WO2015007542A1 - Targeted modified il-1 family members - Google Patents

Abstract

The present disclosure relates to a modified lnterleukin-1 (IL-1) family member cytokine, with reduced activity via its cytokine receptor, wherein said interleukin-1 family member cytokine is specifically delivered to target cells. Preferably, the IL-1 family member cytokine is a mutant, more preferably it is a mutant IL-1 with low affinity to the IL-1 receptor, wherein said mutant IL-1 is specifically delivered to target cells. The targeting is preferably realized by fusion of the modified IL-1 family member cytokine to a targeting moiety, preferably an antibody or antibody-like molecule. The disclosure relates further to the use of such targeted modified IL-1 family member cytokine to treat diseases.

Description

TARGETED MODIFIED IL-1 FAMILY MEMBERS

The present invention relates to a modified lnterleukin-1 (IL-1 ) family member cytokine, with reduced activity via its cytokine receptor, wherein said lnterleukin-1 family member cytokine is specifically delivered to target cells. Preferably, the IL-1 family member cytokine is a mutant, more preferably it is a mutant IL-1 with low affinity to the IL-1 receptor, wherein said mutant IL- 1 is specifically delivered to target cells. The targeting is preferably realized by fusion of the modified IL-1 family member cytokine to a targeting moiety, preferably an antibody or antibodylike molecule. The invention relates further to the use of such targeted modified IL-1 family member cytokine to treat diseases. The lnterleukin-1 (IL-1 ) family consists of 1 1 structurally related family members (IL-1 a, IL-1 -β, IL-1 Ra, IL-18, IL-33 and IL-1 F5 to IL-1 F10), that are among the most potent immune system signaling molecules, acting through a group of closely related receptors. All IL-1 receptors have a similar mode of activation: upon binding of ligand to the primary receptor subunit (i.e. IL-1 R1 for IL-1 a and β, IL-18R for IL-18 and ST2 for IL-33), a second receptor subunit is recruited (i.e. IL-1 RAP for IL-1 a and β, IL-18RAP for IL-18 and IL-1 RAP for IL-33) and signalling is initiated via juxtaposition of the receptor subunits' cytoplasmic Toll/I L-1 receptor (TIR) domains. The dimerized TIR domains provide a docking platform for the MYD88 adaptor protein, which via recruitment of other intermediates leads to activation of the pro-inflammatory nuclear factor-κΒ (NF-κΒ) and mitogen-activated protein kinase (MAPK) pathways. The IL-1 family members are primarily produced by innate immune cells and act on a variety of cell types during the immune response (for review see Sims and Smith, 2010).

T lymphocytes are one of the main IL-1 family target cells and the potentiating effects of in particular IL-1 a and I L-1 β on the expansion and differentiation of different T cell subsets, in particular CD8+ T cells (Ben-Sasson, 201 1 ; Ben-Sasson, 2013) and Th17 cells (Sutton et al., 2006; Acosta-Rodriguez et al., 2007; Dunne et al., 2010; Shaw et al., 2012) have been firmly established. Th17 cells are characterized by the production of IL-17 and play an important role in auto-immune disease and chronic inflammation (reviewed in Wilke et al., 201 1 ). Among T cell subsets, Th17 cells express the highest levels of the IL-1 R and IL-1 plays an important role in Th17 priming. IL-18 is best known as an IFNv-inducing cytokine with a potent action on Th1 cells and natural killer (NK) cells, on (Okamura et al., 1995; Takeda et al. 1998). In addition, IL-18 enhances neutrophil function (Leung et al., 2001 ). Several reports demonstrate IL-18 anti-tumour action in animal models (Micallef et al., 1997; Loeffler et al., 2008; Wigginton et al., 2002; Zaki et al., 2010) and recombinant human IL-18 therapy recently entered clinical trials to evaluate its efficacy for treatment of advanced cancer (Robertson et al., 2008). As opposed to IL-18, IL-33 l acts primarily on Th2 cells (Schmitz et al., 2005) and mast cells (Allakhverdi et al., 2007), and recently was shown to act on CD8 + T cells to drive antiviral responses (Bonilla et al., 2012). The other IL-1 family members are less well characterized, but in summary different IL-1 family members have specificities for different T-cell subsets or other cell types and hence different therapeutic applications.

Besides having indirect anti-tumour activity, via activation of T and NK cells, IL-1 family members were shown to have direct cytostatic properties, which were most convincingly demonstrated on human melanoma cells (Morinaga et al., 1990; Usui et al., 1991 ; Rangnekar et al., 1992). In view of the contribution of several IL-1 family members to inflammatory processes, clinical interest has been mainly oriented towards the development of IL-1 -antagonizing strategies (Dinarello et al., 2012). Nevertheless, exploitation of controlled agonistic IL-1 activity could have applications in different physiological/pathological processes, where immunostimulatory effects would be desirable. One of the main concerns regarding the use of IL-1 in immunostimulatory therapies, is its severe toxicity when administered systemically. However, when IL-1 action could be confined to a selected cellular population, the toxicity issue might be resolved, which opens up therapeutic perspectives.

For instance, although there has been a lot of interest on blocking Th17 responses in view of their pathogenic role in auto-immune conditions such as multiple sclerosis, rheumatoid arthritis and inflammatory bowel disease (Wilke et al., 201 1 ), normal Th17 function is indispensable for protective immunity against a range of pathogens, including Mycobacterium tuberculosis (Khader et al., 2007), Klebsiella pneumoniae (Ye et al., 2001 ) and Bordetella pertussis (Higgins et al., 2006). As I L-1 β stimulates Th17 function, the idea has been raised to use I L-1 β as a T-cell adjuvant to enhance the response to weak vaccines (Ben-Sasson et al., 201 1 ). Other applications could be the targeting of I L-1 β or IL-33 to the CD8+ T-cell population to enhance antiviral responses or targeting IL-18 to Th1 cells or NK cells to promote anti-tumor activity.

