WO2015019124A1 - Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids - Google Patents

Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids Download PDF

Info

Publication number
WO2015019124A1
WO2015019124A1 PCT/IB2013/001989 IB2013001989W WO2015019124A1 WO 2015019124 A1 WO2015019124 A1 WO 2015019124A1 IB 2013001989 W IB2013001989 W IB 2013001989W WO 2015019124 A1 WO2015019124 A1 WO 2015019124A1
Authority
WO
WIPO (PCT)
Prior art keywords
fibrosis
keloid
agent
therapeutic compound
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2013/001989
Other languages
French (fr)
Inventor
Claire DUGAST-DARZACQ
Maïté NOIZET
Xavier Darzacq
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Universite Paris Diderot Paris 7
Societe de Developpement et de Recherche Industrielle SAS
Ecole Normale Superieure de Paris
Original Assignee
Centre National de la Recherche Scientifique CNRS
Institut National de la Sante et de la Recherche Medicale INSERM
Universite Paris Diderot Paris 7
Societe de Developpement et de Recherche Industrielle SAS
Ecole Normale Superieure de Paris
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS, Institut National de la Sante et de la Recherche Medicale INSERM, Universite Paris Diderot Paris 7, Societe de Developpement et de Recherche Industrielle SAS, Ecole Normale Superieure de Paris filed Critical Centre National de la Recherche Scientifique CNRS
Priority to PCT/IB2013/001989 priority Critical patent/WO2015019124A1/en
Priority to PCT/EP2014/066342 priority patent/WO2015018698A1/en
Priority to ES14744577.9T priority patent/ES2653992T3/en
Priority to JP2016532315A priority patent/JP6514204B2/en
Priority to EP17196300.2A priority patent/EP3301112B1/en
Priority to US14/909,626 priority patent/US9840704B2/en
Priority to EP14744577.9A priority patent/EP3030573B1/en
Priority to BR112016002524A priority patent/BR112016002524A2/en
Priority to CA2919573A priority patent/CA2919573A1/en
Priority to CN201480044360.XA priority patent/CN105793279A/en
Publication of WO2015019124A1 publication Critical patent/WO2015019124A1/en
Anticipated expiration legal-status Critical
Priority to US15/809,541 priority patent/US20180057819A1/en
Priority to JP2019030314A priority patent/JP2019108347A/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/12Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications

Definitions

  • the present invention relates to at least one molecular target for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids.
  • the invention concerns a novel therapeutic for preventing or treating fibrosis, hypertrophic scars or keloids and a novel gene therapy approach, involving said molecular target for preventing and/or treating said fibrosis, hypertrophic scars or keloids.
  • the invention concerns a method for preventing and/or treating fibrosis, hypertrophic scars or keloids using said therapeutic or said gene therapy.
  • Fibrosis is the formation of excess fibrous tissues or scar tissue in an organ or a tissue. Fibrosis is a common pathophysiological response of tissues to chronic injury or long-term inflammation. There are many potential origins of this fibrosis. It can be induced by a disease (inherited or not), by side effects of a treatment (for example radiation or chemotherapy), by a toxic environment (for example smoking), or by an injury. It can affect different organs such as the skin or the lung.
  • Fibrosis induced generally the failure of the tissue of the organ that is affected. Fibrotic tissue is like a scar tissue, stiff, thick, and rigid. Sometimes, it can also swell. For example, in the lung, fibrosis lead to a shortness of breath particularly during exercise and dry and hacking cough, due to the abnormal expansion of the fibrosis lung.
  • fibrosis are pulmonary fibrosis (lungs), cystic fibrosis (lung and digestive system), Crohn's Disease (intestine), scleroderma/systemic sclerosis (lungs or skin), arthrofibrosis (knee, shoulder, other joints), cutaneous fibrosis with hypertrophic or keloid scars
  • the tissue concerned by this phenomenon is the skin, it is principally the wound healing process that is affected.
  • the natural wound healing is divided into three sequential phases; each phase is characterized by specific cellular activities: the inflammatory phase, the proliferative phase and the remodeling phase.
  • the first phase begins minutes after injury.
  • the blood vessels rupture induces the clot formation, composed mainly of fibrin and fibronectin.
  • the clot fills partially the lesion and allows the migration of the inflammatory cells within the lesion.
  • the inflammatory cells are recruited to debride the wound. Platelets secrete factors, such as growth factors or cytokines, which induce the recruitment of cells implicated in the wound healing (inflammatory cells such as neutrophils and macrophages, fibroblasts and endothelial cells).
  • the second phase is called the proliferative phase and corresponds to the development of the granulation tissue.
  • Fibroblasts migrate into the wound area, proliferate and form a new provisional extracellular matrix by secreting extracellular matrix (ECM) proteins. Then endothelial cells migrate to promote the neovascularization or angiogenesis of the lesion.
  • ECM extracellular matrix
  • endothelial cells migrate to promote the neovascularization or angiogenesis of the lesion.
  • fibroblasts activate and differentiate into myofibroblasts, presenting contractile properties thanks to their expression of alpha-smooth muscle actin (similar to that in smooth muscle cells).
  • Myofibroblasts have a key role in wound healing as they provide the contraction of the wound.
  • keratinocytes migrate from the wound edge, proliferate and differentiate to reconstitute the epidermis.
  • the last phase of the wound healing process appears after the wound closure. It corresponds to the remodeling of the granulation tissue.
  • the granulation tissue is reorganized, type III collagen is replaced by type I collagen, as normal dermis is principally composed of type I collagen.
  • myofibroblasts in excess are eliminated by apoptosis.
  • the last phase of the wound healing is long. One year after injury, the scar is remodeled; it gets less red and thinner.
  • Fibroblasts are implicated in the process of wound healing, this involves several steps of differentiation from a quiescent fibroblast to a mobilized fibroblast that will transform into a myofibroblast and finally enter apoptosis.
  • fibroblasts In normal wound healing, fibroblasts get activated, and then differentiate into myofibroblasts presenting contractile properties thanks to their expression of alpha-smooth muscle actin (aSMA).
  • aSMA alpha-smooth muscle actin
  • Myofibroblasts are responsible for the deposit of extra cellular matrix and for the wound closure by moving closer the wound edges.
  • the activity of myofibroblasts persists and leads to tissue deformation, which is particularly evident, for example, in hypertrophic scars developed after burn injury.
  • the aim of the present invention is to map, at the whole genome scale, the different genes that will be activated or deactivated during this process, and thus providing a molecular signature of abnormal healing leading to abnormal scar or fibrosis
  • Connective tissues represent a wide variety of physical structures and different functions: tendons, cartilage, bone, dermis, cornea, etc.
  • organs and tissues have specific functions (for example, skin functions are protection, sensation and heat regulation), connective tissues constituting these tissues and organs have also precise functions provided by specific cell types.
  • connective tissues constituting these tissues and organs have also precise functions provided by specific cell types.
  • types III, IX, X collagens are found associated with aggregan and dermatan sulfate in tendons.
  • Fibroblasts are the main cells of connective (or mesenchymal) tissues, in which cells are surrounded by extracellular matrix (contrary to epithelium where they are jointed together).
  • fibroblasts are active in wound healing of damages organs, as they proliferate, differentiate in myofibroblast, secrete collagens and other specific ECM proteins and fibers composing the connective tissue of the organ, leading to the healing and reorganization of the tissue.
  • Myofibroblasts are defined as the primary source of the excessive ECM proteins deposition occurring during fibrosis. Resident myofibroblasts arise from a population of tissue specific fibroblasts that proliferate and undergo activation in response to injury, as it is the case in many organs such as skin, lungs, or kidney.
  • Fibrosis hypertrophic scars and keloids Fibrosis is a common pathophysiological response of tissues to chronic injury. Fibrosis affects different organs such as the skin or the lung. Fibrosis is characterized by a differentiation of fibroblasts into myofibroblasts and an excessive accumulation of connective tissue. Fibrosis induces a loss of function of the organ and potentially the failure of the organ. Hypertrophic, keloid or fibrous scars result from abnormal wound healing. These scars are characterized by an excessive deposit of ECM proteins, especially collagen. In these abnormal wounds, granulation tissue is hyper proliferative, due to an excess of myofibroblasts ( « Cellular and molecular pathology of HTS: basis for treatment. » Armour A, Scott PG, Tredget EE. Wound Repair Regen. 2007 Sep-Oct; 15 Suppl 1:S6-17. Review. Erratum in: Wound Repair Regen. 2008 Jul-Aug;16(4):582).
  • fibroblasts In normal wound healing, fibroblasts get activated, and then differentiate into myofibroblasts presenting contractile properties thanks to their expression of alpha-smooth muscle actin (aSMA).
  • aSMA alpha-smooth muscle actin
  • Myofibroblasts are responsible for the deposit of extra cellular matrix and for the wound closure by moving closer the wound edges.
  • aSMA alpha-smooth muscle actin
  • myofibroblasts persists and leads to tissue deformation, which is particularly evident, for example, in hypertrophic scars developed after burn injury.
  • Hypertrophic and keloid scars are characterized by deposit of excessive amounts of collagen leading to a raised scar (more intense in keloids than in hypertrophic scars). They are formed most often at the sites of pimples, body piercings, cuts and burns. Some hypertrophic scars are non-functional scars as they limit the function of the skin where they developed. They generate a loss of mobility of the scar zone and the neighboring zones, which can completely limit the movements (for example, elbow and mobility of the arm). They are mostly the result of burns of specific anatomical zones.
  • the treatment of the wound is especially adapted to the wound in its early stage if it presents a risk of developing an abnormal scar or failing to heal correctly.
  • By enhancing or manipulating factors that contribute to wound healing it may therefore be possible to correct the process, thereby reducing the likely occurrence of a fibrosis, hypertrophic scar or keloid.
  • a tissue of an organ for example
  • the treatment of this tissue at an early stage is also of interest.
  • the present invention can improve the quality of a patient's life by ensuring that new wounds do not deteriorate into a fibrosis, hypertrophic scar or keloid and existing wounds can be treated in a way that actively promotes healing and by the way prevents the formation of fibrosis, hypertrophic scar or keloid.
  • the present invention relates to a therapeutic compound comprising:
  • the present invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutic compound as defined above together with a pharmaceutically acceptable carrier.
  • the invention also relates to a method for preparing a pharmaceutical composition as described above comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
  • the invention relates to a method for treating or preventing mammalian fibrosis, hypertrophic scar or keloid wherein said method comprises administering to said fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid a therapeutic compound comprising:
  • the invention relates to a kit for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said kit comprises: (a) at least one therapeutic compound or composition as defined above and
  • the invention also relates to a combination therapeutic for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid comprising:
  • the invention relates to the use of: - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXSl, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXSl, STAT4
  • fibrosis for treating fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said agent modulates fibroblast and myofibroblast differentiation and/or activity
  • a therapeutic compound comprising: (a) an agent that inhibits the activity of at least one gene selected from the group consisting of:
  • TCF4 preferentially TCF4, FOXS1, STAT4 an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2 for use in the prevention and/or treatment of fibrosis, hypertrophic scars or keloids.
  • said therapeutic compound also comprises: an agent that inhibits the activity of at least one gene selected from the group consisting of E2F1, EGR2, GLI1, JUN, MYC, SMAD3, SMAD4, SOX9, SRF, preferentially EGR2, SOX9
  • ETS1, PPARG an agent that enhances the activity of at least one gene selected from the group consisting of ETS1, PPARG for use in the prevention and/or treatment of fibrosis, hypertrophic scars or keloids.
  • the invention involves a novel gene therapy approach and/or a novel protein therapy approach.
  • agent that inhibits the activity of a gene refers to an agent than can downregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by decreasing the amount of protein present in a given cell, or by inhibiting the protein's activity.
  • the expression "agent that enhances the activity of a gene” or “enhancer” refers to an agent than can upregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by increasing the amount of protein present in a given cell, or by increasing the protein's activity. It also encompasses agents that act upstream or downstream of said gene or protein in a signaling pathway.
  • the novel therapeutic comprises an inhibitor or enhancer of the gene expression, this inhibitor or enhancer can be either an anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid and viral vectors or a drug.
  • said therapeutic compound is a siRNA selected from the group consisting of siRNA having the sequence as set forth in SEQ ID No: 11 to SEQ ID No:74 and mixtures thereof:
  • siRNA inhibit the expression of the target genes.
  • the agent that enhances the activity of a gene is a cDNA.
  • the expression of the CREB5 gene can be enhanced by administering the CREB5 cDNA.
  • the cDNA can be administered or delivered to the fibrosis, hypertrophic scar or keloid to be treated in any suitable form known to the skilled person in art. It can be delivered as naked DNA, using plasmid vectors, viral vectors, or any other suitable means.
  • the novel therapeutic comprises an inhibitor or enhancer of the protein encoded by the gene function
  • this inhibitor or enhancer can be either a binding agent that binds, either reversibly or irreversibly, to inhibit or enhance protein function such as an antibody or a known, or synthesized, protein agonist or antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit or enhance the protein signaling and so negate or enhance the effects of expression of the protein in wound tissue.
  • Said agent can be any agent known in the art to act upon a given molecular target.
  • the enhancer of PPARG can be selected in the group consisting of thiazolidinediones, such as rosiglitazone and pioglitazone (Curr Drug Targets Cardiovasc Haematol Disord. 2005 Oct;5(5):377-86.
  • the inhibitor of PPARG can be G3335 (CAS 36099-95-3) (Chembiochem. 2006 Jan;7(l):74-82.
  • the dipeptide H-Trp-Glu-OH shows highly antagonistic activity against PPARgamma: bioassay with molecular modeling simulation. Ye F, Zhang ZS, Luo HB, Shen JH, Chen KX, Shen X, Jiang HL.).
  • the therapeutic of the invention is for use in the treatment or prevention of fibrosis, hypertrophic scar or keloid.
  • fibrosis, hypertrophic scars or keloids are preferentially mammalian fibrosis, hypertrophic scars or keloids, more preferentially human fibrosis, hypertrophic scars or keloids.
  • An antibody for use in the invention is most ideally a monoclonal antibody or a humanized antibody.
  • the therapeutic is formulated for topical application, but it can also be formulated for oral, cutaneous, transcutaneous, transdermal, intravenous or any application known.
  • the therapeutic is formulated for application into a dressing or impregnation of a dressing.
  • the therapeutic of the invention may be administered with an active agent.
  • active agent may be an antibiotic or antibacterial agent, an antiseptic, an antiviral, an antifungal, an analgesic, an anti-inflammatory agent, a wound healing agent, a keratolytic agent, an anesthetic agent.
  • actives are well known to skilled practitioners.
  • a pharmaceutical composition for use in treating fibrosis, hypertrophic scar or keloid comprising a therapeutic of the invention together with a pharmaceutical acceptable carrier.
  • active materials may also be present in the pharmaceutical composition, as may be considered appropriate or advisable for the fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid being treated.
  • each of the carriers must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient.
  • formulations include those suitable for topical, oral, rectal, nasal or any administration known and may be prepared by any methods well known in the art of pharmacy.
  • the composition may be prepared by bringing into association the therapeutic of the invention and the carrier.
  • the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely bringing into association the active with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
  • the invention extends to methods for preparing a pharmaceutical composition comprising bringing a therapeutic of the invention in conjugation or association with a pharmaceutically acceptable carrier or vehicle.
  • compositions for topical application to the skin, compounds of conventional use may be made up into a cream, ointment, gel, jelly, solution or suspension etc.
  • Cream or ointment formulations that may be used for the composition are conventional formulations well known in the art.
