WO2015012641A1 - L-asparatate oxidase variant and a method for producing quinolinate or nicotinic acid using the same - Google Patents

L-asparatate oxidase variant and a method for producing quinolinate or nicotinic acid using the same Download PDF

Info

Publication number
WO2015012641A1
WO2015012641A1 PCT/KR2014/006817 KR2014006817W WO2015012641A1 WO 2015012641 A1 WO2015012641 A1 WO 2015012641A1 KR 2014006817 W KR2014006817 W KR 2014006817W WO 2015012641 A1 WO2015012641 A1 WO 2015012641A1
Authority
WO
WIPO (PCT)
Prior art keywords
quinolinate
nadb67
amino acid
ppro
nada
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2014/006817
Other languages
French (fr)
Inventor
So Young Kim
Yong Uk Shin
In Kyung Heo
Ju Eun Kim
Kwang Ho Na
Chang Il Seo
Sung Kwang Son
Jae Hee Lee
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
CJ CheilJedang Corp
Original Assignee
CJ CheilJedang Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by CJ CheilJedang Corp filed Critical CJ CheilJedang Corp
Priority to JP2016529717A priority Critical patent/JP6211191B2/en
Priority to RU2016106171A priority patent/RU2648167C2/en
Publication of WO2015012641A1 publication Critical patent/WO2015012641A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/10Nitrogen as only ring hetero atom
    • C12P17/12Nitrogen as only ring hetero atom containing a six-membered hetero ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C12N9/0022Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y104/00Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/03Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C12Y104/03015D-Glutamate(D-aspartate) oxidase (1.4.3.15)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y104/00Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/03Oxidoreductases acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
    • C12Y104/03016L-Aspartate oxidase (1.4.3.16)