Surprisingly we found that it is possible to design IL-1 family modifications that are defective in activating their receptor, but, when fused to a targeting moiety, regain their activity on selected cell types by a concentration effect at the cell surface. The IL-1 mutants have a reduced affinity for their cognate receptors, and hence are unable to efficiently bind and activate their receptors. However, by fusing them to a targeting moiety (such as a nanobody) the activity of the mutant IL-1 family member is restored on cells expressing the cell surface target, recognized by the targeting moiety. Because the activation is confined to the selected targeted cell types only, no major systemic toxicity occurs. A first aspect of the invention is a targeting construct, comprising a modified IL-1 family member cytokine, characterized by a reduced affinity for its cytokine receptor, and a targeting moiety. IL-1 family member cytokines are known to the person skilled in the art, and include, but are not limited to IL-1 a, IL-1 β, IL-1 Ra, IL18, IL-36Ra, IL-36a, IL-37, IL-36p, IL-36y, IL-38 and IL-33 (also indicated as IL-1 F1 , IL-1 F2, IL-1 F3, IL-1 F4, IL-1 F5, IL-1 F6, IL-1 F7, IL-1 F8, IL- 1 F9, IL-1 F10 and IL-1 F1 1 , respectively). For a review on the IL-1 family, see Dinarello (201 1 ). A modified IL-1 family cytokine means that the IL-1 family cytokine has been changed to alter the affinity to its receptor, with as final result that the modified IL-1 family cytokine has a reduced affinity for the receptor and a consequent reduced biological activity, as compared to the endogenous wild type cytokine that binds normally to the receptor. Such a modification can be a modification that decreases the activity of the normal wild type cytokine, or it can be a modification that increases the affinity of a homologous, non-endogenous IL-1 family cytokine (such as, but not limited to a IL-1 family cytokine of another species that is not active on a human IL-1 family cytokine receptor). Modifications can be any modification reducing or increasing the activity, known to the person skilled in the art, including but not limited to chemical and/or enzymatic modifications such as pegylation and glycosylation, fusion to other proteins and mutations. Preferably said modification is a mutation, even more preferably it is a mutation decreasing the affinity of the IL-1 family cytokine. A reduced affinity and a consequent reduced biological activity as used here means that the modified IL-1 family cytokine has a biological activity of less than 70% of the biological activity of the IL-1 family cytokine, even more preferably less than 60% of the biological activity of the IL-1 family cytokine, more preferably less than 50% of the biological activity of the IL-1 family cytokine, more preferably less than 40% of the biological activity of the IL-1 family cytokine, more preferably less than 30% of the biological activity of the IL-1 family cytokine, more preferably less than 20% of the biological activity of the IL-1 family cytokine, more preferably less than 10% of the biological activity of the IL-1 family cytokine, most preferably less than 1 % of the biological activity of the IL-1 family cytokine as compared to the IL-1 family cytokine that normally binds to the receptor. Preferably, the modified IL-1 family cytokine is a mutant of the wild type IL-1 family cytokine and the activity is compared with the wild type IL-1 family cytokine. The affinity and/or the activity can be measured by any method known to the person skilled in the art.

A preferred embodiment of the invention is a targeting construct, comprising a mutant I L-1 β characterized by reduced affinity for the lnterleukin-1 receptor type I (IL-1 Rl) and/or the interleukin-1 receptor accessory protein (IL-1 RAcP) receptor, and a targeting moiety. A mutant I L-1 β as used here can be any mutant form that has a lower affinity for the receptor and as a consequence a reduced activation of the proinflammatory transcription factor N FKB. The affinity of the mutant I L-1 β to the receptor, in comparison to the affinity of the wild type I L-1 β to the receptor can be measured by Scatchard plot analysis and computer-fitting of binding data (e.g. Scatchard, 1949) or by reflectometric interference spectroscopy under flow through conditions, as described by Brecht et al. (1993). The activity of the mutant I L-1 β is typically measured using a bioassay (for example by the induction of cell death) or by measuring signaling events downstream of the receptor. Such signaling events can be the modification or nuclear translocation of NF-κΒ, or the induction of a selected reporter gene. The mutant may be a point mutant, a deletion or an insertion mutant, or a combination thereof; several mutations may be present in one protein. Preferably, said mutant I L-1 β is obtained by active mutagenesis, such as, but not limited to site directed mutagenesis by polymerase chain reaction amplification. Preferably, said mutant I L-1 β has a biological activity of less than 70% of the biological activity of the wild type IL-Ι β, even more preferably less than 60% of the biological activity of the wild type IL-Ι β, more preferably less than 50% of the biological activity of the wild I L-1 β, more preferably less than 40% of the biological activity of the wild I L-1 β, more preferably less than 30% of the biological activity of the wild IL-Ι β, more preferably less than 20% of the biological activity of the wild I L-1 β, more preferably less than 10% of the biological activity of the wild type, most preferably less than 1 % of the wild type of which it is deduced (i.e. the wild type I L-1 β of which the coding sequence has been mutated to obtain the mutant I L-1 β). Preferably, said mutant is a mutant selected from the group consisting of A1 17G/P1 18G, R120X, L122A, T125G/L126G, R127G, Q130X, Q131 G, K132A, S137G/Q138Y, L145G, H146X, L145A/L147A, Q148X, Q148G/Q150G, Q150G/D151A, M152G, F162A, F162A/Q164E, F166A, Q164E/E167K, N169G/D170G, I 172A, V174A, K208E, K209X, K209A/K210A, K219X, E221X, E221 S/N224A, N224S/K225S, E244K, N245Q (wherein X can be any change in amino acid, preferably a non-conservative change). Even more preferably said mutation is selected from the group consisting of R120A, R120G, Q130A, Q130W, H146A, H146G, H146E, H146N, H146R, Q148E, Q148G, Q148L, K209A, K209D, K219S, K219Q, E221 S and E221 K. Most preferably said mutation is selected from the group consisting of R120G, H146N, H146R, Q148E, Q148G and K209A. (numbering base on the human I L-1 β sequence, genbank accession number NP_000567, version NP-000567.1 , Gl: 10835145). Preferred regions for mutations for IL-18 are Y37-K44, R49-Q54, D59-R63, E67-C74, R80, M87-A97, N 127-K129, Q139-M149, K165-K171 , R183 and Q190-N191 . Most preferred are the regions E67-C74 and M87-A97 (numbering based on the human sequence, genbank accession number AAV38697, version AAV38697.1 , Gl: 54696650 ) . Preferred regions for mutations for IL-33 are I 1 13-Y122, S127-E139, E144-D157, Y163-M183, E200, Q215, L220-C227 and T260-E269 (numbering based on the human sequence, genbank accession number NP_254274, version NP_254274.1 , Gl:15559209)

Preferably, said targeting moiety is targeting to a marker expressed on an I L-1 β receptor expressing cell, preferably a cell expressing IL1 -RI. In one preferred embodiment, said targeting moiety is directed to a tissue specific marker.

The modified I L-1 family member is linked to a targeting moiety. "Linked" as used here may be by a covalent binding, or it may be by an affinity binding. A "targeting moiety" as used here is a binding molecule that can direct the fusion protein towards a binding site on a cell that is expressing a receptor for the I L-1 family member, by specific interaction between the binding site and the binding molecule. In one preferred embodiment, said binding molecule is a small compound, specifically binding to a molecule situated on the outside of the cell. In another preferred embodiment, said molecule is a sugar structure, directed towards a lectin-like molecule expressed on the cell wall. In another preferred embodiment said binding molecule is a peptide, targeting the tumor or inflammation environment. Such peptides are known to the person skilled in the art, and include, but are not limited to NGR and RGD peptides (Yang et al., 201 1 ; WO2005054293). In still another preferred embodiment, said binding molecule is a protein comprising a binding domain. This includes, but is not limited to carbohydrate binding domains (CBD) (Blake et al, 2006), lectin binding proteins, heavy chain antibodies (hcAb), single domain antibodies (sdAb), minibodies (Tramontano et al., 1994), the variable domain of camelid heavy chain antibodies (VHH), the variable domain of the new antigen receptors (VNAR), affibodies (Nygren et al., 2008), alphabodies (WO2010066740), designed ankyrin- repeat domains (DARPins) (Stumpp et al., 2008), anticalins (Skerra et al., 2008), knottins (Kolmar et al., 2008) and engineered CH2 domains (nanoantibodies; Dimitrov, 2009). Preferably, said targeting moiety consists of a single polypeptide chain and is not post- translationally modified. Even more preferably, said targeting moiety is a nanobody.

