WO2015007293A1 - Stem-loop silver nanocluster probes for mirna detection - Google Patents
Stem-loop silver nanocluster probes for mirna detection Download PDFInfo
- Publication number
- WO2015007293A1 WO2015007293A1 PCT/DK2014/050226 DK2014050226W WO2015007293A1 WO 2015007293 A1 WO2015007293 A1 WO 2015007293A1 DK 2014050226 W DK2014050226 W DK 2014050226W WO 2015007293 A1 WO2015007293 A1 WO 2015007293A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- agnc
- loop
- nucleotides
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
Definitions
- the present disclosure relates to silver nanocluster (AgNC) probes for specific and sensitive micro RNA (miRNA) detection.
- the AgNC probes of the present disclosure comprise a partial stem-loop oligonucleotide structure.
- the disclosure further relates to methods for detecting miRNAs in biological samples. Background of invention
- MicroRNAs are small regulatory RNAs of about 21 nucleotides (nt) to about 25 nt which regulate a variety of important cellular events in plants, animals and single cell eukaryotes.
- the individual levels of miRNAs can be useful biomarkers for cellular events or disease diagnosis.
- efforts have been directed towards the development of rapid, simple and sequence-selective detection of miRNAs.
- miRNAs are detected by quantitative RT-PCR, northern blot analysis, microarray and illumina sequencing.
- oligonucleotide probes for miRNA detection utilising the fluorescence properties of silver nanoclusters (AgNCs) have been developed. Yang et al.
- the probes of Yang et al. comprise a 12 nucleotide DNA sequence capable of creating a red emitting AgNC and a 21 nucleotide DNA sequence complementary to the miRNA target sequence (Yang et al., 2011).
- the present invention solves the above problem by providing a silver nanocluster (AgNC) oligonucleotide probe comprising:
- a polycytosine loop sequence consisting of from 6 to 12 cytosine nucleotides
- a target complementary sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA
- anchoring sequence being complementary to at least a part of the target complementary sequence in b) and being capable of hybridising thereto, wherein the polycytosine loop functions as a scaffold for silver
- the invention further relates to a method for detecting a miRNA using the above- defined partial stem-loop oligonucleotide.
- oligonucleotides comprising a partial loop structure defined as above can be used as efficient probes for miRNA detection - even for miRNAs where previous attempts at creating DNA/AgNC probes have failed.
- Figure 1 Depicts the strategy for the partial stem-loop probe structure for detection of miRNA.
- the figure depicts miRNA-21 (miR-21 ; SEQ ID NO:4) and the 6C-21-8bp miR- 21 probe (SEQ ID NO: 1).
- FIG. 1 At the top, 4 different non-stem-loop DNA probe sequences or perfect stem- loop DNA probes which have loop of DNA complementary sequences designed for miR-21 detection are depicted. None of the 4 probes were capable of forming highly emissive AgNC's and could thus not be used for miR-21 detection. As an example, the emission intensity of the first probe sequence is depicted at the bottom.
- Figure 3 shows three different design strategies for a stem-loop probe for miR-21 detection.
- the top forms a full stem-loop structure as the complementary and anchor sequence are the same length (6C-21-22bp; SEQ ID NO:3)).
- the middle probe forms a partial stem-loop structure (6C-21-1 1 bp; SEQ ID NO:2)).
- the probe at the bottom also forms a partial stem-loop structure (6C-21-8bp; SEQ ID NO: 1).
- the miR-21 (SEQ ID NO:4) is shown inverted and aligned to the probes.
- Figure 4. shows anchor length dependent emission of a 6C-21-6bp miR-21 detection probe.
- Figure 5 shows anchor length dependent emission of a 6C-21-7bp miR-21 detection probe.
- Figure 6 shows anchor length dependent emission of the 6C-21-8bp miR-21 detection probe (SEQ ID NO: 1).
- Figure 7 shows anchor length dependent emission of a 6C-21-9bp miR-21 detection probe.
- Figure 8 shows anchor length dependent emission of a 6C-21-10bp miR-21 detection probe.
- Figure 9 shows anchor length dependent emission of the 6C-21-11 bp miR-21 detection probe (SEQ ID NO:2).
- figures 4-9 show that miR-21 probes having longer anchors than 8 bp are more emissive.
- the balance between anchor length for fluorescence and target accessibility is the key point of designing.
- the length of the anchor has to be adjusted according to the specific thermodynamic properties of loop and stem sequences.
- Figure 10 shows the effect of buffer and salt on the fluorescence intensity of the 6C- 21-11 bp miR-21 detection probe alone (black bar; SEQ ID NO:2) and target sensitivity in the presence of target miR-21 (grey bar; SEQ ID NO:4). Electrolytes of the buffer are important for the efficiency of formation of the partial stem and loop structure and target recognition.
- Figure 11 shows a bar graph of figure 10 in the l 0 /l intensity versus miR-21 target concentration (l 0 being the value without target).
