WO2015023927A2 - Composition and method for detection of nanomaterials - Google Patents
Composition and method for detection of nanomaterials Download PDFInfo
- Publication number
- WO2015023927A2 WO2015023927A2 PCT/US2014/051227 US2014051227W WO2015023927A2 WO 2015023927 A2 WO2015023927 A2 WO 2015023927A2 US 2014051227 W US2014051227 W US 2014051227W WO 2015023927 A2 WO2015023927 A2 WO 2015023927A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nanomaterial
- composition
- phage
- qds
- binding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/84—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving inorganic compounds or pH
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56983—Viruses
Definitions
- Nanoparticle or nanomaterial-containing commercial products are estimated to contribute $1 trillion to the global economy by 2015 (Roco, 2006, Scientific American Magazine, July 24). Their increasing presence in consumer goods such as bicycle frames, sporting goods (Endo et al, 2004, Philos Trans A Math Phys Eng Sci 362(1823):2223-2238), and cosmetics (Robichaud et al, 2009, Environ Sci Technol 43(12):4227-4233) has raised serious concerns for environmental health and safety (EH&S).
- Quantum dots are semiconductor fluorescent nanomaterials, which have a commercial value of ⁇ $721 million (Quantum Dots: Technical Status and Market Prospects, 2008, BCC Research), and have been widely used as a model nanomaterial by researchers to study nanomaterial-skin penetration mechanisms along with nanomaterials such as T1O2, ZnO, Au, and carbon nanotubes among others.
- TEM Transmission electron microscopy
- energy dispersive x-ray analysis can detect nanomaterials in TEM sections using an enhancement strategy - such as colloidal silver deposits on QDs (Mortensen et al, 2008, Nano Lett 8(9):2779-2787) conflicting results may be observed when histological sections are examined using fluorescence microscopy (Mortensen et al, 2010, J Biomed Nanotechnol 6(5):596-604).
- nanomaterials may also enter the body through other barriers, including epithelial barriers, mucosal linings, respiratory tract, gastrointestinal tract, and the like (Elder et al, 2009, Wiley Interdiscip Rev Nanomed Nanobiotechnol, 1(4): 434-450).
- epithelial barriers including epithelial barriers, mucosal linings, respiratory tract, gastrointestinal tract, and the like.
- the invention provides a composition comprising a binding domain that binds to a nanomaterial.
- the nanomaterial is selected from the group consisting of dispersed, aggregated, and agglomerated nanomaterial.
- the nanomaterial is a non-immunogenic nanoparticle.
- the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
- QDs quantum dots
- T1O2 nanoparticles T1O2 nanoparticles
- Au nanoparticles Au nanoparticles
- ZnO nanoparticles carbon nanotubes
- semiconductor nanomaterial semiconductor nanomaterial.
- the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-7.
- the composition comprises a bacteriophage which displays the binding domain on its surface.
- the binding domain comprises a peptide which binds to the nanomaterial.
- the peptide is an antibody, or fragment thereof.
- the binding domain comprises a single chain variable fragment (scFv) which binds to the nanomaterial.
- scFv single chain variable fragment
- the binding domain comprises a peptide derived from a fibronectin library.
- the composition comprises a tag domain.
- the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme
- the binding domain is identified from phage display.
- the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NOs: 8-11.
- the invention also provides a composition comprising a binding domain that binds to a quantum dot.
- the quantum dot is selected from the group consisting of dispersed, aggregated, and agglomerated quantum dot.
- the quantum dot is a non-immunogenic quantum dot.
- the quantum dot is coated with glutathione (GSH).
- GSH glutathione
- the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-4.
- the composition comprises a bacteriophage which displays the binding domain on its surface.
- the binding domain comprises a peptide which binds to the quantum dot.
- the peptide is an antibody, or fragment thereof.
- the binding domain comprises a single chain variable fragment (scFv) which binds to the quantum dot.
- the binding domain comprises a peptide derived from a fibronectin library.
- the composition comprises a tag domain.
- the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme.
- the binding domain is identified from phage display.
- the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 10.
- the invention also provides a method of identifying a composition that binds to a nanomaterial in a biological tissue comprising the steps of: providing a library of test compounds; forming a phage library comprising one or more phage, wherein each phage expresses a test compound on its surface; providing a
- nanomaterial solution comprising a nanomaterial; incubating the phage library with the nanomaterial solution to form a nanomaterial-phage solution, thereby producing a population of bound phage that binds to the nanomaterial and a population of unbound phage that does not bind to the nanomaterial; and separating the population of bound phage from the population of unbound phage, wherein the test compound expressed on the surface of the population of bound phage is identified as a composition that binds to the nanomaterial.
- the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
- QDs quantum dots
- T1O2 nanoparticles T1O2 nanoparticles
- Au nanoparticles Au nanoparticles
- ZnO nanoparticles carbon nanotubes
- semiconductor nanomaterial semiconductor nanomaterial.
- the library of test compounds comprises a library of peptides.
- the library of test compounds comprises a library of antibodies, or fragments thereof.
- the library of test compounds comprises a library of single chain variable fragments (scFvs).
- the library of test compounds comprises a library of peptides derived from fibronectin.
- the method further comprises enriching the population of bound phage.
- the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution.
- the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution in the presence of a salt.
- the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution in the presence of polyethylene glycol (PEG).
- PEG polyethylene glycol
- the method further comprises incubating the population of bound phage with a second nanomaterial solution to form a second population of bound phage and a second population of unbound phage.
- the identified composition is assayed for its binding strength.
- identified composition is assayed for its specificity.
- the invention also provides a method of detecting the presence of a nanomaterial in a sample comprising administering a composition that binds to the nanomaterial to the sample.
- the sample is a tissue sample obtained from a subject.
- the subject is selected from the group consisting of a mouse, a rat, a hamster, a guinea pig, a cat, a dog, a monkey, a cow, a fish, a bird, a reptile, an amphibian, a horse, and a human.
- the tissue sample comprises skin.
- the composition comprises a tag domain
- the method comprises detecting the tag domain of the composition.
- the composition comprises a tag domain
- the method comprises administering to the sample a compound that binds to the tag domain
- the sample is an ecological sample.
- the sample is selected from the group consisting of soil, water, plant, fungi, and algae.
- Figure 1 is a diagram depicting an antibody (left) and scFv (right) showing VH, VL, linker and flag tag (yellow). Not drawn to scale.
- FIG. 2 depicts the results of experiments showing BsTN-1 digest patterns after Pan 4.
- GSH QD binder C43 repeats left, red boxes
- T1O2 binder C49 repeats right, red boxes
- Figure 3 depicts the results of experiments using Dot blots, which show binding of C43 to GSH QDs (top- left), while random scFv NT3 does not bind.
- C43, C2, C3, C4 bind only GSH QDs and not DHLA, Invitrogen or Au nanomaterials (bottom- right and bottom- left), whereas random scFv NT3 does not bind any nanomaterial top- right).
- Figure 4 depicts the results of experiments which show that random control phages (against lactoferrin-A) do not bind GSH QDs (left), whereas C2 phages bind GSH QDs (arrow, right).
- Figure 5 are a set of TEM images showing random phage (against IL- 12) not binding TiC nanomaterial (left) and C49 phages (arrows) binding the nanomaterials (right). Scale bar 100 ⁇ .
- Figure 6 depicts the results of experiments demonstrating the binding of GSH QDs to scFvs passively coated on a 96-well ELISA plate,
- GSH QDs bind C43 scFv but not random clone (BiP) or wells coated with no scFvs.
- Figure 7 depicts the results of experiments demonstrating an increase in hydrodynamic diameter upon scFv binding GSH QDs.
- Figure 8 is a set of images depicting tissue sections stained with C2 scFv specific to GSH QDs. Control (no QD, top-left) shows no AP staining, whereas QDs applied on epidermis (top-right) shows AP staining. Fluorescence image (bottom-left) shows presence of QDs and a merged image where brightness/contrast of brightfield image was enhanced shows co-localization of NProbes with QDs (bottom-right).
- Figure 9 depicts the results of experiments where control (no TiC , left) shows no AP staining, and TiC treated skin (nanomaterials in water, center) and skin treated with sunscreen (Eucerin-SPF 15) (right) shows AP staining in SC and epidermis (red arrows). Scale bar 100 ⁇ .
- Figure 10 depicts the results of IHC experiments to test C2 scFv binding GSH QDs.
- Representative thresholded image showing AP staining (top left), and corresponding fluorescence image showing GSH QDs (top right); merged composite image showing white regions of co-localization (yellow arrows) of AP (green) and QDs (red) (bottom right); scatter plot showing co-localization region as yellow (white box).
- Figure 12 is a graph where Tang et al. (2013, Sci China Life Sci 56(2): 181-188), showed presence of background levels of Cd in an in vivo mouse model (grey bars for control), thus rendering data obtained from ICP-MS
- Figure 13 comprising Figure 13A through Figure 13D, depicts the results of experiments demonstrating a titer of phage bound to GSH QD showing more than 100-fold binding (Figure 13B- Figure 13D), compared to a titer of random single clone phage ( Figure 13 A).
- Figure 14 depicts the results of experiments wherein dot blots show the detection of stock concentration of GSH QDs (left) and 50nm of GSH QDs (right) using NProbe (clone 43) and a secondary enzyme-based antibody detection system (anti-flag antibody tagged to horseradish peroxidase).
- Figure 15 depicts TEM images of GSH QDs binding to C3 (top) and C4 (bottom) phages.
- Figure 17 depicts the results of experiments where DLS data shows size measurements for GSH QDs with and without scFvs.
- Image on the left shows increase in size implying binding to GSH QDs with C43 scFV clone (green curve) compared to "no scFv" (red) and random scFv (blue) controls.
- Image on the right shows binding of GSH QDs to C2, C3, and C4 scFvs (light blue, pink, and dark blue curves) compared to no scFv (red) and random scFv (green) controls.
- Figure 18 depicts the results of experiments showing a titer of phage specific for GSH QD binding DLHA QD ⁇ 10-fold (right) more than a random single clone (left).
- Figure 19 depicts a typical histogram data from flow cytometry (Flow Jo 7.5) showing a shift in DQ fluorescence in a tape stripped sample with QDs compared to a sample without QDs.
- Figure 20 is a diagram depicting cyrosectioning direction (red arrow) to section both Dermis (D) and Epidermis (E) simultaneously, thereby preventing accidental transfer of QDs to the blade.
- Figure 21 is a set of images, where the image on the left shows insufficient endogenous AP inhibition by ImM levamisole (red circles) and image on the right shows no endogenous AP presence using 5mM levamisole as inhibitor.
- Figure 22 is set of images demonstrating that the scFv clone isolated against TiC (C49) (right) bound 100-fold more than arbitrary clone against IL-12 (left).
- Figure 23 is a set of images depicting the results of experiments.
- Figure 25 is a series of dot blots onto a nitrocellulose membrane (left column) showing GSHQDs (orange), Au NPs (pink) and CNTs (black) spots. Chemiluminescence detection of scFv binding with HRP (right column). Results show that (Figure 25A) GSH43-scFv binds GSH-QDs but not Au NPs and CNTs, ( Figure 25B) negative control BiP-scFv and ( Figure 25C) Ti49-scFv do not bind any of the NPs.
- Figure 26 is a series of imaged showing brightfield and confocal images investigating the binding of Ti49-scFvs to Ti02 NPs immobilized on a glass slide using FITC-conjugated anti-FLAG secondary antibody detection.
- Figure 27 is a series of images showing QD detection in ex vivo human skin using GSH43-scFv.
- Figure 27A Control skin sample without GSH-QD exposure showing an absence of AP staining indicating a lack of GSH43-scFv non-specific binding to skin.
- Figure 27B Control skin sample without GSH-QD exposure showing an absence of AP staining indicating a lack of GSH43-scFv non-specific binding to skin.
- Figure 28 is a series of LCM imaging microscopy to confirm presence of GSH-QDs in areas of high AP staining.
- Representative skin sample containing QDs injected showing ( Figure 28A) dark bluish-purple staining indicating binding of GSH43-scFvs detected by AP.
- Figure 28B Portions of stained areas were marked for cut and captured onto adhesive tube caps using LCM, and processed for AAS.
- Figure 28C The portion of skin remaining after capture.
- Figure 29, is a series of images showing detection of Ti02 using Ti49-scFv in human skin ex vivo.
- Figure 30, comprising Figures 30A and 30B, is a series of images showing pattern repeats of scFvs generated by panning on (Figure 30A) GSH-QDs and (Figure 30B) Ti02 NPs following a BsfNI digest after Round 4 of panning (red and white boxes).
- Figure 31 is a series of images showing phage titer indicative of binding
- Figure 31 A Phage titer colonies showing ⁇ 10-fold more enrichment of GSH43(j> compared to negative control ⁇ -12 ⁇ on GSH- QDs.
- Figure 3 lB(i) ⁇ 100-fold more enrichment of ⁇ 49 ⁇ compared to ⁇ -12 ⁇ on Ti02 NPs
- Figure 3 lC(i) GSH43 ⁇ I> not binding Au NPs
- Figure 32 is an image showing phage titer of Ti49 on GSH-QDs as target. IL-12 negative clone does not bind GSH-QDs (left), whereas Ti49 clone does (right).
- Figure 33 is a chart indicating that hydrodynamic diameter measurements using Malvern Zetasizer.
- GSH43-scfv-QD conjugate shows a significant increase in hydrodynamic diameter compared to BiP-associated QDs (p ⁇ 0.05) and QDs in TBS (p ⁇ 0.01) using a one-way ANOVA test, whereas BiP- associated complexes do not show any significance (n.s.) compared to QDs in TBS.
- Error bars indicate SEM of 4 independent experiments.
- Figure 34 is a series of images of: (Figure 34A) slides showing Ti02 in water dried indicated by the black arrow
- Figure 35 comprising Figures 35A through 35C is a series of images showing representative confocal single slice images to show GSH43-scFvs binding to QDs.
- Figure 35A GSH-QDs coated on a slide as seen under a UV lamp (white arrow).
- Figure 35C Co-localization plot obtained for 'Merge' image of GSH43-scFv. Pearson's co-localization coefficient was found to be 0.65.
- Figure 36 is a series of images showing LCM imaging of control 'no QD' sample of ex vivo human skin.
- Figure 37 is a series of representative images to prove binding of GSH43-scFvs to GSH-QDs applied on epidermis using LCM and AAS.
- Figure 37A Control skin specimen not treated with QDs showing no AP staining in brightfield (top-left) and no fluorescence (bottom- right). Upon using LCM to cut and capture (top-right, bottom-left) portions of skin for AAS analysis, Cd levels (0.0085 ng/mL) were found to be ⁇ LOQ (0.025 ng/mL).
- Figure 37B GSH-QDs applied on epidermis shows binding to GSH43-scFvs detected by AP (top-left).
- Figure 38 is a series of images showing: (Figure 38A) QDs immobilized on a BSA-coated plated as visible under a UV-lamp whereas wells with no QDs do not fluoresce. ( Figure 38B) Phage ELISA assay of GSH43(j> and negative control ( ⁇ ) on QDs immobilized on BSA-coated plates. With an increasing concentration of phage, significantly more binding (*p ⁇ 0.05) of GSH43 ⁇ I> to GSH-QDs occurs when detected using TMB substrate at 450 nm, compared to negative control ⁇ and GSH43(j> interacting with wells containing BSA alone (no QDs).
- Figure 39 comprising Figures 39A and 39B, shows the amino acid sequence of light (Figure 39A) and heavy ( Figure 39B) chain of GSH43 and Ti49 clones.
- the CDRs in each sequence are in bold typeface and underlined.
- the sequence of GSH43 light chain is set forth in SEQ ID NO. 8; sequence of Ti49 light chain is set forth in SEQ ID NO. 9.
- the sequence of GSH43 heavy chain is set forth in SEQ ID NO. 10; sequence of Ti49 heavy chain is set forth in SEQ ID NO. 11.
- Figure 40 is a set of images comparing assays for identifying nanoparticle binders using panning upon NP immobilization (left) and panning on dispersed nanoparticles (right).
- Figure 41 is a set of images depicting the results of experiments demonstrating the binding of GSH43 in phage and scFv format to various differently coated quantum dots.
- Figure 42 is a set of graphs depicting the results of experiments demonstrating the GSH43 in phage and scFv format to GSH peptide.
- Figure 43 is a graph depicting the results of experiments demonstrating binding of Ti6 and Til5 phage clones to T1O2 nanoparticles. About 1000-fold binding to T1O2 particles was observed compared to a negative phage clone in a panning assay. Moreover, Ti6 does not exhibit cross-reactivity to Au NPs similar in morphology to the T1O2 NPs, whereas Til 5 clone does to a certain extent.
- the present invention provides compositions and methods for detecting a nanomaterial.
- the invention includes the detection of dispersed, aggregated, or agglomerated nanomaterial.
- the invention provides for detection of a nanoparticle.
- the present invention is partly based upon the development of a screening method and the discovery of unique compositions that have the ability to specifically bind to dispersed, aggregated, or agglomerated nanomaterial.
- the present invention provides for the detection of the presence and location of nanomaterials or nanoparticles including, but not limited to quantum dots (QDs); metal oxides, including titanium dioxide (T1O2), zinc oxide (ZnO), ceriumoxide (Ce02), aluminum oxide (AI2O3), silicon oxide (S1O2) antimony tin oxide; metals, including gold, silver, platinum, copper; carbon, including fullerene, grapheme, carbon nanotubes, dendrimers, polymers; lipids, including liposomes and solid lipid particles; group IV, II-V, and II- VI semiconductors, including silicon, germanium, CdS, CdSe; and the like.
- QDs quantum dots
- metal oxides including titanium dioxide (T1O2), zinc oxide (ZnO), ceriumoxide (Ce02), aluminum oxide (AI2O3), silicon oxide (S1O2) antimony tin oxide
- metals including gold, silver, platinum, copper
- carbon including fullerene, grapheme, carbon
- the present invention provides a method or identifying a composition for detecting a nanomaterial.
- the present invention provides a method of screening test compounds for the ability to bind to a dispersed, aggregated, or agglomerated nanomaterial.
- the present invention includes a composition for detecting a nanomaterial.
- the composition comprises a binding domain that specifically binds to a nanomaterial.
- the composition binds to a nanomaterial of specific size, shape, or composition.
- the composition binds to a particular type of nanomaterial, thereby providing specificity in its detection.
- the composition comprises a bacteriophage particle and a binding domain that specifically binds to the
- a binding domain expressed on the surface of a phage particle results in enhanced detection compared to the binding domain alone.
- the present invention includes a method of detecting a nanomaterial.
- the method may comprise detecting the presence and/or abundance of a nanomaterial present in any sample, product, organism, or tissue where it may be desired to detect nanomaterial, including, but not limited to biological systems, ecological systems, industrial systems, commercial product, waste products, or the like.
- the method comprises administering a composition which specifically binds to a nanomaterial to a sample or subject.
- the method comprises detection of a nanomaterial in biopsied or excised tissue sample.
- the method comprises the in vivo detection of a nanomaterial in a subject.
- the method comprises the detection of a biomaterial in an ecological or environmental sample, including for example, water, soil, plant, algae, bacteria, fungi, waste product, and the like.
- an element means one element or more than one element.
- antibody refers to an immunoglobulin molecule which specifically binds with an antigen.
- Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
- the an antibody in the present invention may exist in a variety of forms where the antigen binding portion of the antibody is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment, a single chain antibody (scFv) and a humanized antibody (Harlow et al, 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al, 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al, 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
- scFv single chain antibody
- antibody fragment refers to at least one portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody.
- antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, sdAb (either VL or VH), camelid VHH domains, scFv antibodies, and multi-specific antibodies formed from antibody fragments.
- scFv refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it was derived.
- an scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.
- antibody heavy chain refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
- an “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa ( ⁇ ) and lambda ( ⁇ ) light chains refer to the two major antibody light chain isotypes.
- synthetic antibody an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein.
- the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
- antigen or "Ag” as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
- antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an "antigen" as that term is used herein.
- an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
- antigen-bearing moiety a molecule to which an antibody binds.
- Bio sample or simply “sample”, as that term is used herein, means a sample, such as one that is, but need not be, obtained from an organism, which sample is to be assessed for the presence, absence and/or level, of a sample
- sample includes, but is not limited to, any biological fluid (e.g., blood, lymph, semen, sputum, saliva, phlegm, tears, and the like), fecal matter, a hair sample, a nail sample, a brain sample, a kidney sample, an intestinal tissue sample, a tongue tissue sample, a heart tissue sample, a mammary gland tissue sample, a lung tissue sample, an adipose tissue sample, a muscle tissue sample, and any sample obtained from an organism that can be assayed for the presence or absence of an antigen.
- the sample can comprise an environmental sample (e.g., a water sample, soil sample, and the like) however obtained, to be assessed for the presence absence and/or level, of a nanomaterial of interest according to the methods of the invention.
- fragment as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, preferably, at least about 30 nucleotides, more typically, from about 40 to about 50 nucleotides, preferably, at least about 50 to about 80 nucleotides, even more preferably, at least about 80 nucleotides to about 90 nucleotides, yet even more preferably, at least about 90 to about 100, even more preferably, at least about 100 nucleotides to about 150 nucleotides, yet even more preferably, at least about 150 to about 200, even more preferably, at least about 200 nucleotides to about 250 nucleotides, yet even more preferably, at least about 250 to about 300, more preferably, from about 300 to about 350 nucleotides, preferably, at least about 350 to about 360 nucleotides, and most preferably, the nucleic acid fragment will be greater than about 365 nucleotides in length.
- fragment as applied to a polypeptide, may ordinarily be at least about 20 amino acids in length, preferably, at least about 30 amino acids, more typically, from about 40 to about 50 amino acids, preferably, at least about 50 to about 80 amino acids, even more preferably, at least about 80 amino acids to about 90 amino acids, yet even more preferably, at least about 90 to about 100, even more preferably, at least about 100 amino acids to about 120 amino acids, and most preferably, the amino acid fragment will be greater than about 123 amino acids in length.
- Fab/phage as used herein, is meant a phage particle which expresses the Fab portion of an antibody.
- scFv/phage a phage particle which expresses the Fv portion of an antibody as a single chain.
- Phage or “phage particle,” as these terms are used herein, include that contain phage nucleic acid encoding, inter alia, an antibody. This is because, as would be appreciated by the skilled artisan, unlike peptide phage display (where the peptide DNA insert is small and it is actually cloned into the phage DNA), the larger scFv or Fab DNA inserts are actually cloned into, among other things, a plasmid.
- the nucleic acid encoding the antibody e.g., a plasmid such as, but not limited to, pComb3, not only comprises a plasmid origin of replication, but also a phage (e.g., M13) origin of replication sequence and an M13 packaging sequence, so that when the nucleic acid is produced, a helper phage can be used to provide the required phage (e.g., Ml 3) proteins in trans to make "phage-like" particles. That is, these particles resemble phage on the outside, but on the inside they contain plasmid (also referred to as a "phagemid”) DNA.
- a helper phage can be used to provide the required phage (e.g., Ml 3) proteins in trans to make "phage-like" particles. That is, these particles resemble phage on the outside, but on the inside they contain plasmid (also referred to as a "phagemid”) DNA.
- the phagemid DNA need not encode any Ml 3 phage proteins, except a piece of Ml 3 gene III fused to the DNA for antibody or peptide.
- phage phage particle
- phage-like particle phagemid
- bacteria and "phage” are used interchangeably herein and refer to viruses which infect bacteria.
- bacteria library or "phage library” as used herein, is meant a population of bacterial viruses comprising heterologous DNA, i.e., DNA which is not naturally encoded by the bacterial virus.
- nucleic acid as used herein is defined as a chain of nucleotides.
- nucleic acids are polymers of nucleotides.
- nucleic acids and polynucleotides as used herein are interchangeable.
- nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides.”
- the monomeric nucleotides can be hydro lyzed into nucleosides.
- polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- recombinant means i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- peptide As used herein, the terms "peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
- the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
- telomere binding partner an antibody, or a ligand, which recognizes and binds with a cognate binding partner present in a sample, but which antibody or ligand does not substantially recognize or bind other molecules in the sample.
- ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
- the present invention provides compositions and methods for detecting a nanomaterial.
- the present invention is partly based upon the discovery of compositions that have the ability to bind to dispersed, aggregated, or agglomerated nanomaterials.
- the present invention provides for the detection of the presence and location of nanomaterials or nanoparticles including, but not limited to quantum dots (QDs); metal oxides, including titanium dioxide (T1O2), zinc oxide (ZnO), ceriumoxide (CeC ), aluminum oxide (AI2O3), silicon oxide (S1O2) antimony tin oxide; metals, including gold, silver, platinum, copper; carbon, including fullerene, grapheme, carbon nanotubes, dendrimers, polymers; lipids, including liposomes and solid lipid particles; group IV, II-V, and II-VI semiconductors, including silicon, germanium, CdS, CdSe; and the like.
- the invention allows for identification of nanomaterials rather than soluble ions or elemental metals.
- the present invention provides a method or identifying a composition for detecting a nanomaterial.
- the present invention provides a method of screening test compounds for the ability to bind to a nanomaterial.
- the method of the invention comprises biopanning to screen a library of test compounds to identify one or more compositions which bind to a desired nanomaterial.
- the method comprises using phage display to identify one or more compositions which bind to a nanomaterial.
- the method comprises providing a solution comprising a nanomaterial of interest, incubating with the solution a population of phage wherein each phage displays a test compound on its surface, and enriching the phage which bind to the nanomaterial.
- the method comprises the use of a phage library, including for example a peptide library, antibody library, scFv library, fibronectin library, scaffold library and the like.
- the present invention includes a composition for detecting a nanomaterial.
- the composition of the invention that is useful for detecting a nanomaterial is also referred herein as "NProbe.”
- the composition comprises a binding domain that specifically binds to a nanomaterial.
- the composition binds to a particular type of nanomaterial, defined for example by the size, charge, surface chemistry, and composition of the nanomaterial, thereby providing specificity in its detection.
- the binding domain comprises a peptide that specifically binds to the nanomaterial.
- the binding domain comprises an antibody, antibody fragment, or fibronectin-based peptide that specifically binds to a nanomaterial.
- the binding domain comprises a scFv.
- the composition comprises a phage particle and the binding domain.
- a binding domain expressed on the surface of a phage particle results in enhanced detection compared to the binding domain alone.
- NProbe binding to a nanomaterial is dependent upon the surface chemistry, shape, size, or surface charge of the nanomaterial being detected. It is demonstrated herein that the identified NProbes specifically detect nanomaterials at locations and levels where they were previously undetectable. Therefore, in one embodiment, the composition of the invention is a diagnostic tool for detecting the presence, absence, location, and/or abundance of a nanomaterial in a biological system, environmental system, ecosystem, commercial product, waste product, or the like.
- the present invention includes a method of detecting a nanomaterial.
- the method may comprise detecting a nanomaterial in a biological system, ecological system, industrial system, commercial product, waste product, or the like.
- the method comprises administering a composition which specifically binds to a nanomaterial to a sample or subject.
- the method comprises detection of a nanomaterial in biopsied or excised tissue sample.
- the method comprises the in vivo detection of a nanomaterial in a subject.
- the method comprises the detection of the nanomaterial in an environmental or ecosystem sample, including for example, water, soil, plant, algae, bacteria, fungi, and the like.
- the method comprises using traditional imaging or detection assays to identify the location of the administered composition, thereby indicating the presence or localization of the nanomaterial.
- the method is used to monitor the presence of nanomaterials used in nanomedicine therapeutic regimens, which can thus be used in the determination of how the regimen proceeds.
- the method of the invention allows for the detection of material in any biological tissue or sample. For example, it is demonstrated herein that, in certain instances, nanomaterials can traverse the skin barrier and enter into the body of a subject.
- the method of the invention allows for detection of low
- concentration of dispersed, agglomerated, or aggregated nanomaterials which while currently undetectable using traditional methods, can result in adverse consequences to the subject.
- the present invention includes a screening method for identifying a composition for detecting a nanomaterial in biological systems.
- the method of the invention comprises biopanning to screen a library of test compounds to identify one or more compositions which bind to a nanomaterial of interest. Exemplary nanomaterials for which nanomaterial-binding compositions are screened for using the present method are listed elsewhere herein.
- the method comprises using phage display to identify one or more compositions which bind to a nanomaterial.
- the method comprises providing a solution comprising a dispersed nanomaterial, incubating a population of phage, wherein each phage displays a test compound on its surface, with the solution, and enriching the phage which binds to the nanomaterial.
- Phage display is a powerful tool for selecting proteins with binding properties to almost any target (Willats, 2002, Plant Mol Biol 50(6):837-854). Phage display involves expression of peptides, including for example, antibodies, antibody fragments, proteins, and the like, on the surface of phage particles by the
- Phage display of peptides is an extremely rapid technique ( ⁇ 2 weeks) compared to hybridoma methods (months). Moreover, the amount of target required for antibody phage display is much less (micrograms) than that typically required for hybridoma methods (milligrams) (Willats, 2002, Plant Mol Biol 50(6):837-854). Further, the biopanning technique using phage display, as described herein, has the advantage of providing the opportunity to discover reagents that bind to nanomaterial based on shape as well as composition, Moreover nanomaterial immunogenicity is not a requirement for enrichment of reagents using in vitro display technology.
- the method uses a library of test compounds to be screened.
- the library comprises, peptides, nucleic acids, small molecules, antibodies, antibody fragments, and the like, which may bind the nanomaterial of interest.
- the library comprises a population of test compounds, wherein the test compounds are scFvs.
- the library comprises peptides based on or derived from scaffold proteins, including, for example, fibronectin.
- the method comprises utilizing phage display of fibronectin based peptides to identify a composition that binds to a nanomaterial.
- an antibody library described herein is meant to include a library of antibodies, or antibody fragments, including, for example, scFvs.
- a phage antibody library may be generated.
- a cDNA library is first obtained from mRNA which encodes the desired peptide to be expressed on the phage surface, e.g., the desired antibody.
- cDNA copies of the mRNA are produced using reverse transcriptase.
- cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes.
- the procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al, (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
- Bacteriophage which encode the desired peptide may be engineered such that the peptide is displayed on the surface thereof in such a manner that it is available for binding to its corresponding partner.
- Bacteriophage which express a specific peptide are incubated in the presence of the corresponding antigen, the bacteriophage will bind to the antigen.
- Bacteriophage which do not express the peptide will not bind to the antigen.
- panning techniques are well known in the art and are described for example, in Clackson and Lowman, 2004, Phage Display: A Practical Approach, Oxford University Press, New York.
- a cDNA library is generated from mRNA obtained from a population of antibody -producing cells.
- the mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same.
- Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin.
- this procedure immortalizes DNA encoding human
- immunoglobulin rather than cells which express human immunoglobulin.
- Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHI) of the heavy chain.
- Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment.
- An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein.
- Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al. (1991, J. Mol. Biol. 222:581-597). Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.
- the invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837-839; de Kruif et al. 1995, J. Mol. Biol. 248:97-105).
- phage-cloned antibodies derived from immunized animals can be humanized by known techniques.
- the screening method of the invention comprises incubating the phage antibody library with a solution comprising the nanomaterial of interest.
- the present invention includes the identification of compositions which bind to dispersed, aggregated, or agglomerated nanomaterial, rather than in bulk. Therefore, in certain embodiments, the method comprises forming a solution of dispersed nanomaterial.
- the nanomaterial solution comprises the nanomaterial at a concentration of about InM to about lOOOnM.
- the nanomaterial solution comprises the nanomaterial at a concentration of about ⁇ .
- the nanomaterial solution comprises the nanomaterial at a concentration of about O.O ⁇ g/mL to about lOOmg/mL.
- the nanomaterial solution comprises the
- nanomaterial at a concentration of about lmg/mL.
- the nanomaterial solution described herein may be formed using any suitable solvent or buffer that would provide a disperse nanomaterial solution.
- the solution is formed by adding the nanomaterial of interest to TBS buffer (50 nM Tris HC1, 150 nM NaCl, pH 7.5).
- the buffer comprises a surfactant.
- the buffer does not contain a surfactant.
- the disperse solution is maintained with occasional vortexing, sonication, mixing, or the like, to aid in dispersing.
- the nanomaterial of interest is coated with an agent to allow for solubility and dispersion of the nanomaterial.
- the nanomaterial is coated with glutathione (GSH), or other molecules or polymer ligands such as dihydrolipoic acid, polyethylene amine, polyethylene glycol, and the like. Further detail of nanomaterial coating may be found for example in Hong et al, 2013, Journal of Biomedical Nanotechnology, 9(3)3: 382-392, which is incorporated herein by reference in its entirety.
- the nanomaterial is coated with a surface chemistry of interest to identify compositions which bind to a nanomaterial having a surface chemistry of interest.
- the method comprises identification of a composition which binds to a nanomaterial independent of surface chemistry. In one embodiment, the method comprises incubating the phage antibody library with the nanomaterial solution, to provide a nanomaterial-phage solution, to allow for binding of one or more phage to the nanomaterial. Incubation of the nanomaterial solution with the phage antibody library may be done under any suitable conditions known in the art.
- the method comprises separation of the phage bound to the nanomaterial from the unbound phage.
- methods of separation are optimized for the type of nanomaterial, its agglomeration properties, and size.
- separation of bound phage from unbound phage is performed by centrifugation of the nanomaterial-phage solution. The speed of centrifugation is chosen in such a way that the nanomaterial is not too tightly pelleted to allow for resuspension during wash steps. In one embodiment, the centrifugation speed is about 1300g (4000rpm) to about 90000g (55000rpm), depending upon the material.
- the solution comprises a salt, for example MgCk, which, in certain instances aids in the separation of bound and unbound phage.
- a salt for example MgCk
- inclusion of a salt in the solution allows for use of a slower centrifugation speed, for example 1300g (4000rpm) to about 24000g (29000 rpm).
