WO2015042306A1 - Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols - Google Patents

Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols Download PDF

Info

Publication number
WO2015042306A1
WO2015042306A1 PCT/US2014/056382 US2014056382W WO2015042306A1 WO 2015042306 A1 WO2015042306 A1 WO 2015042306A1 US 2014056382 W US2014056382 W US 2014056382W WO 2015042306 A1 WO2015042306 A1 WO 2015042306A1
Authority
WO
WIPO (PCT)
Prior art keywords
fatty
isolated
acyl
fatty acyl
cerevisiae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/056382
Other languages
French (fr)
Inventor
David Troy STUART
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Alberta
Original Assignee
University of Alberta
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Alberta filed Critical University of Alberta
Priority to US15/022,844 priority Critical patent/US20160222419A1/en
Priority to CA2924885A priority patent/CA2924885A1/en
Publication of WO2015042306A1 publication Critical patent/WO2015042306A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • C12N1/18Baker's yeast; Brewer's yeast
    • C12N1/185Saccharomyces isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0008Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/64Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi
    • C12R2001/85Saccharomyces
    • C12R2001/865Saccharomyces cerevisiae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y102/00Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01084Alcohol-forming fatty acyl-CoA reductase (1.2.1.84)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y301/00Hydrolases acting on ester bonds (3.1)
    • C12Y301/02Thioester hydrolases (3.1.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)
    • C12Y602/01003Long-chain-fatty-acid-CoA ligase (6.2.1.3)

