV-1 replication by individually expressing snoRNA chimeras, including the U16TAR and U16RBE RNA decoys that sequester the HIV-1 Tat and Rev proteins in the nucleolus, respectively (Michienzi et al., 2006; Michienzi et al, 2002). In addition, Applicants also demonstrated that a nucleolar-localizing ribozyme targeting a conserved U5 sequence present in all HIV- 1 transcripts had excellent HIV-1 inhibitory function (Michienzi, A. et al, Proc Natl Acad Sci US A, 99, 14047-14052 (2002); Michienzi, A. et al., AIDS Res Ther., 3, 13 (2006; Unwalla, H.J. et al, Mol Ther., 16, 1 113-11 19 (2008)). As a combinatorial approach to incorporate anti-HIV small RNAs with different mechanisms of action and target specificity, Applicants multiplexed the aforementioned snoRNA chimeras in addition to siRNAs that cleave tat and rev mRNAs with the goal to block all transcript production and efficiently achieve suppression of HIV-1 replication.
[0134] Applicants chose to use a single promoter and an intron-based platform to express combinations of siRNAs and snoRNAs. Both miRNAs and snoRNAs are processed from introns, thereby providing a rationale for Applicants' approach (Hirose, T., Shu, M.D., and Steitz, J.A., Mol Cell, 12, 1 13-123 (2003)). Applicants previously engineered and optimized the polycistronic miRNA cluster referred to as MCM7 to co-expresses three anti-HIV siRNAs from a single Pol II human Ul promoter (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). Applicants have now carefully examined several aspects of using this system in a lentiviral vector backbone platform. The current constructs were further optimized for packaging efficiency by cloning the MCM7 transgene in the forward direction with respect to the CMV promoter in the lentiviral pHIV7-EGFP vector with the Ul -specific transcriptional termination sequence. Applicants were surprised to find the superior packaging efficiency of Applicants' constructs, especially those with the transgene in the forward orientation, compared to the empty pHIV7-EGFP vector. The expression of the anti-HIV RNAs might be expected to negatively impact the transcription of the full-length viral RNA genome during packaging since Applicants' pHIV7-EGFP lentiviral vector is dependent on HIV- 1 Rev for packaging. Since all of constructs contain at least one small RNA against HIV-1 Rev, it was expected the viral titer of the constructs might be lower or equivalent at best to the parental pHIV7-EGFP vector. Applicants have previously overcome this challenge by increasing the amount of HIV Rev expressing plasmid (Li, M., and Rossi, J. J., Methods Mol Biol, 309, 261-272 (2005a)) or by inclusion of a plasmid that expresses an Ago2-targeting shRNA (Harris Soifer, unpublished) during packaging to minimize the RNAi activity in cells during packaging. In the present case, Applicants did not find an advantage to down-regulating Ago2 (data not shown) since the siRNA expression levels are relatively low compared to Pol III transcribed shRNAs and during packaging these are not effectively down-regulating the viral transcripts. Applicants also postulate that the insertion of the MCM7 cassette produces a larger viral transcript (5.4 kb) whose size is closer to the natural HIV- 1 RNA genome (9 kb) and therefore more favorable for packaging compared to the parental empty vector (3.9kb). Indeed Applicants found a 2.5-fold increase in viral titer when the parental MCM7 intron lacking anti-HIV RNAs was incorporated (data not shown) in similarity to Applicants' gene-therapy constructs carrying anti-HIV RNAs. Second, Applicants observed the effect of transgene directionality on packaging efficiency, with the forward orientation yielding greater than 100-fold higher production of virus. It is likely the transgene RNA transcript, when expressed from the Ul promoter in the reverse orientation could create an opposing transcript during packaging which negatively impacts on levels of expression from antisense effect.
[0135] In this study Applicants have demonstrated the versatility of the MCM7 platform for expressing multiple siRNAs as miRNA mimics as well as snoRNAs from the polycistronic transcript, and efficient processing into mature and functional small RNAs that are readily detectable through the Northern blotting analysis. Long term inhibition of viral replication was evaluated by challenging stably transduced CEM T-lymphocytes with HIV-1 NL4-3. The results of these analyses demonstrated that the MCM7-S1/S2M/S3B, MCM7-S 1/S2M/U16TAR, and MCM7-S 1/U16U5RZ/U16TAR constructs conferred complete protection against viral replication and spread during the one-month challenge. Interestingly, the MCM7-
U 16RBE/S2M/U 16TAR and MCM7 -U 16RBE/U 16U5 RZ/U 16T AR constructs did not significantly inhibit HIV replication despite the fact that the small RNAs were actively expressed and readily detectable by Northern blotting. The U16 chimeras in these constructs had demonstrated antiviral activity when individually expressed from the parental vector with the Pol III U6 promoter (Michienzi, A. et al, AIDS Res Ther., 3, 13 (2006; Michienzi, A. et al, Proc Natl Acad Sci US A, 99, 14047-14052 (2002); Unwalla, H.J. et al, Mol Ther., 16, 11 13-11 19 (2008)). This discrepancy is most likely related to the difference in expression levels of these RNAs in the context of the intronic MCM7 platform driven by the Pol II Ul promoter versus independently from the Pol III U6 promoter. [0136] The importance of optimal levels of RNA expression for anti-HIV activity and cell viability is supported by the observation that there was selection for transduced CEM T- lymphocytes with optimal anti-HIV RNA expression during HIV infection. This phenomenon has also been observed for transduced CEM T-lymphocytes harboring a single copy of the transgene (data not shown), reflecting selection of cells with more transcriptionally active integration sites. Applicants evaluated the overall RNA expression with qRT-PCR and showed persistent expression during challenge and therefore it is likely that there is selective pressure for cells with optimal expression to provide antiviral activity in the absence of cellular toxicity. [0137] In addition to RNA expression levels as a determinant for the effectiveness of a RNA- based gene therapy, the nature of the small RNAs should also be considered and carefully balanced between toxicity and therapeutic efficacy. Because RNA decoys act as "sponges" and therefore function in a stoichiometric fashion, the expression level needs to be sufficiently high to achieve therapeutic efficacy, whereas siRNAs and ribozymes are capable of multiple turnover by cleaving their targets in a catalytic manner and should be functional with lower copies per cell. Constructs with the most potent antiviral activities in the context of the MCM7 intron platform tended to have higher RNA expression levels and usually contained more than two RNA agents that are catalytic in nature, such as a siRNA or ribozyme. It is interesting to note that all the constructs that exhibit antiviral activity in the viral challenge assay contain the SI siRNA that targets both the HIV-1 tat and rev messages. Although Applicants' current data cannot demonstrate whether the other two small RNAs in the constructs have additive effects in antiviral activity, the principle of the combinational therapy is to reduce viral escape in a long term setting. Applicants have previously demonstrated the combination of three is superior than two and better than single small RNA agents in prolonging anti-HIV protection in long term setting in a viral challenge assay (Li, M., and Rossi, J. J., Methods Mol Biol, 309, 261-272 (2005a)).
[0138] In summary, these studies represent the first example of incorporating combinations of snoRNA-based agents with siRNA-based agents within a single expression platform driven by a single Pol II promoter. Applicants demonstrated the versatility of the MCM7 platform for expressing a variety of small anti-viral RNAs in addition to miRNAs. Applicants also demonstrated superior packaging of these constructs versus the parental empty pHIV7-EGFP lentiviral vector. The enhanced packaging efficiency was especially pronounced when the transgene was cloned in the forward orientation with respect to the packaging CMV promoter. Finally, after HIV- 1 challenges of CEM T-lymphocytes transduced with the various RNA combinations, Applicants found three small RNA combinations, MCM7-S1/S2M/S3B, MCM7- S1/S2M/U16TAR, and MCM7-S l/U16U5RZ/U16TAR that strongly inhibited viral replication during the one-month challenge. Applicants also found that the pressure of HIV-1 infection resulted in selection of cells with optimal levels anti-HIV gene expression. The two RNA combinations that contained two or more nucleolar RNAs did not significantly inhibit HIV replication, perhaps owing to the non-catalytic nature of RNA decoys versus the siRNAs and ribozyme. Applicants' results suggest these factors should be carefully considered in designing an efficient RNA-based gene therapy. [0139] Protein transgene
[0140] Various protein transgenes can be expressed from Pol II protein promoter. Protein transgene can be antiviral, such as C46 fusion inhibitor or Rev M10 protein or selectable markers to enrich for gene modified cells, such as the P 140K mutant of human methylguanine methyltransferase (P140K MGMT). Protein promoters are typically Pol II, such as human EF1 alpha, CMV, human Ubiquitin, SFFV. Applicants utilized a self-cleaving P2A peptide to express multiple protein transgenes (EGFP and P 140K MGMT) from Applicants' vectors.
[0141] MCM7 platform
[0142] Endogenous polycistronic miRNA cluster (miR-106b-miR-93-miR-25) in the intron of the protein encoding MCM7 gene is engineered as a multiplexing platform to co-express three small RNAs (RNAl, RNA2, RNA3). There are many types of small RNAs that can be expressed from this platform, including small interfering RNAs (siRNAs) and small nucleolar RNAs (snoRNAs). siRNAs are expressed as primary microRNA (pri-miRNA) that requires endogenous RNA interference machinery for processing then gene silencing. SiRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes. Furthermore, dual-targeting siRNA (i.e. bifunctional siRNAs) that target two separate genes or identical gene at two different locations can also be utilized. Examples of endogenous genes important for HIV viral replication include but are not limited to CCR5, CXCR4, and TNP03. Examples of viral targets include but are not limited to HIV Tat, HIV Rev, and a common exon region shared between Tat and Rev mRNA. Applicants utilized siRNAs targeting HIV Tat (S3B), HIV Rev (S2M), and a common shared exon of Tat and Rev (S I) in Applicants' vector (S1/S2M/S3B).
[0143] SnoRNAs can also be successfully incorporated and expressed from the MCM7 platform. These are nucleolar localizing anti-HIV small RNAs constructed with the endogenous U16 snoRNA as a scaffold with the apical loop substituted for various anti-HIV elements. The conserved box C/D domain in U16 snoRNA is sufficient for nucleolar properties. [0144] U16U5RZ is a nucleolar localizing RNA hammerhead ribozyme that recognizes the target by standard Watson-Crick base pairing and cleaves a conserved U5 region in the HIV UTR. U16RBE and U16TAR are nucleolar RNA decoys that sequester HIV Rev and Tat proteins, respectively, into the nucleolus. In U16RBE, the minimal domain within Rev Response element required for interaction with HIV Rev, the Rev binding element (RBE), is substituted into the apical loop of U16 snoRNA. On the other hand, in U16TAR, the minimal trans- activation response element hairpin structure is inserted. There were 5 si-/snoRNA combinations that Applicants constructed and tested (See Table 2). In all cases, small RNA transgene are expressed and processed correctly as demonstrated by the northern blotting analysis (Fig. 3).
[0145] Applicants also evaluated antiviral activity of these triple constructs with an in vitro viral challenge assay. One million untransduced and stable CEM T lymphocytes were challenged in triplicate with the NL4-3 strain of HIV- 1 at an MOI of 0.01, and culture supernatants were collected weekly for the HIV-1 p24 antigen ELISA to evaluate viral replication. Three constructs, MCM7-S 1/S2M/S3B, MCM7-S 1/S2M/U 16TAR, and MCM7- S1/U16U5RZ/U16TAR, showed potent antiviral activity with almost no detectable viral load during the 1 -month challenge assay. Therefore, Applicants continued Applicants' construct development effort with only these three RNA combinations (Fig. 4). In Fig. 4 the dashed line represents the low detection limit of the p24 assay. Three constructs, MCM7-S1/S2M/S3B,
MCM7-S 1/S2M/U16TAR, and MCM7- S 1 /U 16U5 RZ/U 16TAR, showed potent antiviral activity with almost no detectable viral load during the 1 -month challenge assay.
[0146] RNA promoter 1/Termination Seq 1/MCM7 transgene orientation
[0147] The MCM7 cassette is driven by single Pol II Ul promoter and terminated by an Ul- specific termination sequence. This configuration allows the MCM7 platform to be expressed in the forward orientation in the pHIV7 lentiviral backbone. Other Pol II promoters can also be utilized, such as human EF1 alpha, CMV, human Ubiquitin, SFFV, and tissue-specific promoters to engineer tissue specific RNA transgene expression, with the termination sequence substituted with SV40 or BGHpA termination sequence and the requirement that MCM7 platform be expressed in the reverse orientation in the pHIV7 lentiviral backbone.
[0148] Applicants have tested the following combinations of promoter/termination sequences and transgene orientations in the lentiviral vector (In each configuration, all 5 RNA
combinations listed in 2 were construct giving a combination of 15 candidates). See Table 3 and Table 4. Applicants found the combination Ul promoter and Ul termination sequence with MCM7 cassette in forward orientation in the pHIV7 lentiviral vector gave the best packaging efficiency with similar RNA expression and continued Applicants' vector construct development effort with this configuration. [0149] RNA promoter 2/RNA4/Termination seq 2/Transgene orientation
[0150] To increase the functionality of the MCM7 platform, Applicants wish to incorporate additional antiviral small R As to enhance the efficacy of Applicants' vectors. The additional small RNA transgene is independently expressed from a Pol III promoter and therefore terminated by the Pol III termination sequence (a consecutive series of 5 to 6 uracil nucleotides). Examples of Pol III promoters include but not limited to U6, HI, tRNALys, tRNASer, tRNA^8 and examples of small RNA transgene include but not limited to RNA decoys, RNA ribozymes, and siRNAs expressed either as a short hairpin RNA (shRNA) or as a precursor miRNA (pre- miRNA). SiRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes. Furthermore, dual-targeting siRNA (i.e. bifunctional siRNAs) that target two separate genes or identical gene at two different locations can also be utilized. See Table 5. Among the various tRNASer-CCR5 constructs, Applicants optimized the cassette orientation for transgene expression, investigated the efficiency of CCR5 and HIV target knockdown and antiviral potency, and evaluated lentiviral packaging efficiency. [0151] To further verify the biological activity of the mature siRNA sequences produced from the tRNASer-shRNA cassette, Applicants performed a psi-check assay to monitor down- regulation of CCR5 and HIV UTR targets. In this experiment the target sequence is cloned in the 3 ' UTR of the reporter Renilla luciferase gene and the fusion transcript is subject to gene silencing by RNA interference. The firefly luciferase reporter serves as a mean to normalize for differences in transfection efficiency. The ratio of Renilla and firefly luciferase expression provides a measure of gene silencing. In this context, bifunctionality siRNAs expressed as a pre- miRNA or as a shRNA are both capable of mediating HIV and CCR5 target knockdown (Fig. 9). Knowing Applicants' mature siRNA sequences can down-regulate target mRNA, Applicants investigated whether this can directly translate to a decrease in CCR5 surface expression.
