WO2015018659A1 - Glutamine synthetase inhibitors for inhibition of pathological angiogenesis - Google Patents
Glutamine synthetase inhibitors for inhibition of pathological angiogenesis Download PDFInfo
- Publication number
- WO2015018659A1 WO2015018659A1 PCT/EP2014/066013 EP2014066013W WO2015018659A1 WO 2015018659 A1 WO2015018659 A1 WO 2015018659A1 EP 2014066013 W EP2014066013 W EP 2014066013W WO 2015018659 A1 WO2015018659 A1 WO 2015018659A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- glutamine synthetase
- angiogenesis
- treatment
- pathological
- glutamine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/197—Carboxylic acids, e.g. valproic acid having an amino group the amino and the carboxyl groups being attached to the same acyclic carbon chain, e.g. gamma-aminobutyric acid [GABA], beta-alanine, epsilon-aminocaproic acid or pantothenic acid
- A61K31/198—Alpha-amino acids, e.g. alanine or edetic acid [EDTA]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
Definitions
- the present invention relates to the field of angiogenesis, more particularly to the field op pathological angiogenesis such as pathological ocular angiogenesis.
- the invention has found that inhibitors reducing the activity of the enzyme glutamine synthetase can be used for treatment of diseases in which pathological angiogenesis is involved.
- the invention provides siRNAs directed against glutamine synthetase for the treatment of pathological angiogenesis.
- the invention also provides the use of a therapeutically effective amount of inhibitors of glutamine synthetase or a pharmaceutically acceptable salt thereof for the treatment of pathological angiogenesis such as pathological ocular angiogenesis.
- Vessel branching relies on the coordinated actions of migrating 'tip' endothelial cells (ECs) and proliferating 'stalk' ECs (Geudens and Gerhardt, 201 1 ; Potente et al., 201 1 ).
- the vascular endothelial growth factor VEGF is the main driver of this phenomenon and is secreted by hypoxic cells in an attempt to restore tissue oxygenation by promoting blood vessel growth. When VEGF reaches the vascular front, it binds its receptor VEGFR2 on ECs and the cell that gets exposed to the highest level of VEGF is subsequently selected to become the tip cell. Notch signaling on the other hand promotes stalk cell behavior.
- PFKFB3 glycolysis regulator phosphofructokinase-2/fructose-2,6-bisphosphatase 3
- the non-essential amino acid glutamine is a major carbon and nitrogen donor for the production of ATP and biomolecules (e.g. nucleotides, hexosamines, certain amino acids, lipids and nicotinamide) (DeBerardinis and Cheng, 2010).
- ATP and biomolecules e.g. nucleotides, hexosamines, certain amino acids, lipids and nicotinamide
- glutamine synthetase glutamine-ammonia ligase; GLUL or GS
- glutamine synthetase glutamine-ammonia ligase
- GS prokaryote/eukaryote divergence
- GS serves two important biochemical functions: glutamine synthesis and ammonia assimilation.
- tissues have low (glutamine synthesis) or high (ammonia assimilation) GS expression levels (van Straaten et al., 2006).
- high GS expression can be restricted to a subset of cells within one tissue e.g.
- GS knock-out mice do not survive beyond E3.5, probably due to the inability to detoxify the high ammonia levels generated by the amino acid metabolism on which the embryo at that stage mainly relies for energy production (He et al., 2007).
- GS deficiency in humans is extremely rare and leads to severe epileptic encephalopathy or multi- organ failure and subsequent infant death (Haberle et al., 2005; Haberle et al., 2012).
- GS is a transcriptional target of ⁇ -catenin and FoxO transcription factors (Cadoret et al., 2002; van der Vos et al., 2012) and its enzymatic activity can be induced by a-ketoglutarate and citrate.
- GS activity is subject to end-product feedback inhibition (reviewed in (Eisenberg et al., 2000)) and as such functions as a nutrient sensor.
- GS controls cellular metabolic homeostasis by positive regulation of autophagy (van der Vos et al., 2012). To date there is no evidence to support a role of EC glutamine metabolism in vascular branching.
- the present invention provides inhibitors of glutamine synthetase for the treatment of diseases wherein pathological angiogenesis is involved such as for example macular degeneration.
- FIG. 1 Panel 1 : GS expression in ECs is induced upon glutamine withdrawal.
- Panel 2 GS expression co-localizes with the mitochondrial network.
- Figure 2 GS knockdown in ECs causes an increase in glucose and fatty acid oxidation in vitro.
- Figure 3 Sprouting in EC spheroids was reduced upon GS knockdown.
- FIG. 4 Panel 1 : GS is expressed at the vascular front of the mouse neonatal (P5) retinal plexus. IF staining for GS showed expression in ECs at the front of the vascular plexus in retinal explants from wt pups at P5. Panel 2: Endothelial GS is required for normal development of the neonatal retinal vasculature. IB4 staining of retinal plexus in control and GS AEC pups at P5. Panel 3: Analysis of retinal plexus at P5 (GS AEC vs control).
- FIG. 5 GS KD ECs show reduced ability to take the 'tip cell'-position in mixed spheroids, even when genetically instructed by Notch KD .
- Figure 6 GS knockdown reduced EC migration and velocity of random movement (not shown) but did not reduce proliferation.
- FIG. 7 GS knockdown in ECs affects autophagic flux in vitro.
- the invention provides a compound inhibiting glutamine synthetase for treatment of pathological angiogenesis.
- the invention provides a compound inhibiting glutamine synthetase for the treatment of pathological angiogenesis excluding cancer.
- the invention provides a compound inhibiting glutamine synthetase for the treatment of pathological ocular angiogenesis.
- pathological ocular angiogenesis refers to eye (ocular or intraocular) disorders which have an excessive angiogenesis component.
- diseases are age-related macular degeneration, diabetic retinopathy, diabetic maculopathy and choroidal, proliferative retinopathies.
- a compound inhibiting glutamine synthetase encompasses siRNA, ribozymes, shRNA, anti-sense RNA, microRNA directed against glutamine synthetase.
- a “compound” inhibiting glutamine synthetase also includes chemical compounds which are able to inhibit the activity of glutamine synthetase.
- a compound is a siRNA with a specificity for glutamine synthetase for the treatment of pathological angiogenesis.
- siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into an adenoviral associated (AAV) vector.
- AAV adenoviral associated
- siRNA refers to a small interfering RNA(s), which also has been referred to in the art as short interfering RNA and silencing RNA, among others.
- siRNAs generally are described as relatively short, often 20-25 nucleotide-long, double-stranded RNA molecules that are involved in RNA interference (RNAi) pathway(s).
- RNAi RNA interference
- siRNAs are, in part, complementary to specific mRNAs (such as glutamine synthetase) and mediate their down regulation (hence, "interfering"). siRNAs thus can be used for down regulating the expression of specific genes and gene function in cells and organisms.
- siRNAs also play a role in related pathways. The general structure of most naturally occurring siRNAs is well established.
- siRNAs are short double-stranded RNAs, usually 21 nucleotides long, with two nucleotides single stranded "overhangs" on the 3 of each strand. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group.
- the structure results from processing by the enzyme "dicer,” which enzymatically converts relatively long dsRNAs and relatively small hairpin RNAs into siRNAs.
- the term siNA refers to a nucleic acid that acts like a siRNA, as described herein, but may be other than an RNA, such as a DNA, a hybrid RNA:DNA or the like. siNAs function like siRNAs to down regulate expression of gene products.
- RNA interference which also has been called “RNA mediated interference” refers to the cellular processes by which RNA (such as siRNAs) down regulate expression of genes; i.e., down regulate or extinguish the expression of gene functions, such as the synthesis of a protein encoded by a gene.
- RNA interference pathways are conserved in most eukaryotic organisms. It is initiated by the enzyme dicer, which cleaves RNA, particularly double-stranded RNA, into short double-stranded fragments 20-25 base pairs long.
- RNA-induced silencing complex RISC
- the thus incorporated guide strand serves as a recognition sequence for binding of the RISC to nucleic acids with complementary sequences. Binding by RISC to complementary nucleic acids results in their being "silenced.”
- the best studied silencing is the binding of RISCs to RNAs resulting in post-transcriptional gene silencing. Regardless of mechanism, interfering nucleic acids and RNA interference result in down regulation of the target gene or genes that are complementary (in pertinent part) to the guide strand.
- a polynucleotide can be delivered to a cell to express an exogenous nucleotide sequence, to inhibit, eliminate, augment, or alter expression of an endogenous nucleotide sequence, or to affect a specific physiological characteristic not naturally associated with the cell.
- the polynucleotide can be a sequence whose presence or expression in a cell alters the expression or function of cellular genes or RNA.
- the present invention contemplates polynucleotide-based expression inhibitors of glutamine synthetase which may be selected from the group comprising: siRNA, microRNA, interfering RNA or RNAi, dsRNA, ribozymes, antisense polynucleotides, and DNA expression cassettes encoding siRNA, microRNA, dsRNA, ribozymes or antisense nucleic acids.
- SiRNA comprises a double stranded structure typically containing 15 to 50 base pairs and preferably 19 to 25 base pairs and having a nucleotide sequence identical or nearly identical to an expressed target gene or RNA within the cell.
- siRNA may be composed of two annealed polynucleotides or a single polynucleotide that forms a hairpin structure.
- MicroRNAs are small noncoding polynucleotides, about 22 nucleotides long, that direct destruction or translational repression of their mRNA targets.
- Antisense polynucleotides comprise a sequence that is complimentary to a gene or mRNA.
- Antisense polynucleotides include, but are not limited to: morpholinos, 2'-0-methyl polynucleotides, DNA, RNA and the like.
- the polynucleotide-based expression inhibitor may be polymerized in vitro, recombinant, contain chimeric sequences, or derivatives of these groups.
- the polynucleotide-based expression inhibitor may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination such that the target RNA and/or gene is inhibited.
- Polynucleotides may contain an expression cassette coded to express a whole or partial protein, or RNA.
- An expression cassette refers to a natural or recombinantly produced polynucleotide that is capable of expressing a sequence.
- the cassette contains the coding region of the gene of interest along with any other sequences that affect expression of the sequence of interest.
- An expression cassette typically includes a promoter (allowing transcription initiation), and a transcribed sequence.
- the expression cassette may include, but is not limited to, transcriptional enhancers, non-coding sequences, splicing signals, transcription termination signals, and polyadenylation signals.