Definitions

  • the present invention relates to the field of fatty alcohol production and, in particular, to the use of genetically engineered Saccharomyces cerevisi e and Yarrowia Hpolytica to produce fatty alcohols.
  • Fatty alcohols are long chain aliphatic molecules with nonpolar lipophilic hydrocarbon chains and a polar hydrophilic hydroxy! moiety.
  • the hydrocarbon chain lengths of naturally occurring fatty alcohols are highly variable ranging from 8 to 30 carbon atoms.
  • Many organisms synthesize fatty alcohols in small amounts and these molecules are used as pheromones by insects [1], components of waxes that coat plants, insects and mammals [2], ether lipids that form the base of signaling molecules [3 ], and as components of storage lipids [4, 5],
  • Naturally occurring fatty alcohols are derived from fatty acid biosynthetic pathways and so most ha e even numbered carbon chains although some odd chain length alcohols have been identified in bacteria [6] While the majority of naturally occurring fatty alcohols are saturated, some mono unsaturated alcohols have been detected incorporated in wax esters and ether lipids [2],
  • the biosynthesis of fatty alcohols proceeds by the activation of fatty acids to acyl- CoA and subsequent reduction by fatty acyl reductase (FAR) activities that catalyze a four- electron reduction of acyf-CoA.
  • FAR fatty acyl reductase
  • the reaction proceeds through an aldehyde intermediate although in many cases no free aldehyde is released [7].
  • Most alcohol forming FAR activities use reducing equivalents from NADPH [8], however an NADH dependent aldehyde forming FAR activity has been identified in the algae Botryococcus brauni [9].
  • the nature of the available pool of fatty acids is a major determinant of the type of fatty alcohols that will be produced by any organism.
  • FAR enzymes are integral membrane proteins that have a hydrophobic sequence targeting them to the endoplasmic reticulum, Golgi apparatus, or peroxisomes.
  • aldehyde forming FAR enzymes are cytoplasmic or peripheral membrane pro eins [9, 10, 12]. The localization of the enzyme likely reflects its function.
  • A. thaliana FAR enzymes are largely associated with the endoplasmic reticulum and wax ester synthesis, the mouse FARl and FAR2 are localized to peroxisomes for the synthesis of ether lipids [13, 14].
  • Fatty alcohols have a variety of industrial applications. Owing to the amphiphilic nature of fatty alcohols that results from the combination of a long nonpolar acyl chain and a polar hydrophilic hydroxyl these molecules can act as surfactants and a significant portion of fat y alcohols produced are used for this purpose [151. Their chemical character allows fatty alcohols to orient themselves at interfaces for use as emufsifiers and emollients in the cosmetic industry. Additionally, they are used as additives in lubricant, surfactants and detergent formulations as polythoxyiates. Some short chain alcohols are used as flavor and fragrance compounds. They find broad application as platform chemicals since the alcohol moiety is vulnerable to a variety of chemical modifications, and they can be used to form polymers [16], Additionally, fatty alcohols can also be used as fuel additives [17].
  • Fatty alcohols in their free form are very rare in nature with most being derived from waxes into which they are incorporated [2].
  • Fatty alcohols can be produced by hydrolysis or trans-esterification of triglycerides derived from vegetable oils followed by hydrogenation to produce alcohols. Indeed this process makes up the primary source of fatty alcohols employed in industrial and commercial applications [17].
  • Fatty alcohols can also be chemically synthesized from petrochemical feedstock through oligomerization of ethylene followed by oxidation [17].
  • the invention relates to an isolated Saccharomyces cerevisiae and Yarmwia lipolytica cells genetically engineered to produce one or more fatty alcohols, the S. cerevisiae and Y. lipolytica cells genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be deficient in at least one enzyme involved in fatty acid oxidation.
  • the invention relates to an isolated Saccharomyces cerevisiae cell genetically engineered to produce one or more fatty alcohols, the S. cerevisiae cell genetically engineered to: i) express an acyl-CoA t ioesterase; it) express a fatty acyl reductase, and iii) (a) express a fatty acyl activating enzyme, or (b) lack a fatty aeyl-CoA oxidase, or (c) both express a fatty acyl activating enzyme and lack a fatty acyl-CoA oxidase.
  • the invention relates to an isolated S. cerevisiae and Y.
  • lipo!ytica cells genetically engineered to produce one or more fatty alcohols
  • the S. cerevisiae and Y. lipolytica cells genetically engineered to express an acyl-CoA thioesterase from E. coli, a fatty acyl reductase from Mus muscul s and an endogenous fatty acyl activating enzyme, to over-express an endogenous fatty acyl synthetase and to lack an endogenous fatty acyl-CoA oxidase.
  • these enzymes can be expressed from a constitutive or heterologous promoter.
  • the isolated S. cerevisiae and Y. lipolytica cells are genetically engineered to contain mutations or deletions in several genes, including, but not limited to SNF2, . ,011 J and ACB1.
  • genes may also be added to increase fatty alcohol synthesis such as, but not limited to ALD6 and ACS1.
  • the invention relates to an isolated nucleic acid comprising a first nucleotide sequence encoding an acyl -Co A thioesterase, a second nucleotide sequence encoding a fatty acyl reductase and a third nucleotide sequence encoding a fatty acyl activating enzyme.
  • the invention relates to a vector comprising the isolated nucleic acid as described above.
  • the invention relates to isolated S. cerevisae and Y. lipolytica cells comprising either of the isolated nucleic acid or the vector described above.
  • the invention relates to method of producing one or more fatty alcohols comprising cuituring the isolated S, cerevisiae and Y. lipolytica cells described above and isolating the one or more fatty alcohols.
  • the invention relates to a method of producing fatty alcohols comprising hexadecanol and octadecanol, the method cuituring an isolated S. cerevisiae and Y. lipolytica cells genetically engineered to express an acyi-CoA thioesterase from E. coli, a fatty acyl reductase from Mus musculus and an endogenous fatty acyl activating enzyme, to over-express an endogenous fatty acyl synthetase and to lack an endogenous fatty acyl-CoA oxidase in a medium comprising glucose and isolating the one or more fatty alcohols.
  • FIG. 1 Expression of Fatty alcohol synthesizing enzymes in S. cerevisiae. Protein extracts from 3 independent colonies were probed with anti-MYC ascites fluid for the presence of (A) murine FAR1, (B) E, gracilis FAR1, (C) E. coli tesA, (D) S. cerevisiae Tesl, Strains harboring an empty expression vector were probed as a negative control (vector). As a positive control for the antibody binding and western blotting an extract containing a MYC tagged Erg 10 was included in each blot.
  • S. cerevisiae harboring an empty vector (grey bars), a vector overproducing TES1 (open bars) or a vector overproducing E. coli TesA (striped bars ) were cultured in selective medium and lipids were extracted and measured by gas chromatography. Fatty acid concentrations are expressed as mg/gram wet weight of ceils. The means of three independent experiments are shown, error bars indicate standard deviation for the three independent trials.
  • FIG. 6 Fatty alcohol production so S. cerevisiae fed batch culture.
  • the data shown are from a single 4 litre fermentation.
  • the growth of the culture is indicated by increasing ODeoo values (C) and the culture was fed with glucose at the times indicated by the arrows in panel C.
  • FIG. 7 Engineered yeast produce C16 and C18 alcohols. Mutations in SNF2 and FAR1 increase yields. Expression of Arabadops is thaliana FAR5 in S. cerviseae leads to production of exclusively monounsaturated octadecanol compared with the mixed hexadecanol and octadecanol synthesized by mFARl . Additionally, we determined that deletion of the ACB1 gene could increase the proportion of octadecanol synthesized. The Acbl protein is involved in transport of octadecanoic acid and its deletion increases the cellular pools of octadecanoic acid available for conversion to octadecanol. Note that ACB 1 deletion increases the proportion of octadecanol produced in FAR1 expressing strains and increases the abundance of octadecanol in FAR5 expressing strains.
  • FIG. 8 Yeast expressing FAR5 make only C18 alcohol and ACB1 deletion increases the production of C18 alcohol. Mutation of the gene for SNF2, which encodes a chromatin-remodeling enzyme, increases the production of fatty alcohols in FAR1 expressing strains. This mutant was identified in a screen for strains with increases lipid production. The FAR1 expressing strain was mutagenized with ultraviolet light and surviving strains were layered on top of and centrifuged into a density gradient. More buoyant cells (with higher lipid content) floated near the top of the gradient. Several of the more buoyant strains were found to be lipid and fatty alcohol over producers and had mutations in the SNF2 gene.
  • Truncation oiFARl also increases fatty alcohol production. 48 amino acids predicted to encode a membrane anchoring domain in FAR1 were removed to allow FAR1 to function in the cytoplasm. This truncation improves production of fatty alcohols likely by increasing access of Farl to the cytoplasm fatty acid pool.
  • C16 and C18 alcohols can be made from hydrolysates of softwood or wheat.
  • the fatty alcohol producing strains can use cellulosic hydrolysates as feedstock. Hydrolysates of softwood or wheat straw produced by dilute acid treatment were used to provide a carbon source with a sugar content of 40 g/L. The hydrolysates were supplemented with urea to provide nitrogen. Yields of hexadecanol and octadecanol are lower than observed with sugar as a substrate in part owing to inhibitors of cell growth present in the hydrolysates and owing to the ability of the production strain to effectively utilize xylose and arabinose which account for some of the sugars in the hydrolysates.
  • the strain can and will be adapted to tolerate inhibitors in the hydrolysates and will be engineered to effectively ferment xylose and arabinose as well as the glucose in the hydrolysates.
  • the present invention relates to the genetic engineering of Saccharomyces cerviseae for the production of fatty alcohols, including, but not limited to hexadecanoi and octadecanol.
  • Saccharomyces cerviseae for the production of fatty alcohols, including, but not limited to hexadecanoi and octadecanol.
  • genetically engineering S. cerevisiae to express or over- express a plurality of enzymes involved in fatty alcohol synthesis allows production of fatty alcohols in 5. cerevisiae.
  • genetic engineering of 5, cerevisiae to express a plurality of enzymes involved in fatty alcohol synthesis in combination with a deficiency in one or more enzymes involved in fatty acid oxidation may lead to increased yields of fatty alcohols in some embodiments.
  • the invention relates to S. cerevisiae genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be deficient in at least one enzyme involved in fatty acid oxidation.
  • Certain embodiments of the invention also relate to methods of producing fatty alcohols by culturing the genetically engineered S. cerevisiae described herein.
  • the two or more enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase and fatty acyl reductase.
  • the acyi- CoA thioesterase may be derived from a bacterial source, for example, from E. coli.
  • the E. coli acyl-CoA thioesterase may be mutated or truncated.
  • the fatty acyl reductase may be derived from a mammalian source, for example, from a rodent such as Mus musculus, or from plant sources including but not limited to Arahadopsis thaliana, or from single cell organism such as Euglena gracilis.
  • the fatty acyl reductase may also be mutated or truncated to increase fatty alcohol synthesis.
  • the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyl reductase and fatty acyl activating enzyme.
  • the fatty acyl activating enzyme may be, for example, an endogenous fatty acyl activating enzyme.
  • Fatty acyl activating enzymes derived from other sources, including bacterial, plant, single cell organisms, or mammalian, are also contemplated in some embodiments.
  • the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyi reductase, fatty acyl activating enzyme and fatty acyl synthetase.
  • the fatty acyl synthetase may be, for example, an endogenous fatty acyl synthetase.
  • Fatty acyl synthase enzymes derived from other sources, including bacterial, plant, single cell organisms, or mammalian, are also contemplated in some embodiments.
  • the S. cerevisiae is genetically engineered to place expression of the endogenous fatty acyl synthase under control of a heterologous promoter in order to reduce feedback inhibition of fatty acyl synthase expression. It also contemplated that the other genes involved in fatty alcohol synthesis my also be under the control of a heterologous promoter.
  • exogenous enzymes may be expressed in 5 * . cerevisiae to increase the yield of fatty alcohols.
  • malonyl-CoA synthetase from thaliana, and glyceraldehyde-3 -phosphate dehydrogenase from Streptomyces mutans can increase the cellular concentration of malonyl-CoA (substrate for acyl-CoA synthesis) and NADPH (cofactor for acyl-CoA synthesis) respectively.
  • Other enzymes that may be manipulated to increase fatty alcohol yield include the up-regulation of the fatty acid synthase subunits Fasl and Fas2.
  • one or more of the nucleic acids used to express the acyl- CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be codon optimized to improve expression in S. cerevisiae.
  • each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyi reductase, fatty acyi activating enzyme and fatty acyl synthetase may be under the control of respective constitutive promoters so that production of fatty alcohols by fermentation of the S.
  • cerevisiae does not require addition of specific compounds to induce expression of these enzymes.
  • the enzymes involved in fatty acid oxidation comprise, for example, fatty acyl-CoA oxidase (POXl gene).
  • a mutation in the SNF2 gene may increase fatty alcohol production (see Figs. 7-8).
  • the mutation isolated was a null mutation creating a frame shift in the coding sequence of the gene.
  • a complete deletion oiSNF2 has the same effect as the null frame shifting mutation
  • it may be possible to increase the yield of fatty alcohol production e.g. hexadeeanol and octadecanol
  • genes encoding acyl binding proteins such as, but limited to ACB1, which promotes the degradation of CI8-C0A (see Fig. 8)
  • acyl-CoA thioesterase and fatty acyl reductase enzymes can have different specificities with respect to the type of fatty acid they use as a substrate and/or the type of fatty alcohol they produce (11). Accordingly, in certain embodiments, the acyl-CoA thioesterase and/or fatty acyl reductase for genetic engineering of the S. cerevisiae are selected depending on what fatty alcohol(s) are required in the end product (see Fig. 7 for example).
  • the S. cerevisiae strain selected for genetic engineering in accordance wi th the invention is one that is capable of fermenting sugars from lignocellulosic hydrolysates. In some embodiments, the S. cerevisiae strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from
  • the S. cerevisiae strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting both glucose and xylose from lignocellulosic hydrolysates (see Fig. 9). Such strains are known in the art (36, 37, 38).
  • fermentation of the genetically engineered S. cerevisiae described above in a suitable medium allows for high-level production of fatty alcohols, for example, greater than 100 mg/L in 168 hours, for example, at least HOmg/L, at least 120mg/L, at least 130mg/L, at least 140 mg/L, at least 150 mg/L, at least 160 mg/L, at least 170 mg/L, in 168 hours, or any amount there between.
  • cerevisiae described above in a suitable medium allows for production of lOOmg/L or greater of fatty alcohols in 72 hours, for example, 110 mg L or greater, 120 mg/L or greater, 130 mg/L or greater, 140 mg/'L, or greater, 150 mg/L or greater, 160 mg L or greater, 170 mg/L or greater, in 72 hours, or any amount there between.
  • the oleaginous yeast strain Yarrowia lipoiytica is used to increase yields of fatty alcohols.
  • F, lipolytica is capable of fermenting sugars from lignocellulosic hydrolysates and can be advantageous in some situations due to its high rate of fatty acid accumulation and the usage of a wide variety of sugars, glycerol and acetic acid as carbon sources.
  • Y. Hpolytica strains can be genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis such as described above with S. cerevisiae strains. For example, in some Y.
  • the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and tatty acyl synthetase or any combination thereof.
  • These enzymes may be, for example, endogenous or can including bacterial, plant, single cell organisms, or mammalian sources.
  • one or more of the nucleic acids used to express the acyl- CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be codon optimized to improve expression in Y. Hpolytica.
  • each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be under the control of respective constitutive promoters so that production of fatty alcohols by fermentation of the Y.
  • each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be under the control of respective heterologous promoters.
  • the fatty acyl synthase is an endogenous fatty acyl synthase
  • the Y. Hpolytica is genetically engineered to place expression of the endogenous fatty acyl synthase under control of a heterologous promoter in order to reduce feedback inhibition of fatty acyl synthase expression.
  • Y. Hpolytica strains express the FARl gene of M. mus and the tesA gene of is. coli.
  • Y. Hpolytica strains expressing the FARl gene of A, thaliana and the tesA gene of is. coli, and may be deficient in another gene product, or have further genes added to increase the yield of fatty alcohols.
  • the flow of carbon may be redirected from the production of ethanol to the production of acetyl-CoA for fatty acyl-CoA synthesis.
  • This can be accomplished, for example, by the deletion of the ADH1 gene and addition of genes encoding ALD6 and a hyperactive ACS1 to convert acetaldehyde to acetyl- CoA as substrate for fatty acyl-CoA synthesis.
  • Ald6 uses NADP as a cofactor this will lead to an increase in NADPH, which is required for fatty alcohol synthesis.
  • NADPH xylose-5-phosphate kinase
  • ack acetate kinase
  • engineered Y. lipolytica strains can be further modified by the introduction of a mutation to, or a deletion of the SNF2 gene (see Figs. 7-8).
  • the SNF2 gene encodes a chromatin remodeling protein and is involved in the transcriptional regulation of the fatty alcohol synthesis genes. Such a mutation can increase fatty acid synthesis.
  • a codon optimized xylose isomerase derived from Piromyces sp. can be inserted in the yeast strain to increase their ability to use the xylose in cellulosic hydrolysates.
  • the techniques used in the manipulation of recombinant DNA are well known to those of ordinary skill in the art.
  • the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from iignocellulosic hydrolysates. In some embodiments, the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from
  • the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting both glucose and xylose from Iignocellulosic hydrolysates.
  • fermentation of the genetically engineered Y. lipolytica described above in a suitable medium allows for high-level production of fatty alcohols, for example, greater than 100 mg/'L in 168 hours, for example, at least HOmg/L, at least 120mg/L, at least 13Gmg/L, at least 140 mg/L, at least 150 mg/L, at least 160 mg/L, at least 170 mg/'L,, in 168 hours, or any amount there between.
  • Lipolytica described above in a suitable medium allows for production of lOOmg/L or greater of fatty alcohols in 72 hours, for example, 110 mg L or greater, 120 mg/L or greater, 130 mg'L or greater, 140 mg/L. or greater, 150 mg/L or greater, 160 mg/L or greater, 170 mg/ ' L or greater, in 72 hours, or any amount there between.
  • yeast cultures may be fermented at 30 °C in a synthetic medium supplemented with urea to provide a nitrogen source and a dissolved oxygen content of 30%.
  • Glycerol and cellulosic hydrolysates can be used as a carbon feed stock for fatty alcohol production.
  • the production of cellulosic hydrolysates is well known in the art. Dilute acid hydrolysis is one standard method for the production of cellulosic hydrolysates.
  • enzymes used in various embodiments may include those sharing a sequence identity or substantial sequence identity to those enzymes listed herein.
