WO2015035474A1 - Serological test - Google Patents
Serological test Download PDFInfo
- Publication number
- WO2015035474A1 WO2015035474A1 PCT/AU2014/050231 AU2014050231W WO2015035474A1 WO 2015035474 A1 WO2015035474 A1 WO 2015035474A1 AU 2014050231 W AU2014050231 W AU 2014050231W WO 2015035474 A1 WO2015035474 A1 WO 2015035474A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- amino acid
- acid sequence
- protein
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0241—Mollicutes, e.g. Mycoplasma, Erysipelothrix
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/30—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycoplasmatales, e.g. Pleuropneumonia-like organisms [PPLO]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56933—Mycoplasma
Definitions
- the present specification teaches a serological test for Mycoplasma and the development of prophylactic and therapeutic compositions to treat ruminant subjects infected with or potentially exposed to Mycoplasma species.
- Mycoplasma hovis i the most frequently isolated aetiological agent in naturally occuning outbreaks of bovine respiratory disease (BRD) in veal ealves (Gagea .ei al. (2006) J. Vet, Diagii. Invest 18:29-40; Arcangioli el at. (2008) Vet. J. 177:89-93), a chronic disease characterized by pneumonia and arthritis.
- Mycoplasma bovis is also responsible for outbreaks of keratoconjunctivitis (A!berti et ai. (2006) J, Vet. Diagn,. Invest. /i?:41-51), mastitis (Hale et al.
- Vsps variable surface proteins
- Hsp60 and P48 (Scherm et al (2002) Vet. Microbiol #0: 1.41-150; Robino et ai (2005) Vet. Microbiol 109:201-209).
- these are not ideal antigens for immunodiagnosis, because of the phase and antigenic variatio seen in Vsps, and the similarities between Hsp60 and P48 and their orthologs in the closely related species such as M. ag k tiae. Therefore, there remains a need to identify a better Mycoplasma antigen for serological diagnosis.
- An immunogenic protein is identified useful in the identification of Mycoplasm spp and in the development of prophylactic and therapeutic compositions to manage Mycopimma infection and exposure.
- the immunogenic protein is referred to herein as Mycopimma immunogenic lipase A (MilA).
- MoilA Mycopimma immunogenic lipase A
- Reference to. "MilA” includes the MilA protein from Mycopimma bovis and homologs of MilA from othe Mycopimma spp as well as antibody-binding fragments of MilA.
- Region 1 of MilA is defined by the consensus sequence set forth i SEQ ID NOT, Examples of region 1 of MilA include MilA from M, bovis FG45 strain (type strain) [SEQ ID NG:2], and MilA homologs from M. bovis strain Hubei-1 (SEQ ID NQ:3), Mycoplasma agalacfia strain PG2 (SEQ ID NO: 4), Mycoplasma colimbin m strain SF7 (SEQ ID NO: 5). Mycoplasma fermantan strai JER (SEQ ID NO:6), Mycoplasma pulmonis (SEQ ID NO: 7) and Mycoplasma hyopneumomae (SEQ ID NO:S).
- Full length MilA is defined in SEQ ID ' NO: 5 (M hovis PG45), SEQ ID NO: 16 ( btnis Hubei-1 ), SEQ ID NO: 1.7 (M agalacPae PG2), SEQ ID NO: 18 (M columbima SF7), SEQ ED NO: 1.9 (M, fermantans 1E ), SEQ ID G:20 ( pulmonis) and SEQ ID ⁇ O.2 i (M. hyopn umoniae).
- the nucleotide sequence encoding MilA optimized for expression in E. coll is set forth in SEQ ID NO; 13.
- the genomic nucleotide sequence from M. bovis PG45 is set forth in SEQ ID NO: 14.
- a method for detecting current or prior exposur of a ruminant subject to a species of Mycoplasma comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NOT after optimal alignment or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting tor the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
- (OOlOj Further enabled is a method for detecting current or prior exposure of a raminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 2 after optimal alignment or an antibody-binding fragment of the protein, for a time and under condi tions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibod wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
- [0011 J Taught herein is a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment or an antibody- binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp,
- the present specification teaches a device for screening for current or prior exposure of a. subject to a species of Mycoplasma, the device comprising a immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: I or an amino acid sequence having at least 40% similarity to SEQ ID NO: I after optimal alignment or an antibody-binding fragment of the protein, the device further comprising means to contact a sample f om the subject with the immobilized protein.
- Enabled herei is a device for screening for current or prior exposure of a subject to a species of Mycoplasma, the device comprising an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid .sequence having at least 40% similarity to SEQ ID O:2 after optimal alignment or an antibody-binding fragment of the protein, the device further comprising means to contact a sample from the subject with the immobilized protei .
- a device for screening for current or prior exposure of a subject to a species of Mycoplasma comprising an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment or an antibody-binding fragment of the protein, the device further comprising means to contact a sample from the subject with the immobilized protein.
- Taught herein is a method for controlling infection by a species of Mycoplasma in a ruminant subject, the method comprising administering to the subject an antibody- inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment for a time and under conditions sufficient to generate antibodies to said protein.
- Enabled herein is a method for controlling infection by a species of Mycoplasm or a condition caused or exacerbated by infection with Mycoplasma in a ruminant subject, the method comprising administering to the subject an antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino aci d sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
- Infection by Mycoplasma spp ca lead to bovine respiratory disease, keratoconjunctivits, mastitis, meningitis, otitis media, and genital tract disease.
- Taught herein is a method for controlling infection by a species of Mycoplasma or a condition caused or exacerbated by infection with Mycoplasma in a ruminant subject, the method comprising administering to the subject a antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO.1 5 after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
- Infectio by Mycoplasma spp can lead to bovine respiratory disease, keratoconjunctivits, mastitis, meningitis, otitis media, and genital tract disease.
- composition comprising a protein or derivative thereof campnsin the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents.
- composition comprising a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NG:2 or an amino acid sequence having at least 40% similarity to SEQ ID NQ:2 after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents,
- Taught herein is a composition comprising a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents,
- the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs:2 through 8 or is an antibody-binding fragment thereof or comprises an amino acid sequence having at least 40% similarit to any one of SEQ ID N s.2 through 8 after optimal alignment.
- the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs: 15 through 21 or is an antibody-binding fragment thereof or comprises an amino acid sequence having at least 40% similarity to an one of SEQ ID NOs: 15 through 21 after optimal alignment,
- the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or is an antibody-binding fragment thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 through 21 or is an antibody-binding fragment thereof.
- the ruminant animal is selected from the list consisting of cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod.
- the Mycoplasm is Mycoplasma bmis and the ruminant animal is a cow.
- SEQ ID NO Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO).
- the SEQ ID NOs correspond numerically to the sequence identifiers ⁇ 400> 1 (SEQ ID NO:l), ⁇ 400>2 (SEQ ID NO: 2), etc.
- a summary of the sequence identifiers is provided in Table 1.
- a sequence listing is provided after the claims.
- Figure 1 is a diagrammatical representation of a 6 kbp region of MBQVPG45J 10 (Mil A) gene cloned as two 3 kbp fragments, AB and CD, and subcloned as four 1 ,5 kbp DNA fragments, A, B, C and D, with the expressed gene sequences bounded by restriction endonuclease cleavage sites.
- Figure 2 is a ph.otographi.cal representation of Western blots of whole cell proteins of bovis strain 3683 probed with sera from 6 calve (A-F) collected on: 1, day 0; 2, day 24. Uninfected, calves inoculated with Mycoplasma culture medium; Infected, calves inoculated with M hovis strain 3683; Arrow, protein of interest seen in strip 2 in infected calves,
- Figure 3 is a photographical representation of SDS-P GE and Western blot of Mil A (226 kDa). Lanes: 1, Spectra (Trade Mark) Multicolor high range protein ladder (Fermentas); 2, whole cell proteins of M. hovis strain 3683 stained with Coomassie blue; 3, whole cell proteins of M agaiactkie strain PG2 stained with Coomassie blue; 4, Western blot of whole cell proteins of M bovis strain 3683 probed with M fows-specific calf sera; 5, Western blot of whole cell proteins of , agaiactkie strain PG2 probed with . bovis- specific calf sera,
- Figures 4(i) and (ii) are photographical representations showing expression of recombinant proteins in E. coli JM 109 cells, (i) Whole cell proteins of induced clones separated in a 12% w/v polyacryl mide gel stained with Coomassie blue, (ii ) transferred to a PVDF membrane and probed with pooled M, ⁇ , ⁇ -specific bovine sera. Lanes: 1 , PageRuler prestained protein ladder (Thermo Scientific); 2, pGEX-4T-l-w?
- Figure 5 is a diagrammatical representation showing physical map of genes in the region surrounding MBOVPG45_07I0 (mi LA). The predicted size of the gene product is shown as the number of amino acids (aa). LP, lipoprotein; rpoB, DNA-directed RNA polymerase subrjnit beta; rpoC, DNA-directed RNA polymerase subunit beta; BQVPG45_0710 (mi/A), membrane protein; HP, hypothetical protein; ISMbov 7, transposase truncated protein; ISMbov 6, M42 family glutamyl aminopeptidase.
- FIG. 6 is a diagrammatical representation showing multiple sequence alignment of region 1 of mycoplasma immunogenic lipase (MtlA) with bomo!ogs in other mycoplasmas and the mycoplasma GDSL carboxyesterases,
- Figure 7 is a graphical representation showing release of resorufm by the lipase activity of GST-MilA-ab and GST-p65 over 30 min, with GST as the negative control.
- Figures 8(i) and (ii) are graphical representations showing Logio IgG antibody titers of individual calves on day (i) 1.7 and (ii) day 24 after infection in. Experiment 1. The bar indicates the mea of each group.
- Figures 9(i) and (it) are graphical representations showing Logio IgG antibody titers of individual calves on (i) day 17 and (ii) day 24 after infection in Experiment 2, The bar indi cates the mean of each group.
- Figure 10 is a graphical representation of mea ⁇ /. bovis- specific IgM antibody titers of each group in Experiment 3. Bars indicate standard deviation,
- Figure 11 is a graphical representation of mean M. ovis- specific IgM antibody titers of each group in Experiment 3. Bars indicate standard deviation,
- Figure 12 is a schematic diagram of the piasmid vector pGEX-4T-l (reproduced from the GE Healthcare pGEX vector map).
- Figure 13 is a representation of physical maps of mycoplasma hpmologues of MBOVPG45_710 (milA) and adjacent genes. Homologous proteins are shaded the same colour. Numbers above the genes indicate the length of the predicted product in amin acids.
- MBOVPG45 710 membrane protein
- MMB_0654 conserved hypothetical transmembrane protein * MAGa6830, conserved hypothetical protein
- MAG_6100 conserved hypothetical protein
- MMB__03 I 8 conserved hypothetical protein
- MFE_02570 MfeM64YMschreib 0307 lipase/hypothetical protein
- CiMl endo-l,4-beta-glucanase; ⁇ ⁇ , DMA topoisomerase; vvrA t uvrABC system protei A; vpmaYl, variable surface lipoprotein Y; LicA, lichenan-specifie ⁇ component.
- Figure 14 is a graphical representation of M. fev/ -specific IgG ELISA results for sera from feedlot cattle. DETAILED DESCRIPTION
- the instant specification enables an isolated protein or an antibody-binding fragment thereof comprising an amino acid sequence set forth i n SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: ! after optimal alignment.
- Reference to "at least 40%" means 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 ? 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, .89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100% similarity to a recited sequence identifier.
- the protein or a derivative thereof is from Mycoplasma hovis type strain PG45 and comprises the amino acid sequence as set forth in SEQ ID NO;2 or an. amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment.
- the protein or a derivative thereof is from Mycoplasma /> i v.v type strain PG45 and comprises the amino acid sequence as set forth in SEQ ID NO; 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment.
- the protei or a derivative thereof is from Mycoplasma bovis strain Hubei-1 and comprises amino acid sequence as set forth in SEQ ID NO: or an amino acid sequence having at least 40% similarity to SEQ ID NO; 3 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma agalactia strain PG2 and comprises amino acid sequence as set forth in SEQ ID NQ;4 or an amino acid sequence having at least 40% similarity to SEQ ID NO:4 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma columbinium strain SF7 and comprises amino acid sequence as set forth in SEQ ID NO; 5 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 5 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma fermanta strain JER and comprises amino acid sequence as set forth in SEQ ID NO: 6 or an amino acid sequence having at least 40% similarity to SEQ ID NO:6 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma pulmonis and comprises amino acid sequence as set forth in SEQ ID ' NO: 7 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 7 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO:8 or an amino acid sequence having at least 40% similarity to SEQ ID NO:8 after optimal alignment.
- the protein or a derivative thereof is from Mycophsm hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 16 or an. amino acid sequence having at least 40% similarity to SEQ ID NO: 16 after optimal alignment.
- the protei or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 1 7 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 17 after optimal alignment.
- the protein or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 18 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 18 after optimal alignment.
- the protein or a derivative thereof is from Mycoplasma hyopneumwii e and comprises amino acid sequence as set forth in SEQ ID NO: 19 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 19 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasm hyopneimtonia and comprises amino acid sequence as set forth in SEQ ID NO: 20 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 20 after optimal alignment,
- the protein or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO:21 or an amino acid sequence having at least 40% similarity to SEQ ID NG:21 afte optimal alignment
- the present specification teaches an isolated protein comprising an amino acid sequence selected from the list consisting of SEQ ID NOs: l throug 8 or 15 through 21.
- Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO :3.
- Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO :6.
- Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO: 1.7.
- the present specification teaches the use of a protein or a derivative thereof having the amino acid sequence set forth in SEQ ID NQs: 1 through 8 or 15 through 21 or an amino acid sequence with at least 40% similarity to any of SEQ ID Os: 1 through 8 or 15 through 21 in the manufacture of a diagnostic agent to screen for current or prior exposure of a subject to a species of Mycoplasma.
- the protein or derivative may also be used to screen for potential bovine respiratory disease, keratoconjunctivitis, mastitis, meningitis, otitis media and genital tract disease.
- the present specification contemplates a method fo detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting a antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment or an antibody -binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
- the present specification further enables a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacti g an antibody containing sample from the subject -with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is i dicative of current or prior exposure to Mycopktsma Spp.
- the present specification further enables a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in. SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO:- 15 after optimal- alignment .or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp,
- the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs2: through 8 or 15 through 21 or is an antibody- binding fragment thereof. [00841 In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:2 of an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optima! alignment or is an antibody-binding fragment thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at. least 40% similarity to SEQ ID NO: 15 after optimal alignment or is an antibody-binding fragment thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 2 or is an antibody-binding fragment thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 oris an antibody -binding fragment thereof
- the protein comprises the amino acid sequence set forth in SEQ ID NO; 16 through 21 or is an: antibody-binding fragment thereof.
- Reference to a "ruminant subject” includes a cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod.
- the species of Mycoplasma is M. bovis and the ruminant subject is a cow.
- a “derivative” of the protein includes a fragment of the protein such as antibody-binding fragment. Fragments include MilA-AB, MilA-CD, Mil A- A, MilA-B, MilA-C, MilA-D; ilA-cd and MilA-ab.
- a “derivative” also includes a protein having a single or multiple amino acid substitution, deletio and/or addition to SEQ ID NO: 1 or any one of SEQ ID NOs:2 through 8 or SEQ ID NOs; l5 through 21.
- a ''derivative'' further includes the incorporation of an unnatural amino acid or chemical alteration of an amino acid side chain.
- side chain modifications contemplated herein include modifications of amino groups such as by reductive aikylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with metliylacetimidate; acy!ation. with acetic anhydride; carbamoylation of amino groups with cyanate; tnnitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene suiphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyri doxy! ati on of lysine with pyridoxal-5-phosphate fol lowed by reduction with NaBHU.
- modifications of amino groups such as by reductive aikylation by reaction with an aldehyde followed by reduction with NaBH 4 ; amidination with metliylacetimidate; acy!ation. with acetic anhydride; carbamoylation of amino groups with cyanate; tnnitrobenzylation of
- the guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as :2 s 3-butariedione, phenylglyoxal and glyoxal.
- the carboxyl group may be modified by carbodiimide activation via O- acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide,
- Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteie acid; formation of a mixed disulphides with other thiol compounds; reaction with nialeimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuripheriylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
- Tryptophan residues may be modified by, for example, oxidation with N- bromosuecmimide or aikylatio of the indole ring with 2-hydroxy-5-nitrohenzyl bromide or sulphonyl halides.
- Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
- Modification of the imidazole ring of a histidine residue may be accomplished by aikylation with iodoacetic acid derivatives or N-carbethoxylation with diethylpyrocarbonate.
- Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include., but are not limited to, use of norleucine, 4-amino butyric acid, 4- amino-3-hydroxy-5-phenylpenianoie acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglyciiie, ornithine, sarcosine, 4-aniino-3-hydroxy-6-methylheptanoic acid, 2-t enyl alanine and/or D-isomers of amino acids,
- Table 3 A list of unnatural amino acids, contemplated herein is shown in Table 3.
- peptides can be Gonformationally constrained by, for example, incorporation of C e and N «-m ethyl amino acids, introduction of double bonds between C a and C atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the or C terminus.
- any immunoassay may be used to target the MilA protein or its antibody- binding fragment or its derivative form.
- Immunoassays are in effect binding assays. Examples of immunoassays include the various types of enzyme linked immunosorbent assays (ELS A), radioimmunoassays (RIA), Western blotting, dot blotting and FACS analyses.
- ELS A enzyme linked immunosorbent assays
- RIA radioimmunoassays
- Western blotting Western blotting
- dot blotting dot blotting and FACS analyses.
- jOlOJ J In an. embodiment, an. EL-ISA is carried out using immobilized MilA protein. its honiolog, its derivative or an antibody-binding fragment (herein referred to as he "antigen"). In an embodiment, is immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate,
- a sample putatively comprising antibodies to the naturally occurring Mil A protein is then added to the well s. After binding and washing to remove n on -specifically bound immune complexes, the antibody bound complex may be detected. Detection is generally achieved by the addition of a second antibody that is known to bind to the antibody and is linked to a detectable label. This type of ELISA is a simple "sandwich ELISA". Detection may also be achieved by the addition of the second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
- the antibody-anti en complex is detected by a labeled antiimmunoglobulin antibody having an enzyme, chemiiuminescence, radioisotope, impedance or optical signal generating moiety attached thereto.
- the anti -immunoglobulin activity is an an ti-IgG antibody.
- the present specification further enables antibodies to Mil A or its homolog or derivative.
- the antibodies may be monoclonal or polyclonal antibodies.
- the antibodies are useful for screening for MilA protein or its homolo or derivative and for purifying or capturing MIA protein or its homolog or derivative.
- antibody is meant a protein of the immunoglobulin family that is capable of combining, interacting or otherwise associating with an antigen (i.e. Mil protein or its homolog or derivative).
- An antibody is, therefore, an antigen-binding molecule.
- An “antibody” is an example of a immunointeractive molecule and includes a polyclonal or monoclonal antibody. Particularly useful immunointeractive molecules are monoclonal antibodies.
- antigen is used herein in its broadest sense to refer to a MilA substance, or its honralogs or derivatives that are capable of reacting in and/or inducing an immune response.
- antigen-binding molecule any molecule that has binding affinity for a target antigen. It will be understood that this term extends to immunoglobulins (e.g. polyclonal or monoclonal antibodies), immunoglobulin fragments and non- immufioglohulin derived protein frameworks that exhibit antigen-binding activity,
- antigenic determinant or “epitope” is meant that part of an antigenic molecule against which a particular immune response is directed and includes an antibody-binding fragment of a MilA antibody. Typically, in an animal, antigens present several or even many antigenic determinants simultaneously.
- Antibodies described herein may be from any source.
- animal and avian sources and hosts include humans, primates, livestock animals (e.g. sheep, cows, horses, pigs, donkeys), laboratory test animals (e.g. mice, rabbits, guinea pigs, hamsters), companion animals (e.g. dogs, cats), poultry bird (e.g. chickens, ducks, geese, turkeys) and game birds (e.g. pheasants),
- Immunization and subsequent production of monoclonal antibodies can be carried out using standard protocols as for example described by Kohler and Milstein (Kohler et ai (1975), Nature 256:495-499 and Kohler et at (1976), Eur. J. Immunol 6(7):5 11-519, Coligan et al. (19 1 -1997) Current Protocols in Immunology, or Toyama et ai. (1987), Monockma! Antibody, Experiment Manual, published by Kodansha Scientific.
- an animal is immunized with an antigen-containing (i.e. MilA or a fragment or homolog thereof) by standard methods to produce antibody-producing cells, particularly antibody-producing somatic cells (e.g. B lymphocytes). These cells can then be removed from the immunized animal for immortalization.
- the antigen may need to first be associated with a carrier.
- carrier any substance of typically high molecular weight to which a non- or poorly immunogenic substance (e.g. a hapten) Is naturally or artificially linked to enhance its immunogenicity.
- a non- or poorly immunogenic substance e.g. a hapten
- Immortalization of antibody-producing cells may be carried out using methods, which are well-known in the art.
- the immortalization may be achieved by the transfbrmation method using Epstein-Barr virus (EB V) (Kozbor et al (1986), Methods in EnzymoJogy 727: 140).
- EB V Epstein-Barr virus
- antibody-producing cells are immortalized using the cell fusion method (described in [Coligan et al. ⁇ " 1991-1997) supra]), which is widely employed tor the production of monoclonal antibodies.
- somatic antibody- producing cells with the potential to produce antibodies, particularly B cells are fused with a myeloma cell line.
- somatic cells may be derived from the lymph nodes, spleens and peripheral blood of primed animals, preferably rodent animals such as mice and rats.
- rodent animals such as mice and rats.
