WO2015035235A1 - Compositions and methods for increasing mesenchymal stromal cell migration to tumors - Google Patents

Compositions and methods for increasing mesenchymal stromal cell migration to tumors Download PDF

Info

Publication number
WO2015035235A1
WO2015035235A1 PCT/US2014/054389 US2014054389W WO2015035235A1 WO 2015035235 A1 WO2015035235 A1 WO 2015035235A1 US 2014054389 W US2014054389 W US 2014054389W WO 2015035235 A1 WO2015035235 A1 WO 2015035235A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
mscs
msc
cancer
ramf
Prior art date
Application number
PCT/US2014/054389
Other languages
French (fr)
Inventor
Guillermo Daniel MAZZOLINI
Mariana Gabriela GARCIA
Juan BAYO
Original Assignee
Consejo Nacional De Investigaciones Cientificas Y Tecnicas (Conicet)
Asociacion Civil De Estudios Superiores
Inis Biotech Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Nacional De Investigaciones Cientificas Y Tecnicas (Conicet), Asociacion Civil De Estudios Superiores, Inis Biotech Llc filed Critical Consejo Nacional De Investigaciones Cientificas Y Tecnicas (Conicet)
Priority to US14/916,963 priority Critical patent/US20160220612A1/en
Priority to EP14842369.2A priority patent/EP3047275B1/en
Publication of WO2015035235A1 publication Critical patent/WO2015035235A1/en
Priority to US15/892,680 priority patent/US11173180B2/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662Stem cells
    • C12N5/0668Mesenchymal stem cells from other natural sources
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0652Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0669Bone marrow stromal cells; Whole bone marrow
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/20Cytokines; Chemokines
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/40Regulators of development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998Proteins not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2502/00Coculture with; Conditioned medium produced by
    • C12N2502/99Coculture with; Conditioned medium produced by genetically modified cells

