WO2015019125A1 - Molecular targets for the treatment of wounds, in particular chronic wounds - Google Patents
Molecular targets for the treatment of wounds, in particular chronic wounds Download PDFInfo
- Publication number
- WO2015019125A1 WO2015019125A1 PCT/IB2013/001990 IB2013001990W WO2015019125A1 WO 2015019125 A1 WO2015019125 A1 WO 2015019125A1 IB 2013001990 W IB2013001990 W IB 2013001990W WO 2015019125 A1 WO2015019125 A1 WO 2015019125A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- agent
- therapeutic compound
- wound
- activity
- sox9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L15/00—Chemical aspects of, or use of materials for, bandages, dressings or absorbent pads
- A61L15/16—Bandages, dressings or absorbent pads for physiological fluids such as urine or blood, e.g. sanitary towels, tampons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L2300/00—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices
- A61L2300/40—Biologically active materials used in bandages, wound dressings, absorbent pads or medical devices characterised by a specific therapeutic activity or mode of action
- A61L2300/432—Inhibitors, antagonists
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to at least one molecular target for healing or treating wounds, in particular chronic wounds and more preferentially non healing chronic wounds. Further, the invention concerns a novel therapeutic for treating wounds and a novel gene therapy approach, involving said molecular target for treating wounds. Additionally, the invention concerns a method for treating wounds using said therapeutic or said gene therapy.
- the natural wound healing is divided into three sequential phases; each phase is characterized by specific cellular activities: the inflammatory phase, the proliferative phase and the remodeling phase.
- the first phase begins minutes after injury.
- the blood vessels rupture induces the clot formation, composed mainly of fibrin and fibronectin.
- the clot fills partially the lesion and allows the migration of the inflammatory cells within the lesion.
- the inflammatory cells are recruited to debride the wound. Platelets secrete factors, such as growth factors or cytokines, which induce the recruitment of cells implicated in the wound healing (inflammatory cells such as neutrophils and macrophages, fibroblasts and endothelial cells).
- the second phase is called the proliferative phase and corresponds to the development of the granulation tissue. Fibroblasts migrate into the wound area, proliferate and form a new provisional extracellular matrix by secreting extracellular matrix (ECM) proteins. Then endothelial cells migrate to promote the neovascularization or angiogenesis of the lesion.
- ECM extracellular matrix
- fibroblasts activate and differentiate into myofibroblasts, presenting contractile properties thanks to their expression of alpha-smooth muscle actin (similar to that in smooth muscle cells).
- Myofibroblasts have a key role in wound healing as they provide the contraction of the wound.
- keratinocytes migrate from the wound edge, proliferate and differentiate to reconstitute the epidermis.
- the last phase of the wound healing process appears after the wound closure. It corresponds to the remodeling of the granulation tissue.
- the granulation tissue is reorganized, type III collagen is replaced by type I collagen, as normal dermis is principally composed of type I collagen.
- myofibroblasts in excess are eliminated by apoptosis.
- the last phase of the wound healing is long. One year after injury, the scar is remodeled; it gets less red and thinner.
- Chronic wounds are a worldwide health problem, in part due to a lack of adequate methods of treatment. In 2010, more than 7 million people worldwide suffered from chronic wounds, and the projected annual increase is at least ten percent.
- Chronic wounds are sometimes non-healing wounds.
- Common types of chronic wounds include, but are not limited to, venous leg ulcers, diabetic foot ulcers, decubitus ulcers, arterial leg ulcers, those of mixed etiology (venous and arterial) or those with no known etiology.
- Non-healing wounds or chronic wounds are a challenge for the patient, the health care professional, and the health care system. They significantly impair the quality of life for millions of people and impart burden on society in terms of lost productivity and health care money.
- Wound healing is a dynamic pathway that leads to the restoration of tissue integrity and functions. A chronic wound or non-healing wound develops when the normal reparative process is disturbed. By understanding the biology of wound healing, the physician can optimize the wound healing by choosing the adequate treatment.
- fibroblasts in wound healing Fibroblasts are implicated in the process of wound healing, this involves several steps of differentiation from a quiescent fibroblast to a mobilized fibroblast that will transform into a myofibroblast and finally enter apoptosis.
- fibroblasts In chronic or non-healing wounds, this process is misregulated and fibroblasts fail to undertake the myofibroblast differentiation and are found in the wound as unfunctional fibroblasts, called pseudo senescent fibroblasts (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698).
- the aim of the present invention is to map, at the whole genome scale, the different genes that needs to be activated or deactivated during this process, and thus facilitates the healing process of the wound.
- Human fibroblasts have the ability to enter into a physiological process named senescence, which permits a limited replicative cell cycle and thus avoids loss of genetic information.
- replicative senescence and dependent from telomere length It usually occurs when a cell has already conducted several rounds of replication (called replicative senescence and dependent from telomere length), but can also occur in response to environmental stress (Muller M (2009) Cellular senescence: molecular mechanisms, in vivo significance, and redox considerations. Antioxid Redox Signal 11: 59-98). Senescence cells are arrested in cell cycle but maintain metabolic activity (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698).
- Fibroblasts of chronic wounds lose some of their functionalities, and more particularly, they lose part or all of their replicative function (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698).
- human fibroblasts are also associated with an up-regulation of APA-1, a protein which induces matrix remodeling, demonstrating that pseudo-senescence fibroblast phenotype was not induced by telomere attrition (Benanti JA, Williams DK, Robinson KL, Ozer HL, Galloway DA (2002) Induction of extracellular matrix-remodeling genes by the senescence- associated protein APA-1. Mol Cell Biol 22: 7385-7397).
- the present invention can improve the quality of a patient's life by treating wounds in a way that actively promotes healing.
- the present invention relates to a therapeutic compound comprising :
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a therapeutic compound as defined above, together with a pharmaceutically acceptable carrier.
- the invention relates to a method for preparing a pharmaceutical composition as defined above comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
- the invention in another aspect, relates to a method for treating a mammalian wound, wherein said method comprises: administering to said wound a therapeutic compound comprising: - an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- the present invention also relates to a kit for treating a wound, preferably a chronic wound, wherein said kit comprises:
- the invention relates to a combination therapeutic for treating a wound, preferably a chronic wound, comprising: a) an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene and b) at least one further therapeutic.
- the present invention also relates to the use of an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- a therapeutic compound comprising: - an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- said therapeutic composition also comprises at least:
- the inventors have found that these genes were involved in the healing process and that their down-regulation or up-regulation would be useful for the treatment of wounds, in particular chronic wounds.
- the invention involves a novel gene therapy approach and/or a novel protein therapy approach.
- the expression "agent that inhibits the activity of a gene” or “inhibitor” refers to an agent than can downregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by decreasing the amount of protein present in a given cell, or by inhibiting the protein's activity.
- agent that enhances the activity of a gene refers to an agent than can upregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by increasing the amount of protein present in a given cell, or by increasing the protein's activity. It also encompasses agents that act upstream or downstream of said gene or protein in a signaling pathway.
- the novel therapeutic comprises an inhibitor or enhancer of the gene expression
- this inhibitor or enhancer can be either an anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid and viral vectors or a drug.
- said therapeutic compound is a siRNA selected from the group consisting of siRNA having the sequence as set forth in SEQ ID No: l to SEQ ID No:8 and mixtures thereof.
- the expression of the MAF gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No: l and/or SEQ ID No:2.
- the expression of the MEOX2 gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No:3 and/or SEQ ID No:4.
- SEQ ID NO:4 5'-CCCGCCCGUCCUGUGCUCCAA
- the expression of the PPARG gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No: 5 and/or SEQ ID No:6.
- the expression of the SIX2 gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No:7 and/or SEQ ID No:8.
- the agent that enhances the activity of a gene is a cDNA.
- the expression of the CREB5 gene can be enhanced by administering the CREB5 cDNA.
- the cDNA can be administered or delivered to the wound to be treated in any suitable form known to the skilled person in art. It can be delivered as naked DNA, using plasmid vectors, viral vectors, or any other suitable means.
- the novel therapeutic comprises an inhibitor or enhancer of the protein encoded by the gene function
- this inhibitor or enhancer can be either a binding agent that binds, either reversibly or irreversibly, to inhibit or enhance protein function such as an antibody or a known, or synthesized, protein agonist or antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit or enhance the protein signaling and so negate or enhance the effects of expression of the protein in wound tissue.
- Said agent can be any agent known in the art to act upon a given molecular target.
- the enhancer of PPARG can be selected in the group consisting of thiazolidinediones, such as rosiglitazone and pioglitazone (Curr Drug Targets Cardiovasc Haematol Disord. 2005 Oct;5(5):377-86.
- the inhibitor of PPARG can be G3335 (CAS 36099-95-3) (Chembiochem. 2006 Jan;7(l):74-82.
- the dipeptide H-Trp-Glu-OH shows highly antagonistic activity against PPARgamma: bioassay with molecular modeling simulation. Ye F, Zhang ZS, Luo HB, Shen JH, Chen KX, Shen X, Jiang HL.).
- the therapeutic of the invention is for use in treating wounds, more ideally in chronic wounds, preferentially in non-healing wounds. These wounds are preferentially mammalian wounds, more preferentially human wounds. Chronic wounds that are preferably treated using the invention are leg ulcers, diabetic foot ulcers, pressure ulcers.
- An antibody for use in the invention is most ideally a monoclonal antibody or a humanized antibody.