- Exemplary salts include, but are not limited to, MgCi2.6H20,CsCl, MgS04, CaCk, and the like.
- the solution comprises the salt at a concentration of about 0.01M to about 10M.
- the solution comprises the salt at a concentration of about 1M.
- the solution comprises a polyethylene glycol.
- the polyethylene glycol has a molecular weight of about 5000 g/mol to about 10000 g/mol.
- the solution comprises Carbowax 6000g/mol molecular weight.
- the method comprises enriching the bound phage fraction. Enrichment of the bound phage may be done using any suitable method known in the art. For example, in one embodiment, the bound phage is eluted and is transduced into fresh log phase bacterial cells. Phage infected bacteria is selected, for example by use of antibody resistance. In one embodiment, the colonies are grown in suspension, infected with helper phage to produce the phage of interest.
- the phage display is repeated one or more times. For example, repeating the incubation of the selected phage with the nanomaterial, separation of bound from unbound phage, and enriching bound phage, may be repeated to generate a smaller number of high quality compounds.
- the identity of the bound phage is evaluated, for example using traditional molecular biology approaches. In one embodiment, identity of the phage is performed using BsTN- 1 fingerprinting. Detection of repeated fingerprint signatures reveals the enrichment of test compounds that are determined to bind to the nanomaterial.
- the screening method comprises one or more additional screens to confirm the binding activity of the identified composition, as generated by the screening assay described herein.
- the method comprises one or more additional screens to evaluate the specificity of the identified NProbe.
- Exemplary assays that may be performed include, but are not limited to dynamic light scattering, zeta potential, ELISA, FLISA, Dot blot assay, DLS assay, BCA protein assay, imaging analysis, and the like.
- one or more of the above assays are used to evaluate the binding strength of an identified composition to the nanomaterial that it was identified to bind to.
- one or more of the above assays are used to evaluate the specificity or cross-reactivity of the identified composition to bind to other types of nanomaterials or to derivatives of the nanomaterial that it was identified to bind to. For example, as described herein, in certain instances binding of an NProbe to a nanomaterial is dependent on nanomaterial size, agglomeration, surface chemistry, or other property. Thus, in certain embodiments, one or more of the above assays are used to determine if the composition binds to a nanomaterial having a different size, surface chemistry or other property, compared to the nanomaterial for which it was determined to bind. For example, a composition that is determined to bind to 50nm particle is evaluated using one or more of the above assays to determine if it does or does not similarly bind to a lOnm particle.
- the method comprises modifying one or more regions of the identified composition to generate improved compositions with enhanced binding properties.
- an identified composition is an scFv, where some or all of the VH or VL regions can be modified or replaced to produce improved scFv compositions.
- the method comprises an additional phage display assay where a population of scFvs is screened, where each scFv of the additional screen comprises a region of the initially identified scFv (e.g., the VH of the initially identified scFv) and a test region (e.g., random VL chains), to determine if any of the scFvs of the additional screen display enhanced properties compared to the initially identfied scFv.
- a region of the initially identified scFv e.g., the VH of the initially identified scFv
- a test region e.g., random VL chains
- the present invention includes a composition for detecting the presence or location of a nanomaterial.
- the composition of the invention binds to a nanomaterial, thereby indicating the presence, location, and/or abundance of the nanomaterial.
- the composition comprises a binding domain which binds to the nanomaterial of interest.
- the binding domain of the composition specifically binds to the nanomaterial of interest and may comprise an antibody, antibody fragment, a peptidomimetic, a polypeptide or aptamer, a nucleic acid or any other molecule provided it binds specifically to the nanomaterial of interest.
- the composition binds to dispersed, aggregated, or agglomerated nanomaterial.
- the composition of the invention binds to a nanomaterial used in commercial, industrial, pharmaceutical, cosmetic, diagnostic, or the like applications.
- the use of nanomaterials has become increasingly popular in a variety of industries. However, the presence or accumulation within the body may have serious adverse consequences.
- Exemplary nanomaterials which the present composition of the invention binds include those listed elsewhere herein.
- the composition specifically binds to a particular type of nanomaterial. That is, in one embodiment, for example, the composition of the invention specifically binds to QDs, but does not bind to any other nanomaterial.
- the composition of the invention binds to a QD.
- QDs detectable by the composition include QDs made from any material known in the art including, but not limited to, silicon, germanium, zinc, ZnS, cadmium, CdS, CdSe, CdTe, semiconductor materials or the like.
- the QDs comprise a coating, including but not limited to, coatings comprising GSH, dihydrolipoic acid (DHLA), trioctylphosphine oxide (TOPO), DTT, poly(ethylene glycol), surfactants, biomolecules, and the like.
- the composition specifically binds to a particular shape, size, or chemistry of QDs.
- the composition of the invention binds to TiC nanoparticles.
- TiC also known as titanium (IV) oxide or titania
- TiCte includes all forms of oxides of titanium including the different crystal forms, such as rutile, anatase, brookite, and other crystal forms known in art.
- the composition comprises a tag domain which allows for the detection or purification of the composition.
- the tag domain comprises a detection tag and/or a purification tag. It will be appreciated that the tag domain does not interfere in the function of the composition of the invention.
- the tag domain comprises a visible tag, which, allows for the visualization of the composition.
- the tag domain comprises a fluorescent tag.
- fluorescent tags include green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), eGFP, mCherry, hrGFP, hrGFPII, Alexa 488, Alexa 594, and the like.
- Fluorescent tags may also be photoconvertable such as for example kindling red fluorescent protein (KFP-red), PS-CFP2, Dendra2, CoralHue Kaede and CoralHue Kikume.
- Detection proceeds by any known method, including immunoblotting, western analysis, gel-mobility shift assays, tracking of radioactive or bioluminescent markers, nuclear magnetic resonance, electron paramagnetic resonance, stopped-flow spectroscopy, column chromatography, capillary
- tags are any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
- Useful tags in the present invention include magnetic beads (e.g.
- DynabeadsTM DynabeadsTM
- fluorescent dyes e.g., fluorescein isothiocyanate, Texas red, rhodamine, and the like
- radiolabels e.g., 3 H, 125 1, 35 S, 14 C, or 32 P
- enzymes e.g., LacZ, CAT, horse radish peroxidase, alkaline phosphatase and others, commonly used as detectable enzymes, either as marker gene products or in an
- ELISA ELISA
- colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads.
- the tag may be coupled directly or indirectly to the composition according to methods well known in the art. As indicated above, a wide variety of tags may be used, with the choice of tag depending on the sensitivity required, ease of conjugation of the compound, stability requirements, available instrumentation, and disposal provisions.
- the molecules can also be conjugated directly to signal generating compounds, e.g., by conjugation with an enzyme or fluorophore.
- Enzymes of interest as labels include hydrolases, particularly phosphatases, esterases and glycosidases, or oxidoreductases, particularly peroxidases.
- Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc.
- Chemiluminescent compounds include luciferin, and 2,3-dihydrophthalazinediones, e.g., luminol.
- luciferin 2,3-dihydrophthalazinediones
- luminol 2,3-dihydrophthalazinediones
- Means of detecting tags are well known to those of skill in the art.
- means for detection include a scintillation counter or photographic film as in autoradiography.
- the tag is a fluorescent label, it may be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence, e.g., by microscopy, visual inspection, via photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like.
- CCDs charge coupled devices
- enzymatic tags may be detected by providing appropriate substrates for the enzyme and detecting the resulting reaction product.
- simple colorimetric tags may be detected simply by observing the color associated with the tag.
- the tag domain comprises a known epitope that may be used to detect the composition.
- the tag domain comprises an epitope that is recognized by an antibody or other molecule which thereby provides for the detection of the composition.
- the tag domain comprises a known peptide epitope.
- the tag includes but is not limited to: polyhistidine tags (His-tags) (for example H6 and H10, etc.) or other tags for use in IMAC systems, for example, Ni 2+ affinity columns, etc., GST fusions, MBP fusions, streptavidine-tags, the BSP biotinylation target sequence of the bacterial enzyme BIRA and tag epitopes that are directed by antibodies (for example c-myc tags,
- the tag domain allows for the detection of composition using antibody -based detection assays, including, for example, ELISA, immunohistochemistry, immunofluorescence, flow cytometry, and the like. This allows for the amplification of a signal, for example created by enzymatic action upon a substrate, which allows for detection even if only a few compositions of the invention bind to the nanomaterial.
- the binding domain of the composition of the invention is a peptide that binds to the nanomaterial of interest.
- the peptide may be made using chemical methods.
- peptides can be synthesized by solid phase techniques (Roberge J Y et al (1995) Science 269: 202-204), cleaved from the resin, and purified by preparative high performance liquid chromatography.
- Automated synthesis may be achieved, for example, using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
- the peptide may alternatively be made by recombinant means or by cleavage from a longer polypeptide.
- the composition of a peptide may be confirmed by amino acid analysis or sequencing.
- the variants of the peptides according to the present invention may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the peptide is an alternative splice variant of the peptide of the present invention, (iv) fragments of the peptides and/or (v) one in which the peptide is fused with another peptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag).
- a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
- the fragments include peptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence.
- variants may be post- translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
- the "similarity" between two peptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one peptide to a sequence of a second peptide.
- Variants are defined to include peptide sequences different from the original sequence, preferably different from the original sequence in less than 40% of residues per segment of interest, more preferably different from the original sequence in less than 25% of residues per segment of interest, more preferably different by less than 10% of residues per segment of interest, most preferably different from the original protein sequence in just a few residues per segment of interest and at the same time sufficiently homologous to the original sequence to preserve the functionality of the original sequence and/or the ability to bind to ubiquitin or to a ubiquity lated protein.
- the present invention includes amino acid sequences that are at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, or 95% similar or identical to the original amino acid sequence.
- the degree of identity between two peptides is determined using computer algorithms and methods that are widely known for the persons skilled in the art.
- the identity between two amino acid sequences is preferably determined by using the BLASTP algorithm [BLAST Manual, Altschul, S., et al, NCBI LM NIH Bethesda, Md. 20894, Altschul, S., et al, J. Mol. Biol. 215: 403-410 (1990)].
- the peptide can be post-translationally modified.
- post- translational modifications that fall within the scope of the present invention include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristoylation, protein folding and proteolytic processing, etc.
- Some modifications or processing events require introduction of additional biological machinery.
- processing events such as signal peptide cleavage and core glycosylation, are examined by adding canine microsomal membranes or Xenopus egg extracts (U.S. Pat. No. 6, 103,489) to a standard translation reaction.
- the peptide may include unnatural amino acids formed by post- translational modification or by introducing unnatural amino acids during translation.
- a variety of approaches are available for introducing unnatural amino acids during protein translation.
- special tRNAs such as tRNAs which have suppressor properties, suppressor tRNAs, have been used in the process of site- directed non-native amino acid replacement (SNAAR).
- SNAAR site- directed non-native amino acid replacement
- the peptide is derived from a fibronectin scaffold.
- a phage display library of randomized fibronectin-based peptides may be used to identify peptides that bind to the nanomaterial of interest.
- the binding domain of the composition comprises an antibody, or fragment thereof, which binds to the nanomaterial of interest.
- Methods of making and using antibodies are well known in the art.
- polyclonal antibodies useful in the present invention are generated by immunizing rabbits according to standard immunological techniques well-known in the art (see, e.g., Harlow et al, 1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.).
- Such techniques include immunizing an animal with a nanomaterial comprising a portion of another protein such as a maltose binding protein or glutathione (GSH) tag polypeptide portion, and/or a moiety such that the antigenic particle is rendered immunogenic (e.g., an antigen of interest conjugated with keyhole limpet hemocyanin, KLH) and a portion comprising the respective antigenic particle.
- GSH glutathione
- the invention should not be construed as being limited solely to methods and compositions including these antibodies or to these portions of the antigens. Rather, the invention should be construed to include other antibodies, as that term is defined elsewhere herein, to antigens, or portions thereof. Further, the present invention should be construed to encompass antibodies, inter alia, which bind to the specific antigens of interest, and are able to bind the antigen present on Western blots, in solution in enzyme linked immunoassays, in fluorescence activated cells sorting (FACS) assays, in magenetic-actived cell sorting (MACS) assays, and in
- the antibody can specifically bind with any portion of the particle.
- the present invention is not limited to using the complete particle. Rather, the present invention includes using a portion of the particle to produce an antibody that specifically binds with the particle.
- the antibodies can be produced by providing an animal such as, but not limited to, a rabbit, a mouse or a camel, with a particle of the invention, or a portion thereof, or to chimeric molecules comprising the particle.
- an animal such as, but not limited to, a rabbit, a mouse or a camel
- a particle of the invention or a portion thereof, or to chimeric molecules comprising the particle.
- smaller fragments of these particles can also be used to produce antibodies that specifically bind the particle of interest.
- the invention encompasses monoclonal, synthetic antibodies, and the like.
- the crucial feature of the antibody of the invention is that the antibody bind specifically with the particle of interest. That is, the antibody of the invention recognizes a particle of interest or a fragment thereof on Western blots, in immunostaining of cells, and immunoprecipitates using standard methods well-known in the art.
- the antibodies can be used to immunoprecipitate and/or immuno- affinity purify their cognate particle as described in detail elsewhere herein, and additionally, by using methods well-known in the art.
- polyclonal antibodies is accomplished by inoculating the desired animal with the particle and isolating antibodies which specifically bind the particle therefrom using standard antibody production methods such as those described in, for example, Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.).
- Monoclonal antibodies directed against particles, or fragments thereof may be prepared using any well-known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.) and in Tuszynski et al. (1988, Blood, 72: 109-115). Monoclonal antibodies directed against the peptide are generated from mice immunized with the particle using standard procedures as referenced herein.
- Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. Immunol. 12: 125-168), and the references cited therein. Further, the antibody of the invention may be "humanized” using the technology described in, for example, Wright et al, and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77:755-759), and other methods of humanizing antibodies well- known in the art or to be developed.
- humanized antibody has one or more amino acid residues introduced into it from a source which is nonhuman. These nonhuman amino acid residues are often referred to as "import” residues, which are typically taken from an “import” variable domain.
- humanized antibodies comprise one or more CDRs from nonhuman immunoglobulin molecules and framework regions from human.
- humanized chimeric antibodies substantially less than an intact human variable domain has been substituted by the corresponding sequence from a nonhuman species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework (FR) residues are substituted by residues from analogous sites in rodent antibodies.
- Humanization of antibodies can also be achieved by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology,
- a human scFv may also be derived from a yeast or phage display library.
- variable domains both light and heavy
- the choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is to reduce antigenicity.
- sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences.
- the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al, J. Immunol, 151:2296 (1993); Chothia et al, J. Mol. Biol, 196:901 (1987), the contents of which are incorporated herein by reference herein in their entirety).
- Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
- the same framework may be used for several different humanized antibodies (Carter et al, Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al, J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference herein in their entirety).
- the antibody is humanized with retention of high affinity for the target antigen and other favorable biological properties.
- humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences.
- Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art.
- Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind the target antigen.
- residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen, is achieved.
- the CDR residues are directly and most substantially involved in influencing antigen binding.
- a humanized antibody retains a similar specificity as the original antibody.
- affinity and/or specificity of binding of the antibody may be increased using methods of "directed evolution,” as described by Wu et al, J. Mol. Biol., 294: 151 (1999), the contents of which are incorporated herein by reference herein in their entirety.
- the binding domain is characterized by particular functional features or properties of an antibody.
- the invention relates to a binding domain comprising an antibody or functional fragment thereof, wherein the antibody specifically binds to a nanomaterial of interest or fragment thereof.
- the antibody fragment provided herein is a single chain variable fragment (scFv).
- the antibodies of the invention may exist in a variety of other forms including, for example, Fv, Fab, and (Fab')2, as well as bi-functional (i.e. bi-specific) hybrid antibodies (e.g., Lanzavecchia et al, Eur. J. Immunol. 17, 105 (1987)).
- the antibodies and fragments thereof of the invention binds one or more nanomaterials of interest.
- an antibody of the invention comprises heavy and light chain variable regions comprising amino acid sequences that are homologous to the amino acid sequences of the preferred antibodies described herein, and wherein the antibodies retain the desired functional properties of the antibodies of the invention.
- the antibody of the invention is further prepared using an antibody having one or more of the VH and/or VL sequences disclosed herein can be used as starting material to engineer a modified antibody, which modified antibody may have altered properties as compared to the starting antibody.
- the antibody is engineered by modifying one or more amino acids within one or both variable regions (i.e., VH and/or VL), for example within one or more CDR regions and/or within one or more framework regions.
- the binding domain of the invention comprises a scFv that binds to a nanomaterial of interest.
- the present invention is partly based upon the identification of scFv fragments that bind to different nanomaterials.
- the scFv specifically binds to a quantum dot.
- the scFv that binds to QD is one of the group consisting of, C2, C3, C4, and C43 (also referred to herein as "GSH2,” “GSH3,” “GSH4" and “GSH43").
- the scFv that binds to QD is encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43).
- the composition comprises a peptide encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43).
- the composition comprises a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43).
- the composition comprises a polynucleotide comprising a nucleotide sequence that encodes a peptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (CI), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43).
- the composition comprises a fragment, or nucleotide sequence encoding a fragment, of C2, C3, C4, or C43.
- the composition comprises the VH or VL of C2, C3, C4, or C43, or nucleotide sequence encoding the VH or VL of C2, C3, C4, or C43.
- the composition comprises an amino acid sequence encoding the light chain of C43 (SEQ ID NO: 8).
- the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C43 (SEQ ID NO: 8).
- the composition comprises an amino acid sequence encoding the heavy chain of C43 (SEQ ID NO: 10).
- the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C43 (SEQ ID NO: 10).
- the scFv specifically binds to T1O2.
- the scFv that binds to T1O2 is C49, C6, or CI 5 (also referred to herein as "Ti49,” “Ti6,” or “Til 5").
- the scFv that binds to T1O2 is encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15).
- the composition comprises a peptide encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15).
- the composition comprises a polynucleotide comprising a nucleotide sequence that encodes a peptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15).
- the composition comprises a fragment, or nucleotide sequence encoding a fragment, of C49, C6, or C15.
- the composition comprises the VH or VL of C49, C6, or CI 5, or nucleotide sequence encoding the VH or VL of C49, C6, or C15.
- the composition comprises an amino acid sequence encoding the light chain of C49 (SEQ ID NO: 9).
- the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C49 (SEQ ID NO: 9).
- the composition comprises an amino acid sequence encoding the heavy chain of C49 (SEQ ID NO: 1 1).
- the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C49 (SEQ ID NO: 1 1).
- the composition comprises a binding domain, as described herein, and a bacteriophage.
- the composition comprises a bacteriophage that expresses the binding domain, for example, on the surface of the bacteriophage.
- any bacteriophage including any species of bacteriophage, may be used.
- the bacteriophage is a helper phage.
- the bacteriophage is a filamentous phage, including for example Ml 3 and derivatives or variants thereof.
- the bacteriophage is T7 phage.
- the composition includes at least one additional ingredient.
- the additional ingredient is at least one of an aerosolizing medium, a sprayable medium, a cross-linker, a support surface, a fiber, a foam medium, a pharmaceutically acceptable carrier, a lotion, and/or a nutritionally acceptable carrier (including, for example, food and/or beverages, mouthwash, lozenges, items for ingestions, and/or items that are generally regarded as safe
- composition includes two or more of the listed additional ingredients.
- the composition can be part of a device. In some embodiments, at least composition is immobilized on the support surface. In some embodiments, the composition is cross-linked to the support surface. In some embodiments, the composition is embedded in the support surface. In some embodiments, the composition is covalently tethered to the support surface. In some embodiments, the composition includes a magnetic material, and is immobilized on the support surface by an electromagnetic force. In some embodiments, the composition includes (and/or is attached to) a binding partner of a molecule that is on the support surface, and is immobilized on the support surface through the association of the molecule and its binding partner.
- the composition includes a ligand of a receptor on the support surface, and is immobilized on the support surface through the binding of the ligand and receptor.
- the composition can be associated and/or immobilized on the support surface in any number of ways. In embodiments in which a liquid is present, the composition need not be immobilized in all embodiments. Thus, for example, if a wet filter is present, the antibody can be contained within the solution and/or the wet filter.
- the present invention includes a method of detecting the presence of a nanomaterial in biological systems.
- the method comprises detecting the location of a nanomaterial in biological systems.
- the invention includes the use of the NProbe, described elsewhere herein, to detect the presence or location of a nanomaterial in a diagnostic assay, toxicity assay, safety assay, quality assay, environmental contamination assay, and the like.
- the present invention is used to assess the safety and toxicity of a nanomaterial or of a commercial, pharmaceutical, cosmetic, or industrial product comprising a nanomaterial.
- the method is used in a diagnostic assay to indicate that the nanomaterial is present within a subject.
- the method is used to monitor the presence of nanomaterials used in nanomedicine therapeutic regimens, which can thus be used in the determination of how the regimen proceeds.
- the method comprises detecting a nanomaterial in samples obtained over time, to determine how the nanomaterials used in the nanomedicine regimen are processed by the body.
- the method may thus be used to assess the safety of the nanomedicine regimen, or to augment the regimen based upon safety concerns.
- the present method is used as a toxicity or safety assay to evaluate, for example, the skin permeation, body retention, or body clearance of a nanomaterial or product comprising a nanomaterial.
- a toxicity or safety assay to evaluate, for example, the skin permeation, body retention, or body clearance of a nanomaterial or product comprising a nanomaterial.
- such an assay is performed on research subjects, including, for example, mice, rats, cats, dogs, fish, reptiles, amphibians, monkeys, humans, and the like.
- the present invention provides a method of detecting the presence or location of a nanomaterial in a sample with the use of the NProbe composition of the present invention.
- the detection used herein includes quantitative detection and non- quantitative detection.
- the non-quantitative detection include, for example, determination of merely whether or not a nanomaterial is present, determination of whether or not a specific amount or more of a nanomaterial is present, determination for comparison of the amount of nanomaterial with that of another sample (e.g., a control sample).
- the quantitative detection includes determination of the
- the present invention encompasses detection of a nanomaterial, with use of the NProbe composition described elsewhere herein, in vitro, ex vivo, or in vivo.
- the method comprises detecting the presence or location of the nanomaterial in an excised tissue sample or biopsied tissue sample.
- in vivo detection of a nanomaterial comprises administering a composition comprising the NProbe of the invention to the subject.
- composition comprising the NProbe may be administered by any suitable method, including, for example, orally, transarterially, subcutaneous ly, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, by inhalation, or intraperitoneally.
- the composition comprising the NProbe may be, for example, a pharmaceutical composition.
- the test sample is not particularly limited as long as it is a sample that may contain the nanomaterial.
- a sample collected from the body of a subject is a reptile, bird, amphibian, or fish.
- the subject is a mammal.
- the subject is a mouse, rat, hamster, guinea pig, cat, dog, monkey, horse, cow, and the like.
- the subject is a human.
- Specific examples of the test sample may include solid or fluid tissue samples. Fluid tissue samples include for example, blood, interstitial fluid, plasma, extravascular fluid, cerebral fluid, joint fluid, pleural fluid, serum, lymph fluid, saliva.
- Exemplary solid tissue samples include for example, skin, muscle, heart, lung, lymph node, liver, kidney, intestinal layers, brain, and the like.
- the sample is a skin sample, including, for example a sample taken from the epidermis, stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, stratum germinativum, dermis, hypodermis, basement membrane, or a combination thereof.
- the method comprises detecting the presence of the nanomaterial in a sample comprising a basal keratinocyte.
- a sample obtained from the test sample such as culture solution of cells collected from the body of the living organism is also included in the test sample of the present invention.
- the method comprises the detection of a nanomaterial in an environmental or ecological system.
- the test sample is a sample of water, soil, fungi, bacteria, algae, plant, wildlife, and the like.
- the method provides for the ability to detect the presence and amount of contaminating nanomaterials in the environment or in a particular ecosystem.
- the method of detecting the nanomaterial contained in a test sample is not particularly limited, however, detection is preferably performed by an
- the immunological method includes, for example, a radioimmunoassay, an enzyme immunoassay, a fluorescence immunoassay, a luminescence immunoassay, immunoprecipitation, a turbidimetric immunoassay.
- the assay is an enzyme immunoassay, for example an enzyme- linked immunosorbent assay (ELISA) (e.g., a sandwich ELISA).
- ELISA enzyme- linked immunosorbent assay
- FLISA fluorescent-linked immunosorbent assay
- the assay is a flow cytometry assay.
- a general detection method with the use of an NProbe comprises immobilizing an NProbe on a support, adding a test sample thereto, incubating the support to allow the NProbe and nanomaterial to bind to each other, washing the support, and detecting the binding to the support via the NProbe to detect
- the binding between the NProbe and the nanomaterial is generally carried out in a buffer.
- Buffers used in the invention include, for example, a phosphate buffer, a Tris buffer.
- Incubation is carried out under the conditions generally employed, for example, at 4°C to room temperature for 1 hour to 24 hours.
- the washing after incubation can be carried out by any method as long as it does not inhibit the binding between the nanomaterial and the NProbe, using for example a buffer containing a surfactant such as Tween 20.
- a control sample may be provided in addition to a test sample to be tested for the presence of the nanomaterial.
- the control samples include a negative control sample that does not contain the nanomaterial and a positive control sample that contains the nanomaterial.
- it is possible to detect the nanomaterial in the test sample by comparing the result obtained with the negative control sample that does not contain the nanomaterial with the result obtained with the positive control sample that contains the nanomaterial. It is also possible to quantitatively detect nanomaterial contained in the test sample by obtaining the detection results of the control samples and the test sample as numerical values, and comparing these numerical values.
- One embodiment of detecting nanomaterial via an NProbe is a method using an NProbe comprising a detectable tag or label.
- the nanomaterial may be detected by contacting the test sample with an NProbe and then detecting a NProbe-nanomaterial complex with the use of the labeled antibody that specifically binds to the nanomaterial, NProbe, or complex.
- the labeling of an NProbe can be carried out by a generally known method.
- Examples of the detectable label known to those skilled in the art include a fluorescent dye, an enzyme, a coenzyme, a chemiluminescent substance or a radioactive substance.
- radioisotopes 32 P, 14 C, 125 1, 3 H, 131 I and the like
- fluorescein 32 P, 14 C, 125 1, 3 H, 131 I and the like
- rhodamine dansyl chloride
- umbelliferone luciferase
- peroxidase alkaline phosphatase
- beta-galactosidase beta-glucosidase
- horseradish peroxidase glucoamylase
- lysozyme saccharide oxidase, microperoxidase, biotin and the like.
- biotin it is preferred that a biotin-labeled antibody is added, and then avidin conjugated to an enzyme such as alkaline phosphatase is further added.
- the detection of the nanomaterial can be carried out by a method known to those skilled in the art.
- the nanomaterial in the case where the antibody is labeled with a radioactive substance, the nanomaterial may be detected by liquid scintillation or the RIA method.
- the nanomaterial in the case where the antibody is labeled with an enzyme, the nanomaterial may be detected by adding a substrate and detecting an enzymatic change of the substrate such as color development with an absorbance reader.
- the nanomaterial may be detected with the use of a fluorometer.
- the method uses an NProbe labeled with biotin. After the sample is suitably prepared the biotin-labeled NProbe is added. After being incubated appropriately, avidin conjugated to an enzyme such as alkaline phosphatase or peroxidase is added. After being incubated, a substrate of the enzyme conjugated to avidin is added. Then, nanomaterial is detected by means of the enzymatic change of the substrate as an indicator.
- an enzyme such as alkaline phosphatase or peroxidase
- Another embodiment of the method of detecting NProbe of the present invention is a method using an NProbe that specifically binds to the nanomaterial and a secondary antibody that specifically binds to the NProbe.
- the NProbe comprises a tag that serves as an epitope for the secondary antibody.
- the secondary antibody is preferably labeled with a detectable label.
- the NProbe comprises a FLAG tag, while a secondary anti-FLAG antibody, tagged with an enzyme, for example alkaline phosphatase, is used to bind to the NProbe-nanomaterial complex.
- the detection of the secondary antibody can be carried out by the above-mentioned method.
- Example 1 Development of NProbes using phage display to selected commercially important nanomaterials.
- Non-fluorescent nanomaterials are often mistaken for cellular vesicles or glycogen granules (Muhlfeld et al, 2007, Part Fibre Toxicol 4(1 1)) during detection, rendering the data on nanomaterial occurrences in tissue questionable.
- NProbes specific reagents
- phage display of scFv antibodies to commercially important NPs such as QDs, T1O2 and Au
- Binding capability of the NProbes is tested using custom-designed in vitro assays and their specificity is ascertained by testing their cross-reactivity to other commercially available nanomaterials of a similar composition.
- a monovalent scFv phage display library with ⁇ 2xl0 9 unique clones is used to select for specific binders by employing a technique called biopanning, which comprises of repeated centrifugal washes to enrich for binders, thereby washing away unbound phages.
- Bound phages are recovered and regrown for several iterative rounds of enrichment and individual binding clones are identified by sequence analysis. Specific binding scFvs are expressed as free proteins and purified for use in experiments.
- the identified scFvs can be used as antibodies in IHC with a secondary enzyme-based antibody detection system to detect nanomaterials (antigens) in tissue sections, thus providing a tool to transform nanomaterial research.
- the biopanning technique using phage display, as described herein, has the advantage of providing the opportunity to discover reagents that bind to nanomaterial based on shape as well as composition, Moreover nanomaterial immunogenicity is not a requirement for enrichment of reagents using in vitro display technology. While not wishing to be bound by any particular theory, nanomaterial properties, nanomaterial agglomeration state, and dispersant properties may dictate binding capability, specificity and cross-reactivity of the scFv antibodies.
- the experiments and screening method described herein utilizes a phage display antibody library comprising of ⁇ 2xl0 9 unique clones in scFv format, which has been previously used to generate antibodies against proteins (Denny et al., 2008, J Proteome Res 7(5): 1994-2006), haptens (Wuertzer et al, 2008, Mol Ther 16(3):481-486) and cell surface antigens (Haidaris et al, 2001, J Immunol Methods 257(1-2): 185-202).
- a phage display antibody library comprising of ⁇ 2xl0 9 unique clones in scFv format, which has been previously used to generate antibodies against proteins (Denny et al., 2008, J Proteome Res 7(5): 1994-2006), haptens (Wuertzer et al, 2008, Mol Ther 16(3):481-486) and cell surface antigens (Haidaris et al, 2001, J Immunol Methods
- the scFv ( Figure 1) library composed of ⁇ 2xl0 9 unique clones has been used to generate antibodies against a variety of proteins and antigens (Haidaris et al, 2001, J Immunol Methods 257(l-2): 185-202; Shea et al, 2005, J Struct Funct Genomics 6(2-3): 171-175; Wuertzer et al, 2008, Mol Ther 16(3):481-486).
- the use of scFv libraries allow for increased area of interaction and rigidity, and hence generates binders to nanomaterials with higher affinity and specificity, as opposed to those generated by peptide libraries with restricted binding due to their limited amino acid sequences. Binders are generated through rounds of affinity selection (bio- panning) process (Sparks, A.B., Adey, N.B., Cwirla, S. and Kay, B.K. 1996.
- Affinity selection-based enrichment protocols allow for the selection of specific phage binders to nanomaterials.
- the generated NProbes are a new useful tool to accurately detect nanomaterial presence in tissue, their penetration mechanism and translocation fate even in systemic tissues in vivo.
- the biopanning method described herein allows for the generation of a reagent tool kit that will enable the enhanced detection of different types of nanomaterials in tissues as well as in the environment to aid in the assessment of nanomaterial associated EH&S risk.
- the present studies also describe the evaluation of the specificity and cross-reactivity of the selected purified scFvs to nanomaterials using dot blot analysis, FLISA (fluorescence-linked immunosorbent assay) (Esteve-Turrillas and Abad- Fuentes, 2013, Biosens Bioelectron 41 : 12-29), DLS, TEM, BCA and sandwich ELISA.
- FLISA fluorescence-linked immunosorbent assay
- nanomaterials used in the study include QDs (CdSe- ZnS core-shell, 605 nm emission, Labs) rendered negatively charged (- 26.2 mV, glutathione (GSH) coated) and water-soluble (hydrodynamic diameter ⁇ 14 nm) by modifying their surface chemistry using ligand exchange (Ravichandran et al., 2011, Nanotoxicology 5(4):675-865), T1O2 (Aeroxide P25 anatase (80%) and rutile phases (20%), -21 nm, Evonik), and Au nanomaterial (tannic acid coated NanoXactTM gold, 5 and 50 nm, Nanocomposix Inc.).
- the process of bio-panning begins with nanomaterials to be dispersed in TBS buffer (50 nM Tris HC1, 150 nM NaCl, pH 7.5), for which sonication ( ⁇ 5 sees) and vortexing is useful to maintain colloidal dispersion (Chen et al, 2006, Analytical Chemistry 78(14):4872-4879; Denny et al, 2008, J Proteome Res
- a baseline binding level is established using an arbitrary single clone phage before proceeding to use the entire diverse phage library for each nanomaterial.
- the phage library (containing 0.5% casein block, diluted 1 :5 in TBS) is mixed with target nanomaterials in TBS at room temperature for 2 hours with gentle agitation, following which the unbound phage are removed from the solution by repeated centrifugation and resuspension of pellet in TBS containing 0.5% Tween 20 (TBST).
- the bound phages are eluted using 0.1 M Glycine (pH 2.2) and neutralized using 2 M Tris base. To prepare phage pools for the next round, the eluate is transduced into fresh log phase TGI cells at 37°C and ampicillin resistant transductants are plated. The colonies are grown in suspension, infected with helper phage (2 hours, 37°C) followed by growth overnight at 30°C, after which phage stocks are prepared by precipitation with polyethylene glycol 8000 and resuspension in 0.5% casein in TBS. A similar protocol is used with Au nanoparticles (5 and 50 nm) to isolate NProbes after initial optimization of centrifugal washes and speeds.