Definitions

  • MSCs Mesenchymal stromal cells
  • fibroblasts also referred to as fibroblastic colony forming units or mesenchymal stem cells
  • MSCs Mesenchymal stromal cells
  • specific markers e.g., CD105+, CD90+, CD73+
  • lack of hematopoietic markers e.g., CD45, CD34, CD14 or CDl l b, CD79a or CD19
  • HLA class II HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts
  • MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord; from the latter case, MSC are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1 176: 101 -1 17).
  • WJ-MSCs Wharton's jelly
  • perivascular areas mesenchymal cells harvested from umbilical cord perivascular tissue
  • CB-MSCs umbilical cord blood
  • MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469).
  • HCC hepatocellular carcinoma
  • Autocrine motility factor is a 55-kDa cytokine (SEQ ID NO: 1 ) secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306).
  • AMF was isolated, purified, and partially characterized from the serum-free conditioned medium of human A2058 melanoma cells (Liotta, L. A., R. Mandler, et al. (1986)).
  • AMF exhibits sequence identity with glucose- 6-phosphate isomerase (GPI) (alternatively known as phosphoglucose isomerase or phosphohexose isomerase (PHI)), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963).
  • GPI glucose- 6-phosphate isomerase
  • PHI phosphohexose isomerase
  • the stimulation of cell motility is induced by the binding to the autocrine motility factor receptor (AMFR), a 78-kDa seven transmembrane glycoprotein with leucine zipper and RI G-H2 motifs (Shimizu, K., M. Tani, et al. (1999) FEBS Lett 456(2): 295-300).
  • AMFR is stably localized in caveolae
  • caveolin-1 Cav-1
  • Cav-1 has the ability to regulate the endocytic pathway through the stabilization of caveolae expression
  • AMF is secreted by different tumors such as lung (Dobashi, Y., H. Watanabe, et al. (2006) J Pathol 210(4): 431 -440), gastrointestinal, kidney and mammary (Baumann, M., A. Kappl, et al. (1990) Cancer Invest 8(3-4): 351-356) as well as by hepatocellular carcinomas (Torimura, T., T. Ueno, et al. (2001 ) Hepatology 34(1 ): 62-71). Migration of hepatocellular carcinoma cells upon AMF stimulation has been associated to upregulation of metalloproteinase 3 (MMP3) (Yu, F. L., M. H.
  • MMP3 metalloproteinase 3
  • Hepatocellular carcinoma is the sixth most common cancer worldwide and the third cause of cancer-related death (Ferenci, P., M. Fried, et al. (2010) J Gastrointestin Liver Dis 19(3): 31 1-317). Most cases of HCC are secondary to either a viral hepatitis infection (hepatitis B or C) or cirrhosis. Curative therapies such as resection or liver transplantation have been demonstrated to improve patient survival (de Lope, C. R., S. Tremosini, et al. (2012) J Hepatol 56 Suppl 1 : S75-87); however, these strategies can Only be applied to a minority of patients. Therefore, there is an urgent therapeutic need for patients with HCC.
  • hepatitis B or C hepatitis B or C
  • Curative therapies such as resection or liver transplantation have been demonstrated to improve patient survival (de Lope, C. R., S. Tremosini, et al. (2012) J Hepatol 56 Suppl 1 : S75
  • the present application relates to the combined use of cellular and gene therapy to deliver therapeutic genes, e.g., an anti-tumor agent, into tumoral or peritumoral tissues.
  • the application relates to compositions and methods for treating a subject with cancer and/or increasing migration of a mesenchymal stromal cells (MSCs) to a tumor or a tumor cell, e.g. hepatocellular carcinoma (HCC), wherein the MSC comprises a therapeutic agent, e.g., an anti-tumor agent, and is stimulated with a recombinant autocrine motility factor (rAMF).
  • MSCs mesenchymal stromal cells
  • HCC hepatocellular carcinoma
  • rAMF autocrine motility factor
  • methods for increasing adhesion of MSCs to endothelial cells with rAMF are disclosed.
  • FIG. 1A-B Shows real-time PCR (RT-PCR) relative expression of (A) up- regulated and (B) down-regulated genes in MSCs exposed to tumor conditioned media (TCM).
  • RT-PCR real-time PCR
  • FIG. 2A-G Shows (A) detection of AMF (55 kDa) by Western blot in CCM derived from HCC cells and TCM from ex vivo HCC s.c. tumors (upper panel). Colloidal Coomassie staining was performed as loading control (lower panel). MSCs migration was analyzed using Boyden chamber assays with rAMF as chemoattractant for (B) BM- MSCs, (C) Mesenchymal cells harvested from umbilical cord perivascular tissue or (D) AT-MSCs. Results are expressed as percentage of control (DMEM) ⁇ SEM.. *p ⁇ 0.05 and **p ⁇ 0.01 vs DMEM (ANOVA and Dunnett's test).
  • E BM-MSCs
  • F Mesenchymal cells harvested from umbilical cord perivascular tissue
  • G AT-MSCs towards TCM derived from HuH7 (gray bars) or HC-PT-5 (black bars) pretreated with anti-AMF-Ab (AMF-ab) or control isotype IgG (IgG-ab) is shown.
  • Results are expressed as percentage of control (isotype control) ⁇ SEM. *p ⁇ 0.05 and **p ⁇ 0.01 vs isotype control (ANOVA and Dunnett's comparison test). Results are representative of 3 independent experiments.
  • Figure 3A-D Shows (A) MMP3 expression determined by qRT-PCR in BM-
  • MSCs black bars
  • Mesenchymal cells harvested from umbilical cord perivascular tissue white bars
  • AT-MSCs gray bars
  • DMEM unpaired Student's t test
  • MMP2 activity evaluated by zymography in supernatants of BM-MSCs black bars
  • Mesenchymal cells harvested from umbilical cord perivascular tissue white bars
  • AT-MSCs pre- stimulated with ⁇ g/mL of rAMF.
  • Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity.
  • One representative image of the zymography is shown.
  • MMP2 activity was evaluated by zymography in MSCs (BM-MSCs, black bars; Mesenchymal cells harvested from umbilical cord perivascular tissue, white bars; and AT-MSCs r! gray bars) culture supernatant stimulated with TCM from HuH7 cells. TCM from HuH7 cells was blocked with anti-AMF (AMF-ab) or isotype control (IgG-ab). Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity. One representative image of the zymography is shown.
  • FIG. 4A-E Shows (A) pretreatment of BM-MSCs with ⁇ g/mL rAMF (black bars) increases chemotaxis towards TCM derived from HuH7 or HC-PT-5 cells compared to untreated cells (white bars). (B) Shows a wound-healing assay of MSCs after pretreatment with rAMF or control (DMEM). Representative images were taken 24 hours after scratching. (C) Adhesion to HMEC-1 endothelial cells was increased in BM-MSCs exposed to rAMF.
  • (D) Shows expression of AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-1), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) by qRT-PCR. * p ⁇ 0.05, ** pO.01 and *** pO.001 vs untreated cells (DMEM, white bars, unpaired Student's t-test.
  • (E) Shows increased expression of AMFR, JNK, p-JN , c-Fos, p-c-Fos and p-CREB in AMF-treated MSCs evaluated by western blot.
  • FIG. 5A-G BM-MSCs pre-stimulated with ⁇ g/ml of rAMF were labeled with
  • FI fluorescence imaging
  • A Shows total fluorescent intensity as calculated by measuring the region of interest (ROI) for all the tissues isolated and the results were expressed as total radiant efficiency, ns, non significant.
  • B Shows representative tumors images of mice inoculated with rAMF- prestimulated BM-MSCs (MSC-rAMF) or unstimulated cells(MSCs). Images represent the average radiant efficiency.
  • Region of interest was calculated for the isolated (C) tumor, (D) liver, (E) lung and (F) spleen and the results were expressed as the average radiant efficiency. **p ⁇ 0.01 vs unstimulated BM-MSCs (unpaired Student's t-test).
  • G Shows microscopic analysis of transplanted CM-Dil-labeled MSCs (red signal indicated by arrows) and DAPI staining in frozen sections of tumors. Magnification x200.
  • MSC-rAMF AMF-pretreated MSCs
  • DMEM unexposed cells
  • *p ⁇ 0.05 vs DMEM ANOVA and Tukey's comparison test.
  • B Multicellular spheroid growth composed by HCC tumor cells, hepatic stellate cells and endothelial cells (control) or also by MSCs or MSCs prestimulated with rAMF (ANOVA and Tukey's comparison test).
  • C In vivo tumor growth of s.c. HuH7 (saline) and also i.v. injected with MSCs or AMF-pretreated MSCs (ANOVA and Tukey's comparison test).
  • FIG. 7A-B (A) Shows in vitro migration of BM-MSCs (black bars) or
  • HUCPVCs (grey bars) towards CCM from HCC (HuH7 and HC-PT-5), hepatic stellate cells (LX-2), fibroblasts (WI-38) or endothelial cells (HMEC- 1). Bars represent the average of MSCs/field (lOx) ⁇ SEM from three representative visual fields. Results are representative of 3 independent experiments. # p ⁇ 0.001 vs DMEM; *** p ⁇ 0.001 vs BM-MSCs. (B) Adhesion towards endothelial cells of BM-MSCs (black bars) or HUCPVCs (grey bars) was measured. Results are representative of 3 independent experiments. *** p ⁇ 0.001 vs BM-MSCs.
  • FIG. 8A-F CM-Dil and DiR pre-labeled MSCs were i.v. injected in s.c. HuH7 bearing mice. At day 3, mice were sacrificed and organs were removed: (A) lungs, livers, spleen and (C) tumors were exposed to obtain fluorescent images. Images represent the average radiant efficiency. Representative images are shown. (B) Total fluorescent intensity for injected BM-MSCs or HUCPVCs was calculated by measuring the region of interest (ROI) for all the tissues isolated and results were expressed as total radiant efficiency [p/s]/ ⁇ W/cm 2 ]. *** p ⁇ 0.001.
  • AMF/AMFR axis proteins was evaluated in BM-MSCs (black bars) or HUCPVCs (grey bars) by qPCR. *** p ⁇ 0.001 vs BM-MSCs.
  • FIG 11A-B Shows (A) Migration (% of control) towards CM-HuH7of MSCs pre-incubated with anti-CXCRl , anti-CXCR2 or both (anti-CXCRl + anti-CXCR2) or isotype control (IgG) for lh. *p ⁇ 0.05 and **p ⁇ 0.01 vs IgG isotype control. (B) Migration (% of control) of MSCs towards CM-HuH7 pre-incubated with anti-HGF or anti-MCP-1 for lh. *p ⁇ 0.05 vs DMEM. Results were expressed as percentage of control (DMEM).
  • isolated in regard to cells, refers to a cell that is removed from its natural environment (such as in a solid tumor) and that is isolated or separated, and is at least about 30% free, about 50% free, about 75% free, about 90% free, about 95% free, or 100%) free, from other cells with which it is naturally present, but which lack the marker based on which the cells were isolated.
  • heterologous refers to, e.g. , a gene, polypeptide or cell that is not in its natural environment; thus, it is non-naturally-occurring.
  • a heterologous gene or polypeptide includes a gene or polypeptide from one species introduced into another species.
  • a heterologous gene or polypeptide also includes a gene or polypeptide native to an organism that has been altered in some way ⁇ e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.).
  • a heterologous cell includes a cell native to an organism that has been altered in some way (e.g., genetically modified to include a recombinant gene, protein, or virus).
  • Tumor and "neoplasm” as used herein refer to any mass of tissue that results from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions.
  • cancer refers to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth.
  • examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include liver cancer (e.g., hepatocellular carcinoma (HCC)), colon cancer, colorectal cancer (e.g., colorectal carcinoma), gastrointestinal cancer, pancreatic cancer, lung cancer, breast cancer, and kidney cancer.
  • HCC hepatocellular carcinoma
  • colorectal cancer e.g., colorectal carcinoma
  • Metalastasis refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location.
  • a “metastatic” or “metastasizing” cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.
  • cancer cell refers to the total population of cells derived from a tumor or a pre-cancerous lesion including both non umorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic cells (e.g., cancer stem cells).
  • tumorigenic cells e.g., cancer stem cells
  • the term “subject” refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment.
  • the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.
  • the term "subject suspected of having cancer” refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical).
  • a subject suspected of having cancer can also have one or more risk factors.
  • a subject suspected of having cancer has generally not been tested for cancer.
  • a "subject suspected of having cancer” encompasses an individual who has received an initial diagnosis but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).
  • the term "subject at risk for cancer” refers to a subject with one or more risk factors for developing a specific cancer.
  • Risk factors include, but are not limited to, gender, age, genetic predisposition, environmental exposure, previous incidents of cancer, pre-existing non-cancer diseases, and lifestyle.
  • the term "subject diagnosed with a cancer” refers to a subject who has been tested and found to have cancerous cells.
  • the cancer can be diagnosed using any suitable method, including but not limited to, biopsy, x-ray, blood test, and the diagnostic methods of the present invention.
  • biopsy tissue As used herein, the terms "biopsy tissue”, “patient sample”, “tumor sample”, and
  • cancer sample refers to a sample of cells, tissue or fluid that is removed from a subject for the purpose of determining if the sample contains cancerous tissue, including cancer stem cells or for determining gene expression profile of that cancerous tissue.
  • biopsy tissue or fluid is obtained because a subject is suspected of having cancer. The biopsy tissue or fluid is then examined for the presence or absence of cancer, cancer stem cells, and/or cancer stem cell gene signature expression.
  • the term "characterizing cancer in a subject” refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue, the stage of the cancer, and the subject's prognosis. Cancers can be characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, any cancer markers disclosed herein.
  • RNA expression refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through “translation” of mRNA.
  • Gene expression can be regulated at many stages in the process.
  • Up-regulation” or “activation” refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while “down-regulation” or “repression” refers to regulation that decrease production.
  • Molecules e.g., transcription factors
  • activators and “repressors,” respectively.
  • the terms “high levels”, “increased levels”, “high expression”, “increased expression”, “elevated levels” or “up-regulated expression” in regard to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells at levels higher than the expression of that gene in a second cell or population of cells.
  • “high levels”, “increased levels”, “high expression”, “increased expression”, “elevated levels” or “up-regulated expression” can be determined by detecting the amount of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis; or by detecting the amount of a protein in tumor cells, for example, by ELISA, Western blot, quantitative immunofluorescence.
  • “reduced expression” or “decreased expression” in regards to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells, at levels less than the expression of that gene in a second cell or population of cells.
  • “Low levels” of gene expression can be determined by detecting decreased to nearly undetectable amounts of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis.
  • “low levels” of gene expression can be determined by detecting decreased to nearly undetectable amounts of a protein in tumor cells, for example, ELISA, Western blot, or quantitative immunofluorescence.
  • the term "undetectable levels” or “loss of expression” in regards to gene expression as used herein refers to expression of a gene in a cell or population of cells, at levels that cannot be distinguished from background using conventional techniques such that no expression is identified.
  • "Undetectable levels” of gene expression can be determined by the inability to detect levels of a polynucleotide (mRNA, cDNA, etc.) in tumor cells above background by, for example, quantitative RT-PCR or microarray analysis.
  • “undetectable levels” of gene expression can be determined by the inability to detect levels of a protein in tumor cells above background by, for example, ELISA, Western blot, or immunofluorescence.
  • nucleic acid molecule refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA.
  • the term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5 -(carboxyhydroxyl -methyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1 -methyladenine, 1 -methylpseudouracil, 1 -methyl guanine, 1 -methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2- methylguanine, 3-methyl-cytosir:e, 5-methylcytosine, N6-methyladenine, 7- methylguanine, 5-methylaminomethyluracil, 5-meth
  • the term "gene” refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA).
  • the polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activities or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length polypeptide or fragment are retained.
  • the term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences.
  • the term "gene” encompasses both cDNA and genomic forms of a gene.
  • a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns” or “intervening regions” or “intervening sequences.”
  • Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns can contain regulatory elements such as enhancers. Introns are removed or “spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • mRNA messenger RNA
  • the mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • a cDNA form of a gene is "intron-free" and non-naturally-occurring.
  • heterologous gene refers to a gene that is not in its natural environment; thus, it is non-naturally-occurring.
  • a heterologous gene includes a gene from one species introduced into another species.
  • a heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.).
  • Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
  • RNA expression refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through “translation” of mRNA.
  • Gene expression can be regulated at many stages in the process.
  • Up-regulation” or “activation” refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while “down-regulation” or “repression” refers to regulation that decrease production.
  • Molecules e.g., transcription factors
  • activators e.g., transcription factors
  • genomic forms of a gene can also include sequences located on both the 5' and 3' end of the sequences that are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the non-translated sequences present on the mRNA transcript).
  • the 5' flanking region can contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene.
  • the 3' flanking region can contain sequences that direct the termination of transcription, posttranscriptional cleavage and polyadenylation.
  • nucleic acid molecule encoding refers to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
  • Polypeptide “peptide” and “protein” are used interchangeably and refer to a polymeric compound comprised of covalently linked amino acid residues.
  • isolated polypeptide refers to a polypeptide or protein that is substantially free of those compounds that are normally associated therewith in its natural state (e.g. , other proteins or polypeptides, nucleic acids, carbohydrates, lipids). "Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which can be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.
  • heterologous polypeptide refers to a polypeptide that is not in its natural environment; thus, it is non-naturally-occurring.
  • a heterologous polypeptide includes a polypeptide from one species introduced into another species.
  • a heterologous polypeptide also includes a polypeptide native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non- polypeptide, etc.).
  • Heterologous polypeptide are distinguished from endogenous polypeptide in that the heterologous polypeptide sequences are typically encoded by cDNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
  • a mutation can be made by any technique for mutagenesis known in the art, including but not limited to, in vitro site-directed mutagenesis (Hutchinson et al., J Biol. Chem. 253:6551 (1978); Zoller et al, DNA 5:479 (1984); Oliphant et al., Gene 44: 111 (1986); Hutchinson et al., Proc. Natl. Acad. Sci. USA 83:710 (1986)), use of TAB® linkers (Pharmacia), restriction endonuclease digestion/fragment deletion and substitution, PCR-mediated/oligonucleotide-directed mutagenesis, and the like.
  • in vitro site-directed mutagenesis Hutchinson et al., J Biol. Chem. 253:6551 (1978); Zoller et al, DNA 5:479 (1984); Oliphant et al., Gene 44: 111 (1986); Hutchinson et
  • a "variant" of a polypeptide or protein refers to any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein can exist in nature.
  • variants can be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or can involve differential splicing or post-translational modification.
  • the skilled artisan can produce non-naturally-occurring variants having single or multiple amino acid substitutions, deletions, additions, or replacements.
  • These variants can include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin.
  • the techniques for obtaining non-naturally-occurring variants including genetic (suppressions, deletions, mutations, etc. ), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.
  • identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
  • identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
  • Identity and similarity can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D.
  • sequence analysis software refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences.
  • Sequence analysis software can be commercially available or independently developed. Typical sequence analysis software includes, but is not limited to, the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI), BLASTP, BLASTN, BLASTX (Altschul et al, J. Mol. Biol. 215:403 (1990)), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, WI 53715 USA).
  • in vitro refers to an artificial environment and to processes or reactions that occur within an artificial environment.
  • In vitro environments can consist of, but are not limited to, test tubes and cell culture.
  • in vivo refers to the natural environment ⁇ e.g., an animal or a cell) that can be, but are not limited to, processes or reaction that occur within a natural environment.
  • ex vivo refers to "outside” the body.
  • in vitro can be used interchangeably herein.
  • sample is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples can be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
  • terms such as “treating” or “treatment” or “to treat” refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder.
  • those in need of treatment include those already with the disorder; those prone to have the disorder; those who may have had the disorder and in whom the disorder may recur; and, those in whom the disorder is to be prevented.
  • a subject is successfully "treated” if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associate with the specific cancer; reduced morbidity and/or mortality; improvement in quality of life; a reduction in the number of or complete absence of cancer stem cells; a decrease in the proportion of cancer stem cells in a solid tumor (relative to cells in the tumor that are not cancer stem cells); inhibit the proliferation of cancer stem cells; and a delay in or an absence of relapse.
  • the term "therapeutically effective amount” refers to an amount of a therapeutic agent, e.g., an antibody, polypeptide, polynucleotide, small organic molecule, or other drug effective to "treat" a disease or disorder in a subject.
  • the therapeutically effective amount of the therapeutic agent can, in certain embodiments, reduce the number of cancer cells; reduce the proportion of cancer cells in a solid tumor; reduce the tumor size; inhibit or stop cancer cell infiltration into peripheral organs; inhibit and/or stop tumor metastasis; inhibit and stop tumor growth; relieve to some extent one or more of the symptoms associated with the cancer; inhibit the proliferation of cancer cells; or result in a combination of such effects on cancer cells.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells presented herein, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
  • MSC Mesenchymal stromal cell
  • MSCs Mesenchymal stromal cells
  • fibroblasts also referred to as fibroblastic colony forming units or mesenchymal stem cells
  • MSCs Mesenchymal stromal cells
  • CD 105+, CD90+, CD73+ fibroblast-like morphology
  • CD45, CD34, CD 14 or CD l i b, CD79a or CD 19 HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts
  • MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord (youngest, most primitive MSCs); from the latter case, MSCs are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (Mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1 176: 101-1 17). Other rich sources for MSCs are the developing tooth bud of the mandibular third molar and amniotic fluid.
  • MSCs can be successfully isolated from human peripheral blood (Chong PP et al. (2012) J Orthop Res. 30(4):634-42).
  • the MSCs can be isolated from the whole umbilical cord and in this case can be referred to as "mesenchymal cells derived from umbilical cord.” It is noted that as the umbilical cord has different structures, and the isolation of MSCs can also be made or harvested from only a "region" or "structure” such as the perivascular tissue, the Wharton ' s jelly, or the umbilical cord blood.
  • MSCs have a great capacity for self-renewal while maintaining their multipotency.
  • a standard test to confirm multipotency is differentiation of the cells into osteoblasts, adipocytes, and chondrocytes as well as myocytes and neurons.
  • Other attractive features of MSCs include that they are readily isolated from bone marrow by their adherence to tissue culture surfaces, they rapidly expanded in culture, they are highly clonogenic in that they efficiently generated single-cell derived colonies, and they are readily seen to differentiate in culture or in vivo into several cellular phenotypes such as osteoblasts, adipocytes, and chondrocytes.
  • MCSs have been observed to have anti-inflammatory effects.
  • the disease models in which MSCs have produced beneficial effects include diabetes, stroke, spinal cord injury, Parkinsonism, Alzheimer's disease, liver disease, kidney disease, and some cancers. See Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469. MSCs have also been shown to contribute to cancer progression, e.g., hematological malignancies (Torsvik A. and Bjerkvig R. (2013) Cancer Treat Rev. 39(2)180-8).
  • MSCs have the ability to migrate and engraft tumors and it is thought that factors produced by tumor cells and their microenvironments are responsible. MSC motility in vitro has been induced after stimulation with different cytokines (Ries, Egea et al. (2007). Blood 109(9): 4055-4063), growth factors (Ponte, Marais et al. (2007) Stem Cells 25(7): 1737-1745), or chemokines such as CXCL7 (Kalwitz, Endres et al. (2009) Int J Biochem Cell Biol 41 (3): 649-658) or SDF-1 (Gao, Priebe et al. (2009) Stem Cells 27(4): 857- 865).
  • cytokines Ries, Egea et al. (2007). Blood 109(9): 4055-4063
  • growth factors Pieris factor
  • chemokines such as CXCL7 (Kalwitz, Endres et al. (2009) Int J Biochem Cell Biol
  • this application is the first report demonstrating the increased MSCs in vivo migration towards HCC with a simple treatment with rAMF. Reports have demonstrated MSC migration towards a number of tumor-released factors ⁇ e.g., VEGF, PDGF, TGF- ⁇ , MCP-1 , IL-8, TNF-a, IL- ⁇ ⁇ , IL-6, SDF-1 , and HGF).
  • tumor-released factors e.g., VEGF, PDGF, TGF- ⁇ , MCP-1 , IL-8, TNF-a, IL- ⁇ ⁇ , IL-6, SDF-1 , and HGF.
  • MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469). Although there are some promising results with MSCs genetically modified as a therapeutic option for HCC (Gao, Yao et al. (2010) Oncogene 29(19): 2784-2794; Niess, Bao et al.
  • MSCs e.g., MSCs genetically modified to express an anti-tumor gene
  • rAMF rAMF
  • a method for the genetic modification of MSCs is by chemical ⁇ e.g. Lipofectamine) or physical (e.g. electroporation) transfection or viral vectors. Afterwards stably transfected cells can be selected, where the transgene cassette has integrated by chance into the MSC genome.
  • the genetic modification of MSCs is by using non-viral vector systems derived from transposons. After flanking of an expression cassette with terminal inverted repeats, a construct can be transferred into MSC via transfection. If a transposase is expressed in trans during the transfection, the expression cassette will be stably integrated into the genome of the MSC.