- An RNA expression cassette typically includes a translation initiation codon (allowing translation initiation), and a sequence encoding one or more proteins.
- the expression cassette may include, but is not limited to, translation termination signals, a polyadenosine sequence, internal ribosome entry sites (IRES), and non- coding sequences.
- the polynucleotide may contain sequences that do not serve a specific function in the target cell but are used in the generation of the polynucleotide. Such sequences include, but are not limited to, sequences required for replication or selection of the polynucleotide in a host organism.
- siRNA molecules with the ability to knock-down glutamine synthetase activity can be obtained by chemical synthesis or by hairpin siRNA expression vectors.
- the glutamine synthetase siRNAs of the invention may be chemically modified, e.g. as described or example in US20030143732, by phosphorothioate internucleotide linkages, 2'-0- methyl ribonucleotides, 2'-deoxy-2'fluoro ribonucleotides, "universal base” nucleotides, 5-C- methyl nucleotides, and inverted deoxyabasic residue incorporation.
- the sense strand glutamine synthetase siRNAs may also be conjugated to small molecules or peptides, such as membrane-permeant peptides or polyethylene glycol (PEG).
- the present invention relates to an expression vector comprising any of the above described polynucleotide sequences encoding at least one glutamine synthetase siRNA molecule in a manner that allows expression of the nucleic acid molecule, and cells containing such vector.
- the polynucleic acid sequence is operably linked to regulatory signals (promoters, enhancers, suppressors etc.) enabling expression of the polynucleic acid sequence and is introduced into a cell utilizing, preferably, recombinant vector constructs.
- viral-based systems including adenoviral, retroviral, adeno-associated viral, lentiviral, herpes simplex viral vector systems. Selection of the appropriate viral vector system, regulatory regions and host cell is common knowledge within the level of ordinary skill in the art.
- glutamine synthetase siRNA molecules of the invention may be delivered by known gene delivery methods, e.g. as described in US20030143732, including the use of naked siRNA, synthetic nanoparticles composed of cationic lipid formulations, liposome formulations including pH sensitive liposomes and immunoliposomes, or bioconjugates including siRNAs conjugated to fusogenic peptides.
- siRNA expressing vectors can also be systemic, such as by intravenous, intraperitoneal, intraocular, intravitreal or intramuscular administration or even by intrathecal or by intracerebral injection that allows for introduction into the desired target cell (see US 20030143732).
- the compound inhibiting glutamine synthetase is a chemical compound able to inhibit the enzyme glutamine synthetase for the treatment of a pathological angiogenesis, excluding cancer.
- the previous compounds e.g. siRNAs and chemical compounds
- for the treatment of pathological angiogenesis - excluding cancer - are used for the treatment of age-related macular degeneration, diabetic retinopathy, diabetic maculopathy, choroidal, proliferative retinopathies and other intraocular disorders with an excessive angiogenesis component.
- excessive angiogenesis component with respect to intraocular disorders has the same meaning as "pathological ocular angiogenesis” and refers to the fact that in certain pathological eye diseases, such as described herein before, an excess angiogenesis occurs.
- a medical doctor such as an eye doctor or eye surgeon is well positioned to determine if excessive pathological ocular angiogenesis occurs in the eye.
- the invention provides a siRNA with a specificity for glutamine synthetase for the treatment of conditions and disorders resulting from pathological angiogenesis including diseases from the list macular degeneration, atherosclerosis, proliferative retinopathies, arthritis and psoriasis.
- siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into a viral vector.
- siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into an adenoviral-2 associated (AAV-2) vector.
- the instant invention provides a method of reducing angiogenesis in a mammal.
- the method generally involves administering to a mammal a siRNA with a specificity for glutamine synthetase and/or a compound as herein described before which inhibits the enzyme glutamine synthetase in an amount effective to reduce angiogenesis.
- Methods of determining an effect of an agent on angiogenesis include, but are not limited to, inhibition of neovascularization into implants impregnated with an angiogenic factor; inhibition of blood vessel growth in the cornea or anterior eye chamber; inhibition of endothelial cell proliferation, migration or tube formation in vitro; the chick chorioallantoic membrane assay; the hamster cheek pouch assay; the polyvinyl alcohol sponge disk assay; the formation of blood vessels in zebrafish larvae.
- Such assays are well known in the art and have been described in numerous publications.
- pathological angiogenesis refers to the excessive formation and growth of blood vessels during the maintenance and the progression of several disease states.
- pathological angiogenesis can occur are blood vessels (atherosclerosis, bone and joints (rheumatoid arthritis, synovitis, bone and cartilage destruction, osteomyelitis, pannus growth, osteophyte formation), skin (warts, pyogenic granulomas, hair growth, scar keloids, allergic oedema), liver, kidney, lung, ear and other epithelia (inflammatory and infectious processes (including hepatitis, glomerulonephritis, pneumonia), asthma, nasal polyps, otitis, transplantation, liver regeneration), uterus, ovary and placenta (dysfunctional uterine bleeding (e.g.
- Chemical compounds inhibiting the activity of glutamine synthetase are well known in the art and comprise analogues of glutamate, analogues of methionine sulfoximine, analogues of phosphinothricin, bisphosphonates and several miscellaneous inhibitors such as for example tianeptine.
- An overview of inhibitors of glutamine synthetase is presented in Berlicki L. (2008) Mini-reviews in medicinal chemistry 8, 869-878, the inhibitors herein described are incorporated in this application by reference. Yet another overview is presented in WO2007/017768, the inhibitors therein disclosed are herein incorporated by reference. It is understood that these referenced glutamine synthase inhibitors are useful for treatment of pathological angiogenesis, more particularly are useful for treating pathological ocular angiogenesis.
- compositions containing one or more compounds of the present invention can be utilized to achieve the desired pharmacological effect by administration to a patient in need thereof.
- a patient for the purpose of this invention, is a mammal, including a human, in need of treatment for the particular condition or disease, i.e. a disease wherein pathological angiogenesis is involved excluding cancer (excluding tumors or excluding neoplasia which are equivalent terms). Therefore, the present invention includes pharmaceutical compositions that are comprised of a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound, or salt thereof, of the present invention.
- a pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient.
- a pharmaceutically effective amount of compound is preferably that amount which produces a result or exerts an influence on the particular condition being treated.
- the compounds of the present invention can be administered with pharmaceutically-acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations, orally, intraperitoneally, parenterally, topically, nasally, ophthalmically, optically, sublingually, rectally, vaginally, intrathecally, intracerebroventricularly and the like.
- the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, troches, lozenges, melts, powders, solutions, suspensions, or emulsions, and may be prepared according to methods known to the art for the manufacture of pharmaceutical compositions.
- the solid unit dosage forms can be a capsule that can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch.
- the compounds of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatin, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, coloring agents, and flavoring agents such as peppermint, oil of wintergreen, or cherry flavoring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient.
- binders such as acacia, corn starch or gelatin
- disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn star
- Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent.
- Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
- Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavoring and coloring agents described above, may also be present.
- the pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions.
- the oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils.
- Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived from fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate.
- the emulsions may also contain sweetening and flavoring agents.
- Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol.
- the suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate; one or more coloring agents; one or more flavoring agents; and one or more sweetening agents such as sucrose or saccharin.
- Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
- sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose.
- Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
- compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimize or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight.
- the surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB.
- surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
- the pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions.
- Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia ; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent.
- Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions.
- sterile fixed oils are conventionally employed as solvents or suspending media.
- any bland, fixed oil may be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid can be used in the preparation of injectables.
- composition of the invention may also be administered in the form of suppositories for rectal administration of the drug.
- These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
- Such materials are, for example, cocoa butter and polyethylene glycol.
- transdermal delivery devices Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts.
- the construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see for example US 5,023,252).
- Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
- Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art. It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device.
- the construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art.
- Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier.
- a drug delivery catheter into the patient's ventricular system to bypass the blood-brain barrier.
- implantable delivery system used for the transport of agents to specific anatomical regions of the body, is described in US 5,01 1 ,472.
- compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired.
- Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized. Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M. F. et al., "Compendium of Excipients for Parenteral Formulations” PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-31 1 ; Strickley, R.G “Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349 ; and Nema, S. et al. , "Excipients and Their Use in Injectable Products” PDA Journal of Pharmaceutical Science & Technology 1997, 51 (4), 166-171.
- the pharmaceutical composition of the invention is an ophthalmic (or ocular) pharmaceutical composition.
- ocular delivery (or delivery to the eye) is preferred.
- the pharmaceutically acceptable compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride.
- the pharmaceutically acceptable compositions may be formulated in an ointment such as petrolatum.
- Preferred methods of local ocular administration include e.g.
- choroidal injection transscleral injection or placing a scleral patch, selective arterial catheterization, intraocular administration including transretinal, subconjunctival bulbar, intravitreous injection, suprachoroidal injection, subtenon injection, scleral pocket and scleral cutdown injection, by osmotic pump, etc.
- intraocular administration including transretinal, subconjunctival bulbar, intravitreous injection, suprachoroidal injection, subtenon injection, scleral pocket and scleral cutdown injection, by osmotic pump, etc.
- the clinician uses a local approach to the eye after initiation of appropriate anesthesia, including painkillers and ophthalmoplegics.
- a needle containing the therapeutic composition of the invention is directed into the subject's choroid or sclera and inserted under sterile conditions.
- a composition is delivered to the vicinity of the eye, e.g. in close proximity to the posterior segment of the eye.
- the "vicinity of the eye” refers to locations within the orbit, which is the cavity within the skull in which the eye and its appendages are situated.
- the compositions would be delivered close to their intended target within the eye, e.g. close to (within several millimeters of) the portion of the sclera that overlies the posterior segment of the eye, or immediately adjacent to the exterior surface of the sclera.
- a number of polymeric delivery vehicles for providing controlled release have been used in an ocular context and can be used to administer the compositions of the invention.
- biocompatible polymers which may be biodegradable
- U.S. Pat. No. 6,692,759 describes methods for making an implantable device for providing controlled release of therapeutic agents in the eye.
- Other useful polymers and delivery systems for ocular administration of a therapeutic agent have been described.
- the active agent may be released as the polymer degrades.
- Polymers that have been used for drug delivery include, but are not limited to, poly(lactic-co-glycolic acid), polyanhydrides, ethylene vinyl acetate, polyglycolic acid, chitosan, polyorthoesters, polyethers, polylactic acid, and poly (beta amino esters).