- Phage stocks were prepared from the individual clones for testing their binding with the target nanomaterial relative to an arbitrary clone (phage stock of clone selected from the library on an unrelated target).
- a second pelleting method was used for GSH QDs in order to find scFvs exhibiting more than 10-fold enrichment over background.
- this method after incubation of the nanomaterials with the phage library, unbound phages are washed away using a repeated centrifugation and resuspension process in TBST containing 1 M MgCi2.6H20 salt. This technique allows for usage of lower speeds of
- NProbes as a tool to aid researchers in the identification and detection of various types of nanomaterials depends on their binding specificity to the target nanomaterials, and cross-reactivity to other nanomaterials.
- T1O2 nanoparticles and Au nanoparticles (5 and 50 nm, Nanocomposix Inc.), QDs of a similar charge, size and different surface chemistry (dihydrolipoic acid (DHLA) QD) and similarly charged Invitrogen 565 ITK QDs (carboxylated, 565 nm emission), T1O2 nanoparticles from other vendors (Anatase and Rutile phases, Sun Innovations Inc.), and Au nanoparticle powder (Sigma Aldrich, particle size ⁇ 10 ⁇ ) are used, respectively.
- DHLA dihydrolipoic acid
- the membrane is washed 3x with wash buffer for 5 min each and anti-flag HRP secondary antibody is added to the membrane at a dilution of 1 :2000 in blocking buffer.
- the membrane is incubated with a chemiluminescent substrate for 5 min and developed using an x-ray film. Results from the assay demonstrated that spots developed and co-localized with GSH QDs (4.3 ⁇ ) indicating binding of the NProbe (Figure 3; see Figure 14 for 50 nM).
- TEM analysis A specific concentration of nanomaterials (50 nM of GSH QDs and 1 mg/mL of TiC nanoparticles) are mixed with each of their specific binder phages for 2 hours at room temperature, after which they are centrifuged to wash away unbound phages (TBST). The pellet is resuspended in TBS buffer and samples prepared for TEM analysis (Electron Microscopy Core, URMC).
- nanoparticles to show binding with specific phages, isolated using phage display.
- NIH Image J
- Threshold values were limited to 225- 250 pixels for quantification of QDs.
- This technique also aids in understanding trends of NProbe binding QDs with increasing QD concentrations (12.5, 25, 50 and 100 nM). Trends were observed using a plate reader (green optical kit, ex: 525, em: 580-640 nm, Figure 16). Using FLISA, cross-reactivity assays are performed to test NProbes specific against GSH QDs, with DHLA QDs and Invitrogen carboxylated QDs, and the magnitude of binding is tested using an unpaired Student's t-test.
- the technique is modified to a sandwich ELISA, where after addition of nanomaterials to scFv coated wells (coating antibody), a known concentration of nanomaterials is added. The same specific scFvs are then added (capture antibody) to aid in binding of a secondary enzyme-tagged antibody (alkaline phosphatase (AP) tagged anti-flag). A chromogenic substrate is added to the wells, after which absorbance values are obtained using a plate reader. NProbe binding trends with different concentrations of nanomaterials are established. Sandwich ELISA assay using NProbes are also performed for testing cross-reactivity with respective nanomaterials of similar composition. DLS assay: Binder scFvs (0.025 mg/mL) are mixed with 50 nM GSH
- This method of observing a change in size upon scFv binding is also used for Au nanoparticles.
- the same assay is used to obtain insights on the cross- reactivity aspect of the binder scFvs against GSH QDs and Au nanoparticles to nanomaterials of a similar composition (DHLA and Invitrogen QDs, and 5 and 50 nm Au nanoparticles).
- BCA protein assay For non-fluorescent nanomaterials, binder scFvs to T1O2 and Au nanoparticles are isolated, and their binding and cross-reactivity is tested using a BCA assay. In this assay, nanomaterials of different concentrations are incubated with scFvs (0.065 mg/mL), after which scFvs bound to nanomaterials are pelleted using optimal centrifugation speeds. The unbound scFv-containing supernatant are removed and tested for protein (scFv) content using a BCA protein assay kit along with BSA standards. Unknown protein concentration in the supernatant is calculated and subtracted from the input concentration to yield amounts of scFv bound to different concentrations of nanomaterials.
- the same assay is used with other nanomaterials of similar composition to test cross-reactivity of the NProbes obtained.
- the assays described above determine specificity and cross-reactivity of the scFvs to various nanomaterials. If the NProbes isolated against GSH QDs bind DHLA QDs weakly ( ⁇ 10-fold more binding than baseline, Figure 18), then it can be concluded that the binding is influenced by nanomaterial charge or that the scFvs are specific to the core of the QD rather than the surface chemistry. This is also tested with commercial Invitrogen QDs, and the use of assays such as FLISA and DLS for potential cross-reactivity.
- binding curves are established using sandwich ELISA with C49 scFv isolated against T1O2 nanoparticles, and those that are isolated for Au nanoparticles.
- the dependence of nanomaterial agglomeration state on binding is an important factor to be tested, as the NProbes would be used in a biological application setting where nanomaterial agglomeration is highly pertinent (Lynch et al, 2007, Adv Colloid Interface Sci 134-135: 167-174). Low cross-reactivity of NProbes is indicative of the binding being dependent on nanomaterial agglomeration properties.
- Methods described herein for isolation and purification of scFvs depend upon the type of nanomaterial used, its charge, agglomeration state and surface chemistry. Therefore, optimization in terms of speeds used to pellet nanomaterials bound to phages; selection to agglomerates or dispersed single nanomaterials; use of 'salting-out' to separate bound and unbound phages; and lesser amplification compared to routinely observed levels of 500-5000-fold with protein targets; is necessary.
- FN fibronectin
- This library is based on the tenth type III domain of human FN (Koide et al, 1998, J Mol Biol 284(4): 1141-1 151) comprised of -lxlO 9 clones with two surface exposed loops of the protein partially randomized, and has been shown to generate binders for various molecules.
- Example 2 Use of NProbes for detection of nanomaterial stratum corneum (SO penetration and localization using an ex vivo human skin model.
- Skin is the largest organ of the body, and acts as an outside-in and an inside-out barrier. Inevitable human exposure to nanomaterials has caused safety concerns as they have the potential to penetrate the SC and contact viable
- keratinocytes (Monteiro-Riviere et al, 2011, Toxicol Sci 123(l):264-280).
- the nanomaterials in a biological environment interact with proteins and other components (Monteiro-Riviere et al, 201 1, Toxicol Sci 123(l):264-280), and the validation of NProbes lies in the detection of these nanomaterials in the biological milieu. Detection of nanomaterials in the epidermal and dermal layers of skin will resolve many current discrepancies in results associated with the use of conventional microscopic techniques to detect fluorescent (Ravichandran et al, 2011,
- NProbes may be used as a tool to detect both fluorescent and non-fluorescent nanomaterials in human tissue, and to further quantify nanomaterial localization in tissue using standard techniques, thereby validating the use of NProbes as a superior nanomaterial detection method.
- Nanomaterial translocation to the viable epidermal layers, namely the basal keratinocytes would imply shuttling of nanomaterials to systemic circulation, thereby increasing safety concerns with the use of nanomaterial-containing commercial products.
- Detection and quantification of nanomaterials associated with basal cells are of utmost importance, as those associated with suprabasal cells ultimately get sloughed off. It is expected that nanomaterials that are able to breech the SC barrier are able to diffuse to and be taken up by basal keratinocytes and/or enter ciruculation, which might pose a risk to human health.
- Flow cytometry is used along with keratin markers to assess nanomaterial localization (K14 for basal cells (Green et al, 2003, Proc Natl Acad Sci USA 100(26): 15625-30) and K10 for suprabasal cells (Poumay and Pittelkow, 1995, J Invest Dermatol 104(2):271-6)), and results are correlated to that obtained with the use of NProbes.
- nanomaterials undergo a transformation in a biological environment when they come in contact with the different biomolecules present therein, which alters nanomaterial properties such as agglomeration state (Prow et al, 2012, Nanotoxicology 6(2): 173-185), and the way they interact with the cells (Nystrom and Fadeel, 2012, J Control Release 161(2):403- 408).
- Tape-stripping combined with elemental analysis is commonly used to quantify nanomaterial skin penetration based on a depth profile, however, it is a destructive technique and does not provide mechanistic information at the cellular level
- NProbes Use of NProbes is demonstrated using histology, where fluorescent and non-fluorescent nanomaterials bind the specific NProbes in a tissue environment, and quantification of nanomaterial association with different epidermal cells is done using flow cytometry.
- Proposed nanomaterials include negatively charged GSH QDs, T1O2 and negatively charged Au nanoparticles (tannic acid coated).
- GSH QDs negatively charged GSH QDs
- T1O2 negatively charged Au nanoparticles
- Au nanoparticles titanium acid coated
- Nanomaterials (QDs) in water are applied on to skin in quantities lesser than those routinely used for cosmetic testing by pipetting, and spreading them evenly on the epidermal side of the skin surface.
- QDs Nanomaterials
- nanoparticles formulated into sunscreen lotions range from 2 to 30 wt%. Lotions are typically tested at about 2mg/cm2. Thus, typical exposure would be between 0.04 to 0.6 mg/cm2.
- a commercial sunscreen is also tested with NProbes specific to T1O2 nanoparticles. Skin samples remain in the sterile hood for 24 hours, after which excess nanomaterials are wiped off the skin surface using IX PBS. The skin is processed depending upon the experiment as described below.
- NProbes binding of NProbes (scFvs) specific to various nanomaterials isolated as described elsewhere herein are tested in a tissue environment using a secondary anti-flag antibody conjugated to AP.
- a color (bluish-purple) produced upon addition of a substrate for AP indicates binding of primary antibody (scFvs) to target nanomaterials (antigens) tissue sections.
- nanomaterials even isolated single nanomaterials, which cannot be observed using conventional microscopic techniques, are detected.
- Binding specificity Skin samples with and without nanomaterials are processed for histology by keeping them frozen (-80°C) until use. Frozen skin is mounted using TEK OCT compound, after which they are sliced (5 ⁇ thickness) on to microscope slides using a cryostat (Thermo Scientific). The epidermis and the dermis are sectioned simultaneously to prevent accidental transfer of nanomaterials to the blade (red arrow, Figure 20). The slides are fixed in methanol (-20°C, 10 min) prior to the experiment. After washing with IX TBS, an immuno-edge pen is used to mark boundaries to contain all antibody solutions within the slide.
- the slides are blocked with 2% BSA in TBS for 20 min, after which they are incubated overnight with scFvs ( ⁇ 20 ⁇ g/mL) in 2% BSA at 4°C in a humidified chamber.
- the slides are then washed 3x with TBST and incubated with anti-flag antibody conjugated to AP (-1.5 ⁇ g/mL) for 1 hour at room temperature.
- the slides are incubated with BCIP/NBT substrate for AP containing 5 mM levamisole for 30 min at room temperature.
- Levamisole is an endogenous AP inhibitor, thereby allowing for the quantification of AP staining due to the binding of scFv-anti-flag (AP tagged) secondary antibody alone.
- Varying substrate incubation times will result in signal amplification, and allow us to visualize even those sparse QDs not detectable under fluorescence (30 min, Figure 8, black arrows). This is tested using different time points of substrate incubation such as 5, 15, 30 and 60 min.
- samples with and without nanomaterials are compared to examine scFv-nanomaterial binding.
- NProbes specificity of NProbes in terms of binding to intact nanomaterials rather than soluble ions or elemental metal is tested by applying cadmium chloride salt (CdCk), zinc sulfide, or other salts (for testing specificity to intact QDs) and titanium bromide salt (TiBr 4 ) (for testing specificity to intact TiC nanoparticles) on skin, and performing IHC experiments as mentioned above with the use of the NProbes.
- CdCk cadmium chloride salt
- ZDs zinc sulfide
- TiBr 4 titanium bromide salt
- QDi .coloc IS the amount of QDs co-localized with AP relative to the total amount of QDs, and APi, co ioc is the amount of AP staining co-localized relative to the total amount of AP staining in the image.
- Ml and M2 vary between 0 and 1 , where 0 implies no co-localization, and 1 implies complete co-localization. The value of M2 if less than 1 implies presence of more AP staining than QDs. As an example in Figure 10, M2 value of 0.73 was obtained, thereby implying detection of those QDs with the use of NProbes (more green regions, blue arrows) that are not easily visible using conventional microscopy.
- a scatter plot generated shows co- localizing regions (yellow) of the two stains ( Figure 10, white box), and a merge shows co-localized regions of nanomaterials and scFvs in white (yellow arrows)
- Figure 23 demonstrates the ability for C43 to bind to GSH QDs as shown by IHC via AP staining and the colocalization of QDs and C43. Tracking nanomaterial skin association profiles using flow cytometry
- Tape stripping is used to induce a SC defect (Bashir et al, 2001, Skin Res Technol 7(l):40-48 ) in experiments as it has been shown in previous work to decrease epidermal resistance by 80% and increase nanomaterial human skin penetration (Ravichandran et al, 201 1, Nanotoxicology 5(4):675-865). Skin is processed as above, and a barrier defect (tape strip lOx, 3M packing tape 3750) is induced prior to application of nanomaterials (QDs). The epidermis is then separated from the dermis by placing skin samples in a solution containing Dispase (1 :4 ratio in IX PBS) overnight.
- Dispase is a protease that gently cleaves the basement membrane at the epidermal/dermal junction without compromising on the integrity of the epidermis.
- Epidermal sheets obtained are processed for flow cytometry along with keratin markers K14 and K10, which are used to differentiate between nanomaterial associated cell populations. Briefly, skin samples for each type of nanomaterial; intact and tape stripped nanomaterial samples and controls (individually stained
- the epidermis is placed in cell dissociation buffer (40 min, 37°C), and cells are obtained by filtering (cell strainer, 100 ⁇ mesh size) and centrifuging the collected buffer solution.
- the samples are fixed (0.01% formaldehyde), permeated (ice cold methanol, -20°C) and blocked (3% BSA), after which samples are incubated with a mixture of primary antibodies for K14 (1 : 100 dilution of rabbit anti-K14) and K10 (1 : 100 dilution of mouse anti-K10) for 2 hours at room temperature.
- NProbes are incubated with QD containing samples by using a method similar to above ( ⁇ 15 ⁇ g/mL), to yield a quantitative analysis of binding of NProbes to intact QDs (GSH, DHLA and Invitrogen QDs) with the use of a fluorescent anti-flag secondary antibody in a tissue setting.
- Non-fluorescent nanomaterial association with skin cells The above method of conjugating NProbes to QDs as a model nanomaterial, and analyzing scFv binding and nanomaterial cell association profiles in ex vivo skin using flow cytometry, is extended for use with non-fluorescent nanomaterials such as T1O2 and Au nanoparticles.
- NProbes provide a way to analyze binding of these nanomaterials to suprabasal and basal cells (with K14 and K10 markers) without the need for fluorescently tagging nanomaterials. Quantitative results obtained are correlated to tissue histology studies.
- NProbes bind with high specificity to intact nanomaterials in skin, which is proved when binding is observed using flow cytometry.
- Flow cytometry results will indicate binding, if a shift in fluorescence of the secondary antibody is observed caused by nanomaterial-scFv binding, compared to the sample without scFvs (only nanomaterials). This is tested for different NProbes specific to nanomaterials whether fluorescent or non- fluorescent, to demonstrate NProbe binding and analyze nanomaterial cell association profiles for all
- NProbes as a tool to qualitatively detect nanomaterials transformed in tissues, quantitatively measure localization and amount of nanomaterials present in tissue, and study nanomaterial association profiles to understand the associated risk.
- NProbes are tested to bind nanomaterials in tissue. Further, cross- reactivity to other nanomaterials of a similar composition (for GSH QDs, with DHLA QDs and Invitrogen QDs) are tested in tissues to ensure specificity to even transformed nanomaterials.
- Potential artifacts in cryosectioning and staining techniques are optimized by using various concentrations of scFvs to obtain a good signal of AP in order to measure co-localization with nanomaterials. Any discrepancy in results obtained with the use of scFvs are solved using positive control samples containing a large amount of nanomaterials localized in a particular region, for better visualization of AP co-localization with nanomaterials, suggesting binding to NProbes.
- Other strategies include use of imaging flow cytometry (Imagestream), which allow for a visual analysis of each of the cells obtained from the skin samples, thereby aiding in better understanding nanomaterial localization and nanomaterial- NProbe binding.
- Example 3 Demonstrate utility of NProbes to aid in the detection of nanomaterial systemic translocation and localization in tissues using an in vivo mouse model.
- Nanomaterials are applied in relevant doses on the backs of SKH- 1 hairless mice and nanomaterial presence in systemic tissues such as liver, lymph nodes and kidneys is tested 24 hours post application using specific NProbes described elsewhere herein. Demonstrated herein is the detection of those
- NProbes can comprise a diagnostic tool kit to enable the detection of nanomaterials in biological systems.
- Nanomaterials for the in vivo studies include GSH QDs and T1O2 nanoparticles to demonstrate detection of both fluorescent and non-fluorescent nanomaterials.
- a commercial Eucerin Smoothing lotion vehicle is used for nanomaterial application during in vivo experiments as this allows spreading of nanomaterials evenly on the backs of mice, thereby preventing dripping off of nanomaterials.
- Ex vivo studies performed have demonstrated that Eucerin Smoothing lotion enhances nanomaterial penetration when topically applied on mouse skin.
- QDs in 0.05 g lotion
- Mice are housed individually for 24 hours with access to water and standard mouse feed, after which the nanomaterials will be wiped off the skin (TBS) prior to sacrificing them.
- TBS skin
- the tissue samples namely, skin from both barrier intact and disrupted (tape stripped) mice along with the liver, lymph nodes and kidneys are carefully harvested and submitted for elemental organ analysis (Cd for QDs, Ti for T1O2 nanoparticles) quantification using atomic absorption spectroscopy (AAS).
- AAS atomic absorption spectroscopy
- Skin and organ samples harvested 24 hours post nanomaterial application are prepared for IHC as described elsewhere herein. Briefly, samples are stored at -80°C after which they are sliced onto slides using a cryostat (Thermo Scientific) at 5 ⁇ thickness. Slides containing tissue sections are fixed (methanol, - 20°C, 10 min), washed (IX TBS) and blocked (2% BSA in TBS, 20 min). NProbes specific to GSH QDs and T1O2 nanoparticles are incubated with the tissue sections overnight at 4°C in a humidified chamber. The samples are washed (3x, IX TBST), and a secondary anti-flag antibody tagged with AP is incubated with the tissue sections for 1 hour at room temperature.
- Confocal microscopy is used to observe QD presence. Confocal microscopy provides depth information, and hence the location of QDs in all the organs, which is further strengthened by observing AP staining under brightfield setting.
- Example 4 Development and characterization of antibodies to nanoparticles for enhanced detection in biological systems
- NPs nanoparticles
- EH&S environmental health and safety
- the detection of NPs in the environment and in biological systems is challenged by limitations associated with commonly used analytical techniques.
- the results presented herein demonstrate the development and characterization of NP binding antibodies, termed NProbes.
- the methodology used generates NProbes that vary in specificity and avidity to NPs dispersed in solution that can vary in size, composition, and coating chemistry.
- NProbes comprise powerful tools that can provide information on both NP presence and their form thereby facilitating EH&S risk assessment and the ability to develop a mechanistic understanding of the fate and transport of NPs in biological systems.
- results presented herein demonstrate validation of the utility of NProbes for detecting, for example, quantum dots (QDs) and titanium dioxide (TiC ) NPs using in vitro studies and ex vivo human skin models.
- QDs quantum dots
- TiC titanium dioxide
- the results presented herein support the preponderance of existing data that TiC NPs remain primarily localized to the stratum corneum outer layer of skin but that QDs may penetrate into the viable epidermis to a greater extent than previously thought.
- ligand exchange methods were used to prepare water-soluble GSH-QDs. Briefly, ODA-QDs (300 ⁇ ) were precipitated by addition of methanokacetone (1 : 1) and separated by centrifugation at 14,000 rpm for 5 min. The ODA-QDs were resuspended in 300 ⁇ , tetrahydrofuran (THF). 30 mg GSH (Cat. number 3541, Calbiochem) was added to 1 mL methanol and adjusted to pH 1 1.0 with tetramethylammonium hydroxide pentahydrate powder.
- GSH Cat. number 3541, Calbiochem
- the ODA-QD THF solution was slowly added to the GSH-methanol solution while stirring, at room temperature in a 4 mL glass vial (VWR) immersed in a mineral oil bath (light white oil, Sigma- Aldrich Inc.) and the mixture was stirred at 60 °C for 2 h on a hotplate/stirrer (VWR).
- the GSH-QDs were then precipitated with the addition of excess ether (1-2 mL) and centrifuged at 14,000 rpm for 5 min.
- NPs were imaged using a Hitachi 7650 Transmission Electron Microscope and an attached Gatan 1 1 megapixel Erlangshen digital camera system (Electron Microscopy Core, University of Rochester Medical Centre (URMC)). Human Skin Processing and NP application
- PBS IX phosphate-buffered saline
- Invitrogen fungizone
- GSH-QDs and Ti02 NPs were applied on to skin in quantities lesser (0.01 mg/cm 2 ) than those routinely used for cosmetic testing (0.05 mg/cm 2 ) by pipetting and spreading them evenly on the epidermal side of the skin.
- Skin samples were tape stripped (Scotch 3M 3750 clear packing tape, USA) ten times prior to application of GSH-QDs. Each piece of fresh tape was pressed firmly onto the epidermal surface of the skin and removed.
- GSH-QDs were also injected (50 in 100 deionized water) using an insulin needle (skin rested with stratum corneum facing upwards) from epidermis to dermis as a positive control sample. Skin samples were placed in the sterile hood for 24 h, after which excess NPs are wiped off the skin surface using IX PBS. All the samples were stored at -80 °C until processing for histology.
- Frozen skin was mounted using TEK OCT compound, after which they were sliced (5 ⁇ thickness) on to microscope slides using a cryostat (Thermo Scientific). The epidermis and the dermis were sectioned simultaneously to prevent accidental transfer of NPs to the blade.
- the slides were fixed in methanol (-20 °C, 10 min) prior to the experiment and dipped in water (UltrapureTM water, Invitrogen) to remove excess OCT.
- the slides were washed twice with IX TBS to wash off excess methanol and a hydrophobic pen was used to create a water-repellent barrier to keep reagents localized on the tissue specimen.
- the slides were blocked with normal mouse serum for 30 min at room temperature, after which GSH43-scFvs were added to the slides diluted in BSA (10 ⁇ g/mL) and allowed to incubate overnight at 4 °C in a humidified chamber.
- the slides were washed thrice with IX TBST and incubated with anti-FLAG antibody conjugated to alkaline phosphate (AP) (Sigma-Aldrich Inc.) for 1 hr at room temperature. After washing away excess antibodies, the slides were incubated with BCIP/NBT (KPL) substrate for AP containing 5 mM levamisole (Vector laboratories Inc., CA) for 30 min at room temperature.
- AP alkaline phosphate
- Levamisole is an endogenous AP inhibitor that enables visualization of AP staining due to the binding of scFv-anti-FLAG AP -tagged antibody alone.
- Excess substrate solution was washed away with DI water and mowiol (Fluka, #81381, Sigma Aldrich Inc., synthesized in- house) was used as a mounting medium for imaging.
- the samples were analyzed under a fluorescent microscope (Nikon Eclipse E800 with a Spot RTS Camera) at 40x magnification. Images were captured using brightfield and appropriate fluorescence filters, and analyzed using ImageJ (NIH).
- Phage stocks (GSH43(p and ⁇ 49 ⁇ ) of each clone were prepared by infection with VCSM13 helper phage and incubated for 2 h at 37 °C to the mid-log grown colonies, after which it was added to 2 mL LB/Amp/Kan at 30 °C and allowed overnight with good agitation. The culture was centrifuged for 5 min, and phages were precipitated by addition of polyethlyene glycol (PEG) 6000 and NaCl to final concentrations of 4 % and 0.5 M, respectively.
- PEG polyethlyene glycol
- This method involves picking randomly chosen single colonies ( ⁇ 12- 20) from the titer plates after round 4 into a PCR master mix with primers designed to amplify the scFv insert.
- the primers used were ompA
- CDRs complementarity determining regions
- phage stocks were mixed (1 :5 dilution in TBS) with NPs for 2 hr at room temperature for both testing binding to NPs the clones were isolated against and other NPs such as citrated Au NPs (753610, Sigma Aldrich Inc.), CNTs (MWSusp-100, NanoLab, Inc.) and Au powder (326585, Sigma Aldrich Inc.).
- NPs citrated Au NPs
- CNTs MMSusp-100, NanoLab, Inc.
- Au powder 326585, Sigma Aldrich Inc.
- the plates were washed 5 times with TBS and 5 times with TBST, and anti-M13 HRP antibody (GE Healthcare) was added diluted in TBS (0.5 ⁇ g/mL) and incubated for 1 h at room temperature. Following thorough washing, the plate was incubated with Sure BlueTM TMB substrate (KPL) and the absorbance was measured at 450 nm after stopping the reaction with 1 N HC1.
- anti-M13 HRP antibody GE Healthcare
- scFv protein Preparation of the scFv protein from positive binders and negative controls was performed by removing the gene III fragment by digestion of the plasmid with Sail and Xhol, followed by re-ligation of the compatible ends. This manipulation also appends a hexa-histidine tag to the carboxy terminus of the scFv to permit affinity purification of the protein on an immobilized 2+ resin.
- the scFvs also contain a FLAG epitope (DYKDDDDKL) at the amino terminus of the light chain domain to enable secondary detection. After removal of the Ml 3 gene III fragment, scFvs were prepared by growth of the cultures in medium with limiting inorganic phosphate.
- the cell pellets were lysed with BugBusterTM (Novagen) and the His-tagged scFvs were purified on Ni+2 magnetic beads using a Thermo KingFisher instrument to automate bead washing.
- the scFvs were eluted from the washed beads using PBS containing 250 mM imidazole, dialyzed against PBS and stored at 4°C.
- the membrane was washed 3 times with wash buffer for 5 min each, and anti-FLAG HRP (Sigma Aldrich Inc.) antibody was added to the membrane at a 0.5 ⁇ g/mL concentration for 1 h at room temperature.
- the membrane was incubated in an ECL substrate solution for HRP (Reagent A+B, Thermo Scientific) for 5 min and developed using an x-ray film (Phenix).
- GSH43 and negative control (BiP)-scFvs were incubated with GSH- QDs (50 nM) for 2 h at room temperature with gentle agitation, after which the solution was centrifuged at 55,000 rpm for 10 min and the pellet re-suspended in TBS. Samples were analyzed using a Malvern Zetasizer NanoZS (Malvern
- Cd concentration analysis was performed using a Perkin-Elmer PinAAcle 900Z atomic absorption spectrophotometer equipped with longitudinal Zeeman background correction and a transverse heated graphite furnace (Perkin-Elmer Life and Analytical Sciences, Shelton, CT 06484 USA). Cd absorption was measured at 228.8 nm using an electrodeless discharge lamp source.
- a mixed matrix modifier of ammonium phosphate and magnesium nitrate was used to stabilize Cd during the pyrolysis furnace step. Samples were prepared by addition of ammonium phosphate and magnesium nitrate was used to stabilize Cd during the pyrolysis furnace step.
- NProbes were selected from a phage library comprising of ⁇
- Glutathione-coated (GSH) QDs CdSe/ZnS core/shell
- T1O2 NPs Degussa, 80 % anatase and 20 % rutile crystal, ⁇ 21 nm particle size
- the hydrodynamic diameter of the GSH-QDs in water was found to be 14.15 ⁇ 2.5 nm through dynamic light scattering (DLS) measurements and they were negatively charged (-22.82 mV) as determined from zeta potential measurements (pH -5.3-5.6).
- DLS dynamic light scattering
- Ti02 NPs dispersed in water formed aggregates that ranged from -100 nm to -1.5 ⁇ when visualized under TEM.
- NProbes to GSH-QDs and T1O2 NPs were isolated using affinity -based bio-panning which involves mixing the target NPs with the phage library in tris-buffered saline (TBS)+0.5 % casein with gentle agitation. After incubation for 2 hrs at room temperature, the mixture was centrifuged at 55,000 rpm for 10 min (Optima TLX ultracentrifuge, Beckman Coulter) for GSH-QD panning or 1300 g for 5 min for T1O2 NP panning, followed by re-suspension of pellet in TBS containing 0.05 % Tween-20 (TBST).
- TBS tris-buffered saline
- Phage stocks were prepared for the next round of panning by polyethylene glycol (PEG) precipitation.
- PEG polyethylene glycol
- 4 rounds of panning are necessary to enrich for specific binders to NPs, after which a BstNI fingerprinting analysis was performed.
- the presence of identical restriction enzyme patterns among the tested clones was taken as evidence of specific enrichment has been previously shown (Haidaris et al, J Immunol Methods 257, 185-202 (2001)).
- a BsfNI digest of 12 randomly selected clones found pattern repeats indicating 17-25 % clonal abundance (Figure 30).
- Phage clones from the enriched populations termed GSH43(p and ⁇ 49 ⁇ , were selected for further testing.
- the amino acid sequences of the scFvs for the two phage clones are given in ( Figure 39).
- Phage clones GSH43(p and ⁇ 49 ⁇ and their respective purified scFv antibodies were freshly prepared and used for in vitro verification of target binding and cross reactivity testing to citrated gold (Au) NPs, Au NPs in a powdered form and carbon nanotubes (CNTs) discussed elsewhere herein.
- the GSH43-scFvs showed high specific binding to the GSH- QDs indicated by the dark spot formed ( Figure 25A).
- GSH43-scFv did not bind Au NPs (pink spot, center) or CNTs (black spot, right).
- the arbitrary clone (BiP-scFv) did not bind any of the NPs ( Figure 25B).
- the Ti49-scFv did not bind Au NPs and CNTs and in contrast to the phage format, the Ti49-scFv did not bind GSH- QDs ( Figure 25C).
- T1O2 NPs Binding of the Ti49-scFv to T1O2 NPs could not be tested by dot-blot analysis as the presence of the NPs on the nitrocellulose membrane could not be verified.
- the T1O2 NPs were dried onto a glass slide and confocal microscopy was used to quantify the presence of fluorescein isothiocyanate (FITC)-conjugated anti-FLAG reporter. Images ( Figure 26) were captured under brightfield and fluorescence. A control slide without T1O2 NPs showed no background staining ( Figure 34). ImageJ (NIH) was used for analysis of line profiles of three regions of interest (ROIs) and the results averaged.
- FITC fluorescein isothiocyanate
- NProbe reagents The main motivation for developing NProbe reagents is to facilitate and amplify the detection of NPs in biological systems in their particulate form.
- Existing studies of NP skin penetration have highlighted the need to consider the detection limits of the analytical techniques used as well as the assay protocol in drawing definitive conclusions about the NP skin penetration (Monteiro-Riviere et al, Toxicol Sci 123, 264-280 (201 1); Mortensen et al, J Biomed Nanotechnol 6, 596-604 (2010)).
- NProbe binding reagents to T1O2 NPs and GSH-QDs using in vitro assays, it was sought to then test their ability to detect NPs surrounded by a protein corona (Nel et al, Nat Mater 8, 543-557 (2009)) in the biological milieu.
- GSH-QDs were immobilized on a glass slide coated with collagen, which is a main component of skin, GSH43-scFvs binding was examined relative to a negative control (NPep-scFv) using confocal microscopy.
- the Cd level measured from six random ROI collected and combined from the control sample (no QD) was 0.0085 ng/mL, which was below the instrument LOQ.
- AAS analysis measured 0.018 ng/mL Cd, and while this value is below the instrument LOQ it is an order of magnitude higher than the Cd measured on the control (no QDs).
- NProbes can amplify and enable the detection of QDs (strong AP staining in brightfield) present at levels below the limit of detection of highly sensitive techniques such as AAS.
- GSH43-scFV only bound DTT-QDs apart from GSH-QDs ( Figure 41, right).
- the negative phage clone Npep ⁇ does not bind GSH-QDs immobilized on BSA in a phage ELISA assay
- the scFv format binds QDs (GSH-QDs and DTT-QDs) as analyzed using a dot blot assay.
- Ti6 also referred to herein as "C6”
- Til 5 also referred to herein as "CI 5”
- Ti6 does not exhibit cross-reactivity to Au NPs similar in morphology to the TiC NPs, whereas Til 5 clone does to a certain extent ( ⁇ 40-fold).
- scFv NProbe binding reagents for detection of intact NPs, namely GSH-QDs and TiCh in biological systems was developed. This work is unique in the approach to bio-panning on NPs in solution.
- phage display requires the target to be immobilized onto a solid support by chemical coupling (Bass et al, Proteins 8, 309-314 (1990)) or non- covalent adsorption to a hydrophobic surface (Smith et al, Science 228, 1315-1317 (1985)).
- phage binding to components other than the target such as the solid phase (plastic, plates), substances used for blocking (bovine serum albumin (BSA), milk) and capturing agents may predominate during rounds of bio-panning (Vodnik et al, Molecules 16, 790-817 (2011)).
- BSA bovine serum albumin
- the present panning approach helps to minimize occurrences of false positives and favors identification of clones recognizing the NPs dispersed in solution.
- Figure 40 compares results obtained from panning upon NP immobilization (left) versus panning on dispersed NP, where panning on dispersed NP identified 1 binder, GSH43, and 3 binders (GHS2, GSH3, and GSH4) using 1M MgCk 6H2O to induce QD precipitation.
- NProbes antibodies are particularly advantageous for detecting non- fluorescent NPs using cost-effective and common imaging techniques.