  • sequence identity or “identity” in the context of two protein or peptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
  • percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
  • sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
  • Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif).
  • substantially identical in the context of a proteins or peptide indicates that a proteins or peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, or even 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
  • optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch ( eedleman and Wunsch, JMB, 48, 443 (1970)).
  • nucleic acid molecules and peptides that are substantially identical to the nucleic acid molecules and peptides presented herein.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • the term "about” refers to an approximately +/-1G% variation from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
  • plurality means more than one, for example, two or more, three or more, four or more, and the like.
  • Naturally occurring refers to the fact that an object can be found in nature.
  • an organism, or a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
  • isolated means that the material is removed from its original environment (for example, the natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the co-existing materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • compositions, use or method described herein as comprising certain elements and/or steps may also, in certain embodiments consist essentially of those elements and/or steps, and in other embodiments consist of those elements and/or steps, whether or not these embodiments are specifically referred to.
  • FAR Fatty Acyl Reductase NADH Nicotinamide Adenine Dinucleotide, NADPH Nicotinamide Adenine Dinucleotide Phosphate, rpm revolutions per minute, MSTFA Methanolic HCL, N- methyl-N- (trimethylsiylyl) trifluoroacetamide, CoA Coenzyme A, lic Acid Reductase, DTT Dithiothreitol, SDS Sodium Dodeealsulfate.
  • the yeast Saccharomyces cerevisiae is an industrial workhorse for the production of ethanoi and a variety of chemicals and small molecules. [25]. Yeast has great potential as a chassis for the production of lipid based compounds as some oleaginous species are capable of accumulating up to 70% of their dry weight as lipid [26].
  • lipid based compounds as some oleaginous species are capable of accumulating up to 70% of their dry weight as lipid [26].
  • Fatty alcohol synthesizing enzymes can be expressed in S. cerevisiae.
  • Fatty- alcohols can be synthesized from fatty acids by activation of the fatty acid to an aeyl-CoA and subsequent reduction to an alcohol.
  • S. cerevisiae we introduced an expression vector harboring genes for an acyl-CoA thioesterase from either E, coli (tesA), or S. cerevisiae (TES1), a fatty acyl activating enzyme (FAA3) from S, cerevisiae and a fatty acyl reductase from either Mus musculus (niFARl) ox Euglena gracilis (egFARl).
  • tesA, mFARl, and egFARl were heterologous enzymes the open reading frames were altered to include a 10 amino acid epitope tag recognized by the cMYC antibody. This allowed detection of the proteins by Western blotting to confirm expression. Additionally, a truncated version of tesA lacking its signal sequence was used since expression of this variant has previously been shown to result in elevated accumulation of tatty acids and to bypass feedback inhibition of fatty acyl-CoA on fatty acid synthesis [28],
  • FAS1 Over expression of fatty acyl synthetase FAS1 increases fatty alcohol production in yeast.
  • Fatty alcohols are synthesized from fatty acids and their CoA derivatives.
  • Fatty acid synthesis is largely driven by the activity of the enzyme fatty acyl synthetase.
  • the FAS1 and FAS2 genes encode the ⁇ and a subunits of this enzyme. Fasl and Fas2 function in a stoichiometric relationship and FAS 2 gene expression is regulated in part by the Fasl protein abundance such that an increase in Fasl triggers increased transcription of FAS2 [29, 30] .
  • the size of the intracellular fatty acid pool is a key determinant for fatty alcohol production and so we investigated other avenues of engineering increased fatty acid synthesis.
  • Fas ! the initial reactions of fatty acid synthesis are driven by acetyl- CoA carboxylase, which catalyzes the formation of malonyl-CoA.
  • the ACCl gene encodes this activity.
  • the activity of Accl is negatively regulated by phosphorylation catalyzed by the Snfl protein kinase [32].
  • Snfl protein kinase With the intent of reducing Accl inhibition we deleted the SNF1 gene. However, deletion of SNF1 did not yield and increase in fatty alcohol accumulation.
  • acyl-CoA species increases fatty alcohol accumulation hi engineered strains.
  • fatty acids can be subject to a variety of metabolic fates dependent upon the cells requirements.
  • fatty acids can be degraded by ⁇ -oxidation to yield acetyl-CoA.
  • excess fatty acids would be activated to acyl-CoA molecules by an acyl-CoA synthetase.
  • Acyl- CoA molecules act as substrate for fatty acyl-CoA oxidase, an enzyme encoded by POX1 in S. cerevisiae and the first step in the ⁇ -oxidation processes.
  • octadecanol concentration increased from 0.03 mg/g cells to 0.33 mg/g cells (Fig 4B).
  • the poxl mutation caused no reduction in cell viability when glucose was available as a carbon source and caused a very modest reduction in growth rate in synthetic medium, however the POX1 and poxl 11 cultures reached similar cell densities over the 48 hour fermentation experiment (data not shown).
  • Fatty alcohols have also been produced in E. coli where yields of up to 900 mg/L have been reported for cells cultured in minimal medium and induced with arabinose and 1PTG [22]. Although yields in thai system were high it also made use of inducing agents, arabinose and IPTG, which would significantly add to the cost of any large-scale industrial applications.
  • That tesA is not native to S. cerevisiae may have the advantage that it is not subject to the same forms of regulation imposed upon the endogenous TES1 and thus it may have higher or at least less regulated activity in the cells.
  • Feedstock makes up a high proportion of production costs and while most microbial systems will use refined glucose the cost of this may be prohibitive in addition to being a potential conflict with food resources.
  • the sugars derived from Hgnocelhilosic hydrolysates have potential to be the most economical without making use of food grade starch or sugar for the production of industrial chemicals.
  • Yeast is capable of fermenting the sugars from relatively crude hydrolysates and strains resistant to the most common inhibitory compounds present in lignoceilulosic hydrolysates have been developed [36, 37].
  • yeast strains that can ferment xylose as well as glucose have been developed that would allow maximal use of the available carbon in hydrolysates to be utilized [38].
  • yeast strains that can ferment xylose as well as glucose have been developed that would allow maximal use of the available carbon in hydrolysates to be utilized [38].
  • the robust nature of yeast may allo this organism to be successfully employed as a factory for fatty alcohol production on an industrial scale.
  • Fatty alcohols are used in a broad variety of synthetic compounds ranging from detergents, surfactants, and lubricants to cosmetics and pharmaceuticals.
  • the majority of the world's liexadecanoi is synthesized from palm oil and as global demand increases the expansion of palm plantations has begun to have a profound impact upon the environment and biodiversity in some Asian countries. Additionally, the demand for fatty alcohols influences the price and availability of palm oil for food purposes.
  • Yeast has several advantages as a platform for liexadecanoi and octadecanol synthesis. Unlike the situation in E. coli hexadecanof and octadecanol are the primary fatty alcohols produced in yeast. Since little C12/C14 alcohols are present in yeast this simplifies the separation and downstream processing for the final product. Additionally, yeast is very robust and performs well under industrial scale fermentation conditions offering the potential to produce fatty alcohols from celiuiosic hydrolysates.
  • Yeast strains, bacteria strains, media, ami growth conditions All of the S.
  • poxl::KanMX4 and acbl::KanMX4 alleles were amplified from a BY4741 strains obtained from the yeast gene deletion collection (open biosystems).
  • the oligonucleotides used to obtain these fragments yield DNA fragments with the KanMX4 cassette flanked by 500bp ⁇ orACBl 5' sequence and 500bp of POX1 orACBl 3' DNA sequence.
  • W303 was transformed with these DNA fragment sand poxl::KanMX4 and acbl::KanMX4 disruptants were selected on YEPD medium
  • Yeast strains were routinely maintained and propagated in rich YEPD medium (yeast extract 10 g/L, peptone 20 g/L, adenine 20 mg/L, tryptophan 20 mg/L and dextrose 20 g/L), strains harboring plasmids were maintained and propagated in selective synthetic medium lacking nutrients required for selection of the auxotrophic marker gene carried on the plasmid.
  • yeast strains were cultured aerobically in liquid medium at 30 °C with agitation at 200 rpm for the indicated periods of time. Plasmids were constructed and maintained in E. coli DH5a. Bacterial strains were propagated in LB medium (10 g/L tryptone, 10 g/L NaCl, and 5 g/L yeast extract) supplemented with 100 ⁇ g/mL ampicillin, or 50 ⁇ g/mL kanamycin as required for plasmid selection.
  • Cellulosic hydrolysates were prepared from ground wheat straw or softwood sawdust.
  • the feedstocks were treated with 2% sulfuric acid and were subjected to autoclaving at 121 °C for 90 minutes.
  • the insoluble material from his treatment was washed briefly with water, made to a 20% slurry and then enzymatically hydrolyzed with cellulase Optimash 25FPU and Stargen 25FPU/mL (Enzyme solutions).
  • the initial hydrolysis was performed at 50 °C for 1 hour prior to reducing the temperature to 30 °C.
  • Urea was added to 15 mM final concentration to provide a nitrogen source.
  • 50 mL of hydrolysate in a shake flask was inoculated with 5x 10 8 yeast cells to initiate the fermentation. The fermentation reactions were carried out over 48 hours at 30 °C with shaking at 150 RPM.
  • a fatty alcohol producing strain DSY2003 harboring the pALC plasmid was grown to a density of 1 x 10 cells/mL and plated on top of YEPD agar plates. The plates were subjected to UV mediated mutagenesis with 5uJ/cm. The cells were allowed to recover for 24 hours in the dark and then harvested and mixed into Percoll solution. The gradients were centrifuged at 30,000xg for 1 hour at 20 °C. Cells from the uppermost layers of the gradient were plated to agar plates selecting for the pALC plasmid. Colonies on the selective plates were subsequently stained with Nile Red to detect lipid bodies.
  • Candidate over producers were then grown in small cultures and cell extracts were assayed for fatty alcohols by gas chromatography. Mutations were identified by resequencing of the pALC expression plasmid which revealed a truncation. Several of the lipid over producing mutants displayed an inability to utilize sucrose as a carbon source and these were cloned by complementation revealing the SNF2 gene. This mutant isolation strategy was originally described by Kamasaka [41]
  • Plasmid and yeast strain construction The expression vectors used in this study are based on the multicopy plasmid YEpLacl95 [42].
  • the poly linker of YEpLacl 95 was removed and replaced with a. poly linker containing sites for restriction enzymes EcoRI - Noil - Xbal - Spel - Not I - Pstl, this plasmid is referred to as YEplacl95bb.
  • a 750bp DNA fragment from upstream of the PGK1 gene was amplified with oligonucleotides PGK750X and PGK750S.
  • the resulting 750bp fragment was ligated into the Xbal and Spel sites of YEplacl95bb to yield YEpl95-P G i.
  • a 400bp DNA fragment from upstream of the HXT7 gene was amplified with oligonucleotides HXT400X and HXT400S.
  • the resulting 400bp fragment was ligated into the Xbal and Spel sites ofYEplacl 95bb to generate YEpl95- PHXT7.
  • a lOOObp DN A fragment from upstream of the PYK1 gene was amplified with oligonucleotides PYK1000X and PYK1000S.
  • the resulting DNA fragment was ligated into the Xbal and Spel sites of YEplacl 95bb to generate YEpI95-PPlX/.
  • An 830bp DNA fragment from upstream of the FBA1 gene was amplified with oligonucleotides FBA830X and FBA830S, The resulting DNA fragment was ligated into the Xbal and Spel sites of YEplacl95bb to produce YEpl95-PJm4 /.
  • the S. cerevisiae FAS1 and FA A3 genes were obtained by PGR amplification from S. cerevisiae genomic DN A using oligonucleotide primers FASlSbb and FAS13bb, FA 35bb, and FAA33bb.
  • the Mus musculus FAR1 (mFARl) open reading frame was amplified from mouse total cDNA using oligonucleotides FARlSbb and FAR 13bb.
  • the Euglena gracilis FAR1 (egFARl ) open reading frame was amplified from plasmid pPT515 [43].
  • oligonucleotides introduce coding sequence for an 11 amino acid epitope recognized by the anti-MYC 9E10 antibody to the 3 ' end of mFARl.
  • the truncated tesA open reading was amplified from E. coli genomic DNA using oligonucleotides TESASbb, and TESASbb.
  • TESl was amplified from yeast genomic DNA using oligonucleotides TESl Sbb and TES13bb.
  • oligonucleotides introduce coding sequence for an 11 amino acid epitope recognized by the anti-MYC 9E10 antibody to the 3 ' end of tesA and TES1.
  • the PGR amplified DNA fragments were initially ligated with the pGEM-T easy vector. Each gene was sequenced in its entirety. Individual clones that contained no mutations that altered the amino acid sequence were used for subsequent yeast expression plasmid constructions.
  • the restriction enzymes Xbal and Pstl were used to excise the FAS1, FA/13, mFARl, egFARl, TES1, and tesA open reading frames from pGEM-T.
  • FAS1 was ligated into YEpl95-PP6Xi to generate YEpl95-PPGKl-FASL FA A3 was ligated with YEpl95-PHY77 to create YEpl95-RHX77- FAA3, mFARl and egFAR l were independently ligated with YEp- PPYK1 and then a 250bp DNA fragment containing the transcriptional termination sequence from the CYC1 gene was ligated into the plasmids 3 ' to the FA.R1 open reading frames to generate YEpl95-PPiX7- mFARl and PPYK1 -egFARl.
  • the TES1 and tesA open reading frames were ligated with YEpl95-P/3 ⁇ 44i and then a 300bp fragment containing the transcriptional termination sequence from the S. cereviskie ADH1 gene was ligated 3 ' to tesA or TES1 to generate YEpl 95- PFBAl-tesA and Y p ⁇ 95-PFBAl-TESl.
  • the PPYK1-FAR1 fusion genes was excised from YEpl95-PPYKl-mFARl and YEpl95-PPYKl -egFARl as an Xbal/Pstl fragment and ligated into the Spel Pstl cut YEpl95-PHXT7-FAA3 expression plasmid, subsequently the Xbal/Pstl PFBA1- tesA fragment was added thus combining FAA3, mFARl or egFARl, and tesA into a single expression plasmid named pALC 195m and pALCl 95eg.
  • the plasmid pRS303-PPGKl-FASl was constructed by iigating a 4000bp Xbal ⁇ BamHI PPGK1-FASI fragment from YEpl9S-PPGKl-FASl into pR8303 [44].
  • This plasmid was cleaved with Pad to direct its integration into the endogenous S. cerevisiae FAS1 gene thus placing the chromosomal FAS1 open reading frame under the regulation of the PGK1 promoter, generating the strain fasl::PPGKl-FASl::HIS3.
  • Protein analysis and enzyme assays Expression of mFarl egFarl, Tesl and tesA proteins in S. cerevisiae was confirmed by Western blot analysis. Cultures of yeast harboring the expression plasmids pALC195m, or pALC195eg were collected by centrifugation and samples of cells equivalent to 5 OD600 units were lysed by grinding with glass beads in 20% trichloroacetic acid as described [45]. The whole cell extracts were allowed to precipitate on ice for 20 minutes then collected by centrifugation at 10,000 x g for 20 minutes.
  • the protein pellet was washed with lmL of ice-cold acetone, dried and resuspended in 1 X SDS sample buffer (2% SDS, 62.5 mM, Tris-HCl pH 6.8, 100 mM DTT, 10% glycerol). 50 ⁇ of total protein was separated by gel electrophoresis through a 10% polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane. The membranes were blocked for eight hours at 4oC in a solution of Tris Buffered Saline (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 2 mM KC1) supplemented with 0.25% Tween 20 and 10% nonfat milk powder.
  • Tris Buffered Saline 25 mM Tris-HCl pH 7.6, 150 mM NaCl, 2 mM KC1 supplemented with 0.25% Tween 20 and 10% nonfat milk powder.
  • hexane phase w r as transferred into a fresh glass vial and derivatized with 50 MSTFA at 70 °C for 15 min. All extracted samples were dried under z gas and resuspended in 1 mL of chloroform. Samples w ere stored at -20 °C until gas chromatography (GC) analyses. The fatty acid and fatty alcohol composition of the total lipid samples were analyzed as their derivatized forms. Lipids were analyzed with an Agilent technologies 6890M Network GC System gas chromatography instrument using Flame Ionization
  • the separation was performed using an HP MS5, 30 mx25Q ⁇ ⁇ 0,25 ⁇ , non- polar capillary column (Agilent Technologies, Santa Clara, CA), The GC program was as follows: initial temperature of 70 °C, held for 1 min, ramped to 300 °C at 10 C C per min and held for 10 min.
  • Quantitation of fatty alcohol species was performed with a standard cun'e constructed with 0.1 mg, 1.0 mg, and 10.0 mg of the standards C16:0-OH (hexadecanol), CI 6: 1 -OH ((Z)-9-hexadecanol), C18:0-OH (octadecanol), C18: l-OH ((Z)-9-octadecanol) to generate a standard curve to allow accurate quantitation of fatty alcohols by FID.
  • the fasl::PPGKl-FASl poxl::KanMX4 pALC 195m strain was initially cultured in 500 mL -Ura -'-dextrose medium in a 2 L flask.
  • 350 mL of culture was transferred into the 5 L Biostat B fermenter, which held 3.5 L of YEPD (yeast extract 10 g/L, peptone 20 g/L, adenine 20 mg L, tryptophan 40 mg L, and dextrose 60 g/L).
  • the fermenter temperature was maintained at 30 0 C. 2 M NaOH and 2 M HCL were added to the fermentation vessel to maintain the pH at 5.6.
  • the aeration rate was 10 L/min. and the stir rate was maintained at 500 rpm.
  • the feeding schedule consisted of a 100 mL aliquot of 100% glucose addition into the culture ever ⁇ ' 12 hours.
  • W303-1A W303 MAT a leu2-3,112, lrpl-1 canl-lOO ura3-l ade2-l his3-ll,15
  • HXT400X CACGTTCTAGACCACTACTTCTCGTAGGAAC
  • HXT400S C A.GGT AC T AGT T T T TTGAT TAAAAT T AAAAAAAC T T T T T T
  • mFAR3bb GCTGCAGCGGCCGCACTATGCTAAAGGTCCTCCTCAGAGATTAATTTCTGTTCGTATCTCATAGT
  • TESA3bb CA.CTAGTCTAAAGGTCCTCCTCAGA.GATTAATTTCTGTTCTGAGTCATGATTTACTAAAGG TES 15bb G C T T C T AG AAT GAG T GC T T C C.AA A A T G GC
  • Kolattukudy PE Reduction of fatty acids to alcohols by cell-free preparations of Euglena gracilis. Biochemistry 1970,9(5): 1095-1102.
  • Teerawanichpan P, Qiu X Molecular and functional analysis of three fatty acyl- CoA reductases with distinct substrate specificities in copepod Calanus finmarchicus. Mar Biotechnol (NY) 2012,14(2):227-236.
  • Arabidopsis fatty acyl-coenzyme A reductases generate primary fatty alcohols associated with suberin deposition. Plant Physiol 2010, 153(4): 1539-1554. 12. Vioque J, Kolattukudy PE: Resolution and purification of an aldehyde-generating and an alcohol-generating fatty acyl-CoA reductase from pea leaves (Pisum sativum L.). Arch Biochem Biophys 1997,340(l):64-72.
  • Liu A, Tan X, Yao L, Lu X Fatty alcohol production in engineered E. coli expressing Marinobacter fatty acyl-CoA reductases. Appl Microbiol Biotechnol
  • Tan X, Yao L, Gao Q, Wang W, Qi F, Lu X Photosynthesis driven conversion of carbon dioxide to fatty alcohols and hydrocarbons in cyanobacteria. Metab Eng
  • Chirala SS Coordinated regulation and inositol-mediated and fatty acid-mediated repression of fatty acid synthase genes in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 1992,89(21): 10232-10236.
  • Gietz RD Sugino A: New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 1988,74(2):527- 534.
  • Teerawanichpan P, Qiu X Fatty acyl-CoA reductase and wax synthase from Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 2010,45(3):263-273.
  • Sikorski RS, Hieter P A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 1989,122(1): 19- 27.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Genetically engineered Saccharomyces cerevisiae and Yarrowia lipolytica for the production of fatty alcohols, including hexadecanol and octadecanol, are provided. The S. cerevisiae and Y. lipolytica can be genetically engineered to express or over-express a plurality of enzymes involved in fatty alcohol synthesis, such as acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase, and can be further genetically engineered with a deficiency in one or more enzymes involved in fatty acid oxidation, such as fatty acyl-CoA oxidase. Methods of producing fatty alcohols, such as hexadecanol and octadecanol, by fermenting the genetically engineered S. cerevisiae and Y. lipolytica are also described.