- the therapeutic is formulated for topical application, but it can also be formulated for oral, cutaneous, transcutaneous, transdermal, intravenous or any application known.
- the therapeutic is formulated for application into a dressing or impregnation of a dressing.
- the therapeutic of the invention may be administered with another active agent.
- active agent may be an antibiotic or antibacterial agent, an antiseptic, an antiviral, an antifungal, an analgesic, an anti-inflammatory agent, a wound healing agent, a keratolytic agent, an anesthetic agent.
- actives are well known to skilled practitioners.
- a pharmaceutical composition for use in treating wounds comprising a therapeutic of the invention together with a pharmaceutical acceptable carrier.
- Other active materials may also be present in the pharmaceutical composition, as may be considered appropriate or advisable for the wound being treated.
- each of the carriers must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient.
- the formulations include those suitable for topical, oral, rectal, nasal or any administration known and may be prepared by any methods well known in the art of pharmacy.
- the composition may be prepared by bringing into association the therapeutic of the invention and the carrier.
- the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely bringing into association the active with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
- the invention extends to methods for preparing a pharmaceutical composition comprising bringing a therapeutic of the invention in conjugation or association with a pharmaceutically acceptable carrier or vehicle.
- compounds of conventional use may be made up into a cream, ointment, gel, jelly, solution or suspension etc.
- Cream or ointment formulations that may be used for the composition are conventional formulations well known in the art.
- Formulations for oral administration in the present invention may be presented as: capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a nonaqueous liquid; or as an oil-in-water liquid emulsion or a water in oil liquid emulsion; or as a bolus etc.
- the term "acceptable carrier” includes vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica.
- vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinyl
- the further aspect of the invention also, or alternatively, comprises a novel method for treating a mammalian wound, typically a chronic wound, which method comprises administering to said wound
- the invention also comprises a novel method for treating a mammalian wound, typically a chronic wound, which method further comprises administering to said wound - an agent that inhibits the activity of PPARG or homologues thereof having at least 50% identity with PPARG
- kit for treating a wound preferably a chronic wound
- said kit comprises:
- medical device includes an instrument, apparatus, implant, in vitro reagent, or similar or related article that is used to diagnose, prevent, or treat disease or other conditions, and does not achieve its purposes through chemical action within or on the body (which would make it a drug). Whereas medicinal products (also called pharmaceuticals) achieve their principal action by pharmacological, metabolic or immunological means, medical devices act by other means like physical, mechanical, or thermal means.
- a combination therapeutic for treating a wound comprising an inhibitor of MEOX2, MAF, SIX2 or enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 gene expression and an inhibitor of MEOX2, MAF, SIX2 or enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 protein activity.
- the invention also comprises a combination therapeutic for treating a wound, which combination therapeutic further comprises an inhibitor of PPARG gene expression or enhancer of SMAD3, SMAD4 gene expression and an inhibitor of PPARG or enhancer of SMAD3, SMAD4 protein activity.
- a therapeutic for treating a wound comprising an inhibitor of MEOX2, MAF, PPARG, SIX2 protein, or a homologue thereof or an enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 protein, or a homologue thereof.
- the invention also comprises a therapeutic for treating a wound further comprising an inhibitor of PPARG protein, or a homologue thereof or an enhancer of SMAD3, SMAD4 protein, or a homologue thereof.
- an inhibitor of MEOX2, MAF, SIX2 protein, or a homologue thereof in the manufacture of a medicament for treating a wound.
- an inhibitor of MEOX2, MAF, SIX2, or a homologue thereof for treating a wound.
- the invention further provides use of an inhibitor of PPARG protein, or a homologue thereof, in the manufacture of a medicament for treating a wound.
- an inhibitor of PPARG or a homologue thereof for treating a wound.
- homologue refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of MEOX2, MAF, PPARG, SIX2 and which retain the biological activity of the MEOX2, MAF, PPARG, SIX2 sequence. It is preferred that homologues are at least 75% homologous to the MEOX2,ETSl, MAF, PPARG, SIX2 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the MEOX2, MAF, PPARG, SIX2 peptide sequence.
- an enhancer of SMAD3, SMAD4, or a homologue thereof for treating a wound.
- homologue refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl and which retain the biological activity of the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXS1 sequence.
- homologues are at least 75% homologous to the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXS1 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4 SOX9 GLIl, FOXSl peptide sequence.
- Treatment of a wound described herein includes reference to human or veterinary use.
- any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
- Figure la Schematic representation of the different treatments applied to the Normal Human Dermal Fibroblast (NHDF)
- Figure lb Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR with the different treatments
- Figure 2a Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR.
- NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (EGR2, SRF, HICl, STAT4, TCF4, GLI1, JUN, IRF7, E2F1, MYC, CREB5, FOXS1, SOX9 or STAT1) and concomitantly subjected or not to TGFpi treatment.
- the RTqPCR were normalized with TUBB and the mock siRNA treated (T-E-) condition was set to one.
- the treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible.
- Figure 2b Graphic representation of the percentage of differentiated cells as assessed by the percentage of alpha SMA positive cells after treatment of NHDFs as described in a).
- Figure 2c Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR.
- Primary human dermal fibroblasts were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2).
- the RTqPCR were normalized with TUBB and the mock siRNA treated (T-E-) condition was set to 1.
- Figure 2d Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR.
- NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2) and concomitantly treated either with CWFl alone or in combination with TGFpi.
- the RT-qPCR were normalized with TUBB and to the mock siRNA treated (T-E-) condition (set to 1 but not represented on this graph).
- T-E- mock siRNA treated
- Figure 2e Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. NHDFs were treated as depicted in d) except for the exudate treatment which was performed with a different exudate from a different patient suffering from chronic wound (CWF2).
- CWF2 chronic wound
- Figure 3 short and long timing after TGFpi treatment for EGR2, FOXS1, SOX9, SRF, STAT4, TCF4, MYC, JUN, IRF7, E2F1, CREB5 and GLI1.
- Figure 3 graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFP as assessed by RT-qPCR.
- Figure 4 Key transcription factors in fibroblast to myofibroblast differentiation a) Graphical explanation of the in silico gene network analysis b) Table representing the different transcription factors identified by bioinformatical and network analysis.
- Figure 5 short and long timing after TGFpi treatment for PPARG, MAF, MEOX2 and SIX2.
- Figure 5 graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFp as assessed by RT-qPCR.
- FIG. 6 Graphic representation of the TCF4 (a), EGR2 (b), SOX9 (c), STAT4 (d), FOXS1 (e), PPARG (f), MAF (g), MEOX2 (h), and SIX2 (i) mRNA levels after NHDF (donor A) treatment for 48h (light grey) or 72h (dark grey) either with mock siRNA or siRNA directed against different TF mRNA (SOX9, EGR2, TCF4, or FOXS1) and concomitantly treated with TGF- ⁇ .
- the mock siRNA treated with TGF- ⁇ (T+E) condition was set to 100% for each time of treatment (48h and 72h).
- Table 1 genes to be increased or decreased in order to treat wounds, non- healing or chronic wounds
- NHDF Normal Dermal Fibroblast Cell Culture and exudate collection
- NHDF isolated from human explants, were purchased from Promocell.
- NHDF were cultivated in DMEM-F12 (Invitrogen), supplemented with 10% FCS (Invitrogen, 5 ⁇ g/mL of insulin and Ing/mL of b-FGF (PromoKine)).
- the efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
- RT-qPCR Quantitative real-time PCR
- MWG LightCycler480 system
- SEQ ID NO:9 aSMA forward:CTGTTTTCCCATCCATTGTG
- SEQ ID NO: 10 aSMA reverse: CCATGTTCTATCGGGTACTT
- the cycling conditions were as follows : an initial 95 °C for 10 minutes, followed by 45 cycles of 95 °C for 15 sec, 58°C for 30 sec, 72°C for 20 sec.
- LightCycler 480 SW 1.5 was used to evaluate the TM curves, to determine the Cp and to approximate the relative concentration for each amplification reaction.
- RNA Nano Chips (Agilent 2100 bioanalyzer, Agilent, 5067-1511).
- RNAse OUT Invitrogen (Life technologies), 10777-019
- the cDNA was stored at -20°C. Only samples with a good bioanalyzer profile were used for qPCR analysis.
- the DIRE analysis is based on the selection of potential common regulatory elements between genes based on these elements conservation during evolution. From these identified elements, DIRE is able to provide a list of master regulators for a list of co-regulated genes. From those two analyses, and for each list analyzed, we have selected Transcription Factors (TFs) expressed in at least one of the two conditions considered in the concerned list (i.e. number of sequencing his superior to twenty in at least one of the two conditions). Then, we have deeply compared the two sets of analysis and decided to keep in the "key regulators lists" transcription factors belonging to both analyses. Because of possible bias in these two analyses we also decided to rescue transcription factors belonging only to one analysis and not the other but presenting very interesting target genes pattern in one list or the other. Altogether, these genes networks analysis allowed us to propose a list of TFs being key regulators in one or the other fibroblast fate.
- TFs Transcription Factors
- TFs Transcription Factors
- siRNA knock-down of fourteen of the potential key transcription factors identified therein inhibited the fibroblast to myofibroblast differentiation pathway as assessed by analyzing the aSMA expression from TGFp - and siRNA-treated NHDFs :GLI1, HICl, TCF4, SOX9, STAT4 MYC, CREB5, IRF7, JUN,E2F1, EGR2, SRF, SMAD3, FOXS1 as their knockdown inhibiter myofibroblast differentiation to various extents (Fig. 2a-b).