  • Formulations for oral administration in the present invention may be presented as: capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a nonaqueous liquid; or as an oil-in-water liquid emulsion or a water in oil liquid emulsion; or as a bolus etc.
  • the term "acceptable carrier” includes vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica.
  • vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinyl
  • the further aspect of the invention also, or alternatively, comprises a novel method for preventing and/or treating fibrosis, hypertrophic scar or keloid which method comprises: administering to said fibrosis, hypertrophic scar or keloid: an agent that inhibits the activity of at least one gene selected in the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4 preferentially TCF4,
  • the invention also comprises a novel method for preventing and/or treating fibrosis, hypertrophic scar or keloid which method further comprises administering to said fibrosis, hypertrophic scar or keloid:
  • E2F1, EGR2, GLI1, JUN, MYC, SMAD3, SMAD4, SOX9 and SRF preferentially EGR2, SOX9 and/or an agent that enhances the activity of at least one gene selected from ETS1, PPARG.
  • kits for preventing and/or treating fibrosis, hypertrophic scars or keloids which method comprises, wherein said kit comprises: (a) at least one therapeutic as above described; and
  • medical device includes an instrument, apparatus, implant, in vitro reagent, or similar or related article that is used to diagnose, prevent, or treat disease or other conditions, and does not achieve its purposes through chemical action within or on the body (which would make it a drug). Whereas medicinal products (also called pharmaceuticals) achieve their principal action by pharmacological, metabolic or immunological means, medical devices act by other means like physical, mechanical, or thermal means. According to a yet further aspect of the invention there is provided a combination therapeutic for preventing and/or treating fibrosis, hypertrophic scars or keloids comprising an inhibitor or enhancer of gene expression and an inhibitor or enhancer of protein activity.
  • a therapeutic for preventing and/or treating fibrosis, hypertrophic scars or keloids an inhibitor or enhancer of protein, or a homologue thereof.
  • an inhibitor or enhancer of protein, or a homologue thereof in the manufacture of a medicament for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid.
  • an inhibitor or enhance of protein, or a homologue thereof for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid.
  • homologue refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 and which retain the biological activity of the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 sequence.
  • homologues are at least 75% homologous to the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 peptide sequence.
  • Treatment of fibrosis, hypertrophic scar or keloid described herein includes reference to human or veterinary use.
  • the word "comprises”, or variations such as “comprises” or “comprising” is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.
  • any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
  • Figure 1 Key transcription factors in fibroblast to myofibroblast differentiation a) Graphical explanation of the in silico gene network analysis b) Table representing the different transcription factors identified by bioinformatical and network analysis.
  • Figure 2a Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR.
  • NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (FOXS1, EGR2, SRF, SOX9, HICl, STAT4, TCF4, MYC, JUN, IRF7, E2F1, GLI1, CREB5 STAT1) and concomitantly subjected or not to TGFpi treatment.
  • the RTqPCR were normalized with TUBB and the mock siRNA treated (TGF-b) condition was set to one.
  • the treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible.
  • the treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation.
  • Figure 2b Graphic representation of the percentage of differentiated cells as assessed by the percentage of alpha SMA positive cells after treatment of NHDFs as described in a).
  • the treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible.
  • the treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation.
  • Figure 2c Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR.
  • Primary human dermal fibroblasts were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2).
  • the RTqPCR were normalized with TUBB and the mock siRNA treated (TGF-b) condition was set to 1.
  • the treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation.
  • Figure 3 short and long timing after TGFpi treatment of FOXS1, EGR2, SRF, SOX9, HICl, STAT4, TCF4, MYC, JUN, IRF7, E2F1, GLI1, CREB5.
  • Factor graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFP as assessed by RT-qPCR.
  • Figure 4 short and long timing after TGFpi treatment of PPARG, SIX2, MEOX2, MAF.
  • Figure 4 graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFp as assessed by RT-qPCR.
  • FIG. 5 Graphic representation of the TCF4 (a), EGR2 (b), SOX9 (c), STAT4 (d), FOXS1 (e), PPARG (f), MAF (g), MEOX2 (h), and SIX2 (i) mRNA levels after NHDF (donor A) treatment for 48h (light grey) or 72h (dark grey) either with mock siRNA or siRNA directed against different TF mRNA (SOX9, EGR2, TCF4, or FOXS1) and concomitantly treated with TGF- ⁇ .
  • the mock siRNA treated with TGF- ⁇ (T+E) condition was set to 100% for each time of treatment (48h and 72h).
  • Table 1 gene to increase or decrease to treat and/or prevent fibrosis, hypertrophic scars or keloids
  • fibroblasts migrate into the wound where they differentiate into contractile myofibroblasts that will finally enter into apoptosis during the remodeling phase. This differentiation process can be studied ex-vivo in environmentally controlled tissue culture conditions, and therefore the timely controlled succession of different gene expression patterns can be addressed.
  • Myofibroblasts represent the key players in the physiological reconstruction of skin after injury and in generating the pathological tissue deformations that characterize fibrosis such as hypertrophic scars (Desmouliere A, Chaponnier C, Gabbiani G (2005) Tissue repair, contraction, and the myofibroblast. Wound Repair Regen 13: 7-12).
  • NHDF myofibroblasts involved in generating fibrosis, hypertrophic or keloid scars
  • NHDF were cultivated on collagen coated culture plates in DMEM-F12 (Invitrogen), supplemented with 10% FCS (Invitrogen), 5Ng/mL of insulin and Ing/mL of b-FGF (Promo Kine) and 10 ng/mL of TGF-Ol (Promocell), as TGF-Ol is known to induce the expression of aSMA in fibroblasts (Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G 13 (1993) Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol, 1993 jul, 122(1): 103-111). The efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
  • This aSMA expression was assessed by RT-qPCR (mRNA levels) and by Western Blot (protein).
  • the efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
  • Total proteins were extracted by scratching the cells with lysis buffer (TRIS, NaCl, NP40, EDTA, IMDTT) and incubated 30 min in ice. To remove cell debris, the samples were centrifuged at 13,000 x g for 10 min at 4°C and store at -20°C until use. Protein concentration was determined according to BCA method (Sigma). Equal amounts of total protein (20 ⁇ g) were loaded to NuPAGE 10% BIS-Tris gel (Invitrogen), separated by migration at 150 V, and transferred to nitrocellulose membrane (Whatman) 1 hour at 30 V. Then, membranes were stained for aSMA (Abeam) and tubulin (Abeam).
  • lysis buffer TriS, NaCl, NP40, EDTA, IMDTT
  • RT-qPCR Quantitative real-time PCR
  • the cycling conditions were as follows : an initial 95 °C for 10 minutes, followed by 45 cycles of 95 °C for 15 sec, 58°C for 30 sec, 72°C for 20 sec.
  • LightCycler 480 SW 1.5 was used to evaluate the TM curves, to determine the Cp and to approximate the relative concentration for each amplification reaction.
  • the expression the different TF was knocked down by transiently transfecting NHDF with specific small interfering RNAs.
  • At least two different siRNAs Qiagen
  • highly specific ON TARGET PLUS smartpool siRNAs Thermo Scientific
  • NHDF were treated with ⁇ siRNA and ⁇ L of INTERFERin reagent (PolyPlus, Ozyme), according to the manufacturer's instruction and concomittanty treated with TGF- ⁇ and exudates for 6 days.
  • a second transfection was performed at 48h after the first one. The efficiency of the knock down was assessed 48h after the first transfection.
  • upstream regulator analysis Given the particular profile of genes expression between two conditions, consists in selecting potential upstream regulators.
  • the DIRE analysis is based on the selection of potential common regulatory elements between genes based on these elements conservation during evolution. From these identified elements, DIRE is able to provide a list of master regulators for a list of co-regulated genes. From those two analyses, and for each list analyzed, we have selected Transcription Factors (TFs) expressed in at least one of the two conditions considered in the concerned list (i.e. number of sequencing his superior to twenty in at least one of the two conditions). Then, we have deeply compared the two sets of analysis and decided to keep in the "key regulators lists" transcription factors belonging to both analyses.
  • TFs Transcription Factors
  • TFs Transcription Factors
  • siRNA knock-down of fourteen of the potential key transcription factors identified therein inhibited the fibroblast to myofibroblast differentiation pathway as assessed by analyzing the aSMA expression from TGFp and siRNA-treated NHDFs: GLI1, HICl, TCF4, SOX9, STAT4 MYC, CREB5, IRF7, JUN, E2F1, EGR2, SRF, FOXS1 as their knockdown decreased inhibit more or less efficiently the myofibroblast differentiation (Fig. 2 a-b-c).
  • siRNA knock-down of four other potential key transcription factors identified by the in silico analysis seemed to induce the fibroblast to myofibroblast differentiation in absence of TGFP to the same extend as the one obtained with mock transfected cells treated with TGFp. Altogether these results showed that with knocking-down approaches we were able either to reduce or induce fibroblast to myofibroblast differentiation (Table 1).
  • FOXS 1 belongs to the forkhead family of transcription factor often involved in developmental processes such as morphogenesis and differentiation. It has been shown that FOXSl is of primary importance in the development of testicular vasculature. Moreover, FOXSl was described as an early sensory neuronal marker. Here we show that inactivation of FOXSl leads to an increase of myofibroblast differentiation in absence of TGFp.
  • MEOX2 has already been described as implicated in TGFP pathway as it was identified as an important factor in cleft palate development in TGFP3 knockout mice.
  • C2C12 myoblast cells showed that MEOX2 is also important for skeletal muscle development and differentiation.
  • siRNA directed against MEOX2 lead to a bypass of the exudate effect by fibroblasts to be able to differentiate into myofibroblasts.
  • MAF was responsible for inhibition of IL22 expression by neutralizing TGFp.
  • TGFP and MAF have antagonist/opposite effects on IL21 expression in CD4(+) T cells.
  • MAF as an inhibitor of fibroblast to myofibroblast differentiation in absence or presence of exudate as its inactivation by siRNA leads to an increase of myofibroblast differentiation.
  • chondrocyte differentiation a long form of MAF interacts and cooperates with SOX9 to activate downstream targets. This is another example of the differences between myofibroblast and chondrocyte differentiations.
  • SIX2 has been involved in maintaining pluripotency in kidney: in embryonal renal mesenchyme cells it is able to suppress differentiation and during kidney development it maintains the progenitor pool.
  • the invalidation of SIX2 leads to a bypass of the dominant exudate effect on TGFP signaling.
  • TCF4 mRNA was not modified after SOX9, EGR2 or FOXSl knockdown (Fig 5) placing it at the top of the regulatory interaction network between these factors.
  • EGR2 expression was largely inhibited upon siRNA treatment against TCF4 and SOX9 but remained unchanged upon treatment against FOXSl (Fig 5) placing it after TCF4 and SOX9 but before FOXSl in the network.
  • SOX9 mRNA remained largely unchanged upon TCF4 and FOXSl knockdown.
  • FOXSl as a downstream target of SOX9.
  • SOX9 is upregulated upon EGR2 knockdown (Fig 5)
  • the STAT4 mRNA is downregulated by TCF4, SOX9 and EGR2 knockdown (Fig 5) placing is as a downstream target of those TF whereas it remained unchanged upon FOXSl siRNA treatment placing it beforehand.
  • FOXSl mRNA is downregulated upon TCF4, SOX9 and EGR2 siRNA treatment (Fig 5) placing it at the end of this cascade.
  • the PPARG, MAF and MEOX2 mRNA were upregulated upon siRNA treatment against TCF4, SOX9, EGR2 and FOXSl (Fig 5) consistent with their role as antagonist in fibroblast differentiation.
  • SIX2 mRNA level was unchanged upon EGR2 and FOXSl knockdown (Fig 5) but upregulated in the same manner by TCF4 and SOX9 consistent with a close interconnexion between these two TF and suggesting the existence of a balanced signal between the differentiation agonists SOX9 and TCF4 and the antagonist SIX2.
  • Myofibroblast are not only key cells in fibrosis, their importance has long been proven in cancer too where the presence of myofibroblast in the stroma as "cancer associated fibroblast" facilitate tumor development and has been often associated with inflammation, cell invasion, high grade malignancy and poor prognosis.
  • Myofibroblast are enriched in stroma from prostate cancer compared to benign prostatic hyperplasia and associated at the leading edge of carcinomas. They produce MMP, cytokines (IL8, VEGF) and chemokines (CXCL12) to promote cancer proliferation, tumor invasion and neo-angiogenesis. As alternative therapeutic tracks, it seems of primary importance to target stromal cells (and among them myofibroblasts) in cancer to diminish its abilities to migrate, invade and proliferate.
  • Tissue fibrosis (like pulmonary fibrosis, liver fibrosis, renal interstitial fibrosis, cardiovascular fibrosis, hypertrophic or keloid scars?) is primarily attributed to an excessive activation of ECM producing myofibroblasts by TGFpi.
  • a better understanding of the gene expression route from fibroblast to myofibroblast is of great interest in the fibrosis understanding and curing.
  • exudate from chronic wounds are able to prevent and reverse the myofibroblast differentiation giving new signs of the reversibility of differentiation as it has already been shown for liver, kidney or Hepato Stellar Cell (HSC) derived myofibroblast.
  • HSC Hepato Stellar Cell
  • Myofibroblasts are not only key cells in fibrosis, their importance has been long proven in cancer too where the presence of myofibroblast in the stroma as "cancer associated fibroblast" facilitate tumor development and has been often associated with inflammation, cell invasion, high grade malignancy and poor prognosis.
  • Myofibroblast are enriched in stroma from prostate cancer compared to benign prostatic hyperplasia and associated at the leading edge of carcinomas. They produce MMP, cytokines (IL8, VEGF) and chemokines (CXCL12) to promote cancer proliferation, tumor invasion and neo- angiogenesis. As alternative therapeutic tracks, it seems of primary importance to target stromal cells (and among them myofibroblasts) in cancer to diminish its abilities to migrate, invade and proliferate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Materials For Medical Uses (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicinal Preparation (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a therapeutic compound comprising : - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS1, CREB5, HIC1, IRF7, POU2F2, SIX2, STAT4, TCF4, and/or - an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2 for use in the prevention and/or treatment of fibrosis, hypertrophic scar or keloid.

