WO2015014973A2 - Use of specific glycoside phosphorylases for the implementation of phosphorolysis or reverse phosphorolysis reactions - Google Patents

Use of specific glycoside phosphorylases for the implementation of phosphorolysis or reverse phosphorolysis reactions Download PDF

Info

Publication number
WO2015014973A2
WO2015014973A2 PCT/EP2014/066565 EP2014066565W WO2015014973A2 WO 2015014973 A2 WO2015014973 A2 WO 2015014973A2 EP 2014066565 W EP2014066565 W EP 2014066565W WO 2015014973 A2 WO2015014973 A2 WO 2015014973A2
Authority
WO
WIPO (PCT)
Prior art keywords
man
glycoside
phosphate
phosphorylase
donor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2014/066565
Other languages
French (fr)
Other versions
WO2015014973A3 (en
Inventor
Gabrielle POTOCKI DE MONTALK-VERONESE
Simon LADEVEZE
Laurence TARQUIS
Elisabeth LAVILLE
Bernard Henrissat
Pierre Monsan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Institut National des Sciences Appliquees de Toulouse INSA
Institut National de la Recherche Agronomique INRA
Original Assignee
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Institut National des Sciences Appliquees de Toulouse INSA
Institut National de la Recherche Agronomique INRA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aix Marseille Universite, Centre National de la Recherche Scientifique CNRS, Institut National des Sciences Appliquees de Toulouse INSA, Institut National de la Recherche Agronomique INRA filed Critical Aix Marseille Universite
Publication of WO2015014973A2 publication Critical patent/WO2015014973A2/en
Publication of WO2015014973A3 publication Critical patent/WO2015014973A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/02Monosaccharides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/04Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/12Disaccharides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates

Definitions

  • the present invention relates to the use of specific glycoside phosphorylases for the implementation of phosphoro lysis or reverse phosphoro lysis reactions involving a mannosyl donor compound or a mannosyl acceptor compound.
  • the present invention also relates to the use of specific glycoside phosphorylases in a process of degradation, by phosphorolysis, of mannosyl donor compounds that were not known to be degradable by phosphorolysis.
  • a-D-mannopyranose-1 -phosphate is the donor substrate used in reverse phosphorolysis processes catalysed by mannosyl phosphorylases.
  • mannosyl phosphorylases catalysed by mannosyl phosphorylases.
  • no glycoside phosphorylase was known to be able to catalyse the preparation of said a-D-mannopyranose- 1 -phosphate from inexpensive mannosyl donor compounds, like mannan.
  • the present invention also relates to the use of specific glycoside phosphorylases in a process of grafting by reverse phosphorolysis a mannosyl residue on a mannosyl acceptor compound.
  • Mannosylated compounds present nutritional or medical interest.
  • MOS beta- linked mannooligosaccharides
  • MOS have prebiotic properties that can probably be modulated by varying the mannosyl acceptor molecule to render the oligosaccharide more or less fermentable in the host (human or animal) gut.
  • MOS are described as effective in lowering total body fat, because fat excretion has been shown to be increased with MOS consumption by humans or animals (Salinardi, T.C. et al. 2010, J. Nutr. 140, 1943-1948).
  • the oligosaccharide Man-GlcNAc is a component of the N-glycans that cover the gastrointestinal tract, to constitute a physical and chemical barrier between the intestinal contents and the underlying epithelia.
  • N-glycans are a source of endogenous substrates for the GI microbial community that uses them as carbon source in addition to plant polysaccharides. Alterations in the structure and/or quantity of N-glycans alter their barrier function and could play roles in initiating and maintaining mucosal inflammation in inflammatory bowel diseases (IBD), and in driving cancer development in the intestine.
  • IBD inflammatory bowel diseases
  • Glycoside phosphorylases are carbohydrate active enzymes which play a crucial role in the metabolism of all living organisms. They catalyse the breakdown of an osidic linkage from oligosaccharides or polysaccharides as donor substrates and the concomitant phosphate glycosylation, to generate a glycosyl phosphate product and a sugar chain of reduced chain length. These enzymes are also able to perform reverse-phosphorolysis, also called synthetic reaction, to form a glycosidic bond between the glycosyl unit coming from the glycosyl-phosphate, which plays the role of sugar donor, and a carbohydrate acceptor.
  • the GPs ability to form glycosidic linkages in reverse-phosphorolysis is of prime interest for the in vitro synthesis of glycosides, which can be used in medicine, nutrition and cosmetics applications fields.
  • GT glycoside transferases
  • GH glycoside-hydrolases
  • these enzymes use oligosaccharides or polysaccharides as mannosyl donors, and monosaccharides, oligosaccharides or hydroxylated compounds as acceptors.
  • GPs are classified both in glycosyl transferase (GT) and glycoside hydrolase (GH) families, depending on the fold and catalytic mechanism similarities their share with typical GTs and GHs, respectively.
  • GT glycosyl transferase
  • GH glycoside hydrolase
  • GPs The natural structural and functional diversity of GPs appears to be highly restricted, since (i) they are found in only seven of the 226 GH and GT families listed in the CAZy database (March 2013); (ii) approximately only 15 EC entries are currently assigned to GPs, (iii) their specificity towards glycosyl phosphates is limited to a- and ⁇ -D-glucopyranose-l- phosphate which are the most prevalent substrates, a-D-galactopyranose-1 -phosphate, N- acetyl-a-D-glucosamine- 1 -phosphate, and a-D-mannopyranose- 1 -phosphate.
  • a-D-Mannopyranose-1 -phosphate specificity has been described for just four enzymes in the recently created GH130 family, which comprises a total of 533 entries, from archaea, bacteria, and eukaryotes :
  • BfMP mannosylglucose phosphorylase
  • BfMP exhibits a very narrow specificity towards ⁇ -D-Manp- 1,4-D-Glc, meaning that P-D-Man/?-l,4-D-Glc is the only tolerated mannosyl donor during BfMP mediated phosphorolyis and that D-glucose is the only tolerated mannosyl acceptor during BfMP mediated reverse phosphorolyis;
  • RaMPl and RaMP2 from the ruminal bacterium Ruminococcus albus NE1.
  • These enzymes have also been proposed to participate in mannan catabolism in the bovine rumen, and are assisted by an endo-mannanase and an epimerase, via RaMP2 and RaMPl -catalysed phosphorolysis of ⁇ -1,4 mannooligosaccharides and 4-0-P-D-mannopyranosyl-D- glucopyranose, respectively (Kawahara R. et al. (2012), J Biol Chem 287: 42389-42399. doi: 10.1074/jbc.Ml 12.390336);
  • One of the aims of the present invention is to provide specific glycoside phosphorylases able to degrade, by phosphorolysis, mannosyl donor compounds that were not known to be degradable by phosphorolysis, for example mannan.
  • Another aim of the present invention is to provide enzymatically synthesized a-D- mannopyranose-1 -phosphate from beta- linked mannooligosaccharides and beta- linked mannopolysaccharides, in particular mannan.
  • Another aim of the present invention is to provide enzymatically synthesized oligosaccharides and glycoconjugates containing beta-linked mannosyl residues from a-D- mannopyranose- 1 -phosphate.
  • Still another aim of the invention is to provide inflammatory bowel diseases treatment by inhibiting glycoside-phosphorylases.
  • the present invention relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, for the implementation of a phosphorolysis or reverse phosphorolysis reaction involving a-D-mannopyranose-1- phosphate,
  • glycoside-phosphorylase is not RaMP2.
  • the present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, for the implementation of tedious
  • glycoside-phosphorylase is not RaMP2 or Btl033.
  • the present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, to degrade by phosphorolysis a mannosyl donor compound of formula:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man) m _i -donor,
  • glycoside-phosphorylase is not RaMP2.
  • the present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to degrade by phosphorolysis a mannosyl donor compound of formula:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, ⁇ -l,4-D-mannooligosaccharides, ⁇ -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man) m _i -donor,
  • glycoside-phosphorylase is not RaMP2 or Bt 1033.
  • the glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 is refered to UhgbMP (Unknown human gut bacterium Mannoside Phosphorylase, GenBank accession number ADD61463.1), encoded by the gene situated between the nucleotides 2620 and 3603 of the nucleotidic sequence with GenBank accession number GU942931.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 80%, in particular of at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, more particularly of at least 90%, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 64%, in particular an identity percentage comprised from 50% to 63%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% or 63%, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 80%, in particular an identity percentage comprised from 65% to 79%, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 90%, in particular an identity percentage comprised from 65% to 89%, more particularly an identity percentage of 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89%o, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50% and less than 66%, in particular an identity percentage comprised from 50% to 65%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65%, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and less than 80%, in particular an identity percentage comprised from 67% to 79%, with the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and r
  • said glycoside -phosphorylase is characterized, in relation with phosphoro lysis, generating a-D-mannopyranose-1 -phosphate and a (Man) m _i- donor compound from a mannosyl donor of formula (Man) m -donor and inorganic phosphate, by the quantification of said a-D-mannopyranose-1 -phosphate, said (Man) m _i -donor compound or said inorganic phosphate.
  • said glycoside-phosphorylase is characterized by the quantification, in particular by high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD), of a-D-mannopyranose-1 -phosphate, after having contacted said glycoside-phosphorylase with a mannosyl donor and inorganic phosphate.
  • HPAEC-PAD pulsed amperometric detection
  • HPAEC-PAD pulsed amperometric detection
  • said glycoside-phosphorylase is characterized by the quantification, in particular by high-performance liquid chromatography (HPLC), of said (Man) m _i -donor compounds, after having contacted said glycoside-phosphorylase with said (Man) m -donor compounds.
  • HPLC high-performance liquid chromatography
  • the quantification of the (Man)m-l -donor compounds is for example performed by high-performance liquid chromatography (HPLC), according to the procedure described by Kawahara, R. et al. (2012), J. Biol. Chem. 287, 42389-42399.
  • said glycoside-phosphorylase is characterized by the quantification, in particular by a colorimetric method, of inorganic phosphate, after having contacted said glycoside-phosphorylase with a-D-mannopyranose-1 -phosphate and an mannosyl acceptor, in particular D-glucose, D-mannose, D-galactose, D-fructose, ( ⁇ -D- Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, or (P-D-Manp-l,4) j -P-D-Glc/?NAc-l,4-D- GlcpNAc, j being equal to 0, 1 or 2.
  • a colorimetric method of inorganic phosphate
  • the quantification of inorganic phosphate is for example performed by the colorimetric method described by Gawronski, J.D. et al. (2004), Analytical Biochemistry 327, 114-118, or by Chao, C. et al. (2011), Enzyme and Microbial Technology 49, 59-65.
  • the apparent catalytic efficiency kcat app / Krri app of said glycoside-phosphorylase is above about 0.02 s ⁇ mM "1 , in particular above about 0.9 s " ' ⁇ "1 , for phosphoro lysis in presence of inorganic phosphate and a mannosyl donor selected from the list constituted by P-D-mannopyranosyl-l,4-D-mannose, P-D-mannopyranosyl-l,4- D-glucose, -D-mannopyranosyl-l ⁇ -N ⁇ -diacetyl chitobiose and -1,4-D-Mannan.
  • Apparent phosphorolysis catalytic efficiency is for example determined according to a procedure described by Kawahara, R. et al. (2012), J. Biol. Chem. 287, 42389-42399, with 0.01 mg/ml of purified enzyme by quantifying a-D-mannopyranose-1 -phosphate release rate from 5 to 10 mM inorganic phosphate at pH 7.0 and between 1 and 20 mM of ⁇ -D- mannopyranosyl-l,4-D-mannose, between 1 and 10 mM of P-D-mannopyranosyl-l,4-D- glucose, between 0.05 and 0.5 mM of -D-mannopyranosyl-l,4-N,N'-diacetyl chitobiose or between 0.4 and 4 mM of -1,4-D-Mannan.
  • the apparent kinetic parameters, kcat app and Krriapp, are, regarding phosphorolysis, for example determined by fitting the initial rates of a-D-mannopyranose-1 -phosphate release, to the Michaelis-Menten equation ⁇ ibid.).
  • Non-linear regression is for example performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
  • a-D-Mannopyranose-1 -phosphate concentration is for example quantified by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD).
  • Carbohydrates and a-D-mannopyranose-1 -phosphate are in particular separated on a 4 x 250 mm Dionex Carbopac PA100 column.
  • a gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min-1 flow rate.
  • Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
  • identity percentage is meant the percentage of identical amino acids between two aligned sequences, one of them being the amino acid sequence SEQ ID NO: 1, the other one being the amino acid sequence of interest.
  • the "identity percentage" between two polypeptide sequences is determined by comparing both optimally aligned sequences through a comparison window.
  • the portion of the amino-acid sequence in the comparison window may thus include additions or deletions (for example "gaps") as compared to the reference sequence (which does not include these additions or these deletions) so as to obtain an optimal alignment between both sequences.
  • additions or deletions for example "gaps”
  • the identity percentage is calculated by determining the number of positions at which an identical amino-acid residue, can be noted for both compared sequences, then by dividing the number of positions at which identity can be observed between both amino-acid residues, by the total number of positions in the comparison window, then by multiplying the result by hundred to obtain the percentage of amino acid identity between the two sequences.
  • the comparison of the sequence optimal alignment may be effected by a computer using known algorithms.
  • RaMP2 is meant the glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 3 (GenBank accession number ADU20661.1 or YP 004103295.1).
  • SEQ ID NO: 7 GenBank accession number WP 011107586.1.
  • mannosyl donor is meant a donor of mannosyl, in other words a compound comprising a mannoside residue bonded to the rest of the compound (i.e. the "donor” part of the compound), the mannoside residue of which being able to be transferred to another compound, in particular inorganic phosphate, by phosphorolysis.
  • phosphorolysis is meant the breakdown of the glycosidic bond joining said mannosyl to the rest of the mannosyl donor, and the concomitant phosphate mannosylation, to generate a-D-mannopyranose-1 -phosphate, said reactions being catalysed by a glycoside- phosphorylase.
  • said phosphorolysis is characterized by a notable parallel increase in specific activity with the degree of polymerisation (DP).
  • specific activity is meant the activity of an enzyme per milligram of total protein (expressed in ⁇ mol.min ⁇ 1 .mg ⁇ 1 ).
  • enzyme activity is meant the moles of substrate converted by said enzyme per unit of time.
  • p denotes the pyranose form of a monosaccaride.
  • Man/?" is meant mannopyranose.
  • the present invention relates to the use as defined above, wherein said mannosyl donor compound is P-1,4-D-Mannan.
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, ZP 02422496.1, ZP 02205887.1,
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
  • the proteins having the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413 are also identified by the GenBank Accession numbers presented in following table A:
  • glycosidase [Prevotella enoeca] WP_025065587.1 82% 97% 0.0 327 glycosidase [Prevotella timonensis] WP_025072541.1 82% 97% 0.0 329 glycosidase [Prevotella baroniae] WP_027444955.1 82% 97% 0.0 383 glycosidase [Bacteroidales bacterium
  • glycosidase related protein 3,00E-
  • Table A further presents the identity to UhgbMP (%), the sequence coverage (%) and the E-value of said proteins.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 80%, in particular of at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, more particularly of at least 90%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 5,00E-167, in particular an E-value of 0.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 64%, in particular an identity percentage comprised from 50% to 63%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% or 63%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 1,00E-153 to 1,00E-106, in particular from 1,00E-153 to 1,00E-120 or from l,00E-120 to 1,00E-106.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 80%, in particular an identity percentage comprised from 65% to 79%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 1,00E-147, in particular from 0 to 1,00E-155, or from 1,00E-155 to 1,00E-147, the E-value being more particularly of 0.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 66%, in particular an identity percentage comprised from 50% to 65%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%), 62%o, 63%o, 64%o or 65%>, with the amino acid sequence SEQ ID NO: 1, and has an E- value comprised from 1,00E-161 to 1,00E-106, in particular from 1,00E-161 to 1,00E-120 or from 1,00E-120 to 1,00E-106.
  • the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and less than 80%, in particular an identity percentage comprised from 67% to 79%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 1,00E-147, inappel ⁇
  • the present invention relates to the use as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: l .
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1 and wherein said mannosyl donor compound is P-1,4-D-Mannan.
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
  • the gene encoding for the glycoside-phosphorylase in particular UhgbMP, can be amplified by any means known in the art, for instance by PCR using an appropriate set of primers.
  • the amplified gene or PCR product can then be ligated into any appropriate expression vector, such as for example the expression vector pDEST17, which can be used to transform any host organism known in the art such as, for example, E. coli.
  • any appropriate expression vector such as for example the expression vector pDEST17, which can be used to transform any host organism known in the art such as, for example, E. coli.
  • the enzyme produced by the host organism can then be extracted and purified by any method known in the art such as, for example, using a TALON resin (immobilized metal affinity chromatography (IMAC) resin, Clontech) loaded with cobalt to purify His-tagged UhgbMP.
  • TALON resin immobilized metal affinity chromatography (IMAC) resin, Clontech
  • the invention further relates to a glycoside-phosphorylase, in particular UhgbMP, which contains at least one deletion, substitution or addition, or any combination thereof, which does not diminish the phosphorylase and/or reverse phosphorylase activity of said glycoside-phosphorylase by at most 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%.
  • the glycoside-phosphorylase of the present invention in particular UhgbMP, contains at least one deletion, substitution or addition, or any combination thereof, which does not diminish the phosphorylase and/or reverse phosphorylase activity of said glycoside-phosphorylase by at most 90%>.
  • the present invention also relates to a glycoside-phosphorylase, in particular UhgbMP, which contains at least one deletion, substitution or addition, or any combination thereof, and which retains 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the phosphorylase and/or reverse phosphorylase activity of the wild type glycoside-phosphorylase.
  • the phosphorylase and/or reverse phosphorylase activity can be measured by any method known to a skilled person, in particular by the determination of the apparent catalytic efficiency.
  • an addition that does not influence the enzyme's activity is an N- or C-terminal addition of a His-tag, or of another purification tag.
  • the present invention relates to the use as defined above, wherein a mannosyl residue is grafted on a mannosyl acceptor containing a hydroxyl group, in the presence of said a-D-mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man-Acceptor wherein Man represents mannose.
  • the present invention relates to a process of degradation of a mannosyl donor compound of formula:
  • Man represents mannose and m is an integer comprised from
  • 1 to 1000 in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose,
  • glycoside-phosphorylase is not RaMP2.
  • the present invention also relates to a process of degradation of a mannosyl donor compound of formula:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • said mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, ⁇ -l,4-D-mannooligosaccharides, ⁇ -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, provoked
  • glycoside-phosphorylase is not RaMP2 or Btl033.
  • said glycoside-phosphorylase is characterized, in relation with phosphorolysis, generating a-D-mannopyranose-1 -phosphate and a (Man) m _i- donor compound from a mannosyl donor of formula (Man) m -donor and inorganic phosphate, by the quantification of said a-D-mannopyranose-1 -phosphate, said (Man) m _i -donor compound or said inorganic phosphate.
  • the apparent catalytic efficiency kcat app / Krri app of said glycoside-phosphorylase is above about 0.02 s 'ltiM "1 , in particular above about 0.9 s " 'mlV 1 , for phosphorolysis in presence of inorganic phosphate and a mannosyl donor selected from the list constituted by -D-mannopyranosyl-l,4-D-mannose, -D-mannopyranosyl-l,4- D-glucose, -D-mannopyranosyl-l ⁇ -N ⁇ -diacetyl chitobiose and -1,4-D-Mannan.
  • the present invention relates to the process of degradation as defined above, wherein said step of phosphorolysis is followed by a further step of contacting said compound of formula (Man) m _i -donor with said glycoside- phosphorylase and inorganic phosphate, in a aqueous medium, to obtain by phosphorolysis a- D-mannopyranose-1 -phosphate and a compound of formula (Man) m _2-donor, said further step being repeated p times, p being an integer comprised from 0 to (m-2), to obtain a-D- mannopyranose-1 -phosphate and a compound of formula (Man)( m _ p )_2-donor.
  • the present invention relates to the process of degradation as defined above, wherein said mannosyl donor compound is P-1,4-D-Mannan.
  • the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS 13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1,tician wherein
  • the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
  • the present invention relates to the process of degradation as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the process of degradation as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1 and wherein said mannosyl donor compound is ⁇ -1,4-0- Mannan.
  • the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
  • the present invention relates to the process of degradation as defined above, comprising:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • said mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium
  • the present invention relates to the process of degradation as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
  • the present invention relates to the process of degradation as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D-mannose, D-galactose, D-fructose, (P-D-Man/?-l,4)i-D- Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4) j -P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
  • the present invention relates to the process of degradation as defined above, wherein said mannose is grafted on said mannosyl acceptor via a ⁇ - linkage.
  • the present invention relates to the process of degradation as defined above, wherein said phosphorolysis and said reverse phosphorolysis are performed in one-pot.
  • the present invention relates to the process of degradation as defined above, wherein said reverse phosphorolysis is performed subsequently to said phosphorolysis.
  • said phosphorolysis and said reverse phosphorolysis are performed independently.
  • said reverse phosphorolysis can be performed with commercial a-D- mannopyranose- 1 -phosphate .
  • the present invention relates to the process of degradation as defined above, comprising:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyltician.
  • glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%), with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphoro lysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man) m _i -donor;
  • the present invention also relates to the use of a glycoside- phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to graft a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, in the presence of a-D-mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, with the proviso that said glycoside-phosphorylase is not RaMP2.
  • the present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to graft a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, in the presence of a-D- mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose,
  • glycoside-phosphorylase is not RaMP2 or Btl033.
  • mannosyl acceptor an acceptor of mannosyl, in other words a compound on which a mannoside residue is able to be grafted, by reverse phosphorolysis.
  • reverse phosphorolysis is meant the formation of a glycosidic bond between the mannosyl unit of the a-D-mannopyranose-1 -phosphate and the mannosyl acceptor, said formation being catalyzed by a glycoside-phosphorylase.
  • said glycoside-phosphorylase is characterized, in relation with reverse phosphorolysis, generating a mannosylated acceptor and inorganic phosphate from a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, by the quantification of said a-D-mannopyranose-1 -phosphate or said inorganic phosphate.