  • a genetically modified MSC according to some embodiments of the invention can be prepared by transduction of native MSCs with pseudotyped virions, expressing foreign glycoproteins on their surface, which alter the tropism and often the titer of the virion.
  • a genetically modified MSC can be engineered to express an oncolytic virus expressing anti-tumor genes.
  • Autocrine motility factor is a 55-kDa cytokine secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306).
  • AMF exhibits sequence identity with glucose-6-phosphate isomerase (GPI), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963).
  • GPI glucose-6-phosphate isomerase
  • AMFR autocrine motility factor receptor
  • Cav-1 caveolin-1
  • AMF-induced motility is mediated by upregulation of MMP2 and MMP3 (Torimura, Ueno et al. (2001 ) Hepatology 34(1): 62-71 ; Yu, Liao et al. (2004) Biochem Biophys Res Commun 314(1 ): 76-82).
  • AMF was shown to increase the expression of mRNA MMP3 in MSCs. It was previously reported that MSCs exposed to CM derived from HCC cell lines increased their MMP2 activity (Garcia, Bayo et al.
  • AMF present in the CM is, at least in part, responsible for the increased in MMP2 activity since blockage of AMF decreased MMP2 activity.
  • stimulation with rAMF increased the invasion capacity of MSCs across collagen and the MMPs inhibitor significantly decreased the invasion capacity of MSCs.
  • AMF is produced by several tumors, such as lung (Dobashi, Watanabe et al.
  • AMF is not considered a typical chemotactic factor such as VEGF, PDGF, TGF- ⁇ ,
  • AMF intracellular AMF
  • IL-8 TNF-a
  • IL- ⁇ ⁇ IL-6
  • SDF-1 SDF-1
  • HGF HGF
  • intracellular AMF has been shown to be involved in glucose metabolism in all types of cells and some reports have described the extracellular form of AMF as inducing tumor migration and endothelial cell migration related to angiogenesis.
  • AMF-induced migration has been described in tumor cells and its role in metastasis.
  • exogenous AMF stimulated migration of human cancer melanoma, fibrosarcoma and HCC cells as well as human umbilical vein endothelial cells (HUVECs) (Liotta, Mandler et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306; Silletti, Watanabe et al. (1991) Cancer Res 51(13): 3507-351 1 ; Watanabe, Carmi et al.
  • AMFR has been found stably localized to caveolae at the plasma membrane caveolin-1 , a caveolar coat protein that has been described as a negative regulator of caveolae-mediated endocytosis of AMFR to the endoplasmic reticulum (Le, Guay et al. (2002) J Biol Chem 277(5): 3371-3379). It is disclosed herein that rAMF treatment of MSCs induced AMFR and caveolin-1 and -2 expressions, supporting their role in the maintenance of the receptor on the cell surface.
  • AMF enhances integrin ⁇ activity leading to activation of mitogen activated protein kinase (MAPK) and Rho pathways (Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71).
  • MPK mitogen activated protein kinase
  • Rho pathways Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71).
  • Small GTPase is largely involved in motility and cell adhesion due to its role in cytoskeleton organization. GTPase activity is regulated by GTPase-activating proteins (GAPs) and GDP dissociation inhibitors (GDIs).
  • GAPs GTPase-activating proteins
  • GDIs GDP dissociation inhibitors
  • GDI2 Rho GDP dissociation inhibitor
  • GDI2 Rho GDP dissociation inhibitor
  • rAMF treatment decreased mRNA of GDI-2, supporting its role as inhibitor of migration.
  • rAMF is a chemoattractant factor for MSCs, e.g., MSCs comprising a therapeutic agent.
  • the AMF can be naturally produced or recombinant.
  • the AMF is human AMF.
  • the AMF comprises the polypeptide sequence of SEQ ID NO: l or a functional fragment thereof.
  • the AMF comprises a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100%) identical to an AMF amino acid sequence that is naturally produced in an animal ⁇ e.g., SEQ ID NO: l).
  • the AMF comprises or consists of a sequence having at least 80%, at least 85%o, at least 90%, at least 95%, at least 99%, or 100%) sequence identity to SEQ ID NOT or a functional fragment thereof.
  • Certain embodiments are directed to a composition
  • a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has (1 ) increased migration to a tumor or a tumor cell after rAMF stimulation and/or (2) increased adhesion to an endothelial cell, e.g., a vascular endothelial cell, after rAMF stimulation.
  • MSC mesenchymal stromal cell
  • rAMF autocrine motility factor
  • Certain embodiments are directed to a composition
  • a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has increased migration to a tumor or a tumor-derived cell.
  • the increased migration is relative to or compared to MSC without rAMF stimulation.
  • Certain embodiments are directed to a composition
  • a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (AMF), wherein the MSC comprises a therapeutie agent and wherein the MSC of the composition has increased adhesion to an endothelial cell, e.g., a vascular endothelial cell.
  • the increased adhesion is relative to or compared to MSC without rAMF stimulation.
  • the increased migration and/or adhesion is about 1.5-fold, about 2-fold, about 2.5-fold, or about 3-fold greater than migration and/or adhesion of the MSC without rAMF stimulation. In some embodiments, the increase in migration and/or adhesion is at least about 20-60%, 30-60%, 40-60%, 30-50%, or 20-40% greater than migration and/or adhesion of the MSC without rAMF stimulation.
  • the MSC of the composition is selected from the group consisting of bone marrow MSC, adipose tissue MSC, umbilical cord MSC, and any combination thereof.
  • the tumor is a solid tumor or cancer.
  • the tumor is a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, or a combination thereof.
  • the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma.
  • the tumor or the tumor cell expresses endogenous AMF.
  • the therapeutic agent is a recombinant anti-tumor gene
  • an interferon e.g., interferon a, interferon ⁇
  • an interleukin interleukin 1 , interleukin 12
  • a chemokine e.g., CX3CL1
  • a suicide gene e.g., thymidine kinase, IL- 12, IFN-gamma, TNF-alpha
  • a cytotoxic drug an antibody, or an oncolytic virus.
  • the therapeutic agent is an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., HI 01), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia).
  • OV oncolytic virus
  • the oncolytic virus is engineered to expresses a recombinant anti-tumor gene.
  • the recombinant oncolytic virus is an oncolytic adenovirus.
  • the therapeutic agent is an oncolytic virus (see, e.g., Dwyer RM et al. (2010) Stem Cell Res Ther. 1(3):25), e.g., onyx-015 (see, e.g., Khuri FR et al. (2000) Nat Med. 6(8):879-85); Ad-F512(H-N)5/3 (see, e.g., Viale D.L., et al. (2013) J Invest Dermatol doi: 10.1038/jid.2013.191 (e-publication ahead of print)).
  • oncolytic virus see, e.g., Dwyer RM et al. (2010) Stem Cell Res Ther. 1(3):25
  • onyx-015 see, e.g., Khuri FR et al. (2000) Nat Med. 6(8):879-85
  • Ad-F512(H-N)5/3 see, e.g., Viale D.L., et al. (2013)
  • the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells).
  • the MSC comprises a recombinant AMF receptor, CXCR1 , CXCR2, or MCP-1.
  • Certain embodiments are directed to a method for increasing migration or anchorage of a mesenchymal stromal cell (MSC) to a tumor comprising (a) stimulating the MSC with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the tumor, wherein the MSC comprises a therapeutic agent.
  • MSC mesenchymal stromal cell
  • rAMF recombinant autocrine motility factor
  • the methods of the application include increasing migration or anchorage of MSCs to a tumor, e.g., a solid tumor or cancer.
  • the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof.
  • the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma.
  • the tumor or the tumor cell expresses endogenous AMF.
  • the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene ⁇ e.g., an interferon ⁇ e.g., interferon a, interferon ⁇ ), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, T F-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
  • a therapeutic agent e.g., a recombinant anti-tumor gene ⁇ e.g., an interferon ⁇ e.g., interferon a, interferon ⁇
  • an interleukin interleukin 1 , interleukin 12
  • the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells ⁇ e.g., adenovirus (e.g., H101 ), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia).
  • OV oncolytic virus
  • the oncolytic virus is engineered to expresses a recombinant anti-tumor gene.
  • the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 ⁇ see, e.g., Lopez, et al. (2012) Mol Ther.
  • the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon ⁇ e.g., interferon a, interferon ⁇ ), an interleukin ⁇ e.g., interleukin 1 , interleukin 12), a chemokine ⁇ e.g., CX3CL1), or a suicide gene ⁇ e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells).
  • the MSC comprises a recombinant AMF receptor, CXCRl , CXCR2, or MCP-1.
  • Certain aspects of the application are related to cell therapies using cells genetically engineered to express a heterologous gene, e.g., an anti-cancer gene. Some embodiments are directed to a method for treating a subject with a tumor comprising administering to the subject a composition of the application.
  • Some embodiments are directed to a method for treating a subject with a tumor comprising (a) stimulating a mesenchymal stromal cell (MSC) comprising a therapeutic agent with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the subject.
  • MSC mesenchymal stromal cell
  • rAMF recombinant autocrine motility factor
  • stimulating a MSC with a recombinant protein of the application is accomplished by pretreatment of the MSC prior to administration to a subject.
  • Methods for pretreating the MSC include, e.g., culturing MSCs with the recombinant protein, e.g., rAMF, for about 1 -48 hours, about 6-48 hours, about 6-36 hours, about 6-24 hours, about 12-24 hours, about 12-36 hours, about 12-48 hours, about 18-48 hours, about 18-36 hours, or about 18-24 hours prior to administration of the stimulated MSC.
  • the subject's tumor is a solid tumor or cancer.
  • the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof.
  • the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma.
  • the tumor expresses endogenous AMF.
  • the tumor is metastatic and/or vascularized.
  • the methods of the application treating a tumor wherein the
  • MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene (e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
  • a recombinant anti-tumor gene e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase,
  • the therapeutic agent is an oncolytic virus, i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia).
  • adenovirus e.g., H101
  • Reovirus e.g., H101
  • measles e.g., HSV1716
  • Newcastle disease virus and vaccinia e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia).
  • the oncolytic virus is engineered to expresses a recombinant anti-tumor gene.
  • the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 (see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33).
  • Ad-F512(H-N)5/3 see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33.
  • the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells).
  • an interferon e.g., interferon a, interferon ⁇
  • an interleukin e.g., interleukin 1 , interleukin 12
  • chemokine e.g., CX3CL1
  • suicide gene e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can
  • the suicide gene encodes Herpes simplex viral thymidine kinase
  • the subject ideally is treated with ganciclovir in a manner permitting the Herpes simplex viral thymidine kinase to render the ganciclovir cytotoxic.
  • Another possibility is the use of cytosine deaminase as a cytotoxic protein, which converts 5-fluorocytosine to the toxic compound 5- fluorouracil.
  • the method for treating a subject with a tumor comprises introducing into the subject's bloodstream a therapeutically effective amount of a rAMF stimulated MSC or composition of the application.
  • the administration to the subject is systemic (e.g., parenteral) or local, e.g., to an intra-hepatic artery.
  • the therapeutically effective number of MSCs includes, without limitation, the following amounts and ranges of amounts: (i) from about lxl 0 5 to about lxl O 9 cells/kg body weight; (ii) from about lxl 0 6 to about l xlO 8 cells/kg body
  • LX-2 cell line human HSCs generated by spontaneous immortalization in low serum conditions
  • Dr. Scott Friedman Human microvascular endothelial cells (HMEC-1) were provided by CDC (Centers for Disease Control, Atlanta, GA, USA).
  • Cell lines were cultured in complete DMEM (2 ⁇ /L glutamine, 100 U/mL penicillin, 100 mg/mL streptomycin and 10% heat-inactivated fetal bovine serum (FBS)).
  • FBS heat-inactivated fetal bovine serum
  • HCC cells Primary culture of HCC cells (HC-PT-5) was previously generated in our laboratory and cultured the eight passage in 70% DMEM/ 30%) F12 (Invitrogen/Life Technologies) culture medium supplemented with 2 ⁇ /L glutamine, 100 units/mL penicillin, 100 mg/mL streptomycin and 10 % FBS. isolation of MSCs, AT-MSCs and Mesenchymal cells harvested from umbilical cord perivascular tissue
  • MSCs were characterized according to the guidelines f om International society for cellular therapy (ISCT).
  • TCM tumor conditioned medium
  • HuH7 or HC-PT-5 subcutaneous tumors s.c.
  • s.c. subcutaneous tumors
  • BM-MSCs or AMF stimulated BM-MSC were lysed with 150 mmol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4, 0.1% SDS, 1.0% Nonidet P-40, 0.5% Na-deoxycholate, 0.2 mmol/L phenylmethylsulfonyl fluoride, and protease inhibitor cocktail. Lysates were centrifuged at 12,000 g for 20 min and the supernatants were used as total cell lysates. CCM and TCM were concentrated 100-fold using Vivaspin 6 centrifugal concentrator (Sartorius-Stedim Biotech). The protein concentration was determined by Bradford protein assay (Bio-Rad).
  • Protein was separated by SDS-PAGE and transferred onto nitrocellulose membrane (Hybond-ECL, Amersham Biosciences). Blots were blocked and incubated with anti-AMF (1 :700) polyclonal antibody (sc-33777, Santa Cruz Biotechnology), anti-AMFR (1 : 1000) polyclonal antibody (AP2162a, ABGENT), anti- JNK (1 : 1000) polyclonal antibody (9252, Cell Signaling), anti-phospho-JNK (1 : 1000) polyclonal antibody (9251 , Cell Signaling), anti-c-Fos (1 : 1000) monoclonal antibody (2250, Cell Signaling), anti-phospho-c-Fos (1 : 1000) monoclonal antibody (5348, Cell Signaling), anti-phospho-CREB (1 : 1000) monoclonal antibody (9198, Cell Signaling) or anti-Actin (1 :700) polyclonal antibody (sc-1615, Santa Cruz Biotechnology) at 4°C overnight.
  • In vitro migration was performed using a 48-Transwell microchemotaxis Boyden Chamber unit (Neuroprobe, Inc.).
  • MSCs 1.2 x 10 3 cells/well
  • DMEM, TCM or recombinant human AMF (rAMF) where placed in the lower chamber of the Transwell unit. Both chambers were separated by 8 ⁇ pore polycarbonate filters (Nucleopore membrane, Neuroprobe).
  • TCM were pre-incubated for 60 min with anti-AMF polyclonal antibody (sc-33777, Santa Cruz Biotechnology) or isotype control IgG.
  • BM-MSCs were incubated overnight (O.N.) with ⁇ g/ml of rAMF in DMEM without FBS or DMEM without FBS as control.
  • the polycarbonate filters were previously incubated with 10 mg/ml type IV collagen (Sigma-Aldrich) for 18 h at 4°C; for MMP inhibition, BM-MSCs were preincubated with 1 ,10 phenantroline (0.5 or 1 mM) (Sigma-Aldrich). MSCs viability was not affected by 1 ,10 phenantroline (not shown). All the systems were incubated for 4 h at 37 °C in a 5% C0 2 humidified atmosphere. After that, the membrane was carefully removed and cells on the upper side of the membrane were scraped off with a blade.
  • Cells attached to the lower side of the membrane were fixed in 2% formaldehyde, and stained with 40,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich). Cells were counted using fluorescent-field microscopy and a 10X objective lens: the images captured in three representative visual fields were analyzed using CellProfiler software (www.cellprofiler.com), and the mean number of cells/field + SEM was calculated.
  • DAPI 40,6-diamidino-2-phenylindole dihydrochloride
  • RT-PCR Reverse Transcription-polymerase Chain Reaction
  • mRNA of BM-MSCs O.N. pretreated or not with 1 ⁇ rAMF was extracted using Trizol Reagent (Sigma-Aldrich Co., St. Louis, MO). For quantification of MMP3 mRNA level, MSCs were 24 h starved before rAMF pre-treatment. Total mRNA (4 ⁇ g) was reverse transcribed with 200 U of Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) using 500 ng of Oligo (dT) primers. cDNAs were subjected to real-time polymerase chain reaction (qPCR) (Stratagene Mx3005p, Stratagene, La Jolla. CA, USA).
  • qPCR real-time polymerase chain reaction
  • mRNA levels of metalloproteinase 3 MMP3, AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-2), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) were quantified by SYBR® Green (Invitrogen), using the following primer pairs:
  • AMFR 5'-ACAAGATGTGGGCCTTGCAAGA -3 forward (SEQ ID NO: 4), 5'-
  • GDI-2 5 '-GACC AGCTTFGG AGCTCTTG-3 ' (forward) (SEQ ID NO: 6), 5'-
  • AGAGTCTCCCTGAGCCTGA-3 ' (reverse) (SEQ ID NO: 25).
  • GPDH glyceraldehyde-3 -phosphate dehydrogenase
  • NTC non-template control
  • HCC cells were seeded in 96-well culture tissue plates at 3xl0 4 cells/cm 2 density for 1 day prior to the assay. Then cells were cultured with CM of BM-MSCs pre-treated with ⁇ g/ml of rAMF for 48h. DMEM and CM of untreated BM-MSCs were used as control. Cell proliferation was evaluated by [3H]- thymidine incorporation assay. Each sample was assayed in sextuplicate and normalized to DMEM control. Three-Dimensional Spheroids
  • Spheroid size was evaluated using inverted microscopy and a 4X objective lens: the images were captured and diameters determined using ImageJ software (National Institute of Health, NIH), finally spheroid volume was determined was calculated by the formula ⁇ /6 x larger diameter x (smaller diameter) 2 and expressed as arbitrary unity.
  • HuH7 tumors were established and after 10 days BM-MSCs or BM-MSCs pre-treated with rAMF were intravenously (i.v.) injected. Tumor growth was assessed by calliper measurement, and tumor volume (mm 3 ) was calculated by the formula ⁇ /6 x larger diameter x (smaller diameter) .
  • BM-MSCs or BM-MSCs pre-treated with rAMF were prestained with CMDil for histological analysis and DiR (Molecular Probes, Invitrogen) for fluorescence imaging (FI) and were i.v. injected (5 x 10 5 cells/mice) 10 days after tumor inoculation.
  • FI was performed using the Xenogen In Vivo Imaging System (IVIS; Caliper Life Sciences, Hopkinton, MA, USA). Mice injected with CMDil-DiR-labeled MSCs were analyzed 1 h after MSC injection and every day until the experimental end point. Images represent the radiant efficiency and were analyzed with IVIS Living Image (Caliper Life Sciences) software. Regions of interest (ROI) were automatically drawn around the isolated organs to assess the fluorescence signal emitted.
  • IVIS In Vivo Imaging System
  • Results were expressed as average radiant efficiency in units of photons/second within the region of interest [p/s/cm 2 /sr] / [ ⁇ ' ⁇ /cm 2 ] or as total radiant efficiency in units of photons/second within the region of interest [p/s] / [ ⁇ /cm j.
  • HCC hepatocellular carcinoma
  • TCM Tumor conditioned media
  • HCC samples were also analyzed.
  • MSCs were exposed overnight to TCM or DMEM (as control) and studied using a microarray gene expression analysis with the aim to identify genes that were differentially expressed in MSCs exposed or not to TCM.
  • Table 3 shows 445 genes differentially expressed in MSC exposed to TCM from sample 1 in comparison with non-exposed cells.
  • T able 4 shows 51 1 genes differentially expressed in MSC exposed to TCM from sample 2 in comparison with non-exposed cells.
  • Table 5 shows 521 genes differentially expressed in MSC exposed to TCM from sample 4 in comparison with non-exposed cells.
  • Table 6 shows 51 1 genes differentially expressed in MSC exposed to TCM from sample 5 in comparison with non-exposed cells.
  • FIG. 1A shows the relative mR A expression of up-regulated genes CTGF, CYR61 , GJAl , SPARC, and AMFR.
  • Autocrine Motility Factor Receptor (AMFR) was up-regulated in MSCs exposed to all CM derived from HCC samples.
  • Figure IB shows relative mRNA expression of down-regulated genes HSPA1A, HSP1 B, and IGFBP3.
  • Recombinant AMF exerts a specific chemoatractant activity on MSCs from
  • TCM tumor conditioned media
  • a 55 kDa soluble AMF was detected in CCM and TCM ( Figure 2A).
  • MSCs recombinant human AMF
  • rAMF recombinant human AMF
  • MSCs from different sources were evaluated by in vitro migration assay with modified Boyden chambers as described in Example 1.
  • Human MSCs derived from bone marrow (BM-MSCs), perivascular umbilical cord region (Mesenchymal cells harvested from umbilical cord perivascular tissue), or adipose tissue (AT-MSCs) were used in a modified Boyden chamber assay.
  • rAMF concentration 5 ⁇ g/mL or 10 ⁇ g/mL were not capable of inducing migration neither in BM-MSCs nor in Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs.
  • TCM were pretreated with polyclonal antibody against AMF (anti-AMF) to examine whether HCC tumor-secreted AMF was involved in MSC migration as described in the methods of Example 1 .
  • anti-AMF polyclonal antibody against AMF
  • FIG. 2E-G antibody blocking of AMF present in the TCM from either HuH7 or HC-PT-5 reduced their capability to induce MSC migration in a dose dependent manner.
  • BM-MSCs showed a 40% reduction of migration in response to TCM derived from both HCC tumors.
  • a similar effect was observed in Mesenchymal cells harvested from umbilical cord perivascular tissue with a reduction of 30% and 40% in the response to TCM from HuH7 and HC-PT-5, respectively.
  • the reduction in AT-MSC migration potential was 30% and 20% towards TCM from HuH7 and HC-PT-5, respectively.
  • results show that AMF was secreted in the culture monolayers from HCC s.c tumors. Moreover, the results show for the first time that AMF produced by HCC is a chemoattractant factor for MSCs and induces migration of MSCs.
  • the migration was shown using MSCs from different sources (i.e., bone marrow (BM), perivascular cells from umbilical cord (Mesenchymal cells harvested from umbilical cord perivascular tissue) and adipose tissue (AT-MSCs)) and the MSCs from all of he tested sources exhibited migration towards AMF in a dose-dependent manner. ⁇ ⁇ ⁇ of AMF was sufficient to induce MSCs migration.
  • BM bone marrow
  • perivascular cells from umbilical cord
  • AT-MSCs adipose tissue
  • MMPs matrix metalloproteinase
  • MMP3 mRNA level in MSCs was evaluated by qRT-PCR as described in
  • Example 1 MMP3 transcripts showed a 2.4-fold increase in BM-MSCs and Mesenchymal cells harvested from umbilical cord perivascular tissue, and 1 .4-fold in AT- MSCs exposed to rAMF compared to unexposed cells (Figure 3A).
  • BM-MSCs stimulated with HCC CCM had increased MMP2 activity.
  • gelatinolytic activity corresponding to MMP2 was detected in supernatants from BM- MSCs and also from Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs.
  • MMP2 activity was measured by zymography (as described in Example 1 ) in MSCs culture supernatant pre-stimulated with 1 ⁇ g/mL of rAMF or from un-stimulated cells as control to determine whether the induction of MMP2 was dependent on the presence of AMF in the TCM.
  • MMP2 activity was significantly enhanced when different sources MSCs were stimulated with rAMF ( Figure 3B).
  • MMP2 activity was also measured in MSC culture supernatant stimulated with
  • rAMF increased the expression of mRNA MMP3 in MSCs.
  • AMF present in the TCM was, at least in part, responsible for the increased in MMP2 activity, which supports a critical role for AMF in MSC migration and invasion since blockage of AMF decreased MMP2 activity and inhibition of MMP2 decreased invasion in vitro.
  • AMF enhances BM-MSCs migration towards HCC by stimulating endothelial cell adhesion and modulating critical related genes
  • MSC migration to HCC is critical for their use as cell earners of therapeutic genes.
  • MSCs were pretreated with rAMF to determine the effect of MSC migration towards the HCC TCMs.
  • In vitro migration assay was used to measure migration of MSCs as described in Example 1 .
  • MSCs migration to conditioned medium from ex vivo s.c. tumors (TCM) derived from HuH7 or HC-PT-5 cell lines. These results show that rAMF pretreatment influenced migration of MSCs towards TCM.
  • Adhesion to endothelial cells is considered a crucial event for the efficient arrest of MSCs within tumor vasculature for subsequent transmigration.
  • the effect of rAMF on cell adhesion was tested by pretreating MSCs with rAMF and measuring cell adhesion as described in Example 1. Pretreatment with rAMF resulted in a 2-fold enhancement in BM-MSCs adhesion to human endothelial cells HMEC-1 ( Figure 4C).
  • Recombinant AMF increases the in vivo homing of MSCs into HCC
  • FI Noninvasive fluorescence imaging
  • Human MSCs derived from bone marrow (BM-MSCs) pre- stimulated with rAMF ( ⁇ g/mL) or control BM-MSCs (no stimulation) were stained with cell trackers DiR and CM-Dil prior to intravenous injection in mice carrying s.c.
  • HuH7 tumor nodules as described in Example 1. Three days later, mice were sacrificed and the fluorescence signal in the isolated tumors was analyzed. The total fluorescent intensity in both groups of animals were similar, indicating no differences in the quantity of injected BM-MSCs (Figure 5A).
  • MSCs migration towards HCC in vivo This is the first report demonstrating the increased in vivo migration of MSCs towards HCC with pretreatment of MSCs with rAMF.
  • HUCPVCs presented higher migration and adhesion than BM-MSCs
  • BM-MSCs bone marrow-derived mesenchymal stem cells
  • HUCPVCs human umbilical cord perivascular cells
  • Figure 7A hepatic stellate cells
  • HMEC-1 endothelial ceils
  • a higher migratory capacity towards ail the CCM was found for HUCPVCs when compared to BM-MSCs.
  • HUCPVCs showed capability to migrate to CCM derived from nonturnoral components (fibroblast and endothelial cells).
  • MSCs within the microvasculature is considered a critical step for an efficient homing and anchorage to tumors. Therefore, cell adhesion assays were also performed as described in Example 1 to evaluate adhesion ability of MSCs. In that assay, HUCPVCs showed an increased in vitro adhesion to HMEC-1 endothelial cells in comparison with BM-MSCs ( Figure 7B).
  • HUCPVCs presented in vivo migration towards HCC tumors
  • CM-Dil and DiR prelabelled BM-MSCs or HUCPVCs were i.v. injected in HCC tumor-bearing mice in order to evaluate MSC recruitment. Similar to our previous observation with BM-MSCs ( Figure 5), at 3 days after cell transplantation a positive signal corresponding to HUCPVCs was found in liver, lungs, spleen, and s.c. tumors ( Figure 8A). Despite the fact that total signal was lower in mice injected with HUCPVCs compared to those injected with BM-MSCs ( Figure 8B), the percentage of total signal corresponding to s.c.
  • AMF autocrine motility factor
  • HUCPVCs showed enhanced migration towards AMF
  • Anti-CXCRl, anti-CXCR2, and anti-MCP-1 antibodies inhibit MSC migration
  • HC-PT-5 with anti-HGF (10 ⁇ g/ml), anti-MCP-1 (10 ⁇ g/ml) or isotype control IgG for 1 hour.
  • anti-CXCRl (10 ⁇ / ⁇ ) anti-CXCR2 (10 ⁇ g/ml)
  • both anti-CXCRl/ anti-CXCR2 or isotype control IgG were pre-incubated with MSC for 1 hour.
  • In vitro migration of MSCs towards TCM-HuH7 or TCM-HC-PT-5 were evaluated using the methods described in Example 1.
  • MSCs will be engineered to express oncolytic virus expressing or not anti-tumor genes (including e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1 ), or a suicide gene (e.g., thymidine kinase, IL- 12, IFN-gamma, TNF-alpha).
  • anti-tumor genes including e.g., an interferon (e.g., interferon a, interferon ⁇ ), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1 ), or a suicide gene (e.g., thymidine kinase, IL- 12, IFN-gamma, TNF-alpha).
  • infected MSCs will be stimulated in culture with rAMF for about 18 h and systemically injected (5x l 0 5 ) in HCC, colorectal cancer, and/or breast cancer tumor-bearing mice. Tumor growth will be assessed by calliper and tumor volume (mm 3 ) will be calculated using the formula ⁇ /6 x larger diameter x (smaller diameter) 2 .