- FOXS 1 belongs to the forkhead family of transcription factor often involved in developmental processes such as morphogenesis and differentiation. It has been shown that FOXSl is of primary importance in the development of testicular vasculature. Moreover, FOXSl was described as an early sensory neuronal marker. Here we show that inactivation of FOXSl leads to an increase of myofibroblast differentiation in absence of TGFp.
- MEOX2 has already been described as implicated in TGFP pathway as it was identified as an important factor in cleft palate development in TGFP3 knockout mice.
- C2C12 myoblast cells showed that MEOX2 is also important for skeletal muscle development and differentiation.
- siRNA directed against MEOX2 lead to a bypass of the exudate effect by fibroblasts to be able to differentiate into myofibroblasts.
- MAF was responsible for inhibition of IL22 expression by neutralizing TGFp.
- TGFP and MAF have antagonist/opposite effects on IL21 expression in CD4(+) T cells.
- MAF as an inhibitor of fibroblast to myofibroblast differentiation in absence or presence of exudate as its inactivation by siRNA leads to an increase of myofibroblast differentiation (Fig.2c-d).
- a long form of MAF interacts and cooperates with SOX9 to activate downstream targets. This is another example of the differences between myofibroblast and chondrocyte differentiations.
- SIX2 has been involved in maintaining pluripotency in kidney: in embryonal renal mesenchyme cells it is able to suppress differentiation and during kidney development it maintains the progenitor pool.
- the invalidation of SIX2 leads to a bypass of the dominant exudate effect on TGFP signaling (Fig.2c-d).
- TCF4 mRNA was not modified after SOX9, EGR2 or FOXSl knockdown (Fig 6) placing it at the top of the regulatory interaction network between these factors.
- EGR2 expression was largely inhibited upon siRNA treatment against TCF4 and SOX9 but remained unchanged upon treatment against FOXSl (Fig 6) placing it after TCF4 and SOX9 but before FOXSl in the network.
- SOX9 mRNA remained largely unchanged upon TCF4 and FOXSl knockdown.
- FOXSl as a downstream target of SOX9.
- SOX9 is upregulated upon EGR2 knockdown (Fig 6)
- the STAT4 mRNA is downregulated by TCF4, SOX9 and EGR2 knockdown (Fig 6) placing is as a downstream target of those TF whereas it remained unchanged upon FOXSl siRNA treatment placing it beforehand.
- FOXSl mRNA is downregulated upon TCF4, SOX9 and EGR2 siRNA treatment (Fig 6) placing it at the end of this cascade.
- the PPARG, MAF and MEOX2 mRNA were upregulated upon siRNA treatment against TCF4, SOX9, EGR2 and FOXSl (Fig 6) consistent with their role as antagonist in fibroblast differentiation.
- SIX2 mRNA level was unchanged upon EGR2 and FOXS 1 knockdown (Fig 6) but upregulated in the same manner by TCF4 and SOX9 consistent with a close interconnexion between these two TF and suggesting the existence of a balanced signal between the differentiation agonists SOX9 and TCF4 and the antagonist SIX2.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Diabetes (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Dermatology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Materials Engineering (AREA)
- Obesity (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to a therapeutic compound comprising: - an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or - an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HIC1, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXS1, GLI1, SOX9 and homologues thereof having at least 50% identity with said gene for use in the treatment of wounds, preferably chronic wounds.
Description
Molecular targets for the treatment of wounds, in particular chronic wounds Field of the invention
The present invention relates to at least one molecular target for healing or treating wounds, in particular chronic wounds and more preferentially non healing chronic wounds. Further, the invention concerns a novel therapeutic for treating wounds and a novel gene therapy approach, involving said molecular target for treating wounds. Additionally, the invention concerns a method for treating wounds using said therapeutic or said gene therapy.
Background of the invention
The natural wound healing is divided into three sequential phases; each phase is characterized by specific cellular activities: the inflammatory phase, the proliferative phase and the remodeling phase.
The first phase, called the inflammatory phase, begins minutes after injury. The blood vessels rupture induces the clot formation, composed mainly of fibrin and fibronectin. The clot fills partially the lesion and allows the migration of the inflammatory cells within the lesion. The inflammatory cells are recruited to debride the wound. Platelets secrete factors, such as growth factors or cytokines, which induce the recruitment of cells implicated in the wound healing (inflammatory cells such as neutrophils and macrophages, fibroblasts and endothelial cells).
The second phase is called the proliferative phase and corresponds to the development of the granulation tissue. Fibroblasts migrate into the wound area, proliferate and form a new provisional extracellular matrix by secreting extracellular matrix (ECM) proteins. Then endothelial cells migrate to promote the neovascularization or angiogenesis of the lesion.
Inside the granulation tissue, fibroblasts activate and differentiate into myofibroblasts, presenting contractile properties thanks to their expression of alpha-smooth muscle actin (similar to that in smooth muscle cells). Myofibroblasts have a key role in wound healing as they provide the contraction of the wound. Finally, keratinocytes migrate from the wound edge, proliferate and differentiate to reconstitute the epidermis.
The last phase of the wound healing process appears after the wound closure. It corresponds to the remodeling of the granulation tissue. The granulation tissue is reorganized, type III collagen is replaced by type I collagen, as normal dermis is principally composed of type I
collagen. During this phase, myofibroblasts in excess are eliminated by apoptosis. The last phase of the wound healing is long. One year after injury, the scar is remodeled; it gets less red and thinner.
However, this process is not only complex but fragile; it is susceptible to interruption or failure leading to the formation of chronic or non-healing wounds or formation of abnormal scars. Factors which may contribute to this include diseases (such as diabetes, venous or arterial disease), age, infection or tissue localization.
Chronic or non-healing wounds
Chronic wounds are a worldwide health problem, in part due to a lack of adequate methods of treatment. In 2010, more than 7 million people worldwide suffered from chronic wounds, and the projected annual increase is at least ten percent.
Chronic wounds are sometimes non-healing wounds. Common types of chronic wounds include, but are not limited to, venous leg ulcers, diabetic foot ulcers, decubitus ulcers, arterial leg ulcers, those of mixed etiology (venous and arterial) or those with no known etiology. We can also find acute wounds that become chronic as they do not heal correctly.
Non-healing wounds or chronic wounds are a challenge for the patient, the health care professional, and the health care system. They significantly impair the quality of life for millions of people and impart burden on society in terms of lost productivity and health care money. Wound healing is a dynamic pathway that leads to the restoration of tissue integrity and functions. A chronic wound or non-healing wound develops when the normal reparative process is disturbed. By understanding the biology of wound healing, the physician can optimize the wound healing by choosing the adequate treatment.
In chronic or non-healing wounds, the natural healing process is altered, and thus healing is prolonged, incomplete and sometimes wounds never close. A chronic wound occurs when some factor causes the disruption of the normal inflammatory and proliferative phases. By enhancing or manipulating factors involved in wound healing it may therefore be possible to correct the process, thereby reducing the likely occurrence of a chronic wound or accelerate its subsequent repair. Role of fibroblasts in wound healing
Fibroblasts are implicated in the process of wound healing, this involves several steps of differentiation from a quiescent fibroblast to a mobilized fibroblast that will transform into a myofibroblast and finally enter apoptosis. In chronic or non-healing wounds, this process is misregulated and fibroblasts fail to undertake the myofibroblast differentiation and are found in the wound as unfunctional fibroblasts, called pseudo senescent fibroblasts (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698). The aim of the present invention is to map, at the whole genome scale, the different genes that needs to be activated or deactivated during this process, and thus facilitates the healing process of the wound. Human fibroblasts have the ability to enter into a physiological process named senescence, which permits a limited replicative cell cycle and thus avoids loss of genetic information. It usually occurs when a cell has already conducted several rounds of replication (called replicative senescence and dependent from telomere length), but can also occur in response to environmental stress (Muller M (2009) Cellular senescence: molecular mechanisms, in vivo significance, and redox considerations. Antioxid Redox Signal 11: 59-98). Senescence cells are arrested in cell cycle but maintain metabolic activity (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698).
Fibroblasts of chronic wounds lose some of their functionalities, and more particularly, they lose part or all of their replicative function (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698). In a wound, human fibroblasts are also associated with an up-regulation of APA-1, a protein which induces matrix remodeling, demonstrating that pseudo-senescence fibroblast phenotype was not induced by telomere attrition (Benanti JA, Williams DK, Robinson KL, Ozer HL, Galloway DA (2002) Induction of extracellular matrix-remodeling genes by the senescence- associated protein APA-1. Mol Cell Biol 22: 7385-7397). Thus, senescent fibroblasts in chronic wounds would appear more particularly due to a chronic inflammation than to a telomere shortening (Telgenhoff D, Shroot B (2005) Cellular senescence mechanisms in chronic wound healing. Cell Death Differ 12: 695-698).
The present invention can improve the quality of a patient's life by treating wounds in a way that actively promotes healing.
SUMMARY OF THE INVENTION
The present invention relates to a therapeutic compound comprising :
- an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
for use in the treatment of wounds, preferably chronic wounds.
