WO2015007294A1 - Chimera silver nanocluster probes for mirna detection - Google Patents
Chimera silver nanocluster probes for mirna detection Download PDFInfo
- Publication number
- WO2015007294A1 WO2015007294A1 PCT/DK2014/050227 DK2014050227W WO2015007294A1 WO 2015007294 A1 WO2015007294 A1 WO 2015007294A1 DK 2014050227 W DK2014050227 W DK 2014050227W WO 2015007294 A1 WO2015007294 A1 WO 2015007294A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dna
- agnc
- rna
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
Definitions
- the present disclosure relates to silver nanocluster (AgNC) probes for specific and sensitive micro RNA (miRNA) detection.
- the AgNC probes of the present invention are DNA/RNA chimera oligonucleotides.
- the disclosure further relates to methods for detecting miRNAs in biological samples.
- MicroRNAs are small regulatory RNAs of about 21 nucleotides (nt) to about 25 nt which regulate a variety of important cellular events in plants, animals and single cell eukaryotes.
- nt nucleotides
- 25 nt nucleotide
- the individual levels of miRNAs can be useful biomarkers for cellular events or disease diagnosis.
- miRNAs are detected by quantitative RT-PCR, northern blot analysis, microarray and illumina sequencing.
- oligonucleotide probes for miRNA detection utilising the fluorescent properties of silver nanoclusters have been developed.
- Yang et al. disclose silver nanocluster DNA probes for detection of miRNAs.
- the probes of Yang et al. comprise a 12 nucleotide DNA sequence capable of creating a red emitting AgNC and a 21 nucleotide DNA sequence complementary to the miRNA target sequence (Yang et al., 2011).
- the present invention solves the above problem by providing a DNA/RNA chimera oligonucleotide silver nanocluster (AgNC) probe comprising or consisting of: a) a 12nt DNA AgNC scaffold and an RNA complementary sequence against target miRNA comprising at least 21 nucleotides, or b) a 12nt RNA AgNC scaffold and a DNA complementary sequence against target miRNA comprising at least 21 nucleotides.
- AgNC DNA/RNA chimera oligonucleotide silver nanocluster
- the invention further relates to a method for detecting a miRNA using the above- defined DNA/RNA chimera oligonucleotide.
- the present inventors have surprisingly shown that DNA/RNA chimera oligonucleotides defined as above can be used as efficient hybridisation probes for miRNA detection - even in situations where an oligonucleotide with an identical sequence comprising only DNA nucleotide residues has failed as a miRNA detection probe.
- the advantages of the present invention are numerous and include:
- Figure 1 shows a DNA/RNA chimeric AgNC probe directed against human miR-Let7a (SEQ ID NO:5) and an RNA/DNA chimeric AgNC probe directed against miR160 of Arabidopsis thaliana (SEQ ID NO: 13).
- FIG. 1 Fluorescence profile of the miR-Let-7a-D12-R22 probe (1.5 uM; SEQ ID NO: 1) in the presence of different concentrations of target miRNA.
- MiR-Let-7a (SEQ ID NO: 5) in a concentration ranging from 0.05 uM to 1.5 uM were hybridized with the probe for 10 min and then highly emissive AgNCs were generated by addition of AgN03 and NaBH4.
- Figure 3 shows a bar graph of the fluorescence intensity from figure 2.
- Figure 4. Stern-Volmer plot of the data presented in Figure 2. The Stern-Volmer plot follows a linear dependence of the l 0 /l intensity versus miR-Let-7a target concentration (l 0 being the value without target).
- FIG. 6 Emission spectra of 7.5 ⁇ _ miR-Let-7a-D12-R22 probe (black square; SEQ ID NO: 1) and mixtures of 7.5 ⁇ _ miR-Let-7a-D12-R22 probe with 7.5 ⁇ _ of miR-Let-7a target (open circle curve; SEQ ID NO:5), miR-21 target (open triangle; SEQ ID NO: 10), miR200C target (inverted open triangle; SEQ ID NO:6), miR172 target (diamond with cross; SEQ ID NO: 11), miR166 target (triangle with X; SEQ ID NO: 12) and miR122 target (triangle with cross; SEQ ID NO:7).
- the miR-Let-7a-D12-R22 sensor is capable of recognizing its target miRNA with high specificity.
- FIG. 9 Emission spectra of 7.5 ⁇ _ R12-D21-160 (SEQ ID NO:2), an example of a reverse (RNA/DNA) chimera which generates a highly emissive AgNC species.
- the probe creates a strong red emission (black square).
- the emission was significantly dropped.
- 19 bp target diamond; miR-160 19bp; SEQ ID NO: 18
- 21 bp target triangle; miR-160; SEQ ID NO:13).
- FIG. 10 Detection of miR-let-7a in cancer cell lines using Let-7a-D12-R22 sensor (SEQ ID NO: 1).
- Graph shows the emission intensity of Let-7a-D12-R22 sensor and sensor with total RNAs from different cancer cell lines.
- Small RNA blot analysis shows the level of miR-let-7a in each cancer cell lines.
- U6snRNP used as a loading control. The results show that the Let-7a-D12-R22 probe is capable of detecting its target in vitro.
- a control or a control sample according to the present invention is understood to be a sample which in the context of the currently tested miRNA can function as a control to determine relative changes in expression of the miRNA.
- the control may have either a low (or no: include probe only)) expression of the miRNA, normal expression of the miRNA, or elevated expression depending on the purpose of the test. For instance, if one is to test a cancer cell sample for aberrant (higher or lower) expression of a particular miRNA, one may use a tissue or cell sample from a normal (non-cancerous) tissue of the same origin. E.g. if a breast cancer tissue sample is tested for elevated expression of a particular miRNA, the expression may be compared to the expression of the miRNA in normal breast tissue.
- a multiplex assay is an assay that simultaneously measures multiple analytes in a single run/cycle of the assay. In the present context, multiplex assaying is used to denote the simultaneous measurement of two or more miRNAs in a sample. Sequences miR-Let-7a-D12-R22 chimera probe:
- miRNAs are involved in various biological processes and pathological responses, particularly in the development of organs and tissues.
- miRNAs are key regulators for the shape of leaves, flower development, flowering time, reproduction, stem development, apical dominancy and root development.
- Profiling the levels of miRNAs has been an indispensable approach for detailed understanding of plant development and growth.
- the expression levels of miRNAs have been especially correlated to cancer type, stage of tumour, and treatment response.
- MiRNAs have become a new class of biomarkers for diagnostic analysis as well as therapeutic targets themselves.
- ERa estrogen receptor
- miRNAs let-7 microRNAs
- the sensitivity of the method is highly changeable due to the melting temperature of the designed probe and the labelling of target miRNA is also a difficult step in the procedure.
- LNA locked nucleic acid
- Alternative strategies based on nanotechnology have been developed for miRNA detection such as Electrocatalytic Nanoparticle Tags (ENT), Surface Plasmon Resonance Imaging (SPRI), Gold-nanoparticles-based array and Surface Enhanced Raman Scattering (SERS)-based assays.
- ENT Electrocatalytic Nanoparticle Tags
- SPRI Surface Plasmon Resonance Imaging
- SERS Surface Enhanced Raman Scattering
- Our detection strategy is based on the emission properties of small silver nano- clusters.
- small silver clusters (less than 100 atoms) can be stabilized, leading to bright and photo-stable fluorescence.
- a scaffold base sequence of 12 nucleotides (12nt-RED: 5'-CCTCCTTCCTCC-3' (SEQ ID NO:3)) that associates in creating a red emitting DNA/AgNC based on the work of Richard et al (Richards et al., 2008).
- DNA/RNA chimeric probes were designed to have a complementary sequence to different target miRNAs.
- miRNAs in humans such as miR-Let-7a (Let-7a) are very difficult to design highly emissive DNA/AgNC probes against using standard DNA/AgNC methods.
- standard DNA/AgNC methods simply fail to provide usable detection probes.
- the current chimera method being a 12nt DNA scaffold and a 22nt RNA complementary sequence against target miRNA (e.g. Let-7a) or a combination of a 12nt RNA and a 21 nt DNA complementary sequence (e.g.
- the present invention provides a novel oligonucleotide probe for simple, inexpensive and instant miRNA detection in biological samples.
- the DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide probe of the present invention comprises or consists of:
- the 12 nucleotide DNA/RNA sequence which is not complementary to the sequence of the target miRNA functions as a scaffold for silver nanoclustering.
- the 12 nucleotide sequence acting as a AgNC scaffold is a DNA sequence according to SEQ ID NO:3 or an RNA sequence according to SEQ ID NO:4.
- the 12 nucleotide sequence acting as a AgNC scaffold is a DNA or RNA sequence according to either of SEQ ID NOs:3 or 4 wherein the bases at one, two or three positions are exchanged for another base.
- the 12 nucleotide sequence acting as a AgNC scaffold is a DNA or RNA sequence having at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to either of SEQ I D NOs:3 or 4.