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present application is directed to compositions and methods for treating a subject with cancer and/or increasing migration of a mesenchymal stromal cells (MSCs) stimulated with a recombinant autocrine motility factor (rAMF) to a tumor or a tumor cell, e.g. hepatocellular carcinoma (HCC). In addition, methods for increasing adhesion of MSCs to endothelial cells with rAMF are disclosed. In some embodiments, the MSCs comprise a therapeutic agent, e.g., an anti-tumor agent.

Description

COMPOSITIONS AND METHODS FOR INCREASING MESENCHYMAL STROMAL CELL MIGRATION TO TUMORS
REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0001] The content of the electronically submitted sequence listing in ASCII text file
(Name: "31 81_006PC01 SequenceListing.ascii"; Size: 10,549; and Date of Creation: September 4, 2014) filed with the application is incorporated herein by reference in its entirety.
BACKGROUND
[0002] Mesenchymal stromal cells (MSCs) (also referred to as fibroblastic colony forming units or mesenchymal stem cells) constitute a heterogeneous cell population, characterized by their adherence to plastic, fibroblast-like morphology, expression of specific markers (e.g., CD105+, CD90+, CD73+), lack of hematopoietic markers (e.g., CD45, CD34, CD14 or CDl l b, CD79a or CD19) and HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts (Dominici, M., K. Le Blanc, et al. (2006) Cytotherapy 8(4): 315-317). MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord; from the latter case, MSC are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1 176: 101 -1 17). MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469). However, the mechanisms involved in MSCs recruitment to tumors in general, and to specific tumors, e.g., hepatocellular carcinoma (HCC), are not fully understood.
[0003] Autocrine motility factor (AMF) is a 55-kDa cytokine (SEQ ID NO: 1 ) secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306). AMF was isolated, purified, and partially characterized from the serum-free conditioned medium of human A2058 melanoma cells (Liotta, L. A., R. Mandler, et al. (1986)). AMF exhibits sequence identity with glucose- 6-phosphate isomerase (GPI) (alternatively known as phosphoglucose isomerase or phosphohexose isomerase (PHI)), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963). The stimulation of cell motility is induced by the binding to the autocrine motility factor receptor (AMFR), a 78-kDa seven transmembrane glycoprotein with leucine zipper and RI G-H2 motifs (Shimizu, K., M. Tani, et al. (1999) FEBS Lett 456(2): 295-300). AMFR is stably localized in caveolae, and caveolin-1 (Cav- 1) has the ability to regulate the endocytic pathway through the stabilization of caveolae expression (Le, P. U., G. Guay, et al. (2002) J Biol Chem 277(5): 3371 -3379).
[0004] AMF is secreted by different tumors such as lung (Dobashi, Y., H. Watanabe, et al. (2006) J Pathol 210(4): 431 -440), gastrointestinal, kidney and mammary (Baumann, M., A. Kappl, et al. (1990) Cancer Invest 8(3-4): 351-356) as well as by hepatocellular carcinomas (Torimura, T., T. Ueno, et al. (2001 ) Hepatology 34(1 ): 62-71). Migration of hepatocellular carcinoma cells upon AMF stimulation has been associated to upregulation of metalloproteinase 3 (MMP3) (Yu, F. L., M. H. Liao, et al. (2004) Biochem Biophys Res Commun 314(1 ): 76-82) and activation of the small G-protein RhoC (Yanagawa, T., H. Watanabe, et al. (2004) Lab Invest 84(4): 513-522).
[0005] Hepatocellular carcinoma (HCC) is the sixth most common cancer worldwide and the third cause of cancer- related death (Ferenci, P., M. Fried, et al. (2010) J Gastrointestin Liver Dis 19(3): 31 1-317). Most cases of HCC are secondary to either a viral hepatitis infection (hepatitis B or C) or cirrhosis. Curative therapies such as resection or liver transplantation have been demonstrated to improve patient survival (de Lope, C. R., S. Tremosini, et al. (2012) J Hepatol 56 Suppl 1 : S75-87); however, these strategies can Only be applied to a minority of patients. Therefore, there is an urgent therapeutic need for patients with HCC.
BRIEF SUMMARY
[0006] The present application relates to the combined use of cellular and gene therapy to deliver therapeutic genes, e.g., an anti-tumor agent, into tumoral or peritumoral tissues. In some embodiments, the application relates to compositions and methods for treating a subject with cancer and/or increasing migration of a mesenchymal stromal cells (MSCs) to a tumor or a tumor cell, e.g. hepatocellular carcinoma (HCC), wherein the MSC comprises a therapeutic agent, e.g., an anti-tumor agent, and is stimulated with a recombinant autocrine motility factor (rAMF). In addition, methods for increasing adhesion of MSCs to endothelial cells with rAMF are disclosed.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0007] Figure 1A-B. Shows real-time PCR (RT-PCR) relative expression of (A) up- regulated and (B) down-regulated genes in MSCs exposed to tumor conditioned media (TCM).
[0008] Figure 2A-G. Shows (A) detection of AMF (55 kDa) by Western blot in CCM derived from HCC cells and TCM from ex vivo HCC s.c. tumors (upper panel). Colloidal Coomassie staining was performed as loading control (lower panel). MSCs migration was analyzed using Boyden chamber assays with rAMF as chemoattractant for (B) BM- MSCs, (C) Mesenchymal cells harvested from umbilical cord perivascular tissue or (D) AT-MSCs. Results are expressed as percentage of control (DMEM) ± SEM.. *p<0.05 and **p<0.01 vs DMEM (ANOVA and Dunnett's test). Cell migration of (E) BM-MSCs, (F) Mesenchymal cells harvested from umbilical cord perivascular tissue or (G) AT-MSCs towards TCM derived from HuH7 (gray bars) or HC-PT-5 (black bars) pretreated with anti-AMF-Ab (AMF-ab) or control isotype IgG (IgG-ab) is shown. Results are expressed as percentage of control (isotype control) ± SEM. *p<0.05 and **p<0.01 vs isotype control (ANOVA and Dunnett's comparison test). Results are representative of 3 independent experiments.
[0009] Figure 3A-D. Shows (A) MMP3 expression determined by qRT-PCR in BM-
MSCs (black bars), Mesenchymal cells harvested from umbilical cord perivascular tissue (white bars) or AT-MSCs (gray bars) stimulated with ^g/ml of rAMF. ** pO.01 vs unstimulated cells (DMEM, unpaired Student's t test). (B) MMP2 activity evaluated by zymography in supernatants of BM-MSCs (black bars), Mesenchymal cells harvested from umbilical cord perivascular tissue (white bars) or AT-MSCs (gray bars) pre- stimulated with ^g/mL of rAMF. Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity. One representative image of the zymography is shown. * p<0.05, ** pO.01 and *** pO.001 vs untreated cells (DMEM, ANOVA and Tukey's comparison test). (C) MMP2 activity was evaluated by zymography in MSCs (BM-MSCs, black bars; Mesenchymal cells harvested from umbilical cord perivascular tissue, white bars; and AT-MSCsr! gray bars) culture supernatant stimulated with TCM from HuH7 cells. TCM from HuH7 cells was blocked with anti-AMF (AMF-ab) or isotype control (IgG-ab). Band intensity of 3 independent experiments was detected by densitometric evaluation and plotted as MMP2 relative activity. One representative image of the zymography is shown. * p<0.05 and ** p<0.01 vs DMEM (ANOVA); # p<0.05, ## pO.Ol and ### pO.001 vs AMF-blocked TCM from HuH7 (HuH7 TCM+/AMF-ab+, ANOVA and Tukey's comparison test). (D) Invasion capacity of untreated BM-MSCs (white bars) or BM-MSCs stimulated with rAMF (black bars) to type IV collagen using TCM from HuH7 or HC-PT-5 preincubated with different doses of the MMP inhibitor 1 ,10 phenantroline (Phe). *** pO.001 vs without stimulation with rAMF and σσσ p<0.001 vs without preincubation with Phe (ANOVA). Results are representative of 3 independent experiments.
[0010] Figure 4A-E. Shows (A) pretreatment of BM-MSCs with ^g/mL rAMF (black bars) increases chemotaxis towards TCM derived from HuH7 or HC-PT-5 cells compared to untreated cells (white bars). (B) Shows a wound-healing assay of MSCs after pretreatment with rAMF or control (DMEM). Representative images were taken 24 hours after scratching. (C) Adhesion to HMEC-1 endothelial cells was increased in BM-MSCs exposed to rAMF. (D) Shows expression of AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-1), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) by qRT-PCR. * p<0.05, ** pO.01 and *** pO.001 vs untreated cells (DMEM, white bars, unpaired Student's t-test. (E) Shows increased expression of AMFR, JNK, p-JN , c-Fos, p-c-Fos and p-CREB in AMF-treated MSCs evaluated by western blot.
[0011] Figure 5A-G. BM-MSCs pre-stimulated with ^g/ml of rAMF were labeled with
DiR and CMDil cell trackers and i.v. injected in s.c. HuH7 tumor-bearing mice. After 3 days, tumors were removed and fluorescence imaging (FI) was performed. (A) Shows total fluorescent intensity as calculated by measuring the region of interest (ROI) for all the tissues isolated and the results were expressed as total radiant efficiency, ns, non significant. (B) Shows representative tumors images of mice inoculated with rAMF- prestimulated BM-MSCs (MSC-rAMF) or unstimulated cells(MSCs). Images represent the average radiant efficiency. Region of interest (ROI) was calculated for the isolated (C) tumor, (D) liver, (E) lung and (F) spleen and the results were expressed as the average radiant efficiency. **p<0.01 vs unstimulated BM-MSCs (unpaired Student's t-test). (G) Shows microscopic analysis of transplanted CM-Dil-labeled MSCs (red signal indicated by arrows) and DAPI staining in frozen sections of tumors. Magnification x200.
100121 Figure 6A-C. (A) Shows in vitro proliferation of HuH7 cells exposed to MSCs,
AMF-pretreated MSCs (MSC-rAMF) or unexposed cells (DMEM). *p<0.05 vs DMEM (ANOVA and Tukey's comparison test). (B) Multicellular spheroid growth composed by HCC tumor cells, hepatic stellate cells and endothelial cells (control) or also by MSCs or MSCs prestimulated with rAMF (ANOVA and Tukey's comparison test). (C) In vivo tumor growth of s.c. HuH7 (saline) and also i.v. injected with MSCs or AMF-pretreated MSCs (ANOVA and Tukey's comparison test).
[0013] Figure 7A-B. (A) Shows in vitro migration of BM-MSCs (black bars) or
HUCPVCs (grey bars) towards CCM from HCC (HuH7 and HC-PT-5), hepatic stellate cells (LX-2), fibroblasts (WI-38) or endothelial cells (HMEC- 1). Bars represent the average of MSCs/field (lOx) ± SEM from three representative visual fields. Results are representative of 3 independent experiments. # p < 0.001 vs DMEM; *** p < 0.001 vs BM-MSCs. (B) Adhesion towards endothelial cells of BM-MSCs (black bars) or HUCPVCs (grey bars) was measured. Results are representative of 3 independent experiments. *** p < 0.001 vs BM-MSCs.
[0014] Figure 8A-F. CM-Dil and DiR pre-labeled MSCs were i.v. injected in s.c. HuH7 bearing mice. At day 3, mice were sacrificed and organs were removed: (A) lungs, livers, spleen and (C) tumors were exposed to obtain fluorescent images. Images represent the average radiant efficiency. Representative images are shown. (B) Total fluorescent intensity for injected BM-MSCs or HUCPVCs was calculated by measuring the region of interest (ROI) for all the tissues isolated and results were expressed as total radiant efficiency [p/s]/^W/cm2]. *** p < 0.001. (D) Signal present in the isolated liver, spleen, lungs and tumors was represented as percentage of total signal for BM-MSCs or HUCPVCs injected mice. * p < 0.05 vs BM-MSCs. (E) Microscopic analysis of transplanted CM-Dil-labeled MSCs (red signal indicated by arrows) and DAPI staining in frozen sections of tumors. 200x magnification. (F) In vitro migration of MSCs to TCM derived from HuH7 or HC-PT-5 s.c. tumors. Bars represent the average of MSCs/field (l Ox) ± SEM from three representative visual fields. Results are representative of 3 independent experiments. *** p < 0.001 vs BM-MSCs [0015] Figure 9A-B. Expression of (A) cytokines and chemokines receptors and (B)
AMF/AMFR axis proteins was evaluated in BM-MSCs (black bars) or HUCPVCs (grey bars) by qPCR. *** p < 0.001 vs BM-MSCs.
[0016] Figure lOA-B. (A) In vitro migration of BM-MSCs (black bars) or HUCPVCs
(grey bars) towards rAMF was measured. # p < 0.05 vs DMEM (0 μg/ml rAMF); * p < 0.05 vs BM-MSCs. (B) In vitro migration of BM-MSCs (black bars) or HUCPVCs (grey bars) towards HC-PT-5 TCM pre-incubated with anti-AMF antibody (AMF-ab) or control isotype (IgG-ab) was evaluated. # p < 0.05 vs IgG-ab; * p < 0.05 vs BM-MSCs. Bars represent the average of MSCs/field (lOx) ± SEM from three representative visual fields. Results are representative of 3 independent experiments.
[0017] Figure 11A-B. Shows (A) Migration (% of control) towards CM-HuH7of MSCs pre-incubated with anti-CXCRl , anti-CXCR2 or both (anti-CXCRl + anti-CXCR2) or isotype control (IgG) for lh. *p<0.05 and **p<0.01 vs IgG isotype control. (B) Migration (% of control) of MSCs towards CM-HuH7 pre-incubated with anti-HGF or anti-MCP-1 for lh. *p<0.05 vs DMEM. Results were expressed as percentage of control (DMEM).
DETAILED DESCRIPTION
Definitions
[0018] To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
[0019] "Isolated" in regard to cells, refers to a cell that is removed from its natural environment (such as in a solid tumor) and that is isolated or separated, and is at least about 30% free, about 50% free, about 75% free, about 90% free, about 95% free, or 100%) free, from other cells with which it is naturally present, but which lack the marker based on which the cells were isolated.
[0020] As used herein, the term "heterologous" refers to, e.g. , a gene, polypeptide or cell that is not in its natural environment; thus, it is non-naturally-occurring. For example, a heterologous gene or polypeptide includes a gene or polypeptide from one species introduced into another species. A heterologous gene or polypeptide also includes a gene or polypeptide native to an organism that has been altered in some way {e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.). In another example, a heterologous cell includes a cell native to an organism that has been altered in some way (e.g., genetically modified to include a recombinant gene, protein, or virus).
[0021] "Tumor" and "neoplasm" as used herein refer to any mass of tissue that results from excessive cell growth or proliferation, either benign (noncancerous) or malignant (cancerous) including pre-cancerous lesions.
[0022] As used herein, the terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals in which a population of cells are characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include liver cancer (e.g., hepatocellular carcinoma (HCC)), colon cancer, colorectal cancer (e.g., colorectal carcinoma), gastrointestinal cancer, pancreatic cancer, lung cancer, breast cancer, and kidney cancer.
[0023] "Metastasis" as used herein refers to the process by which a cancer spreads or transfers from the site of origin to other regions of the body with the development of a similar cancerous lesion at the new location. A "metastatic" or "metastasizing" cell is one that loses adhesive contacts with neighboring cells and migrates via the bloodstream or lymph from the primary site of disease to invade neighboring body structures.
[0024] The terms "cancer cell", "tumor cell" and grammatical equivalents refer to the total population of cells derived from a tumor or a pre-cancerous lesion including both non umorigenic cells, which comprise the bulk of the tumor cell population, and tumorigenic cells (e.g., cancer stem cells).
[0025] As used herein, the term "subject" refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment. Typically, the terms "subject" and "patient" are used interchangeably herein in reference to a human subject.
[0026] As used herein, the term "subject suspected of having cancer" refers to a subject that presents one or more symptoms indicative of a cancer (e.g., a noticeable lump or mass) or is being screened for a cancer (e.g., during a routine physical). A subject suspected of having cancer can also have one or more risk factors. A subject suspected of having cancer has generally not been tested for cancer. However, a "subject suspected of having cancer" encompasses an individual who has received an initial diagnosis but for whom the stage of cancer is not known. The term further includes people who once had cancer (e.g., an individual in remission).
[0027] As used herein, the term "subject at risk for cancer" refers to a subject with one or more risk factors for developing a specific cancer. Risk factors include, but are not limited to, gender, age, genetic predisposition, environmental exposure, previous incidents of cancer, pre-existing non-cancer diseases, and lifestyle.
[0028] As used herein, the term "subject diagnosed with a cancer" refers to a subject who has been tested and found to have cancerous cells. The cancer can be diagnosed using any suitable method, including but not limited to, biopsy, x-ray, blood test, and the diagnostic methods of the present invention.
[0029] As used herein, the terms "biopsy tissue", "patient sample", "tumor sample", and
"cancer sample" refer to a sample of cells, tissue or fluid that is removed from a subject for the purpose of determining if the sample contains cancerous tissue, including cancer stem cells or for determining gene expression profile of that cancerous tissue. In some embodiments, biopsy tissue or fluid is obtained because a subject is suspected of having cancer. The biopsy tissue or fluid is then examined for the presence or absence of cancer, cancer stem cells, and/or cancer stem cell gene signature expression.
[0030] As used herein, the term "characterizing cancer in a subject" refers to the identification of one or more properties of a cancer sample in a subject, including but not limited to, the presence of benign, pre-cancerous or cancerous tissue, the stage of the cancer, and the subject's prognosis. Cancers can be characterized by the identification of the expression of one or more cancer marker genes, including but not limited to, any cancer markers disclosed herein.
[0031] As used herein, the term "gene expression" refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through "translation" of mRNA. Gene expression can be regulated at many stages in the process. "Up-regulation" or "activation" refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while "down-regulation" or "repression" refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up- regulation or down-regulation are often called "activators" and "repressors," respectively, [0032] The terms "high levels", "increased levels", "high expression", "increased expression", "elevated levels" or "up-regulated expression" in regard to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells at levels higher than the expression of that gene in a second cell or population of cells. In certain embodiments, "high levels", "increased levels", "high expression", "increased expression", "elevated levels" or "up-regulated expression" can be determined by detecting the amount of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis; or by detecting the amount of a protein in tumor cells, for example, by ELISA, Western blot, quantitative immunofluorescence.
[0033] As used herein, the terms "low levels", "decreased levels", "low expression",
"reduced expression" or "decreased expression" in regards to gene expression are used herein interchangeably to refer to expression of a gene in a cell or population of cells, at levels less than the expression of that gene in a second cell or population of cells. "Low levels" of gene expression can be determined by detecting decreased to nearly undetectable amounts of a polynucleotide (mRNA, cDNA, etc.) in tumor cells, for example, by quantitative RT-PCR or microarray analysis. Alternatively "low levels" of gene expression can be determined by detecting decreased to nearly undetectable amounts of a protein in tumor cells, for example, ELISA, Western blot, or quantitative immunofluorescence.
[0034] The term "undetectable levels" or "loss of expression" in regards to gene expression as used herein refers to expression of a gene in a cell or population of cells, at levels that cannot be distinguished from background using conventional techniques such that no expression is identified. "Undetectable levels" of gene expression can be determined by the inability to detect levels of a polynucleotide (mRNA, cDNA, etc.) in tumor cells above background by, for example, quantitative RT-PCR or microarray analysis. Alternatively "undetectable levels" of gene expression can be determined by the inability to detect levels of a protein in tumor cells above background by, for example, ELISA, Western blot, or immunofluorescence.
[0035] As used herein, if the expression is "below the level of detection" for a given assay, the expression may still be detectable by another assay. [0036] As used herein, the term "nucleic acid molecule" refers to any nucleic acid containing molecule, including but not limited to, DNA or RNA. The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5 -(carboxyhydroxyl -methyl) uracil, 5-fluorouracil, 5-bromouracil, 5- carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1 -methyladenine, 1 -methylpseudouracil, 1 -methyl guanine, 1 -methylinosine, 2,2-dimethyl-guanine, 2-methyladenine, 2- methylguanine, 3-methyl-cytosir:e, 5-methylcytosine, N6-methyladenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxy-amino-methyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio- N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2- thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5- oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