- Figure 12 shows the effect of buffer and salt on the fluorescence intensity of the 6C- 21-8bp miR-21 detection probe (black bar; SEQ ID NO: 1) and target sensitivity in the presence of target miR-21 (grey bar; SEQ ID NO:4).
- Figure 13 shows a bar graph of figure 12 in the l 0 /l intensity versus miR-21 target concentration (l 0 being the value without target).
- Figure 14. Bar graph of emission intensity. 1.5 uM of 6C-21-8bp (SEQ ID NO: 1), 6C- 21-11 bp (SEQ ID NO:2) or 6C-21-22bp (SEQ ID NO: 3) probes were tested with 1.5 uM of miR-21 target (SEQ ID NO: 4).
- Figure 15 shows the l 0 /l intensity versus miR-21 target concentration (l 0 being the value without target) of the bar graph of figure 14. Higher value of l 0 /l implies better target recognition efficiency.
- FIG. 16 Sensitivity of miR-21 probe.
- the figure shows the fluorescence profile of the 6C-21-8bp miR-21 probe (1.5 uM; SEQ ID NO: 1) in the presence of different concentrations of target miRNA (miR-21 ; SEQ ID NO:4).
- MiR-21 in a concentration ranging from 0.1 uM to 1.5 uM was hybridized with the probe for 10 min and then highly emissive AgNCs were generated by addition of AgN03 and NaBH4.
- Figure 17. Stern-Volmer plot of figure 16 follows a linear dependence of the l 0 /l intensity versus miR-21 target concentration (l 0 being the value without target).
- FIG. 18 Specificity of miR-21 probe. Emission spectra of 1.5 ⁇ 6C-21-8bp miR-21 detection probe (black square; SEQ ID NO: 1) and mixtures of 1.5 ⁇ 6C-21-8bp miR- 21 probe (SEQ ID NO:1) with 1.5 ⁇ _ of miR-210 target (open circle curve; SEQ ID NO: 8), miR200C target (open triangle; SEQ ID NO:5), miR122 target (inverted open triangle; SEQ ID NO: 6), miR-9 target (diamond with cross; SEQ ID NO:7), miR166 target (triangle with X; SEQ ID NO: 11), miR160 target (triangle with cross; SEQ ID NO: 12) and miR-21 target (Hexagon; SEQ ID NO:4).
- the 6C-21-8bp miR-21 detection probe recognizes its target miR-21 with high specificity.
- FIG. 20 Detection of miR-21 in cancer cell lines using 6C-21-8bp sensor (SEQ ID NO: 1).
- Graph shows the emission intensity of sensor when mixed with total RNAs from each cancer cell line.
- Small RNA blot analysis shows the relative amount of target miR- 21 in each cancer cell line.
- U6 snRNA was used as a loading control.
- Figure 21 Generation strategy of colorful stem-loop sensors for multiplex target detection.
- Graph demonstrates the wavelength tuning by modulating the functional size of the loop by introducing one (1 MM) or two (2MM) mismatches between the complementary and anchor sequence in the positions most proximal to the 6C-loop.
- Cartoon shows the sequence of the sensors and the expected stem-loop structure of the probes.
- a control or a control sample according to the present invention is understood to be a sample which in the context of the currently tested miRNA can function as a control to determine relative changes in expression of the miRNA.
- the control may have either a low (or no: include probe only) expression of the miRNA, normal expression of the miRNA, or elevated expression depending on the purpose of the test. For instance, if one is to test a cancer cell sample for aberrant (higher or lower) expression of a particular miRNA, one may use a tissue or cell sample from a normal (non-cancerous) tissue of the same origin. E.g. if a breast cancer tissue sample is tested for elevated expression of a particular miRNA, the expression may be compared to the expression of the miRNA in normal breast tissue.
- Two nucleotide sequences are said to be complementary if, when they are aligned antiparallel to each other, they are able to anneal to form a double helix.
- Two nucleotides are said to be 100% complementary if the nucleotide bases form Watson-Crick base pairs at each possible position. If two nucleotides are of different lengths, 100% complementarity implies the formation of Watson-Crick base pairs at each possible position in the overlapping region.
- a multiplex assay is an assay that simultaneously measures multiple analytes in a single run/cycle of the assay.
- multiplex assaying is used to denote the simultaneous measurement of two or more miRNAs in a sample.
- T m The melting temperature (T m ) is defined as the temperature at which half of the nucleotide strands are in the random coil or single-stranded (e.g. ssDNA) state. Tm depends on the length of the nucleotide and its specific nucleotide sequence. DNA, when in a state where its two strands are dissociated (i.e., the dsDNA molecule exists as two independent strands), is referred to as having been denatured by the high temperature.
- Non-emissive miR-21 sensors without partial stem-loop structure without partial stem-loop structure:
- miRNAs are involved in various biological processes and pathological responses, particularly in the development of organs and tissues.
- miRNAs are key regulators for the shape of leaves, flower development, flowering time, reproduction, stem development, apical dominancy and root
- miRNAs have become a new class of biomarker for diagnostic analysis as well as therapeutic targets themselves.