Definitions

  • Nicotinic acid is an oxide of nicotine and one of vitamin B complex. It is a water soluble vitamin, which is also called niacin, or vitamin B 3 and prevalent in animal and plant. Deficiency of nicotinic acid may cause pellagra disease or neuropathies.
  • nicotinic acid is present in the form of nicotinic acid amide coenzyme, i.e., nicotinamide adenine dinucleotide (NAD) or nicotinamide adenine dinucleotide phosphate (NADP), in vivo, and is involved in oxidation reduction reactions
  • quinolinate phosphoribosyltransferase nadC
  • nadD nicotinate-mononucleotide adenyl transferase
  • nadE NAD synthetase
  • NMN nadR nicotinamide-nucleotide adenyl transferase
  • pncA nicotinamidase
  • the invention provides L-aspartate oxidase variants showing that the feedback regulation by nicotinic acid or nicotinamide adenine dinucleotide (NAD) is released.
  • NAD nicotinamide adenine dinucleotide
  • the invention provides quinolinate-producing microorganisms that include the L-aspartate oxidase variants.
  • the invention provides methods of producing quinolinate by culturing the microorganisms.
  • L-aspartate oxidase has a catalytic activity of oxidizing L-aspartate to iminosuccinate, as represented in Reaction Scheme 1.
  • polynucleotide sequence encoding L-aspartate oxidase of the present invention can be hybridized with the polynucleotide of SEQ ID. NO: 24 or the probe prepared from the same under 'stringent conditions', and may be a variant modified polynucleotide sequence encoding L-aspartate oxidase which normally functions.
  • stringent conditions refer to conditions which allow the specific hybridization between the polynucleotide, and are described specifically, for example, in Molecular Cloning (A Laboratory Manual, J. Sambrook et al., Editors, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989) or Current Protocols in Molecular Biology (F.M.
  • an another amino acid refers to the other amino acid residue except the amino acid originally located in the amino acid sequence prior to the modification.
  • the another amino acid of the present invention may include one amino acid selected from the group consisting of arginine, glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, and histidine except lysine.
  • the another amino acid may include one amino acid selected from the group consisting of arginine, valine, leucine, isoleucine, methionine, tryptophan, and histidine.
  • the another amino acid may include arginine.
  • the term “302 nd” refers to the position of amino acid from the methionine of the amino acid sequence represented by SEQ ID NO: 1, since the methionine of the amino acid sequence is counted to the first amino acid residue.
  • L-aspartate oxidase In general, the activity of L-aspartate oxidase is regulated by nicotinic acid or NAD accumulated in microorganisms, in other words, its feedback regulation is inhibited by nicotinic acid or NAD.
  • the feedback regulation by nicotinic acid of NAD may be released in the L-aspartate oxidase variants of the present invention, unlike common L-aspartate oxidase.
  • a polynucleotide may have a nucleotide sequence that encodes a L-aspartate oxidase variant having an amino acid sequence which a 302 nd amino acid in the amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid.
  • 904 th to 906 th nucleotides in a nucleotide sequence represented by SEQ ID NO:24 may be appropriately substituted with any combination of nucleotides except for AAG, AAA, TAA, TAG, and TGA.
  • Another aspect of the present invention provides a vector including an above-described polynucleotide, which is operably linked to a regulatory sequence.
  • the polynucleotide may have a nucleotide sequence that 904 th to 906 th nucleotides in the nucleotide sequence represented by SEQ ID NO: 24 are appropriately substituted.
  • the polynucleotide may have a nucleotide sequence that 904 th to 906 th nucleotides in the nucleotide sequence represented by SEQ ID NO: 24 are substituted with any combination of nucleotides except for AAG, AAA, TAA, TAG, and TGA.
  • the polynucleotide may be operably linked to a regulatory sequence.
  • the regulatory sequence may regulate expression of L-aspartate oxidase, and include a promoter, a terminator, or an enhancer.
  • the promoter of the present invention may be a lambda PL promoter, a trp promoter, a lac promoter, a T7 promoter, a pPro promoter, a pCJ1 promoter, or a pCJ7 promoter (Korean Patent No. 10-0620092).
  • the promoter may be a pCJ1 promoter, but it's not limited thereof.
  • the promoter may be operably linked to a nucleotide sequence encoding a gene.
  • operably linked refers to a functional linkage between a nucleic acid expression regulatory sequence (for example, a promoter, a signal sequence, an array of transcriptional regulatory factor binding sites, a terminator, or an enhancer) and other nucleotide sequences. Accordingly, the regulatory sequence may regulate transcription and/or translation of the nucleotide sequence encoding the gene.
  • Another aspect of the present invention provides a microorganism comprising an above-described polynucleotide, wherein the polynucleotide may comprise a nucleotide sequence encoding an amino acid sequence which 302 nd amino acid in the amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid.
  • the polynucleotide may be obtained through random mutation or genetic engineering manipulation.
  • a microorganism, in which part of an amino acid sequence of SEQ ID NO: 1 is partially substituted, may be constructed by transformation of the obtained polynucleotide.
  • the term "transformation” refers to introducing a gene into a host cell to be expressed therein.
  • the transformed gene may be in any gene, for example, that is inserted into a chromosome of the host cell, or that is out of the chromosome of the host cell, as long as the introduced gene is expressible within the host cell.
  • the gene includes a polynucleotide encoding a polypeptide, such as DNA and RNA.
  • the gene may be introduced in the form of an expression cassette, which is a polynucleotide structure including all the elements required for self-expression of the gene, into a host cell.
  • the expression cassette may include a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector that is self-replicable.
  • the gene may also be introduced into a host cell by itself or in the form of a polynucleotide structure and operably linked to a sequence that is required for expression in the host cell.
  • microorganism having an ability to produce quinolinate refers to a microorganism capable of producing quinolinate from a carbon source in a culture medium and of accumulating quinolinate.
  • the microorganism having an improved ability to produce quinolinate may be further modified to enhance the activity of quinolinate synthetase.
  • the enhanced activity of the quinolinate synthetase may be achieved by additionally introducing the quinolinate synthetase to increase the expression thereof in the microorganism.
  • the enhanced activity of the quinolinate synthetase may also be achieved by replacing a promoter linked to the quinolinate synthetase in the microorganism with a strong promoter.
  • the enhanced activity of the quinolinate synthetase may be achieved by increasing the activity of the quinolinate synthetase itself.
  • the quinolinate synthetase may have an amino acid sequence represented by SEQ ID NO: 29 or may have an amino acid sequence that is homologous thereto. In other words, it is not limited thereto, because there may be the difference in the amino acid sequence of the protein depending on the microbial species or strains. It can be a mutant protein or artificial variant with an amino acid sequence comprising substitution, deletion, insertion, or addition of one or several amino acids at one or more locations of the amino acid sequence of represented by SEQ ID NO: 29, as long as it can synthesize quinolinic acid from iminosuccinic acid.
  • the sequence of gene nadA encoding this enzyme can be obtained from the genome sequence (gi: GI:89109380) of Escherichia coli ( E.
  • polynucleotide encoding the amino acid sequence of the present invention may comprise the polynucleotide sequence encoding the protein having amino acid sequence represented by SEQ ID NO: 29, or the amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, and particularly specifically 97% or more homology with the same, as long as it has similar activity as L-aspartate oxidase. The most specifically, it may be the polynucleotide sequence represented by SEQ ID NO: 26.
  • the expression of a gene encoding the quinolinate synthetase or the activity of this enzyme is enhanced, the yield of quinolinate in cells may be increased.
  • the activities of aspartic acid oxidase and quinolinate synthetase may be enhanced by substituting endogenous promoters with strong promoters, by inducing a mutation in the promoters, or by increasing the copy number of the genes.
  • strong promoters generally known strong promoters, including pTac, pTrc, pPro, pR, pL, pCJ1, pCysK, and the like, may be used.
  • the quinolinate phosphoribosyltransferase may have an activity to synthesize nicotinic acid mononucleotide from quinolinate, as shown in Reaction Scheme 3. Therefore, the yield of quinolinate in cells may be increased by deleting a gene having the activity to synthesize nicotinic acid mononucleotide or by weakening the activity of the gene.
  • Weakening or removing the activity of quinolinate phosphoribosyltransferase may be performed by substituting an endogenous gene encoding quinolinate phosphoribosyltransferase with a modified gene to weaken or remove the activity of the enzyme, by replacing a promoter of the endogenous gene with a weak promoter, or by deleting the endogenous gene encoding the enzyme from chromosome.
  • the activity of quinolinate phosphoribosyltransferase converting quinolinate into nicotinic acid mononucleotide may be removed.
  • the gene nadC encoding quinolinate phosphoribosyltransferase may be removed from the genome of the microorganism by homologous recombination.
  • the sequence of the gene nadC may be obtained from the genome sequence (GI:89106990) of E.
  • the polynucleotide encoding the amino acid sequence in of the present invention may comprise the polynucleotide sequence encoding the protein having amino acid sequence represented by SEQ ID NO: 30, or the amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, and particularly specifically 97% or more homology with the same, as long as it has similar activity as L-aspartate oxidase. The most specifically, it may be the polynucleotide sequence represented by SEQ ID NO: 25.
  • the microorganism having an ability to produce quinolinate may be a prokaryotic microorganism or an eukaryotic microorganism.
  • examples of the microorganism having an ability to produce quinolinate may belong to the genus Enterbacter , genus Escherichia , genus Erwinia , genus Serratia , genus Providencia genus, genus Corynebacterium , and genus Brevibacterium , but it's not limited thereto.
  • the microorganism having an ability to produce quinolinate may be belong to the genus Escherichia .
  • Another aspect of the present invention provides a method of producing quinolinate, comprising: culturing a microorganism that includes a polynucleotide encoding a L-aspartate oxidase which a 302 nd amino acid in an amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid; and recovering quinolinate from a cultured solution.
  • the culturing of the microorganism may be performed using a suitable culture medium under suitable culture conditions that are well-known in the art. Such culturing procedures may be used by one of ordinary skill in the art and may be readily adjusted depending on a selected microorganism.
  • the culturing method may include a batch culture type, a continuous culture type, and a fed-batch culture type, but it's not limited thereto.
  • Various examples of culturing methods are disclosed in, for example, "Biochemical Engineering” (by James M. Lee , Prentice-Hall International Editions, pp 138-176").
  • Examples of carbon sources available for the culture medium may include carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, and starch; oils and fats, such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids, such as palmitic acid, stearic acid, and linoleic acid; alcohols, such as glycol and ethanol; and organic acids, such as acetic acid, which may be used alone or in combination, but it's not limited thereto.
  • carbohydrates such as glucose, sucrose, lactose, fructose, maltose, and starch
  • oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil
  • fatty acids such as palmitic acid, stearic acid, and linoleic acid
  • alcohols such as glycol and ethanol
  • organic acids such as acetic acid, which may be used alone or in combination, but it's not limited thereto.
  • nitrogen sources available for the culture medium may include organic nitrogen sources, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor (CSL), soybean flour, and urea; and inorganic nitrogen sources, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, which may be used alone or in combination, but it's not limited thereto.
  • organic nitrogen sources such as peptones, yeast extract, meat extract, malt extract, corn steep liquor (CSL), soybean flour, and urea
  • inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, which may be used alone or in combination, but it's not limited thereto.
  • Examples of phosphorous sources available for the culture media may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts.
  • the culture medium may also include metal salts such as magnesium sulfate or iron sulfate.
  • the culture medium may further include amino acids, vitamins, and suitable precursors, in addition to the above-listed components.
  • the culture medium for culturing microorganisms, or individual components may be added to a culture solution in a batch or continuous manner.
  • the pH of the culture solution may be adjusted by adding a compound, for example, ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, or sulfuric acid in a proper manner.
  • foaming in the culture solution may be suppressed using an anti-foaming agent such as a fatty acid, for example, polyglycol ester.
  • oxygen or an oxygen-containing gas for example, air
  • the temperature of the culture solution may be maintained in a temperature range of about 20°C to about 45°C, specifically about 25°C to about 40°C.
  • the culturing may be maintained until a target quantity of quinolinate is obtained, specifically, the period may be about 10 hours to 160 hours.
  • Another aspect of the present invention provides a method of producing nicotinic acid, comprising: culturing a microorganism that includes a polynucleotide encoding L-aspartate oxidase which 302 nd amino acid in an amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid; and conducting decarboxylation reaction by adding an acid to a cultured product.
  • decarboxylation reaction refers to a reaction to produce nicotinic acid by removing a carboxyl group from quinolinate and releasing carbon dioxide.
  • the resulting quinolinate-including culture solution may be subjected to centrifugation or membrane filtration to remove the microorganism. Then, to accelerate the decarboxylation reaction, an acid that provides a hydrogen group may be added into the quinolinate-including culture solution. Any acid may be used without limitation, as long as it can provide hydrogen group to the culture solution.
  • the acid being added into the culture solution may be hydrochloric acid or sulfuric acid.
  • the culture solution may be have a pH of about 5 or less, or may specifically be in a range of about 2 to about 3.
  • the decarboxylation reaction of the culture solution may be performed at a temperature of about 100°C to about 150°C, or may specifically be in a range of about 120°C to about 135°C.
  • the decarboxylation reaction of the culture solution may be performed at a pressure of about 0.1 MPa to about 0.5 Mpa, or may specifically be performed at a pressure of about 0.2 MPa to about 0.4 MPa.
  • quinolinate in the culture solution may be converted into nicotinic acid, as shown in Reaction Scheme 4.
  • the method of producing nicotinic acid may further include recovering and purifying the nicotinic acid.
  • the recovering of nicotinic acid may be conducted by a common method known in the art, including filtration of the culture solution and crystallization processes.
  • quinolinate may be effectively produced by culturing a microorganism including a L-aspartate oxidase variant that the feedback regulation by nicotinic acid or NAD. Nicotinic acid is released.
  • FIG. 1 illustrates a pathway to produce nicotinic acid in a method of producing nicotinic acid according to an embodiment of the present invention.
  • an E. coli -derived nadB gene encoding the wild L-aspartate oxidase was cloned in an expression vector.
  • a chromosome of E.coli K12 W3110 strain was used as a template.
  • the strain was purchased from the American Type Culture Collection (ATCC No.23257).
  • SEQ ID NO: 24 obtained from the GenBank of the National Institute of Health (NIH GenBank).
  • Primers of SEQ ID NOs: 2 and 3 having the recognition sites of restriction enzymes NdeI and BamHI are constructed to amplify the ORF region of the nadB gene, for gene cloning.
  • PCR was conducted using chromosomal DNA of E.coli K12 W3110 as the template and oligonucleotides represented by SEQ ID NOs: 2and 3 as primers.
  • the polymerase used was PfuUltra TM DNA polymerase (Stratagene, U.S.A.), and PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 2 minutes.
  • an amplified gene of about 1.9 kb including the nadB ORF gene and the recognition sites of restriction enzymes NdeI and BamHI was obtained.
  • nadB gene obtained through the PCR was recovered by agarose gel elution, and then treated with the restriction enzymes NdeI and BamHI, followed by ligation into a pProLar vector (CloneTech, U.S.A) treated with the restriction enzymes NdeI and BamHI so as to express L-aspartate oxidase from the nadB gene linked to a pPro promoter.
  • the resulting vector was named "pPro-nadB vector".
  • nadB gene variant library was constructed using the pPro-nadB vector obtained in ⁇ 1-1> as a template by error-prone PCR in the presence of dGTP and MnSO 4 .
  • PCR was conducted using these obtained fragments as templates under the PCR conditions by repeating 10 times of the cycle comprising denaturation at 96°C for 60 seconds, denaturation at 50°C for 60 seconds, and extension at 72°C for 1 minute, and 20 repetition of the cycle after addition of primers of SEQ ID NOs. 7 and 8.
  • a nadB -deficient cassette containing the upstream region of nadB gene-loxpCm-downstream region of nadB gene of 1.8 kb was obtained.
  • a pPro - nadB- pCJ1-nadA recombinant vector of 5.9 kb was constructed, in which the nadB gene expression is regulated by the pPro promoter as a constitutive promoter, and the nadA gene expression is regulated by pCJ1 promoter.
  • the constructed pPro - nadB-pCJ1-nadA had the sequence represented by SEQ ID NO: 27.
  • a recombinant vector pPro-nadB67-pCJ1-nadA including the nadB variant and the wild nadA gene was also constructed.
  • the constructed pPro-nadB67-pCJ1-nadA had the sequence represented by SEQ ID NO: 28.
  • the polymerase used was PfuUltra TM DNA polymerase (Stratagene, U.S.A), and the PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 72°C for 2 minutes.
  • amplified genes of about 1.9 kb of the wild type nadB and the nadB67 variant including the recognition sites of the restriction enzymes BamHI and NdeI were obtained.
  • Cells including the overexpressed wild type L-aspartate oxidase and L-aspartate oxidase variants were recovered from the culture medium, followed by purification of the wild type L-aspartate oxidase and L-aspartate oxidase variants from the recovered cells by Ni-NTA spin kit (Quiagen, U.S.A).
  • the recovered protein was 50% of a total protein, about 2% of the recovered protein was recovered as L-aspartate oxidase.
  • the L-aspartate oxidase converts aspartate as a substrate to iminoaspartate in the presence of an FAD as cofactor, and the imminoaspartate is converted b to oxaloacetate.
  • Hydrogen peroxide (H 2 O 2 ) that is generated through the above-described reaction, was used to identify the activity of the nadB. Absorbance at 560 nm of a reaction product of H 2 O 2 with a product from the reaction was measured using an Amplex Red (Invitrogen, Korea) to determine the activity of the nadB.
  • NAD was added at different concentrations to create a condition for competitive inhibition to FAD so as to evaluate the resistance of L-aspartate oxidase against the feedback regulation by NAD.
  • the Relative activity of the wild type L-aspartate oxidase at a NAD concentration of 1 mM was less than 50 %, while the relative activities of the L-aspartate oxidase variants at the same NAD concentration remained about 70% or higher (Table 14), thereby indicating that the feedback regulation by NAD was released in L-aspartate oxidase variants.
  • the present invention is related to L-aspartate oxidase variants that are resistant against the feedback regulation by nicotinic acid or NAD, and thus may effectively produce quinolinate.
  • Quinolinate may be effectively produced by culturing of a microorganism including such a L-aspartate oxidase variant according to the embodiments of the present invention.
  • Quinolinate may also be effectively produced using the microorganism in which the activity of quinolinate synthetase is additionally enhanced or the activity of quinolinate phosphoribosyltransferase is additionally weakened. Through such transformation of the microorganism, the yield of quinolinate or nicotinic acid may be improved, which is industrially and highly useful.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

To produce quinolinate effectively, a L-aspartate oxidase variant that the feedback regulation by nicotinic acid or NAD is released, and a microorganism including the L-aspartate oxidase variant are provided. Quinolinate may be effectively produced by culturing of the microorganism including the L-aspartate oxidase variant.