The invention also relates to a pharmaceutical composition comprising a therapeutic compound as defined above, together with a pharmaceutically acceptable carrier. In one aspect, the invention relates to a method for preparing a pharmaceutical composition as defined above comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
In another aspect, the invention relates to a method for treating a mammalian wound, wherein said method comprises: administering to said wound a therapeutic compound comprising: - an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
The present invention also relates to a kit for treating a wound, preferably a chronic wound, wherein said kit comprises:
(a) at least one therapeutic compound or pharmaceutical composition as defined above; and
(b) at least one dressing for applying to said wound.
In yet another aspect, the invention relates to a combination therapeutic for treating a wound, preferably a chronic wound, comprising: a) an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene and b) at least one further therapeutic.
The present invention also relates to the use of an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene for treating a wound, preferably a chronic wound, wherein said agent modulates fibroblast and myofibroblast differentiation and/or activity.
DETAILED DESCRIPTION OF THE INVENTION
Accordingly, in one aspect of the invention there is provided a therapeutic compound comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
for use in the treatment of wounds, preferably chronic wounds.
In a preferred embodiment of the invention, said therapeutic composition also comprises at least:
(a) - an agent that inhibits the activity of PPARG or homologues thereof having at least 50% identity with PPARG
and/or
(b) - an agent that enhances the activity of at least one gene selected from the group consisting of SMAD3, SMAD4 and homologues thereof having at least 50% identity with said genes.
Indeed, the inventors have found that these genes were involved in the healing process and that their down-regulation or up-regulation would be useful for the treatment of wounds, in particular chronic wounds. Thus, the invention involves a novel gene therapy approach and/or a novel protein therapy approach.
As used herein, the expression "agent that inhibits the activity of a gene" or "inhibitor" refers to an agent than can downregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by decreasing the amount of protein present in a given cell, or by inhibiting the protein's activity.
As used herein, the expression "agent that enhances the activity of a gene" or "enhancer" refers to an agent than can upregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by increasing the amount of protein present in a given cell, or by increasing the protein's activity. It also encompasses agents that act upstream or downstream of said gene or protein in a signaling pathway.
In one embodiment of the invention, the novel therapeutic comprises an inhibitor or enhancer of the gene expression, this inhibitor or enhancer can be either an anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid and viral vectors or a drug.
In a preferred embodiment, said therapeutic compound is a siRNA selected from the group consisting of siRNA having the sequence as set forth in SEQ ID No: l to SEQ ID No:8 and mixtures thereof.
Typically, the expression of the MAF gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No: l and/or SEQ ID No:2.
SEQ ID NO: 1: 5'- UUCGAUCUGAUGAAGUUUGAA
SEQ ID NO:2: 5 ' -CGGC AGGAGA AUGGCAUC AGA
Typically, the expression of the MEOX2 gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No:3 and/or SEQ ID No:4.
SEQ ID NO:3: 5'-AGCAUGCGCACUUAUGAUAUA
SEQ ID NO:4: 5'-CCCGCCCGUCCUGUGCUCCAA
Typically, the expression of the PPARG gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No: 5 and/or SEQ ID No:6. SEQ ID NO:5: 5 ' -UCCGGAGAAC AAUCAGAUUGA
SEQ ID NO:6: 5 ' -GAGGGCGAUCUUGACAGGAAA
Typically, the expression of the SIX2 gene can be inhibited by the siRNAs having the sequences as set forth in SEQ ID No:7 and/or SEQ ID No:8.
SEQ ID NO:7: 5'-CAACGAGAACUCCAAUUCUAA SEQ ID NO: 8 : 5 ' -CCCGCUGAAUGGCAGCGGCAA
In one embodiment, the agent that enhances the activity of a gene is a cDNA.
Typically, the expression of the CREB5 gene can be enhanced by administering the CREB5 cDNA.
The same applies mutatis mutandis for all the other genes listed. The cDNA can be administered or delivered to the wound to be treated in any suitable form known to the skilled person in art. It can be delivered as naked DNA, using plasmid vectors, viral vectors, or any other suitable means.
In another embodiment, the novel therapeutic comprises an inhibitor or enhancer of the protein encoded by the gene function, this inhibitor or enhancer can be either a binding agent that binds, either reversibly or irreversibly, to inhibit or enhance protein function such as an antibody or a known, or synthesized, protein agonist or antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit or enhance the protein signaling and so negate or enhance the effects of expression of the protein in wound tissue.
Said agent (inhibitor or enhancer) can be any agent known in the art to act upon a given molecular target.
Typically, the enhancer of PPARG can be selected in the group consisting of thiazolidinediones, such as rosiglitazone and pioglitazone (Curr Drug Targets Cardiovasc Haematol Disord. 2005 Oct;5(5):377-86. Role of PPAR- gamma agonist thiazolidinediones in treatment of pre-diabetic and diabetic individuals: a cardiovascular perspective. Dumasia R, Eagle KA, Kline-Rogers E, May N, Cho L, Mukherjee D).
Typically, the inhibitor of PPARG can be G3335 (CAS 36099-95-3) (Chembiochem. 2006 Jan;7(l):74-82. The dipeptide H-Trp-Glu-OH shows highly antagonistic activity against PPARgamma: bioassay with molecular modeling simulation. Ye F, Zhang ZS, Luo HB, Shen JH, Chen KX, Shen X, Jiang HL.).
The therapeutic of the invention is for use in treating wounds, more ideally in chronic wounds, preferentially in non-healing wounds. These wounds are preferentially mammalian wounds, more preferentially human wounds. Chronic wounds that are preferably treated using the invention are leg ulcers, diabetic foot ulcers, pressure ulcers.
An antibody for use in the invention is most ideally a monoclonal antibody or a humanized antibody.
In the above aspects and embodiments of the invention the therapeutic is formulated for topical application, but it can also be formulated for oral, cutaneous, transcutaneous, transdermal, intravenous or any application known.
Alternatively, in the above aspects of the invention the therapeutic is formulated for application into a dressing or impregnation of a dressing.
The therapeutic of the invention may be administered with another active agent. Such active agent may be an antibiotic or antibacterial agent, an antiseptic, an antiviral, an antifungal, an analgesic, an anti-inflammatory agent, a wound healing agent, a keratolytic agent, an anesthetic agent. Such actives are well known to skilled practitioners.
In another aspect of the invention, there is provided a pharmaceutical composition for use in treating wounds comprising a therapeutic of the invention together with a pharmaceutical acceptable carrier. Other active materials may also be present in the pharmaceutical composition, as may be considered appropriate or advisable for the wound being treated.
The carrier, or, if more than one be present, each of the carriers, must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient. The formulations include those suitable for topical, oral, rectal, nasal or any administration known and may be prepared by any methods well known in the art of pharmacy.
The composition may be prepared by bringing into association the therapeutic of the invention and the carrier. In general, the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely bringing into association the active with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product. The invention extends to methods for preparing a pharmaceutical composition comprising bringing a therapeutic of the invention in conjugation or association with a pharmaceutically acceptable carrier or vehicle.
For topical application to the skin, compounds of conventional use may be made up into a cream, ointment, gel, jelly, solution or suspension etc. Cream or ointment formulations that may be used for the composition are conventional formulations well known in the art.
Formulations for oral administration in the present invention may be presented as: capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a nonaqueous liquid; or as an oil-in-water liquid emulsion or a water in oil liquid emulsion; or as a bolus etc.
For compositions for oral administration (e.g. tablets and capsules), the term "acceptable carrier" includes vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica. Flavouring agents such as peppermint, oil of wintergreen, cherry flavouring and the like can also be used. It may be desirable to add a colouring agent to make the dosage form readily identifiable. Tablets may also be coated by methods well known in the art. Additionally, or alternatively, the further aspect of the invention also, or alternatively, comprises a novel method for treating a mammalian wound, typically a chronic wound, which method comprises administering to said wound
- an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
The invention also comprises a novel method for treating a mammalian wound, typically a chronic wound, which method further comprises administering to said wound
- an agent that inhibits the activity of PPARG or homologues thereof having at least 50% identity with PPARG
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of SMAD3, SMAD4 and homologues thereof having at least 50% identity with said genes.
According to yet a further aspect of the invention there is provided a kit for treating a wound, preferably a chronic wound, wherein said kit comprises:
(a) at least one therapeutic as above described; and (b) at least one medical device for applying to said wound
The term "medical device" includes an instrument, apparatus, implant, in vitro reagent, or similar or related article that is used to diagnose, prevent, or treat disease or other conditions, and does not achieve its purposes through chemical action within or on the body (which would make it a drug). Whereas medicinal products (also called pharmaceuticals) achieve their principal action by pharmacological, metabolic or immunological means, medical devices act by other means like physical, mechanical, or thermal means.
According to a yet further aspect of the invention there is provided a combination therapeutic for treating a wound comprising an inhibitor of MEOX2, MAF, SIX2 or enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 gene expression and an inhibitor of MEOX2, MAF, SIX2 or enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 protein activity.
The invention also comprises a combination therapeutic for treating a wound, which combination therapeutic further comprises an inhibitor of PPARG gene expression or enhancer of SMAD3, SMAD4 gene expression and an inhibitor of PPARG or enhancer of SMAD3, SMAD4 protein activity.
According to a further aspect of the invention there is provided a therapeutic for treating a wound comprising an inhibitor of MEOX2, MAF, PPARG, SIX2 protein, or a homologue thereof or an enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4,
SRF, STAT4, TCF4, SOX9, GLI1, FOXSl, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 protein, or a homologue thereof.