The targeting moiety can be any targeting moiety known to the person skilled in the art. In a non-limiting example, said targeting moiety may be a bispecific antibody, directed to a binding site on the target cell for one specificity, and to the targeted cytokine, or to a tag fused to said cytokine for the other specificity. In another non-limiting example, the targeting moiety may be chemically linked to the mutant lnterleukin-1 , or it may be a recombinant fusion protein. Preferably, said targeting construct is a recombinant fusion protein. The targeting moiety may be fused directly to the mutant I L-1 β, or it may be fused with the help of a linker fragment, preferably a GGS linker. The targeting moiety may be fused at the aminoterminal or at the carboxyterminal end of the mutated IL-Ι β; preferably said targeting moiety is fused at the carboxyterminal extremity of the mutated I L-1 β molecule. The targeting construct may further comprise other domains such as, but not limited to a tag sequence, a signal sequence, another cytokine or an antibody.

Another aspect of the invention is a targeting construct according to the invention for use as a medicament. One preferred embodiment is a targeting construct according to the invention for use in stimulation of the immune response. Indeed, it is know that I L-1 treatment can induce antigen expression on B-cells (Killar et al., 1989); likewise, I L-18 treatment is augmenting cellular and humoral immunities (Kinoshita et al., 201 1 ). In a similar way, it has been demonstrated that I L-1 acts on T-cells to enhance the magnitude of in vivo immune responses (Ben-Sasson et al., 201 1 ; Ben Sasson et al., 2013). Therefore, one preferred aspect of the invention is the targeting construct according to the invention for use as an adjuvant in vaccination. The targeting construct according to the invention is especially interesting in this respect, as the pro-inflammatory effect of normal wild type I L-1 makes the application of I L-1 as such impossible. Still another aspect of the invention is a targeting construct according to the invention for use in treatment of cancer. Indeed, Morinaga et al., 1990, Usui et al., 1991 and Rangnekar et al., 1992 have shown that I L-1 family members do have direct cytostatic properties, which were most convincingly demonstrated on human melanoma cells.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 : Schematic representation of the I L-1 β-nanobody fusion proteins

Figure 2: Concentration dependency of the induction of the N FKB activity by wild type and mutant Q148G I L-1 Her2 nanobody fusions (A) and other selected mutants (B), in mock transfected cells, or cells transfected with signaling deficient Her2.

Figure 3: Effect of wild type and mutant (Q148G, L145A/L147A, F162A/Q164E) IL-1 Her2 nanobody fusions on nuclear translocation of endogenous NF-κΒ p65 in mock transfected cells, or cells transfected with signaling deficient Her2.

Figure 4: Induction of the N FKB activity by wild type and 5 different IL-1 mutants, fused to an anti-murine leptin receptor nanobody, on cells expressing the murine leptin receptor (mLR) or not (no mLR). Figure 5: Concentration dependency of the induction of the N FKB activity by IL1 double mutants fused to the Her2 nanobody in mock transfected cells, or cells transfected with signaling deficient Her2. EXAMPLES.

Materials and methods to the examples

Cloning of IL-1 -nanobody fusion proteins. The 4-10 nanobody directed against the murine leptin receptor is described in Zabeau et al. (2012) and in the patent WO 2006/053883. The anti-Her2 nanobody 1 R59B is described in Vaneycken et al. (201 1 ). Both nanobodies were cloned with a C-terminal His tag in the pMET7 eukaryotic expression vector. A codon-optimized sequence encoding the mature I L-1 β protein, preceded by the SigK leader peptide, and equipped with an N-terminal HA tag, was generated via gene synthesis (Invitrogen Gene Art). To generate the IL-13-nanobody fusion proteins, the I L-1 β sequence was cloned 5' to the nanobody sequence in pMet7, with a 13 x GGS linker separating the cytokine and nanobody moieties. (Fig. 1 )

IL-Ιβ mutants.

I L-1 β mutants expected to have reduced binding affinity for the IL-1 R were selected based on literature and analysis of published crystal structures of human I L-1 β complexed with its receptor. Mutations in the hlL-1 β moiety were created via site-directed mutagenesis (QuickChange, Stratagene) using the mutagenesis primers as indicated in table I:

Table I: mutants and primers used

Fw primer Rev primer

ATGAGCG GTCCCGCAG

K132A GCACCCTGCGGGACAGCCAGCAGGCTAGCC GGCCGCTCATGACCAGGCTAGCCTGCT TGGTCATGAGCGGCC GGCTGTCCCGCAGGGTGC

S137G/ CAGCAGAAAAGCCTGGTCATGGGGTACCCCT GCAGTGCCTTCAGCTCGTAGGGGTACC Q138Y ACGAGCTGAAGGCACTGC CCATGACCAGGC I I I I CTGCTG

L145G GCCCCTACGAGCTGAAGGCAGGTCATCTGCA CCATGTCCTGGCCCTGCAGATGACCTG GGGCCAGGACATGG CCTTCAGCTCGTAGGGGC

H146A CGAGCTGAAGGCACTGGCTCTTCAGGGCCA CCATGTCCTG GCCCTG AAG AG CCAGTG GGACATGG CCTTCAGCTCG

H146G CCTACGAGCTGAAGGCACTGGGTCTGCAGG CCATGTCCTGGCCCTGCAGACCCAGTG GCCAGGACATGG CCTTCAGCTCGTAGG

H146E GCTGAAGGCACTGGAGCTGCAGGGCCAGG CCTGGCCCTGCAGCTCCAGTGCCTTCA

GC

H146N AGCTGAAGGCACTGAATCTGCAGGGCCAG CTGGCCCTGCAGATTCAGTGCCTTCAGC

T

H146R CTGAAGGCACTGCGTCTGCAGGGCCAG CTGGCCCTGCAGACGCAGTGCCTTCAG

L145A GCGGCCCCTACGAGCTGAAGGCAGCGCATG CCATGTCCTGGCCCTGCGCATGCGCTG L147A CGCAGGGCCAGGACATGG CCTTCAGCTCGTAGGGGCCGC

Q148E GGCACTGCATCTGGAGGGCCAGGACAT ATGTCCTGGCCCTCCAGATGCAGTGCC

Q148G GAAGGCACTGCATCTGGGTGGCCAGGACAT GCTGTTCCATGTCCTGGCCACCCAGATG GGAACAGC CAGTGCCTTC

Q148L GCACTGCATCTGCTGGGCCAGGACATG CATGTCCTGGCCCAGCAGATGCAGTGC

Q148G/ CGAGCTGAAGGCACTGCATCTGGGGGGCGG CCTGCTGTTCCATGTCCCCGCCCCCCA Q150G GGACATGGAACAGCAGG GATGCAGTGCCTTCAGCTCG

Q150G/ GCACTGCATCTGCAGGGCGGGGCCATGGAA GCTGAACACGACCTGCTGTTCCATGGCC D151A CAGCAGGTCGTGTTCAGC CCGCCCTGCAGATGCAGTGC

M152G G C ACTG C ATCTG CAGGGCCAGGACGGGGAA GCTCATGCTGAACACCACCTGCTGTTCC CAGCAGGTGGTGTTCAGCATGAGC CCGTCCTGGCCCTGCAGATGCAGTGC