Description

L-ASPARATATE OXIDASE VARIANT AND A METHOD FOR PRODUCING QUINOLINATE OR NICOTINIC ACID USING THE SAME
The invention relates to L-aspartate oxidase variants, quinolinate-producing microorganisms including genes that encode the L-aspartate oxidase variants, and methods of producing quinolinate or nicotinic acid in high efficiency by using the microorganisms.
Nicotinic acid is an oxide of nicotine and one of vitamin B complex. It is a water soluble vitamin, which is also called niacin, or vitamin B3 and prevalent in animal and plant. Deficiency of nicotinic acid may cause pellagra disease or neuropathies. In general, nicotinic acid is present in the form of nicotinic acid amide coenzyme, i.e., nicotinamide adenine dinucleotide (NAD) or nicotinamide adenine dinucleotide phosphate (NADP), in vivo, and is involved in oxidation reduction reactions
Quinolinate, which is also called quinolinic acid, is produced by oxidation of quinoline. Quinolinic acid is known to have neurotoxicity and cause various neurological disorders. Quinolinate is also known as a precursor of nicotinic acid.
Nicotinic acid that is widely applicable to the foods and medicinal products may be prepared by a chemical synthetic method or a biological production method. Chemical synthesis of nicotinic acid may result in large quantities of toxic waste including catalysts. Thus, the waste is required for a thorough management and great expenses for disposal. In addition, pyrimidine used as a precursor has various derivatives, and then fluctuations in supply and price of pyrimidine cause an unstable price of nicotniic acid.
To solve the such problems from the chemical synthesis method, biological methods of producing nicotinic acid by using renewable carbohydrate-derived materials have been studied. Biological production of nicotinic acid is accomplished mainly through two biosynthetic pathways, one of which is a biosynthetic pathway of nicotinic acid from tryptophan as a starting material in eukaryotes, and the other is from aspartic acid as a starting material as in prokaryotes. Both of the pathways use quinolinate as an intermediate, and biosynthesize nicotinic acid from quinolinate by the action of quinolinate phosphoribosyltransferase (nadC), nicotinate-mononucleotide adenyl transferase (nadD), NAD synthetase (nadE), nicotinamide-nucleotide adenyl transferase (NMN nadR), and nicotinamidase (pncA).
Biological synthesis methods of nicotinic acid by using recombinant E. coli or Corynebacterium glutamicum via the pathway of aspartic acid is disclosed (Korean Patent No. 10-1223904). While the inventors of the present invention researched to address the problems from such biological synthesis methods of nicotinic acid and to improve the yield of quinolinate or nicotinic acid, they found enzyme variants involved in the high-yield production of quinolinate and completed the present invention.
The invention provides L-aspartate oxidase variants showing that the feedback regulation by nicotinic acid or nicotinamide adenine dinucleotide (NAD) is released.
The invention provides quinolinate-producing microorganisms that include the L-aspartate oxidase variants.
The invention provides methods of producing quinolinate by culturing the microorganisms.
The invention provides methods of producing nicotinic acid by culturing the microorganisms and decarboxylation of quinolinate.
An aspect of the present invention provides an L-aspartate oxidase variant having an amino acid sequence which a 302nd amino acid in amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid.
L-aspartate oxidase has a catalytic activity of oxidizing L-aspartate to iminosuccinate, as represented in Reaction Scheme 1.
<Reaction Scheme 1>
L-Aspartate + Fumarate <=> α-iminosuccinate + Succinate + H+
L-Aspartate + Oxygen <=> Hydrogen peroxide + α-iminosuccinate + H+
L-aspartate oxidase of the present invention may comprise the amino acid sequence represented by SEQ ID NO: 1. However, it is not limited thereto, because there may be the difference in the amino acid sequence of the protein depending on the microbial species or strains. In other words, it can be a mutant protein or artificial variant with an amino acid sequence comprising substitution, deletion, insertion, or addition of one or several amino acids at one or more locations of the amino acid sequence of represented by SEQ ID NO: 1, as long as it can oxidize L-aspartate to iminosuccinate. Herein, "several" may differ depending on the location or type in the three-dimensional structure of amino acid residues of the protein, but specifically means 2 to 20, specifically 2 to 10, and more specifically 2 to 5. In addition, the substitution, deletion, insertion, addition or inversion of the amino acid includes those caused by artificial variants or natural mutation, if based on the difference in the individual or species of microorganism.
The polynucleotide encoding the amino acid sequence in of the present invention may comprise the polynucleotide sequence encoding the protein having amino acid sequence represented by SEQ ID NO: 1, or the amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, and particularly specifically 97% or more homology with the same, as long as it has similar activity as L-aspartate oxidase. The most specifically, it may be the polynucleotide sequence represented by SEQ ID NO: 24.
The term "homology" refers to the identity between two amino acid sequences and may be determined by the well known method well known to those skilled in the art, using BLAST 2.0 to compute the parameter such as score, identity and similarity.
In addition, the polynucleotide sequence encoding L-aspartate oxidase of the present invention can be hybridized with the polynucleotide of SEQ ID. NO: 24 or the probe prepared from the same under 'stringent conditions', and may be a variant modified polynucleotide sequence encoding L-aspartate oxidase which normally functions. As used herein, "stringent conditions" refer to conditions which allow the specific hybridization between the polynucleotide, and are described specifically, for example, in Molecular Cloning (A Laboratory Manual, J. Sambrook et al., Editors, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989) or Current Protocols in Molecular Biology (F.M. Ausubel et al., Editors, John Wiley & Sons, Inc., New York). For example, which describes, for example, the hybridization is carried out in the hybridization buffer of 65℃ (3.5 SSC, 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 2.5 mM NaH2PO4 (pH 7), 0.5% SDS, 2 mM EDTA). SSC is 0.15 M sodium chloride/0.15 M sodium citrate of pH 7. After hybridization, the membrane to which DNA is delivered transfered is rinsed with 2 X SSC at room temperature and then rinsed again with 0.1 to 0.5 X SSC/0.1 X SDS at a temperature of 68℃.
As used herein, the term "an another amino acid" refers to the other amino acid residue except the amino acid originally located in the amino acid sequence prior to the modification. Specifically the another amino acid of the present invention may include one amino acid selected from the group consisting of arginine, glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, and histidine except lysine. Specifically, the another amino acid may include one amino acid selected from the group consisting of arginine, valine, leucine, isoleucine, methionine, tryptophan, and histidine. For example, the another amino acid may include arginine.
As used herein, the term "302nd" refers to the position of amino acid from the methionine of the amino acid sequence represented by SEQ ID NO: 1, since the methionine of the amino acid sequence is counted to the first amino acid residue.
In general, the activity of L-aspartate oxidase is regulated by nicotinic acid or NAD accumulated in microorganisms, in other words, its feedback regulation is inhibited by nicotinic acid or NAD. The feedback regulation by nicotinic acid of NAD may be released in the L-aspartate oxidase variants of the present invention, unlike common L-aspartate oxidase.
The other aspect of the present invention provides a polynucleotide having a nucleotide sequence that encodes for the L-aspartate oxidase variants.
In an embodiment of the present invention, a polynucleotide may have a nucleotide sequence that encodes a L-aspartate oxidase variant having an amino acid sequence which a 302nd amino acid in the amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid.
The 302nd amino acid may include one amino acid selected from the group consisting of arginine, glycine, alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagine, glutamine, and histidine. Accordingly, the nucleotide sequence corresponding to the 302nd amino acid may be appropriately substituted. In a specific embodiment, 904th to 906th nucleotides in a nucleotide sequence represented by SEQ ID NO:24 may be appropriately substituted with any combination of nucleotides except for AAG, AAA, TAA, TAG, and TGA.
Another aspect of the present invention provides a vector including an above-described polynucleotide, which is operably linked to a regulatory sequence.
The polynucleotide may have a nucleotide sequence that 904th to 906th nucleotides in the nucleotide sequence represented by SEQ ID NO: 24 are appropriately substituted. In a specific embodiment, the polynucleotide may have a nucleotide sequence that 904th to 906th nucleotides in the nucleotide sequence represented by SEQ ID NO: 24 are substituted with any combination of nucleotides except for AAG, AAA, TAA, TAG, and TGA. The polynucleotide may be operably linked to a regulatory sequence. The regulatory sequence may regulate expression of L-aspartate oxidase, and include a promoter, a terminator, or an enhancer.
The vector of the present invention is not specifically limited, and may be any vector known in the art. For example, the vector may be pCR2.1-TOPO vector (Invitrogen, U.S.A) or pECCG117 (KFCC-10673), but it's not limited thereof.
The promoter of the present invention may be a lambda PL promoter, a trp promoter, a lac promoter, a T7 promoter, a pPro promoter, a pCJ1 promoter, or a pCJ7 promoter (Korean Patent No. 10-0620092). In a specific embodiment, the promoter may be a pCJ1 promoter, but it's not limited thereof.
The promoter may be operably linked to a nucleotide sequence encoding a gene. As used herein, the term "operably linked" refers to a functional linkage between a nucleic acid expression regulatory sequence (for example, a promoter, a signal sequence, an array of transcriptional regulatory factor binding sites, a terminator, or an enhancer) and other nucleotide sequences. Accordingly, the regulatory sequence may regulate transcription and/or translation of the nucleotide sequence encoding the gene.
Another aspect of the present invention provides a microorganism comprising an above-described polynucleotide, wherein the polynucleotide may comprise a nucleotide sequence encoding an amino acid sequence which 302nd amino acid in the amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid.
In a specific embodiment, according to the substitution of the 302nd amino acid in the amino acid sequence of SEQ ID NO: 1, part of a nucleotide sequence of SEQ ID NO: 24 may be substituted. For example, the polynucleotide may comprise a polynucleotide that 904th to 906th nucleotides in the nucleotide sequence of SEQ ID NO: 24 are substituted with other nucleotides.
The polynucleotide may be obtained through random mutation or genetic engineering manipulation. A microorganism, in which part of an amino acid sequence of SEQ ID NO: 1 is partially substituted, may be constructed by transformation of the obtained polynucleotide.
As used herein, the term "transformation" refers to introducing a gene into a host cell to be expressed therein. The transformed gene may be in any gene, for example, that is inserted into a chromosome of the host cell, or that is out of the chromosome of the host cell, as long as the introduced gene is expressible within the host cell. The gene includes a polynucleotide encoding a polypeptide, such as DNA and RNA. For example, the gene may be introduced in the form of an expression cassette, which is a polynucleotide structure including all the elements required for self-expression of the gene, into a host cell. Typically, the expression cassette may include a promoter operably linked to the gene, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector that is self-replicable. The gene may also be introduced into a host cell by itself or in the form of a polynucleotide structure and operably linked to a sequence that is required for expression in the host cell.
As used herein, the term "microorganism having an ability to produce quinolinate" refers to a microorganism capable of producing quinolinate from a carbon source in a culture medium and of accumulating quinolinate.
To improve the ability to produce quinolinate, it is required that microorganisms produce large quantities of quinolinate, and the produced quinolinate can be accumulated without being used in other ways. Therefore, in some embodiments of the present invention, the microorganism having an improved ability to produce quinolinate may be obtained by removing or weakening the activity of quinolinate phosphoribosyltransferase that is involved in a decomposition pathway of quinolinate, by enhancing the expression or activity of quinolinate synthetase that is involved in a synthetic pathway of quinolinate, or by a combination thereof.
In a specific embodiment, the microorganism having an improved ability to produce quinolinate may be further modified to enhance the activity of quinolinate synthetase. Specifically, the enhanced activity of the quinolinate synthetase may be achieved by additionally introducing the quinolinate synthetase to increase the expression thereof in the microorganism. The enhanced activity of the quinolinate synthetase may also be achieved by replacing a promoter linked to the quinolinate synthetase in the microorganism with a strong promoter. In addition, the enhanced activity of the quinolinate synthetase may be achieved by increasing the activity of the quinolinate synthetase itself.
In the case where the heterogenous quinolinate synthetase is introduced, a polynucleotide encoding this enzyme may be introduced to increase the expression of the polynucleotide. The polynucleotide encoding the quinolinate synthetase may be expressed in a plasmid of the microorganism or may be inserted into a chromosome of the microorganism and expressed therein.