Description

Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
Field of the invention
The present invention relates to at least one molecular target for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids. Further, the invention concerns a novel therapeutic for preventing or treating fibrosis, hypertrophic scars or keloids and a novel gene therapy approach, involving said molecular target for preventing and/or treating said fibrosis, hypertrophic scars or keloids. Additionally, the invention concerns a method for preventing and/or treating fibrosis, hypertrophic scars or keloids using said therapeutic or said gene therapy.
Background of the invention
Fibrosis is the formation of excess fibrous tissues or scar tissue in an organ or a tissue. Fibrosis is a common pathophysiological response of tissues to chronic injury or long-term inflammation. There are many potential origins of this fibrosis. It can be induced by a disease (inherited or not), by side effects of a treatment (for example radiation or chemotherapy), by a toxic environment (for example smoking), or by an injury. It can affect different organs such as the skin or the lung.
Fibrosis induced generally the failure of the tissue of the organ that is affected. Fibrotic tissue is like a scar tissue, stiff, thick, and rigid. Sometimes, it can also swell. For example, in the lung, fibrosis lead to a shortness of breath particularly during exercise and dry and hacking cough, due to the abnormal expansion of the fibrosis lung.
Some examples of fibrosis are pulmonary fibrosis (lungs), cystic fibrosis (lung and digestive system), Crohn's Disease (intestine), scleroderma/systemic sclerosis (lungs or skin), arthrofibrosis (knee, shoulder, other joints), cutaneous fibrosis with hypertrophic or keloid scars
When the tissue concerned by this phenomenon is the skin, it is principally the wound healing process that is affected. The natural wound healing is divided into three sequential phases; each phase is characterized by specific cellular activities: the inflammatory phase, the proliferative phase and the remodeling phase.
The first phase, called the inflammatory phase, begins minutes after injury. The blood vessels rupture induces the clot formation, composed mainly of fibrin and fibronectin. The clot fills partially the lesion and allows the migration of the inflammatory cells within the lesion. The inflammatory cells are recruited to debride the wound. Platelets secrete factors, such as growth factors or cytokines, which induce the recruitment of cells implicated in the wound healing (inflammatory cells such as neutrophils and macrophages, fibroblasts and endothelial cells).
The second phase is called the proliferative phase and corresponds to the development of the granulation tissue. Fibroblasts migrate into the wound area, proliferate and form a new provisional extracellular matrix by secreting extracellular matrix (ECM) proteins. Then endothelial cells migrate to promote the neovascularization or angiogenesis of the lesion. Inside the granulation tissue, fibroblasts activate and differentiate into myofibroblasts, presenting contractile properties thanks to their expression of alpha-smooth muscle actin (similar to that in smooth muscle cells). Myofibroblasts have a key role in wound healing as they provide the contraction of the wound. Finally, keratinocytes migrate from the wound edge, proliferate and differentiate to reconstitute the epidermis. The last phase of the wound healing process appears after the wound closure. It corresponds to the remodeling of the granulation tissue. The granulation tissue is reorganized, type III collagen is replaced by type I collagen, as normal dermis is principally composed of type I collagen. During this phase, myofibroblasts in excess are eliminated by apoptosis. The last phase of the wound healing is long. One year after injury, the scar is remodeled; it gets less red and thinner.
However, this process is not only complex but fragile; it is susceptible to interruption or failure leading to the formation of chronic or non-healing wounds or formation of abnormal scars. Factors which may contribute to this include diseases (such as diabetes, venous or arterial disease), age, infection or tissue localization. Role of fibroblasts in wound healing Fibroblasts are implicated in the process of wound healing, this involves several steps of differentiation from a quiescent fibroblast to a mobilized fibroblast that will transform into a myofibroblast and finally enter apoptosis.
In normal wound healing, fibroblasts get activated, and then differentiate into myofibroblasts presenting contractile properties thanks to their expression of alpha-smooth muscle actin (aSMA). Myofibroblasts are responsible for the deposit of extra cellular matrix and for the wound closure by moving closer the wound edges. In hypertrophic scar, keloid or fibrous wound healing, the activity of myofibroblasts persists and leads to tissue deformation, which is particularly evident, for example, in hypertrophic scars developed after burn injury. The aim of the present invention is to map, at the whole genome scale, the different genes that will be activated or deactivated during this process, and thus providing a molecular signature of abnormal healing leading to abnormal scar or fibrosis
Connective tissues represent a wide variety of physical structures and different functions: tendons, cartilage, bone, dermis, cornea, etc... As organs and tissues have specific functions (for example, skin functions are protection, sensation and heat regulation), connective tissues constituting these tissues and organs have also precise functions provided by specific cell types. For example, in the papillar or reticular dermis collagen I, III and V, XIV, elastic fibers, perlecan or SPARC are found On the contrary, types III, IX, X collagens are found associated with aggregan and dermatan sulfate in tendons. Fibroblasts are the main cells of connective (or mesenchymal) tissues, in which cells are surrounded by extracellular matrix (contrary to epithelium where they are jointed together). These fibroblasts are active in wound healing of damages organs, as they proliferate, differentiate in myofibroblast, secrete collagens and other specific ECM proteins and fibers composing the connective tissue of the organ, leading to the healing and reorganization of the tissue.
Myofibroblasts are defined as the primary source of the excessive ECM proteins deposition occurring during fibrosis. Resident myofibroblasts arise from a population of tissue specific fibroblasts that proliferate and undergo activation in response to injury, as it is the case in many organs such as skin, lungs, or kidney.
Fibrosis, hypertrophic scars and keloids Fibrosis is a common pathophysiological response of tissues to chronic injury. Fibrosis affects different organs such as the skin or the lung. Fibrosis is characterized by a differentiation of fibroblasts into myofibroblasts and an excessive accumulation of connective tissue. Fibrosis induces a loss of function of the organ and potentially the failure of the organ. Hypertrophic, keloid or fibrous scars result from abnormal wound healing. These scars are characterized by an excessive deposit of ECM proteins, especially collagen. In these abnormal wounds, granulation tissue is hyper proliferative, due to an excess of myofibroblasts (« Cellular and molecular pathology of HTS: basis for treatment. » Armour A, Scott PG, Tredget EE. Wound Repair Regen. 2007 Sep-Oct; 15 Suppl 1:S6-17. Review. Erratum in: Wound Repair Regen. 2008 Jul-Aug;16(4):582).
In normal wound healing, fibroblasts get activated, and then differentiate into myofibroblasts presenting contractile properties thanks to their expression of alpha-smooth muscle actin (aSMA). Myofibroblasts are responsible for the deposit of extra cellular matrix and for the wound closure by moving closer the wound edges. In hypertrophic scar, keloid or fibrous wound healing, the activity of myofibroblasts persists and leads to tissue deformation, which is particularly evident, for example, in hypertrophic scars developed after burn injury.
Hypertrophic and keloid scars are characterized by deposit of excessive amounts of collagen leading to a raised scar (more intense in keloids than in hypertrophic scars). They are formed most often at the sites of pimples, body piercings, cuts and burns. Some hypertrophic scars are non-functional scars as they limit the function of the skin where they developed. They generate a loss of mobility of the scar zone and the neighboring zones, which can completely limit the movements (for example, elbow and mobility of the arm). They are mostly the result of burns of specific anatomical zones.
Thus, the treatment of the wound is especially adapted to the wound in its early stage if it presents a risk of developing an abnormal scar or failing to heal correctly. By enhancing or manipulating factors that contribute to wound healing it may therefore be possible to correct the process, thereby reducing the likely occurrence of a fibrosis, hypertrophic scar or keloid. If a tissue (of an organ for example) is susceptible of developing a fibrosis, the treatment of this tissue at an early stage is also of interest. The present invention can improve the quality of a patient's life by ensuring that new wounds do not deteriorate into a fibrosis, hypertrophic scar or keloid and existing wounds can be treated in a way that actively promotes healing and by the way prevents the formation of fibrosis, hypertrophic scar or keloid.
SUMMARY OF THE INVENTION
In one aspect, the present invention relates to a therapeutic compound comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXS1, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2
for use in the prevention and/or treatment of fibrosis, hypertrophic scar or keloid.
The present invention also relates to a pharmaceutical composition comprising a therapeutic compound as defined above together with a pharmaceutically acceptable carrier. The invention also relates to a method for preparing a pharmaceutical composition as described above comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
In one aspect, the invention relates to a method for treating or preventing mammalian fibrosis, hypertrophic scar or keloid wherein said method comprises administering to said fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid a therapeutic compound comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXS1, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2.
In another aspect, the invention relates to a kit for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said kit comprises: (a) at least one therapeutic compound or composition as defined above and
(b) at least one dressing for applying to said wound.
The invention also relates to a combination therapeutic for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid comprising:
(a) - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS l, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXS l, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2 and b) at least one further therapeutic.
In yet another aspect, the invention relates to the use of: - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXSl, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXSl, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2
for treating fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said agent modulates fibroblast and myofibroblast differentiation and/or activity
DETAILED DESCRIPTION OF THE INVENTION
Accordingly, in one aspect of the invention there is provided a therapeutic compound comprising: (a) an agent that inhibits the activity of at least one gene selected from the group consisting of:
FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4 preferentially TCF4, FOXS1, STAT4 an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2 for use in the prevention and/or treatment of fibrosis, hypertrophic scars or keloids.
In a preferred embodiment of the invention, said therapeutic compound also comprises: an agent that inhibits the activity of at least one gene selected from the group consisting of E2F1, EGR2, GLI1, JUN, MYC, SMAD3, SMAD4, SOX9, SRF, preferentially EGR2, SOX9
an agent that enhances the activity of at least one gene selected from the group consisting of ETS1, PPARG for use in the prevention and/or treatment of fibrosis, hypertrophic scars or keloids. Indeed, the inventors have found that these genes were involved in the fibrosis process and that their down-regulation or up-regulation would be useful for the treatment of fibrosis, hypertrophic scars or keloids.
Thus, the invention involves a novel gene therapy approach and/or a novel protein therapy approach. As used herein, the expression "agent that inhibits the activity of a gene" or "inhibitor" refers to an agent than can downregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by decreasing the amount of protein present in a given cell, or by inhibiting the protein's activity.
As used herein, the expression "agent that enhances the activity of a gene" or "enhancer" refers to an agent than can upregulate said gene. It encompasses agents that act at the level of the gene expression, as well as agents that act at the level of the protein, either by increasing the amount of protein present in a given cell, or by increasing the protein's activity. It also encompasses agents that act upstream or downstream of said gene or protein in a signaling pathway. In one embodiment the novel therapeutic comprises an inhibitor or enhancer of the gene expression, this inhibitor or enhancer can be either an anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid and viral vectors or a drug.
In a preferred embodiment, said therapeutic compound is a siRNA selected from the group consisting of siRNA having the sequence as set forth in SEQ ID No: 11 to SEQ ID No:74 and mixtures thereof:
Figure imgf000009_0001
Figure imgf000010_0001
Figure imgf000011_0001
These siRNA inhibit the expression of the target genes.
In one embodiment, the agent that enhances the activity of a gene is a cDNA.
Typically, the expression of the CREB5 gene can be enhanced by administering the CREB5 cDNA. The same applies mutatis mutandis for all the other genes listed.
The cDNA can be administered or delivered to the fibrosis, hypertrophic scar or keloid to be treated in any suitable form known to the skilled person in art. It can be delivered as naked DNA, using plasmid vectors, viral vectors, or any other suitable means.
In another embodiment, the novel therapeutic comprises an inhibitor or enhancer of the protein encoded by the gene function, this inhibitor or enhancer can be either a binding agent that binds, either reversibly or irreversibly, to inhibit or enhance protein function such as an antibody or a known, or synthesized, protein agonist or antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit or enhance the protein signaling and so negate or enhance the effects of expression of the protein in wound tissue. Said agent (inhibitor or enhancer) can be any agent known in the art to act upon a given molecular target.