- Peptides, proteins such as collagen and albumin, and dendrimers have also been used. Any of these can be used in various embodiments of the invention.
- Poly(ortho-esters) have been introduced into the eye and demonstrated favorable properties for sustained release ocular drug delivery (Einmahl S. (2002), Invest. Ophthalmol. Vis. Sci., 43(5).
- Polylactide particles have been used to target an agent to the retina and RPE following intravitreous injection of a suspension of such particles (Bourges, J.L. et al (2003) Invest. Ophthalmol. Vis. Sci., 44(8).
- a macroscopic implantable device suitable for introduction into the posterior or anterior segment of the eye is referred to herein as an ocular implant (Jaffe, G. (2000) Invest. Ophthalmol. Vis. Sci., 41 (1 1 ).
- Such devices may be comprised of a plurality of nanoparticles less than or microparticles impregnated with the agent.
- Methods for making microparticles and nanoparticles are known in the art.
- a microparticle will have a diameter of 500 microns or less, e.g., between 50 and 500 microns, between 20 and 50 microns, between 1 and 20 microns, between 1 and 10 microns, and a nanoparticle will have a diameter of less than 1 micron.
- the device is implanted into the space occupied by the vitreous humor.
- the ocular implant may comprise a polymeric matrix.
- the invention also provides periocular implants, which are macroscopic implantable device suitable for introduction in the vicinity of the eye, e.g., in close proximity to the eye.
- the periocular implant is made of similar materials to those described above.
- compositions according to the present invention can be illustrated as follows:
- Sterile IV Solution A 5 mg/mL solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 - 2 mg/mL with sterile 5% dextrose and is administered as an IV infusion over about 60 minutes.
- Lyophilised powder for IV administration A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lyophilised powder, (ii) 32- 327 mg/mL sodium citrate, and (iii) 300 - 3000 mg Dextran 40.
- the formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/mL, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/mL, and is administered either IV bolus or by IV infusion over 15 - 60 minutes.
- Intramuscular suspension The following solution or suspension can be prepared, for intramuscular injection:
- the compounds of this invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutical agents where the combination causes no unacceptable adverse effects.
- the present invention relates also to such combinations.
- the compounds of this invention can be combined with other anti-angiogenic agents.
- Anti-angiogenic agents include, but are not limited to, angiostatic steroids such as heparin derivatives and glucocorticosteroids; thrombospondin; cytokines such as IL-12; fumagillin and synthetic derivatives thereof, such as AGM 12470; interferon-alpha; endostatin; soluble growth factor receptors; neutralizing monoclonal antibodies directed against growth factors such as vascular endothelial growth factor and the like.
- the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication.
- the amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
- the total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day.
- Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing.
- "drug holidays" in which a patient is not dosed with a drug for a certain period of time may be beneficial to the overall balance between pharmacological effect and tolerability.
- a unit dosage may contain from about 0.5 mg to about 150 mg of active ingredient, and can be administered one or more times per day or less than once a day.
- the average daily dosage for administration by injection including intravenous, intramuscular, intraocular, intravitreal, subcutaneous, intrathecal, intraceroventricularly and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight.
- the average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
- the average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight.
- the average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily.
- the transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg.
- the average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
- the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like.
- the desired mode of treatment and number of doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
- Glutamine Synthetase (GS) expression and enzyme activity are induced by metabolic stress in ECs
- GS mRNA levels in different endothelial cell (EC) subtypes were comparable to those in luminal MCF breast cancer cells, known to have high GS levels (Kung et al., 201 1 ).
- GS mRNA and protein levels did not differ significantly between quiescent (contact- inhibited) and proliferating cells.
- HBSS Hank's Balanced Salt Solution
- GS mRNA and protein levels were significantly induced.
- overnight incubation of HUVECs in hypoxia (0.5% 0 2 ) markedly induced GS expression.
- GS knock down does not affect glycolytic flux, the major ATP-generating pathway in ECs
- GSkd ECs retained normal proliferative capacity when cultured in standard 2mM glutamine containing culture medium, both under normoxic and hypoxic conditions (see Figure 6). Surprisingly, even in glutamine containing culture medium, GSkd ECs were not able to restart proliferation upon reseeding after quiescence, a phenomenon highly similar to the one observed in quiescent wt ECs reseeded in glutamine free medium.
- P5 GS vAEC retinal plexi showed a severe hypobranching phenotype; radial expansion of the plexus was also significantly reduced and vascular area was also significantly reduced.
- the number of filopodia per unit length of the vascular front was significantly lower in GS vAEC pups as was the number of distal sprouts with filopodia.
- the complexity of the vasculature at the utmost leading front of the plexus was decreased as determined by the number of branches in distal sprouts. Vessel coverage by NG2 + pericytes was not affected and QgvAEc p
- CNV choroidal neovascularization
- Intraocular delivery of small interfering RNAs specific for glutamine synthetase to the eye of a mouse is subjected to a model for age-related macular degeneration (as in the CNV-model of example 8) is accomplished by delivery of a specific small interfering RNA for glutamine synthetase into the eye via intraocular delivery.
- a model for age-related macular degeneration as in the CNV-model of example 8
- siRNA sequences directed against murine glutamine synthetase are used.
- the sequences are modified with phosphorothioate modifications throughout and 2'-0-(2-methoxy)ethyl substitutions on the sugars of the first and last 5 nucleotides to increase biological half-lives and binding affinity.
- Clinical analysis of the mice is carried out essentially as described in example 8.
- CNV Choroidal neovascularization
- Glutamine synthetase is a genetic determinant of cell type-specific glutamine independence in breast epithelia. PLoS genetics 7, e1002229.
- Muzumdar M.D., Tasic, B., Miyamichi, K., Li, L, and Luo, L. (2007).
Landscapes
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to the field of angiogenesis, more particularly to the field op pathological angiogenesis. In particular the invention has found that inhibitors reducing the activity of the enzyme glutamine synthetase can be used for treatment of diseases in which pathological angiogenesis is involved. In particular the invention provides siRNAs directed against glutamine synthetase for the treatment of pathological angiogenesis. The invention also provides the use of a therapeutically effective amount of inhibitors of glutamine synthetase or a pharmaceutically acceptable salt thereof for the treatment of pathological angiogenesis.
Description
Glutamine synthetase inhibitors for inhibition of pathological angiogenesis
Field of the invention
The present invention relates to the field of angiogenesis, more particularly to the field op pathological angiogenesis such as pathological ocular angiogenesis. In particular the invention has found that inhibitors reducing the activity of the enzyme glutamine synthetase can be used for treatment of diseases in which pathological angiogenesis is involved. In particular the invention provides siRNAs directed against glutamine synthetase for the treatment of pathological angiogenesis. The invention also provides the use of a therapeutically effective amount of inhibitors of glutamine synthetase or a pharmaceutically acceptable salt thereof for the treatment of pathological angiogenesis such as pathological ocular angiogenesis.
Introduction of the invention
Vessel branching relies on the coordinated actions of migrating 'tip' endothelial cells (ECs) and proliferating 'stalk' ECs (Geudens and Gerhardt, 201 1 ; Potente et al., 201 1 ). The vascular endothelial growth factor VEGF is the main driver of this phenomenon and is secreted by hypoxic cells in an attempt to restore tissue oxygenation by promoting blood vessel growth. When VEGF reaches the vascular front, it binds its receptor VEGFR2 on ECs and the cell that gets exposed to the highest level of VEGF is subsequently selected to become the tip cell. Notch signaling on the other hand promotes stalk cell behavior. Recently, the glycolysis regulator phosphofructokinase-2/fructose-2,6-bisphosphatase 3 (PFKFB3) was shown to co- determine vessel sprouting. PFKFB3 activity can overrule Notch signaling and redirect committed stalk cells to tip cells; conversely, inhibition of the enzyme prevents ECs from taking the tip cell position (De Bock et al., 2013). These findings launched the concept of metabolic and genetic signaling acting in parallel to determine vessel branching.
The non-essential amino acid glutamine is a major carbon and nitrogen donor for the production of ATP and biomolecules (e.g. nucleotides, hexosamines, certain amino acids, lipids and nicotinamide) (DeBerardinis and Cheng, 2010). As such, various metabolic pathways use glutamine as a substrate, but glutamine synthetase (glutamate-ammonia ligase; GLUL or GS) is the only enzyme capable of de novo glutamine production from glutamate and ammonia in an ATP-driven reaction. To date, three different classes of GS enzymes have
been identified with a common ancestral gene predating the prokaryote/eukaryote divergence (Kumada et al., 1993; van Rooyen et al., 2006). GS serves two important biochemical functions: glutamine synthesis and ammonia assimilation. Depending on the prevailing function, tissues have low (glutamine synthesis) or high (ammonia assimilation) GS expression levels (van Straaten et al., 2006). Furthermore, high GS expression can be restricted to a subset of cells within one tissue e.g. pericentral hepatocytes in the liver (Gebhardt et al., 2007; Gebhardt and Mecke, 1983). GS knock-out mice do not survive beyond E3.5, probably due to the inability to detoxify the high ammonia levels generated by the amino acid metabolism on which the embryo at that stage mainly relies for energy production (He et al., 2007). GS deficiency in humans is extremely rare and leads to severe epileptic encephalopathy or multi- organ failure and subsequent infant death (Haberle et al., 2005; Haberle et al., 2012). GS is a transcriptional target of β-catenin and FoxO transcription factors (Cadoret et al., 2002; van der Vos et al., 2012) and its enzymatic activity can be induced by a-ketoglutarate and citrate. Conversely, GS activity is subject to end-product feedback inhibition (reviewed in (Eisenberg et al., 2000)) and as such functions as a nutrient sensor. Furthermore, GS controls cellular metabolic homeostasis by positive regulation of autophagy (van der Vos et al., 2012). To date there is no evidence to support a role of EC glutamine metabolism in vascular branching. In the present invention we show that loss of GS expression in endothelial cells (ECs) leads to severely impaired vessel branching, both in developmental and pathological angiogenesis. The present invention provides inhibitors of glutamine synthetase for the treatment of diseases wherein pathological angiogenesis is involved such as for example macular degeneration.