  • the apparent catalytic efficiency kcat app / Krri app of said glycoside-phosphorylase is above about 0.05 s 'ltiM "1 , in particular above about 0.4 s " 'mlV 1 , for reverse phosphorolysis in presence of a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, in particular selected from D-glucose, D-mannose, D-galactose, D- fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4) j -P-D- Glc/?NAc- 1 ,4-D-GlcpNAc, j being equal to 0, 1 or 2.
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is not L-arabinose, D-cellobiose, D-fucose, L-fucose, L-rhamnose, Xylitol, D-lyxose, L-xylose, D-mannitol, D-altrose, D-xylose or D-allose.
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, ZP 02422496.1, ZP 02205887.1,
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
  • the present invention relates to the use as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is a carbohydrate.
  • carbohydrates is meant saccharides, in particular monosaccharides, oligosaccharides, and polysaccharides.
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D- mannose, D-galactose, D-fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1 , and (P-D-Man/?-l,4) j -P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
  • said mannosyl acceptor is selected from the list constituted by D-glucose, D- mannose, D-galactose, D-fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1 , and (P-D-Man/?-l,4) j -P-D-Glc/?NAc-l,4
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the list constituted by glycoproteins and glycopeptides.
  • glycoprotein is meant a protein that contains saccharide chains, in particular oligosaccharide and/or monosaccharide chains, covalently attached to the side-chains of amino acids constituting said protein.
  • glycopeptide is meant a peptide that contains saccharide chains, in particular oligosaccharide and/or monosaccharide chains, covalently attached to the side-chains of amino acids constituting said peptide.
  • the present invention relates to the use as defined above, wherein said mannosyl acceptor is water.
  • the present invention relates to the use as defined above, wherein said mannosyl residue is grafted on said mannosyl acceptor via a ⁇ -linkage.
  • the present invention relates to the use as defined above, wherein said a-D-mannopyranose-1 -phosphate is obtained from degradation by phosphorolysis of a mannosyl donor compound of formula (Man) m -donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15, said mannosyl donor compound being selected from the list constituted by P-l,4-D-mannan, ⁇ -1,4- ⁇ - mannooligosaccharides, ⁇ -D-mannopyranosyl- 1 ,4-D-glucose, ⁇ -D-mannopyranosyl- 1 ,4-N- acetyl-D-glucosamine, ⁇ -D-mannopyranosyl-l,4-N, ⁇ '-diacetyl chitobiose, and glycoproteins constituted by a protein glycosyl, Man represents
  • the present invention relates to the process of grafting a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, comprising a step of contacting a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, with a-D-mannopyranose-1 -phosphate and said mannosyl acceptor, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose and inorganic phosphate,
  • glycoside-phosphorylase is not RaMP2.
  • the present invention relates to the process of grafting a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, comprising a step of contacting a glycoside- phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, with a-D-mannopyranose-1 -phosphate and said mannosyl acceptor, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose and inorganic phosphate,
  • glycoside-phosphorylase is not RaMP2 or Btl033.
  • said glycoside-phosphorylase is characterized, in relation with reverse phosphorolysis, generating a mannosylated acceptor and inorganic phosphate from a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, by the quantification of said a-D-mannopyranose-1 -phosphate or said inorganic phosphate.
  • the apparent catalytic efficiency kcat app / Krriapp of said glycoside-phosphorylase is above about 0.05 s ⁇ mM "1 , in particular above about 0.4 s " "1 , for reverse phosphorolysis in presence of a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, in particular selected from D-glucose, D-mannose, D-galactose, D- fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4)j-P-D- Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
  • a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, in particular selected from D-glucose, D-mannose, D-galactose, D- fruct
  • the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is chosen among glycoside- phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS 13361.1, ABX42090.1, AFG35891.1 , ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, _
  • ZP 02422496.1 ZP 02205887.1, ZP 02090881.1, ZP 02071200.1, ZP 02067106.1, ZP 01958898, YP 210978.1 and YP 001297942.1.
  • the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
  • the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is a carbohydrate.
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D-mannose, D-galactose, D-fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1 , and (P-D-Man/?-l,4) j -P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the list constituted by glycoproteins and glycopeptides.
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is water.
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl residue is grafted on said mannosyl acceptor via a ⁇ -linkage.
  • the present invention relates to the process of grafting as defined above, comprising:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15, radical ⁇
  • said mannosyl donor compound being selected from the list constituted by ⁇ - 1 ,4-D-mannan, ⁇ - 1 ,4-D-mannooligosaccharides, ⁇ -D-mannopyranosyl- 1 ,4-D-glucose, ⁇ -D-mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 , -N,N- diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D- mannopyranosyl-l ⁇ -N.N'-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 , or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an
  • Said embodiment concerns the grafting of a mannosyl residue from a-D- mannopyranose-1 -phosphate to a mannosyl acceptor in presence of a glycoside- phosphorylase, said a-D-mannopyranose-1 -phosphate being obtained by degradation of a mannosyl donor by said glycoside-phosphorylase.
  • the present invention relates to the process of grafting as defined above, wherein said phosphorolysis and said reverse phosphorolysis are performed in one-pot.
  • the present invention relates to the process of grafting as defined above, wherein said reverse phosphorolysis is performed subsequently to said phosphorolysis.
  • said phosphorolysis and said reverse phosphorolysis are performed independently.
  • said reverse phosphorolysis can be performed with commercial a-D- mannopyranose- 1 -phosphate.
  • the present invention also relates to the process of grafting as defined above, comprising:
  • Said embodiment concerns the grafting of one mannosylated residue on a mannosyl acceptor, said grafting being repeated (n+1) times to obtain a compound of the following formula: (Man) n+ 2-Acceptor.
  • mannosyl residues are polymerized, through the creation of beta- 1,4 linkages, yielding to the synthesis of manno-oligo and manno-polysaccharides grafted on an acceptor.
  • the present invention relates to the process of grafting as defined above, comprising:
  • Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
  • said mannosyl donor compound being selected from the list constituted by ⁇ -1,4- ⁇ - mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, ⁇ -D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by ⁇ -D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%), with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium,
  • the present invention relates to the process of grafting as defined above, wherein said mannosyl donor compound is ⁇ -1,4- D-Mannan.
  • the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
  • the present invention relates to a pharmaceutical composition
  • a pharmaceutical composition comprising as active substance an inhibitor of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, said inhibitor being in particular D- altrose, D-xylose or D-allose, in association with a pharmaceutically acceptable vehicle.
  • the present invention relates to the pharmaceutical composition as defined above, admimstrable by oral route at a dose comprised from about 0.1 mg/kg to about 1000 mg/kg of body weight.
  • the present invention relates to the pharmaceutical composition as defined above, admimstrable by rectal route at a dose comprised from about 0.1 mg/kg to about 1000 mg/kg of body weight.
  • the present invention relates to the pharmaceutical composition as defined above, under a form liable to be admimstrable by oral route, under the form of a unit dose comprised from about 5 mg to about 10,000 mg, in particular from about 10 mg to about 2,000 mg, in particular from about 50 to about 1,000 mg.
  • the present invention relates to the pharmaceutical composition as defined above, under a form liable to be admimstrable by rectal route, under the form of a unit dose comprised from about 5 mg to about 10,000 mg, in particular from about 10 mg to about 2,000 mg, in particular from about 50 to about 1,000 mg.
  • the present invention relates to a composition
  • a composition comprising an inhibitor of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, for treating inflammatory bowel diseases.
  • the present invention relates to the composition as defined above, wherein said inflammatory bowel diseases belong to the group consisting of Crohn's disease, ulcerative colitis and colon cancer. DESCRIPTION OF THE DRAWINGS
  • Figure 1A presents the 1H NMR spectra of the products synthesized by reverse phosphoro lysis by UhgbMP from 1) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D- mannose, 2) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D-glucose, 3) 10 mM a-D- mannopyranose-1 -phosphate and 10 mM N,N"-diacetyl chitobiose.
  • Figure IB presents the 13 C (B) NMR spectra of the products synthesized by reverse phosphoro lysis by UhgbMP from 1) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D- mannose, 2) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D-glucose.
  • Figure 2 presents the dependency of UhgbMP specific activity (phosphoro lysis) with the polymerisation degree (DP) of the phosphorolysed P-l ,4-D-mannoligosaccharides.
  • Example 1 Recombinant UhgbMP production and purification
  • the UhgbMP (SEQ ID NO: 1) encoding gene (SEQ ID NO: 2) was PCR amplified from the E. coli metagenomic clone (Genbank accession number GU942931) using primers forward 5 'AGTATGAGTAGC AAAGTTATTATTCCTTGG 3 ' (SEQ ID NO: 5) and reverse 5 ' TCAGATGATGCTTGTACGTTTGGTAAATTC 3 ' (SEQ ID NO: 6), by using the Expand Long Template PCR kit (Roche).
  • E.coli BL21-AI cells harboring the UhgbMP-encoding plasmid were cultured at 20°C for 24 hours in ZYM-5052 autoinduction medium supplemented with 100 ⁇ g/mL ampicillin, inoculated at OD600nm 0.1.
  • Example 2 Synthesis of manno-oligosaccharides from a-D-mannopyranose-l-phosphate and carbohydrate acceptors
  • Reaction was performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM of the a-D-mannopyranose-l-phosphate (reference M1755, Sigma), and 10 mM of carbohydrate acceptors.
  • the reaction can be performed with a concentration of said N,N"-diacetyl chitobiose comprised from 0.1 to 10 mM, in particular from 0.5 to 1 mM, more particularly with a concentration of ImM.
  • the apparent kinetic parameters for reverse phosphorolysis were determined by fitting the initial rates of a-D-mannopyranose-l-phosphate release and consumption, respectively, to the Michaelis-Menten equation. Non-linear regression was performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
  • reaction conditions were different than those used for synthesis of mannooligosaccharides : Reaction was performed with 0.01 mg/ml purified UhgbMP at 37 °C in Tris HC1 20mM, pH 7.0. Substrate concentrations were as follows: 10 mM a-D- mannopyranose-l-phosphate and 5 to 40 mM of D-glucose, D-galactose, D-fructose, or N- acetyl-D-glucosamine, or, 5 or 10 mM a-D-mannopyranose-l-phosphate and 5 to 40 mM of D-mannose, or 5 mM a-D-mannopyranose-l-phosphate and 0.1 to 1 mM of N,N"-diacetyl chitobiose.
  • Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-l-phosphate were separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min "1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
  • HPAEC-PAD pulsed amperometric detection
  • tetradeuterio-3-trimethylsilylpropanoate was selected as the internal standard.
  • 1H and 13 C NMR spectra were recorded on a Bruker Advance 500 MHz spectrometer using a 5 mm z- gradient TBI probe at 298 K, an acquisition frequency of 500.13 MHz and a spectral width of 8012.82 Hz. Spectra were acquired and processed using TopSpin 3.0 software.
  • the various signals were assigned by comparison with signals obtained from a-D-mannopyranose-1- phosphate, -D-mannopyranosyl-l,4-D-mannose (Megazyme, Irleland, reference O-MBI), ⁇ - D-mannopyranosyl-l,4-D-glucose (Carbosynth, United Kingdom, reference OM04754), or ⁇ - D-mannopyranosyl-l,4-N,N'-diacetyl chitobiose (Dextra, United Kingdom, reference MC0320), used as standards.
  • a-D-mannopyranose-1- phosphate -D-mannopyranosyl-l,4-D-mannose
  • ⁇ - D-mannopyranosyl-l,4-D-glucose Carbosynth, United Kingdom, reference OM04754
  • UhgbMP produces mannose and, further, mannooligosaccharides of DP ranging from 1 to 12, indicating that water itself plays the role of first acceptor at the beginning of the reaction.
  • the ⁇ -1,4 regio-specific synthesis of manno- oligosaccharides was characterized by 1H and 13 C NMR ( Figure 1).
  • Various carbohydrates were tested as acceptors (Table 1). D-G1C/?NAC and P-D-G1C/?NAC-1,4-D-G1C/?NAC were the best recognized acceptors, given that the UhgbMP Km value for these compounds are 6 and 48 fold lower than for D-mannose, respectively.
  • UhgbMP Starting from a-D-mannopyranose-1- phosphate and D-Glc/?NAc or P-D-Glc ?NAc-l,4-D-GlcpNAc, UhgbMP generates series of mannooligosaccharides containing D-Glc/?NAc or P-D-G1C/?NAC-1,4-D-G1C/?NAC at their reducing end, with a DP of up to 4. D-glucose, D-mannose, D-galactose and D-fructose are also recognized as acceptors.
  • UhgbMP is the most effective phosphorylase for production of N-glycan core oligosaccharides, such as P-D-Man/?-l,4-D-GlcNAc and P-D-Man ?-l,4-P-D-Glc ?NAc-l,4-D- GlcpNAc, whose commercial price today exceeds $ 10,000 per mg.
  • the UhgbMP apparent catalytic efficiency for reverse phosphorolysis using N-acetyl-D-glucosamine and ⁇ - D-Glc/?NAC- 1 ,4-D-GlcNAc as acceptors is 24 and 262 times higher than that of RaMP2.
  • Example 3 Phosphorolysis of oligosaccharides or polysaccharides by UhgbMP
  • Reaction was performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM carbohydrate donor, excepted for P-D-mannopyranosyl-l ⁇ -N.N'-diacetyl chitobiose (Dextra, United Kingdom, reference MC0320) which was used at 2 mM.
  • 10 mM inorganic phosphate prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-so
  • the apparent kinetic parameters for phosphorolysis were determined by fitting the initial rates of a-D-mannose-1 -phosphate release and consumption, respectively, to the Michaelis-Menten equation. Non-linear regression was performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
  • reaction conditions were different than those used for synthesis of mannooligosaccharides : Reaction was performed with 0.01 mg/ml purified UhgbMP at 37 °C in Tris HC1 20mM, pH 7.0. Substrate concentrations were as follows: 10 mM inorganic phosphate and 1 to 10 mM of -D-mannopyranosyl-l,4-D-glucose, 10 mM inorganic phosphate and 0.4 to 4 mM of -l,4-D-mannan, 5 or 10 mM inorganic phosphate and 1 to 20 mM of -D-mannopyranosyl-l,4-D-mannose, 5 mM inorganic phosphate and 0.05 to 0.5 mM of ⁇ -D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose.
  • Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min "1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference. _
  • UhgbMP exhibits a wide specificity towards carbohydrate donors (Table 2).
  • UhgbMP is thus to date the only characterized GH130 enzyme that is able to breakdown mannan, a constituent of hemicellulose in grains and nuts.
  • UhgbMP carbohydrate donor that we tested for UhgbMP is P-D-mannopyranosyl-l,4-N,N'- diacetyl chitobiose (P-D-Man/?-l,4- P-D-Glc ?NAc-l,4-D-GlcpNAc), a signature motif of human N-glycans.
  • the Km for this compound is respectively 10- and 57-fold lower than that obtained for P-l,4-D-mannobiose and P-D-Man ?-l,4-D-Glcp.
  • Example 4 Quantification of UhgbMP inhibition by carbohydrates or hydroxylated compounds
  • the percentage of UhgbMP inhibition by carbohydrates or other hydroxylated compounds was measured with 0.1 mg/ml purified enzyme by quantifying a-D-mannopyranose-1- ⁇ ⁇
  • phosphate consumption rate from 10 mM a-D-mannopyranose-1 -phosphate as glycosyl donor, with and without 10 mM of L-rhamnose, D-altrose, D-allose, D-fucose, L-fucose, D-mannitol, D-lyxose, xylitol, L-xylose, D-xylose, L-arabinose, or D-cellobiose. It was checked by HPAEC-PAD that less than 10 % of a-D-mannopyranose-1 -phosphate was consumed during the phase of activity measurement.
  • Example 5 Test of various sugar-phosphates as glycosyl donors for reverse phosphorolysis ⁇
  • Reactions were performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HCl 20mM, pH 7.0, with 10 mM of the a-D-fructose-1- and -6-phosphate, D-ribose-1 -phosphate, a-D-galactosamine-1 -phosphate, a-D-glucosamine- 1 -phosphate, D-mannose-6-phosphate, a-D- glucopyranosyl-1 or -6-phosphate as putative glycoside donors.
  • Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and a isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min "1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
  • HPAEC-PAD pulsed amperometric detection
  • sugar-phophates a-D-fructose-1- and -6-phosphate, D-ribose-1 -phosphate, a-D- galactosamine-1 -phosphate, a-D-glucosamine- 1 -phosphate, D-mannose-6-phosphate, a-D- glucopyranosyl-1 or -6-phosphate
  • UhgbMP sugar-phophates
  • Example 6 Protocol to assay mannosylation of GlcNAc-GlcNAc-protein by UhgbMP - catalysed reverse-phosphorolysis
  • Mature human intestinal Muc2 (SEQ ID NO: 4) glycoprotein is purified from mucus, as described by Allen, A. et al. (1998), The International Journal of Biochemistry & Cell Biology 30, 797-801.
  • Muc2 glycoprotein containing GlcNAc-GlcNAc N-glycosylation motifs are obtained by hydrolysis of the mature Muc2 glycoprotein with mannosidases classified in the families GH92 and GH2 of glycoside-hydrolases (Tailford, L.E. et al. (2007), J. Biol. Chem. 282, 11291-11299 ; Cantarel, B.L. et al. (2009), Nucl. Acids Res. 37, D233-D238 ; Zhu, Y. et al. (2010), Nature Chemical Biology 6, 125-132).
  • UhgbMP reverse-phosphorolysis from a-D-mannopyranose-1 -phosphate and the human intestinal Muc2 glycoprotein containing GlcNAc-GlcNAc N-glycosylation motifs is determined after incubation of 0.1 mg/ml purified enzyme during 24h at 37°C in Tris HCl 20mM, pH 7.0 with 10 mM a-D-mannopyranose-1 -phosphate (reference Ml 755, Sigma) and between 1 and 100 ⁇ of the Muc2 protein obtained as described above, by quantifying a-D- mannopyranose-1 -phosphate consumption rate by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD).
  • HPAEC-PAD pulsed amperometric detection
  • Example 7 Protocol to assay phosphorolysis of a Man-GlcNAc-GlcNAc-protein by UhgbMP
  • Mature human intestinal Muc2 glycoprotein is purified from mucus, as described by Allen, A. et al. (1998), The International Journal of Biochemistry & Cell Biology 30, 797-801.
  • Muc2 glycoprotein containing Man-GlcNAc-GlcNAc N-glycosylation motifs are obtained by hydrolysis of the mature Muc2 glycoprotein with mannosidases classified in the families GH92 of glycoside-hydrolases (Cantarel, B.L. et al. (2009), Nucl. Acids Res. 37, D233- D238 ; Zhu, Y. et al. (2010), Nature Chemical Biology 6, 125-132).
  • UhgbMP catalysed phosphorolysis of the human intestinal Muc2 glycoprotein containing Man-GlcNAc-GlcNAc N-glycosylation motifs is determined after incubation of 0.1 mg/ml purified enzyme during 24h at 37 °C in Tris HC1 20mM, pH 7.0 with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and between 1 and 100 ⁇ of the Muc2 protein obtained as described above, by quantifying a-D-mannopyranose-1 -phosphate release rate by using high- performance anion exchange chromatography with pulsed amperometric detection (HPAEC- PAD).
  • Example 8 Protocol for the one-pot synthesis of mannooligosaccharides containing a GlcNAc (or GlcNAC-GlcNAc) at their reducing end, from mannan, inorganic phosphate, and V-acetyl-D-glucosamine (or ⁇ yV'-diacetyl chitobiose) as substrates
  • Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM mannan (Megazyme, Ireland, reference P-MANCB), 10 mM N-acetyl-D-glucosamine (Sigma, reference A8625), or 1 mM N,N"-diacetyl chitobiose (Dextra, reference C8002).
  • 10 mM inorganic phosphate prepared from a stock solution of 100 mM phosphate obtained from
  • Carbohydrate analysis is performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD).
  • HPAEC-PAD pulsed amperometric detection
  • Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column.
  • a gradient of sodium acetate (from 0 to 150 mM in 15 min) and a isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min "1 flow rate.
  • Detection is ⁇ performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
  • Example 9 Protocol for the two-step synthesis of mannooligosaccharides containing a GlcNAc (or GlcNAC-GlcNAc) at their reducing end, from mannan, inorganic phosphate, and V-acetyl-D-glucosamine (or ⁇ yV'-diacetyl chitobiose) as substrates
  • Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM mannan (Megazyme, Ireland, reference P-MANCB).
  • 10 mM inorganic phosphate prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref
  • a-D-mannopyranose-l-phosphate is purified from the reaction medium obtained at step 9b by preparative high-performance liquid chromatography (HPLC) or low-pressure liquid chromatography (LPLC) by using first a C18 column to eliminate oligosaccharides of polymerisation degree > 3, and secondly a H+ or K+ column to separate a-D-mannopyranose- l-phosphate from oligosaccharides of polymerisation degree ⁇ 3.
  • HPLC high-performance liquid chromatography
  • LPLC low-pressure liquid chromatography
  • Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM of the a-D-mannopyranose-l-phosphate obtained in step 9b, and 10 mM N-acetyl-D-glucosamine (Sigma, reference A8625), or 1 mM N,N"-diacetyl chitobiose (Dextra, reference C8002).
  • Carbohydrate analysis is performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-l-phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step ofrac
  • IBD inflammatory bowel disease
  • Uhgb MP inhibitor D-altrose, D-xylose or D-allose
  • the placebo consisted of the beverage Without enzyme inhibitor.
  • the use of this standard beverage facilitates the double-blinded placebo-controlled character of the study. Patients are instructed to drink one bottle with 200 ml of the beverage in the morning at breakfast and a second in the evening at supper. After three weeks of consuming two bottles per day, patients return to the hospital to fill in a questionnaire and to undergo endoscopy. Patients brought fresh stools, produced in the morning immediately before they come to the hospital.
  • washout period Between the inhibitor and the placebo period there is a washout period of four weeks.
  • the purpose of this washout period is to overcome effects of the first study period possibly intervening with effects of the final period. All investigators, including the endoscopist, are blinded to the randomization. The endoscopist and the pathologist do not participate in obtaining clinical data and are blinded to results until data analysis was finished. During endoscopy, findings were scored according to the Crohn's disease endoscopic index of severity (CDEIS) (Mary, J. Y. & Modigliani, R. Development and validation of an endoscopic index of the severity for Crohn's disease: a prospective multicentre study.
  • CDEIS Crohn's disease endoscopic index of severity
  • stools are processed. pH is determined. Bile acids and short chain fatty acids in stools are quantified by gas chromatography(van Faassen A, Hazen MJ, van den Brandt PA, van den Bogaard AE, Hermus RJ, Janknegt RA. Bile acids and pH values in total feces and in fecal water from habitually omnivorous and vegetarian subjects.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Saccharide Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention relates to the use of specific glycoside phosphorylases for the implementation of phosphoro lysis or reverse phosphoro lysis reactions involving a mannosyl donor compound or a mannosyl acceptor compound.