F162A CATGGAACAGCAGGTGGTGTTCAGCATGAGC GTCGTTGCTTTCCTCGCCCTGCACGGC GCCGTGCAGGGCGAGGAAAGCAACGAC GCTCATGCTGAACACCACCTGCTGTTCC

ATG

F162A GCAGGTCGTGTTCAGCATGAGCGCCGTGGA GGATCTTGTCATTGCTTTCCTCGCCCTC Q164E GGGCGAGGAAAGCAATGACAAGATCC CACGGCGCTCATGCTGAACACGACCTG

C

F166A CCGACTTCACCATGCAGGCCGTCTCCAGCGG CCAGATCTGCTGCCGCCGCTGGAGACG CGGCAGCAGATCTGG GCCTGCATGGTGAAGTCGG

Q164E/ GCATGAGCTTCGTGGGGGGCAAGGAAAGCA GGCCACGGGGATCTTGTCATTGCTTTCC E167K ATGACAAGATCCCCGTGGCC TTGCCCCCCACGAAGCTCATGC

N169G/ GCAGGGCGAGGAAAGCGGCGGCAAGATCCC CTTCTCTTTCAGGCCTAGGGCCACGGG D170G CGTGGCCCTAGGCCTGAAAGAGAAG GATCTTGCCGCCGCTTTCCTCGCCCTGC

1172 A GAAAGCAACGACAAGGCCCCCGTGGCCCTG CCCAGGGCCACGGGGGCCTTGTCGTTG GG CTTTC

V174A GCAACGACAAGATCCCCGCGGCCCTGGGCC CTTTCAGGCCCAGGGCCGCGGGGATCT Fw primer Rev primer

TGAAAG TGTCGTTGC

32 K208E GCAGCTGGAAAGCGTGGATCCCAAGAACTAC GCGTTTTTCCATCTTTTTCTCGGGGTAGT

CCCGAGAAAAAGATGGAAAAACGC TCTTGGGATCCACGCTTTCCAGCTGC

33 K209A CCCCAAGAACTACCCCAAGGCAAAGATGGAA GTTGAACACGAAGCGCTTTTCCATCTTT

AAGCGCTTCGTGTTCAAC GCCTTGGGGTAGTTCTTGGGG

34 K209D GCAGCTGGAAAGCGTGGATCCCAAGAACTAC GCGTTTTTCCATCTTGTCCTTGGGGTAG

CCCAAGGACAAGATGGAAAAACGC TTCTTGGGATCCACGCTTTCCAGCTGC

35 K209A CCCCAAGAACTACCCCAAGGCAGCGATGGAA GAACACGAAGCGTTTTTCCATCGCTGCC K210A AAACGCTTCGTGTTC TTGGGGTAGTTCTTGGGG

36 K219S AAAAACGCTTCGTGTTCAACAGCATCGAGAT GAGCTTGTTGTTGATCTCGATGCTGTTG

CAACAACAAGCTC AACACGAAGCGTTTTT

37 K219Q AAAAACGCTTCGTGTTCAACCAGATCGAGAT CTTGTTGTTG ATCTCG ATCTG GTTG AAC

CAACAACAAG ACGAAGCGTTTTT

38 E221S GCTTCGTGTTCAACAAGATCTCGATCAACAAC ACTCGAGCTTGTTGTTGATCGAGATCTT

AAGCTCGAGT GTTGAACACGAAGC

39 E221 K CTTCGTGTTCAACAAGATCAAGATCAACAACA TCG AG CTTGTTGTTG ATCTTGATCTTGTT

AGCTCGA GAACACGAAG

40 K219S/ GGAAAAACGCTTCGTCTTCAACAGCATCTCG CGAACTCGAGCTTGTTGTTGATCGAGAT E221S AT CAACAACAAG CTCG AGTTCG GCTGTTGAAGACGAAGCGTTTTTCC

41 E221S/ CGCTTCGTGTTCAACAAGATCTCGATCAACG CTCG AACTCG AG CTTG GCGTTG ATCG AG N224A CCAAGCTCGAGTTCGAG ATCTTGTTGAACACGAAGCG

42 N224S/ CAACAAGATCGAGATCAACAGCAGCCTCGAA CTGGGCGCTCTCGAATTCGAGGCTGCT K225S TTCGAGAGCGCCCAG GTTGATCTCGATCTTGTTG

43 E244K CCCCAACTG GTACATCAGTACTAGTCAG GCC GGAACACGGGCATATTCTTGGCCTGACT

AAGAATATGCCCGTGTTCC AGTACTGATGTACCAGTTGGGG

44 N245Q CAGCACTAGTCAGGCCGAGCAGATGCCCGT GGTGCCGCCCAGGAAGACGGGCATCTG

CTTCCTGGGCGGCACC CTCGGCCTGACTAGTGCTG

45 E244K/ CATCAGCACTAGTCAGGCCAAGCAGATGCCC GGTGCCGCCCAGGAAGACGGGCATCTG N245Q GTCTTCCTGGGCGGCACC CTTGGCCTGACTAGTGCTGATG

46 R120G/ GCGGCAGCGCCCCTGTCGGAAGCTTGAACT GCAGGGTGCAGTTCAAGCTTCCGACAG

* Q131 G GCACCCTGC GGGCGCTGCCGC

47 R120G/ CGAGCTGAAGGCACTGGCTCTTCAGGGCCA CCATGTCCTG GCCCTG AAG AG CCAGTG

* H146A GGACATGG CCTTCAGCTCG

49 R120G/ GCGGCCCCTACGAGCTGAAGGCAGCGCATG CCATGTCCTGGCCCTGCGCATGCGCTG

* L145A CGCAGGGCCAGGACATGG CCTTCAGCTCGTAGGGGCCGC

L147A

48 R120G/ GCGGCAGCGCCCCTGTCGGAAGCTTGAACT GCAGGGTGCAGTTCAAGCTTCCGACAG

** Q148G GCACCCTGC GGGCGCTGCCGC

50 R120G/ GCAGGTCGTGTTCAGCATGAGCGCCGTGGA GGATCTTGTCATTGCTTTCCTCGCCCTC

* F162A GGGCGAGGAAAGCAATGACAAGATCC CACGGCGCTCATGCTGAACACGACCTG Q164E C

51 R120G/ GCAGCTGGAAAGCGTGGATCCCAAGAACTAC GCGTTTTTCCATCTTTTTCTCGGGGTAGT

* K208E CCCGAGAAAAAGATGGAAAAACGC TCTTGGGATCCACGCTTTCCAGCTGC Fw primer Rev primer

52 Q131 G/ CTGCGGGACAGCCAGGGGAAGAGCCTGGTC CGCTCATGACCAGGCTCTTCCCCTGGCT

** Q148G ATGAGCG GTCCCGCAG

53 Q148G/ GCAGGTCGTGTTCAGCATGAGCGCCGTGGA GGATCTTGTCATTGCTTTCCTCGCCCTC

** F162A GGGCGAGGAAAGCAATGACAAGATCC CACGGCGCTCATGCTGAACACGACCTG Q164E C

54 Q148G/ GCAGCTGGAAAGCGTGGATCCCAAGAACTAC GCGTTTTTCCATCTTTTTCTCGGGGTAGT

** K208E CCCGAGAAAAAGATGGAAAAACGC TCTTGGGATCCACGCTTTCCAGCTGC

* double/triple-mutants were created using R120G as template. ** double/triple-mutants were created using Q148G as template.