- murine spleen cells are used. It would be possible, however, to use rat, rabbit, sheep or goat cells, or cells from other animal species instead.
- the second reaso ses from the inherent ability of lymphocytic tumor cells to produce their own antibodies.
- myeloma cell lines incapable of producing endogenous light or heavy immunoglobulin chains are used.
- a third reason for selection of these cell lines is for their suitability and efficiency for fusion.
- Many myeloma cell lines may be used for the production of fused cell hybrids, including, e.g. P3X63-Ag8, P3X63-AG8.653, P3/NSl-Ag4-l (NS-1), Sp2/0-Agl4 and S 1 4/5.XXO.BU. 1.
- the P3X63-Ag8 and NS-i cell lines have been described by Kohier and Milstein (Kohler et al. 1976 supra).
- Shuiman et al. (1978) Nature 276:269-270, developed the Sp2/Q-Agl4 myeloma line.
- the Sl 4/5.XXO.Bu.1 line was reported by Trowbridge (1982), J. Exp. Pied 148(1):22Q-2X1.
- Methods for generating hybrids of antibody-producing splee or lymph node cells and m eloma cells usually involve mixing somatic cells with myeloma cells in a 10: ! proportion (although the proportion may vary from about 20: 1 to about 1 : 1), respectively, in the presence of an agent or agents (chemical, viral or electrical) that promotes the fusion of cell membranes. Fusion methods have been described ( ohler et al. (1975) supra, Kohler et al. (.1.976) supra, Gefter e i al. (1977), Somatic Cell Genet £.231.-236 and Volk et al. (1982) supra). The fusion-promoting agents used by those investigators were Sendai virus and polyethylene glycol (PEG).
- PEG polyethylene glycol
- fusion procedures produce viable hybrids at very low frequency (e.g. when spleens are used as a source of somatic cells, only one hybrid is obtained for roughly every 1x10 " spleen cells), it is preferable to have a means of selecting the fused cell hybrids from the remaining unfused cells, particularly the unfused myeloma cells.
- a means of detecting the desired antibody-producing hybridomas among other resulting fused cell hybrids is also necessary.
- the selection of fused cell hybrids is accomplished by brieflyig the cell s in media that support the growth of hybridomas but prevent the growth of the unfused myeloma cells, which normally would go on dividing indefinitely.
- The- somatic cells used in the fusion do not maintain long-term viability in in vitro culture and hence do not pose a problem.
- myeloma cells lacking hvpoxanthine phosphoribosyl transferase HPRT -negative
- HPRT hypoxanthine/aminopterin/thymidine
- myeloma cells with different genetic deficiencies (drug sensitivities, etc) that can be selected against in media supporting the growth of genotypically competent hybrids is also possible.
- each cell line may be propagated in either of two standard ways.
- a suspension of the ybridoraa cells can be injected into a histocompatible animal. The injected animal will then develop tumors that secrete th specific monoclonal antibody produced b tire fused cell hybrid.
- the body fluids of the animal such as serum or ascites fluid, can be tapped to provide monoclonal antibodies in high concentration.
- the individual cell lines may be propagated in vitro in laboratory culture vessels.
- the culture medium containing high concentrations of a single specific monoclonal antibody can be harvested, by decantatioii, filtration or eentrifugation, and subsequently purified.
- the cell lines are tested for their specificity to detect the antigen of interest by any suitable immunodetection means.
- cell lines can be aliquoted into a number of wells and incubated and the supernatant from each well is analyzed by enzyme- linked immunosorbent assay (ELISA), indirect fluorescent antibody technique, or the like.
- ELISA enzyme- linked immunosorbent assay
- the cell iine(s) producing a monoclonal antibody capable of recognizing the target antigen but which does not recognize non-target epitopes are identified and then directly cultured in vitro or injected into a histocompatible animal to form tumors and to produce, collect and purify tire required antibodies.
- the present specification is further directed to a compositio comprising a protein comprising an amino acid sequence set forth in SEQ ID NO: 1 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO: 1. in the manufacture of a medicament for the treatment or prophylaxis of infection by Mycoplasma species.
- composition comprising a protein comprising an amino acid sequence set forth in SEQ 3D NQ:2 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO:2 in the manufacture of a medicament for the treatment or prophylaxis of infection by Mycoplasma species.
- composition comprising a protein comprising an amino acid sequence set forth in SEQ ID NO: 15 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO: 15 in the manufacture of a medicament for the treatment or prophylaxis of infection by Kfycapl sm species,
- the protein comprises the amino acid sequence set forth by SEQ ID NO:2 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein,
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 3 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the ⁇ protein comprises the amino acid sequence set forth by SEQ ID NO:4 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 5 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein. - 5J -
- the protein comprises the amino acid sequence set forth by SEQ ID NO:6 or an amnio acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NQ:7 or an amine- acid sequence having at least 40% similarity thereto or is a derivati ve of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 8 or an amino acid sequence having at least 40% similarity thereto or is a deri ative of the protein.
- the protein compri ses the amino acid sequence set forth by SEQ ID NO: 16 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 17 or a amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 18 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein,
- the protein comprises the amino acid sequence set forth by SEQ ID NO: 19 or a amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO:20 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein comprises the amino acid sequence set forth by SEQ ID NO:21 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- the protein is formulated, with a pharmaceutical carrier, excipient or diluent, which is non toxic to a ruminant subject,
- the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral (including intravenous).
- any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols, flavouring agents, preservatives, coloring agents and the like in the case of oral liquid preparations, such as, for example, suspensions, elixirs and solutions; or carriers such as starches,, sugars, microcrystalMne cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations such as, for example, powders, capsules and tablets, with the solid oral preparations being preferred over the liquid preparations. Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be coated by standard aqueous or nonaqueous techniques.
- compositions disclosed herein suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient, as a powder or granules or as a solution or a suspension i an aqueous liquid, a non-aqueous liquid, an oil-in- water emulsio or a water-in-oi I liquid emulsion.
- Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more necessary ingredients.
- compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
- a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
- compositions may be administered orally, parenterally (including subcutaneous injections, intravenous, intramuscular, intrasternal injection or infusion techniques), by inhalation spray, or reetally, in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, excipient and diluents.
- the composition may also further comprise an adjuvant.
- compositions When administered by nasal aerosol or inhalation, these compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
- the protein may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts.
- the injectable solutions or suspensions may be tonnulated according to known art, using suitable non-toxic, parenteraily-acceptable diluents or solvents, such as mannitol, 1 ,3-butanediol, water. Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
- compositions When rectally administered in the form of suppositories, these compositions may be prepared by mixing the protein with a suitable non-irritating exctptent, such as cocoa butter, synthetic glycexide esters or polyethylene glycols, which are solid at ordinary temperatures, but liquefy and/or dissolve in the rectal cavity to release the protein.
- a suitable non-irritating exctptent such as cocoa butter, synthetic glycexide esters or polyethylene glycols, which are solid at ordinary temperatures, but liquefy and/or dissolve in the rectal cavity to release the protein.
- the effective dosage of the protein employed in therapy may vary depending on the particular compound employed, the mode of administration, the conditio being treated and the severity of the condition being treated.
- the dosage regimen utilizing the proteins of the present disclosure is selected in accordance with a variety of factors including type, species, age, weight, se and medical condition of the ruminant subject; the severity of the Mycoplasma infection to be treated; the route of administration; the renal and hepatic function of the subject; and the particular peptide employed.
- a veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug requited to prevent, counter or arrest the progress of the condition.
- Optimal precision in achieving concentratio of protei within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the protein's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of the protein.
- Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protei or derivati ve thereof comprising the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 40% similarity to SEQ ID NO: I after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
- Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protei or derivative thereof comprising the amino acid sequence set forth in SEQ ID ' NO: or an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
- Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth In SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment for a time and under conditions sufficient to generate antibodies to the- protein,
- the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or a protein having at least 40% similarity to SEQ ID NO:2 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 or a protein having at least 40% similarity to SEQ ID NO: 15 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO:3 or a protein having at least 40% similarity to SEQ ID ' NO: 3 or is derivative thereof
- the protein comprises the amino acid sequence set forth in SEQ ID NO:4 or a protein having at least 40% similarity to SEQ ID NO: 4 or is a derivative thereof
- the protein comprises the amino acid sequence set forth in SEQ ID NO 5 or a protein having at least 40% similarity to SEQ ID NO 5 or is a derivative thereof
- the protein comprises the amino acid sequence set forth in SEQ ID ⁇ 6 or a protein having at least 40% similarity to SEQ ID NO:6 or is a derivative thereof [0154] In an embodiment the protein comprises the amino acid sequence set forth in SEQ D NO:7 or a protein having at least 40% similarity to SEQ ID NQ:7 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NQ:8 or a protein having at least 40% similarity to SEQ ID NO; 8 or is a derivative thereof.
- the protein comprises the amino acid sequence set fort in SEQ ID NO: 16 or a protein having at least 40% similarity to SEQ ID NO: 16 or is a deri ative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 17 or a protein having at least 40% similarity to SEQ ID NO: 17 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: IS or a protein having at least 40% similarity to SEQ ID NO: 18 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO: 1 or a protein having at least 40% similarity to SEQ ID NO: 19 or is a derivative thereof.
- the protein comprises the amino acid sequence set forth in SEQ ID NO:20 or a protein having at least 40% similarity to SEQ ID NG:20 or is a derivative thereof.
- the pnstera comprises the amino acid sequence set forth in SEQ ED NO:2I or a protein having at least 40% similarity to SEQ ID NO:21 or is a derivative thereof.
- These aspects include conditions caused or exacerbated by Mycoplasma infection such as bovine respiratory disease, keratoconjunctivitis, mastitis, meningitis, otitis medi and genital tract disease.
- the formulation of protein and its subsequent administration is within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several day s to several months, or until a cure is effected or a diminution of the disease state is achieved. Optim l dosing schedules can be calculated from measurements of drug accumulation in the subject. Persons or ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on. EC5 0 S found to be effective in in vitro and in vivo animal models.
- dosage is from 0.01 ⁇ g to l.OOg per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or eve once every 2 to 20 years.
- Persons of ordinary skill in the art can easily estimate repetition rats for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
- a ruminant subject is administered, an antibody to MilA or its homolog or derivative. This is regarded as passive immunotherapy. Antibodies to MilA or its homolog or derivative are generated as previously described herein.
- Mycoplasma hovis wild-type strains 3683, 149040, PG45 and the temperature sensitive (is) mutant strains A, B and C were used.
- M, bovis wild-type Strains (1/500 dilutions) were incubated for 17 h at 37 ° C in MB medium, and 1 /100 dilutions of the ts mutants were incubated for 24 h at 33 C C in MB medium.
- pGEX-4T-l plasmid ( Figure 12) was used for cloning different regions of MilA and E. call JM109 cells were used to express recombinant GST-MilA proteins.
- Experiment 2 Thirty five, one-month-old Friesian-cross calves were grouped according, to their weight and randomly grouped into 2 groups. Group 1 , the uninfected group, consisted of 5 calves exposed to an aerosol of mycoplasma culture medium, and Group 2 consisted of 30 cal ves exposed to an aerosol of M bovis strain 3683. Infection and sampling were performed as described for Experiment 1. [0.169] Experiment 3 - Group 3 cattle totaled 31 and were provided with vaccine A. SDS-PAGE and Western blots analysis
- the total proteins were separated i 10% w/v or 12% w/v polyacryl amide separating gels by electrophoresis at 180 V for 1 h in the BioRad mini-vertical PAGE system containing Laemmli 's buffer (0.1 % w/v SDS, 0.025 M Tris, 0.19 M glycine). Broad range prestained (Fermentas) or unstained protein markers (New England Biolabs, USA), or biotinylaied protein markers (Cell Signaling Technology, USA) were used as molecular mass standards. The gels were stained with Coomassie brilliant blue -250 (BioRad, USA),
- PVDF polyvinyls dene difluoride
- the membrane was then washed three times (5 min each) with PBS-T [phosphate buffered saline (140 mM NaCl, 2,7 mM KC1, 10 mM Na 2 H 2 P04, mM HjPO*) containing 0, 1% v/v Tween 20 (Asia Pacific Specialty Chemicals, Australia)].
- PBS-T phosphate buffered saline (140 mM NaCl, 2,7 mM KC1, 10 mM Na 2 H 2 P04, mM HjPO*) containing 0, 1% v/v Tween 20 (Asia Pacific Specialty Chemicals, Australia)].
- the membrane was then probed with a pool of M bovh ⁇ -specific calf sera, diluted to 1/100 in 1% w/v skim milk in. PBS-T, and incubated for 1 h at room temperature with gentle rocking.
- anti-M bovis rabbit antibody diluted to 1/20,000 in.
- HRP horseradish peroxidase
- Mycoplasma bovis cells from a 25 ml culture were pelleted by eentrifugatio at 16,000 g for 20 min at 4°C in a Sorvall . R.C-5B centrifuge (Sorvall, USA). The cell pellet was washed three times with PBS and resuspended in 0.25 ml PBS using a. 25 gauge needle and syringe. The cells were lysed with a 0.25 ml volume of 1% v/v Triton X-114 (Sigma, USA) and the mixture incubated on ice for 60 min, with mixing every 15 min. The ceil suspension was centrifuged at 13,000 ⁇ g for 30 min at 4 C.
- the hydrophobic and hydrophiiic fractions were precipitated using the methanol/chloroform method.
- To 1 volume of protein suspension 4 volumes of ice-cold methanol, 1 volume of ice-cold chloroform and 3 volumes of distilled water were added, the solutions vigorously mixed and then centrifuged for 1 min at 16,000 % g. The supernatant was discarded and the protein pellet resuspended i 4 volumes of methanol, vortexed and centnfuged for 5 min at 16,000 g at T, The supernatant was removed, the pellet dried under a vacuum and then dissolved in 8 M ur a. The proteins were then analyzed by SDS-PAGE or two dimensional electrophoresis (2 -DE).
- sample preparation for two dimensional gel electrophoresis (2-DE) was carried out as described by Gorg (2004).
- a .20 ml overnight, culture of M. bovi was pelleted by eentrifugation at 1.6,000 x g for 20 min at 4°C and the cell pellet washed three times with PBS, and resuspended using a 25 gauge needle i 0.5 ml of sample preparation solution [8 M urea, 4% w/v CHAPS (GE Healthcare, USA), 2% y/v IPG buffer pH 3 -1 1 (GE Healthcare, USA) and 40 mM DL-dithiothreitol (DTT) (Sigma- Aldrich.)].
- the strip holder was placed on an Etlari TPGphorll isoelectric focusing system (Am ersharo -Bioscience) and the gel was re-swe) ' .led for 12 h at 30 V, then at 60 V for 6 h, and the isoelectric focusing performed for 5.5 h, at 200 V for 1 h, at 500 V for 1 h, at 1000 V for 1 h, at a gradient of 1000 V to 8000 V for 1 h, and at 8000 V for 1.5 h.
- Etlari TPGphorll isoelectric focusing system Am ersharo -Bioscience
- the strip was removed from the stri holder and equilibrated in SDS equilibration buffer (6 M urea, 75 mM Tris-HCi [pH 8.8], 87% v/v glycerol, 2% w/v SDS, 0.002% w/v bromophenoi blue with 10 mg . DTT/ml) for 15 min, followed by another 15 min with 25 mg jodoacetamide/ml (Am ersham, USA) substituted for the DTT.
- the IEF strip gel was placed on top of a 12,5% w/v polyaerylamide SDS- PAGE gel arid sealed with agarose sealing solution (0.5% w/v agarose, 0.002% w/v bromophenoi blue in Laemmli's buffer) and the proteins separated according to their mass by electrophoresis. Once electrophoresis was completed the proteins were either transferred onto a PVDF membrane or stained with either colloidal Coomassie blue or silver (Plusone Silver Staining Kit-Protein, GE Healthcare, USA) according to the m an ufacturer ' s i nstru cti ons .
- a 6 ⁇ b region of the M A gene was codon-optimized for expression in E. colt and the TG A tryptophan codons altered to TGG to confirm with E, coli codon usage.
- the synthetic gene sequence was designed to contain a number of restriction endoimclease cleavage sites to aid manipulation in pGEX-4T-.l (BamHJL, Sail, XhoJ and Bgffi) [ Figure 1].
- the modified DNA sequences were then manufactured by Genscript (USA) and cloned in pUC57.
- the gene sequence optimized for expression in E. coli is set forth in SEQ ID Nos: 13 and 22.
- the MilA-AB (SEQ ID NO: 13) and milA-CD (SEQ ID N0.22) fragments were excised from pUC57 using i1 ⁇ 43 ⁇ 4wHI, Bgll and 6 / ⁇ , purified by agarose gel electrophoresis and extraction with a QIAEX II kit (Qiagen, Germany) according to the manufacturer's instructions, and ligated in to pGEX-4T-l (GE Healthcare) that had been digested with Ba Kl and Sail.
- the MilA-h, MlA- , M lA-C and MilA-D DNA fragments were excised from pGEXr4T-l -MilA -AB or pGEX-4T-l -.1 ⁇ 23 ⁇ 4-CD with appropriate restriction endoriucleases ( Figure I), purified, and ligated to similarly digested pGEX-4T-l ,
- PGR was performed using 2 ng of pGEX-4T-l-M3 ⁇ 44-AB or pGEX-4T- i -M -CD DNA as the template and 0.4 ⁇ . ⁇ of the appropriate primers ( Figure I) in a reaction volume of 50 ⁇ containing 2 raM MgSQ , 100 ⁇ of each deoxynucleoside triphosphate and 1,5 U of Platinum Taq therm o- polyrnerase (Life Technologies).
- Cycling conditions included an initial denaturation step at 94 °C for 4 rain, followed by 35 cycles of 94°C for I min, 55°C for i rain and 68°C for 2 min. Th 1.8 kb products were excised, purified and ligated into pGEX-4T- 1.
- the ligated plasmids were used to transform E. coti JM109 cells by eleetrophoration (Noormohammadi et at. (1999) Microbiology 145: 2087-2094).
- the transform ants were selected on LB agar containing ampicillin (50 g ml) and selected clones were incubated for 3 h at 30°C in the presence of 1 mM isopropyl -D-l-thiogalactopyranoside (IPTG) [Invitrogen], Expression of GST fusion proteins from the recombinant plasmids was assessed by SDS-PAGE and Western blotting of whole ceil lysates. Fusion protein GST- MilA-ab was purified by affinity chromatography using glutathione-Sepharose 4B beads (GE Healthcare) and elution with free glutathione (Crabb et ai. (1995) Arch. Virol. 7 ⁇ :245-258).
- the vector pGEX-4T-l ( Figure 12) was used to transform E. colt JM109 cells by electroporation, according to the manufacturer's instructions (Gene Pulser, Bio Rad). The transformants were selected on LB agar containing ampicillin (50 ⁇ ⁇ 1.), and a single transformant was selected and grown overnight in LB broth supplemented with ampicillin (50 pg ml). The plasmid DNA was purified from the E, eoli cells using the Qiagen Plasmid Midi Kit (Qiagen) according to the manufacturer's instructions.
- the pUC57-milA-AB and pUC57 -mi IA CD plasmids were digested with appropriate restriction endomicl eases (RE), BamHL, Bg and Sail, and pGEX-4T-1 was digested with BcmiHl and Sail according to the manufacturer's instructions (Ne England BioLahs).
- the digested DNA was separated in a 1% w/v agarose gel and the required DNA bands (3 kb for the m/M-AB and milA-CU fragments and 5 kb for pGEX-4T-l ) were excised and the DNA extracted using the QIAEX II kit (Qiagen, Germany) according to the manufacturer's instructions.
- the atnount of DNA was quantified by measuring the absorbance at 260 ran using a NanoDrop spectrophotometer (Biolab, Australia).
- the milA- AB and milA-CD DNA fragments were ligated to similarly digested pGEX ⁇ 4T ⁇ l with T4 DNA ligase (Promega) in ligation buffer (Promega) at 4°C overnight
- T4 DNA ligase Promega
- ligation buffer Promega
- Transfomiants were selected on LB agar containing ampiciUin (50 ⁇ %/ ⁇ ) and resistant transformants screened by PGR to confirm insertio of the mili-AB or milA-CD DN fragment in the pGEX-4T-l vector.
- Those clones containing a 3 kb product as confirmed by PCR were selected and cultured overnight in LB broth supplemented with 50 g ampiciilin ml.
- the plasmid DNA was purified using the Wizard Plus SV Mimpreps kit (Promega), digested ' with BarnHl and Sail and screened for the presence of the 3 kb insert and the 4. kb pGEX-4T-l vector by electrophoresis in a 0,8% w v agarose gel.
- the clones with the expected RE digestion pattern were selected for expression.
- a single transf rmant was used to set up an overnight culture in 5 ml LB broth containing 100 ⁇ g ampicillin/ml. The following day a 1/100 dilution of the overnight culture was used to inoculate 3 ml LB broth containing 100 ⁇ ampicillin/ml and this culture incubated at 37°C with shaking until it reached an OD ⁇ 3 ⁇ 4xi of 0,6-0.8 (around 2,5 h). A 1 ml sample of the culture was centrifuged at 1.6,000 x g for 5 mi and the cells resuspended in 100 ⁇ of PBS and stored at -20 ' C to be used as an uninduced sample.
- JPTCi isopropyi ⁇ -D- l-thiogalactopyranoside
- PCR was performed with 2 ng of pGEX-4T-l -miIA-AB plasmid DNA as the template with primers abF-ifcswH ' I and abR->$3 ⁇ 4r/I in a reaction volume of 50 ⁇ containing 2 mM MgS0 4 , 100 ⁇ of each deoxynucleoside triphosphate, 0,4 ⁇ V! of each primer and 1.5 U of Platinum Taq thermo-polymerase (Life Technologies). Cycling conditions included an initial denaturation step at 94°C for 4 min, followed by 35 cycles of 94°C for 1 mm, 5 for 1 min and 68"C for 2 min. The final cycle included an elongation step at 68"C for 5 min.