- the AgNC scaffold is RNA and vice versa, so that a DNA/RNA chimeric nucleotide is obtained.
- the RNA or DNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA is a DNA or RNA sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 40 nucleotides, for example from 21 to 30 nucleotides, more preferred between 21 and 25 nucleotides.
- the length of the target complementary sequence is the same length as the target miRNA and 100% complementary thereto.
- the target complementary sequence is longer than the target miRNA.
- the target complementary sequence is a DNA or RNA sequence consisting of 22 consecutive nucleotides, said consecutive nucleotides being 100% complementary to the sequence of a target miRNA.
- the miRNA target is a human miRNA, such as one or more of the human miRNAs listed in the below table.
- the target miRNA is one of more of the miRNAs selected from the group consisting of: hsa-miR-Let-7a, hsa-miR-200c, hsa-miR-122, hsa-miR-9, hsa-miR-210, hsa-miR-27b and hsa-miR-21.
- melanoma Prostate cancer, Neuroblastoma, cardiomyopathy, SLE
- hsa-miR- 5'- UGGAGUGUGACAAUGGUGUUUG - 3' Oral Squamous Cell carcinoma, 122 (SEQ ID NO:7) Hepatocellular Carcinoma, HCV infection, Breast Cancer, Gastric cancer, Lung cancer,
- ALL lymphoblastic leukemia
- AML acute myeloid leukemia
- MDD Duchenne muscular dystrophy
- Lung cancer Pancreatic Cancer, Prostate cancer, Kidney cancer, Head and Neck Cancer, cervical cancer, Gastric cancer, hsa-miR- 5'- UAGCUUAUCAGACUGAUGUUGA - 3' Colorectal Cancer, diffuse large B- 21 (SEQ ID NO:10) cell lymphoma (DLBCL), lung cancer, Pancreatic cancer, Breast Cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, hepatocellular carcinoma (HCC), Vascular disease, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), autism spectrum disorder (ASD),
- ALL acute lymphoblastic leukemia
- AML acute myeloid leukemia
- AML acute myeloid leukemia
- ASSD autism spectrum disorder
- CLL chronic lymphocytic leukemia
- DMD epithelial ovarian cancer
- OSCC head and neck squamous cell carcinoma
- HNSCC heart failure
- NSCLC non-small cell lung cancer
- cholesteatoma Hodgkin's lymphoma
- Colon Carcinoma hsa-miR- 5'- UUCACAGUGGCUAAGUUCUGC-3'
- miR-27b is located on chromosome 9 and has been shown to function as a tumor suppressor in neuroblastoma via targeting the peroxisome proliferator-activated receptor c
- miR-27b targets vascular endothelial growth factor C
- VEGFC tumor progression and angiogenesis
- the chimera silver nanocluster (AgNC) oligonucleotide probe of the present invention is a probe capable of detecting human miR-Let-7a.
- MiR-Let-7a is involved in the regulation of expression of multiple genes and plays a role in several types of human cancers.
- the miR-Let-7a detection probe is a 12nt DNA/22nt RNA probe comprising or consisting of SEQ ID NO:1.
- the probe directed against miR-Let-7a comprises or consists of an oligonucleotide sequence wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3.
- the invention relates to a variant of SEQ ID NO: 1 , wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3.
- the probe directed against miR-Let-7a comprises or consists of an oligonucleotide sequence wherein the bases at one, two or three positions of the AgNC part are exchanged for another base as compared to the sequence of SEQ ID NO:3.
- the invention relates to a variant of SEQ ID NO: 1 , wherein the bases at one, two or three positions of the AgNC scaffold sequence part are exchanged for another base as compared to the sequence of SEQ ID NO:3.
- the target miRNA is a plant miRNA, such as Arabidopsis thaliana miR-160.
- the chimera oligonucleotide is an R12-D21 chimera oligonucleotide comprising or consisting of SEQ ID NO:2.
- the 12 nt RNA AgNC scaffold sequence may be modified as described above.
- the present invention relates to use of the AgNC oligonucleotide probe of the present invention for diagnosing a disease.
- the diagnostic method is an in vitro diagnostic method performed on a biological sample isolated from a subject as described further herein below.
- the present invention relates to use of the AgNC oligonucleotide probe of the present invention for classifying a disease based on miRNA expression.
- the disease may be selected from ovarian cancer, Colorectal cancer, breast cancer, lung cancer, melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE, Oral Squamous Cell carcinoma, Hepatocellular Carcinoma, HCV infection, Gastric cancer, Lung cancer, Pancreatic cancer.
- Hodgkin's lymphoma Epithelial Ovarian Cancer, Gastric Cancer, diffuse large B-cell lymphoma (DLBCL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Duchenne muscular dystrophy (DMD), Kidney cancer, Head and Neck Cancer, cervical cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, Vascular disease, autism spectrum disorder (ASD), Cervical cancer, chronic lymphocytic leukemia (CLL), esophageal cancer, Glioblastoma, uterine leiomyoma (ULM), Bladder cancer, head and neck squamous cell carcinoma (HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Colon Carcinoma, leukemia, Alzheimer's disease and diabetes.
- DLBCL diffuse large B-cell lymphoma
- ALL acute lymphoblastic leukemia
- AML
- the disease is a cancer, such as breast cancer or prostate cancer.
- Method for detection of miRNA is a cancer, such as breast cancer or prostate cancer.
- the present invention further provides a method for detecting one or more miRNAs in a sample.
- the method for miRNA detection comprises the steps of:
- chimera oligonucleotides of the present invention comprising a nucleotide sequence being 100% complementary to a target miRNA
- an altered fluorescence intensity compared to a control indicates an altered expression of said miRNA. If the sample has an increased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be lower than the control. Vice versa, if the sample has a decreased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be higher than the control.
- the Ag-containing composition is preferably AgN0 3 .
- the Ag-containing composition further comprises NaBH 4 .
- Addition of AgN0 3 and NaBH 4 results in the generation of AgNC's with DNA or RNA working as a scaffold.
- the reaction is performed in the presence of a suitable buffer.
- buffer solutions include TAPS, Bicine, Tris, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, MES, Succinic acid.
- the buffer is a Tris-acetate buffer, for example a Tris-acetate buffer such as a 20 mM or a 40 mM Tris-acetate buffer solution.
- the buffer further comprises NaN03.
- the concentration of NaN03 is usually in the range of 1 to 50 mM, for example 5-30 mM, such 5 mM or 25 mM NaN03.
- the present method is preferably an in vitro miRNA detection method capable of detecting one or more miRNAs in a sample obtained from a plant or an animal, preferably from a human, such as in a tissue or cell sample or body fluid such as urine, saliva or serum obtained from the human.
- the present method may be applied to any sample comprising RNA.
- the sample may be whole blood or a biopsy obtained from a relevant organ or tissue of the human body, such as a tumour biopsy comprising cancer cells.
- the sample comprising one or more miRNAs is a biological sample selected from the group consisting of whole cell lysate and isolated total RNA obtained from a tissue or cells.
- the quantification provided by the method of the present invention is usually a relative quantification seen in comparison to the expression level of the particular miRNA in a relevant control sample.
- the excitation/emission spectra of the miRNA probes of the present invention depend on the specific nucleotide sequence and secondary structures formed by the probe.
- the emission peaks of particular miRNA AgNC probes can be determined by measuring the emitted fluorescence after excitation at different wavelengths as previously described by e.g. Yang et al., 201 1.
- the emitted fluorescence may be measured after excitation at an appropriate wavelength with any equipment capable of measuring fluorescence, such as a fluorimeter.
- the present method is a multiplex miRNA detection method that allows for the detection of two or more miRNAs simultaneously in the same sample. Different maximal excitation/emission wavelengths of individual miRNA probes allows for detection of more than one miRNA in the same reaction.
- two or more different miRNAs are detected in the same reaction.
- three or more different miRNAs are detected in the same reaction.
- the present method is used for the specific and sensitive detection and quantification of a single-stranded nucleotide species, different from a miRNA, in a sample, such as siRNA, intermediate non-coding RNA and long non- coding RNA.
- the probe will be a chimera oligonucleotide comprising a nucleotide sequences comprising at least 21 nucleotides or more and being 100% complementary to the target sequence.
- the invention also provides a kit comprising one or more DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide miRNA detection probes and the reagents needed for testing samples.
- AgNC DNA/RNA chimera silver nanocluster
- the invention further relates to a kit of parts for detection of one or more miRNAs in a sample comprising:
- RNA/RNA chimera silver nanocluster (AgNC) oligonucleotide miRNA detection probes comprising a 21 nucleotide sequence
- kit of parts optionally comprises instructions for use of the kit.
- the instructions for use may be essentially as described in Example 1.
- the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of SEQ ID NO: 1.
- the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of an oligonucleotide wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3.
- the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of an oligonucleotide wherein the AgNC scaffold sequence part comprises or consists of an oligonucleotide sequence wherein the bases at one, two or three positions are exchanged for another base as compared to the sequence of SEQ ID NO:3.