Applicants utilized a cell line that over-expresses CCR5 and transiently transfected Applicants' constructs to monitor CCR5 expression by flow cytometry. Specific decrease in CCR5 expression was only observed with cells transfected with tRNASer-CCR5-12sh cassette (Fig. 10).
[0152] Collectively based on these data, Applicants incorporated tRNASer-CCR5-12sh cassette into the MCM7 platform. Lentiviral packaging efficiency was similar in the presence and absence of this additional cassette and independent of the orientation of the cassette. Because the reverse orientation of this cassette consistently gives higher transgene expression, Applicants determined this is the most optimal configuration for further development. See Table 6. [0153] To validate proper processing and expression of all small RNA transgenes in this combination, Applicants transduced CEM T lymphocytes to create stably expressing cell line then performed northern blotting analysis (Fig. 1 1). To evaluate the antiviral potency,
Applicants challenged the stably expressing CEM T-cells with M-tropic JR-FL strain of HIV virus and monitored viral replication for 42 days. Result showed MCM7 vectors have potent antiviral activity with similar activity to the first generation lentiviral construct (Shl-TAR- CCR5RZ) with at least 3-logs reduction in viral replication (Fig. 12).
[0154] RNA promoter 3/RNA5/termination seq 3/transgene orientation
[0155] To further increase the functionality and versatility of Applicants' MCM7 platform, Applicants incorporated a second independent small RNA expression cassette. This transgene is incorporated downstream of the MCM7 platform in the multiple cloning site before the protein promoter. This additional small RNA transgene is independently expressed from a Pol III promoter and therefore terminated by the Pol III termination sequence (a consecutive series of 5 to 6 uracil nucleotides). Examples of Pol III promoters include but not limited to U6, HI, tRNALys, tRNASer, tRNA^8 and examples of small RNA transgene include but not limited to
RNA decoys, RNA ribozymes, and siRNAs expressed either as a short hairpin RNA (shRNA) or as a precursor miRNA (pre-miRNA). SiRNAs targeting any gene of interest can be incorporated, including endogenous or viral genes. Furthermore, dual-targeting siRNA (i.e. bifunctional siRNAs) that target two separate genes or identical gene at two different locations can also be utilized. Applicants have successfully incorporated and expressed a Pol III U6-driven TAR RNA decoy (U16TAR) in this configuration.
EXAMPLE 2
[0156] Lentiviral vector design to incorporate a polycinstronic MCM7 platform and a drug selection marker (MGMTP140K) for combinatorial RNA-based gene therapy [0157] Lentiviral vectors are efficient gene delivery vehicles with the ability to transduce non- dividing cells such as HSPCs resulting in long-term expression of the therapeutic transgenes in differentiated progeny. Applicants modified a third generation, self inactivating lentiviral vector, pHIV7, that previously demonstrated high efficiency in transducing primary CD4+ T
lymphocytes and HSPCs (Yam, PY et al. (2002). Design of HIV vectors for efficient gene delivery into human hematopoietic cells. Molecular therapy : the journal of the American
Society of Gene Therapy 5: 479-484) to also express MGMTP140K from a CMV promoter (Fig. 13a). Applicants observed no differences in viral titer and transduction efficiency with inclusion of MGMT transgene (data not shown). Applicants' earliest lentiviral vector used independent Pol III promoters (FGLV, Fig. 13b) to ensure strong and persistent expression of antiviral small RNA transgenes. Subsequently, Applicants engineered an MCM7 platform that co-expresses three small RNAs within the polycistronic cluster from a single Pol II Ul promoter (SGLV, Fig. 13c) to express small RNAs at more moderate levels to reduce potential vector toxicity. The MCM7 platofrm is designed to co-express three small RNAs within the polycistronic cluster using a single Pol II promoter. Although any Pol II promoter can be utilized to engineer tissue-specific transgene expression in this platform, Applicants selected the Ul promoter for ubiquitous and persistent transgene expression in all hematopoietic cells derived from HPSCs. Applicants previously demonstrated combinations of both si- and snoRNAs can be multiplexed in this format with antiviral functionality (Chung, J, et al. (2012). Endogenous MCM7 microRNA cluster as a novel platform to multiplex small interfering and nucleolar RNAs for combinational HIV-1 gene therapy. Human gene therapy 23 : 1200-1208). Since the MCM7 platform expresses small RNAs at lower levels than independent Pol III promoters, Applicants reasoned that Applicants could incorporate additional small RNA transgenes to further enhance antiviral potency without a significant increase in toxicity. Applicants incorporated a CCR5- targeting siRNA driven by an independent Pol III transfer RNA Serine promoter (tRNASer) [tRNASer-CCR5sh cassette] in the 3 ' intron of MCM7 in both orientations [forward (SGLV3) or reverse (SGLV4), Fig. 13c] as a viral entry inhibitor. Applicants also introduced a fifth RNA cassette, the nucleolar TAR RNA decoy driven by the independent Pol III U6 promoter (U6- U16TAR cassette) to increase antiviral potency by inhibiting Tat-dependent viral transcription. This cassette was cloned outside of the MCM7 transgene to reduce the possibility of promoter interference that could negatively impact gene expression. These novel lentiviral vectors express up to five antiviral small RNAs to block both viral entry and replication of both tropisms of HIV with cassettes driven by both Pol II and III promoters.
[0158] Biological activity and expression optimization of the tRNA -CCR5sh cassette in the MCM7 platform
[0159] Applicants investigated the use of transfer RNA (tRNA) promoters to express candidate antiviral RNAs due to their small size, ease in multiplexing and independent regulation of RNA expression. T his (Pol III) expression strategy utilizes the endogenous transfer RNA biogenesis pathway to express a primary tRNA-shRNA chimeric transcript and then release the mature shRNA by tRNAse Z cleavage (Scherer, LJ, et al. (2007). Optimization and characterization of tRNA-shRNA expression constructs. Nucleic acids research 35: 2620-2628) for further processing into mature siRNA. In the present constructs, Applicants utilized a Serine tR A promoter (tRNASer) to express a CCR5 shRNA as an entry inhibitor against R5 -tropic HIV. To assess the ability of this construct to down regulate surface CCR5 expression, Applicants transiently transfected plasmids containing either the promoter sequence only (the endogenous tRNASer gene) or with the tR ASer-CCR5sh cassette into a CCR5 over-expressing U373 -MAGI- CCR5E cells (Vodicka, MA, et al. (1997). Indicator cell lines for detection of primary strains of human and simian immunodeficiency viruses. Virology 233 : 193-198). The reduction in CCR5 expression by flow cytometry was evaluated 72 hours after introduction of the construct. Potent and specific CCR5 knockdown was only observed with tRNASer-CCR5sh cassette and not with the (empty) tRNASer promoter alone (Fig. 14a). Applicants also utilized quantitative RT-PCR for CCR5 RNA expression as the measure of functionality of Applicants' tRNASer-CCR5sh cassette in primary cells where CCR5 protein expression is often difficult to resolve by flow cytometry. Applicants observed 80% down regulation of CCR5 transcript RNA in primary macrophages derived from in vitro differentiation of gene modified HSPCs. This data demonstrates that sufficient CCR5 siRNA is produced in the context of MCM7 platform to down regulate gene expression in primary cells (Fig. 14b).
[0160] To further assess the processing of the tRNASer-CCR5sh cassette in combination with the other anti-HIV elements, Applicants incorporated this expression unit into the 3 ' intron of the MCM7 platform ("inside MCM7") in both orientations [forward (SGLV3) and reverse (SGLV4), Fig. 13c] with respect to the parental Ul promoter. When transiently transfected into HEK 293 cells, Applicants observed the reverse orientation (SGLV4) gives 2.4-fold enhancement in transgene expression based on Northern blotting analysis with a radioactive probe specific for detecting the guide strand of the CCR5 shRNA (Fig. 15a). Moreover, this analysis further distinguishes products in various stages of processing including the primary tRNASer-shRNA chimeric transcript, the released shRNA, and the mature Dicer-processed siRNA sequence capable of gene silencing. The siRNA is the dominate product suggesting efficient processing but some saturation of the processing pathway due to over-expression from the transient transfection is also evident (Fig. 15a). Interestingly, pHIV7 containing only the tRNASer- CCR5sh RNA cassette (no MCM7) drives dramatically higher expression levels in stably transduced CEM T lymphocytes than the above vector where the transgenes is inside the MCM7
3 ' intron based on Northern blotting analysis (Fig. 15b), even though the vector is present at only one to two integrated copies per cell. These high levels of tRNASer-CCR5 shRNA expression result in the accumulation of incompletely processed tRNASer-shRNA chimeric transcript and large quantities of shRNAs. Based on these results, Applicants concluded the tRNASer- CCR5shR A cassette in reverse orientation located within the 3 ' intron of MCM7 platform would provide a more optimal level of siR A expression.
[0161] Flexible MCM7 platform expresses up to five antiviral small RNAs at
physiological level with efficient processing [0162] Combinatorial therapy has inherent challenges including various types of interference or competition between the individual elements that can negatively impact the potential therapeutic outcome. For example, when a vector encodes multiple RNAi triggers, competition can arise between different RNAi triggers for RNAi pathway components and incorporation into the RNA-induced silencing complex (RISC). To ensure all the transgenes are expressed and processed into functional forms, Applicants performed Northern blotting analysis with CEM T lymphocytes that stably express the transgenes. To ensure the expression level resembles the optimum physiological condition of one to two copies of integrated vectors in HSPCs,
Applicants only sorted transduced populations that were lower than 30% EGFP positive (EGFP+). [0163] Northern expression analyses indicate that incorporation of additional RNA cassettes such as tRNASer-CCR5sh did not interfere with expression and processing of other transgenes in the MCM7 platform (Fig. 16). Applicants also confirmed correct and efficient processing of all RNAi triggers precursors (SI, S2M, S3B, and CCR5sh) into functional mature 20-23 nt siRNAs, and the small nucleolar RNAs (U16U5RZ and U16TAR) into 132-nt processed products (Fig. 16). Applicants did not observe accumulation of pri- and pre-miRNA precursors suggesting that the endogenous RNAi pathway is not saturated and that it is possible to co-express four siRNAs safely in a combinatorial approach. Therefore, MCM7 serves as a versatile tool in a
multiplexing approach with the capacity for incorporating small RNA cassettes driven by both Pol II and Pol III RNA promoters. Comparing transgene expression levels between the newer second generation and former first generation combinatorial strategies with two different classes of RNA promoters, SGLVs with Pol II driven MCM7 platform express transgenes at a lower level compared to expression from FGLV with independent Pol III promoters (lanes 3-5 versus lane 6 in Fig. 16). While the lower levels resulting from the Ul promoter may reduce toxicity, Applicants questioned whether these levels were sufficient for efficacy. Therefore, Applicants next turned to assessing the anti-HIV activity of the current combinations.
[0164] The MCM7 platform produces sufficient small RNAs to protect gene modified cells from R5 tropic HIV [0165] Applicants first assessed the antiviral functionality by viral challenge of gene modified CEM T lymphocytes with R5 tropic HIV- 1 JR-FL for 42 days, monitoring viral replication by p24 capsid levels in the culture supernatant (Fig. 12). All the therapeutic constructs (FGLV, SGLV4, SGLV5, and SGLV6) provided long-term protection, with up to a 5-log reduction in p24 capsid production in comparison to pLV and untransduced (unprotected) cells. Notably, SGLV4 and SGLV5 had almost no detectable levels of p24 capsid during this long term challenge, providing evidence that the MCM7 platform indeed expresses sufficient amount of small RNAs for functionality. To further demonstrate the feasibility of stem cell based approach in protecting gene modified progenies, Applicants evaluated antiviral potency of Applicants' constructs using macrophages derived from HSPCs. Macrophages are myeloid cells particularly suited for demonstrating anti-HIV potency in HIV challenge assays with vectors expressing CCR5 RNAi triggers because of the requirement of CCR5 co-receptor usage for infection with R5-tropic virus. Applicants wished to design an assay where adult CD34+ HPSCs are the substrate for gene modification as they are the eventual clinical target cell population for a stem cell based gene therapy approach. After transduction, CD34+ HPSCs can be induced into differentiating into the myeloid cells in vitro and efficacy of the candidate constructs evaluated by challenge with R5-tropic Bal HIV virus. To this end, Applicants developed a novel single cell flow cytometric assay of intracellular staining with an antibody specific to HIV- 1 core antigens (55, 39, 33, and 24 kD proteins) to monitor viral replication. The 55 kD protein is the primary precursor, while the 39 and 33 kD proteins are the intermediates of the mature 24 kD core protein (Chassagne, J, et al. (1986). A monoclonal antibody against LAV gag precursor: use for viral protein analysis and antigenic expression in infected cells. Journal of immunology 136: 1442-1445). Applicants used uninfected macrophages to establish non-specific staining and background signal in the flow cytometric assay. Using this novel method, Applicants were able to follow the kinetics of HIV infection on the cellular basis during the 42-day challenge in primary macrophages.