Description

^
USE OF SPECIFIC GLYCOSIDE PHOSPHORYLASES FOR THE IMPLEMENTATION OF PHOSPHOROLYSIS OR REVERSE PHOSPHOROLYSIS REACTIONS The present invention relates to the use of specific glycoside phosphorylases for the implementation of phosphoro lysis or reverse phosphoro lysis reactions involving a mannosyl donor compound or a mannosyl acceptor compound.
The present invention also relates to the use of specific glycoside phosphorylases in a process of degradation, by phosphorolysis, of mannosyl donor compounds that were not known to be degradable by phosphorolysis.
a-D-mannopyranose-1 -phosphate is the donor substrate used in reverse phosphorolysis processes catalysed by mannosyl phosphorylases. However, until now, no glycoside phosphorylase was known to be able to catalyse the preparation of said a-D-mannopyranose- 1 -phosphate from inexpensive mannosyl donor compounds, like mannan.
The present invention also relates to the use of specific glycoside phosphorylases in a process of grafting by reverse phosphorolysis a mannosyl residue on a mannosyl acceptor compound.
Mannosylated compounds present nutritional or medical interest. In particular, beta- linked mannooligosaccharides (MOS) have prebiotic properties that can probably be modulated by varying the mannosyl acceptor molecule to render the oligosaccharide more or less fermentable in the host (human or animal) gut. Moreover, MOS are described as effective in lowering total body fat, because fat excretion has been shown to be increased with MOS consumption by humans or animals (Salinardi, T.C. et al. 2010, J. Nutr. 140, 1943-1948).
In addition, the oligosaccharide Man-GlcNAc is a component of the N-glycans that cover the gastrointestinal tract, to constitute a physical and chemical barrier between the intestinal contents and the underlying epithelia. N-glycans are a source of endogenous substrates for the GI microbial community that uses them as carbon source in addition to plant polysaccharides. Alterations in the structure and/or quantity of N-glycans alter their barrier function and could play roles in initiating and maintaining mucosal inflammation in inflammatory bowel diseases (IBD), and in driving cancer development in the intestine. Restoring the mucosal barrier in chronic inflammation is likely to diminish the risk of cancer development and should be part of the therapeutic goal, particularly in extensive colitis (Sheng, Y.H. et al. 2012, J. Gastroenterol. Hepatol. 27, 28-38). „
2
Glycoside phosphorylases (GPs) are carbohydrate active enzymes which play a crucial role in the metabolism of all living organisms. They catalyse the breakdown of an osidic linkage from oligosaccharides or polysaccharides as donor substrates and the concomitant phosphate glycosylation, to generate a glycosyl phosphate product and a sugar chain of reduced chain length. These enzymes are also able to perform reverse-phosphorolysis, also called synthetic reaction, to form a glycosidic bond between the glycosyl unit coming from the glycosyl-phosphate, which plays the role of sugar donor, and a carbohydrate acceptor.
The GPs ability to form glycosidic linkages in reverse-phosphorolysis is of prime interest for the in vitro synthesis of glycosides, which can be used in medicine, nutrition and cosmetics applications fields.
Other known enzymatic beta-mannoside synthesis processes are based on the use of :
- mannosyl-transferases (glycoside transferases (GT) belonging to GT2, GT4, GT33 families); however, GTs use sugar nucleotides as substrates, which are expensive to produce;
- mannosidases or mannanases (glycoside-hydrolases (GH) belonging to GH2 and GH5 families) that are used for transmannosylation; these enzymes use oligosaccharides or polysaccharides as mannosyl donors, and monosaccharides, oligosaccharides or hydroxylated compounds as acceptors.
In the CAZy database (www.cazy.org), GPs are classified both in glycosyl transferase (GT) and glycoside hydrolase (GH) families, depending on the fold and catalytic mechanism similarities their share with typical GTs and GHs, respectively.
The natural structural and functional diversity of GPs appears to be highly restricted, since (i) they are found in only seven of the 226 GH and GT families listed in the CAZy database (March 2013); (ii) approximately only 15 EC entries are currently assigned to GPs, (iii) their specificity towards glycosyl phosphates is limited to a- and β-D-glucopyranose-l- phosphate which are the most prevalent substrates, a-D-galactopyranose-1 -phosphate, N- acetyl-a-D-glucosamine- 1 -phosphate, and a-D-mannopyranose- 1 -phosphate.
a-D-Mannopyranose-1 -phosphate specificity has been described for just four enzymes in the recently created GH130 family, which comprises a total of 533 entries, from archaea, bacteria, and eukaryotes :
- the B. fragilis NCTC 9343 mannosylglucose phosphorylase (BfMP), which converts
P-D-mannopyranosyl-l,4-D-glucopyranose and phosphate into a-D-mannopyranose- 1- phosphate and D-glucose (Senoura, T. et al. (2011), Biochemical and Biophysical Research Communications 408, 701-706). BfMP exhibits a very narrow specificity towards β-D-Manp- 1,4-D-Glc, meaning that P-D-Man/?-l,4-D-Glc is the only tolerated mannosyl donor during BfMP mediated phosphorolyis and that D-glucose is the only tolerated mannosyl acceptor during BfMP mediated reverse phosphorolyis;
- RaMPl and RaMP2 from the ruminal bacterium Ruminococcus albus NE1. These enzymes have also been proposed to participate in mannan catabolism in the bovine rumen, and are assisted by an endo-mannanase and an epimerase, via RaMP2 and RaMPl -catalysed phosphorolysis of β-1,4 mannooligosaccharides and 4-0-P-D-mannopyranosyl-D- glucopyranose, respectively (Kawahara R. et al. (2012), J Biol Chem 287: 42389-42399. doi: 10.1074/jbc.Ml 12.390336);
- Btl033, a -D-mannosyl-N-acetyl-l,4-D-glucosamine phosphorylase produced by the human gut inhabitant B. thetaiotamicron VPI-5482 (Nihira et al. (2013), J Biol Chem 288:
27366-27374. doi: 10.1074/jbc.Ml 13.469080). This enzyme is not able to phosphorolyse β-D-
Man/?-l,4-D-Glc and β-1,4 mannooligosaccharides (polymerisation degree >2), contrary to
RaMP2 and UhgbMP.
One of the aims of the present invention is to provide specific glycoside phosphorylases able to degrade, by phosphorolysis, mannosyl donor compounds that were not known to be degradable by phosphorolysis, for example mannan.
Another aim of the present invention is to provide enzymatically synthesized a-D- mannopyranose-1 -phosphate from beta- linked mannooligosaccharides and beta- linked mannopolysaccharides, in particular mannan.
Another aim of the present invention is to provide enzymatically synthesized oligosaccharides and glycoconjugates containing beta-linked mannosyl residues from a-D- mannopyranose- 1 -phosphate.
Still another aim of the invention is to provide inflammatory bowel diseases treatment by inhibiting glycoside-phosphorylases.
The present invention relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, for the implementation of a phosphorolysis or reverse phosphorolysis reaction involving a-D-mannopyranose-1- phosphate,
with the proviso that said glycoside-phosphorylase is not RaMP2.
The present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, for the implementation of „
4
a phosphoro lysis or reverse phosphoro lysis reaction involving a-D-mannopyranose-1 - phosphate,
with the proviso that said glycoside-phosphorylase is not RaMP2 or Btl033.
The present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, to degrade by phosphorolysis a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2.
The present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to degrade by phosphorolysis a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, β-l,4-D-mannooligosaccharides, β-D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2 or Bt 1033.
The glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 is refered to UhgbMP (Unknown human gut bacterium Mannoside Phosphorylase, GenBank accession number ADD61463.1), encoded by the gene situated between the nucleotides 2620 and 3603 of the nucleotidic sequence with GenBank accession number GU942931.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 80%, in particular of at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, more particularly of at least 90%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 64%, in particular an identity percentage comprised from 50% to 63%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% or 63%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 80%, in particular an identity percentage comprised from 65% to 79%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 90%, in particular an identity percentage comprised from 65% to 89%, more particularly an identity percentage of 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% or 89%o, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50% and less than 66%, in particular an identity percentage comprised from 50% to 65%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64% or 65%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and less than 80%, in particular an identity percentage comprised from 67% to 79%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and r
6
less than 90%, in particular an identity percentage comprised from 67% to 89%, with the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, said glycoside -phosphorylase is characterized, in relation with phosphoro lysis, generating a-D-mannopyranose-1 -phosphate and a (Man)m_i- donor compound from a mannosyl donor of formula (Man)m-donor and inorganic phosphate, by the quantification of said a-D-mannopyranose-1 -phosphate, said (Man)m_i -donor compound or said inorganic phosphate.
In an advantageous embodiment, said glycoside-phosphorylase is characterized by the quantification, in particular by high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD), of a-D-mannopyranose-1 -phosphate, after having contacted said glycoside-phosphorylase with a mannosyl donor and inorganic phosphate.
The quantification of a-D-mannopyranose-1 -phosphate is for example performed by high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD), according to the procedure described by Orvisky, E. et al. (2003), Analytical Biochemistry 317, 12-18.
In an advantageous embodiment, said glycoside-phosphorylase is characterized by the quantification, in particular by high-performance liquid chromatography (HPLC), of said (Man)m_i -donor compounds, after having contacted said glycoside-phosphorylase with said (Man)m-donor compounds.
The quantification of the (Man)m-l -donor compounds is for example performed by high-performance liquid chromatography (HPLC), according to the procedure described by Kawahara, R. et al. (2012), J. Biol. Chem. 287, 42389-42399.
In an advantageous embodiment, said glycoside-phosphorylase is characterized by the quantification, in particular by a colorimetric method, of inorganic phosphate, after having contacted said glycoside-phosphorylase with a-D-mannopyranose-1 -phosphate and an mannosyl acceptor, in particular D-glucose, D-mannose, D-galactose, D-fructose, (β-D- Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, or (P-D-Manp-l,4)j-P-D-Glc/?NAc-l,4-D- GlcpNAc, j being equal to 0, 1 or 2.
The quantification of inorganic phosphate is for example performed by the colorimetric method described by Gawronski, J.D. et al. (2004), Analytical Biochemistry 327, 114-118, or by Chao, C. et al. (2011), Enzyme and Microbial Technology 49, 59-65.
In an advantageous embodiment, the apparent catalytic efficiency kcatapp/ Krriapp of said glycoside-phosphorylase is above about 0.02 s^mM"1, in particular above about 0.9 s" 'ητΜ"1, for phosphoro lysis in presence of inorganic phosphate and a mannosyl donor selected from the list constituted by P-D-mannopyranosyl-l,4-D-mannose, P-D-mannopyranosyl-l,4- D-glucose, -D-mannopyranosyl-l^-N^-diacetyl chitobiose and -1,4-D-Mannan.
Apparent phosphorolysis catalytic efficiency is for example determined according to a procedure described by Kawahara, R. et al. (2012), J. Biol. Chem. 287, 42389-42399, with 0.01 mg/ml of purified enzyme by quantifying a-D-mannopyranose-1 -phosphate release rate from 5 to 10 mM inorganic phosphate at pH 7.0 and between 1 and 20 mM of β-D- mannopyranosyl-l,4-D-mannose, between 1 and 10 mM of P-D-mannopyranosyl-l,4-D- glucose, between 0.05 and 0.5 mM of -D-mannopyranosyl-l,4-N,N'-diacetyl chitobiose or between 0.4 and 4 mM of -1,4-D-Mannan.
The apparent kinetic parameters, kcatapp and Krriapp, are, regarding phosphorolysis, for example determined by fitting the initial rates of a-D-mannopyranose-1 -phosphate release, to the Michaelis-Menten equation {ibid.). Non-linear regression is for example performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
a-D-Mannopyranose-1 -phosphate concentration is for example quantified by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D-mannopyranose-1 -phosphate are in particular separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min-1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
By "identity percentage" is meant the percentage of identical amino acids between two aligned sequences, one of them being the amino acid sequence SEQ ID NO: 1, the other one being the amino acid sequence of interest.
In particular, the "identity percentage" between two polypeptide sequences is determined by comparing both optimally aligned sequences through a comparison window.
The portion of the amino-acid sequence in the comparison window may thus include additions or deletions (for example "gaps") as compared to the reference sequence (which does not include these additions or these deletions) so as to obtain an optimal alignment between both sequences.
The identity percentage is calculated by determining the number of positions at which an identical amino-acid residue, can be noted for both compared sequences, then by dividing the number of positions at which identity can be observed between both amino-acid residues, by the total number of positions in the comparison window, then by multiplying the result by hundred to obtain the percentage of amino acid identity between the two sequences.
The comparison of the sequence optimal alignment may be effected by a computer using known algorithms.
Most preferably, the sequence identity percentage is determined using the BLASTP software (version 2.2.29), the parameters being set as follows: (1) Max target sequences=500 ; (2) short queries (Automatically adjust parameters for short input sequences)= Λ— yes ; (3) Expect threshold=10; (4) Word size=3; (5) Max matches in a query range=0; (6) Matrix=BLOSUM62 ; (7) Gap Costs= "Existence: 11 Extension: 1; (8) Compositional adjustments— conditional compositional score matrix adjustment"; (9) Filter (Low complexity regions)— no; (10) Mask (Mask for lookup table only)— no ; (11) Mask (Mask lower case letters)— no.
By "RaMP2" is meant the glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 3 (GenBank accession number ADU20661.1 or YP 004103295.1).
By "Btl033" is meant the glycoside-phosphorylase having the amino acid sequence
SEQ ID NO: 7 (GenBank accession number WP 011107586.1).
By "mannosyl donor" is meant a donor of mannosyl, in other words a compound comprising a mannoside residue bonded to the rest of the compound (i.e. the "donor" part of the compound), the mannoside residue of which being able to be transferred to another compound, in particular inorganic phosphate, by phosphorolysis.
By "phosphorolysis" is meant the breakdown of the glycosidic bond joining said mannosyl to the rest of the mannosyl donor, and the concomitant phosphate mannosylation, to generate a-D-mannopyranose-1 -phosphate, said reactions being catalysed by a glycoside- phosphorylase.
Interestingly, the inventors have found that UhgbMP and enzymes having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with UhgbMP are able to phosphorolyse -D-mannopyranosyl-l,4-D-glucopyranose, -l,4-linked D-manno- oligosaccharides and mannan (P-D-Man/?-l,4-(D-Man/?)n, with n = 1 to 15). Regarding mannan, said phosphorolysis is characterized by a notable parallel increase in specific activity with the degree of polymerisation (DP).
By "specific activity" is meant the activity of an enzyme per milligram of total protein (expressed in μmol.min~1.mg~1).
By "enzyme activity" is meant the moles of substrate converted by said enzyme per unit of time. "p" denotes the pyranose form of a monosaccaride. For example, by "Man/?" is meant mannopyranose.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl donor compound is P-1,4-D-Mannan.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, ZP 02422496.1, ZP 02205887.1, ZP 02090881.1, ZP 02071200.1, ZP 02067106.1, ZP 01958898, YP 210978.1 and YP 001297942.1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413. The proteins having the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413 are also identified by the GenBank Accession numbers presented in following table A:
Idendity
Accession Sequence SEQ ID
Protein name to E-value number coverage NO
UhgbMP
Uhgb MP ADD61463.1 100% 100% 0.0 1
MULTISPECIES: glycosidase WP 005657882.1
99% 100% 0.0 46 [Bacteroides] (EDS13361.1)
MULTISPECIES: glycosidase
WP_005776041.1 92% 97% 0.0 49 [Bacteroides]
glycosidase [Bacteroides fragilis] WP_005809670.1 92% 97% 0.0 51
MULTISPECIES: glycosidase WP 005786056.1
91% 97% 0.0 50 [Bacteroides] (YP_210978.1) glycosidase [Bacteroides sp.
WP 009291829.1 91% 97% 0.0 109 2_1_56FAA] hypothetical protein M101 1274
[Bacteroides fragilis str. 1007-1-F EXY14005.1 91% 97% 0.0 307
#8]
hypothetical protein Ml 18 1182
EXY47258.1 91% 97% 0.0 308 [Bacteroides fragilis str. 3783N1-2]
hypothetical protein M072 1228
EXZ06325.1 91% 97% 0.0 309 [Bacteroides fragilis str. DS-208]
hypothetical protein M069 1383
[Bacteroides fragilis str. Bl EXZ84244.1 91% 97% 0.0 310 (UDC16-1)]
hypothetical protein M087 1235
EYAO 1159.1 91% 97% 0.0 311 [Bacteroides fragilis str. S23 R14]
hypothetical protein M132 1192
EYA72129.1 91% 97% 0.0 312 [Bacteroides fragilis str. S24L15]
pF04041 domain protein [Tannerella
WP 021930111.1 88% 97% 0.0 235 sp. CAG:118]
glycosidase [Bacteroides dorei] WP_007841086.1 87% 97% 0.0 81 glycosidase [Porphyromonas sp. oral
WP 009433021.1 87% 97% 0.0 114 taxon 279]
hypothetical protein [Porphyromonas
WP_021666340.1 87% 97% 0.0 227 sp. oral taxon 278]
hypothetical protein [Porphyromonas
WP_005468873.1 86% 97% 0.0 43 catoniae]
MULTISPECIES: glycosidase WP 005840987.1
86% 97% 0.0 53 [Bacteroides] (YP_001297942.1) hypothetical protein [Bacteroides
WP 005941607.1 86% 99% 0.0 58 massiliensis]
MULTISPECIES: glycosidase WP 007832896.1
86% 97% 0.0 79 [Bacteroides] (ZP_03299783.1) glycosidase [Bacteroides sp.
WP_008672798.1 86% 97% 0.0 92 9_1_42FAA]
glycosidase [Bacteroides sp.
WP_022506919.1 86% 99% 0.0 282 CAG:98]
hypothetical protein M097 3456
[Bacteroides vulgatus str. 3775 KDS27775.1 86% 97% 0.0 354 SL(B) 10 (iv)]
glycosidase [Parabacteroides
WP_028728909.1 85% 97% 0.0 401 gordonii]
MULTISPECIES: glycosidase
WP_005857736.1 84% 97% 0.0 55 [Bacteroidales] , , glycosidase [Dysgonomonas gadei] WP 006797616.1 84% 97% 0.0 62 glycosidase [Bacteroides sp.
WP_008772434.1 84% 97% 0.0 95 2_1_33B]
MULTISPECIES: hypothetical
WP_016275348.1 84% 97% 0.0 188 protein [Bacteroidales]
glycosidase [Porphyromonas
WP_025003950.1 84% 97% 0.0 326 macacae]
hypothetical protein M095 3316
[Parabacteroides distasonis str. KDS64210.1 84% 97% 0.0 357 3999B T(B) 4]
5,00E- glycosidase [Prevotella stercorea] WP_007897166.1 83% 79% 82
167 glycosidase [Bacteroides
WP_018108189.1 83% 97% 0.0 198 propionicifaciens]
glycosidase [Porphyromonas
WP_018361032.1 83% 97% 0.0 201 macacae]
putative uncharacterized protein
WP_022192625.1 83% 97% 0.0 255 [Parabacteroides sp. CAG:2]
glycoside hydrolase [Bacteroides
GAE84647.1 83% 97% 0.0 305 reticulotermitis JCM 10512]
hypothetical protein M091 4429
[Parabacteroides distasonis str. 3776 KDS39128.1 83% 97% 0.0 355
D15 i]
hypothetical protein
HMPREF1002_01378 KEJ87210.1 83% 97% 0.0 411 [Porphyromonas sp. 31 2]
glycosidase [Prevotella buccalis] WP_004350808.1 82% 97% 0.0 31 glycosidase [Prevotella oralis] WP_004368520.1 82% 97% 0.0 34
MULTISPECIES: glycosidase
WP_007655989.1 82% 97% 0.0 75 [Parabacteroides]
glycosidase [Prevotella timonensis] WP_008122173.1 82% 97% 0.0 84
PF04041 domain protein [Prevotella
WP_021584220.1 82% 97% 0.0 223 pleuritidis]
PF04041 domain protein [Prevotella
WP_021590755.1 82% 97% 0.0 224 baroniae]
putative uncharacterized protein
WP_022158713.1 82% 97% 0.0 252 [Prevotella sp. CAG:520]
putative uncharacterized protein
WP_022429863.1 82% 97% 0.0 273 [Prevotella stercorea CAG:629]
PF04041 domain protein [Prevotella
WP_023057032.1 82% 97% 0.0 290 sp. BV3P1] „
12 hypothetical protein [Prevotella
WP_023984840.1 82% 97% 0.0 292 oralis]
glycosidase [Prevotella enoeca] WP_025065587.1 82% 97% 0.0 327 glycosidase [Prevotella timonensis] WP_025072541.1 82% 97% 0.0 329 glycosidase [Prevotella baroniae] WP_027444955.1 82% 97% 0.0 383 glycosidase [Bacteroidales bacterium
WP 019129862.1 81% 97% 0.0 210 ph8]
putative uncharacterized protein
WP 022311711.1 81% 97% 0.0 265 [Prevotella sp. CAG:474]
putative uncharacterized protein
WP_022284896.1 80% 97% 0.0 262 [Bacteroides sp. CAG:770]
predicted glycosylase [Alistipes sp.
WP_022332491.1 80% 93% 0.0 267 CAG:29]
glycosidase [Alistipes onderdonkii] WP_026318229.1 80% 97% 0.0 351
WP 005844805.1
glycosidase [Prevotella dentalis] 79% 97% 0.0 54
(AGB28392.1) glycosidase [Alistipes sp. HGB5] WP_009597303.1 79% 97% 0.0 117
MULTISPECIES: glycosidase WP 009597427.1
79% 97% 0.0 118 [Alistipes] (AFL78596.1)
Predicted glycosylase [Alistipes
WP_015547179.1 79% 97% 0.0 179 shahii]
predicted glycosylase [Alistipes sp.
WP_022061059.1 79% 97% 0.0 243 CAG:53]
glycosidase [Hallella seregens] WP_027952368.1 79% 97% 0.0 387 putative uncharacterized protein
WP 016564452.1 78% 97% 0.0 193 [Bacteroides sp. CAG:927]
putative uncharacterized protein
WP_022015682.1 78% 97% 0.0 239 [Bacteroides sp. CAG:545]
putative uncharacterized protein
WP_022147864.1 78% 97% 0.0 250 [Bacteroides sp. CAG:709]
glycosidase [Alistipes onderdonkii] WP_026318218.1 78% 100% 0.0 350 glycosidase [Porphyromonas levii] WP_018358458.1 77% 97% 0.0 200 putative uncharacterized protein
WP_021903730.1 77% 97% 0.0 233 [Porphyromonas sp. CAG: 1061]
putative uncharacterized protein
WP_022307455.1 77% 97% 0.0 264 [Alistipes sp. CAG:268]
hypothetical protein [Prevotella sp.
WP_009437337.1 76% 97% 0.0 116 oral taxon 473]
glycosidase [Porphyromonas
WP_018028730.1 76% 97% 0.0 197 somerae]
MULTISPECIES: hypothetical
WP 021256311.1 76% 97% 0.0 222 protein [Paenibacillus]
glycosidase [Porphyromonas
WP_025081440.1 76% 97% 0.0 331 bennonis]
hypothetical protein [uncultured
AIA99576.1 76% 97% 0.0 332 bacterium contigOOO 10(2014)]
glycosidase [Paenibacillus
WP_028547193.1 76% 97% 0.0 398 taiwanensis]