- miR-21 has been implicated in the prognosis of non-small-cell lung cancer, but the results are controversial. Recent study resolved this issue and showed that miR-21 can be used as a prognosis marker for lung cancer and lymphoid metastasis (Wang et al., 2013). Using microarrays or LNA RT-PCR panels,
- microarray-based, nanotechnology-based, QRT- PCR-based, amplification-based, enzymatic assay-based and deep sequencing-based offer good specificity and sensitivity but real practical application of them is still limited due to their high cost, time-consuming and complex procedures.
- the microarray-based method has been most widely used for the profiling of miRNAs and is based on the hybridization between target and complementary probe.
- the sensitivity of the method is highly changeable due to the melting temperature of the designed probe and the labelling of target miRNA is also a difficult step in the procedure.
- LNA locked nucleic acid
- Alternative strategies based on nanotechnology have been developed for miRNA detection such as Electrocatalytic Nanoparticle Tags (ENT), Surface Plasmon Resonance Imaging (SPRI), Gold-nanoparticles-based array and Surface Enhanced Raman Scattering (SERS)-based assays.
- ENT Electrocatalytic Nanoparticle Tags
- SPRI Surface Plasmon Resonance Imaging
- SERS Surface Enhanced Raman Scattering
- the present detection strategy is based on the emission properties of small silver nano-clusters.
- small silver clusters (less than 100 atoms) can be stabilized, leading to bright and photo-stable fluorescence.
- These scaffolds include biological compounds (e.g. DNA, RNA, and proteins), polymers, dendrimers, organic compounds and inorganic matrices.
- biological compounds e.g. DNA, RNA, and proteins
- polymers e.g. DNA, RNA, and proteins
- DNA/AgN03/NaBH4 in a 1 : 17: 17 ratio the DNA/AgNCs probes generated a very bright red fluorescence within an hour. In the presence of their target miRNAs, the glowing red fluorescence of the DNA/AgNCs probes is selectively turned off.
- our original method was not successful in designing DNA/AgNCs probes for some miRNAs, such as miR-21. MiR-21 has very low GC contents and Tm values compared to the other miRNAs in humans. Due to the thermodynamic disadvantage of miR-21 , we could not successfully create a highly emissive DNA/AgNC probe against miR-21 with our previous method.
- the partial stem-loop AgNC probe of the present disclosure which doesn't require a 12nt scaffold DNA and its structure formation can be modulated by anchoring sequences.
- a poly-cytosine loop (Driehorst et al., 201 1) for the encapsulation of a highly emissive species with DNA complementary sequences against the target of interest.
- the length of the anchoring sequence complementary to the DNA complementary sequence of target miRNA is important for both the generation of fluorescence and target accessibility.
- the present invention provides a novel oligonucleotide probe for simple, inexpensive and instant miRNA detection in biological samples.
- the silver nanocluster (AgNC) oligonucleotide probe of the present invention comprises or consists of:
- a polycytosine loop sequence consisting of from 6 to 12 cytosine nucleotides
- a target complementary sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA
- anchoring sequence being complementary to at least a part of the target complementary sequence in b) and being capable of hybridising thereto, wherein the polycytosine loop functions as a scaffold for silver
- the total length of the AgNC oligonucleotide probe of the present invention is at least 29 nucleotides.
- the AgNC oligonucleotide probe is an
- the total length of the AgNC oligonucleotide probe of the present invention is between 29 to 50 nucleotides, more preferred between 31 and 40 nucleotides, such as 36 nucleotides.
- the polycytosine (poly-C) loop functions as a scaffold for silver nanoclustering.
- the length of the poly-C loop plays an important role for the thermodynamic properties of the probe as a whole, the fluorescence intensity and the emission wavelength generated by the silver nanoclustering.
- the poly-C loop consists of at least 6 cytosine residues, such as at least 7 or 8 cytosine residues.
- the poly-C loop consists of 6 cytosine residues.
- the poly-C loop is even longer than 8 residues, such as a 9-12 C-loop.
- a part of the C residues in the poly-C loop are exchanged for another base, such as thymine or guanine, such as one or more bases, for example two, three or more bases.
- Exchange of one or more of the bases in the poly-C loop can affect the emission wavelength, which can e.g. be used for multiplex detection.
- the size of the loop can be functionally increased without changing the length of the poly-C loop itself by the introduction of one or more mismatches nucleotides in the anchor sequence most proximal to the loop as described herein below.
- the target complementary sequence is the same length as the target miRNA and 100% complementary thereto. In other embodiments, the target complementary sequence is longer than the target miRNA.
- the target complementary sequence is a nucleotide sequence consisting of 22 consecutive nucleotides being 100% complementary to the sequence of a target miRNA.
- the target complementary sequence is a nucleotide sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 40 nucleotides, for example from 21 to 30 nucleotides, more preferred between 21 to 25 nucleotides.
- the target complementary sequence may be either at the 5' termini or the 3' termini of the polycytosine loop sequence, the anchoring sequence being in the opposite position.