Production of lL-Ιβ fusion proteins.

I L-1 β fusion proteins were produced in HEK293T cells. For small-scale production, HEK293T cells were seeded in 6-well plates at 400000 cells/well in DMEM supplemented with 10% FCS. After 24 hours, culture medium was replaced by medium with reduced serum (DMEM/5%FCS) and cells were transfected using linear PEL Briefly, PEI transfection mix was prepared by combining 1 μg expression vector with 5 μg PEI in 160 μΙ DMEM, incubated for 10 minutes at RT and added to the wells dropwise. After 24 hours, transfected cells were washed with DMEM and layered with 1 .5 ml OptiMem/well for protein production. Conditioned media were recuperated after 48 hours, filtered through 0.45 μ filters and stored at -20°C. I L-1 β content in the conditioned media was determined by Elisa according to the manufacturer's instructions (R&D Systems).

NF-KB reporter gene assay. To assess IL-1 R activation, we used HEK-Blue™ I L-1 β cells that stably express the IL-1 R (Invivogen) and transfected them transiently with an NF-κΒ luciferase reportergene. Briefly, HEK-Blue™ IL-1 β cells were seeded in culture medium (DMEM/10%FCS) in 96-well plates (10000 cells/well) and transfected the next day using the calciumphosphate precipitation method with the indicated amounts of expression plasmids and 5 ng/well of the 3KB-LUC reportergene plasmid (Vanden Berghe et al., 1998). 24 hours post-transfection, culture medium was replaced by starvation medium (DMEM) and 48 hours post-transfection, cells were induced for 6 hours with fusion proteins. After induction, cells were lysed and luciferase activity in lysates was determined using the Promega Firefly Luciferase Assay System on a Berthold centra LB960 luminometer. Analysis of NF-κΒ nuclear translocation via confocal microscopy.

For confocal imaging, 10⁵ HEK293-T cells/well (in 6-well plate) were seeded on glass coverslips (Zeiss), coated with poly-L-lysine (Sigma). The next day, cells were transfected with 200 ng/well of empty vector or HER2Acyt expression plasmid using the calcium phosphate precipitation method. After 48 hours, cells were treated for 30 minutes with vehicle (medium) or IL1 -Her2 nanobody fusion protein (10 ng/ml). Next, cells were rinsed with 1 PBS and fixed for 15 minutes at room temperature in 4% paraformaldehyde. After three washes with 1 xPBS, cells were permeabilized with 0.1 % Triton X-100 in 1 xPBS for 10 minutes and blocked in 1 % BSA in 1 xPBS for another 10 minutes at room temperature. Samples were then incubated for 1 hour at 37°C with rabbit anti-p65 antibody (Santa Cruz C20, diluted 1 :800) and mouse anti- Flag Antibody (Sigma M2, 1 :2000). After four washes in 1 x PBS, cells were incubated for 1 hour at room temperature with anti-rabbit Alexa 488 and anti-mouse Alexa 594 fluorochrome- conjugated secondary antibodies (both diluted 1 :800). After secondary antibody incubation, cells were washed four times in 1 xPBS and nuclei were stained with DAPI (2 μg/ml). After a final wash step in 1 xPBS, coverslips were mounted using propyl gallate. Images were acquired using a 60x 1 .35 NA objective on an Olympus IX-81 laser scanning confocal microscope and analyzed using Fluoview 1000 software.

Example 1 : IL-i -ligand and IL-i -nanobody fusion proteins. Fig. 1 shows a scheme of the IL-1 β-nanobody fusion proteins constructed with either WT hlL- 1 β or the hlL1 β mutants described in table I.

Example 2: IL-1 β activity of selected mutant IL-i p-nanobody fusions is restored on cells expressing the Nb targets.

Wild type I L-1 β and 45 I L-1 β mutants (Table I) were fused to a well-characterized nanobody recognizing Her2 (1 R59BJ. The IL-1 β-nanobody fusion proteins were tested on HEK-Blue™ IL- 1 β cells, transiently transfected with an NF-κΒ reportergene plasmid (5 ng/well) and a Her2Acyt (signalling-deficient) expression plasmid (2 ng/well). Cells were treated for 6 hours with ΙΙ_-1 β-ΗβΓ2 nanobody fusions (dose response ranging from 0,4 to 250 ng/ml). As demonstrated in Fig. 2A, the ΙΙ_-1 β-0148Θ-ΗβΓ2 nanobody fusion displayed a reduced ability to activate NF-κΒ as compared to the WT ΙΙ_1 -β-ΗβΓ2 nanobody fusion. Importantly, targeting of the Q148G mutant to Her2Acyt-expressing cells restored its activity and produced a dose- response curve for NF-κΒ activation that perfectly parallels that of the WT I L-1 β on mock- transfected cells. Also evident from this figure is a strong targeting effect for the WT IL-1 β Her2 nanobody fusion. Similar "activation by targeting" effects were observed for six other I L-1 β mutants (R120G, Q131 G, H146A, H145A/L147A, F162A/Q164E and K208E) fused to the Her2 nanobody (Fig. 2B).

To obtain further proof for the "activation by targeting" concept, we next explored whether we could visualize the selective activation of NF-κΒ in Her2-expressing cells by the Ιί-1 β-ΗβΓ2 nanobody fusions via confocal microscopy. We measured activation of endogenous NF-κΒ by assaying its nuclear translocation. As evident from Fig. 3, only the WT Ιί-1 β-ΗβΓ2 nanobody fusion promoted translocation of endogenous NF-κΒ in cells that do not express Her2. Whereas they did not promote detectable NF-κΒ translocation in mock-transfected cells, the three tested mutant IL1-3-Her2 nanobody fusions triggered NF-κΒ nuclear translocation in cells that also stained positive for Her2, indicating they only act on targeted cells. To evaluate whether the "activation by targeting" concept also works using a nanobody to an unrelated membrane protein, we fused WT I L-1 β and five of the disabled I L-1 β mutants (R120G, Q131 G, H 146A, Q148G, K209A) to a previously characterized nanobody recognizing the rmLR (4-10). An experiment similar to that reported for the IL-i p-Her2 nanobody fusion (Fig. 2) was performed using HEK-Blue™ I L-1 β cells, transiently transfected with a rmLR expression plasmid (10 ng/well). Similar to the results obtained with the Her2 nanobody fusion proteins, all investigated mutant I L-1 β nanobody fusions (tested at 12.5 ng/ml) showed a reduced ability, as compared to the WT fusion, to activate NF-κΒ on cells that do not express mLRs. However, targeting by the rmLR nanobody moiety partially restored the activity of the selected mutants (Fig. 4). Because the I L-1 β mutants described above retained significant residual biological activity, we combined different mutations to obtain double/triple mutants with reduced basal activity. Nine double/triple mutants were tested (cf. table I mutants 46 to 54) and from these, six mutant proteins (Q131 G/Q148G, Q148G/K208E, R120G/Q131 G, R120G/Q131 G, R120G/H146A, R120G/K208E, R120G/F162A/Q164E) displayed no residual activity (using the same assay for measuring NF-κΒ as in Fig. 2) on Her2-negative cells, whilst partially restored activity was apparent on cells overexpressing Her2Acyt (Fig. 5).