Description

RELATED APPLICATIONS
This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 61/879,453, filed September 18, 2013, which is incorporated herein by reference.
FIELD OF THE INVENTION
The present invention relates to the field of fatty alcohol production and, in particular, to the use of genetically engineered Saccharomyces cerevisi e and Yarrowia Hpolytica to produce fatty alcohols.
BACKGROUND OF THE INVENTION
Fatty alcohols are long chain aliphatic molecules with nonpolar lipophilic hydrocarbon chains and a polar hydrophilic hydroxy! moiety. The hydrocarbon chain lengths of naturally occurring fatty alcohols are highly variable ranging from 8 to 30 carbon atoms. Many organisms synthesize fatty alcohols in small amounts and these molecules are used as pheromones by insects [1], components of waxes that coat plants, insects and mammals [2], ether lipids that form the base of signaling molecules [3 ], and as components of storage lipids [4, 5], Naturally occurring fatty alcohols are derived from fatty acid biosynthetic pathways and so most ha e even numbered carbon chains although some odd chain length alcohols have been identified in bacteria [6], While the majority of naturally occurring fatty alcohols are saturated, some mono unsaturated alcohols have been detected incorporated in wax esters and ether lipids [2],
The biosynthesis of fatty alcohols proceeds by the activation of fatty acids to acyl- CoA and subsequent reduction by fatty acyl reductase (FAR) activities that catalyze a four- electron reduction of acyf-CoA. The reaction proceeds through an aldehyde intermediate although in many cases no free aldehyde is released [7]. Most alcohol forming FAR activities use reducing equivalents from NADPH [8], however an NADH dependent aldehyde forming FAR activity has been identified in the algae Botryococcus brauni [9]. The nature of the available pool of fatty acids is a major determinant of the type of fatty alcohols that will be produced by any organism.
The relatively low abundance of naturally occurring unsaturated fatty alcohols suggests that the FAR catalyzed reaction takes place before the ceils can convert the saturated acyl-CoA to an unsaturated chain. However, this may also reflect the substrate specificity of the FAR enzyme catalyzing the reaction. CfFARl from the copepod Calanus finmarchicus displays rigid specificity for saturated acyl-CoA substrates while CfFAR3 displays excellent activity toward monounsaturated C18: l-CoA [10]. Additionally, FAR enzymes display some preference for the carbon chain length of the substrate. When expressed in yeast where C18: l is the most abundant fatty acid, the Arabidopsis thaliana FAR1, FAR2, FAR.4, and FAR5 enzymes yielded dramatically different profiles of fatty alcohols produced. FAR5 yielded primarily C18:0 octadecanol whereas FAR3 yielded almost exclusively C26:0 alcohol [1 1 j.
Most alcohol forming FAR enzymes are integral membrane proteins that have a hydrophobic sequence targeting them to the endoplasmic reticulum, Golgi apparatus, or peroxisomes. In contrast aldehyde forming FAR enzymes are cytoplasmic or peripheral membrane pro eins [9, 10, 12]. The localization of the enzyme likely reflects its function. Whereas A. thaliana FAR enzymes are largely associated with the endoplasmic reticulum and wax ester synthesis, the mouse FARl and FAR2 are localized to peroxisomes for the synthesis of ether lipids [13, 14].
Fatty alcohols have a variety of industrial applications. Owing to the amphiphilic nature of fatty alcohols that results from the combination of a long nonpolar acyl chain and a polar hydrophilic hydroxyl these molecules can act as surfactants and a significant portion of fat y alcohols produced are used for this purpose [151. Their chemical character allows fatty alcohols to orient themselves at interfaces for use as emufsifiers and emollients in the cosmetic industry. Additionally, they are used as additives in lubricant, surfactants and detergent formulations as polythoxyiates. Some short chain alcohols are used as flavor and fragrance compounds. They find broad application as platform chemicals since the alcohol moiety is vulnerable to a variety of chemical modifications, and they can be used to form polymers [16], Additionally, fatty alcohols can also be used as fuel additives [17].
Fatty alcohols in their free form are very rare in nature with most being derived from waxes into which they are incorporated [2]. Fatty alcohols can be produced by hydrolysis or trans-esterification of triglycerides derived from vegetable oils followed by hydrogenation to produce alcohols. Indeed this process makes up the primary source of fatty alcohols employed in industrial and commercial applications [17]. Fatty alcohols can also be chemically synthesized from petrochemical feedstock through oligomerization of ethylene followed by oxidation [17].
Increasing costs associated with the production of petroleum products, concerns about food oil security, and environmental impacts of replacing rainforest with palm oil plantations have increased interest in development of microbial systems that can catalyze the con version of low value carbohydrate feedstock into high value lipid products.
Currently the primary source of the widely used C16 and C18 hexadecanol and octadecanol is reduction of palm oil [17]. Similarly CI 2 and CI 4 dodecanol and teradecanol are derived from palm kernel and coconut oil [17], These are food oils of choice for much of the world [18] and increased industrial demand has lead to extensive deforestation of rainforest in Asia with resulting loss of biodiversity and replacement of forest with palm plantations [19, 20]. Considering the broad use of fatty alcohols, and the desire to minimize deforestation microbial biosynthesis of fatty alcohols is a desirable goal.
The biosynthesis of C12/C 14 and C16/C18 alcohols through engineering the expression of FAR and fatty acid activating enzymes in E. coli and cyanobacteria
Synechocyslis sp has been reported [21-23]. Routes to the synthesis of fatty alcohol species using carboxylic acid reductase (CAR) have also been described [24].
This background information is provided for the purpose of making known information belie ved by the applicant to be of possible rele vance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art agai st the present invention.
SUMMARY OF THE INVENTION
In accordance with one aspect, the invention relates to an isolated Saccharomyces cerevisiae and Yarmwia lipolytica cells genetically engineered to produce one or more fatty alcohols, the S. cerevisiae and Y. lipolytica cells genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be deficient in at feast one enzyme involved in fatty acid oxidation.
In accordance with another aspect, the invention relates to an isolated Saccharomyces cerevisiae cell genetically engineered to produce one or more fatty alcohols, the S. cerevisiae cell genetically engineered to: i) express an acyl-CoA t ioesterase; it) express a fatty acyl reductase, and iii) (a) express a fatty acyl activating enzyme, or (b) lack a fatty aeyl-CoA oxidase, or (c) both express a fatty acyl activating enzyme and lack a fatty acyl-CoA oxidase. In accordance with another aspect, the invention relates to an isolated S. cerevisiae and Y. lipo!ytica cells genetically engineered to produce one or more fatty alcohols, the S. cerevisiae and Y. lipolytica cells genetically engineered to express an acyl-CoA thioesterase from E. coli, a fatty acyl reductase from Mus muscul s and an endogenous fatty acyl activating enzyme, to over-express an endogenous fatty acyl synthetase and to lack an endogenous fatty acyl-CoA oxidase. Moreover, these enzymes can be expressed from a constitutive or heterologous promoter.
In accordance with another aspect, the isolated S. cerevisiae and Y. lipolytica cells are genetically engineered to contain mutations or deletions in several genes, including, but not limited to SNF2, . ,011 J and ACB1. In other embodiments, genes may also be added to increase fatty alcohol synthesis such as, but not limited to ALD6 and ACS1.
In accordance with another aspect, the invention relates to an isolated nucleic acid comprising a first nucleotide sequence encoding an acyl -Co A thioesterase, a second nucleotide sequence encoding a fatty acyl reductase and a third nucleotide sequence encoding a fatty acyl activating enzyme.
In accordance with another aspect, the invention relates to a vector comprising the isolated nucleic acid as described above.
In accordance with another aspect, the invention relates to isolated S. cerevisae and Y. lipolytica cells comprising either of the isolated nucleic acid or the vector described above.
In accordance with another aspect, the invention relates to method of producing one or more fatty alcohols comprising cuituring the isolated S, cerevisiae and Y. lipolytica cells described above and isolating the one or more fatty alcohols.
In accordance with another aspect, the invention relates to a method of producing fatty alcohols comprising hexadecanol and octadecanol, the method cuituring an isolated S. cerevisiae and Y. lipolytica cells genetically engineered to express an acyi-CoA thioesterase from E. coli, a fatty acyl reductase from Mus musculus and an endogenous fatty acyl activating enzyme, to over-express an endogenous fatty acyl synthetase and to lack an endogenous fatty acyl-CoA oxidase in a medium comprising glucose and isolating the one or more fatty alcohols.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings. Figure 1. Expression of Fatty alcohol synthesizing enzymes in S. cerevisiae. Protein extracts from 3 independent colonies were probed with anti-MYC ascites fluid for the presence of (A) murine FAR1, (B) E, gracilis FAR1, (C) E. coli tesA, (D) S. cerevisiae Tesl, Strains harboring an empty expression vector were probed as a negative control (vector). As a positive control for the antibody binding and western blotting an extract containing a MYC tagged Erg 10 was included in each blot.
Figure 2. Expression of is. coli tesA increases fatty acid accumulation in 5.
cerevisiae. S. cerevisiae harboring an empty vector (grey bars), a vector overproducing TES1 (open bars) or a vector overproducing E. coli TesA (striped bars ) were cultured in selective medium and lipids were extracted and measured by gas chromatography. Fatty acid concentrations are expressed as mg/gram wet weight of ceils. The means of three independent experiments are shown, error bars indicate standard deviation for the three independent trials.
Figure 3. Production of hexadecanol and octadecanol in S. cerevisiae.
Chromatograms from GC-FID analysis of lipid from 5. cerevisiae harboring an empty expression vector (A) or the pALCm expression vector (B). Peaks corresponding to methyl esters (ME) and fatty alcohols (Ale) are indicated by arrows. CI 9:0 was included as an internal standard. The Peak corresponding to MSTFA derivitized C16:0 alcohol was characterized by mass spectrometry to confirm its identity (C).
Figure 4, Engineering the fatly acid biosynthesis pathway increases fatty acid and fatty alcohol accumulation in S. cerevisiae. (A) GC-FID analysis of lipids in S.
cerevisiae harboring the endogenous FAS! or a PPGKl-FASl a fusion of the FAS1 open reading frame to the PGKl promoter. Fatty acid concentrations are expressed as mg/g ceils wet weight. Data shown are the means of three independent experiments. Errors bars indicate standard deviation. (B) GC-FID analysis of S. cerevisiae harboring the pALCm plasmid and the indicated additional genetic modifications. Fatty alcohol concentrations are expressed as mg/g wet weight of cells. The mean values from two independent trials are shown. (C) GC- FID analysis of fatty acids from the same strains shown in panel B. Fatty acid concentrations are expressed as mg/g wet weight of cells. Data shown are the mean values from two independent trials.
Figure 5. Reduced nitrogen availability increases both fatty acid and fatty alcohol production in engineered S. cerevisiae. GC-FID analysis of lipids from S.
cerevisiae DSY2003 (poxl : : KanMX4 fas I : :PPGK1-FAS Ί) harboring the expression plasmid pALCm. Cells were cultured in synthetic complete medium containing either 5g'L ammonium sulfate (+ Nitrogen, light grey bars) or with no added ammoni m sulfate (- Nitrogen, dark grey bars). Fatty alcohol (A) and fatty acid (B) concentrations are expressed as mg g wet weight of cells. Data shown are the means from two independent experiments.
Figure 6. Fatty alcohol production so S. cerevisiae fed batch culture. GC-FT.D analysis of fatty alcohol (A) and fatty acids (B) at the indicated times during a fed batch fermentation of strain DSY2003 harboring pALCm. The data shown are from a single 4 litre fermentation. The growth of the culture is indicated by increasing ODeoo values (C) and the culture was fed with glucose at the times indicated by the arrows in panel C.
Figure 7. Engineered yeast produce C16 and C18 alcohols. Mutations in SNF2 and FAR1 increase yields. Expression of Arabadops is thaliana FAR5 in S. cerviseae leads to production of exclusively monounsaturated octadecanol compared with the mixed hexadecanol and octadecanol synthesized by mFARl . Additionally, we determined that deletion of the ACB1 gene could increase the proportion of octadecanol synthesized. The Acbl protein is involved in transport of octadecanoic acid and its deletion increases the cellular pools of octadecanoic acid available for conversion to octadecanol. Note that ACB 1 deletion increases the proportion of octadecanol produced in FAR1 expressing strains and increases the abundance of octadecanol in FAR5 expressing strains.
Figure 8. Yeast expressing FAR5 make only C18 alcohol and ACB1 deletion increases the production of C18 alcohol. Mutation of the gene for SNF2, which encodes a chromatin-remodeling enzyme, increases the production of fatty alcohols in FAR1 expressing strains. This mutant was identified in a screen for strains with increases lipid production. The FAR1 expressing strain was mutagenized with ultraviolet light and surviving strains were layered on top of and centrifuged into a density gradient. More buoyant cells (with higher lipid content) floated near the top of the gradient. Several of the more buoyant strains were found to be lipid and fatty alcohol over producers and had mutations in the SNF2 gene.
Truncation oiFARl also increases fatty alcohol production. 48 amino acids predicted to encode a membrane anchoring domain in FAR1 were removed to allow FAR1 to function in the cytoplasm. This truncation improves production of fatty alcohols likely by increasing access of Farl to the cytoplasm fatty acid pool.
Figure 9. C16 and C18 alcohols can be made from hydrolysates of softwood or wheat. The fatty alcohol producing strains can use cellulosic hydrolysates as feedstock. Hydrolysates of softwood or wheat straw produced by dilute acid treatment were used to provide a carbon source with a sugar content of 40 g/L. The hydrolysates were supplemented with urea to provide nitrogen. Yields of hexadecanol and octadecanol are lower than observed with sugar as a substrate in part owing to inhibitors of cell growth present in the hydrolysates and owing to the ability of the production strain to effectively utilize xylose and arabinose which account for some of the sugars in the hydrolysates. The strain can and will be adapted to tolerate inhibitors in the hydrolysates and will be engineered to effectively ferment xylose and arabinose as well as the glucose in the hydrolysates.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to the genetic engineering of Saccharomyces cerviseae for the production of fatty alcohols, including, but not limited to hexadecanoi and octadecanol. In particular, it has been discovered that genetically engineering S. cerevisiae to express or over- express a plurality of enzymes involved in fatty alcohol synthesis allows production of fatty alcohols in 5. cerevisiae. In addition, genetic engineering of 5, cerevisiae to express a plurality of enzymes involved in fatty alcohol synthesis in combination with a deficiency in one or more enzymes involved in fatty acid oxidation may lead to increased yields of fatty alcohols in some embodiments.
Accordingly, in some embodiments, the invention relates to S. cerevisiae genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be deficient in at least one enzyme involved in fatty acid oxidation.
Certain embodiments of the invention also relate to methods of producing fatty alcohols by culturing the genetically engineered S. cerevisiae described herein.
The two or more enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase and fatty acyl reductase. In certain embodiment, the acyi- CoA thioesterase may be derived from a bacterial source, for example, from E. coli. In some embodiments, the E. coli acyl-CoA thioesterase may be mutated or truncated. In certain embodiments, the fatty acyl reductase may be derived from a mammalian source, for example, from a rodent such as Mus musculus, or from plant sources including but not limited to Arahadopsis thaliana, or from single cell organism such as Euglena gracilis. The fatty acyl reductase may also be mutated or truncated to increase fatty alcohol synthesis.
In certain embodiments, the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyl reductase and fatty acyl activating enzyme. The fatty acyl activating enzyme may be, for example, an endogenous fatty acyl activating enzyme. Fatty acyl activating enzymes derived from other sources, including bacterial, plant, single cell organisms, or mammalian, are also contemplated in some embodiments. In certain embodiments, the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyi reductase, fatty acyl activating enzyme and fatty acyl synthetase. The fatty acyl synthetase may be, for example, an endogenous fatty acyl synthetase. Fatty acyl synthase enzymes derived from other sources, including bacterial, plant, single cell organisms, or mammalian, are also contemplated in some embodiments. In certain embodiments, in which the fatty acyl synthase is an endogenous fatty acyl synthase, the S. cerevisiae is genetically engineered to place expression of the endogenous fatty acyl synthase under control of a heterologous promoter in order to reduce feedback inhibition of fatty acyl synthase expression. It also contemplated that the other genes involved in fatty alcohol synthesis my also be under the control of a heterologous promoter.