Figures
Figure 1 : Panel 1 : GS expression in ECs is induced upon glutamine withdrawal. Panel 2: GS expression co-localizes with the mitochondrial network. IF staining for GS in cultured ECs revealed cytosolic localization of the enzyme with a high intensity staining at the mitochondrial network. Mitochondrial co-localization was confirmed by co-staining with the mitochondrial marker TOMM20. Specificity of the GS staining was confirmed in shGS-transduced ECs (not shown).
Figure 2: GS knockdown in ECs causes an increase in glucose and fatty acid oxidation in vitro.
Figure 3: Sprouting in EC spheroids was reduced upon GS knockdown.
Figure 4: Panel 1 : GS is expressed at the vascular front of the mouse neonatal (P5) retinal plexus. IF staining for GS showed expression in ECs at the front of the vascular plexus in retinal explants from wt pups at P5. Panel 2: Endothelial GS is required for normal development of the neonatal retinal vasculature. IB4 staining of retinal plexus in control and GSAEC pups at P5. Panel 3: Analysis of retinal plexus at P5 (GSAEC vs control).
Figure 5: GSKD ECs show reduced ability to take the 'tip cell'-position in mixed spheroids, even when genetically instructed by NotchKD.
Figure 6: GS knockdown reduced EC migration and velocity of random movement (not shown) but did not reduce proliferation.
Figure 7: GS knockdown in ECs affects autophagic flux in vitro. Western blotting for autophagy markers ATG3, ATG5 and LC3A in control- and shGS-transduced ECs under both control and starvation conditions. Basal levels of ATG3 and ATG5 were reduced in shGS-ECs. Starvation- induced increase in LC3 lipidation was completely abolished in shGS-ECs. a-Tubulin was used as a loading control.
Figure 8: Quantification of FITC-dextran labeled choroidal neovessels in GSECKO animals (Cre+) and control littermates (Cre neg), expressed as % area (meaniSEM; N=7 for ctrl, N=12 for QgECKo. p=o.o9). Choroids were analyzed 14 days after laser burn injury.
Figure 9: Methionine sulfoximine (MSO) treated mice showed a strong reduction in the pathological neovascular area when compared to saline-treated mice (data are mean ±SEM; n = 6 mice for both groups; p=0.062).
Detailed description of the invention
The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is
specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., current Protocols in Moleciiar Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art. Glutamine synthetase (GS, E.C. 6.3.1 .2) is one of the most significant enzymes in nitrogen metabolism. It catalyzes the conversion of glutamate and ammonium ion to glutamine in the presence of ATP. The mechanism of the enzymatic reaction consists of two steps. Glutamate (1 in the scheme) is phosphorylated by ATP forming active intermediate - gamma-glutamyl phosphate (2 in the scheme), which subsequently reacts with ammonia yielding glutamine (3 in the scheme). Glutamine amide nitrogen atom is then transferred by glutamate synthetase (GOAT) to alpha-ketoglutarate forming two glutamate molecules. Thus, the GS-GOGAT cycle allows incorporation of inorganic nitrogen in the cell metabolism. The following scheme depicts the reaction mechanism:
Scheme:
Possible medical applications of using GS inhibitors have been described in the art for the treatment of cancer and tuberculosis (see Berlicki L. (2008) Mini-reviews in medicinal
chemistry, 8, 869-878). The present invention surprisingly shows that the inhibition of glutamine synthetase can prevent pathological angiogenesis.
Accordingly in a first embodiment the invention provides a compound inhibiting glutamine synthetase for treatment of pathological angiogenesis. In yet another embodiment the invention provides a compound inhibiting glutamine synthetase for the treatment of pathological angiogenesis excluding cancer.
In yet another embodiment the invention provides a compound inhibiting glutamine synthetase for the treatment of pathological ocular angiogenesis.
The term "pathological ocular angiogenesis" refers to eye (ocular or intraocular) disorders which have an excessive angiogenesis component. A non-limiting list of such diseases are age-related macular degeneration, diabetic retinopathy, diabetic maculopathy and choroidal, proliferative retinopathies.
In the present invention "a compound" inhibiting glutamine synthetase encompasses siRNA, ribozymes, shRNA, anti-sense RNA, microRNA directed against glutamine synthetase. In addition a "compound" inhibiting glutamine synthetase also includes chemical compounds which are able to inhibit the activity of glutamine synthetase.
In a particular embodiment a compound is a siRNA with a specificity for glutamine synthetase for the treatment of pathological angiogenesis.
In a specific embodiment the siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into an adenoviral associated (AAV) vector.
The term "siRNA" refers to a small interfering RNA(s), which also has been referred to in the art as short interfering RNA and silencing RNA, among others. siRNAs generally are described as relatively short, often 20-25 nucleotide-long, double-stranded RNA molecules that are involved in RNA interference (RNAi) pathway(s). Generally, siRNAs are, in part, complementary to specific mRNAs (such as glutamine synthetase) and mediate their down regulation (hence, "interfering"). siRNAs thus can be used for down regulating the expression of specific genes and gene function in cells and organisms. siRNAs also play a role in related pathways. The general structure of most naturally occurring siRNAs is well established. Generally, siRNAs are short double-stranded RNAs, usually 21 nucleotides long, with two
nucleotides single stranded "overhangs" on the 3 of each strand. Each strand has a 5' phosphate group and a 3' hydroxyl (-OH) group. In vivo, the structure results from processing by the enzyme "dicer," which enzymatically converts relatively long dsRNAs and relatively small hairpin RNAs into siRNAs. The term siNA refers to a nucleic acid that acts like a siRNA, as described herein, but may be other than an RNA, such as a DNA, a hybrid RNA:DNA or the like. siNAs function like siRNAs to down regulate expression of gene products. The term "RNA interference" which also has been called "RNA mediated interference" refers to the cellular processes by which RNA (such as siRNAs) down regulate expression of genes; i.e., down regulate or extinguish the expression of gene functions, such as the synthesis of a protein encoded by a gene. Typically, double-stranded ribonucleic acid inhibits the expression of genes with complementary nucleotide sequences. RNA interference pathways are conserved in most eukaryotic organisms. It is initiated by the enzyme dicer, which cleaves RNA, particularly double-stranded RNA, into short double-stranded fragments 20-25 base pairs long. One strand of the double-stranded RNA (called the "guide strand") is part of a complex of proteins called the RNA-induced silencing complex (RISC). The thus incorporated guide strand serves as a recognition sequence for binding of the RISC to nucleic acids with complementary sequences. Binding by RISC to complementary nucleic acids results in their being "silenced." The best studied silencing is the binding of RISCs to RNAs resulting in post-transcriptional gene silencing. Regardless of mechanism, interfering nucleic acids and RNA interference result in down regulation of the target gene or genes that are complementary (in pertinent part) to the guide strand. A polynucleotide can be delivered to a cell to express an exogenous nucleotide sequence, to inhibit, eliminate, augment, or alter expression of an endogenous nucleotide sequence, or to affect a specific physiological characteristic not naturally associated with the cell. The polynucleotide can be a sequence whose presence or expression in a cell alters the expression or function of cellular genes or RNA.
In addition, the present invention contemplates polynucleotide-based expression inhibitors of glutamine synthetase which may be selected from the group comprising: siRNA, microRNA, interfering RNA or RNAi, dsRNA, ribozymes, antisense polynucleotides, and DNA expression cassettes encoding siRNA, microRNA, dsRNA, ribozymes or antisense nucleic acids. SiRNA comprises a double stranded structure typically containing 15 to 50 base pairs and preferably 19 to 25 base pairs and having a nucleotide sequence identical or nearly identical to an expressed target gene or RNA within the cell. An siRNA may be composed of two annealed polynucleotides or a single polynucleotide that forms a hairpin structure. MicroRNAs (miRNAs) are small noncoding polynucleotides, about 22 nucleotides long, that direct destruction or translational repression of their mRNA targets. Antisense polynucleotides comprise a
sequence that is complimentary to a gene or mRNA. Antisense polynucleotides include, but are not limited to: morpholinos, 2'-0-methyl polynucleotides, DNA, RNA and the like. The polynucleotide-based expression inhibitor may be polymerized in vitro, recombinant, contain chimeric sequences, or derivatives of these groups. The polynucleotide-based expression inhibitor may contain ribonucleotides, deoxyribonucleotides, synthetic nucleotides, or any suitable combination such that the target RNA and/or gene is inhibited. Polynucleotides may contain an expression cassette coded to express a whole or partial protein, or RNA. An expression cassette refers to a natural or recombinantly produced polynucleotide that is capable of expressing a sequence. The cassette contains the coding region of the gene of interest along with any other sequences that affect expression of the sequence of interest. An expression cassette typically includes a promoter (allowing transcription initiation), and a transcribed sequence. Optionally, the expression cassette may include, but is not limited to, transcriptional enhancers, non-coding sequences, splicing signals, transcription termination signals, and polyadenylation signals. An RNA expression cassette typically includes a translation initiation codon (allowing translation initiation), and a sequence encoding one or more proteins. Optionally, the expression cassette may include, but is not limited to, translation termination signals, a polyadenosine sequence, internal ribosome entry sites (IRES), and non- coding sequences. The polynucleotide may contain sequences that do not serve a specific function in the target cell but are used in the generation of the polynucleotide. Such sequences include, but are not limited to, sequences required for replication or selection of the polynucleotide in a host organism.
Based on the RNA sequence of glutamine synthetase, siRNA molecules with the ability to knock-down glutamine synthetase activity can be obtained by chemical synthesis or by hairpin siRNA expression vectors. There are numerous companies that provide the supply of costumer-designed siRNAs on a given RNA sequence, e.g. Ambion, Imgenex, Dharmacon.
The glutamine synthetase siRNAs of the invention may be chemically modified, e.g. as described or example in US20030143732, by phosphorothioate internucleotide linkages, 2'-0- methyl ribonucleotides, 2'-deoxy-2'fluoro ribonucleotides, "universal base" nucleotides, 5-C- methyl nucleotides, and inverted deoxyabasic residue incorporation. The sense strand glutamine synthetase siRNAs may also be conjugated to small molecules or peptides, such as membrane-permeant peptides or polyethylene glycol (PEG). Other siRNA conjugates which form part of the present invention include cholesterol and alternative lipid-like molecules, such as fatty acids or bile-salt derivatives.