glycosidase [Paenibacillus alvei] WP_005543591.1 75% 97% 0.0 44 glycosidase [Paenibacillus 5,00E-
WP_006678432.1 74% 97% 60 dendritiformis] 178 glycosidase [Paenibacillus sp. OSY- 6,00E-
WP_019420855.1 74% 97% 211 SE] 178 glycosidase [Paenibacillus 7,00E-
WP_028594496.1 74% 97% 400 assamensis] 179 glycosidase [Herpetosiphon 2,00E-
WP_012188447.1 73% 97% 135 aurantiacus] 172 glycosidase [Caldanaerobius 1,00E-
WP_026486530.1 72% 96% 360 polysaccharolyticus] 169 glycosidase [Clostridium WP 012199744.1 9,00E-
71% 97% 136 phytofermentans] (ABX42090.1) 170
7,00E- glycosidase [Mahella australiensis] WP_013781285.1 71% 96% 160
165 glycosidase [Caldanaerobius 3,00E-
WP_026485574.1 71% 96% 359 polysaccharolyticus] 169
MULTISPECIES: glycosidase 9,00E-
WP_006856800.1 70% 95% 64 [Roseburia] 157 glycosidase [Caldicellulosiruptor 2,00E-
WP 011915905.1 70% 95% 130 saccharolyticus] 158 glycosidase [Caldicellulosiruptor WP 015908872.1 2,00E-
70% 96% 183 bescii] (ACM61623.1) 160 hypothetical protein [Treponema 2,00E-
WP_021686473.1 70% 97% 230 lecithinolyticum] 165
3,00E- glycosidase [Treponema phagedenis] WP_002698257.1 69% 97% 17
160 glycosidase [Caldicellulosiruptor WP 013291420.1 2,00E-
69% 96% 144 obsidiansis] (ADL43426.1) 159 glycosidase [Caldicellulosiruptor 6,00E-
WP_013402243.1 69% 96% 150 hydrothermalis] 159 glycosidase [Caldicellulosiruptor 8,00E-
WP 013429364.1 69% 96% 151 kronotskyensis] 159 glycosidase [Caldicellulosiruptor 8,00E-
WP_013433376.1 69% 96% 152 kristjanssonii] 160
MULTISPECIES: glycosidase WP 014041916.1 2,00E-
69% 96% 162 [Caldicellulosiruptor] (AEM72946.1) 159
glycosidase [Fervidobacterium WP 014452319.1 3,00E-
69% 96% 166 pennivorans] (AFG35891.1) 157 putative uncharacterized protein 1.00E-
WP_022518503.1 69% 96% 285 [Roseburia sp. CAG: 100] 158 hypothetical protein [Catonella 8,00E-
WP_023355711.1 69% 97% 291 morbi] 164 glycosidase-like protein 1.00E-
ETT59152.1 69% 95% 302 [Paenibacillus sp. FSL R7-277] 158
4,00E- glycosidase [Treponema phagedenis] WP_024751802.1 69% 97% 319
160 glycosidase [Thermotogae bacterium 1.00E-
WP_029684040.1 69% 96% 410 JGI 0000106-011] 157
MULTISPECIES: glycosidase 3,00E-
WP_003021946.1 68% 96% 21 [Lachnospiraceae] 159 putative glycosylase [ [Clostridium 2,00E-
WP_004630151.1 68% 96% 40 termitidis] 158 glycosidase [Prevotella sp. oral 4,00E-
WP 009434539.1 68% 99% 115 taxon 306] 160 glycosidase [Mariprofundus 2,00E-
WP 009851056.1 68% 96% 122 ferrooxydans] 155 glycosidase [Dictyoglomus 1,00E-
WP_012547681.1 68% 97% 140 thermophilum] 157 glycosidase [Dictyoglomus 2,00E-
WP_012584146.1 68% 97% 142 turgidum] 157 WP 014731198.1
4,00E- glycosidase [Mesotoga prima] (AFK07300.1 ; 68% 96% 169
153
AFK07371.1) glycosidase [Paenibacillus sp. 8,00E-
WP_019913476.1 68% 96% 216 HW567] 161 hypothetical protein [Prevotella sp. 2,00E-
WP 021671911.1 68% 99% 228 F0091] 160 putative uncharacterized protein 9,00E-
WP_022463168.1 68% 97% 278 [Blautia sp. CAG:37] 161 glycosidase-like protein 5,00E-
ETT40362.1 68% 95% 300 [Paenibacillus sp. FSL R7-269] 158 glycosidase [Mariprofundus 3,00E-
WP_026195333.1 68% 96% 349 ferrooxydans] 156 glycosidase [Butyrivibrio sp. 2,00E-
WP_026511627.1 68% 97% 363 LC3010] 160
WP 004100329.1 6,00E- glycosidase [Thermosipho africanus] 67% 96% 26
(ACJ75237.1) 153 glycosidase [Prevotella 1,00E-
WP_004359255.1 67% 99% 33 melaninogenica] 159
2,00E- glycosidase [Prevotella veroralis] WP_004384352.1 67% 99% 38
158
Glycosidase related protein 9,00E-
WP_006489307.1 67% 96% 59 [Mesotoga sp. VNslOO] 153
1,00E- glycosidase [Bacteroides finegoldii] WP_007760098.1 67% 98% 77
159
3,00E- glycosidase [Imtechella halotolerans] WP_008237718.1 67% 93% 87
148
2,00E- glycosidase [Prevotella histicola] WP_008822147.1 67% 99% 96
160
1,00E- glycosidase [Prevotella sp. C561] WP_009012765.1 67% 99% 98
159 glycosidase [Paenibacillus sp. oral 2,00E-
WP_009223904.1 67% 96% 104 taxon 786] 155
MULTISPECIES: glycosidase 3,00E-
WP_010537903.1 67% 98% 128 [Bacteroides] 157 glycosidase [Zunongwangia 8,00E-
WP_013073563.1 67% 97% 143 profunda] 161
8,00E- glycosidase [Prevotella veroralis] WP 018910261.1 67% 99% 208
159 hypothetical protein [Bacteroides 5,00E-
WP 021646149.1 67% 97% 225 pyogenes] 156 exporter of the RND superfamily 1.00E-
GAE22054.1 67% 97% 295 [Bacteroides pyogenes JCM 10003] 156
predicted glycoside hydrolase 3,00E-
GAE14030.1 67% 97% 296 [Bacteroides pyogenes JCM 6292] 156
PF04041 domain protein [Prevotella 1.00E-
ETT01200.1 67% 99% 298 sp. ICM33] 159 glycosidase [Bacteroides 3,00E-
WP_025074213.1 67% 98% 330 faecichinchillae] 157
4,00E- glycosidase [Bamesiella viscericola] WP_025278016.1 67% 99% 333
162
3,00E- glycosidase [Prevotella scopos] WP_025839877.1 67% 99% 345
160 glycosidase [Butyrivibrio sp. 1.00E-
WP_026525522.1 67% 98% 367 MB2005] 157 glycosidase [Butyrivibrio sp. 3,00E-
WP_026669023.1 67% 97% 369 AE3006] 157 glycosidase [ [Clostridium 2,00E-
WP_027628420.1 67% 96% 385 cellobioparum] 158
1.00E- glycosidase [Paenibacillus sp. J14] WP_028537518.1 67% 96% 395
155 glycosidase [Epulopiscium sp. TST.t. 1.00E-
WP_029487932.1 67% 98% 405 morphotype B'] 166 hypothetical protein [Bacteroides sp. 7,00E-
WP_002561891.1 66% 99% 13 HPS0048] 159 glycosidase [Capnocytophaga 1.00E-
WP_002674213.1 66% 99% 15 ochracea] 155 glycosidase [Capnocytophaga 1.00E-
WP_002679718.1 66% 99% 16 sputigena] 153
MULTISPECIES: glycosidase 1.00E-
WP_004306232.1 66% 98% 28 [Bacteroides] 156
MULTISPECIES: glycosidase 3,00Ε-
WP_004318517.1 66% 98% 29 [Bacteroides] 156
2,00Ε- glycosidase [Prevotella bivia] WP_004336686.1 66% 98% 30
157
8,00Ε- glycosidase [Prevotella denticola] WP_004353840.1 66% 99% 32
157
2,00Ε- glycosidase [Prevotella oris] WP_004371886.1 66% 98% 35
158
6,00Ε- glycosidase [Prevotella oris] WP_004377652.1 66% 98% 36
159
MULTISPECIES: glycosidase 3,00Ε-
WP_005681191.1 66% 98% 48 [Bacteroides] 156
3,00Ε- glycosidase [Bacteroides coprosuis] WP_006743673.1 66% 97% 61
156 glycosidase [Bacteroides 4,00E-
WP_007212742.1 66% 99% 68 cellulosilyticus] 159
1.00E- glycosidase [Prevotella multiformis] WP_007367403.1 66% 99% 70
156
Ι,ΟΟΕ- glycosidase [Bacteroides nordii] WP_007484755.1 66% 99% 72
158
MULTISPECIES: glycosidase 3,00E-
WP_007559989.1 66% 99% 73 [Bacteroides] 157
5,00E- glycosidase [Prevotella amnii] WP_008448842.1 66% 98% 89
159
1.00E- glycosidase [Bacteroides sp. 1 1 14] WP_008761672.1 66% 98% 93
155
MULTISPECIES: glycosidase 2,00E-
WP_008765821.1 66% 98% 94 [Bacteroides] 156 glycosidase [Barnesiella 2,00E-
WP_008860872.1 66% 99% 97 intestinihominis] 162
9,00E- glycosidase [Bacteroides sp. D22] WP_009039638.1 66% 98% 100
157 glycosidase [Prevotella sp. oral 4,00E-
WP_009227855.1 66% 98% 106 taxon 299] 159 glycosidase [Prevotella sp. oral 5,00E-
WP_009230884.1 66% 98% 107 taxon 317] 158 hypothetical protein 7,00E-
WP 009409904.1 66% 99% 111 [Capnocytophaga sp. oral taxon 324] 154
MULTISPECIES: glycosidase 1.00E-
WP_009417204.1 66% 99% 113 [Capnocytophaga] 154 hypothetical protein 7,00E-
WP_009750727.1 66% 99% 119 [Capnocytophaga sp. oral taxon 326] 155
2,00E- glycosidase [Thermosipho africanus] WP_012580125.1 66% 96% 141
147 glycosidase [Bacteroides 9,00E-
WP_013547083.1 66% 99% 155 helcogenes] 158 glycosidase [Capnocytophaga 1.00E-
WP 013998379.1 66% 93% 161 canimorsus] 146 glycosidase [Ornithobacterium WP 014791648.1 3,00E-
66% 99% 171 rhinotracheale] (AFL98126.1) 156 glycosidase [Capnocytophaga 3,00E-
WP_015781954.1 66% 99% 182 ochracea] 155 hypothetical protein [Paenibacillus 2,00E-
WP .016313761.1 66% 96% 192 barengoltzii] 153 hypothetical protein [candidate
1.00E- division EM 19 bacterium SCGC WP_018195826.1 66% 98% 199
156
AAA471-D06] ,„
4,00E- glycosidase [Prevotella nanceiensis] WP_018362024.1 66% 98% 202
159
1,00E- glycosidase [Prevotella loescheii] WP_018966875.1 66% 98% 209
155
MULTISPECIES: hypothetical 1.00E-
WP 020250119.1 66% 98% 219 protein [Fervidibacteria] 157 uncharacterized protein
8,00E- BN772 03615 [Bacteroides sp. CDA85485.1 66% 98% 221
157
CAG:754]
glycosidase related protein 8,00E-
WP_022039580.1 66% 99% 240 [Bacteroides sp. CAG:702] 157 putative uncharacterized protein 2,00E-
WP_022181905.1 66% 97% 253 [Firmicutes bacterium CAG:137] 154 uncharacterized protein [Bacteroides 9,00E-
WP_022210298.1 66% 99% 256 cellulosilyticus CAG:158] 159 putative uncharacterized protein 3,00E-
WP_022354087.1 66% 99% 270 [Bacteroides sp. CAG:875] 157 glycosidase [Draconibacterium 4,00E-
AHW59446.1 66% 99% 314 orientale] 158
9,00E- glycosidase [Prevotella shahii] WP_025815819.1 66% 98% 342
157
6,00E- glycosidase [Bacteroides nordii] WP_025866909.1 66% 99% 346
159 glycosidase [Capnocytophaga 6,00E-
WP_026193925.1 66% 98% 348 cynodegmi] 157 hypothetical protein M082 5855 5,00E-
KDS13138.1 66% 98% 353 [Bacteroides fragilis str. 3725 D9 ii] 157 hypothetical protein M094 0359
8,00E- [Bacteroides uniformis str. 3978 T3 KDS51703.1 66% 97% 356
156 ϋ]
6,00E- glycosidase [Bacteroides sp. 14(A)] WP_026367858.1 66% 99% 358
159 glycosidase [Butyrivibrio sp. 9,00E-
WP 026494966.1 66% 98% 361 WCD3002] 158 glycosidase [Bacteroides 8,00E-
WP_011107586.1 66% 98% 7 thetaiotaomicron] - BT1033 157
WP 004300473.1 9,00E- glycosidase [Bacteroides ovatus] 65% 99% 27
(ZP 02067106.1) 157
4,00E- glycosidase [Prevotella oulorum] WP_004381049.1 65% 96% 37
153
WP 005675734.1 3,00E- glycosidase [Bacteroides caccae] 65% 99% 47
(ZP_01958898.1) 156 MULTISPECIES: glycosidase WP 005828866.1 1.00E-
65% 99% 52 [Bacteroides] (ZP_02071200.1) 158
MULTISPECIES: glycosidase 6,00E-
WP_005924061.1 65% 99% 57 [Bacteroides] 158
1.00E- glycosidase [Prevotella salivae] WP_007135680.1 65% 97% 67
153
MULTISPECIES: glycosidase 2,00E-
WP_007666450.1 65% 99% 76 [Bacteroides] 156 glycosidase [Chryseobacterium sp. 2,00E-
WP_007840056.1 65% 98% 80 CF314] 157 glycosidase [Flavobacterium sp. 5,00E-
WP_008467432.1 65% 97% 90 F52] 158
3,00E- glycosidase [Prevotella maculosa] WP_008565315.1 65% 98% 91
155
1.00E- glycosidase [Bacteroides sp. D20] WP_009037046.1 65% 99% 99
158 glycosidase [Prevotella sp. oral 9,00E-
WP_009236589.1 65% 98% 108 taxon 472] 155 hypothetical protein 2,00E-
WP_009416958.1 65% 99% 112 [Capnocytophaga sp. oral taxon 332] 154
glycosidase [Marinilabilia 1.00E-
WP_010665304.1 65% 99% 129 salmonicolor] 151 glycosidase [Flavobacterium 7,00E-
WP_012024105.1 65% 97% 133 johnsoniae] 159 glycosidase [Maribacter sp. 1.00E-
WP_013304978.1 65% 97% 146 HTCC2170] 150 glycosidase [Spirochaeta 2,00E-
WP 013312904.1 65% 97% 148 thermophila] 151 glycosidase [Bacteroides 2,00E-
WP_013616878.1 65% 99% 156 salanitronis] 154 glycosidase [Spirochaeta 5,00E-
WP_014623767.1 65% 97% 168 thermophila] 152
MULTISPECIES: Predicted 4,00E-
WP 015559136.1 65% 97% 180 glycosylase [Ruminococcus] 155
hypothetical protein 3,00E-
WP_016281590.1 65% 96% 189 [Lachnospiraceae bacterium A4] 150
8,00E- glycosidase [Paenibacillus sanguinis] WP_018751671.1 65% 96% 204
151
1.00E- glycosidase [Prevotella maculosa] WP_019966835.1 65% 98% 217
154
PF04041 domain protein [Prevotella 9,00E-
WP_021824962.1 65% 97% 231 salivae] 155 uncharacterized protein [Bacteroides 3,00E-
WP_021892132.1 65% 99% 232 sp. CAG:20] 161 uncharacterized protein [Bacteroides 2,00E-
WP_022130312.1 65% 99% 248 sp. CAG:530] 156 uncharacterized protein [Bacteroides 1.00E-
WP_022394484.1 65% 99% 272 intestinalis CAG:315] 156 glycosidase [Zhouia amylolytica 7,00E-
ETN94324.1 65% 96% 297 AD3] 157
5,00E- glycosidase [Prevotella oulorum] WP 025069999.1 65% 96% 328
152
5,00E- glycosidase [Bacteroides rodentium] WP_025833278.1 65% 99% 343
158 glycosidase [Gelidibacter 2,00E-
WP_027125932.1 65% 96% 376 mesophilus] 155 glycosidase [Leeuwenhoekiella sp. 1.00E-
WP_028376565.1 65% 98% 389 Hel_I_48] 156
1.00E- glycosidase [Prevotella sp. HJM029] WP_028900669.1 65% 96% 402
152
WP 002847919.1 2,00E- glycosidase [Ruminococcus albus] 64% 97% 19
(ZP_08158270.1) 152 glycosidase [Chryseobacterium 9,00E-
WP_002982641.1 64% 98% 20 gleum] 156
MULTISPECIES: glycosidase 4,00E-
WP_007566231.1 64% 99% 74 [Bacteroides] 155 glycosidase [Flavobacterium sp. 9,00E-
WP_007810298.1 64% 97% 78 CF136] 155 glycosidase [Bacteroides 1.00E-
WP_008144770.1 64% 99% 85 coprophilus] 154
MULTISPECIES: glycosidase 2,00E-
WP_009088587.1 64% 99% 101 [Elizabethkingia] 153 hypothetical protein [Bacteroides 1.00E-
WP_009129096.1 64% 99% 102 oleiciplenus] 153
MULTISPECIES: glycosidase 2,00E-
WP_009319210.1 64% 97% 110 [Porphyromonadaceae] 151 glycosidase [Leeuwenhoekiella 1.00E-
WP_009778951.1 64% 98% 120 blandensis] 154 glycosidase [Mesoflavibacter 2,00E-
WP_010518669.1 64% 98% 126 zeaxanthinifaciens] 156 glycosidase [Thermosipho WP 012057234.1 9,00E-
64% 96% 134 melanesiensis] (ABR30874.1) 148 hypothetical protein [Elizabethkingia 4,00E-
WP_016198959.1 64% 99% 186 meningoseptica] 152
2,00E- glycosidase [Paenibacillus terrigena] WP_018756021.1 64% 96% 206
152
1,00E- glycosidase [Paenibacillus fonticola] WP_019637318.1 64% 96% 212
147 glycosidase [Flavobacterium sp. 1,00E-
WP 020079936.1 64% 97% 218 SCGC AAA160-P02] 153 putative uncharacterized protein 4,00E-
WP_022128289.1 64% 97% 247 [Ruminococcus sp. CAG:579] 152 uncharacterized protein [Bacteroides 4,00E-
WP_022232854.1 64% 99% 258 sp. CAG:443] 156 uncharacterized protein [Bacteroides 3,00E-
WP_022277494.1 64% 99% 261 coprophilus CAG:333] 155 uncharacterized protein 3,00E-
WP_022455924.1 64% 97% 276 [Parabacteroides sp. CAG:409] 152
Glycosidase related protein 4,00E-
CDN80270.1 64% 99% 313 [Elizabethkingia anophelis] 153 glycosidase [Aquimarina sp. 22II- 3,00E-
EZH73463.1 64% 98% 315 Sl l-z7] 154 glycosidase [Elizabethkingia 3,00E-
WP_024568043.1 64% 99% 317 anophelis] 152
2,00E- glycosidase [Ruminococcus albus] WP_024858077.1 64% 97% 322
152 glycosidase [Flavobacterium sp. JGI 1,00E-
WP_025571695.1 64% 97% 335 0001001-DOl] 155 glycosidase [Aquimarina 4,00E-
WP_025663106.1 64% 98% 336 megaterium] 154 glycosidase [Bacteroides 2,00E-
WP_025834961.1 64% 99% 344 stercorirosoris] 154 glycosidase [Flavobacterium 9,00E-
WP_026714400.1 64% 97% 370 daejeonense] 155 glycosidase [Flavobacterium 4,00E-
WP_026727657.1 64% 97% 371 denitrificans] 156 glycosidase [Gaetbulibacter 6,00E-
WP 027136596.1 64% 97% 377 saemankumensis] 154
5,00E- glycosidase [Cytophaga fermentans] WP_027473751.1 64% 99% 384
151 glycosidase [Flavobacterium sp. 4,00E-
WP_029273078.1 64% 97% 404 KJJ] 157
WP 005356317.1 2,00E- glycosidase [ [Eubacterium siraeum] 63% 99% 42
(ZP_02422496.1) 153 glycosidase [Halanaerobium 2,00E-
WP_014554200.1 63% 99% 167 praevalens] 153
Predicted glycosylase [ 8,00E-
WP_015517885.1 63% 99% 176 [Eubacterium siraeum] 153
2,00E- glycosidase [Bacteroides barnesiae] WP 018711719.1 63% 99% 203
151 uncharacterized protein 2,00E-
WP_021910734.1 63% 96% 234 [Eubacterium sp. CAG:786] 146
uncharacterized protein 2,00E-
WP_021955434.1 63% 96% 237 [Eubacterium sp. CAG:115] 146 glycosidase related protein 8,00E-
WP_022288676.1 63% 99% 263 [Ruminococcus sp. CAG:57] 152 uncharacterized protein [Bacteroides 1,00E-
WP_022338980.1 63% 99% 268 sp. CAG:714] 151 glycosidase [Aquimarina 1,00E-
WP_024771505.1 63% 98% 320 macrocephali] 152 glycosidase [Bacteroides Ι,ΟΟΕ-
WP 024993894.1 63% 98% 325 paurosaccharolyticus] 147 glycosidase [Anaerophaga Ι,ΟΟΕ-
WP_026055203.1 63% 97% 347 thermohalophila] 147 glycosidase [Chryseobacterium sp. Ι,ΟΟΕ-
WP_027371934.1 63% 98% 382 UNC8MFC0I] 151 glycosidase [Ruminococcus sp. 3,00Ε-
WP_028506306.1 63% 99% 390 FC2018] 152 glycosidase [Ruminococcus sp. 3,00Ε-
WP_028510924.1 63% 99% 391 NK3A76] 152 glycosidase [Spirochaeta 3,00Ε-
WP_028974065.1 63% 97% 403 cellobiosiphila] 144 glycosidase [Thermophagus Ι,ΟΟΕ-
WP 010528491.1 62% 99% 127 xiamenensis] 148 uncharacterized protein 3,00Ε-
WP_022271458.1 62% 99% 260 [Eubacterium siraeum CAG:80] 152
predicted glycosylase 4,00Ε-
WP_022473971.1 62% 97% 279 [Ruminococcus sp. CAG:353] 148
Chain A - cristal structure of
7,00Ε- TM1225 [Thermotoga maritima AAD36300.1 61% 96% 8
128
MSB8]
MULTISPECIES: glycosylase WP 004080062.1 2,00Ε-
61% 97% 25 [Thermotoga] (ADA67643.1) 130
WP 012311206.1 5,00Ε- glycosylase [Thermotoga sp. RQ2] 61% 97% 138
(ACB09929.1) 130 glycosylase [Thermotoga WP 015919816.1 2,00E-
61% 97% 184 neapolitana] (ACM23522.1) 130
1,00E- glycosylase [Thermotoga sp. EMP] WP_008195435.1 60% 97% 86
129
WP 011943967.1 6,00E- glycosylase [Thermotoga petrophila] 60% 97% 131
(ABQ47551.1) 127
2,00E- glycosylase [Thermotoga sp. A7A] WP_029683035.1 60% 97% 409
129 glycosylase [Opitutaceae bacterium 2,00E-
WP_007359676.1 59% 96% 69 TAV1] 125 glycosidase [Clostridium 1.00E-
WP_029502036.1 59% 96% 406 phytofermentans] 138 hypothetical protein [Vibrio 4,00E-
WP_002028992.1 58% 93% 12 cholerae] 124
WP 012375132.1 1.00E- glycosylase [Opitutus terrae] 58% 96% 139
(ACB75595.1) 124 putative uncharacterized protein 6,00E-
WP_022188802.1 58% 97% 254 [Ruminococcus sp. CAG: 177] 127 putative uncharacterized protein 2,00E-
WP_022240579.1 58% 97% 259 [Clostridium sp. CAG:413] 127
MULTISPECIES: glycosylase 2,00E-
WP 000111640.1 57% 99% 10 [Vibrio] 130
1.00E- glycosylase [Vibrio cholerae] WP_001908866.1 57% 99% 11
130 glycosylase [Marinomonas sp. 7,00E-
WP_009836219.1 57% 97% 121 MED121] 132
MULTISPECIES: glycosylase WP 012003469.1 2,00E-
57% 96% 132 [Thermotoga] (ABV33993.1) 121 glycosidase [ [[Clostridium] 3,00E-
WP_015358820.1 57% 96% 174 stercorarium] 121 glycosidase related protein 5,00E-
WP_022517033.1 57% 96% 284 [Roseburia sp. CAG: 100] 124 glycosylase [Ruminococcus 5,00E-
WP_009984354.1 56% 95% 123 flavefaciens] 120
WP 014856762.1 1.00E- glycosylase [Melioribacter roseus] 56% 96% 172
(AFN75330.1) 121 „ .
6,00E- glycosylase [Amphibacillus xylanus] WP O 15010952.1 56% 96% 173
125 glycosylase [Ruminococcus 7,00E-
WP_019680777.1 56% 96% 213 flavefaciens] 120 putative uncharacterized protein 8,00E-
WP_022143092.1 56% 96% 249 [Ruminococcus sp. CAG:563] 121 glycosylase [Ruminococcus 9,00E-
EWM52544.1 56% 96% 306 flavefaciens 007c] 120
8,00E- glycosylase [Paembacillus fonticola] WP_026342093.1 56% 96% 352
123 glycosylase [Aliagarivorans 7,00E-
WP_026958751.1 56% 99% 375 taiwanensis] 133 glycosylase [ [Clostridium 4,00E-
WP_027631321.1 56% 96% 386 cellobioparum] 124 glycosylase [Ruminococcus 2,00E-
WP_028520880.1 56% 95% 394 flavefaciens] 118 hypothetical protein [Eubacterium 3,00E-
WP 004053156.1 55% 97% 24 plexicaudatum] 119 putative glycosylase [ [Clostridium 3,00E-
WP_004628984.1 55% 96% 39 termitidis] 123 glycosylase [Faecalibacterium WP 005922713.1 2,00E-
55% 96% 56 prausnitzii] (ZP_02090881.1) 118 glycosylase [Verrucomicrobiae 3,00E-
WP_008099469.1 55% 97% 83 bacterium DG1235] 124 putative glycosylase [Clostridium sp. 6,00E-
WP_008421760.1 55% 96% 88 Maddingley MBC34-26] 118
Predicted glycosylase 5,00E-
WP_015537563.1 55% 96% 178 [Faecalibacterium prausnitzii] 118 putative uncharacterized protein 9,00E-
WP_022080138.1 55% 96% 244 [Ruminococcus sp. CAG:488] 119 putative uncharacterized protein 3,00E-
WP_022461809.1 55% 97% 277 [Blautia sp. CAG:37] 117 glycosidase related protein 4,00E-
WP_022516286.1 55% 97% 283 [Roseburia sp. CAG: 182] 120 glycosylase [Ruminococcus 7,00E-
WP_024861808.1 55% 95% 323 flavefaciens] 118
2,00E- glycosylase [Paembacillus graminis] WP_025708303.1 55% 96% 340
119
MULTISPECIES: glycosylase 2,00E-
WP_026512558.1 55% 96% 364 [Butyrivibrio] 118 glycosylase [Ruminococcus 1,00E-
WP_028516981.1 55% 96% 393 flavefaciens] 119 MULTISPECIES: glycosylase WP 004851781.1 5,00E-
54% 97% 41 [Coprococcus] (ZP_02205887.1) 118
MULTISPECIES: conserved 4,00E-
WP_005586402.1 54% 96% 45 hypothetical protein [Firmicutes] 116 glycosylase [Oribacterium sp. oral 1,00E-
WP 009215050.1 54% 99% 103 taxon 078] 119 glycosylase [Clostridium 1,00E-
WP_012200281.1 54% 95% 137 phytofermentans] 117
4,00E- glycosylase [Roseburia hominis] WP_014080407.1 54% 97% 163
119 putative glycosylase [Clostridium 2,00E-
WP_015395330.1 54% 96% 175 saccharoperbutylacetonicum] 115 glycosylase [ [Clostridium 2,00E-
WP 015926354.1 54% 99% 185 cellulolyticum] 125 glycosidase [Clostridium 3,00E-
WP_016208716.1 54% 96% 187 sartagoforme] 117 glycosylase [Paenibacillus sp. 7,00E-
WP 017691679.1 54% 96% 195 PAMC 26794] 120 glycosidase related protein 2,00E-
WP_020435906.1 54% 97% 220 [Ruminococcus sp. CAG:55] 119 putative uncharacterized protein 8,00E-
WP_022046103.1 54% 97% 241 [Roseburia sp. CAG: 18] 120 predicted glycosylase [Coprococcus 3,00E-
WP 022216164.1 54% 97% 257 sp. CAG:131] 118 uncharacterized protein 3,00E-
WP_022445741.1 54% 97% 274 [Faecalibacterium sp. CAG:74] 118 putative uncharacterized protein 1,00E-
WP_022495503.1 54% 95% 280 [Ruminococcus sp. CAG:624] 116 glycosidase related protein 4,00E-
WP_022500747.1 54% 96% 281 [Firmicutes bacterium CAG:95] 117
glycosylase [Butyrivibrio 2,00E-
WP_022755522.1 54% 97% 286 fibrisolvens] 116 glycosylase [Butyrivibrio 3,00E-
WP_022758436.1 54% 97% 287 fibrisolvens] 116 glycosylase [Butyrivibrio sp. 2,00E-
WP_022764543.1 54% 96% 288 XPD2006] 118 glycosidase like protein 6,00E-
ETT35389.1 54% 96% 299 [Paenibacillus sp. FSL R5-192] 119 glycosylase [Cellulomonas sp. 1,00E-
WP_024285163.1 54% 96% 316 KRMCY2] 111
MULTISPECIES: glycosylase 9,00E-
WP_024629800.1 54% 96% 318 [Paenibacillus] 121 glycosylase [Butyrivibrio sp. 3,00E-
WP_024867154.1 54% 96% 324 FCS014] 116 glycosylase [Butyrivibrio sp. 4,00E-
WP 026521011.1 54% 97% 365 VCB2001] 117 glycosylase [Butyrivibrio sp. 8,00E-
WP_026521090.1 54% 96% 366 VCB2001] 117 glycosylase [Butyrivibrio sp. 1.00E-
WP_026529031.1 54% 96% 368 VCD2006] 118 glycosylase [Clostridium 3,00E-
WP_026885845.1 54% 96% 373 beijerinckii] 117 glycosylase [Butyrivibrio 2,00E-
WP_027205091.1 54% 97% 378 fibrisolvens] 116 glycosylase [Pseudobutyrivibrio sp. 1.00E-
WP_028235021.1 54% 97% 388 MD2005] 117 glycosylase [Ruminococcus 2,00E-
WP_028516231.1 54% 95% 392 flavefaciens] 116
2,00E- glycosylase [Roseburia intestinalis] WP_006855602.1 53% 97% 63
117 glycosylase [Marvinbryantia 4,00E-
WP_006861995.1 53% 97% 66 formatexigens] 113 glycosylase [Paenibacillus sp. oral 2,00E-
WP 009224131.1 53% 96% 105 taxon 786] 116 glycosylase [Clostridium 3,00E-
WP_010073266.1 53% 96% 124 cellulovorans] 116
WP 013373633.1
glycosylase [Paenibacillus 1.00E- (ADO59098.1 ; 53% 96% 149 polymyxa] 117
CCI71609.1) glycosylase [Ethanoligenens 2,00E-
WP_013484828.1 53% 97% 153 harbinense] 116 glycosylase [Bacillus 3,00E-
WP_013487973.1 53% 98% 154 cellulosilyticus] 120 glycosylase [Cellulosilyticum 1.00E-
WP_013658367.1 53% 97% 158 lentocellum] 114 glycosylase [Clostridium sp. WP 014315229.1 3,00E-
53% 99% 165 BNL1100] (AEY67872.1) 120
MULTISPECIES: Predicted 9,00E-
WP 015520962.1 53% 97% 177 glycosylase [Roseburia] 118
Predicted glycosylase [Roseburia 3,00E-
WP_015561278.1 53% 97% 181 intestinalis] 117 hypothetical protein 2,00E-
WP_016281854.1 53% 97% 190 [Lachnospiraceae bacterium A4] 114 MULTISPECIES: glycosylase 5,00E-
WP_016822703.1 53% 96% 194 [Paenibacillus] 117
1.00E- glycosylase [Paenibacillus sp. A9] WP_017813118.1 53% 96% 196
118
3,00E- glycosylase [Paenibacillus sanguinis] WP_018752750.1 53% 96% 205
116 glycosylase [Paenibacillus 1.00E-
WP_018883934.1 53% 97% 207 massiliensis] 119 glycosylase [Paenibacillus 1.00E-