- the anchoring sequence is 100% complementary to the target complementary sequence in the overlapping, i.e. base-pairing, region.
- the anchoring sequence is complementary to at least a part of the target
- the anchoring sequence hybridises to the part of the target complementary sequence positioned most proximal to the C-loop.
- the length and melting temperature (T m ) of the anchoring sequence is an important determinant for both emission intensity and sensitivity of the probe. Generally, the longer the anchor sequence, the brighter the fluorescence of the probe, however, the sensitivity of the probe decreases the longer the anchor sequence becomes ( Figures 14-15).
- the length/T m of the anchoring sequence must be so that the stem-loop structure is maintained until exposure to the specific target miRNA. Upon contact with target miRNA, the stem-loop structure is disrupted due to hybridisation of the target complementary sequence to the miRNA target ( Figure 1).
- the anchor sequence is a nucleotide sequence consisting of from 2 to 12 nucleotides. In one embodiment, the anchor sequence is a nucleotide sequence consisting of from 4 to 12 nucleotides, such as from 6 to 10 nucleotides, for example 8 nucleotides.
- the anchor sequence is short, e.g. less than 4 nucleotides, it is preferably 100% complementary to the target complementary sequence, i.e. no mismatches.
- the T m of the anchor sequence is about 15-30°C, such as about 20°C.
- One way of manipulating the T m of the anchor sequence is by changing the length of the anchor. For instance, for miRNA targets having a relatively high A and U content, the optimal anchor length may be longer than for miRNA targets having a relatively high G and C content. Changing the length of the anchor sequence is one way of manipulating the T m value of the anchor. Alternatively, one or more mismatches may be introduced into the sequence of the anchor to decrease the strength of hybridisation of anchor and target complementary sequence.
- the anchoring sequence is at least 70%, such as at least 75%, for example at least 80%, such as at least 85%, for example at least 90% complementary to the target complementary sequence.
- the anchor sequence contains one or more mismatches in the anchor sequence most proximal to the C-loop, such as one or two mismatched nucleotides.
- the effect of introducing one or more mismatches next to the loop is that the size of the loop is functionally increased since there will be no base-pairing between the mismatched nucleotides as illustrated in figure 21.
- the anchoring sequence contains a single mismatched nucleotide positioned most proximal to the C-loop.
- nucleotides having a single mismatched nucleotide would be 91 % complementary to the target complementary sequence.
- the anchoring sequence contains two mismatched nucleotides positioned most proximal to the C-loop.
- 1 1 nucleotides having a single mismatched nucleotide would be 82% complementary to the target complementary sequence.
- the length and base composition of the anchoring sequence may be further adjusted by the skilled person to provide favourable thermodynamic conditions for specific hybridisation to target miRNA, while retaining good initial AgNC emission of the probe.
- Manipulation of the length and complementarity of the anchor sequence can change the emission spectra of the probes, thus allowing for multiplex miRNA detection, i.e. detection of different miRNA's in a single sample.
- the AgNC oligonucleotide probe of the present invention comprises 100% DNA nucleotides.
- the AgNC oligonucleotide probe of the invention may comprise 100% RNA nucleotides or a suitable mixture of DNA and RNA nucleotides, thus creating a DNA/RNA chimeric partial stem-loop oligonucleotide probe.
- the miRNA target is a human miRNA, such as one or more of the human miRNAs listed in the below table.
- the target miRNA is one of more of the miRNAs selected from the group consisting of: hsa-miR-21 , hsa- miR-Let-7a, hsa-miR-200c, hsa-miR-122, hsa-miR-9, hsa-miR-27b and hsa-miR-210.
- melanoma Prostate cancer, Neuroblastoma, cardiomyopathy, SLE
- hsa-miR- 5'- UGGAGUGUGACAAUGGUGUUUG - 3' Oral Squamous Cell carcinoma, 122 (SEQ ID NO:6) Hepatocellular Carcinoma, HCV infection, Breast Cancer, Gastric cancer, Lung cancer,
- ALL lymphoblastic leukemia
- AML acute myeloid leukemia
- MDD Duchenne muscular dystrophy
- Lung cancer Pancreatic Cancer, Prostate cancer, Kidney cancer, Head and Neck Cancer, cervical cancer, Gastric cancer, hsa-miR- 5'- UAGCUUAUCAGACUGAUGUUGA - 3' Colorectal Cancer, diffuse large B-
- HCC hepatocellular carcinoma
- ALL acute lymphoblastic leukemia
- AML acute myeloid leukemia
- ASD autism spectrum disorder
- CLL chronic lymphocytic leukemia
- DMD epithelial ovarian cancer
- OSCC head and neck squamous cell carcinoma
- HNSCC heart failure
- NSCLC non-small cell lung cancer
- cholesteatoma Hodgkin's lymphoma
- Colon Carcinoma hsa-miR- 5'- UUCACAGUGGCUAAGUUCUGC-3'
- Lung cancer Non small cell lung cancer, Neuroblastoma, Leukemia, esophageal cancer, breast cancer, colorectal cancer, glioblastoma, cardiac hypertrophy and oral squamous cell carcinoma.