The invention also comprises a therapeutic for treating a wound further comprising an inhibitor of PPARG protein, or a homologue thereof or an enhancer of SMAD3, SMAD4 protein, or a homologue thereof.
According to a further aspect of the invention there is provided use of an inhibitor of MEOX2, MAF, SIX2 protein, or a homologue thereof, in the manufacture of a medicament for treating a wound. According to a further aspect of the invention there is provided use of an inhibitor of MEOX2, MAF, SIX2, or a homologue thereof, for treating a wound. The invention further provides use of an inhibitor of PPARG protein, or a homologue thereof, in the manufacture of a medicament for treating a wound. According to a further aspect of the invention there is provided use of an inhibitor of PPARG or a homologue thereof, for treating a wound.
The term "homologue" as used herein refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of MEOX2, MAF, PPARG, SIX2 and which retain the biological activity of the MEOX2, MAF, PPARG, SIX2 sequence. It is preferred that homologues are at least 75% homologous to the MEOX2,ETSl, MAF, PPARG, SIX2 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the MEOX2, MAF, PPARG, SIX2 peptide sequence.
According to a further aspect of the invention there is provided use of an enhancer of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, SOX9, GLI1 , FOXSl, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 protein, or a homologue thereof, in the manufacture of a medicament for treating a wound. According to a further aspect of the invention there is provided use of an enhancer of SMAD3, SMAD4, or a homologue thereof, for treating a wound.
The term "homologue" as used herein refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXSl and which retain the biological activity of the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3,
SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXS1 sequence. It is preferred that homologues are at least 75% homologous to the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4, SOX9, GLI1, FOXS1 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SMAD3, SMAD4, SRF, STAT4, TCF4 SOX9 GLIl, FOXSl peptide sequence.
Treatment of a wound described herein includes reference to human or veterinary use.
In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprises", or variations such as "comprises" or "comprising" is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
Preferred features of each aspect of the invention may be as described in connection with any of the other aspects. Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.
Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
The full identity of the genes according to the invention is available on the NCBI database (http://www.ncbi.nlm.nih.gov/), or is well known to those skilled in the art.
FIGURE LEGENDS
The legends of the figures are the following:
Figure la: Schematic representation of the different treatments applied to the Normal Human Dermal Fibroblast (NHDF)
Figure lb: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR with the different treatments
Figure 2a: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (EGR2, SRF, HICl, STAT4, TCF4, GLI1, JUN, IRF7, E2F1, MYC, CREB5, FOXS1, SOX9 or STAT1) and concomitantly subjected or not to TGFpi treatment. The RTqPCR were normalized with TUBB and the mock siRNA treated (T-E-) condition was set to one. The treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible. Figure 2b: Graphic representation of the percentage of differentiated cells as assessed by the percentage of alpha SMA positive cells after treatment of NHDFs as described in a). The treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible.
Figure 2c: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. Primary human dermal fibroblasts were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2). The RTqPCR were normalized with TUBB and the mock siRNA treated (T-E-) condition was set to 1.
Figure 2d: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2) and concomitantly treated either with CWFl alone or in combination with TGFpi. The RT-qPCR were normalized with TUBB and to the mock siRNA treated (T-E-) condition (set to 1 but not represented on this graph). To help in analyzing the effect of the different siRNA, the condition where the cells were treated with mock siRNA and TGFpi is added and represents the normal differentiation (light grey bar in the mock histogram).
Figure 2e: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. NHDFs were treated as depicted in d) except for the exudate treatment which was performed with a different exudate from a different patient suffering from chronic wound (CWF2).
Figure 3: short and long timing after TGFpi treatment for EGR2, FOXS1, SOX9, SRF, STAT4, TCF4, MYC, JUN, IRF7, E2F1, CREB5 and GLI1. For each Factor, graphic
representation of the mRNA levels after increasing time of treatment of the NHDF with TGFP as assessed by RT-qPCR.
Figure 4: Key transcription factors in fibroblast to myofibroblast differentiation a) Graphical explanation of the in silico gene network analysis b) Table representing the different transcription factors identified by bioinformatical and network analysis.
Figure 5: short and long timing after TGFpi treatment for PPARG, MAF, MEOX2 and SIX2. For each Factor, graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFp as assessed by RT-qPCR. Figure 6: Graphic representation of the TCF4 (a), EGR2 (b), SOX9 (c), STAT4 (d), FOXS1 (e), PPARG (f), MAF (g), MEOX2 (h), and SIX2 (i) mRNA levels after NHDF (donor A) treatment for 48h (light grey) or 72h (dark grey) either with mock siRNA or siRNA directed against different TF mRNA (SOX9, EGR2, TCF4, or FOXS1) and concomitantly treated with TGF-β. For all graphs, the mock siRNA treated with TGF-β (T+E) condition was set to 100% for each time of treatment (48h and 72h).
Table 1: genes to be increased or decreased in order to treat wounds, non- healing or chronic wounds
Table 2: siRNA sequences for each target gene. EXAMPLE In response to a lesion, fibroblasts migrate into the wound where they differentiate into contractile myofibroblasts that will finally enter into apoptosis during the remodeling phase. This differentiation process can be studied ex-vivo in environmentally controlled tissue culture conditions, and therefore the timely controlled succession of different gene expression patterns can be addressed. Materials and methods
Establishment of an ex vivo model of chronic wounds
Normal Dermal Fibroblast Cell Culture and exudate collection
NHDF, isolated from human explants, were purchased from Promocell. NHDF were cultivated in DMEM-F12 (Invitrogen), supplemented with 10% FCS (Invitrogen, 5μg/mL of insulin and Ing/mL of b-FGF (PromoKine)).
To collect exudates, two patients with mixed ulcers were recruited. For patient selection, it was decided to exclude any other comorbidity factor potentially involved in wound etiology: diabetes, peripheral arterial diseases, malnutrition. Exudates were collected from negative pressure therapy. All the exudates were centrifuged at 1,500 x g for 3 minutes to remove cell debris. The supernatant was filtered and stored at -80°C until use. Aliquots were used to determine protein concentration according to BCA method (Sigma). Establishment of an ex vivo model of chronic wounds
For experiments, cells were deprived of insulin and b-FGF during 48 hours. Then, the cells were cultivated on collagen coated culture plates in DMEM-F12, supplemented with 10% FCS, lOng/mL of TGF-βΙ (Promocell) for 4 days. Four points were tested in order to appreciate the effect of exudate on fibroblast differentiation: untreated cells (T-E-), fibroblasts treated with TGF-βΙ (T+E-), cells treated with exudate (T-E+) and finally fibroblasts treated with TGF-βΙ and exudate at the same time (T+E+).
The efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
Western Blotting assay Total proteins were extracted by scratching the cells with lysis buffer (TRIS, NaCl, NP40, EDTA, IMDTT) and incubated 30 min in ice. To remove cell debris, the samples were centrifuged at 13,000 x g for 10 min at 4°C and stored at -20°C until use. Protein concentration was determined according to BCA method (Sigma). Equal amounts of total protein (20μg) were loaded to NuPAGE 10% BIS-Tris gel (Invitrogen), separated by migration at 150 V, and transferred to nitrocellulose membrane (Whatman) 1 hour at 30 V. Then, membranes were stained for aSMA (Abeam) and tubulin (Abeam). Incubations were followed by secondary antibodies goat anti-rabbit IgG and goat anti-mouse IgG, respectively, conjugated with horseradish-peroxidase (HRP) (Promega). Signals were detected by ECL chemiluminescence using UptiLight HS WB Substrate (Uptima, Interchim). Bands were digitized with a scanner and the ratio between all bands density of the same blot was
calculated by software (ImageJ 1.43u, 64-bit). Relative aSMA expression was normalized to the respective value for tubulin.