In a further embodiment, the present invention relates to an expression vector comprising any of the above described polynucleotide sequences encoding at least one glutamine synthetase siRNA molecule in a manner that allows expression of the nucleic acid molecule, and cells containing such vector. The polynucleic acid sequence is operably linked to regulatory signals (promoters, enhancers, suppressors etc.) enabling expression of the polynucleic acid sequence and is introduced into a cell utilizing, preferably, recombinant vector constructs. A variety of viral-based systems are available, including adenoviral, retroviral, adeno-associated viral, lentiviral, herpes simplex viral vector systems. Selection of the appropriate viral vector system, regulatory regions and host cell is common knowledge within the level of ordinary skill in the art.
As gene delivery and gene silencing techniques improve, the selective deletion of glutamine synthetase, for example in the eye, may prove useful in order to limit the impact of protein deletion to a particular system under study. The glutamine synthetase siRNA molecules of the invention may be delivered by known gene delivery methods, e.g. as described in US20030143732, including the use of naked siRNA, synthetic nanoparticles composed of cationic lipid formulations, liposome formulations including pH sensitive liposomes and immunoliposomes, or bioconjugates including siRNAs conjugated to fusogenic peptides. Delivery of siRNA expressing vectors can also be systemic, such as by intravenous, intraperitoneal, intraocular, intravitreal or intramuscular administration or even by intrathecal or by intracerebral injection that allows for introduction into the desired target cell (see US 20030143732).
In yet another embodiment the compound inhibiting glutamine synthetase is a chemical compound able to inhibit the enzyme glutamine synthetase for the treatment of a pathological angiogenesis, excluding cancer. In specific embodiments the previous compounds (e.g. siRNAs and chemical compounds) for the treatment of pathological angiogenesis - excluding cancer - are used for the treatment of age-related macular degeneration, diabetic retinopathy, diabetic maculopathy, choroidal, proliferative retinopathies and other intraocular disorders with an excessive angiogenesis component. The term "excessive angiogenesis component with respect to intraocular disorders" has the same meaning as "pathological ocular angiogenesis" and refers to the fact that in certain pathological eye diseases, such as described herein before, an excess angiogenesis occurs. A medical doctor such as an eye doctor or eye surgeon is well positioned to determine if excessive pathological ocular angiogenesis occurs in the eye.
In yet another embodiment the invention provides a siRNA with a specificity for glutamine synthetase for the treatment of conditions and disorders resulting from pathological angiogenesis including diseases from the list macular degeneration, atherosclerosis, proliferative retinopathies, arthritis and psoriasis.
In a specific embodiment said siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into a viral vector.
In yet another specific embodiment said siRNA with a specificity for glutamine synthetase is expressed by an expression construct incorporated into an adenoviral-2 associated (AAV-2) vector.
The instant invention provides a method of reducing angiogenesis in a mammal. The method generally involves administering to a mammal a siRNA with a specificity for glutamine synthetase and/or a compound as herein described before which inhibits the enzyme glutamine synthetase in an amount effective to reduce angiogenesis. An effective amount of a siRNA with a specificity for glutamine synthetase, in combination with, or applied separately with a compound as herein described before which inhibits the enzyme glutamine synthetase, reduces angiogenesis by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, or more, when compared to an untreated (e.g. a placebo-treated) control. Whether angiogenesis is reduced can be determined using any known method. Methods of determining an effect of an agent on angiogenesis are known in the art and include, but are not limited to, inhibition of neovascularization into implants impregnated with an angiogenic factor; inhibition of blood vessel growth in the cornea or anterior eye chamber; inhibition of endothelial cell proliferation, migration or tube formation in vitro; the chick chorioallantoic membrane assay; the hamster cheek pouch assay; the polyvinyl alcohol sponge disk assay; the formation of blood vessels in zebrafish larvae. Such assays are well known in the art and have been described in numerous publications.
The term "pathological angiogenesis" as used herein refers to the excessive formation and growth of blood vessels during the maintenance and the progression of several disease states. Examples where pathological angiogenesis can occur are blood vessels (atherosclerosis, bone and joints (rheumatoid arthritis, synovitis, bone and cartilage destruction, osteomyelitis, pannus growth, osteophyte formation), skin (warts, pyogenic granulomas, hair growth, scar keloids, allergic oedema), liver, kidney, lung, ear and other epithelia (inflammatory and infectious processes (including hepatitis, glomerulonephritis, pneumonia), asthma, nasal polyps, otitis,
transplantation, liver regeneration), uterus, ovary and placenta (dysfunctional uterine bleeding (e.g. due to intrauterine contraceptive devices), follicular cyst formation, ovarian hyperstimulation syndrome, endometriosis), brain, nerves and eye (retinopathy of prematurity, diabetic retinopathy, choroidal and other intraocular disorders (e.g. macular degeneration), leukomalacia), heart and skeletal muscle due to work overload, adipose tissue (obesity), endocrine organs (thyroiditis, thyroid enlargement, pancreas transplantation). While it is generally known in the art that pathological angiogenesis is also associated with neoplasms and metastasis, the latter conditions are herein specifically excluded (or disclaimed) from the claim scope of the invention. Chemical compounds inhibiting the activity of glutamine synthetase are well known in the art and comprise analogues of glutamate, analogues of methionine sulfoximine, analogues of phosphinothricin, bisphosphonates and several miscellaneous inhibitors such as for example tianeptine. An overview of inhibitors of glutamine synthetase is presented in Berlicki L. (2008) Mini-reviews in medicinal chemistry 8, 869-878, the inhibitors herein described are incorporated in this application by reference. Yet another overview is presented in WO2007/017768, the inhibitors therein disclosed are herein incorporated by reference. It is understood that these referenced glutamine synthase inhibitors are useful for treatment of pathological angiogenesis, more particularly are useful for treating pathological ocular angiogenesis. Medicinal uses:
This invention also relates to pharmaceutical compositions containing one or more compounds of the present invention. These compositions can be utilized to achieve the desired pharmacological effect by administration to a patient in need thereof. A patient, for the purpose of this invention, is a mammal, including a human, in need of treatment for the particular condition or disease, i.e. a disease wherein pathological angiogenesis is involved excluding cancer (excluding tumors or excluding neoplasia which are equivalent terms). Therefore, the present invention includes pharmaceutical compositions that are comprised of a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a compound, or salt thereof, of the present invention. A pharmaceutically acceptable carrier is preferably a carrier that is relatively non-toxic and innocuous to a patient at concentrations consistent with effective activity of the active ingredient so that any side effects ascribable to the carrier do not vitiate the beneficial effects of the active ingredient. A pharmaceutically effective amount of compound is preferably that amount which produces a result or exerts an influence on the particular condition being treated. The compounds of the present invention can be
administered with pharmaceutically-acceptable carriers well known in the art using any effective conventional dosage unit forms, including immediate, slow and timed release preparations, orally, intraperitoneally, parenterally, topically, nasally, ophthalmically, optically, sublingually, rectally, vaginally, intrathecally, intracerebroventricularly and the like. For oral administration, the compounds can be formulated into solid or liquid preparations such as capsules, pills, tablets, troches, lozenges, melts, powders, solutions, suspensions, or emulsions, and may be prepared according to methods known to the art for the manufacture of pharmaceutical compositions. The solid unit dosage forms can be a capsule that can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers such as lactose, sucrose, calcium phosphate, and corn starch.
In another embodiment, the compounds of this invention may be tableted with conventional tablet bases such as lactose, sucrose and cornstarch in combination with binders such as acacia, corn starch or gelatin, disintegrating agents intended to assist the break-up and dissolution of the tablet following administration such as potato starch, alginic acid, corn starch, and guar gum, gum tragacanth, acacia, lubricants intended to improve the flow of tablet granulation and to prevent the adhesion of tablet material to the surfaces of the tablet dies and punches, for example talc, stearic acid, or magnesium, calcium or zinc stearate, dyes, coloring agents, and flavoring agents such as peppermint, oil of wintergreen, or cherry flavoring, intended to enhance the aesthetic qualities of the tablets and make them more acceptable to the patient. Suitable excipients for use in oral liquid dosage forms include dicalcium phosphate and diluents such as water and alcohols, for example, ethanol, benzyl alcohol, and polyethylene alcohols, either with or without the addition of a pharmaceutically acceptable surfactant, suspending agent or emulsifying agent. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance tablets, pills or capsules may be coated with shellac, sugar or both.
Dispersible powders and granules are suitable for the preparation of an aqueous suspension. They provide the active ingredient in admixture with a dispersing or wetting agent, a suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example those sweetening, flavoring and coloring agents described above, may also be present.
The pharmaceutical compositions of this invention may also be in the form of oil-in-water emulsions. The oily phase may be a vegetable oil such as liquid paraffin or a mixture of vegetable oils. Suitable emulsifying agents may be (1 ) naturally occurring gums such as gum acacia and gum tragacanth, (2) naturally occurring phosphatides such as soy bean and lecithin, (3) esters or partial esters derived from fatty acids and hexitol anhydrides, for example, sorbitan monooleate, (4) condensation products of said partial esters with ethylene oxide, for example, polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening and flavoring agents.
Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil such as, for example, arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent such as, for example, beeswax, hard paraffin, or cetyl alcohol. The suspensions may also contain one or more preservatives, for example, ethyl or n-propyl p-hydroxybenzoate; one or more coloring agents; one or more flavoring agents; and one or more sweetening agents such as sucrose or saccharin. Syrups and elixirs may be formulated with sweetening agents such as, for example, glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, and preservative, such as methyl and propyl parabens and flavoring and coloring agents.
The parenteral compositions of this invention will typically contain from about 0.5% to about 25% by weight of the active ingredient in solution. Preservatives and buffers may also be used advantageously. In order to minimize or eliminate irritation at the site of injection, such compositions may contain a non-ionic surfactant having a hydrophile-lipophile balance (HLB) preferably of from about 12 to about 17. The quantity of surfactant in such formulation preferably ranges from about 5% to about 15% by weight. The surfactant can be a single component having the above HLB or can be a mixture of two or more components having the desired HLB. Illustrative of surfactants used in parenteral formulations are the class of polyethylene sorbitan fatty acid esters, for example, sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol. The pharmaceutical compositions may be in the form of sterile injectable aqueous suspensions. Such suspensions may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate,
polyvinylpyrrolidone, gum tragacanth and gum acacia ; dispersing or wetting agents which may be a naturally occurring phosphatide such as lecithin, a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate, a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadeca-ethyleneoxycetanol, a condensation product of ethylene oxide with a partial ester derived form a fatty acid and a hexitol such as polyoxyethylene sorbitol monooleate, or a condensation product of an ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride, for example polyoxyethylene sorbitan monooleate.