- miR-27b is located on chromosome 9 and has been shown to function as a tumor suppressor in neuroblastoma via targeting the peroxisome
- miR-27b targets vascular endothelial growth factor C (VEGFC) and functioned as an inhibitor of tumor progression and angiogenesis through targeting VEGFC in Colorectal cancer.
- VEGFC vascular endothelial growth factor C
- the AgNC oligonucleotide probe is a probe capable of detecting miRNA-21 (miR-21).
- the miR-21 specific AgNC oligonucleotide probe comprises or consists of SEQ ID NO:1 , 2 or 3.
- miR-21 specific AgNC oligonucleotide probe comprises or consists of SEQ ID NO: 1.
- the present invention relates to a variant of SEQ ID NO: 1 , wherein the loop length and/or base composition of the polycytosine loop is altered as described herein above. In one embodiment, the present invention relates to a variant of SEQ ID NO: 1 , wherein the anchor length and/or base composition of the anchor sequence is altered as described herein above.
- the present invention relates to an AgNC oligonucleotide probe comprising or consisting of an oligonucleotide sequence of from 29 to 45 nucleotides comprising or consisting of:
- the present invention relates to use of the AgNC oligonucleotide probe of the present invention for diagnosing a disease.
- the diagnostic method is an in vitro diagnostic method performed on a biological sample isolated from a subject as described further herein below.
- the present invention relates to use of the AgNC oligonucleotide probe of the present invention for classifying a disease based on miRNA expression.
- the disease may be selected from ovarian cancer, Colorectal cancer, breast cancer, lung cancer, melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE, Oral Squamous Cell carcinoma, Hepatocellular Carcinoma, HCV infection, Gastric cancer, Lung cancer, Pancreatic cancer.
- Hodgkin's lymphoma Epithelial Ovarian Cancer, Gastric Cancer, diffuse large B-cell lymphoma (DLBCL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Duchenne muscular dystrophy (DMD), Kidney cancer, Head and Neck Cancer, cervical cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, Vascular disease, autism spectrum disorder (ASD), Cervical cancer, chronic lymphocytic leukemia (CLL), esophageal cancer, Glioblastoma, uterine leiomyoma (ULM), Bladder cancer, head and neck squamous cell carcinoma (HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Colon Carcinoma, leukemia, Alzheimer's disease and diabetes.
- DLBCL diffuse large B-cell lymphoma
- ALL acute lymphoblastic leukemia
- AML
- the disease is a cancer, such as breast cancer.
- Method for detection of miRNA is a cancer, such as breast cancer.
- the present invention further provides a method for detecting one or more miRNAs in a sample.
- the method for miRNA detection comprises the steps of:
- the emitted fluorescence of the sample will be lower than the control.
- the sample has a decreased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be higher than the control.
- the Ag-containing composition is preferably AgN0 3 .
- the Ag-containing composition further comprises NaBH 4 . Addition of AgN0 3 and NaBH 4 results in the generation of AgNC's with DNA or RNA working as a scaffold.
- the reaction is performed in the presence of a suitable buffer.
- buffer solutions include TAPS, Bicine, Tris, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, MES, Succinic acid.
- the buffer is a Tris-acetate buffer, for example a Tris-acetate buffer such as a 20 mM or a 40 mM Tris-acetate buffer solution.
- the buffer further comprises NaN03.
- the concentration of NaN03 is usually in the range of 1 to 50 mM, for example 5-30 mM, such 5 mM or 25 mM NaN03.
- the present method is preferably an in vitro miRNA detection method capable of detecting one or more miRNAs in a sample obtained from a plant or an animal, preferably from a human, such as in a tissue or cell sample or body fluid such as urine obtained from the human.
- the present method may be applied to any sample comprising RNA.
- the sample may be whole blood or a biopsy obtained from a relevant organ or tissue of the human body, such as a tumour biopsy comprising cancer cells.
- the sample comprising one or more miRNAs is a biological sample selected from the group consisting of whole cell lysate and isolated total RNA obtained from a tissue or cells.
- the quantification provided by the method of the present invention is usually a relative quantification seen in comparison to the expression level of the particular miRNA in a relevant control sample.
- the excitation/emission spectra of the miRNA probes of the present invention depend on the specific nucleotide sequence and length of the probe.
- the emission peaks of particular miRNA AgNC probes can be determined by measuring the emitted fluorescence after excitation at different wavelengths as previously described by e.g. Yang et al., 201 1.
- the emitted fluorescence may be measured after excitation at an appropriate wavelength with any equipment capable of measuring fluorescence, such as a fluorimeter.
- the present method is a multiplex miRNA detection method that allows for the detection of two or more miRNAs simultaneously in the same sample. Different maximal excitation/emission wavelengths of individual miRNA probes allows for detection of more than one miRNA in the same reaction. In one embodiment two or more different miRNAs are detected in the same reaction.
- three or more different miRNAs are detected in the same reaction.