- the data presented herein for non-fluorescent T1O2 detection is consistent with current literature on T1O2 NP skin penetration, where they have been reported to
- NProbes allows the conclusion that these occurrences result from the presence of intact NP, thus providing an advantage over elemental analysis techniques that cannot distinguish between particles and soluble ions.
- Experiments can be designed to engineer higher affinity NProbes with lower cross reactivity through mutagenesis studies of the GSH43 and Ti49-scFvs as well as to screen additional protein phage libraries. Factors that appear to limit phage enrichments to only 10 or 100-fold despite conducting 4 rounds of panning can be evaluated. It is believed that this may arise from shape complementarity binding in the phage format that is enhanced by the large (25 kD) scFv fusion protein. Enrichment maybe hindered by affinity recognition of transient morphologic features that result from NP agglomeration during the bio-panning process.
- Enrichment may also be hindered by the centrifugation process used to separate NP bound phage which can cause inadvertent pelleting of non-bound phage. This likely limited the enrichment to 10-fold when panning on GSH-QDs which required ultracentrifugation for pelleting.
- the lower centrifugation force needed to pellet the T1O2 NPs may explain the 100- fold enrichment observed over the negative control phage (IL-12(p).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Inorganic Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides compositions and methods for detecting the presence, location, or abundance of a nanomaterial. In certain embodiments, the composition of the invention is identified using a screening method utilizing phage display of a library of test compounds.
Description
TITLE OF THE INVENTION
Composition and Method for Detection of Nanomaterials
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application
No. 61/866,716 filed August 16, 2013, the contents of which are incorporated by reference herein in their entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with government support under CDC R21OH009970, awarded by the National Institutes of Health (NIH). The government has certain rights in the invention. BACKGROUND OF THE INVENTION
Nanoparticle or nanomaterial-containing commercial products are estimated to contribute $1 trillion to the global economy by 2015 (Roco, 2006, Scientific American Magazine, July 24). Their increasing presence in consumer goods such as bicycle frames, sporting goods (Endo et al, 2004, Philos Trans A Math Phys Eng Sci 362(1823):2223-2238), and cosmetics (Robichaud et al, 2009, Environ Sci Technol 43(12):4227-4233) has raised serious concerns for environmental health and safety (EH&S).
The unique physiochemical properties (high surface area to volume ratio and size) of nanomaterials, not present in the bulk form (Misra et al., 2008, Biomaterials 29(12): 1750-1761), which are exploited in many technological applications, might be altered in biological tissues (Elder et al, 2009, Wiley
Interdiscip Rev Nanomed Nanobiotechnol l(4):434-450; Oberd5rster, 2010, J Intern Med 267(1):89-105) and may lead to potential toxicity (Jin et al, 2008, Chem Res Toxicol 21(9): 1871-1877; AshaRani et al. 2009, ACS Nano 3(2):279-290). Quantum dots (QDs) are semiconductor fluorescent nanomaterials, which have a commercial value of ~$721 million (Quantum Dots: Technical Status and Market Prospects, 2008, BCC Research), and have been widely used as a model nanomaterial by researchers to study nanomaterial-skin penetration mechanisms along with nanomaterials such as T1O2, ZnO, Au, and carbon nanotubes among others. Although a considerable body of
literature studying nanomaterial-skin interaction exists, results show varying trends largely dependent upon nanomaterial types and sizes (Alvarez-Roman et al., 2004, J Control Release 99(l):53-62; Wu et al, 2009, Toxicol Lett 191(1): 1-8), animal models used (Gopee et al, 2009, Toxicol Sci 11 l(l):37-48; Zhang and Monteiro- Riviere, 2008, Skin Pharmacol Appl 21 :166-180; Jeong et al, 2010, Biochem
Biophys Res Commun 394(3):612-615), whether skin barrier was intact or disrupted (Ravichandran et al, 2011, Nanotoxicology 5(4):675-865), and the nanomaterial detection techniques employed (Elder et al, 2009, Wiley Interdiscip Rev Nanomed Nanobiotechnol l(4):434-450; Alvarez-Roman et al, 2004, J Control Release 99(l):53-62; Mortensen et al, 2008, Nano Lett 8(9):2779-2787). Taken together, skin is a supreme barrier for nanomaterial entry, but reports do suggest nanomaterial accumulation in hair follicles, and enhanced penetration especially when the barrier is impaired using ultraviolet radiation (Mortensen et al, 2008, Nano Lett 8(9):2779- 2787; Jeong et al, 2010, Biochem Biophys Res Commun 394(3):612-615) or dermabrasion (Zhang and Monteiro-Riviere, 2008, Skin Pharmacol Appl 21 : 166-180) in skin, and varies from almost no presence (Zhang and Monteiro-Riviere, 2008, Skin Pharmacol Appl 21: 166-180; Zhang et al., 2008, Toxicol Appl Pharmacol 228(2):200- 211) to some detectable beneath the stratum corneum (SC) (Jeong et al, 2010, Biochem Biophys Res Commun 394(3):612-615; Ravichandran et al, 2011,
Nanotoxicology 5(4):675-865) when tape stripping was used. Elemental organ analysis employed in quantitative in vivo studies showed systemic levels to be <0.001% of the applied dose (Mortensen et al, 2013, Nanotoxicology, doi:
10.3109/17435390.2012.741726; Gulson et al, 2010, Toxicol Sci 118(1): 140-149). However, the key limitation with this technique is the inability to distinguish between intact nanomaterial and soluble ion skin penetration (DeLouise, 2012, J Invest Dermatol 132(3 Pt 2):964-975).
A key concern persisting amongst the vast body of literature addressing nanomaterial skin penetration is the possibility of occurrences of isolated undetectable nanomaterials in biological systems. This hampers the ability to accurately determine nanomaterial location and translocation fate in tissues. Currently used tape stripping (Lindemann, 2003, J Biomed Opt 8(4):601-607; Lademann et al, 2009, Eur J Pharm Biopharm 72(2):317-23) combined with elemental analysis, although a popular method, does not give mechanistic information at the cellular level (Lademann et al, 2009, Eur J Pharm Biopharm 72(2):317-23), as presence of trace
metal ions (example, Zn) can interfere with detection of TiC /ZnO nanomaterials (Monteiro-Riviere et al, 201 1, Toxicol Sci 123(l):264-280; Gulson et al, 2010, Toxicol Sci 118(1): 140-149), which are a major constituent of sunscreens. The same study (Monteiro-Riviere et al., 2011, Toxicol Sci 123(l):264-280) showed that using highly sensitive techniques such as TOF-SIMS, was able to detect trace levels of TiC nanomaterials in skin that were not seen using standard histology. Other routinely used techniques such as confocal and fluorescence microscopy allow for background noise reduction, however, pose substantial challenges with tissue autofluorescence can limit the ability of fluorescent nanomaterials to be conclusively separated from the surrounding tissue (Mortensen et al, 2010, J Biomed Nanotechnol 6(5):596-604). Transmission electron microscopy (TEM) allows for ultrastructural resolution and detailed analysis of nanomaterial localization in sub-cellular regions however, has its limitations in terms of difficulty in quantification due to small sampling area of tissue sections (-70-100 nm), time and cost of processing. While TEM coupled with energy dispersive x-ray analysis can detect nanomaterials in TEM sections using an enhancement strategy - such as colloidal silver deposits on QDs (Mortensen et al, 2008, Nano Lett 8(9):2779-2787) conflicting results may be observed when histological sections are examined using fluorescence microscopy (Mortensen et al, 2010, J Biomed Nanotechnol 6(5):596-604). This discrepancy makes nanomaterial detection challenging and results from the different studies unreliable (Ravichandran et al, 201 1, Nanotoxicology 5(4):675-865; Zhang and Monteiro-Riviere, 2008, Skin Pharmacol Appl 21 : 166-180). To combat this inconsistency in data, minimize incorrect understanding of nanomaterial-tissue interaction, gain a full understanding of all factors involving nanomaterial skin penetration, and quantify levels of various types of nanomaterials in the model systems employed, a more efficient analytical technique for detecting nanomaterials is necessary. The gap in knowledge in the above mentioned studies calls for the availability of more sensitive analytical techniques and assays for detection of nanomaterials penetrating skin, and to better understand the factors and mechanisms involved in the process. Further, it is important to note that while skin represents a major source of entry of nanomaterials, nanomaterials may also enter the body through other barriers, including epithelial barriers, mucosal linings, respiratory tract, gastrointestinal tract, and the like (Elder et al, 2009, Wiley Interdiscip Rev Nanomed Nanobiotechnol, 1(4): 434-450).
Thus, there is a need in the art for improved compositions and methods to detect nanomaterials. The present invention satisfies this unmet need.
SUMMARY OF THE INVENTION
The invention provides a composition comprising a binding domain that binds to a nanomaterial.
In one embodiment, the nanomaterial is selected from the group consisting of dispersed, aggregated, and agglomerated nanomaterial.
In one embodiment, the nanomaterial is a non-immunogenic nanoparticle.
In one embodiment, the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
In one embodiment, the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-7.
In one embodiment, the composition comprises a bacteriophage which displays the binding domain on its surface.
In one embodiment, the binding domain comprises a peptide which binds to the nanomaterial.
In one embodiment, the peptide is an antibody, or fragment thereof.
In one embodiment, the binding domain comprises a single chain variable fragment (scFv) which binds to the nanomaterial.
In one embodiment, the binding domain comprises a peptide derived from a fibronectin library.
In one embodiment, the composition comprises a tag domain.
In one embodiment, the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme
In one embodiment, the binding domain is identified from phage display.
In one embodiment, the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NOs: 8-11.
The invention also provides a composition comprising a binding domain that binds to a quantum dot.
In one embodiment, the quantum dot is selected from the group consisting of dispersed, aggregated, and agglomerated quantum dot.
In one embodiment, the quantum dot is a non-immunogenic quantum dot.
In one embodiment, the quantum dot is coated with glutathione (GSH).
In one embodiment, the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-4.
In one embodiment, the composition comprises a bacteriophage which displays the binding domain on its surface.
In one embodiment, the binding domain comprises a peptide which binds to the quantum dot.
In one embodiment, the peptide is an antibody, or fragment thereof. In one embodiment, the binding domain comprises a single chain variable fragment (scFv) which binds to the quantum dot.
In one embodiment, the binding domain comprises a peptide derived from a fibronectin library.
In one embodiment, the composition comprises a tag domain.
In one embodiment, the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme.
In one embodiment, the binding domain is identified from phage display.
In one embodiment, the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 10.
The invention also provides a method of identifying a composition that binds to a nanomaterial in a biological tissue comprising the steps of: providing a library of test compounds; forming a phage library comprising one or more phage, wherein each phage expresses a test compound on its surface; providing a
nanomaterial solution comprising a nanomaterial; incubating the phage library with the nanomaterial solution to form a nanomaterial-phage solution, thereby producing a population of bound phage that binds to the nanomaterial and a population of unbound phage that does not bind to the nanomaterial; and separating the population of bound phage from the population of unbound phage, wherein the test compound
expressed on the surface of the population of bound phage is identified as a composition that binds to the nanomaterial.
In one embodiment, the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
In one embodiment, the library of test compounds comprises a library of peptides.
In one embodiment, the library of test compounds comprises a library of antibodies, or fragments thereof.
In one embodiment, the library of test compounds comprises a library of single chain variable fragments (scFvs).
In one embodiment, the library of test compounds comprises a library of peptides derived from fibronectin.
In one embodiment, the method further comprises enriching the population of bound phage.
In one embodiment, the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution.
In one embodiment, the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution in the presence of a salt.
In one embodiment, the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial - phage solution in the presence of polyethylene glycol (PEG).
In one embodiment, the method further comprises incubating the population of bound phage with a second nanomaterial solution to form a second population of bound phage and a second population of unbound phage.
In one embodiment, the identified composition is assayed for its binding strength.
In one embodiment, identified composition is assayed for its specificity.
The invention also provides a method of detecting the presence of a nanomaterial in a sample comprising administering a composition that binds to the nanomaterial to the sample.
In one embodiment, the sample is a tissue sample obtained from a subject.
In one embodiment, the subject is selected from the group consisting of a mouse, a rat, a hamster, a guinea pig, a cat, a dog, a monkey, a cow, a fish, a bird, a reptile, an amphibian, a horse, and a human.
In one embodiment, the tissue sample comprises skin.
In one embodiment, the composition comprises a tag domain, and wherein the method comprises detecting the tag domain of the composition.
In one embodiment, the composition comprises a tag domain, and wherein the method comprises administering to the sample a compound that binds to the tag domain.
In one embodiment, the sample is an ecological sample.
In one embodiment, the sample is selected from the group consisting of soil, water, plant, fungi, and algae.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and
instrumentalities of the embodiments shown in the drawings.
Figure 1 is a diagram depicting an antibody (left) and scFv (right) showing VH, VL, linker and flag tag (yellow). Not drawn to scale.
Figure 2 depicts the results of experiments showing BsTN-1 digest patterns after Pan 4. GSH QD binder C43 repeats (left, red boxes), T1O2 binder C49 repeats (right, red boxes).
Figure 3 depicts the results of experiments using Dot blots, which show binding of C43 to GSH QDs (top- left), while random scFv NT3 does not bind. C43, C2, C3, C4 bind only GSH QDs and not DHLA, Invitrogen or Au nanomaterials (bottom- right and bottom- left), whereas random scFv NT3 does not bind any nanomaterial top- right).
Figure 4 depicts the results of experiments which show that random control phages (against lactoferrin-A) do not bind GSH QDs (left), whereas C2 phages bind GSH QDs (arrow, right).
Figure 5 are a set of TEM images showing random phage (against IL- 12) not binding TiC nanomaterial (left) and C49 phages (arrows) binding the nanomaterials (right). Scale bar 100 μιη.
Figure 6 depicts the results of experiments demonstrating the binding of GSH QDs to scFvs passively coated on a 96-well ELISA plate, (top) GSH QDs bind C43 scFv but not random clone (BiP) or wells coated with no scFvs. Scale bar 200 μιη. (bottom) Values normalized to random scFv (control) binding. Error bars represent SEM, n=3. * represents statistical significance when tested using Student's one-tailed t-test with BiP, p<0.05.
Figure 7 depicts the results of experiments demonstrating an increase in hydrodynamic diameter upon scFv binding GSH QDs. GSH QD in TBS and a random scFv (BiP) were used as controls. Error bars represent SEM. Statistics were done using Student's t-test (n=3-4 experiments per sample).
Figure 8 is a set of images depicting tissue sections stained with C2 scFv specific to GSH QDs. Control (no QD, top-left) shows no AP staining, whereas QDs applied on epidermis (top-right) shows AP staining. Fluorescence image (bottom-left) shows presence of QDs and a merged image where brightness/contrast of brightfield image was enhanced shows co-localization of NProbes with QDs (bottom-right).
Figure 9 depicts the results of experiments where control (no TiC , left) shows no AP staining, and TiC treated skin (nanomaterials in water, center) and skin treated with sunscreen (Eucerin-SPF 15) (right) shows AP staining in SC and epidermis (red arrows). Scale bar 100 μιη.
Figure 10 depicts the results of IHC experiments to test C2 scFv binding GSH QDs. Representative thresholded image showing AP staining (top left), and corresponding fluorescence image showing GSH QDs (top right); merged composite image showing white regions of co-localization (yellow arrows) of AP (green) and QDs (red) (bottom right); scatter plot showing co-localization region as yellow (white box).
Figure 11 depicts flow cytometry data showing significant increase (2- fold) in percentage of basal cells associated with QDs (p<0.05, one-tailed), in tape stripped skin than intact skin, n=3-5 experiments with skin from different donors.
Figure 12 is a graph where Tang et al. (2013, Sci China Life Sci 56(2): 181-188), showed presence of background levels of Cd in an in vivo mouse model (grey bars for control), thus rendering data obtained from ICP-MS
questionable.
Figure 13, comprising Figure 13A through Figure 13D, depicts the results of experiments demonstrating a titer of phage bound to GSH QD showing more than 100-fold binding (Figure 13B-Figure 13D), compared to a titer of random single clone phage (Figure 13 A).
Figure 14 depicts the results of experiments wherein dot blots show the detection of stock concentration of GSH QDs (left) and 50nm of GSH QDs (right) using NProbe (clone 43) and a secondary enzyme-based antibody detection system (anti-flag antibody tagged to horseradish peroxidase).
Figure 15 depicts TEM images of GSH QDs binding to C3 (top) and C4 (bottom) phages.
Figure 16 depicts the results of experiments where FLISA assay values measured in a plate reader show scFvs binding with QDs varying in concentration where binding increases with increased QD concentration for C43 and C2 clones (green and purple markers), and "no scFv" and random scFv controls (Bip) show baseline binding (blue and red markers). Error bars represent SEM for n= 3-4 experiments.
Figure 17 depicts the results of experiments where DLS data shows size measurements for GSH QDs with and without scFvs. Image on the left shows increase in size implying binding to GSH QDs with C43 scFV clone (green curve) compared to "no scFv" (red) and random scFv (blue) controls. Image on the right shows binding of GSH QDs to C2, C3, and C4 scFvs (light blue, pink, and dark blue curves) compared to no scFv (red) and random scFv (green) controls.
Figure 18 depicts the results of experiments showing a titer of phage specific for GSH QD binding DLHA QD ~10-fold (right) more than a random single clone (left).
Figure 19 depicts a typical histogram data from flow cytometry (Flow Jo 7.5) showing a shift in DQ fluorescence in a tape stripped sample with QDs compared to a sample without QDs.
Figure 20 is a diagram depicting cyrosectioning direction (red arrow) to section both Dermis (D) and Epidermis (E) simultaneously, thereby preventing accidental transfer of QDs to the blade.
Figure 21 is a set of images, where the image on the left shows insufficient endogenous AP inhibition by ImM levamisole (red circles) and image on the right shows no endogenous AP presence using 5mM levamisole as inhibitor.
Figure 22 is set of images demonstrating that the scFv clone isolated against TiC (C49) (right) bound 100-fold more than arbitrary clone against IL-12 (left).
Figure 23 is a set of images depicting the results of experiments.
Control (no GSH QD, top-left) skin showing no AP staining, and GSH QD treated skin (NPs in water, top-center) showing C43 binding GSH QD via AP staining. QD presence in intact human skin (top-right). Co-localization of C43 (green) and GSH QDs (red) analyzed using 'co-localization finder' plugin in Image J (NIH) (bottom- left, white regions depicted by yellow circles). Images were obtained at 40x magnification. Scale bar 100 μιη.
Figure 24, comprising Figures 24A through 24D, is a series of TEM images showing (Figure 24A) Τί49φ (black arrows) binding Ti02 NPs and (Figure 24B) no binding of negative control (ϋ-12φ) to Ti02 NPs. Scale bar=200 nm.
(Figure 24C) GSH43<I> (black arrows) bind GSH-QDs (red arrows) and (Figure 24D) negative control (LF(j)) does not bind GSH-QDs. Scale bar=50 nm.
Figure 25, comprising Figures 25A through 25C, is a series of dot blots onto a nitrocellulose membrane (left column) showing GSHQDs (orange), Au NPs (pink) and CNTs (black) spots. Chemiluminescence detection of scFv binding with HRP (right column). Results show that (Figure 25A) GSH43-scFv binds GSH-QDs but not Au NPs and CNTs, (Figure 25B) negative control BiP-scFv and (Figure 25C) Ti49-scFv do not bind any of the NPs.
Figure 26, comprising Figures 26A and 26B, is a series of imaged showing brightfield and confocal images investigating the binding of Ti49-scFvs to Ti02 NPs immobilized on a glass slide using FITC-conjugated anti-FLAG secondary antibody detection. (Figure 26A) Representative images of negative control Npep-
scFv showing minimal binding to Ti02 NPs (row i), whereas Ti49-scFvs shows strong binding to Ti02 NPs (row ii). Scale bar=20 μιη. (Figure 26B) Quantitative analysis of the integrated fluorescence intensity shows significant difference in the Ti49-scFv treated sample compared to negative control Npep-scFv. Data shown is average of three ROIs from the images. Error bars indicate SEM. **p=0.0075 using student's unpaired t-test.
Figure 27, comprising Figures 27A through 27D, is a series of images showing QD detection in ex vivo human skin using GSH43-scFv. (Figure 27A) Control skin sample without GSH-QD exposure showing an absence of AP staining indicating a lack of GSH43-scFv non-specific binding to skin. (Figure 27B)
Brightfield image of skin sample exposed to GSH-QDs for 24 h showing numerous areas with strong AP staining (black, blue, and red arrows). Inset shows an area of high AP staining (blue arrow) in the epidermis that correlates with high QD presence as seen under (Figure 27C) fluorescence imaging, exposure 1.642 s. (Figure 27D) Applying a threshold to enhance the fluorescent signal shows that some of the areas with strong AP staining (black arrows) co-localize with QD fluorescence, whereas other areas (red arrows) indicate potential presence of QDs that are not visible under the fluorescence exposure conditions used. This suggests the ability of GSH43-scFv to detect the presence of QDs that may otherwise being undetectable in skin. This was confirmed with LCM studies. Scale bar=50 μιη.
Figure 28, comprising Figures 28A through 28D, is a series of LCM imaging microscopy to confirm presence of GSH-QDs in areas of high AP staining. Representative skin sample containing QDs injected showing (Figure 28A) dark bluish-purple staining indicating binding of GSH43-scFvs detected by AP. (Figure 28B) Portions of stained areas were marked for cut and captured onto adhesive tube caps using LCM, and processed for AAS. (Figure 28C) The portion of skin remaining after capture. (Figure 28D) Fluorescence image of skin sample before dissection showing QD presence. Scale bar=50 μιη.
Figure 29, comprising Figures 28A and 28B, is a series of images showing detection of Ti02 using Ti49-scFv in human skin ex vivo. Representative images of (Figure 29A) Ti02 applied on epidermis of intact skin, red arrows indicates AP staining due to binding of Ti49-scFv to Ti02 NPs. Blue arrows indicate AP staining, which could potentially be Ti02 particles penetrated through skin to the
dermis. (Figure 29B) Control sample with no Ti02 applied and upon exposure to Ti49-scFvs, no non-specific binding (no AP staining) was observed. Scale bar=50 μιη.
Figure 30, comprising Figures 30A and 30B, is a series of images showing pattern repeats of scFvs generated by panning on (Figure 30A) GSH-QDs and (Figure 30B) Ti02 NPs following a BsfNI digest after Round 4 of panning (red and white boxes).
Figure 31, comprising Figures 31A through 3 ID, is a series of images showing phage titer indicative of binding (Figure 31 A) Phage titer colonies showing ~10-fold more enrichment of GSH43(j> compared to negative control Ιί-12φ on GSH- QDs. (Figure 3 lB(i)) ~100-fold more enrichment of Τί49φ compared to Ιί-12φ on Ti02 NPs (Figure 3 lC(i)) GSH43<I> not binding Au NPs and (Figure 3 lC(ii)) CNTs. (Figure 3 lD(i)) Τί49φ not binding Au NPs, ( Figure 3 lD(ii)) CNTs, and (Figure 3 lD(iii)) Au powder (left). Red arrows indicate colonies not visible clearly .
Figure 32 is an image showing phage titer of Ti49 on GSH-QDs as target. IL-12 negative clone does not bind GSH-QDs (left), whereas Ti49 clone does (right).
Figure 33 is a chart indicating that hydrodynamic diameter measurements using Malvern Zetasizer. GSH43-scfv-QD conjugate shows a significant increase in hydrodynamic diameter compared to BiP-associated QDs (p<0.05) and QDs in TBS (p<0.01) using a one-way ANOVA test, whereas BiP- associated complexes do not show any significance (n.s.) compared to QDs in TBS. Error bars indicate SEM of 4 independent experiments.
Figure 34, comprising Figures 34A and 34B, is a series of images of: (Figure 34A) slides showing Ti02 in water dried indicated by the black arrow
(bottom) whereas control shows no white spot (top). (Figure 34B) Confocal images of slide without Ti02 NPs incubated with Ti49-scFvs followed by detection with Alexa Fluor 647-(pseudo-color green) conjugated anti-FLAG antibody. No non-specific staining was observed. Scale bar=20 μιη.
Figure 35, comprising Figures 35A through 35C is a series of images showing representative confocal single slice images to show GSH43-scFvs binding to QDs. (Figure 35A) GSH-QDs coated on a slide as seen under a UV lamp (white arrow). (Figure 35B) GSH43-scFvs binds GSH-QDs as detected by FITC-conjugated anti-FLAG antibody. Merge image shows co-localization proving binding of scFvs to QDs, whereas negative control (Npep) shows absence of FITC-conjugated anti-FLAG
fluorescence and hence no binding. Scale bar=20 μηι. (Figure 35C) Co-localization plot obtained for 'Merge' image of GSH43-scFv. Pearson's co-localization coefficient was found to be 0.65.
Figure 36, comprising Figures 36A through 36D, is a series of images showing LCM imaging of control 'no QD' sample of ex vivo human skin.
Representative control sample showing (Figure 36A) no AP staining indicating lack of binding of GSH43-scFvs to GSH-QDs. (Figure 36B) Portions of tissue sections were marked for cut and captured onto adhesive tube caps using LCM, and processed for AAS. (Figure 36C) The portion of skin remaining after capture is shown. (Figure 36D) Complete absence of GSH-QDs (no fluorescence). Scale bar=50 μιη.
Figure 37, comprising Figures 37A through 37C, is a series of representative images to prove binding of GSH43-scFvs to GSH-QDs applied on epidermis using LCM and AAS. (Figure 37A) Control skin specimen not treated with QDs showing no AP staining in brightfield (top-left) and no fluorescence (bottom- right). Upon using LCM to cut and capture (top-right, bottom-left) portions of skin for AAS analysis, Cd levels (0.0085 ng/mL) were found to be <LOQ (0.025 ng/mL). (Figure 37B) GSH-QDs applied on epidermis shows binding to GSH43-scFvs detected by AP (top-left). A portion with visible staining and fluorescence (bottom- right) was marked for cut (top-right) and captured (bottom-left) for AAS analysis. Cd levels were found to be 0.108 ng/mL proving presence of QDs. (Figure 37C) Areas where AP staining was visible (top-left) but not fluorescence (white arrow, bottom- right), however when samples was marked for cut (top-right) and captured (bottom- left) using LCM, and analyzed using AAS, Cd levels were found to be 0.018 ng/mL which was greater than control. Scale bar=50 μιη.
Figure 38, comprising Figures 38A and 38B, is a series of images showing: (Figure 38A) QDs immobilized on a BSA-coated plated as visible under a UV-lamp whereas wells with no QDs do not fluoresce. (Figure 38B) Phage ELISA assay of GSH43(j> and negative control (Νρερφ) on QDs immobilized on BSA-coated plates. With an increasing concentration of phage, significantly more binding (*p<0.05) of GSH43<I> to GSH-QDs occurs when detected using TMB substrate at 450 nm, compared to negative control Νρερφ and GSH43(j> interacting with wells containing BSA alone (no QDs). Values are average of three independent experiments and error bars represent SEM. Statistics was performed using two-tailed unpaired student's t-test.
Figure 39, comprising Figures 39A and 39B, shows the amino acid sequence of light (Figure 39A) and heavy (Figure 39B) chain of GSH43 and Ti49 clones. The CDRs in each sequence are in bold typeface and underlined. The sequence of GSH43 light chain is set forth in SEQ ID NO. 8; sequence of Ti49 light chain is set forth in SEQ ID NO. 9. The sequence of GSH43 heavy chain is set forth in SEQ ID NO. 10; sequence of Ti49 heavy chain is set forth in SEQ ID NO. 11.
Figure 40 is a set of images comparing assays for identifying nanoparticle binders using panning upon NP immobilization (left) and panning on dispersed nanoparticles (right).
Figure 41 is a set of images depicting the results of experiments demonstrating the binding of GSH43 in phage and scFv format to various differently coated quantum dots.
Figure 42 is a set of graphs depicting the results of experiments demonstrating the GSH43 in phage and scFv format to GSH peptide.
Figure 43 is a graph depicting the results of experiments demonstrating binding of Ti6 and Til5 phage clones to T1O2 nanoparticles. About 1000-fold binding to T1O2 particles was observed compared to a negative phage clone in a panning assay. Moreover, Ti6 does not exhibit cross-reactivity to Au NPs similar in morphology to the T1O2 NPs, whereas Til 5 clone does to a certain extent.
DETAILED DESCRIPTION
The present invention provides compositions and methods for detecting a nanomaterial. For example, in certain embodiments, the invention includes the detection of dispersed, aggregated, or agglomerated nanomaterial. In one embodiment, the invention provides for detection of a nanoparticle. The present invention is partly based upon the development of a screening method and the discovery of unique compositions that have the ability to specifically bind to dispersed, aggregated, or agglomerated nanomaterial. For example, the present invention provides for the detection of the presence and location of nanomaterials or nanoparticles including, but not limited to quantum dots (QDs); metal oxides, including titanium dioxide (T1O2), zinc oxide (ZnO), ceriumoxide (Ce02), aluminum oxide (AI2O3), silicon oxide (S1O2) antimony tin oxide; metals, including gold, silver, platinum, copper; carbon, including fullerene, grapheme, carbon nanotubes, dendrimers, polymers; lipids, including liposomes and solid lipid particles; group IV,
II-V, and II- VI semiconductors, including silicon, germanium, CdS, CdSe; and the like.
In one embodiment, the present invention provides a method or identifying a composition for detecting a nanomaterial. For example, in one embodiment, the present invention provides a method of screening test compounds for the ability to bind to a dispersed, aggregated, or agglomerated nanomaterial.
In one embodiment, the present invention includes a composition for detecting a nanomaterial. In one embodiment, the composition comprises a binding domain that specifically binds to a nanomaterial. In certain instances the composition binds to a nanomaterial of specific size, shape, or composition. In one embodiment, the composition binds to a particular type of nanomaterial, thereby providing specificity in its detection. In one embodiment, the composition comprises a bacteriophage particle and a binding domain that specifically binds to the
nanomaterial. For example, it is described herein that in certain instances, a binding domain expressed on the surface of a phage particle results in enhanced detection compared to the binding domain alone.
In one embodiment, the present invention includes a method of detecting a nanomaterial. For example, the method may comprise detecting the presence and/or abundance of a nanomaterial present in any sample, product, organism, or tissue where it may be desired to detect nanomaterial, including, but not limited to biological systems, ecological systems, industrial systems, commercial product, waste products, or the like. For example, in one embodiment, the method comprises administering a composition which specifically binds to a nanomaterial to a sample or subject. In certain embodiments, the method comprises detection of a nanomaterial in biopsied or excised tissue sample. In another embodiment, the method comprises the in vivo detection of a nanomaterial in a subject. In one embodiment, the method comprises the detection of a biomaterial in an ecological or environmental sample, including for example, water, soil, plant, algae, bacteria, fungi, waste product, and the like.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or
equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
As used herein, each of the following terms has the meaning associated with it in this section.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
The term "antibody," as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The an antibody in the present invention may exist in a variety of forms where the antigen binding portion of the antibody is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment, a single chain antibody (scFv) and a humanized antibody (Harlow et al, 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al, 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al, 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
The term "antibody fragment" refers to at least one portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, sdAb (either VL or VH), camelid VHH domains, scFv antibodies, and multi-specific antibodies formed from antibody fragments. The term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it was derived. Unless
specified, as used herein an scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.
An "antibody heavy chain," as used herein, refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
An "antibody light chain," as used herein, refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) and lambda (λ) light chains refer to the two major antibody light chain isotypes.
By the term "synthetic antibody" as used herein, is meant an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
The term "antigen" or "Ag" as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an "antigen" as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not
be encoded by a "gene" at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
By the term "antigen-bearing moiety" as used herein, is meant a molecule to which an antibody binds.
"Biological sample," or simply "sample", as that term is used herein, means a sample, such as one that is, but need not be, obtained from an organism, which sample is to be assessed for the presence, absence and/or level, of a
nanomaterial of interest according to the methods of the invention. Such sample includes, but is not limited to, any biological fluid (e.g., blood, lymph, semen, sputum, saliva, phlegm, tears, and the like), fecal matter, a hair sample, a nail sample, a brain sample, a kidney sample, an intestinal tissue sample, a tongue tissue sample, a heart tissue sample, a mammary gland tissue sample, a lung tissue sample, an adipose tissue sample, a muscle tissue sample, and any sample obtained from an organism that can be assayed for the presence or absence of an antigen. Further, the sample can comprise an environmental sample (e.g., a water sample, soil sample, and the like) however obtained, to be assessed for the presence absence and/or level, of a nanomaterial of interest according to the methods of the invention.
As used herein, the term "fragment" as applied to a nucleic acid, may ordinarily be at least about 20 nucleotides in length, preferably, at least about 30 nucleotides, more typically, from about 40 to about 50 nucleotides, preferably, at least about 50 to about 80 nucleotides, even more preferably, at least about 80 nucleotides to about 90 nucleotides, yet even more preferably, at least about 90 to about 100, even more preferably, at least about 100 nucleotides to about 150 nucleotides, yet even more preferably, at least about 150 to about 200, even more preferably, at least about 200 nucleotides to about 250 nucleotides, yet even more preferably, at least about 250 to about 300, more preferably, from about 300 to about 350 nucleotides, preferably, at least about 350 to about 360 nucleotides, and most preferably, the nucleic acid fragment will be greater than about 365 nucleotides in length.
As used herein, the term "fragment" as applied to a polypeptide, may ordinarily be at least about 20 amino acids in length, preferably, at least about 30 amino acids, more typically, from about 40 to about 50 amino acids, preferably, at least about 50 to about 80 amino acids, even more preferably, at least about 80 amino
acids to about 90 amino acids, yet even more preferably, at least about 90 to about 100, even more preferably, at least about 100 amino acids to about 120 amino acids, and most preferably, the amino acid fragment will be greater than about 123 amino acids in length.
By the term "Fab/phage" as used herein, is meant a phage particle which expresses the Fab portion of an antibody.