In further embodiments, other exogenous enzymes may be expressed in 5*. cerevisiae to increase the yield of fatty alcohols. For example, the addition of malonyl-CoA synthetase from thaliana, and glyceraldehyde-3 -phosphate dehydrogenase from Streptomyces mutans can increase the cellular concentration of malonyl-CoA (substrate for acyl-CoA synthesis) and NADPH (cofactor for acyl-CoA synthesis) respectively. Other enzymes that may be manipulated to increase fatty alcohol yield include the up-regulation of the fatty acid synthase subunits Fasl and Fas2.
In certain embodiments , one or more of the nucleic acids used to express the acyl- CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be codon optimized to improve expression in S. cerevisiae. In certain embodiments, each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyi reductase, fatty acyi activating enzyme and fatty acyl synthetase may be under the control of respective constitutive promoters so that production of fatty alcohols by fermentation of the S.
cerevisiae does not require addition of specific compounds to induce expression of these enzymes.
In certain embodiments, the enzymes involved in fatty acid oxidation comprise, for example, fatty acyl-CoA oxidase (POXl gene).
In other embodiments, it may be advantageous to mutate or delete various genes in order to increase fatty alcohol production. For example, a mutation in the SNF2 gene may increase fatty alcohol production (see Figs. 7-8). The mutation isolated was a null mutation creating a frame shift in the coding sequence of the gene. A complete deletion oiSNF2 has the same effect as the null frame shifting mutation In another embodiment, it may be possible to increase the yield of fatty alcohol production (e.g. hexadeeanol and octadecanol) through the mutation or deletion of genes encoding acyl binding proteins, such as, but limited to ACB1, which promotes the degradation of CI8-C0A (see Fig. 8),
As is known in the art, different acyl-CoA thioesterase and fatty acyl reductase enzymes can have different specificities with respect to the type of fatty acid they use as a substrate and/or the type of fatty alcohol they produce (11). Accordingly, in certain embodiments, the acyl-CoA thioesterase and/or fatty acyl reductase for genetic engineering of the S. cerevisiae are selected depending on what fatty alcohol(s) are required in the end product (see Fig. 7 for example).
In certain embodiments, the S. cerevisiae strain selected for genetic engineering in accordance wi th the invention is one that is capable of fermenting sugars from lignocellulosic hydrolysates. In some embodiments, the S. cerevisiae strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from
lignocellulosic hydrolysates and is resistant to the most common inhibitory compounds present in such lignocellulosic hydrolysates. In some embodiments, the S. cerevisiae strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting both glucose and xylose from lignocellulosic hydrolysates (see Fig. 9). Such strains are known in the art (36, 37, 38).
In certain embodiments, fermentation of the genetically engineered S. cerevisiae described above in a suitable medium allows for high-level production of fatty alcohols, for example, greater than 100 mg/L in 168 hours, for example, at least HOmg/L, at least 120mg/L, at least 130mg/L, at least 140 mg/L, at least 150 mg/L, at least 160 mg/L, at least 170 mg/L, in 168 hours, or any amount there between. In certain embodiments, fermentation of the genetically engineered S. cerevisiae described above in a suitable medium allows for production of lOOmg/L or greater of fatty alcohols in 72 hours, for example, 110 mg L or greater, 120 mg/L or greater, 130 mg/L or greater, 140 mg/'L, or greater, 150 mg/L or greater, 160 mg L or greater, 170 mg/L or greater, in 72 hours, or any amount there between.
In addition to S. cerevisiae, in other embodiments, the oleaginous yeast strain Yarrowia lipoiytica is used to increase yields of fatty alcohols. F, lipolytica is capable of fermenting sugars from lignocellulosic hydrolysates and can be advantageous in some situations due to its high rate of fatty acid accumulation and the usage of a wide variety of sugars, glycerol and acetic acid as carbon sources. In some embodiments, Y. Hpolytica strains can be genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis such as described above with S. cerevisiae strains. For example, in some Y. Hpolytica strains, the enzymes involved in fatty alcohol synthesis may comprise, for example, acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and tatty acyl synthetase or any combination thereof. These enzymes may be, for example, endogenous or can including bacterial, plant, single cell organisms, or mammalian sources.
In certain embodiments, one or more of the nucleic acids used to express the acyl- CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be codon optimized to improve expression in Y. Hpolytica. In certain embodiments, each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be under the control of respective constitutive promoters so that production of fatty alcohols by fermentation of the Y. Hpolytica does not require a ddition of specific compounds to induce expression of these enzymes, In still further embodiments, each of the nucleic acids used to express the acyl-CoA thioesterase, fatty acyl reductase, fatty acyl activating enzyme and fatty acyl synthetase may be under the control of respective heterologous promoters. As a non-limiting example, where the fatty acyl synthase is an endogenous fatty acyl synthase, the Y. Hpolytica is genetically engineered to place expression of the endogenous fatty acyl synthase under control of a heterologous promoter in order to reduce feedback inhibition of fatty acyl synthase expression.
In some embodiments, Y. Hpolytica strains express the FARl gene of M. mus and the tesA gene of is. coli.
In further embodiments, Y. Hpolytica strains expressing the FARl gene of A, thaliana and the tesA gene of is. coli, and may be deficient in another gene product, or have further genes added to increase the yield of fatty alcohols. For example, the flow of carbon may be redirected from the production of ethanol to the production of acetyl-CoA for fatty acyl-CoA synthesis. This can be accomplished, for example, by the deletion of the ADH1 gene and addition of genes encoding ALD6 and a hyperactive ACS1 to convert acetaldehyde to acetyl- CoA as substrate for fatty acyl-CoA synthesis. Considering that Ald6 uses NADP as a cofactor this will lead to an increase in NADPH, which is required for fatty alcohol synthesis.
In situations where NADPH is limiting production of fatty alcohol synthesis, a further increase in NADPH can be achieved through expression of xpkA (xylose-5-phosphate kinase) and ack (acetate kinase) from Aspergillus nidulans. These enzymes create a heterologous phosphoketolase pathway leading to elevated NADPH production.
Moreover, some embodiments of engineered Y. lipolytica strains can be further modified by the introduction of a mutation to, or a deletion of the SNF2 gene (see Figs. 7-8). The SNF2 gene encodes a chromatin remodeling protein and is involved in the transcriptional regulation of the fatty alcohol synthesis genes. Such a mutation can increase fatty acid synthesis.
In other embodiments, a codon optimized xylose isomerase derived from Piromyces sp. can be inserted in the yeast strain to increase their ability to use the xylose in cellulosic hydrolysates. The techniques used in the manipulation of recombinant DNA are well known to those of ordinary skill in the art.
In certain embodiments, the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from iignocellulosic hydrolysates. In some embodiments, the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting sugars from
Iignocellulosic hydrolysates and is resistant to the most common inhibitory compounds present in such Iignocellulosic hydrolysates. In some embodiments, the Y. lipolytica strain selected for genetic engineering in accordance with the invention is one that is capable of fermenting both glucose and xylose from Iignocellulosic hydrolysates.
In certain embodiments, fermentation of the genetically engineered Y. lipolytica described above in a suitable medium allows for high-level production of fatty alcohols, for example, greater than 100 mg/'L in 168 hours, for example, at least HOmg/L, at least 120mg/L, at least 13Gmg/L, at least 140 mg/L, at least 150 mg/L, at least 160 mg/L, at least 170 mg/'L,, in 168 hours, or any amount there between. In certain embodiments, fermentation of the genetically engineered Y. Lipolytica described above in a suitable medium allows for production of lOOmg/L or greater of fatty alcohols in 72 hours, for example, 110 mg L or greater, 120 mg/L or greater, 130 mg'L or greater, 140 mg/L. or greater, 150 mg/L or greater, 160 mg/L or greater, 170 mg/'L or greater, in 72 hours, or any amount there between.
Conditions that are relevant to optimal growth of yeast cultures include, but are not limited to, fermentation temperature, pH, inoculation density and feeding schedules. For example, yeast cultures may be fermented at 30 °C in a synthetic medium supplemented with urea to provide a nitrogen source and a dissolved oxygen content of 30%. Glycerol and cellulosic hydrolysates can be used as a carbon feed stock for fatty alcohol production. The production of cellulosic hydrolysates is well known in the art. Dilute acid hydrolysis is one standard method for the production of cellulosic hydrolysates. In addition, enzymes used in various embodiments may include those sharing a sequence identity or substantial sequence identity to those enzymes listed herein.
As used herein, "sequence identity" or "identity" in the context of two protein or peptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity." Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif).
The term "substantial identity" in the context of a proteins or peptide indicates that a proteins or peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, or 94%, or even 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window. In certain embodiments, optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch ( eedleman and Wunsch, JMB, 48, 443 (1970)). An indication that two peptide sequences are substantially identical is that one peptide is immunologically reactive with antibodies raised against the second peptide. Thus, a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution. Thus, the invention also provides nucleic acid molecules and peptides that are substantially identical to the nucleic acid molecules and peptides presented herein.
For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. to which this invention belongs.
As used herein, the term "about" refers to an approximately +/-1G% variation from a given value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
The term "plurality" as used herein means more than one, for example, two or more, three or more, four or more, and the like.
"Naturally occurring," as used herein, as applied to an object, refers to the fact that an object can be found in nature. For example, an organism, or a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
The term "isolated," as used herein with reference to a material, means that the material is removed from its original environment (for example, the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the co-existing materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
The use of the word "a" or "an" when used herein in conjunction with the term "comprising" may mean "one," but it is also consistent with the meaning of "one or more," "at least one" and "one or more than one."
As used herein, the terms "comprising," "having," "including" and "containing," and grammatical variations thereof, are inclusive or open-ended and do not exclude additional, unrecited elements and/or method steps. The term "consisting essentially of when used herein in connection with a composition, use or method, denotes that additional elements and/or method steps may be present, but that these additions do not materially affect the manner in which the recited composition, method or use functions. The term "consisting of" when used herein in comiection with a composition, use or method, excludes the presence of additional elements and/or method steps. A composition, use or method described herein as comprising certain elements and/or steps may also, in certain embodiments consist essentially of those elements and/or steps, and in other embodiments consist of those elements and/or steps, whether or not these embodiments are specifically referred to.
It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions and kits of the invention can be used to achieve methods of the invention, To gain a better understanding of the invention described herein, the following examples are set forth. It will be understood that these examples are intended to describe illustrative embodiments of the invention and are not intended to limit the scope of the invention in any way. EXAMPLES
Overview:
Background: Fatty alcohols are important components of a vast array of surfactants, lubricants, detergents, pharmaceuticals and cosmetics. CI 6 and CI 8 alcohols are rare in nature but can be synthesized from petroleum or from palm oil. However, the rising price of oil and the impact that expanding palm plantations have on biodiversity and diversion of food oils to industrial use has motivated increased efforts to develop microbial platforms for the biosynthesis of these valuable chemicals. We have investigated the potential to produce fatty alcohols in the yeast Saccharomyces cerevisiac owing to this organism's robust growth, genetic manipulabiliry, and potential for the use of celiulosic hydroiysates as feedstock.
Results: We engineered S. cerevisiae to produce C16 and CI 8 alcohols through introduction of a thioesterase activity from E. coli and a fatty acyl reductase from mouse, additionally a native acyl-CoA synthetase activity encoded by the FAA3 gene was over produced. The strain was further engineered by over expression of fatty acyl synthetase encoded by FAS1 and deletion of acyl-CoA oxidase encoded by POX1. In fed batch fermentation in rich medium this strain produced 194 mg/L of C16/C18 alcohols in 72 hours.
Conclusions: Through engineering both pathways for fatty alcohol synthesis and degradation this work achieved CI 6 and C18 alcohol production in yeast without the use of inducing sugars or agents whose cost would be prohibitive for an industrial application. We show that yeast is a potential platform for industrial scale production of C16 and CI 8 fatty alcohols.
Abbreviations:
GC Gas chromatography, GC-FID Gas chromatography with Flame Ionization
Detector, FAR Fatty Acyl Reductase, NADH Nicotinamide Adenine Dinucleotide, NADPH Nicotinamide Adenine Dinucleotide Phosphate, rpm revolutions per minute, MSTFA Methanolic HCL, N- methyl-N- (trimethylsiylyl) trifluoroacetamide, CoA Coenzyme A, lic Acid Reductase, DTT Dithiothreitol, SDS Sodium Dodeealsulfate.
Figure imgf000016_0001
The yeast Saccharomyces cerevisiae is an industrial workhorse for the production of ethanoi and a variety of chemicals and small molecules. [25]. Yeast has great potential as a chassis for the production of lipid based compounds as some oleaginous species are capable of accumulating up to 70% of their dry weight as lipid [26]. Here we demonstrate the production of both saturated and monounsaturated hexadecanoi and octadecanol by an engineered strain of S. cerevisiae. The high productivity of this strain (2.8 mg/L/Hr) and the robust nature of yeast offers the potential for microbial biosynthesis of hexadecanoi and octadecanol at an industrial scale. While this manuscript was being revised synthesis of fatty alcohol was reported in S. cerevisiae however the reported yields were lower than obtained in this work [27]. The focus of this investigation was to determine whether S. cerevisiae could be developed as a potential platform for the industrial production of hexadecanoi and octadecanol.
Results:
Fatty alcohol synthesizing enzymes can be expressed in S. cerevisiae. Fatty- alcohols can be synthesized from fatty acids by activation of the fatty acid to an aeyl-CoA and subsequent reduction to an alcohol. To determine whether fatty alcohols could be effectively produced by S. cerevisiae we introduced an expression vector harboring genes for an acyl-CoA thioesterase from either E, coli (tesA), or S. cerevisiae (TES1), a fatty acyl activating enzyme (FAA3) from S, cerevisiae and a fatty acyl reductase from either Mus musculus (niFARl) ox Euglena gracilis (egFARl). Because tesA, mFARl, and egFARl were heterologous enzymes the open reading frames were altered to include a 10 amino acid epitope tag recognized by the cMYC antibody. This allowed detection of the proteins by Western blotting to confirm expression. Additionally, a truncated version of tesA lacking its signal sequence was used since expression of this variant has previously been shown to result in elevated accumulation of tatty acids and to bypass feedback inhibition of fatty acyl-CoA on fatty acid synthesis [28],
Western blotting extracts from candidate strains demonstrated that Tesl, tesA, mFarl, and egFARl were produced in the yeast strains (Fig. 1 ; A - D). The thioesterase was included to determine whether its expression would increase fatty acid availability as substrate for fatty alcohol synthesis. Over expression of TES1 had little discernabie effect on the abundance of C16:0, C16: l , C 18:0 or C 18 : 1 fatty acids (Fig 2). In contrast expression of a truncated form of it. coli tesA, lacking its leader sequence increased the cellular concentration of the most abundant fatty acids. C I 6:0 concentration increased by 22.5% while C16: 1 increased by 34%, CI 8:() and C18: l were increased by 33% and 35% respectively (Fig, 2).
Synthesis of hexadecanol and octadecanol by engineered 8. cerevisiae. To achieve conversion of fatty acids to fatty alcohols the fatty acyl- activating enzyme Faa.3 w¾s over produced in conjunction with tesA and with fatty acyl reductase from either Euglena gracilis or Mm musculus. Cell extracts were spiked with nonadecylic acid (C I 9) as an internal standard and the extracted lipids were analyzed by gas chromatography (Fig. 3). No fatty alcohols could be detected in a strain harboring the empty expression vector (Fig. 3 A). In contrast, the combined expression oi tesA, FAA3 and niFARI from plasmid pALC195m resulted in the production of both hexadecanol and octadecanol (Fig. 3B & Table 4). In two experiments with two independent S. cerevisiae strains yields of 1 .64 mg/L and 1.72 mg/L hexadecanol were obtained in a 48 hour fermentation period corresponding to 0.23 mg/L/OD600 and 0.22 mg/L/OD600 (Fig. 3B & Table 4), Very little fatty alcohol synthesis was detected in strains expressing tesA, FAA3 and egFARl (0.01 mg/L octadecanol) (Table 4). The identity of the peak corresponding to hexadecanol was confirmed by mass- spectrometry (Fig. 3C). Thus the combined expression of acyl-thioesterase, fatty acyl activating enzyme and fatty acyl reductase can yield the synthesis of fatty alcohols in yeast. Interestingly, although C 18 : 1 and CI 6: 1 are the most abundant fatty acids in this yeast C 16:0 and CI 8:0 were the most abundantly produced fatty alcohols. This may reflect the specificity of the mouse fatty acyl reductase.