[0166] Representative intracellular HIV staining results at D 18 of the viral challenge are shown in Fig. 17. Applicants observed a 2-log difference in fluorescence intensity comparing unspecific background staining of uninfected cells (Fig. 17a) to an actual HIV infected culture (Fig. 17b) validating that Applicants' novel flow cytometric assay has excellent sensitivity for
HIV detection. Furthermore, Applicants found that 76.5% of untransduced (unprotected) macrophages infected with HIV at D18 (Fig. 17b) and as high as 95% at later time points (e.g.,
D28) (Fig. 18, unTDX trace) providing good dynamic range as a vector screen to distinguish constructs with varying antiviral activities. For example, this flow cytometric assay can distinguish constructs with intermediate protection [31.7% HIV infection in SGLV1 (Fig. 17d) and 56.4% in SGLV6 (Fig. 17h)] from constructs with the best protection [16.7% HIV infection in FGLV (Fig. 17c); 1.6% in SGLV2 (Fig. 17e); 3.9% in SGLV4 (Fig. 17f); 3.9% in SGLV5 (Fig. 17g); 8.9% in SGLV7 (Fig. 17i)]. When comparing constructs with the highest antiviral activities, Applicants observed that SGLV2 had better antiviral activity (1.6% infection, Fig. 17e) compared to small RNAs expressed from independent strong Pol III promoters such as in FGLV (16.7% infection, Fig. 17c). There results emphasize that the higher levels of small RNA transgene expression are not necessary for anti-HIV potency, as lower RNA expression from the MCM7 platform with a single Pol II Ul promoter is sufficient for functionality. When comparing different RNA combinations in the MCM7 platform (SGLVs), Applicants observed that the antiviral protection also increase in constructs containing at least 2 anti-HIV siRNAs (i.e., SGLV4 and SGLV5). This could be due to the additive nature and efficiency of multiple siRNAs in cleaving HIV targets to inhibit HIV replication.
[0167] To Applicants' surprise, Applicants observed no benefit in adding the tRNASer-CCR5sh cassette as an entry inhibitor (3.9% in SGLV4, Fig. 17f) or the nucleolar TAR RNA decoy (8.9% in SGLV7, Fig. 17i) to the parental SGLV2 construct (1.6% in Fig. 17e), perhaps because the parental construct already has potent antiviral activity with very low HIV infection. Another measure of the potency of the various constructs is the duration of protection from HIV-1 replication. Applicants therefore followed the kinetics of HIV infection for 42 days with the aforementioned intracellular HIV staining methodology to identify construct(s) with persistent protection (Fig. 18). In this group, Applicants observed an increase in the frequency of infected cells in some constructs over time: SGLV5 (D28) > FGLV (D35) > SGLV4 = SGLV7 (D35), but SGLV2 had no significant increase in viral infection though 42 days of culture. Applicants' long term results further confirm that over-expression of small RNA is not a guarantee of long term antiviral protection and that the MCM7 platform does provide lower but sufficient level of RNA expression for functionality.
[0168] Lower small RNA expression reduces the possibility of potential vector-related toxicity
[0169] Having established that sufficient levels of small RNAs are produced from the MCM7 platform for potent antiviral protection, Applicants continued to explore the issue of potential vector-related toxicity on hematopoietic potential using an in vitro colony forming unit (CFU) assay. The CFU assay measures the hematopoietic potential of uni- and multi-potent myelo- erythroid progenitors and therefore can be used to assess potential toxicity of multiplexed RNA expression in gene modified HSPCs. Applicants normalized the total number of CFUs to the untransduced control with respect to each donor to account for differences in hematopoietic potential between donors. Applicants found the transduction process for gene modification and the empty vector had minimal impact on hematopoietic potential (83±11% for pLV, Fig. 19) which is relevant for clinical translation of stem cell based gene therapy. In contrast, the levels of therapeutic small RNA expressed from independent strong Pol III promoters in FGLV had a negative impact on hematopoietic potential (54±4%, Fig. 19). However, when the small RNA expression is lowered with the MCM7 platform (e.g., SGLV4), Applicants observed a recovery of hematopoietic potential to a similar level as the empty vector (77±5% vs. 83±5%, respectively, Fig. 19). Surprisingly, incorporating U6-U16TAR cassette that expresses the nucleolar TAR RNA decoy (SGLV7) created a sharp decline in CFU formation (from 77±5% to 59±4%, Fig. 19). It is therefore possible that the U6-U16TAR RNA cassette alone may be responsible for the reduction in hematopoietic potential in the independent Pol III driven FGLV observed in this assay. Further experiments, including the assessment of each individual RNA cassette on CFU potential is required to establish the relative roles of the higher levels of the RNA antiviral expression levels versus the specific inclusion of the U6-U16TAR moiety on the loss CFU potential observed with FGLV.
[0170] In vivo 06-BG/BCNU drug selection for enrichment of gene modified cells in humanized NSG mice [0171] One of the current hurdles in stem cell based gene therapy for HIV is the low frequency of gene modified cells, typically generated by current in vivo protocols, preventing clinical assessment of antiviral efficacy. Therefore, Applicants wished to include a gene in Applicants' second generation lentiviral vectors that confers a survival advantage to a clinically relevant drug, thereby increasing the frequency of HIV resistant cells in vivo. The endogenous MGMT enzyme is responsible for repairing DNA damage caused by alkylating agents such as BCNU. 06-BG deactivates endogenous MGMT so that cells cannot repair BCNU-induced DNA damages resulting in cell death. However, gene modified cells that express a modified MGMT (MGMTP140K) are not sensitive to 06-BG treatment and therefore can repair DNA damage from BCNU treatment and survive. The net result of the 06-BG/BCNU selection is increased frequency of gene modified cells. Therefore, Applicants included this drug resistance gene in Applicants' anti-HIV constructs and developed a protocol to test for enrichment of gene modified HSPC and CD4+ progeny in vivo. In order to establish that a sufficient level of MGMTP140K was expressed in the relevant cell types, CD34+ HSPCs were transduced with an MGMT expressing vector (FGLV) and used to transplant immunodeficient NSG mice as described in Experimental Procedures. Animals were treated with 06-BG and BCNU at 7th and 8th weeks (2X treatment cohort) or at 7th, 8th and 9th weeks (3X treatment cohort) following transplantation. Two or three weeks after completion of the 06-BG/BCNU treatment (i.e., 1 1 weeks following transplantation), animals were necropsied and the level of engraftment and frequency of gene modified cells in the spleen and bone marrow were evaluated.
[0172] Applicants' results demonstrate that engraftment of the bone marrow and spleen with human (CD45+) cells was significantly reduced in treated animal cohorts relative to the control cohort (p<0.001) (Figs. 20a and 20c, respectively) but the frequency of GFP+/CD45+ cells in the bone marrow and spleen was enriched 10 and 15-fold in the 2X and 3X treated cohorts respectively (Fig. 20b and 20d). The average frequency of GFP+/CD3+/CD4+ T lymphocytes in the spleen increased 3-fold only when 06-BG/BCNU treatment was performed three times (Fig. 20e). Similarly, GFP+/CD4+/CD14+ monocytes were increased 3-fold in the spleens of mice following three 06-BG/BCNU treatments (Fig. 20f). No deficiencies in lineage development were noted in the drug treated mice (data not shown). These data demonstrate that selective enrichment of HlV-target cells occurred in vivo and thus may allow for post-transplant increases in the frequency of HlV-resistant cells in patients where engraftment of these cells may be suboptimal.
[0173] Applicants demonstrate here that the MCM7 intron is a flexible and versatile platform for co-expressing combinations of up to three si- and snoRNAs within the MCM7 sequence and the ability to add additional independent RNA cassettes (both inside and outside of MCM7) for a total of five small RNAs. To Applicants' knowledge, this is the first example of multiplexing both classes of RNA promoters in a combinatorial approach. Applicants observed expression and complete processing of all small RNA transgenes into functional forms without saturation of processing pathways or promoter interference that could negatively impact transcription.
Interestingly, although the tRNASer-CCR5sh cassette is expressed at high levels in the pLV without MCM7, its expression is much weaker in the context of MCM7. This result may be related to the requirement of splicing of the intronic MCM7 cluster prior to trans gene expression. Moreover, expression is also related to orientation of the cassette in MCM7 highlighting the importance of optimal placement in multiplexing strategies. The level of small RNA expression from the MCM7 platform driven by a single Pol II Ul promoter is much weaker compared to the amounts driven by independent Pol III promoters. Nonetheless, Applicants established that sufficient amounts of antiviral small RNA were produced from the MCM7 platform to protect gene modified CEM T lymphocytes and primary macrophages derived from gene modified HSPCs from R5 tropic HIV, with the duration and level of protection highly dependent on RNA combination. This suggests that the optimal level of RNA expression is more important than achieving maximal levels of RNA expression for a given modality. It is likely that the overall amount of small RNA processing that can occur in a cell at any given time is limited. In theory, because of the catalytic nature of siRNAs and ribozymes in turning over multiple substrates, it should take less to achieve the same therapeutic effect compared to agents that sequester their target in stoichoimetric ratio such as TAR RNA decoys.
[0174] Applicants' results show that the multiple siRNAs in the MCM7 platform provided better protection against HIV, e.g., three siRNAs targeting tat and rev (SGLV2) was better than single tat/rev siRNA (SGLV1). This could be due to the additive nature and efficiency of multiple siRNAs in cleaving HIV targets, while increasing the selective pressure against viral escape. Interestingly, the addition of two other potent anti-HIV RNAs, tRNAser CCR5sh entry inhibitor and a U6-driven nucleolar TAR RNA decoy (SGLV4 and SGLV7, respectively), to the parental triple siRNA construct (SGLV2) did not provide additional benefit in inhibiting viral replication or preventing viral breakthrough. In fact, the additional small RNA cassettes actually negatively impacted potency with the observation of viral breakthrough at 35 days with the parental construct observed limited breakthrough through the 42 day culture. It is unclear why addition of the entry inhibitor and the nucleolar TAR RNA decoy was less optimal in inhibiting HIV, although it is possible that CCR5 siRNA may compete with other anti-HIV siRNAs (i.e., SI, S2M, S3B siRNAs) for RISC factors in gene silencing. Furthermore, TAR RNA has been reported as a pri-miRNA that is processed into functional miRNAs (Ouellet, et al. (2008).
Identification of functional microRNAs released through asymmetrical processing of HIV- 1 TAR element. Nucleic acids research 36: 2353-2365) and a potent binder to TRBP (HIV-1 TAR RNA binding protein) within the endogenous RISC that negatively impacts RNAi pathway. The newly discovery of toxicity associated with over-expression of the TAR RNA decoy (see below) could implicate selection of cells with overall less RNA expression translating into less optimal antiviral protection.
[0175] Applicants performed an in vitro CFU assay to identify any vector-related myelo- erythroid toxicity. Applicants' data demonstrates that the MCM7 platform has the capacity to safely express four siRNAs with complete processing without reducing in vitro hematopoietic potential of gene modified HSPCs. Surprisingly, Applicants observed a reduction of CFU potential with incorporation of additional U6-U16TAR cassette making the first report of toxicity related to over-expression of RNA decoys. It is possible that the U6-U16TAR cassette is responsible for the observed toxicity in FGLV, but further experiments including assessment of each individual Pol III RNA cassette on CFU potential are likely required. Additional studies may be required to assess the potential for toxicity in other (lymphoid) cell populations not addressed in these in vitro assays. Increasing the frequency of gene modified cells in vivo may be required to achieve a clinically meaningful antiviral effect in cases where engraftment of gene modified cells is low. Therefore, Applicants incorporated a drug resistance gene (MGMTP140K) in Applicants' improved lentiviral vector to allow for in vivo enrichment of gene modified cells using alkylating agents. Applicants' result demonstrated the feasibility of this approach in increasing the frequency of gene modified CD4+ cells using in vivo treatment with levels of
BCNU similar to those used in a non-human primate model of HIV gene therapy (Younan, PM, et al. (2013). Positive selection of mC46-expressing CD4+ T cells and maintenance of virus specific immunity in a primate AIDS model. Blood 122: 179-187). In summary, combinatorial gene therapy approaches are often most effective when targeting multiple stages of viral replication. Applicants present here the improved MCM7 platform with enhanced flexibility, increased safety with sufficient level of transgene to long term inhibition of HIV in CD34- derived macrophages as a useful tool for combinatorial gene therapy. Applicants demonstrate that more is not always better but rather a balance between transgene expression, mechanism of action, and target choice is required for optimizing the combinatorial approach. EXAMPLE 3
[0176] NSG mice (N=8 per group) were transplanted with 0.5xl06 CD34+ HSPC that had been transduced with either Applicants' first generation lentiviral vector (FGLV) or second generation lentiviral vectors SGLV2 and SGLV4 (See table 7 for construct identity). Prior to transplantation the CD34+ HSPC were transduced at 28% (FGLV), 44% (SGLV2) and 31% (SGLV4) as determined by flow cytometric analysis for GFP 5 days after transduction. Animals were maintained according to IACUC protocols and administered 20 μg/week/mouse Fc/IL-7 to enhance T-cell development as previously reported.