The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Diluents and solvents that may be employed are, for example, water, Ringer's solution, isotonic sodium chloride solutions and isotonic glucose solutions. In addition, sterile fixed oils are conventionally employed as solvents or suspending media. For this purpose, any bland, fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.
A composition of the invention may also be administered in the form of suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritation excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials are, for example, cocoa butter and polyethylene glycol.
Another formulation employed in the methods of the present invention employs transdermal delivery devices ("patches"). Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art (see for example US 5,023,252). Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art. It may be desirable or necessary to introduce the pharmaceutical composition to the patient via a mechanical delivery device. The construction and use of mechanical delivery devices for the delivery of pharmaceutical agents is well known in the art. Direct techniques for, for example, administering a drug directly to the brain usually involve placement of a drug delivery catheter into the patient's ventricular system
to bypass the blood-brain barrier. One such implantable delivery system, used for the transport of agents to specific anatomical regions of the body, is described in US 5,01 1 ,472.
The compositions of the invention can also contain other conventional pharmaceutically acceptable compounding ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in appropriate dosage forms can be utilized. Such ingredients and procedures include those described in the following references, each of which is incorporated herein by reference: Powell, M. F. et al., "Compendium of Excipients for Parenteral Formulations" PDA Journal of Pharmaceutical Science & Technology 1998, 52(5), 238-31 1 ; Strickley, R.G "Parenteral Formulations of Small Molecule Therapeutics Marketed in the United States (1999)-Part-1 " PDA Journal of Pharmaceutical Science & Technology 1999, 53(6), 324-349 ; and Nema, S. et al. , "Excipients and Their Use in Injectable Products" PDA Journal of Pharmaceutical Science & Technology 1997, 51 (4), 166-171.
In a particular embodiment the pharmaceutical composition of the invention is an ophthalmic (or ocular) pharmaceutical composition.
In a specific embodiment ocular delivery (or delivery to the eye) is preferred. For local delivery to the eye, the pharmaceutically acceptable compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutically acceptable compositions may be formulated in an ointment such as petrolatum. Preferred methods of local ocular administration include e.g. choroidal injection, transscleral injection or placing a scleral patch, selective arterial catheterization, intraocular administration including transretinal, subconjunctival bulbar, intravitreous injection, suprachoroidal injection, subtenon injection, scleral pocket and scleral cutdown injection, by osmotic pump, etc. In choroidal injection and scleral patching, the clinician uses a local approach to the eye after initiation of appropriate anesthesia, including painkillers and ophthalmoplegics. A needle containing the therapeutic composition of the invention is directed into the subject's choroid or sclera and inserted under sterile conditions. When the needle is properly positioned the compound is injected into either or both of the choroid or sclera. When using either of these methods, the clinician can choose a sustained release or longer acting formulation. Thus, the procedure can be repeated only every several months, depending on the subject's tolerance of the treatment and response. Intraocular administration of drugs intended for treatment of macular degeneration and other intraocular
conditions is well known in the art. See, e.g. U.S. Pat. Nos. 5,632,984 and 5,770,589. U.S. Pat. No. 6,378,526 provides methods for intrascleral injection of a therapeutic at a location overlying the retina, which provide a minimally invasive technique for delivering the agent to the posterior segment of the eye. In certain embodiments of the invention a composition is delivered to the vicinity of the eye, e.g. in close proximity to the posterior segment of the eye. The "vicinity of the eye" refers to locations within the orbit, which is the cavity within the skull in which the eye and its appendages are situated. Typically the compositions would be delivered close to their intended target within the eye, e.g. close to (within several millimeters of) the portion of the sclera that overlies the posterior segment of the eye, or immediately adjacent to the exterior surface of the sclera. A number of polymeric delivery vehicles for providing controlled release have been used in an ocular context and can be used to administer the compositions of the invention. Various polymers, e.g., biocompatible polymers, which may be biodegradable, can be used. For example, U.S. Pat. No. 6,692,759 describes methods for making an implantable device for providing controlled release of therapeutic agents in the eye. Other useful polymers and delivery systems for ocular administration of a therapeutic agent have been described. The active agent may be released as the polymer degrades. Polymers that have been used for drug delivery include, but are not limited to, poly(lactic-co-glycolic acid), polyanhydrides, ethylene vinyl acetate, polyglycolic acid, chitosan, polyorthoesters, polyethers, polylactic acid, and poly (beta amino esters). Peptides, proteins such as collagen and albumin, and dendrimers (e.g., PAMAM dendrimers) have also been used. Any of these can be used in various embodiments of the invention. Poly(ortho-esters) have been introduced into the eye and demonstrated favorable properties for sustained release ocular drug delivery (Einmahl S. (2002), Invest. Ophthalmol. Vis. Sci., 43(5). Polylactide particles have been used to target an agent to the retina and RPE following intravitreous injection of a suspension of such particles (Bourges, J.L. et al (2003) Invest. Ophthalmol. Vis. Sci., 44(8). A macroscopic implantable device suitable for introduction into the posterior or anterior segment of the eye is referred to herein as an ocular implant (Jaffe, G. (2000) Invest. Ophthalmol. Vis. Sci., 41 (1 1 ). Such devices may be comprised of a plurality of nanoparticles less than or microparticles impregnated with the agent. Methods for making microparticles and nanoparticles are known in the art. Generally, a microparticle will have a diameter of 500 microns or less, e.g., between 50 and 500 microns, between 20 and 50 microns, between 1 and 20 microns, between 1 and 10 microns, and a nanoparticle will have a diameter of less than 1 micron. Preferably the device is implanted into the space occupied by the vitreous humor. The ocular implant may comprise a polymeric matrix. The invention also provides periocular implants, which are macroscopic implantable device suitable for introduction in the vicinity of the eye, e.g., in close proximity to
the eye. In certain embodiments the periocular implant is made of similar materials to those described above.
Pharmaceutical compositions according to the present invention can be illustrated as follows:
Sterile IV Solution: A 5 mg/mL solution of the desired compound of this invention can be made using sterile, injectable water, and the pH is adjusted if necessary. The solution is diluted for administration to 1 - 2 mg/mL with sterile 5% dextrose and is administered as an IV infusion over about 60 minutes.
Lyophilised powder for IV administration: A sterile preparation can be prepared with (i) 100 - 1000 mg of the desired compound of this invention as a lyophilised powder, (ii) 32- 327 mg/mL sodium citrate, and (iii) 300 - 3000 mg Dextran 40. The formulation is reconstituted with sterile, injectable saline or dextrose 5% to a concentration of 10 to 20 mg/mL, which is further diluted with saline or dextrose 5% to 0.2 - 0.4 mg/mL, and is administered either IV bolus or by IV infusion over 15 - 60 minutes.
Intramuscular suspension: The following solution or suspension can be prepared, for intramuscular injection:
50 mg/mL of the desired, water-insoluble compound of this invention
5 mg/mL sodium carboxymethylcellulose
4 mg/mL TWEEN 80
9 mg/mL sodium chloride
9 mg/mL benzyl alcohol
Combination therapies
The compounds of this invention can be administered as the sole pharmaceutical agent or in combination with one or more other pharmaceutical agents where the combination causes no unacceptable adverse effects. The present invention relates also to such combinations. For example, the compounds of this invention can be combined with other anti-angiogenic agents. Anti-angiogenic agents include, but are not limited to, angiostatic steroids such as heparin derivatives and glucocorticosteroids; thrombospondin; cytokines such as IL-12; fumagillin and synthetic derivatives thereof, such as AGM 12470; interferon-alpha; endostatin; soluble growth factor receptors; neutralizing monoclonal antibodies directed against growth factors such as vascular endothelial growth factor and the like.
Dose and administration
Based upon standard laboratory techniques known to evaluate compounds useful for the treatment of diseases where excessive (or pathological) angiogenesis occurs, by standard toxicity tests and by standard pharmacological assays for the determination of treatment of the conditions identified above in mammals, and by comparison of these results with the results of known medicaments that are used to treat these above described conditions, the effective dosage of the compounds of this invention can readily be determined for treatment of each desired indication. The amount of the active ingredient to be administered in the treatment of one of these conditions can vary widely according to such considerations as the particular compound and dosage unit employed, the mode of administration, the period of treatment, the age and sex of the patient treated, and the nature and extent of the condition treated.
The total amount of the active ingredient to be administered will generally range from about 0.001 mg/kg to about 200 mg/kg body weight per day, and preferably from about 0.01 mg/kg to about 20 mg/kg body weight per day. Clinically useful dosing schedules will range from one to three times a day dosing to once every four weeks dosing. In addition, "drug holidays" in which a patient is not dosed with a drug for a certain period of time, may be beneficial to the overall balance between pharmacological effect and tolerability. A unit dosage may contain from about 0.5 mg to about 150 mg of active ingredient, and can be administered one or more times per day or less than once a day. The average daily dosage for administration by injection, including intravenous, intramuscular, intraocular, intravitreal, subcutaneous, intrathecal, intraceroventricularly and parenteral injections, and use of infusion techniques will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily rectal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily vaginal dosage regimen will preferably be from 0.01 to 200 mg/kg of total body weight. The average daily topical dosage regimen will preferably be from 0.1 to 200 mg administered between one to four times daily. The transdermal concentration will preferably be that required to maintain a daily dose of from 0.01 to 200 mg/kg. The average daily inhalation dosage regimen will preferably be from 0.01 to 100 mg/kg of total body weight.
It is evident for the skilled artesan that the specific initial and continuing dosage regimen for each patient will vary according to the nature and severity of the condition as determined by the attending diagnostician, the activity of the specific compound employed, the age and general condition of the patient, time of administration, route of administration, rate of excretion of the drug, drug combinations, and the like. The desired mode of treatment and number of
doses of a compound of the present invention or a pharmaceutically acceptable salt or ester or composition thereof can be ascertained by those skilled in the art using conventional treatment tests.