WP_019688927.1 53% 96% 214 polymyxa] 116 glycosylase [Paenibacillus sp. 1.00E-
WP_019912399.1 53% 96% 215 HW567] 116 putative uncharacterized protein 2,00E-
WP 021940922.1 53% 97% 236 [Clostridium sp. CAG:632] 114
uncharacterized protein 5,00E-
WP_022050273.1 53% 98% 242 [Ruminococcus sp. CAG:254] 115 glycosidase related protein 8,00E-
WP_022123092.1 53% 97% 246 [Clostridium sp. CAG:510] 117 glycosidase related protein 6,00E-
WP_022154802.1 53% 97% 251 [Firmicutes bacterium CAG:65] 118 predicted glycosylase [Clostridium 1.00E-
WP_022313618.1 53% 97% 266 sp. CAG:91] 117 glycosidase related protein 2,00E-
WP_022352419.1 53% 97% 269 [Firmicutes bacterium CAG:534] 114
glycosidase related protein 3,00E-
WP_022367889.1 53% 97% 271 [Firmicutes bacterium CAG:882] 116
uncharacterized protein 1.00E-
WP_022446695.1 53% 96% 275 [Faecalibacterium sp. CAG:74] 115 glycosylase [Butyrivibrio sp. 2,00E-
WP_022776252.1 53% 97% 289 AE2015] 116 glycosylase [Paenibacillus 3,00E-
WP_023990882.1 53% 96% 293 polymyxa] 117 glycosylase [Paenibacillus sp. FSL 5,00E-
ETT46633.1 53% 96% 301 R7-269] 115 glycosylase [Paenibacillus sp. FSL 4,00E-
ETT68908.1 53% 96% 303 H8-237] 117 glycosylase [Paenibacillus sp. FSL 3,00E-
ETT77608.1 53% 96% 304 R7-277] 115 glycosylase [Paenibacillus 3,00E-
WP_025366120.1 53% 96% 334 polymyxa] 117 glycosylase [Paenibacillus 3,00E-
WP_025681756.1 53% 96% 338 massiliensis] 118 glycosylase [Paenibacillus 1.00E-
WP_025721963.1 53% 96% 341 polymyxa] 116 glycosylase [Butyrivibrio sp. 9,00E-
WP_026507173.1 53% 97% 362 MC2013] 121
2,00E- glycosylase [Clostridium akagii] WP_026882155.1 53% 97% 372
121 glycosylase [Butyrivibrio 4,00E-
WP_027207065.1 53% 97% 379 fibrisolvens] 116 glycosylase [Butyrivibrio 8,00E-
WP_027216979.1 53% 97% 380 fibrisolvens] 116 glycosylase [Butyrivibrio 1,00E-
WP_027218703.1 53% 97% 381 fibrisolvens] 114
4,00E- glycosylase [Paenibacillus sp. J14] WP_028539687.1 53% 96% 396
116 glycosylase [Paenibacillus sp. 2,00E-
WP_028540809.1 53% 96% 397 UNCCL52] 117 glycosylase [Paenibacillus 3,00E-
WP_028589902.1 53% 97% 399 panacisoli] 118 glycosylase [Clostridium 3,00E-
WP_029504721.1 53% 97% 407 phytofermentans] 117
4,00E- glycosylase [Treponema bryantii] WP_022930997.1 53% 96% 413
112 hypothetical protein [uncultured 2,00E-
CAI78545.1 52% 96% 9 Chloroflexi bacterium] 114 hypothetical protein [Clostridium 4,00E-
WP_002579182.1 52% 96% 14 butyricum] 112
4,00E- glycosylase [Clostridium butyricum] WP_003410166.1 52% 96% 22
111 putative glycosidase [Clostridium 3,00E-
WP_003424363.1 52% 96% 23 butyricum] 112 glycosylase [Paenibacillus sp. Aloe- 3,00E-
WP_007432940.1 52% 97% 71 11] 115
8,00E- glycosylase [Paenibacillus peoriae] WP_010347083.1 52% 97% 125
117 glycosylase [Paenibacillus 3,00E-
WP_013312515.1 52% 97% 147 polymyxa] 116
6,00E- glycosylase [Paenibacillus terrae] WP_014278667.1 52% 97% 164
117 hypothetical protein 3,00E-
WP_016298584.1 52% 97% 191 [Lachnospiraceae bacterium M18-1] 111 hypothetical protein [Ruminococcus 2,00E-
WP 021681646.1 52% 96% 229 callidus] 114 predicted glycosylase 1,00E-
WP_021977609.1 52% 97% 238 [Ruminococcus sp. CAG:17] 114
hypothetical protein
5,00E- Q607_CBUC00205G0058 ETI88253.1 52% 96% 294
111
[Clostridium butyricum DORA l] _
Figure imgf000030_0001
Table A
Table A further presents the identity to UhgbMP (%), the sequence coverage (%) and the E-value of said proteins.
Most preferably, the sequence identity percentage is determined using the BLASTP software (version 2.2.29), the parameters being set as follows: (1) Max target sequences=500 ; (2) short queries (Automatically adjust parameters for short input sequences)= Λ— yes ; (3) Expect threshold=10; (4) Word size=3; (5) Max matches in a query range=0; (6) Matrix=BLOSUM62 ; (7) Gap Costs= "Existence: 11 Extension: 1; (8) Compositional adjustments— conditional compositional score matrix adjustment"; (9) Filter (Low complexity regions)— no; (10) Mask (Mask for lookup table only)— no ; (11) Mask (Mask lower case letters)— no;
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 80%, in particular of at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, more particularly of at least 90%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 5,00E-167, in particular an E-value of 0.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 64%, in particular an identity percentage comprised from 50% to 63%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62% or 63%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 1,00E-153 to 1,00E-106, in particular from 1,00E-153 to 1,00E-120 or from l,00E-120 to 1,00E-106.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 64% and less than 80%, in particular an identity percentage comprised from 65% to 79%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 1,00E-147, in particular from 0 to 1,00E-155, or from 1,00E-155 to 1,00E-147, the E-value being more particularly of 0.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of at least 50%> and less than 66%, in particular an identity percentage comprised from 50% to 65%, more particularly an identity percentage of 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%), 62%o, 63%o, 64%o or 65%>, with the amino acid sequence SEQ ID NO: 1, and has an E- value comprised from 1,00E-161 to 1,00E-106, in particular from 1,00E-161 to 1,00E-120 or from 1,00E-120 to 1,00E-106.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein glycoside-phosphorylase has an identity percentage of more than 66% and less than 80%, in particular an identity percentage comprised from 67% to 79%, with the amino acid sequence SEQ ID NO: 1, and has an E-value comprised from 0 to 1,00E-147, in „ Λ
31
particular from 0 to 1,00E-155, or from 1,00E-155 to 1,00E-147, the E-value being more particularly of 0.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: l .
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1 and wherein said mannosyl donor compound is P-1,4-D-Mannan.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
For example, the gene encoding for the glycoside-phosphorylase, in particular UhgbMP, can be amplified by any means known in the art, for instance by PCR using an appropriate set of primers.
The amplified gene or PCR product can then be ligated into any appropriate expression vector, such as for example the expression vector pDEST17, which can be used to transform any host organism known in the art such as, for example, E. coli.
The enzyme produced by the host organism can then be extracted and purified by any method known in the art such as, for example, using a TALON resin (immobilized metal affinity chromatography (IMAC) resin, Clontech) loaded with cobalt to purify His-tagged UhgbMP.
In this regard, the invention further relates to a glycoside-phosphorylase, in particular UhgbMP, which contains at least one deletion, substitution or addition, or any combination thereof, which does not diminish the phosphorylase and/or reverse phosphorylase activity of said glycoside-phosphorylase by at most 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80% or 90%. In one embodiment, the glycoside-phosphorylase of the present invention, in particular UhgbMP, contains at least one deletion, substitution or addition, or any combination thereof, which does not diminish the phosphorylase and/or reverse phosphorylase activity of said glycoside-phosphorylase by at most 90%>. In other words, the present invention also relates to a glycoside-phosphorylase, in particular UhgbMP, which contains at least one deletion, substitution or addition, or any combination thereof, and which retains 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the phosphorylase and/or reverse phosphorylase activity of the wild type glycoside-phosphorylase. The phosphorylase and/or reverse phosphorylase activity can be measured by any method known to a skilled person, in particular by the determination of the apparent catalytic efficiency. A _
32
non-limiting example of an addition that does not influence the enzyme's activity is an N- or C-terminal addition of a His-tag, or of another purification tag.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein a mannosyl residue is grafted on a mannosyl acceptor containing a hydroxyl group, in the presence of said a-D-mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man-Acceptor wherein Man represents mannose.
In another aspect, the present invention relates to a process of degradation of a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from
1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose,
comprising a step of contacting said mannosyl donor with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, and inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1- phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2.
The present invention also relates to a process of degradation of a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, β-l,4-D-mannooligosaccharides, β-D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, „„
33
comprising a step of contacting said mannosyl donor with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, and inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1 - phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2 or Btl033.
In an advantageous embodiment, said glycoside-phosphorylase is characterized, in relation with phosphorolysis, generating a-D-mannopyranose-1 -phosphate and a (Man)m_i- donor compound from a mannosyl donor of formula (Man)m-donor and inorganic phosphate, by the quantification of said a-D-mannopyranose-1 -phosphate, said (Man)m_i -donor compound or said inorganic phosphate.
In an advantageous embodiment, the apparent catalytic efficiency kcatapp/ Krriapp of said glycoside-phosphorylase is above about 0.02 s 'ltiM"1, in particular above about 0.9 s" 'mlV 1, for phosphorolysis in presence of inorganic phosphate and a mannosyl donor selected from the list constituted by -D-mannopyranosyl-l,4-D-mannose, -D-mannopyranosyl-l,4- D-glucose, -D-mannopyranosyl-l^-N^-diacetyl chitobiose and -1,4-D-Mannan.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said step of phosphorolysis is followed by a further step of contacting said compound of formula (Man)m_i -donor with said glycoside- phosphorylase and inorganic phosphate, in a aqueous medium, to obtain by phosphorolysis a- D-mannopyranose-1 -phosphate and a compound of formula (Man)m_2-donor, said further step being repeated p times, p being an integer comprised from 0 to (m-2), to obtain a-D- mannopyranose-1 -phosphate and a compound of formula (Man)(m_p)_2-donor.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said mannosyl donor compound is P-1,4-D-Mannan.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS 13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, „„
34
ZP 03299783.1, ZP 02422496.1, ZP 02205887.1, ZP 02090881.1, ZP 02071200.1, ZP 02067106.1, ZP 01958898, YP 210978.1 and YP 001297942.1.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1 and wherein said mannosyl donor compound is β-1,4-0- Mannan.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, comprising:
- a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphoro lysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
- a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1- phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to „
35
obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D-mannose, D-galactose, D-fructose, (P-D-Man/?-l,4)i-D- Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4)j-P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said mannose is grafted on said mannosyl acceptor via a β- linkage.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said phosphorolysis and said reverse phosphorolysis are performed in one-pot.
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, wherein said reverse phosphorolysis is performed subsequently to said phosphorolysis.
In an advantageous embodiment, said phosphorolysis and said reverse phosphorolysis are performed independently.
In particular, said reverse phosphorolysis can be performed with commercial a-D- mannopyranose- 1 -phosphate .
In an advantageous embodiment, the present invention relates to the process of degradation as defined above, comprising:
a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl „„
36
chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%), with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphoro lysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1 - phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate,
a further step of contacting said mannosylated acceptor of formula Man- Acceptor with a- D-mannopyranose-1 -phosphate and said glycoside-phosphorylase, said further step being repeated n times, n being an integer comprised from 0 to 9, to obtain a (n+2) times mannosyated acceptor of the following structure: (Man)n-Man-Man-Acceptor wherein Man represents mannose, and inorganic phosphate.
In another aspect, the present invention also relates to the use of a glycoside- phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to graft a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, in the presence of a-D-mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, with the proviso that said glycoside-phosphorylase is not RaMP2.
The present invention also relates to the use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, to graft a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, in the presence of a-D- mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose,
with the proviso that said glycoside-phosphorylase is not RaMP2 or Btl033.
By "mannosyl acceptor" is meant an acceptor of mannosyl, in other words a compound on which a mannoside residue is able to be grafted, by reverse phosphorolysis.
By "reverse phosphorolysis" is meant the formation of a glycosidic bond between the mannosyl unit of the a-D-mannopyranose-1 -phosphate and the mannosyl acceptor, said formation being catalyzed by a glycoside-phosphorylase. „
37
In an advantageous embodiment, said glycoside-phosphorylase is characterized, in relation with reverse phosphorolysis, generating a mannosylated acceptor and inorganic phosphate from a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, by the quantification of said a-D-mannopyranose-1 -phosphate or said inorganic phosphate.
In an advantageous embodiment, the apparent catalytic efficiency kcatapp/ Krriapp of said glycoside-phosphorylase is above about 0.05 s 'ltiM"1, in particular above about 0.4 s" 'mlV 1, for reverse phosphorolysis in presence of a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, in particular selected from D-glucose, D-mannose, D-galactose, D- fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4)j-P-D- Glc/?NAc- 1 ,4-D-GlcpNAc, j being equal to 0, 1 or 2.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is not L-arabinose, D-cellobiose, D-fucose, L-fucose, L-rhamnose, Xylitol, D-lyxose, L-xylose, D-mannitol, D-altrose, D-xylose or D-allose.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among glycoside-phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS13361.1, ABX42090.1, AFG35891.1, ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, ZP 02422496.1, ZP 02205887.1, ZP 02090881.1, ZP 02071200.1, ZP 02067106.1, ZP 01958898, YP 210978.1 and YP 001297942.1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is a carbohydrate. By "carbohydrates" is meant saccharides, in particular monosaccharides, oligosaccharides, and polysaccharides.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D- mannose, D-galactose, D-fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1 , and (P-D-Man/?-l,4)j-P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is selected from the list constituted by glycoproteins and glycopeptides.
By "glycoprotein" is meant a protein that contains saccharide chains, in particular oligosaccharide and/or monosaccharide chains, covalently attached to the side-chains of amino acids constituting said protein.
By "glycopeptide" is meant a peptide that contains saccharide chains, in particular oligosaccharide and/or monosaccharide chains, covalently attached to the side-chains of amino acids constituting said peptide.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl acceptor is water.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said mannosyl residue is grafted on said mannosyl acceptor via a β-linkage.
Considering a-D-mannopyranose-1 -phosphate and said β-linkage between mannosyl residue and said acceptor, there is inversion of configuration at C-1 of the mannosyl residue of the a-D-mannopyranose-1 -phosphate donor.
In an advantageous embodiment, the present invention relates to the use as defined above, wherein said a-D-mannopyranose-1 -phosphate is obtained from degradation by phosphorolysis of a mannosyl donor compound of formula (Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15, said mannosyl donor compound being selected from the list constituted by P-l,4-D-mannan, β-1,4-Ό- mannooligosaccharides, β-D-mannopyranosyl- 1 ,4-D-glucose, β-D-mannopyranosyl- 1 ,4-N- acetyl-D-glucosamine, β-D-mannopyranosyl-l,4-N,Λ'-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl-l,4-N,Λ'-diacetyl chitobiose, with said glycoside-phosphorylase. In another aspect, the present invention relates to the process of grafting a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, comprising a step of contacting a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, with a-D-mannopyranose-1 -phosphate and said mannosyl acceptor, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose and inorganic phosphate,
with the proviso that said glycoside-phosphorylase is not RaMP2.
The present invention relates to the process of grafting a mannosyl residue on a mannosyl acceptor containing a hydroxyl group, comprising a step of contacting a glycoside- phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, with a-D-mannopyranose-1 -phosphate and said mannosyl acceptor, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose and inorganic phosphate,
with the proviso that said glycoside-phosphorylase is not RaMP2 or Btl033.
In an advantageous embodiment, said glycoside-phosphorylase is characterized, in relation with reverse phosphorolysis, generating a mannosylated acceptor and inorganic phosphate from a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, by the quantification of said a-D-mannopyranose-1 -phosphate or said inorganic phosphate.
In an advantageous embodiment, the apparent catalytic efficiency kcatapp/ Krriapp of said glycoside-phosphorylase is above about 0.05 s^mM"1, in particular above about 0.4 s" "1, for reverse phosphorolysis in presence of a-D-mannopyranose-1 -phosphate and a mannosyl acceptor, in particular selected from D-glucose, D-mannose, D-galactose, D- fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, and (P-D-Man/?-l,4)j-P-D- Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or 2.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is chosen among glycoside- phosphorylases identified by the following GenBank Accession numbers: ADD61463.1, AEY67872.1, AFN75330.1, ADO59098.1, CCI71609.1, ADD61810.1, CBL14186.1, AFK85719.1, ADA67643.1, AAD36300.1, ACB09929.1, ABQ47551.1, ACM23522.1, ABV33993.1, AGB28392.1, AFL78596.1, EDS 13361.1, ABX42090.1, AFG35891.1 , ACJ75237.1, ADL43426.1, AEM72946.1, ACM61623.1, ABR30874.1, AFK07300.1, AFK07371.1, AFL98126.1, AAO76140.1, ACB75595.1, ZP 08158270.1, ZP 03299783.1, _
40
ZP 02422496.1, ZP 02205887.1, ZP 02090881.1, ZP 02071200.1, ZP 02067106.1, ZP 01958898, YP 210978.1 and YP 001297942.1.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase has the amino acid sequence SEQ ID NO: 1.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is a carbohydrate.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D-mannose, D-galactose, D-fructose, (P-D-Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1 , and (P-D-Man/?-l,4)j-P-D-Glc/?NAc-l,4-D-Glc/?NAc, j being equal to 0, 1 or
2.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is selected from the list constituted by glycoproteins and glycopeptides.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl acceptor is water.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl residue is grafted on said mannosyl acceptor via a β-linkage.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, comprising:
- a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15, „ Λ
41
said mannosyl donor compound being selected from the list constituted by β- 1 ,4-D-mannan, β- 1 ,4-D-mannooligosaccharides, β-D-mannopyranosyl- 1 ,4-D-glucose, β-D-mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 , -N,N- diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D- mannopyranosyl-l ^-N.N'-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 , or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1 - phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate.
Said embodiment concerns the grafting of a mannosyl residue from a-D- mannopyranose-1 -phosphate to a mannosyl acceptor in presence of a glycoside- phosphorylase, said a-D-mannopyranose-1 -phosphate being obtained by degradation of a mannosyl donor by said glycoside-phosphorylase.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said phosphorolysis and said reverse phosphorolysis are performed in one-pot.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said reverse phosphorolysis is performed subsequently to said phosphorolysis.
In an advantageous embodiment, said phosphorolysis and said reverse phosphorolysis are performed independently.
In particular, said reverse phosphorolysis can be performed with commercial a-D- mannopyranose- 1 -phosphate.
In an advantageous embodiment, the present invention also relates to the process of grafting as defined above, comprising:
a step of contacting a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 , or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%), with said amino acid sequence, with a-D-mannopyranose-1 -phosphate and said mannosyl acceptor, in an aqueous medium, to obtain by reverse _
42
phosphorolysis a mannosylated acceptor of formula Man-Acceptor wherein Man represents mannose and inorganic phosphate,
a further step of contacting said mannosylated acceptor of formula Man- Acceptor with a-D-mannopyranose-1 -phosphate and said glycoside-phosphorylase, said further step being repeated n times, n being an integer comprised from 0 to 9, to obtain a (n+2) times mannosyated acceptor of the following structure: (Man)n-Man-Man-Acceptor wherein Man represents mannose, and inorganic phosphate.
Said embodiment concerns the grafting of one mannosylated residue on a mannosyl acceptor, said grafting being repeated (n+1) times to obtain a compound of the following formula: (Man)n+2-Acceptor.
In other words, mannosyl residues are polymerized, through the creation of beta- 1,4 linkages, yielding to the synthesis of manno-oligo and manno-polysaccharides grafted on an acceptor.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, comprising:
- a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%), with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
- a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1 - phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate; „„
43
- a further step of contacting said mannosylated acceptor of formula Man-Acceptor with a-D-mannopyranose-1 -phosphate and said glycoside-phosphorylase, said further step being repeated n times, n being an integer comprised from 0 to 9, to obtain a (n+2) times mannosyated acceptor of the following structure: (Man)n-Man-Man-Acceptor wherein Man represents mannose, and inorganic phosphate.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said mannosyl donor compound is β-1,4- D-Mannan.
In an advantageous embodiment, the present invention relates to the process of grafting as defined above, wherein said glycoside-phosphorylase is recombinantly expressed.
In another aspect, the present invention relates to a pharmaceutical composition comprising as active substance an inhibitor of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, said inhibitor being in particular D- altrose, D-xylose or D-allose, in association with a pharmaceutically acceptable vehicle.
In an advantageous embodiment, the present invention relates to the pharmaceutical composition as defined above, admimstrable by oral route at a dose comprised from about 0.1 mg/kg to about 1000 mg/kg of body weight.
In an advantageous embodiment, the present invention relates to the pharmaceutical composition as defined above, admimstrable by rectal route at a dose comprised from about 0.1 mg/kg to about 1000 mg/kg of body weight.
In an advantageous embodiment, the present invention relates to the pharmaceutical composition as defined above, under a form liable to be admimstrable by oral route, under the form of a unit dose comprised from about 5 mg to about 10,000 mg, in particular from about 10 mg to about 2,000 mg, in particular from about 50 to about 1,000 mg.
In an advantageous embodiment, the present invention relates to the pharmaceutical composition as defined above, under a form liable to be admimstrable by rectal route, under the form of a unit dose comprised from about 5 mg to about 10,000 mg, in particular from about 10 mg to about 2,000 mg, in particular from about 50 to about 1,000 mg.
In another aspect, the present invention relates to a composition comprising an inhibitor of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%>, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, for treating inflammatory bowel diseases. „„
44
In an advantageous embodiment, the present invention relates to the composition as defined above, wherein said inflammatory bowel diseases belong to the group consisting of Crohn's disease, ulcerative colitis and colon cancer. DESCRIPTION OF THE DRAWINGS
Figure 1A presents the 1H NMR spectra of the products synthesized by reverse phosphoro lysis by UhgbMP from 1) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D- mannose, 2) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D-glucose, 3) 10 mM a-D- mannopyranose-1 -phosphate and 10 mM N,N"-diacetyl chitobiose.
Figure IB presents the 13C (B) NMR spectra of the products synthesized by reverse phosphoro lysis by UhgbMP from 1) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D- mannose, 2) 10 mM a-D-mannopyranose-1 -phosphate and 10 mM D-glucose.
Figure 2 presents the dependency of UhgbMP specific activity (phosphoro lysis) with the polymerisation degree (DP) of the phosphorolysed P-l ,4-D-mannoligosaccharides.
EXAMPLES
Example 1 : Recombinant UhgbMP production and purification
First, the UhgbMP (SEQ ID NO: 1) encoding gene (SEQ ID NO: 2) was PCR amplified from the E. coli metagenomic clone (Genbank accession number GU942931) using primers forward 5 'AGTATGAGTAGC AAAGTTATTATTCCTTGG 3 ' (SEQ ID NO: 5) and reverse 5 ' TCAGATGATGCTTGTACGTTTGGTAAATTC 3 ' (SEQ ID NO: 6), by using the Expand Long Template PCR kit (Roche).
To allow heterologous UhgbMP production in E. coli with His(6) tag at the N-terminal extremity, the PCR product was purified and subsequently cloned into the pCR8/GW/TOPO entry vector (Invitrogen), and then into the pDEST17 destination vector (Invitrogen), according to the manufacturer's recommendations. E.coli BL21-AI cells (Invitrogen) harboring the UhgbMP-encoding plasmid were cultured at 20°C for 24 hours in ZYM-5052 autoinduction medium supplemented with 100 μg/mL ampicillin, inoculated at OD600nm 0.1. Cells were harvested and resuspended in 20mM Tris HCl, pH 7.0, 300 mM NaCl, and lysed by sonication. Soluble lysate was applied to a TALON resin loaded with cobalt (GE Healthcare) equilibrated in 20mM Tris HCl, pH 7.0, 300 mM NaCl. After column washing with 8 volumes of the same buffer supplemented with lOmM imidazole, the protein was eluted in 20mM Tris HCl, pH 7.0, 300 mM NaCl, 150 mM imidazole. Finally, the protein „
45
sample was desalted on a PD-10 column (GE Healthcare) and eluted in 20 mM Tris-HCl pH7.0, Tween 80 0.1% (vol/vol). Protein concentrations were determined by spectrometry using a NanoDrop® ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). In these conditions, 84 % of UhgbMP remained soluble after 8 days at 4°C.
Example 2 : Synthesis of manno-oligosaccharides from a-D-mannopyranose-l-phosphate and carbohydrate acceptors
Reaction was performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM of the a-D-mannopyranose-l-phosphate (reference M1755, Sigma), and 10 mM of carbohydrate acceptors.
When the acceptor is N,N"-diacetyl chitobiose (Dextra, reference C8002), the reaction can be performed with a concentration of said N,N"-diacetyl chitobiose comprised from 0.1 to 10 mM, in particular from 0.5 to 1 mM, more particularly with a concentration of ImM.
The apparent kinetic parameters for reverse phosphorolysis were determined by fitting the initial rates of a-D-mannopyranose-l-phosphate release and consumption, respectively, to the Michaelis-Menten equation. Non-linear regression was performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
Here the reaction conditions were different than those used for synthesis of mannooligosaccharides : Reaction was performed with 0.01 mg/ml purified UhgbMP at 37 °C in Tris HC1 20mM, pH 7.0. Substrate concentrations were as follows: 10 mM a-D- mannopyranose-l-phosphate and 5 to 40 mM of D-glucose, D-galactose, D-fructose, or N- acetyl-D-glucosamine, or, 5 or 10 mM a-D-mannopyranose-l-phosphate and 5 to 40 mM of D-mannose, or 5 mM a-D-mannopyranose-l-phosphate and 0.1 to 1 mM of N,N"-diacetyl chitobiose.
Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-l-phosphate were separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min"1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
NMR Spectroscopy: Freeze-dried reaction media were exchanged twice with 99.9 atom% D20 and lyophilized. Deuterium oxide was used as the solvent and sodium 2,2,3,3- „„
46
tetradeuterio-3-trimethylsilylpropanoate was selected as the internal standard. 1H and 13C NMR spectra were recorded on a Bruker Advance 500 MHz spectrometer using a 5 mm z- gradient TBI probe at 298 K, an acquisition frequency of 500.13 MHz and a spectral width of 8012.82 Hz. Spectra were acquired and processed using TopSpin 3.0 software. The various signals were assigned by comparison with signals obtained from a-D-mannopyranose-1- phosphate, -D-mannopyranosyl-l,4-D-mannose (Megazyme, Irleland, reference O-MBI), β- D-mannopyranosyl-l,4-D-glucose (Carbosynth, United Kingdom, reference OM04754), or β- D-mannopyranosyl-l,4-N,N'-diacetyl chitobiose (Dextra, United Kingdom, reference MC0320), used as standards.
Results
First, even without any carbohydrate acceptor, UhgbMP produces mannose and, further, mannooligosaccharides of DP ranging from 1 to 12, indicating that water itself plays the role of first acceptor at the beginning of the reaction. The β-1,4 regio-specific synthesis of manno- oligosaccharides was characterized by 1H and 13C NMR (Figure 1). Various carbohydrates were tested as acceptors (Table 1). D-G1C/?NAC and P-D-G1C/?NAC-1,4-D-G1C/?NAC were the best recognized acceptors, given that the UhgbMP Km value for these compounds are 6 and 48 fold lower than for D-mannose, respectively. Starting from a-D-mannopyranose-1- phosphate and D-Glc/?NAc or P-D-Glc ?NAc-l,4-D-GlcpNAc, UhgbMP generates series of mannooligosaccharides containing D-Glc/?NAc or P-D-G1C/?NAC-1,4-D-G1C/?NAC at their reducing end, with a DP of up to 4. D-glucose, D-mannose, D-galactose and D-fructose are also recognized as acceptors.
Figure imgf000047_0001
Table 1 „
47
UhgbMP is the most effective phosphorylase for production of N-glycan core oligosaccharides, such as P-D-Man/?-l,4-D-GlcNAc and P-D-Man ?-l,4-P-D-Glc ?NAc-l,4-D- GlcpNAc, whose commercial price today exceeds $ 10,000 per mg. In fact, the UhgbMP apparent catalytic efficiency for reverse phosphorolysis using N-acetyl-D-glucosamine and β- D-Glc/?NAC- 1 ,4-D-GlcNAc as acceptors is 24 and 262 times higher than that of RaMP2.
Example 3 : Phosphorolysis of oligosaccharides or polysaccharides by UhgbMP
Reaction was performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM carbohydrate donor, excepted for P-D-mannopyranosyl-l^-N.N'-diacetyl chitobiose (Dextra, United Kingdom, reference MC0320) which was used at 2 mM.
The apparent kinetic parameters for phosphorolysis were determined by fitting the initial rates of a-D-mannose-1 -phosphate release and consumption, respectively, to the Michaelis-Menten equation. Non-linear regression was performed with SigmaPlot Enzyme Kinetics module, version 1.3 (Systat Software, Inc., San Jose California USA).
Here the reaction conditions were different than those used for synthesis of mannooligosaccharides : Reaction was performed with 0.01 mg/ml purified UhgbMP at 37 °C in Tris HC1 20mM, pH 7.0. Substrate concentrations were as follows: 10 mM inorganic phosphate and 1 to 10 mM of -D-mannopyranosyl-l,4-D-glucose, 10 mM inorganic phosphate and 0.4 to 4 mM of -l,4-D-mannan, 5 or 10 mM inorganic phosphate and 1 to 20 mM of -D-mannopyranosyl-l,4-D-mannose, 5 mM inorganic phosphate and 0.05 to 0.5 mM of β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose.
Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min"1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference. _
48
Results
UhgbMP exhibits a wide specificity towards carbohydrate donors (Table 2). UhgbMP is able to phosphorolyse -D-mannopyranosyl-l,4-D-glucopyranose, P-l,4-linked D-manno- oligosaccharides and mannan (P-D-Manp-l,4-(D-Man/?)n, with n = 1 to 15), characterized by a notable parallel increase in specific activity with the degree of polymerisation (DP) (Figure 2). UhgbMP is thus to date the only characterized GH130 enzyme that is able to breakdown mannan, a constituent of hemicellulose in grains and nuts. Interestingly, the best recognized UhgbMP carbohydrate donor that we tested for UhgbMP is P-D-mannopyranosyl-l,4-N,N'- diacetyl chitobiose (P-D-Man/?-l,4- P-D-Glc ?NAc-l,4-D-GlcpNAc), a signature motif of human N-glycans. The Km for this compound is respectively 10- and 57-fold lower than that obtained for P-l,4-D-mannobiose and P-D-Man ?-l,4-D-Glcp. However, neither cellobiose (β- D-G1C/?-1,4-D-G1C/?) nor N,N-diacetyl chitobiose (P-D-G1C/?NAC-1,4-D-G1C/?NAC) could be phosphorolysed, indicating that the UhgbMP subsite -1 is highly specific for mannosyl residues.
Figure imgf000049_0001
Table 2
Finally, no trace of oligosaccharide-phosphate was visible, at any reaction time, on HPAEC- PAD chromatograms of products obtained during phosphorolysis reactions, irrespective of the donor substrate. UhgbMP is thus an exo-acting enzyme, able to breakdown only the first beta- mannosidic linkage at the non-reducing end of donor oligosaccharides.
Example 4 : Quantification of UhgbMP inhibition by carbohydrates or hydroxylated compounds
The percentage of UhgbMP inhibition by carbohydrates or other hydroxylated compounds was measured with 0.1 mg/ml purified enzyme by quantifying a-D-mannopyranose-1- Λ η
49
phosphate consumption rate from 10 mM a-D-mannopyranose-1 -phosphate as glycosyl donor, with and without 10 mM of L-rhamnose, D-altrose, D-allose, D-fucose, L-fucose, D-mannitol, D-lyxose, xylitol, L-xylose, D-xylose, L-arabinose, or D-cellobiose. It was checked by HPAEC-PAD that less than 10 % of a-D-mannopyranose-1 -phosphate was consumed during the phase of activity measurement.
The presence of these compounds decreased enzyme-specific activity, in some cases quite markedly (Table 3). But concentrations of these compounds did not decrease during reaction, and no significant additional product was produced compared with reaction in the presence of_a-D-mannopyranose 1 -phosphate as sole substrate. These carbohydrates thus act as UhgbMP inhibitors.
Figure imgf000050_0001
Table 3
Example 5 : Test of various sugar-phosphates as glycosyl donors for reverse phosphorolysis ^
Reactions were performed with 0.1 mg/ml purified UhgbMP during 24h at 37 °C in Tris HCl 20mM, pH 7.0, with 10 mM of the a-D-fructose-1- and -6-phosphate, D-ribose-1 -phosphate, a-D-galactosamine-1 -phosphate, a-D-glucosamine- 1 -phosphate, D-mannose-6-phosphate, a-D- glucopyranosyl-1 or -6-phosphate as putative glycoside donors.
Carbohydrate analysis was performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and a isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min"1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
All of said sugar-phophates (a-D-fructose-1- and -6-phosphate, D-ribose-1 -phosphate, a-D- galactosamine-1 -phosphate, a-D-glucosamine- 1 -phosphate, D-mannose-6-phosphate, a-D- glucopyranosyl-1 or -6-phosphate) remained untouched by UhgbMP.
Example 6 : Protocol to assay mannosylation of GlcNAc-GlcNAc-protein by UhgbMP - catalysed reverse-phosphorolysis
Mature human intestinal Muc2 (SEQ ID NO: 4) glycoprotein is purified from mucus, as described by Allen, A. et al. (1998), The International Journal of Biochemistry & Cell Biology 30, 797-801.
Muc2 glycoprotein containing GlcNAc-GlcNAc N-glycosylation motifs are obtained by hydrolysis of the mature Muc2 glycoprotein with mannosidases classified in the families GH92 and GH2 of glycoside-hydrolases (Tailford, L.E. et al. (2007), J. Biol. Chem. 282, 11291-11299 ; Cantarel, B.L. et al. (2009), Nucl. Acids Res. 37, D233-D238 ; Zhu, Y. et al. (2010), Nature Chemical Biology 6, 125-132).
UhgbMP reverse-phosphorolysis from a-D-mannopyranose-1 -phosphate and the human intestinal Muc2 glycoprotein containing GlcNAc-GlcNAc N-glycosylation motifs is determined after incubation of 0.1 mg/ml purified enzyme during 24h at 37°C in Tris HCl 20mM, pH 7.0 with 10 mM a-D-mannopyranose-1 -phosphate (reference Ml 755, Sigma) and between 1 and 100 μΜ of the Muc2 protein obtained as described above, by quantifying a-D- mannopyranose-1 -phosphate consumption rate by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). ^
Example 7 : Protocol to assay phosphorolysis of a Man-GlcNAc-GlcNAc-protein by UhgbMP
Mature human intestinal Muc2 glycoprotein is purified from mucus, as described by Allen, A. et al. (1998), The International Journal of Biochemistry & Cell Biology 30, 797-801.
Muc2 glycoprotein containing Man-GlcNAc-GlcNAc N-glycosylation motifs are obtained by hydrolysis of the mature Muc2 glycoprotein with mannosidases classified in the families GH92 of glycoside-hydrolases (Cantarel, B.L. et al. (2009), Nucl. Acids Res. 37, D233- D238 ; Zhu, Y. et al. (2010), Nature Chemical Biology 6, 125-132).
UhgbMP catalysed phosphorolysis of the human intestinal Muc2 glycoprotein containing Man-GlcNAc-GlcNAc N-glycosylation motifs is determined after incubation of 0.1 mg/ml purified enzyme during 24h at 37 °C in Tris HC1 20mM, pH 7.0 with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and between 1 and 100 μΜ of the Muc2 protein obtained as described above, by quantifying a-D-mannopyranose-1 -phosphate release rate by using high- performance anion exchange chromatography with pulsed amperometric detection (HPAEC- PAD). Example 8 : Protocol for the one-pot synthesis of mannooligosaccharides containing a GlcNAc (or GlcNAC-GlcNAc) at their reducing end, from mannan, inorganic phosphate, and V-acetyl-D-glucosamine (or \yV'-diacetyl chitobiose) as substrates
Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM mannan (Megazyme, Ireland, reference P-MANCB), 10 mM N-acetyl-D-glucosamine (Sigma, reference A8625), or 1 mM N,N"-diacetyl chitobiose (Dextra, reference C8002).
Carbohydrate analysis is performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-1 -phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and a isocratic step of 300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min"1 flow rate. Detection is ^ performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference.
Example 9 : Protocol for the two-step synthesis of mannooligosaccharides containing a GlcNAc (or GlcNAC-GlcNAc) at their reducing end, from mannan, inorganic phosphate, and V-acetyl-D-glucosamine (or \yV'-diacetyl chitobiose) as substrates
9a - Production of a-D-mannopyranose-l-phosphate from mannan and inorganic phosphate
Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM inorganic phosphate (prepared from a stock solution of 100 mM phosphate obtained from a mix of 100 mM di-sodium hydrogen phosphate dodecahydrate (ref 28028.298 / VWR Prolabo) and of 100 mM sodium dihydrogen phosphate dihydrate (ref 28015.294 / VWR Prolabo) solutions to reach a pH of 7.0) and 10 mM mannan (Megazyme, Ireland, reference P-MANCB).
9b - Purification of a-D-mannopyranose-l-phosphate
a-D-mannopyranose-l-phosphate is purified from the reaction medium obtained at step 9b by preparative high-performance liquid chromatography (HPLC) or low-pressure liquid chromatography (LPLC) by using first a C18 column to eliminate oligosaccharides of polymerisation degree > 3, and secondly a H+ or K+ column to separate a-D-mannopyranose- l-phosphate from oligosaccharides of polymerisation degree < 3.
9c - Production of mannooligosaccharides containing a GlcNAc (or GlcNAC-GlcNAc) at their reducing end, from a-D-mannopyranose-l-phosphate and V-acetyl-D-glucosamine (or 7\yV-diacetyl chitobiose) as substrates
Reaction is performed with 0.1 mg/ml purified UhgbMP during lOh at 37 °C in Tris HC1 20mM, pH 7.0, with 10 mM of the a-D-mannopyranose-l-phosphate obtained in step 9b, and 10 mM N-acetyl-D-glucosamine (Sigma, reference A8625), or 1 mM N,N"-diacetyl chitobiose (Dextra, reference C8002).
Carbohydrate analysis is performed by using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). Carbohydrates and a-D- mannopyranose-l-phosphate are separated on a 4 x 250 mm Dionex Carbopac PA100 column. A gradient of sodium acetate (from 0 to 150 mM in 15 min) and an isocratic step of „
53
300 mM sodium acetate in 150 mM NaOH is applied at a 1 mL.min"1 flow rate. Detection is performed using a Dionex ED40 module with a gold working electrode and a Ag/AgCl pH reference. Example 10 : In vivo study of effects of Uhgb MP inhibitors on Inflammatory Bowel Deseases
Twenty to fifty patients with an inflammatory bowel disease (IBD) (Crohn's disease, ulcerative colitis) are recruited. None of the included patients have overtly clinical symptoms during the time of the study and none are on medication for IBD problems. Thus, no nonsteroidal anti-inflammatory drugs, antibiotics, 5 -aminosalicylic acid, corticosteroids, or other anti- inflammatory agents are used during the time of the study. After providing written informed consent, patients are randomly allocated to begin with Uhgb MP inhibitor supplementation or with a placebo using a doubleblind crossover design. Five grams of Uhgb MP inhibitor (D-altrose, D-xylose or D-allose ) are dissolved in 200 ml of a commercially available milk-based beverage (Nutridrink®, Nutricia Nederland B.V.). The placebo consisted of the beverage Without enzyme inhibitor. The use of this standard beverage facilitates the double-blinded placebo-controlled character of the study. Patients are instructed to drink one bottle with 200 ml of the beverage in the morning at breakfast and a second in the evening at supper. After three weeks of consuming two bottles per day, patients return to the hospital to fill in a questionnaire and to undergo endoscopy. Patients brought fresh stools, produced in the morning immediately before they come to the hospital. Between the inhibitor and the placebo period there is a washout period of four weeks. The purpose of this washout period is to overcome effects of the first study period possibly intervening with effects of the final period. All investigators, including the endoscopist, are blinded to the randomization. The endoscopist and the pathologist do not participate in obtaining clinical data and are blinded to results until data analysis was finished. During endoscopy, findings were scored according to the Crohn's disease endoscopic index of severity (CDEIS) (Mary, J. Y. & Modigliani, R. Development and validation of an endoscopic index of the severity for Crohn's disease: a prospective multicentre study. Groupe d'Etudes Therapeutiques des Affections Inflammatoires du Tube Digestif (GETAID). Gut 30, 983-989 (1989)) and to the ulcerative colitis endocscopic index of severity (UCEIS) (Travis, S. P. et al. Developing an ulcerative colitis endocscopic index of severity (UCEIS): results of pilot phase. Gut 40 (Suppl. 1), A-201 (2008)) criteria. At least three biopsy specimens are randomly taken from the mucosa in areas without apparent signs of ulceration or mucous exudate. Biopsy „
54
specimens are encoded, fixed in formalin, and embedded in paraffin. Histologic sections are stained with hematoxylin and eosin. The average scores for all endoscopic and all histologic criteria of the CDEIS and UCEIS are called "total endoscopic score" and "total histologic score," respectively. Within two hours after defecation, stools are processed. pH is determined. Bile acids and short chain fatty acids in stools are quantified by gas chromatography(van Faassen A, Hazen MJ, van den Brandt PA, van den Bogaard AE, Hermus RJ, Janknegt RA. Bile acids and pH values in total feces and in fecal water from habitually omnivorous and vegetarian subjects. Am J Clin Nutr 1993;58:917-22. ; van den Bogaard AE, Hazen MJ, van Boven CP. Quantitative gas chromatographic analysis of volatile fatty acids in spent culture media and body fluids. J Clin Microbiol 1986;23 :523-30).. Levels of significance are set at P _ 0.05. Differences between the enzyme inhibitor and the placebo period are statistically analyzed using Wilcoxon's signed-rank test (C. F. M. Welters, E.Heineman, F. B. J.M.Thunnissen, A. E. J.M. Van den Bogaard, P. B. Soeters, and C. G. M. I. Baeten, "Effect of dietary inulin supplementation on inflammation of pouch mucosa in patients with an ileal pouch-anal anastomosis,c Diseases of the Colon and Rectum, vol. 45, no. 5, pp. 621 Rect 2002).