Typically, the enhancer of PPARG can be selected in the group consisting of thiazolidinediones, such as rosiglitazone and pioglitazone (Curr Drug Targets Cardiovasc Haematol Disord. 2005 Oct;5(5):377-86. Role of PPAR- gamma agonist thiazolidinediones in treatment of pre-diabetic and diabetic individuals: a cardiovascular perspective. Dumasia R, Eagle KA, Kline-Rogers E, May N, Cho L, Mukherjee D).
Typically, the inhibitor of PPARG can be G3335 (CAS 36099-95-3) (Chembiochem. 2006 Jan;7(l):74-82. The dipeptide H-Trp-Glu-OH shows highly antagonistic activity against PPARgamma: bioassay with molecular modeling simulation. Ye F, Zhang ZS, Luo HB, Shen JH, Chen KX, Shen X, Jiang HL.).
The therapeutic of the invention is for use in the treatment or prevention of fibrosis, hypertrophic scar or keloid. These fibrosis, hypertrophic scars or keloids are preferentially mammalian fibrosis, hypertrophic scars or keloids, more preferentially human fibrosis, hypertrophic scars or keloids.
An antibody for use in the invention is most ideally a monoclonal antibody or a humanized antibody.
In the above aspects and embodiments of the invention the therapeutic is formulated for topical application, but it can also be formulated for oral, cutaneous, transcutaneous, transdermal, intravenous or any application known.
Alternatively, in the above aspects of the invention the therapeutic is formulated for application into a dressing or impregnation of a dressing.
The therapeutic of the invention may be administered with an active agent. Such active agent may be an antibiotic or antibacterial agent, an antiseptic, an antiviral, an antifungal, an analgesic, an anti-inflammatory agent, a wound healing agent, a keratolytic agent, an anesthetic agent. Such actives are well known to skilled practitioners.
In another aspect of the invention, there is provided a pharmaceutical composition for use in treating fibrosis, hypertrophic scar or keloid comprising a therapeutic of the invention together with a pharmaceutical acceptable carrier.
Other active materials may also be present in the pharmaceutical composition, as may be considered appropriate or advisable for the fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid being treated.
The carrier, or, if more than one be present, each of the carriers, must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient.
The formulations include those suitable for topical, oral, rectal, nasal or any administration known and may be prepared by any methods well known in the art of pharmacy.
The composition may be prepared by bringing into association the therapeutic of the invention and the carrier. In general, the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely bringing into association the active with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product. The invention extends to methods for preparing a pharmaceutical composition comprising bringing a therapeutic of the invention in conjugation or association with a pharmaceutically acceptable carrier or vehicle.
For topical application to the skin, compounds of conventional use may be made up into a cream, ointment, gel, jelly, solution or suspension etc. Cream or ointment formulations that may be used for the composition are conventional formulations well known in the art.
Formulations for oral administration in the present invention may be presented as: capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a nonaqueous liquid; or as an oil-in-water liquid emulsion or a water in oil liquid emulsion; or as a bolus etc.
For compositions for oral administration (e.g. tablets and capsules), the term "acceptable carrier" includes vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica. Flavouring agents such as peppermint, oil of wintergreen, cherry flavouring and the like can also be used. It may be desirable to add a colouring agent to make the dosage form readily identifiable. Tablets may also be coated by methods well known in the art. Additionally, or alternatively, the further aspect of the invention also, or alternatively, comprises a novel method for preventing and/or treating fibrosis, hypertrophic scar or keloid which method comprises: administering to said fibrosis, hypertrophic scar or keloid: an agent that inhibits the activity of at least one gene selected in the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4 preferentially TCF4,
FOXS1, STAT4 and/or
-an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2 and SIX2. The invention also comprises a novel method for preventing and/or treating fibrosis, hypertrophic scar or keloid which method further comprises administering to said fibrosis, hypertrophic scar or keloid:
-an agent that inhibits the activity of at least one gene selected from E2F1, EGR2, GLI1, JUN, MYC, SMAD3, SMAD4, SOX9 and SRF preferentially EGR2, SOX9 and/or an agent that enhances the activity of at least one gene selected from ETS1, PPARG.
According to yet a further aspect of the invention there is provided a kit for preventing and/or treating fibrosis, hypertrophic scars or keloids which method comprises, wherein said kit comprises: (a) at least one therapeutic as above described; and
(b) at least one medical device for applying to said fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid.
The term "medical device" includes an instrument, apparatus, implant, in vitro reagent, or similar or related article that is used to diagnose, prevent, or treat disease or other conditions, and does not achieve its purposes through chemical action within or on the body (which would make it a drug). Whereas medicinal products (also called pharmaceuticals) achieve their principal action by pharmacological, metabolic or immunological means, medical devices act by other means like physical, mechanical, or thermal means. According to a yet further aspect of the invention there is provided a combination therapeutic for preventing and/or treating fibrosis, hypertrophic scars or keloids comprising an inhibitor or enhancer of gene expression and an inhibitor or enhancer of protein activity.
According to a further aspect of the invention there is provided a therapeutic for preventing and/or treating fibrosis, hypertrophic scars or keloids an inhibitor or enhancer of protein, or a homologue thereof.
According to a further aspect of the invention there is provided use of an inhibitor or enhancer of protein, or a homologue thereof, in the manufacture of a medicament for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid. According to a further aspect of the invention there is provided use of an inhibitor or enhance of protein, or a homologue thereof, for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid. The term "homologue" as used herein refers to amino acid sequences which have a sequence at least 50% homologous to the amino acid sequence of FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 and which retain the biological activity of the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 sequence. It is preferred that homologues are at least 75% homologous to the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 peptide sequence and, in increasing order of preference, at least 80%, 85%, 90%, 95% or 99% homologous to the FOXS1, CREB5, E2F1, EGR2, ETS1, GLI1, HICl, IRF7, JUN, MAF, MEOX2, MYC, POU2F2, PPARG, SIX2, SMAD3, SMAD4, SOX9, SRF, STAT4, TCF4 peptide sequence.
Treatment of fibrosis, hypertrophic scar or keloid described herein includes reference to human or veterinary use. In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprises", or variations such as "comprises" or "comprising" is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.
Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.
Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
The full identity of the genes according to the invention is available on the NCBI database (http://www.ncbi.nlm.nih.gov/), or is well known to those skilled in the art.
The present invention will now be described by way of the following examples with particular reference to Figures and Table wherein: FIGURE LEGENDS
Figure 1: Key transcription factors in fibroblast to myofibroblast differentiation a) Graphical explanation of the in silico gene network analysis b) Table representing the different transcription factors identified by bioinformatical and network analysis.
Figure 2a: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. NHDFs were treated either with mock siRNA or siRNA directed against different mRNA (FOXS1, EGR2, SRF, SOX9, HICl, STAT4, TCF4, MYC, JUN, IRF7, E2F1, GLI1, CREB5 STAT1) and concomitantly subjected or not to TGFpi treatment. The RTqPCR were normalized with TUBB and the mock siRNA treated (TGF-b) condition was set to one. The treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible. The treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation.
Figure 2b: Graphic representation of the percentage of differentiated cells as assessed by the percentage of alpha SMA positive cells after treatment of NHDFs as described in a). The treatments of NHDFs with siRNA against SRF, HICl or STAT4 lead to extensive cell death (*): no analysis was possible. The treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation.
Figure 2c: Graphic representation of the aSMA mRNA levels as assessed by RT-qPCR. Primary human dermal fibroblasts were treated either with mock siRNA or siRNA directed against different mRNA (PPARG, MAF, MEOX2, SIX2, STAT1 or USF2). The RTqPCR were normalized with TUBB and the mock siRNA treated (TGF-b) condition was set to 1. The treatments of NHDFs with siRNA against STAT1 and USF2 represent a control experiment as these factors do not have any action on fibroblast to myofibroblast differentiation. Figure 3: short and long timing after TGFpi treatment of FOXS1, EGR2, SRF, SOX9, HICl, STAT4, TCF4, MYC, JUN, IRF7, E2F1, GLI1, CREB5. For each Factor, graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFP as assessed by RT-qPCR.
Figure 4: short and long timing after TGFpi treatment of PPARG, SIX2, MEOX2, MAF. For each Factor, graphic representation of the mRNA levels after increasing time of treatment of the NHDF with TGFp as assessed by RT-qPCR. Figure 5 Graphic representation of the TCF4 (a), EGR2 (b), SOX9 (c), STAT4 (d), FOXS1 (e), PPARG (f), MAF (g), MEOX2 (h), and SIX2 (i) mRNA levels after NHDF (donor A) treatment for 48h (light grey) or 72h (dark grey) either with mock siRNA or siRNA directed against different TF mRNA (SOX9, EGR2, TCF4, or FOXS1) and concomitantly treated with TGF-β. For all graphs, the mock siRNA treated with TGF-β (T+E) condition was set to 100% for each time of treatment (48h and 72h).
Table 1: gene to increase or decrease to treat and/or prevent fibrosis, hypertrophic scars or keloids
Table 2: siRNA sequences against the target genes EXAMPLE
In response to a lesion, fibroblasts migrate into the wound where they differentiate into contractile myofibroblasts that will finally enter into apoptosis during the remodeling phase. This differentiation process can be studied ex-vivo in environmentally controlled tissue culture conditions, and therefore the timely controlled succession of different gene expression patterns can be addressed.
Materials and methods
Establishment of an ex vivo model of fibrosis, hypertrophic scar or keloid
Myofibroblasts represent the key players in the physiological reconstruction of skin after injury and in generating the pathological tissue deformations that characterize fibrosis such as hypertrophic scars (Desmouliere A, Chaponnier C, Gabbiani G (2005) Tissue repair, contraction, and the myofibroblast. Wound Repair Regen 13: 7-12).
To study the myofibroblasts involved in generating fibrosis, hypertrophic or keloid scars, NHDF were cultivated on collagen coated culture plates in DMEM-F12 (Invitrogen), supplemented with 10% FCS (Invitrogen), 5Ng/mL of insulin and Ing/mL of b-FGF (Promo Kine) and 10 ng/mL of TGF-Ol (Promocell), as TGF-Ol is known to induce the expression of aSMA in fibroblasts (Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G 13 (1993) Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol, 1993 jul, 122(1): 103-111). The efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
This aSMA expression was assessed by RT-qPCR (mRNA levels) and by Western Blot (protein).
The efficiency of fibroblast differentiation was estimated by analyzing the expression of the myofibroblast marker alpha smooth muscle actin (aSMA).
Western Blotting assay
Total proteins were extracted by scratching the cells with lysis buffer (TRIS, NaCl, NP40, EDTA, IMDTT) and incubated 30 min in ice. To remove cell debris, the samples were centrifuged at 13,000 x g for 10 min at 4°C and store at -20°C until use. Protein concentration was determined according to BCA method (Sigma). Equal amounts of total protein (20μg) were loaded to NuPAGE 10% BIS-Tris gel (Invitrogen), separated by migration at 150 V, and transferred to nitrocellulose membrane (Whatman) 1 hour at 30 V. Then, membranes were stained for aSMA (Abeam) and tubulin (Abeam). Incubations were followed by secondary antibodies goat anti-rabbit IgG and goat anti-mouse IgG, respectively, conjugated with horseradish-peroxidase (HRP) (Promega). Signals were detected by ECL chemiluminescence using UptiLight HS WB Substrate (Uptima, Interchim). Bands were digitized with a scanner and the ratio between all bands density of the same blot was calculated by software (ImageJ 1.43u, 64-bit). Relative aSMA expression was normalized to the respective value for tubulin. Total RNA Sample Preparation
After four days of experiment, treated fibroblasts were lysed with TRIzol Reagent (Invitrogen) and stored at -80°C. Then RNA was purified using chloroform and precipitated by isopropanol. Total RNA was quantified on the NanoDrop 2000c Spectrophotometer (Thermo Scientific). Reverse transcription of 500 ng total RNA to cDNA was done with oligot dT (Invitrogen) using Superscript III RT (Invitrogen) and RNAse OUT (Invitrogen). The cDNA was store at -20°C.
Quantitative real-time RT-PCR
Quantitative real-time PCR (RT-qPCR) was done using 5μί of 1:20 diluted cDNA on the LightCycler480 system (Roche) using Maxima SYBR Green qPCR Master Mix (Fermentas). Forward and reverse primers were designed by Eurofins (MWG, aSMA forward: CTGTTTTCCCATCCATTGTG (SEQ ID NO:9), aSMA reverse: CCATGTTCTATCGGGTACTT (SEQ ID NO: 10)) and a ΙΟΟμΜ stock was stored at -20°C. Forward and reverse primer pairs were used for each RT-qPCR reaction. The cycling conditions were as follows : an initial 95 °C for 10 minutes, followed by 45 cycles of 95 °C for 15 sec, 58°C for 30 sec, 72°C for 20 sec. LightCycler 480 SW 1.5 was used to evaluate the TM curves, to determine the Cp and to approximate the relative concentration for each amplification reaction. siRNA treatment