- the kit of parts may further comprise a buffer solution suitable for detection of miRNAs.
- miR-Let-7a-D12-R22 means a DNA 12nt scaffold (D12) and a 100% complementary RNA sequence (R22) to Let-7a (22nt). miR-Let-7a-D12-R22 probe - Stock- ⁇ ⁇ :
- the NaBH4 solution may be prepared by pre-measuring 2mg of NaBH4 in 50ml conical tube. Just before the NaBH4 is to be used, 50 ml water is added to the tube and the contents are mixed by brief vortexing. The solution is used within about 5 minutes of addition of water.
- reaction volume is added 450 ⁇ of MilliQ water to make up to 500 ⁇ volume (The used fluorimeter apparatus requires at least 500 ⁇ volume)
- reaction volume is added 450 ⁇ of MilliQ water to make up to 500 ⁇ volume (The used fluorimeter apparatus requires at least 500 ⁇ volume)
- Buffer Concentration in 50 ⁇ reaction volume is 10mM Tris Acetate and 0.5mM NaCI.
- the chimera miR-Let-7a-D12-R22 probe (SEQ ID NO:1) successfully generated a strong red fluorescence when it was excited at 540 nm whereas the following standard 100% DNA AgNC probes did not efficiently form highly emissive AgNCs:
- the base sequence is identical between the functional SEQ ID NO: 1 and the nonfunctional SEQ ID NO: 14, the only difference being that SEQ ID NO:1 is a DNA/RNA chimera, while SEQ ID NO: 14 is 100% DNA.
- SEQ ID NO:1 is a DNA/RNA chimera
- SEQ ID NO: 14 is 100% DNA.
- FIG. 6 shows an overview of the observed red AgNC fluorescence, 1 h after AgN03 and NaBH4 are added to solutions containing final concentrations of 1.5 ⁇ (7.5 ⁇ _) miR-Let-7a-D12-R22 probe (SEQ ID NO:1) and 1.5 ⁇ miR-Let-7a target (open circle curve; SEQ ID NO:5), miR21 target (open triangle; SEQ ID NO: 10), miR200C target (inverted open triangle; SEQ ID NO:6), miR172 target (diamond with cross; SEQ ID NO:), miR166 target (triangle with X; SEQ ID NO:12) and miR122 target (triangle with cross; SEQ ID NO:7).
- the miR-Let-7a target has the largest effect on l 0 /l ratio as can be seen in Figure 8 (a ⁇ 8 times drop in the fluorescence intensity), while the presence of other non-specific targets only has a limited effect on the observed fluorescence intensity of the miR-Let-7a-D12-R22 probe.
- RNA has been considered to form more flexible structures and wobble mismatch pairs.
- wobble base pairing where highly emissive silver clusters can be encapsulated and that fairly open may occur in the chimera miR-Let-7a-D12-R22 probe to explain the high fluorescence obtained.
- the experiment shows that a combination of a 12nt RNA sequence acting as a AgNC scaffold and a 21 nt DNA target complementary sequence also functions in addition to the D12-R21 combination shown for detection of miR-Let7a in Example 1.
- Detection of miR-let-7a levels in cancer cell lines was performed essentially as described previously by Yang and Vosch (201 1) with minor modification (used Tris- acetate buffer). Briefly, the sensor (Let-7a-D12-R22 (SEQ ID NO:1)) was incubated with total RNA from each cell line for 20 min and the creation of AgNCs were commenced as previously described in Yang and Vosch (201 1).
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure relates to silver nanocluster (AgNC) oligonucleotide probes for specific and sensitive micro RNA (miRNA) detection. The AgNC probes are DNA/RNA chimera oligonucleotides. Further disclosed are methods for detecting miRNAs in biological samples and a kit of parts comprising the AgNC miRNA probes.
Description
Chimera silver nanocluster probes for miRNA detection
Field of invention
The present disclosure relates to silver nanocluster (AgNC) probes for specific and sensitive micro RNA (miRNA) detection. The AgNC probes of the present invention are DNA/RNA chimera oligonucleotides. The disclosure further relates to methods for detecting miRNAs in biological samples.
Background of invention
MicroRNAs (miRNAs) are small regulatory RNAs of about 21 nucleotides (nt) to about 25 nt which regulate a variety of important cellular events in plants, animals and single cell eukaryotes. The individual levels of miRNAs can be useful biomarkers for cellular events or disease diagnosis. Thus, efforts have been directed towards the
development of rapid, simple and sequence selective detection of miRNAs. Currently, miRNAs are detected by quantitative RT-PCR, northern blot analysis, microarray and illumina sequencing.
Recently, oligonucleotide probes for miRNA detection utilising the fluorescent properties of silver nanoclusters (AgNCs) have been developed. Yang et al. disclose silver nanocluster DNA probes for detection of miRNAs. The probes of Yang et al. comprise a 12 nucleotide DNA sequence capable of creating a red emitting AgNC and a 21 nucleotide DNA sequence complementary to the miRNA target sequence (Yang et al., 2011).
In a follow-up study, Shah et al. discovered that simply replacing the oligonucleotide sequence complementary to the target miRNA did not always ensure that probes were capable of forming fast, bright emission suitable for use in miRNA detection. It was concluded that the secondary structure of the probe plays an important role in the generation of fluorescent AgNCs and thus for sufficient probe emission. Shah et al. further concluded that DNA/RNA hybrids (perfect complementary) were not capable of generating fluorescent AgNCs, presumably due to a different conformation of the DNA- RNA hybrid (Shah et al., 2012).
Sufficient target specificity, sensitivity and initial emission intensity is a challenge with current AgNC probe design strategies. There is thus a need in the art for the design of novel AgNC probes for miRNA detection with sufficient initial emission intensity and a higher degree of target sensitivity and specificity.
Summary of invention
The present invention solves the above problem by providing a DNA/RNA chimera oligonucleotide silver nanocluster (AgNC) probe comprising or consisting of: a) a 12nt DNA AgNC scaffold and an RNA complementary sequence against target miRNA comprising at least 21 nucleotides, or b) a 12nt RNA AgNC scaffold and a DNA complementary sequence against target miRNA comprising at least 21 nucleotides.
The invention further relates to a method for detecting a miRNA using the above- defined DNA/RNA chimera oligonucleotide. The present inventors have surprisingly shown that DNA/RNA chimera oligonucleotides defined as above can be used as efficient hybridisation probes for miRNA detection - even in situations where an oligonucleotide with an identical sequence comprising only DNA nucleotide residues has failed as a miRNA detection probe. The advantages of the present invention are numerous and include:
• Simple, inexpensive and instant technique for miRNA detection
• Improved target sensitivity
• Improved target specificity
· Improved initial emission intensity of the probe
• Faster miRNA detection than with conventional time-consuming methods such as northern blot analysis and quantitative RT-PCR
• No radioisotopes or DIG labelling necessary
• Possible to design probes for miRNAs, for which previous DNA/AgNC probe design efforts have failed
Description of Drawings
Figure 1 shows a DNA/RNA chimeric AgNC probe directed against human miR-Let7a (SEQ ID NO:5) and an RNA/DNA chimeric AgNC probe directed against miR160 of Arabidopsis thaliana (SEQ ID NO: 13).
Figure 2. Fluorescence profile of the miR-Let-7a-D12-R22 probe (1.5 uM; SEQ ID NO: 1) in the presence of different concentrations of target miRNA. MiR-Let-7a (SEQ ID NO: 5) in a concentration ranging from 0.05 uM to 1.5 uM were hybridized with the probe for 10 min and then highly emissive AgNCs were generated by addition of AgN03 and NaBH4.
Figure 3 shows a bar graph of the fluorescence intensity from figure 2. Figure 4. Stern-Volmer plot of the data presented in Figure 2. The Stern-Volmer plot follows a linear dependence of the l0/l intensity versus miR-Let-7a target concentration (l0 being the value without target).
Figure 5. Bar graph conversion of Figure 4.
Figure 6. Emission spectra of 7.5 μΙ_ miR-Let-7a-D12-R22 probe (black square; SEQ ID NO: 1) and mixtures of 7.5 μΙ_ miR-Let-7a-D12-R22 probe with 7.5 μΙ_ of miR-Let-7a target (open circle curve; SEQ ID NO:5), miR-21 target (open triangle; SEQ ID NO: 10), miR200C target (inverted open triangle; SEQ ID NO:6), miR172 target (diamond with cross; SEQ ID NO: 11), miR166 target (triangle with X; SEQ ID NO: 12) and miR122 target (triangle with cross; SEQ ID NO:7). The miR-Let-7a-D12-R22 sensor is capable of recognizing its target miRNA with high specificity.
Figure 7. Bar graph of the fluorescence intensity of Figure 6.
Figure 8. I0/I values of the fluorescence intensity of the AgNC when adding 7.5 μΙ_ of the different miRNA sequences to 7.5 μΙ_ of miR-Let-7a-D12-R22 (SEQ ID NO: 1).