These data altogether indicate that targeting partially inactive mutant I L-1 β, by fusing it to a nanobody recognizing a cell surface receptor, can restore its activity on nanobody target cells, probably by forced receptor interaction through a membrane concentration effect. The fact that activation by targeting can be accomplished using nanobodies recognizing different classes of membrane proteins indicates broad applicability of the "activation by targeting" concept.

Because these data provide proof of concept for the ability of targeting mutant I L-1 family members to selected cell types, restoring their activity on these target cells only, nanobodies are produced that allow targeting I L-1 family members to physiologically relevant I L-1 β target cells. In view of the important role of I L-1 family members as T- and NK-cell activators, the nanobodies are designed to specifically target I L-1 to T- and NK-cell subsets. More specifically nanobodies targeting CCR6, which are predominantly expressed on Th17 cells as well as nanobodies targeting CD8 on cytotoxic T cells are developed and fused to the members of the I L1 -family, preferably I L-1 β. Example 3: Effect of IL-i -nanobody fusions on IL-17 production by primary human T cells.

Primary human T cells were isolated from buffy coats. First, PBMC's were isolated by lymphoprep density gradient centrifugation and incubated O/N with 0.5 ng/ml rhlL-2 for recovery. Next, T-cells were isolated using the pan-T cell isolation kit (Miltenyi Biotec) according to the manufacturer's instructions. Briefly, T cells were resuspended (1 x 10⁶/ml) in RPMI-1640 supplemented with 10 %FCS and CD3/CD28 activating microbeads (Miltenyi Biotec). Next, cells (100 μΙ/well) were plated in U-bottom 96-well plates and stimulated for 96 hours with the indicated concentrations of I L-1 β variants. After an additional 6 hours stimulation with PMA/ionomycin (both at 100 nM), supernatants were recovered and IL-17 levels were determined by Elisa (R&D Systems). Additional cytokines are evaluated via Luminex technology.

For selected mutant I L-1 β-nanobody fusions (e.g. with a nanobody targeting CCR6) target cell- specific IL-17 and IFNy production are evaluated by intracellular staining using a flow cytometric approach.

Also, to corroborate selectivity for the Th17 population, binding to PBMC subpopulations is measured via double staining using the Flag tag and selected CD markers, followed by flow cytometric analysis.

Finally, in a clinically relevant in vitro model of human Th17 cell function, the adjuvant activity of the IL-13-nanobody fusions is assessed. In view of the need for more efficacious vaccines against Bordetella pertussis (or adjuvants for the existing vaccines), we determined whether the selected fusion proteins enhance the human Th17 response in a coculture model of naive T cells with B. pertussis-treated monocyte-derived dendritic cells (MDDCs). Human MDDCs are isolated from buffy coats (using the monocyte isolation kit II, Miltenyi Biotec), treated with different ratios of B. pertussis for 48 hours and then cocultured with naive allogeneic T cells for 12 days. After restimulation with anti-CD3/anti-CD28, the cytokine profiles in supernatants are determined using Elisa/Luminex technology (cfr. supra).

Example 4: Effect of IL-i -nanobody fusions on CTLs

To assess whether IL-13-CD8 nanobody fusions can specifically enhance the function of CD8+ T cells, human PBMC's are isolated by lymphoprep density gradient centrifugation from buffy coats and stimulated for 24 hours with CD3/CD28 activating microbeads (Miltenyi Biotec) in combination with wt or mutant IL13-CD8 Nb fusions. The effect of these fusion proteins on CD8+ T cell activation is evaluated by performing intracellular staining for active (phosphorylated) NF-κΒ and IFNy. In addition, to investigate whether the IL-13-nanobody fusions affect CTL degranulation, PBMC's (2 x10⁶ cells/ml) are differentiated for 48 hours in the presence of phytohaemagglutinin (PHA, 1 μ9/η"ΐΙ) and IL-2 (100 lU/ml) in combination with increasing doses of the I L-1 β fusion proteins. Next, to induce degranulation, cells are stimulated for 3 hours with CD3/CD28 dynabeads and analysed by flow cytometry. Degranulation is measured via detection of cell surface CD107a, a well-established marker for natural killer activity. In all flow cytometric analyses on leukocyte pools, anti-CD8 staining is included to allow monitoring of the cell-type specificity of the I L-13-CD8 Nb effects.

Finally to assess whether the IL-13-CD8 nanobody fusions promote anti-tumor activity in vivo, C57BL/6 mice are injected subcutaneously with TC1 tumor cells, which produce the E6 and E7 antigenic oncoproteins from HPV16. This model was previously used to demonstrate that I L-1 β promotes CD8+ T cell-mediated, antigen-specific, anti-tumor responses (Ben-Sasson, 2013). Briefly, mice are immunized four days after tumor injection with a vaccine containing the HPV16E 7₄9_-57 peptide, combined with DOTAP and LPS, and with our without WT or mutant IL- 13-CD8 Nb fusions or IL-13-GFP Nb fusions. Tumor size is monitored for 18 days post- immunization.

Example 5: In vivo experiments - Vaccine adjuvans effect.

In a first series of experiments C57BL/6 mice are treated iv/ip with different doses of WT and mutant IL-13-nanobody fusions and unfused I L-1 β, to monitor acute toxicity. Venous blood is collected at different times post treatment by tail venepuncture and the cytokine profile in serum is determined by Luminex assay. In addition, via flow cytometric analysis intracellular cytokine levels (IL-17, IFNy) and activation of IL-1 R (as assessed by measuring phospho-NF- KB levels) are determined in selected leukocyte subsets.

When optimal doses have been established, their adjuvant activity is assessed in a murine vaccination protocol. Briefly, C57BL/6 mice are immunized ip with acellular pertussis vaccine (Pa). The Pa vaccine is composed of 5 μg mouse of purified recombinant detoxified pertussis toxin (PT9K/129G) + filamentous hemagglutinin (FHA) (composition according to Brereton et al., 201 1 ). 24 hours after immunization, selected mutant I L1 β-Nb or PBS are administered ip or iv. Animals are boosted after 28 days. One set of animals is sacrificed 14 days after the second immunization and splenocytes are isolated and restimulated in vitro with medium or FHA for 3 days. Cytokine levels in culture supernatants (IL-17, IFNy, IL-2, IL-10, IL-5, IL-4, etc.) are determined via Luminex technology. A second set of mice is challenged with B. pertussis on day 14 post-boost and sacrificed 2h and 5 and 10 days post-challenge. Lungs are isolated and CFU in lung homogenates will be quantified on Bordet-Gengou agar plates. Cytokine levels in lung homogenates are determined as in splenocyte supernatants. In addition, blood is sampled (from the tail vene) before immunization and then every 14 days for determination of B. pertussis-specific IgG levels in serum.