The quinolinate synthetase may have an amino acid sequence represented by SEQ ID NO: 29 or may have an amino acid sequence that is homologous thereto. In other words, it is not limited thereto, because there may be the difference in the amino acid sequence of the protein depending on the microbial species or strains. It can be a mutant protein or artificial variant with an amino acid sequence comprising substitution, deletion, insertion, or addition of one or several amino acids at one or more locations of the amino acid sequence of represented by SEQ ID NO: 29, as long as it can synthesize quinolinic acid from iminosuccinic acid. The sequence of gene nadA encoding this enzyme can be obtained from the genome sequence (gi: GI:89109380) of Escherichia coli (E. coli) as disclosed in an article (Mol Syst Biol., 2006;2:2006.0007., Epub 2006 Feb 21) or the database available from the National Center for Biotechnology Information (NCBI) or the DNA Data Bank of Japan (DDBJ). Also, the polynucleotide encoding the amino acid sequence of the present invention may comprise the polynucleotide sequence encoding the protein having amino acid sequence represented by SEQ ID NO: 29, or the amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, and particularly specifically 97% or more homology with the same, as long as it has similar activity as L-aspartate oxidase. The most specifically, it may be the polynucleotide sequence represented by SEQ ID NO: 26.
The quinolinate synthetase has an activity to synthesize quinolinic acid from iminosuccinic acid, as shown in Reaction Scheme 2.
<Reaction Scheme 2>
α-iminosuccinate + Dihydroxyacetone phosphate <=> Quinolinate + Phosphate + 2H2O
Therefore, when the expression of a gene encoding the quinolinate synthetase or the activity of this enzyme is enhanced, the yield of quinolinate in cells may be increased.
In some embodiments, in the microorganism having an ability to produce quinolinate, the activities of aspartic acid oxidase and quinolinate synthetase may be enhanced by substituting endogenous promoters with strong promoters, by inducing a mutation in the promoters, or by increasing the copy number of the genes. For the substitution with strong promoters, generally known strong promoters, including pTac, pTrc, pPro, pR, pL, pCJ1, pCysK, and the like, may be used.
In a specific embodiment, there is provided a microorganism having an improved ability to produce quinolinate, wherein the activity of quinolinate phosphoribosyltransferase may be additionally reduced or removed.
The activity of quinolinate phosphoribosyltransferase may be reduced or removed by modifying a gene encoding quinolinate phosphoribosyltransferase or by using a microRNA that suppresses transcription.
The quinolinate phosphoribosyltransferase may have an amino acid sequence represented by SEQ ID NO: 30 or an amino acid sequence that is highly homologous thereto. In other words, it is not limited thereto, because there may be the difference in the amino acid sequence of the protein depending on the microbial species or strains. It can be a mutant protein or artificial variant with an amino acid sequence comprising substitution, deletion, insertion, or addition of one or several amino acids at one or more locations of the amino acid sequence of represented by SEQ ID NO: 30, as long as it can synthesize nicotinic acid (nicotinate) mononucleotide from quinolinate.
The quinolinate phosphoribosyltransferase may have an activity to synthesize nicotinic acid mononucleotide from quinolinate, as shown in Reaction Scheme 3. Therefore, the yield of quinolinate in cells may be increased by deleting a gene having the activity to synthesize nicotinic acid mononucleotide or by weakening the activity of the gene.
<Reaction Scheme 3>
5-Phospho-α-D-ribose 1-diphosphate + Quinolinate + 2H+ <=> CO2 + Diphosphate + Nicotinate ribonucleotide
Weakening or removing the activity of quinolinate phosphoribosyltransferase may be performed by substituting an endogenous gene encoding quinolinate phosphoribosyltransferase with a modified gene to weaken or remove the activity of the enzyme, by replacing a promoter of the endogenous gene with a weak promoter, or by deleting the endogenous gene encoding the enzyme from chromosome.
In a specific embodiment, in the microorganism having an improved activity to produce quinolinate, the activity of quinolinate phosphoribosyltransferase converting quinolinate into nicotinic acid mononucleotide may be removed. To this end, the gene nadC encoding quinolinate phosphoribosyltransferase may be removed from the genome of the microorganism by homologous recombination. The sequence of the gene nadC may be obtained from the genome sequence (GI:89106990) of E. coli as disclosed in an article (Mol Syst Biol., 2006;2:2006.0007, Epub 2006 Feb 21), or the database available from the National Center for Biotechnology Information (NCBI) or the DNA Data Bank of Japan (DDBJ). Also, the polynucleotide encoding the amino acid sequence in of the present invention may comprise the polynucleotide sequence encoding the protein having amino acid sequence represented by SEQ ID NO: 30, or the amino acid sequence of 80% or more, specifically 90% or more, more specifically 95% or more, and particularly specifically 97% or more homology with the same, as long as it has similar activity as L-aspartate oxidase. The most specifically, it may be the polynucleotide sequence represented by SEQ ID NO: 25.
In a specific embodiment, the microorganism having an ability to produce quinolinate may be a prokaryotic microorganism or an eukaryotic microorganism.
In some embodiments, examples of the microorganism having an ability to produce quinolinate may belong to the genus Enterbacter, genus Escherichia, genus Erwinia, genus Serratia, genus Providencia genus, genus Corynebacterium, and genus Brevibacterium, but it's not limited thereto.
In a specific embodiment, the microorganism having an ability to produce quinolinate may be belong to the genus Escherichia.
Specifically, the microorganism having an ability to produce quinolinate may be Escherichia coli (E. coli).
Another aspect of the present invention provides a method of producing quinolinate, comprising: culturing a microorganism that includes a polynucleotide encoding a L-aspartate oxidase which a 302nd amino acid in an amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid; and recovering quinolinate from a cultured solution.
The culturing of the microorganism may be performed using a suitable culture medium under suitable culture conditions that are well-known in the art. Such culturing procedures may be used by one of ordinary skill in the art and may be readily adjusted depending on a selected microorganism. The culturing method may include a batch culture type, a continuous culture type, and a fed-batch culture type, but it's not limited thereto. Various examples of culturing methods are disclosed in, for example, "Biochemical Engineering" (by James M. Lee, Prentice-Hall International Editions, pp 138-176").
The culture medium used in the culturing process is required to satisfy suitable conditions for a selected microorganism. Various culture media for microorganisms are disclosed in, for example, "Manual of Methods for General Bacteriology (by the American Society for Bacteriology, Washington D.C., U.S.A, 1981)". For example, the culture medium may include various carbon sources, nitrogen sources, and trace elements.
Examples of carbon sources available for the culture medium may include carbohydrates, such as glucose, sucrose, lactose, fructose, maltose, and starch; oils and fats, such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids, such as palmitic acid, stearic acid, and linoleic acid; alcohols, such as glycol and ethanol; and organic acids, such as acetic acid, which may be used alone or in combination, but it's not limited thereto.
Examples of nitrogen sources available for the culture medium may include organic nitrogen sources, such as peptones, yeast extract, meat extract, malt extract, corn steep liquor (CSL), soybean flour, and urea; and inorganic nitrogen sources, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, which may be used alone or in combination, but it's not limited thereto.
Examples of phosphorous sources available for the culture media may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts. In some embodiments, the culture medium may also include metal salts such as magnesium sulfate or iron sulfate. In some embodiments, the culture medium may further include amino acids, vitamins, and suitable precursors, in addition to the above-listed components. The culture medium for culturing microorganisms, or individual components may be added to a culture solution in a batch or continuous manner.
In some embodiments, during the culture, the pH of the culture solution may be adjusted by adding a compound, for example, ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, or sulfuric acid in a proper manner. In addition, during the culture, foaming in the culture solution may be suppressed using an anti-foaming agent such as a fatty acid, for example, polyglycol ester. To keep the culture solution in an aerobic condition, oxygen or an oxygen-containing gas (for example, air) may be supplied into the culture solution. The temperature of the culture solution may be maintained in a temperature range of about 20℃ to about 45℃, specifically about 25℃ to about 40℃. The culturing may be maintained until a target quantity of quinolinate is obtained, specifically, the period may be about 10 hours to 160 hours.
Another aspect of the present invention provides a method of producing nicotinic acid, comprising: culturing a microorganism that includes a polynucleotide encoding L-aspartate oxidase which 302nd amino acid in an amino acid sequence represented by SEQ ID NO:1 is substituted with another amino acid; and conducting decarboxylation reaction by adding an acid to a cultured product.
As used herein, the term "decarboxylation reaction" refers to a reaction to produce nicotinic acid by removing a carboxyl group from quinolinate and releasing carbon dioxide.
In particular, after the culturing of the microorganism, the resulting quinolinate-including culture solution may be subjected to centrifugation or membrane filtration to remove the microorganism. Then, to accelerate the decarboxylation reaction, an acid that provides a hydrogen group may be added into the quinolinate-including culture solution. Any acid may be used without limitation, as long as it can provide hydrogen group to the culture solution.
In an embodiment, the quinolinate-including culture solution may be used without purification.
In an embodiment, the acid being added into the culture solution may be hydrochloric acid or sulfuric acid.
In an embodiment, after the addition of the acid, the culture solution may be have a pH of about 5 or less, or may specifically be in a range of about 2 to about 3.
In an embodiment, the decarboxylation reaction of the culture solution may be performed at a temperature of about 100℃ to about 150℃, or may specifically be in a range of about 120℃ to about 135℃.
In an embodiment, the decarboxylation reaction of the culture solution may be performed at a pressure of about 0.1 MPa to about 0.5 Mpa, or may specifically be performed at a pressure of about 0.2 MPa to about 0.4 MPa.
Upon conducting the decarboxylation under high-temperature and high-pressure conditions for about 1 hour to 3 hours after the addition of an acid into the quinolinate-including culture solution, quinolinate in the culture solution may be converted into nicotinic acid, as shown in Reaction Scheme 4.
<Reaction Scheme 4>
Quinolinate + 2H+ <=> CO2 + Nicotinic acid
In an embodiment, the method of producing nicotinic acid may further include recovering and purifying the nicotinic acid.
In an embodiment, the recovering of nicotinic acid may be conducted by a common method known in the art, including filtration of the culture solution and crystallization processes.
According to embodiments of the present invention, quinolinate may be effectively produced by culturing a microorganism including a L-aspartate oxidase variant that the feedback regulation by nicotinic acid or NAD. Nicotinic acid is released. These methods using the microorganism may solve the problems from the conventional chemical synthesis methods, regarding environmental issues due to generation of catalyst byproducts, high-energy consumption and use of non-renewable resources, and the problem of low yield with the conventional biosynthesis methods. Consequently, these methods may efficiently produce quinolinate and nicotinic acid in an environmental-friendly manner.
FIG. 1 illustrates a pathway to produce nicotinic acid in a method of producing nicotinic acid according to an embodiment of the present invention.
The present invention will be described in further detail with reference to the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention.
Example 1. Preparation of L-aspartate oxidase variants NAD-feedback regulation is released
<1-1> Construction of plasmid expressing L-aspartate oxidase
To prepare L-aspartate oxidase variants, an E. coli-derived nadB gene encoding the wild L-aspartate oxidase was cloned in an expression vector. To this end, a chromosome of E.coli K12 W3110 strain was used as a template. The strain was purchased from the American Type Culture Collection (ATCC No.23257). Based on the nucleotide sequence for the nadB gene (NCBI Registration No. "GI:89109380") represented by SEQ ID NO: 24 obtained from the GenBank of the National Institute of Health (NIH GenBank). Primers of SEQ ID NOs: 2 and 3 having the recognition sites of restriction enzymes NdeI and BamHI are constructed to amplify the ORF region of the nadB gene, for gene cloning.
Table 1
Nucleotide sequence SEQ ID NO
5' AATTCATATGAATACTCTCCCTGAACATT 3' 2
5' AATTGGATCCCTATACCACTACGCTTGATCAC 3' 3
PCR was conducted using chromosomal DNA of E.coli K12 W3110 as the template and oligonucleotides represented by SEQ ID NOs: 2and 3 as primers. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A.), and PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 50℃ for 30 seconds, and extension at 72℃ for 2 minutes. Through the PCR, an amplified gene of about 1.9 kb including the nadB ORF gene and the recognition sites of restriction enzymes NdeI and BamHI was obtained.
The nadB gene obtained through the PCR was recovered by agarose gel elution, and then treated with the restriction enzymes NdeI and BamHI, followed by ligation into a pProLar vector (CloneTech, U.S.A) treated with the restriction enzymes NdeI and BamHI so as to express L-aspartate oxidase from the nadB gene linked to a pPro promoter. The resulting vector was named "pPro-nadB vector".
<1-2> Construction of plasmid library of L-aspartate oxidase variant
To obtain L-aspartate oxidase variants, a nadB gene variant library was constructed using the pPro-nadB vector obtained in <1-1> as a template by error-prone PCR in the presence of dGTP and MnSO4.