- the present method is used for the specific and sensitive detection and quantification of a single-stranded nucleotide species, different from a miRNA, in a sample, such as siRNA, intermediate non-coding RNA and long non- coding RNA.
- the probe will be an oligonucleotide comprising a target complementary sequence comprising at least 21 nucleotides or more being 100% complementary to the target sequence.
- the invention also provides a kit of parts comprising one or more AgNC oligonucleotide miRNA detection probes and the reagents needed for testing samples.
- the invention further relates to a kit of parts for detection of one or more miRNAs in a sample comprising:
- the kit of parts optionally comprises instructions for use of the kit.
- the instructions for use may be essentially as described in Example 1.
- the kit of parts may further comprise a buffer solution suitable for detection of miRNAs.
- Example 1 Sensitivity and specificity of stem-loop AgNC miR-21 probe Based on the data depicted in figures 4-15 testing the emitted fluorescence and target recognition of stem-loop probes with varying anchor stem lengths, the 6C-21-8bp miR- 21 probe was selected for further analysis.
- 6C-21-8bp means a 6C loop, a 100% complementary sequence to miR-21 (22nt), and an 8bp anchor sequence.
- the NaBH4 solution may be prepared by pre-measuring 2mg of NaBH4 in 50ml conical tube. Just before the NaBH4 is to be used, 50ml water is added to the tube and the contents are mixed by brief vortexing. The solution is used within about 5 minutes of addition of water.
- reaction volume is added 450 ⁇ of MilliQ water to make up to 500 ⁇ volume (The used fluorimeter apparatus requires at least 500 ⁇ volume)
- reaction volume is added 450 ⁇ of MilliQ water to make up to 500 ⁇ volume (The used fluorimeter apparatus requires at least 500 ⁇ volume)
- Buffer Concentration in 50 ⁇ reaction volume is 20mM Tris Acetate and 25mM NaN03.
- the 6C-21-22bp (SEQ ID NO: 3) showed the ratio of 1 indicating no accessibility to its target.
- the results demonstrate that the balance between the formation of a strong fluorescence and target accessibility can be modulated by the length of the anchor sequence. Best-fit adjustment of the anchor length is the key factor of our partial stem and loop AgNCs probe.
- FIG. 18 shows an overview of the observed red AgNC fluorescence, 1 h after AgN03 and NaBH4 are added to solutions containing final concentrations of 1.5 ⁇ (7.5 ⁇ _) 6C-8bp-21 probe and 1.5 ⁇ 1.5 ⁇ _ of miR-210 target (open circle curve), miR-200C target (open triangle), miR-122 target (inverted open triangle), miR-9 target (diamond with cross), miR166 target (triangle with X), miR- 160 target (triangle with cross) and miR-21 target (Hexagon).
- the 6C-21-8bp target (miR-21) has the largest effect on l 0 /l ratio as can be seen in Figure 19 ( ⁇ 6 times drop in the fluorescence intensity), while the presence of other non-specific targets only had a limited effect on the observed fluorescence intensity of the 6C-21-8bp probe.
- One of the most important features of the 6C-21-8bp probe for miR-21 detection is a partially complemented stem structure.
- a probe When a probe is fully complemented by 21 nt anchoring sequences, even though it generated very strong fluorescence two times higher than that of 6C-21-8bp, it is not able to access its target. Therefore, to design a best-fit probe, the balance between structural stability of stem region and target accessibility have to be primarily considered. For example, when an anchoring region of a loop and stem junction contains many GC bases, one should reduce the length of anchor, e.g. down to 4 bp or even lower. On the other hand, if few GC bases are present in the anchoring region, one should extend the length of the anchor.
- this strategy for AgNC probe design for miRNA detection has the further advantage of allowing for easier prediction of functional high-emitting, sensitive and specific miRNA probes. By manipulating the length and base content of the polycytosine loop, probes with different emission wavelengths can be constructed.
- Detection of miR-21 levels in cancer cell lines was performed essentially by the protocol in Yang and Vosch (2011) with minor modification (used Tris-acetate buffer). Briefly, the sensor (6C-21-8bp (SEQ ID NO: 1)) was incubated with total RNA from each cell line for 20 min and the creation of AgNCs were commenced as previously described in Yang and Vosch (201 1). The results are shown in figure 20. MCF7 cell lines highly accumulated miR-21 while HEK293 and HELA control cell lines showed barely detectable levels of miR-21. By applying the sensor, we found that the emission intensity was correlated to the level of the miRNA. When the total RNA of MCF7 cell line was added to the sensor, the emission of the sensor was dramatically reduced.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses silver nanocluster (AgNC) probes for specific and sensitive micro RNA (miRNA) detection. The AgNC probes of the present invention comprise a partial stem-loop oligonucleotide structure. The invention further discloses methods for detecting miRNAs in biological samples.