[0037] The term "gene" refers to a nucleic acid (e.g., DNA) sequence that comprises coding sequences necessary for the production of a polypeptide, precursor, or RNA (e.g., rRNA, tRNA). The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activities or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, immunogenicity, etc.) of the full-length polypeptide or fragment are retained. The term also encompasses the coding region of a structural gene and the sequences located adjacent to the coding region on both the 5' and 3' ends for a distance of about 1 kb or more on either end such that the gene corresponds to the length of the full-length mRNA. Sequences located 5' of the coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' or downstream of the coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed "introns" or "intervening regions" or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns can contain regulatory elements such as enhancers. Introns are removed or "spliced out" from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. A cDNA form of a gene is "intron-free" and non-naturally-occurring.
[0038] As used herein, the term "heterologous gene" refers to a gene that is not in its natural environment; thus, it is non-naturally-occurring. For example, a heterologous gene includes a gene from one species introduced into another species. A heterologous gene also includes a gene native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non-native regulatory sequences, etc.). Heterologous genes are distinguished from endogenous genes in that the heterologous gene sequences are typically joined to DNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
[0039] As used herein, the term "gene expression" refers to the process of converting genetic information encoded in a gene into RNA (e.g., mRNA, rRNA, tRNA, or snRNA) through "transcription" of the gene (e.g., via the enzymatic action of an RNA polymerase), and for protein encoding genes, into protein through "translation" of mRNA. Gene expression can be regulated at many stages in the process. "Up-regulation" or "activation" refers to regulation that increases the production of gene expression products (e.g., RNA or protein), while "down-regulation" or "repression" refers to regulation that decrease production. Molecules (e.g., transcription factors) that are involved in up- regulation or down-regulation are often called "activators" and "repressors," respectively.
[0040] In addition to containing introns, genomic forms of a gene can also include sequences located on both the 5' and 3' end of the sequences that are present on the RNA transcript. These sequences are referred to as "flanking" sequences or regions (these flanking sequences are located 5' or 3' to the non-translated sequences present on the mRNA transcript). The 5' flanking region can contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3' flanking region can contain sequences that direct the termination of transcription, posttranscriptional cleavage and polyadenylation.
[0041] As used herein, the terms "nucleic acid molecule encoding," "DNA sequence encoding," and "DNA encoding" refer to the order or sequence of deoxyribonucleotides along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of amino acids along the polypeptide (protein) chain. The DNA sequence thus codes for the amino acid sequence.
[0042] "Polypeptide," "peptide" and "protein" are used interchangeably and refer to a polymeric compound comprised of covalently linked amino acid residues.
[0043] An "isolated polypeptide," "isolated peptide" or "isolated protein" refer to a polypeptide or protein that is substantially free of those compounds that are normally associated therewith in its natural state (e.g. , other proteins or polypeptides, nucleic acids, carbohydrates, lipids). "Isolated" is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which can be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.
[0044] As used herein, the term "heterologous polypeptide" refers to a polypeptide that is not in its natural environment; thus, it is non-naturally-occurring.' For example, a heterologous polypeptide includes a polypeptide from one species introduced into another species. A heterologous polypeptide also includes a polypeptide native to an organism that has been altered in some way (e.g., mutated, added in multiple copies, linked to non- polypeptide, etc.). Heterologous polypeptide are distinguished from endogenous polypeptide in that the heterologous polypeptide sequences are typically encoded by cDNA sequences that are not found naturally associated with the gene sequences in the chromosome or are associated with portions of the chromosome not found in nature (e.g., genes expressed in loci where the gene is not normally expressed).
[0045] A mutation can be made by any technique for mutagenesis known in the art, including but not limited to, in vitro site-directed mutagenesis (Hutchinson et al., J Biol. Chem. 253:6551 (1978); Zoller et al, DNA 5:479 (1984); Oliphant et al., Gene 44: 111 (1986); Hutchinson et al., Proc. Natl. Acad. Sci. USA 83:710 (1986)), use of TAB® linkers (Pharmacia), restriction endonuclease digestion/fragment deletion and substitution, PCR-mediated/oligonucleotide-directed mutagenesis, and the like. PCR- based techniques are preferred for site-directed mutagenesis (see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70), [0046] A "variant" of a polypeptide or protein refers to any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein can exist in nature. These variants can be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or can involve differential splicing or post-translational modification. The skilled artisan can produce non-naturally-occurring variants having single or multiple amino acid substitutions, deletions, additions, or replacements. These variants can include, inter alia: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and (d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin. The techniques for obtaining non-naturally-occurring variants, including genetic (suppressions, deletions, mutations, etc. ), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art.
[0047] The term "percent identity," as known in the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York ( 1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M, and Griffin, H. G., eds.) Humana Press, New Jersey ( 1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York ( 1991 ). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations can be performed using sequence analysis software such as the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, WI). Multiple alignment of the sequences can be performed using the Clustal method of alignment (Higgins et al , CABIOS. 5: 151 (1989)) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method can be selected: KTUPLE 1 , GAP PENALTY::;3, WJMX)W=5 and DIAGONALS SAVED=5.
[0048] The term "sequence analysis software" refers to any computer algorithm or software program that is useful for the analysis of nucleotide or amino acid sequences. "Sequence analysis software" can be commercially available or independently developed. Typical sequence analysis software includes, but is not limited to, the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI), BLASTP, BLASTN, BLASTX (Altschul et al, J. Mol. Biol. 215:403 (1990)), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, WI 53715 USA). Within the context of this application it will be understood that where sequence analysis software is used for analysis, that the results of the analysis will be based on the "default values" of the program referenced, unless otherwise specified. As used herein "default values" will mean any set of values or parameters that originally load with the software when first initialized.
[0049] As used herein, the term "in vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments can consist of, but are not limited to, test tubes and cell culture. The term "in vivo" refers to the natural environment {e.g., an animal or a cell) that can be, but are not limited to, processes or reaction that occur within a natural environment.
[005( ] As used herein, the term "ex vivo" refers to "outside" the body. The terms "ex vivo" and "in vitro" can be used interchangeably herein.
[0051 ] As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples can be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum and the like. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.
[0052] In certain embodiments, terms such as "treating" or "treatment" or "to treat" refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; those who may have had the disorder and in whom the disorder may recur; and, those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully "treated" if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including the spread of cancer into soft tissue and bone; inhibition of or an absence of tumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associate with the specific cancer; reduced morbidity and/or mortality; improvement in quality of life; a reduction in the number of or complete absence of cancer stem cells; a decrease in the proportion of cancer stem cells in a solid tumor (relative to cells in the tumor that are not cancer stem cells); inhibit the proliferation of cancer stem cells; and a delay in or an absence of relapse.
[0053] In certain embodiments, the term "therapeutically effective amount" refers to an amount of a therapeutic agent, e.g., an antibody, polypeptide, polynucleotide, small organic molecule, or other drug effective to "treat" a disease or disorder in a subject. In the case of cancer, the therapeutically effective amount of the therapeutic agent can, in certain embodiments, reduce the number of cancer cells; reduce the proportion of cancer cells in a solid tumor; reduce the tumor size; inhibit or stop cancer cell infiltration into peripheral organs; inhibit and/or stop tumor metastasis; inhibit and stop tumor growth; relieve to some extent one or more of the symptoms associated with the cancer; inhibit the proliferation of cancer cells; or result in a combination of such effects on cancer cells.
[0054] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells presented herein, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
Mesenchymal stromal cell (MSC)
[0055] Mesenchymal stromal cells (MSCs) (also referred to as fibroblastic colony forming units or mesenchymal stem cells) constitute a heterogeneous cell population, characterized by their adherence to plastic, fibroblast-like morphology, expression of specific markers (CD 105+, CD90+, CD73+), lack of hematopoietic markers (CD45, CD34, CD 14 or CD l i b, CD79a or CD 19) and HLA class II and capability to differentiate in vitro into osteoblasts, adipocytes and chondroblasts (Dominici, M., K. Le Blanc, et al. (2006) Cytotherapy 8(4): 315-317). MSCs are most often derived from bone marrow (BM), but can also be isolated from adipose tissue (AT) or from umbilical cord (youngest, most primitive MSCs); from the latter case, MSCs are isolated from the Wharton's jelly (WJ-MSCs), perivascular areas (Mesenchymal cells harvested from umbilical cord perivascular tissue) or umbilical cord blood (CB-MSCs) (Bernardo, M. E., F. Locatelli, et al. (2009) Ann N Y Acad Sci 1 176: 101-1 17). Other rich sources for MSCs are the developing tooth bud of the mandibular third molar and amniotic fluid. It has also been reported that MSCs can be successfully isolated from human peripheral blood (Chong PP et al. (2012) J Orthop Res. 30(4):634-42). The MSCs can be isolated from the whole umbilical cord and in this case can be referred to as "mesenchymal cells derived from umbilical cord." It is noted that as the umbilical cord has different structures, and the isolation of MSCs can also be made or harvested from only a "region" or "structure" such as the perivascular tissue, the Wharton's jelly, or the umbilical cord blood.
[0056] MSCs have a great capacity for self-renewal while maintaining their multipotency. A standard test to confirm multipotency is differentiation of the cells into osteoblasts, adipocytes, and chondrocytes as well as myocytes and neurons. Other attractive features of MSCs include that they are readily isolated from bone marrow by their adherence to tissue culture surfaces, they rapidly expanded in culture, they are highly clonogenic in that they efficiently generated single-cell derived colonies, and they are readily seen to differentiate in culture or in vivo into several cellular phenotypes such as osteoblasts, adipocytes, and chondrocytes. These properties are retained as the cells are expanded through 20 or so population doublings, particularly if the cells were plated at low density and passed before they reach confluency (Gregory CA, et al. (2005) Sci STKE 294:pe37). The plasticity of MSCs was also illustrated by experiments in which MSCs were cultured without fetal calf serum (Pochampally et al. (2004) Blood 103: 1647-1652) or, even more dramatically, when the MSCs were subjected to environmental stress in culture to generate multi-lineage-differentiating stress-enduring MSCs or Muse cells (Wakao et al. (201 1) Proc Natl Acad Sci USA 108:9875-9880). Under such circumstances, the MSCs reverted to a more primitive phenotype and expressed genes characteristic of embryonic genes.
[0057] MCSs have been observed to have anti-inflammatory effects. The disease models in which MSCs have produced beneficial effects include diabetes, stroke, spinal cord injury, Parkinsonism, Alzheimer's disease, liver disease, kidney disease, and some cancers. See Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469. MSCs have also been shown to contribute to cancer progression, e.g., hematological malignancies (Torsvik A. and Bjerkvig R. (2013) Cancer Treat Rev. 39(2)180-8).
[0058] MSCs have the ability to migrate and engraft tumors and it is thought that factors produced by tumor cells and their microenvironments are responsible. MSC motility in vitro has been induced after stimulation with different cytokines (Ries, Egea et al. (2007). Blood 109(9): 4055-4063), growth factors (Ponte, Marais et al. (2007) Stem Cells 25(7): 1737-1745), or chemokines such as CXCL7 (Kalwitz, Endres et al. (2009) Int J Biochem Cell Biol 41 (3): 649-658) or SDF-1 (Gao, Priebe et al. (2009) Stem Cells 27(4): 857- 865). However, this application is the first report demonstrating the increased MSCs in vivo migration towards HCC with a simple treatment with rAMF. Reports have demonstrated MSC migration towards a number of tumor-released factors {e.g., VEGF, PDGF, TGF-β, MCP-1 , IL-8, TNF-a, IL-Ι β, IL-6, SDF-1 , and HGF). However, there is a lack of robust data confirming the role of any specific factors in the recruitment of MSCs towards tumors such as HCC.
[0059] MSCs show tropism for inflamed, injured or tumorigenic sites and their ability to be cultured and expanded in vitro, their self-renewal properties and low immunogenicity make these cells useful for cell therapy (Prockop, D. J. and J. Y. Oh (2012) J Cell Biochem 1 13(5): 1460-1469). Although there are some promising results with MSCs genetically modified as a therapeutic option for HCC (Gao, Yao et al. (2010) Oncogene 29(19): 2784-2794; Niess, Bao et al. (201 1 ) Ann Surg 254(5): 767-774; discussion 774- 765), these reports left a need to enhance the efficacy of MSCs migration towards tumor {e.g., HCC) microenvironment. The current application includes certain embodiments where MSCs, e.g. , MSCs genetically modified to express an anti-tumor gene, are pretreated with rAMF to increase migration toward a tumor microenvironment.
[0060] In some embodiments a method for the genetic modification of MSCs is by chemical {e.g. Lipofectamine) or physical (e.g. electroporation) transfection or viral vectors. Afterwards stably transfected cells can be selected, where the transgene cassette has integrated by chance into the MSC genome. In another embodiment, the genetic modification of MSCs is by using non-viral vector systems derived from transposons. After flanking of an expression cassette with terminal inverted repeats, a construct can be transferred into MSC via transfection. If a transposase is expressed in trans during the transfection, the expression cassette will be stably integrated into the genome of the MSC.
[0061] A genetically modified MSC according to some embodiments of the invention can be prepared by transduction of native MSCs with pseudotyped virions, expressing foreign glycoproteins on their surface, which alter the tropism and often the titer of the virion.
[0062] A genetically modified MSC according to some embodiments can be engineered to express an oncolytic virus expressing anti-tumor genes.
Autocrine motility factor (AMF)
[0063] Autocrine motility factor (AMF) is a 55-kDa cytokine secreted by tumors that regulates cell motility (Liotta, L. A., R. Mandler, et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306). AMF exhibits sequence identity with glucose-6-phosphate isomerase (GPI), a glycolytic enzyme involved in carbohydrate metabolism (Watanabe, H., K. Takehana, et al. (1996) Cancer Res 56(13): 2960-2963). The stimulation of cell motility is induced by the binding to the autocrine motility factor receptor (AMFR), a 78- kDa seven transmembrane glycoprotein with leucine zipper and RING-H2 motifs (Shimizu, K., M. Tani, et al. (1999) FEBS Lett 456(2): 295-300). AMFR is stably localized in caveolae, and caveolin-1 (Cav-1) has the ability to regulate the endocytic pathway through the stabilization of caveolae expression (Le, P. U., G. Guay, et al. (2002) J Biol Chem 277(5): 3371-3379).
[0064] One of the key steps in the transmigration process across the basement membrane is dependent on the proteolytic activity of metalloproteinases. In tumor cells, AMF- induced motility is mediated by upregulation of MMP2 and MMP3 (Torimura, Ueno et al. (2001 ) Hepatology 34(1): 62-71 ; Yu, Liao et al. (2004) Biochem Biophys Res Commun 314(1 ): 76-82). As disclosed herein, AMF was shown to increase the expression of mRNA MMP3 in MSCs. It was previously reported that MSCs exposed to CM derived from HCC cell lines increased their MMP2 activity (Garcia, Bayo et al. (201 1) Mol Pharm 8(5): 1538-1548). As disclosed herein, AMF present in the CM is, at least in part, responsible for the increased in MMP2 activity since blockage of AMF decreased MMP2 activity. In addition, stimulation with rAMF increased the invasion capacity of MSCs across collagen and the MMPs inhibitor significantly decreased the invasion capacity of MSCs.
[0065] AMF is produced by several tumors, such as lung (Dobashi, Watanabe et al.
(2006) J Pathol 210(4):431 -440), gastrointestinal, kidney and breast (Baumann, Kappl et al. ( 1990) Cancer Invest 8(3-4):351 -356 as well as hepatocellular carcinomas (HCC) (Ogata, Torimura et al. (1999) Hum Pathol 30(4): 443-450). It is also reported herein that AMF is secreted in the CM from HCC s.c tumors.
[0066] AMF is not considered a typical chemotactic factor such as VEGF, PDGF, TGF-β,
MCP-1 , IL-8, TNF-a, IL-Ι β, IL-6, SDF-1 , and HGF. Instead, intracellular AMF has been shown to be involved in glucose metabolism in all types of cells and some reports have described the extracellular form of AMF as inducing tumor migration and endothelial cell migration related to angiogenesis.
[0067] AMF-induced migration has been described in tumor cells and its role in metastasis. In vitro studies have demonstrated that exogenous AMF stimulated migration of human cancer melanoma, fibrosarcoma and HCC cells as well as human umbilical vein endothelial cells (HUVECs) (Liotta, Mandler et al. (1986) Proc Natl Acad Sci U S A 83(10): 3302-3306; Silletti, Watanabe et al. (1991) Cancer Res 51(13): 3507-351 1 ; Watanabe, Carmi et al. (1991) J Biol Chem 266(20): 13442-13448; Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71). Overexpression of AMF in NIH-3T3 fibroblasts was reported to induce malignant transformation (Tsutsumi, Hogan et al. (2003) Cancer Res 63(1 ): 242-249). In embodiments of the current application, rAMF treatment does not induce malignant transformation in MSCs or promote increased tumor development or metastasis. In cancer cells, it has been observed that AMF-induced migration is mediated by its interaction with AMF receptor (AMFR) on cell surface (Silletti, Watanabe et al. (1991 ) Cancer Res 51 (13): 3507-351 1 ). AMFR has been found stably localized to caveolae at the plasma membrane caveolin-1 , a caveolar coat protein that has been described as a negative regulator of caveolae-mediated endocytosis of AMFR to the endoplasmic reticulum (Le, Guay et al. (2002) J Biol Chem 277(5): 3371-3379). It is disclosed herein that rAMF treatment of MSCs induced AMFR and caveolin-1 and -2 expressions, supporting their role in the maintenance of the receptor on the cell surface. Moreover, in cancer cells AMF enhances integrin βΐ activity leading to activation of mitogen activated protein kinase (MAPK) and Rho pathways (Torimura, Ueno et al. (2001) Hepatology 34(1): 62-71). Small GTPase is largely involved in motility and cell adhesion due to its role in cytoskeleton organization. GTPase activity is regulated by GTPase-activating proteins (GAPs) and GDP dissociation inhibitors (GDIs). In bladder cancer, Rho GDP dissociation inhibitor (GDI) β (GDI2) is diminished in cells with higher motility indicating its role as suppressor of migration. However other reports indicated that GDI2 is upregulated in tumors with a more aggressive phenotype (Tapper, Kettunen et al. (2001) Cancer Genet Cytogenet 128(1 ): 1 -6; Yanagawa, Watanabe et al. (2004) Lab Invest 84(4): 513-522). As disclosed herein, rAMF treatment decreased mRNA of GDI-2, supporting its role as inhibitor of migration. In certain embodiments, rAMF is a chemoattractant factor for MSCs, e.g., MSCs comprising a therapeutic agent.
The AMF can be naturally produced or recombinant. In certain embodiments, the AMF is human AMF. In some embodiments, the AMF comprises the polypeptide sequence of SEQ ID NO: l or a functional fragment thereof. In some embodiments, the AMF comprises a polypeptide having an amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100%) identical to an AMF amino acid sequence that is naturally produced in an animal {e.g., SEQ ID NO: l). in some embodiments, the AMF comprises or consists of a sequence having at least 80%, at least 85%o, at least 90%, at least 95%, at least 99%, or 100%) sequence identity to SEQ ID NOT or a functional fragment thereof.
Compositions
Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has (1 ) increased migration to a tumor or a tumor cell after rAMF stimulation and/or (2) increased adhesion to an endothelial cell, e.g., a vascular endothelial cell, after rAMF stimulation.