The expression the different TF was knocked down by transiently transfecting NHDF with specific small interfering RNAs. At least two different siRNAs (Qiagen) or highly specific ON TARGET PLUS smartpool siRNAs (Thermo Scientific) were used for each target. NHDF were treated with ΙΟηΜ siRNA and ^L of INTERFERin reagent (PolyPlus, Ozyme), according to the manufacturer's instruction and concomittanty treated with TGF-βΙ and exudates for 6 days. To maintain a sufficient knocking down, a second transfection was performed at 48h after the first one. The efficiency of the knock down was assessed 48h after the first transfection.
q-Smooth Muscle Actin Immunofluorescence
Cells grown in collagen coated culture dishes, and treated as previously described, were fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes and permeabilized with 2.5% Triton X-100 (Euromedex, 2000-B) in PBS for 3 minutes. After saturation with 5% BSA in PBS, cells were stained for a-SMA (Abeam, ab5694) and for DNA (DAPI). As secondary antibody, CyTM3 conjugated anti rabbit (GE Healthcare, PA43004) was used. Samples were observed with an oil immersion objective (Plan Fluor 40X/1.30 Oil, Nikon) on a Nikon ECLIPSE Ti (Nikon). Digital images were taken with a digital camera (Cool SNAP HQ2, Photometries) and software (MetaMorf 7.5.4.0). To estimate the percentage of fibroblast differentiation due to the different treatments, the total number of cells per field was determined by the DAPI, and myofibroblasts, differentiated fibroblasts, were counted using the a-SMA staining. Then, STUDENT (t-) and χ2 tests were realized to evaluate the differentially expression of aSMA between the untreated fibroblasts (without TGFP) and the treated ones. Network analysis In order to enlighten master regulators of fibroblast fate after each different treatment, we have performed a gene network analysis treating gene expression listsdetermined after mRNA seq deep sequencing analysis of the gene profile of fibroblasts treated with TGF β with the gene profile of fibroblast treated without TGFp. In these analysis and based on the assumption that the decrease or increase of interconnected genes is of stronger significance than a significant Log FC, we have used lists of genes selected only based on their P value and not on the value of their Log FC. We have performed two types of analysis: an ingenuity "upstream regulator analysis" and a DIRE (http://dire.dcode.org/) analysis. The Ingenuity "upstream regulator analysis", given the particular profile of genes expression between two conditions, consists in selecting potential upstream regulators. The DIRE analysis is based on the selection of potential common regulatory elements between genes based on these elements conservation during evolution. From these identified elements, DIRE is able to provide a list of master regulators for a list of co-regulated genes. From those two analyses, and for each list analyzed, we have selected Transcription Factors (TFs) expressed in at least one of the two conditions considered in the concerned list (i.e. number of sequencing his superior to twenty in at least one of the two conditions). Then, we have deeply compared the two sets of analysis and decided to keep in the "key regulators lists" transcription factors belonging to both analyses. Because of possible bias in these two analyses we also decided to rescue transcription factors belonging only to one analysis and not the other but presenting very interesting target genes pattern in one list or the other. Altogether, these genes networks analysis allowed us to propose a list of TFs being key regulators in one or the other fibroblast fate (Fig 1)
Gene expression route upon fibroblast to myofibroblast differentiation
Identification of the main molecular targets implicated in fibroblast differentiation of human primary fibroblasts under normal and pathological conditions
We have performed an in silico gene network analysis to enlighten putative upstream regulators of the different gene expression routes defined previously. This approach was original in the sense that we used global gene network analysis to identify potential key regulators and we did not take into account a change in these factors expression to select them. For example, we used the DIRE program ( http ://di re . dcode . org/) to identify evolutionary conserved potential regulatory elements in the different genes lists which allowed us to enlighten transcription factors that could potentially bind to these elements and thus regulate these sets of genes. Twenty- three transcription factors were selected out from this analysis.
To prioritize the extensive study of the different Transcription Factors (TFs), we performed a time response study of TFs after the different fibroblast treatments. We did a short (between 30mn and 8 hours) and a long (between 8 hours and 96 hours) analysis of their changes in expression after the different treatments (Fig 3 and 4).
We have performed an exhaustive siRNA-based approach to study in one hand the role of these different factors in normal fibroblast to myofibroblast differentiation pathway (Figures 2).
The siRNA knock-down of fourteen of the potential key transcription factors identified therein inhibited the fibroblast to myofibroblast differentiation pathway as assessed by analyzing the aSMA expression from TGFp and siRNA-treated NHDFs: GLI1, HICl, TCF4, SOX9, STAT4 MYC, CREB5, IRF7, JUN, E2F1, EGR2, SRF, FOXS1 as their knockdown decreased inhibit more or less efficiently the myofibroblast differentiation (Fig. 2 a-b-c). Very interestingly, except for SOX9, FOXS1 and EGR2 which expression is strongly and rapidly up regulated upon TGFP treatment, the mRNA levels of the other factors is constant during the first day or so after TGFP treatment and overall unchanged during the four days of differentiation. This indicates that the maintenance of their expression but not their over- expression is necessary for fibroblast to myofibroblast differentiation.
The siRNA knock-down of four other potential key transcription factors identified by the in silico analysis (MAF, SIX2, MEOX2 and PPARG) seemed to induce the fibroblast to myofibroblast differentiation in absence of TGFP to the same extend as the one obtained with mock transfected cells treated with TGFp. Altogether these results showed that with knocking-down approaches we were able either to reduce or induce fibroblast to myofibroblast differentiation (Table 1).
An in silico gene network analysis allowed us to identify potential key regulators of fibroblast cell fate either during differentiation into. By knocking down approaches, we found a strong effect on differentiation for nineteen of these factors.
We have also identified factors which seemed to play a role but maybe not as strongly as the ones described in the paragraph before as their knockdown leads to consistent but mild decrease of aSMA expression. These factors are MYC, JUN, E2F1, IRF7 and CREB5. Very interestingly, we showed that the inactivation of some transcription factors leads to an increase of fibroblast differentiation per se. The knocking down of PPARG mRNA leads to an increase of fibroblast to myofibroblast differentiation.
FOXS 1 belongs to the forkhead family of transcription factor often involved in developmental processes such as morphogenesis and differentiation. It has been shown that FOXSl is of primary importance in the development of testicular vasculature. Moreover, FOXSl was described as an early sensory neuronal marker. Here we show that inactivation of FOXSl leads to an increase of myofibroblast differentiation in absence of TGFp.
MEOX2 has already been described as implicated in TGFP pathway as it was identified as an important factor in cleft palate development in TGFP3 knockout mice. Experiments in C2C12 myoblast cells showed that MEOX2 is also important for skeletal muscle development and differentiation. Here, we showed that siRNA directed against MEOX2 lead to a bypass of the exudate effect by fibroblasts to be able to differentiate into myofibroblasts.
In T cells, it has been shown that MAF was responsible for inhibition of IL22 expression by neutralizing TGFp. TGFP and MAF have antagonist/opposite effects on IL21 expression in CD4(+) T cells. In the same connection, in this study, we implicated MAF as an inhibitor of fibroblast to myofibroblast differentiation in absence or presence of exudate as its inactivation by siRNA leads to an increase of myofibroblast differentiation. On the contrary, during chondrocyte differentiation, a long form of MAF interacts and cooperates with SOX9 to activate downstream targets. This is another example of the differences between myofibroblast and chondrocyte differentiations.
SIX2 has been involved in maintaining pluripotency in kidney: in embryonal renal mesenchyme cells it is able to suppress differentiation and during kidney development it maintains the progenitor pool. Here, in dermal fibroblast, the invalidation of SIX2 leads to a bypass of the dominant exudate effect on TGFP signaling.
Regulatory interactions between key transcription factors during fibroblast to myofibroblast differentiation
The expression of TCF4 mRNA was not modified after SOX9, EGR2 or FOXSl knockdown (Fig 5) placing it at the top of the regulatory interaction network between these factors. On the contrary EGR2 expression was largely inhibited upon siRNA treatment against TCF4 and SOX9 but remained unchanged upon treatment against FOXSl (Fig 5) placing it after TCF4 and SOX9 but before FOXSl in the network. SOX9 mRNA remained largely unchanged upon TCF4 and FOXSl knockdown. We placed FOXSl as a downstream target of SOX9. On the contrary SOX9 is upregulated upon EGR2 knockdown (Fig 5) The STAT4 mRNA is downregulated by TCF4, SOX9 and EGR2 knockdown (Fig 5) placing is as a downstream target of those TF whereas it remained unchanged upon FOXSl siRNA treatment placing it beforehand. Consistently, FOXSl mRNA is downregulated upon TCF4, SOX9 and EGR2 siRNA treatment (Fig 5) placing it at the end of this cascade. Globally, the PPARG, MAF and MEOX2 mRNA were upregulated upon siRNA treatment against TCF4, SOX9, EGR2 and FOXSl (Fig 5) consistent with their role as antagonist in fibroblast differentiation. SIX2 mRNA level was unchanged upon EGR2 and FOXSl knockdown (Fig 5) but upregulated in the same manner by TCF4 and SOX9 consistent with a close interconnexion between these two TF and suggesting the existence of a balanced signal between the differentiation agonists SOX9 and TCF4 and the antagonist SIX2.
The identification of transcription factors able to bypass differentiation is of major importance in the fibrosis, hypertrophic scar or keloid. In this study, by focusing on fibroblast, by no mean we tried to dissimulate the importance of other cells like neutrophils and macrophages in the skin healing process but we willingly simplified the biological context to draw a clearer picture of the situation. Cancer connection
Myofibroblast are not only key cells in fibrosis, their importance has long been proven in cancer too where the presence of myofibroblast in the stroma as "cancer associated fibroblast" facilitate tumor development and has been often associated with inflammation, cell invasion, high grade malignancy and poor prognosis. Myofibroblast are enriched in stroma from prostate cancer compared to benign prostatic hyperplasia and associated at the leading edge of carcinomas. They produce MMP, cytokines (IL8, VEGF) and chemokines (CXCL12) to promote cancer proliferation, tumor invasion and neo-angiogenesis. As alternative therapeutic tracks, it seems of primary importance to target stromal cells (and among them myofibroblasts) in cancer to diminish its abilities to migrate, invade and proliferate. But the cancer case is not so trivial; it has been suggested that, as inflammation is often linked to cancer, finding new ways of bypassing or inhibiting inflammation could also help fighting against cancer. This extensive study on TGFP-dependent fibroblast to myofibroblast differentiation gives a lot of new paths for therapeutic targets discovery. Nonetheless, because of TGFP dual pro-fibrosis and anti-inflammation activities, therapeutics playing with inhibition or re-enforcement of TGFP action should be well-balanced as inhibition of fibrosis via inhibition of TGFP pathway could also increase cancer susceptibility. The better understanding of normal fibroblast to myofibroblast differentiation is of major importance in the field as it opens new ways into novel therapeutics markers or targets that can be used in other important pathologies.
Tissue fibrosis (like pulmonary fibrosis, liver fibrosis, renal interstitial fibrosis, cardiovascular fibrosis, hypertrophic or keloid scars...) is primarily attributed to an excessive activation of ECM producing myofibroblasts by TGFpi. A better understanding of the gene expression route from fibroblast to myofibroblast is of great interest in the fibrosis understanding and curing. We showed that exudate from chronic wounds are able to prevent and reverse the myofibroblast differentiation giving new signs of the reversibility of differentiation as it has already been shown for liver, kidney or Hepato Stellar Cell (HSC) derived myofibroblast. We also identify transcription factors which inactivation inhibits TGFP-dependent myofibroblast differentiation. Myofibroblasts are not only key cells in fibrosis, their importance has been long proven in cancer too where the presence of myofibroblast in the stroma as "cancer associated fibroblast" facilitate tumor development and has been often associated with inflammation, cell invasion, high grade malignancy and poor prognosis. Myofibroblast are enriched in stroma from prostate cancer compared to benign prostatic hyperplasia and associated at the leading edge of carcinomas. They produce MMP, cytokines (IL8, VEGF) and chemokines (CXCL12) to promote cancer proliferation, tumor invasion and neo- angiogenesis. As alternative therapeutic tracks, it seems of primary importance to target stromal cells (and among them myofibroblasts) in cancer to diminish its abilities to migrate, invade and proliferate. But the cancer case is not so trivial; it has been suggested that, as inflammation is often linked to cancer, finding new ways of bypassing or inhibiting inflammation could also help fighting against cancer. The study on TGFP-dependent fibroblast to myofibroblast differentiation shows a lot of new paths for therapeutic targets discovery. Nonetheless, because of TGFP dual pro-fibrosis and anti-inflammation activities, therapeutics playing with inhibition or re-enforcement of TGFP action should be well- balanced as inhibition of fibrosis via inhibition of TGFP pathway could also increase cancer susceptibility.