[0177] Eleven weeks after transplantation, animals were challenged with HIV-lBai virus (41580 IU/mouse) and mice were followed for serum viremia every two weeks by RT-PCR. Some mice died during the 5 weeks following HIV challenge for undetermined reasons and so all animals were necroposied 6 weeks after infection. When comparing the level of HIV in the serum of mice transplanted with untransduced or transduced HSPC, serum viremia was reduced > 1 log by SGLV4 at 5 weeks after infection (Figure 21). [0178] Applicants evaluated the percentage of CD45+CD4+, CD45+/GFP+, CD45+/CD3+/CD4+/GFP+ and CD45+/CD14+/GFP+ cells in the spleen of each animal at necropsy. While Applicants observed a reduction in the overall number of CD4+ T-cells, all animals transplanted with gene modified HSPC showed an increased in the average level of CD45+/GFP+ cells in the spleen. All animals transplanted with gene modified HSPC also showed increases in the CD3+/CD4+/GFP+ cells among all CD3+/CD4+ T-cells and SGLV2 and SGLV4 showed an increase in the average level of CD4+/CD14+/GFP+ monocytes among all CD4+/CD14+ monocytes (Figure 22).
[0179] These results demonstrate that Applicants have created an effective anti-viral construct that can both control viremia and confer a selective advantage to gene modified T-cell and monocytes in the face of R5 viral infection. The candidate construct chosen from these experiments is SGLV4 which shows greater ability to control virus in both in vitro and in vivo cultures and is less toxic than Applicants' previous clinical construct Applicants have successfully developed and utilized an adult model of HIV infection that will allow Applicants to test these vectors in samples from HIV+ patients and determine Applicants' ability to create clinical products.
EXPERIMENTAL PROCEDURES
[0180] Generation of MCM7 snoRNA constructs
[0181] The U16RBE and U16U5RZ snoRNA molecules were amplified by PCR from pTZ/U6-U16RBE and pTZ/U6-C36U5 DNA vectors (Michienzi, A. et al, AIDS Res Ther., 3, 13 (2006); Unwalla, H.J. et al., Mol Ther., 16, 11 13-1 119 (2008)), using primer sets A, and B, as Xhol/Hindlll and EcoRllBamHl fragments, respectively. The fragments were digested with appropriate enzymes followed by cloning into the pcDNA3-CMV-MCM7-Sl/S2/U16TAR plasmid (Aagaard, L.A. et al, Gene Ther., 15, 1536-1549 (2008)). The Ul-specific
transcriptional terminator along with a new Notl site was introduced at the terminus of the common 3' region of the MCM7 cassette by replacing the original DNA sequence with a PCR product generated with primer set C. The CMV promoter was replaced by the Ul promoter flanked by Mlul and Kpnl sites generated from amplification from a Ul plasmid (pKS-Ul, unpublished data) with primer set D. [0182] To generate lentiviral vectors, the Ul-MCM7-Ult fragments were excised by Mlul and Notl digestion and ligated into the pHIV7-EGFP lentiviral vector in both forward and reverse orientations (i.e., the Ul promoter is in the same or opposite orientation as the packaging CMV promoter, respectively) depending on the directionality of the multiple cloning site. ,.
[0183] Primer sequences are given below with restriction sites underlined and Ul -specific terminator in bold: A: Forward: 5'-CCC CCC CCTC GAG CTT GCA ATG ATG TCG TAA TTT G-3' (SEQ ID NO: l)
Reverse: 5' -CCC CAA GCT TAA AAA TTT CTT GCT CAG TAA GAA TTT-3' SEQ ID NO:2)
B: Forward: 5' -CCC CCC CGA ATT CCT TGC AAT GAT GTC GTA ATT TG-3' SEQ ID NO:3)
Reverse: 5' -CCC CGG ATC CAA AAA TTT CTT GCT CAG TAA GAA TTT-3 ' SEQ ID NO:4)
C: Forward: 5'-ATC GAT CCG CGG ATG CTG GGG GGA GGG GGG AT-3 '
SEQ ID NO:5) Reverse: 5'-ACG TGT TAA CGC GGC CGC AGT CTA CTT TTG AAA CTC TGC
CCC TTG TCT CCT AGA-3 ' SEQ ID NO : 6)
D: Forward: 5'-ATC GAT ACG CGT CTA AGG ACC AGC TTC TTT GGG AGA G-3' SEQ ID NO: 7)
Reverse: 5'-ATC GAT GGT ACC GAT CTT CGG GCT CTG CCC CG-3'
SEQ ID NO: 8)
[0184] Sequence of tRNASer-CCR5shRNA constructs: tRNASer promoter sequence (5' leader sequence in bold, promoter sequence in italic):
5' GAAAATGACTTTGCCACGCTTAGCATGTG^CG^GGrGGCCG^GrGGrr
AA GGCGA TGGA CTGCTAA TCCA TTGTGCTCTGCA CGCGTGGGTTCGAA TCCCA TCCTCGT CG 3' (SEQ ID NO: 9)
Bifunctional siRNA (bi-CCR5-5) as pre-miRNA sequence:
5 ' GGCCTGGGAGACCTGGGGACGCTGTGACACTTCAAACTTCCCCAGCTCTCCCA GGCCCG 3 ' (SEQ ID NO: 10) Bifunctional siRNA (bi-CCR5-5) as shRNA sequence:
5' GCCTGGGAGAGCTGGGGAATTCAAGAGATTCCCCAGCTCTCCCAGGC 3'
(SEQ ID NO: 11)
CCR5-12sh sequence: 5 ' AGTGTCAAGTCCAATCTATGATTCAAGAGATCATAGATTGGACTTGACAC 3 ' (SEQ ID NO: 12)
[0185] Generation of improved second generation lentiviral vectors with polycistronic MCM7 platform and selectable MGMTP140K marker
[0186] The MGMTP140K transgene was co-expressed with the EGFP marker from a polycistronic message utilizing a self-cleaving P2A peptide sequence from the CMV promoter. The MGMTP140K gene was first PCR amplified from pRSC-SMPGW2 plasmid (Trobridge, GD, et al. (2009). Protection of stem cell-derived lymphocytes in a primate AIDS gene therapy model after in vivo selection. PloS one 4: e7693), using the following primers (Forward: 5'-GGG TCT AGA ATG GAC AAG GAT TGT GAA ATG AAA CGC-3' [SEQ ID NO: 13] and Reverse: 5'- GGG GAA TTC CGT ACG TCA GTT TCG GCC AGC AGG CG-3' [SEQ ID NO: 14]) flanked by Xbal and EcoRI sites. The fragment was digested with appropriate enzymes then subcloned into Nhel and EcoRI sites of the pFUG-P2A-WPRE vector (John Burnett, unpublished) just downstream of the P2A peptide sequence to generate pFUG-P2A-MGMTpl40K-WPRE. The P2A- MGMTP140K fragment was then excised by BsrGI and BsiWI digestion then subclone into the BsrGI site of pHIV7-GFP vector (Yam, PY, et al. (2002). Design of HIV vectors for efficient gene delivery into human hematopoietic cells. Molecular therapy : the journal of the American Society of Gene Therapy 5: 479-484) to generate a modified lentiviral vector pHIV7-GFP-P2A- MGMTP140K The same strategy was utilized to introduce the P2A-MGMTP140K fragment into FGLV (Li, MJ, et al. (2005). Long-term inhibition of HIV- 1 infection in primary hematopoietic cells by lentiviral vector delivery of a triple combination of anti-HIV shRNA, anti-CCR5 ribozyme, and a nucleolar-localizing TAR decoy. Molecular therapy : the journal of the
American Society of Gene Therapy 12: 900-909) to generate the modified lentiviral vector suitable for drug selection. The CCR5 -targeting siRNA is expressed from the Pol III tRNASer promoter. The tRNASer-CCR5sh cassette was amplified from pi 133-2 with the following primers (Forward: 5 '-ATGC GCCGGC ATCGAT GAA AAT GAC TTT GCC ACG CTT AGC ATG TGA CGA GGT GGC CGA GT-3' [SEQ ID NO: 15] and Reverse: ATGC GGCGCC ATTTAAAT AAA AAA GTG TCA AGT CCA ATC TAT GAT CTC TTG AAT CAT AGA-3' [SEQ ID NO: 16]) flanked by Nael and Swal sites on the 5' end and Narl and Clal sites on the 3' end. The Nael-Narl and Swal-Clal fragments were subcloned into pcDNA3-Ul-MCM7-Ult plasmids (Chung, J et al. (2012). Endogenous MCM7 microRNA cluster as a novel platform to multiplex small interfering and nucleolar RNAs for combinational HIV- 1 gene therapy. Human gene therapy 23: 1200-1208) containing three triple combinations of small anti-HTV RNAs with the Clal and Swal sites approximately 70 bases upstream of the 3 ' splice signal to generate clones in both forward and reverse orientations, respectively [pcDNA3-Ul-MCM7-CCR5sh- Ult]. Ul-MCM7-CCR5sh-Ult fragments were exercised from pcDNA3-Ul-MCM7-CCR5sh- Ult plasmids with Nrul and Notl digestion and subcloned into pHIV7-GFP-P2A-MGMTpl40K vector to generate SGLVs..
[0187] SGLV7 was generated by inserting the U6-U16TAR fragment into SGLV4. The U6- U16TAR fragment was generated from linearization of the pTZ/U6-U16TAR plasmid
(Michienzi, et al. (2002). A nucleolar TAR decoy inhibitor of HIV- 1 replication. Proceedings of the National Academy of Sciences of the United States of America 99: 14047-14052) by BamHI digestion, followed by fill-in of the overhang by Klenow Fragment to create a blunt end, then digested with Sphl. This fragment was then ligated into SGLV4 that had been similarly treated except with the initial linearization with Notl enzyme.
[0188] Lentiviral vector production
[0189] Lentiviral vectors with appropriate inserts were packaged in 293T cells using calcium phosphate precipitation as previously described (Li, M.J., and Rossi, J.J., Methods EnzymoL, 392, 218-226 (2005b) with the addition of 1.5 μg of pAgo2sh plasmid (Harris Soifer, unpublished) that expresses a short hairpin RNA (shRNA) transcribed from the human U6 promoter to down-regulate Argonaute 2 (Ago2) protein expression to reduce post-transcriptional gene silencing induced by anti-HIV siRNA within constructs during packaging. The viral supernatants were collected 48 hours post-transfection, concentrated via ultracentrifugation, and stored at -80 °C until use. Viral titers were determined by transduction of HT 1080 cells and analyzed for EGFP expression with flow cytometry. In embodiments, 15 μg of transfer plasmid were co-transfected with helper plasmids (15 μg pCMV-Pol/Gag, 5 μg pCMV-Rev, and 5 μg pCMV-VSVG) into HEK 293T cells with 90-95% confluency per 10cm dish. Viral supernatant was harvested 48 hours post-transfection, concentrated by ultracentrifugation, and stored in -80 °C until use. Viral titers were determined by transduction of HT 1080 cells and analyzed for EGFP expression with FACS analysis. [0190] Cell culture and vector transduction
[0191] HEK 293T and HT1080 cells were purchased from ATCC (Manassas, VA, USA) and maintained in high glucose (4.5 g/1) DMEM supplemented with 2 mM glutamine and 10% FBS. The human CEM T-lymphocytes was cultured in RPMI 1640 medium supplemented with 10% FBS. In embodiments, CEM T lymphocytes were transduced with lentiviral vectors at MOI of 0.5 and 2.5 in the presence of 4 μg/ml polybrene (EMD Millipore, Billerica, MA) enhanced by centrifugation. Cells with around 30% EGFP expression were expanded and sorted to purity for further experiments.
[0192] CEM T-lymphocytes were transduced with lentiviral vectors as previously described (Li, M.J., and Rossi, J. J., Methods Enzymol, 392, 218-226 (2005b)), with the exception of the multiplicity of infection (MOI) utilized. At an MOI of 50, almost 100% of the cells are EGFP+ as determined by flow cytometry and were used for subsequent experiments without sorting.
[0193] U373 -MAGI-CCR5E cells were obtained through the NIH AIDS Reagent Program (Vodicka, MA, et al. (1997). Indicator cell lines for detection of primary strains of human and simian immunodeficiency viruses. Virology 233 : 193-198) and maintained in complete DMEM, supplemented with 0.2 mg/ml G418, 0.1 mg/ml hygromycin B, and 1.0 μg/ml puromycin. Adult CD34+ HSPCs were isolated from G-CSF mobilized peripheral blood (purchased from
Progenitor Cell Therapy, Mountain View, CA) from health donors under consent and in accordance to institutional IRB approval using previously described methods (Tran, et al. (2012). Optimized processing of growth factor mobilized peripheral blood CD34+ products by counterflow centrifugal elutriation. Stem cells translational medicine 1 : 422-429). Briefly, the washed concentrated mobilized peripheral blood were labeled with CliniMACS CD34 microbead (Miltenyi Biotec, Auburn, CA) and selected with the CliniMACS Cell Separation System (Miltenyi Biotec, Auburn, CA). The purity of the selected CD34 cells was above 95% by FACS analysis. Enriched CD34+ cells were cryopreserved using a controlled rate freezer and stored in liquid nitrogen until use.
[0194] For transduced HSPCs used for in vitro CFU assay setup and macrophage
differentiation in HIV challenge, HSPCs were thawed and pre-stimulated in StemSpan-SFT6 media [StemSpan (Stem Cell Technologies, Vancouver, British Columbia, Canada)
supplemented with 100 ng/ml SCF (Gibco, Grand Island, NY), 100 ng/ml Flt3-L (CellGenix, Freiburg, Germany), 10 ng/ml TPO (CellGenix, Freiburg, Germany), 50 ng/ml IL6 (Life Technologies, Carlsbad, CA)], for 48 hours prior to transduction. Lentiviral vectors adjusted to MOI of 20 were added to 6.4x104 pre-stimulated HSPCs in 250 μΐ StemSpan-SFT6 media in the presence of 20 μg/ml rapamycin (Sigm-Aldrich, St. Louis, MO) on RetroNectin (Takara, Mountain View, CA)-coated 96-well plate. After 24 hours incubation, the lentiviral vector and rapamycin were washed away and HSPCs were cultured in 1.3 ml StemSpan-SFT6 media supplemented with 0.75 μΜ SRI (Cellagen Technologies, San Diego, CA) for 5 days prior to sorting. HSPCs were sorted on CD34 marker, in addition to EGFP expression for the transduced population. Only CD34+ (untransduced) or CD34+/GFP+ (transduced) cells were used for subsequent colony forming assay set up and macrophage differentiation for HIV challenge experiments. [0195] For transduced HSPCs used for mice transplantation, HSPCs were pre-stimulated overnight in StemSpan-SFT6 media then transduced with FGLV at MOI =10 at lxlO6 cell/ml on Retronectin (Takara, Otsu-Shiga Japan)-coated non-tissue culture T-75 flask (5 μg protein/cm2, 1.3-2.6xl05 vaiable cells/cm2) for 24 hours in the presence of 20 μg/mL rapamycin. Lentivirus and rapamycin were removed and cells were washed once before being resuspended for transplantation in injection saline solution (APP Pharmaceuticals, Lake Zurich, IL).
[0196] Generation of adult CD34+ HSPC derived macrophages
[0197] Sorted HSPCs were cultured in Iscove's modified Dulbeco's media (IMDM) with 20% FBS supplemented with 2mM glutamine, 25 ng/ml SCF (Gibco, Grand Island, NY), 30 ng/ml Flt-3L (CellGenix, Freiburg, Germany), 30 ng/ml IL3 (Gibco, Grand Island, NY), 30 ng/ml M- CSF (PeptroTech, Rocky Hill, NJ) for 10 days for guided differentiation to monoctyes, then switched to DMEM with 10% FBS supplemented with 2 mM glutamine, 10 ng/ml GM-CSF (Leukine, Sanofi US, Bridgewater, NJ), 10 ng/ml M-CSF (PeptroTech, Rocky Hill, NJ) for 5 days for activation into macrophages. Adherent macrophage cells were collected for HIV challenge experiments. The purity of cells was typically greater than 90% CD 14+ based on FACS analysis.
[0198] Flow cytometric assay for CCR5 knockdown studies in U373-MAGI-C CR5E cells
[0199] About lxlO5 U373-MAGI-CCR5E cells were seeded per well in a 24-well dish one day prior to transfection. An equal ratio of pHTV7-EGFP to tRNASer construct in pBluescript with 400 ng total plasmid DNA were transiently transfected with Lipofectamine 2000 (Life
Technologies, Carlsbed, CA) following manufacturer's instructions. The EGFP marker from the co-transfected pHIV7-EGFP plasmid serves as an internal control for transfection efficiency. Cells were detached 72 hours later and stained with CCR5-APC antibody (clone 2D7, BD Pharmingen, San Jose, CA) to estimate CCR5 knockdown by flow cytometry. Data were collected on Gallios flow cytometer (Beckman Coulter, Brea, CA) and analyzed by FCS express version 4 software (De Novo software, Los Angeles, CA).
[0200] Northern blotting analysis [0201] Approximately 2 μg of pcDNA3-Ul-Sl/S2M/S3B-Ult with tRNASer-CCR5sh cassette in either orientation was transfected into HEK 293 cells with 90-95% confluency per well in 6- well dish with Lipofectamine 2000 with manufacturer's protocol. Total RNA was extracted 48 hours later with STAT-60 according to manufacturer's protocol. For each construct, 10 μg of total RNA were loaded onto 8% polyacrylamide gel with 8M urea then electroblotted onto a Hybond-N nylon membrane (Amersham, Arlington, Height, IL) and hybridized with P32-labeled DNA probe specific for small RNA. Small nuclear U2A RNA serves as internal control. Total RNA from sorted CEM T lymphocytes were isolated similarly and Northern blotting analysis was performed as described above, with the exception of 20 μg of total RNA used as input. The U6 small nuclear RNA was used as a loading control. [0202] The small RNA probe sequences are given below:
SI : 5'-GCG GAG ACA GCG ACG AAG AGC-3' (SEQ ID NO: 17) S2M: 5'-GCC TGT GCC TCT TCA GCT ACC-3' (SEQ ID NO: 18) S3B: 5 '-CAT CTC CTA TGG CAG GAA GAA-3' (SEQ ID NO: 19) U16RBE: 5'-CGT CAG CGT CAT TGA CGC TGC GCC CA-3' (SEQ ID NO:20) U16U5RZ (U5RZ): 5'-GAG TGC TTT TCG AAA ACT CAT CAG AA-3' (SEQ ID NO:21) U16TAR: 5'-CCA GAG AGC TCC CAG GCT CAG-3' (SEQ ID NO:22) U6: 5'-TAT GGA ACG CTT CTC GAA TT-3' (SEQ ID NO:23) CCR5sh: 5'-AAA GTG TCA AGT CCA ATC TAT GA-3' (SEQ ID NO:24)
CCR5RZ: 5' GTG TCA AGT TTC GTC CAC ACG GAC TCA TCA GCA ATC TA-3'
(SEQ ID NO:25)
U2A: 5'-AGA ACA GAT ACT ACA CTT GA-3'. (SEQ ID NO:26)
[0203] HIV-1 challenge, p24 antigen assays and intracellular HIV staining for monitor viral replica [0204] One million untransduced or stably transduced CEM-T lymphocytes were infected in triplicate with the NL4-3 strain of HIV- 1 at an MOI of 0.01. After overnight incubation, cells were washed three times with Hank's balanced salts solution and cultured in RPMI 1640 with 10% FBS. At designated time points, culture supernatants were collected and analyzed for HIV- 1 replication by a p24 ELISA assay (Perkin Elmer, USA) according to the manufacturer's protocol.
[0205] About lxlO5 CD34-derived macrophages were infected in triplicate with HIV-1 Bal strain at MOI of 0.01. After overnight incubation, the HIV virus was removed and the cells were cultured in DMEM with 10% FBS supplemented with 2mM glutamine, 10 ng/ml GM-CSF, 10 ng/ml M-CSF.
[0206] Viral replication was analyzed by intracellular staining of HIV core proteins at indicated time points. Cells were detached with Accutase solution (Sigma-Aldrich, St. Louis, MO), viability estimated by LIVE/DEAD fixable aqua dead cell stain (Sigma-Aldrich, St. Louis, MO), fixed and permeabilized with intracellular fixation and permeabilization buffer set (eBioscience, San Diego, CA) before staining with KC57-RD antibody (KC57-RD1 antibody, clone FH190-1-1, Beckman Coulter, Brea, CA) that recognizes HIV-1 core proteins and finally analyzed by flow cytometry. Data were collected on Gallios flow cytometer and analyzed by FCS express version 4 software.
[0207] Real-time quantitative RT-PCR to quantify anti-HIV RNA expression [0208] Total RNA from stably transduced CEM T-lymphocytes challenged with HIV-1 was extracted with STAT-60 reagent (Tel-Test, Friendswood, TX, USA) according to the manufacturer's instructions then resuspended in nuclease-free water. Residual DNA was digested using Turbo DNase (Ambion, USA) with 1 μg of total RNA in a 10 μΐ reaction following the manufacturer's instructions. Both SI siRNA and U16TAR RNA decoy expression were analyzed by real time qRT-PCR with the CFX96 Real-Time Detection System (Bio-Rad, Hercules, CA, USA) and expression levels were normalized to the U6 small nuclear RNA. S 1 siRNA was reverse transcribed into cDNA using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) with 100 ng DNase-treated total RNA and stem-loop RT primer according to the manufacturer's instruction. Real time PCR was carried out with 1.3 μΐ of RT reaction, 0.2 μΜ SI -specific probe, 1.5 μΜ forward primer, 0.7 μΜ reverse primer in TaqMan Universal PCR Master Mix diluted to IX concentration (Applied Biosystems, Foster City, CA, USA) in a final volume of 20 μΐ. PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 30s, 64 °C for 30s, 72 °C for 30s (DiGiusto, D.L. et al, Sci Transl Med., 2, 36-43 (2010)). The exact copy number of S I siRNA was determined using a standard curve constructed with known concentrations of synthetic S 1 RNA oligo (Integrated DNA Technology). [0209] The U16TAR RNA decoy and the internal control small nuclear U6 RNA were reverse transcribed using 200 ng of DNase-treated total RNA with 50 ng of random primers (Invitrogen, USA) and Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen, USA) in a 20 μΐ reaction according to the manufacturer's instructions.. Real time PCR for the U16TAR RNA decoy was carried out with 1 μΐ of the RT reaction, 0.2 μΜ TAR-specific probe, 0.5 μΜ of each U16-specific forward and reverse primers in TaqMan Universal PCR Master Mix diluted to IX concentrations (Applied Biosystems, Foster City, CA, USA) in a final volume of 20 μΐ. The PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 30s, and 64 °C for 1 min. The exact copy of RNA molecules were determined with a standard curve constructed with known concentrations of U16TAR plasmid. Quantification of the U6 internal control was accomplished using 2 μΐ of the RT reaction with 0.4 μΜ of each U6-specific forward and reverse primers utilizing iQ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) in a final volume of 25 μΐ. The PCR conditions were 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30s. A standard curve with known amounts of total RNA input was utilized to determine the precise RNA input to account for sample-to-sample variability. [0210] Quantitative RT -PCR primer sequences are given below:
S 1 : Stem-loop RT primer: 5 ' -GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GCG GA-3 ' (SEQ ID NO:27)
Probe: 5'-(6-FAM)-TCG CAC TGG ATA CGA CAG CGG AGA CA-(BHQl)-3 ' (SEQ ID NO:28)) Forward: 5'-GCC TCT TCG TCG CTG TCT-3 ' (SEQ ID NO:29)
Reverse: 5'-GTG CAG GGT CCG AGG T-3' (SEQ ID NO:30)
U16TAR: Probe: 5'-(6-FAM)-ATC TGA GCC TGG GAG CTC TCT GGC T-(BHQl)-3'
(SEQ ID NO:31)
Forward: 5'-TGC GTC TTA CTC TGT TCT CAG CGA-3 ' (SEQ ID NO:32) Reverse: 5'-CGT CAA CCT TCT GTA CCA GCT TAC-3 ' (SEQ ID NO:33) U6: Forward: 5'-GCT CGC TTC GGC AGC ACA TAT ACT AA-3' (SEQ ID NO:34)
Reverse: 5'-ACG AAT TTG CGT GTC ATC CTT GCG-3 ' (SEQ ID NO:35)
[0211] Real-time quantitative RT-PCR for CCR5 knockdown studies in macrophages differentiated from adult HSPCs [0212] Total RNA from CD34-derived macrophages were extracted with STAT-60 reagent (Tel-Test, Friendswood, TX) with manufacturer's protocol then resuspended in nuclease-free water. Residual DNA was digested with Ambion TURBO DNase (Life Technologies, Carlsbed, CA) with 2 μg of total RNA in a 15-μ1 reaction, in accordance with manufacturer's instructions. Complementary DNA was then synthesized with 1 μg of DNase-treated RNA with 100 ng of random primers (Invitrogen, Carlsbad, CA) and Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA) in a 27-μ1 reaction according to manufacturer's instructions. Real time PCR was carried out with CFX96 real-time detection system with 10 ng of cDNA, 0.4 μΜ of each gene specific (CCR5 or GAPDH) primers with iQ SYBR green supermix (Bio-Rad, Hercules, CA) in a final volume of 25 μΐ. The PCR conditions were 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s, 62 °C for 1 min. A standard curve with known serial dilutions of total RNA input was utilized to calculate the ratio between CCR5 and GAPDH to estimate percentage of CCR5 down-regulation.
Primer sequences for PCR were as follows:
CCR5-F: 5'-TTC ATT ACA CCT GCA GCT CTC-3' (SEQ ID NO:36); CCR5-R: 5'-CCT GTT AGA GCT ACT GCA ATT AT-3 ' (SEQ ID NO:37); GAPDH-F: 5'-CGC TCT CTG CTC CTC CTG TT-3 ' (SEQ ID NO:38); GAPDH-R: 5'-CCA TGG TGT CTG AGC GAT GT-3 ' (SEQ ID NO:39). [0213] In Vitro CFU assay for adult CD34+ HSPCs
[0214] A total of 500 sorted CD34+ cells were plated in triplicate in MethoCult H4435- enriched methylcellulose media (Stem Cell Technologies, Vancouver, British Columbia, Canada) according to manufacturer's protocol. Cells were cultured for 12 to 13 days before colony scoring under inverted microscope.
[0215] Fc/IL-7 protein production Fc/IL-7 was cloned into an OptiVect- TOPO (Invitrogen, Carlsbad, CA) vector and protein was produced from a cloned transfected DG44 CHO cell line as per the methods of Lo et al ((1998). High level expression and secretion of Fc-X fusion proteins in mammalian cells. Protein engineering 1 1 : 495-500). [0216] Humanized NSG mouse model
[0217] NOD.Cg- r cscid IL2rgtmlwjl/SzJ (NSG) mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and bred at the City of Hope Animal Resources Center according to protocols approved by the Institutional Animal Care and Use Committee of the City of Hope. Adult (8-10 week old) NSG mice were irradiated at 270 cGy 24 hours prior to transplantation. Each animal was transplanted with lxlO6 HSPCs following transduction as described via intravenous injection. To enhance T lymphopoiesis, 20 μg Fc/IL7 protein was administered per animal intravenously weekly for 11 weeks.
[0218] In Vivo 06-BG and BCNU selection for enrichment of gene modified cells
[0219] 06-BG (Sigma-Aldrich, St. Louis, MO) was prepared in 4% DMSO, 30% PEG-400 (Sigma-Aldrich, St. Louis, MO) and 66% injection saline solution. BCNU (injectable carmustine) was purchased from Bristol-Myers Squibb and stock solution was reconstituted in supplied absolute ethanol at 100 mg/ 3ml, as per manufacturer's instructions, then diluted in injection saline solution before administration. Drug selection was performed at either at the 7th and 8th weeks (2X treatment cohort, N = 12 mice), or 7th, 8th, and 9th weeks (3X treatment cohort, N = 12 mice) post-transplantation. Control cohort (N = 12 mice) received saline injection.
Animals in treatment cohorts received 20 mg/kg 06-BG followed by 5 mg/kg BCNU 1.5 hour later via IP injection for each round of drug selection.
[0220] Flow cytometric analysis of engraftment and gene modification frequency
[0221] Mice were necropsied 1 1 weeks after transplantation for analysis of engraftment and enrichment of gene modified cells. Single cell suspensions of bone marrow (femurs) and spleen were prepared by mechanical dissociation and red cells lysed using ACK lysis Buffer (Sigma- Aldrich, St. Louis, MO). All cell suspensions were pre-treated with human immunoglobulin (GammaGard, Baxter Healthcare Corp. Deerfield, IL) for 30 minutes to block nonspecific antibody staining. Spleenocytes were stained with a human pan-leukocyte antibody to CD45- PC5 (BioLegend, San Diego, CA), and lineage specific anti-human antibodies, CD3-ECD, CD4- APC, and CD14-APC-Alexa-750 (Invitrogen, Carlsbad, CA) for 20 minutes and washed 2 times with 1 mL of PBS containing 0.1% BSA (Sigma-Aldrich, St Louis, MO). Bone marrow cells were stained with antibodies to human CD45-PC5 (Beckman Coulter, Brea, CA), for 20 minutes and washed 2 times with 1 mL of PBS containing 0.1% BSA. To establish analytical gates and background staining, bone marrow and spleen samples from two to three untransplanted mice were stained with the same antibody panel. Data were collected on Gallios flow cytometer and analyzed by FCS express version 4 software.
[0222] Statistical analyses
[0223] The average and standard deviation for S I siRNA and U16TAR R A decoy expression were derived from three independent measurements. Data were analyzed by the statistical software Prism version 5.01 (GraphPad Software, La Jolla, CA, USA) using one-way ANOVA followed by Bonferroni's multiple comparsion test. P-values less than or equal to 0.05 were considered as statistically significant compared to cells cultured under identical conditions in the absence of HIV (i.e., DO).
[0224] In vitro CFU data were analyzed with statistical software Prism version 6.01 (GraphPad Software, La Jolla, CA), using one-way ANOVA followed by Bonferroni's comparison test. Values oip less than or equal to 0.05 were considered statically significant compared to untransduced control. The average and standard deviation were derived from two to three independent donors as indicated. In vivo drug selection data were also analyzed with Prism software using two-way ANOVA followed by two-tailed t-test. Values oip less than or equal to 0.05 were considered statistically significant compared to control animals. The average and standard deviation were derived from cohorts of 12 animals per group.
TABLES
[0225] Table 1. Packaging efficiencies of lentiviral vectors with MCM7 transgene. aViral titer is determined by transducing HT1080 cells with unconcentrated viral supernatant and reported in transduction units per milliliter (TU/ml). Samples with -30-40% EGFP+ cells, determined from flow cytometry, were used for calculation. The values are averages of two independent experiments.
Figure imgf000071_0001
EGFP) EGFP) Reverse)
(4.01±1.23) (4.20±0.50)
MCM7-S1/S2M/S3B 2.84 0.030 95.5
x 106 x lO4
(4.11±1.24) (3.00±0.42)
MCM7-S 1/S2M/U16TAR 2.91 0.021 137
x 106 x lO4
(4.34±1.46) (1.44±0.34)
MCM7-S1/U16U5RZ/U16TAR 3.08 0.010 301
x 106 x lO4
(4.66±1.72) (2.41±0.45)
MCM7-U16RBE/S2M/U16TAR 3.30 0.017 193
x 106 x lO4
MCM7- (4.12±1.58) (1.18±0.22)
2.92 0.008 349
U 16RBE/U 16U5RZ/U 16TAR x 106 x lO4
[0226] Table 2. Examples of si-/snoRNA combinations constructed and analyzed.
Constructs RNA1 RNA2 RNA3
S1/S2M/S3B S1 S2M S3B
S1/S2M/U16TAR S1 S2M U16TAR
S1/U5RZ/U16TAR S1 U16U5RZ U16TAR
RBE/S2M/U16TAR U16RBE S2M U16TAR
RBE/U 16U5RZ/U 16TAR U16RBE U16U5RZ U16TAR
[0227] Table 3. Analysis of combinations of promoter/termination sequences and transgene orientations.
Forward-U1t Reverse U1t
Unconcentrated viral titer
Construct Viral titer (TU/ml) Viral titer (TU/ml)
MCM7-S1/S2M/S3B 4.01 ±1 .23*106 4.20±0.50*104 MCM7-S1/S2M/U16TAR 4.1 1 ±1 .24*106 3.00±0.42*104 MCM7-S1/U16U5RZ/U16TAR 4.34±1 .46*106 1 .44±0.34*104 MCM7-U16RBE/S2M/U16TAR 4.66±1 .72*106 2.41 ±0.45x104 MCM7-U16RBE/U16U5RZ/U16TAR 4.12±1 .58*106 4.18±0.22*104
[0228] Table 4. Analysis of combinations of promoter/termination sequences and transgene orientations.
Construct Concentrated Viral
Titer (TU/ml)
Forward (with U1 Reverse (with terminator)13 BGHpA)c
MCM7-S1/S2M/S3B 8.01 x 108 5.70 x 107 MCM7-S1/S2M/TAR 8.61 x 108 5.88 x 107 MCM7-S 1 /U 16U5RZ/U 16TAR 6.31 x 10° 7.96 x 10b
MCM7-U16RBE/S2M/U16TAR 6.75 x 108 3.14 x 107
MCM7-U16RBE/U 16U5RZ/U 16TAR 5.08 x 108 1.39 x 107
[0229] Table 5. Examples of promoter and termination sequences.
RNA promoter 2 RNA4 Termination seq orientatio
2 n
tRNA Bifunctional Pol III term seq Forward
siRNA as shRNA
(against CCR5
and HIV UTR)
tRNA Bifunctional Pol III term seq Reverse
siRNA as shRNA
(against CCR5
and HIV UTR)
tRNA Bifunctional Pol III term seq Forward
siRNA as pre- miRNA (against
CCR5 and HIV
UTR)
tRNA Bifunctional Pol III term seq Reverse
siRNA as pre- miRNA (against
CCR5 and HIV
UTR)
tRNA siRNA as shRNA Pol term seq Forward
(CCR5-sh12)
tRNA siRNA as shRNA Pol term seq Reverse
(CCR5-sh12)
[0230] Table 6. Unconcentrated Viral titer of various MCM7 constructs (TU/ml):
MCM7-S1/S2M/S3B MCM7-S1/S2M/S3B- MCM7-S1/S2M/S3B- F12sh R12sh
2.41 e6 1 .31 e6 1 .75e6
MCM7-S1/S2M/U16TAR MCM7- MCM7-S1/S2M/U16TAR- S1/S2M/U16TAR- R12sh
F12sh
2.36e6 1 .78e6 2.46e6
MCM7- MCM7-S1/U16U5RZ MCM7- S1/U16U5RZ/U16TAR /U16TAR-F12sh S 1 /U 16 U 5RZ/U 16TAR- R12sh
2.65e6 1 .77e6 1 .91 e6
[0231] Table 7. Lentiviral Vector Constructs used in this study. In each column, sh indicates short hairpin RNA, decoy indicates RNA decoy, Rx indicates ribozyme, tat is HIV tat RNA, rev is HIV rev RNA, tat/rev is the shared sequence between HIV rev and tat RNAs, CCR5 is the cellular co-receptor for R5 tropic HIV.
Figure imgf000074_0001
EMBODIMENTS
[0232] Embodiment 1. A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein said first RNA promoter is a forward promoter. [0233] Embodiment 2. The recombinant nucleic acid of claim 1, further comprising a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second RNA promoter is a reverse promoter.