- PCR products were resolved by electrophoresis in a 1% w/v agarose gel containing SyberSafe (Trade Mark) DNA gel stain (Molecular Probes) at 80 V for 1.5 ft and visualized under UV illumination using the ChemiDoc imaging system (BioRad).
- SyberSafe Trade Mark DNA gel stain (Molecular Probes)
- the 1 ,8 kb product was excised and the DNA extracted and digested with BamB md Sail as.
- the digested DNA was purified using the Wizard Plus SV Mini rep kit (Promega) according, to the manufacturer's instructions.
- a similar PG was performed to produce the 1.84 kb cd DNA fragment using the cdF-5 «wHI and cdK-Sail primers (Table 13), and the product digested and purified as above.
- a single colony was used to inoculate 5 ml of LB broth containing 100 ttg ampieillin/ml and this culture incubated overnight at 37°C.
- the 5 ml overnight culture was inoculated into 500 ml LB containing 100 pg ampicillin/ml and incubated at 37T with shaking until it reached an OD 6( JO of 0.6-0.8 (around 2,5 h),
- a 1 ml sample of the culture was centrifuged at 16,000 % g for 5 min, resuspended in 100 ⁇ of PBS and stored at -20°C for use as the uninduced sample.
- the cell suspension was sonicated 10 times for 10 sec each on ice and 1% v/v Triton X-100 (Plusone-Pharrnacia Biotech) added and the mixture vortexed and incubated for 30 min on ice. The mixture was then centrifuged at 6,500 x g for 1 min at 4°C and the pellet and supernatant were stored separately.
- glutathione affinity column 1 ,33 ml of glutathione-sepharose 4B beads (GE Healthcare) were centrifuged at 500 ⁇ g for 5 min and the supernatant removed.
- the beads were washed with PBS, centrifuged as above and the pellet of beads carefully placed in a Poly-Prep chromatography column (Bio ad) and left to settle at 4°C for 10 min.
- the column was equilibrated by passing 5 ml of ice cold PBS through it.
- the cell supernatant was filtered through a 0.45 pm nitrocellulose filter (Miliipore) and then placed on the column and allowed to pass through.
- the column was then washed 3 times with 10 ml ice cold PBS and 10 ml of elution buffer (50 mM Tris-HCl [pH 8], 10 mM reduced glutathione [GE Healthcare]) was added to the column and left on it overnight at 4 0.
- elution buffer 50 mM Tris-HCl [pH 8], 10 mM reduced glutathione [GE Healthcare]
- Plasmid DNA of clones expressing the Mil A-AB, MilA-CD, Mil A- A, Mil A-B, MilA-C, MilA-D, Mil A-ab and MilA-ed proteins was extracted using the Wizard Plus SV Miiiipreps kit (Promega). Appfoximately 600 ng of plasmid DNA of each eonstract was used as the template in 20 ⁇ sequencing reactions containing the BDT sequencing terminator mix, BDT dilution buffer and 5 ⁇ of the primer (pGEXFwd or pGEXRev), The reaction was incubated at 96X fo 1 min, followed by 30 cycles of 96X for 10 s, 5 OX for 5 s and 60 X for 4 min.
- reaction products were purified by adding 125 niM EDTA, 2.5 M sodium acetate and 100% v/v ethanol to a total volume of 74.4 ⁇ , and the mixture vortexed, incubated on ice for 1.5 min and centrifuged for 20 min at 16,000 x g at RT. The supernatant wa carefully removed and the pellet was washed in 70% v/v ethanol, centrifuged as above for 5 min, the supernatant discarded and the pellet dried by incubation in a heating block at 95 for 1 min.
- the sequencing products were analysed by capillar)' sequencing and the sequences aligned to the predicted sequence using Geneious Pro 5.1.6.
- the ELISA method used was adapted from Duffy et al (1999) J. Clin. Microbial 37; 1024-1029. Each well contained 1 ,2 ⁇ 3 ⁇ 4 of GST-Mil A-ab and blocking was performed with 5% v/v sheep serum in phosphate buffer saline. Dilutions of positive control, negative control and test sera were made in 2,5% v/v sheep serum in PBS -T (PBS containing 0.05% v/v Tween 20) by preparing two fold dilutions of the positive control calf serum, pool starting from 1/75, to 1/9600, as well as a single dilution of the negative control calf serum pool (1/300) and of test sera ( 1 /300).
- HRP-eonjugated sheep anti-bovine IgG heavy and light chain antibody (Bethyl) was diluted at 1/2000 in 2.5% sheep serum in PBS-T and used as the conjugate. After the final wash, 10 ⁇ of 0.3 g/L 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulfonic acid) [ABTS Peroxidase Substrate, KPL] was added to each well and the plate incubated for 7 min at room temperature. The reaction was stopped by addition of 100 ⁇ of 1% w/v SDS to each well, and the absorbance of each well measured at 405 nm using a Hybrid Multimode microplate reader (BioTe ).
- Test results from both experiments were pooled to calculate the sensitivity and specificity of the IgG ELISA.
- the sensitivity was calculated separately for each time point and the sensitivity on day 24 after infection was considered to be the overall sensitivity of the IgG ELISA.
- the specificity was calculated using one randomly selected sample from each of the uninfected calves (Group 1 -uninfected, Group 2-before infection, Group 3- vaccine A),
- MHA Mycoplasma immunogenic lipase A
- Mass spectrometry c analysis identified the coding sequence as that of MBO VPG45_710, which is predicted to be a 302.9 kDa membrane protein in . hi. bovis PG45 (accession number 313678759). Only the amino terminal 60% of the coding sequence was identified, with peptides derived from the remaining 40% not detected, explaining the lower molecular weight estimated for the protein from SD.S-polyaciylami.de gels.
- the coding sequences of milA were synthesized as two 3 kb fragments, mi A- AB and mfM-CD, with B /rMl and Sail cleavage sites located at the amino and carboxyl terminal ends, respectively.
- the two 3 kb fragments were able to be reduced in size by inclusion of Bgttl and Xhol.
- PG and RE digestion screening also confirmed that the plasmids pGEX ⁇ 4T ⁇ 1 ⁇ //?/Z4 ⁇ AB, pGEX T-l.-»» 4-Cp, pGEX-4T-l-ra?M-A, pGEX-4T-.l ⁇ »iW-B, pGEX-4T-l-m/M-C and pGEX-4T-l-i»/M-D., which were cloned in E. eott JM109 cells, contained the expected inserts.
- the predicted molecular weight (M ) of the recombinant proteins GST-MilA- AB, GST-MiiA-CD, GST-yil A-A, GST-MilA-B, GST-MilA-C and GST-MilA-D were 135,5 kDa, 137 kDa, 82.8 kDa, 79 kDa, 72 kDa and 73,3 kDa, respectively.
- the actual MWs .of the recombinant proteins are summarized.
- the GST-MiiA-CD, GST-MilA-B, GST-MilA-C and GST-MilA-D recombinant proteins were highly expressed, but did not react with M, bovis-specifw calf sera.
- the GST-MiiA-AB and GST-MilA ⁇ A proteins reacted weakly with ⁇ ⁇ 5-specific calf sera. All the GST fusion proteins bound anti- GST antibody strongly.
- the recombinant proteins GST-MilA-ab and GST-Mil A-cd were predicted to have MWs of 92.9 kDa and 94.3 kDa, respectively.
- MBGVPG45_710 (milA) is predicted to code for a 302 fcDa protein of 2700 aa in the M. bovis reference strain PG45. Further analysis revealed that it contained a membrane spanning region at its amino terminal end, with the remainder of the protein predicted be located extraeellularly, Homologs were found in M. bovis strain Hubei-1, M. agalaciiae strains 5632 and PG2, cohrmhinunt SF7 and M sumam strains JER and 64 (Table 4).
- SGNHJrydrolase region at the amino terminal end (aa 1-375) that belonged to a family of GDSL-like lipases ( Figure 5).
- the SGNHJhydrolase region is characterized by the conserved catalytic site amino acids Ser, Gly, Asp and His.
- the active site catalytic triad, Ser-His-Asp is in block 1 (Ser 99) and block V (His 362 and Asp 360).
- I block I the conserved amino acid sequence is GDSL rather than the GDSL motif of the GDSL family lipases, as found in M. hyo eumomae mhp677 ⁇ Schmidt, 2004 #1241 ⁇ .
- Gly is conserved
- i block MI the sequence AXND is conserved in both M bovis PG45 and M.
- infected calves had high IgG titers by day 24 ( Figure 9 and Table 6).
- calves were above the cutoff value of 47,4 at day 10, but only one remained above the cutoff on days 17 and 24.
- infected group four calves were positive on day 17 and twenty eight were positive on day 24,
- the sensitivity of the IgG ELISA was 0% and 14,3% on days 10 and 17, respectively.
- the overall sensitivity of IgG ELISA was 92,8% and specificity was 98,7%,
- the sensitivity of the IgG ELISA for wild-type and vaccinated calves at each time point is shown in Table 9, The overall sensitivity of the IgG ELISA was 91 % and specificity was 98.4 %.
- a 1/50 test serum dilution was selected, together with a HRP-conjjugate dilution of 1/2000, as this offered the best discrimination between infected and uninfected animals.
- the development time for the ABTS substrate was increased to 20 min and the dilution series of the primary antibody for the standard curve for the test plate was 1/5, 1/10, 1/20, 1/40, 3/80, 1/ 160, 1/320 and 1/640.
- the mean titer for the uninfected calves in the IgM ELISA was 99, and the cut off value was calculated to be 287 (99 + 188), On day 0, three animals were positive, but all were considered negative one week later. At day 14 after vaccination, 2 animals in Group 3 were positive, and the number of positive animals increased to 3, 5, 9 and 11 at each time point, Only one animal in Group 2 was positive before challenge, but the number increased to 11 and 18 on days 17 nd 24 after challenge (Table 1 1 and Figure 1 1 ).
- the sensitivity of the IgM ELISA for wild-type and vaccinated calves at each time point is shown in Table 12.
- the overall sensitivity of the IgM ELISA was 47,5 % and specificity was 98.8 .
- experiment 1 had 24 calves, which were allocated into three groups. Grou 1 consisted of 4 calves exposed to aerosol of mycoplasma culture medium, Group 2 consisted of 12 calves exposed to Mycoplasm hovis strain 3683, while Group 3 consisted of 8 calves exposed to M bovis temperature sensitive vaccine strain A on days I and 3 and challenged together with calves from Grou 2 with bovisstimn 3683 three weeks after vaccination. Aerosol exposure was carried out as described before(Wawegama et al. (2012) supra).
- the cut-off value for the IgG ELISA was calculated by considering all the uninfected calves in both experiments, including all the sera from Group .1 , sera from day 0 to day 18 from Group 2 and sera from day 0 from Group 3. The sensitivity was calculated at day 42 and the specificity was calculated for a randomly selected time point. [0223] The closed herd was considered as negative for M boviv and descriptive stati stics were computed and cut off value was calculated,
- the mean antibody titer for the daily herd was calculated as 36 ⁇ 14.13, therefore, the cut-off was calculated as 64.3 AU. According to the cut-off all the cows except 2 were seiO-negative for M hovis and the 2 positive cows had antibody units less than 1.5 times the cut-off. Specificity of the IgG ELIS A using the dairy herd sera was calculated as 96%.
- the M doiw-specific IgG ELISA is able to detect M, bovis infection in calves as well as adult cattle and can be used as a sera-diagnostic assay to screen for carriers for M. bovis.
- MilA is a 226 kDa protein identified from M. b ' ovis strain 3683 by Western blotting. MilA is immunoreactive based on &oi7,v-speeific calf sera. MilA was estimated to be 226 kDa, but the gene encoding it, ,MBOVPG45__0710 (MilA), which was identified by mass speetrometri analysis of tryptie peptides derived from it, was predicted to encode a 30 kDa protein, suggesting that MilA may be cleaved into 2 peptides, as is see with the ciliary adhesin of M hyopneumomae,
- Vsps variable surface proteins
- the Vsps may have diagnostic utility (Brank et al. (1999) Clin, diagn. 1Mb. Immunol. 6; 861-867), they are subject to phase variation and antigenic variation, which may result in variations in the antibody response against them in individual infected cattle and compromise the sensitivity of the assay Poumarat et al. (1999) supra; Buchenau et al (2010) Res. Vet. Set 59:223-229). Therefore, use of a protein such as Mil A that is not subject to phase or antigenic variation,, but is still highly immunoreactive, is proposed to result in a useful diagnostic tool.
- Geometri c mean of anti- bovis IgG titers
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Hematology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Urology & Nephrology (AREA)
- Pulmonology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Communicable Diseases (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Oncology (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Chemical & Material Sciences (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present specification teaches a serological test for Mycoplasma and the development of prophylactic and therapeutic compositions to treat ruminant subjects infected with or potentially exposed to Mycoplasma species.
Description
SEROLOGICAL TEST
FILING DATA
[0001] This application is associated with and claims priority from Australian Provisional Patent Application No. 2013903549, filed on 16 September 2013, entitled "A serological test" and Australian Provisional Patent Application No. 2014902094, filed on 2 June 2014, entitled "A serological test - II the entire contents of which, are incorporated herein by reference.
BACKGROUND FIELD
[0002] The present specification teaches a serological test for Mycoplasma and the development of prophylactic and therapeutic compositions to treat ruminant subjects infected with or potentially exposed to Mycoplasma species.
DESCRIPTION OF PRI OR ART
(0003] Bibliographic details of the publications referred to by author in this specification are collected alphabetically at the end of the description.
[0004] Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country,
[0005] Mycoplasma hovis i the most frequently isolated aetiological agent in naturally occuning outbreaks of bovine respiratory disease (BRD) in veal ealves (Gagea .ei al. (2006) J. Vet, Diagii. Invest 18:29-40; Arcangioli el at. (2008) Vet. J. 177:89-93), a
chronic disease characterized by pneumonia and arthritis. Mycoplasma bovis is also responsible for outbreaks of keratoconjunctivitis (A!berti et ai. (2006) J, Vet. Diagn,. Invest. /i?:41-51), mastitis (Hale et al. (1962) Cornell Vet, 52: 193-200), meningitis (Stipovits et al (1993) Acta Vet. Hung, J 73 ), otitis media (Walz e ai (1997) J. Vet. Diagn. invest 9:250-254) and genital tract disease (LaFaunee and McEntee (1982) Cornell Vet. 72: 160- 16?).
[0006] The significance of respirator).' tract infection with M, bovis has become increasingly apparent in recent years because of greater recognition of its role in pneumonia in many parts of the world (Nicholas et ai (2002) Vaccine 20:3569-3575), and due to its increasing resistance to antimicrobial drugs (Ayling et al. (2000) Vet. Rec. 146:745-747). In the absence of an effective vaccine or antimicrobial therapy, an alternative strategy to controlling M. bovis infection in cattle is to separate infected from uninfected cattle (Pfuetzner (1996) Rev. Set. Tech. Off. Int. Epiz. 15:1477). Currently M bovis diagnostic methods, including culture (Sachse et ai. (1993) Rev. Sci Tech. Off. Int. Epiz. 22:571-580), polymerase chain reaction assays (Gonzalez et al. (1995) Vet. Microbiol 7: 183-190; Ayling et ai (1997) Vet Ree. ,/ /:307-308) and antigen capture ELISAs (Heller et i (1993) Vet. Microbiol 37: 127-133; Ball et i. (1994b) IR Vet. J. 47:45), have not completely fulfilled the need for a rapid diagnostic test to detect infection, and there is a clear need for a sensitive and specific serological assay based on a species- specific immunologically reactive antigen,
[0007] Published genome sequences of several M bovis strains have contributed to the identification of novel antigenic proteins. These include strai Hubei-1 Li et ai (2011) PLoS ONE 0:e20999 and strain PG45 Wise et ai (201 1) Infect. Imrmm. 79:982-983. . Most effort thus far has been concentrated on identifying and characterising the variable surface proteins (Vsps) [Be rens et i ( 1.994) Infect, lmmun. 02:5075-5084; Poumarat et al FEMS Microbiol Lett. 775:103-110·]. Apart from the Vsps, only a few antigenic proteins of M. bovis have been identified and characterized, including Hsp60 and P48 (Scherm et al (2002) Vet. Microbiol #0: 1.41-150; Robino et ai (2005) Vet. Microbiol 109:201-209). However, these are not ideal antigens for immunodiagnosis, because of the
phase and antigenic variatio seen in Vsps, and the similarities between Hsp60 and P48 and their orthologs in the closely related species such as M. ag k tiae. Therefore, there remains a need to identify a better Mycoplasma antigen for serological diagnosis.
SUMMARY j'0008] An immunogenic protein is identified useful in the identification of Mycoplasm spp and in the development of prophylactic and therapeutic compositions to manage Mycopimma infection and exposure. The immunogenic protein is referred to herein as Mycopimma immunogenic lipase A (MilA). Reference to. "MilA" includes the MilA protein from Mycopimma bovis and homologs of MilA from othe Mycopimma spp as well as antibody-binding fragments of MilA. Region 1 of MilA is defined by the consensus sequence set forth i SEQ ID NOT, Examples of region 1 of MilA include MilA from M, bovis FG45 strain (type strain) [SEQ ID NG:2], and MilA homologs from M. bovis strain Hubei-1 (SEQ ID NQ:3), Mycoplasma agalacfia strain PG2 (SEQ ID NO: 4), Mycoplasma colimbin m strain SF7 (SEQ ID NO: 5). Mycoplasma fermantan strai JER (SEQ ID NO:6), Mycoplasma pulmonis (SEQ ID NO: 7) and Mycoplasma hyopneumomae (SEQ ID NO:S). Full length MilA is defined in SEQ ID 'NO: 5 (M hovis PG45), SEQ ID NO: 16 ( btnis Hubei-1 ), SEQ ID NO: 1.7 (M agalacPae PG2), SEQ ID NO: 18 (M columbima SF7), SEQ ED NO: 1.9 (M, fermantans 1E ), SEQ ID G:20 ( pulmonis) and SEQ ID \O.2 i (M. hyopn umoniae). The nucleotide sequence encoding MilA optimized for expression in E. coll is set forth in SEQ ID NO; 13. The genomic nucleotide sequence from M. bovis PG45 is set forth in SEQ ID NO: 14.
[0009] Enabled herein is a method for detecting current or prior exposur of a ruminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NOT after optimal alignment or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting tor the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
(OOlOj Further enabled is a method for detecting current or prior exposure of a
raminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 2 after optimal alignment or an antibody-binding fragment of the protein, for a time and under condi tions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibod wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
[0011 J Taught herein is a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment or an antibody- binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp,
[0012] The present specification teaches a device for screening for current or prior exposure of a. subject to a species of Mycoplasma, the device comprising a immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: I or an amino acid sequence having at least 40% similarity to SEQ ID NO: I after optimal alignment or an antibody-binding fragment of the protein, the device further comprising means to contact a sample f om the subject with the immobilized protein.
[0013] Enabled herei is a device for screening for current or prior exposure of a subject to a species of Mycoplasma, the device comprising an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid .sequence having at least 40% similarity to SEQ ID O:2 after optimal alignment or an antibody-binding fragment of the protein, the device further comprising
means to contact a sample from the subject with the immobilized protei .
(0014] Further enabled herein is a device for screening for current or prior exposure of a subject to a species of Mycoplasma, the device comprising an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment or an antibody-binding fragment of the protein, the device further comprising means to contact a sample from the subject with the immobilized protein.
[00.15] Taught herein is a method for controlling infection by a species of Mycoplasma in a ruminant subject, the method comprising administering to the subject an antibody- inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment for a time and under conditions sufficient to generate antibodies to said protein.
[001.6] Enabled herein is a method for controlling infection by a species of Mycoplasm or a condition caused or exacerbated by infection with Mycoplasma in a ruminant subject, the method comprising administering to the subject an antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino aci d sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein. Infection by Mycoplasma spp ca lead to bovine respiratory disease, keratoconjunctivits, mastitis, meningitis, otitis media, and genital tract disease.
[0017] Taught herein is a method for controlling infection by a species of Mycoplasma or a condition caused or exacerbated by infection with Mycoplasma in a ruminant subject, the method comprising administering to the subject a antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO.1 5 after optimal alignment for a time and under conditions sufficient to generate antibodies to the
protein. Infectio by Mycoplasma spp can lead to bovine respiratory disease, keratoconjunctivits, mastitis, meningitis, otitis media, and genital tract disease.
[0018] The present specification is instructional on a composition comprising a protein or derivative thereof campnsin the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents.
[0019 J Enabled herein is a composition comprising a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NG:2 or an amino acid sequence having at least 40% similarity to SEQ ID NQ:2 after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents,
[0020] Taught herein is a composition comprising a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment and one or more pharmaceutically acceptable carriers, excipients and/or diluents,
[0021] Enabled herein is the use of the above compositions in the manufacture of a medicament for the treatment or prophylaxis of Mycoplasma infection or a condition caused or exacerbated by Mycoplasma infection in a ruminant subject,
[0022] In an embodiment, the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs:2 through 8 or is an antibody-binding fragment thereof or comprises an amino acid sequence having at least 40% similarit to any one of SEQ ID N s.2 through 8 after optimal alignment.
[0023] In an embodiment, the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs: 15 through 21 or is an antibody-binding fragment thereof or comprises an amino acid sequence having at least 40% similarity to an one of
SEQ ID NOs: 15 through 21 after optimal alignment,
(0024] Enabled herein is the method wherein the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or is an antibody-binding fragment thereof.
[0025] Enabled herein is the method wherein the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 through 21 or is an antibody-binding fragment thereof.