Claims

Claims
1. A therapeutic compound comprising :
- an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXS1, STAT4;
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2
for use in the prevention and/or treatment of fibrosis, hypertrophic scar or keloid.
2. A therapeutic compound according to claim 1 further comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of E2F1, EGR2, GLI1, JUN, MYC, SMAD3, SMAD4, SOX9, SRF preferentially EGR2, SOX9 and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of ETS1 and PPARG.
3. A therapeutic compound according to claim 1 or 2 wherein said agent is selected from the group consisting of: anti-sense DNA or RNA, siRNA, shRNA, cDNA, TALENS or ribozymes, either naked or in the form of plasmid or viral vectors.
4. A therapeutic compound according to claim 1 or 2 wherein said agent is an inhibitor or enhancer of protein function.
5. A therapeutic compound according to claim 4 wherein said agent is selected from the group consisting of: a binding agent that binds, either reversibly or irreversibly, to inhibit protein function such as an antibody or a synthetic antagonist; or an agent that works upstream or downstream of the protein signaling mechanism to inhibit protein function.
6. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for use in treating mammalian fibrosis, hypertrophic scars or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid.
7. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for use in treating human fibrosis, hypertrophic scars or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid
8. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for topical application.
9. A therapeutic compound according to any preceding claim wherein the therapeutic compound is for application to a dressing or impregnation of a dressing.
10. A pharmaceutical composition comprising a therapeutic compound according to any preceding claim together with a pharmaceutically acceptable carrier.
11. A method for preparing a pharmaceutical composition according to claim 10 comprising bringing said therapeutic compound in conjunction or association with a pharmaceutically or veterinary acceptable carrier or vehicle.
12. A method for treating a mammalian fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said method comprises administering to said fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid a therapeutic compound comprising:
- an agent that inhibits the activity of at least one gene selected from the group consisting of FOXS1, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXS1, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2.
13. A kit for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said kit comprises: (a) at least one therapeutic compound according to any of claims 1 -9 or a composition according to claim 10 and
(b) at least one dressing for applying to said fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid.
14. A combination therapeutic for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid comprising:
(a) - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXSl, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXSl, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2 and b) at least one further therapeutic.
15. Use of - an agent that inhibits the activity of at least one gene selected from the group consisting of FOXSl, CREB5, HICl, IRF7, POU2F2, SIX2, STAT4, TCF4, preferentially TCF4, FOXSl, STAT4
and/or
- an agent that enhances the activity of at least one gene selected from the group consisting of MAF, MEOX2, SIX2
for treating a fibrosis, hypertrophic scar or keloid or tissue susceptible of developing fibrosis, hypertrophic scar or keloid wherein said agent modulates fibroblast and myofibroblast differentiation and/or activity
PCT/IB2013/001989 2013-08-05 2013-08-05 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids Ceased WO2015019124A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
PCT/IB2013/001989 WO2015019124A1 (en) 2013-08-05 2013-08-05 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
BR112016002524A BR112016002524A2 (en) 2013-08-05 2014-07-30 molecular targets for the prevention and / or treatment of fibrosis, hypertrophic scars and keloids
CA2919573A CA2919573A1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
JP2016532315A JP6514204B2 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and / or treatment of fibrosis, hypertrophic scars or keloids
EP17196300.2A EP3301112B1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
US14/909,626 US9840704B2 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
EP14744577.9A EP3030573B1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
PCT/EP2014/066342 WO2015018698A1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
ES14744577.9T ES2653992T3 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and / or treatment of fibrosis, hypertrophic scars or keloids
CN201480044360.XA CN105793279A (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
US15/809,541 US20180057819A1 (en) 2013-08-05 2017-11-10 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
JP2019030314A JP2019108347A (en) 2013-08-05 2019-02-22 Molecular targets for prevention and/or treatment of fibrosis, hypertrophic scars or keloid