Figure 9. Emission spectra of 7.5 μΙ_ R12-D21-160 (SEQ ID NO:2), an example of a reverse (RNA/DNA) chimera which generates a highly emissive AgNC species. In 20
mM Tris-acetate buffer condition, the probe creates a strong red emission (black square). In the presence of 7.5 μΙ_ target sequences, the emission was significantly dropped. 19 bp target (diamond; miR-160 19bp; SEQ ID NO: 18), 21 bp target (triangle; miR-160; SEQ ID NO:13).
Figure 10. Detection of miR-let-7a in cancer cell lines using Let-7a-D12-R22 sensor (SEQ ID NO: 1). Graph shows the emission intensity of Let-7a-D12-R22 sensor and sensor with total RNAs from different cancer cell lines. Small RNA blot analysis shows the level of miR-let-7a in each cancer cell lines. U6snRNP used as a loading control. The results show that the Let-7a-D12-R22 probe is capable of detecting its target in vitro.
Definitions
Control: A control or a control sample according to the present invention is understood to be a sample which in the context of the currently tested miRNA can function as a control to determine relative changes in expression of the miRNA. The control may have either a low (or no: include probe only)) expression of the miRNA, normal expression of the miRNA, or elevated expression depending on the purpose of the test. For instance, if one is to test a cancer cell sample for aberrant (higher or lower) expression of a particular miRNA, one may use a tissue or cell sample from a normal (non-cancerous) tissue of the same origin. E.g. if a breast cancer tissue sample is tested for elevated expression of a particular miRNA, the expression may be compared to the expression of the miRNA in normal breast tissue.
Complementary: Two nucleotide sequences are said to be complementary if, when they are aligned antiparallel to each other, they are able to anneal to form a double helix. Two nucleotides are said to be 100% complementary if the nucleotide bases form Watson-Crick base pairs at each possible position. If two nucleotides are of different lengths, 100% complementarity implies the formation of Watson-Crick base pairs at each possible position in the overlapping region.
Multiplex: A multiplex assay is an assay that simultaneously measures multiple analytes in a single run/cycle of the assay. In the present context, multiplex assaying is used to denote the simultaneous measurement of two or more miRNAs in a sample. Sequences miR-Let-7a-D12-R22 chimera probe:
5'-CCTCCTTCCTCCrArArCrUrArUrArCrArArCrCrUrArCrUrArCrCrUrCrA- 3' (SEQ ID NO: 1) miR-160-R12-D21 chimera probe:
5'- rCrCrUrCrCrUrUrCrCrUrCrCTGGCATACAGGGAGCCAGGCA-3' (SEQ ID NO:2)
12 nt AgNC DNA scaffold sequence:
5'-CCTCCTTCCTCC-3' (SEQ ID NO:3)
12 nt AgNC RNA scaffold sequence:
5'-rCrCrUrCrCrUrUrCrCrUrCrC-3' (SEQ ID NO:4) Hsa-miR-Let-7a:
5' - UGAGGUAGUAGGUUGUAUAGUU - 3' (SEQ ID NO:5) hsa-miR-200c :
5' - UAAUACUGCCGGGUAAUGAUGGA - 3' (SEQ ID NO:6) hsa-miR-122
5'- UGGAGUGUGACAAUGGUGUUUG - 3' (SEQ ID NO:7) hsa-miR-9
5'- UCUUUGGUUAUCUAGCUGUAUGA - 3' (SEQ ID NO:8) hsa-miR-210
5'- CUGUGCGUGUGACAGCGGCUGA
hsa-miR-21
5'- UAGCUUAUCAGACUGAUGUUGA - 3' (SEQ ID NO: 10) hsa-miR-27b
5'- UUCACAGUGGCUAAGUUCUGC-3' (SEQ ID NO: 18) Ath-miR172:
5'-AGAAUCUUGAUGAUGCUGCAU-3' (SEQ ID NO:1 1) Ath-miR166:
5'-UCGGACCAGGCUUCAUUCCCC-3' (SEQ ID N0: 12) Ath-miR160:
5'- UGCCUGGCUCCCUGUAUGCCA -3' (SEQ ID N0: 13)
Non-functional 100% DNA AgNC probes for miR-Let-7a:
5'-CCTCCTTCCTCCAACTATACAACCTACTACCTCA -3' (SEQ ID NO: 14)
5'-CCTCCTTCCTCCAACTATACAACCTACTACCTCAGG -3' (SEQ ID NO: 15) 5'-CCTCCTAACTATACAACCTACTACCTCAAGGAGG -3' (SEQ ID NO: 16)
5'-AAAAAACTATACAACCTACTACCTCATTTTTT -3' (SEQ ID NO: 17)
Ath-miR-160 19bp:
5'- UGCCUGGCUCCCUGUAUGC -3' (SEQ ID NO: 18)
Detailed description of the invention
Recent studies have reported that miRNAs are involved in various biological processes and pathological responses, particularly in the development of organs and tissues. In plants, miRNAs are key regulators for the shape of leaves, flower development, flowering time, reproduction, stem development, apical dominancy and root development. Profiling the levels of miRNAs has been an indispensable approach for detailed understanding of plant development and growth. In humans, in addition to the roles in development and growth, the expression levels of miRNAs have been especially correlated to cancer type, stage of tumour, and treatment response. MiRNAs
have become a new class of biomarkers for diagnostic analysis as well as therapeutic targets themselves.
For instance, estrogen receptor (ER)a has oncogenic roles and a correlation with let-7 microRNAs (miRNAs) has been reported in breast tumours. Due to let-7 expression in ER-positive breast tumour tissues and a correlation between let-7, ERa and ERa downstream genes, it has been suggested that let-7 has a role as a tumour suppressor in ER-positive breast cancer stem cells, further suggesting that let-7 can be used as a biomarker of breast cancer (Sun et al., 2013). On the other hand, one of the most urgent clinical needs in prostate cancer (PCa) is the isolation of efficient prognostic markers to avoid overtreatment and to improve clinical risk stratification. Recent studies have suggested that specific miRNAs such as let-7b can be used as putative prognostic markers in a high-risk PCa (Schubert et al., 2013). Several methods for miRNA detection have been developed for research purposes and clinical diagnosis. Those methods can be separated into several categories, each with its own advantages and drawbacks; microarray-based, nanotechnology-based, QRT- PCR-based, amplification-based, enzymatic assay-based and deep sequencing-based. These current methods offer good specificity and sensitivity but real practical application of them is still limited due to their high cost, time-consuming and complex procedures. For instance, the microarray-based method has been most widely used for the profiling of miRNAs and is based on the hybridization between target and complementary probe. In addition to the high cost, the sensitivity of the method is highly changeable due to the melting temperature of the designed probe and the labelling of target miRNA is also a difficult step in the procedure. To improve on these weak points, the locked nucleic acid (LNA) technique was developed to upgrade the microarray method, however it still has limited accurate miRNA detection. Alternative strategies based on nanotechnology have been developed for miRNA detection such as Electrocatalytic Nanoparticle Tags (ENT), Surface Plasmon Resonance Imaging (SPRI), Gold-nanoparticles-based array and Surface Enhanced Raman Scattering (SERS)-based assays. In spite of their significant specificity and sensitivity to fM concentrations, these methods mostly require sophisticated instruments with very high running cost and also suffer from many skilled and difficult processing steps.
Our detection strategy is based on the emission properties of small silver nano- clusters. With the proper scaffold materials, small silver clusters (less than 100 atoms) can be stabilized, leading to bright and photo-stable fluorescence. We selected a scaffold base sequence of 12 nucleotides (12nt-RED: 5'-CCTCCTTCCTCC-3' (SEQ ID NO:3)) that associates in creating a red emitting DNA/AgNC based on the work of Richard et al (Richards et al., 2008). By using the 12 nucleotides sequence as a scaffold for AgNC, DNA/RNA chimeric probes were designed to have a complementary sequence to different target miRNAs. Some miRNAs in humans, such as miR-Let-7a (Let-7a) are very difficult to design highly emissive DNA/AgNC probes against using standard DNA/AgNC methods. In spite of having very high cytosine contents and relatively high Tm values, in some cases standard DNA/AgNC methods simply fail to provide usable detection probes. To overcome the problem, we invented the current chimera method being a 12nt DNA scaffold and a 22nt RNA complementary sequence against target miRNA (e.g. Let-7a) or a combination of a 12nt RNA and a 21 nt DNA complementary sequence (e.g.
miR160 in plant).
MicroRNA detection probe
The present invention provides a novel oligonucleotide probe for simple, inexpensive and instant miRNA detection in biological samples. The DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide probe of the present invention comprises or consists of:
a) a 12 nucleotide DNA sequence acting as a AgNC scaffold and an RNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA, or b) a 12 nucleotide RNA sequence acting as a AgNC scaffold and a DNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA.
The 12 nucleotide DNA/RNA sequence which is not complementary to the sequence of the target miRNA functions as a scaffold for silver nanoclustering.