In the error-prone PCR using the pPro-nadB recombinant vector as a template, primers 4 and 5 were used, concentrations of dGTP and MnSO4 in a PCR mix, which were used to control a GC rate and an error rate, were 2 mM and 8 mM, respectively, and the polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A.). PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 50℃ for 30 seconds, and extension at 72℃ for 2 minutes. Through the PCR, a DNA fragment of about 1.9 kb was obtained. This DNA fragment was purified via agarose gel elution, treated with the restriction enzyme DpnI (NEB, U.S.A) for about 1 hour, and then transformed into E.coli DH5α strain (Invitrogen, U.S.A.) via CaCl2 method. The transformed E.coli DH5α strain was smeared on a Luria-Bertani (LB)-kanamycin(Km) (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, kanamycin 25 ㎍/L) plate medium, and cultured overnight at 37℃ to obtain kanamycin-resistant colonies. Ten clones were randomly selected from them, followed by sequencing. As a result, the error rate of the nadB gene was estimated to be about 4.5 nucleotide/1 kb. The number of strains with a nadB gene variant obtained was about 3x 105 or more.
Table 2
Nucleotide sequence SEQ ID NO
5' CTCGAGCATAGCATTTTTATCC 3' 4
5' CAGTGAGCGAGGAAGCGG 3' 5
<1-3> Selection of L-aspartate oxidase variants showing released NAD-feedback regulation
<1-3-1> Construction of L-aspartate oxidase-deficient strain
The nadB gene negatively affects on the production of quinolinate under the feedback regulation by NAD (J Biol Chem. 1982 Jan 25;257(2):626-32.). For this reason, it is important to discover a nadB gene the feedback regulation by NAD is released. To effectively selecting better naB gene variants, an endogenous nadB gene was removed from a strain. Based on the nucleotide sequence for the nadB gene (NCBI Registration No. "GI:89109380") represented by SEQ ID NO: 24 obtained from the GenBank of the National Institute of Health (NIH GenBank), primers of SEQ ID NOs: 6 and 7 able to amplify the downstream region of the nadB gene, primers of SEQ ID NOs: 8 and 9 able to amplify the upstream region of the nadB gene, and primers of SEQ ID NOs: 10 and 11 able to amplify loxpCm were constructed.
Table 3
Nucleotide sequence SEQ ID NO
5' CATTATACGAACGGTACCCCAAAGCCTGGGTCAGCGCCGT 3' 6
5' GGCGGATATTCAGCAGTGG 3' 7
5' CCCAAACCAAATTTCCACG 3' 8
5' CGGTAGGTACCGAGCTCGAATTTCTTTGTTTAATTTACTA 3' 9
5' TAGTAAATTAAACAAAGAAATTCGAGCTCGGTACCTACCG 3' 10
5' ACGGCGCTGACCCAGGCTTTGGGGTACCGTTCGTATAATG 3' 11
PCR was performed using a chromosomal DNA of E. coli K12 W3110 (ATCC NO. 23257) as a template and oligonucleotides of SEQ ID NOs. 6 and 7 as primers to amplify the upstream and SEQ ID NOs. 8 and 9 as primers to amplify downstream regions of nadB gene of 0.4 kb and 0.4 kb, respectively. In addition, PCR was performed using the plasmid vector containing loxpCm, pLoxpCat2 vector, as a template and oligonucleotides of SEQ ID NOs. 10 and 11 as primers to amplify loxpCm gene having the sequence homologous to nadB gene on both ends of 1.0 kb. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A), and the PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 53℃ for 30 seconds, and extension at 72℃ for 1 minute, followed by agarose gel elution to obtain a nadB-upstream fragment, a nadB-downstream fragment, and a loxpCm fragment. PCR was conducted using these obtained fragments as templates under the PCR conditions by repeating 10 times of the cycle comprising denaturation at 96℃ for 60 seconds, denaturation at 50℃ for 60 seconds, and extension at 72℃ for 1 minute, and 20 repetition of the cycle after addition of primers of SEQ ID NOs. 7 and 8. As a result, a nadB-deficient cassette containing the upstream region of nadB gene-loxpCm-downstream region of nadB gene of 1.8 kb was obtained.
E. coli K12 W3110 strain containing pKD46 as lambda red recombinase expression vector was transformed with the nadB-deficient cassette by electroporation, and then the strain was smeared on a LB plate medium (tryptone 10 g, yeast extract 5 g, NaCl 10 g, chloramphenical 15 ㎍/L, and agar 1.5 %) containing chloramphenicol as a selective marker. Then cultured at 37℃ overnight to select microorganism strains exhibiting resistance against chloramphenical.
The selected strains were directly used as templates to perform PCR using primers of SEQ ID NOs. 7 and 8 under the same conditions. The gene sizes of the wild strain and the nadB-deficient strain were identified to be 2.4 kb and 0.8 kb, respectively on 1.0% agarose gel, thereby confirming the deletion of nadB gene in E. coli K12 W3110. The construction of the nadB-deficient strain, named W3110nadB, was completed.
<1-3-2> Selection of L-aspartate oxidase variants
To find a nadB gene resistant to the feedback regulation by NAD, 6-aminopyridine-3-carboxylic acid (6-NA, purchased from Aldrich, U.S.A) as a nicotinic acid analogue, and 6-aminonicotinamide (6-Nm, purchased from Aldrich, U.S.A) as a nicotinamide analogue were used. Although a 6-NAD analogue should be used, due to the structural similarity of NAD with nicotinic acid and nicotinamide, resistant nadB gene variants were primarily selected using the nicotinic acid analogue and nicotinamide analogue, and then the NAD-feedback resistance of each of the selected nadB gene variants was confirmed (ref. Journal of bacteriology, June 1983, p.1126-1136). L-aspartate oxidase variant plasmid library constructed in <1-2> of Example 1 was transformed into W3110nadB strain via CaCl2 method.
The transformed W3110nadB strain was smeared on a M9-(6,NA)-(6,Nm) plate medium (NaHPO4-7H2O 12.8 g, KH2PO4 3 g, NaCl 0.5 g, NH4Cl 1 g, MgSO4 2 mM, CaCl2 0.1 mM, casamino acid 1 g, 6-aminopyridine-3-carboxylic acid (6-NA) 0.3 g/L, 6-aminonicotinamide (6-Nm) 0.3 g/L) to select colonies with higher growth rate compared to the wild nadB. A total of 1 x 107 colonies were screened and three of them were selected, and then named pPro-nadB64, pPro-nadB67, and pPro-nadB110, respectively. The selected three strains were each inoculated and cultured in a M9-(6,NA)-(6,Nm) liquid medium (NaHPO4-7H2O 12.8 g, KH2PO4 3 g, NaCl 0.5 g, NH4Cl 1 g, MgSO4 2 mM, CaCl2 0.1 mM, casamino acid 1 g, 6-aminopyridine-3-carboxylic acid (6-NA) 0.3 g/L, 6-aminonicotinamide (6-Nm) 0.3 g/L), and then optical densities (OD) thereof were compared. As a result, the growth rates of pPro-nadB67 were found to be higher than those of the pPro-nadB64 and pPro-nadB72 in the media containing 6-NA and 6-Nm, as shown in Table 4. Accordingly, the pPro-nadB67 was selected and sequence thereof was identified. As a result, the pPro-nadB67 was found to include arginine as substituent for lysine, the 302nd amino acid from the start amino acid methione.
E. coli K12 W3110 which is deficient of nadC gene, and contains a pPro-nadB67(Lys302Arg)-pCJ-nadA by using pProlar vetor as an expression vector for nadB gene variant, was named CV01-0518. Then it was deposited under the Budapest Treaty at the Korean Culture Center of Microorganisms (KCCM) with Accession No. KCCM11434P on June 20, 2013.
Table 4 Growth rate comparison of three nadB variants in a liquid media containing 6-NA and 6-Nm
nadB name OD (4hr) OD (12hr)
pPro nadB 0.24 1.06
pPro nadB64 0.44 1.12
pPro nadB67 0.62 1.30
pPro nadB72 0.46 1.18
Example 2. Quinolinic acid yield comparison between nadB gene variants
<2-1> Construction of quinolinate phosphoribosyltransferase-deficient strain
PCR was conducted using on chromosomal DNA of E. coli K12 W3110 as a template to obtain a nadC gene that is involved in the decomposition pathway of quinolinate. Based on the nucleotide sequence for the nadC gene (NCBI Registration No. " GI:89106990") represented by SEQ ID NO: 25 obtained from the GenBank of the National Institute of Health (NIH GenBank), primers represented by SEQ ID NOs: 12 and 13 able to amplify the downstream region of the nadC gene, primers of SEQ ID NOs: 14 and 15 able to amplify the upstream and downstream regions of the nadC gene, and loxpCm gene, and primers of SEQ ID NOs: 16 and 17 able to amplify the upstream region of the nadC gene were constructed.
Table 5
Nucleotide sequence SEQ ID NO
5' CATTATACGAACGGTACCCCCAGTTGAATAAACACCTCTTCA 3' 12
5' TGGCGGCAGGCTAATATT 3' 13
5' GTTCTTCCAGATTCTCTACTTTTCGAGCTCGGTACCTACCG 3' 14
5' TGAAGAGGTGTTTATTCAACTGGGGGTACCGTTCGTATAATG 3' 15
5' ATAACCACCATCAGTTCGATA 3' 16
5' CGGTAGGTACCGAGCTCGAAAAGTAGAGAATCTGGAAGAAC 3' 17
PCR was performed using chromosomal DNA of E. coli K12 W3110 as a template and oligonucleotides of SEQ ID NOs: 12 and 13, and 16 and 17 as primers to amplify the upstream and downstream regions of nadC gene of 0.5 kb and 0.3 kb, respectively. In addition, PCR was performed using a plasmid vector including loxpCm, pLoxpCat2 vector, as a template and oligonucleotides of SEQ ID NOs. 14 and 15 as primers to amplify loxpCm gene having the sequence homologous to nadC gene on both ends of 1.0 kb. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A), and PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 53℃ for 30 seconds, and extension at 72℃ for 1 minute. As a result, a nadC-upstream fragment, a nadC-downstream fragment, and a loxpCm fragment were obtained. PCR was conducted using these fragments resulting from the above-described PCR as templates under the PCR conditions including 10 repetition of the cycle comprising denaturation at 96℃ for 60 seconds, denaturation at 50℃ for 60 seconds, and extension at 72℃ for 1 minute, and 20 repetition of the cycle after addition of primers of SEQ ID NOs: 12 and 17. As a result, a nadC-deficient cassette containing the upstream region of nadC gene-loxpCm-downstream region of nadC gene of 1.8 kb was obtained.
E. coli K12 W3110 strain containing pKD46 as expression vector of lambda red recombinase was transformed with the nadC-deficient cassette by electroporation, and then the strain was smeared on a LB plate medium (tryptone 10 g, yeast extract 5 g, NaCl 10 g, and agar 1.5 %) containing chloramphenicol as a selective marker, and cultured at 37℃ overnight to select microorganism strains exhibiting resistance against chloramphenical.
The selected strains were directly used as templates to perform PCR using primers of SEQ ID NOs: 13 and 16 under the same conditions, and the gene sizes of the wild strain and the nadC-deficient strain were identified to be 1.6 kb and 1.3 kb, respectively on 1.0% agarose gel, thereby confirming the deletion of nadC gene in E. coli K12 W3110. The construction of the nadC-deficient strain, named W3110nadC, was completed.
<2-2> Construction of plasmid for expression of aspartate oxidase and quinolinate synthetase
Two enzymes, aspartate oxidase and quinolinate synthetase, are required to produce quinolinate. Accordingly, a plasmid able to express both nadB and nadA genes encoding the two enzymes was constructed. First, PCR was performed using chromosomal DNA of E. coli W3110 to obtain nadA gene encoding quinolinate synthetase. Based on the nucleotide sequence for the nadA gene (NCBI Registration No. "GI: 89107601") represented by SEQ ID NO: 26 obtained from the GenBank of the National Institute of Health (NIH GenBank), primers of SEQ ID NOs:18 and 19 able to amplify the ORF region of the nadA gene including ATG and TAA regions and having the recognition sites of restriction enzymes ApaI and NotI were synthesized.
Table 6
Nucleotide sequence SEQ ID NO
5' AATTGGGCCCATGAGCGTAATGTTTGATCCA 3' 18
5' AATTGCGGCCGCTCGTGCCTACCGCTTCG 3' 19
PCR was performed using chromosomal DNA of E. coli K12 W3110 as a template, and oligonucleotides of SEQ ID NOs: 18 and 19 as primers. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A), and the PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 50℃ for 30 seconds, and extension at 72℃ for 1 minute. As a result, an amplified gene of about 1.0 kb including the nadA gene and the recognition sites of restriction enzymes ApaI and NotI was obtained.
A pCJ1 promoter was obtained through PCR using a plasmid including the pCJ1 promoter as a template, based on the disclosure in Korean laid-open Patent No. 10-2006-0068505. Primers represented by SEQ ID NOs: 20 and 21 having the recognition sites of restriction enzymes BamHI and ApaI were constructed for ligating the pCJ1 promoter with the amplified nadA gene.
Table 7
Nucleotide sequence SEQ ID NO
5' CCGCGGATCCCACCGCGGGCTTATTCCATTAC 3' 20
5' GATGGGCCCATCTTAATCTCCTAGATTGGGTTTC 3' 21
PCR was performed using chromosomal DNA of E. coli K12 W3110 as a template, and oligonucleotides of SEQ ID NOs: 20 and 21 as primers. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A), and the PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 50℃ for 30 seconds, and extension at 72℃ for 1 minute. As a result, an amplified fragment of about 0.3 kb including the pCJ1 promoter and the recognition sites of the restriction enzymes BamHI and ApaI was obtained.
The nadA gene obtained through the PCR was treated with restriction enzymes ApaI and NotI, and the amplified pCJ1 promoter fragment was treated with restriction enzymes ApaI and BamHI. The nadA gene and pCJ1 promoter fragment treated with the restriction enzymes, respectively, were cloned via ligation into the pPro-nadB vector obtained in <1-1> that was treated with the restriction enzymes NotI and BamHI. Ultimately a pPro-nadB- pCJ1-nadA recombinant vector of 5.9 kb was constructed, in which the nadB gene expression is regulated by the pPro promoter as a constitutive promoter, and the nadA gene expression is regulated by pCJ1 promoter. The constructed pPro-nadB-pCJ1-nadA had the sequence represented by SEQ ID NO: 27. In addition, through the above-described processes, a recombinant vector pPro-nadB67-pCJ1-nadA including the nadB variant and the wild nadA gene was also constructed. The constructed pPro-nadB67-pCJ1-nadA had the sequence represented by SEQ ID NO: 28.
<2-2-1> Construction of vector in which 302 nd amino acid of nadB gene of pPro- nadB67-pCJ1-nadA is substituted with amino acid except for lysine and arginine
To confirm the resistance against NAD-feedback regulation of nadB67 gene variant, including arginine instead of lysine as the 302nd amino acid starting from methionine of L-aspartate oxidase, the 302nd amino acid of the nadB gene was substituted with each of 18 different amino acids, except for lysine and arginine. Quick mutagenesis using the recombinant vector pPro-nadB67-pCJ1-nadA as a template was performed. The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A.). PCR was conducted by repeating 18 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 55℃ for 30 seconds, and extension at 68℃ for 15 minutes. The resulting PCR product was treated with the restriction enzyme DpnI (NEB, U.S.A), and then transformed into E.coli DH5α strain (Invitrogen, U.S.A.) via CaCl2 method. The transformed E.coli DH5α strain was smeared on a LB-Km plate medium (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, kanamycin 25 ㎍/L), and cultured overnight at 37℃ to select kanamycin-resistant colonies. The resulting colonies were subjected to plasmid extraction and sequencing to identify the substitution of the 302nd amino acid with the 18 different amino acids. The resulting 18 nadB variants as plasmids were named as in Table 2.