Description
Stem-loop silver nanocluster probes for miRNA detection Field of invention The present disclosure relates to silver nanocluster (AgNC) probes for specific and sensitive micro RNA (miRNA) detection. The AgNC probes of the present disclosure comprise a partial stem-loop oligonucleotide structure. The disclosure further relates to methods for detecting miRNAs in biological samples. Background of invention
MicroRNAs (miRNAs or miRs) are small regulatory RNAs of about 21 nucleotides (nt) to about 25 nt which regulate a variety of important cellular events in plants, animals and single cell eukaryotes. The individual levels of miRNAs can be useful biomarkers for cellular events or disease diagnosis. Thus, efforts have been directed towards the development of rapid, simple and sequence-selective detection of miRNAs. Currently, miRNAs are detected by quantitative RT-PCR, northern blot analysis, microarray and illumina sequencing. Recently, oligonucleotide probes for miRNA detection utilising the fluorescence properties of silver nanoclusters (AgNCs) have been developed. Yang et al. thus disclose silver nanocluster DNA probes for detection of miRNAs. The probes of Yang et al. comprise a 12 nucleotide DNA sequence capable of creating a red emitting AgNC and a 21 nucleotide DNA sequence complementary to the miRNA target sequence (Yang et al., 2011).
In a follow-up study, Shah et al. discovered that simply replacing the sequence complementary to the target miRNA did not always ensure that probes were capable of forming fast, bright emission suitable for use in miRNA detection. It was concluded that the secondary structure of the probe plays an important role in the generation of fluorescent AgNCs and thus for sufficient probe emission (Shah et al., 2012).
Sufficient target specificity, sensitivity and initial emission intensity is a challenge with current AgNC probe design strategies. There is thus a need in the art for the design of
novel AgNC probes for miRNA detection with sufficient initial emission intensity and a higher degree of target sensitivity and specificity.
Summary of invention
The present invention solves the above problem by providing a silver nanocluster (AgNC) oligonucleotide probe comprising:
a) a polycytosine loop sequence consisting of from 6 to 12 cytosine nucleotides,
b) a target complementary sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA, and
c) an anchoring sequence consisting of from 2 to 12 nucleotides, said
anchoring sequence being complementary to at least a part of the target complementary sequence in b) and being capable of hybridising thereto, wherein the polycytosine loop functions as a scaffold for silver
nanoclustering. The invention further relates to a method for detecting a miRNA using the above- defined partial stem-loop oligonucleotide.
The present inventors have surprisingly shown that oligonucleotides comprising a partial loop structure defined as above can be used as efficient probes for miRNA detection - even for miRNAs where previous attempts at creating DNA/AgNC probes have failed.
The advantages of the present invention are numerous and include: · Simple, inexpensive and instant technique for miRNA detection
• Improved target sensitivity
• Improved target specificity
• Improved initial emission intensity of the probe
• Faster miRNA detection than with conventional time-consuming methods such as northern blot analysis and quantitative RT-PCR
• No radioisotopes or DIG labelling necessary
• Possible to design probes for miRNAs, for which previous DNA/AgNC probe design efforts have failed
• Systematic design of probes possible due to rational prediction in DNA structure
• Avoidance of the unpredictability of secondary structure and suboptimal emission and sensitivity of current methods
Description of Drawings
Figure 1. Depicts the strategy for the partial stem-loop probe structure for detection of miRNA. The figure depicts miRNA-21 (miR-21 ; SEQ ID NO:4) and the 6C-21-8bp miR- 21 probe (SEQ ID NO: 1).
Figure 2. At the top, 4 different non-stem-loop DNA probe sequences or perfect stem- loop DNA probes which have loop of DNA complementary sequences designed for miR-21 detection are depicted. None of the 4 probes were capable of forming highly emissive AgNC's and could thus not be used for miR-21 detection. As an example, the emission intensity of the first probe sequence is depicted at the bottom.
Figure 3. shows three different design strategies for a stem-loop probe for miR-21 detection. The top forms a full stem-loop structure as the complementary and anchor sequence are the same length (6C-21-22bp; SEQ ID NO:3)). The middle probe forms a partial stem-loop structure (6C-21-1 1 bp; SEQ ID NO:2)). The probe at the bottom also forms a partial stem-loop structure (6C-21-8bp; SEQ ID NO: 1). The miR-21 (SEQ ID NO:4) is shown inverted and aligned to the probes.
Figure 4. shows anchor length dependent emission of a 6C-21-6bp miR-21 detection probe.
Figure 5 shows anchor length dependent emission of a 6C-21-7bp miR-21 detection probe.
Figure 6 shows anchor length dependent emission of the 6C-21-8bp miR-21 detection probe (SEQ ID NO: 1).
Figure 7 shows anchor length dependent emission of a 6C-21-9bp miR-21 detection probe.
Figure 8 shows anchor length dependent emission of a 6C-21-10bp miR-21 detection probe. Figure 9 shows anchor length dependent emission of the 6C-21-11 bp miR-21 detection probe (SEQ ID NO:2).
Collectively, figures 4-9 show that miR-21 probes having longer anchors than 8 bp are more emissive. The balance between anchor length for fluorescence and target accessibility is the key point of designing. The length of the anchor has to be adjusted according to the specific thermodynamic properties of loop and stem sequences.