[0234] Embodiment 3. The recombinant nucleic acid of claim 2, wherein said recombinant nucleic acid forms part of a viral expression vector. [0235] Embodiment 4. The recombinant nucleic acid of claims 1 or 2, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
[0236] Embodiment 5. The recombinant nucleic acid of any one of claims 1-3, wherein said first RNA promoter is a RNA polymerase II promoter.
[0237] Embodiment 6. The recombinant nucleic acid of claim 5, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
[0238] Embodiment 7. The recombinant nucleic acid of claim 6, wherein said snRNA promoter is a Ul promoter.
[0239] Embodiment 8. The recombinant nucleic acid of any one of claims 2-7, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA. [0240] Embodiment 9. The recombinant nucleic acid of claim 8, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy. [0241] Embodiment 10. The recombinant nucleic acid of claim 9, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
[0242] Embodiment 11. The recombinant nucleic acid of claims 9 or 10, wherein said viral replication inhibiting siRNA is a Rev siRNA.
[0243] Embodiment 12. The recombinant nucleic acid of any one of claims 9-1 1, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
[0244] Embodiment 13. The recombinant nucleic acid of any one of claims 9-12, wherein said ribozyme is a small nucleolar (sno) RNA.
[0245] Embodiment 14. The recombinant nucleic acid of claim 13, wherein said snoRNA is a U5 ribozyme. [0246] Embodiment 15. The recombinant nucleic acid of any one of claims 9-14, wherein said RNA decoy is a snoRNA.
[0247] Embodiment 16. The recombinant nucleic acid of claim 15, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
[0248] Embodiment 17. The recombinant nucleic acid of any one of claims 2-16, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
[0249] Embodiment 18. The recombinant nucleic acid of any one of claims 2-16, wherein said second RNA promoter is a polymerase III promoter.
[0250] Embodiment 19. The recombinant nucleic acid of claim 18, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter. [0251] Embodiment 20. The recombinant nucleic acid of claim 19, wherein said snRNA promoter is a U6 promoter.
[0252] Embodiment 21. The recombinant nucleic acid of any one of claims 2-20, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA. [0253] Embodiment 22. The recombinant nucleic acid of claim 21, wherein said cellular receptor siRNA is a T cell receptor siRNA.
[0254] Embodiment 23. The recombinant nucleic acid of claim 22, wherein said T cell receptor siRNA is a small hairpin (sh) RNA. [0255] Embodiment 24. The recombinant nucleic acid of claim 23, wherein said shRNA is a CCR5 shRNA.
[0256] Embodiment 25. The recombinant nucleic acid of claim 23, wherein said shRNA is a CXCR4 shRNA.
[0257] Embodiment 26. The recombinant nucleic acid of any one of claims 2-25, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
[0258] Embodiment 27. The recombinant nucleic acid of claim 26, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
[0259] Embodiment 28. The recombinant nucleic acid of any one of claims 1-27, further comprising a transcriptional terminator sequence. [0260] Embodiment 29. The recombinant nucleic acid of any one of claims 2-28, further comprising a transcriptional terminator sequence.
[0261] Embodiment 30. The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is an Ul terminator sequence.
[0262] Embodiment 31. The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
[0263] Embodiment 32. The recombinant nucleic acid of any one of claims 1-31, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence. [0264] Embodiment 33. The recombinant nucleic acid of claim 32, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
[0265] Embodiment 34. The recombinant nucleic acid of claim 32, wherein said intron sequence is a MCM7 intron sequence. [0266] Embodiment 35. The recombinant nucleic acid of any one of claims 2-34, further comprising an antiviral protein encoding sequence.
[0267] Embodiment 36. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence is downstream of said viral entry inhibiting RNA encoding sequence. [0268] Embodiment 37. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a C46 fusion inhibitor.
[0269] Embodiment 38. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a mutant Rev protein.
[0270] Embodiment 39. The recombinant nucleic acid of claim 38, wherein said mutant Rev protein is a Rev M10 protein.
[0271] Embodiment 40. The recombinant nucleic acid of claim 35, further comprising a transcriptional terminator sequence.
[0272] Embodiment 41. The recombinant nucleic acid of claim 40, wherein said transcriptional terminator sequence is an Ul terminator sequence. [0273] Embodiment 42. The recombinant nucleic acid of claims 40 or 41, wherein said transcriptional terminator sequence is downstream of said antiviral protein encoding sequence.
[0274] Embodiment 43. The recombinant nucleic acid of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0275] Embodiment 44. The recombinant nucleic of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0276] Embodiment 45. The recombinant nucleic acid of any one of claims 2-42, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a U5 ribozyme, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0277] Embodiment 46. A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising: (i) a first RNA promoter operably linked to: a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and (ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
[0278] Embodiment 47. The recombinant nucleic acid of claim 46, wherein said recombinant nucleic acid forms part of a viral expression vector. [0279] Embodiment 48. The recombinant nucleic acid of claims 46 or 47, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
[0280] Embodiment 49. The recombinant nucleic acid of any one of claims 46-48, wherein said first RNA promoter is a RNA polymerase II promoter.
[0281] Embodiment 50. The recombinant nucleic acid of claim 49, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
[0282] Embodiment 51. The recombinant nucleic acid of claim 50, wherein said snRNA promoter is a Ul promoter.
[0283] Embodiment 52. The recombinant nucleic acid of any one of claims 46-51, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA.
[0284] Embodiment 53. The recombinant nucleic acid of claim 52, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
[0285] Embodiment 54. The recombinant nucleic acid of claim 53, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
[0286] Embodiment 55. The recombinant nucleic acid of claim 53, wherein said viral replication inhibiting siRNA is a Rev siRNA. [0287] Embodiment 56. The recombinant nucleic acid of claim 53, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
[0288] Embodiment 57. The recombinant nucleic acid of claim 53, wherein said ribozyme is a small nucleolar (sno) RNA.
[0289] Embodiment 58. The recombinant nucleic acid of claim 57, wherein said snoRNA is a U5 ribozyme.
[0290] Embodiment 59. The recombinant nucleic acid of claim 53, wherein said RNA decoy is a snoRNA.
[0291] Embodiment 60. The recombinant nucleic acid of claim 59, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
[0292] Embodiment 61. The recombinant nucleic acid of any one of claims 46-60, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
[0293] Embodiment 62. The recombinant nucleic acid of any one of claims 46-61, wherein said second RNA promoter is a polymerase III promoter.
[0294] Embodiment 63. The recombinant nucleic acid of claim 62, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
[0295] Embodiment 64. The recombinant nucleic acid of claim 63, wherein said snRNA promoter is a U6 promoter.
[0296] Embodiment 65. The recombinant nucleic acid of any one of claims 46-64, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
[0297] Embodiment 66. The recombinant nucleic acid of claim 65, wherein said cellular receptor siRNA is a T cell receptor siRNA.
[0298] Embodiment 67. The recombinant nucleic acid of claim 66, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
[0299] Embodiment 68. The recombinant nucleic acid of claim 67, wherein said shRNA is a CCR5 shRNA.
[0300] Embodiment 69. The recombinant nucleic acid of claim 67, wherein said shRNA is a CXCR4 shRNA. [0301] Embodiment 70. The recombinant nucleic acid of any one of claims 46-69, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
[0302] Embodiment 71. The recombinant nucleic acid of claim 70, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA. [0303] Embodiment 72. The recombinant nucleic acid of any one of claims 46-71, further comprising a transcriptional terminator sequence.
[0304] Embodiment 73. The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is an Ul terminator sequence.
[0305] Embodiment 74. The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
[0306] Embodiment 75. The recombinant nucleic acid of any one of claims 46-74, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence. [0307] Embodiment 76. The recombinant nucleic acid of claim 75, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
[0308] Embodiment 77. The recombinant nucleic acid of claim 76, wherein said intron sequence is a MCM7 intron sequence.
[0309] Embodiment 78. The recombinant nucleic acid of any one of claims 46-77, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0310] Embodiment 79. The recombinant nucleic acid of any one of claims 46-77, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA. [0311] Embodiment 80. The recombinant nucleic acid of any one of claims 46-77, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a U5 ribozyme, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
[0312] Embodiment 81. A mammalian cell comprising a recombinant antiviral polycistronic RNA comprising: (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA. [0313] Embodiment 82. The mammalian cell of claim 81, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
[0314] Embodiment 83. The mammalian cell of claim 82, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy. [0315] Embodiment 84. The mammalian cell of claim 83, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
[0316] Embodiment 85. The mammalian cell of claims 83 or 84, wherein said viral replication inhibiting siRNA is a Rev siRNA.
[0317] Embodiment 86. The mammalian cell of any one of claims 83, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
[0318] Embodiment 87. The mammalian cell of any one of claims 83-86, wherein said ribozyme is a snoRNA.
[0319] Embodiment 88. The mammalian cell of claim 87, wherein said ribozyme is a U5 ribozyme. [0320] Embodiment 89. The mammalian cell of any one of claims 83-88, wherein said RNA decoy is a snoRNA.
[0321] Embodiment 90. The mammalian cell of any one of claims 83-88, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy
[0322] Embodiment 91. The mammalian cell of any one of claims 81-90, wherein said viral entry inhibiting RNA is a cellular receptor siRNA. [0323] Embodiment 92. The mammalian cell of claim 91, wherein said cellular receptor siRNA is a T cell receptor siRNA.
[0324] Embodiment 93. The mammalian cell of claim 92, wherein said T cell receptor siRNA is a small hairpin (sh) RNA. [0325] Embodiment 94. The mammalian cell of claim 93, wherein said shRNA is a CCR5 shRNA.
[0326] Embodiment 95. The mammalian cell of claim 93, wherein said shRNA is a CXCR4 shRNA.
[0327] Embodiment 96. The mammalian cell of any one of claims 81-90, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
[0328] Embodiment 97. The mammalian cell of claim 96, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
[0329] Embodiment 98. The mammalian cell of any one of claims 81-97, further comprising an antiviral protein. [0330] Embodiment 99. The mammalian cell of claim 98, wherein said antiviral protein is a C46 fusion inhibitor.
[0331] Embodiment 100. The mammalian cell of claim 98, wherein said antiviral protein is a mutant Rev protein.
[0332] Embodiment 101. The mammalian cell of claim 100, wherein said mutant Rev protein is a Rev M10 protein.
[0333] Embodiment 102. The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat siRNA, and said viral entry inhibiting RNA is a CCR5 shRNA.
[0334] Embodiment 103. The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
[0335] Embodiment 104. The mammalian cell of claim 81, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA. [0336] Embodiment 105. A kit comprising a recombinant antiviral polycistronic RNA comprising, (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
[0337] Embodiment 106. The kit of claim 105, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
[0338] Embodiment 107. The kit of claims 105 or 106, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
[0339] Embodiment 108. The kit of claim 107, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
[0340] Embodiment 109. The kit of any one of claims 105-108, wherein said viral replication inhibiting siRNA is a Rev siRNA.
[0341] Embodiment 110. The kit of claim 107, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA. [0342] Embodiment 11 1. The kit of claim 107, wherein said ribozyme is a snoRNA.
[0343] Embodiment 112. The kit of claim 107, wherein said ribozyme is a U5 ribozyme.
[0344] Embodiment 113. The kit of claim 107, wherein said RNA decoy is a snoRNA.
[0345] Embodiment 114. The kit of claim 107, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy. [0346] Embodiment 115. The kit of claim 105, wherein said viral entry inhibiting RNA is a cellular receptor siRNA.
[0347] Embodiment 116. The kit of claim 1 15, wherein said cellular receptor siRNA is a T cell receptor siRNA.
[0348] Embodiment 117. The kit of claim 116, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
[0349] Embodiment 118. The kit of claim 117, wherein said shRNA is a CCR5 shRNA.
[0350] Embodiment 119. The kit of claim 117, wherein said shRNA is a CXCR4 shRNA. [0351] Embodiment 120. The kit of any one of claims 105-119, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
[0352] Embodiment 121. The kit of claim 120, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA. [0353] Embodiment 122. The kit of any one of claims 105-121, wherein said first antiviral
RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat siRNA, and said viral entry inhibiting RNA is a CCR5 shRNA.
[0354] Embodiment 123. The kit of any one of claims 105-121, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
[0355] Embodiment 124. The kit of any one of claims 105-121, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
[0356] Embodiment 125. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45.
[0357] Embodiment 126. A method of treating an infectious disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45. [0358] Embodiment 127. The method of claim 126, wherein said infectious disease is caused by a virus.
[0359] Embodiment 128. The method of claim 127, wherein said virus is HIV.
[0360] Embodiment 129. The method of claim 126, wherein said subject suffers from AIDS.
[0361] Embodiment 130. A method of inhibiting HIV replication in a patient, said method comprising administering to said patient a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45, thereby inhibiting HIV replication in said patient.