Total RNA Sample Preparation
After four days of experiment, treated fibroblasts were lysed with TRIzol Reagent (Invitrogen) and stored at -80°C. Then RNA was purified using chloroform and precipitated by isopropanol. Total RNA was quantified on the NanoDrop 2000c Spectrophotometer (Thermo Scientific). Reverse transcription of 500 ng total RNA to cDNA was done with oligot dT (Invitrogen) using Superscript III RT (Invitrogen) and RNAse OUT (Invitrogen). The cDNA was store at -20°C. Quantitative real-time RT-PCR
Quantitative real-time PCR (RT-qPCR) was done using 5μί of 1:20 diluted cDNA on the LightCycler480 system (Roche) using Maxima SYBR Green qPCR Master Mix (Fermentas). Forward and reverse primers for aSMA were designed by Eurofins (MWG, aSMA forward:CTGTTTTCCCATCCATTGTG (SEQ ID NO:9), aSMA reverse: CCATGTTCTATCGGGTACTT (SEQ ID NO: 10)) and a ΙΟΟμΜ stock was stored at -20°C. Forward and reverse primer pairs were used for each RT-qPCR reaction. The cycling conditions were as follows : an initial 95 °C for 10 minutes, followed by 45 cycles of 95 °C for 15 sec, 58°C for 30 sec, 72°C for 20 sec. LightCycler 480 SW 1.5 was used to evaluate the TM curves, to determine the Cp and to approximate the relative concentration for each amplification reaction. siRNA treatment a-Smooth Muscle Actin Immunofluorescence
Cells grown in collagen coated culture dishes, and treated as previously described, were fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes and permeabilized with 2.5% Triton X-100 (Euromedex, 2000-B) in PBS for 3 minutes. After saturation with 5% BSA in PBS, cells were stained for a-SMA (Abeam, ab5694) and for DNA (DAPI). As secondary antibody, CyTM3 conjugated anti rabbit (GE Healthcare, PA43004) was used. Samples were observed with an oil immersion objective (Plan Fluor 40X/1.30 Oil, Nikon) on a Nikon ECLIPSE Ti (Nikon). Digital images were taken with a digital camera (Cool SNAP HQ2, Photometries) and software (MetaMorf 7.5.4.0). To estimate the percentage of fibroblast differentiation due
to the different treatments, the total number of cells per field was determined by the DAPI, and myofibroblasts, differentiated fibroblasts, were counted using the a-SMA staining. Then, STUDENT (t-) and χ2 tests were realized to evaluate the differentially expression of aSMA between the untreated fibroblasts (T-E-) and the treated ones. mRNA Expression Analysis
Total RNA Sample Preparation and cDNA Synthesis
After four days of experiment, treated fibroblasts were detached with TRIzol Reagent (Invitrogen (Life Technologies), 15596-018) and stored at -80°C. Then RNA was purified using chloroform and precipitate by isopropanol. Total RNA was quantified on the NanoDrop 2000c Spectrophotometer (Thermo Scientific) and their quality was evaluated on the RNA Nano Chips (Agilent 2100 bioanalyzer, Agilent, 5067-1511). Reverse transcription of 500 ng total RNA to cDNA was done with oligot dT (Invitrogen (Life technologies), 18418-020) using Superscript III RT (Invitrogen (Life technologies), 18080-085) and RNAse OUT (Invitrogen (Life technologies), 10777-019). The cDNA was stored at -20°C. Only samples with a good bioanalyzer profile were used for qPCR analysis.
Network analysis
In order to enlighten master regulators of fibroblast fate after each different treatment, we performed a gene network analysis treating gene expression lists determined after mRNA seq deep sequencing analysis of the gene profile of T-E- with the gene profile of T+E-, T+E+ and T-E+ 1. In these analysis and based on the assumption that the decrease or increase of interconnected genes is of stronger significance than a significant Log FC, we have used lists of genes selected only based on their P value and not on the value of their Log FC. We have performed two types of analysis: an ingenuity "upstream regulator analysis" and a DIRE (http://dire.dcode.org/) analysis. The Ingenuity "upstream regulator analysis", given the particular profile of genes expression between two conditions, consists in selecting potential upstream regulators. The DIRE analysis is based on the selection of potential common regulatory elements between genes based on these elements conservation during evolution. From these identified elements, DIRE is able to provide a list of master regulators for a list of co-regulated genes. From those two analyses, and for each list analyzed, we have selected Transcription Factors (TFs) expressed in at least one of the two conditions considered in the concerned list (i.e. number of sequencing his superior to twenty in at least one of the two
conditions). Then, we have deeply compared the two sets of analysis and decided to keep in the "key regulators lists" transcription factors belonging to both analyses. Because of possible bias in these two analyses we also decided to rescue transcription factors belonging only to one analysis and not the other but presenting very interesting target genes pattern in one list or the other. Altogether, these genes networks analysis allowed us to propose a list of TFs being key regulators in one or the other fibroblast fate.
For the chronic or non-healing wound model, chronic wound exudates were added to cell cultures (50( g/mL of total proteins of exudate). The experiments that were performed are depicted in Figure la): cells were either not treated (T-E-), either treated with TGFP alone (T+E-), exudate alone (T-E+) or TGF-β and exudate (T+E+) for 4 days. The assays described previously were used to assess the level of differentiation. Chronic wound exudates decrease the expression of aSMA (mRNA, figure lb). This indicated that chronic wound exudates clearly inhibit fibroblast differentiation. This is correlated to the fact that in chronic wounds, non-functional fibroblasts, also called pseudo-senescent fibroblasts, are present. Gene expression route upon fibroblast to myofibroblast differentiation
Identification of the main molecular targets implicated in fibroblast differentiation of human primary fibroblasts under normal and pathological conditions
We performed an in silico gene network analysis to enlighten putative upstream regulators of the different gene expression routes defined previously. This approach was original in the sense that we used global gene network analysis to identify potential key regulators and we did not take into account a change in these factors expression to select them. For example, we used the DIRE program (http://dire.dcode.org/) to identify evolutionary conserved potential regulatory elements in the different genes lists which allowed us to enlighten transcription factors that could potentially bind to these elements and thus regulate these sets of genes. Twenty-three transcription factors were selected out from this analysis.
To prioritize the extensive study of the different Transcription Factors (TFs), we performed a time response study of TFs after the different fibroblast treatments. We did a short-term (between 30mn and 8 hours) and a long-term (between 8 hours and 96 hours) analysis of their changes in expression after the different treatments.
We performed an exhaustive siRNA-based approach to study on one hand the role of these different factors in normal fibroblast to myofibroblast differentiation pathway and on the other hand, in the chronic-exudate-dependent non-differentiation cell fate.
The siRNA knock-down of fourteen of the potential key transcription factors identified therein inhibited the fibroblast to myofibroblast differentiation pathway as assessed by analyzing the aSMA expression from TGFp - and siRNA-treated NHDFs :GLI1, HICl, TCF4, SOX9, STAT4 MYC, CREB5, IRF7, JUN,E2F1, EGR2, SRF, SMAD3, FOXS1 as their knockdown inhibiter myofibroblast differentiation to various extents (Fig. 2a-b). Very interestingly, except for SOX9, FOXS1 and EGR2, whose expression is strongly and rapidly up-regulated upon TGFP treatment, the mRNA levels of the other factors is constant during the first day or so after TGFP treatment and overall unchanged during the four days of differentiation (Fig 3). This indicates that the maintenance of their expression but not their over-expression is necessary for fibroblast to myofibroblast differentiation.
The siRNA knock-down of four other potential key transcription factors identified by the in silico analysis (MAF, SIX2, MEOX2 and PPARG) seemed to induce the fibroblast to myofibroblast differentiation in absence of TGFP to the same extend as the one obtained with mock transfected cells treated with TGFp. Even more interestingly the induction of myofibroblast differentiation was old true even in presence of chronic wound exudates and was very similar to the differentiation obtained in presence of TGFP -only for mock transfected cells. In absence of these factors, the fibroblasts seemed able to bypass the exudate dominant action in order to differentiate into myofibroblasts. We can also enlighten that, except for FOXS1, all these factors are slightly too strongly down regulated upon TGFP treatment (Fig. 5) supporting that their down regulation could be necessary for differentiation.
Altogether these results showed that with knocking-down approaches we were able either to reduce fibroblast to myofibroblast differentiation or to induce this differentiation even in a chronic wound context (table 1).
An in silico gene network analysis allowed us to identify potential key regulators of fibroblast cell fate either during differentiation into myofibroblast or in a context of chronic wounds. By knocking down approaches, we found a strong effect on differentiation for nineteen factors. The strength of our analysis comes from the unbiased approach to look for evolutionary
conserved common DNA element in the different lists of genes (via the DIRE program) and from there to identify putative upstream transcription regulators, rather than to look at differences in the expression levels of the transcription factors. It is very likely that we would have missed those cell fate regulators by looking at their differential expression only. By knocking-down approaches we identified transcription factors required for normal fibroblast to myofibroblast differentiation (Fig.2). We used the aSMA to follow myofibroblast differentiation as it is their best ex-vivo marker.
We have also identified factors which seemed to play a role but maybe not as strongly as the ones described in the paragraph before as their knockdown leads to consistent but mild decrease of aSMA expression. These factors are MYC, JUN, E2F1, IRF7 and CREB5.
Very interestingly, we showed that the inactivation of some transcription factors leads to an increase of fibroblast differentiation per se. The invalidation of some of these factors could even increase fibroblast to myofibroblast differentiation in a chronic wound context. The knocking down of PPARG mRNA leads to an increase of fibroblast to myofibroblast differentiation (Fig.2c-d) even in the presence of chronic exudate.
FOXS 1 belongs to the forkhead family of transcription factor often involved in developmental processes such as morphogenesis and differentiation. It has been shown that FOXSl is of primary importance in the development of testicular vasculature. Moreover, FOXSl was described as an early sensory neuronal marker. Here we show that inactivation of FOXSl leads to an increase of myofibroblast differentiation in absence of TGFp.
MEOX2 has already been described as implicated in TGFP pathway as it was identified as an important factor in cleft palate development in TGFP3 knockout mice. Experiments in C2C12 myoblast cells showed that MEOX2 is also important for skeletal muscle development and differentiation. Here, we showed that siRNA directed against MEOX2 lead to a bypass of the exudate effect by fibroblasts to be able to differentiate into myofibroblasts.
In T cells, it has been shown that MAF was responsible for inhibition of IL22 expression by neutralizing TGFp. TGFP and MAF have antagonist/opposite effects on IL21 expression in CD4(+) T cells. In the same connection, in this study, we implicated MAF as an inhibitor of fibroblast to myofibroblast differentiation in absence or presence of exudate as its inactivation
by siRNA leads to an increase of myofibroblast differentiation (Fig.2c-d). On the contrary, during chondrocyte differentiation, a long form of MAF interacts and cooperates with SOX9 to activate downstream targets. This is another example of the differences between myofibroblast and chondrocyte differentiations. SIX2 has been involved in maintaining pluripotency in kidney: in embryonal renal mesenchyme cells it is able to suppress differentiation and during kidney development it maintains the progenitor pool. Here, in dermal fibroblast, the invalidation of SIX2 leads to a bypass of the dominant exudate effect on TGFP signaling (Fig.2c-d).