Table 8 L-aspartate oxidase variants in which 302nd amino acid was substituted with another amino acid
Name Original 302nd amino acid of nadB Substituted amino acid
pPro-nadB67-pCJ1-nadA Lysine Arginine
pPro-nadB67(G)-pCJ1-nadA Glycine
pPro-nadB67(A)-pCJ1-nadA Alanine
pPro-nadB67(S)-pCJ1-nadA Serine
pPro-nadB67(T)-pCJ1-nadA Threonine
pPro-nadB67(C)-pCJ1-nadA Cysteine
pPro-nadB67(V)-pCJ1-nadA Valine
pPro-nadB67(L)-pCJ1-nadA Leucine
pPro-nadB67(I)-pCJ1-nadA Isoleucine
pPro-nadB67(M)-pCJ1-nadA Methionine
pPro-nadB67(P)-pCJ1-nadA Proline
pPro-nadB67(F)-pCJ1-nadA Phenylalanine
pPro-nadB67(Y)-pCJ1-nadA Tyrosine
pPro-nadB67(W)-pCJ1-nadA Tryptophan
pPro-nadB67(D)-pCJ1-nadA Aspartic acid
pPro-nadB67(E)-pCJ1-nadA Glutamic acid
pPro-nadB67(N)-pCJ1-nadA Asparagine
pPro-nadB67(Q)-pCJ1-nadA Glutamine
pPro-nadB67(H)-pCJ-nadA Histidine
<2-3> Evaluation of quinolinate-producing ability of wild nadB and nadB67 variants with respect to NAD concentration
To compare the ability to produce quinolinate in the wild type nadB gene and nadB gene variants with respect to NAD concentration, a quinolinate titer assay was conducted. After the quinolinate-producing strain (W3110-ΔnadC) obtained in <2-1> of Example 2 was transformed with the plasmid pPro-nadB67-pCJq1-nadA constructed in <2-2> of Example 2, and each of the 18 types of nadB67 variants constructed in <2-2-1> of Example 2 via CaCl2 method. The transformed strains were cultured overnight in a LB-Km plate medium in a 37℃ culture batch to obtain a single colony, and then the single colony was inoculated by one platinum pool into 25 ㎖ of a culture medium for the quinolinate potency assay and cultured at 37℃ for 24 hours to 72 hours by shaking at 250 rpm. Table 9 shows the composition of the culture medium for producing quinolinate. To identify the NAD feedback resistance of the nadB67 variants, nicotinic acid (NA) was added to the culture medium at different concentrations, followed by comparison of the produced quantities of quinolinate.
Table 9 Composition of the culture medium for quinolinate potency assay
Composition Concentration (per liter)
Glucose 70 g
Ammonium sulfate 17 g
KH2PO4 1.0 g
MgSO4·H2O 0.5 g
FeSO4·H2O 5 mg
MnSO4·H2O 5 mg
ZnSO4 5 mg
Calcium carbonate 30 g
Yeast extract 2 g
The quantity of quinolinate (quinolinic acid, QA) in each of the culture solutions was analyzed by high performance liquid chromatography (HPLC). The results are shown in Table 10. Table 10 shows the ability to produce quinolinate of the nadB67 variants with respect to NAD concentration.
Table 10 Production quantities of quinolinate with respect to NAD concentrations
Strain Plasmid QA (mg/L)
NA 0uM NA 5uM NA 10uM
W3110-ΔnadC pPro-nadB-pCJ-nadA 3500 1600 700
pPro-nadB67-pCJ-nadA 4553 3860 3251
pPro-nadB67(G)-pCJ-nadA 4560 3830 3058
pPro-nadB67(A)-pCJ-nadA 4560 3830 3058
pPro-nadB67(S)-pCJ-nadA 4560 3830 3058
pPro-nadB67(T)-pCJ-nadA 4560 3830 3058
pPro-nadB67(C)-pCJ-nadA 4560 3830 3058
pPro-nadB67(V)-pCJ-nadA 4425 3937 3280
pPro-nadB67(L)-pCJ-nadA 4425 3937 3280
pPro-nadB67(I)-pCJ-nadA 4425 3937 3280
pPro-nadB67(M)-pCJ-nadA 4425 3937 3280
pPro-nadB67(P)-pCJ-nadA 2223 1879 1975
pPro-nadB67(F)-pCJ-nadA 4241 3795 3141
pPro-nadB67(Y)-pCJ-nadA 4241 3795 3141
pPro-nadB67(W)-pCJ-nadA 4707 3715 3186
pPro-nadB67(D)-pCJ-nadA 100 100 100
pPro-nadB67(E)-pCJ-nadA 100 100 100
pPro-nadB67(N)-pCJ-nadA 4552 3939 3171
pPro-nadB67(Q)-pCJ-nadA 4552 3939 3171
pPro-nadB67(H)-pCJ-nadA 4891 3751 3255
Table 11 Relative yield of quinolinate with respect to NAD concentration
Strain Plasmid Relative Percentage (%)
NA 0 uM NA 5 uM NA 10 uM
W3110-ΔnadC pPro-nadB-pCJ-nadA 100 46 20
pPro-nadB67-pCJ-nadA 100 85 71
pPro-nadB67(G)-pCJ-nadA 100 84 67
pPro-nadB67(A)-pCJ-nadA 100 84 67
pPro-nadB67(S)-pCJ-nadA 100 84 67
pPro-nadB67(T)-pCJ-nadA 100 84 67
pPro-nadB67(C)-pCJ-nadA 100 84 67
pPro-nadB67(V)-pCJ-nadA 100 89 74
pPro-nadB67(L)-pCJ-nadA 100 89 74
pPro-nadB67(I)-pCJ-nadA 100 89 74
pPro-nadB67(M)-pCJ-nadA 100 89 74
pPro-nadB67(P)-pCJ-nadA 100 85 89
pPro-nadB67(F)-pCJ-nadA 100 89 74
pPro-nadB67(Y)-pCJ-nadA 100 89 74
pPro-nadB67(W)-pCJ-nadA 100 79 68
pPro-nadB67(D)-pCJ-nadA 100 100 100
pPro-nadB67(E)-pCJ-nadA 100 100 100
pPro-nadB67(N)-pCJ-nadA 100 87 70
pPro-nadB67(Q)-pCJ-nadA 100 87 70
pPro-nadB67(H)-pCJ-nadA 100 77 67
For the two quinolinate-producing variants including the plasmids pPro-nadB67(D)-pCJ-nadA and pPro-nadB67(E)-pCJ-nadA, the nadB gene was destroyed and lost activity. As a result, the quinlinate-producing variants mostly had very low quinolinate (QA) levels, the level was converted to a residual relative yield in percentage (%). It was based on 100% of the produced QA level when a nicotinic acid (NA) is 0 uM.
Referring to Table 11, the yield of quinolinate was less than 50% when the pPro-nadB-pCJ-nadA plasmid including the wild type nadB gene was used, and the culture medium contains nicotinic acid, over 5 uM or greater. Whereas the yield of quinolinate was 70% or greater when the pPro-nadB67-pCJ-nadA plasmid and 302nd variants recombinant plasmids including the nadB gene variant were used. W3110-ΔnadC strain is an NAD auxotroph that requires supply of external NAD for growth. W3110-ΔnadC strain is unable to directly accept NAD, and uses heterogenous nicotinic acid (NA) or nicotinamide (Nm) to produce NAD. When an amount of intracellular NAD is 1 mM or greater, the nadB gene is feedback-regulated to maintain the amount of intracellular NAD constant. Accordingly, the production of QA may be limited by the nadB gene that is feedback-regulated. Adding NA to a culture medium means an increase of NAD in a strain. Accordingly, the production quantities of QA were compared between the strains with the addition of NA to the culture medium at different concentrations to identify a degree of feedback regulation in the nadB gene variants with respect to NAD concentration. As a result, the nadB gene variants with substituted 302nd amino acids were found that the feedback regulation by NAD is released.
<2-4> Production of nicotinic acid through decarboxylation reaction
To identify the ability to produce nicotinic acid of the quinolinate-producing strains into which nadB variants were introduced, the yields of quinolinate in Table 10 were used. The production method of nicotinic acid used herein was decarboxylation of the quinolinate-including culture solution under high-temperature and high-pressure conditions based on the disclosure of Korean Patent No. 10-1223904, to convert quinolinate to nicotinic acid. To remove cells from the quinolinate-containing culture solution, centrifugation was performed at about 3000 rpm to about 4000 rpm for about 10 minutes to about 30 minutes. The quinolinate-containing supernatant resulting from the centrifugation was separated and used as a sample for decarboxylation reaction.
The decarboxylation reaction was conducted at about 135℃ at about 0.2 MPa for about 3 hours. The samples used are shown in Table 12. An aqueous solution of quinolinate (a standard product of Sigma-Aldrich Co.) in deionized water was used as a control group. Each samples of the aqueous solutions of quinolinate was titrated with sodium hydroxide, ammonia water, hydrochloric acid, or sulfuric acid, specifically the conversion of quinolinate into nicotinic acid took place at pH of 2. Table 12 shows the production quantities of nicotinic acid converted from quinolinate of Table 10 through high-temperature and high-pressure reaction.
Table 12
Strain Plasmid Quinolinate (mg/L) Nicotinic acid (mg/L)
W3110-ΔnadC pPro-nadB-pCJ-nadA 3500 2555
pPro-nadB67-pCJ-nadA 4553 3324
pPro-nadB67(G)-pCJ-nadA 4560 3329
pPro-nadB67(A)-pCJ-nadA 4560 3329
pPro-nadB67(S)-pCJ-nadA 4560 3329
pPro-nadB67(T)-pCJ-nadA 4560 3329
pPro-nadB67(C)-pCJ-nadA 4560 3329
pPro-nadB67(V)-pCJ-nadA 4425 3230
pPro-nadB67(L)-pCJ-nadA 4425 3230
pPro-nadB67(I)-pCJ-nadA 4425 3230
pPro-nadB67(M)-pCJ-nadA 4425 3230
pPro-nadB67(P)-pCJ-nadA 2223 1623
pPro-nadB67(F)-pCJ-nadA 4241 3096
pPro-nadB67(Y)-pCJ-nadA 4241 3096
pPro-nadB67(W)-pCJ-nadA 4707 3436
pPro-nadB67(D)-pCJ-nadA 100 73
pPro-nadB67(E)-pCJ-nadA 100 73
pPro-nadB67(N)-pCJ-nadA 4552 3323
pPro-nadB67(Q)-pCJ-nadA 4552 3323
pPro-nadB67(H)-pCJ-nadA 4891 3570
The experiment of converting quinolinate in aqueous solution (deionized water) into nicotinic acid, as disclosed in the prior reference Chinese Patent No. 101353322, was performed at 135℃ and at 0.2 MPa for about 3 hours. The temperature and the pressure levels were lower than 150℃ to 250℃ in the prior reference, respectively. The results are shown in Table 12.
Example 3: Confirmation of NAD feedback resistance activity of L-aspartate oxidase variants
<3-1> Construction of L-aspartate oxidase over-expression plasmid
To more clarify the NAD-feedback resistance activities of L-aspartate oxidase variants, the NAD-feedback resistance of a L-aspartate oxidase variant encoded by the nadB67 variant selected in <Example 1-3-2> was evaluated. To clone the wild type nadB and the nadB variants into a pCDF-duet vector containing a histidine (His)-tag, PCR was performed using the wild type pPro-nadB plasmid and the recombinant pPro-nadB67 as templates, respectively. For use in PCR, primers of SEQ ID NOs: 22 and 23 able to amplify the ORF region of the wild type nadB and the variant nadB67 gene that includes ATG and TAA regions and having the recognition sites of the restriction enzymes BamHI and NdeI were constructed.
Table 13
Nucleotide sequence SEQ ID NO.
5' AATTGGATCCGATGAATACTCTCCCTGAACATT 3' 22
5' AATTCATATGTTATCTGTTTATGTAATGATTGC 3' 23
The polymerase used was PfuUltraTM DNA polymerase (Stratagene, U.S.A), and the PCR was conducted by repeating 30 times of a cycle comprising denaturation at 96℃ for 30 seconds, annealing at 50℃ for 30 seconds, and extension at 72℃ for 2 minutes. As a result, amplified genes of about 1.9 kb of the wild type nadB and the nadB67 variant including the recognition sites of the restriction enzymes BamHI and NdeI were obtained.
The genes of the wild type nadB and nadB67 variant obtained through the PCR were treated with the restriction enzymes BamHI and NdeI, and then cloned via ligation into a pCDF-duet vector treated with the restriction enzymes BamHI and NdeI. Ultimately recombinant vectors including the genes of the wild type nadB and the nadB67 variant, respectively, was constructed wherein the expression of each of the genes is controllable by a T7 promoter as a constitutive promoter and the gene contains the His-tag capable of protein purification. The constructed recombinant vectors were named pT7-nadB and pT7-nadB67, respectively. Other recombinant vectors in which valine, leucine, isoleucine, and histidine were substituted for the 302nd amino acid of the wild type nadB, respectively, were constructed using the same method, and named pT7-nadB67(V), pT7-nadB67(L), pT7-nadB67(I), pT7-nadB67(H), respectively.
<3-2> Purification of L-aspartate oxidase
After the recombinant vector pT7-nadB, pT7-nadB67, pT7-nadB67(V), pT7-nadB67(L), pT7-nadB67(I), or pT7-nadB67(H) was transformed into a tuner strain via CaCl2 method, the transformed strain was smeared on a LB-SP (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, and spectinomycin 50 ㎍/L) plate medium, and cultured overnight at 37℃ to select spectinomycin-resistant colonies. One colony was selected from them and cultured in a LB-SP (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, spectinomycin 50 ㎍/L) liquid medium, and then a isopropyl-1-thio-β-D-galactopyranoside (IPTG) derivative was added thereto when the growth optical density (OD) value reached to 0.4, and cultured at about 18℃ overnight. Cells including the overexpressed wild type L-aspartate oxidase and L-aspartate oxidase variants were recovered from the culture medium, followed by purification of the wild type L-aspartate oxidase and L-aspartate oxidase variants from the recovered cells by Ni-NTA spin kit (Quiagen, U.S.A). The recovered protein was 50% of a total protein, about 2% of the recovered protein was recovered as L-aspartate oxidase.
<3-3> Activity test of L-aspartate oxidase variants
The L-aspartate oxidase converts aspartate as a substrate to iminoaspartate in the presence of an FAD as cofactor, and the imminoaspartate is converted b to oxaloacetate. Hydrogen peroxide (H2O2), that is generated through the above-described reaction, was used to identify the activity of the nadB. Absorbance at 560 nm of a reaction product of H2O2 with a product from the reaction was measured using an Amplex Red (Invitrogen, Korea) to determine the activity of the nadB. Here, NAD was added at different concentrations to create a condition for competitive inhibition to FAD so as to evaluate the resistance of L-aspartate oxidase against the feedback regulation by NAD. The Relative activity of the wild type L-aspartate oxidase at a NAD concentration of 1 mM was less than 50 %, while the relative activities of the L-aspartate oxidase variants at the same NAD concentration remained about 70% or higher (Table 14), thereby indicating that the feedback regulation by NAD was released in L-aspartate oxidase variants.
Table 14 Activity comparison between L-aspartate oxidases with respect to NAD concentration
Relativeactivity
NAD concentration(mM) Relative (%)
Wild type-nadB Variant-nadB67 Variant -nadB67(V) Variant -nadB67(L) Variant nadB67(I) Variant -nadB67(H)
0 100 100 100 100 100 100
0.05 95 102 100 100 100 100
0.3 82 96 95 95 95 95
0.5 65 75 77 76 76 77
1 22 74 75 74 75 74
Depositary Institution: Korean Culture Center of Microorganisms (KCCM) (International Depositary Authority)
Accession No : KCCM11434
Date of deposit : June 20, 2013
While the invention has been particularly shown and described with reference to exemplary embodiments thereof, it will be understood that various changes in form and details may be made therein without departing from the spirit and scope of the following claims.
The present invention is related to L-aspartate oxidase variants that are resistant against the feedback regulation by nicotinic acid or NAD, and thus may effectively produce quinolinate. Quinolinate may be effectively produced by culturing of a microorganism including such a L-aspartate oxidase variant according to the embodiments of the present invention. Quinolinate may also be effectively produced using the microorganism in which the activity of quinolinate synthetase is additionally enhanced or the activity of quinolinate phosphoribosyltransferase is additionally weakened. Through such transformation of the microorganism, the yield of quinolinate or nicotinic acid may be improved, which is industrially and highly useful.
Figure PCTKR2014006817-appb-I000001