[0026] In an embodiment, the ruminant animal is selected from the list consisting of cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod. lit an embodiment, the Mycoplasm is Mycoplasma bmis and the ruminant animal is a cow.
[0027] Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO). The SEQ ID NOs correspond numerically to the sequence identifiers <400> 1 (SEQ ID NO:l), <400>2 (SEQ ID NO: 2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided after the claims.
[0028] A summary of sequence identifiers used throughout the subject specification is provided in Table 1.
Table 1
|0029| A list of abbreviations used throughout the subject specification are provided i n
Table 2.
Table 2
Abbreviations
BRIEF DESCRIPTION OF THE FIGURES
|0030] Figure 1 is a diagrammatical representation of a 6 kbp region of MBQVPG45J 10 (Mil A) gene cloned as two 3 kbp fragments, AB and CD, and subcloned as four 1 ,5 kbp DNA fragments, A, B, C and D, with the expressed gene sequences bounded by restriction endonuclease cleavage sites. In addition, two 2 kb DNA fragments were amplified using primers containing appropriate restriction endonuclease cleavage sites: abF-ifcwwHI, CAACggatccATCAAAGACGTGA (binding site, 144 - 166) [SEQ ID NO:9]; abF SM, TTCgtcgacGGATTTCGCCT (3931 - 1950) [SEQ 3D NO: 10]; cdF- B m, CACTGggatccATCTCGAACATC (3128 - 3150) [SEQ ID 'NO: 11]; and cdR- Sal'L, ACAgtcgacCCAGGTTCG (4955 - 4872) [SEQ ID NO: 12].
[0031] Figure 2 is a ph.otographi.cal representation of Western blots of whole cell proteins of bovis strain 3683 probed with sera from 6 calve (A-F) collected on: 1, day 0; 2, day 24. Uninfected, calves inoculated with Mycoplasma culture medium; Infected, calves inoculated with M hovis strain 3683; Arrow, protein of interest seen in strip 2 in infected calves,
[0032] Figure 3 is a photographical representation of SDS-P GE and Western blot of Mil A (226 kDa). Lanes: 1, Spectra (Trade Mark) Multicolor high range protein ladder (Fermentas); 2, whole cell proteins of M. hovis strain 3683 stained with Coomassie blue; 3, whole cell proteins of M agaiactkie strain PG2 stained with Coomassie blue; 4, Western blot of whole cell proteins of M bovis strain 3683 probed with M fows-specific calf sera; 5, Western blot of whole cell proteins of , agaiactkie strain PG2 probed with . bovis- specific calf sera,
[0033] Figures 4(i) and (ii) are photographical representations showing expression of recombinant proteins in E. coli JM 109 cells, (i) Whole cell proteins of induced clones separated in a 12% w/v polyacryl mide gel stained with Coomassie blue, (ii ) transferred to a PVDF membrane and probed with pooled M, Λον ,ν-specific bovine sera. Lanes: 1 , PageRuler prestained protein ladder (Thermo Scientific); 2, pGEX-4T-l-w? /4-AB induced
(125.5 kDa); 3, pGEX-4T- 1 -milA-CD induced (127 kDa); 4, pGEX-4T-S -w M-A induced (72.8 kDa); 5, pGEX~4 - l-/«/M-B induced (69 kDa); 6, pGEX-4T-i -miW-C induced (71.9 kDa); 7, pGEX-4T-l-/»/M-D induced (73,3 kDa); 8, pGEX-4T-l -/?/i/ -cd induced (94,3 kDa); 9, pGEX-4T-l -w?I4-ab induced (92.9 kDa).
[0034] Figure 5 is a diagrammatical representation showing physical map of genes in the region surrounding MBOVPG45_07I0 (mi LA). The predicted size of the gene product is shown as the number of amino acids (aa). LP, lipoprotein; rpoB, DNA-directed RNA polymerase subrjnit beta; rpoC, DNA-directed RNA polymerase subunit beta; BQVPG45_0710 (mi/A), membrane protein; HP, hypothetical protein; ISMbov 7, transposase truncated protein; ISMbov 6, M42 family glutamyl aminopeptidase.
[0035] Figure 6 is a diagrammatical representation showing multiple sequence alignment of region 1 of mycoplasma immunogenic lipase (MtlA) with bomo!ogs in other mycoplasmas and the mycoplasma GDSL carboxyesterases,
|0036] Numbers on the right indicate the position of the adjacent amino acid. Identical amino acids are shaded black. Grey shading indicates at least one substitution with a very similar amino acid. Light grey shading indicates at least one substitution with a similar amino acid. Dashed lines indicate gaps in the amino acid sequence alignment, GDSL-like lipase conserved sequence blocks are underlined. Asterisks (*) indicate the active site residues and the arrowheads indicate the conserved amino acids of the SGNH_hydrolase family. The sequences included in the alignment are: MBOVPG45J5710 (MilA), M bovis strain PG45; MMBJ)654, M bovis strain Hubei-1;. MAGa6830, M. agahcti PG2; MCSF?J)I871 , M coiwnbinum SF7; MFE 0257Q, Al firm M ms JER; MYPU3130, pulmonis: and mhp677, hyopnetimomae.
[00371 Figure 7 is a graphical representation showing release of resorufm by the lipase activity of GST-MilA-ab and GST-p65 over 30 min, with GST as the negative control.
[0038] Figures 8(i) and (ii) are graphical representations showing Logio IgG antibody titers of individual calves on day (i) 1.7 and (ii) day 24 after infection in. Experiment 1. The bar indicates the mea of each group.
[0039] Figures 9(i) and (it) are graphical representations showing Logio IgG antibody titers of individual calves on (i) day 17 and (ii) day 24 after infection in Experiment 2, The bar indi cates the mean of each group.
[0040] Figure 10 is a graphical representation of mea Λ/. bovis- specific IgM antibody titers of each group in Experiment 3. Bars indicate standard deviation,
[0041] Figure 11 is a graphical representation of mean M. ovis- specific IgM antibody titers of each group in Experiment 3. Bars indicate standard deviation,
[0042] Figure 12 is a schematic diagram of the piasmid vector pGEX-4T-l (reproduced from the GE Healthcare pGEX vector map).
[0043] Figure 13 is a representation of physical maps of mycoplasma hpmologues of MBOVPG45_710 (milA) and adjacent genes. Homologous proteins are shaded the same colour. Numbers above the genes indicate the length of the predicted product in amin acids. MBOVPG45 710 (milA), membrane protein; MMB_0654, conserved hypothetical transmembrane protein* MAGa6830, conserved hypothetical protein; MAG_6100, conserved hypothetical protein; MMB__03 I 8, conserved hypothetical protein; MFE_02570 MfeM64YM„0307, lipase/hypothetical protein; MCSF7_ l8'71): lipase; HP, hypothetical protein; LP, lipoprotein; AP, aminopeptidase; rpoB, DNA-directed RNA polymerase subunit beta; rpoC, DNA-directed RN polymerase subumt beta; ceiMl, endo-l,4-beta-glucanase; ί ρΑ, DMA topoisomerase; vvrAt uvrABC system protei A; vpmaYl, variable surface lipoprotein Y; LicA, lichenan-specifie ΠΑ component.
[0044] Figure 14 is a graphical representation of M. fev/ -specific IgG ELISA results for sera from feedlot cattle.
DETAILED DESCRIPTION
|0045] Throughout this specification, unless the context requires otherwise, the word "comprise" or variations such as "comprises" or "composing", will be understood to imply the inclusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any element or integer or method step or group of elements or integers or method steps.
[0046] As used in the subject specification, tire singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a Mycoplasma " includes a singie Mycoplasma cell, as well as two or more Mycoplasmas cells; reference to "an antibody" includes a single antibody, as well as two or more antibodies, reference to "the disclosure" includes a single reference to "the disclosure" includes a single and multiple aspects taught by the disclosure; and so forth. Aspects taught and enabled herein are encompassed by the term "invention". All such aspects are enabled within the width of the present invention.
[0047] In an embodiment, the instant specification enables an isolated protein or an antibody-binding fragment thereof comprising an amino acid sequence set forth i n SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: ! after optimal alignment.
[0048] Reference to "at least 40%" means 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55? 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, .89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100% similarity to a recited sequence identifier.
[0049] In an embodiment, the protein or a derivative thereof is from Mycoplasma hovis type strain PG45 and comprises the amino acid sequence as set forth in SEQ ID NO;2 or an. amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment.
[0050] In an embodiment, the protein or a derivative thereof is from Mycoplasma /> i v.v type strain PG45 and comprises the amino acid sequence as set forth in SEQ ID NO; 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment.
(0051] In an embodiment, the protei or a derivative thereof is from Mycoplasma bovis strain Hubei-1 and comprises amino acid sequence as set forth in SEQ ID NO: or an amino acid sequence having at least 40% similarity to SEQ ID NO; 3 after optimal alignment,
[0052] In an embodiment, the protein or a derivative thereof is from Mycoplasma agalactia strain PG2 and comprises amino acid sequence as set forth in SEQ ID NQ;4 or an amino acid sequence having at least 40% similarity to SEQ ID NO:4 after optimal alignment,
[0053] In an embodiment, the protein or a derivative thereof is from Mycoplasma columbinium strain SF7 and comprises amino acid sequence as set forth in SEQ ID NO; 5 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 5 after optimal alignment,
[0054] In an embodiment, the protein or a derivative thereof is from Mycoplasma fermanta strain JER and comprises amino acid sequence as set forth in SEQ ID NO: 6 or an amino acid sequence having at least 40% similarity to SEQ ID NO:6 after optimal alignment,
[0055] In an embodiment, the protein or a derivative thereof is from Mycoplasma pulmonis and comprises amino acid sequence as set forth in SEQ ID 'NO: 7 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 7 after optimal alignment,
[0056] In an embodiment, the protein or a derivative thereof is from Mycoplasma
hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO:8 or an amino acid sequence having at least 40% similarity to SEQ ID NO:8 after optimal alignment.
[0057] In an embodiment, the protein or a derivative thereof is from Mycophsm hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 16 or an. amino acid sequence having at least 40% similarity to SEQ ID NO: 16 after optimal alignment.
[0058] In an embodiment, the protei or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 1 7 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 17 after optimal alignment.
[0059] I an embodiment, the protein or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO: 18 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 18 after optimal alignment.
[0060] In an embodiment, the protein or a derivative thereof is from Mycoplasma hyopneumwii e and comprises amino acid sequence as set forth in SEQ ID NO: 19 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 19 after optimal alignment,
[006J] In an embodiment, the protein or a derivative thereof is from Mycoplasm hyopneimtonia and comprises amino acid sequence as set forth in SEQ ID NO: 20 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 20 after optimal alignment,
[0062] In an embodiment, the protein or a derivative thereof is from Mycoplasma hyopneumomae and comprises amino acid sequence as set forth in SEQ ID NO:21 or an
amino acid sequence having at least 40% similarity to SEQ ID NG:21 afte optimal alignment
[0063] The present specification teaches an isolated protein comprising an amino acid sequence selected from the list consisting of SEQ ID NOs: l throug 8 or 15 through 21.
(0064] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO; I .
[0065] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID Q:2.
[0066] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO :3.
[0067] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO :4.
[0068] Enabled herein is an isolated protei comprising an amino acid sequence set forth in SEQ ID NO: 5.
[0069] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO :6.
(0070] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO:7.
[0071] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO:8.
[0072] Enabled herein is an isolated protein comprising an amino acid sequence set
forth in SEQ ID NO: 15.
(0073] Enabled herei is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO: 16,
[0074] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO: 1.7.
[0075] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO: 18,
[0076] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO: 1 ,
[0077] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO:20.
[0078] Enabled herein is an isolated protein comprising an amino acid sequence set forth in SEQ ID NO:21.
[0079] The present specification teaches the use of a protein or a derivative thereof having the amino acid sequence set forth in SEQ ID NQs: 1 through 8 or 15 through 21 or an amino acid sequence with at least 40% similarity to any of SEQ ID Os: 1 through 8 or 15 through 21 in the manufacture of a diagnostic agent to screen for current or prior exposure of a subject to a species of Mycoplasma. The protein or derivative may also be used to screen for potential bovine respiratory disease, keratoconjunctivitis, mastitis, meningitis, otitis media and genital tract disease.
[0080] Hence, the present specification contemplates a method fo detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting a antibody containing sample from the subject with an immobilized protein or
derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO: l after optimal alignment or an antibody -binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
[0081] The present specification further enables a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacti g an antibody containing sample from the subject -with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is i dicative of current or prior exposure to Mycopktsma Spp.
[0082] The present specification further enables a method for detecting current or prior exposure of a ruminant subject to a species of Mycoplasma, the method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in. SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO:- 15 after optimal- alignment .or an antibody-binding fragment of the protein, for a time and under conditions sufficient for an antibody specific for the protein, if present in the sample, to bind to the protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp,
[00831 I a embodiment, the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs2: through 8 or 15 through 21 or is an antibody- binding fragment thereof.
[00841 In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:2 of an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optima! alignment or is an antibody-binding fragment thereof.
[0085] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 or an amino acid sequence having at. least 40% similarity to SEQ ID NO: 15 after optimal alignment or is an antibody-binding fragment thereof.
[0086] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 2 or is an antibody-binding fragment thereof.
[0087] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 oris an antibody -binding fragment thereof
[0088] I an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO; 16 through 21 or is an: antibody-binding fragment thereof.
[0089] Reference to a "ruminant subject" includes a cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod.
[0090] In an embodiment, the species of Mycoplasma is M. bovis and the ruminant subject is a cow.
[009!] A "derivative" of the protein includes a fragment of the protein such as antibody-binding fragment. Fragments include MilA-AB, MilA-CD, Mil A- A, MilA-B, MilA-C, MilA-D; ilA-cd and MilA-ab. A "derivative" also includes a protein having a single or multiple amino acid substitution, deletio and/or addition to SEQ ID NO: 1 or any one of SEQ ID NOs:2 through 8 or SEQ ID NOs; l5 through 21. A ''derivative'' further includes the incorporation of an unnatural amino acid or chemical alteration of an amino acid side chain.
[0092] Examples of side chain modifications contemplated herein include modifications of amino groups such as by reductive aikylation by reaction with an aldehyde followed by reduction with NaBH4; amidination with metliylacetimidate; acy!ation. with acetic anhydride; carbamoylation of amino groups with cyanate; tnnitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene suiphonic acid (TNBS); acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; and pyri doxy! ati on of lysine with pyridoxal-5-phosphate fol lowed by reduction with NaBHU.
[0093] The guanidine group of arginine residues may be modified by the formation of heterocyclic condensation products with reagents such as :2s3-butariedione, phenylglyoxal and glyoxal.
[0094] The carboxyl group may be modified by carbodiimide activation via O- acylisourea formation followed by subsequent derivitization, for example, to a corresponding amide,
[0095] Sulphydryl groups may be modified by methods such as carboxymethylation with iodoacetic acid or iodoacetamide; performic acid oxidation to cysteie acid; formation of a mixed disulphides with other thiol compounds; reaction with nialeimide, maleic anhydride or other substituted maleimide; formation of mercurial derivatives using 4- chloromercuribenzoate, 4-chloromercuripheriylsulphonic acid, phenylmercury chloride, 2- chloromercuri-4-nitrophenol and other mercurials; carbamoylation with cyanate at alkaline pH.
(0096] Tryptophan residues may be modified by, for example, oxidation with N- bromosuecmimide or aikylatio of the indole ring with 2-hydroxy-5-nitrohenzyl bromide or sulphonyl halides. Tyrosine residues on the other hand, may be altered by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
[0097] Modification of the imidazole ring of a histidine residue may be accomplished by aikylation with iodoacetic acid derivatives or N-carbethoxylation with
diethylpyrocarbonate.
(0098] Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include., but are not limited to, use of norleucine, 4-amino butyric acid, 4- amino-3-hydroxy-5-phenylpenianoie acid, 6-aminohexanoic acid, t-butylglycine, norvaline, phenylglyciiie, ornithine, sarcosine, 4-aniino-3-hydroxy-6-methylheptanoic acid, 2-t enyl alanine and/or D-isomers of amino acids, A list of unnatural amino acids, contemplated herein is shown in Table 3.
Table 3
Codes for non-conventional amino acids
Non-conventional Code Non- conventional Code amino acid amino acid a-amraobutyric acid Abu L-N-methylalamrte Nmala a-amino-(¾-methylbutyrate Mgabu L-N-methylarginine Nmarg aminocyclopropane- Cpro L-N-methylasparagine Nmasn carboxylate L-N- ethyiaspartic acid Nmasp aminoisobutyric acid Aib L- -m ethylcystein e Nmcys ammonorbomyl- Norb L-N-m ethyl gl.utami.ne Nmgln carboxylate L-N-meth f glutami c acid Nmglu e e 1 ohexyl alanine Chexa L-Nmeth ylhi sti dine Nmhis eyclopentylal anine Cpe L-N-methyiisoileucine Nmile
D-alanine Dal L-N-methylleucine Nmleu
D-arginme Darg L-N-methyllysine Nmlys
D-aspartic acid Dasp L-N~methy!methi onme Nmmef
D-cysteine Dcys L-N-methylnorl eucine Nmnle
D-giutamine Dgln L-N-methylnorvaliiie Nmnva
D-glutaraic acid Dglu L-N-methylorni thine Nraora
D-histidine Dhis L-N-methylphetiylaianin Nmphe
D-isoleucine Dile L-N-methylproIine Nmpro
D4eucine Dleu L-N~methyl serine Nmser
D4ysine Dlys L-N-methy 1 threonine Nmthr
D-methionine Dmet L-N-m eth ltryptoph an Nmtrp
D-omithine Dom L-N-methyltyrosine Nmtyr
D-phenyl alanine Dphe L-N-methyrvaline Nmval
D-proline Dpro L-N-methyiethylglycine Nmetg
D-serine Dser L-N-methy i-t-butylglyci ne Nmtbug
D-threonine Dthr L-norleucin Nle
D-tryptophan Dtrp L-norvaline Nva
D-lyrosine Dtyr -methyl-aminoisobuiyrate Maib
D-valine Dval Gt-meth yl -γ- ami nobuty rate Mgabu
D-oc-methy 1 alani ne Dmala a-methylcydohexylalanine Mchexa
D-a-m ethylargi ni ne Dmarg -methy 1 ey 1 copen tyl al ani n e Mcpen
D-a-meth yl asparagi ne Dmasn oc-meth yl -ec- napthyl alani n e Manap
D- -methyi aspartate Dmasp a-methylpenictilamine Mpen
D- -methylcysteme Dmcys N-(4-aminobutyi)glycme Ngl
D-a-methylglutamme Dmgln N-(2-ami noethyl)glyci ne Naeg
D-a-methyi hi stidi n e Dmhis N-(3 -ami nopropyl)giy cine Norn
D- -methy li soleuei n e Draiie N-ami no- -methy i b uty rate Nmaabu
D-a-methylleucine Dm leu a-napthy] alanine Anap
Non-conventional Code Non-conventional Code amino acid amino acid
D-a-methyl lysine Dmlys N-benzylglyeine Nphe
D-a-m ethyl methi on i n e Dmmet N-(2-carbamyl ethyl )glycine Ngln
D-a-methyl orni thi ne Dmom N-(carbamylmethyl)glycine Nasn
D-a-methylphenylalanine Dmphe N-(2-carboxyethyl)glycine Ngln
D-a-m ethyl proli ne Dmpro N~(carboxym ethyl )g! y cine Nasp
D-a-methyl serine Dmser N-cyclobutylgiycine Ncbut
D-a-methylthreoni ne Dmthr N-c el oheptyl gl y cine Nchep
D-a-m ethy ltryptop han Drntrp N-cycl ohexyl gl y cin e Nchex
D-a-methyl tyro sine Dmty N-cyclodecyiglycine Ncdec
D-a-meihylvaline Dmval N-cylcododecylglycine Ncdod.