Claims

WHAT IS CLAIMED IS: 1. A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising a first RNA promoter operably linked to: (i) a first antiviral RNA encoding sequence, (ii) a second antiviral RNA encoding sequence and a (iii) third antiviral RNA encoding sequence, wherein said first RNA promoter is a forward promoter.
2. The recombinant nucleic acid of claim 1, further comprising a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence, wherein said second RNA promoter is a reverse promoter.
3. The recombinant nucleic acid of claim 2, wherein said recombinant nucleic acid forms part of a viral expression vector.
4. The recombinant nucleic acid of claim 2, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
5. The recombinant nucleic acid of claim 2, wherein said first RNA promoter is a RNA polymerase II promoter.
6. The recombinant nucleic acid of claim 5, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
7. The recombinant nucleic acid of claim 6, wherein said snRNA promoter is a Ul promoter.
8. The recombinant nucleic acid of claim 2, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA.
9. The recombinant nucleic acid of claim 8, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
10. The recombinant nucleic acid of claim 9, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
11. The recombinant nucleic acid of claim 9, wherein said viral replication inhibiting siRNA is a Rev siRNA.
12. The recombinant nucleic acid of claim 9, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
13. The recombinant nucleic acid of claim 9, wherein said ribozyme is a small nucleolar (sno) RNA.
14. The recombinant nucleic acid of claim 13, wherein said snoRNA is a U5 ribozyme.
15. The recombinant nucleic acid of claim 9, wherein said RNA decoy is a snoRNA.
16. The recombinant nucleic acid of claim 15, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
17. The recombinant nucleic acid of claim 2, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
18. The recombinant nucleic acid of claim 2, wherein said second RNA promoter is a polymerase III promoter.
19. The recombinant nucleic acid of claim 18, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
20. The recombinant nucleic acid of claim 19, wherein said snRNA promoter is a U6 promoter.
21. The recombinant nucleic acid of claim 2, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
22. The recombinant nucleic acid of claim 21, wherein said cellular receptor siRNA is a T cell receptor siRNA.
23. The recombinant nucleic acid of claim 22, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
24. The recombinant nucleic acid of claim 23, wherein said shRNA is a CCR5 shRNA.
25. The recombinant nucleic acid of claim 23, wherein said shRNA is a CXCR4 shRNA.
26. The recombinant nucleic acid of claim 2, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
27. The recombinant nucleic acid of claim 26, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
28. The recombinant nucleic acid of claim 1, further comprising a transcriptional terminator sequence.
29. The recombinant nucleic acid of claim 2, further comprising a transcriptional terminator sequence.
30. The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is an Ul terminator sequence.
31. The recombinant nucleic acid of claim 29, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
32. The recombinant nucleic acid of claim 1, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence.
33. The recombinant nucleic acid of claim 32, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
34. The recombinant nucleic acid of claim 33, wherein said intron sequence is a MCM7 intron sequence.
35. The recombinant nucleic acid of claim 2, further comprising an antiviral protein encoding sequence.
36. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence is downstream of said viral entry inhibiting RNA encoding sequence.
37. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a C46 fusion inhibitor.
38. The recombinant nucleic acid of claim 35, wherein said antiviral protein encoding sequence encodes a mutant Rev protein.
39. The recombinant nucleic acid of claim 38, wherein said mutant Rev protein is a Rev M10 protein.
40. The recombinant nucleic acid of claim 35, further comprising a transcriptional terminator sequence.
41. The recombinant nucleic acid of claim 40, wherein said transcriptional terminator sequence is an Ul terminator sequence.
42. The recombinant nucleic acid of claim 40, wherein said transcriptional terminator sequence is downstream of said antiviral protein encoding sequence.
43. The recombinant nucleic acid of claim 2, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
44. The recombinant nucleic acid of claim 2, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
45. The recombinant nucleic acid of claim 2, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a U5 ribozyme, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
46. A recombinant nucleic acid encoding an antiviral polycistronic RNA, said recombinant nucleic acid comprising:
(i) a first RNA promoter operably linked to: a first antiviral RNA encoding sequence, a second antiviral RNA encoding sequence and a third antiviral RNA encoding sequence; and
(ii) a second RNA promoter operably linked to a viral entry inhibiting RNA encoding sequence.
47. The recombinant nucleic acid of claim 46, wherein said recombinant nucleic acid forms part of a viral expression vector.
48. The recombinant nucleic acid of claim 46, wherein said recombinant nucleic acid forms part of a recombinant viral particle.
49. The recombinant nucleic acid of claim 46, wherein said first RNA promoter is a RNA polymerase II promoter.
50. The recombinant nucleic acid of claim 46, wherein said RNA polymerase II promoter is a small nuclear RNA (snRNA) promoter.
51. The recombinant nucleic acid of claim 50, wherein said snRNA promoter is a Ul promoter.
52. The recombinant nucleic acid of claim 46, wherein said first antiviral RNA encoding sequence encodes a first small interfering RNA (siRNA), said second antiviral RNA encoding sequence encodes a second siRNA and said third antiviral RNA encoding sequence encodes a third siRNA.
53. The recombinant nucleic acid of claim 52, wherein said first siRNA, second siRNA and third siRNA are independently a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
54. The recombinant nucleic acid of claim 53, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
55. The recombinant nucleic acid of claim 53, wherein said viral replication inhibiting siRNA is a Rev siRNA.
56. The recombinant nucleic acid of claim 53, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
57. The recombinant nucleic acid of claim 53, wherein said ribozyme is a small nucleolar (sno) RNA.
58. The recombinant nucleic acid of claim 57, wherein said snoRNA is a U5 ribozyme.
59. The recombinant nucleic acid of claim 53, wherein said RNA decoy is a snoRNA.
60. The recombinant nucleic acid of claim 59, wherein said snoRNA is a rev binding RNA decoy or a Tat binding RNA decoy.
61. The recombinant nucleic acid of claim 46, wherein said second RNA promoter is downstream of said third antiviral RNA encoding sequence.
62. The recombinant nucleic acid of claim 46, wherein said second RNA promoter is a polymerase III promoter.
63. The recombinant nucleic acid of claim 62, wherein said RNA polymerase III promoter is a small nuclear RNA (snRNA) promoter.
64. The recombinant nucleic acid of claim 63, wherein said snRNA promoter is a U6 promoter.
65. The recombinant nucleic acid of claim 46, wherein said viral entry inhibiting RNA encoding sequence encodes a cellular receptor siRNA.
66. The recombinant nucleic acid of claim 65, wherein said cellular receptor siRNA is a T cell receptor siRNA.
67. The recombinant nucleic acid of claim 66, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
68. The recombinant nucleic acid of claim 67, wherein said shRNA is a CCR5 shRNA.
69. The recombinant nucleic acid of claim 67, wherein said shRNA is a CXCR4 shRNA.
70. The recombinant nucleic acid of claim 46, wherein said viral entry inhibiting RNA encoding sequence encodes a nuclear receptor siRNA.
71. The recombinant nucleic acid of claim 70, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
72. The recombinant nucleic acid of claim 46, further comprising a transcriptional terminator sequence.
73. The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is an Ul terminator sequence.
74. The recombinant nucleic acid of claim 72, wherein said transcriptional terminator sequence is downstream of said viral entry inhibiting RNA encoding sequence.
75. The recombinant nucleic acid of claim 46, further comprising a first nucleic acid linker connecting said first antiviral RNA encoding sequence to said second antiviral RNA encoding sequence and a second nucleic acid linker connecting said second antiviral RNA encoding sequence to said third antiviral RNA encoding sequence.
76. The recombinant nucleic acid of claim 75, wherein said first nucleic acid linker or said second nucleic acid linker comprise an intron sequence.
77. The recombinant nucleic acid of claim 76, wherein said intron sequence is a MCM7 intron sequence.
78. The recombinant nucleic acid of claim 46, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat siRNA, said second RNA promoter is a U6 promoter and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
79. The recombinant nucleic acid of claim 46, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a Rev siRNA, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
80. The recombinant nucleic acid of claim 46, wherein said first RNA promoter is a Ul promoter, said first antiviral RNA encoding sequence encodes a Tat/Rev siRNA, said second antiviral RNA encoding sequence encodes a U5 ribozyme, said third antiviral RNA encoding sequence encodes a Tat binding RNA decoy, said second RNA promoter is a U6 promoter, and said viral entry inhibiting RNA encoding sequence encodes a CCR5 shRNA.
81. A mammalian cell comprising a recombinant antiviral polycistronic RNA comprising:
(i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
82. The mammalian cell of claim 81, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
83. The mammalian cell of claim 82, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
84. The mammalian cell of claim 83, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
85. The mammalian cell of claim 83, wherein said viral replication inhibiting siRNA is a Rev siRNA.
86. The mammalian cell of claim 83, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
87. The mammalian cell of claim 83, wherein said ribozyme is a snoRNA.
88. The mammalian cell of claim 87, wherein said ribozyme is a U5 ribozyme.
89. The mammalian cell of claim 83, wherein said RNA decoy is a snoRNA.
90. The mammalian cell of claim 83, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
91. The mammalian cell of claim 81 , wherein said viral entry inhibiting RNA is a cellular receptor siRNA.
92. The mammalian cell of claim 91, wherein said cellular receptor siRNA is a T cell receptor siRNA.
93. The mammalian cell of claim 92, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
94. The mammalian cell of claim 93, wherein said shRNA is a CCR5 shRNA.
95. The mammalian cell of claim 93, wherein said shRNA is a CXCR4 shRNA.
96. The mammalian cell of claim 81, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
97. The mammalian cell of claim 96, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
98. The mammalian cell of claim 81, further comprising an antiviral protein.
99. The mammalian cell of claim 98, wherein said antiviral protein is a C46 fusion inhibitor.
100. The mammalian cell of claim 98, wherein said antiviral protein is a mutant Rev protein.
101. The mammalian cell of claim 100, wherein said mutant Rev protein is a Rev Ml 0 protein.
102. The mammalian cell of claim 81 , wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat siRNA, and said viral entry inhibiting RNA is a CCR5 shRNA.
103. The mammalian cell of claim 81 , wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
104. The mammalian cell of claim 81 , wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
105. A kit comprising a recombinant antiviral polycistronic RNA comprising, (i) a first antiviral RNA, a second antiviral RNA and a third antiviral RNA; and (ii) a viral entry inhibiting RNA.
106. The kit of claim 105, wherein said first antiviral RNA, said second antiviral RNA and said third antiviral RNA is a small interfering RNA (siRNA).
107. The kit of claim 106, wherein said siRNA is a viral transcription inhibiting siRNA, a viral replication inhibiting siRNA, a viral transcription and replication inhibiting siRNA, a ribozyme or an RNA decoy.
108. The kit of claim 107, wherein said viral transcription inhibiting siRNA is a Tat siRNA.
109. The kit of claim 107, wherein said viral replication inhibiting siRNA is a Rev siRNA.
1 10. The kit of claim 107, wherein said viral transcription and replication inhibiting siRNA is a Tat/Rev siRNA.
1 1 1. The kit of claim 107, wherein said ribozyme is a snoRNA.
1 12. The kit of claim 107, wherein said ribozyme is a U5 ribozyme.
1 13. The kit of claim 107, wherein said RNA decoy is a snoRNA.
114. The kit of claim 107, wherein said RNA decoy is a rev binding RNA decoy or a Tat binding RNA decoy.
115. The kit of claim 105, wherein said viral entry inhibiting RNA is a cellular receptor siRNA.
116. The kit of claim 115, wherein said cellular receptor siRNA is a T cell receptor siRNA.
1 17. The kit of claim 1 16, wherein said T cell receptor siRNA is a small hairpin (sh) RNA.
1 18. The kit of claim 1 17, wherein said shRNA is a CCR5 shRNA.
1 19. The kit of claim 1 17, wherein said shRNA is a CXCR4 shRNA.
120. The kit of claim 105, wherein said viral entry inhibiting RNA is a nuclear receptor siRNA.
121. The kit of claim 120, wherein said nuclear receptor siRNA is a transportin 3 (TNP03) siRNA.
122. The kit of claim 105, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat siRNA, and said viral entry inhibiting RNA is a CCR5 shRNA.
123. The kit of claim 105, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a Rev siRNA, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
124. The kit of claim 105, wherein said first antiviral RNA is a Tat/Rev siRNA, said second antiviral RNA is a U5 ribozyme, said third antiviral RNA is a Tat binding RNA decoy, and said viral entry inhibiting RNA is a CCR5 shRNA.
125. A pharmaceutical composition comprising a pharmaceutically acceptable excipient and a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45.
126. A method of treating an infectious disease in a subject in need thereof, said method comprising administering to said subject a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45.
127. The method of claim 126, wherein said infectious disease is caused by a virus.
128. The method of claim 127, wherein said virus is HIV.
129. The method of claim 126, wherein said subject suffers from AIDS.
130. A method of inhibiting HIV replication in a patient, said method comprising administering to said patient a therapeutically effective amount of a recombinant viral particle comprising a recombinant nucleic acid of any one of claims 1-45, thereby inhibiting HIV replication in said patient.
PCT/US2014/056384 2013-09-18 2014-09-18 Rna-based hiv inhibitors Ceased WO2015042308A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/073,481 US20160289681A1 (en) 2013-09-18 2016-03-17 Rna-based hiv inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361879617P 2013-09-18 2013-09-18
US61/879,617 2013-09-18