Regulatory interactions between key transcription factors during fibroblast to
myofibroblast differentiation
The expression of TCF4 mRNA was not modified after SOX9, EGR2 or FOXSl knockdown (Fig 6) placing it at the top of the regulatory interaction network between these factors. On the contrary EGR2 expression was largely inhibited upon siRNA treatment against TCF4 and SOX9 but remained unchanged upon treatment against FOXSl (Fig 6) placing it after TCF4 and SOX9 but before FOXSl in the network. SOX9 mRNA remained largely unchanged upon TCF4 and FOXSl knockdown. We placed FOXSl as a downstream target of SOX9. On the contrary SOX9 is upregulated upon EGR2 knockdown (Fig 6) The STAT4 mRNA is downregulated by TCF4, SOX9 and EGR2 knockdown (Fig 6) placing is as a downstream target of those TF whereas it remained unchanged upon FOXSl siRNA treatment placing it beforehand. Consistently, FOXSl mRNA is downregulated upon TCF4, SOX9 and EGR2 siRNA treatment (Fig 6) placing it at the end of this cascade. Globally, the PPARG, MAF and MEOX2 mRNA were upregulated upon siRNA treatment against TCF4, SOX9, EGR2 and FOXSl (Fig 6) consistent with their role as antagonist in fibroblast differentiation. SIX2 mRNA level was unchanged upon EGR2 and FOXS 1 knockdown (Fig 6) but upregulated in the same manner by TCF4 and SOX9 consistent with a close interconnexion between these two TF and suggesting the existence of a balanced signal between the differentiation agonists SOX9 and TCF4 and the antagonist SIX2.
The identification of transcription factors able to bypass chronic wound exudates effect is of major importance in the chronic wound field as it gives new insight into targets that can be used in the treatment of chronic wounds such as leg ulcers. In this study, by focusing on
fibroblast, by no mean we tried to dissimulate the importance of other cells like neutrophils and macrophages in the skin healing process but we willingly simplified the biological context to draw a clearer picture of the situation.
Claims
1. A therapeutic compound comprising :
- an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2, preferentially MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
for use in the treatment of wounds, preferably chronic wounds.
2. A therapeutic compound according to claim 1 further comprising:
- an agent that inhibits the activity of PPARG or homologues thereof having at least 50% identity with PPARG
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of SMAD3, SMAD4 and homologues thereof having at least 50% identity with said genes.
3. A therapeutic compound according to claim 1 or 2 wherein said agent is selected from the group consisting of: anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid or viral vectors.
4. A therapeutic compound according to claim 1 or 2 wherein said agent is an inhibitor or enhancer of protein function.
5. A therapeutic compound according to claim 4 wherein said agent is selected from the group consisting of: a binding agent that binds, either reversibly or irreversibly, to inhibit protein function such as an antibody or a synthetic antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit protein function.
6. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for use in treating mammalian wounds.
7. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for use in treating chronic wounds such as venous ulcers, diabetic ulcers, or pressure ulcers.
8. A therapeutic compound according to any preceding claim wherein the therapeutic is for use in treating human wounds.
9. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for topical application.
10. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for application to a medical device or impregnation of a medical device.
11. A pharmaceutical composition comprising a therapeutic compound according to any preceding claim together with a pharmaceutically acceptable carrier.
12. A method for preparing a pharmaceutical composition according to claim 11 comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
13. A method for treating a mammalian wound, wherein said method comprises: administering to said wound a therapeutic compound comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9 , preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene
14. A kit for treating a wound, preferably a chronic wound, wherein said kit comprises: (a) at least one therapeutic compound according to any of claims 1 -10 or a composition according to claim 11 ; and
(b) at least one dressing for applying to said wound.
15. A combination therapeutic for treating a wound, preferably a chronic wound, comprising:
a) an an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene and b) at least one further therapeutic.
16. Use of an
an agent that inhibits the activity of at least one gene selected from the group consisting of MEOX2, MAF, SIX2 and homologues thereof having at least 50% identity with said genes and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of CREB5, E2F1, EGR2, HICl, IRF7, JUN, MYC, SRF, STAT4, TCF4, FOXSl, GLI1, SOX9, preferentially FOXSl, EGR2, SOX9, TCF4, STAT4 and homologues thereof having at least 50% identity with said gene for treating a wound, wherein said agent modulates fibroblast and myofibroblast differentiation and/or activity.
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2013/001990 WO2015019125A1 (en) | 2013-08-05 | 2013-08-05 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| US14/909,669 US10071097B2 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| EP18156497.2A EP3354659A3 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| EP14744578.7A EP3030574B1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| ES14744578.7T ES2675579T3 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| PCT/EP2014/066344 WO2015018699A1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| CA2919600A CA2919600A1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| JP2016532316A JP6473155B2 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, especially chronic wounds |
| CN201480043897.4A CN105829338A (en) | 2013-08-05 | 2014-07-30 | Molecular targets for treating wounds, especially chronic wounds |
| BR112016002570A BR112016002570A2 (en) | 2013-08-05 | 2014-07-30 | molecular targets for wound care, in particular chronic wounds |
| US16/055,571 US20190022097A1 (en) | 2013-08-05 | 2018-08-06 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| JP2018214549A JP2019038847A (en) | 2013-08-05 | 2018-11-15 | Molecular targets for treating wounds in particular chronic wounds |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/IB2013/001990 WO2015019125A1 (en) | 2013-08-05 | 2013-08-05 | Molecular targets for the treatment of wounds, in particular chronic wounds |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2014/066344 Continuation WO2015018699A1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| US14/909,669 Continuation US10071097B2 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015019125A1 true WO2015019125A1 (en) | 2015-02-12 |
Family
ID=49447578
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2013/001990 Ceased WO2015019125A1 (en) | 2013-08-05 | 2013-08-05 | Molecular targets for the treatment of wounds, in particular chronic wounds |
| PCT/EP2014/066344 Ceased WO2015018699A1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2014/066344 Ceased WO2015018699A1 (en) | 2013-08-05 | 2014-07-30 | Molecular targets for the treatment of wounds, in particular chronic wounds |
Country Status (8)
| Country | Link |
|---|---|
| US (2) | US10071097B2 (en) |
| EP (2) | EP3030574B1 (en) |
| JP (2) | JP6473155B2 (en) |
| CN (1) | CN105829338A (en) |
| BR (1) | BR112016002570A2 (en) |
| CA (1) | CA2919600A1 (en) |
| ES (1) | ES2675579T3 (en) |
| WO (2) | WO2015019125A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017053389A1 (en) * | 2015-09-21 | 2017-03-30 | Jeffrey Stern | Methods for inhibiting epithelial to mesenchymal transition by inhibition of foxs1 |
| CN106868006A (en) * | 2017-03-29 | 2017-06-20 | 华中科技大学同济医学院附属协和医院 | A kind of E2F1 albumen can combine DNA fragmentation and the application in E2F1 Activity determinations |
| RU2708302C1 (en) * | 2016-01-11 | 2019-12-05 | Тюркие Шише Ве Джам Фабрикалары А.Ш. | Glass with low-emission coating, resistant to heat treatment |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012120269A1 (en) * | 2011-03-08 | 2012-09-13 | University College Cardiff Consultants Limited | Molecular targets for healing or treating wounds |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1225682A (en) * | 1996-04-23 | 1999-08-11 | 哈佛大学校长及研究员协会 | Method and compositions for regulating T cell subsets by modulating transcription facter activity |
| DE10235624A1 (en) * | 2002-08-02 | 2004-02-19 | Aventis Pharma Deutschland Gmbh | New fused tetracyclic compounds, e.g. endiandric acid H obtained from the plant Beilschmieda fulva, are c-maf and NFAT inhibitors useful for treating allergy or asthma |