Claims (11)

  1. An L-aspartate oxidase variant having an amino acid sequence of which a 302nd amino acid in an amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid.
  2. The L-aspartate oxidase variant according to claim 1, wherein another amino acid is selected from the group consisting of arginine, valine, leucine, isoleucine, methionine, tryptophan, and histidine.
  3. The L-aspartate oxidase variant according to claim 1, wherein the feedback regulation by nicotinic acid or NAD is released.
  4. A polynucleotide comprising a nucleotide sequence that encoding an amino acid sequence which a 302nd amino acid in an amino acid sequence represented by SEQ ID NO: 1 is substituted with another amino acid.
  5. A vector comprising the polynucleotide of claim 4 which is operably linked to a regulatory sequence.
  6. A microorganism comprising the polynucleotide of claim 4.
  7. The microorganism according to claim 6, wherein the microorganism belongs to the genus Escherichia.
  8. The microorganism according to claim 6, wherein the activity of quinolinate synthetase is enhanced.
  9. The microorganism according to claim 6, wherein the activity of endogenous quinolinate phosphoribosyltransferase is reduced.
  10. A method of producing quinolinate, the method comprising:
    culturing the microorganism of claim 6 in a medium; and
    recovering quinolinate from the cultured medium.
  11. A method of producing nicotinic acid, the method comprising:
    culturing the microorganism of claim 6 in a medium; and
    conducting a decarboxylation reaction by adding an acid to the cultured medium.
PCT/KR2014/006817 2013-07-25 2014-07-25 L-asparatate oxidase variant and a method for producing quinolinate or nicotinic acid using the same Ceased WO2015012641A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2016529717A JP6211191B2 (en) 2013-07-25 2014-07-25 L-aspartate oxidase mutant and method for producing quinolinate or nicotinic acid using the same
RU2016106171A RU2648167C2 (en) 2013-07-25 2014-07-25 L-asparatate oxidase variant and method for producing quinolinate or nicotinic acid using same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020130088240A KR101634582B1 (en) 2013-07-25 2013-07-25 L-aspartate oxidase variant resistant to nicotinic acid or NAD and a method for producing quinolinate or nicotinic acid
KR10-2013-0088240 2013-07-25