D-N-methylalamne Dnmala N-eyclooctyigiycme Ncoct
D-N-methyl argi ni ne Dnmarg N-cyclopropyigiycine Ncpro
D- -m ethylasparagi ne Dnmasn N-cycloundecylglycme Ncund
D-N-methylaspartate Dnmasp N-(2, 2-dipheny 1 ethyl )g! y cine Nbhm
D-N-methyleysteine Dnmcys N-(3 , 3 -diphenylpropyl)gly cine Nbhe
D-N-methylglutamine Dnmgln N-(3-guanidinopropyl)glycine Narg
D-N -methyl glutara ate Dnmglu N-( 3 -h droxy eth yl )gl ycine Nthr
D-N-m ethyl histi di ne Dnmhis N-f hydroxy ethyl ))glyci ne Nser
D-N-m eth 1 i soleucine Dnmile N-(imi dazol y 1 ethy! »gi cine Nhis
D-N-methy lleuci ne Dnmleu N-(3 - i ndol yl y ethyl )gl ci ne Nhtrp
D-N-methyl lysine Dnmiys N-methyl-y-aminobutyrate Nmgabu
N-methylcyelohexyialanme Nmehexa D -N-meth y 1 m et hi oni ne Dnmmet
D-N-methylorni thine Dnmorn N-methy!cyclopenty! alanine Nmcpen
N-methylglycine Nala D-N-methylphenylal anine Dnmphe
N-methyiaminoisobutyrate Nmaib D-N-methyl prol i ne Dmnpro
N-( l- ethylpropyi)glycine Nile D-N-methyl serine Dnrnser
N-(2-niethylpiOpyl)glyeine Meu D-N-methyl threoni ne Dnmthr
D-N-methyl tryptophan Dnmtrp N-(i -methylethyl)glycme Nval
D-N-methyl tyrosine Dnmtyr N-m ethyl a-na pthylal anine Nmanap
D-N-methylvaline Dnmval N-methyipeniciilamine Nmpen γ-aminobutyric acid Gabu N- p-hy droxyphen yl )glycine Nhtyr
L-/-butylglycine Tbug N-(thiomethyl )gl ycine Ncys
L-ethyl glycine Etg penicillamine Pen
L-homophen lal anine Hphe L-a-methy 1 al anine Mala
L-a-methylarginine Marg L- -methyla sp ai'agi ne Masn
L-a-methylaspartate Masp L-a-methyi -/-butylglycine Mtbug
L-a-methylcysteine Mcys L-methylethyl glycine Metg
L-a-methylglutamine Mgln L- -methylgl u tamate Mglu
L-a-methylhi sti dine Mhis L-a-m eth l homophen ylal anin e Mhphe
L-a-methyli soleucine Mile N-(2-methylthioethyl)glycme Nmet
Non-conventional Code Non-conventional Code amino acid amino acid
L- -methylleucine Mleu L-a-methylly-sine Mlys
L-a-methylm ethi onine Mmet L-a-methylnorleucine Mnle
L~a~methy]norvaline Mnva L-a-methylomithine Morn
L-a-methylphenylalanine Mphe L-a-methyl proline Mpro
L- -methylseri n e Mser L-a-m ethyl .threoni ne Mthr
L-a-methyltryptaphan Mtrp L-a-methyltyrosine Mtyr
L-a-methyly al ί ne Mval L-N-methyihoinophenylaianine Nmhplie
N-(N-(2,2-diphenylethyl) Nnbhm N-(N-(3,3-diphenylpropyl) Nnbhe carbamylmethyl)glycine carbamylmethyl)g1ycine
1 -carfooxy- 1 -(2,2-di phenyl - Nmbc
et hylammo)cy el opropan e
(0099] Crosslinkers can be used, for example, to stabilize 3D conformations, using honio-bifunctional crosslinkers such as the bifunctional imido esters having CH2)n spacer groups with n = 1 to n = 6, giutaraidehyde, N-hydroxys ccinimide esters and hetero- bifunctional reagents which usually contain an ammo-reactive moiety such as N- hydroxysuccininiide and another group specific-reactive moiety such as maleimido or dithio moiety (SH) or carbodiimide (CQOH). In addition, peptides can be Gonformationally constrained by, for example, incorporation of Ce and N «-m ethyl amino acids, introduction of double bonds between Ca and C atoms of amino acids and the formation of cyclic peptides or analogs by introducing covalent bonds such as forming an amide bond between the N and C termini, between two side chains or between a side chain and the or C terminus.
[0100] Any immunoassay may be used to target the MilA protein or its antibody- binding fragment or its derivative form. Immunoassays are in effect binding assays. Examples of immunoassays include the various types of enzyme linked immunosorbent assays (ELS A), radioimmunoassays (RIA), Western blotting, dot blotting and FACS analyses. jOlOJ J In an. embodiment, an. EL-ISA is carried out using immobilized MilA protein.
its honiolog, its derivative or an antibody-binding fragment (herein referred to as he "antigen"). In an embodiment, is immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate,
[0102] A sample putatively comprising antibodies to the naturally occurring Mil A protein is then added to the well s. After binding and washing to remove n on -specifically bound immune complexes, the antibody bound complex may be detected. Detection is generally achieved by the addition of a second antibody that is known to bind to the antibody and is linked to a detectable label. This type of ELISA is a simple "sandwich ELISA". Detection may also be achieved by the addition of the second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.
[0103] In an embodiment, the antibody-anti en complex is detected by a labeled antiimmunoglobulin antibody having an enzyme, chemiiuminescence, radioisotope, impedance or optical signal generating moiety attached thereto. In an embodiment, the anti -immunoglobulin activity is an an ti-IgG antibody.
[0104] The present specification further enables antibodies to Mil A or its homolog or derivative. The antibodies may be monoclonal or polyclonal antibodies. The antibodies are useful for screening for MilA protein or its homolo or derivative and for purifying or capturing MIA protein or its homolog or derivative.
['01 OS I By "antibody" is meant a protein of the immunoglobulin family that is capable of combining, interacting or otherwise associating with an antigen (i.e. Mil protein or its homolog or derivative). An antibody is, therefore, an antigen-binding molecule. An "antibody" is an example of a immunointeractive molecule and includes a polyclonal or monoclonal antibody. Particularly useful immunointeractive molecules are monoclonal antibodies.
[0106] The term "antigen" is used herein in its broadest sense to refer to a MilA
substance, or its honralogs or derivatives that are capable of reacting in and/or inducing an immune response.
[0107] By "antigen-binding molecule" is meant any molecule that has binding affinity for a target antigen. It will be understood that this term extends to immunoglobulins (e.g. polyclonal or monoclonal antibodies), immunoglobulin fragments and non- immufioglohulin derived protein frameworks that exhibit antigen-binding activity,
[0108] By "antigenic determinant" or "epitope" is meant that part of an antigenic molecule against which a particular immune response is directed and includes an antibody-binding fragment of a MilA antibody. Typically, in an animal, antigens present several or even many antigenic determinants simultaneously.
[010 1 Antibodies described herein may be from any source. Examples of animal and avian sources and hosts include humans, primates, livestock animals (e.g. sheep, cows, horses, pigs, donkeys), laboratory test animals (e.g. mice, rabbits, guinea pigs, hamsters), companion animals (e.g. dogs, cats), poultry bird (e.g. chickens, ducks, geese, turkeys) and game birds (e.g. pheasants),
[0110] Immunization and subsequent production of monoclonal antibodies can be carried out using standard protocols as for example described by Kohler and Milstein (Kohler et ai (1975), Nature 256:495-499 and Kohler et at (1976), Eur. J. Immunol 6(7):5 11-519, Coligan et al. (19 1 -1997) Current Protocols in Immunology, or Toyama et ai. (1987), Monockma! Antibody, Experiment Manual, published by Kodansha Scientific. Essentially, an animal is immunized with an antigen-containing (i.e. MilA or a fragment or homolog thereof) by standard methods to produce antibody-producing cells, particularly antibody-producing somatic cells (e.g. B lymphocytes). These cells can then be removed from the immunized animal for immortalization. The antigen may need to first be associated with a carrier.
[0111] By "carrier" is meant any substance of typically high molecular weight to
which a non- or poorly immunogenic substance (e.g. a hapten) Is naturally or artificially linked to enhance its immunogenicity.
[0112] Immortalization of antibody-producing cells may be carried out using methods, which are well-known in the art. For example, the immortalization may be achieved by the transfbrmation method using Epstein-Barr virus (EB V) (Kozbor et al (1986), Methods in EnzymoJogy 727: 140). In an embodiment, antibody-producing cells are immortalized using the cell fusion method (described in [Coligan et al. {"1991-1997) supra]), which is widely employed tor the production of monoclonal antibodies. In this method, somatic antibody- producing cells with the potential to produce antibodies, particularly B cells, are fused with a myeloma cell line. These somatic cells may be derived from the lymph nodes, spleens and peripheral blood of primed animals, preferably rodent animals such as mice and rats. In an embodiment murine spleen cells are used. It would be possible, however, to use rat, rabbit, sheep or goat cells, or cells from other animal species instead.
[0113] Specialized myeloma cell lines have been developed from lymphocytic tumours for use in hybridom.a-produc.ing fusion procedures (Kohier et al (1 76) mpra, Kozbor et al #986) supra, and Volk et al (1982) J. Virol 42( I) ;220-227), These cell lines have been developed for at least three reasons. The first is to facilitate the selectio of fused hybridomas from unfused and similarly indefinitel self-propagating myeloma cells. Usually, this is accomplished b using myelomas with enzyme deficiencies that render them incapable of growing in certain selective media that support the growth of hybridomas. The second reaso ari ses from the inherent ability of lymphocytic tumor cells to produce their own antibodies. To eliminate the production of tumor cell antibodies by the hybridomas, myeloma cell lines incapable of producing endogenous light or heavy immunoglobulin chains are used. A third reason for selection of these cell lines is for their suitability and efficiency for fusion.
[0114] Many myeloma cell lines may be used for the production of fused cell hybrids, including, e.g. P3X63-Ag8, P3X63-AG8.653, P3/NSl-Ag4-l (NS-1), Sp2/0-Agl4 and S 1 4/5.XXO.BU. 1. The P3X63-Ag8 and NS-i cell lines have been described by Kohier
and Milstein (Kohler et al. 1976 supra). Shuiman et al. (1978), Nature 276:269-270, developed the Sp2/Q-Agl4 myeloma line. The Sl 4/5.XXO.Bu.1 line was reported by Trowbridge (1982), J. Exp. Pied 148(1):22Q-2X1.
[0115] Methods for generating hybrids of antibody-producing splee or lymph node cells and m eloma cells usually involve mixing somatic cells with myeloma cells in a 10: ! proportion (although the proportion may vary from about 20: 1 to about 1 : 1), respectively, in the presence of an agent or agents (chemical, viral or electrical) that promotes the fusion of cell membranes. Fusion methods have been described ( ohler et al. (1975) supra, Kohler et al. (.1.976) supra, Gefter e i al. (1977), Somatic Cell Genet £.231.-236 and Volk et al. (1982) supra). The fusion-promoting agents used by those investigators were Sendai virus and polyethylene glycol (PEG).
[0116] Because fusion procedures produce viable hybrids at very low frequency (e.g. when spleens are used as a source of somatic cells, only one hybrid is obtained for roughly every 1x10" spleen cells), it is preferable to have a means of selecting the fused cell hybrids from the remaining unfused cells, particularly the unfused myeloma cells. A means of detecting the desired antibody-producing hybridomas among other resulting fused cell hybrids is also necessary. Generally, the selection of fused cell hybrids is accomplished by culturiiig the cell s in media that support the growth of hybridomas but prevent the growth of the unfused myeloma cells, which normally would go on dividing indefinitely. The- somatic cells used in the fusion do not maintain long-term viability in in vitro culture and hence do not pose a problem. In the example of the present invention, myeloma cells lacking hvpoxanthine phosphoribosyl transferase (HPRT -negative) were used. Selection against these cells is made in hypoxanthine/aminopterin/thymidine (HAT) medium, a medium in which the fused cell hybrids survive due to the HPRT-positive genotype of the spleen cells. The use of myeloma cells with different genetic deficiencies (drug sensitivities, etc) that can be selected against in media supporting the growth of genotypically competent hybrids is also possible.
[0117] Several weeks are required to selectively culture the fused cell hybrids. Early
in this time period, it is necessar to identify those hybrids which produce the desired antibody, so that they may subsequently be cloned and propagated. Generally, around 10% of the hybrids obtained produce the desi red antibody, although a range of from about 1 to about 30% is not uncommon. The detection of antibody-producing hybrids can be achieved by an one of several standard assay methods, including enzyme-linked immunoassay and radioimmunoassay techniques as, for example, described in US Patent No. 6,056,957.
[0118] Once the desired fused cell hybrids have been selected and cloned into individual antibody -producing cell lines, each cell line may be propagated in either of two standard ways. A suspension of the ybridoraa cells can be injected into a histocompatible animal. The injected animal will then develop tumors that secrete th specific monoclonal antibody produced b tire fused cell hybrid. The body fluids of the animal, such as serum or ascites fluid, can be tapped to provide monoclonal antibodies in high concentration. Alternatively, the individual cell lines may be propagated in vitro in laboratory culture vessels. The culture medium containing high concentrations of a single specific monoclonal antibody can be harvested, by decantatioii, filtration or eentrifugation, and subsequently purified.
[0119] The cell lines are tested for their specificity to detect the antigen of interest by any suitable immunodetection means. For example, cell lines can be aliquoted into a number of wells and incubated and the supernatant from each well is analyzed by enzyme- linked immunosorbent assay (ELISA), indirect fluorescent antibody technique, or the like. The cell iine(s) producing a monoclonal antibody capable of recognizing the target antigen but which does not recognize non-target epitopes are identified and then directly cultured in vitro or injected into a histocompatible animal to form tumors and to produce, collect and purify tire required antibodies.
[0120] The present specification is further directed to a compositio comprising a protein comprising an amino acid sequence set forth in SEQ ID NO: 1 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO: 1. in the manufacture of a medicament for the treatment or prophylaxis of infection by Mycoplasma
species.
(0121] Also enabled herein is a composition comprising a protein comprising an amino acid sequence set forth in SEQ 3D NQ:2 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO:2 in the manufacture of a medicament for the treatment or prophylaxis of infection by Mycoplasma species.
[0122] Also enabled herein is a composition comprising a protein comprising an amino acid sequence set forth in SEQ ID NO: 15 or a derivative thereof or a protein having at lest 40% sequence similarity to SEQ ID NO: 15 in the manufacture of a medicament for the treatment or prophylaxis of infection by Kfycapl sm species,
[0123] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO:2 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[01 4] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein,
[01 5] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 3 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0126] In an embodiment, the■ protein comprises the amino acid sequence set forth by SEQ ID NO:4 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0127] In a embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 5 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
- 5J -
[0128] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO:6 or an amnio acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0129] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NQ:7 or an amine- acid sequence having at least 40% similarity thereto or is a derivati ve of the protein.
[0130] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 8 or an amino acid sequence having at least 40% similarity thereto or is a deri ative of the protein.
[0131] In an embodiment, the protein compri ses the amino acid sequence set forth by SEQ ID NO: 16 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0132] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 17 or a amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0133] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 18 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein,
[0134] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO: 19 or a amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
[0135] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO:20 or an amino acid sequence having at least 40% similarity thereto or is a
derivative of the protein.
(0136] In an embodiment, the protein comprises the amino acid sequence set forth by SEQ ID NO:21 or an amino acid sequence having at least 40% similarity thereto or is a derivative of the protein.
(0137] Generally, the protein is formulated, with a pharmaceutical carrier, excipient or diluent, which is non toxic to a ruminant subject,
[0138] The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral (including intravenous). In preparing the compositions for oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols, flavouring agents, preservatives, coloring agents and the like in the case of oral liquid preparations, such as, for example, suspensions, elixirs and solutions; or carriers such as starches,, sugars, microcrystalMne cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations such as, for example, powders, capsules and tablets, with the solid oral preparations being preferred over the liquid preparations. Because of their ease of administration, tablets and capsules represent the most advantageous oral dosage unit form in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be coated by standard aqueous or nonaqueous techniques.
[0139] Compositions disclosed herein suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient, as a powder or granules or as a solution or a suspension i an aqueous liquid, a non-aqueous liquid, an oil-in- water emulsio or a water-in-oi I liquid emulsion. Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with
liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation. For example, a tablet may be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
[0140] The components and/or extracts enabled herein may be administered orally, parenterally (including subcutaneous injections, intravenous, intramuscular, intrasternal injection or infusion techniques), by inhalation spray, or reetally, in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, excipient and diluents. The composition may also further comprise an adjuvant.
[01 J] When administered by nasal aerosol or inhalation, these compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art.
[0142] The protein may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. When administered by injection, the injectable solutions or suspensions may be tonnulated according to known art, using suitable non-toxic, parenteraily-acceptable diluents or solvents, such as mannitol, 1 ,3-butanediol, water. Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
[0.143] When rectally administered in the form of suppositories, these compositions may be prepared by mixing the protein with a suitable non-irritating exctptent, such as cocoa butter, synthetic glycexide esters or polyethylene glycols, which are solid at ordinary temperatures, but liquefy and/or dissolve in the rectal cavity to release the protein.
[0144] The effective dosage of the protein employed in therapy may vary depending on the particular compound employed, the mode of administration, the conditio being treated and the severity of the condition being treated. Thus, the dosage regimen utilizing the proteins of the present disclosure is selected in accordance with a variety of factors including type, species, age, weight, se and medical condition of the ruminant subject; the severity of the Mycoplasma infection to be treated; the route of administration; the renal and hepatic function of the subject; and the particular peptide employed. A veterinarian of ordinary skill can readily determine and prescribe the effective amount of the drug requited to prevent, counter or arrest the progress of the condition. Optimal precision in achieving concentratio of protei within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the protein's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of the protein.
[0145] Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protei or derivati ve thereof comprising the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 40% similarity to SEQ ID NO: I after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
[0146] Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protei or derivative thereof comprising the amino acid sequence set forth in SEQ ID 'NO: or an amino acid sequence having at least 40% similarity to SEQ ID NO:2 after optimal alignment for a time and under conditions sufficient to generate antibodies to the protein.
[0147] Another aspect enabled herein is a method for controlling infection by a species of Mycoplasma in a subject, the method comprising administering to the subject an antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth In SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO: 15 after optimal alignment for a time and under conditions sufficient to generate antibodies to the- protein,
[0148] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or a protein having at least 40% similarity to SEQ ID NO:2 or is a derivative thereof.
[0149] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 15 or a protein having at least 40% similarity to SEQ ID NO: 15 or is a derivative thereof.
[0150] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:3 or a protein having at least 40% similarity to SEQ ID 'NO: 3 or is derivative thereof
[0151] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:4 or a protein having at least 40% similarity to SEQ ID NO: 4 or is a derivative thereof
[0152] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO 5 or a protein having at least 40% similarity to SEQ ID NO 5 or is a derivative thereof
[0153] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID ΝΌ 6 or a protein having at least 40% similarity to SEQ ID NO:6 or is a derivative thereof
[0154] In an embodiment the protein comprises the amino acid sequence set forth in SEQ D NO:7 or a protein having at least 40% similarity to SEQ ID NQ:7 or is a derivative thereof.
[0155] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NQ:8 or a protein having at least 40% similarity to SEQ ID NO; 8 or is a derivative thereof.
[0156] In an embodiment, the protein comprises the amino acid sequence set fort in SEQ ID NO: 16 or a protein having at least 40% similarity to SEQ ID NO: 16 or is a deri ative thereof.
[0157] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 17 or a protein having at least 40% similarity to SEQ ID NO: 17 or is a derivative thereof.
[0158] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: IS or a protein having at least 40% similarity to SEQ ID NO: 18 or is a derivative thereof.
[0159] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO: 1 or a protein having at least 40% similarity to SEQ ID NO: 19 or is a derivative thereof.
[0160] In an embodiment, the protein comprises the amino acid sequence set forth in SEQ ID NO:20 or a protein having at least 40% similarity to SEQ ID NG:20 or is a derivative thereof.
[0161] In an embodiment, the pnstera comprises the amino acid sequence set forth in SEQ ED NO:2I or a protein having at least 40% similarity to SEQ ID NO:21 or is a
derivative thereof.
(0162] These aspects include conditions caused or exacerbated by Mycoplasma infection such as bovine respiratory disease, keratoconjunctivitis, mastitis, meningitis, otitis medi and genital tract disease.
(0163] The formulation of protein and its subsequent administration (dosing) is within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several day s to several months, or until a cure is effected or a diminution of the disease state is achieved. Optim l dosing schedules can be calculated from measurements of drug accumulation in the subject. Persons or ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on. EC50S found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 μg to l.OOg per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or eve once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rats for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therap to prevent the recurrence o the disease state, wherein the oligonucleotide is administrated in maintenance doses, ranging from 0.0 lpg to 100 g per kg of body weight, once or more daily, to once every 20 years.
(0164] I another embodiment, a ruminant subject is administered, an antibody to MilA or its homolog or derivative. This is regarded as passive immunotherapy. Antibodies to MilA or its homolog or derivative are generated as previously described herein.
EXAMPLES
[0165] Embodiments contemplated herein are now described by the following non- limiting Examples.
Materials and Methods
Bacterial strains amlplasmids
[0166] Mycoplasma hovis wild-type strains 3683, 149040, PG45 and the temperature sensitive (is) mutant strains A, B and C were used. M, bovis wild-type Strains (1/500 dilutions) were incubated for 17 h at 37°C in MB medium, and 1 /100 dilutions of the ts mutants were incubated for 24 h at 33 CC in MB medium. pGEX-4T-l plasmid (Figure 12) was used for cloning different regions of MilA and E. call JM109 cells were used to express recombinant GST-MilA proteins.
Serum samples from experimentally infected calves
[0167] Experiment I- Sixteen, one-month-old Friesian-cross calves were weighed and allocated into two groups. Group 1 consisted of 4 animals exposed only to mycoplasma culture medium, while Group 2 consisted 12 calves exposed to an overnight culture of M.. bovis strai 3683 twice on day 1 and 3, with each calf receiving an estimated dose of 10" " CCU, using an aerosol exposure method described previously (Czaja et al. (2002) Vet. Rec. 750:9-11; Wawegama et al. (2012) Vet. Microbiol 75^:220-224). The calves in Groups 1 and 2 calves were held in separate facilities. Blood samples were taken from all the calves on days 0, 10, 17 and 24 after infection.
[0168] Experiment 2 - Thirty five, one-month-old Friesian-cross calves were grouped according, to their weight and randomly grouped into 2 groups. Group 1 , the uninfected group, consisted of 5 calves exposed to an aerosol of mycoplasma culture medium, and Group 2 consisted of 30 cal ves exposed to an aerosol of M bovis strain 3683. Infection and sampling were performed as described for Experiment 1.
[0.169] Experiment 3 - Group 3 cattle totaled 31 and were provided with vaccine A. SDS-PAGE and Western blots analysis
[0170] The whole cell proteins of M bovis strain 3683 were separated by sodium dodecyl sulfate polyacryl amide in 1.0% w/v polyacrylamide gels and Western blotting performed as described by Markham et aL (1998) Infect Imman. 66:2845-2853. Cells from a 10 ml culture were collected following centrifugatioii at 16,000 g for 5 min, and washed 3 times with PBS. After the final centrifugation the supernatant was discarded and the cell pellet was resuspended in a volume of distilled water 1/50* that of the original broth using a 25 gauge needle and a 1 ml syringe, The cell lysate was then mixed with 2 x. SDS-PAGE lysis buffer (10% w/v SDS, 100% v/y glycerol, 0,5 M Tris-HCl, pH 6.8, 10% v/v β-mercaptoethanol, 10% w/v bromophenol blue) and heated at 100°C for 5 min.