In one embodiment the 12 nucleotide sequence acting as a AgNC scaffold is a DNA sequence according to SEQ ID NO:3 or an RNA sequence according to SEQ ID NO:4. In one embodiment, the 12 nucleotide sequence acting as a AgNC scaffold is a DNA or RNA sequence according to either of SEQ ID NOs:3 or 4 wherein the bases at one, two or three positions are exchanged for another base.
In one embodiment, the 12 nucleotide sequence acting as a AgNC scaffold is a DNA or RNA sequence having at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to either of SEQ I D NOs:3 or 4.
If the target complementary sequence is DNA, the AgNC scaffold is RNA and vice versa, so that a DNA/RNA chimeric nucleotide is obtained. In one embodiment, the RNA or DNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA is a DNA or RNA sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 40 nucleotides, for example from 21 to 30 nucleotides, more preferred between 21 and 25 nucleotides.
Usually, the length of the target complementary sequence is the same length as the target miRNA and 100% complementary thereto.
In one embodiment, the target complementary sequence is longer than the target miRNA.
In one embodiment, the target complementary sequence is a DNA or RNA sequence consisting of 22 consecutive nucleotides, said consecutive nucleotides being 100% complementary to the sequence of a target miRNA.
In one embodiment, the miRNA target is a human miRNA, such as one or more of the human miRNAs listed in the below table. Thus, in one embodiment, the target miRNA is one of more of the miRNAs selected from the group consisting of: hsa-miR-Let-7a, hsa-miR-200c, hsa-miR-122, hsa-miR-9, hsa-miR-210, hsa-miR-27b and hsa-miR-21.
miRNA Sequence Diseases
Name
hsa-miR- 5' - UAAUACUGCCGGGUAAUGAUGGA - 3' Ovarian cancer, Colorectal cancer, 200c (SEQ ID NO:6) breast cancer, lung cancer,
melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE
hsa-miR- 5'- UGGAGUGUGACAAUGGUGUUUG - 3' Oral Squamous Cell carcinoma, 122 (SEQ ID NO:7) Hepatocellular Carcinoma, HCV infection, Breast Cancer, Gastric cancer, Lung cancer,
hsa-miR- 5'- UGAGGUAGUAGGUUGUAUAGUU- 3' Lung cancer, hepatocellular Let-7a (SEQ ID NO:5) carcinoma, Oral Squamous cell carcinoma, Prostate cancer, Breast cancer, Pancreatic cancer hsa-miR-9 5'- UCUUUGGUUAUCUAGCUGUAUGA - 3' Hodgkin's lymphoma, Epithelial
(SEQ ID NO:8) Ovarian Cancer, Lung cancer,
Neuroblastoma, Ovarian Cancer, Hepatocellular Carcinoma, Gastric Cancer
hsa-miR- 5'- CUGUGCGUGUGACAGCGGCUGA - 3' Breast Cancer, diffuse large B-cell 210 (SEQ ID NO:9) lymphoma (DLBCL), acute
lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Breast Cancer, Duchenne muscular dystrophy (DMD), Lung cancer, Pancreatic Cancer, Prostate cancer, Kidney cancer, Head and Neck Cancer, cervical cancer, Gastric cancer, hsa-miR- 5'- UAGCUUAUCAGACUGAUGUUGA - 3' Colorectal Cancer, diffuse large B- 21 (SEQ ID NO:10) cell lymphoma (DLBCL), lung cancer, Pancreatic cancer, Breast Cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, hepatocellular carcinoma (HCC), Vascular disease, acute
lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), autism spectrum disorder (ASD),
Cervical cancer, chronic lymphocytic leukemia (CLL),
Duchenne muscular dystrophy
(DMD), epithelial ovarian cancer
(EOC), esophageal cancer,
Gastric Cancer, Glioblastoma,
Ovarian Cancer, uterine leiomyoma (ULM), Bladder cancer,
Oral Squamous Cell Carcinoma
(OSCC), head and neck squamous cell carcinoma
(HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Hodgkin's lymphoma, Colon Carcinoma, hsa-miR- 5'- UUCACAGUGGCUAAGUUCUGC-3' (SEQ Dysregulation of miRNA-27b has
27b ID NO:18) been reported in Prostate cancer,
Lung cancer, Non small cell lung cancer, Neuroblastoma, Leukemia, esophageal cancer, breast cancer, colorectal cancer, glioblastoma, cardiac hypertrophy and oral squamous cell carcinoma. miR-27b is located on chromosome 9 and has been shown to function as a tumor suppressor in neuroblastoma via targeting the peroxisome proliferator-activated receptor c
(PPARc). miR-27b targets vascular endothelial growth factor C
(VEGFC) and functioned as an inhibitor of tumor progression and angiogenesis through targeting
VEGFC in Colorectal cancer.
In a particular embodiment, the chimera silver nanocluster (AgNC) oligonucleotide probe of the present invention is a probe capable of detecting human miR-Let-7a.
MiR-Let-7a is involved in the regulation of expression of multiple genes and plays a role in several types of human cancers.
In one embodiment, the miR-Let-7a detection probe is a 12nt DNA/22nt RNA probe comprising or consisting of SEQ ID NO:1. In one embodiment, the probe directed against miR-Let-7a comprises or consists of an oligonucleotide sequence wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3. Thus, in one embodiment, the invention relates to a variant of SEQ ID NO: 1 , wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3.
In one embodiment, the probe directed against miR-Let-7a comprises or consists of an oligonucleotide sequence wherein the bases at one, two or three positions of the AgNC part are exchanged for another base as compared to the sequence of SEQ ID NO:3. Thus, in one embodiment, the invention relates to a variant of SEQ ID NO: 1 , wherein the bases at one, two or three positions of the AgNC scaffold sequence part are exchanged for another base as compared to the sequence of SEQ ID NO:3.
In one embodiment, the target miRNA is a plant miRNA, such as Arabidopsis thaliana miR-160.
In one embodiment the chimera oligonucleotide is an R12-D21 chimera oligonucleotide comprising or consisting of SEQ ID NO:2. The 12 nt RNA AgNC scaffold sequence may be modified as described above.
In one embodiment, the present invention relates to use of the AgNC oligonucleotide probe of the present invention for diagnosing a disease. Preferably, the diagnostic method is an in vitro diagnostic method performed on a biological sample isolated from a subject as described further herein below.
In one embodiment, the present invention relates to use of the AgNC oligonucleotide probe of the present invention for classifying a disease based on miRNA expression.
The disease may be selected from ovarian cancer, Colorectal cancer, breast cancer, lung cancer, melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE, Oral Squamous Cell carcinoma, Hepatocellular Carcinoma, HCV infection, Gastric cancer, Lung cancer, Pancreatic cancer. Hodgkin's lymphoma, Epithelial Ovarian Cancer, Gastric Cancer, diffuse large B-cell lymphoma (DLBCL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Duchenne muscular dystrophy (DMD), Kidney cancer, Head and Neck Cancer, cervical cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, Vascular disease, autism spectrum disorder (ASD), Cervical cancer, chronic lymphocytic leukemia (CLL), esophageal cancer, Glioblastoma, uterine leiomyoma (ULM), Bladder cancer, head and neck squamous cell carcinoma (HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Colon Carcinoma, leukemia, Alzheimer's disease and diabetes.
In one embodiment, the disease is a cancer, such as breast cancer or prostate cancer. Method for detection of miRNA
The present invention further provides a method for detecting one or more miRNAs in a sample. The method for miRNA detection comprises the steps of:
a) providing a sample comprising one or more miRNAs,
b) providing one or more chimera oligonucleotides of the present invention comprising a nucleotide sequence being 100% complementary to a target miRNA,
c) contacting said chimera oligonucleotide with said sample,
d) generating AgNC's by addition of a suitable Ag-containing composition, and
e) measuring the emitted fluorescence,
wherein an altered fluorescence intensity compared to a control indicates an altered expression of said miRNA.
If the sample has an increased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be lower than the control. Vice versa, if the sample has a decreased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be higher than the control.
The Ag-containing composition is preferably AgN03. In a preferred embodiment, the Ag-containing composition further comprises NaBH4. Addition of AgN03 and NaBH4 results in the generation of AgNC's with DNA or RNA working as a scaffold. The reaction is performed in the presence of a suitable buffer. Exemplary buffer solutions include TAPS, Bicine, Tris, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, MES, Succinic acid. In one embodiment, the buffer is a Tris-acetate buffer, for example a Tris-acetate buffer such as a 20 mM or a 40 mM Tris-acetate buffer solution. In one embodiment, the buffer further comprises NaN03. The concentration of NaN03 is usually in the range of 1 to 50 mM, for example 5-30 mM, such 5 mM or 25 mM NaN03.
The present method is preferably an in vitro miRNA detection method capable of detecting one or more miRNAs in a sample obtained from a plant or an animal, preferably from a human, such as in a tissue or cell sample or body fluid such as urine, saliva or serum obtained from the human.