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US15/073,481 Continuation US20160289681A1 (en) 2013-09-18 2016-03-17 Rna-based hiv inhibitors

Publications (2)

Publication Number Publication Date
WO2015042308A2 true WO2015042308A2 (en) 2015-03-26
WO2015042308A3 WO2015042308A3 (en) 2015-11-12

Family

ID=52689599

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/056384 Ceased WO2015042308A2 (en) 2013-09-18 2014-09-18 Rna-based hiv inhibitors

Country Status (2)

Country Link
US (1) US20160289681A1 (en)
WO (1) WO2015042308A2 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017139065A1 (en) * 2016-02-08 2017-08-17 American Gene Technologies International Inc. Hiv vaccination and immunotherapy
US9834790B1 (en) 2016-01-15 2017-12-05 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
WO2018009847A1 (en) * 2016-07-08 2018-01-11 American Gene Technologies International Inc. Hiv pre-immunization and immunotherapy
US10137144B2 (en) 2016-01-15 2018-11-27 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
EP3518981A4 (en) * 2016-10-03 2020-06-10 President and Fellows of Harvard College Delivery of therapeutic rnas via arrdc1-mediated microvesicles
US10767183B2 (en) 2016-03-09 2020-09-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US10945954B2 (en) 2012-02-06 2021-03-16 President And Fellows Of Harvard College ARRDC1-mediated microvesicles (ARMMS) and uses thereof
US11001817B2 (en) 2014-10-31 2021-05-11 President And Fellows Of Harvard College Delivery of cargo proteins via ARRDC1-mediated microvesicles (ARMMs)
US11104902B2 (en) * 2017-09-22 2021-08-31 City Of Hope Splice inhibiting oligonucleotides
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
WO2024189038A1 (en) 2023-03-15 2024-09-19 European Molecular Biology Laboratory Methods of preventing or treating cardiomyopathy by redirecting mislocalized pathogenic rbm20 protein variants
US12503497B2 (en) 2019-09-26 2025-12-23 President And Fellows Of Harvard College Minimal arrestin domain containing protein 1(ARRDC1) constructs
US12559769B2 (en) 2017-06-16 2026-02-24 American Gene Technologies International Inc. Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9605266B2 (en) * 2014-07-16 2017-03-28 City Of Hope Cell-specific internalizing RNA aptamers against human CCR5 and uses therefore
EP3268475B1 (en) * 2015-03-11 2020-10-21 Yissum Research and Development Company of the Hebrew University of Jerusalem Ltd. Decoy oligonucleotides for the treatment of diseases
US20250154457A1 (en) * 2021-03-04 2025-05-15 City Of Hope T-cells for anti-hiv car-t therapy and methods of use

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU750598B2 (en) * 1998-07-22 2002-07-25 Immusol Incorporated Substantially complete ribozyme libraries
WO2008094516A2 (en) * 2007-01-29 2008-08-07 City Of Hope Multi-targeting short interfering rnas

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11007209B2 (en) 2008-10-17 2021-05-18 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US10945954B2 (en) 2012-02-06 2021-03-16 President And Fellows Of Harvard College ARRDC1-mediated microvesicles (ARMMS) and uses thereof
US11001817B2 (en) 2014-10-31 2021-05-11 President And Fellows Of Harvard College Delivery of cargo proteins via ARRDC1-mediated microvesicles (ARMMs)
US11827910B2 (en) 2014-10-31 2023-11-28 President And Fellows Of Harvard College Delivery of CAS9 via ARRDC1-mediated microvesicles (ARMMs)
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10472649B2 (en) 2016-01-15 2019-11-12 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10023880B2 (en) 2016-01-15 2018-07-17 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US9834790B1 (en) 2016-01-15 2017-12-05 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12410446B2 (en) 2016-01-15 2025-09-09 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10420789B2 (en) 2016-01-15 2019-09-24 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10428350B2 (en) 2016-01-15 2019-10-01 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US9914938B2 (en) 2016-01-15 2018-03-13 American Gene Technologies International, Inc. Methods and compositions for the activation of gamma-delta T-cells
US10036040B2 (en) 2016-01-15 2018-07-31 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10772905B2 (en) 2016-01-15 2020-09-15 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10137144B2 (en) 2016-01-15 2018-11-27 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US11519006B2 (en) 2016-01-15 2022-12-06 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12090200B2 (en) 2016-02-08 2024-09-17 American Gene Technologies International Inc. Methods of producing cells resistant to HIV infection
US10888613B2 (en) 2016-02-08 2021-01-12 American Gene Technologies International Inc. Method of producing cells resistant to HIV infection
JP2022101658A (en) * 2016-02-08 2022-07-06 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド HIV vaccination and immunotherapy
WO2017139065A1 (en) * 2016-02-08 2017-08-17 American Gene Technologies International Inc. Hiv vaccination and immunotherapy
JP2019509029A (en) * 2016-02-08 2019-04-04 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド HIV vaccination and immunotherapy
JP7551157B2 (en) 2016-02-08 2024-09-17 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド HIV Vaccination and Immunotherapy
JP7153332B2 (en) 2016-02-08 2022-10-14 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド HIV vaccination and immunotherapy
US10975374B2 (en) 2016-03-09 2021-04-13 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US10767183B2 (en) 2016-03-09 2020-09-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US10036038B2 (en) 2016-07-08 2018-07-31 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US12370253B2 (en) 2016-07-08 2025-07-29 American Gene Technologies International Inc. Pre-immunization and immunotherapy
WO2018009847A1 (en) * 2016-07-08 2018-01-11 American Gene Technologies International Inc. Hiv pre-immunization and immunotherapy
US11911458B2 (en) 2016-07-08 2024-02-27 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11090379B2 (en) 2016-07-08 2021-08-17 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10494647B2 (en) 2016-07-08 2019-12-03 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10233464B2 (en) 2016-07-08 2019-03-19 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11730823B2 (en) 2016-10-03 2023-08-22 President And Fellows Of Harvard College Delivery of therapeutic RNAs via ARRDC1-mediated microvesicles
EP3518981A4 (en) * 2016-10-03 2020-06-10 President and Fellows of Harvard College Delivery of therapeutic rnas via arrdc1-mediated microvesicles
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US12559769B2 (en) 2017-06-16 2026-02-24 American Gene Technologies International Inc. Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells
US11104902B2 (en) * 2017-09-22 2021-08-31 City Of Hope Splice inhibiting oligonucleotides
US11767530B2 (en) 2017-09-22 2023-09-26 City Of Hope Splice inhibiting oligonucleotides
US12503497B2 (en) 2019-09-26 2025-12-23 President And Fellows Of Harvard College Minimal arrestin domain containing protein 1(ARRDC1) constructs
WO2024189038A1 (en) 2023-03-15 2024-09-19 European Molecular Biology Laboratory Methods of preventing or treating cardiomyopathy by redirecting mislocalized pathogenic rbm20 protein variants

Also Published As

Publication number Publication date
WO2015042308A3 (en) 2015-11-12
US20160289681A1 (en) 2016-10-06

Similar Documents

Publication Publication Date Title
US20160289681A1 (en) Rna-based hiv inhibitors
JP6713073B2 (en) Compositions and methods for treating abnormal hemoglobinopathy
US20210269804A1 (en) Multiplexed shrnas and uses thereof
Hanke et al. HERV‐K (HML‐2), a seemingly silent subtenant–but still waters run deep
US20090227509A1 (en) Modulation of hiv replication by rna interference
ES2833449T3 (en) Gene therapy for the treatment of HIV and its uses
US20250354166A1 (en) Lentiviral vectors useful for the treatment of disease
EP3810638A1 (en) Gene therapy
WO2006041290A2 (en) Nucleic acids against viruses , in particular hiv
WO2012159120A2 (en) Gene therapy based strategy for treating hiv
US20200339994A1 (en) Treatment of HIV
WO2014200557A1 (en) Method of increasing the amount of fetal hemoglobin in a cell and/or mammal
EP1582591A2 (en) Sirna and their use for knock down expression of porcine endogenous retrovirus
Rahimi et al. Molecular Approach for HIV-1 Replication Inhibition: Assessment of Different siRNAs Targeting Tat and Nef Genes to Effectively Suppress their Expression.
DeSimone et al. Journal of Stem Cell Research
Malard Efficacy, safety, and delivery of anti-HIV short-hairpin RNA molecules for use in HIV gene therapy
Fallarino Anti HIV-1 gene therapy approach combining multiple siRNAs with the membrane-anchored fusion inhibitor C-peptide maC46
CN121399150A (en) Modified vectors
Choi et al. Multiplexing 7 miRNA-based shRNAs to suppress HIV replication
Turner Transcriptional Gene Silencing of HIV-1 by Non-Coding RNAs: Progress towards a TGS-based genetic therapy
Matamoros Inhibition of CCR5 and CXCR4 prevents HIV infection
Spanevello Development of lentiviral vectors expressing multiple small interfering RNAs as a gene therapy approach against HIV-1 infection
van den Berg et al. RNAi-Based Gene Expression Strategies to Combat HIV

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14846099

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14846099

Country of ref document: EP

Kind code of ref document: A2