Over expression of fatty acyl synthetase FAS1 increases fatty alcohol production in yeast. Fatty alcohols are synthesized from fatty acids and their CoA derivatives. Fatty acid synthesis is largely driven by the activity of the enzyme fatty acyl synthetase. In S, cerevisiae the FAS1 and FAS2 genes encode the β and a subunits of this enzyme. Fasl and Fas2 function in a stoichiometric relationship and FAS 2 gene expression is regulated in part by the Fasl protein abundance such that an increase in Fasl triggers increased transcription of FAS2 [29, 30] .
To increase carbon flux toward fatty acid synthesis and decouple FASl expression from feedback inhibition induced by the presence of saturated fatty acids [31 ], we replaced the endogenous FASl promoter with the promoter from the PGK1 gene. The PGKl gene is highly expressed in cells growing in the presence of glucose and does not display regulation by fatty acids. The increased transcription of FASl yielded an increase in the cellular accumulation of CI 6:0 and C16: l fatty acids. C16:0 increased from 2.21 mg/g cells to 4.48 mg/g cells and CI 6: 1 increased from 6.62mg/g cells to 8.19 mg/g cells (Fig 4A). In contrast upregulation of FASl in this strain yielded no significant increase C18:0 and C18: l (Fig 4A). Cells overexpressing FASl and harbouring the pALC195m plasmid expressing iesA, FAA3 and mFARl displayed an increased accumulation of fatty alcohols, Hexadecanol
concentrations of 0.16 mg/g- wet weight of cells were found in FASl o er expressing strains compared to 0.096 mg/g cells in the control strain (Fig 4B). Octadecanol concentrations did not display a significant increase possibly reflecting the lack of increase in octadecanoic acid accumulated in she l-'ASl over expressing cells.
The size of the intracellular fatty acid pool is a key determinant for fatty alcohol production and so we investigated other avenues of engineering increased fatty acid synthesis. In addition to Fas ! the initial reactions of fatty acid synthesis are driven by acetyl- CoA carboxylase, which catalyzes the formation of malonyl-CoA. In S, cerevisiae the ACCl gene encodes this activity. The activity of Accl is negatively regulated by phosphorylation catalyzed by the Snfl protein kinase [32]. With the intent of reducing Accl inhibition we deleted the SNF1 gene. However, deletion of SNF1 did not yield and increase in fatty alcohol accumulation. Indeed we repeatedly observed reduced free fatty alcohol concentrations in snfl 1 1 strains (data not shown). This may be the result of complex activities of Snfl in metabolic regulation including the transcriptio al down regulation of ACCl and FASl in snfl mutants [33].
Reduced degradation of acyl-CoA species increases fatty alcohol accumulation hi engineered strains. In S. cerevisiae, fatty acids can be subject to a variety of metabolic fates dependent upon the cells requirements. In addition to incorporation into membranes and storage as triacylglycerides, fatty acids can be degraded by β-oxidation to yield acetyl-CoA. Typically excess fatty acids would be activated to acyl-CoA molecules by an acyl-CoA synthetase. Acyl- CoA molecules act as substrate for fatty acyl-CoA oxidase, an enzyme encoded by POX1 in S. cerevisiae and the first step in the β-oxidation processes. Deletion of POX1 in a strain over expressing FAS1 and harboring the pALC195m plasmid yielded a significant increase in the accumulation of hexadecanol and octadecanol. 50 mL shake flask fermentation experiments with two independently constructed strains revealed that POX1 deletion yielded an increase in hexadecanol from 0.16 mg/g cells to 0.26 mg/ g cells.
Additionally, octadecanol concentration increased from 0.03 mg/g cells to 0.33 mg/g cells (Fig 4B). The poxl mutation caused no reduction in cell viability when glucose was available as a carbon source and caused a very modest reduction in growth rate in synthetic medium, however the POX1 and poxl 11 cultures reached similar cell densities over the 48 hour fermentation experiment (data not shown).
Analysis of fatty acids in these strains revealed a 60% reduction in the abundance of C I 6:0, 75% reduction in C16i l, a 6% increase in C 18:0 and a 24% reduction in C18: l (Fig. 4C). The reduction in fatty acids with a commensurate increase in fatty alcohol suggested that fatty- acids were being converted to alcohols. Notably the abundance of fatty acids remained greater than the accumulated fatty alcohols suggesting that the available fatty acid pool was not limiting to hexadecanol and octadecanol production.
Reduced nitrogen increases production of fatty alcohols. Growth under low nitrogen conditions increases that fatty acid accumulation in many cell types by forcing cells to scavenge nitrogen from amino acids. This can potentially lead to a reduction in citric acid cycle intermediates and result in accumulation of citrate, which stimulates fatty acid synthesis. We tested the hypothesis that reduced nitrogen availability would increase fatty alcohol synthesis in our recombinant 5'. cerevisiae strains. Cells harboring plasmid pALC195m, cultured in growth medium lacking ammonium sulfate grew to lower cell density than cells cultured in the presence of ammonium sulfate (OD600 3.4 compared to OD600 5.4 with ammonium sulfate) but accumulated higher concentrations of all the measured fatty acids (Fig 5A). C16:() increased by27%, C16: l increased by 48%, C18:0 increased by 91%, and C 18 : 1 increased by 56%. A smaller increase was observed in the concentration of fatty alcohol under nitrogen limiting growth conditions, Hexadecanol increased by 1 1% octadecanol increased by 20%, and (Z)-9- octadecanol increased by 8% (Fig 5B).
Production of hexadecanol and octadecanol in fed batch S. cerevisiae
fermentation. To investigate the potential for fatty alcohol production by S, cerevisiae on a larger scale we performed a fed-batch fermentation trial on a 4 L scale with strain DSY2003 harboring pALC195m. This trial was performed in rich glucose medium rather than synthetic medium. During progression of the fermentation we observed an increase in fatty alcohol accumulation. Over 72 hours the strain ultimately produced 88.4 mg/L hexadecanol, 4.1 mg/L (Z)-9-hexadecanol, 73.5 mg/L octadecanol, and 28.0 mg/L (Z)-9-octadecanol for a combined yield of 194 mg/L C16/C18 alcohol (Fig. 6A). This corresponds to 2.85 mg/g wet weight of cells at a production rate of 2.75 mg L/hr, and approximately 0.002 g C16/C 8 / gram glucose. In contrast, fatty acid pools displayed a reduction in abundance as the fermentation progressed consistent with the utilization of nascent fatty acids for the synthesis of fatty alcohol (Fig. 6B). It appeared that fatty alcohol synthesis continued even in the presence of reduced fatty acid pools implying that fatty acid a vailability had not become limiting within the time frame of this fermentation. Additionally , we did not observe a plateau in biomass accumulation during this experiment suggesting that even greater yields of fatty alcohol could have been achieved without the further addition of sugar (Fig. 6C). The yields of hexadecanol and octadecanol from this strain were greater than those previously reported for S. cet-evisiae [27].
Discussion:
Fatty acid based biofuels and oleochemicals are in great demand globally and the market for these compounds continues to grow [34]. The expansion of plantations for palm and oilseed crops has impinged upon rainforest and other habitats as well as creating conflict with food crops [191. These considerations lead us to investigate the potential for microbial synthesis of fatty alcohols from carbohydrate sources. An additional benefit from a microbial system for fatty alcohol synthesis is the potential to engineer production of molecules with specific chain lengths or modifications.
Fatty alcohol biosynthesis in S. cerevisiae has been recently reported [27]. In that study fatty alcohol yields of approximately 100 mg/L were reported for cells cultured in minimal medium and induced with galactose over 168 hours. The approach reported in this manuscript achieved yields of 194 mg/L of hexadecanol and octadecanol in 72 hours with cells grown in rich medium. The higher production rate observed in our approach may be attributable to the culture conditions in addition to our use of an FAAB over expressing strain and deletion of the POX1 gene to promote accumulation of acyl-CoA.
Fatty alcohols have also been produced in E. coli where yields of up to 900 mg/L have been reported for cells cultured in minimal medium and induced with arabinose and 1PTG [22]. Although yields in thai system were high it also made use of inducing agents, arabinose and IPTG, which would significantly add to the cost of any large-scale industrial applications.
We achieved a greater production of fatty acids through the expression of the E. coli thioesterase tesA than with the S. cerevisiae TES1. That tesA is not native to S. cerevisiae may have the advantage that it is not subject to the same forms of regulation imposed upon the endogenous TES1 and thus it may have higher or at least less regulated activity in the cells.
We selected murine FAR1 for a fatty acyl reductase activity based upon its preference for the synthesis of C16 and CI S fatty alcohols. Our experiment made use of the native FAR! sequence and based upon Western blot analysis the protein was effectively produced in yeast. Codon optimization of the FAR1 gene might improve its production in 5. cerevisiae and potentially increase the fatty alcohol production. The Euglena gracilis FAR 1 was also produced in S. cerevisiae but displayed much lower activity than murine Farl . It is currently- unclear why the Euglena enzyme had less activity in S, cerevisiae. Its activity may have been limited owing to localization or some other aspect of the foreign cellular environment in which it was expressed.
Interestingly, our strains predominantly produced saturated fatty alcohol despite the fact that monounsaturated CI 6: 1 and C18: 1 were the most abundant forms of fatty acid in these cells. This likely reflects the substrate preference of the FAR enzyme used in the system. Alternatively it may be that desaturases have little affinity for fatty alcohols or perhaps the fatty alcohols produced do not have access to the endogenous desaturase enzymes. Since FAR enzyme specificity is a likely determinant of the nature of the fatty alcohols produced ί I 1], this opens the possibility that FAR enzymes and thioesterases with different specificities could be employed to tailor a strain as a platform for the synthesis of particular species of fatty alcohols.
An economically viable system for the microbial production of fatty alcohols will be largely dependent upon generating strains that can produce fatty alcohols at close to the theoretical maximum yield of approximately 0.3 g g glucose [35]. This will likely require further manipulation of the fatty acid biosynthesis pathway in addition to optimization of FAR activity either through identification of a more active enzyme or engineering to increase catalytic activity.
An additional consideration for an economically viable microbial platform for fatty alcohol production is the feedstock used. Feedstock makes up a high proportion of production costs and while most microbial systems will use refined glucose the cost of this may be prohibitive in addition to being a potential conflict with food resources. The sugars derived from Hgnocelhilosic hydrolysates have potential to be the most economical without making use of food grade starch or sugar for the production of industrial chemicals. Yeast is capable of fermenting the sugars from relatively crude hydrolysates and strains resistant to the most common inhibitory compounds present in lignoceilulosic hydrolysates have been developed [36, 37]. In addition, yeast strains that can ferment xylose as well as glucose have been developed that would allow maximal use of the available carbon in hydrolysates to be utilized [38]. Thus, the robust nature of yeast may allo this organism to be successfully employed as a factory for fatty alcohol production on an industrial scale.
Conclusions:
Fatty alcohols are used in a broad variety of synthetic compounds ranging from detergents, surfactants, and lubricants to cosmetics and pharmaceuticals. The majority of the world's liexadecanoi is synthesized from palm oil and as global demand increases the expansion of palm plantations has begun to have a profound impact upon the environment and biodiversity in some Asian countries. Additionally, the demand for fatty alcohols influences the price and availability of palm oil for food purposes. We have been able to achieve high-level production of liexadecanoi and octadecanol in S. cerevisiae. This initial demonstration of the potential to use yeast as a production platform has yet to be optimized and thus has the potential for far greater yields. Yeast has several advantages as a platform for liexadecanoi and octadecanol synthesis. Unlike the situation in E. coli hexadecanof and octadecanol are the primary fatty alcohols produced in yeast. Since little C12/C14 alcohols are present in yeast this simplifies the separation and downstream processing for the final product. Additionally, yeast is very robust and performs well under industrial scale fermentation conditions offering the potential to produce fatty alcohols from celiuiosic hydrolysates.
Methods:
Yeast strains, bacteria strains, media, ami growth conditions: All of the S.
cerevisiae strains used in this work were derived from W303 [39]. The relevant genotype of ail strains is listed in Table 1. To delete the POX1 and ACB1 genes in W303, the
poxl::KanMX4 and acbl::KanMX4 alleles were amplified from a BY4741 strains obtained from the yeast gene deletion collection (open biosystems). The oligonucleotides used to obtain these fragments (poxl<¾5 / poxl<¾3 and acbl<¾5 / acbl<¾3) yield DNA fragments with the KanMX4 cassette flanked by 500bp οΐΡΟΧΙ orACBl 5' sequence and 500bp of POX1 orACBl 3' DNA sequence. W303 was transformed with these DNA fragment sand poxl::KanMX4 and acbl::KanMX4 disruptants were selected on YEPD medium
supplemented with 200 μg/mL G418. The deletions were confirmed by PCR analysis of genomic DNA from candidate strains. The SNF2 gene was deleted and replaced with a DNA cassette encoding the Kluvermyces lactis LEU2 gene using a PCR based method. Yeast strains were routinely maintained and propagated in rich YEPD medium (yeast extract 10 g/L, peptone 20 g/L, adenine 20 mg/L, tryptophan 20 mg/L and dextrose 20 g/L), strains harboring plasmids were maintained and propagated in selective synthetic medium lacking nutrients required for selection of the auxotrophic marker gene carried on the plasmid. In shake flask experiments yeast strains were cultured aerobically in liquid medium at 30 °C with agitation at 200 rpm for the indicated periods of time. Plasmids were constructed and maintained in E. coli DH5a. Bacterial strains were propagated in LB medium (10 g/L tryptone, 10 g/L NaCl, and 5 g/L yeast extract) supplemented with 100 μg/mL ampicillin, or 50 μg/mL kanamycin as required for plasmid selection.
Cellulosic hydrolysates were prepared from ground wheat straw or softwood sawdust. The feedstocks were treated with 2% sulfuric acid and were subjected to autoclaving at 121 °C for 90 minutes. The insoluble material from his treatment was washed briefly with water, made to a 20% slurry and then enzymatically hydrolyzed with cellulase Optimash 25FPU and Stargen 25FPU/mL (Enzyme solutions). The initial hydrolysis was performed at 50 °C for 1 hour prior to reducing the temperature to 30 °C. Urea was added to 15 mM final concentration to provide a nitrogen source. 50 mL of hydrolysate in a shake flask was inoculated with 5x 108 yeast cells to initiate the fermentation. The fermentation reactions were carried out over 48 hours at 30 °C with shaking at 150 RPM.
Selection of lipid overproducing strains. A fatty alcohol producing strain DSY2003 harboring the pALC plasmid was grown to a density of 1 x 10 cells/mL and plated on top of YEPD agar plates. The plates were subjected to UV mediated mutagenesis with 5uJ/cm. The cells were allowed to recover for 24 hours in the dark and then harvested and mixed into Percoll solution. The gradients were centrifuged at 30,000xg for 1 hour at 20 °C. Cells from the uppermost layers of the gradient were plated to agar plates selecting for the pALC plasmid. Colonies on the selective plates were subsequently stained with Nile Red to detect lipid bodies. Candidate over producers were then grown in small cultures and cell extracts were assayed for fatty alcohols by gas chromatography. Mutations were identified by resequencing of the pALC expression plasmid which revealed a truncation. Several of the lipid over producing mutants displayed an inability to utilize sucrose as a carbon source and these were cloned by complementation revealing the SNF2 gene. This mutant isolation strategy was originally described by Kamasaka [41]
Reagents: Restriction Enzymes, T4 DNA lipase, and Ta DNA polymerase were obtained from New England Bolas. pGEM®-T Easy Vectors were obtained from Promega. DNA purification kits and reagents were supplied by Qiagen. All oligonucleotides used in this study were purchased from Integrated DNA Technologies (IDT). Methanolic ITCL, N- methyl-N- (trimethylsiylyl) trifliioroacetamide (MSTFA), HPLC grade hexane and chloroform were from Sigma ALDRICH. All fatty acid and fatty alcohol standards and internal standards used in this study were ordered from Nu-Chek Prep Inc.