Preparation and running of SDS-PAGE els
[0171] The total proteins were separated i 10% w/v or 12% w/v polyacryl amide separating gels by electrophoresis at 180 V for 1 h in the BioRad mini-vertical PAGE system containing Laemmli 's buffer (0.1 % w/v SDS, 0.025 M Tris, 0.19 M glycine). Broad range prestained (Fermentas) or unstained protein markers (New England Biolabs, USA), or biotinylaied protein markers (Cell Signaling Technology, USA) were used as molecular mass standards. The gels were stained with Coomassie brilliant blue -250 (BioRad, USA),
Western blotting
[0172] After SDS-PAGE the proteins were transferred onto a polyvinyls dene difluoride (PVDF) membrane (Millipore, USA) using the BioRad mini-vertieal PAGE and blotting system containing chilled Western transfer buffer (Laemmli's buffer containing 20% v/v methanol) for 1 h at a constant voltage of 100 V. After transfer, the PVDF membrane was blocked overnight with 5% w/v skim milk (Diploma, Australia) in distilled water at 4aC. The membrane was then washed three times (5 min each) with PBS-T [phosphate buffered saline (140 mM NaCl, 2,7 mM KC1, 10 mM Na2H2P04, mM HjPO*) containing 0, 1% v/v Tween 20 (Asia Pacific Specialty Chemicals, Australia)].
The membrane was then probed with a pool of M bovh ^-specific calf sera, diluted to 1/100 in 1% w/v skim milk in. PBS-T, and incubated for 1 h at room temperature with gentle rocking. Alternatively, anti-M bovis rabbit antibody diluted to 1/20,000 in. PBS-T/1% w/v skim milk, was used, The membrane was then washed three times with PBS-T as before. The membrane was then probed with horseradish peroxidase (HRP) -conjugated sheep anti- bovine IgG antibody (Bethyl Laboratories, Inc, USA), diluted to 1/5000 in 1% w/v skim milk in PBS-T, or HRP-conjugated swine anti-rabbit IgG antibody (Dako. Denmark), diluted to 1./50G0 in J% w/v skim milk in PBS-T, for I h at room temperature. After incubation the membrane was washed three times with PBS-T (5 min each) and the bound enzyme was detected using chemiktminescence (ECL, Western blotting detection reagent and analysis system, Amersham Biosciences, UK), or with SIGMAFAST (Trade. Mark) 3,3' di ami nob enzj dine (DAB) according to the manufacturer's instructions.
Triton Χ-Π4 partitioning
[0173] Mycoplasma bovis cells from a 25 ml culture were pelleted by eentrifugatio at 16,000 g for 20 min at 4°C in a Sorvall . R.C-5B centrifuge (Sorvall, USA). The cell pellet was washed three times with PBS and resuspended in 0.25 ml PBS using a. 25 gauge needle and syringe. The cells were lysed with a 0.25 ml volume of 1% v/v Triton X-114 (Sigma, USA) and the mixture incubated on ice for 60 min, with mixing every 15 min. The ceil suspension was centrifuged at 13,000 \ g for 30 min at 4 C. and the supernatant was carefully loaded onto a 1 ml 6% w/v sucrose cushion containing 0.06% v/ Triton X-1 14 and incubated for 9 min at 37°C in a water bath in order to achieve phase separation. The sample was centrifuged at 400 g for 7 min at 37°C and the supernatant hydrophiiic protein fraction) was carefully aspirated, leaving on oily pellet predominantly containing the hydrophobic fraction. The oily pellet was resuspended in 0.5 ml of ice-cold PBS and placed on a 6% w/v sucrose cushion and phase separatio carried out again as described above. Finally, the oily pellet was resuspended in 0.5 ml ice-cold PBS. The hydrophobic and hydrophiiic fractions were precipitated using the methanol/chloroform method. To 1 volume of protein suspension 4 volumes of ice-cold methanol, 1 volume of ice-cold chloroform and 3 volumes of distilled water were added, the solutions vigorously mixed and then centrifuged for 1 min at 16,000 % g. The supernatant was discarded and the
protein pellet resuspended i 4 volumes of methanol, vortexed and centnfuged for 5 min at 16,000 g at T, The supernatant was removed, the pellet dried under a vacuum and then dissolved in 8 M ur a. The proteins were then analyzed by SDS-PAGE or two dimensional electrophoresis (2 -DE).
Mass spectrometric analysis
(0174] For mass spectrometric identificatio of proteins, the hydrophobic protein fraction of M. bovis strain 368.3 was separated in a 7.5% w/v polyacrylamide gel and stained with colloidal Coomassie blue (Life Technologies) according to the manufacturer's instructions. The major bands betwee 180 kDa and 250 kDa were excised and analyzed at the Adelaide Proteomics Centre, The University of Adelaide, using liquid chromatography eleetrospray ionization ion - trap (LC-eSI-IT) mass spectrometry.
Two dimensional gel electrophoresis (2-DE)
Sample preparation
|01 5] Sample preparation for two dimensional gel electrophoresis (2-DE) was carried out as described by Gorg (2004). A .20 ml overnight, culture of M. bovi was pelleted by eentrifugation at 1.6,000 x g for 20 min at 4°C and the cell pellet washed three times with PBS, and resuspended using a 25 gauge needle i 0.5 ml of sample preparation solution [8 M urea, 4% w/v CHAPS (GE Healthcare, USA), 2% y/v IPG buffer pH 3 -1 1 (GE Healthcare, USA) and 40 mM DL-dithiothreitol (DTT) (Sigma- Aldrich.)]. The sample was then sonicated 4 times (1.5 sec each with 5 min intervals on ice) and oentrifuged at 42,000 g for 30 min at 15°C. The supernatant was stored in 0.1 ml. aliquots at -8QT. The protein content of the samples was quantified using the 2D Quant kit (GE Healthcare, Sweden) according to the manufacturer's instructions. A 100 μ quantity of each sample was cleaned using the 2D clean-up kit (GE Healthcare, USA) according to the manufacturer's instructions and resuspended in urea rehydration solution [8 M urea, 2% w/v CHAPS (GE Healthcare, USA)]. Prior to electrophoresis, 0.5% y/v IPG buffer (pH 3-1 1) and 2.8 mg DTT/ml were added.
First dimension isoelectri focusing (IEF)
[0176] For the first dimension isoelectric focusing, 60 ^ig of the protein in 125 μΐ of rehydration solution was pipetted into a 7 cm IEF strip holder, and a dry 7 cm strip gel (pH 3-11) placed gel side down into the holder and overlaid with mineral oil (GE Healthcare). The strip holder was placed on an Etlari TPGphorll isoelectric focusing system (Am ersharo -Bioscience) and the gel was re-swe)'.led for 12 h at 30 V, then at 60 V for 6 h, and the isoelectric focusing performed for 5.5 h, at 200 V for 1 h, at 500 V for 1 h, at 1000 V for 1 h, at a gradient of 1000 V to 8000 V for 1 h, and at 8000 V for 1.5 h. Once the IEF was complete, the strip was removed from the stri holder and equilibrated in SDS equilibration buffer (6 M urea, 75 mM Tris-HCi [pH 8.8], 87% v/v glycerol, 2% w/v SDS, 0.002% w/v bromophenoi blue with 10 mg . DTT/ml) for 15 min, followed by another 15 min with 25 mg jodoacetamide/ml (Am ersham, USA) substituted for the DTT.
Second dimension electrophoresis
[0177] The IEF strip gel was placed on top of a 12,5% w/v polyaerylamide SDS- PAGE gel arid sealed with agarose sealing solution (0.5% w/v agarose, 0.002% w/v bromophenoi blue in Laemmli's buffer) and the proteins separated according to their mass by electrophoresis. Once electrophoresis was completed the proteins were either transferred onto a PVDF membrane or stained with either colloidal Coomassie blue or silver (Plusone Silver Staining Kit-Protein, GE Healthcare, USA) according to the m an ufacturer ' s i nstru cti ons .
Expression of recombinant Mycoplasma immunogenic lipase A (MUA) protei
[0178] A 6 ¥b region of the M A gene was codon-optimized for expression in E. colt and the TG A tryptophan codons altered to TGG to confirm with E, coli codon usage. The synthetic gene sequence was designed to contain a number of restriction endoimclease cleavage sites to aid manipulation in pGEX-4T-.l (BamHJL, Sail, XhoJ and Bgffi) [Figure 1]. The modified DNA sequences were then manufactured by Genscript (USA) and cloned in pUC57.
[0179] The gene sequence optimized for expression in E. coli is set forth in SEQ ID
Nos: 13 and 22. The MilA-AB (SEQ ID NO: 13) and milA-CD (SEQ ID N0.22) fragments were excised from pUC57 using i¼¾wHI, Bgll and 6 /Ι, purified by agarose gel electrophoresis and extraction with a QIAEX II kit (Qiagen, Germany) according to the manufacturer's instructions, and ligated in to pGEX-4T-l (GE Healthcare) that had been digested with Ba Kl and Sail. The MilA-h, MlA- , M lA-C and MilA-D DNA fragments were excised from pGEXr4T-l -MilA -AB or pGEX-4T-l -.½¾-CD with appropriate restriction endoriucleases (Figure I), purified, and ligated to similarly digested pGEX-4T-l , In order to develop the MilA-ab and MHA-cd DNA fragments, PGR was performed using 2 ng of pGEX-4T-l-M¾4-AB or pGEX-4T- i -M -CD DNA as the template and 0.4 μ.ΥΙ of the appropriate primers (Figure I) in a reaction volume of 50 μΐ containing 2 raM MgSQ , 100 μΜ of each deoxynucleoside triphosphate and 1,5 U of Platinum Taq therm o- polyrnerase (Life Technologies). Cycling conditions included an initial denaturation step at 94 °C for 4 rain, followed by 35 cycles of 94°C for I min, 55°C for i rain and 68°C for 2 min. Th 1.8 kb products were excised, purified and ligated into pGEX-4T- 1. The ligated plasmids were used to transform E. coti JM109 cells by eleetrophoration (Noormohammadi et at. (1999) Microbiology 145: 2087-2094). The transform ants were selected on LB agar containing ampicillin (50 g ml) and selected clones were incubated for 3 h at 30°C in the presence of 1 mM isopropyl -D-l-thiogalactopyranoside (IPTG) [Invitrogen], Expression of GST fusion proteins from the recombinant plasmids was assessed by SDS-PAGE and Western blotting of whole ceil lysates. Fusion protein GST- MilA-ab was purified by affinity chromatography using glutathione-Sepharose 4B beads (GE Healthcare) and elution with free glutathione (Crabb et ai. (1995) Arch. Virol. 7^:245-258).
Constructing the recombinant protein
Preparing pl mMDNA
[0.180] The vector pGEX-4T-l (Figure 12) was used to transform E. colt JM109 cells by electroporation, according to the manufacturer's instructions (Gene Pulser, Bio Rad). The transformants were selected on LB agar containing ampicillin (50 μ§ ι 1.), and a single transformant was selected and grown overnight in LB broth supplemented with ampicillin
(50 pg ml). The plasmid DNA was purified from the E, eoli cells using the Qiagen Plasmid Midi Kit (Qiagen) according to the manufacturer's instructions.
[0181] Purification of the plasmids pUC57.½ M-AB and pUC57/iw'M-CP was performed in the same manner.
Generation of pGEX~4T~l-mUA-AB and pGEX-4T-l-mi\A-CD
[0182] The pUC57-milA-AB and pUC57 -mi IA CD plasmids were digested with appropriate restriction endomicl eases (RE), BamHL, Bg and Sail,, and pGEX-4T-1 was digested with BcmiHl and Sail according to the manufacturer's instructions (Ne England BioLahs). The digested DNA was separated in a 1% w/v agarose gel and the required DNA bands (3 kb for the m/M-AB and milA-CU fragments and 5 kb for pGEX-4T-l ) were excised and the DNA extracted using the QIAEX II kit (Qiagen, Germany) according to the manufacturer's instructions. The atnount of DNA was quantified by measuring the absorbance at 260 ran using a NanoDrop spectrophotometer (Biolab, Australia). The milA- AB and milA-CD DNA fragments were ligated to similarly digested pGEX~4T~l with T4 DNA ligase (Promega) in ligation buffer (Promega) at 4°C overnight The ligation mixture was then used to transform E. cot JM109 cells by eiectroporation as above. Transfomiants were selected on LB agar containing ampiciUin (50 μ%/αή) and resistant transformants screened by PGR to confirm insertio of the mili-AB or milA-CD DN fragment in the pGEX-4T-l vector.
Screening clon es
[0183] AmpiciUin resistant colonies were selected and resuspended in 25 μΐ of dH¾0, and 1 μ.Ι of this was used as template i a screening PGR that contained 1.25 U Gotaq (Registered Trade Mark) Flexi DNA polymerase (Promega), 5 x Green Gotaq (Registered Trade Mark) Flexi bu tler. 1.5 mM MgCl2, 200 μΜ of each dNTP and 1 μΜ of each of the pGEX-4T-l forward and reverse primers (pGEXfwd
[GGGCTGGCAAGCCACGTTTGGTG (SEQ ID NO:23)] and pGEXrev [CCGGGAG :TGCATGTGTCAGA GG (SEQ ID NO:24)]). The reactions were incubated at 95°C for 4 min, followed by 30 cycles of 95 C for 30 s, 55°C for 30 s and 72T; for 7.5
min, finishing with 5 min at 72 " , in an iCycler (BioRad). PCR products were visualized by agarose gel electrophoresis and the image captured using the CheraiDoc imaging system (BioRad).
[0184] Those clones containing a 3 kb product as confirmed by PCR were selected and cultured overnight in LB broth supplemented with 50 g ampiciilin ml. The plasmid DNA was purified using the Wizard Plus SV Mimpreps kit (Promega), digested 'with BarnHl and Sail and screened for the presence of the 3 kb insert and the 4. kb pGEX-4T-l vector by electrophoresis in a 0,8% w v agarose gel. The clones with the expected RE digestion pattern were selected for expression.
Screen ing clones for protein expression
[0185] A single transf rmant was used to set up an overnight culture in 5 ml LB broth containing 100 μg ampicillin/ml. The following day a 1/100 dilution of the overnight culture was used to inoculate 3 ml LB broth containing 100 μ§ ampicillin/ml and this culture incubated at 37°C with shaking until it reached an OD<¾xi of 0,6-0.8 (around 2,5 h). A 1 ml sample of the culture was centrifuged at 1.6,000 x g for 5 mi and the cells resuspended in 100 μΐ of PBS and stored at -20 'C to be used as an uninduced sample. To the remaining culture 1 mM of isopropyi β-D- l-thiogalactopyranoside (JPTCi) (Invitrogen) was added and the culture incubated at 30 "C with shaking for 3 h. A 500 μΐ sample of the culture was centrifuged at 16,000 x g for 5 min and the cell pellet resuspended in 100 μΐ of PBS, stored at -20°C and used as the induced sample,
[0186] Whole cell proteins of the induced and uninduced samples were separated in a 10% polyacrylamlde gel by SDS-PAGE and either stained with Coornassie blue or transferred to a PVDF membrane as described in Section 5.2.3 and probed with pooled M, £ov¾'~specific calf sera and then with HRP-conjugated sheep anti-bovine IgG antibody.
Constructing the milA-A, milA-B, inilA-C and milA-B plmmids
[0187] The pGEX-4T-l-/w M-AB and pGEX-4T-l-/i«M-CD plasmids were digested with BarnHl and Bgill to release the mliA-B and mi!A-D regions and with Xhol to release
ihe milA-A and milA-C regions. Each of these four DNA fragments was separately ligated into similarly digested pGEX-4T-l. and ampicillm resistant clones were screened by PCR. Clones were screened by RE digestion using the appropriate RE combinations (BwnH! and Bgill for miiA-B and milA-D, Xhol for miiA-A and mi!A-C\ and positive clones were then screened for protein expression.
Constructing pGEX-4T-t-mlA-ub and pGEX-4T-1-mMA-cd plamiids using specific primers
[0188] Primers were designed using Geneious Pro 5.1.6 to amplify 1.8 kb gene product from the original gene sequence of region milA- AB, extending from base 144 to base 1950, encompassing the region between regions miiA-A and iiA-B that were excluded in these constructs. A BamHl cleavage site was added to the 5' end of the forward primer (abF-i¾»wHi) and a Sail cleavage site was added to the 3' end of the reverse primer (abR-Λα/Ι) (Table 7). Forward and reverse primers (cdF-BamHi, cdK-Satl) were similarly designed to amplify the region between bases 3128 and 4872 (Table 13).
[0189] PCR was performed with 2 ng of pGEX-4T-l -miIA-AB plasmid DNA as the template with primers abF-ifcswH'I and abR->$¾r/I in a reaction volume of 50 μΐ containing 2 mM MgS04, 100 μΜ of each deoxynucleoside triphosphate, 0,4 μ V! of each primer and 1.5 U of Platinum Taq thermo-polymerase (Life Technologies). Cycling conditions included an initial denaturation step at 94°C for 4 min, followed by 35 cycles of 94°C for 1 mm, 5 for 1 min and 68"C for 2 min. The final cycle included an elongation step at 68"C for 5 min. PCR products were resolved by electrophoresis in a 1% w/v agarose gel containing SyberSafe (Trade Mark) DNA gel stain (Molecular Probes) at 80 V for 1.5 ft and visualized under UV illumination using the ChemiDoc imaging system (BioRad). The 1 ,8 kb product was excised and the DNA extracted and digested with BamB md Sail as. The digested DNA was purified using the Wizard Plus SV Mini rep kit (Promega) according, to the manufacturer's instructions. A similar PG was performed to produce the 1.84 kb cd DNA fragment using the cdF-5«wHI and cdK-Sail primers (Table 13), and the product digested and purified as above. The w/ -ab and mi/A-cd fragments were cloned into pGEX-4T-l and used to transform E. co!i JMJ09 ceils, Colonies expressing the GST-
MilA-ab and GST-MilA-cd proteins were screened as described above. Large scale fusion protein p duct m
[0190] A single colony was used to inoculate 5 ml of LB broth containing 100 ttg ampieillin/ml and this culture incubated overnight at 37°C. The 5 ml overnight culture was inoculated into 500 ml LB containing 100 pg ampicillin/ml and incubated at 37T with shaking until it reached an OD6(JO of 0.6-0.8 (around 2,5 h), A 1 ml sample of the culture was centrifuged at 16,000 % g for 5 min, resuspended in 100 μΐ of PBS and stored at -20°C for use as the uninduced sample. To the remaining culture, 1 mM of IPTG was added and the culture incubated at 30T with shaking for approximately 3 h. After induction, the cell s were pelleted by cefttrifuging the culture at 8,500 x g for 10 min, the pellet resuspended in 25 ml of ice cold PBS, 1 rng lysozyme/mi (aMResco, USA) added and the mixture incubated for 10 min on ice. To the mixture, 1 mM phenyl methanesulfonyl fluoride (PMSF) (Sigma) was added, and this mixture vortexed and then incubated overnight at 4"C. The cell suspension was sonicated 10 times for 10 sec each on ice and 1% v/v Triton X-100 (Plusone-Pharrnacia Biotech) added and the mixture vortexed and incubated for 30 min on ice. The mixture was then centrifuged at 6,500 x g for 1 min at 4°C and the pellet and supernatant were stored separately. To prepare the glutathione affinity column, 1 ,33 ml of glutathione-sepharose 4B beads (GE Healthcare) were centrifuged at 500 \ g for 5 min and the supernatant removed. The beads were washed with PBS, centrifuged as above and the pellet of beads carefully placed in a Poly-Prep chromatography column (Bio ad) and left to settle at 4°C for 10 min. The column was equilibrated by passing 5 ml of ice cold PBS through it. The cell supernatant was filtered through a 0.45 pm nitrocellulose filter (Miliipore) and then placed on the column and allowed to pass through. The column was then washed 3 times with 10 ml ice cold PBS and 10 ml of elution buffer (50 mM Tris-HCl [pH 8], 10 mM reduced glutathione [GE Healthcare]) was added to the column and left on it overnight at 4 0. After 18 h of incubation, the protein was eluted from the column in 1 ml aliquots. The eluted fractions were tested by electrophoresing a 2 μ! sample of each aliquot through a 10% w/v polyacrylamide gel by SBS-PAGE and then staining the proteins with Coomassie blue.
Purification and estimation of protein concentration
[019!] The aliquots contai ning significant amounts of the recombinant proteins were dialysed (10 kDa cutoff [BioRad]) against 4 changes of 100 mi volumes of PBS at 4X. The concentration of protein was determined using the BioRad protein assay (BioRad) according to the manufacturer's instructions. The protei was then stored at -80"C in 1 ml aliquots.
Sequencing of the pGEX~4T~l gene constructs expression ndlA gem fragments
[0192] Plasmid DNA of clones expressing the Mil A-AB, MilA-CD, Mil A- A, Mil A-B, MilA-C, MilA-D, Mil A-ab and MilA-ed proteins was extracted using the Wizard Plus SV Miiiipreps kit (Promega). Appfoximately 600 ng of plasmid DNA of each eonstract was used as the template in 20 μΐ sequencing reactions containing the BDT sequencing terminator mix, BDT dilution buffer and 5 μΜ of the primer (pGEXFwd or pGEXRev), The reaction was incubated at 96X fo 1 min, followed by 30 cycles of 96X for 10 s, 5 OX for 5 s and 60 X for 4 min. The reaction products were purified by adding 125 niM EDTA, 2.5 M sodium acetate and 100% v/v ethanol to a total volume of 74.4 μΐ, and the mixture vortexed, incubated on ice for 1.5 min and centrifuged for 20 min at 16,000 x g at RT. The supernatant wa carefully removed and the pellet was washed in 70% v/v ethanol, centrifuged as above for 5 min, the supernatant discarded and the pellet dried by incubation in a heating block at 95 for 1 min. The sequencing products were analysed by capillar)' sequencing and the sequences aligned to the predicted sequence using Geneious Pro 5.1.6.