By the term "scFv/phage" are used herein, is meant a phage particle which expresses the Fv portion of an antibody as a single chain.
"Phage," or "phage particle," as these terms are used herein, include that contain phage nucleic acid encoding, inter alia, an antibody. This is because, as would be appreciated by the skilled artisan, unlike peptide phage display (where the peptide DNA insert is small and it is actually cloned into the phage DNA), the larger scFv or Fab DNA inserts are actually cloned into, among other things, a plasmid. Thus, the nucleic acid encoding the antibody, e.g., a plasmid such as, but not limited to, pComb3, not only comprises a plasmid origin of replication, but also a phage (e.g., M13) origin of replication sequence and an M13 packaging sequence, so that when the nucleic acid is produced, a helper phage can be used to provide the required phage (e.g., Ml 3) proteins in trans to make "phage-like" particles. That is, these particles resemble phage on the outside, but on the inside they contain plasmid (also referred to as a "phagemid") DNA. In other words, the phagemid DNA need not encode any Ml 3 phage proteins, except a piece of Ml 3 gene III fused to the DNA for antibody or peptide. Thus, it should be understood that the terms "phage," "phage particle," "phage-like particle" and "phagemid" are used interchangeably herein.
The terms "bacteriophage" and "phage" are used interchangeably herein and refer to viruses which infect bacteria. By the use of the terms
"bacteriophage library" or "phage library" as used herein, is meant a population of bacterial viruses comprising heterologous DNA, i.e., DNA which is not naturally encoded by the bacterial virus.
The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides." The monomeric nucleotides can be hydro lyzed into nucleosides. As used herein polynucleotides include, but are not
limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
By the term "specifically binds," as used herein, is meant an antibody, or a ligand, which recognizes and binds with a cognate binding partner present in a sample, but which antibody or ligand does not substantially recognize or bind other molecules in the sample.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description
The present invention provides compositions and methods for detecting a nanomaterial. The present invention is partly based upon the discovery of compositions that have the ability to bind to dispersed, aggregated, or agglomerated nanomaterials. For example, the present invention provides for the detection of the presence and location of nanomaterials or nanoparticles including, but not limited to quantum dots (QDs); metal oxides, including titanium dioxide (T1O2), zinc oxide (ZnO), ceriumoxide (CeC ), aluminum oxide (AI2O3), silicon oxide (S1O2) antimony tin oxide; metals, including gold, silver, platinum, copper; carbon, including fullerene, grapheme, carbon nanotubes, dendrimers, polymers; lipids, including liposomes and solid lipid particles; group IV, II-V, and II-VI semiconductors, including silicon, germanium, CdS, CdSe; and the like. In certain embodiments, the invention allows for identification of nanomaterials rather than soluble ions or elemental metals.
In one embodiment, the present invention provides a method or identifying a composition for detecting a nanomaterial. For example, in one embodiment, the present invention provides a method of screening test compounds for the ability to bind to a nanomaterial. In certain embodiments, the method of the invention comprises biopanning to screen a library of test compounds to identify one or more compositions which bind to a desired nanomaterial. In one embodiment, the method comprises using phage display to identify one or more compositions which bind to a nanomaterial. In certain embodiments, the method comprises providing a solution comprising a nanomaterial of interest, incubating with the solution a population of phage wherein each phage displays a test compound on its surface, and enriching the phage which bind to the nanomaterial. In certain embodiments, the method comprises the use of a phage library, including for example a peptide library, antibody library, scFv library, fibronectin library, scaffold library and the like.
In one embodiment, the present invention includes a composition for detecting a nanomaterial. The composition of the invention that is useful for detecting a nanomaterial is also referred herein as "NProbe." In one embodiment, the composition comprises a binding domain that specifically binds to a nanomaterial. In one embodiment, the composition binds to a particular type of nanomaterial, defined for example by the size, charge, surface chemistry, and composition of the nanomaterial, thereby providing specificity in its detection. In one embodiment, the binding domain comprises a peptide that specifically binds to the nanomaterial. For example, in certain embodiments, the binding domain comprises an antibody,
antibody fragment, or fibronectin-based peptide that specifically binds to a nanomaterial. For example, in one embodiment, the binding domain comprises a scFv. In one embodiment, the composition comprises a phage particle and the binding domain. For example, it is described herein that in certain instances, a binding domain expressed on the surface of a phage particle results in enhanced detection compared to the binding domain alone. In one embodiment, NProbe binding to a nanomaterial is dependent upon the surface chemistry, shape, size, or surface charge of the nanomaterial being detected. It is demonstrated herein that the identified NProbes specifically detect nanomaterials at locations and levels where they were previously undetectable. Therefore, in one embodiment, the composition of the invention is a diagnostic tool for detecting the presence, absence, location, and/or abundance of a nanomaterial in a biological system, environmental system, ecosystem, commercial product, waste product, or the like.
In one embodiment, the present invention includes a method of detecting a nanomaterial. For example, the method may comprise detecting a nanomaterial in a biological system, ecological system, industrial system, commercial product, waste product, or the like. For example, in one embodiment, the method comprises administering a composition which specifically binds to a nanomaterial to a sample or subject. In certain embodiments, the method comprises detection of a nanomaterial in biopsied or excised tissue sample. In another embodiment, the method comprises the in vivo detection of a nanomaterial in a subject. In one embodiment, the method comprises the detection of the nanomaterial in an environmental or ecosystem sample, including for example, water, soil, plant, algae, bacteria, fungi, and the like. In one embodiment, the method comprises using traditional imaging or detection assays to identify the location of the administered composition, thereby indicating the presence or localization of the nanomaterial. In certain aspects, the method is used to monitor the presence of nanomaterials used in nanomedicine therapeutic regimens, which can thus be used in the determination of how the regimen proceeds. The method of the invention allows for the detection of material in any biological tissue or sample. For example, it is demonstrated herein that, in certain instances, nanomaterials can traverse the skin barrier and enter into the body of a subject. The method of the invention allows for detection of low
concentration of dispersed, agglomerated, or aggregated nanomaterials, which while
currently undetectable using traditional methods, can result in adverse consequences to the subject.
Screening method
In one embodiment, the present invention includes a screening method for identifying a composition for detecting a nanomaterial in biological systems. In certain embodiments, the method of the invention comprises biopanning to screen a library of test compounds to identify one or more compositions which bind to a nanomaterial of interest. Exemplary nanomaterials for which nanomaterial-binding compositions are screened for using the present method are listed elsewhere herein.
In one embodiment, the method comprises using phage display to identify one or more compositions which bind to a nanomaterial. In certain embodiments, the method comprises providing a solution comprising a dispersed nanomaterial, incubating a population of phage, wherein each phage displays a test compound on its surface, with the solution, and enriching the phage which binds to the nanomaterial.
Phage display is a powerful tool for selecting proteins with binding properties to almost any target (Willats, 2002, Plant Mol Biol 50(6):837-854). Phage display involves expression of peptides, including for example, antibodies, antibody fragments, proteins, and the like, on the surface of phage particles by the
incorporation of a nucleotide sequence encoding the peptide to be displayed into the genome of the phage, as a fusion to the gene encoding a minor phage coat protein (Lynch et al, 2006, Sci STKE 2006(327):pel4; Willats, 2002, Plant Mol Biol 50(6):837-854). This technique has been used to isolate peptide probes for a variety of targets inorganic metals (Naik et al, 2002, Nat Mater 1(3): 169-172), semiconductors (Flynn et al, 2003, Acta Materialia 51 :5867-5880; Whaley et al., 2000, Nature 405(6787):665-668) and NPs (Chen et al, 2006, Analytical Chemistry 78(14):4872- 4879; Bassindale et al, 2007, Chemical Communications(28):2956-2958; Wang et al, 2003, Nat Mater 2(3): 196-200).
Phage display of peptides is an extremely rapid technique (~2 weeks) compared to hybridoma methods (months). Moreover, the amount of target required for antibody phage display is much less (micrograms) than that typically required for hybridoma methods (milligrams) (Willats, 2002, Plant Mol Biol 50(6):837-854). Further, the biopanning technique using phage display, as described herein, has the
advantage of providing the opportunity to discover reagents that bind to nanomaterial based on shape as well as composition, Moreover nanomaterial immunogenicity is not a requirement for enrichment of reagents using in vitro display technology.
In one embodiment, the method uses a library of test compounds to be screened. In certain embodiments, the library comprises, peptides, nucleic acids, small molecules, antibodies, antibody fragments, and the like, which may bind the nanomaterial of interest. In one embodiment, the library comprises a population of test compounds, wherein the test compounds are scFvs. A phage display library of phage expressing a population of scFvs has been used to identify compositions for other applications, as described in Shea et al, 2005, J Struct Funct Genomics, 6(2-3): 171-175; Bliss et al, 2003, J Clin Microbiol, 41(3): 1 152-60; WO/2007/011907; and WO201 1/123683, each of which are herein incorporated by reference in their entireties. In one embodiment, the library comprises peptides based on or derived from scaffold proteins, including, for example, fibronectin. For example, phage display of randomized peptides based on the 10th fibronectin type II domain of human fibronectin has been demonstrated to identify conformational epitopes (Sullivan et al, 2013, Biochemistry 52 ( 10) : 1802— 1813). In certain embodiments, the method comprises utilizing phage display of fibronectin based peptides to identify a composition that binds to a nanomaterial.
It is noted that an antibody library described herein is meant to include a library of antibodies, or antibody fragments, including, for example, scFvs.
In one embodiment of the invention, a phage antibody library may be generated. To generate a phage antibody library, a cDNA library is first obtained from mRNA which encodes the desired peptide to be expressed on the phage surface, e.g., the desired antibody. cDNA copies of the mRNA are produced using reverse transcriptase. cDNA which specifies immunoglobulin fragments are obtained by PCR and the resulting DNA is cloned into a suitable bacteriophage vector to generate a bacteriophage DNA library comprising DNA specifying immunoglobulin genes. The procedures for making a bacteriophage library comprising heterologous DNA are well known in the art and are described, for example, in Sambrook et al, (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).
Bacteriophage which encode the desired peptide, may be engineered such that the peptide is displayed on the surface thereof in such a manner that it is available for binding to its corresponding partner. Thus, when bacteriophage which
express a specific peptide are incubated in the presence of the corresponding antigen, the bacteriophage will bind to the antigen. Bacteriophage which do not express the peptide will not bind to the antigen. Such panning techniques are well known in the art and are described for example, in Clackson and Lowman, 2004, Phage Display: A Practical Approach, Oxford University Press, New York.
Processes such as those described above, have been developed for the production of human antibodies using M13 bacteriophage display (Burton et al, 1994, Adv. Immunol. 57: 191-280). Essentially, a cDNA library is generated from mRNA obtained from a population of antibody -producing cells. The mRNA encodes rearranged immunoglobulin genes and thus, the cDNA encodes the same. Amplified cDNA is cloned into Ml 3 expression vectors creating a library of phage which express human Fab fragments on their surface. Phage which display the antibody of interest are selected by antigen binding and are propagated in bacteria to produce soluble human Fab immunoglobulin. Thus, in contrast to conventional monoclonal antibody synthesis, this procedure immortalizes DNA encoding human
immunoglobulin rather than cells which express human immunoglobulin.
The procedures just presented describe the generation of phage which encode the Fab portion of an antibody molecule. However, the invention should not be construed to be limited solely to the generation of phage encoding Fab antibodies. Rather, phage which encode single chain antibodies (scFv/phage antibody libraries) are also included in the invention. Fab molecules comprise the entire Ig light chain, that is, they comprise both the variable and constant region of the light chain, but include only the variable region and first constant region domain (CHI) of the heavy chain. Single chain antibody molecules comprise a single chain of protein comprising the Ig Fv fragment. An Ig Fv fragment includes only the variable regions of the heavy and light chains of the antibody, having no constant region contained therein. Phage libraries comprising scFv DNA may be generated following the procedures described in Marks et al. (1991, J. Mol. Biol. 222:581-597). Panning of phage so generated for the isolation of a desired antibody is conducted in a manner similar to that described for phage libraries comprising Fab DNA.
The invention should also be construed to include synthetic phage display libraries in which the heavy and light chain variable regions may be synthesized such that they include nearly all possible specificities (Barbas, 1995, Nature Medicine 1 :837-839; de Kruif et al. 1995, J. Mol. Biol. 248:97-105).
In another embodiment of the invention, phage-cloned antibodies derived from immunized animals can be humanized by known techniques.
In one embodiment, the screening method of the invention comprises incubating the phage antibody library with a solution comprising the nanomaterial of interest. In one embodiment, the present invention includes the identification of compositions which bind to dispersed, aggregated, or agglomerated nanomaterial, rather than in bulk. Therefore, in certain embodiments, the method comprises forming a solution of dispersed nanomaterial. In certain embodiments, the nanomaterial solution comprises the nanomaterial at a concentration of about InM to about lOOOnM. In one embodiment, the nanomaterial solution comprises the nanomaterial at a concentration of about ΙΟΟηΜ. In one embodiment, the nanomaterial solution comprises the nanomaterial at a concentration of about O.O^g/mL to about lOOmg/mL. In one embodiment, the nanomaterial solution comprises the
nanomaterial at a concentration of about lmg/mL.
The nanomaterial solution described herein may be formed using any suitable solvent or buffer that would provide a disperse nanomaterial solution. For example, in one embodiment, the solution is formed by adding the nanomaterial of interest to TBS buffer (50 nM Tris HC1, 150 nM NaCl, pH 7.5). However, the present invention is not limited to any particular buffer. In certain embodiments, the buffer comprises a surfactant. In certain embodiments, the buffer does not contain a surfactant. In certain instances, the disperse solution is maintained with occasional vortexing, sonication, mixing, or the like, to aid in dispersing.
In certain instances, the nanomaterial of interest is coated with an agent to allow for solubility and dispersion of the nanomaterial. For example, in certain embodiments, the nanomaterial is coated with glutathione (GSH), or other molecules or polymer ligands such as dihydrolipoic acid, polyethylene amine, polyethylene glycol, and the like. Further detail of nanomaterial coating may be found for example in Hong et al, 2013, Journal of Biomedical Nanotechnology, 9(3)3: 382-392, which is incorporated herein by reference in its entirety. In one embodiment, the nanomaterial is coated with a surface chemistry of interest to identify compositions which bind to a nanomaterial having a surface chemistry of interest. In one embodiment, the method comprises identification of a composition which binds to a nanomaterial independent of surface chemistry.
In one embodiment, the method comprises incubating the phage antibody library with the nanomaterial solution, to provide a nanomaterial-phage solution, to allow for binding of one or more phage to the nanomaterial. Incubation of the nanomaterial solution with the phage antibody library may be done under any suitable conditions known in the art.
In one embodiment, the method comprises separation of the phage bound to the nanomaterial from the unbound phage. In certain embodiments, methods of separation are optimized for the type of nanomaterial, its agglomeration properties, and size. In one embodiment, separation of bound phage from unbound phage is performed by centrifugation of the nanomaterial-phage solution. The speed of centrifugation is chosen in such a way that the nanomaterial is not too tightly pelleted to allow for resuspension during wash steps. In one embodiment, the centrifugation speed is about 1300g (4000rpm) to about 90000g (55000rpm), depending upon the material. In one embodiment, the solution comprises a salt, for example MgCk, which, in certain instances aids in the separation of bound and unbound phage. For example, in certain instances, inclusion of a salt in the solution allows for use of a slower centrifugation speed, for example 1300g (4000rpm) to about 24000g (29000 rpm). Exemplary salts include, but are not limited to, MgCi2.6H20,CsCl, MgS04, CaCk, and the like. In one embodiment the solution comprises the salt at a concentration of about 0.01M to about 10M. In one embodiment, the solution comprises the salt at a concentration of about 1M.
In one embodiment, the solution comprises a polyethylene glycol. In certain embodiments, the polyethylene glycol has a molecular weight of about 5000 g/mol to about 10000 g/mol. In one embodiment, the solution comprises Carbowax 6000g/mol molecular weight.
In one embodiment, the method comprises enriching the bound phage fraction. Enrichment of the bound phage may be done using any suitable method known in the art. For example, in one embodiment, the bound phage is eluted and is transduced into fresh log phase bacterial cells. Phage infected bacteria is selected, for example by use of antibody resistance. In one embodiment, the colonies are grown in suspension, infected with helper phage to produce the phage of interest.
In certain embodiments, the phage display is repeated one or more times. For example, repeating the incubation of the selected phage with the nanomaterial, separation of bound from unbound phage, and enriching bound phage,
may be repeated to generate a smaller number of high quality compounds. In certain embodiments, the identity of the bound phage is evaluated, for example using traditional molecular biology approaches. In one embodiment, identity of the phage is performed using BsTN- 1 fingerprinting. Detection of repeated fingerprint signatures reveals the enrichment of test compounds that are determined to bind to the nanomaterial.
In certain embodiments, the screening method comprises one or more additional screens to confirm the binding activity of the identified composition, as generated by the screening assay described herein. In one embodiment, the method comprises one or more additional screens to evaluate the specificity of the identified NProbe. Exemplary assays that may be performed include, but are not limited to dynamic light scattering, zeta potential, ELISA, FLISA, Dot blot assay, DLS assay, BCA protein assay, imaging analysis, and the like. For example, in one embodiment, one or more of the above assays are used to evaluate the binding strength of an identified composition to the nanomaterial that it was identified to bind to. In another embodiment, one or more of the above assays are used to evaluate the specificity or cross-reactivity of the identified composition to bind to other types of nanomaterials or to derivatives of the nanomaterial that it was identified to bind to. For example, as described herein, in certain instances binding of an NProbe to a nanomaterial is dependent on nanomaterial size, agglomeration, surface chemistry, or other property. Thus, in certain embodiments, one or more of the above assays are used to determine if the composition binds to a nanomaterial having a different size, surface chemistry or other property, compared to the nanomaterial for which it was determined to bind. For example, a composition that is determined to bind to 50nm particle is evaluated using one or more of the above assays to determine if it does or does not similarly bind to a lOnm particle.
In certain embodiments, the method comprises modifying one or more regions of the identified composition to generate improved compositions with enhanced binding properties. For example, in one embodiment, an identified composition is an scFv, where some or all of the VH or VL regions can be modified or replaced to produce improved scFv compositions. In one embodiment, the method comprises an additional phage display assay where a population of scFvs is screened, where each scFv of the additional screen comprises a region of the initially identified scFv (e.g., the VH of the initially identified scFv) and a test region (e.g., random VL
chains), to determine if any of the scFvs of the additional screen display enhanced properties compared to the initially identfied scFv.
Composition
In one embodiment, the present invention includes a composition for detecting the presence or location of a nanomaterial. In certain embodiments, the composition of the invention binds to a nanomaterial, thereby indicating the presence, location, and/or abundance of the nanomaterial. For example, in one embodiment, the composition comprises a binding domain which binds to the nanomaterial of interest. The binding domain of the composition specifically binds to the nanomaterial of interest and may comprise an antibody, antibody fragment, a peptidomimetic, a polypeptide or aptamer, a nucleic acid or any other molecule provided it binds specifically to the nanomaterial of interest. In one embodiment, the composition binds to dispersed, aggregated, or agglomerated nanomaterial.
In certain embodiments, the composition of the invention binds to a nanomaterial used in commercial, industrial, pharmaceutical, cosmetic, diagnostic, or the like applications. The use of nanomaterials has become increasingly popular in a variety of industries. However, the presence or accumulation within the body may have serious adverse consequences. Exemplary nanomaterials which the present composition of the invention binds include those listed elsewhere herein. In certain embodiments, the composition specifically binds to a particular type of nanomaterial. That is, in one embodiment, for example, the composition of the invention specifically binds to QDs, but does not bind to any other nanomaterial.
In one embodiment, the composition of the invention binds to a QD. Exemplary QDs detectable by the composition include QDs made from any material known in the art including, but not limited to, silicon, germanium, zinc, ZnS, cadmium, CdS, CdSe, CdTe, semiconductor materials or the like. In certain instances the QDs comprise a coating, including but not limited to, coatings comprising GSH, dihydrolipoic acid (DHLA), trioctylphosphine oxide (TOPO), DTT, poly(ethylene glycol), surfactants, biomolecules, and the like. In certain embodiments, the composition specifically binds to a particular shape, size, or chemistry of QDs.
In one embodiment, the composition of the invention binds to TiC nanoparticles. TiC , also known as titanium (IV) oxide or titania, is the naturally occurring oxide of titanium. TiCte includes all forms of oxides of titanium including
the different crystal forms, such as rutile, anatase, brookite, and other crystal forms known in art.
In one embodiment, the composition comprises a tag domain which allows for the detection or purification of the composition. In one embodiment, the tag domain comprises a detection tag and/or a purification tag. It will be appreciated that the tag domain does not interfere in the function of the composition of the invention.
For example, in certain embodiments, the tag domain comprises a visible tag, which, allows for the visualization of the composition. For example, in certain embodiments, the tag domain comprises a fluorescent tag. Non-limiting examples of fluorescent tags include green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP), eGFP, mCherry, hrGFP, hrGFPII, Alexa 488, Alexa 594, and the like. Fluorescent tags may also be photoconvertable such as for example kindling red fluorescent protein (KFP-red), PS-CFP2, Dendra2, CoralHue Kaede and CoralHue Kikume. Detection proceeds by any known method, including immunoblotting, western analysis, gel-mobility shift assays, tracking of radioactive or bioluminescent markers, nuclear magnetic resonance, electron paramagnetic resonance, stopped-flow spectroscopy, column chromatography, capillary
electrophoresis, or other methods which track a molecule based upon an alteration in size and/or charge. The particular tag is not a critical aspect of the invention. The tag can be any material having a detectable physical or chemical property. Such tags have been well-developed in the field of immunoassays and, in general, any tag useful in such methods can be applied to the present invention. Thus, a tag is any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful tags in the present invention include magnetic beads (e.g. Dynabeads™), fluorescent dyes (e.g., fluorescein isothiocyanate, Texas red, rhodamine, and the like), radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P), enzymes (e.g., LacZ, CAT, horse radish peroxidase, alkaline phosphatase and others, commonly used as detectable enzymes, either as marker gene products or in an
ELISA), and colorimetric labels such as colloidal gold or colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads.
The tag may be coupled directly or indirectly to the composition according to methods well known in the art. As indicated above, a wide variety of
tags may be used, with the choice of tag depending on the sensitivity required, ease of conjugation of the compound, stability requirements, available instrumentation, and disposal provisions.
The molecules can also be conjugated directly to signal generating compounds, e.g., by conjugation with an enzyme or fluorophore. Enzymes of interest as labels include hydrolases, particularly phosphatases, esterases and glycosidases, or oxidoreductases, particularly peroxidases. Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc.
Chemiluminescent compounds include luciferin, and 2,3-dihydrophthalazinediones, e.g., luminol. For a review of various labeling or signal producing systems which may be used, see, U.S. Pat. No. 4,391,904, which is incorporated herein by reference.
Means of detecting tags are well known to those of skill in the art. Thus, for example, where the tag is a radioactive label, means for detection include a scintillation counter or photographic film as in autoradiography. Where the tag is a fluorescent label, it may be detected by exciting the fluorochrome with the appropriate wavelength of light and detecting the resulting fluorescence, e.g., by microscopy, visual inspection, via photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like. Similarly, enzymatic tags may be detected by providing appropriate substrates for the enzyme and detecting the resulting reaction product. Finally, simple colorimetric tags may be detected simply by observing the color associated with the tag.
In one embodiment, the tag domain comprises a known epitope that may be used to detect the composition. For example, in one embodiment, the tag domain comprises an epitope that is recognized by an antibody or other molecule which thereby provides for the detection of the composition. In one embodiment, the tag domain comprises a known peptide epitope. The tag includes but is not limited to: polyhistidine tags (His-tags) (for example H6 and H10, etc.) or other tags for use in IMAC systems, for example, Ni2+ affinity columns, etc., GST fusions, MBP fusions, streptavidine-tags, the BSP biotinylation target sequence of the bacterial enzyme BIRA and tag epitopes that are directed by antibodies (for example c-myc tags,
FLAG-tags, among others). In certain embodiments, the tag domain allows for the detection of composition using antibody -based detection assays, including, for example, ELISA, immunohistochemistry, immunofluorescence, flow cytometry, and the like. This allows for the amplification of a signal, for example created by
enzymatic action upon a substrate, which allows for detection even if only a few compositions of the invention bind to the nanomaterial.
In one embodiment, the binding domain of the composition of the invention is a peptide that binds to the nanomaterial of interest. The peptide may be made using chemical methods. For example, peptides can be synthesized by solid phase techniques (Roberge J Y et al (1995) Science 269: 202-204), cleaved from the resin, and purified by preparative high performance liquid chromatography.
Automated synthesis may be achieved, for example, using the ABI 431 A Peptide Synthesizer (Perkin Elmer) in accordance with the instructions provided by the manufacturer.
The peptide may alternatively be made by recombinant means or by cleavage from a longer polypeptide. The composition of a peptide may be confirmed by amino acid analysis or sequencing.
The variants of the peptides according to the present invention may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the peptide is an alternative splice variant of the peptide of the present invention, (iv) fragments of the peptides and/or (v) one in which the peptide is fused with another peptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include peptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post- translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
As known in the art the "similarity" between two peptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one peptide to a sequence of a second peptide. Variants are defined to include peptide sequences different from the original sequence, preferably different from the original sequence in less than 40% of residues per segment of interest, more preferably different from the original sequence in less than 25% of residues per segment of interest, more preferably different by less than 10% of residues per
segment of interest, most preferably different from the original protein sequence in just a few residues per segment of interest and at the same time sufficiently homologous to the original sequence to preserve the functionality of the original sequence and/or the ability to bind to ubiquitin or to a ubiquity lated protein. The present invention includes amino acid sequences that are at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, or 95% similar or identical to the original amino acid sequence. The degree of identity between two peptides is determined using computer algorithms and methods that are widely known for the persons skilled in the art. The identity between two amino acid sequences is preferably determined by using the BLASTP algorithm [BLAST Manual, Altschul, S., et al, NCBI LM NIH Bethesda, Md. 20894, Altschul, S., et al, J. Mol. Biol. 215: 403-410 (1990)].
The peptide can be post-translationally modified. For example, post- translational modifications that fall within the scope of the present invention include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristoylation, protein folding and proteolytic processing, etc. Some modifications or processing events require introduction of additional biological machinery. For example, processing events, such as signal peptide cleavage and core glycosylation, are examined by adding canine microsomal membranes or Xenopus egg extracts (U.S. Pat. No. 6, 103,489) to a standard translation reaction.
The peptide may include unnatural amino acids formed by post- translational modification or by introducing unnatural amino acids during translation. A variety of approaches are available for introducing unnatural amino acids during protein translation. By way of example, special tRNAs, such as tRNAs which have suppressor properties, suppressor tRNAs, have been used in the process of site- directed non-native amino acid replacement (SNAAR). The term "functionally equivalent" as used herein refers to a peptide according to the invention that preferably retains at least one biological function or activity.
In one embodiment, the peptide is derived from a fibronectin scaffold. For example, as described elsewhere herein, a phage display library of randomized fibronectin-based peptides may be used to identify peptides that bind to the nanomaterial of interest.
In one embodiment, the binding domain of the composition comprises an antibody, or fragment thereof, which binds to the nanomaterial of interest. Methods of making and using antibodies are well known in the art. For example, polyclonal
antibodies useful in the present invention are generated by immunizing rabbits according to standard immunological techniques well-known in the art (see, e.g., Harlow et al, 1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.). Such techniques include immunizing an animal with a nanomaterial comprising a portion of another protein such as a maltose binding protein or glutathione (GSH) tag polypeptide portion, and/or a moiety such that the antigenic particle is rendered immunogenic (e.g., an antigen of interest conjugated with keyhole limpet hemocyanin, KLH) and a portion comprising the respective antigenic particle.
However, the invention should not be construed as being limited solely to methods and compositions including these antibodies or to these portions of the antigens. Rather, the invention should be construed to include other antibodies, as that term is defined elsewhere herein, to antigens, or portions thereof. Further, the present invention should be construed to encompass antibodies, inter alia, which bind to the specific antigens of interest, and are able to bind the antigen present on Western blots, in solution in enzyme linked immunoassays, in fluorescence activated cells sorting (FACS) assays, in magenetic-actived cell sorting (MACS) assays, and in
immunofluorescence microscopy of a cell or tissue comprising the particle.
One skilled in the art would appreciate, based upon the disclosure provided herein, that the antibody can specifically bind with any portion of the particle. The present invention is not limited to using the complete particle. Rather, the present invention includes using a portion of the particle to produce an antibody that specifically binds with the particle.
In certain aspects, the antibodies can be produced by providing an animal such as, but not limited to, a rabbit, a mouse or a camel, with a particle of the invention, or a portion thereof, or to chimeric molecules comprising the particle. One skilled in the art would appreciate, based upon the disclosure provided herein, that smaller fragments of these particles can also be used to produce antibodies that specifically bind the particle of interest.
The invention encompasses monoclonal, synthetic antibodies, and the like. One skilled in the art would understand, based upon the disclosure provided herein, that the crucial feature of the antibody of the invention is that the antibody bind specifically with the particle of interest. That is, the antibody of the invention recognizes a particle of interest or a fragment thereof on Western blots, in
immunostaining of cells, and immunoprecipitates using standard methods well-known in the art.
One skilled in the art would appreciate, based upon the disclosure provided herein, that the antibodies can be used to immunoprecipitate and/or immuno- affinity purify their cognate particle as described in detail elsewhere herein, and additionally, by using methods well-known in the art.
The skilled artisan would appreciate, based upon the disclosure provided herein, that that present invention includes use of a single antibody recognizing a single epitope but that the invention is not limited to use of a single antibody. Instead, the invention encompasses use of at least one antibody where the antibodies can be directed to the same or different epitopes.
In certain instances, the generation of polyclonal antibodies is accomplished by inoculating the desired animal with the particle and isolating antibodies which specifically bind the particle therefrom using standard antibody production methods such as those described in, for example, Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.).
Monoclonal antibodies directed against particles, or fragments thereof, may be prepared using any well-known monoclonal antibody preparation procedures, such as those described, for example, in Harlow et al. (1988, In: Antibodies, A Laboratory Manual, Cold Spring Harbor, N.Y.) and in Tuszynski et al. (1988, Blood, 72: 109-115). Monoclonal antibodies directed against the peptide are generated from mice immunized with the particle using standard procedures as referenced herein.
Nucleic acid encoding the monoclonal antibody obtained using the procedures described herein may be cloned and sequenced using technology which is available in the art, and is described, for example, in Wright et al. (1992, Critical Rev. Immunol. 12: 125-168), and the references cited therein. Further, the antibody of the invention may be "humanized" using the technology described in, for example, Wright et al, and in the references cited therein, and in Gu et al. (1997, Thrombosis and Hematocyst 77:755-759), and other methods of humanizing antibodies well- known in the art or to be developed.
A humanized antibody has one or more amino acid residues introduced into it from a source which is nonhuman. These nonhuman amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Thus, humanized antibodies comprise one or more CDRs from
nonhuman immunoglobulin molecules and framework regions from human.
Humanization of antibodies is well-known in the art and can essentially be performed following the method of Winter and co-workers (Jones et al, Nature, 321 :522-525 (1986); Riechmann et al, Nature, 332:323-327 (1988); Verhoeyen et al, Science, 239: 1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, i.e., CDR-grafting (EP 239,400; PCT Publication No. WO 91/09967; and U.S. Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089; 6,548,640, the contents of which are incorporated herein by reference herein in their entirety). In such humanized chimeric antibodies, substantially less than an intact human variable domain has been substituted by the corresponding sequence from a nonhuman species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some framework (FR) residues are substituted by residues from analogous sites in rodent antibodies. Humanization of antibodies can also be achieved by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology,
28(4/5):489-498; Studnicka et al, Protein Engineering, 7(6):805-814 (1994); and Roguska et al, PNAS, 91:969-973 (1994)) or chain shuffling (U.S. Pat. No.
5,565,332), the contents of which are incorporated herein by reference herein in their entirety.
In some instances, a human scFv may also be derived from a yeast or phage display library.
The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is to reduce antigenicity. According to the so-called "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al, J. Immunol, 151:2296 (1993); Chothia et al, J. Mol. Biol, 196:901 (1987), the contents of which are incorporated herein by reference herein in their entirety). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al, Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al, J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference herein in their entirety).
In some embodiments, the antibody is humanized with retention of high affinity for the target antigen and other favorable biological properties.
According to one aspect of the invention, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind the target antigen. In this way, residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen, is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding.
A humanized antibody retains a similar specificity as the original antibody. However, using certain methods of humanization, the affinity and/or specificity of binding of the antibody may be increased using methods of "directed evolution," as described by Wu et al, J. Mol. Biol., 294: 151 (1999), the contents of which are incorporated herein by reference herein in their entirety.
In one embodiment, the binding domain is characterized by particular functional features or properties of an antibody. In one embodiment, the invention relates to a binding domain comprising an antibody or functional fragment thereof, wherein the antibody specifically binds to a nanomaterial of interest or fragment thereof.
In one embodiment, the antibody fragment provided herein is a single chain variable fragment (scFv). In another embodiment, the antibodies of the invention may exist in a variety of other forms including, for example, Fv, Fab, and (Fab')2, as well as bi-functional (i.e. bi-specific) hybrid antibodies (e.g., Lanzavecchia et al, Eur. J. Immunol. 17, 105 (1987)). In one embodiment, the antibodies and fragments thereof of the invention binds one or more nanomaterials of interest.
In one embodiment, an antibody of the invention comprises heavy and light chain variable regions comprising amino acid sequences that are homologous to the amino acid sequences of the preferred antibodies described herein, and wherein
the antibodies retain the desired functional properties of the antibodies of the invention.