It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following examples are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims. Examples
1 . Glutamine Synthetase (GS) expression and enzyme activity are induced by metabolic stress in ECs
GS mRNA levels in different endothelial cell (EC) subtypes were comparable to those in luminal MCF breast cancer cells, known to have high GS levels (Kung et al., 201 1 ). In HUVECs GS mRNA and protein levels did not differ significantly between quiescent (contact- inhibited) and proliferating cells. However, upon L-glutamine withdrawal and upon replacement of normal growth medium by Hank's Balanced Salt Solution (HBSS) to induce starvation, GS mRNA and protein levels were significantly induced. Likewise, overnight incubation of HUVECs in hypoxia (0.5% 02) markedly induced GS expression. We observed a significant increase in GS enzymatic activity, determined by the γ-glutamyltransferase assay (Levintow, 1954) for L-glutamine withdrawal, for incubation in HBSS and for hypoxic incubation. Other physiologically relevant stress stimuli such as oxidative stress or shear stress (to mimic blood flow) did not alter GS expression levels (see Figure 1 ). Intracellular stainings revealed co- localization of GS with the mitochondrial network (Tomm20 co-staining) in HUVECs, both in quiescent and proliferating cells.
2. GS knock down (GS kd) does not affect glycolytic flux, the major ATP-generating pathway in ECs
Lentiviral shRNA-mediated knock-down of GS (GSkd) did not affect overall ATP levels in ECs, measured by both a luminescence-based assay on cell lysates and by real-time intracellular
GO-ATEAM ATP sensor imaging (Nakano et al., 201 1 ). The sequence of the shGS used in the present invention was 5'-
CCGGGCACACCTGTAAACGGATAATCTCGAGATTATCCGTTTACAGGTGTGCTTTTTG- 3'. Likewise, glycolytic flux, the main ATP generating pathway in ECs (De Bock et al., 2013) was not altered upon GSkd whilst glucose oxidation and fatty acid oxidation were significantly increased (see Figure 2). No effects of GSkd could be seen on glutamine oxidation.
3. In vitro EC proliferation and migration (conditionally) depend on GS
GSkd ECs retained normal proliferative capacity when cultured in standard 2mM glutamine containing culture medium, both under normoxic and hypoxic conditions (see Figure 6). Surprisingly, even in glutamine containing culture medium, GSkd ECs were not able to restart proliferation upon reseeding after quiescence, a phenomenon highly similar to the one observed in quiescent wt ECs reseeded in glutamine free medium.
Wound closure in scratch-wound assays was significantly impaired in GSkd ECs compared to control transduced ECs. Polarisation of ECs at the wound edge was determined by GM130 golgi staining. Furthermore, velocity of random movement in sparsely seeded GSkd ECs was reduced as determined by time-lapse video imaging. Loss of GS expression resulted in a decrease of lammelipodial area (measured as percentage of total cellular area).
4. GS regulates vessel sprouting in vitro
To determine the importance of GS in vascular sprouting, we used the 3D EC spheroid sprouting assay (Korff et al., 2001 ). In wt EC spheroids, GSkd significantly reduced the number of sprouts / spheroid both under normoxia and hypoxia as well as the total sprout length (see Figure 3).
5. Vascular branching is severely reduced in the mouse neonatal retina
To determine the impact of loss of GS expression in ECs on vessel branching in vivo, we used the neonatal mouse retina as a model for developmental angiogenesis (Phng and Gerhardt, 2009). Immunofluorescent staining on whole mount retinas from 5-day-old (P5) mice showed prominent expression of GS in the vessels mainly at the front of the plexus, implying a prominent role for GS in vessel sprouting in this plexus (see Figure 4). To circumvent
embryonic lethality in GS mice (He et al., 2007) we intercrossed GS mice with an EC- specific tamoxifen inducible Cre driver, VE-cadherin(PAC)-CreERT2 (Benedito et al., 2009), and obtained GSvAEC mice. Additional intercrosses with the double fluorescent (mT/mG) Cre reporter mice (Muzumdar et al., 2007) allowed us to optimize the tamoxifen (Tarn) treatment scheme; three consecutive Tarn administrations at postnatal days P1 -P3 resulted on average in 55 - 90% recombination. Correct recombination of the loxed GS allele was determined by PCR. P5 GSvAEC retinal plexi showed a severe hypobranching phenotype; radial expansion of the plexus was also significantly reduced and vascular area was also significantly reduced. The number of filopodia per unit length of the vascular front was significantly lower in GSvAEC pups as was the number of distal sprouts with filopodia. Furthermore, the complexity of the vasculature at the utmost leading front of the plexus was decreased as determined by the number of branches in distal sprouts. Vessel coverage by NG2+ pericytes was not affected and QgvAEc p|exj 8|η0ννΘ(;| a very modest, though significant, increase in the number of empty collagen IV sleeves. Bodyweight did not differ between GSvAEC pups and control littermates. Similar analyses on P9 retinal plexi (following the P1 -P3 Tarn administration scheme) revealed a hypobranching phenotype in the deeper vascular plexus comparable to the one observed in the superficial plexus in P5 pups. Remarkably, at P9 the superficial plexus completely restored and did not display any difference in branching and vascular area anymore. This indicates that the vascular formation in GSvAEC is delayed. 6. GSkd prevents ECs from obtaining the tip cell position in vitro
To determine if reduced GS expression affects the EC's ability to occupy the tip cell position in a vessel sprout, we used mosaic EC spheroids composed of a 1 :1 mixture of GSWT/RED and QgKD/GFP ^gee jgU re 5) Both in conditions with or without Mitomycin C pre-treatment (to rule out possible differences in proliferation), GSKD/GFP ECS were found less frequently at the tip. siRNA-mediated knock-down of pro-stalk Notch (NotchKD/GFP) resulted in a clear increase in the number of GFP positive tip cells; however, combined GS/Notch knock-down (GSKD/GFPNotchKD/GFP) completely abolished this effect showing that GS can override genetic tip/stalk specification.
7. GS knock-down in ECs affects autophagic flux in vitro
A western blot for autophagy markers in control and shGS-transduced endothelial cells is depicted in Figure 7.
8. Application of the choroid neovascularization model in GSECKO animals (Cre+) and control littermates (Cre neg)
The protein extravasation and hemorrhage associated with choroidal neovascularization (CNV) are primary causes of severe vision loss in retinal diseases such as age-related macular degeneration (ARMD). In ARMD the normal barrier function of Bruch's membrane is compromised, and CNV can develop either under the retinal pigment epithelium (RPE) and photoreceptor outer segments. Choroidal neovascularization (CNV) was induced in GSECKO animals (Cre+) and control littermates (Cre neg) mice by laser burn. Laser burn (400 mW) was performed with Alcon Purepoint equipment. CNV was measured by investigators masked to treatment. Eyes were enucleated after retrobulbar perfusion with FITC-dextran (HMW) and flat mounted. The CNV area, total lesion area, and their ratio were analyzed using Zeiss Axio Imager Z1 microscope with macros (KS300 image analysis software) on FITC-perfused (200 μΙ_; 25 mg/mL; 10 min) flat mounts. Figure 8 shows the ratio between the neovascular area and the lesion area.
In a next experimental set up the intraocular administration of siRNAs directed against glutamine synthetase or the use of chemical inhibitors against glutamine synthetase, is carried out in a murine model for age-related macular degeneration.
9. Selective inhibition of glutamine synthetase can be used to treat ocular angiogenesis in an animal model for age-related macular degeneration
Intraocular delivery of small interfering RNAs specific for glutamine synthetase to the eye of a mouse is subjected to a model for age-related macular degeneration (as in the CNV-model of example 8) is accomplished by delivery of a specific small interfering RNA for glutamine synthetase into the eye via intraocular delivery. Representative examples of siRNA sequences directed against murine glutamine synthetase are used. Alternatively the sequences are modified with phosphorothioate modifications throughout and 2'-0-(2-methoxy)ethyl substitutions on the sugars of the first and last 5 nucleotides to increase biological half-lives
and binding affinity. Clinical analysis of the mice is carried out essentially as described in example 8.
10. Administration of methionine sulfoximine, an inhibitor of glutamine synthetase, reduces pathological ocular angiogenesis
Choroidal neovascularization (CNV) was induced in male C57BL/6 mice by laser burn as previously described (Van de Veire S et al (2010) Cell 141 (1 ):178-90). With a Purepoint® Laser (Alcon, Fort Worth, United States), three spots were made on the retina in a star shaped way (0.4 Watt, 0.1 sec, 50 μηη spot size). Mice were randomly allocated to the treatment groups and injected i.p. with saline (ctrl) or 10 mg/kg L-methionine sulfoximine (MSO) every other day. After two weeks, the eyes were enucleated 1 minute after retrobulbar injection with fluorescein isothiocyanate (FITC)-conjugated dextran (Mr 2,000,000) (Sigma), fixed in 4% PFA and choroids were dissected and flat-mounted for analysis of the neovascular lesion area. As shown in Figure 9, MSO-treated mice showed a strong reduction in the pathological neovascular area when compared to saline-treated mice (data are mean ± SEM; n= 6 mice for both groups; p=0.062).
References
Benedito, R., Roca, C, Sorensen, I., Adams, S., Gossler, A., Fruttiger, M., and Adams, R.H. (2009). The notch ligands DII4 and Jaggedl have opposing effects on angiogenesis. Cell 137, 1 124-1 135.
Cadoret, A., Ovejero, C, Terris, B., Souil, E., Levy, L., Lamers, W.H., Kitajewski, J., Kahn, A., and Perret, C. (2002). New targets of beta-catenin signaling in the liver are involved in the glutamine metabolism. Oncogene 27, 8293-8301 .
De Bock, K., Georgiadou, M., Schoors, S., Ghesquiere, B., Cauwenberghs, S., Cantelmo, A.R., Kuchnio, A., Wong, B.W., Queaegebeur, A., Eelen, G., et al. (2013). Role of GLUTAMINE SYNTH ETAS E-d riven glycolysis in vessel sprouting. . Cell (in press).
DeBerardinis, R.J., and Cheng, T. (2010). Q's next: the diverse functions of glutamine in metabolism, cell biology and cancer. Oncogene 29, 313-324.
Eisenberg, D., Gill, H.S., Pfluegl, G.M., and Rotstein, S.H. (2000). Structure-function relationships of glutamine synthetases. Biochimica et biophysica acta 1477, 122-145.
Gebhardt, R., Baldysiak-Figiel, A., Krugel, V., Ueberham, E., and Gaunitz, F. (2007). Hepatocellular expression of glutamine synthetase: an indicator of morphogen actions as master regulators of zonation in adult liver. Progress in histochemistry and cytochemistry 41, 201 -266. Gebhardt, R., and Mecke, D. (1983). Heterogeneous distribution of glutamine synthetase among rat liver parenchymal cells in situ and in primary culture. The EMBO journal 2, 567-570.