Example 6: Direct antitumor effect of IL-i -nanobody fusions

To investigate the direct anti-tumour activity of selected IL1 -nanobody fusions, we use human A375 melanoma cells, which were shown to be highly susceptible to IL-1 -induced cytostatic effects (Morinaga et al., 1990). To allow targeting of mutant IL-1 family members to the A375 cells, a stable A375 clone expressing a cell surface marker to which high-affinity nanobodies are already available (i.e. CD20) is generated. The sensitivity of this cell line, as compared to the parental A375 cells, to the antiproliferative effect of the mutant IL1 -nanobody fusion, is investigated in vitro using the XTT proliferation assay. In vivo anti-tumour activity of the mutant IL-1 -nanobody fusions is investigated using an A375 xenotransplant model. Briefly, athymic nude mice are inoculated subcutaneously with A375 cells (parental or expressing a surface marker for targeting) and tumor growth is monitored for four weeks in animals treated with PBS or mutant IL1 -nanobody fusions. Example 7: Extension of principle to IL18: application in tumor models

To assess the indirect anti-tumour activity of IL1 family members, experiments are conducted to address the efficacy of selected mutant IL-18-nanobody fusions using the Meth A syngeneic mouse sarcoma model according to the protocol that was used previously to demonstrate anti- tumour activity of IL-18 (Micallef et al., 1997). IL18 variants used in these experiments consist of mutant IL-18s fused to nanobodies targeting immune cells with tumoricidal properties (i.e. CTLs, NK-cells). The mice are treated with the construct, and a significant reduction of the tumor is noted when compared to the mock treated control.

REFERENCES

Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. (2007) Interleukins 1 beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17- producing human T helper cells. Nat Immunol. 8:942-9. Allakhverdi Z, Smith DE, Comeau MR, Delespesse G. (2007) Cutting edge: The ST2 ligand IL- 33 potently activates and drives maturation of human mast cells. J Immunol. 179:2051 -4.

Ben-Sasson SZ, Caucheteux S, Crank M, Hu-Li J, Paul WE. (201 1 ) IL-1 acts on T cells to enhance the magnitude of in vivo immune responses. Cytokine.56: 122-5.

Ben-Sasson SZ, Hogg A, Hu-Li J, Wingfield P, Chen X, Crank M, Caucheteux S, Ratner- Hurevich M, Berzofsky JA, Nir-Paz R, Paul WE. (2013) IL-1 enhances expansion, effector function, tissue localization, and memory response of antigen-specific CD8 T cells. J Exp Med. 210:491 -502.

Blake, A.W., McCartney, L., Flint, J., Bolam, D.N., Boraston, A.B., Gilbert, H.J. and Knox, J. P. (2006) Understanding the biological rationale for the diversity of cellulose-directed carbohydrate-binding molecules in prokaryotic enzymes. J. Biol. Chem. 281 , 29321 -29329.

Bonilla WV, Frohlich A, Senn K, Kallert S, Fernandez M, Johnson S, Kreutzfeldt M, Hegazy AN, Schrick C, Fallon PG, Klemenz R, Nakae S, Adler H, Merkler D, Lohning M, Pinschewer DD.(2012). The alarmin interleukin-33 drives protective antiviral CD8⁺ T cell responses. Science. 335:984-9. Brecht A., Gauglitz G., Polster J. (1993). Interferometric immunoassay in a FIA-system - A sensitive and rapid approach in label-free immunosensing. , Biosens Bioelectron 8 : 387-392.

Brereton CF, Sutton CE, Ross PJ, Iwakura Y, Pizza M, Rappuoli R, Lavelle EC, Mills KH. (201 1 ). Escherichia coli heat-labile enterotoxin promotes protective Th17 responses against infection by driving innate IL-1 and IL-23 production. J Immunol. 201 1 May 15;186(10):5896- 906.

Dimitrov, D.S. (2009) Engineered CH2 domains (nanoantibodies). mAbs 1 , 26-28.

Dinarello CA, Simon A, van der Meer JW. (2012). Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nat Rev Drug Discov. 1 1 :633-52.

Dunne A, Ross PJ, Pospisilova E, Masin J, Meaney A, Sutton CE, Iwakura Y, Tschopp J, Sebo P, Mills KH. (2010). Inflammasome activation by adenylate cyclase toxin directs Th17 responses and protection against Bordetella pertussis. J Immunol. 185:171 1 -9. Higgins SC, Jarnicki AG, Lavelle EC, Mills KH. TLR4 mediates vaccine-induced protective cellular immunity to Bordetella pertussis: role of IL-17-producing T cells. J Immunol. 2006 Dec 1 ;177(1 1 )7980-9.

Khader SA, Bell GK, Pearl JE, Fountain JJ, Rangel-Moreno J, Cilley GE, Shen F, Eaton SM, Gaffen SL, Swain SL, Locksley RM, Haynes L, Randall TD, Cooper AM. (2007). IL-23 and IL- 17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat Immunol. 2007 8:369-77.

Killar, L.M., Hatfield, C.A., Carding, S.R., Pan, M., Winterrowd, G.E. and Bottomly, K. (1989) In vivo administration of interleukin 1 elecits an increased la antigen expression on B cells throught the production of interleukin 4. Eur. J. Immunol. 19, 2205-2210.

Kinoshita, M., Miyazaki, H., Ono, S., Inatsu, A., Nakashima, H., Tsujimoto, H., Shinomiya, N., Saitoh, D. and Seki, S. (201 1 ). Enhancement of neutrophil function by interleukin 18 therapy protects burn-injuredf mice from methicillin-resistant Staphylococcus aureus. Infect. Immun. 79, 2670-2680. Kolmar, H. (2008) Alternative binding proteins: biological activity and therapeutic potential of cysteine-knot miniproteins. FEBS J. 275, 2684-2690.

Leung BP, Culshaw S, Gracie JA, Hunter D, Canetti CA, Campbell C, Cunha F, Liew FY, Mclnnes IB. (2001 ). A role for IL-18 in neutrophil activation. J Immunol. 167:2879-86.

Loeffler M, Le'Negrate G, Krajewska M, Reed JC. (2008). IL-18-producing Salmonella inhibit tumor growth. Cancer Gene Ther. 15:787-94.

Micallef MJ, Tanimoto T, Kohno K, Ikeda M, Kurimoto M. (1997). Interleukin 18 induces the sequential activation of natural killer cells and cytotoxic T lymphocytes to protect syngeneic mice from transplantation with Meth A sarcoma. Cancer Res. ;57:4557-63.