[0071] Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has increased migration to a tumor or a tumor-derived cell. In some embodiments, the increased migration is relative to or compared to MSC without rAMF stimulation.
[0072] Certain embodiments are directed to a composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (AMF), wherein the MSC comprises a therapeutie agent and wherein the MSC of the composition has increased adhesion to an endothelial cell, e.g., a vascular endothelial cell. In some embodiments, the increased adhesion is relative to or compared to MSC without rAMF stimulation.
[0073] In some embodiments, the increased migration and/or adhesion is about 1.5-fold, about 2-fold, about 2.5-fold, or about 3-fold greater than migration and/or adhesion of the MSC without rAMF stimulation. In some embodiments, the increase in migration and/or adhesion is at least about 20-60%, 30-60%, 40-60%, 30-50%, or 20-40% greater than migration and/or adhesion of the MSC without rAMF stimulation.
[0074] In some embodiments, the MSC of the composition is selected from the group consisting of bone marrow MSC, adipose tissue MSC, umbilical cord MSC, and any combination thereof.
[0075] In some embodiments, the tumor is a solid tumor or cancer. In some embodiments, the tumor is a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, or a combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor or the tumor cell expresses endogenous AMF.
[0076] In some embodiments, the therapeutic agent is a recombinant anti-tumor gene
{e.g., an interferon (e.g., interferon a, interferon β), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1 ), a suicide gene (e.g., thymidine kinase, IL- 12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
[0077] In some embodiments, the therapeutic agent is an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., HI 01), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21 (2-3): 1 19- 26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus. In some embodiments, the therapeutic agent is an oncolytic virus (see, e.g., Dwyer RM et al. (2010) Stem Cell Res Ther. 1(3):25), e.g., onyx-015 (see, e.g., Khuri FR et al. (2000) Nat Med. 6(8):879-85); Ad-F512(H-N)5/3 (see, e.g., Viale D.L., et al. (2013) J Invest Dermatol doi: 10.1038/jid.2013.191 (e-publication ahead of print)). In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon a, interferon β), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In some embodiments, the MSC comprises a recombinant AMF receptor, CXCR1 , CXCR2, or MCP-1.
Methods of increasing migration or anchorage
[0078] Certain embodiments are directed to a method for increasing migration or anchorage of a mesenchymal stromal cell (MSC) to a tumor comprising (a) stimulating the MSC with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the tumor, wherein the MSC comprises a therapeutic agent.
[0079] In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor, e.g., a solid tumor or cancer. In some embodiments, the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor or the tumor cell expresses endogenous AMF.
[0080] In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene {e.g., an interferon {e.g., interferon a, interferon β), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, T F-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
[0081] In some embodiments, the methods of the application include increasing migration or anchorage of MSCs to a tumor wherein the MSCs comprise a therapeutic agent, e.g., an oncolytic virus (OV), i.e., a virus that preferentially infects and kills cancer cells {e.g., adenovirus (e.g., H101 ), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21 (2-3): 1 19-26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 {see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33) , In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon {e.g., interferon a, interferon β), an interleukin {e.g., interleukin 1 , interleukin 12), a chemokine {e.g., CX3CL1), or a suicide gene {e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In some embodiments, the MSC comprises a recombinant AMF receptor, CXCRl , CXCR2, or MCP-1.
Methods of treatment
[0082] Certain aspects of the application are related to cell therapies using cells genetically engineered to express a heterologous gene, e.g., an anti-cancer gene. Some embodiments are directed to a method for treating a subject with a tumor comprising administering to the subject a composition of the application.
[0083] Some embodiments are directed to a method for treating a subject with a tumor comprising (a) stimulating a mesenchymal stromal cell (MSC) comprising a therapeutic agent with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the subject.
[0084] In some embodiments, stimulating a MSC with a recombinant protein of the application, e.g., rAMF, is accomplished by pretreatment of the MSC prior to administration to a subject. Methods for pretreating the MSC include, e.g., culturing MSCs with the recombinant protein, e.g., rAMF, for about 1 -48 hours, about 6-48 hours, about 6-36 hours, about 6-24 hours, about 12-24 hours, about 12-36 hours, about 12-48 hours, about 18-48 hours, about 18-36 hours, or about 18-24 hours prior to administration of the stimulated MSC.
[00S5] In some embodiments, the subject's tumor is a solid tumor or cancer. In some embodiments, the tumor is selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, a breast cancer, and any combination thereof. In some embodiments, the tumor is a carcinoma, e.g., hepatocellular carcinoma (HCC) or colorectal carcinoma. In some embodiments, the tumor expresses endogenous AMF. In some embodiments, the tumor is metastatic and/or vascularized.
[0086] In some embodiments, the methods of the application treating a tumor wherein the
MSCs comprise a therapeutic agent, e.g., a recombinant anti-tumor gene (e.g., an interferon (e.g., interferon a, interferon β), an interleukin (interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), a suicide gene (e.g., thymidine kinase, IL-12, IFN-gamma, TNF-alpha), or any combination thereof), a cytotoxic drug, an antibody, or an oncolytic virus.
[0087] In some embodiments, the therapeutic agent is an oncolytic virus, i.e., a virus that preferentially infects and kills cancer cells (e.g., adenovirus (e.g., H101), Reovirus, measles, herpes simplex (e.g., HSV1716), Newcastle disease virus and vaccinia). See, e.g., Nakashima et al. (2010) Cytokine Growth Factor Rev. 21(2-3): 1 19-26. In some embodiments, the oncolytic virus is engineered to expresses a recombinant anti-tumor gene. In one embodiment, the recombinant oncolytic virus is an oncolytic adenovirus, e.g., Ad-F512(H-N)5/3 (see, e.g., Lopez, et al. (2012) Mol Ther. 20(12):2222-33). In some embodiments, the oncolytic virus can be used as a vector for delivery of anti-tumor genes, e.g., an interferon (e.g., interferon a, interferon β), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1), or a suicide gene (e.g., encoding enzymes that can metabolize a separately administered non-toxic pro-drug into a potent cytotoxin, which can diffuse to and kill neighboring cells). In one embodiment, the suicide gene encodes Herpes simplex viral thymidine kinase, and the subject ideally is treated with ganciclovir in a manner permitting the Herpes simplex viral thymidine kinase to render the ganciclovir cytotoxic. Another possibility is the use of cytosine deaminase as a cytotoxic protein, which converts 5-fluorocytosine to the toxic compound 5- fluorouracil.
[0088] In some embodiments, the method for treating a subject with a tumor comprises introducing into the subject's bloodstream a therapeutically effective amount of a rAMF stimulated MSC or composition of the application. In some embodiments, the administration to the subject is systemic (e.g., parenteral) or local, e.g., to an intra-hepatic artery.
[0089] In some embodiments, the therapeutically effective number of MSCs includes, without limitation, the following amounts and ranges of amounts: (i) from about lxl 05 to about lxl O9 cells/kg body weight; (ii) from about lxl 06 to about l xlO8 cells/kg body
A 7
weight; (iii) from about 5x10 to about 2x10 cells/kg body weight; (iv) from about 5x 10 to about l xl O7 cells/kg body weight; (v) from about lxl 07 to about 2xl07 cells/kg body weight; (vi) from about 7x l 06 to about 9xl 06 cells/kg body weight; (vii) about l xl 05 cells/kg body weight; (viii) about lxl 06 cells/kg body weight; (ix) about 5xl06 cells/kg body weight; (x) about 1x10 cells/kg body weight; (xi) about 6x10 cells/kg body weight; (xii) about 7xl 06 cells/kg body weight; (xiii) about 8xl 06 cells/kg body weight; and (ix) about 9xl 06 cells/kg body weight. Human body weights envisioned include, without limitation, about 50 kg, about 60 kg; about 70 kg; about 80 kg, about 90 kg; and about 100 kg. Therapeutically effective amounts can be based on pre-clinical animal experiments and standard protocols from the transplantation of MSCs.
[0090] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al , ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al , ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No. 4,683, 195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise. Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al , eds., Methods In Enzymology, Vols. 154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Ernbryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.).
[0091] The following examples are offered by way of illustration and not by way of limitation.
Exam les
Example 1 Materials and Methods
C S! lines
[0092] Human HCC cell line HuH7 were kindly provided by Prof. Jesus Prieto (CIMA,
University of Navarra, Pamplona, Spain). LX-2 cell line (human HSCs generated by spontaneous immortalization in low serum conditions) was kindly provided by Dr. Scott Friedman (Division of Liver Diseases, Mount Sinai School of Medicine, New York, NY, USA). Human microvascular endothelial cells (HMEC-1) were provided by CDC (Centers for Disease Control, Atlanta, GA, USA). Cell lines were cultured in complete DMEM (2 μπιοΙ/L glutamine, 100 U/mL penicillin, 100 mg/mL streptomycin and 10% heat-inactivated fetal bovine serum (FBS)). Primary culture of HCC cells (HC-PT-5) was previously generated in our laboratory and cultured the eight passage in 70% DMEM/ 30%) F12 (Invitrogen/Life Technologies) culture medium supplemented with 2 μΓηοΙ/L glutamine, 100 units/mL penicillin, 100 mg/mL streptomycin and 10 % FBS. isolation of MSCs, AT-MSCs and Mesenchymal cells harvested from umbilical cord perivascular tissue
[0093] Cells were obtained from allogeneic bone marrow transplantation of healthy donors after informed consent (Hospital Naval Pedro Mallo, Buenos Aires, Argentina). Mononuclear cells were plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina). After 2 h incubation, non-adherent cells were removed and adherent hMSCs were cultured and used for different experiments between passages 4 to 6. For AT-MSCs generation, cells were isolated from discarded fat from esthetical liposuctions after informed consent as described previously Zuk et al. (Zuk, Zhu et al. (2001). Tissue Eng 7(2):21 1-228). Briefly, discarded lipoaspirates were washed extensively with sterile phosphate-buffered saline. Washed aspirates were treated with 0.075% type collagenase (Sigma-Aldrich) in PBS for 30 min at 37°C with agitation. The cells were centrifugated and cellular pellet was plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina) and used for different experiments between passages 4 to 6.
[0094] Mesenchymal cells harvested from umbilical cord perivascular tissue were isolated from discarded umbilical cord obtained from healthy donors from the Service of Gynaecology and Obstetrics after informed consent in our institution adapted from the protocol previously described in Sarugaser, Lickorish et al. (2005). Stem Cells 23(2):220- 229). Umbilical cords were dissected and vessels with its surrounding Warthon's Jelly were pulled out. Then the perivascular Wharton's Jelly were removed from the vessels and mechanically disrupted. Minced fragments were plated in complete DMEM low glucose/20% FBS (Internegocios S.A., Argentina). After 7 days incubation, non-adherent cells and minced fragments were removed and adherents Mesenchymal cells harvested from umbilical cord perivascular tissue were cultured and used for different experiments between passages 4 to 6.
[0095] MSCs were characterized according to the guidelines f om International society for cellular therapy (ISCT).
Conditioned Medium
[0096] To obtain tumor conditioned medium (TCM), HuH7 or HC-PT-5 subcutaneous tumors (s.c.) were dissected and minced into pieces smaller than 1 mm3 and transferred into a 24 wells tissue culture plate (6 fragments/well) with 500 μΐ of DMEM supplemented with 2 μηιοΐ/ΐ glutamine, 100 units/ml penicillin, and 100 mg/ml streptomycin. Cell conditioned medium (CCM) was obtained from HCC cell lines cultured as described above to 90% confluence and then were washed with PBS and cultured with DMEM without FBS. In both cases, 18 hours later conditioned medium was harvested and stored at -80 °C until use. Western Blot
BM-MSCs or AMF stimulated BM-MSC were lysed with 150 mmol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4, 0.1% SDS, 1.0% Nonidet P-40, 0.5% Na-deoxycholate, 0.2 mmol/L phenylmethylsulfonyl fluoride, and protease inhibitor cocktail. Lysates were centrifuged at 12,000 g for 20 min and the supernatants were used as total cell lysates. CCM and TCM were concentrated 100-fold using Vivaspin 6 centrifugal concentrator (Sartorius-Stedim Biotech). The protein concentration was determined by Bradford protein assay (Bio-Rad). Protein was separated by SDS-PAGE and transferred onto nitrocellulose membrane (Hybond-ECL, Amersham Biosciences). Blots were blocked and incubated with anti-AMF (1 :700) polyclonal antibody (sc-33777, Santa Cruz Biotechnology), anti-AMFR (1 : 1000) polyclonal antibody (AP2162a, ABGENT), anti- JNK (1 : 1000) polyclonal antibody (9252, Cell Signaling), anti-phospho-JNK (1 : 1000) polyclonal antibody (9251 , Cell Signaling), anti-c-Fos (1 : 1000) monoclonal antibody (2250, Cell Signaling), anti-phospho-c-Fos (1 : 1000) monoclonal antibody (5348, Cell Signaling), anti-phospho-CREB (1 : 1000) monoclonal antibody (9198, Cell Signaling) or anti-Actin (1 :700) polyclonal antibody (sc-1615, Santa Cruz Biotechnology) at 4°C overnight. Finally, blots were then incubated with the corresponding HRP-conjugated IgG at room temperature for 1 hour. The reactions were visualized using the enhanced chemiluminescence (ECL) reagent (Sigma). Staining with colloidal Coomassie was performed as loading control for conditioned medium as was reported previously (Welinder, Ekblad. (201 1) J Proteome Res 10(3): 1416-1419). Density of each band was quantified with Scion Image software (Scion Corporation, Frederick, MD).
In vitro migration, invasion, and wound-healing assays
In vitro migration was performed using a 48-Transwell microchemotaxis Boyden Chamber unit (Neuroprobe, Inc.). In brief, MSCs (1.2 x 103 cells/well) were placed in the upper chamber and DMEM, TCM or recombinant human AMF (rAMF) where placed in the lower chamber of the Transwell unit. Both chambers were separated by 8 μιη pore polycarbonate filters (Nucleopore membrane, Neuroprobe). For blocking experiments, TCM were pre-incubated for 60 min with anti-AMF polyclonal antibody (sc-33777, Santa Cruz Biotechnology) or isotype control IgG. For AMF pre-treatment BM-MSCs were incubated overnight (O.N.) with ^g/ml of rAMF in DMEM without FBS or DMEM without FBS as control.
[0099] For the invasion assay the polycarbonate filters were previously incubated with 10 mg/ml type IV collagen (Sigma-Aldrich) for 18 h at 4°C; for MMP inhibition, BM-MSCs were preincubated with 1 ,10 phenantroline (0.5 or 1 mM) (Sigma-Aldrich). MSCs viability was not affected by 1 ,10 phenantroline (not shown). All the systems were incubated for 4 h at 37 °C in a 5% C02 humidified atmosphere. After that, the membrane was carefully removed and cells on the upper side of the membrane were scraped off with a blade. Cells attached to the lower side of the membrane were fixed in 2% formaldehyde, and stained with 40,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich). Cells were counted using fluorescent-field microscopy and a 10X objective lens: the images captured in three representative visual fields were analyzed using CellProfiler software (www.cellprofiler.com), and the mean number of cells/field + SEM was calculated.
[0100] For the wound-healing assay, Fast-DiO-stained MSCs were seeded at 2.5x104 cell/cm2 in DMEM with 10% FBS for 24 hours. Then, cells were preincubated overnight with 1 μg/ml rAMF or DMEM without FBS. The monolayers were then scratched by a 200 ml-tip, washed with PBS and incubated for 24 hours more in DMEM without FBS. Cells within the scratched area were counted under a fluorescent-field microscope at 40X and the number of cells/field were determined. Additionally, adherent cells were counted at the end of the experiment confirming the same number of cells in all the conditions.
Gelatin Zymography Assay
[0101] To evaluate whether AMF induced gelatinolytic activity in MSCs, 5xl04 cells were seeded in 24-well plates for 18 h. Cells were treated with ^g/ml of rAMF, TCM or serum-free DMEM as untreated control for 2 h; then, MSCs were washed with PBS and cultured in DMEM for 6 h before supernatants were collected. For blocking experiments, TCM were pre-incubated for 60 min with anti-AMF polyclonal antibody (sc-33777, Santa Cruz Biotechnology) or isotype control IgG. MMP2 activity was determined by zymography. Briefly, 20 of MSC supernatant was run on a 10% SDS-PAGE containing 0.1% gelatin (Sigma-Aldrich). The gel was stained with Coomassie Brilliant Blue R-250 for 30 min at room temperature. Gelatinase activity was visualized by negative staining; gel images were obtained with a digital camera (Canon EOS 5D), and were subjected to densitometry analysis using Scion Image software (Scion Corporation, Frederick, MD). Relative MMP2 activity was obtained by normalizing values to untreated samples (DMEM).
Cell Adhesion Assays
[0102] For analyses of MSC adhesion to endothelial cells, 2xl05 HMEC-1 were seeded in
96-weIl microplates and cultured for 1 day prior the assay. Coated wells were incubated for 5 minutes with 0.1 ml of 5xl 04 cells/ml of Fast-DiO labeled MSCs O.N. pretreated or not with 1 μg/ml rAMF. The cell suspension was discarded and the cells were fixed with 2% paraformaldehyde. Cells were counted using fluorescent-field microscopy and a 20X objective lens: the images captured in ten representative visual fields were analyzed using CellProfiler software (cellprofiler.com) and normalizing to untreated control.
Reverse Transcription-polymerase Chain Reaction (RT-PCR)
[0103] Total mRNA of BM-MSCs O.N. pretreated or not with 1 μ^πιΐ rAMF was extracted using Trizol Reagent (Sigma-Aldrich Co., St. Louis, MO). For quantification of MMP3 mRNA level, MSCs were 24 h starved before rAMF pre-treatment. Total mRNA (4 μg) was reverse transcribed with 200 U of Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) using 500 ng of Oligo (dT) primers. cDNAs were subjected to real-time polymerase chain reaction (qPCR) (Stratagene Mx3005p, Stratagene, La Jolla. CA, USA). For qRT-PCR, the mRNA levels of metalloproteinase 3 MMP3, AMF receptor (AMFR), GDP dissociation inhibitor 2 (GDI-2), caveolin-1 (CAV-1) and caveolin-2 (CAV-2) were quantified by SYBR® Green (Invitrogen), using the following primer pairs:
[0104] MMP3 5'-ACGCCAGCCAACTGTGATCCT-3 ' (forward) (SEQ ID NO: 2), 5'-
ATATGCGGC ATCC ACGCCTGAA-3 ' (reverse) (SEQ ID NO: 3);
[0105] AMFR 5'-ACAAGATGTGGGCCTTGCAAGA -3 (forward) (SEQ ID NO: 4), 5'-
AAAACGCAGTGCTCCCAGGATA-3' (reverse) (SEQ ID NO: 5);
[0106] GDI-2 5 '-GACC AGCTTFGG AGCTCTTG-3 ' (forward) (SEQ ID NO: 6), 5'-
TGCGGG AA ATA AAGATCTGG-3 ' (reverse) (SEQ ID NO: 7);
[0107] CAV-1 5'-AATCCAAGCATCCC'nTGCCCA-3' (forward) (SEQ ID NO: 8), 5'-
ACC AGG C AGCT!TCTGT ACG A -3' (reverse) (SEQ ID NO: 9); [0108] CAV-2 5'-GAGAGACAGGGGAGTTGTCAACTT-3 ' (forward) (SEQ ID NO:
10), 5'- GCCCGGCCCAGAAATAATGAGAT -3' (reverse) (SEQ ID NO: 1 1);
[0109] CXCR1 5 '-TTTTCCGCC AGGCTTACC AT-3 ' (forward) (SEQ ID NO: 14), and
5'-AACACCATCCGCCATTTTGC-3' (reverse) (SEQ ID NO: 15);
[0110] CXCR2 5 '-TAAGTGG AGCCCCGTGGGG-3 ' (forward) (SEQ ID NO: 16),and
5 '-TGGGCTC AGGGGC AGGATG-3 ' (reverse) (SEQ ID NO: 17);
[0111] CCR2 5 '-CGAGAGCGGTGAAGA AGTC A-3 ' (forward) (SEQ ID NO: 18),and
5 '- AGC ATGTTGCCC AC AAAACC-3 ' (reverse) (SEQ ID NO: 19);
[0112] IL-6R 5 '-GC ACTTGCTGGTGG ATGTTC-3 ' (forward) (SEQ ID NO: 20),and 5'-
AGCCTTTGTCGTCAGGGATG-3 ' (reverse) (SEQ ID NO: 21);
[0113] IL-6ST 5'-CCCACCTCATGCACTGTTGA-3' (forward) (SEQ ID NO: 22),and
5 '-TTATGTGGCGGATTCGGCTT-3 ' (reverse) (SEQ ID NO: 23); and
[0114] IGFBP3 5 '- ACTGTGGCC ATG ACTGAG-3 ' (forward) (SEQ ID NO: 24),and 5'-
AGAGTCTCCCTGAGCCTGA-3 ' (reverse) (SEQ ID NO: 25).
[0115] All PCR amplifications were carried out using a cycle of 95 °C for 10 min and 45 cycles under the following parameters: 95°C for 30 sec, 58°C for 30 sec, 72°C for 1 min. At the end of the PCR reaction, the temperature was increased from 60°C to 95°C at a rate of 2°C/min, and the fluorescence was measured every 15 sec to construct the melting curve. Values were normalized to levels of glyceraldehyde-3 -phosphate dehydrogenase (GAPDH; used as housekeeping) transcript (forward 5'-CATCTCTGCCCCCTCTGCTG -3' (SEQ ID NO: 12); reverse 5'-GCCTGCTTCACCACCTTCTTG-3' (SEQ ID NO: 13)). Data were processed by the AACt method (Livak KJ, Schmittgen TD. (2001) Methods 25(4):402-408).
[0116] The relative amount of the PCR product amplified from untreated cells was set as
1. A non-template control (NTC) was run in every assay, and all determinations were performed in triplicate in three separated experiments.
Proliferation Assays
[0117] HCC cells were seeded in 96-well culture tissue plates at 3xl04 cells/cm2 density for 1 day prior to the assay. Then cells were cultured with CM of BM-MSCs pre-treated with ^g/ml of rAMF for 48h. DMEM and CM of untreated BM-MSCs were used as control. Cell proliferation was evaluated by [3H]- thymidine incorporation assay. Each sample was assayed in sextuplicate and normalized to DMEM control. Three-Dimensional Spheroids