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2013/001989 WO2015019124A1 (en) 2013-08-05 2013-08-05 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/909,626 Continuation US9840704B2 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids

Publications (1)

Publication Number Publication Date
WO2015019124A1 true WO2015019124A1 (en) 2015-02-12

Family

ID=49517536

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/IB2013/001989 Ceased WO2015019124A1 (en) 2013-08-05 2013-08-05 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
PCT/EP2014/066342 Ceased WO2015018698A1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids

Family Applications After (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/066342 Ceased WO2015018698A1 (en) 2013-08-05 2014-07-30 Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids

Country Status (8)

Country Link
US (2) US9840704B2 (en)
EP (2) EP3301112B1 (en)
JP (2) JP6514204B2 (en)
CN (1) CN105793279A (en)
BR (1) BR112016002524A2 (en)
CA (1) CA2919573A1 (en)
ES (1) ES2653992T3 (en)
WO (2) WO2015019124A1 (en)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201505382D0 (en) 2015-03-29 2015-05-13 Svanborg Catharina Novel therapy
KR101751513B1 (en) * 2015-06-23 2017-06-27 한국과학기술연구원 In vitro fibrosis model, method for producing the same and uses
EP3458157A4 (en) * 2016-05-19 2020-05-27 Momenta Pharmaceuticals, Inc. Methods for treating disorders associated with fibrosis and systemic sclerosis
WO2018217882A1 (en) * 2017-05-23 2018-11-29 EMULATE, Inc. Advanced pulmonary models
JP6709440B2 (en) * 2018-06-08 2020-06-17 学校法人福岡大学 Composition for inhibiting hypertrophic scar formation
KR102100163B1 (en) 2019-09-24 2020-04-13 테고사이언스 (주) Compositions of Prevention or Treatment of Keloid or Hypertrophic scar
CN111001003B (en) * 2020-01-06 2021-04-16 北京大学第三医院(北京大学第三临床医学院) Application of POU2F1 gene expression inhibitor in the preparation of medicaments for the treatment of tissue fibrosis diseases
CN112294962B (en) * 2020-11-13 2023-06-06 上海长海医院 Application of BCL-2 and BCL-XL inhibitors in scar treatment
CN114854738A (en) * 2021-02-04 2022-08-05 纳肽得(青岛)生物医药有限公司 SiRNA for treating diseases associated with TGF beta 1 expression
CN115616215B (en) * 2021-07-13 2026-03-06 上海交通大学医学院附属第九人民医院 A scar diagnostic reagent and its application
CN116004816A (en) * 2022-08-11 2023-04-25 中国医科大学附属第一医院 Application of IRF7 in skin fibroma
US20260115201A1 (en) * 2022-10-12 2026-04-30 The Texas A&M University System Potential therapeutics for fibrosis by blocking the increase of a key enzyme
CN120285149A (en) * 2024-01-09 2025-07-11 清华大学 Use of POU2F2 protein or its mutant in preventing and treating infection

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009085274A2 (en) * 2007-12-21 2009-07-09 Coda Therapeutics, Inc. Use of anti-connexin polynucleotides and peptides for the treatment ofabnormal or excessive scars

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2011062161A (en) * 2009-09-18 2011-03-31 Univ Of Tsukuba Method for diagnosing colon cancer by using blood

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009085274A2 (en) * 2007-12-21 2009-07-09 Coda Therapeutics, Inc. Use of anti-connexin polynucleotides and peptides for the treatment ofabnormal or excessive scars

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
ARMOUR A; SCOTT PG; TREDGET EE: "Cellular and molecular pathology of HTS: basis for treatment.", WOUND REPAIR REGEN., vol. 15, no. 1, September 2007 (2007-09-01), pages 56 - 17
CEDERBERG A ET AL: "Chromosome Localization, Sequence Analysis, and Expression Pattern Identify FKHL 18 as a Novel Human Forkhead Gene", GENOMICS, ACADEMIC PRESS, SAN DIEGO, US, vol. 44, no. 3, 15 September 1997 (1997-09-15), pages 344 - 346, XP004459173, ISSN: 0888-7543, DOI: 10.1006/GENO.1997.4864 *
CHEMBIOCHEM., vol. 7, no. 1, January 2006 (2006-01-01), pages 74 - 82
CURR DRUG TARGETS CARDIOVASC HAEMATOL DISORD., vol. 5, no. 5, October 2005 (2005-10-01), pages 377 - 86
DESMOULIERE A; CHAPONNIER C; GABBIANI G: "Tissue repair, contraction, and the myofibroblast", WOUND REPAIR REGEN, vol. 13, 2005, pages 7 - 12
DESMOULIERE A; GEINOZ A; GABBIANI F; GABBIANI G: "Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts", J CELL BIOL, vol. 122, no. 1, 13 July 1993 (1993-07-13), pages 103 - 111
JENNIFER M. HAHN ET AL: "Keloid-derived keratinocytes exhibit an abnormal gene expression profile consistent with a distinct causal role in keloid pathology", WOUND REPAIR AND REGENERATION, vol. 21, no. 4, 1 July 2013 (2013-07-01), pages 530 - 544, XP055112583, ISSN: 1067-1927, DOI: 10.1111/wrr.12060 *
JÉRÔME AVOUAC ET AL: "Inactivation of the transcription factor STAT-4 prevents inflammation-driven fibrosis in animal models of systemic sclerosis", ARTHRITIS & RHEUMATISM, vol. 63, no. 3, 25 March 2011 (2011-03-25), pages 800 - 809, XP055112868, ISSN: 0004-3591, DOI: 10.1002/art.30171 *
TAO LING ET AL: "Role of the JAK-STAT pathway in proliferation and differentiation of human hypertrophic scar fibroblasts induced by connective tissue growth factor.", MOLECULAR MEDICINE REPORTS 2010 NOV-DEC, vol. 3, no. 6, November 2010 (2010-11-01), pages 941 - 945, XP002722998, ISSN: 1791-3004 *
WOUND REPAIR REGEN, vol. 16, no. 4, July 2008 (2008-07-01), pages 582

Also Published As

Publication number Publication date
CN105793279A (en) 2016-07-20
JP2019108347A (en) 2019-07-04
WO2015018698A1 (en) 2015-02-12
EP3301112B1 (en) 2020-01-01
JP2016532694A (en) 2016-10-20
US20180057819A1 (en) 2018-03-01
US20160168565A1 (en) 2016-06-16
EP3030573B1 (en) 2017-11-22
CA2919573A1 (en) 2015-02-12
EP3030573A1 (en) 2016-06-15
EP3301112A3 (en) 2018-04-18
ES2653992T3 (en) 2018-02-09
EP3301112A2 (en) 2018-04-04
US9840704B2 (en) 2017-12-12
BR112016002524A2 (en) 2017-09-12
JP6514204B2 (en) 2019-05-15

Similar Documents

Publication Publication Date Title
EP3030573B1 (en) Molecular targets for the prevention and/or treatment of fibrosis, hypertrophic scars or keloids
Huang et al. Development of a novel RNAi therapy: engineered miR-31 exosomes promoted the healing of diabetic wounds
Zhang et al. IFN-γ enhances the efficacy of mesenchymal stromal cell-derived exosomes via miR-21 in myocardial infarction rats
Sun et al. Low‐dose paclitaxel ameliorates fibrosis in the remnant kidney model by down‐regulating miR‐192
Liu et al. Wnt/β-catenin pathway forms a negative feedback loop during TGF-β1 induced human normal skin fibroblast-to-myofibroblast transition
Uemura et al. Smad2 and Smad3 play different roles in rat hepatic stellate cell function and α-smooth muscle actin organization
Wang et al. KLF4 alleviates hypertrophic scar fibrosis by directly activating BMP4 transcription
Huang et al. Paracrine action of mesenchymal stromal cells delivered by microspheres contributes to cutaneous wound healing and prevents scar formation in mice
Shangguan et al. GAS5 knockdown ameliorates apoptosis and inflammatory response by modulating miR-26b-5p/Smad1 axis in cerebral ischaemia/reperfusion injury
Pi et al. LncRNA XIST accelerates burn wound healing by promoting M2 macrophage polarization through targeting IL-33 via miR-19b
Zhang et al. Suv39h1 downregulation inhibits neointimal hyperplasia after vascular injury
Green et al. HuR-dependent expression of Wisp1 is necessary for TGFβ-induced cardiac myofibroblast activity
KR102026138B1 (en) Composition for Inhibition or Treatment of Keloids and Hypertrophic Scar Comprising CRIF1 Antagonist
US20190022097A1 (en) Molecular targets for the treatment of wounds, in particular chronic wounds
Huang et al. Mesenchymal Stem Cell–Derived Exosome miR-153–3 Induced M2-Type Polarization of Macrophages to Improve the Healing Effect of Burn Wounds
Zhu et al. Mechanical stretch-induced IGF2 overexpression in epidermal keratinocytes promotes hypertrophic scar formation through the IGF1R/pc-Jun axis
Wu et al. Morphine induces fibroblast activation through up-regulation of connexin 43 expression: implication of fibrosis in wound healing
Zhang et al. ALKBH5 exacerbates psoriatic dermatitis in mice by promoting angiogenesis
WO2024028912A9 (en) Gamma-secretase inhibitors for use in the treatment of inherited epidermolysis bullosa
Yong et al. SOCS3 control the activity of NF-KB induced by HSP70 via degradation of MyD88-adapter-like protein (Mal) in IPEC-J2 cells
Hasegawa et al. 667 A novel TGF-beta/Smad signaling inhibitor ameliorates bleomycin-induced skin fibrosis
Pils et al. 669 Senescence-associated secretion of vesicular miR-23a-3p and its impact during the paracrine crosstalk of dermal and epidermal cells
Muzumdar et al. 668 Activation of Nrf2 promotes wound healing by expansion of hair follicle stem cell populations
Saito et al. 666 Interferon-γ deficiency attenuates skin fibrosis in a murine model of chronic graft-versus-host disease-like scleroderma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13785905

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13785905

Country of ref document: EP

Kind code of ref document: A1