In some embodiments, the antibody of the invention is further prepared using an antibody having one or more of the VH and/or VL sequences disclosed herein can be used as starting material to engineer a modified antibody, which modified antibody may have altered properties as compared to the starting antibody. In various embodiments, the antibody is engineered by modifying one or more amino acids within one or both variable regions (i.e., VH and/or VL), for example within one or more CDR regions and/or within one or more framework regions.
Once expressed, whole antibodies, dimers derived therefrom, individual light and heavy chains, or other forms of antibodies can be purified according to standard procedures known in the art.
As disclosed herein, in certain embodiments, the binding domain of the invention comprises a scFv that binds to a nanomaterial of interest. For example, the present invention is partly based upon the identification of scFv fragments that bind to different nanomaterials. In one embodiment, the scFv specifically binds to a quantum dot. For example, in one embodiment, the scFv that binds to QD is one of the group consisting of, C2, C3, C4, and C43 (also referred to herein as "GSH2," "GSH3," "GSH4" and "GSH43"). In one embodiment, the scFv that binds to QD is encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43). In one embodiment, the composition comprises a peptide encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (C2), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence that encodes a peptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 (CI), SEQ ID NO: 2 (C3), SEQ ID NO: 3 (C4), and SEQ ID NO: 4 (C43).
In one embodiment, the composition comprises a fragment, or nucleotide sequence encoding a fragment, of C2, C3, C4, or C43. For example, in one embodiment, the composition comprises the VH or VL of C2, C3, C4, or C43, or
nucleotide sequence encoding the VH or VL of C2, C3, C4, or C43. In one embodiment, the composition comprises an amino acid sequence encoding the light chain of C43 (SEQ ID NO: 8). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C43 (SEQ ID NO: 8). In one embodiment, the composition comprises an amino acid sequence encoding the heavy chain of C43 (SEQ ID NO: 10). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C43 (SEQ ID NO: 10).
In another embodiment, the scFv specifically binds to T1O2. In one embodiment, the scFv that binds to T1O2 is C49, C6, or CI 5 (also referred to herein as "Ti49," "Ti6," or "Til 5"). In one embodiment, the scFv that binds to T1O2 is encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15). In one embodiment, the composition comprises a peptide encoded by a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence that encodes a peptide encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO: 5 (C49), SEQ ID NO: 6 (C6), and SEQ ID NO: 7 (C15).
In one embodiment, the composition comprises a fragment, or nucleotide sequence encoding a fragment, of C49, C6, or C15. For example, in one embodiment, the composition comprises the VH or VL of C49, C6, or CI 5, or nucleotide sequence encoding the VH or VL of C49, C6, or C15. In one embodiment, the composition comprises an amino acid sequence encoding the light chain of C49 (SEQ ID NO: 9). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C49 (SEQ ID NO: 9). In one embodiment, the composition comprises an amino acid sequence encoding the heavy chain of C49 (SEQ ID NO: 1 1). In one embodiment, the composition comprises a polynucleotide comprising a nucleotide sequence encoding the light chain of C49 (SEQ ID NO: 1 1).
In certain embodiments, the composition comprises a binding domain, as described herein, and a bacteriophage. For example, in one embodiment, the composition comprises a bacteriophage that expresses the binding domain, for example, on the surface of the bacteriophage. As would be understood by those skilled in the art, any bacteriophage, including any species of bacteriophage, may be used. For example, in one embodiment, the bacteriophage is a helper phage. In one embodiment, the bacteriophage is a filamentous phage, including for example Ml 3 and derivatives or variants thereof. In one embodiment, the bacteriophage is T7 phage.
In some embodiments, the composition includes at least one additional ingredient. In some embodiments, the additional ingredient is at least one of an aerosolizing medium, a sprayable medium, a cross-linker, a support surface, a fiber, a foam medium, a pharmaceutically acceptable carrier, a lotion, and/or a nutritionally acceptable carrier (including, for example, food and/or beverages, mouthwash, lozenges, items for ingestions, and/or items that are generally regarded as safe
(GRAS). In some embodiments, the composition includes two or more of the listed additional ingredients.
In some embodiments, the composition can be part of a device. In some embodiments, at least composition is immobilized on the support surface. In some embodiments, the composition is cross-linked to the support surface. In some embodiments, the composition is embedded in the support surface. In some embodiments, the composition is covalently tethered to the support surface. In some embodiments, the composition includes a magnetic material, and is immobilized on the support surface by an electromagnetic force. In some embodiments, the composition includes (and/or is attached to) a binding partner of a molecule that is on the support surface, and is immobilized on the support surface through the association of the molecule and its binding partner. In some embodiments, the composition includes a ligand of a receptor on the support surface, and is immobilized on the support surface through the binding of the ligand and receptor. In some embodiments, the composition can be associated and/or immobilized on the support surface in any number of ways. In embodiments in which a liquid is present, the composition need not be immobilized in all embodiments. Thus, for example, if a wet filter is present, the antibody can be contained within the solution and/or the wet filter.
Method of detecting a nanomaterial
In one embodiment, the present invention includes a method of detecting the presence of a nanomaterial in biological systems. In one embodiment, the method comprises detecting the location of a nanomaterial in biological systems. The invention includes the use of the NProbe, described elsewhere herein, to detect the presence or location of a nanomaterial in a diagnostic assay, toxicity assay, safety assay, quality assay, environmental contamination assay, and the like. For example, in certain embodiments, the present invention is used to assess the safety and toxicity of a nanomaterial or of a commercial, pharmaceutical, cosmetic, or industrial product comprising a nanomaterial. In another embodiment, the method is used in a diagnostic assay to indicate that the nanomaterial is present within a subject. In certain aspects, the method is used to monitor the presence of nanomaterials used in nanomedicine therapeutic regimens, which can thus be used in the determination of how the regimen proceeds. For example, in certain embodiments, the method comprises detecting a nanomaterial in samples obtained over time, to determine how the nanomaterials used in the nanomedicine regimen are processed by the body. In one embodiment, the method may thus be used to assess the safety of the nanomedicine regimen, or to augment the regimen based upon safety concerns.
In one embodiment, the present method is used as a toxicity or safety assay to evaluate, for example, the skin permeation, body retention, or body clearance of a nanomaterial or product comprising a nanomaterial. In certain embodiments, such an assay is performed on research subjects, including, for example, mice, rats, cats, dogs, fish, reptiles, amphibians, monkeys, humans, and the like.
In another aspect, the present invention provides a method of detecting the presence or location of a nanomaterial in a sample with the use of the NProbe composition of the present invention.
The detection used herein includes quantitative detection and non- quantitative detection. The non-quantitative detection include, for example, determination of merely whether or not a nanomaterial is present, determination of whether or not a specific amount or more of a nanomaterial is present, determination for comparison of the amount of nanomaterial with that of another sample (e.g., a control sample). The quantitative detection includes determination of the
concentration of nanomaterial, and the determination of the amount of nanomaterial.
The present invention encompasses detection of a nanomaterial, with use of the NProbe composition described elsewhere herein, in vitro, ex vivo, or in vivo. In one embodiment, the method comprises detecting the presence or location of the nanomaterial in an excised tissue sample or biopsied tissue sample. In certain embodiment, in vivo detection of a nanomaterial comprises administering a composition comprising the NProbe of the invention to the subject. Administration of the composition comprising the NProbe may be performed by any suitable method, including, for example, orally, transarterially, subcutaneous ly, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, by inhalation, or intraperitoneally. The composition comprising the NProbe may be, for example, a pharmaceutical composition.
The test sample is not particularly limited as long as it is a sample that may contain the nanomaterial. In one embodiment, a sample collected from the body of a subject. In certain embodiments, the subject is a reptile, bird, amphibian, or fish. In one embodiment the subject is a mammal. In certain embodiments, the subject is a mouse, rat, hamster, guinea pig, cat, dog, monkey, horse, cow, and the like. In one embodiment, the subject is a human. Specific examples of the test sample may include solid or fluid tissue samples. Fluid tissue samples include for example, blood, interstitial fluid, plasma, extravascular fluid, cerebral fluid, joint fluid, pleural fluid, serum, lymph fluid, saliva. Exemplary solid tissue samples include for example, skin, muscle, heart, lung, lymph node, liver, kidney, intestinal layers, brain, and the like. In certain embodiments, the sample is a skin sample, including, for example a sample taken from the epidermis, stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, stratum germinativum, dermis, hypodermis, basement membrane, or a combination thereof. In one embodiment, the method comprises detecting the presence of the nanomaterial in a sample comprising a basal keratinocyte. In addition, a sample obtained from the test sample such as culture solution of cells collected from the body of the living organism is also included in the test sample of the present invention.
In one embodiment, the method comprises the detection of a nanomaterial in an environmental or ecological system. For example, in certain embodiments, the test sample is a sample of water, soil, fungi, bacteria, algae, plant, wildlife, and the like. In certain embodiments, the method provides for the ability to
detect the presence and amount of contaminating nanomaterials in the environment or in a particular ecosystem.
The method of detecting the nanomaterial contained in a test sample is not particularly limited, however, detection is preferably performed by an
immunological method with the use of an NProbe composition, as described elsewhere herein. Examples of the immunological method include, for example, a radioimmunoassay, an enzyme immunoassay, a fluorescence immunoassay, a luminescence immunoassay, immunoprecipitation, a turbidimetric immunoassay. In one embodiment, the assay is an enzyme immunoassay, for example an enzyme- linked immunosorbent assay (ELISA) (e.g., a sandwich ELISA). In another embodiment, the assay is a fluorescent-linked immunosorbent assay (FLISA). In another embodiment, the assay is a flow cytometry assay. The above-mentioned methods can be carried out by a method known to those skilled in the art.
A general detection method with the use of an NProbe comprises immobilizing an NProbe on a support, adding a test sample thereto, incubating the support to allow the NProbe and nanomaterial to bind to each other, washing the support, and detecting the binding to the support via the NProbe to detect
nanomaterial in a test sample.
The binding between the NProbe and the nanomaterial is generally carried out in a buffer. Buffers used in the invention include, for example, a phosphate buffer, a Tris buffer. Incubation is carried out under the conditions generally employed, for example, at 4°C to room temperature for 1 hour to 24 hours. The washing after incubation can be carried out by any method as long as it does not inhibit the binding between the nanomaterial and the NProbe, using for example a buffer containing a surfactant such as Tween 20.
In the method of detecting a nanomaterial of the present invention, a control sample may be provided in addition to a test sample to be tested for the presence of the nanomaterial. The control samples include a negative control sample that does not contain the nanomaterial and a positive control sample that contains the nanomaterial. In this case, it is possible to detect the nanomaterial in the test sample by comparing the result obtained with the negative control sample that does not contain the nanomaterial with the result obtained with the positive control sample that contains the nanomaterial. It is also possible to quantitatively detect nanomaterial
contained in the test sample by obtaining the detection results of the control samples and the test sample as numerical values, and comparing these numerical values.
One embodiment of detecting nanomaterial via an NProbe is a method using an NProbe comprising a detectable tag or label. For example, the nanomaterial may be detected by contacting the test sample with an NProbe and then detecting a NProbe-nanomaterial complex with the use of the labeled antibody that specifically binds to the nanomaterial, NProbe, or complex.
The labeling of an NProbe can be carried out by a generally known method. Examples of the detectable label known to those skilled in the art include a fluorescent dye, an enzyme, a coenzyme, a chemiluminescent substance or a radioactive substance. Specific examples may include radioisotopes (32P, 14C, 1251, 3H, 131I and the like), fluorescein, rhodamine, dansyl chloride, umbelliferone, luciferase, peroxidase, alkaline phosphatase, beta-galactosidase, beta-glucosidase, horseradish peroxidase, glucoamylase, lysozyme, saccharide oxidase, microperoxidase, biotin and the like. In the case where biotin is used as a detectable label, it is preferred that a biotin-labeled antibody is added, and then avidin conjugated to an enzyme such as alkaline phosphatase is further added.
The detection of the nanomaterial can be carried out by a method known to those skilled in the art. For example, in the case where the antibody is labeled with a radioactive substance, the nanomaterial may be detected by liquid scintillation or the RIA method. In the case where the antibody is labeled with an enzyme, the nanomaterial may be detected by adding a substrate and detecting an enzymatic change of the substrate such as color development with an absorbance reader. In the case where the antibody is labeled with a fluorescent substance, the nanomaterial may be detected with the use of a fluorometer.
In one embodiment, the method uses an NProbe labeled with biotin. After the sample is suitably prepared the biotin-labeled NProbe is added. After being incubated appropriately, avidin conjugated to an enzyme such as alkaline phosphatase or peroxidase is added. After being incubated, a substrate of the enzyme conjugated to avidin is added. Then, nanomaterial is detected by means of the enzymatic change of the substrate as an indicator.
Another embodiment of the method of detecting NProbe of the present invention is a method using an NProbe that specifically binds to the nanomaterial and a secondary antibody that specifically binds to the NProbe. In one embodiment, the
NProbe comprises a tag that serves as an epitope for the secondary antibody. In this case, the secondary antibody is preferably labeled with a detectable label. In one embodiment, the NProbe comprises a FLAG tag, while a secondary anti-FLAG antibody, tagged with an enzyme, for example alkaline phosphatase, is used to bind to the NProbe-nanomaterial complex. The detection of the secondary antibody can be carried out by the above-mentioned method.
EXPERIMENTAL EXAMPLES
The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred
embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
Example 1 : Development of NProbes using phage display to selected commercially important nanomaterials.
Engineered nanomaterials with their multitude of industrial and consumer applications (Hansen et al, 2008, Ecotoxicology 17(5):438-447) have raised concerns for EH&S due to long term chronic low dose exposure and inevitable human contact of nanomaterials. Better detection of nanomaterials in biological systems is important, and overcoming any technological and experimental challenges for the same is key.
In order to minimize unintentional exposure to nanomaterials that can cause detrimental side effects in humans, understanding nanomaterial-tissue interaction is an urgent need (DeLouise, 2012, J Invest Dermatol 132(3 Pt 2):964-975; De Jong and Borm, 2008, Int J Nanomedicine 3(2): 133-149). Most metal oxides and semiconductor nanomaterials or nanoparticles are sparingly soluble but their long
term presence causes toxic side effects (DeLouise, 2012, J Invest Dermatol 132(3 Pt 2):964-975), such as reactive oxygen species generation (Long et al, 2006, Environ Sci Technol 40(14):4346-4352), exposure of cryptic epitopes (Lynch et al, 2006, Sci STKE 2006(327):pel4), and cytotoxicity (Trouiller et al, 2009, Cancer Res
69(22):8784-8789; Jin et al., 2008, Chem Res Toxicol 21(9): 1871-1877). An improvement in detection abilities is necessary in order to quantify low doses due to long-term chronic nanomaterial exposure rather than the acute high exposure nanomaterial models, often employed by researchers, as the former is more likely and elicits a long term response in humans. Confocal microcopy although routinely used, cannot be used for non- fluorescent nanomaterials without add-ons and fails to accurately quantify levels of fluorescent nanomaterials above background (Mortensen et al, 2010, J Biomed Nanotechnol 6(5):596-604). Non-fluorescent nanomaterials are often mistaken for cellular vesicles or glycogen granules (Muhlfeld et al, 2007, Part Fibre Toxicol 4(1 1)) during detection, rendering the data on nanomaterial occurrences in tissue questionable.
Presented herein is the development of specific reagents (NProbes) using phage display of scFv antibodies to commercially important NPs such as QDs, T1O2 and Au, to enable their improved detection. Binding capability of the NProbes is tested using custom-designed in vitro assays and their specificity is ascertained by testing their cross-reactivity to other commercially available nanomaterials of a similar composition. A monovalent scFv phage display library with ~2xl09 unique clones is used to select for specific binders by employing a technique called biopanning, which comprises of repeated centrifugal washes to enrich for binders, thereby washing away unbound phages. Bound phages are recovered and regrown for several iterative rounds of enrichment and individual binding clones are identified by sequence analysis. Specific binding scFvs are expressed as free proteins and purified for use in experiments. The identified scFvs can be used as antibodies in IHC with a secondary enzyme-based antibody detection system to detect nanomaterials (antigens) in tissue sections, thus providing a tool to transform nanomaterial research. The biopanning technique using phage display, as described herein, has the advantage of providing the opportunity to discover reagents that bind to nanomaterial based on shape as well as composition, Moreover nanomaterial immunogenicity is not a requirement for enrichment of reagents using in vitro display technology. While not wishing to be bound by any particular theory, nanomaterial properties, nanomaterial
agglomeration state, and dispersant properties may dictate binding capability, specificity and cross-reactivity of the scFv antibodies.
The experiments and screening method described herein utilizes a phage display antibody library comprising of ~2xl09 unique clones in scFv format, which has been previously used to generate antibodies against proteins (Denny et al., 2008, J Proteome Res 7(5): 1994-2006), haptens (Wuertzer et al, 2008, Mol Ther 16(3):481-486) and cell surface antigens (Haidaris et al, 2001, J Immunol Methods 257(1-2): 185-202). Presented herein is the screening and identification of scFv binders to highly dispersed nanomaterials of commercial importance.
The scFv (Figure 1) library composed of ~2xl09 unique clones has been used to generate antibodies against a variety of proteins and antigens (Haidaris et al, 2001, J Immunol Methods 257(l-2): 185-202; Shea et al, 2005, J Struct Funct Genomics 6(2-3): 171-175; Wuertzer et al, 2008, Mol Ther 16(3):481-486). The use of scFv libraries allow for increased area of interaction and rigidity, and hence generates binders to nanomaterials with higher affinity and specificity, as opposed to those generated by peptide libraries with restricted binding due to their limited amino acid sequences. Binders are generated through rounds of affinity selection (bio- panning) process (Sparks, A.B., Adey, N.B., Cwirla, S. and Kay, B.K. 1996.
Screening phage-displayed random peptide libraries. In: B.K. Kay, J. Winter and J. McCafferty (eds.), Affinity selection-based enrichment protocols (bio-panning) allow for the selection of specific phage binders to nanomaterials. The generated NProbes are a new useful tool to accurately detect nanomaterial presence in tissue, their penetration mechanism and translocation fate even in systemic tissues in vivo. The biopanning method described herein allows for the generation of a reagent tool kit that will enable the enhanced detection of different types of nanomaterials in tissues as well as in the environment to aid in the assessment of nanomaterial associated EH&S risk.
The present studies also describe the evaluation of the specificity and cross-reactivity of the selected purified scFvs to nanomaterials using dot blot analysis, FLISA (fluorescence-linked immunosorbent assay) (Esteve-Turrillas and Abad- Fuentes, 2013, Biosens Bioelectron 41 : 12-29), DLS, TEM, BCA and sandwich ELISA. nanomaterials used in the study include QDs (CdSe- ZnS core-shell, 605 nm emission, Labs) rendered negatively charged (- 26.2 mV, glutathione (GSH) coated) and water-soluble (hydrodynamic diameter ~14 nm) by modifying their
surface chemistry using ligand exchange (Ravichandran et al., 2011, Nanotoxicology 5(4):675-865), T1O2 (Aeroxide P25 anatase (80%) and rutile phases (20%), -21 nm, Evonik), and Au nanomaterial (tannic acid coated NanoXact™ gold, 5 and 50 nm, Nanocomposix Inc.).
Selection of specific phage binders to nanomaterials
The process of bio-panning begins with nanomaterials to be dispersed in TBS buffer (50 nM Tris HC1, 150 nM NaCl, pH 7.5), for which sonication (~5 sees) and vortexing is useful to maintain colloidal dispersion (Chen et al, 2006, Analytical Chemistry 78(14):4872-4879; Denny et al, 2008, J Proteome Res
7(5): 1994-2006). Although QDs and Au nanomaterials tend to be stable in this buffer, and show little agglomeration, TiC available in a powdered form is known to aggregate and agglomerate (Meifiner et al, 2009, Journal of Physics:Conference Series 170(2009):012012).
A centrifugal washing technique described previously (Chen et al,
2006, Analytical Chemistry 78(14):4872-4879), allows for enrichment of specific phage binders from the scFv library of ~2xl09 unique clones. This method first involves optimization of centrifugal speeds, which depends upon the type of nanomaterial used, its agglomeration properties and size. The speed is chosen in such a way that the particles are not too tightly pelleted to allow for resuspension during wash steps. In these studies, for GSH QDs (100 nM), a speed of 55,000 rpm (108,000 g, 10 min) was chosen as optimum, whereas for T1O2 nanoparticles (1 mg/mL), a speed of 1300 g (5 min) was found optimal for bio-panning.
A baseline binding level is established using an arbitrary single clone phage before proceeding to use the entire diverse phage library for each nanomaterial. The phage library (containing 0.5% casein block, diluted 1 :5 in TBS) is mixed with target nanomaterials in TBS at room temperature for 2 hours with gentle agitation, following which the unbound phage are removed from the solution by repeated centrifugation and resuspension of pellet in TBS containing 0.5% Tween 20 (TBST).
The bound phages are eluted using 0.1 M Glycine (pH 2.2) and neutralized using 2 M Tris base. To prepare phage pools for the next round, the eluate is transduced into fresh log phase TGI cells at 37°C and ampicillin resistant transductants are plated. The colonies are grown in suspension, infected with helper phage (2 hours, 37°C) followed by growth overnight at 30°C, after which phage
stocks are prepared by precipitation with polyethylene glycol 8000 and resuspension in 0.5% casein in TBS. A similar protocol is used with Au nanoparticles (5 and 50 nm) to isolate NProbes after initial optimization of centrifugal washes and speeds. Typically, 4 rounds of panning are necessary to select for specific binders to target nanomaterials, after which a BsTN-1 fingerprinting is performed to identify 'pattern repeats', indicative of clone enrichment. This method is used to rapidly and inexpensively reduce the number of clones to a minimum, before proceeding to DNA sequencing. The number of binders obtained is calculated based on the number of different repeating patterns among randomly picked colonies (-12-20). In studies with GSH QDs, 3 repeats among 12 colonies were observed, thereby implying 25% abundance of the binder (Figure 2, boxes indicating repeats). It is important to note that all clones are enriched and that abundance does not necessarily imply highest affinity and selectivity.
Phage stocks were prepared from the individual clones for testing their binding with the target nanomaterial relative to an arbitrary clone (phage stock of clone selected from the library on an unrelated target). Studies demonstrated that binder C43 obtained for GSH QDs showed a 10-fold increase (n=2) over baseline binding of a clone isolated against lactoferrin-A, while binder C49 (Figure 2, boxes) isolated against T1O2 nanoparticle showed a 100-fold increase (n=2) in binding strength compared to background (clone isolated against IL-12) (Figure 22). These values are in accordance with those reported in literature for isolating specific peptides against ZnO (Rothenstein et al, 2012, J Am Chem Soc 134(30): 12547- 12556) using phage display.
A second pelleting method was used for GSH QDs in order to find scFvs exhibiting more than 10-fold enrichment over background. In this method, after incubation of the nanomaterials with the phage library, unbound phages are washed away using a repeated centrifugation and resuspension process in TBST containing 1 M MgCi2.6H20 salt. This technique allows for usage of lower speeds of
centrifugation (-30,000 g), thereby aiding in avoiding any potential detrimental effects to phage and preventing precipitation of non-binding phage, caused due to use of higher speeds. At the end of four rounds of panning GSH QDs using salt, three binders were identified, C2, C3 and C4, which exhibited more than 100-fold binding differential compared to baseline binding using a single random phage from the library (Figure 13). Panning binder phages with other QDs, along with a random
phage from the library serves as an assay to test cross-reactivity of the binder phages. All selected binders are tested for in vitro binding to target nanomaterials and cross- reactivity to other nanomaterials using the custom-designed assays elsewhere herein. NProbe testing for binding, specificity and cross-reactivity
The use of NProbes as a tool to aid researchers in the identification and detection of various types of nanomaterials depends on their binding specificity to the target nanomaterials, and cross-reactivity to other nanomaterials. For testing cross- reactivity of NProbes generated against GSH QDs, T1O2 nanoparticles and Au nanoparticles (5 and 50 nm, Nanocomposix Inc.), QDs of a similar charge, size and different surface chemistry (dihydrolipoic acid (DHLA) QD) and similarly charged Invitrogen 565 ITK QDs (carboxylated, 565 nm emission), T1O2 nanoparticles from other vendors (Anatase and Rutile phases, Sun Innovations Inc.), and Au nanoparticle powder (Sigma Aldrich, particle size <10 μιη) are used, respectively.
Dot blot assay: For testing binding of NProbes with GSH QDs, 1 μΐ, of GSH QDs of different concentrations (0.5-50 nM) are blotted on a nitrocellulose membrane. The membrane is blocked for 1 hour at room temperature using 5% nonfat milk in washing buffer (0.15 M NaCl, 10 mL Tris HC1 (pH=8), 1 mL Tween 20 in water), after which it is incubated overnight at 4°C with primary antibodies (C43 scFv) at a concentration of 4 μg/mL in blocking buffer. The membrane is washed 3x with wash buffer for 5 min each and anti-flag HRP secondary antibody is added to the membrane at a dilution of 1 :2000 in blocking buffer. The membrane is incubated with a chemiluminescent substrate for 5 min and developed using an x-ray film. Results from the assay demonstrated that spots developed and co-localized with GSH QDs (4.3 μΜ) indicating binding of the NProbe (Figure 3; see Figure 14 for 50 nM).
Cross-reactivity of all the NProbes against GSH QD to DHLA QDs and Invitrogen carboxylated QDs were tested using the above method. Results showed high specificity of the QD binders as spots only co-localized with GSH QDs, and not DHLA, Invitrogen QDs and negatively charged Au nanoparticles (Figure 3).
Moreover, an arbitrary clone tested did not bind any of the nanomaterials (Figure 3, top-right).
TEM analysis: A specific concentration of nanomaterials (50 nM of GSH QDs and 1 mg/mL of TiC nanoparticles) are mixed with each of their specific binder phages for 2 hours at room temperature, after which they are centrifuged to wash away unbound phages (TBST). The pellet is resuspended in TBS buffer and samples prepared for TEM analysis (Electron Microscopy Core, URMC). Results showed binding of C2 (Figure 4), C3 and C4 phages (Figure 15) to QDs (arrow), whereas a random single clone phage (against lactoferrin-A) does not. Binding of C49 phages (arrows) to T1O2 nanoparticles was also observed, whereas a random phage control (against IL-12) did not bind, proving specificity and binding ability of the C49 binder (Figure 5) to TiC nanoparticles. A similar protocol is used for Au
nanoparticles to show binding with specific phages, isolated using phage display.
F LIS A/Sandwich ELISA: For FLISA, binder scFvs are non-specifically coated overnight at 4°C on high binding plates (input concentration 0.065 mg/mL), after which the plates are washed 2x with TBST, and blocked with 2% bovine serum albumin (BSA) in TBS for 20 min. 50 nM GSH GDs in TBS are added to the coated plates and allowed to incubate at room temperature for 2 hours. The plates are then washed 3x with TBST and imaged under a fluorescent microscope, which uses a narrow emission (620 nm, band pass= 10 nm) filter for imaging QDs. Images are obtained at a 4x magnification and analyzed using Image J (NIH). Threshold values were limited to 225- 250 pixels for quantification of QDs. An example is shown in Figure 6, where a 'no scFv' condition (wells incubated with TBS alone) was used to subtract background fluorescence, after which all values were normalized to the arbitrary scFv (BiP) control. Results showed significant binding (n=3 experiments, 3 wells/condition) of GSH QDs to NProbes isolated against them (C2, C3, C4, C43). The experiment is replicated a number of times based on a power analysis (a=0.05, 1- β>0.8, n=4).
This technique also aids in understanding trends of NProbe binding QDs with increasing QD concentrations (12.5, 25, 50 and 100 nM). Trends were observed using a plate reader (green optical kit, ex: 525, em: 580-640 nm, Figure 16). Using FLISA, cross-reactivity assays are performed to test NProbes specific against GSH QDs, with DHLA QDs and Invitrogen carboxylated QDs, and the magnitude of binding is tested using an unpaired Student's t-test. For non-fluorescent nanomaterials (TiC and Au nanoparticles), the technique is modified to a sandwich ELISA, where
after addition of nanomaterials to scFv coated wells (coating antibody), a known concentration of nanomaterials is added. The same specific scFvs are then added (capture antibody) to aid in binding of a secondary enzyme-tagged antibody (alkaline phosphatase (AP) tagged anti-flag). A chromogenic substrate is added to the wells, after which absorbance values are obtained using a plate reader. NProbe binding trends with different concentrations of nanomaterials are established. Sandwich ELISA assay using NProbes are also performed for testing cross-reactivity with respective nanomaterials of similar composition. DLS assay: Binder scFvs (0.025 mg/mL) are mixed with 50 nM GSH
QDs for 2 hours at room temperature, after which unbound scFvs are washed away by centrifuging the samples at 55,000 rpm for 10 min. The pellets are resuspended in TBS buffer, after which their hydrodynamic diameter is measured using Malvern Zetasizer. Results showed that GSH QD bound to scFvs showed a significant increase (pO.001) in size (Figure 7), when compared to GSH QD in TBS buffer or GSH QD bound to a random scFv (controls). A shift in the histograms (towards right) was observed indicating an increase in size of GSH QDs bound to scFvs (Figure 17) compared to controls. This method of observing a change in size upon scFv binding is also used for Au nanoparticles. The same assay is used to obtain insights on the cross- reactivity aspect of the binder scFvs against GSH QDs and Au nanoparticles to nanomaterials of a similar composition (DHLA and Invitrogen QDs, and 5 and 50 nm Au nanoparticles).
BCA protein assay: For non-fluorescent nanomaterials, binder scFvs to T1O2 and Au nanoparticles are isolated, and their binding and cross-reactivity is tested using a BCA assay. In this assay, nanomaterials of different concentrations are incubated with scFvs (0.065 mg/mL), after which scFvs bound to nanomaterials are pelleted using optimal centrifugation speeds. The unbound scFv-containing supernatant are removed and tested for protein (scFv) content using a BCA protein assay kit along with BSA standards. Unknown protein concentration in the supernatant is calculated and subtracted from the input concentration to yield amounts of scFv bound to different concentrations of nanomaterials. The same assay is used with other nanomaterials of similar composition to test cross-reactivity of the NProbes obtained.
The assays described above determine specificity and cross-reactivity of the scFvs to various nanomaterials. If the NProbes isolated against GSH QDs bind DHLA QDs weakly (~ 10-fold more binding than baseline, Figure 18), then it can be concluded that the binding is influenced by nanomaterial charge or that the scFvs are specific to the core of the QD rather than the surface chemistry. This is also tested with commercial Invitrogen QDs, and the use of assays such as FLISA and DLS for potential cross-reactivity. Moreover, binding curves are established using sandwich ELISA with C49 scFv isolated against T1O2 nanoparticles, and those that are isolated for Au nanoparticles. The dependence of nanomaterial agglomeration state on binding is an important factor to be tested, as the NProbes would be used in a biological application setting where nanomaterial agglomeration is highly pertinent (Lynch et al, 2007, Adv Colloid Interface Sci 134-135: 167-174). Low cross-reactivity of NProbes is indicative of the binding being dependent on nanomaterial agglomeration properties. Using the above mentioned techniques, questions pertaining to the scFv- nanomaterial binding interaction whether to agglomerates or single nanomaterials, are resolved.
Methods described herein for isolation and purification of scFvs, depend upon the type of nanomaterial used, its charge, agglomeration state and surface chemistry. Therefore, optimization in terms of speeds used to pellet nanomaterials bound to phages; selection to agglomerates or dispersed single nanomaterials; use of 'salting-out' to separate bound and unbound phages; and lesser amplification compared to routinely observed levels of 500-5000-fold with protein targets; is necessary. Should there be an absence of binders in the scFv library (polyethyleneimine QDs, n=3 with different wash and pelleting techniques, and Invitrogen 565 nm ITK QDs, n=2, where no enrichment was found after round 2), a diversity library utilizing a fibronectin (FN)-derived scaffold, to complement the antibody library to bind nanomaterial targets is used. This library is based on the tenth type III domain of human FN (Koide et al, 1998, J Mol Biol 284(4): 1141-1 151) comprised of -lxlO9 clones with two surface exposed loops of the protein partially randomized, and has been shown to generate binders for various molecules.
Misleading cross-reactivity results from the above mentioned assays such as FLISA due to the possible low binding of scFvs to the plates is tested by using biotinylated scFvs to aid in binding to a streptavidin coated plate. This decreases any variability in data observed due to possible hidden nanomaterial binding sites based on scFv
orientation on the plate and ensure good repeatability of results, thereby aiding in better understanding of their cross-reactivity properties.
Example 2: Use of NProbes for detection of nanomaterial stratum corneum (SO penetration and localization using an ex vivo human skin model.
Skin is the largest organ of the body, and acts as an outside-in and an inside-out barrier. Inevitable human exposure to nanomaterials has caused safety concerns as they have the potential to penetrate the SC and contact viable
keratinocytes (Monteiro-Riviere et al, 2011, Toxicol Sci 123(l):264-280). The nanomaterials in a biological environment interact with proteins and other components (Monteiro-Riviere et al, 201 1, Toxicol Sci 123(l):264-280), and the validation of NProbes lies in the detection of these nanomaterials in the biological milieu. Detection of nanomaterials in the epidermal and dermal layers of skin will resolve many current discrepancies in results associated with the use of conventional microscopic techniques to detect fluorescent (Ravichandran et al, 2011,
Nanotoxicology 5(4):675-865; Zhang and Monteiro-Riviere, 2008, Skin Pharmacol Appl 21 : 166-180) and non-fluorescent nanomaterials (Kerte'sz et al, 2005, Nucl Instrum Methods Phys Res B 231 :280-285; Kiss et al, 2007, Exp. Dermatol. 17:659- 667).
It is demonstrated herein that NProbes may be used as a tool to detect both fluorescent and non-fluorescent nanomaterials in human tissue, and to further quantify nanomaterial localization in tissue using standard techniques, thereby validating the use of NProbes as a superior nanomaterial detection method.