The present method may be applied to any sample comprising RNA. For instance, the sample may be whole blood or a biopsy obtained from a relevant organ or tissue of the human body, such as a tumour biopsy comprising cancer cells.
In one embodiment the sample comprising one or more miRNAs is a biological sample selected from the group consisting of whole cell lysate and isolated total RNA obtained from a tissue or cells.
The quantification provided by the method of the present invention is usually a relative quantification seen in comparison to the expression level of the particular miRNA in a relevant control sample.
The excitation/emission spectra of the miRNA probes of the present invention depend on the specific nucleotide sequence and secondary structures formed by the probe. The emission peaks of particular miRNA AgNC probes can be determined by measuring the emitted fluorescence after excitation at different wavelengths as previously described by e.g. Yang et al., 201 1.
The emitted fluorescence may be measured after excitation at an appropriate wavelength with any equipment capable of measuring fluorescence, such as a fluorimeter.
In one embodiment the present method is a multiplex miRNA detection method that allows for the detection of two or more miRNAs simultaneously in the same sample. Different maximal excitation/emission wavelengths of individual miRNA probes allows for detection of more than one miRNA in the same reaction.
In one embodiment two or more different miRNAs are detected in the same reaction.
In one embodiment three or more different miRNAs are detected in the same reaction.
In an alternative embodiment, the present method is used for the specific and sensitive detection and quantification of a single-stranded nucleotide species, different from a miRNA, in a sample, such as siRNA, intermediate non-coding RNA and long non- coding RNA. In such cases the probe will be a chimera oligonucleotide comprising a nucleotide sequences comprising at least 21 nucleotides or more and being 100% complementary to the target sequence.
Kit of parts
The invention also provides a kit comprising one or more DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide miRNA detection probes and the reagents needed for testing samples.
Thus, the invention further relates to a kit of parts for detection of one or more miRNAs in a sample comprising:
a) one or more DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide miRNA detection probes comprising a 21 nucleotide sequence being
100% complementary to target miRNA,
b) AgN03, and
c) NaBH4. The kit of parts optionally comprises instructions for use of the kit. The instructions for use may be essentially as described in Example 1.
In one embodiment the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of SEQ ID NO: 1.
In one embodiment, the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of an oligonucleotide wherein the AgNC scaffold sequence part has at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3.
In one embodiment, the kit of parts comprises an oligonucleotide miRNA detection probe directed against miR-Let-7a, said probe comprising or consisting of an oligonucleotide wherein the AgNC scaffold sequence part comprises or consists of an oligonucleotide sequence wherein the bases at one, two or three positions are exchanged for another base as compared to the sequence of SEQ ID NO:3.
The kit of parts may further comprise a buffer solution suitable for detection of miRNAs.
References
Richards CI, Choi S, Hsiang JC, Antoku Y, Vosch T, Bongiorno A, Tzeng YL, Dickson RM. Oligonucleotide-stabilized Ag nanocluster fluorophores. J Am Chem Soc. 2008 Apr 16; 130(15):5038-9.
Schubert M , Spahn M , Kneitz S, Scholz CJ, Joniau S, Stroebel P, Riedmiller H, Kneitz B. Distinct microRNA Expression Profile in Prostate Cancer Patients with Early Clinical Failure and the Impact oflet-7 as Prognostic Marker in High-Risk Prostate Cancer. PLoS One. 2013 Jun 14;8(6):e65064.
Shah P, R0rvig-Lund A, Chaabane SB, Thulstrup PW, Kjaergaard HG, Fron E, Hofkens J, Yang SW, Vosch T. Design aspects of bright red emissive silver nanoclusters/DNA probes for microRNA detection. ACS Nano. 2012 Oct
23;6(10):8803-14.
Sun X, Qin S, Fan C, Xu C, Du N, Ren H. Let-7: a regulator of the ERct signaling pathway in human breast tumors and breast cancer stem cells. Oncol Rep. 2013 May;29(5):2079-87.
Yang SW, Vosch T. Rapid detection of microRNA by a silver nanocluster DNA probe. Anal Chem. 201 1 Sep 15;83(18):6935-9.
Examples
Example 1. Sensitivity and specificity of DNA-RNA chimera miR-l_et-7a D12-R22 probe
Sequences:
The nomenclature "miR-Let-7a-D12-R22" means a DNA 12nt scaffold (D12) and a 100% complementary RNA sequence (R22) to Let-7a (22nt). miR-Let-7a-D12-R22 probe - Stock-Ι ΟΟμΜ:
5'- CCTCCTTCCTCCrArArCrUrArUrArCrArArCrCrUrArCrUrArCrCrUrCrA-3' (SEQ ID NO: 1) hsa-miR-Let-7a - Stock-100μΜ:
5' - UGAGGUAGUAGGUUGUAUAGUU - 3' (SEQ ID NO:5)
Solutions: 500mM Tris Acetate Buffer (Stock)
5mM NaCI Solution (Stock)
MilliQ Water- 18.2ΜΏ
1 mM AgN03 solution
1 mM NaBH4 solution
The NaBH4 solution may be prepared by pre-measuring 2mg of NaBH4 in 50ml conical tube. Just before the NaBH4 is to be used, 50 ml water is added to the tube and the contents are mixed by brief vortexing. The solution is used within about 5 minutes of addition of water.
For DNA/RNA chimera miRNA probe:
1. Take 7.5μΙ of the stock DNA/RNA chimera miRNA probe Solution.
2. Add 7.5μΙ of MilliQ Water
3. Add 1 μΙ of Tris Acetate Solution
4. Add 5μΙ of NaCI solution
5. Add 4μΙ of MilliQ Water to make up to 25μΙ reaction volume
6. Vortex and briefly spin down.
7. Denature 25μΙ reaction mixture by heating at 95°C for 10 mins
8. Briefly spin down to collect evaporated volume.
9. Allow reaction mixture to anneal by incubating at 25°C for 20 minutes
10. Add 12.5μΙ of AgN03 and 12.5μΙ of freshly prepared NaBH4.
1 1. Incubate the 50μΙ reaction volume at 25°C for 1 hr.
12. After 1 hr the reaction volume is added 450μΙ of MilliQ water to make up to 500μΙ volume (The used fluorimeter apparatus requires at least 500μΙ volume)
For microRNA detection:
1. Take 7.5μΙ of 100μΜ stock DNA/RNA chimera miRNA probe Solution.
2. Add corresponding volume of the miRNA (Refer to table).
3. Add 1 μΙ of Tris Acetate Solution
4. Add 5μΙ of NaCI solution
5. Add MilliQ Water to make up to 25μΙ reaction volume
6. Vortex and briefly spin down.
7. Denature 25μΙ reaction mixture by heating at 95°C for 10 minutes
8. Briefly spin down to collect evaporated volume.
9. Allow reaction mixture to anneal by incubating at 25°C for 20 minutes
10. Add 12.5μΙ of AgN03 and 12.5μΙ of freshly prepared NaBH4.
1 1. Incubate 50μΙ reaction volume at 25°C for 1 hr.
12. After 1 hr the reaction volume is added 450μΙ of MilliQ water to make up to 500μΙ volume (The used fluorimeter apparatus requires at least 500μΙ volume)
Buffer Concentration in 50μΙ reaction volume is 10mM Tris Acetate and 0.5mM NaCI.
The volumes of miRNA and the corresponding concentration in 50μΙ and 500μΙ is shown in the below table.
miRNA volume added Concentration in 50μΙ Concentration in 500μΙ
7.5μΙ 15μΜ 1.5μΜ
5μΙ 10μΜ 1 μΜ
2.5μΙ 5μΜ 0.5μΜ
1 μΙ 2μΜ 0.2μΜ
5μΙ (1 : 10 diluted miR-Let- 1 μΜ 0.1 μΜ
7a stock)
Stock of miRNA-Ι ΟΟμΜ (10μΜ stock to detect 1 μΜ miRNA concentration).
The chimera miR-Let-7a-D12-R22 probe (SEQ ID NO:1) successfully generated a strong red fluorescence when it was excited at 540 nm whereas the following standard 100% DNA AgNC probes did not efficiently form highly emissive AgNCs:
1. 5'-CCTCCTTCCTCCAACTATACAACCTACTACCTCA -3' (SEQ ID NO: 14)
2. 5'-CCTCCTTCCTCCAACTATACAACCTACTACCTCAGG -3' (SEQ ID NO: 15) 3. 5'-CCTCCTAACTATACAACCTACTACCTCAAGGAGG -3' (SEQ ID NO: 16)
4. 5'-AAAAAACTATACAACCTACTACCTCATTTTTT -3' (SEQ ID NO: 17)
The base sequence is identical between the functional SEQ ID NO: 1 and the nonfunctional SEQ ID NO: 14, the only difference being that SEQ ID NO:1 is a DNA/RNA chimera, while SEQ ID NO: 14 is 100% DNA. Thus, the results show that DNA/RNA chimera probes can be used to detect miRNAs where probes having an identical base sequence and consisting of only DNA nucleotides has failed.