[0118] Ninety-six- well tissue culture plates were coated with 2% agarose in PBS. A total of 3 x l O3 HuH7 cells, I x 103 LX-2, 1 x 103 HMEC-1 with or without 1 x 103 BM- SC per spheroid were mixed in complete DMEM to obtain a single multicellular spheroid per well. Seventy-five microliters of supernatant was careful ly removed from each well every 2 days and replaced with fresh medium or CM from BM-MSC. Viability above 75% was confirmed by Trypan blue exclusion test in all experiments. Spheroid size was evaluated using inverted microscopy and a 4X objective lens: the images were captured and diameters determined using ImageJ software (National Institute of Health, NIH), finally spheroid volume was determined was calculated by the formula π/6 x larger diameter x (smaller diameter)2 and expressed as arbitrary unity.
Mice and in vivo experiments
[0119] Six- to eight-week-old male nude BALB/c mice were purchased from CNEA
(Comision Nacional de Energia Atomica, Ezeiza, Buenos Aires, Argentina). The animals were maintained at our Animal Resources Facilities (School of Biomedical Sciences, Austral University) in accordance with the experimental ethical committee and the NIH guidelines on the ethical use of animals. Subcutaneous model: HuH7 cells (2 x 106) or HC-PT-5 cells (5 x 106) were inoculated subcutaneously (s.c.) into the right flank of nude mice. To evaluate the effect of BM-MSCs pre-treated with recombinant human AMP (rAMF) on tumor development, s.c. HuH7 tumors were established and after 10 days BM-MSCs or BM-MSCs pre-treated with rAMF were intravenously (i.v.) injected. Tumor growth was assessed by calliper measurement, and tumor volume (mm3) was calculated by the formula π/6 x larger diameter x (smaller diameter) . For in vivo migration studies, BM-MSCs or BM-MSCs pre-treated with rAMF were prestained with CMDil for histological analysis and DiR (Molecular Probes, Invitrogen) for fluorescence imaging (FI) and were i.v. injected (5 x 105 cells/mice) 10 days after tumor inoculation. FI was performed using the Xenogen In Vivo Imaging System (IVIS; Caliper Life Sciences, Hopkinton, MA, USA). Mice injected with CMDil-DiR-labeled MSCs were analyzed 1 h after MSC injection and every day until the experimental end point. Images represent the radiant efficiency and were analyzed with IVIS Living Image (Caliper Life Sciences) software. Regions of interest (ROI) were automatically drawn around the isolated organs to assess the fluorescence signal emitted. Results were expressed as average radiant efficiency in units of photons/second within the region of interest [p/s/cm2/sr] / [μ'νν/cm2] or as total radiant efficiency in units of photons/second within the region of interest [p/s] / [μψ/cm j.
Detection of BM-MSC by Fluorescence
[0120] To detect CMDiI+ cells within tumors, frozen sections were mounted in mounting media with DAPI (Vector Laboratories, Inc.) and observed under a fluorescence microscope using a 20X objective lens.
Statistical Analyses
[0.1.21] Unpaired Student's t test, one-way analysis of variance following by post tests or
Kruskal-Wallis and Dunn's post-tests (GraphPad Prism Software) were used for statistical analyses. Differences with p values lower than 0.05 were considered as statistically significant.
Example 2
Identification of secreted factors from HCC microenvironment
[0122] Factors secreted from hepatocellular carcinoma (HCC) microenvironment were identified. Tumor conditioned media (TCM) were obtained from fresh HCC samples or tumors generated from primary cultured human HCC cells (HC-PT-5) or the HuH7 cell line in BALB/c nude mice.
[0123] In vitro migratory capacity of MSCs to different TCM samples was analyzed using a 48-Transwell microchemotaxis Boyden Chamber unit (Neuroprobe, Inc.).
[0124] Factors present in the different TCM were identified using two Human Cytokine and Chemokine Antibody Arrays (RayBiotech). The factors identified are shown in Tables 1 and 2.
[0125] Changes in the gene expression patterns in MSCs exposed to TCM derived from
HCC samples were also analyzed. MSCs were exposed overnight to TCM or DMEM (as control) and studied using a microarray gene expression analysis with the aim to identify genes that were differentially expressed in MSCs exposed or not to TCM. Table 3 shows 445 genes differentially expressed in MSC exposed to TCM from sample 1 in comparison with non-exposed cells. T able 4 shows 51 1 genes differentially expressed in MSC exposed to TCM from sample 2 in comparison with non-exposed cells. Table 5 shows 521 genes differentially expressed in MSC exposed to TCM from sample 4 in comparison with non-exposed cells. Table 6 shows 51 1 genes differentially expressed in MSC exposed to TCM from sample 5 in comparison with non-exposed cells.
[0126] Expression of receptors recognized by soluble factors were analyzed. Receptors with positive signal in at least two of the three replicates of microarray are listed in Table 7.
[0127] Real-time PCR (qRT-PCR) was used to analyze the expression of selected genes related to migration in MSCs exposed to TCM. Figure 1A shows the relative mR A expression of up-regulated genes CTGF, CYR61 , GJAl , SPARC, and AMFR. Autocrine Motility Factor Receptor (AMFR) was up-regulated in MSCs exposed to all CM derived from HCC samples. Figure IB shows relative mRNA expression of down-regulated genes HSPA1A, HSP1 B, and IGFBP3.
Example 3
Recombinant AMF exerts a specific chemoatractant activity on MSCs from
different sources
[0128] The tumor conditioned media (TCM) from ex vivo subcutaneous (s.c.) tumors derived from HuH7 cell line or HC-PT-5 HCC primary culture and conditioned media from cell culture monolayers (CCM) were subjected to western blot analysis according to the method described in Example 1. A 55 kDa soluble AMF was detected in CCM and TCM (Figure 2A).
[0129] The ability of recombinant human AMF (rAMF) to induce MSCs chemotaxis in vitro was analyzed. MSCs from different sources were evaluated by in vitro migration assay with modified Boyden chambers as described in Example 1. Human MSCs derived from bone marrow (BM-MSCs), perivascular umbilical cord region (Mesenchymal cells harvested from umbilical cord perivascular tissue), or adipose tissue (AT-MSCs) were used in a modified Boyden chamber assay.
[0130] The MSCs from the different sources migrated in a dose-dependent manner towards recombinant AMF (Figure 2B-D), The most significant migration degree was shown in the dose ranging between 0.5 μg/mL and 1 μg/mL (p<0.01) of rAMF for both BM-MSC and Mesenchymal cells harvested from umbilical cord perivascular tissue (Figure 2B-C), while AT-MSCs migrated better at 0.75 μg/mL of rAMF (Figure 2D). Interestingly, higher rAMF concentration (5 μg/mL or 10 μg/mL) were not capable of inducing migration neither in BM-MSCs nor in Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs.
[0131] Next, TCM were pretreated with polyclonal antibody against AMF (anti-AMF) to examine whether HCC tumor-secreted AMF was involved in MSC migration as described in the methods of Example 1 . As shown in Figure 2E-G, antibody blocking of AMF present in the TCM from either HuH7 or HC-PT-5 reduced their capability to induce MSC migration in a dose dependent manner. At 1 μg/mL of anti-AMF, BM-MSCs showed a 40% reduction of migration in response to TCM derived from both HCC tumors. A similar effect was observed in Mesenchymal cells harvested from umbilical cord perivascular tissue with a reduction of 30% and 40% in the response to TCM from HuH7 and HC-PT-5, respectively. Finally, the reduction in AT-MSC migration potential was 30% and 20% towards TCM from HuH7 and HC-PT-5, respectively. These results show that AMF exerted a potent chemotactic role in HCC tumor cells.
[0132] These results show that AMF was secreted in the culture monolayers from HCC s.c tumors. Moreover, the results show for the first time that AMF produced by HCC is a chemoattractant factor for MSCs and induces migration of MSCs. The migration was shown using MSCs from different sources (i.e., bone marrow (BM), perivascular cells from umbilical cord (Mesenchymal cells harvested from umbilical cord perivascular tissue) and adipose tissue (AT-MSCs)) and the MSCs from all of he tested sources exhibited migration towards AMF in a dose-dependent manner. \ μ§ ηύ of AMF was sufficient to induce MSCs migration.
Example 4
AMF stimulates matrix metalloproteinase (MMPs) activity on MSCs
[0133] One of the key steps in the transmigration process across the basement membrane is dependent on the proteolytic activity of metalloproteinases. The effect of rAMF on the MSC metalloproteinase activity needed for cell migration was characterized- [0134] MMP3 mRNA level in MSCs was evaluated by qRT-PCR as described in
Example 1 . MMP3 transcripts showed a 2.4-fold increase in BM-MSCs and Mesenchymal cells harvested from umbilical cord perivascular tissue, and 1 .4-fold in AT- MSCs exposed to rAMF compared to unexposed cells (Figure 3A).
[0135] BM-MSCs stimulated with HCC CCM had increased MMP2 activity. As previously reported (Garcia, Bayo et al. (201 1). Mol Pharm 8(5): 1538- 1548), gelatinolytic activity corresponding to MMP2 was detected in supernatants from BM- MSCs and also from Mesenchymal cells harvested from umbilical cord perivascular tissue and AT-MSCs. In the present example, MMP2 activity was measured by zymography (as described in Example 1 ) in MSCs culture supernatant pre-stimulated with 1 μg/mL of rAMF or from un-stimulated cells as control to determine whether the induction of MMP2 was dependent on the presence of AMF in the TCM. MMP2 activity was significantly enhanced when different sources MSCs were stimulated with rAMF (Figure 3B).
[0136] MMP2 activity was also measured in MSC culture supernatant stimulated with
TCM derived from HuH7 previously blocked with polyclonal Ab anti-AMF. As a result, the increased MMP2 activity previously observed was completely abolished when MSCs were treated with AMF blocked-TCM showing a similar level of MMP2 activity than untreated cells (Figure 3C).
[0137] Stimulation with rAMF increased the invasion capacity of MSCs across collagen and the MMPs inhibitor significantly decreased the invasion capacity of MSCs. (Figure 3D).
[0Ϊ38] These results show that MMP3 expression and MMP2 activity was induced in
MSCs by rAMF. In particular, rAMF increased the expression of mRNA MMP3 in MSCs. The results also show that AMF present in the TCM was, at least in part, responsible for the increased in MMP2 activity, which supports a critical role for AMF in MSC migration and invasion since blockage of AMF decreased MMP2 activity and inhibition of MMP2 decreased invasion in vitro. Example 5
AMF enhances BM-MSCs migration towards HCC by stimulating endothelial cell adhesion and modulating critical related genes
[0139] Specific MSC migration to HCC is critical for their use as cell earners of therapeutic genes. MSCs were pretreated with rAMF to determine the effect of MSC migration towards the HCC TCMs. In vitro migration assay was used to measure migration of MSCs as described in Example 1 .
[0140] As shown in Figure 4A, rAMF pretreatment induced a 40% increase in BM-
MSCs migration to conditioned medium from ex vivo s.c. tumors (TCM) derived from HuH7 or HC-PT-5 cell lines. These results show that rAMF pretreatment influenced migration of MSCs towards TCM.
[0141] By wound-healing assay, it was observed that overnight rAMF pretreatment did not modify MSC general motility (Figure 4B) indicating that rAMF pretreatment increases specific chemotaxis towards HCC.
[0142] Adhesion to endothelial cells is considered a crucial event for the efficient arrest of MSCs within tumor vasculature for subsequent transmigration. The effect of rAMF on cell adhesion was tested by pretreating MSCs with rAMF and measuring cell adhesion as described in Example 1. Pretreatment with rAMF resulted in a 2-fold enhancement in BM-MSCs adhesion to human endothelial cells HMEC-1 (Figure 4C).
[0143] Genes related to the AMF-AMFR pathway were also studied. As shown in Figure
4D, a 1 .8-fold induction of AMF receptor mR A was observed when BM-MSCs were stimulated with rAMF. Additionally, mRNA levels of caveolin-1 (CAV- 1 ) and caveolin- 2 (CAV-2) were increased in 2.4-fold and 2.3-fold respectively, while Rho GDP dissociation inhibitor (GDI) β (GDI-2) expression was reduced 10% after rAMF treatment in BM-MSCs. Moreover, rAMF t eatment induced the expression of AMFR, and the proteins involved in AMF-AMFR signaling pathways such as JNK, p-JNK, c-Fos, p-c-Fos and p-CREB (Figure 4E).
[0 I44 { These results demonstrated that pretreatment with rAMF significantly increased
MSC migration towards HCC in vitro and increased MSC adhesion to endothelial cells. Furthermore, these results show that rAMF treatment induced AMFR and caveolin-1 and -2 (genes having a possible role in maintenance of the receptor on the cell surface) expression and decreased GDI-2 (a gene having a possible role as inhibitor of migration) mRNA expression. AMFR and activation of mitogen activated protein kinase (MAPK) pathway was observed after rAMF treatment.
Example 6
Recombinant AMF increases the in vivo homing of MSCs into HCC
Enhancement of MSC migration towards HCC by rAMF stimulation was studied in vivo. Noninvasive fluorescence imaging (FI) was used to measure migration of MSCs as described in Example 1. Human MSCs derived from bone marrow (BM-MSCs) pre- stimulated with rAMF (^g/mL) or control BM-MSCs (no stimulation) were stained with cell trackers DiR and CM-Dil prior to intravenous injection in mice carrying s.c. HuH7 tumor nodules as described in Example 1. Three days later, mice were sacrificed and the fluorescence signal in the isolated tumors was analyzed. The total fluorescent intensity in both groups of animals were similar, indicating no differences in the quantity of injected BM-MSCs (Figure 5A). Tumors from animals injected with rAMF-pretreated BM-MSCs showed a stronger Di . signal in comparison with control mice ( Figure 5B-C). Mice that received BM-MSC pretreated with rAMF did not show increased signal in liver, lung or spleen (Figure 5D-F), indicating a specific increased recruitment of BM-MSCs in tumor microenvironment. The presence of BM-MSCs in the isolated tumors was confirmed by cell visualization under fluorescence microscopy (Figure 5G). rAMF increased in vivo migration to HCC tumors. These results show that stimulation of MSCs with rAMF increased in vivo migration of MSCs towards experimental HCC tumors in comparison with non-stimulated MSCs.
In vitro studies indicated that HuH7 HCC cells exposed to CCM from MSC pretreated with rAMF did not enhance cell proliferation compared to unexposed cells or to HuH7 cells exposed to CCM from untreated MSCs (Figure 6A). Moreover, pretreatment of MSCs with AMF did not affect the in vitro growth of multicellular spheroids composed of HuH7 HCC cells, hepatic stellate cells LX-2 and HMEC-1 endothelial cells (Figure 6B). Finally, AMF-prestimulated MSCs did not enhance tumor growth compared to control tumor-bearing mice (saline) or to the group of mice administered with unstimulated MSCs (Figure 6C). These studies indicated, as a whole, that AMF promoted MSC homing to the HCC niche without affecting tumor growth.
[0147] Pretreatment with rAMF was shown to significantly increase (by 30%, ρΟ,ΟΙ )
MSCs migration towards HCC in vivo. This is the first report demonstrating the increased in vivo migration of MSCs towards HCC with pretreatment of MSCs with rAMF.
Example 7
HUCPVCs presented higher migration and adhesion than BM-MSCs
[0148] in vitro migration assays were performed as described in Example 3 . Specifically, in vitro migration of bone marrow-derived mesenchymal stem cells (BM-MSCs) (black bars) or human umbilical cord perivascular cells (HUCPVCs) (grey bars) towards CCM from HCC (HuH7 and HC-PT-5), hepatic stellate cells (LX-2), fibroblasts (Wl-38) or endothelial ceils (HMEC-1) was measured (Figure 7A). In each case, a higher migratory capacity towards ail the CCM was found for HUCPVCs when compared to BM-MSCs. Moreover, in contrast to BM-MCSs, HUCPVCs showed capability to migrate to CCM derived from nonturnoral components (fibroblast and endothelial cells).
[0149] Besides their capacity to migrate toward factors secreted by HCC, the arrest of
MSCs within the microvasculature is considered a critical step for an efficient homing and anchorage to tumors. Therefore, cell adhesion assays were also performed as described in Example 1 to evaluate adhesion ability of MSCs. In that assay, HUCPVCs showed an increased in vitro adhesion to HMEC-1 endothelial cells in comparison with BM-MSCs (Figure 7B).
Example 8
HUCPVCs presented in vivo migration towards HCC tumors
[0150] To further characterize MSC behavior in vivo, noninvasive migration assays were performed as described in Example 1. CM-Dil and DiR prelabelled BM-MSCs or HUCPVCs were i.v. injected in HCC tumor-bearing mice in order to evaluate MSC recruitment. Similar to our previous observation with BM-MSCs (Figure 5), at 3 days after cell transplantation a positive signal corresponding to HUCPVCs was found in liver, lungs, spleen, and s.c. tumors (Figure 8A). Despite the fact that total signal was lower in mice injected with HUCPVCs compared to those injected with BM-MSCs (Figure 8B), the percentage of total signal corresponding to s.c. tumor locations was increased in mice administered with HUCPVCs in comparison with animals that received BM-MSCs (Figures 8C and 8D), indicating an enhanced engraftment of HUCPVCs into HCC tumors. In the other evaluated tissues, signal intensity was similar for BM-MSC or HUCPVCs in lung and liver and it was comparatively reduced in the spleen of HUCPVCs-injected mice (Figure 8D). Presence of MSCs in the s.c. tumors was also confirmed by fluorescence microscopy (Figure 8E). Finally, MSCs were evaluated for whether they might present differential migratory capacity towards CM obtained from s.c. tumors (TCM). A greater in vitro migratory capacity towards TCM from HCC was observed for HUCPVCs when compared to BM-MSCs (Figure 8F).
Example 9
Differential expression of cytokines/chemokines receptors and AMF/AAMFR pathway in MSCs 51] In order to evaluate mechanisms partially explaining the differential migratory capacity of HUCPVCs compared to BM-MSCs towards tumor released factors, the expression of some chemokine receptors likely involved in MSC recruitment towards HCC was analyzed. Because interleukin- (IL-) 8, GRO, chemokine (C-C motif) ligand (CCL)-2, and IL-6 are among the most relevant factors in HCC (Bayo et al , Liver International 34(3):330-334 (2014)\ qPCR (as described in Example 1 ) was used to evaluate the expression of CXCR1 , CXCR2, CCR2, IL-6R, and IL-6ST. Constitutive CXCR1 and CXCR2 mRNA expression was found to be lower and CCR2 slightly higher in HUCPVCs when compared to BM-MSCs, while IL-6R and IL-6ST expression was similar in both MSCs sources (Figure 9A). Next, the axis of the autocrine motility factor (AMF) was evaluated. By qPCR, a significantly higher expression of the AMF receptor (AMFR) was found in HUCPVCs when compared to BM-MSCs. Similarly, genes known to be related to the availability of the receptor in the cell surface such as caveolin-1 (CAV-1 ) and caveolin-2 (CAV-2) were also highly expressed in HUCPVCs as well as the metalloproteinase 3 (MMP3), necessary to the transmigration process. In contrast, expression levels of insulin-like growth factor-binding protein 3 (IGFBP3), a protein that negatively regulates AMF/AMFR pathway, were found to be reduced in HUCPVCs when compared to BM-MSCs (Figure 9B).
Example 10
HUCPVCs showed enhanced migration towards AMF
[0152] The in vitro migration response to the recombinant AMF (rAMF) of both BM-
MSCs (black bars) or HUCPVCs (grey bars) was tested using a chemotaxis assay (Figure 10A). A significantly higher migration to different doses of rAMF (0.5 and 0.75μg/mL) was observed for HUCPVCs when compared to BM-MSCs. In spite of different types of MSCs showing similar reduction in migration levels (50% of control) towards HuH7 TCM after the blockage with anti-AMF antibody fdata not shown), preincubation of HC- PT-5 TCM with anti-AMF antibody (AMF-ab) resulted in a further reduction in HUCPVCs migration capacity (54% of control) when compared to BM-MSCs (67% of control) (Figure 10B).
Example 1 1
Anti-CXCRl, anti-CXCR2, and anti-MCP-1 antibodies inhibit MSC migration
[0153] Blocking experiments were performed by preincubating TCM-HuH7 or TCM-
HC-PT-5 with anti-HGF (10 μg/ml), anti-MCP-1 (10 μg/ml) or isotype control IgG for 1 hour. Similarly, anti-CXCRl (10 μ /πιΙ), anti-CXCR2 (10 μg/ml), both anti-CXCRl/ anti-CXCR2, or isotype control IgG were pre-incubated with MSC for 1 hour. In vitro migration of MSCs towards TCM-HuH7 or TCM-HC-PT-5 were evaluated using the methods described in Example 1.
[0154] Antibody inhibition of CXCR1 or CXCR2 decreased MSC migration around 30% and incubation with both anti-CXCRl and anti-CXCR2 antibodies inhibited migration around 40% (Figure 11A). Moreover, anti-MCP-1 inhibited MSC migration around 20%, but anti-HGF had no effect on MSC migration towards CM-HuH7 (Figure 11B), Example 12
Migration of MSCs engineered to express oncolytic viruses expressing anti-tumor genes
[0155] MSCs will be engineered to express oncolytic virus expressing or not anti-tumor genes (including e.g., an interferon (e.g., interferon a, interferon β), an interleukin (e.g., interleukin 1 , interleukin 12), a chemokine (e.g., CX3CL1 ), or a suicide gene (e.g., thymidine kinase, IL- 12, IFN-gamma, TNF-alpha). First, MSCs will be infected in vitro at different MOIs (multiplicity of infection) ranging from 10 to 1000 in complete DMEM without SFB during 2 hours. Then, infected MSCs will be stimulated in culture with rAMF for about 18 h and systemically injected (5x l 05) in HCC, colorectal cancer, and/or breast cancer tumor-bearing mice. Tumor growth will be assessed by calliper and tumor volume (mm3) will be calculated using the formula π/6 x larger diameter x (smaller diameter)2.