Publications (1)

Publication Number Publication Date
WO2015012641A1 true WO2015012641A1 (en) 2015-01-29

Family

ID=51220504

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2014/006817 Ceased WO2015012641A1 (en) 2013-07-25 2014-07-25 L-asparatate oxidase variant and a method for producing quinolinate or nicotinic acid using the same

Country Status (10)

Country Link
US (1) US9290743B2 (en)
EP (1) EP2829602B1 (en)
JP (1) JP6211191B2 (en)
KR (1) KR101634582B1 (en)
CN (1) CN104450638B (en)
BR (1) BR102014018364B1 (en)
ES (1) ES2664092T3 (en)
MY (1) MY172675A (en)
RU (1) RU2648167C2 (en)
WO (1) WO2015012641A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020000250A (en) * 2015-03-18 2020-01-09 シージェイ チェイルジェダン コーポレーション Pyruvate dehydrogenase mutant, microorganism containing the same, and method for producing L-amino acid using the same

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101656363B1 (en) * 2014-07-07 2016-09-09 씨제이제일제당 주식회사 A recombinant microorganism producing quinolinic acid and a method of producing quinolinic acid using the microorganism
KR101758446B1 (en) * 2015-02-03 2017-07-17 씨제이제일제당 (주) A microorganism having an ability to produce quinolinic acid and a method for producing a quinolinic acid using the same
JP2018076715A (en) * 2016-11-10 2018-05-17 大阪瓦斯株式会社 Petroleum recovery enhancement method
CN111909907B (en) * 2020-07-08 2022-05-24 浙江工业大学 Aspartate oxidase mutant, engineering bacteria and application of aspartate oxidase mutant in preparation of refined glufosinate-ammonium through oxidation-reduction coupling
CN115948358B (en) * 2022-05-27 2024-04-12 中国石油大学(华东) L-aspartic oxidase SaAO, and coding gene and application thereof
CN116396973B (en) * 2022-11-28 2025-02-25 杭州唯铂莱生物科技有限公司 An expression cassette combination for preparing nicotinamide, a recombinant bacterium and a method for producing nicotinamide
CN119662617B (en) * 2024-12-11 2026-01-30 河南大学 Nicotinamide enzyme mutants and their methods in the production of nicotinic acid

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6271031B1 (en) * 1998-08-12 2001-08-07 E.I. Du Pont De Nemours And Company Quinolinate metabolism enzymes
KR100620092B1 (en) * 2004-12-16 2006-09-08 씨제이 주식회사 Novel promoter sequences derived from Corynebacterium spp., Expression cassettes and vectors comprising the same, host cells comprising the vector and methods of expressing genes using the same
KR101223904B1 (en) * 2011-01-14 2013-01-21 씨제이제일제당 (주) Method for the preparation of nicotinic acid

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101353322B (en) 2008-09-09 2010-08-11 浙江大学 Method for preparing nicotinic acid by non-catalytic decarboxylation of picolinic acid in liquid water at high temperature
KR101359844B1 (en) * 2012-01-06 2014-02-25 씨제이제일제당 (주) Recombinant microorganism producing quinolinic acid and method of producing quinolinic acid using the same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6271031B1 (en) * 1998-08-12 2001-08-07 E.I. Du Pont De Nemours And Company Quinolinate metabolism enzymes
KR100620092B1 (en) * 2004-12-16 2006-09-08 씨제이 주식회사 Novel promoter sequences derived from Corynebacterium spp., Expression cassettes and vectors comprising the same, host cells comprising the vector and methods of expressing genes using the same
KR101223904B1 (en) * 2011-01-14 2013-01-21 씨제이제일제당 (주) Method for the preparation of nicotinic acid

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2020000250A (en) * 2015-03-18 2020-01-09 シージェイ チェイルジェダン コーポレーション Pyruvate dehydrogenase mutant, microorganism containing the same, and method for producing L-amino acid using the same

Also Published As

Publication number Publication date
RU2648167C2 (en) 2018-03-22
CN104450638B (en) 2017-08-04
KR20150014006A (en) 2015-02-06
BR102014018364A2 (en) 2015-11-17
BR102014018364B1 (en) 2022-09-20
US9290743B2 (en) 2016-03-22
ES2664092T3 (en) 2018-04-18
RU2016106171A (en) 2017-08-30
MY172675A (en) 2019-12-10
US20150031093A1 (en) 2015-01-29
JP2016525353A (en) 2016-08-25
CN104450638A (en) 2015-03-25
EP2829602B1 (en) 2018-01-31
KR101634582B1 (en) 2016-06-30
JP6211191B2 (en) 2017-10-11
EP2829602A1 (en) 2015-01-28

Similar Documents

Publication Publication Date Title
US9290743B2 (en) L-aspartate oxidase variant and a method for producing quinolinate or nicotinic acid using the same
WO2019160301A1 (en) Modified polypeptide with attenuated activity of citrate synthase and method for producing l-amino acids using same
WO2015064917A1 (en) Microorganism of corynebacterium sp. having enhanced l-lysine producibility and method for producing l-lysine using same
WO2018124440A2 (en) Novel isopropylmalate synthase mutant and production method of l-leucine using same
WO2013105802A2 (en) Microorganisms of corynebacterium which can utilize xylose and method for producing l-lysine using same
WO2013105827A2 (en) Recombinant microorganism having improved putrescine producing ability and method for producing putrescine by using same
WO2019164346A1 (en) Recombinant coryneform microorganism for producing l-tryptophan and method for producing l-tryptophan by using same
WO2019124932A2 (en) Corynebacterium sp. microorganism producing l-arginine and l-arginine production method using same
WO2015186990A1 (en) Microorganism for producing o-acetyl-homoserine and method for producing o-acetyl-homoserine by using same
WO2017034165A1 (en) Corynebacterium sp. microorganisms having l-lysine-producing ability and method for producing l-lysine using same
EP3926048A1 (en) Microorganism producing l-amino acid and method for producing l-amino acid by using same
WO2021112469A1 (en) Novel branched-chain amino acid aminotransferase mutant and leucine production method using same
WO2022005225A1 (en) Microorganism having increased activity of 3-methyl-2-oxobutanoate hydroxymethyltransferase, and use thereof
WO2017007159A1 (en) Microorganism having l-lysine productivity and method for producing l-lysine by using same
WO2012096553A2 (en) Method for the preparation of nicotinic acid
WO2013103246A2 (en) Recombinant microorganism producing quinolinic acid and production method of quinolinic acid using same
WO2014171747A1 (en) Microorganism having l-tryptophan productivity and method for production of l-tryptophan using same
WO2020067618A1 (en) L-amino acid-producing microorganism exhibiting increased α-glucosidase activity, and l-amino acid production method using same
WO2022231058A1 (en) Novel water-soluble pyridine nucleotide transhydrogenase variant, and method for producing l-tryptophan using same
WO2023085874A1 (en) Polypeptide variant having biotin synthase activity and biotin production method using same
WO2022270857A1 (en) Recombinant microorganism in which expression of nadh:quinone oxidoreductase is controlled, and method for producing o-phosphoserine, cysteine, and derivative thereof by using same
WO2018093033A1 (en) L-lysine producing microorganism of genus corynebacterium, and method for producing l-lysine using same
WO2023121055A1 (en) L-isoleucine-producing microorganism and l-isoleucine producing method using same
WO2022225319A1 (en) Novel l-serine ammonia-lyase variant and method for producing xmp or gmp, using same
WO2016006856A1 (en) Recombinant microorganism producing quinolinic acid and method for producing quinolinic acid using same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14828691

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2016529717

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2016106171

Country of ref document: RU

Kind code of ref document: A

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC, FORM 1205A DATED 11-05-2016

122 Ep: pct application non-entry in european phase

Ref document number: 14828691

Country of ref document: EP

Kind code of ref document: A1