Characterization qfMilA protein
[0193] The protein sequences of the different recombinant proteins were aligned to the predicted gene sequences using both: Pfam (Sanger Institute) and BlastP (NCBI [National Center for Biotechnology Information]).
[0194] For the specific detection of lipase activity, two fold dilutions (2 μΜ, 1 μΜ, 0.5 μΜ, 0.25 μΜ and 0.125 μ.Μ ) of recombinant GST-MilA-ab were incubated at room temperature with 100 pg of l ,2-0-dilauryl-rac-glycei 7-3-g3ut.ai"ic acid regorufin methyl ester (Sigma), as described by Schmidt et al. (2004) J. acteriol 7*6:5790-5798» Similar
concentrations of GST-P65 and GST were used as positive and negative controls, respectively. The release of resorufm was detected using a spectrophotometer (BioTek) with ab sorb anee measured at 572 nm each minute for 30 min.
Optimized indirect IgG ELISA using GST-MUA-ab
[0195] The ELISA method used was adapted from Duffy et al (1999) J. Clin. Microbial 37; 1024-1029. Each well contained 1 ,2 μ¾ of GST-Mil A-ab and blocking was performed with 5% v/v sheep serum in phosphate buffer saline. Dilutions of positive control, negative control and test sera were made in 2,5% v/v sheep serum in PBS -T (PBS containing 0.05% v/v Tween 20) by preparing two fold dilutions of the positive control calf serum, pool starting from 1/75, to 1/9600, as well as a single dilution of the negative control calf serum pool (1/300) and of test sera ( 1 /300). HRP-eonjugated sheep anti-bovine IgG heavy and light chain antibody (Bethyl) was diluted at 1/2000 in 2.5% sheep serum in PBS-T and used as the conjugate. After the final wash, 10 μΐ of 0.3 g/L 2,2'-azino-bis(3- ethylbenzothiazoline-6-sulfonic acid) [ABTS Peroxidase Substrate, KPL] was added to each well and the plate incubated for 7 min at room temperature. The reaction was stopped by addition of 100 μΐ of 1% w/v SDS to each well, and the absorbance of each well measured at 405 nm using a Hybrid Multimode microplate reader (BioTe ).
Testing th e sensitivity of in direct IgG ELISA
|Ό'Ί 96] Calf sera collected at different time points during Experiments 1 and 2 were tested using the IgG ELISA protocol described as above. The antibody titer for each serum sample was calculated by plotting the OD values on the standard curve generated using the dilutions of the positive control serum pool on each plate using the program DeltaSoft 3 (Biometallic, Inc). All statistical analyses were performed using the Mann-Whitney test in SPSS versio 20 (IBM). The cut-off value for the IgG ELISA was calculated using the test results of all the uninfected animals in both experiments, including all the samples from Group 1 and the samples from day 0 from Group 2 (total of 83). The average antibody titer of these uninfected animals was calculated and considered as the cut-off value.
[0197] Test results from both experiments were pooled to calculate the sensitivity and
specificity of the IgG ELISA. The sensitivity was calculated separately for each time point and the sensitivity on day 24 after infection was considered to be the overall sensitivity of the IgG ELISA. The specificity was calculated using one randomly selected sample from each of the uninfected calves (Group 1 -uninfected, Group 2-before infection, Group 3- vaccine A),
EXAMPLE 1
Identification of Mycoplasma immunogenic lipase A (MHA)
[0198] In Western blots a single protein with a molecular weight greater than 170 kDa was recognized in serum antibodies from all the infected calves in Experiment 1 at day 24 after infection. Sera from the uninfected calves and sera collected on day 0 from infected calves did not contain antibody recognising this protein (Figure 2). A similar sized protein (226 kDa) was detected in whole cell proteins of hi, bovis strain 3683 and M. ag lactiae strain PG2, but antibodies in infected calf sera only bound to the protein in hi. bovis (Figure 3). Mass spectrometry c analysis identified the coding sequence as that of MBO VPG45_710, which is predicted to be a 302.9 kDa membrane protein in . hi. bovis PG45 (accession number 313678759). Only the amino terminal 60% of the coding sequence was identified, with peptides derived from the remaining 40% not detected, explaining the lower molecular weight estimated for the protein from SD.S-polyaciylami.de gels.
EXAMPLE 2
Expression of recombinant MMA protein
[0199] The MilA-AB, MM-CD, MUA-A, M-B, MUA-C, MilA-D, MilA-ab and MilA- d regions were successfully inserted into pGEX-4T-l and introduced into E. coli JM109 cells. Recombinant GST-MilA-CD, GST-MilA-B, GST-Mil A-C, GST-Mil A-D and GST-MilA-cd were highly expressed, but did not react with Aov s-specific calf sera. GST-MilA-AB and GST-MilA-A reacted weakly, but GST-MilA-ab reacted strongly wit hi. bovis-specific calf sera (Figure 4). DNA sequencing established that all the cloned inserts had the expected sequences.
EXAMPLE 3
Construction ofpGEX-4T-l expression, plasmids for regions of MBOVPG4S710 (m A)
[0200] The coding sequences of milA were synthesized as two 3 kb fragments, mi A- AB and mfM-CD, with B /rMl and Sail cleavage sites located at the amino and carboxyl terminal ends, respectively. The two 3 kb fragments were able to be reduced in size by inclusion of Bgttl and Xhol. sites at their mid-points, producing four 1 ,5 kb fragments, milA-A, miiA-B, miJA-C and milA-D, The primers abF and abR, and cdF and cdR, were designed to amplify the 1.8 kbp mi!A-ab and 1.84 kbp mi!A-cd products, respectively. PG and RE digestion screening also confirmed that the plasmids pGEX~4T~1 ~//?/Z4~AB, pGEX T-l.-»» 4-Cp, pGEX-4T-l-ra?M-A, pGEX-4T-.l→»iW-B, pGEX-4T-l-m/M-C and pGEX-4T-l-i»/M-D., which were cloned in E. eott JM109 cells, contained the expected inserts. PGR and RE digestion screening also confirmed that pQEX-4T- i-w/ i-ab and pGEX-4T-l-/w'M-cd5 which were cloned in E. coli JM109 cells, contained the expected inserts.
EXAMPLE 4
Expression of recombinant proteins
[0201] The predicted molecular weight (M ) of the recombinant proteins GST-MilA- AB, GST-MiiA-CD, GST-yil A-A, GST-MilA-B, GST-MilA-C and GST-MilA-D were 135,5 kDa, 137 kDa, 82.8 kDa, 79 kDa, 72 kDa and 73,3 kDa, respectively. The actual MWs .of the recombinant proteins are summarized. The GST-MiiA-CD, GST-MilA-B, GST-MilA-C and GST-MilA-D recombinant proteins were highly expressed, but did not react with M, bovis-specifw calf sera. The GST-MiiA-AB and GST-MilA~A proteins reacted weakly with ό ν5-specific calf sera. All the GST fusion proteins bound anti- GST antibody strongly. The recombinant proteins GST-MilA-ab and GST-Mil A-cd were predicted to have MWs of 92.9 kDa and 94.3 kDa, respectively. Only GST-MilA-ab reacted with M tews-specific calf sera, while both GST-MilA-ab and GST-MilA-cd bound to anti-GST antibody.
[0202] DNA sequencing and analysis established that the cloned milA-AB, milA- D, m/M~A, mi!A-B, milA-C, milA-D, mifA-ab and milA-cd inserts had the expected sequences.
EXAMPLE 5
Characterization of MilA
(0203] The gene encoding MBGVPG45_710 (milA) is predicted to code for a 302 fcDa protein of 2700 aa in the M. bovis reference strain PG45. Further analysis revealed that it contained a membrane spanning region at its amino terminal end, with the remainder of the protein predicted be located extraeellularly, Homologs were found in M. bovis strain Hubei-1, M. agalaciiae strains 5632 and PG2, cohrmhinunt SF7 and M fermemam strains JER and 64 (Table 4). Searches of the Pfam database identified an SGNHJrydrolase region at the amino terminal end (aa 1-375) that belonged to a family of GDSL-like lipases (Figure 5). The SGNHJhydrolase region is characterized by the conserved catalytic site amino acids Ser, Gly, Asp and His. The active site catalytic triad, Ser-His-Asp is in block 1 (Ser 99) and block V (His 362 and Asp 360). Alignment of region 1 of MilA (a 1-375) with other mycoplasma lipases demonstrated that in MilA, the Ser, Gly, Asp and His residues in blocks I, II, III and V were conserved (Figure 6), I block I, the conserved amino acid sequence is GDSL rather than the GDSL motif of the GDSL family lipases, as found in M. hyo eumomae mhp677 {Schmidt, 2004 #1241 }. In block II, Gly is conserved, while i block MI, the sequence AXND is conserved in both M bovis PG45 and M. bovis Hubei-1, although in most of the hydrolase family this sequence is GXND, as it is in fermentam, M agalaciiae and A./, cohmhimtm. I Block V all mycoplasma MilA homologs have the sequence DIHP, instead of the more typical DXXHP sequence. Analysis of genome sequences adjacent to MilA revealed the presence of rpoC, rpoB and a lipoprotein gene upstream, and a hypothetical protein, transposase and aminopeptidase genes downstream (Figure 5). Physical maps of MilA homologs are shown in Figure 13. The MilA gene is located downstream of rpoC and rpoB in all genomes, the exception being the second copy of the gene in bovis strain Hubei-1. In most species the genes downstream of the MilA homolog differ from each other .
[0204] The recombinant GST-Mil A-ab protei catalyzed release of resoruim from 1 ,2- O-dilauryl-rac-glycero-3-glutaric acid resoruim methyl ester over a 30. min period. Within the 30 min period the OOS72 of GST-Mil A-ab changed from 0.18 to 0.3, while GST-P65 changed from 0.17 to 0,2 only indicating the release of resoruim by GST-Mil A-ab was greater than that released by GST-P65. The ODs72 o GST was constant at 0.135 as it was unable to catal yze any rel ease of resoruim (Fi gur e 7),
EXAMPLE 6
Sensitivity of IgG EL ISA in experiment l studies
Experiment 1
[0205] No calves in the uninfected grou had detectable changes in antibody titers against GST-MilA-ab, throughout the experiment. The calves in the infected group did not have significant increase in antibody titers until 3 weeks after infection (Table 5). The mean IgG titer of uninfected calves was 23.4 ± 1.2, so a cutoff of 47,4 (mean + 2 x SD) was used to define positive test results. On day 10 after inoculation none of the infected calves were positive, but by day 17 two animals were positive, and by day 24 eleven animals were positive.
Experiment 2
[0206] As in Experiment 1 , infected calves had high IgG titers by day 24 (Figure 9 and Table 6). In the uninfected group 2 calves were above the cutoff value of 47,4 at day 10, but only one remained above the cutoff on days 17 and 24. In the infected group four calves were positive on day 17 and twenty eight were positive on day 24,
[0207] The sensitivity of the IgG ELISA was 0% and 14,3% on days 10 and 17, respectively. The overall sensitivity of IgG ELISA was 92,8% and specificity was 98,7%,
Experiment 3
[0208] There was no increase in the antibody titer against the recombinant M. bovis MilA-ab protein in calves in Group 3 (Vaccine A) until 2 weeks after challenge, after
which it continued increasing until the calves were euthanized (day 45) [Table 7], The titers were significantl higher than those of animals i the negative and challenged only groups on day 17, but by day 24 were only significantly different from those of cal ves in the negative control group, as in the calves in Group 2 IgG titers had increased by 2 weeks after challenge.
(0209] The results were similar to those in Experiment 2 whe a cut off value of 65 was assigned to the assay. On day 0, before vaccination or challenge, 9 animals were positive, but by day 7 the same animals were negative, except for two in Grou 3. Ten days after challenge, 4 animals in Group 3 were positive, while 3 and 19 animals on day 17, and 27 and 31 animals on da 24 were positive in Groups 2 and 3, respectively (Table 8 and Figure 10).
[0210] The sensitivity of the IgG ELISA for wild-type and vaccinated calves at each time point is shown in Table 9, The overall sensitivity of the IgG ELISA was 91 % and specificity was 98.4 %.
Optimization of the IgM E LISA
[0211] A 1/50 test serum dilution was selected, together with a HRP-conjjugate dilution of 1/2000, as this offered the best discrimination between infected and uninfected animals. The development time for the ABTS substrate was increased to 20 min and the dilution series of the primary antibody for the standard curve for the test plate was 1/5, 1/10, 1/20, 1/40, 3/80, 1/ 160, 1/320 and 1/640.
Sensitivity of the IgM ELISA in experimental studies
[0212] Based on the results shown in Table 10, on the day of challenge there was no significant difference between the IgM titers of the three groups. O day 10 after challenge the calves in Group 3 had begun to develop significantly higher IgM titers than the calves in the other two groups, while by day 1 calves in Group 2 were also developing increased titers compared to the calves in Group 1 The calves in both Groups 2 and 3 -continued to show an increase in IgM antibody titers up to day 45 (Table 10).
[0213] The mean titer for the uninfected calves in the IgM ELISA was 99, and the cut off value was calculated to be 287 (99 + 188), On day 0, three animals were positive, but all were considered negative one week later. At day 14 after vaccination, 2 animals in Group 3 were positive, and the number of positive animals increased to 3, 5, 9 and 11 at each time point, Only one animal in Group 2 was positive before challenge, but the number increased to 11 and 18 on days 17 nd 24 after challenge (Table 1 1 and Figure 1 1 ).
[0214] The sensitivity of the IgM ELISA for wild-type and vaccinated calves at each time point is shown in Table 12. The overall sensitivity of the IgM ELISA was 47,5 % and specificity was 98.8 .
[0215] The data show that the test can be used to evaluate the immune status of vaccinated cows.
EXAMPLE 7
IgG titers in feedl t cattle
Materials and Methods
Cattle Ser
Experimental study
(0216] Sera from ninety Frisian-cross claves aged one month were collected fro two similar experiments. Experiments I and 2 have been described above. Briefly, experiment 1 had 24 calves, which were allocated into three groups. Grou 1 consisted of 4 calves exposed to aerosol of mycoplasma culture medium, Group 2 consisted of 12 calves exposed to Mycoplasm hovis strain 3683, while Group 3 consisted of 8 calves exposed to M bovis temperature sensitive vaccine strain A on days I and 3 and challenged together with calves from Grou 2 with bovisstimn 3683 three weeks after vaccination. Aerosol exposure was carried out as described before(Wawegama et al. (2012) supra). Sera were collected from all the calves on days 0, 7, 14, 18, 28, 35 and 42 and all the calves were euthanized and necropsied on day 42 for lung lesions as described previousl (Wawegama et al, (2013) supra). In Experiment 2, sixty six one-month old Frisian cross calves were allocated into three groups. Group 1 contained 5 calves exposed to aerosol of mycoplasma culture medium. Group 2 contained 30 calves exposed to M bovisst ti 3683 and Grou 3 contained 3.1 calves vaccinated and challenged as described in experiment 1. Aerosol infection and sampling was performed as described for Experiment 1.
[0217J Ail the calves were tested negative for BVDV and M bovispuor to the commencement of these experiments. The three groups were separately housed and observed for clinical signs' throughout the experiments. At necropsy Group 2 calves showed varied degree of lobular pulmonary consolidation and Group 3 had mild lobular lesions but none in Group 1 calves. Culture and PCR confirmed presence ofM bovis only from swabs from trachea, bronchi and lesions in Group 2 and 3 calf lungs and no specific pathogen from Group 1.
Dairy cattle herd
[0218| Fifty two serum samples were collected from adult cattle in a dairy herd in New South Wales, Australia. The herd have been tested negative for BVDV and M hovis. using PCR assay and had no record of respiratory infection for the last few years and there have been no heifer introduction to the herd from other farms, therefore, considered as a closed herd for bovis incidence.
Feedlot cattle
[0219] The sera supplied from University of Queensland, Australia were collected at two time points (!) introduction to a feedlot; and (2) six weeks later. A total of 7,448 cattle were tested. The sera were frozen at -20 C until analyzed. All the sera were analysed blindly.
In-hmtse IgG ELISA
[0220] The recombinant protein based M. έον/,ϊ-specific IgG ELISA (see above) was used to test sera collected from all the three resources. Antibody units (AD) were calculated for each sample using the standard curve on each ELISA plate and DeltaSoft 3 (Biometallie, inc.).
Data analysis
[0221] Statistical analysis and graphs were performed using Graphpad prism 5, The results of the two experimental studies were combined together and descriptive statistics were computed for the 3 groups at each time point. Differences between AU on each day and between each group were analysed using Mann-Whitney tests.
[0222] The cut-off value for the IgG ELISA was calculated by considering all the uninfected calves in both experiments, including all the sera from Group .1 , sera from day 0 to day 18 from Group 2 and sera from day 0 from Group 3. The sensitivity was calculated at day 42 and the specificity was calculated for a randomly selected time point.
[0223] The closed herd was considered as negative for M boviv and descriptive stati stics were computed and cut off value was calculated,
[0224] The feedlot cattle sera collected at introduction (Day 0) were considered as negative forM hovis as their original erd disease status is unknown and the cut-off value was computed- The cattle with AU higher tha the calculated cut-off value were grouped into 3 band scores >300AU, 300-250 AU and 250-2GQAU and the cattle come under each band and any other cow in contact with them within 2 weeks before the introduction to the feedlot were removed from the negative sample and descriptive statistics and cut-off value were calculated. Once the cut-off is selected M fov&sero-prevalence was calcul ted using the AU values of all the cattle sera- Results
Experimental study
[0225] The results of Grou 1 and Group 2 of both experiments are discussed above. The new mean AU calculated after addition of Group 3 antibody litres are summarized in Table 14. The calves in Group 3 had significantly higher AU than animals in Grou I and 2 on day 17 after challenge but by day 24 the animals in Group 2 had developed AU similar to those calves of Group 3, The mean AU of uninfected calves was 25 ± 20, therefore, a cut-off of 65 (mean + 2 x ST>) was computed. In combined experiments results 24 days after challenge 36 animals out of 42 in Group 2 and 8 out of 3 in Group 3 were sero positive for hovis (Table 14).
[0226] The sensitivity at day 42 (24 days after challenge) was calculated as 91 % and specificity as 98.4%.
Daily cattle herd
[0227] The mean antibody titer for the daily herd was calculated as 36 ± 14.13, therefore, the cut-off was calculated as 64.3 AU. According to the cut-off all the cows except 2 were seiO-negative for M hovis and the 2 positive cows had antibody units less
than 1.5 times the cut-off. Specificity of the IgG ELIS A using the dairy herd sera was calculated as 96%.
Feedlot cattle
[0228] The descriptive statistics of the M ¾ow.y-speeific antibody units of the cattle before introduction to the feed lot herd and after are summarised in Table 15. The mean was calculated as 56.5 ±70.2 with a cut-off of 196.8. After removal of cattle with antibody units higher than 300 and their contact cattle data the mean had dropped to 46.55 and cut off was calculated as 123.5 All With the removal of cattle with ALT between 300-250 and 250-200 have sightly changed the cut-off from 117.3 to 1 1.4 A.U (Table 15). The cut-off 111.4 was selected as the steady cut-off point for the feedlot cattle as the two serum populations day 0 and day 42 cross over close to 11 1.4 (Figure 14). Out of 7448 cattle, 90% were sero-negetive for M. bovis before introduction to the feedlot herds and 73.5 % of them have sero-converted afte 6 weeks in the feedlot, either due to infection, exposure or subclinical infectio with M. bovis.
|0229] Hence, the M doiw-specific IgG ELISA is able to detect M, bovis infection in calves as well as adult cattle and can be used as a sera-diagnostic assay to screen for carriers for M. bovis.
EXAMPLE 8
Further char cterimtkm of MilA
[0230] MilA is a 226 kDa protein identified from M. b ' ovis strain 3683 by Western blotting. MilA is immunoreactive based on &oi7,v-speeific calf sera. MilA was estimated to be 226 kDa, but the gene encoding it, ,MBOVPG45__0710 (MilA), which was identified by mass speetrometri analysis of tryptie peptides derived from it, was predicted to encode a 30 kDa protein, suggesting that MilA may be cleaved into 2 peptides, as is see with the ciliary adhesin of M hyopneumomae,
[02311 A search of the Pfafn database with MilA revealed that it belonged to the GDSL-like lipase family. The SGNHJrsydroI se superfamily is characterized by conserved single residues of serine, glycine, aspargine and histidine in each of the four blocks I, Π, III and V (Merlgaard et al (2000) Structure #:373-383). Although most carboxylesterase genes encode the conserved GxSxG motif (Wei et al (1995) Nat Struct Mol, Biol 2:218- 223), Upton and Buckley (1995) Set 20: 178-179 identified this new family of hydrolases (lipases) to contain a GxSxS (GDSLS) motif In MilA, the conserved amino acid serine is present in block I in the motif GDSL not GDSL as in the amino-terminal homolog mhp677 / P65 ofM hyopnetmioniae . In block III, Mil A and the M cotumbimm and M. fermentam homologs (Rechnitzer et al (2011) Microbiology 757:760-773; Shu et al (201 1 ) J. Bacterial 793:4302-4303) contain the conserved AND motif, but not the glycine in the conserved GXND motif found in other hydrolases (Lo et l (2003) J. Mot Biol 330:539- 551 ). Block V contains the conserved motif DXXHP, but in all the Mycoplasma proteins, including mhp67 in M. hyopneumomae and MilA, the conserved motif was DXHP. Therefore, the Mycoplasma lipases/hydrolases comprise a new lipolytic enzyme family.