Nanomaterial translocation to the viable epidermal layers, namely the basal keratinocytes would imply shuttling of nanomaterials to systemic circulation, thereby increasing safety concerns with the use of nanomaterial-containing commercial products. Detection and quantification of nanomaterials associated with basal cells are of utmost importance, as those associated with suprabasal cells ultimately get sloughed off. It is expected that nanomaterials that are able to breech the SC barrier are able to diffuse to and be taken up by basal keratinocytes and/or enter ciruculation, which might pose a risk to human health. Flow cytometry is used along with keratin markers to assess nanomaterial localization (K14 for basal cells (Green et al, 2003, Proc Natl Acad Sci USA 100(26): 15625-30) and K10 for suprabasal cells (Poumay
and Pittelkow, 1995, J Invest Dermatol 104(2):271-6)), and results are correlated to that obtained with the use of NProbes.
Detection of both fluorescent (Ravichandran et al, 201 1, Nanotoxicology 5(4):675-865; Zhang and Monteiro-Riviere, 2008, Skin Pharmacol Appl 21 : 166-180) and non- fluorescent nanomaterials (Monteiro-Riviere et al, 2011, Toxicol Sci 123(l):264-280) has been a challenge due to discrepancy in results when using conventional microscopic techniques such as TEM and fluorescence microscopy. Although conflicting results on nanomaterial skin penetration based on nanomaterial type and size are found, collective studies show that nanomaterial penetration into the viable layers of the skin occurs when the SC is compromised (Prow et al, 2012, Nanotoxicology 6(2): 173-185) (flexing, tape stripping, abrasion). This implies that nanomaterial contact to wounded or diseased areas of skin is likely to cause an increase in penetration of nanomaterials into skin (viable epidermis) (Prow et al, 2012, Nanotoxicology 6(2): 173-185). Moreover, nanomaterials undergo a transformation in a biological environment when they come in contact with the different biomolecules present therein, which alters nanomaterial properties such as agglomeration state (Prow et al, 2012, Nanotoxicology 6(2): 173-185), and the way they interact with the cells (Nystrom and Fadeel, 2012, J Control Release 161(2):403- 408). Tape-stripping combined with elemental analysis is commonly used to quantify nanomaterial skin penetration based on a depth profile, however, it is a destructive technique and does not provide mechanistic information at the cellular level
(Lademann et al, 2009, Eur J Pharm Biopharm 72(2):317-23).Therefore, the present studies utilize specific NProbes to identify NPs in tissues that may be modified by the tissue environment using ex vivo human skin, and use flow cytometry to obtain quantitative data on nanomaterial-NProbe binding and association to skin cells. Flow cytometry has been previously shown to demonstrate an increase in QD penetration in barrier defected skin (Figure 19) (Ravichandran et al, 201 1, Nanotoxicology
5(4):675-865).
Use of NProbes is demonstrated using histology, where fluorescent and non-fluorescent nanomaterials bind the specific NProbes in a tissue environment, and quantification of nanomaterial association with different epidermal cells is done using flow cytometry. Proposed nanomaterials include negatively charged GSH QDs, T1O2 and negatively charged Au nanoparticles (tannic acid coated). For all experiments fresh viable human skin from adult donors is obtained following abdominoplasty or
mammoplasty within hours of surgery. The skin is washed thrice with IX PBS and treated with fungizone to remove any microbial contamination. Skin is processed using standard methods (Ravichandran et al, 201 1, Nanotoxicology 5(4):675-865) to remove fat and thin the dermis for easy handling. The samples are placed on gauze in a sterile petri dish filled with media (5-8 mL) to keep the skin viable. Nanomaterials (QDs) in water are applied on to skin in quantities lesser than those routinely used for cosmetic testing by pipetting, and spreading them evenly on the epidermal side of the skin surface. For T1O2 nanoparticles (1 wt. % NPs in 2 mg/cm2 sunscreen applied for testing), 0.02 mg/cm2 nanoparticles is applied in water. Typically nanoparticles formulated into sunscreen lotions range from 2 to 30 wt%. Lotions are typically tested at about 2mg/cm2. Thus, typical exposure would be between 0.04 to 0.6 mg/cm2. A commercial sunscreen is also tested with NProbes specific to T1O2 nanoparticles. Skin samples remain in the sterile hood for 24 hours, after which excess nanomaterials are wiped off the skin surface using IX PBS. The skin is processed depending upon the experiment as described below.
NProbe in tissue histology for various nanomaterials
Binding of NProbes (scFvs) specific to various nanomaterials isolated as described elsewhere herein are tested in a tissue environment using a secondary anti-flag antibody conjugated to AP. A color (bluish-purple) produced upon addition of a substrate for AP indicates binding of primary antibody (scFvs) to target nanomaterials (antigens) tissue sections. Using this method (color appearance), and varying the substrate application times presence of sparse populations of
nanomaterials (even isolated single nanomaterials), which cannot be observed using conventional microscopic techniques, are detected.
Binding specificity: Skin samples with and without nanomaterials are processed for histology by keeping them frozen (-80°C) until use. Frozen skin is mounted using TEK OCT compound, after which they are sliced (5 μιη thickness) on to microscope slides using a cryostat (Thermo Scientific). The epidermis and the dermis are sectioned simultaneously to prevent accidental transfer of nanomaterials to the blade (red arrow, Figure 20). The slides are fixed in methanol (-20°C, 10 min) prior to the experiment. After washing with IX TBS, an immuno-edge pen is used to mark boundaries to contain all antibody solutions within the slide. The slides are
blocked with 2% BSA in TBS for 20 min, after which they are incubated overnight with scFvs (~20 μg/mL) in 2% BSA at 4°C in a humidified chamber. The slides are then washed 3x with TBST and incubated with anti-flag antibody conjugated to AP (-1.5 μg/mL) for 1 hour at room temperature. After washing away excess antibodies, the slides are incubated with BCIP/NBT substrate for AP containing 5 mM levamisole for 30 min at room temperature. Levamisole is an endogenous AP inhibitor, thereby allowing for the quantification of AP staining due to the binding of scFv-anti-flag (AP tagged) secondary antibody alone. Excess substrate solution is washed off with deionized water (2x, 5 min each) and the slides are mounted for imaging. A fluorescence microscope with appropriate filter sets is used to obtain images of tissue sections containing QDs, and scFv binding to nanomaterials based on a color appearance (BCIP/NBT) is examined under brightfield. An example is shown in Figure 8, where endogenous AP has been suppressed using levamisole inhibitor in the BCIP/NBT substrate (Figure 21), and QD co-localization with C2 scFv (represented by bluish-purple AP staining), and no AP staining in the 'no QD' control sample is observed. Varying substrate incubation times will result in signal amplification, and allow us to visualize even those sparse QDs not detectable under fluorescence (30 min, Figure 8, black arrows). This is tested using different time points of substrate incubation such as 5, 15, 30 and 60 min. For non-fluorescent nanomaterials, samples with and without nanomaterials are compared to examine scFv-nanomaterial binding. As an example, even though samples without nanomaterials (control) in Figure 9 were treated the same way as mentioned above (all images thresholded the same in Image J), no AP staining was discernible in the control specimen (Figure 9), while treated samples- TiC nanoparticles in water and a sunscreen containing TiC nanoparticles showed AP staining in the SC and other epidermal layers (Figure 9, red arrows). Positive controls such as nanomaterial application on dermis side of skin and nanomaterial injection into skin (40°) are included in experiments. Moreover, specificity of NProbes in terms of binding to intact nanomaterials rather than soluble ions or elemental metal is tested by applying cadmium chloride salt (CdCk), zinc sulfide, or other salts (for testing specificity to intact QDs) and titanium bromide salt (TiBr4) (for testing specificity to intact TiC nanoparticles) on skin, and performing IHC experiments as mentioned above with the use of the NProbes.
Quantification of co-localization: To prove binding specificity, and use NProbes as a tool to detect different kinds of nanomaterials in tissue sections, the amount of co-localization of each fluorophore or a quantitative result indicating presence of undetectable nanomaterials using AP staining is obtained using Manders coefficient (Manders et al, 1993, J Microscopy 169(3):375-382) (Image J) values for each image. QD fluorescence (red) and AP staining (green) are considered fluorophores, and Ml and M2 are Manders coefficients, which represent the amount of fluorescence of the co-localizing objects in each component of the image relative to the total fluorescence in that component. Ml and M2 are not dependent upon the signal intensities in the two components. In the present case,
Ml =∑iQDi coloc and Ml =∑iAPi'coloc
∑iQDi ∑iAPi
where, QDi .coloc IS the amount of QDs co-localized with AP relative to the total amount of QDs, and APi,coioc is the amount of AP staining co-localized relative to the total amount of AP staining in the image. Ml and M2 vary between 0 and 1 , where 0 implies no co-localization, and 1 implies complete co-localization. The value of M2 if less than 1 implies presence of more AP staining than QDs. As an example in Figure 10, M2 value of 0.73 was obtained, thereby implying detection of those QDs with the use of NProbes (more green regions, blue arrows) that are not easily visible using conventional microscopy. A scatter plot generated shows co- localizing regions (yellow) of the two stains (Figure 10, white box), and a merge shows co-localized regions of nanomaterials and scFvs in white (yellow arrows)
Figure 23 demonstrates the ability for C43 to bind to GSH QDs as shown by IHC via AP staining and the colocalization of QDs and C43. Tracking nanomaterial skin association profiles using flow cytometry
Tape stripping is used to induce a SC defect (Bashir et al, 2001, Skin Res Technol 7(l):40-48 ) in experiments as it has been shown in previous work to decrease epidermal resistance by 80% and increase nanomaterial human skin penetration (Ravichandran et al, 201 1, Nanotoxicology 5(4):675-865). Skin is processed as above, and a barrier defect (tape strip lOx, 3M packing tape 3750) is induced prior to application of nanomaterials (QDs). The epidermis is then separated from the dermis by placing skin samples in a solution containing Dispase (1 :4 ratio in IX PBS) overnight. Dispase is a protease that gently cleaves the basement membrane
at the epidermal/dermal junction without compromising on the integrity of the epidermis. Epidermal sheets obtained are processed for flow cytometry along with keratin markers K14 and K10, which are used to differentiate between nanomaterial associated cell populations. Briefly, skin samples for each type of nanomaterial; intact and tape stripped nanomaterial samples and controls (individually stained
compensation controls, and 'no nanomaterial' samples for intact and disrupted skin) are prepared. The epidermis is placed in cell dissociation buffer (40 min, 37°C), and cells are obtained by filtering (cell strainer, 100 μιη mesh size) and centrifuging the collected buffer solution. The samples are fixed (0.01% formaldehyde), permeated (ice cold methanol, -20°C) and blocked (3% BSA), after which samples are incubated with a mixture of primary antibodies for K14 (1 : 100 dilution of rabbit anti-K14) and K10 (1 : 100 dilution of mouse anti-K10) for 2 hours at room temperature. After washing (ice cold PBS, 3x), samples are incubated with secondary antibodies (anti- rabbit Cy5.5 and anti-mouse FITC) in the dark for 1 hour. After washing, samples are resuspended in 3% formalin for analysis using flow cytometry (BD LSR-II, 18-color) using appropriate channels for QD, FITC and Cy5.5. Results are analyzed using Flow Jo, and QD localization with K10 and K14 is reported as percentage of cells associated and a fold change of median intensity over control. An example of a study investigating GSH QD association with basal and suprabasal keratinocytes of the skin and percentages associated with the same is shown in Figure 11. Results show significant (two-fold) nanomaterial association to basal cells (~7%) when the barrier was disrupted compared to intact skin (3.5%), implying potential shuttling of those nanomaterials into circulation, thereby causing long-term risk. Fluorescent nanomaterial association with skin cells: NProbes are incubated with QD containing samples by using a method similar to above (~15 μg/mL), to yield a quantitative analysis of binding of NProbes to intact QDs (GSH, DHLA and Invitrogen QDs) with the use of a fluorescent anti-flag secondary antibody in a tissue setting. For flow cytometry, controls used include GSH QD containing samples stained with fluorescent reporter antibody (no scFv condition) and single stained samples (compensation controls). Results obtained are correlated to those obtained from tissue histology.
Non-fluorescent nanomaterial association with skin cells: The above method of conjugating NProbes to QDs as a model nanomaterial, and analyzing scFv binding and nanomaterial cell association profiles in ex vivo skin using flow cytometry, is extended for use with non-fluorescent nanomaterials such as T1O2 and Au nanoparticles. Thus, NProbes provide a way to analyze binding of these nanomaterials to suprabasal and basal cells (with K14 and K10 markers) without the need for fluorescently tagging nanomaterials. Quantitative results obtained are correlated to tissue histology studies.
It is expected that NProbes bind with high specificity to intact nanomaterials in skin, which is proved when binding is observed using flow cytometry. Flow cytometry results will indicate binding, if a shift in fluorescence of the secondary antibody is observed caused by nanomaterial-scFv binding, compared to the sample without scFvs (only nanomaterials). This is tested for different NProbes specific to nanomaterials whether fluorescent or non- fluorescent, to demonstrate NProbe binding and analyze nanomaterial cell association profiles for all
nanomaterial types. Moreover, it is expected that no binding is observed of scFvs to CdCk or TiBr4 salts applied on skin using IHC. This demonstrates that NProbes bind intact nanomaterials rather than soluble ions or elemental metals. It is expected that QDs associate with a significant number of basal cells (K14) based on previous in vitro studies with primary keratinocytes (Mortensen et al, 2012, Nanotoxicology.
2012 Oct 25. [Epub ahead of print]) indicating greater nanomaterial associated risk, as these QDs potentially elicit long term toxicity effects. Demonstrated herein is the use of NProbes as a tool to qualitatively detect nanomaterials transformed in tissues, quantitatively measure localization and amount of nanomaterials present in tissue, and study nanomaterial association profiles to understand the associated risk.
All NProbes are tested to bind nanomaterials in tissue. Further, cross- reactivity to other nanomaterials of a similar composition (for GSH QDs, with DHLA QDs and Invitrogen QDs) are tested in tissues to ensure specificity to even transformed nanomaterials. Potential artifacts in cryosectioning and staining techniques are optimized by using various concentrations of scFvs to obtain a good signal of AP in order to measure co-localization with nanomaterials. Any discrepancy in results obtained with the use of scFvs are solved using positive control samples containing a large amount of nanomaterials localized in a particular region, for better visualization of AP co-localization with nanomaterials, suggesting binding to
NProbes. Other strategies include use of imaging flow cytometry (Imagestream), which allow for a visual analysis of each of the cells obtained from the skin samples, thereby aiding in better understanding nanomaterial localization and nanomaterial- NProbe binding.
Example 3: Demonstrate utility of NProbes to aid in the detection of nanomaterial systemic translocation and localization in tissues using an in vivo mouse model.
Although nanomaterials are exploited for their desirable properties in formulating day-to-day consumer products (Chen and Schluesener, 2008, Toxicol Lett 176(1): 1-12), limited attempts have been made to detect them at the doses they occur in the environment and biological systems, in order to combat the potential long-term chronic toxicity caused by these materials. They are present in textiles, antibiotics, cosmetics, sporting goods, microelectronic components and drug carriers to name a few (Hou et al, 2013, Environmental Science: Processes & Impacts 15(1): 103-122), therefore whether nanomaterials are administered for medical purposes or if humans are unintentionally exposed during occupational applications (Oberdorster et al, 2005, Environ Health Perspect 113(7):823-839), their presence may cause hazardous effects. In vivo studies using QDs have shown that nanomaterials can penetrate intact and damaged mouse skin, accumulate near hair follicles (Alvarez-Roman et al, 2004, J Control Release 99(l):53-62), and deposit in organs such as liver and kidneys (Tang et al, 2013, Sci China Life Sci 56(2): 181-188). However, use of fluorescence microscopy cannot always detect QDs in the organ slices as detection can be hindered by tissue auto fluorescence, and it does not allow the achievement of nanoscale resolution. Furthermore, TEM may not adequately distinguish QDs from cellular structures like ribosomes (Tang et al, 2013, Sci China Life Sci 56(2): 181-188), and sample analysis volume is highly limited. Presented herein are studies to qualitatively and quantitatively determine if QDs and TiC nanomaterials can penetrate skin and undergo systemic translocation following application to barrier intact and disrupted in vivo mouse skin. Nanomaterials are applied in relevant doses on the backs of SKH- 1 hairless mice and nanomaterial presence in systemic tissues such as liver, lymph nodes and kidneys is tested 24 hours post application using specific NProbes described elsewhere herein. Demonstrated herein is the detection of those
nanomaterials commonly rendered undetectable with the use fluorescence microscopy and TEM in distal organs. Different barrier disruption models are tested including
tape stripping and UVB exposure, to determine if systemic translocation depends on disruption method.
Although use of mass spectrometry has yielded data on the systemic levels of QD accumulation, it does not give adequate information about the localization of intact nanomaterials (Mortensen et al, 2010, J Biomed Nanotechnol 6(5): 596-604), and important low level nanomaterial signal might be lost during sample preparation. Literature evidence for presence of QDs in liver, spleen, lymph nodes, kidneys and lungs exists (Ballou et al, 2004, Bioconjug Chem 15(l):79-86; Ballou et al, 2007, Bioconjug Chem 18(2):389-396; Yang et al, 2007, Environ Health Perspect 1 15(9): 1339-1343) following intravenous and tail vein injection.
However, detecting low levels of nanomaterials due to long-term chronic topical skin exposure is not often feasible with even sensitive techniques such as ICP-MS due to difficulty in detecting presence of Cd above background levels (commonly present due to diet and environmental exposure), mainly in organs such as liver and kidneys (Figure 12) (Tang et al, 2013, Sci China Life Sci 56(2): 181-188). Moreover, some studies show systemic absorption of nanomaterials in vivo (Gopee et al, 2009, Toxicol Sci 11 l(l):37-48; Mortensen et al, 201 1, Biomed Opt Express 2(6): 1610- 1625; Gulson et al, 2010, Toxicol Sci 118(1): 140- 149), while other studies even with use of very sensitive techniques such as TOF-SIMS, show no evidence of systemic nanomaterial levels (Monteiro-Riviere et al, 201 1, Toxicol Sci 123(l):264-280) despite being detected in the SC and epidermis.
To resolve the discrepancy in systemic levels of nanomaterials in vivo, IHC-based detection of nanomaterials (fluorescent and non-fluorescent) is used, using specific scFv NProbes generated to QD and T1O2 nanoparticles. Previous work has shown that specific scFvs generated against c-Met implicated in lung cancer, enabled detection of the target localized in tumor tissues in vivo in a mouse model using IHC (Lu et al, 2011, Biomaterials 32(12): 3265-3274). It is examined herein whether NProbes allow for detection of even isolated amounts of nanomaterials in organs. Thus, the experiments presented herein validate that NProbes can comprise a diagnostic tool kit to enable the detection of nanomaterials in biological systems.
Nanomaterials for the in vivo studies include GSH QDs and T1O2 nanoparticles to demonstrate detection of both fluorescent and non-fluorescent nanomaterials. For all experiments, 5-9 month old SKH-1 hairless mice are used, after careful consideration of the number of mice required using power analysis (a=0.05, 1-
β>0.8). A commercial Eucerin Smoothing lotion vehicle is used for nanomaterial application during in vivo experiments as this allows spreading of nanomaterials evenly on the backs of mice, thereby preventing dripping off of nanomaterials. Ex vivo studies performed have demonstrated that Eucerin Smoothing lotion enhances nanomaterial penetration when topically applied on mouse skin. QDs (in 0.05 g lotion) is applied on the skin at the back of the mice on an area of 6 cm2 (0.01 mg/cm2), which is based on the amount used for nanomaterial testing (assuming 5 wt. % of the cosmetic contains nanomaterial). Mice are housed individually for 24 hours with access to water and standard mouse feed, after which the nanomaterials will be wiped off the skin (TBS) prior to sacrificing them. The tissue samples namely, skin from both barrier intact and disrupted (tape stripped) mice along with the liver, lymph nodes and kidneys are carefully harvested and submitted for elemental organ analysis (Cd for QDs, Ti for T1O2 nanoparticles) quantification using atomic absorption spectroscopy (AAS). The experiments are repeated using another group of mice to test nanomaterial presence using IHC ( Probes), and correlate the results to data obtained using AAS.
Skin and organ samples harvested 24 hours post nanomaterial application are prepared for IHC as described elsewhere herein. Briefly, samples are stored at -80°C after which they are sliced onto slides using a cryostat (Thermo Scientific) at 5 μιη thickness. Slides containing tissue sections are fixed (methanol, - 20°C, 10 min), washed (IX TBS) and blocked (2% BSA in TBS, 20 min). NProbes specific to GSH QDs and T1O2 nanoparticles are incubated with the tissue sections overnight at 4°C in a humidified chamber. The samples are washed (3x, IX TBST), and a secondary anti-flag antibody tagged with AP is incubated with the tissue sections for 1 hour at room temperature. After incubation with BCIP/NBT substrate (30 min), the slides are imaged using a fluorescent microscope with settings appropriate for QDs (Nikon Eclipse E800 with a Spot RTS camera, 355-365 nm excitation and emission of 420 nm and up) and brightfield to visualize AP staining. NProbe and QD co-localization is quantified for even sparsely present QDs in the organs using co-localization coefficients obtained from image processing (Image J). Appropriate 'no nanomaterial' controls, and tail vein nanomaterial injection as a positive control are included for each experiment. Levamisole (5 mM) is used in the substrate solution for all samples to minimize background staining due to endogenous AP present in tissue.
Systemic tissues from barrier defected samples are expected to show higher presence of nanomaterials relative to intact skin controls (Ravichandran et al, 2011, Nanotoxicology 5(4):675-865; Mortensen et al, 2008, Nano Lett 8(9):2779- 2787; Gopee et al, 2009, Toxicol Sci 11 l(l):37-48). Moreover, it is expect that QD accumulation is observed in different distal organs when analyzed using fluorescence microscopy. Background fluorescence and other issues mentioned above associated with fluorescence microscopy is overcome with the use NProbes to show presence of nanomaterials in organs. The presence of non- fluorescent nanomaterials in various tissues using NProbes, and common microscopic techniques for detection is expected to be observed. Therefore, the discrepancies associated with the use of mass spectrometry and AAS techniques is eradicated, by detecting presence of intact nanomaterials rather than soluble ions (Cd, Ti) in all organs using NProbes.
In certain experiments, confocal microscopy is used to observe QD presence. Confocal microscopy provides depth information, and hence the location of QDs in all the organs, which is further strengthened by observing AP staining under brightfield setting.
Example 4: Development and characterization of antibodies to nanoparticles for enhanced detection in biological systems
The increasing use of nanoparticles (NPs) in technological applications and in commercial products has escalated environmental health and safety (EH&S) concerns. The detection of NPs in the environment and in biological systems is challenged by limitations associated with commonly used analytical techniques. The results presented herein demonstrate the development and characterization of NP binding antibodies, termed NProbes. The methodology used generates NProbes that vary in specificity and avidity to NPs dispersed in solution that can vary in size, composition, and coating chemistry. Thus, NProbes comprise powerful tools that can provide information on both NP presence and their form thereby facilitating EH&S risk assessment and the ability to develop a mechanistic understanding of the fate and transport of NPs in biological systems. The results presented herein demonstrate validation of the utility of NProbes for detecting, for example, quantum dots (QDs) and titanium dioxide (TiC ) NPs using in vitro studies and ex vivo human skin models. The results presented herein support the preponderance of existing data that TiC NPs remain primarily localized to the stratum corneum outer layer of skin but
that QDs may penetrate into the viable epidermis to a greater extent than previously thought.
The materials and methods employed in the experiments disclosed herein are now described.
Quantum Dot Synthesis and Characterization
Commercially available CdSe/ZnS core/shell QDs capped with octadecylamine (ODA) ( -Labs, 5.8 nm core diameter and 620 nm emission wavelength) were purchased. Previously described (Zheng et al, J Biomed
Nanotechnol 9, 382-392 (2013)) ligand exchange methods were used to prepare water-soluble GSH-QDs. Briefly, ODA-QDs (300 μΚ) were precipitated by addition of methanokacetone (1 : 1) and separated by centrifugation at 14,000 rpm for 5 min. The ODA-QDs were resuspended in 300 μΐ, tetrahydrofuran (THF). 30 mg GSH (Cat. number 3541, Calbiochem) was added to 1 mL methanol and adjusted to pH 1 1.0 with tetramethylammonium hydroxide pentahydrate powder. The ODA-QD THF solution was slowly added to the GSH-methanol solution while stirring, at room temperature in a 4 mL glass vial (VWR) immersed in a mineral oil bath (light white oil, Sigma- Aldrich Inc.) and the mixture was stirred at 60 °C for 2 h on a hotplate/stirrer (VWR). The GSH-QDs were then precipitated with the addition of excess ether (1-2 mL) and centrifuged at 14,000 rpm for 5 min. The supernatant was discarded and GSH-QDs were resuspended in 300 0.01 N NaOH and dialysed using a 5 kD molecular weight cutoff DispoDialyzer filter (Harvard Apparatus Inc.) against excess water (50 mL water, changed once) for 48 h. The concentration of QDs was determined by measuring the UV-vis absorbance previously described (Yu et al, Chem Mater 15, 2854-2860 (2003)). The hydrodynamic diameter of the GSH-QDs was measured by dynamic light scattering and the surface charge was determined from zeta potential measurements made in water (pH=6.7) using a Malvern Zetasizer Nano ZS (Malvern Instruments Inc.) prior to bio-panning experiments.
TEM Imaging
Briefly (Home et al., Adv Virus Res 10, 101-170 (1963)), 10 μΐ, of the sample was placed into a carbon coated nickel grid and 10 μΐ^ of 2 % phosphotungstic acid was added and allowed for 2-5 min. Excess fluid was wicked off and samples let
dry. The NPs were imaged using a Hitachi 7650 Transmission Electron Microscope and an attached Gatan 1 1 megapixel Erlangshen digital camera system (Electron Microscopy Core, University of Rochester Medical Centre (URMC)). Human Skin Processing and NP application
Fresh viable human skin from adult donors was obtained following a mammoplasty or abdominoplasty within hours of surgery. Skin samples were approved for usage by the University of Rochester Research Subjects Review Board (RSRB). The skin was washed thrice with IX phosphate-buffered saline (PBS) and treated with fungizone (Invitrogen) to remove any microbial contamination. Skin was then processed to remove fat and thin the dermis for easy handling. The samples were placed on gauze in a sterile petridish filled with media (5-8 mL) to keep the skin viable. GSH-QDs and Ti02 NPs were applied on to skin in quantities lesser (0.01 mg/cm2) than those routinely used for cosmetic testing (0.05 mg/cm2) by pipetting and spreading them evenly on the epidermal side of the skin. Skin samples were tape stripped (Scotch 3M 3750 clear packing tape, USA) ten times prior to application of GSH-QDs. Each piece of fresh tape was pressed firmly onto the epidermal surface of the skin and removed. GSH-QDs were also injected (50 in 100 deionized water) using an insulin needle (skin rested with stratum corneum facing upwards) from epidermis to dermis as a positive control sample. Skin samples were placed in the sterile hood for 24 h, after which excess NPs are wiped off the skin surface using IX PBS. All the samples were stored at -80 °C until processing for histology.
IHC
Frozen skin was mounted using TEK OCT compound, after which they were sliced (5 μιη thickness) on to microscope slides using a cryostat (Thermo Scientific). The epidermis and the dermis were sectioned simultaneously to prevent accidental transfer of NPs to the blade. The slides were fixed in methanol (-20 °C, 10 min) prior to the experiment and dipped in water (Ultrapure™ water, Invitrogen) to remove excess OCT. The slides were washed twice with IX TBS to wash off excess methanol and a hydrophobic pen was used to create a water-repellent barrier to keep reagents localized on the tissue specimen. The slides were blocked with normal mouse serum for 30 min at room temperature, after which GSH43-scFvs were added to the slides diluted in BSA (10 μg/mL) and allowed to incubate overnight at 4 °C in a
humidified chamber. The slides were washed thrice with IX TBST and incubated with anti-FLAG antibody conjugated to alkaline phosphate (AP) (Sigma-Aldrich Inc.) for 1 hr at room temperature. After washing away excess antibodies, the slides were incubated with BCIP/NBT (KPL) substrate for AP containing 5 mM levamisole (Vector laboratories Inc., CA) for 30 min at room temperature. Levamisole is an endogenous AP inhibitor that enables visualization of AP staining due to the binding of scFv-anti-FLAG AP -tagged antibody alone. Excess substrate solution was washed away with DI water and mowiol (Fluka, #81381, Sigma Aldrich Inc., synthesized in- house) was used as a mounting medium for imaging. The samples were analyzed under a fluorescent microscope (Nikon Eclipse E800 with a Spot RTS Camera) at 40x magnification. Images were captured using brightfield and appropriate fluorescence filters, and analyzed using ImageJ (NIH).
Phage Display Library
A previously prepared library (Haidaris et al, Journal of immunological methods 257, 185-202 (2001); Shea et al, Journal of structural and functional genomics 6, 171-175 (2005); Pershad et al, Anal Biochem 412, 210-216 (201 1)) of human scFvs derived from the peripheral leukocytes of several hundred individuals and cloned into the ρΑΡ-ΙΠβ vector, with an approximate diversity of 2xl09 clones, was used for all enrichments. General methods for enrichment and analysis of phage antibody libraries have been described (Haidaris et al, Journal of immunological methods 257, 185-202 (2001); Shea et al, Journal of structural and functional genomics 6, 171-175 (2005); Barbas et al, Phage Display: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001)).
Phage Stock Preparation
Phage stocks (GSH43(p and Τί49φ) of each clone were prepared by infection with VCSM13 helper phage and incubated for 2 h at 37 °C to the mid-log grown colonies, after which it was added to 2 mL LB/Amp/Kan at 30 °C and allowed overnight with good agitation. The culture was centrifuged for 5 min, and phages were precipitated by addition of polyethlyene glycol (PEG) 6000 and NaCl to final concentrations of 4 % and 0.5 M, respectively. After incubation at room temperature for 30-60 minutes, the solution was then centrifuged (13,000 rpm, 10 min) to obtain the phage pellet, which was then re-suspended in TBS with 0.5 % casein.
BstNl Fingerprinting
This method involves picking randomly chosen single colonies (~12- 20) from the titer plates after round 4 into a PCR master mix with primers designed to amplify the scFv insert. The primers used were ompA
(TCGCGATTGCAGTGGCACT; SEQ ID NO: 12) and -266:
(CCCCTTATTAGCGTTTGCCATCTT; SEQ ID NO: 13). A 2 step PCR was run: 30 sec at 95 °C, Γ30" at 60 °C, for 25 cycles followed by 5' at 72 °C. The PCR products of -1,000 bp were digested with BstNI and loaded onto a 1.8-2 % agarose gel for electrophoresis, after which the gel was photographed. The selected clones were sequenced at the University of Rochester Functional Genomics Core Facility (Figure 39). The complementarity determining regions (CDRs) are identified according to Kabat et al (Kabat et al, US Public Health Services, NIH, Bethesda, MD, Publication no. 91-3242, (1991)).
Panning Assay
Individual phage stocks were mixed (1 :5 dilution in TBS) with NPs for 2 hr at room temperature for both testing binding to NPs the clones were isolated against and other NPs such as citrated Au NPs (753610, Sigma Aldrich Inc.), CNTs (MWSusp-100, NanoLab, Inc.) and Au powder (326585, Sigma Aldrich Inc.). After 2 hr, the unbound phages were separated by centrifugation and the NP -phage pellet was washed 5 times in TBST and once in water before eluting with glycine (pH 2.2). The eluted phages were titered by transduction of host cells to ampicillin resistance to estimate binding relative to an arbitrary clone.
Phage ELISA with GSH-QD Immobilization
2 % BSA diluted in TBS was coated for 20 min at room temperature and washed 3 times with deionized water. 50 nM of GSH-QDs were incubated overnight at 4 °C with gentle agitation. Excess QDs were washed off with TBST (Figure 38A). The plate was blocked with TBS+0.5 % casein for 1 hr at room temperature, following which GSH43(p and negative control Npepcp were incubated at a series of dilutions (1 : 1, 1 :2, 1 :3, 1 :4) in TBS containing 0.5 % casein. The plates were washed 5 times with TBS and 5 times with TBST, and anti-M13 HRP antibody (GE Healthcare) was added diluted in TBS (0.5 μg/mL) and incubated for 1 h at room
temperature. Following thorough washing, the plate was incubated with Sure Blue™ TMB substrate (KPL) and the absorbance was measured at 450 nm after stopping the reaction with 1 N HC1.
Protein (scFv) Synthesis and Purification
Preparation of the scFv protein from positive binders and negative controls was performed by removing the gene III fragment by digestion of the plasmid with Sail and Xhol, followed by re-ligation of the compatible ends. This manipulation also appends a hexa-histidine tag to the carboxy terminus of the scFv to permit affinity purification of the protein on an immobilized 2+ resin. The scFvs also contain a FLAG epitope (DYKDDDDKL) at the amino terminus of the light chain domain to enable secondary detection. After removal of the Ml 3 gene III fragment, scFvs were prepared by growth of the cultures in medium with limiting inorganic phosphate. The cell pellets were lysed with BugBuster™ (Novagen) and the His-tagged scFvs were purified on Ni+2 magnetic beads using a Thermo KingFisher instrument to automate bead washing. The scFvs were eluted from the washed beads using PBS containing 250 mM imidazole, dialyzed against PBS and stored at 4°C.