Morinaga Y, Hayashi H, Takeuchi A, Onozaki K. (1990). Antiproliferative effect of interleukin 1 (IL-1 ) on tumor cells: G0-G1 arrest of a human melanoma cell line by IL-1. Biochem Biophys Res Commun. 173:186-92.

Nygren, P-A. (2008) Alternative binding proteins: affibody binding proteins developed from a small three-helix bundle scaffold. FEBS J. 275, 2668-2676.

Okamura H, Tsutsi H, Komatsu T, Yutsudo M, Hakura A, Tanimoto T, Torigoe K, Okura T, Nukada Y, Hattori K, et al. (1995). Cloning of a new cytokine that induces IFN-gamma production by T cells. Nature. 378:88-91 . Rangnekar VV, Waheed S, Rangnekar VM. (1992). lnterleukin-1 -inducible tumor growth arrest is characterized by activation of cell type-specific "early" gene expression programs. J Biol Chem. 267:6240-8.

Robertson MJ, Kirkwood JM, Logan TF, Koch KM, Kathman S, Kirby LC, Bell WN, Thurmond LM, Weisenbach J, Dar MM. (2008). A dose-escalation study of recombinant human interleukin-18 using two different schedules of administration in patients with cancer. Clin Cancer Res. 14:3462-9

Scatchard G. (1949). Ann New York Acad Sci 51 , 660-72.

Schmitz J, Owyang A, Oldham E, Song Y, Murphy E, McClanahan TK, Zurawski G, Moshrefi M, Qin J, Li X, Gorman DM, Bazan JF, Kastelein RA. (2005). IL-33, an interleukin-1 -like cytokine that signals via the IL-1 receptor-related protein ST2 and induces T helper type 2- associated cytokines. Immunity. 23:479-90.

Shaw MH, Kamada N, Kim YG, Nunez G. (2012). Microbiota-induced IL-1 β, but not IL-6, is critical for the development of steady-state TH17 cells in the intestine. J Exp Med. 209:251 -8. Sims JE, Smith DE. The IL-1 family: regulators of immunity. (2010). Nat Rev Immunol. 10:89- 102.

Skerra, A. (2008) Alternative binding proteins: anticalins - harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities. FEBS J. 275, 2677-2683.

Stump, M.T., Binz, H.K., Amstutz, P. (2008) DARPins: a new generation of protein therapeutics. Drug iscov. Today 13, 695-701.

Sutton C, Brereton C, Keogh B, Mills KH, Lavelle EC. (2006). A crucial role for interleukin (IL)- 1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med. 203:1685-91.

Takeda K, Tsutsui H, Yoshimoto T, Adachi O, Yoshida N, Kishimoto T, Okamura H, Nakanishi K, Akira S. (1998). Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8:383-90.

Tramontano, A., Bianchi, E., Venturini, S., Martin, F., Pessi, A and Sollazzo, M. (1994) The making of the minibody: an engineered beta-protein for the display of conformationally constrained peptides. J. Mol. Recognition 7, 9-24. Usui N, Mimnaugh EG, Sinha BK. (1991 ). A role for the interleukin 1 receptor in the synergistic antitumor effects of human interleukin 1 alpha and etoposide against human melanoma cells. Cancer Res. 1991 51 :769-74.

Vanden Berghe W, Plaisance S, Boone E, De Bosscher K, Schmitz ML, Fiers W, Haegeman G. (1998). p38 and extracellular signal-regulated kinase mitogen-activated protein kinase pathways are required for nuclear factor-kappaB p65 transactivation mediated by tumor necrosis factor. J Biol Chem. 273:3285-90.

Vaneycken I, Devoogdt N, Van Gassen N, Vincke C, Xavier C, Wernery U, Muyldermans S, Lahoutte T, Caveliers V. (201 1 ). Preclinical screening of anti-HER2 nanobodies for molecular imaging of breast cancer. FASEB J. 25:2433-46.

Wigginton JM, Lee JK, Wiltrout TA, Alvord WG, Hixon JA, Subleski J, Back TC, Wiltrout RH. (2002). Synergistic engagement of an ineffective endogenous anti-tumor immune response and induction of IFN-gamma and Fas-ligand-dependent tumor eradication by combined administration of IL-18 and IL-2. J Immunol. 169:4467-74. Wilke CM, Bishop K, Fox D, Zou W. (201 1 ). Deciphering the role of Th17 cells in human disease. Trends Immunol. 32:603-1 1.

Ye P, Rodriguez FH, Kanaly S, Stocking KL, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, Shellito JE, Bagby GJ, Nelson S, Charrier K, Peschon JJ, Kolls JK. (2001 ). Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med. 194:519-27.

Zabeau L, Verhee A, Catteeuw D, Faes L, Seeuws S, Decruy T, Elewaut D, Peelman F, Tavernier J. (2012). Selection of non-competitive leptin antagonists using a random nanobody- based approach. Biochem J. 441 :425-34.

Zaki MH, Vogel P, Body-Malapel M, Lamkanfi M, Kanneganti TD. (2010). IL-18 production downstream of the Nlrp3 inflammasome confers protection against colorectal tumor formation. J Immunol. 185:4912-20.

Claims

1 . A targeting construct, comprising a modified IL-1 family cytokine characterized by a reduced affinity for its receptor, and a targeting moiety.

2. The targeting construct, according to claim 1 , wherein said modified IL-1 family cytokine is a mutant IL-1 family cytokine.

3. The targeting construct according to claim 1 or 2, wherein said targeting moiety is targeting to a marker expressed on a IL-1 family cytokine receptor expressing cell.

4. The targeting construct, according to claim 2, wherein said mutant IL-1 family cytokine is a mutant I L-1 β.

5. The targeting construct, according to claim 4, wherein said targeting moiety is targeting to a marker expressed on an IL-1 R1 and/or IL-1 RacP expressing cell.

6. The targeting construct according to any of the preceding claims, wherein said targeting moiety is directed to a tissue specific marker.

7. The targeting construct according to any of the claims 1 -5, wherein said targeting moiety is directed to Her2.

8. The targeting construct according to any of the previous claims, wherein said targeting moiety is an antibody.

9. The targeting construct according to claim 8, wherein said antibody is a nanobody.

10. The targeting construct according to any of the preceding claims, wherein the modified IL-1 family cytokine is an I L-1 β mutant, selected from the group consisting of

A1 17G/P1 18G, R120GR120X, L122A, T125G/L126G, R127G, Q130X, Q131 G, K132A, S137G/Q138Y, L145G, H146X, L145A/L147A, Q148X, Q148G/Q150G, Q150G/D151A, M152G, F162A, F162A/Q164E, F166A, Q164E/E167K, N169G/D170G, I 172A, V174A, K208E, K209A K209X, K209A/K210A, K219X, and E221 KX, E221 S/N224A, N224S/K225S, E244K and N245Q

1 1 . A targeting construct according to any of the claims 1 -10 for use as a medicament.

12. The targeting construct according to any of the claims 1 -10 for use in stimulation of the immune response.

13. The targeting construct according to any of the claims 1 -10 for use in treatment of cancer.