[0232] Under experimental conditions an IgG ELISA based on a fragment of MilA is a fast, convenient, sensitive and reproducible method to detect cattle infected with M. bovis. The concentration of recombinant MilA antigen needed (1.2 /welί) was quite low, highlightin its sensitivity for use as an ELIS.A antigen. The dilution used to test sera (1/300) was higher tha that used in .other ELIS As (Bereiter et at. (1990) Vet. Microbiol
25: 177-192), allowing more freedom to adjust the test serum dilution and thus assess very low concentrations of antibody against hi bovis. An increase in M &ovw'-specific IgG titers could be detected 3 weeks after experimental infection and the ELISA was found to have a high sensitivity, making it a suitable diagnostic tool for field situations.
[0233] Use of a single, highly immimoreaetive protein is highly likely to result in a more specific ELISA. The most immunoreactive antigens in the M bovis cell membrane are the Vsps (variable surface proteins), but while the Vsps may have diagnostic utility (Brank et al. (1999) Clin, diagn. 1Mb. Immunol. 6; 861-867), they are subject to phase variation and antigenic variation, which may result in variations in the antibody response against them in individual infected cattle and compromise the sensitivity of the assay Poumarat et al. (1999) supra; Buchenau et al (2010) Res. Vet. Set 59:223-229). Therefore, use of a protein such as Mil A that is not subject to phase or antigenic variation,, but is still highly immunoreactive, is proposed to result in a useful diagnostic tool.
[0234] Those skilled in the art will appreciate that the disclosure described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure contemplates all such variations and modifications. The disclosure also enables all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features or com positions or compounds.
Table 4
Homologs of mil A in other mycoplasma specie
Query Amino acid
Predicted gene
Organism Gene name coverage (% sequence function
of residues) similarity
MBGVPG45J)7IQ
M. bovis PG45 Membrane protein 100% 100%
(milA)
M hovis Hubei- Conserved
MMB__06'54 99% 92% I hypothetical protein
M agaiactiae Conserved
MAGa6830 100% 89% sir 5632 hy potheti cal protei n
M agaiactiae Conserved
MAG„6100 100% 89%
PG2 hypothetical protein
M bovis Hubei- Conserved
MMB_Q318 99% 75% 1 hypothetical protein
M coh binum
MCSF7_01871 Lipase 99% 48%
SF7
M. fermentam
FE_Q257Q Lipase 97% 49%
JER
M fermentam
MfeM64YM 0307 Hypothetical protein 97% 49%
M64
Table 5
Anti-M. hovis IgG titers of calf sera from Experiment 1
Geometri c mean of anti- bovis IgG titers
Group Number DDaayyss aafftteerr cchhaalllleennggee
of calves * —
10 ' 17 24
1 Uninfected 4 1.38a L4a 1.353
2 Infected 12 L26^ L3_5^ 2., 1,5*
Values marked with the same superscript letters are not significantly different (P <0.05)
Table 6
Anti-M. hovis IgG titers of calf sera from Experiment 2
Geometric mean ofanti- bovis IgG titers
Group No. calves Days after challenge
10 17 24
1 Uninfected 5 J .35 ' l ,23:i 1.25a
2 Infected 30 L12a L3a 2.3b
Values marked with the same superscript letters are not significantly different (P <0,05)
Table 7
Anti-M, hovis IgG titres of calf sera from Experiment 3
Geometric mean anti-M bovis IgG titres
Group No. calves Days after challenge
10 17 24
1 Uninfected 5 1.35a i,23a 1.25a
2 Wild-type 30 1.12;1 1.3* 1.3
-d
3 Vaccine A 31 1.4b I .97c 2.5
Values marked with the same superscript letters are not significantly different (p < 0.05)
Table S
Number of calves positive in each group in Experiment 3 using cut off value of 65
Number of animals positive on day :
Group No. calves
0
Uninfected 0
Wild-type 30 0
Days after challenge are highlighted.
Table 9
Sensitivity oflgG ELISA
Days after challenge are highlighted.
Table 10
Anti-M. bovis IgMtitres of calf sera from Experiment 3
Geometric mean anti- bovis IgM litres
No.
Group Days after challenge
calves
0 10 17 24 Uninfected 5 2.02a 1.9a 1 .78a 1.89a Wild-type 30 i .89''' 1.99* 2.3¾ 2.35 Vaccine A 1 \ .≠ 2.15a 2 35b 2.5b
Values marked with the same superscript letters are not significantly different (p < 0.05)
Tabl 11
Number of calves positive in each group i Experiment 3 using a cut off value 287
No. No, positive on dav:
Group
calves 0 7 14 18_ 2S 35 42
Uninfected 5 0 0 0 0 mm§B
Wild-type 30 3 0 0 0 lllltlll 1 I II 11111
Vaccine A 31 2 0 2 1 1
Days after challenge are highli ghted.
Table 12
Sensitivity oflgM EIJSA
Table 13
Primers used to done regions of the MBOVPG4S0710 (milA gene for expression
Lower case letters - restriction endonudease cleavage sites included to aid cloning of PCR products
Table 14
Number of calves positive in each group in experimental studies using a cut-off of 65 antibody units (A.U)
¾fi¾s- R&alteiige sirs ?,h¾d ?d
Table 15
Descriptive statistics for deedlot cattle M. bmis-specific antibody units on Day 0
No. of Cut-off
Mean AU SD Sero-negative % animals value
Total data 7448 56.5 70,2 196.8 96,5
AD >300
5395 46.6 38.4 123.5 95.4 removed
AU 300-250
5373 45,6 35.8 1 173 95, 1 removed
AU 250-200
5343 44.6 33,4 111.4 94,7 removed
BIBLIOGRAPHY
Aiberti etal (2006)./ Vet, Diagn,, Invest, 18:41-51
Arcangioii etal. (2008) Vet J.777:89-93
Ayling et al. (1997) Vet Rc.7 7:307-308
Ayling et al (2Q00) Vet Rec.7^:745-747
Bali etal. (1994b) /it i¾ J.77:45
Be rens et al. (] 994) Infect Imtmm.62:5075-5084
Bereiter et al. (1990) Vet Microbiol.25:177-192
Brank ei a! (1999) Clin, diagn. Lab. Immunol 6:861-867
Buchenau .etal. (2010) Res. Vet Sci. «9:223-229
Coligan et l. (1991-1997) Current Protocols in Immunology
Crabh etal. (1995) Arch. Virol.740:245-258
Czaja etal. (2002) f¾ Rec.150:9-11
Duffy ί?/α/. (1999) J Clin. Microbiol.37.1024-1029
Gageaei a. (2006) J. Vet Diagn. Invest 18:29-40
( ier etal (1977), Somatic Cell Gene 3: 231-236
Gonzalez et al. (1995) Vet. Microbiol. ¥7: 183-190
Hale et al. (1962) Cornell Vet. 52: 193-200
Heller et al. ( 1993) Vet. Microbiol. 57:127-133
ohler et al (1975), Nature 256:495-499
Koshler era/. (1976), Eur.. J. Immunol 60:51 1 -51
LaFaunce and McEntee (1982) Cornell Vet. 72: 160- 167
Li etal. (201 1) P.LoS ONE <5:e20999
l.o mi. (2003) J. Mai. Biol. 550:539-551
Markham <?* «/. (1998) Infect. Immuri. 66:2845-2853
¾*¾igaard et al. (2000) Structure #:373-38'3
Nicholas et at. (2002) Vaccine 20:3569-3575
Noorraoharaniadi et al. (1999) Microbiology / 5:2087-2094
Pfuetzner ( 1996) Rev, .Set. Tech. Off. Int. Epi∑< 75: 1477
Poumarat ef #/. FEMS Microbiol. Lett. i?5: 103-1 10
Rechnitzer et al (2011) Microbiology 757:760-773
Robinoeia/. (2005) Vet Microbiol 109:201-209 Sachses/. (1993) Rev. Sci. Tech. Off. Inf. Epiz, 72:571-580 Schema etal. (2002) Vet. Microbiol W.141-150 Schmidt etal. (2004) J. Bacterial 18.6:5790-579$ Shu et l. (2011) J. BacterioL / 93:4302-4303 Shulman etal (1978), Nature 276:269-270 Stipovits etal. (1993) Acta Vet. Hung.4.1:73-$$
Toy am a et al (1987), Monoclonal Antibody, Experiment Manual, published by Kodansha Scientific
Trowbridge (1 82), J. Exp. Med 148(1):220-221
Upton and Buckley (1 95) Set.2(7:178-179
Yolk et L (1982) J. Virol 42{l):22Q-227
W&\z etal. (1997) J. Vet. Diagti Invest.9:250-254
Wawegam e-1? a/, (2012) Vet. Microbiol.158:220-224
Wei et l. (1995) Nat. Struct. Mol Biol.2:218-223
Wmet l, {2011) Infect. Immwh 79:982-983
Claims
1. A method for detecting current or prior exposure of a ruminant subj ect to a species of Mycoplasma, said method comprising contacting an antibody containing sample from the subject with an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NOi or an amino acid sequence having at least 40% similarity to SEQ ID NQ: 1 after optimal alignment or an antibody-binding fragment of said protein, for a time and under conditions sufficient for an antibody specific for said protein, i present in the sample, to bind to said protein and then detecting for the presence of bound antibody wherein the presence of bound antibody is indicative of current or prior exposure to Mycoplasma spp.
2. The method of Claim 1 wherei the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NGs2: through 8 or SEQ ID Nos: 15 through 21 or is an antibod -binding fragment thereof.
3. The method of Claim 2 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID HO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO:'2 or SEQ ID NO: 15 after optimal alignment or is an antibody- binding fragment thereof.
4. The method of Claim 3 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO: 15 or is an antibody-binding fragment thereof.
5. The method of Claim 4 wherein the species oi Mycoplasma is Mycoplasma hovis.
6. The method of Claim 1 wherein bound antibody is detected by an antiimmunoglobulin antibody labeled with a reporter molecule capable of providing an identifiable signal.
7. The method of Claim 6 wherein the anti -immunoglobuli antibody is an anti-lgG antibody.
8. The method of Claim 6 wherei the reporter molecule is selected from the list consisting of an enzyme, chemiluminescence molecule, radioactive isotope, or a molecule providing an impedance or optical signal,
9. The method of Claim 8 wherein the reporter molecule is an enzyme.
10. The method of Claim 8 wherein the chemiluminescence molecule is a fluorescent molecule.
11. The method of any one of Claims 1 to 10 wherein the sample is selected from the li st consisting of serum, whole blood, milk, respiratory fluid or a nasal swab.
12. The method of Claim 1 wherein the ruminant subject is selected from a cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod.
13. The method of Claim 1 wherein the subject is a cow.
14. A device for screening for current or prior exposure of a ruminant subject to a species of Mycoplasma, the device comprising an immobilized protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO. l or a amino acid sequence having at least 40% similarity to SEQ ID NO: 1 after optimal alignment or an antibody-binding fragment of said protein, the device further comprising means to contact a sample from the subject with the immobilized protein.
1 5. The device of Claim 14 wherein the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NOs: 2 through 8 or SEQ ID NOs.TS through 21 or is an antibody-binding fragment thereof.
16. The device of Claim 15 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO: 15 or an. amino acid sequence having at least 40% similarity to SEQ ID NO:2 or SEQ ID NO: 15 after optimal alignment or is an antihody- binding fragment thereof.
17. The device of Claim 16 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO: 15 or is an antibody-binding fragment thereof
18. The device of Clai m 14 wherein the ruminant -subject is selected from a cow, sheep, goat giraffe, yak, camel, llama, antelope and macropod.
19. The device of claim .18 wherein the ruminant subject is a cow.
20. The device of Claim 19 wherein the species of Mycoplasma is Mycoplasma hovis.
21. A method for controlling infection by a species of Mycoplasma in a ruminant subject, said method comprising administering to said subject an antibody-inducing effective amount of a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: 1 or an amino acid sequence having at least 40% similarity to SEQ ID NO: I after optimal alignment for a time and under conditions sufficient to generate antibodies to said protein.
22. The method of Claim 21 wherein the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID Nos: 2 through 8 or SEQ ID NOs: 15 through 1 or is an antibody-binding fragment thereof
23. The method of Claim 22 wherein the protein compri ses the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO: 15 or an amino acid sequence having at least 40% similarity to SEQ ID NO:2 or SEQ ID NO: 15 after optimal alignment or is an antibody- binding fragment, thereof.
24. The method of Claim 23 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO :2 or SEQ ID NO: 15 or is an antibody-binding fragment thereof.
25. The method of Claim 21 wherein the ruminant subject is selected from a cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod,
26. The method of Claim 25 wherein the ruminant subject is a cow.
27. The method of Claim 26 wherein the species of 'Mycoplasma is Mycoplasma hovis.
28. A composition comprising a protein or derivative thereof comprising the amino acid sequence set forth in SEQ ID NO: l or an amino acid sequence having at least 40% similarity to SEQ ID NO; 1 after optimal alignment and one or more pharmaceutically acceptable earners, excipients and/or diluents.
29. The composition of Clai 28 wherein the protein comprises an amino acid sequence selected from the listing consisting of SEQ ID NQs2: through 8 or SEQ ID NOs: 15 through 21 or is an antibody-binding fragment thereof;
30. The composition of Claim 29 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 15 or an amino aeid sequence having at least 40% similarity to SEQ ID NO;2 or SEQ ID NO: 15 after optimal alignment or is an antibody -binding fragment thereof.
31. The composition of Claim 30 wherein the protein comprises the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 15 or is an antibody-binding fragment thereof.
32. Use of the composition of any one of Claims 28 to 31 in the manufacture of a medicament for the treatment or prophylaxis of Mycoplasma infection in a ruminant subject.
33. Use of Claim 32 wherein the ruminant subject is selected from a cow, sheep, goat, giraffe, yak, camel, llama, antelope and macropod.
34, Use of Claim 33 wherein the subject is a cow.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2013903549A AU2013903549A0 (en) | 2013-09-16 | A serological test | |
| AU2013903549 | 2013-09-16 | ||
| AU2014902094A AU2014902094A0 (en) | 2014-06-02 | A serological test - ii | |
| AU2014902094 | 2014-06-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015035474A1 true WO2015035474A1 (en) | 2015-03-19 |
Family
ID=52664849
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2014/050231 Ceased WO2015035474A1 (en) | 2013-09-16 | 2014-09-16 | Serological test |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015035474A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107118262A (en) * | 2016-02-24 | 2017-09-01 | 华中农业大学 | A kind of Mycoplasma bovis MbovP579 albumen and its application |
| CN110256555A (en) * | 2019-06-04 | 2019-09-20 | 中国农业科学院兰州兽医研究所 | A kind of mycoplasma filamentous cluster monoclonal antibody and its preparation method and application |
| CN110746504A (en) * | 2019-11-06 | 2020-02-04 | 华中农业大学 | Monoclonal antibody of anti-mycoplasma bovis Mbovp579 protein and application thereof |
| CN112979767A (en) * | 2021-02-08 | 2021-06-18 | 山东省滨州畜牧兽医研究院 | Antigen composition for detecting mycoplasma bovis antibody, kit and application thereof |
| WO2022216162A1 (en) * | 2021-04-09 | 2022-10-13 | Pictor Limited | Multiplex immunoassay for the detection of mycoplasma bovis infection |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2722509A1 (en) * | 1994-07-15 | 1996-01-19 | Pasteur Institut | IDENTIFICATION OF GENES ENCODING PROTEINS HAVING ESTERASE ACTIVITY IN DIFFERENT MYCOPLASMA MYCOIDES STRAINS |
| US5788962A (en) * | 1995-01-17 | 1998-08-04 | The Curators Of The University Of Missouri | DNA sequences coding for mycoplasma hyopneumoniae surface antigens, corresponding proteins and use in vaccines and diagnostic procedures |
| WO2003004051A2 (en) * | 2001-07-02 | 2003-01-16 | Pfizer Products Inc. | Mycoplasma hyopneumoniae vaccine and methods for reducing mycoplasma bovis pneumonia in cattle |
-
2014
- 2014-09-16 WO PCT/AU2014/050231 patent/WO2015035474A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2722509A1 (en) * | 1994-07-15 | 1996-01-19 | Pasteur Institut | IDENTIFICATION OF GENES ENCODING PROTEINS HAVING ESTERASE ACTIVITY IN DIFFERENT MYCOPLASMA MYCOIDES STRAINS |
| US5788962A (en) * | 1995-01-17 | 1998-08-04 | The Curators Of The University Of Missouri | DNA sequences coding for mycoplasma hyopneumoniae surface antigens, corresponding proteins and use in vaccines and diagnostic procedures |
| WO2003004051A2 (en) * | 2001-07-02 | 2003-01-16 | Pfizer Products Inc. | Mycoplasma hyopneumoniae vaccine and methods for reducing mycoplasma bovis pneumonia in cattle |
Non-Patent Citations (4)
| Title |
|---|
| ADAMU, J. Y. ET AL.: "Membrane proteins of Mycoplasma bovis and their role in pathogenesis", RESEARCH IN VETERINARY SCIENCE, vol. 95, no. 2, 27 June 2013 (2013-06-27), pages 321 - 325 * |
| DATABASE GENBANK 11 March 2010 (2010-03-11), accession no. AV27666 * |
| DATABASE GENBANK 25 January 2011 (2011-01-25), accession no. DR24994 * |
| WAWEGAMA, N. K. ET AL.: "Development of a recombinant protein-based enzyme-linked immunosorbent assay for diagnosis of Mycoplasma bovis infection in cattle", CLINICAL AND VACCINE IMMUNOLOGY, vol. 21, no. 2, 2014, pages 196 - 202 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107118262A (en) * | 2016-02-24 | 2017-09-01 | 华中农业大学 | A kind of Mycoplasma bovis MbovP579 albumen and its application |
| CN110256555A (en) * | 2019-06-04 | 2019-09-20 | 中国农业科学院兰州兽医研究所 | A kind of mycoplasma filamentous cluster monoclonal antibody and its preparation method and application |
| CN110746504A (en) * | 2019-11-06 | 2020-02-04 | 华中农业大学 | Monoclonal antibody of anti-mycoplasma bovis Mbovp579 protein and application thereof |
| CN110746504B (en) * | 2019-11-06 | 2021-01-15 | 华中农业大学 | Monoclonal antibody of anti-mycoplasma bovis Mbovp579 protein and application thereof |
| CN112979767A (en) * | 2021-02-08 | 2021-06-18 | 山东省滨州畜牧兽医研究院 | Antigen composition for detecting mycoplasma bovis antibody, kit and application thereof |
| WO2022216162A1 (en) * | 2021-04-09 | 2022-10-13 | Pictor Limited | Multiplex immunoassay for the detection of mycoplasma bovis infection |
| EP4320438A4 (en) * | 2021-04-09 | 2025-02-26 | Pictor Limited | MULTIPLEX IMMUNOASSAY FOR THE DETECTION OF MYCOPLASMA BOVIS INFECTION |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3328644B2 (en) | Isolation and recultivation of pathogenic Borrelia burgdorferi strain, pathogenic Borrelia burgdorferi | |
| Moffitt et al. | Identification of protective pneumococcal TH17 antigens from the soluble fraction of a killed whole cell vaccine | |
| WO1992000055A1 (en) | Compositions and methods for the prevention and diagnosis of lyme disease | |
| WO2015035474A1 (en) | Serological test | |
| US20140112948A1 (en) | Multi-Target Recombination Gene and the Application of its Protein to Prevent and Cure Helicobacter Pylori | |
| KR20160102993A (en) | Mutant fragments of ospa and methods and uses relating thereto | |
| WO2021206638A1 (en) | Vaccine and/or antibody for viral infection | |
| Luo et al. | Immunogenic proteins and their vaccine development potential evaluation in outer membrane proteins (OMPs) of Flavobacterium columnare | |
| Li et al. | A novel dendrimeric peptide induces high level neutralizing antibodies against classical swine fever virus in rabbits | |
| US8703432B2 (en) | Recombinant Treponema spp. proteins for use in vaccine, antibodies against said proteins, and diagnostic and therapeutic methods including the same | |
| Zhou et al. | A canine-derived chimeric antibody with high neutralizing activity against canine parvovirus-2 | |
| CN103724413B (en) | Trichina paramyosin B cell antigen epi-position 8A1 and application thereof | |
| WO2015199618A1 (en) | Epstein-barr virus lmp2 specific antibody and uses thereof | |
| CN101981052B (en) | Compositions, methods and kits | |
| KR20220009960A (en) | Recombinant Classical Swine Fever Virus | |
| ES2358804T3 (en) | CAMPYLOBACTER JEJUNI POLIPEPTIDES LOCATED IN SURFACE. | |
| Faber et al. | Production, quality control, stability and pharmacotoxicity of a malaria vaccine comprising three highly similar PfAMA1 protein molecules to overcome antigenic variation | |
| Hasan-Abad et al. | Functional deimmunization of interferon beta-1b by identifying and silencing human T cells epitopes | |
| CA2901333C (en) | Novel toxins in type a clostridium perfringens | |
| CA2520386A1 (en) | Nontypeable haemophilus influenzae virulence factors | |
| Parra et al. | Identification, cloning, expression, and purification of Francisella lpp3: an immunogenic lipoprotein | |
| JP2003501013A (en) | Lawsonia-derived genes and related SodC polypeptides, peptides and proteins and uses thereof | |
| Qin et al. | Production of an anti-idiotypic antibody single chain variable fragment vaccine against Edwardsiella tarda | |
| JP2003516113A (en) | Lawsonia-derived genes and related FlgE polypeptides, peptides and proteins and uses thereof | |
| MX2010009516A (en) | Novel sequences of brachyspira, immunogenic compositions, methods for preparation and use thereof. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14844316 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14844316 Country of ref document: EP Kind code of ref document: A1 |