Using the strong red emission, we tested whether the chimera miR-Let-7a-D12R-22 was able to recognize miR-Let-7a in a concentration dependent manner ranging from 0.05 uM to 1.5 uM (Figure 2). The target recognition of chimera miR-Let-7a-D12-R22 was verified by the Stern-Volmer plot, which follows a linear dependence of the l0/l intensity versus miR-Let-7a target concentration (l0 being the value without addition of target) with a value for the slope of 7-8 (Figure 4).
In a next step, the effect of adding different miRNA target sequences to the miR-Let- 7a-D12-R22 probe was investigated. Figure 6 shows an overview of the observed red
AgNC fluorescence, 1 h after AgN03 and NaBH4 are added to solutions containing final concentrations of 1.5 μΜ (7.5 μΙ_) miR-Let-7a-D12-R22 probe (SEQ ID NO:1) and 1.5 μΜ miR-Let-7a target (open circle curve; SEQ ID NO:5), miR21 target (open triangle; SEQ ID NO: 10), miR200C target (inverted open triangle; SEQ ID NO:6), miR172 target (diamond with cross; SEQ ID NO:), miR166 target (triangle with X; SEQ ID NO:12) and miR122 target (triangle with cross; SEQ ID NO:7). The miR-Let-7a target has the largest effect on l0/l ratio as can be seen in Figure 8 (a ~8 times drop in the fluorescence intensity), while the presence of other non-specific targets only has a limited effect on the observed fluorescence intensity of the miR-Let-7a-D12-R22 probe. This clearly opens perspectives towards designing and creating chimera DNA/AgNCs probes with a high specificity toward detecting specific mi RNA sequences, especially some miRNAs, which cannot be detected by our previous designing strategy (Shah et al., 2012).
We have previously suggested that the secondary structure of the DNA/AgNC probe, such as hair-pin and mismatch self-dimer, is important for a strong fluorescence (Shah et al., 2012). However, in contrast to DNA forming secondary structure, RNA has been considered to form more flexible structures and wobble mismatch pairs. We carefully speculate that wobble base pairing where highly emissive silver clusters can be encapsulated and that fairly open may occur in the chimera miR-Let-7a-D12-R22 probe to explain the high fluorescence obtained.
Example 2. RNA/DNA chimera miR-160 R12-D21 probe
Sequences:
R12-D21-160 chimera probe:
5'- rCrCrUrCrCrUrUrCrCrUrCrCTGGCATACAGGGAGCCAGGCA-3' (SEQ ID NO:2)
Ath-miR160:
5'- UGCCUGGCUCCCUGUAUGCCA -3' (SEQ ID NO: 13) The experiments were performed essentially as described in Example 1.
As shown in Figure 9, the chimera R12-D21-160 probe generated a strong red fluorescence and successfully recognized its target miR160.
The experiment shows that a combination of a 12nt RNA sequence acting as a AgNC scaffold and a 21 nt DNA target complementary sequence also functions in addition to the D12-R21 combination shown for detection of miR-Let7a in Example 1.
Example 3. Detection of target miRNA's in cell lines
Detection of miR-let-7a levels in cancer cell lines was performed essentially as described previously by Yang and Vosch (201 1) with minor modification (used Tris- acetate buffer). Briefly, the sensor (Let-7a-D12-R22 (SEQ ID NO:1)) was incubated with total RNA from each cell line for 20 min and the creation of AgNCs were commenced as previously described in Yang and Vosch (201 1).
The results are shown in figure 10. Small RNA blot analysis showed that the HT-29 cell line highly accumulated miR-let-7a while HEK293 and HEPG2 control cell lines showed barely detectable levels of miR-let-7a. By applying the sensor, we observed that the emission intensity correlated to the levels of miRNAs in the cell lines. When the total RNA of the HT-29 cell line was added to the sensor, the emission of sensor was dramatically reduced. In contrast, the addition of total RNA of HEK293 and HEPG2 cell lines did not notably change the emission intensities, showing the emission drop is clearly correlated to the presence of target miRNA. This result strongly supports that the functionality of the sensor is valid enough to discriminate the level of target miRNA both in vitro and in vivo.
Claims
1 A DNA/RNA chimera silver nanocluster (AgNC) oligonucleotide miRNA detection probe comprising:
a) a 12 nucleotide DNA sequence acting as a AgNC scaffold and an RNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA, or b) a 12 nucleotide RNA sequence acting as a AgNC scaffold and a DNA sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA.
2. The DNA/RNA chimera AgNC probe according to claim 1 , wherein the RNA or DNA sequence comprising the 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA is a nucleotide sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 25 nucleotides.
3. The DNA/RNA chimera AgNC probe according to claim 2, wherein the RNA or DNA sequence comprising the 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA is a nucleotide sequence consisting of 22 nucleotides.
The DNA/RNA chimera AgNC probe according to any of the preceding claims, wherein the nucleotide sequence acting as a AgNC scaffold is: a. a DNA nucleotide consisting of SEQ ID NO:3 or an RNA nucleotide
consisting of SEQ ID NO:4,
b. a DNA nucleotide according to SEQ ID NO:3 wherein the bases at one, two or three positions are exchanged for another base or an RNA nucleotide according to SEQ ID NO:4 wherein the bases at one, two or three positions are exchanged for another base, or
c. a DNA nucleotide sequence having at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:3 or an RNA nucleotide sequence having at least 80%, preferably at least 90%, more preferred at least 95% sequence identity to SEQ ID NO:4.
5. The DNA/RNA chimera AgNC probe according to any of the preceding claims, wherein the miRNA target is a human miRNA, such as a miRNA selected from the group consisting of: hsa-miR-Let-7a, hsa-miR-200c, hsa-miR-122, hsa-miR- 9, hsa-miR-210, hsa-miR27b and hsa-miR-21.
6. The DNA/RNA chimera AgNC probe according to any of the preceding claims, wherein said DNA/RNA chimera AgNC probe is capable of detecting human miRNA-Let7a.
7. The DNA/RNA chimera AgNC probe according to claim 6, comprising or
consisting of the nucleotide of SEQ ID NO: 1.
8. The DNA/RNA chimera AgNC probe according to claim 7, wherein the
sequence of SEQ ID NO:1 is modified as defined in any of claims 2 to 4.
9. A method for detecting one or more miRNAs in a sample, the method
comprising the steps of:
a) providing a sample comprising one or more miRNAs, b) providing one or more DNA/RNA chimera AgNC probes
according to any of the preceding claims,
c) contacting said one or more DNA/RNA chimera AgNC probes with said sample,
d) generating AgNC's by addition of a suitable Ag-containing
composition, and
e) measuring the emitted fluorescence,
wherein an altered fluorescence intensity compared to a control indicates an altered expression of said miRNAs.
10. The method according to claim 9, wherein the Ag-containing composition is AgN03.
1 1. The method according to claim 10, wherein the Ag-containing composition further comprises NaBH4.
12. The method according to any of claims 9 to 1 1 , wherein a decreased fluorescence intensity compared to control indicates an increased expression of the one or more miRNAs.
13. The method according to any of claims 9 to 11 , wherein an increased
fluorescence intensity compared to control indicates a decreased expression of the one or more miRNAs.
14. The method according to any of claims 9 to 13, wherein the sample comprising RNA is a biological sample obtained from a plant or an animal, such as a human.
15. The method according to claim 14, wherein the biological sample is a tumour sample comprising cancer cells.
16. The method according to any of claims 14 to 15, wherein the biological sample is whole cell lysate or isolated total RNA.
17. The method according to any of claims 9 to 16, wherein the method provides a relative quantification compared to a control.
18. The method according to any of claims 9 to 17, wherein the miRNA is miR-Let- 7a.
19. The method according to any of claims 9 to 18, wherein the DNA/RNA chimera AgNC probes comprise or consist of SEQ ID NO:1.
20. The method according to any of claims 9 to 19, wherein two or more miRNAs are detected simultaneously.
21. A kit of parts for detection of one or more miRNAs comprising:
a) one or more DNA/RNA chimera AgNC probes according to any of claims
1 to 8,
b) AgN03,
c) NaBH4, and
d) optionally instructions for use.