| EP1944361A1 (en) * | 2007-01-11 | 2008-07-16 | INSERM (Institut National de la Santé et de la Recherche Médicale) | A method for expanding monocytes |
| EP2105511A1 (en) * | 2008-03-28 | 2009-09-30 | Fraunhofer-Gesellschaft zur Förderung der Angewandten Forschung e.V. | Medicament compositions and substances for treatment and identifying adenocarcinoma of the lung |
| US7960363B2 (en) * | 2009-05-01 | 2011-06-14 | Riken | Therapeutic agent for wounds and screening method for the same |
| EP2322163A1 (en) * | 2009-11-03 | 2011-05-18 | Pharnext | New therapeutics approaches for treating alzheimer disease |
| TWI505828B (en) * | 2010-12-20 | 2015-11-01 | 葛蘭素史克智慧財產(第二)有限公司 | Novel pharmaceutical composition |
| CN102146411B (en) * | 2011-01-06 | 2013-01-02 | 中国人民解放军第三军医大学第三附属医院 | Novel bifunctional cicatrix and tissue fibrosis resistant oligonucleotide medicament |
-
2013
- 2013-08-05 WO PCT/IB2013/001990 patent/WO2015019125A1/en not_active Ceased
-
2014
- 2014-07-30 EP EP14744578.7A patent/EP3030574B1/en not_active Not-in-force
- 2014-07-30 US US14/909,669 patent/US10071097B2/en not_active Expired - Fee Related
- 2014-07-30 JP JP2016532316A patent/JP6473155B2/en not_active Expired - Fee Related
- 2014-07-30 CN CN201480043897.4A patent/CN105829338A/en active Pending
- 2014-07-30 CA CA2919600A patent/CA2919600A1/en not_active Abandoned
- 2014-07-30 WO PCT/EP2014/066344 patent/WO2015018699A1/en not_active Ceased
- 2014-07-30 BR BR112016002570A patent/BR112016002570A2/en not_active Application Discontinuation
- 2014-07-30 ES ES14744578.7T patent/ES2675579T3/en active Active
- 2014-07-30 EP EP18156497.2A patent/EP3354659A3/en not_active Withdrawn
-
2018
- 2018-08-06 US US16/055,571 patent/US20190022097A1/en not_active Abandoned
- 2018-11-15 JP JP2018214549A patent/JP2019038847A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012120269A1 (en) * | 2011-03-08 | 2012-09-13 | University College Cardiff Consultants Limited | Molecular targets for healing or treating wounds |
Non-Patent Citations (10)
| Title |
|---|
| BENANTI JA; WILLIAMS DK; ROBINSON KL; OZER HL; GALLOWAY DA: "Induction of extracellular matrix-remodeling genes by the senescence- associated protein APA-1", MOL CELL BIOL, vol. 22, 2002, pages 7385 - 7397 |
| CHEMBIOCHEM., vol. 7, no. 1, January 2006 (2006-01-01), pages 74 - 82 |
| CURR DRUG TARGETS CARDIOVASC HAEMATOL DISORD., vol. 5, no. 5, October 2005 (2005-10-01), pages 377 - 86 |
| DANIEL NOWINSKI ET AL: "Analysis of Gene Expression in Fibroblasts in Response to Keratinocyte-Derived Factors In Vitro: Potential Implications for the Wound Healing Process1", JOURNAL OF INVESTIGATIVE DERMATOLOGY, vol. 122, no. 1, 1 January 2004 (2004-01-01), pages 216 - 221, XP055111564, ISSN: 0022-202X, DOI: 10.1046/j.0022-202X.2003.22112.x * |
| DAVID H GORSKI ET AL: "Inhibition of endothelial cell activation by the homeobox gene Gax", JOURNAL OF SURGICAL RESEARCH, vol. 111, no. 1, 1 May 2003 (2003-05-01), pages 91 - 99, XP055111506, ISSN: 0022-4804, DOI: 10.1016/S0022-4804(03)00042-8 * |
| DUSTIN M BERMUDEZ ET AL: "Inhibition of stromal cell-derived factor-1 further impairs diabetic wound healing", JOURNAL OF VASCULAR SURGERY, C.V. MOSBY CO., ST. LOUIS, MO, US, vol. 53, no. 3, 5 October 2010 (2010-10-05), pages 774 - 784, XP028147676, ISSN: 0741-5214, [retrieved on 20101022], DOI: 10.1016/J.JVS.2010.10.056 * |
| MARTIN P ET AL: "Growth factors and cutaneous wound repair", PROGRESS IN GROWTH FACTOR RESEARCH, PERGAMON PRESS, GB, vol. 4, no. 1, 1 January 1992 (1992-01-01), pages 25 - 44, XP026324179, ISSN: 0955-2235, [retrieved on 19920101], DOI: 10.1016/0955-2235(92)90003-Z * |
| MULLER M: "Cellular senescence: molecular mechanisms, in vivo significance, and redox considerations", ANTIOXID REDOX SIGNAL, vol. 11, 2009, pages 59 - 98 |
| P. LIU ET AL: "Cross Talk Among Smad, MAPK, and Integrin Signaling Pathways Enhances Adventitial Fibroblast Functions Activated by Transforming Growth Factor- 1 and Inhibited by Gax", ARTERIOSCLEROSIS, THROMBOSIS, AND VASCULAR BIOLOGY, vol. 28, no. 4, 1 April 2008 (2008-04-01), pages 725 - 731, XP055111941, ISSN: 1079-5642, DOI: 10.1161/ATVBAHA.107.159889 * |
| TELGENHOFF D; SHROOT B: "Cellular senescence mechanisms in chronic wound healing", CELL DEATH DIFFER, vol. 12, 2005, pages 695 - 698 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017053389A1 (en) * | 2015-09-21 | 2017-03-30 | Jeffrey Stern | Methods for inhibiting epithelial to mesenchymal transition by inhibition of foxs1 |
| RU2708302C1 (en) * | 2016-01-11 | 2019-12-05 | Тюркие Шише Ве Джам Фабрикалары А.Ш. | Glass with low-emission coating, resistant to heat treatment |
| CN106868006A (en) * | 2017-03-29 | 2017-06-20 | 华中科技大学同济医学院附属协和医院 | A kind of E2F1 albumen can combine DNA fragmentation and the application in E2F1 Activity determinations |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3354659A2 (en) | 2018-08-01 |
| EP3030574B1 (en) | 2018-03-28 |
| JP2019038847A (en) | 2019-03-14 |
| CA2919600A1 (en) | 2015-02-12 |
| BR112016002570A2 (en) | 2017-09-12 |
| EP3030574A1 (en) | 2016-06-15 |
| CN105829338A (en) | 2016-08-03 |
| EP3354659A3 (en) | 2018-09-12 |
| ES2675579T3 (en) | 2018-07-11 |
| JP2016527290A (en) | 2016-09-08 |
| WO2015018699A1 (en) | 2015-02-12 |
| US20190022097A1 (en) | 2019-01-24 |
| US20170281628A1 (en) | 2017-10-05 |
| JP6473155B2 (en) | 2019-02-20 |
| US10071097B2 (en) | 2018-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3030573B1 (en) | Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids | |
| Huang et al. | Development of a novel RNAi therapy: engineered miR-31 exosomes promoted the healing of diabetic wounds | |
| Sun et al. | Low‐dose paclitaxel ameliorates fibrosis in the remnant kidney model by down‐regulating miR‐192 | |
| Ning et al. | Blocking exosomal miRNA-153-3p derived from bone marrow mesenchymal stem cells ameliorates hypoxia-induced myocardial and microvascular damage by targeting the ANGPT1-mediated VEGF/PI3k/Akt/eNOS pathway | |
| Maleszewska et al. | IL-1β and TGFβ2 synergistically induce endothelial to mesenchymal transition in an NFκB-dependent manner | |
| Wang et al. | KLF4 alleviates hypertrophic scar fibrosis by directly activating BMP4 transcription | |
| Liu et al. | Wnt/β-catenin pathway forms a negative feedback loop during TGF-β1 induced human normal skin fibroblast-to-myofibroblast transition | |
| Li et al. | circPAN3 exerts a profibrotic role via sponging miR-221 through FoxO3/ATG7-activated autophagy in a rat model of myocardial infarction | |
| Feng et al. | LncRNA Blnc1 expression and its effect on renal fibrosis in diabetic nephropathy | |
| Zhang et al. | MicroRNA‐182 exacerbates blood‐brain barrier (BBB) disruption by downregulating the mTOR/FOXO1 pathway in cerebral ischemia | |
| Shangguan et al. | GAS5 knockdown ameliorates apoptosis and inflammatory response by modulating miR-26b-5p/Smad1 axis in cerebral ischaemia/reperfusion injury | |
| US20190022097A1 (en) | Molecular targets for the treatment of wounds, in particular chronic wounds | |
| Wang et al. | Functional characterization of TRAP1-like protein involved in modulating fibrotic processes mediated by TGF-β/Smad signaling in hypertrophic scar fibroblasts | |
| Zhang et al. | Suv39h1 downregulation inhibits neointimal hyperplasia after vascular injury | |
| Green et al. | HuR-dependent expression of Wisp1 is necessary for TGFβ-induced cardiac myofibroblast activity | |
| KR102026138B1 (en) | Composition for Inhibition or Treatment of Keloids and Hypertrophic Scar Comprising CRIF1 Antagonist | |
| Wu et al. | Silibinin attenuates TGF-β2-induced fibrogenic changes in human trabecular meshwork cells by targeting JAK2/STAT3 and PI3K/AKT signaling pathways | |
| Li et al. | Mechanism of cold exposure delaying wound healing in mice | |
| Sun et al. | Down‐regulation of mir‐27b promotes angiogenesis and fibroblast activation through activating PI3K/AKT signaling pathway | |
| Li et al. | Sevoflurane Preconditioning Downregulates GRIA1 Expression to Attenuate Cerebral Ischemia–Reperfusion-Induced Neuronal Injury | |
| Zhang et al. | The mechanisms related to fibroblasts in burn surface | |
| Ren et al. | The rejuvenation and functional restoration of aged adipose stem cells by DUXAP10 knockdown via the regulation of the miR-214-3p/RASSF5 axis | |
| CN108245678A (en) | Prevent or delay the method and drug of heart aging | |
| Fu et al. | Tanshinone ⅡA inhibits the lipopolysaccharide-induced epithelial-mesenchymal transition and protects bovine endometrial epithelial cells from pyolysin-induced damage by modulating the NF-κB/Snail2 signaling pathway | |
| Tao et al. | Pirfenidone suppresses the abnormal activation of human Müller cells after platelet-derived growth factor-BB stimulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13779625 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13779625 Country of ref document: EP Kind code of ref document: A1 |