Claims

1. Use of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, to degrade by phosphoro lysis a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, to obtain by phosphoro lysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2, said mannosyl donor compound being in particular P-1,4-D-Mannan, said glycoside-phosphorylase being in particular chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413, said glycoside-phosphorylase having more particularly the amino acid sequence SEQ ID NO: 1, said glycoside-phosphorylase being in particular recombinantly expressed.
2. Process of degradation of a mannosyl donor compound of formula:
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, β-l,4-D-mannooligosaccharides, β-D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ^-N.N'-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose,
said mannosyl donor compound being in particular P-1,4-D-Mannan, comprising a step of contacting said mannosyl donor with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, and inorganic phosphate, in an aqueous medium, to obtain by phosphoro lysis a-D-mannopyranose-1 - phosphate and a compound of formula (Man)m_i -donor,
with the proviso that said glycoside-phosphorylase is not RaMP2, said glycoside-phosphorylase having more particularly the amino acid sequence SEQ ID NO: 1.
3. Process according to claim 2, wherein said step of phosphorolysis is followed by a further step of contacting said compound of formula (Man)m_i -donor with said glycoside- phosphorylase and inorganic phosphate, in a aqueous medium, to obtain by phosphorolysis a- D-mannopyranose-1 -phosphate and a compound of formula (Man)m_2-donor, said further step being repeated p times, p being an integer comprised from 0 to (m-2), to obtain a-D- mannopyranose-1 -phosphate and a compound of formula (Man)(m_p)_2-donor.
4. Process according to anyone of claims 2 to 3, wherein said glycoside-phosphorylase is chosen among proteins comprising or constituted by the amino acid sequence SEQ ID NO: 1, 7 and 8 to 413.
5. Process according to anyone of claims 2 to 4, wherein said glycoside-phosphorylase is recombinantly expressed.
6. Process according to anyone of claims 2 to 5, wherein said glycoside-phosphorylase is characterized, in relation with phosphorolysis, generating a-D-mannopyranose-1 -phosphate and a (Man)m_i -donor compound from a mannosyl donor of formula (Man)m-donor and inorganic phosphate, by the quantification of said a-D-mannopyranose-1 -phosphate, said (Man)m_i -donor compound or said inorganic phosphate.
7. Process according to anyone of claims 2 to 6, wherein the apparent catalytic efficiency kcatapp/ Krriapp of said glycoside-phosphorylase is above about 0.02 s^mM"1, in particular above about 0.9 s 'mM"1, for phosphorolysis in presence of inorganic phosphate and a mannosyl donor selected from the list constituted by p-D-mannopyranosyl-l ,4-D-mannose, β- D-mannopyranosyl-l ,4-D-glucose, p-D-mannopyranosyl-l ^-N^-diacetyl chitobiose and β- 1 ,4-D-Mannan.
8. Use according to claim 1 , wherein a mannosyl residue is grafted on a mannosyl acceptor containing a hydroxyl group, in the presence of said a-D-mannopyranose-1 -phosphate, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose.
9. Process according to anyone of claims 2 to 7, comprising:
a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β- 1 ,4-D-mannan, β- 1 ,4-D-mannooligosaccharides, β-D-mannopyranosyl- 1 ,4-D-glucose, β-D-mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 , -N,N- diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D- mannopyranosyl-l ^-N.N'-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1 , or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1 - phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate.
10. Process according to claim 9, wherein said mannosyl acceptor is selected from the group constituted by carbohydrates, glycoproteins, glycopeptides, water and hydroxylated compounds, in particular polyols.
11. Process according to anyone of claims 9 to 10, wherein said mannosyl acceptor is selected from the list constituted by D-glucose, D-mannose, D-galactose, D-fructose, (β-D- Manp-l,4)i-D-Glc/?NAc, i being equal to 0 or 1, and (P-D-Manp-l,4)j-P-D-Glc/?NAc-l,4-D- GlcpNAc, j being equal to 0, 1 or 2.
12. Process according to anyone of claims 9 to 11 wherein:
said phosphorolysis and said reverse phosphorolysis are performed in one-pot, or said reverse phosphorolysis is performed subsequently to said phosphorolysis.
13. Process according to anyone of claims 9 to 12, comprising:
a step of contacting a compound of formula
(Man)m-donor, wherein Man represents mannose and m is an integer comprised from 1 to 1000, in particular from 1 to 100, more particularly from 1 to 20, even more particularly from 1 to 15,
said mannosyl donor compound being selected from the list constituted by β-1,4-Ό- mannan, -l,4-D-mannooligosaccharides, -D-mannopyranosyl-l,4-D-glucose, β-D- mannopyranosyl- 1 ,4-N-acetyl-D-glucosamine, β-D-mannopyranosyl- 1 ,4-N,N"-diacetyl chitobiose, and glycoproteins constituted by a protein glycosylated by β-D-mannopyranosyl- 1 ,4-N,N-diacetyl chitobiose, with a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, in the presence of inorganic phosphate, in an aqueous medium, to obtain by phosphorolysis a-D-mannopyranose-1 -phosphate and a compound of formula (Man)m_i -donor;
a step of contacting said glycoside-phosphorylase with said a-D-mannopyranose-1- phosphate and a mannosyl acceptor containing a hydroxyl group, in an aqueous medium, to obtain by reverse phosphorolysis a mannosylated acceptor of formula Man- Acceptor wherein Man represents mannose, and inorganic phosphate,
a further step of contacting said mannosylated acceptor of formula Man- Acceptor with a- D-mannopyranose-1 -phosphate and said glycoside-phosphorylase, said further step being repeated n times, n being an integer comprised from 0 to 9, to obtain a (n+2) times mannosyated acceptor of the following structure: (Man)n-Man-Man-Acceptor wherein Man represents mannose, and inorganic phosphate.
14. Pharmaceutical composition comprising as active substance an inhibitor of a glycoside- phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%, with said amino acid sequence, said inhibitor being in particular D-altrose, D-xylose or D-allose, in association with a pharmaceutically acceptable vehicle, in particular administrable by oral or rectal route at a dose comprised from about 0.1 mg/kg to about 1000 mg/kg of body weight, or in particular under a form liable to be administrable by oral or rectal route, under the form of a unit dose comprised from about 5 mg to about 10,000 mg, in particular from about 10 mg to about 2,000 mg, in particular from about 50 to about 1,000 mg.
15. Composition comprising an inhibitor of a glycoside-phosphorylase having the amino acid sequence SEQ ID NO: 1, or having an identity percentage of at least 50%, in particular at least 60, 70, 80 or 90%>, with said amino acid sequence, said inhibitor being in particular D- altrose, D-xylose or D-allose, for treating inflammatory bowel diseases, in particular inflammatory bowel diseases belonging to the group consisting of Crohn's disease, ulcerative colitis and colon cancer.
PCT/EP2014/066565 2013-07-31 2014-07-31 Use of specific glycoside phosphorylases for the implementation of phosphorolysis or reverse phosphorolysis reactions Ceased WO2015014973A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP13306108 2013-07-31
EP13306108.5 2013-07-31

Publications (2)

Publication Number Publication Date
WO2015014973A2 true WO2015014973A2 (en) 2015-02-05
WO2015014973A3 WO2015014973A3 (en) 2015-04-02

Family

ID=48948368

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2014/066565 Ceased WO2015014973A2 (en) 2013-07-31 2014-07-31 Use of specific glycoside phosphorylases for the implementation of phosphorolysis or reverse phosphorolysis reactions

Country Status (1)

Country Link
WO (1) WO2015014973A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020516615A (en) * 2017-04-07 2020-06-11 セカンド ゲノム インコーポレイテッド Proteins for the treatment of epithelial barrier dysfunction
US11666627B2 (en) 2017-04-07 2023-06-06 Second Genome, Inc. Proteins for the treatment of epithelial barrier function disorders
CN116350648A (en) * 2023-03-23 2023-06-30 江南大学附属医院 A polyphenol-oligosaccharide complex for treating inflammatory bowel disease and its preparation and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6000758B2 (en) * 2012-08-30 2016-10-05 国立大学法人 新潟大学 Oligosaccharide synthase and method for producing core sugar chain structure of asparagine-linked glycoprotein

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020516615A (en) * 2017-04-07 2020-06-11 セカンド ゲノム インコーポレイテッド Proteins for the treatment of epithelial barrier dysfunction
US11666627B2 (en) 2017-04-07 2023-06-06 Second Genome, Inc. Proteins for the treatment of epithelial barrier function disorders
CN116350648A (en) * 2023-03-23 2023-06-30 江南大学附属医院 A polyphenol-oligosaccharide complex for treating inflammatory bowel disease and its preparation and application
CN116350648B (en) * 2023-03-23 2024-01-26 江南大学附属医院 Polyphenol-oligosaccharide compound for treating inflammatory bowel disease and preparation and application thereof

Also Published As

Publication number Publication date
WO2015014973A3 (en) 2015-04-02

Similar Documents

Publication Publication Date Title
Gänzle Enzymatic synthesis of galacto-oligosaccharides and other lactose derivatives (hetero-oligosaccharides) from lactose
US20200390798A1 (en) Glycan polymers and related methods thereof
Elferink et al. A comprehensive overview of substrate specificity of glycoside hydrolases and transporters in the small intestine: “A gut feeling”
La Rosa et al. The human gut Firmicute Roseburia intestinalis is a primary degrader of dietary β-mannans
Juge et al. Sialidases from gut bacteria: a mini-review
Nihira et al. Discovery of β-1, 4-D-mannosyl-N-acetyl-D-glucosamine phosphorylase involved in the metabolism of N-glycans
Playne et al. Galacto-oligosaccharides and other products derived from lactose
Lammerts van Bueren et al. Prebiotic galactooligosaccharides activate mucin and pectic galactan utilization pathways in the human gut symbiont Bacteroides thetaiotaomicron
Ladeveze et al. Role of glycoside phosphorylases in mannose foraging by human gut bacteria
Hodoniczky et al. Oral and intestinal digestion of oligosaccharides as potential sweeteners: A systematic evaluation
EP2596113B1 (en) Galacto-oligosaccharide-containing composition and a method of producing it
Glaze et al. Biosynthesis of CMP-N, N′-diacetyllegionaminic acid from UDP-N, N′-diacetylbacillosamine in Legionella pneumophila
Sugiyama et al. Introduction of H-antigens into oligosaccharides and sugar chains of glycoproteins using highly efficient 1, 2-α-l-fucosynthase
Tanabe et al. Inaccuracy of AOAC method 2009.01 with amyloglucosidase for measuring non-digestible oligosaccharides and proposal for an improvement of the method
Daud et al. Characterization of edible swiftlet’s nest as a prebiotic ingredient using a simulated colon model
Jang et al. Stability of enzyme-modified flavonoid C-and O-glycosides from common buckwheat sprout extracts during in vitro digestion and colonic fermentation
Delgado-Fernandez et al. Hydrolysis of lactose and transglycosylation of selected sugar alcohols by LacA β-galactosidase from Lactobacillus plantarum WCFS1
US20190037899A1 (en) Intramolecular Trans-Sialidase
Piedrabuena et al. Exploring the transferase activity of Ffase from Schwanniomyces occidentalis, a β-fructofuranosidase showing high fructosyl-acceptor promiscuity
Díez-Municio et al. Synthesis and structural characterization of raffinosyl-oligofructosides upon transfructosylation by Lactobacillus gasseri DSM 20604 inulosucrase
WO2015014973A2 (en) Use of specific glycoside phosphorylases for the implementation of phosphorolysis or reverse phosphorolysis reactions
Nejatie et al. Kinetic and structural characterization of sialidases (Kdnases) from ascomycete fungal pathogens
Zu et al. Application of an α-galactosidase from Bacteroides fragilis on structural analysis of raffinose family oligosaccharides
Grün et al. Mechanism of action of the endo-(1→ 3)-α-glucanase MutAp from the mycoparasitic fungus Trichoderma harzianum
WO2018048305A1 (en) Prebiotic branched galacto-oligosaccharides (gos)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14749758

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14749758

Country of ref document: EP

Kind code of ref document: A2