Dot Blot Assay
In this assay, 1 each of GSH-QDs, Au NPs and CNTs were spotted onto three separate pieces of nitrocellulose membrane (Optitran BA-S83, Whatman, Germany), after which the membrane was blocked with 5 % non-fat milk in washing buffer (0.15 NaCl, 10 mL Tris HC1 (pH=8), 1 mL Tween 20 in water), and incubated overnight at 4 °C with GSH43, negative control (BiP) and Ti49-scFvs at a concentration of 4 μg/mL in milk. The membrane was washed 3 times with wash buffer for 5 min each, and anti-FLAG HRP (Sigma Aldrich Inc.) antibody was added to the membrane at a 0.5 μg/mL concentration for 1 h at room temperature. The membrane was incubated in an ECL substrate solution for HRP (Reagent A+B, Thermo Scientific) for 5 min and developed using an x-ray film (Phenix).
DLS Assay
GSH43 and negative control (BiP)-scFvs were incubated with GSH- QDs (50 nM) for 2 h at room temperature with gentle agitation, after which the solution was centrifuged at 55,000 rpm for 10 min and the pellet re-suspended in
TBS. Samples were analyzed using a Malvern Zetasizer NanoZS (Malvern
Instruments Inc.).
Confocal Microscopy
Hence to confirm Ti49-scFv binding, -0.4 mg of Ti02 NPs in water was dried at 100 °C overnight on glass slides (VWR), after which the spot was enclosed in a barrier using a hydrophobic pen (ImmEdge™ Pen, Vector Labs) (Figure 34A). Slides were blocked in normal goat serum (1 : 10 diluted in TBS) and incubated with Ti49 and negative control (Npep)-scFvs (5 μg/mL) overnight at 4 °C. Slides were then washed with TBST and AdhesiveCap™ (Zeiss) microfuge tubes were analyzed using AAS for presence of cadmium (Cd) for both QD containing samples and control. A total of three regions for positive control studies with GSH-QDs injected in skin and two regions from control tissue sections were collected for AAS analysis. Cd concentration analysis was performed using a Perkin-Elmer PinAAcle 900Z atomic absorption spectrophotometer equipped with longitudinal Zeeman background correction and a transverse heated graphite furnace (Perkin-Elmer Life and Analytical Sciences, Shelton, CT 06484 USA). Cd absorption was measured at 228.8 nm using an electrodeless discharge lamp source. A mixed matrix modifier of ammonium phosphate and magnesium nitrate was used to stabilize Cd during the pyrolysis furnace step. Samples were prepared by addition of ammonium phosphate and magnesium nitrate was used to stabilize Cd during the pyrolysis furnace step. Both, positive controls as described above and GSH-QDs (applied on the epidermis) samples were prepared for AAS by adding 200 of 4% ultrapure nitric acid (PlasmaPure Nitric Acid, SCP Science, NY) to the microfuge tube. The tube was then capped and inverted for 3 h to dissolve the sample on the cap. After vortexing the tube, 100 was taken for AA analysis.
The results of the experiments presented in this Example are now described.
Briefly, NProbes were selected from a phage library comprising of ~
2xl09 unique scFv antibodies each displaying monovalently on the minor pill coat protein of Ml 3 filamentous phage. This library has previously been used to generate scFvs against proteins (Denny et al, J Proteome Res 7, 1994-2006 (2008)) and cell surface antigens (Haidaris et al, J Immunol Methods 257, 185-202 (2001)). A key
difference from all prior work is that the current results are from unique protocols to conduct bio-panning on NPs dispersed in solution rather than the standard method of immobilizing the target onto a substrate (Hoogenboom et al, Immunotechnology 4, 1- 20 (1998); Nissim et al, EMBO J 13, 692-698 (1994)). The scFv antibodies are engineered with a FLAG tag to enable secondary detection/amplification in tissue sections using standard immunohistochemistry (IHC) staining. The results presented herein demonstrate a proof-of-concept for NProbe generation and their use for detecting QDs and T1O2 NPs using in vitro assays and ex vivo human skin models. Selection of binders to QDs and TiC using phage display
Glutathione-coated (GSH) QDs (CdSe/ZnS core/shell) and T1O2 NPs (Degussa, 80 % anatase and 20 % rutile crystal, ~21 nm particle size) was used for all experiments. The hydrodynamic diameter of the GSH-QDs in water was found to be 14.15±2.5 nm through dynamic light scattering (DLS) measurements and they were negatively charged (-22.82 mV) as determined from zeta potential measurements (pH -5.3-5.6). Ti02 NPs dispersed in water formed aggregates that ranged from -100 nm to -1.5 μιη when visualized under TEM. NProbes to GSH-QDs and T1O2 NPs were isolated using affinity -based bio-panning which involves mixing the target NPs with the phage library in tris-buffered saline (TBS)+0.5 % casein with gentle agitation. After incubation for 2 hrs at room temperature, the mixture was centrifuged at 55,000 rpm for 10 min (Optima TLX ultracentrifuge, Beckman Coulter) for GSH-QD panning or 1300 g for 5 min for T1O2 NP panning, followed by re-suspension of pellet in TBS containing 0.05 % Tween-20 (TBST). This wash cycle of centrifugation/re- suspension in TBS was repeated 5 times, following which the pellet was washed once in deionized water. After washing the bound phages were eluted using 0.1 M glycine (pH 2.2) and neutralized using 2 M Tris base. The titer of the eluted phage was quantified by transduction of ampicillin-resistant TGI Escherichia coli host cells and colonies counted. A pool for the next round of enrichment was generated by transduction of 20-100 % of the previous round eluate. After overnight incubation, the pooled transductants were grown at 37 °C, infected with VCS M13 helper phage, and grown overnight at 30 °C. Phage stocks were prepared for the next round of panning by polyethylene glycol (PEG) precipitation. Typically, 4 rounds of panning are necessary to enrich for specific binders to NPs, after which a BstNI fingerprinting analysis was performed. The presence of identical restriction enzyme patterns among
the tested clones was taken as evidence of specific enrichment has been previously shown (Haidaris et al, J Immunol Methods 257, 185-202 (2001)). After 4 rounds of panning against GSH-QDs and TiC NPs a BsfNI digest of 12 randomly selected clones found pattern repeats indicating 17-25 % clonal abundance (Figure 30). Phage clones from the enriched populations, termed GSH43(p and Τί49φ, were selected for further testing. The amino acid sequences of the scFvs for the two phage clones are given in (Figure 39). Phage clones GSH43(p and Τί49φ and their respective purified scFv antibodies were freshly prepared and used for in vitro verification of target binding and cross reactivity testing to citrated gold (Au) NPs, Au NPs in a powdered form and carbon nanotubes (CNTs) discussed elsewhere herein.
Verification of binding in vitro using phage clones
Several in vitro assays were conducted to quantify the binding of the GSH43(p and Τί49φ clones to their respective NP targets relative to the binding of irrelevant phage clones that include interleukin-12 (IL-12(p), lactoferrin (LFcp), human GRP78 (BiPcp) and peptide (Npepcp). The GSH43(p and Τί49φ clones consistently showed a 10-fold and 100-fold increase in NP binding over a negative control (IL- 12φ), respectively. These values are in accordance with those reported for isolating specific peptides against solid ZnO substrates using phage display (Rothenstein et al, J Am Chem Soc 134, 12547-12556 (2012)) which reported an 8-fold enrichment.
Images of titer plates are shown in Figure 31. To further verify phage binding to NPs, TEM imaging was performed where the GSH43(p and Τί49φ clones were mixed with GSH-QDs and T1O2 NPs respectively for 2 hr at room temperature, and then centrifuged to wash away unbound phages. The pellet was re-suspended in TBS buffer and samples were prepared for TEM analysis. Results showed that Τί49φ bound to T1O2 NPs (black arrows, Figure 24A), whereas a negative clone phage (against IL-12(p) did not (Figure 24B). Results also showed that GSH43(p bound GSH-QDs (Figure 24C), whereas a negative clone (against LFcp) did not (Figure 24D). To test for potential cross-reactivity binding, the GSH43(p and Τί49φ clones were exposed to citrated Au NPs (20 nm) and carboxylated multi-walled CNTs for 2r h at room temperature. After removal of unbound phage by centrifugation, the pellet was washed 3 times with TBST buffer, after which the phages were eluted. Titer plate images show negligible binding of the GSH43(p, Τί49φ or IL-12(p clones to Au NPs or CNTs (Figure 31). Moreover, Τί49φ did not bind Au in a powder form (<10 μιη
particle size) when tested under similar panning conditions (1300 g centrifugation, 5 min) indicating specific binding of the Τί49φ clone to Ti02 NPs (Figure 31). While these results indicate low non-specific binding of the phage clones to dissimilar materials surprisingly, some cross-reactivity binding of the GSH43(p clone to TiC NPs and to a much lesser extent, the binding of the Τί49φ clone to GSH-QDs was observed (Figure 32). Without wishing to be bound by any particular theory, it is believed that the origin of this cross-reactivity binding in the phage format is unlikely to be a random event or driven by electrostatics as the citrate-coated Au NPs are negatively charged similar to the GSH-QDs and TiC NPs. Moreover, it was observed that the phage clones exhibit sequence specific binding. The light chain of GSH43(p clone was exchanged with the light chain of IL-12(p and the hybrid scFv was tested for binding to the GSH-QDs and TiC NPs. This manipulation reduced the hybrid GSH43(p binding to the GSH-QDs by approximately 4-fold and it reduced the cross- reactivity binding to the T1O2 NPs to background (IL-12(p) levels. Hence, this finding suggests that the cross-reactivity binding observed may result from a shape complementarity effect linked to the bio-panning process that is investigated further in scFv format discussed elsewhere herein.
Verification of binding in vitro using scFvs
Having demonstrated clonal abundance, phage enrichment over control, binding of the phage clones to GSH-QDs and TiCte NPs with a lack of cross- reactivity binding to Au NPs, Au powder and CNTs, experiments were performed to purify the scFvs for similar NP binding and cross-reactivity testing. To examine scFv binding, dot blot assays was used to test the binding of the GSH43-scFv and the Ti49- scFv to GSH-QDs, and their cross-reactivity to Au NPs and CNTs. Similar to the phage binding studies, the GSH43-scFvs showed high specific binding to the GSH- QDs indicated by the dark spot formed (Figure 25A). GSH43-scFv did not bind Au NPs (pink spot, center) or CNTs (black spot, right). The arbitrary clone (BiP-scFv) did not bind any of the NPs (Figure 25B). Similarly, the Ti49-scFv did not bind Au NPs and CNTs and in contrast to the phage format, the Ti49-scFv did not bind GSH- QDs (Figure 25C). Binding of GSH43-scFv to GSH-QDs was further confirmed using dynamic light scattering (DLS), using BiP-scFv as a negative control. The hydrodynamic diameter of the GSH-QDs bound to GSH43-scFvs (-651 nm) was significantly higher than that of BiP-associated GSH-QDs (~1.5-fold) and GSH-QDs
in TBS (~2.5-fold) (Figure 33). Despite the high tendency of GSH-QDs to agglomerate in TBS buffer (-271 nm), this data supports the binding of GSH43-scFv to GSH-QDs. Binding of the Ti49-scFv to T1O2 NPs could not be tested by dot-blot analysis as the presence of the NPs on the nitrocellulose membrane could not be verified. Hence, to confirm Ti49-scFv binding, the T1O2 NPs were dried onto a glass slide and confocal microscopy was used to quantify the presence of fluorescein isothiocyanate (FITC)-conjugated anti-FLAG reporter. Images (Figure 26) were captured under brightfield and fluorescence. A control slide without T1O2 NPs showed no background staining (Figure 34). ImageJ (NIH) was used for analysis of line profiles of three regions of interest (ROIs) and the results averaged. Although a slight non-specific binding of Npep-scFv on T1O2 was seen, the quantification clearly showed a significant difference in the level of Ti49-scFv binding to T1O2 NPs compared to negative control (p<0.05, student's unpaired t-test, Figure 26B). Validation of scFvs to detect NPs in a biological milieu
The main motivation for developing NProbe reagents is to facilitate and amplify the detection of NPs in biological systems in their particulate form. Existing studies of NP skin penetration have highlighted the need to consider the detection limits of the analytical techniques used as well as the assay protocol in drawing definitive conclusions about the NP skin penetration (Monteiro-Riviere et al, Toxicol Sci 123, 264-280 (201 1); Mortensen et al, J Biomed Nanotechnol 6, 596-604 (2010)). Having developed and characterized NProbe binding reagents to T1O2 NPs and GSH-QDs using in vitro assays, it was sought to then test their ability to detect NPs surrounded by a protein corona (Nel et al, Nat Mater 8, 543-557 (2009)) in the biological milieu. First, GSH-QDs were immobilized on a glass slide coated with collagen, which is a main component of skin, GSH43-scFvs binding was examined relative to a negative control (NPep-scFv) using confocal microscopy. Strong specific GSH43-scFvs binding to the GSH-QDs coated on collagen as indicated by the Pearson's co-localization coefficient of 0.65 was observed (Figure 35). GSH43-scFvs did not bind collagen films without containing QDs (data not shown). Next, the ability of the scFv to detect NPs in fresh ex vivo human skin was tested. Following NP skin exposure the tissue was prepared for IHC detection of bound NProbes using a secondary anti-FLAG antibody conjugated to an alkaline phosphatase (AP) reporter. Figure 27 shows bright-field and fluorescent images of a skin section following a 24 h
application GSH-QDs to the stratum corneum and a control sample (no QD exposure). The control sample showed a complete lack of AP staining (Figure 27A) indicating the absence of non-specific GSH43-scFv binding to the skin sections. In contrast, the skin sample exposed to GSH-QDs showed numerous punctate areas of strong AP staining in bright- field (Figure 27B). Observation of this skin section under fluorescence imaging showed a dense cluster of QDs (Figure 27C) that co-localizes with AP staining (blue arrows, Figure 27 inset). However, based on fluorescence imaging (Figure 27C) the detection of GSH-QD presence in skin is suggested to be far less than that suggested by AP staining; confirming a similar trend observed with the silver enhanced TEM imaging process. Using ImageJ software the fluorescence image can be threshold enhanced (Figure 27D) which revealed many more potential instances of QDs in the skin tissue; but as previously noted (Mortensen et al, J Biomed Nanotechnol 6, 596-604 (2010)) it is difficult to unambiguously distinguish the QDs from tissue autofluorescence artifacts. Results from AP staining (Figure 27B) however, clearly demonstrated the utility of NProbes to overcome this challenge. The AP staining identified many areas that co-localize with high fluorescence (black arrows, Figures 27B and 27D). Additionally, regions with strong AP staining with corresponding regions that do not show presence of QD fluorescence was observed (red arrows, Figures 27B and 27D). This suggests that NProbes are able to detect QDs that may have been dislodged from tissue sample during processing or have degraded.
To validate that the areas of strong AP staining do indeed contain QD presence, laser capture microdissection (LCM) microscopy was used to isolate portions of the tissue sample by catapulting them into AdhesiveCap™ microfuge tubes, which were then assayed for elemental cadmium (Cd) using atomic absorption spectroscopy (AAS). Initial studies were conducted on a skin sample with a high QD presence introduced by dermal injection to ensure Cd levels exceeded the AAS detection limit of quantification (LOQ). The control skin sample (no QDs) again showed no discernable AP staining and no QDs visible under fluorescence (Figure 36). In contrast, strong AP staining is seen under brightfield in the dermis where GSH-QDs were injected as shown in Figure 28A with the corresponding QD fluorescence before dissection shown in Figure 28D. The portion of the skin marked for dissection is enclosed in the blue dotted area (Figure 28B). The portion remaining after catapult is shown in Figure 28C. AAS analysis of the tissue areas where strong QD fluorescence was co-localized with AP staining was performed to confirm the
presence of QD. Results indicated detection of 214 ng/mL of Cd with an instrument LOQ of 0.025 ng/mL Cd.
Having demonstrated the ability of the LCM/AAS techniques to detect QD presence in the positive control sample, this methodology was used to confirm the presence QDs in epidermal regions that exhibit strong AP staining following topical QD application on tape stripped skin (Figure 37). Tape stripping is a technique widely used to disrupt barrier function and has been previously shown (Ravichandran et al, Nanotoxicology 5, 675_,686 (2011)) to enhance penetration of topically applied NPs. Initial measurements of individual ROIs in tissue sections showed levels of Cd <LOQ using AAS. However by combining six ROIs with strong AP staining, it was possible to measure 0.108 ng/mL Cd, suggesting the presence of QDs in these regions. The Cd level measured from six random ROI collected and combined from the control sample (no QD) was 0.0085 ng/mL, which was below the instrument LOQ. In addition, experiments were designed to collect and combine six ROIs with strong AP staining that lacked discernible QD signal under fluorescence imaging. AAS analysis measured 0.018 ng/mL Cd, and while this value is below the instrument LOQ it is an order of magnitude higher than the Cd measured on the control (no QDs). Hence, these results suggest that NProbes can amplify and enable the detection of QDs (strong AP staining in brightfield) present at levels below the limit of detection of highly sensitive techniques such as AAS.
Similar studies were conducted to investigate the penetration of T1O2 NPs on an intact skin sample using the Ti49-scFvs. Results show strong AP staining (Figure 29A) relative to the control (no T1O2 NPs, Figure 29B), however the strong staining is mainly confined to the upper layers of the stratum corneum (Figure 29A, red arrows). This finding is in fact, consistent with most recent studies of T1O2 NP penetration through intact skin using different animal models (Mortensen et al, Nano Lett 8, 2779-2787 (2008); Ryman-Rasmussen et al, Toxicol Sci 91, 159-165 (2006); Gamer et al, Toxicol In Vitro 20, 301-307 (2006); Sadrieh et al, Toxicol Sci 1 15, 156-166 (2010)) and likely reflects the tendency of T1O2 to agglomerate on the skin surface hindering penetration. However, a few areas with mild staining were detected beneath the stratum corneum (Figure 29A, blue arrows) suggesting the potential for T1O2 NPs to penetrate through defects in the skin barrier and to successfully reach the lower layers of the epidermis and dermis.
Experiments were conducted to examine the binding of GSH43(p and GSH43-scFV to quantum dots with varied coatings. It was found that GSH43 φ bound QDs with different coatings (Figure 41, left) as indicated by the color change (DHLA- QDs, DTT-QDs, PEI-QDs and carboxylated-QDs from Invitrogen). However, GSH43-scFV only bound DTT-QDs apart from GSH-QDs (Figure 41, right). Further, although the negative phage clone Npep φ does not bind GSH-QDs immobilized on BSA in a phage ELISA assay, the scFv format binds QDs (GSH-QDs and DTT-QDs) as analyzed using a dot blot assay.
Experiments were also conducted to compare binding of GSH φ and GSH-scFv to GSH coated on strips (Figure 42). While GSH43 φ binds GSH coated on strips in a phage ELISA assay, GSH43-scFv shows no consistent trend in a scFv ELISA (both 1 hour and overnight incubation).
Additional experiments were conducted using other clones which were identified in a biopanning assay to bind to Ti02. These clones, Ti6 (also referred to herein as "C6") and Til 5 ("also referred to herein as "CI 5") demonstrated -1000-fold binding to T1O2 particles compared to a negative phage clone in a panning assay (Figure 43). Moreover, Ti6 does not exhibit cross-reactivity to Au NPs similar in morphology to the TiC NPs, whereas Til 5 clone does to a certain extent (~40-fold). These clones were also tested against other TiC NPs <100 nm in size and containing <1% Mn dopant (Sigma) and were found to exhibit no differences (~ 1000-fold binding) in binding in comparison to the original TiC (Evonik/Degussa P25) NPs that were used to discover the binders through panning.
In summary, using phage display technology, scFv NProbe binding reagents for detection of intact NPs, namely GSH-QDs and TiCh in biological systems was developed. This work is unique in the approach to bio-panning on NPs in solution. Typically phage display requires the target to be immobilized onto a solid support by chemical coupling (Bass et al, Proteins 8, 309-314 (1990)) or non- covalent adsorption to a hydrophobic surface (Smith et al, Science 228, 1315-1317 (1985)). A previous study (Mardyani et al., J Mater Chem 19, 6321-6323 (2009)) reported isolation of peptides using phage display that bind QDs immobilized on protein (gelatin)-coated polystyrene plates. However, when QDs were immobilized on gelatin and enrichments were performed, only clones that bound gelatin were found. This phenomenon has been previously reported (Vodnik et al, Molecules 16, 790-817 (201 1)), where often target-unrelated clones are enriched that bind to other
components in the screening system rather than the target itself. In fact, phage binding to components other than the target such as the solid phase (plastic, plates), substances used for blocking (bovine serum albumin (BSA), milk) and capturing agents may predominate during rounds of bio-panning (Vodnik et al, Molecules 16, 790-817 (2011)). The present panning approach helps to minimize occurrences of false positives and favors identification of clones recognizing the NPs dispersed in solution. For example, Figure 40 compares results obtained from panning upon NP immobilization (left) versus panning on dispersed NP, where panning on dispersed NP identified 1 binder, GSH43, and 3 binders (GHS2, GSH3, and GSH4) using 1M MgCk 6H2O to induce QD precipitation.
It is of interest to note however, that the GSH43(p did selectively bind GSH-QDs that were immobilized onto a BSA-coated plate (Figure 38) in a phage enzyme-linked immunosorbent assay (ELISA). In these proof-of-concept studies, the utility of scFv antibodies to detect NPs in both in vitro and ex vivo biological environments was demonstrated. The scFvs isolated did not bind dissimilar material tested, namely Au NPs, Au powder or CNTs. Several controls were included to validate binding including the use of random scFvs selected from the library and 'no- NP' controls in all experiments. The present methodology can be further exploited to develop NProbes for binding other NP types thereby providing an expansive tool kit that can complement other techniques to further the understanding of NP interactions in biological systems. NProbes antibodies are particularly advantageous for detecting non- fluorescent NPs using cost-effective and common imaging techniques. The data presented herein for non-fluorescent T1O2 detection is consistent with current literature on T1O2 NP skin penetration, where they have been reported to
predominantly localize in the upper layers of the stratum corneum. However, some instances were detected below the stratum corneum, and in particular for QDs many instances of dark AP staining without a co-localized fluorescent signal were detected below the stratum corneum suggesting skin penetration may occur to a greater extent than previously considered. NProbes allows the conclusion that these occurrences result from the presence of intact NP, thus providing an advantage over elemental analysis techniques that cannot distinguish between particles and soluble ions.
Experiments can be designed to engineer higher affinity NProbes with lower cross reactivity through mutagenesis studies of the GSH43 and Ti49-scFvs as well as to screen additional protein phage libraries. Factors that appear to limit phage
enrichments to only 10 or 100-fold despite conducting 4 rounds of panning can be evaluated. It is believed that this may arise from shape complementarity binding in the phage format that is enhanced by the large (25 kD) scFv fusion protein. Enrichment maybe hindered by affinity recognition of transient morphologic features that result from NP agglomeration during the bio-panning process. Enrichment may also be hindered by the centrifugation process used to separate NP bound phage which can cause inadvertent pelleting of non-bound phage. This likely limited the enrichment to 10-fold when panning on GSH-QDs which required ultracentrifugation for pelleting. The lower centrifugation force needed to pellet the T1O2 NPs may explain the 100- fold enrichment observed over the negative control phage (IL-12(p).
Additional studies can be designed to investigate the effect of adding salt to the solution prior to centrifugation to facilitate NP precipitation at lower speeds and/or using different protein libraries and/or buffer systems to minimize
agglomeration. Experiments can also be designed seek to understand differences in the cross-reactivity binding behavior observed between the phage and scFv formats. Shape complementary is an important factor in promoting protein aggregation (Li et al, Sci Rep 3, 3271 (2013)) and it is likely to play a role in the unexpected cross reactivity binding observed between the GSH-QD and T1O2 with the NP phages (Τί49φ and GSH43(p). The present studies found that the GSH43(p binds the GSH peptide coated onto a plate, whereas GSH43-scFvs did not (Figure 42). This calls into question epitope recognition pattern differences between the phage and scFv formats. Experiments can be designed to quantify the cross-reactivity binding of the GSH43 and T1O2 clones (scFv and phage formats) to QDs and T1O2 from other vendors with different coatings. It is desirable to develop NProbes that can recognize the NP independent of the coating but the latter is a handle that can be adjusted to enable higher specificity and potentially multiplexed detection. Therefore, it is expected that NProbes can be advanced and used in conjunction with conventional techniques to overall improve NP detection abilities in tissues and other biological systems. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the
invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
1. A composition comprising a binding domain that binds to a nanomaterial.
2. The composition of claim 1, wherein the nanomaterial is selected from the group consisting of dispersed, aggregated, and agglomerated nanomaterial.
3. The composition of claim 1, where the nanomaterial is a non- immunogenic nanoparticle.
4. The composition of claim 1 , wherein the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
5. The composition of claim 1, wherein the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-7.
6. The composition of claim 1, wherein the composition comprises a bacteriophage which displays the binding domain on its surface.
7. The composition of claim 1, wherein the binding domain comprises a peptide which binds to the nanomaterial.
8. The composition of claim 7, wherein the peptide is an antibody, or fragment thereof.
9. The composition of claim 1, wherein the binding domain comprises a single chain variable fragment (scFv) which binds to the nanomaterial.
10. The composition of claim 1, wherein the binding domain comprises a peptide derived from a fibronectin library.
11. The composition of claim 1 , wherein the composition comprises a tag domain.
12. The composition of claim 1 1, wherein the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme
13. The composition of claim 1, wherein the binding domain is identified from phage display.
14. The composition of claim 1, wherein the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NOs: 8-1 1.
15. A composition comprising a binding domain that binds to a quantum dot.
16. The composition of claim 15, wherein the quantum dot is selected from the group consisting of dispersed, aggregated, and agglomerated quantum dot.
17. The composition of claim 15, wherein the quantum dot is a non-immunogenic quantum dot.
18. The composition of claim 15, wherein the quantum dot is coated with glutathione (GSH).
19. The composition of claim 15, wherein the binding domain comprises a peptide encoded by the nucleotide sequence selected from the group consisting of SEQ ID NOs 1-4.
20. The composition of claim 15, wherein the composition comprises a bacteriophage which displays the binding domain on its surface.
21. The composition of claim 15, wherein the binding domain comprises a peptide which binds to the quantum dot.
22. The composition of claim 21, wherein the peptide is an antibody, or fragment thereof.
23. The composition of claim 21, wherein the binding domain comprises a single chain variable fragment (scFv) which binds to the quantum dot.
24. The composition of claim 15, wherein the binding domain comprises a peptide derived from a fibronectin library.
25. The composition of claim 15, wherein the composition comprises a tag domain.
26. The composition of claim 25, wherein the tag domain is selected from the group consisting of a fluorescent tag, a peptide epitope, and an enzyme.
27. The composition of claim 15, wherein the binding domain is identified from phage display.
28. The composition of claim 15, wherein the binding domain comprises a peptide comprising at least one amino acid sequence selected from the group consisting of SEQ ID NO: 8 and SEQ ID NO: 10.
29. A method of identifying a composition that binds to a nanomaterial in a biological tissue comprising the steps of: providing a library of test compounds;
forming a phage library comprising one or more phage, wherein each phage expresses a test compound on its surface;
providing a nanomaterial solution comprising a nanomaterial;
incubating the phage library with the nanomaterial solution to form a nanomaterial-phage solution, thereby producing a population of bound phage that binds to the nanomaterial and a population of unbound phage that does not bind to the nanomaterial; and separating the population of bound phage from the population of
unbound phage, wherein the test compound expressed on the surface of the population of bound phage is identified as a composition that binds to the nanomaterial.
30. The method of claim 29, wherein the nanomaterial is selected from the group consisting of quantum dots (QDs), TiC nanoparticles, Au
nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
31. The method of claim 29, wherein the library of test compounds comprises a library of peptides.
32. The method of claim 29, wherein the library of test compounds comprises a library of antibodies, or fragments thereof.
33. The method of claim 29, wherein the library of test compounds comprises a library of single chain variable fragments (scFvs).
34. The method of claim 29, wherein the library of test compounds comprises a library of peptides derived from fibronectin.
35. The method of claim 29, further comprising enriching the population of bound phage.
36. The method of claim 29, wherein the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial-phage solution.
37. The method of claim 36, wherein the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial-phage solution in the presence of a salt.
38. The method of claim 36, wherein the separation of the population of bound phage and the population of unbound phage comprises centrifugation of the nanomaterial-phage solution in the presence of polyethylene glycol (PEG).
39. The method of claim 29, further comprising incubating the population of bound phage with a second nanomaterial solution to form a second population of bound phage and a second population of unbound phage.
40. The method of claim 29, wherein the identified composition is assayed for its binding strength.
41. The method of claim 29, wherein the identified composition is assayed for its specificity.
42. A method of detecting the presence of a nanomaterial in a sample comprising administering a composition that binds to the nanomaterial to the sample.
43. The method of claim 42, wherein the nanomaterial is selected from the group consisting of dispersed, aggregated, and agglomerated nanomaterial.
44. The method of claim 42, where the nanomaterial is a non- immunogenic nanoparticle.
45. The method of claim 42, wherein the nanomaterial is selected from the group consisting of quantum dots (QDs), T1O2 nanoparticles, Au
nanoparticles, ZnO nanoparticles, carbon nanotubes, and semiconductor nanomaterial.
46. The method of claim 42, wherein the sample is a tissue sample obtained from a subject.
47. The method of claim 42, wherein the subject is selected from the group consisting of a mouse, a rat, a hamster, a guinea pig, a cat, a dog, a monkey, a cow, a fish, a bird, a reptile, an amphibian, a horse, and a human.
48. The method of claim 46, wherein the tissue sample comprises skin.
49. The method of claim 42, wherein the composition comprises a tag domain, and wherein the method comprises detecting the tag domain of the composition.
50. The method of claim 42, wherein the composition comprises a tag domain, and wherein the method comprises administering to the sample a compound that binds to the tag domain.
51. The method of claim 42, wherein the sample is an ecological sample.
52. The method of claim 51, wherein the sample is selected from the group consisting of soil, water, plant, fungi, and algae.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361866716P | 2013-08-16 | 2013-08-16 | |
| US61/866,716 | 2013-08-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2015023927A2 true WO2015023927A2 (en) | 2015-02-19 |
| WO2015023927A3 WO2015023927A3 (en) | 2015-04-09 |
Family
ID=52468817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/051227 Ceased WO2015023927A2 (en) | 2013-08-16 | 2014-08-15 | Composition and method for detection of nanomaterials |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015023927A2 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116899551A (en) * | 2023-06-20 | 2023-10-20 | 齐鲁理工学院 | A kind of cerium-based nanozyme, its preparation method and application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050064508A1 (en) * | 2003-09-22 | 2005-03-24 | Semzyme | Peptide mediated synthesis of metallic and magnetic materials |
| US7538329B2 (en) * | 2005-02-02 | 2009-05-26 | Nomadics, Inc. | Energy-transfer nanocomposite materials and methods of making and using same |
| EP2152629A4 (en) * | 2007-04-30 | 2010-09-22 | Agency Science Tech & Res | FORMATION OF GLUTATHION CROSSLINKED ON A NANOSTRUCTURE |
| WO2010081173A2 (en) * | 2009-01-12 | 2010-07-15 | Cytomx Therapeutics, Llc | Modified antibody compositions, methods of making and using thereof |
| WO2010093627A2 (en) * | 2009-02-12 | 2010-08-19 | Centocor Ortho Biotech Inc. | Fibronectin type iii domain based scaffold compositions, methods and uses |
-
2014
- 2014-08-15 WO PCT/US2014/051227 patent/WO2015023927A2/en not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116899551A (en) * | 2023-06-20 | 2023-10-20 | 齐鲁理工学院 | A kind of cerium-based nanozyme, its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015023927A3 (en) | 2015-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Iaccino et al. | Monitoring multiple myeloma by idiotype-specific peptide binders of tumor-derived exosomes | |
| US11867696B2 (en) | Antigen-coupled immunoreagents | |
| US20100130367A1 (en) | Methods of Quantitatively Assessing Inflammation with Biosensing Nanoparticles | |
| CA2880765C (en) | Compositions and methods for rapid and reversible biomolecular labeling | |
| US20240426816A1 (en) | Compositions and methods for rapid and reversible biomolecular labeling | |
| US20080135490A1 (en) | Quantum dot biolabeling and immunomagnetic separation for detection of contaminants | |
| US20190112356A1 (en) | High-affinity immunopolymers | |
| JP2021531448A (en) | Methods for Reducing Drug Target Interference in Anti-Drug Antibody (ADA) Immune Assays | |
| CN103270168A (en) | Method for detecting cancer cell | |
| US12596119B2 (en) | Analyte detection immunoassay | |
| Kumarasamy et al. | Production, characterization and in-vitro applications of single-domain antibody against thyroglobulin selected from novel T7 phage display library | |
| Mahatnirunkul et al. | One-step gold nanoparticle size-shift assay using synthetic binding proteins and dynamic light scattering | |
| EP4471425A1 (en) | Latex particle dispersion liquid | |
| JPWO2018194152A1 (en) | Method for detecting aldosterone and renin | |
| Kristensen et al. | Thyroid transcription factor-1 in primary CNS tumors | |
| US20190277836A1 (en) | Methods, compositions and kits for labeling of proteins | |
| EP3608669A1 (en) | Fluorescent premix particles, fluorescent stain containing same, and fluorescent staining method in which these are used | |
| Ravichandran et al. | Development and characterization of antibody reagents for detecting nanoparticles | |
| CN110244041A (en) | It is a kind of detect albumen kit and its application | |
| Albrecht et al. | Labeling considerations for confocal microscopy | |
| Bentley et al. | Development and characterization of antibody reagents for detecting nanoparticles | |
| Buxbaum | Immunological Methods | |
| JP2012504408A (en) | Epitopes derived from SATB2 and uses thereof | |
| US20240302379A1 (en) | Methods for identifying and monitoring interactions of protein with ligand | |
| EP3131930B1 (en) | Antibodies recognizing the central domain of dna polymerase pol theta, and use thereof for diagnosing cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14835911 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14835911 Country of ref document: EP Kind code of ref document: A2 |