22. The kit of parts according to claim 21 , wherein the AgNC oligonucleotide miRNA detection probe comprises or consists of SEQ ID NO:1.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DKPA201370409 | 2013-07-19 | ||
| DKPA201370409 | 2013-07-19 | ||
| DKPA201370692 | 2013-11-18 | ||
| DKPA201370692 | 2013-11-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015007294A1 true WO2015007294A1 (en) | 2015-01-22 |
Family
ID=51302880
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2014/050227 Ceased WO2015007294A1 (en) | 2013-07-19 | 2014-07-18 | Chimera silver nanocluster probes for mirna detection |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015007294A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104801722A (en) * | 2015-03-13 | 2015-07-29 | 武汉理工大学 | Preparation method of human serum albumin gold nanoclusters |
| CN105928917A (en) * | 2016-04-20 | 2016-09-07 | 盐城工学院 | Silver nanocluster sensor, and preparation method and application thereof |
| CN109082480A (en) * | 2018-07-25 | 2018-12-25 | 湘潭大学 | A kind of method that the discoloration silver nanoclusters of DNA director are used for while detecting two kinds of HIV DNA |
| CN112638475A (en) * | 2018-06-28 | 2021-04-09 | 英国研究与创新基金会 | MicroRNA targeting agents for the treatment of cardiac diseases |
| CN113061649A (en) * | 2021-04-02 | 2021-07-02 | 福州大学 | Surface-enhanced Raman spectroscopy sensor for detecting microRNA and preparation method thereof |
| CN118127127A (en) * | 2024-02-02 | 2024-06-04 | 博迪泰(厦门)生物科技有限公司 | Detection method and application of miRNA based on click chemistry combined CRISPR/Cas12a |
-
2014
- 2014-07-18 WO PCT/DK2014/050227 patent/WO2015007294A1/en not_active Ceased
Non-Patent Citations (10)
| Title |
|---|
| PRATIK SHAH ET AL: "Design Aspects of Bright Red Emissive Silver Nanoclusters/DNA Probes for MicroRNA Detection", ACS NANO, vol. 6, no. 10, 23 October 2012 (2012-10-23), pages 8803 - 8814, XP055146138, ISSN: 1936-0851, DOI: 10.1021/nn302633q * |
| PRATIK SHAH ET AL: "DNA-RNA chimera indicates the flexibility of the backbone influences the encapsulation of fluorescent AgNC emitters", CHEMICAL COMMUNICATIONS, vol. 50, no. 88, 1 October 2014 (2014-10-01), pages 13592 - 13595, XP055149073, ISSN: 1359-7345, DOI: 10.1039/C4CC06439A * |
| RICHARDS CHRIS I ET AL: "Oligonucleotide-stabilized Ag nanocluster fluorophores", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, ACS PUBLICATIONS, US, vol. 130, no. 15, 1 April 2008 (2008-04-01), pages 5038 - 5039, XP009105196, ISSN: 0002-7863, DOI: 10.1021/JA8005644 * |
| RICHARDS CI; CHOI S; HSIANG JC; ANTOKU Y; VOSCH T; BONGIORNO A; TZENG YL; DICKSON RM: "Oligonucleotide-stabilized Ag nanocluster fluorophores", J AM CHEM SOC., vol. 130, no. 15, 16 April 2008 (2008-04-16), pages 5038 - 9 |
| SCHUBERT M; SPAHN M; KNEITZ S; SCHOLZ CJ; JONIAU S; STROEBEL P; RIEDMILLER H; KNEITZ B: "Distinct microRNA Expression Profile in Prostate Cancer Patients with Early Clinical Failure and the Impact of let-7 as Prognostic Marker in High-Risk Prostate Cancer", PLOS ONE., vol. 8, no. 6, 14 June 2013 (2013-06-14), pages E65064 |
| SEONG WOOK YANG ET AL: "Rapid Detection of MicroRNA by a Silver Nanocluster DNA Probe", ANALYTICAL CHEMISTRY, vol. 83, no. 18, 15 September 2011 (2011-09-15), pages 6935 - 6939, XP055147213, ISSN: 0003-2700, DOI: 10.1021/ac201903n * |
| SHAH P; RORVIG-LUND A; CHAABANE SB; THULSTRUP PW; KJAERGAARD HG; FRON E; HOFKENS J; YANG SW; VOSCH T: "Design aspects of bright red emissive silver nanoclusters/DNA probes for microRNA detection", ACS NANO, vol. 6, no. 10, 23 October 2012 (2012-10-23), pages 8803 - 14 |
| SUN X; QIN S; FAN C; XU C; DU N; REN H: "Let-7: a regulator of the ERa signaling pathway in human breast tumors and breast cancer stem cells", ONCOL REP., vol. 29, no. 5, May 2013 (2013-05-01), pages 2079 - 87 |
| YANG SW; VOSCH T: "Rapid detection of microRNA by a silver nanocluster DNA probe", ANAL CHEM., vol. 83, no. 18, 15 September 2011 (2011-09-15), pages 6935 - 9 |
| YEN-CHUN SHIANG ET AL: "Fluorescent gold and silver nanoclusters for the analysis of biopolymers and cell imaging", JOURNAL OF MATERIALS CHEMISTRY, vol. 22, no. 26, 1 January 2012 (2012-01-01), pages 12972, XP055149078, ISSN: 0959-9428, DOI: 10.1039/c2jm30563a * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104801722A (en) * | 2015-03-13 | 2015-07-29 | 武汉理工大学 | Preparation method of human serum albumin gold nanoclusters |
| CN105928917A (en) * | 2016-04-20 | 2016-09-07 | 盐城工学院 | Silver nanocluster sensor, and preparation method and application thereof |
| CN112638475A (en) * | 2018-06-28 | 2021-04-09 | 英国研究与创新基金会 | MicroRNA targeting agents for the treatment of cardiac diseases |
| CN109082480A (en) * | 2018-07-25 | 2018-12-25 | 湘潭大学 | A kind of method that the discoloration silver nanoclusters of DNA director are used for while detecting two kinds of HIV DNA |
| CN109082480B (en) * | 2018-07-25 | 2021-10-19 | 湘潭大学 | A DNA-guided color-changing silver nanocluster for simultaneous detection of two HIV DNAs |
| CN113061649A (en) * | 2021-04-02 | 2021-07-02 | 福州大学 | Surface-enhanced Raman spectroscopy sensor for detecting microRNA and preparation method thereof |
| CN118127127A (en) * | 2024-02-02 | 2024-06-04 | 博迪泰(厦门)生物科技有限公司 | Detection method and application of miRNA based on click chemistry combined CRISPR/Cas12a |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cissell et al. | Trends in microRNA detection | |
| Qiu et al. | Rapid and multiplexed microRNA diagnostic assay using quantum dot-based forster resonance energy transfer | |
| Deng et al. | Quantum dots-labeled strip biosensor for rapid and sensitive detection of microRNA based on target-recycled nonenzymatic amplification strategy | |
| Wang et al. | A copper-free and enzyme-free click chemistry-mediated single quantum dot nanosensor for accurate detection of microRNAs in cancer cells and tissues | |
| Wang et al. | Sensing telomerase: From in vitro detection to in vivo imaging | |
| WO2015007293A1 (en) | Stem-loop silver nanocluster probes for mirna detection | |
| Yang et al. | Double signal amplification strategy for ultrasensitive electrochemical biosensor based on nuclease and quantum dot-DNA nanocomposites in the detection of breast cancer 1 gene mutation | |
| Islam et al. | A PCR-free electrochemical method for messenger RNA detection in cancer tissue samples | |
| WO2015007294A1 (en) | Chimera silver nanocluster probes for mirna detection | |
| Goryacheva et al. | Luminescent quantum dots for miRNA detection | |
| Chai et al. | Ultrasensitive electrochemical detection of miRNA coupling tetrahedral DNA modified gold nanoparticles tags and catalyzed hairpin assembly | |
| CN102876676B (en) | Blood serum/blood plasma micro ribonucleic acid (miRNA) marker relevant with pancreatic cancer and application thereof | |
| Chen et al. | Zeptomolar-level one-pot simultaneous detection of multiple colorectal cancer microRNAs by cascade isothermal amplification | |
| Piao et al. | Enzyme-free colorimetric detection of MicroRNA-21 using metal chelator as label for signal generation and amplification | |
| Liu et al. | Rapid and reliable microRNA detection by stacking hybridization on electrochemiluminescent chip system | |
| Wei et al. | Precision miRNA profiling: electrochemiluminescence powered by CRISPR-Cas13a and hybridization chain reaction | |
| Hong et al. | In situ monitoring of cytoplasmic precursor and mature microRNA using gold nanoparticle and graphene oxide composite probes | |
| Wu et al. | Sticky-flares for in situ monitoring of human telomerase RNA in living cells | |
| WO2016136033A1 (en) | Target nucleic acid detection method, assay kit, and probe-immobilized substrate | |
| Luo et al. | Fluorescence sensing telomerase activity: from extracellular detection to in situ imaging | |
| Esmaeilzadeh et al. | Recent advances on the electrochemical and optical biosensing strategies for monitoring microRNA-21: a review | |
| CN114196733A (en) | Telomere G-quadruplex DNA and thioflavin T-mediated fluorescent biosensor and its application in lncRNA detection | |
| Djebbi et al. | Highly sensitive fluorescence multiplexed miRNAs biosensors for accurate clinically diagnosis lung cancer disease using LNA-modified DNA probe and DSN enzyme | |
| Li et al. | Ultrasensitive microRNA-21 detection based on DNA hybridization chain reaction and SYBR Green dye | |
| Ghanbari et al. | A rapid and simple method for simultaneous determination of three breast cancer related microRNAs based on magnetic nanoparticles modified with S9. 6 antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14750436 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14750436 Country of ref document: EP Kind code of ref document: A1 |