Claims

WHAT IS CLAIMED IS:
1. A composition comprising a mesenchymal stromal cell (MSC) stimulated with a recombinant autocrine motility factor (rAMF), wherein the MSC comprises a therapeutic agent and wherein the MSC of the composition has (1) increased migration to a tumor or a tumor cell after rAMF stimulation and/or (2) increased adhesion to an endothelial cell after rAMF stimulation.
2. The composition of claim 1 , wherein the endothelial cell is a vascular endothelial cell.
3. The composition of claim 1 or 2, wherein the tumor is a solid tumor.
4. The composition of any one of claims 1 -3, wherein the tumor is a cancer selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, or a breast cancer.
5. The composition of any one of claims 1-4, wherein the tumor is a carcinoma.
6. The composition of claim 5, wherein the carcinoma is hepatocellular carcinoma
(HCC).
7. The composition of claim 5, wherein carcinoma is colorectal carcinoma.
8. The composition any one of claims 1 -7, wherein the tumor or the tumor cell expresses endogenous AMF.
9. The composition of any one of claims 1 -7, wherein the increased migration and/or adhesion is two-fold greater than migration and/or adhesion of the MSC without rAMF stimulation.
10. The composition of any one of claims 1 -9, wherein the source of the MSC is selected from the group consisting of bone marrow, adipose tissue, and umbilical cord.
1 1. The composition of claim 10, wherein the umbilical cord MSC is harvested from human umbilical cord perivascular tissue.
12. The composition of any one of claims 1 -1 1 , wherein the therapeutic agent is a recombinant anti-tumor gene.
13. The composition of any one of claims 1-1 1 , wherein the therapeutic agent is an oncolytic virus.
14. The composition of claim 13, wherein the oncolytic virus is engineered to express a recombinant anti-tumor gene.
15. The composition of claim 12 or 14, wherein the anti-tumor gene is selected from the group consisting of an interferon, an interleukin, a chemokine, a suicide gene, and any combination thereof.
16. The composition of claim 15, wherein the anti-tumor gene is selected from the group consisting of interferon a, interferon β, interleukin 1, interleukin 12, CX3CL1 , thymidine kinase, IL-12, IFN-gamma, TNF-alpha, and any combination thereof.
17. The composition of any one of claims 1 -16, wherein the MSC further comprises a recombinant AMF receptor.
18. The composition of any one of claims 1-17, wherein the MSC stimulated with rAMF expresses increased levels of matrix metalloproteinase (MMP) after rAMF stimulation.
19. The composition of claim 18, wherein the MMP is selected from the group consisting MMP2, MMP3, or any combination thereof.
20. A method for increasing migration or anchorage of a mesenchymal stromal cell (MSC) to a tumor comprising (a) stimulaiing the MSC with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the tumor, wherein the MSC comprises a therapeutic agent.
21. A method for treating a subject with a tumor comprising (a) stimulating a mesenchymal stromal cell (MSC) comprising a therapeutic agent with a recombinant autocrine motility factor (rAMF), and (b) administering the stimulated MSC of (a) to the subject.
22. The method of claim 20 or 21 , wherein the tumor is a solid tumor.
23. The method of any one of claims 20-22, wherein the tumor is a cancer selected from the group consisting of a liver cancer, a colon cancer, a pancreatic cancer, a lung cancer, a gastrointestinal cancer, a kidney cancer, or a breast cancer.
24. The method of any one of claims 20-23, wherein the tumor is a carcinoma.
25. The method of claim 24, wherein the carcinoma is hepatocellular carcinoma
(HCC).
26. The method of claim 24, wherein carcinoma is colorectal carcinoma.
27. The method any one of claims 20-26, wherein the tumor expresses endogenous
AMF.
28. The method of any one of claims 20 and 22-27, wherein the increased migration is two-fold greater than migration of the MSC without rAMF stimulation.
29. The method of any one of claims 20-28, wherein the source of the MSC is selected from the group consisting of bone marrow, adipose tissue, and umbilical cord.
30. The method of claim 29, wherein the umbilical cord MSC is harvested from human umbilical cord perivascular tissue.
31. The method of any one of claims 20-30, wherein the therapeutic agent is a recombinant anti-tumor gene.
32. The method of any one of claims 20-30, wherein the therapeutic agent is an oncolytic virus.
33. The method of claim 32, wherein the oncolytic virus is engineered to express a recombinant anti -tumor gene.
34. The method of claim 31 and 33, wherein the anti-tumor gene is selected from the group consisting of an interferon, an interleukin, a chemokine, a suicide gene, and any combination thereof
35. The method of claim 34, wherein the anti-tumor gene is selected from the group consisting of interferon a, interferon β, interleukin 1 , interleukin 12, CX3CL1 , thymidine kinase, IL-12, IFN-gamma, TNF-alpha, or any combination thereof.
36. The method of any one of claims 20-35, wherein the MSC further comprises a recombinant AMF receptor.
37. The method of any one of claims 20-35, wherein the MSC stimulated with rAMF expresses increased levels of matrix metalloproteinase (MMP) after rAMF stimulation.
38. The method of claim 37, wherein the MMP is selected from the group consisting MMP2, MMP3, or any combination thereof.
39. The method of claim 21 , wherein the administration is systemic.
40. The method of claim 21 , wherein the administration is to an intra-hepatic artery.
PCT/US2014/054389 2013-09-06 2014-09-05 Compositions and methods for increasing mesenchymal stromal cell migration to tumors WO2015035235A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US14/916,963 US20160220612A1 (en) 2013-09-06 2014-09-05 Compositions and methods for increasing mesenchymal stromal cell migration to tumors
EP14842369.2A EP3047275B1 (en) 2013-09-06 2014-09-05 Compositions and methods for increasing mesenchymal stromal cell migration to tumors
US15/892,680 US11173180B2 (en) 2013-09-06 2018-02-09 Compositions and methods for increasing mesenchymal stromal cell migration to tumors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361874852P 2013-09-06 2013-09-06
US61/874,852 2013-09-06

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/916,963 A-371-Of-International US20160220612A1 (en) 2013-09-06 2014-09-05 Compositions and methods for increasing mesenchymal stromal cell migration to tumors
US15/892,680 Continuation US11173180B2 (en) 2013-09-06 2018-02-09 Compositions and methods for increasing mesenchymal stromal cell migration to tumors

Publications (1)

Publication Number Publication Date
WO2015035235A1 true WO2015035235A1 (en) 2015-03-12

Family

ID=52628981

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/054389 WO2015035235A1 (en) 2013-09-06 2014-09-05 Compositions and methods for increasing mesenchymal stromal cell migration to tumors

Country Status (4)

Country Link
US (2) US20160220612A1 (en)
EP (1) EP3047275B1 (en)
AR (1) AR097570A1 (en)
WO (1) WO2015035235A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016026854A3 (en) * 2014-08-18 2016-04-14 Apceth Gmbh & Co. Kg Genetically modified mesenchymal stem cells expressing an immune response-stimulating cytokine to attract and/or activate immune cells
WO2019213510A1 (en) 2018-05-04 2019-11-07 Figene, Llc Fibroblast delivery of tumor inhibitory agents
US10993967B2 (en) 2018-10-17 2021-05-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007035843A2 (en) * 2005-09-21 2007-03-29 Dask Technologies, Llc Methods and compositions for organ and tissue functionality
WO2009050282A1 (en) * 2007-10-17 2009-04-23 Txcell Tr1 cells, mesenchymal stem cells and uses thereof

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
ES2060942T3 (en) * 1989-02-02 1994-12-01 Joel S Greenberger GENETIC THERAPY USING STROMIC CELLS.
JP2006505380A (en) * 2002-11-05 2006-02-16 ザ ブリガム アンド ウィメンズ ホスピタル インコーポレイテッド Mesenchymal stem cells and methods of use thereof
EP2101818A1 (en) * 2006-12-18 2009-09-23 Cartela R&D AB Binding agents to the integrin alpha-11 subunit, and uses thereof
EP2113560A1 (en) * 2008-04-28 2009-11-04 TXCell Compositions for treating an arthritic condition
EP2746387A1 (en) * 2008-07-21 2014-06-25 Taiga Biotechnologies, Inc. Differentiated anucleated cells and method for preparing the same
US9180166B2 (en) * 2010-03-12 2015-11-10 New Jersey Institute Of Technology Cartilage repair systems and applications utilizing a glycosaminoglycan mimic
US20130171115A1 (en) * 2011-12-30 2013-07-04 Gang Li Cell-mediated gene therapy for cancer using mesenchymal stem cells expressing a suicide gene
WO2013158962A1 (en) * 2012-04-19 2013-10-24 The Board Of Trustees Of The Leland Stanford Junior University Imaging-aided gene therapy using mesenchymal stem cells as target-delivery vehicle

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007035843A2 (en) * 2005-09-21 2007-03-29 Dask Technologies, Llc Methods and compositions for organ and tissue functionality
WO2009050282A1 (en) * 2007-10-17 2009-04-23 Txcell Tr1 cells, mesenchymal stem cells and uses thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ARAKI ET AL., JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 284, no. 47, 20 November 2009 (2009-11-20), pages 32305 - 32311, XP008182966 *
BAYO ET AL.: "Human umbilical cord perivascular cells exhibited enhanced migration capacity towards hepatocellular carcinoma in comparison with bone marrow mesenchymal stromal cells: a role for autocrine motility factor receptor", BIOMED RESEARCH INTERNATIONAL, vol. 2014, 23 July 2014 (2014-07-23), XP055324398 *
BAYO ET AL.: "Increased migration of human mesenchymal stromal cells by autocrine motility factor (AMF) resulted in enhanced recruitment towards hepatocellular carcinoma", PLOS ONE, vol. 9, no. ISS. 4, 15 April 2014 (2014-04-15), pages E95171, XP055324399 *
DAI ET AL.: "Potential implications of mesenchymal stem cells in cancer therapy", CANCER LETTERS, vol. 305, 1 June 2011 (2011-06-01), pages 8 - 20, XP055324397 *
LOPEZ ET AL., MOL THER., vol. 20, no. 12, 2012, pages 2222 - 33
NAKASHIMA ET AL., CYTOKINE GROWTH FACTOR REV., vol. 21, no. 2-3, 2010, pages 119 - 26
See also references of EP3047275A4

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016026854A3 (en) * 2014-08-18 2016-04-14 Apceth Gmbh & Co. Kg Genetically modified mesenchymal stem cells expressing an immune response-stimulating cytokine to attract and/or activate immune cells
EP3656387A3 (en) * 2014-08-18 2020-07-01 Apceth GmbH & Co. KG Genetically modified mesenchymal stem cells expressing an immune response-stimulating cytokine to attract and/or activate immune cells
US11464806B2 (en) 2014-08-18 2022-10-11 JunctuCell Biomed Manufacturing GmbH Genetically modified mesenchymal stem cells expressing an immune response-stimulating cytokine to attract and/or activate immune cells
US11446332B2 (en) 2017-04-13 2022-09-20 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
WO2019213510A1 (en) 2018-05-04 2019-11-07 Figene, Llc Fibroblast delivery of tumor inhibitory agents
EP3810159A4 (en) * 2018-05-04 2022-01-19 Figene, LLC Fibroblast delivery of tumor inhibitory agents
US10993967B2 (en) 2018-10-17 2021-05-04 Senti Biosciences, Inc. Combinatorial cancer immunotherapy
US11419898B2 (en) 2018-10-17 2022-08-23 Senti Biosciences, Inc. Combinatorial cancer immunotherapy

Also Published As

Publication number Publication date
US20160220612A1 (en) 2016-08-04
EP3047275A4 (en) 2017-01-25
AR097570A1 (en) 2016-03-23
US11173180B2 (en) 2021-11-16
EP3047275A1 (en) 2016-07-27
EP3047275B1 (en) 2020-11-18
US20190022143A1 (en) 2019-01-24

Similar Documents

Publication Publication Date Title
US20190022143A1 (en) Compositions and methods for increasing mesenchymal stromal cell migration to tumors
Hezaveh et al. Tryptophan-derived microbial metabolites activate the aryl hydrocarbon receptor in tumor-associated macrophages to suppress anti-tumor immunity
Nakao et al. Intratumoral expression of IL-7 and IL-12 using an oncolytic virus increases systemic sensitivity to immune checkpoint blockade
Waghray et al. GM-CSF mediates mesenchymal–epithelial cross-talk in pancreatic cancer
Huang et al. Targeted homing of CCR2-overexpressing mesenchymal stromal cells to ischemic brain enhances post-stroke recovery partially through PRDX4-mediated blood-brain barrier preservation
Li et al. CCL5-armed oncolytic virus augments CCR5-engineered NK cell infiltration and antitumor efficiency
Yu et al. Preconditioning with interleukin‐1 beta and interferon‐gamma enhances the efficacy of human umbilical cord blood‐derived mesenchymal stem cells‐based therapy via enhancing prostaglandin E2 secretion and indoleamine 2, 3‐dioxygenase activity in dextran sulfate sodium‐induced colitis
Melen et al. Influence of carrier cells on the clinical outcome of children with neuroblastoma treated with high dose of oncolytic adenovirus delivered in mesenchymal stem cells
Brzoska et al. Sdf‐1 (CXCL12) improves skeletal muscle regeneration via the mobilisation of Cxcr4 and CD34 expressing cells
Rosenblum et al. CXC chemokine ligand (CXCL) 9 and CXCL10 are antagonistic costimulation molecules during the priming of alloreactive T cell effectors
Garcia et al. Hepatocellular carcinoma cells and their fibrotic microenvironment modulate bone marrow-derived mesenchymal stromal cell migration in vitro and in vivo
Lynch et al. TGF-β1-licensed murine MSCs show superior therapeutic efficacy in modulating corneal allograft immune rejection in vivo
JP2017525364A (en) Genetically modified mesenchymal stem cells expressing immune response stimulating cytokines for initiating and / or activating immune cells
Cafforio et al. pIL6-TRAIL-engineered umbilical cord mesenchymal/stromal stem cells are highly cytotoxic for myeloma cells both in vitro and in vivo
JPWO2010032696A1 (en) Cancer diagnosis and treatment methods
Fernández-López et al. Entamoeba histolytica interaction with enteropathogenic Escherichia coli increases parasite virulence and inflammation in amebiasis
Vela et al. Anti-CXCR4 antibody combined with activated and expanded natural killer cells for sarcoma immunotherapy
Fayyad-Kazan et al. Identification and evaluation of new immunoregulatory genes in mesenchymal stromal cells of different origins: comparison of normal and inflammatory conditions
Burra et al. Therapeutic application of stem cells in gastroenterology: an up-date
Slama et al. The dual role of mesenchymal stem cells in cancer pathophysiology: pro-tumorigenic effects versus therapeutic potential
Tanoue et al. Survivin-responsive conditionally replicating adenovirus kills rhabdomyosarcoma stem cells more efficiently than their progeny
WO2018053618A1 (en) Methods of culturing mesenchymal stromal cells
Mei et al. The emerging role of tissue-resident memory CD8+ T lymphocytes in human digestive tract cancers
Wu et al. Adipose tissue-derived human mesenchymal stromal cells can better suppress complement lysis, engraft and inhibit acute graft-versus-host disease in mice
Dai et al. Ectopic CXCR2 expression cells improve the anti-tumor efficiency of CAR-T cells and remodel the immune microenvironment of pancreatic ductal adenocarcinoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14842369

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14916963

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2014842369

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2014842369

Country of ref document: EP