Plasmid and yeast strain construction The expression vectors used in this study are based on the multicopy plasmid YEpLacl95 [42]. The poly linker of YEpLacl 95 was removed and replaced with a. poly linker containing sites for restriction enzymes EcoRI - Noil - Xbal - Spel - Not I - Pstl, this plasmid is referred to as YEplacl95bb. A 750bp DNA fragment from upstream of the PGK1 gene was amplified with oligonucleotides PGK750X and PGK750S. The resulting 750bp fragment was ligated into the Xbal and Spel sites of YEplacl95bb to yield YEpl95-P G i. A 400bp DNA fragment from upstream of the HXT7 gene was amplified with oligonucleotides HXT400X and HXT400S. The resulting 400bp fragment was ligated into the Xbal and Spel sites ofYEplacl 95bb to generate YEpl95- PHXT7. A lOOObp DN A fragment from upstream of the PYK1 gene was amplified with oligonucleotides PYK1000X and PYK1000S. The resulting DNA fragment was ligated into the Xbal and Spel sites of YEplacl 95bb to generate YEpI95-PPlX/. An 830bp DNA fragment from upstream of the FBA1 gene was amplified with oligonucleotides FBA830X and FBA830S, The resulting DNA fragment was ligated into the Xbal and Spel sites of YEplacl95bb to produce YEpl95-PJm4 /.
The S. cerevisiae FAS1 and FA A3 genes were obtained by PGR amplification from S. cerevisiae genomic DN A using oligonucleotide primers FASlSbb and FAS13bb, FA 35bb, and FAA33bb. The Mus musculus FAR1 (mFARl) open reading frame was amplified from mouse total cDNA using oligonucleotides FARlSbb and FAR 13bb. The Euglena gracilis FAR1 (egFARl ) open reading frame was amplified from plasmid pPT515 [43]. These oligonucleotides introduce coding sequence for an 11 amino acid epitope recognized by the anti-MYC 9E10 antibody to the 3 ' end of mFARl. The truncated tesA open reading was amplified from E. coli genomic DNA using oligonucleotides TESASbb, and TESASbb. TESl was amplified from yeast genomic DNA using oligonucleotides TESl Sbb and TES13bb. These oligonucleotides introduce coding sequence for an 11 amino acid epitope recognized by the anti-MYC 9E10 antibody to the 3 ' end of tesA and TES1. The PGR amplified DNA fragments were initially ligated with the pGEM-T easy vector. Each gene was sequenced in its entirety. Individual clones that contained no mutations that altered the amino acid sequence were used for subsequent yeast expression plasmid constructions. The restriction enzymes Xbal and Pstl were used to excise the FAS1, FA/13, mFARl, egFARl, TES1, and tesA open reading frames from pGEM-T. FAS1 was ligated into YEpl95-PP6Xi to generate YEpl95-PPGKl-FASL FA A3 was ligated with YEpl95-PHY77 to create YEpl95-RHX77- FAA3, mFARl and egFAR l were independently ligated with YEp- PPYK1 and then a 250bp DNA fragment containing the transcriptional termination sequence from the CYC1 gene was ligated into the plasmids 3 ' to the FA.R1 open reading frames to generate YEpl95-PPiX7- mFARl and PPYK1 -egFARl. 'The TES1 and tesA open reading frames were ligated with YEpl95-P/¾4i and then a 300bp fragment containing the transcriptional termination sequence from the S. cereviskie ADH1 gene was ligated 3 ' to tesA or TES1 to generate YEpl 95- PFBAl-tesA and Y p\95-PFBAl-TESl. The PPYK1-FAR1 fusion genes was excised from YEpl95-PPYKl-mFARl and YEpl95-PPYKl -egFARl as an Xbal/Pstl fragment and ligated into the Spel Pstl cut YEpl95-PHXT7-FAA3 expression plasmid, subsequently the Xbal/Pstl PFBA1- tesA fragment was added thus combining FAA3, mFARl or egFARl, and tesA into a single expression plasmid named pALC 195m and pALCl 95eg. The plasmid pRS303-PPGKl-FASl was constructed by iigating a 4000bp Xbal■■ BamHI PPGK1-FASI fragment from YEpl9S-PPGKl-FASl into pR8303 [44]. This plasmid was cleaved with Pad to direct its integration into the endogenous S. cerevisiae FAS1 gene thus placing the chromosomal FAS1 open reading frame under the regulation of the PGK1 promoter, generating the strain fasl::PPGKl-FASl::HIS3.
Protein analysis and enzyme assays: Expression of mFarl egFarl, Tesl and tesA proteins in S. cerevisiae was confirmed by Western blot analysis. Cultures of yeast harboring the expression plasmids pALC195m, or pALC195eg were collected by centrifugation and samples of cells equivalent to 5 OD600 units were lysed by grinding with glass beads in 20% trichloroacetic acid as described [45]. The whole cell extracts were allowed to precipitate on ice for 20 minutes then collected by centrifugation at 10,000 x g for 20 minutes. 'The protein pellet was washed with lmL of ice-cold acetone, dried and resuspended in 1 X SDS sample buffer (2% SDS, 62.5 mM, Tris-HCl pH 6.8, 100 mM DTT, 10% glycerol). 50 μξ of total protein was separated by gel electrophoresis through a 10% polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane. The membranes were blocked for eight hours at 4oC in a solution of Tris Buffered Saline (25 mM Tris-HCl pH 7.6, 150 mM NaCl, 2 mM KC1) supplemented with 0.25% Tween 20 and 10% nonfat milk powder. Then probed for 8 hours with anti-MYC ascites fluid (Covance laboratories) at a dilution of 1 : 10,000. Following extensive washing the primary antibodies were detected with Horse Radish Peroxidase labeled anti-mouse secondary antibody (Jackson Laboratories) applied to the blots at a 1 :5,000 dilution. The protein signals were visualized with enhanced
chemiluminescence.
Extraction and analysis of 'fatty acid and fatty alcohols: To extract total cellular lipids, 25 mL of culture was harvested when the desired growth phase was achieved
(O.D.600 reading 6 to 8 in shake flask experiment, or at the indicated times in fed -batch fermentation experiment). Cells were collected by centrifugation at 3000*g 3 min and washed in sterile water. Cell pellets were weighted and resuspended in 3 mL of methanolic- HCL. The suspensions were transferred into glass tubes and lysed by grinding with glass beads (3 x 1 min grinding with 1 min off intervals between grinding) and incubated at 80 °C for 2 hours. Fatty acids and fatty alcohols were extracted in 2mL n-hexane spiked with 0.5 mg or 1 mg of heptadecanoic acid (CI 7) as an internal standard followed by shaking at 200 rpm for 30 min. The hexane phase wras transferred into a fresh glass vial and derivatized with 50 MSTFA at 70 °C for 15 min. All extracted samples were dried under z gas and resuspended in 1 mL of chloroform. Samples w ere stored at -20 °C until gas chromatography (GC) analyses. The fatty acid and fatty alcohol composition of the total lipid samples were analyzed as their derivatized forms. Lipids were analyzed with an Agilent technologies 6890M Network GC System gas chromatography instrument using Flame Ionization
Detection. The separation was performed using an HP MS5, 30 mx25Q μηιχ0,25 μιη, non- polar capillary column (Agilent Technologies, Santa Clara, CA), The GC program was as follows: initial temperature of 70 °C, held for 1 min, ramped to 300 °C at 10 CC per min and held for 10 min. Quantitation of fatty alcohol species was performed with a standard cun'e constructed with 0.1 mg, 1.0 mg, and 10.0 mg of the standards C16:0-OH (hexadecanol), CI 6: 1 -OH ((Z)-9-hexadecanol), C18:0-OH (octadecanol), C18: l-OH ((Z)-9-octadecanol) to generate a standard curve to allow accurate quantitation of fatty alcohols by FID.
Fed-batch fermentation culture; The fasl::PPGKl-FASl poxl::KanMX4 pALC 195m strain was initially cultured in 500 mL -Ura -'-dextrose medium in a 2 L flask. When the cell culture reached early stationary phase, 350 mL of culture was transferred into the 5 L Biostat B fermenter, which held 3.5 L of YEPD (yeast extract 10 g/L, peptone 20 g/L, adenine 20 mg L, tryptophan 40 mg L, and dextrose 60 g/L). The fermenter temperature was maintained at 30 0C. 2 M NaOH and 2 M HCL were added to the fermentation vessel to maintain the pH at 5.6. The aeration rate was 10 L/min. and the stir rate was maintained at 500 rpm. The feeding schedule consisted of a 100 mL aliquot of 100% glucose addition into the culture ever}' 12 hours.
Tables:
Table ΐ . Saccharomyces cerevisiae strains used in this study
Strain Background Relevant genotype
W303-1A W303 MAT a leu2-3,112, lrpl-1 canl-lOO ura3-l ade2-l his3-ll,15
DSY2001 W303 fasJ::PPGKl-FASl-HIS3
DSY2002 W303 poxl::KanMX4
DSY2003 W303 paxl :KanMX4fasl::VPGKl-FASl-HlS3
DSY2004 W303 poxl::KanMX4fasl::?PGKl-FASl-HIS3 snfi::LEU2
DSY2005 BY4741 MATa his3M leu2A0 ΜΕΤ15Δ0 ura3A0
DSY2006 BY4741 acbl::KanMX4
'able 2. Plasmids used in this study
Plasmid Relevant genotype
YEplacl 95bb YEp3acl95 with modified polylinker URA3 selection pFBAl-TESA YEplacl95 FBA1 promoter driving iesA, cycl
terminator
pFBAl-TESl YEplacl95 FBA1 promoter driving TES1, cycl
terminator
pPYKl -mFARI YEplacl95 PYKl promoter driving mFARI, ADHI terminator pPYKl-egFARl YEplacl 95 PYKl promoter driving egFARL ADHI terminator
pHXT7-FAA3 YEplacl95 HXT7 promoter driving FAA3
pALC195m YEplacl95 HXT7-FAA3 PYKl -mFARI FBA l-tesA
pALC195eg YEplacl95 HXT7-FAA3 PYKl-egFARl FBAl-tesA
pPGKl-FAS l pRS303 PGKl promoter driving truncated FASl, HIS3 selection Table 3. Oligonucleotide primers used in this study
Oligonucleotide Sequence 5' - 3 "
Poxl /75 T C T T T G T A T T T T T C C T A G C G
Pox 1 IB G A T T G T TAG C A. T A G C A AC T C A
PGK750X CACGTTCTAGAACGCACAGATATTATAACATCTG
PGK750S CAGGTACTAGTTGTTTTATATTTGTTGTAAAAAGTAG
HXT400X CACGTTCTAGACCACTACTTCTCGTAGGAAC
HXT400S C A.GGT AC T AGT T T T TTGAT TAAAAT T AAAAAAAC T T T T T
PYK1000X CACG CTAGAAATGCTACTATTTTGGAGATTAAT
PYK1000S CAGGTACTAGTTGTGATGATGTTTTATTTGTTTTG
FBA830X CACGTTCTAGAAGTTGATGGATCCAACTGGC
FBA830S CAGGTACTAGTTTTGAATATGTATTACTTGGTTATG
FASlSbb CTTCTAGAATGGACGCTTACTCCACAAGACCATTA
FAS13bb GCTGCAGCGGCCGCACTAGTCTAAAGGTCCTCCTCAGAGATTAATTTCTGTTCGGATTGTTCATA
CTTTTCCCAG
FAA5bb T G T AGA-AT G T C C GAAC AAC AC T C T G T C
FAA3bb GCTGCAGCGGCCGCACTAG CAATAGCAAAA GTG T C
mFARSbb TCTAGAATGGTTTCAATCCCAGAATAC
mFAR3bb GCTGCAGCGGCCGCACTATGCTAAAGGTCCTCCTCAGAGATTAATTTCTGTTCGTATCTCATAGT
GCTGGATGC
egFARSbb CTTCTAGAATGAACGATTTCTACGCG
egFAR3bb GCTGCAGCGGCCGCACTAGTCTAAAGGTCCTCCTCAGAGATTAATTTCTGTTCCAGCATGGCCCG
CAGGAATC
TESASbb G T T C TAG A A T G GC GG AC A C G T T T GAT T C T G
TESA3bb CA.CTAGTCTAAAGGTCCTCCTCAGA.GATTAATTTCTGTTCTGAGTCATGATTTACTAAAGG TES 15bb G C T T C T AG AAT GAG T GC T T C C.AA A A T G GC
TES 13bb CTACTAGTCTACAGGTCCTCCTCAGAGATTAATTTCTGTTCGAACTTGGCTCGAATGT
Table 4. Hexadecanol production by engineered S. cerevisiae
Vector Hexadecanol Octadecanol (mg/L. culture)
Vector 0.00 0.00 0.00 0.00
pALCeg 0.01 0.01 0.00 0.00
pALCm 1.64 1.72 0.68 0.67
Values were obtained from two independent 48 hour fermentations. Citations:
1. Tillman JA, Seybold SJ, Jurenka RA, Blomquist GJ: Insect pheromones— an overview of biosynthesis and endocrine regulation. Insect Biochem Mol Biol 1999,29(6):481- 514.
2. Metz JG, Pollard MR, Anderson L, Hayes TR, Lassner MW: Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed. Plant Physiol 2000,122(3):635-644.
3. Lienard MA, Hagstrom AK, Lassance JM, Lofstedt C: Evolution of
multicomponent pheromone signals in small ermine moths involves a single fatty-acyl reductase gene. Proc Natl Acad Sci U S A 2010,107(24): 10955-10960.
4. Fixter LM, Nagi NM, McCormak JG, Fewson CA: Structure, distribution and function of wax esters in Acinetobacter calcoaceticus. Microbiology 1986,132:3147-3157.
5. Tucci S, Vacula R, Krajcovic J, Proksch P, Martin W: Variability of wax ester fermentation in natural and bleached Euglena gracilis Strains in response to oxygen and the elongase inhibitor flufenacet. J Eukaryot Microbiol 2010,57(l):63-69.
6. Ju SJ, Harvey HR: Lipids as markers of nutritional condition and diet in the Antarctic krill Euphausia superba and Euphausia crystallorophias during austral winter. Deep-Sea Research Part II-Topical Studies in Oceanography 2004,51: 17-19.
7. Kolattukudy PE: Reduction of fatty acids to alcohols by cell-free preparations of Euglena gracilis. Biochemistry 1970,9(5): 1095-1102.
8. Pollard MR, McKeon T, Gupta LM, Stumpf PK: Studies on biosynthesis of waxes by developing jojoba seed. II. The demonstration of wax biosynthesis by cell-free homogenates. Lipids 1979,14:651-662.
9. Wang X, Kolattukudy PE: Solubilization and purification of aldehyde-generating fatty acyl-CoA reductase from green alga Botryococcus braunii. FEBS Lett 1995,370(1-
2): 15-18.
10. Teerawanichpan P, Qiu X: Molecular and functional analysis of three fatty acyl- CoA reductases with distinct substrate specificities in copepod Calanus finmarchicus. Mar Biotechnol (NY) 2012,14(2):227-236.
1 1. Domergue F, Vishwanath SJ, Joubes J, Ono J, Lee JA, Bourdon M, et al: Three
Arabidopsis fatty acyl-coenzyme A reductases, FARl, FAR4, and FAR5, generate primary fatty alcohols associated with suberin deposition. Plant Physiol 2010, 153(4): 1539-1554. 12. Vioque J, Kolattukudy PE: Resolution and purification of an aldehyde-generating and an alcohol-generating fatty acyl-CoA reductase from pea leaves (Pisum sativum L.). Arch Biochem Biophys 1997,340(l):64-72.
13. Rowland O, Domergue F: Plant fatty acyl reductases: enzymes generating fatty alcohols for protective layers with potential for industrial applications. Plant Sci 2012,193- 194:28-38.
14. Cheng JB, Russell DW: Mammalian wax biosynthesis. I. Identification of two fatty acyl-Coenzyme A reductases with different substrate specificities and tissue distributions. J Biol Chem 2004,279(36):37789-37797.
15. Knaut J, Richtler HJ: Trends in industrial uses of palm and lauric oils. J Amer Oil Chem Soc 1985,62:317-327.
16. Khalkar S, Bhowmick D, Pratap A: Synthesis of polymers from fatty alcohol and acrylic acid and its impact on tribological properties. J Oleo Sci 2013,62(3): 167-173.
17. Rupilius W, Ahmad S: Palm oil and palm kernel oil as raw materials for basic oleochemicals and biodiesel. European Journal of lipid science and technology
2007,109:433-439.
18. Carter C, Finley W, Fry J, Jackson D, Willis L: Palm oil markets and future supply. European Journal of Lipid Science and Technology 2007,109(4):307-314.
19. Fitzherbert EB, Struebig MJ, Morel A, Danielsen F, Bruhl CA, Donald PF, et al: How will oil palm expansion affect biodiversity? Trends Ecol Evol 2008,23(10):538-545.
20. Lees AC, Vieira IC: Forests: Oil-palm concerns in Brazilian Amazon. Nature 2013,497: 188.
21. Zheng YN, Li LL, Liu Q, Yang JM, Wang XW, Liu W, et al: Optimization of fatty alcohol biosynthesis pathway for selectively enhanced production of CI 2/ 14 and CI 6/18 fatty alcohols in engineered Escherichia coli. Microb Cell Fact 2012,11:65.
22. Liu A, Tan X, Yao L, Lu X: Fatty alcohol production in engineered E. coli expressing Marinobacter fatty acyl-CoA reductases. Appl Microbiol Biotechnol
2013,97(15):7061-7071.
23. Tan X, Yao L, Gao Q, Wang W, Qi F, Lu X: Photosynthesis driven conversion of carbon dioxide to fatty alcohols and hydrocarbons in cyanobacteria. Metab Eng
2011,13(2): 169-176.
24. Akhtar MK, Turner NJ, Jones PR: Carboxylic acid reductase is a versatile enzyme for the conversion of fatty acids into fuels and chemical commodities. Proc Natl Acad Sci U S A 2013,110(l):87-92. 25. Hong KK, Nielsen J: Metabolic engineering of Saccharomyces cerevisiae: a key cell factory platform for future biorefineries. Cell Mol Life Sci 2012,69(16):2671-2690.
26. Ageitos JM, Vallejo JA, Veiga-Crespo P, Villa TG: Oily yeasts as oleaginous cell factories. Appl Microbiol Biotechnol 2011,90(4): 1219-1227.
27. Runguphan W, Keasling JD: Metabolic Engineering of Saccharomyces cerevisiae for Production of Fatty Acid-Derived Biofuels and Chemicals. Metab Eng 2013 :ePub ahead of print.
28. Cho H, Cronan JE, Jr.: Defective export of a periplasmic enzyme disrupts regulation of fatty acid synthesis. J Biol Chem 1995,270(9):4216-4219.
29. Wenz P, Schwank S, Hoja U, Schuller HJ: A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product. Nucleic Acids Res 2001,29(22):4625- 4632.
30. Schuller HJ, Hahn A, Troster F, Schutz A, Schweizer E: Coordinate genetic control of yeast fatty acid synthase genes FAS1 and FAS2 by an upstream activation site common to genes involved in membrane lipid biosynthesis. EMBO J 1992,11(1): 107- 114.
31. Chirala SS: Coordinated regulation and inositol-mediated and fatty acid-mediated repression of fatty acid synthase genes in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 1992,89(21): 10232-10236.
32. Woods A, Munday MR, Scott J, Yang X, Carlson M, Carling D: Yeast SNF1 is functionally related to mammalian AMP-activated protein kinase and regulates acetyl-CoA carboxylase in vivo. J Biol Chem 1994,269(30): 19509- 19515.
33. Usaite R, Jewett MC, Oliveira AP, Yates JR, 3rd, Olsson L, Nielsen J:
Reconstruction of the yeast Snf 1 kinase regulatory network reveals its role as a global energy regulator. Mol Syst Biol 2009,5:319.
34. Metzger JO, Bornscheuer U: Lipids as renewable resources: current state of chemical and biotechnological conversion and diversification. Appl Microbiol Biot 2006,71(1): 13-22.
35. Lennen RM, Pfleger BF: Engineering Escherichia coli to synthesize free fatty acids. Trends Biotechnol 2012,30(12):659-667.
36. Koppram R, Albers E, Olsson L: Evolutionary engineering strategies to enhance tolerance of xylose utilizing recombinant yeast to inhibitors derived from spruce biomass. Biotechnol Biofuels 2012,5(1):32. 37. Weber C, Farwick A, Benisch F, Brat D, Dietz H, Subtil T, et al: Trends and challenges in the microbial production of lignocellulosic bioalcohol fuels. Appl Microbiol Biotechnol 2010,87(4) : 1303 - 1315.
38. Cai Z, Zhang B, Li Y: Engineering Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: reflections and perspectives. Biotechnol J 2012,7(l):34-46.
39. Thomas BJ, Rothstein R: Elevated recombination rates in transcriptionally active DNA. Cell 1989,56(4):619-630.
40. Sherman F: Getting started with yeast. Methods Enzymol 2002,350:3-41.
41. Kamisaka Y, Noda N, Tomita N, Kimura K, Kodaki T, Hosaka K: Identification of genes affecting lipid content using transposon mutagenesis in Saccharomyces cerevisiae. Biosci Biotechnol Biochem 2006, 70:646-653.
42. Gietz RD, Sugino A: New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 1988,74(2):527- 534.
43. Teerawanichpan P, Qiu X: Fatty acyl-CoA reductase and wax synthase from Euglena gracilis in the biosynthesis of medium-chain wax esters. Lipids 2010,45(3):263-273.
44. Sikorski RS, Hieter P: A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 1989,122(1): 19- 27.
45. Foiani M, Liberi G, Lucchini G, Plevani P: Cell cycle-dependent phosphorylation and dephosphorylation of the yeast DNA polymerase alpha-primase B subunit. Mol Cell Biol 1995,15(2):883-891.
The disclosures of all patents, patent applications, publications and database entries referenced in this specification are hereby specifically incorporated by reference in their entirety to the same extent as if each such individual patent, patent application, publication and database entry were specifically and individually indicated to be incorporated by reference.
Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the in vention. All such modifications as would be apparen t to one skilled in the art. are intended to be included within the scope of the following claims.