Geudens, I., and Gerhardt, H. (201 1 ). Coordinating cell behaviour during blood vessel formation. Development 138, 4569-4583.
Haberle, J., Gorg, B., Rutsch, F., Schmidt, E., Toutain, A., Benoist, J.F., Gelot, A., Sue, A.L., Hohne, W., Schliess, F., et al. (2005). Congenital glutamine deficiency with glutamine synthetase mutations. The New England journal of medicine 353, 1926-1933.
Haberle, J., Shahbeck, N., Ibrahim, K., Schmitt, B., Scheer, I., O'Gorman, R., Chaudhry, F.A., and Ben-Omran, T. (2012). Glutamine supplementation in a child with inherited GS deficiency improves the clinical status and partially corrects the peripheral and central amino acid imbalance. Orphanet journal of rare diseases 7, 48.
He, Y., Hakvoort, T.B., Vermeulen, J.L., Lamers, W.H., and Van Roon, M.A. (2007). Glutamine synthetase is essential in early mouse embryogenesis. Developmental dynamics : an official publication of the American Association of Anatomists 236, 1865-1875.
Korff, T., Kimmina, S., Martiny-Baron, G., and Augustin, H.G. (2001 ). Blood vessel maturation in a 3-dimensional spheroidal coculture model: direct contact with smooth muscle cells regulates endothelial cell quiescence and abrogates VEGF responsiveness. FASEB journal :
official publication of the Federation of American Societies for Experimental Biology 15, 447- 457.
Kumada, Y., Benson, D.R., Hillemann, D., Hosted, T.J., Rochefort, D.A., Thompson, C.J., Wohlleben, W., and Tateno, Y. (1993). Evolution of the glutamine synthetase gene, one of the oldest existing and functioning genes. Proceedings of the National Academy of Sciences of the United States of America 90, 3009-3013.
Kung, H.N., Marks, J.R., and Chi, J.T. (201 1 ). Glutamine synthetase is a genetic determinant of cell type-specific glutamine independence in breast epithelia. PLoS genetics 7, e1002229.
Levintow, L. (1954). The glutamyltransferase activity of normal and neoplastic tissues. Journal of the National Cancer Institute 15, 347-352.
Muzumdar, M.D., Tasic, B., Miyamichi, K., Li, L, and Luo, L. (2007). A global double- fluorescent Cre reporter mouse. Genesis 45, 593-605.
Nakano, M., Imamura, H., Nagai, T., and Noji, H. (201 1 ). Ca(2)(+) regulation of mitochondrial ATP synthesis visualized at the single cell level. ACS chemical biology 6, 709-715. Phng, L.K., and Gerhardt, H. (2009). Angiogenesis: a team effort coordinated by notch. Developmental cell 16, 196-208.
Potente, M., Gerhardt, H., and Carmeliet, P. (201 1 ). Basic and therapeutic aspects of angiogenesis. Cell 146, 873-887. van der Vos, K.E., Eliasson, P., Proikas-Cezanne, T., Vervoort, S.J., van Boxtel, R., Putker, M., van Zutphen, I.J., Mauthe, M., Zellmer, S., Pals, C, et al. (2012). Modulation of glutamine metabolism by the PI(3)K-PKB-FOXO network regulates autophagy. Nature cell biology 14, 829-837. van Rooyen, J.M., Abratt, V.R., and Sewell, B.T. (2006). Three-dimensional structure of a type III glutamine synthetase by single-particle reconstruction. Journal of molecular biology 361, 796-810. van Straaten, H.W., He, Y., van Duist, M.M., Labruyere, W.T., Vermeulen, J.L., van Dijk, P.J., Ruijter, J.M., Lamers, W.H., and Hakvoort, T.B. (2006). Cellular concentrations of glutamine synthetase in murine organs. Biochemistry and cell biology = Biochimie et biologie cellulaire 84, 215-231.
Wang, Y., Rattner, A., Zhou, Y., Williams, J., Smallwood, P.M., and Nathans, J. (2012). Norrin/Frizzled4 signaling in retinal vascular development and blood brain barrier plasticity. Cell 151, 1332-1344.
Claims
1 . A compound inhibiting the activity of glutamine synthetase for the treatment of pathological angiogenesis excluding cancer.
2. A compound according to claim 1 for the treatment of pathological ocular angiogenesis such as age-related macular degeneration, diabetic retinopathy, diabetic maculopathy, proliferative retinopathies, choroidal and other intraocular disorders with an excessive angiogenesis component.
3. A compound according to claims 1 or 2 which is selected from the list consisting of a siRNA directed against glutamine synthetase, dsRNA directed against glutamine synthetase, anti-sense directed against glutamine synthetase, a ribozyme directed against glutamine synthetase, a microRNA directed against glutamine synthetase, methionine sulfoximine or an analogue thereof, phosphinotricin or an analogue thereof, bisphosphonates and tianeptine.
4. A pharmaceutical ophthalmic composition comprising a compound and a pharmaceutically acceptable carrier according to claims 1 or 3.
5. A pharmaceutical ophthalmic composition according to claim 4 for the treatment of pathological angiogenesis wherein said pathological angiogenesis is associated with age-related macular degeneration, diabetic retinopathy, diabetic maculopathy, proliferative retinopathies, choroidal and other intraocular disorders with an excessive angiogenesis component.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13179243 | 2013-08-05 | ||
| EP13179243.4 | 2013-08-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015018659A1 true WO2015018659A1 (en) | 2015-02-12 |
Family
ID=48917422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2014/066013 Ceased WO2015018659A1 (en) | 2013-08-05 | 2014-07-25 | Glutamine synthetase inhibitors for inhibition of pathological angiogenesis |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015018659A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024227949A1 (en) * | 2023-05-04 | 2024-11-07 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Screening and uses of glutamine synthetase modulators |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000071104A2 (en) * | 1999-05-21 | 2000-11-30 | Novartis Ag | Use of bisphosphonic acids for treating angiogenesis |
| WO2001090064A2 (en) * | 2000-05-19 | 2001-11-29 | Sabinsa Corporation | COMPOSITION AND METHOD CONTAINING PRODUCTS EXTRACTED FROM COMMIPHORA Sp. FOR PREVENTION AND TREATMENT OF ABNORMAL CELL GROWTH AND PROLIFERATION IN INFLAMMATION, NEOPLASIA AND CARDIOVASCULAR DISEASE |
| EP1752143A1 (en) * | 2005-08-08 | 2007-02-14 | NewThera | Novel uses for drugs targeting glutamine synthetase |
-
2014
- 2014-07-25 WO PCT/EP2014/066013 patent/WO2015018659A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000071104A2 (en) * | 1999-05-21 | 2000-11-30 | Novartis Ag | Use of bisphosphonic acids for treating angiogenesis |
| WO2001090064A2 (en) * | 2000-05-19 | 2001-11-29 | Sabinsa Corporation | COMPOSITION AND METHOD CONTAINING PRODUCTS EXTRACTED FROM COMMIPHORA Sp. FOR PREVENTION AND TREATMENT OF ABNORMAL CELL GROWTH AND PROLIFERATION IN INFLAMMATION, NEOPLASIA AND CARDIOVASCULAR DISEASE |
| EP1752143A1 (en) * | 2005-08-08 | 2007-02-14 | NewThera | Novel uses for drugs targeting glutamine synthetase |
Non-Patent Citations (2)
| Title |
|---|
| BERLICKI LUKASZ: "Inhibitors of glutamine synthetase and their potential application in medicine", MINI REVIEWS IN MEDICINAL CHEMISTRY,, vol. 8, no. 9, 1 August 2008 (2008-08-01), pages 869 - 878, XP009180049, ISSN: 1389-5575 * |
| HONDA S. ET AL: "Therapeutic Effect of Oral Bisphosphonates on Choroidal Neovascularization in the Human Eye", JOURNAL OF OPHTHALMOLOGY, vol. 2010, 206837, 2010, pages 1 - 7, XP002730526, DOI: 10.1155/2010/206837 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024227949A1 (en) * | 2023-05-04 | 2024-11-07 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Screening and uses of glutamine synthetase modulators |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2186528B1 (en) | Pharmaceutical containing hif-1 alpha and hif-2 alpha expression inhibitor | |
| CN103200945B (en) | RNA interference in ocular syndromes | |
| KR101852210B1 (en) | Rna interference in dermal and fibrotic indications | |
| Martínez et al. | In vitro and in vivo efficacy of SYL040012, a novel siRNA compound for treatment of glaucoma | |
| EP3030240B1 (en) | Carnitine palmitoyltransferase 1 inhibitors for inhibition of pathological angiogenesis | |
| AU2011282902B2 (en) | siRNA targeting VEGFA and methods for treatment in vivo | |
| US20180258429A1 (en) | Sarna compositions and methods of use | |
| CN102046810B (en) | Inhibition of angiognesis | |
| EA022418B1 (en) | METHODS OF TREATING EYE DISEASES | |
| CN105209619A (en) | Mir-204 and mir-211 and uses thereof | |
| KR20160110370A (en) | Methods for treatment of wound healing utilizing chemically modified oligonucleotides | |
| US20140296319A1 (en) | Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna | |
| US20220056443A1 (en) | Metabolic benefits of short mir-22 mirna antagomir therapies | |
| Fan et al. | MicroRNA-126 inhibits pathological retinal neovascularization via suppressing vascular endothelial growth factor expression in a rat model of retinopathy of prematurity | |
| WO2013007766A1 (en) | Means and methods for the treatment of pathological angiogenesis | |
| WO2015018659A1 (en) | Glutamine synthetase inhibitors for inhibition of pathological angiogenesis | |
| KR20150140598A (en) | Pharmaceutical composition for preventing and treating cancer comprising double-stranded microRNAs as active ingredient | |
| WO2013166240A1 (en) | Micro-rnas involved in macular degeneration | |
| JP2026513271A (en) | OCA2 modulator, its composition and use | |
| WO2025165814A1 (en) | Compositions and methods for regulating cardiac angiogenesis post ischemia | |
| US20220273694A1 (en) | Compositions and methods for decreasing intraocular pressure |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14742538 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14742538 Country of ref document: EP Kind code of ref document: A1 |