Claims

What is claimed is:
1. An isolated Saccharomyces cerevisiae cell genetically engineered to produce one or more fatty alcohols, the S. cerevisiae cell genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be defic ent in at least one enzyme involved in fatty acid oxidation.
2. The isolated 5. cerevisiae cell according to claim 1, wherein the one or more fatty alcohols is octadecanol or hexadecanol
3. The isolated S. cerevisiae cell according to any one of claims 1 to 2, wherein the two or more enzymes involved in fatty alcohol synthesis comprise acyl-CoA thioesterase and fatty acyl reductase.
4. The isolated S. cerevisiae cell according to claim 3, wherein the acyi-CoA thioesterase is an E. coli acyl-CoA thioesterase.
5. The isolated S. cerevisiae cell according to claim 3 or 4, wherein the fatty acyl reductase is a Mus musculus fatty acyl reductase.
6. The isolated S. cerevisiae cell according to any one of claims 3 to 5, wherein the two or more enzymes involved in fatty alcohol synthesis further comprise a fatty acyl activating enzyme.
7. The isolated S. cerevisiae cell according to claim 6, wherein the fatty acyl activating enzyme is a S. cerevisiae fatty acyl activating enzyme.
8. The isolated S. cerevisiae cell according to claim 7, wherein the acyl-CoA thioesterase, fatty acyl reductase and fatty acyl activating enzyme are expressed from a vector comprising a first nucleic acid encoding the acyl-CoA thioesterase, a second nucleic acid encoding the fatty acyl reductase and a third nucleic acid encoding the fatty acyl activating enzyme.
9. The isolated S. cerevisiae cell according to any one of claims 3 to 8, wherein the two or more enzymes involved in fatty alcohol synthesis further comprise fatty acyl synthetase.
10. The isolated S, cerevisiae ceil according to claim 9, wherein the fatty acyl synthetase is an endogenous fatty acyl synthetase.
11. The isolated S. cerevisiae cell according to any one of claims 1 to 10, wherein the at least one enzyme involved in fatly acid oxidation comprises fatty acyl-CoA oxidase.
12. An isolated Saccharomyces cerevisiae cell genetically engineered to produce one or more fatty alcohols, the S. cerevisiae cell genetically engineered to:
i) express an acyl-CoA thioesterase;
ii) express a fatty acyl reductase, and
iii) (a) express a fatty acyl activating enzyme, or
(b) lack a fatty acyl-CoA oxidase, or
(c) both (a) and (b).
13. The isolated S. cerevisiae cell according to claim 12, wherein the one or more fatty alcohols is octadecanol or hexadecanol.
14. The isolated S. cerevisiae cell according to any one of claims 12 to 13, wherein the acyl-CoA thioesterase is an E. coli acyl-CoA thioesterase.
15. The isolated S, cerevisiae cell according to any one of claims 12 to 14, wherein the fatty acyl reductase is a Mus muscul s fatty acyl reductase.
16. The isolated S. cerevisiae cell according to any one of claims 12 to 15, wherein the S, cerevisiae cell is genetically engineered to express a fatty acyl activating enzyme.
17. The isolated S. cerevisiae cell according to claim 1 6, wherein the fatty acyl activating enzyme is a S. cerevisiae fatty acyl activating enzyme.
18. The isolated S. cerevisiae cell according to claim 16 or 17, wherein the acyl-CoA thioesterase, fatty acyl reductase and fatty acyl activating enzyme are expressed from a vector comprising a first nucleic acid encoding the acyl-CoA thioesterase, a second nucleic acid encoding the fatty acyl reductase and a third nucleic acid erscodirsg the fatty acyl activating enzyme.
19. The isolated S. cerevisiae cell according to any one of claims 12 to 18, wherein the S. cerevisiae cell is genetically engineered to lack a fatty acyl-CoA oxidase.
20. The isolated S. cerevisiae cell according to any one of claims 12 to 19, wherein the S. cerevisiae cell is further genetically engineered to over-express fatty acyl synthetase.
21. The isolated S. cerevisiae ceil according to claim 20, wherein the fatty acyl synthetase is an endogenous fatty acyl synthetase.
22. An isolated Saccharomyces cerevisiae cell genetically engineered to produce one or more fatty alcohols, the S. cerevisiae cell genetically engineered to express an acyl-CoA thioesterase from E. coli, a fatty acyl reductase from Mus musculus and an endogenous fatty acyl activating enzyme, to over-express an endogenous fatty acyl synthetase and to lack an endogenous fatty acyl-CoA oxidase.
23. The isolated S. cerevisiae cell according to claim 22, wherein the acyl-CoA thioesterase, fatty acyl reductase and fatty acyl activating enzyme are expressed from a vector comprising a first nucleic acid encoding the acyl-CoA thioesterase, a second nucleic acid encoding the fatty acyl reductase and a third nucleic acid encoding the fatty acyl activating enzyme.
24. An isolated nucleic acid comprising a first nucleotide sequence encoding an acyl- CoA thioesterase, a second nucleotide sequence encoding a fatty acyl reductase and a third nucleotide sequence encoding a fatty acyl activating enzyme.
25. The isolated nucleic acid according to claim 24, wherein the acyl-CoA thioesterase is an E. coli acyl-CoA thioesterase.
26. The isolated nucleic acid according to any one of claims 23 to 25, wherein the fatty acyl reductase is a Mus musculus fatty acyl reductase.
27. A vector comprising the isolated nucleic acid of any one of claims 23 to 26.
28. An isolated Saccharomyces cerevisae cell comprising the isolated nucleic acid according to any one of claims 23 to 26, or the vector according to claim 27.
29. The isolated S. cerevisiae cell according to claim 28, wherein the S. cerevisiae cell is further genetically engineered to over-express a fatty acyl synthase.
30. The isolated S. cerevisiae cell according to claim 28 or 29, wherein the S. cerevisiae cell is further genetically engineered to be deficient in at least one enzyme involved in fatty acid oxidation.
31. The isolated S. cerevisiae ceil according to claim 30, wherein the at least one enzyme involved in fatty acid oxidation comprises fatty aeyl-CoA oxidase.
32. The isolated 5'. cerevisae cell of any one of claims 1 -2,3 or 28 to 31 wherein the isolated 8. cerevisae cell is further engineered contain a mutation or deletion of the SNF2 gene.
33. The isolated S. cerevisae cell of any one of claims 1-23 or 28 to 31 wherein the isolated S, cerevisae cell is further engineered to contain a deletion of the ACB1 gene.
34. A method of producing one or more fatty alcohols comprising culturing the isolated S. cerevisiae cell of any one of claims 1 to 23 or 28 to 33 and isolating the one or more fatty alcohols.
35. A method of producing fatty alcohols comprising hexadecanol and octadecanol, the method culturing the isolated S. cerevisiae cell of any one of claims 28 to 33 in a medium comprising glucose and isolating the one or more fatty alcohols.
36. An isolated Yarrow ia lipoiytica cell genetically engineered to produce one or more fatty alcohols, the F lipoiytica cell genetically engineered to express or overexpress two or more enzymes involved in fatty alcohol synthesis and further genetically engineered to be deficient in at least one enzyme involved in fatty acid oxidation.
37. The isolated Y. Iipoiytica cell according to claim 36, wherein the one or more fatty alcohols is selected from the group consisting of octadecanol and hexadecanol.
38. The isolated Y. Iipoiytica cell according to any one of claims 36 to 37, wherein the two or more enzymes involved in fatty alcohol synthesis comprise acyl-CoA thioesierase and fatty acyl reductase.
39. The isolated Y. Iipoiytica cell according to any one of claims 36 to 38, wherein the isolated Y. Iipoiytica cell is further genetically engineered to contain a mutation in the SNF2 gene.
40. The isolated Y. Iipoiytica cell according to any one of claims 36 to 39, wherein the isolated Y. Iipoiytica cell is further genetically engineered to contain a deletion of the ADH1 gene and contain the addition of the ALD6 gene and a hyperactive ACS1 gene.
41. The isolated Y. Iipoiytica cell according to any one of claims 36 to 40, wherein the at least one enzyme involved in fatty acid oxidation comprises fatty acyl-CoA oxidase.
PCT/US2014/056382 2013-09-18 2014-09-18 Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols Ceased WO2015042306A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US15/022,844 US20160222419A1 (en) 2013-09-18 2014-09-18 Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols
CA2924885A CA2924885A1 (en) 2013-09-18 2014-09-18 Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361879453P 2013-09-18 2013-09-18
US61/879,453 2013-09-18

Publications (1)

Publication Number Publication Date
WO2015042306A1 true WO2015042306A1 (en) 2015-03-26

Family

ID=52689406

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/056382 Ceased WO2015042306A1 (en) 2013-09-18 2014-09-18 Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols

Country Status (3)

Country Link
US (1) US20160222419A1 (en)
CA (1) CA2924885A1 (en)
WO (1) WO2015042306A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016159869A1 (en) * 2015-04-02 2016-10-06 Biopetrolia Ab Fungal cells and methods for production of very long chain fatty acid derived products
WO2018138966A1 (en) * 2017-01-27 2018-08-02 神戸天然物化学株式会社 Transformant and use thereof
JP2020520644A (en) * 2017-05-17 2020-07-16 プロヴィヴィ インコーポレイテッド Microorganisms and related compounds for the production of insect pheromones
US11109596B2 (en) 2015-11-18 2021-09-07 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
US11214818B2 (en) 2016-06-06 2022-01-04 Provivi, Inc. Semi-biosynthetic production of fatty alcohols and fatty aldehydes

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102014220186B4 (en) 2013-12-12 2017-06-22 Technische Universität Dresden Yeast strains and processes for the production of omega-hydroxy fatty acids and dicarboxylic acids
CN115806923B (en) * 2022-10-12 2024-11-15 齐鲁工业大学(山东省科学院) An engineered bacterium containing acyl-CoA oxidase gene and its application in preparing 10-hydroxy-2-decenoic acid
CN118028291A (en) * 2023-06-06 2024-05-14 天津大学 Application of overexpression of alkane hydroxylase and laccase genes in LDPE degradation

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100154293A1 (en) * 2008-12-23 2010-06-24 Louis Hom Methods and compositions related to thioesterase enzymes
US20130040352A1 (en) * 2009-06-30 2013-02-14 Codexis, Inc. Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far)
WO2013130062A1 (en) * 2012-02-29 2013-09-06 Exxonmobil Research And Engineering Company Four-gene pathway for wax ester synthesis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100154293A1 (en) * 2008-12-23 2010-06-24 Louis Hom Methods and compositions related to thioesterase enzymes
US20130040352A1 (en) * 2009-06-30 2013-02-14 Codexis, Inc. Production of fatty alcohols with fatty alcohol forming acyl-coa reductases (far)
WO2013130062A1 (en) * 2012-02-29 2013-09-06 Exxonmobil Research And Engineering Company Four-gene pathway for wax ester synthesis

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016159869A1 (en) * 2015-04-02 2016-10-06 Biopetrolia Ab Fungal cells and methods for production of very long chain fatty acid derived products
US10550413B2 (en) 2015-04-02 2020-02-04 Biopetrolia Ab Fungal cells and methods for production of very long chain fatty acid derived products
US11109596B2 (en) 2015-11-18 2021-09-07 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
US11844353B2 (en) 2015-11-18 2023-12-19 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
US11214818B2 (en) 2016-06-06 2022-01-04 Provivi, Inc. Semi-biosynthetic production of fatty alcohols and fatty aldehydes
WO2018138966A1 (en) * 2017-01-27 2018-08-02 神戸天然物化学株式会社 Transformant and use thereof
JP2020520644A (en) * 2017-05-17 2020-07-16 プロヴィヴィ インコーポレイテッド Microorganisms and related compounds for the production of insect pheromones
US11104921B2 (en) 2017-05-17 2021-08-31 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds
JP7216018B2 (en) 2017-05-17 2023-01-31 プロヴィヴィ インコーポレイテッド Microorganisms and related compounds for production of insect pheromones
US11866760B2 (en) 2017-05-17 2024-01-09 Provivi, Inc. Microorganisms for the production of insect pheromones and related compounds

Also Published As

Publication number Publication date
CA2924885A1 (en) 2015-03-26
US20160222419A1 (en) 2016-08-04

Similar Documents

Publication Publication Date Title
US20160222419A1 (en) Genetically engineered saccharomyces cerevisiae and yarrowia lipolytica and production of fatty alcohols
Yang et al. Subcellular engineering of lipase dependent pathways directed towards lipid related organelles for highly effectively compartmentalized biosynthesis of triacylglycerol derived products in Yarrowia lipolytica
CN108271383B (en) Fungal cells and methods for producing very long chain fatty acid derivatives
Krishnan et al. Biosynthesis of fatty alcohols in engineered microbial cell factories: advances and limitations
Tsai et al. Delta-9 fatty acid desaturase overexpression enhanced lipid production and oleic acid content in Rhodosporidium toruloides for preferable yeast lipid production
AU2011223619B2 (en) Microbial engineering for the production of fatty acids and fatty acid derivatives
Fillet et al. Microbial production of fatty alcohols
US10370686B2 (en) Yeast cell modified to overproduce fatty acid and fatty acid-derived compounds
CN105745327A (en) Method for mass producing human blood coagulation factor vii derivative
US20240043850A1 (en) Compositions and methods for type iii polyketide production in oleaginous yeast species
Zhang et al. Harnessing transcription factor Mga2 and fatty acid elongases to overproduce palmitoleic acid in Saccharomyces cerevisiae
Kumari et al. Tailored designing of a diploid S. cerevisiae natural isolate for increased production of fatty acid ethyl ester
US8993281B2 (en) Genetically modified Acinetobacter hosts for lipid production
Tang et al. Engineering Saccharomyces cerevisiae for efficient biosynthesis of fatty alcohols based on enhanced supply of free fatty acids
KR20190141683A (en) Thioesterase Variants with Improved Activity for the Production of Heavy Chain Fatty Acid Derivatives
Kawahara et al. Biosynthesis of fatty acid derivatives by cyanobacteria: from basics to biofuel production
Jiang et al. Exploring engineering strategies that enhance de novo production of exotic cyclopropane fatty acids in Saccharomyces cerevisiae
US10557152B2 (en) Yeast host cells and methods for producing fatty alcohols
JP2024020570A (en) Lipid production method
US11999988B2 (en) Method of increasing lipid productivity in nannochloropsis by introducing a gene encoding both a thioredoxin domain and a thioredoxin reductase domain
Dong et al. De novo biosynthesis of free vaccenic acid with a low content of oleic acid in Saccharomyces cerevisiae
Tsai Production of preferable high-oleic acid yeast
呉志展 Enhancing lipid production in a novel
Helm Exploring alternative feedstocks for the production of itaconic acid with $ ustilago $$ spp. $
Hu Multidimensional engineering for the production of fatty acid derivatives in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14846069

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 15022844

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2924885

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14846069

Country of ref document: EP

Kind code of ref document: A1