Figure 10 shows the effect of buffer and salt on the fluorescence intensity of the 6C- 21-11 bp miR-21 detection probe alone (black bar; SEQ ID NO:2) and target sensitivity in the presence of target miR-21 (grey bar; SEQ ID NO:4). Electrolytes of the buffer are important for the efficiency of formation of the partial stem and loop structure and target recognition.
Figure 11 shows a bar graph of figure 10 in the l0/l intensity versus miR-21 target concentration (l0 being the value without target).
Figure 12 shows the effect of buffer and salt on the fluorescence intensity of the 6C- 21-8bp miR-21 detection probe (black bar; SEQ ID NO: 1) and target sensitivity in the presence of target miR-21 (grey bar; SEQ ID NO:4).
Figure 13 shows a bar graph of figure 12 in the l0/l intensity versus miR-21 target concentration (l0 being the value without target).
Figure 14. Bar graph of emission intensity. 1.5 uM of 6C-21-8bp (SEQ ID NO: 1), 6C- 21-11 bp (SEQ ID NO:2) or 6C-21-22bp (SEQ ID NO: 3) probes were tested with 1.5 uM of miR-21 target (SEQ ID NO: 4). Figure 15 shows the l0/l intensity versus miR-21 target concentration (l0 being the value without target) of the bar graph of figure 14. Higher value of l0/l implies better target recognition efficiency.
Figure 16. Sensitivity of miR-21 probe. The figure shows the fluorescence profile of the 6C-21-8bp miR-21 probe (1.5 uM; SEQ ID NO: 1) in the presence of different concentrations of target miRNA (miR-21 ; SEQ ID NO:4). MiR-21 in a concentration ranging from 0.1 uM to 1.5 uM was hybridized with the probe for 10 min and then highly emissive AgNCs were generated by addition of AgN03 and NaBH4. Figure 17. Stern-Volmer plot of figure 16 follows a linear dependence of the l0/l intensity versus miR-21 target concentration (l0 being the value without target).
Figure 18. Specificity of miR-21 probe. Emission spectra of 1.5 μΜ 6C-21-8bp miR-21 detection probe (black square; SEQ ID NO: 1) and mixtures of 1.5 μΜ 6C-21-8bp miR- 21 probe (SEQ ID NO:1) with 1.5 μΙ_ of miR-210 target (open circle curve; SEQ ID NO: 8), miR200C target (open triangle; SEQ ID NO:5), miR122 target (inverted open triangle; SEQ ID NO: 6), miR-9 target (diamond with cross; SEQ ID NO:7), miR166 target (triangle with X; SEQ ID NO: 11), miR160 target (triangle with cross; SEQ ID NO: 12) and miR-21 target (Hexagon; SEQ ID NO:4). The 6C-21-8bp miR-21 detection probe recognizes its target miR-21 with high specificity.
Figure 19. Bar graph of the fluorescence intensity of figure 18.
Figure 20. Detection of miR-21 in cancer cell lines using 6C-21-8bp sensor (SEQ ID NO: 1). Graph shows the emission intensity of sensor when mixed with total RNAs from each cancer cell line. Small RNA blot analysis shows the relative amount of target miR- 21 in each cancer cell line. U6 snRNA was used as a loading control.
Figure 21. Generation strategy of colorful stem-loop sensors for multiplex target detection. Graph demonstrates the wavelength tuning by modulating the functional size
of the loop by introducing one (1 MM) or two (2MM) mismatches between the complementary and anchor sequence in the positions most proximal to the 6C-loop. Cartoon shows the sequence of the sensors and the expected stem-loop structure of the probes.
Definitions
Control: A control or a control sample according to the present invention is understood to be a sample which in the context of the currently tested miRNA can function as a control to determine relative changes in expression of the miRNA. The control may have either a low (or no: include probe only) expression of the miRNA, normal expression of the miRNA, or elevated expression depending on the purpose of the test. For instance, if one is to test a cancer cell sample for aberrant (higher or lower) expression of a particular miRNA, one may use a tissue or cell sample from a normal (non-cancerous) tissue of the same origin. E.g. if a breast cancer tissue sample is tested for elevated expression of a particular miRNA, the expression may be compared to the expression of the miRNA in normal breast tissue. Complementary: Two nucleotide sequences are said to be complementary if, when they are aligned antiparallel to each other, they are able to anneal to form a double helix. Two nucleotides are said to be 100% complementary if the nucleotide bases form Watson-Crick base pairs at each possible position. If two nucleotides are of different lengths, 100% complementarity implies the formation of Watson-Crick base pairs at each possible position in the overlapping region.
Multiplex: A multiplex assay is an assay that simultaneously measures multiple analytes in a single run/cycle of the assay. In the present context, multiplex assaying is used to denote the simultaneous measurement of two or more miRNAs in a sample.
Melting temperature (Tm): The melting temperature (Tm) is defined as the temperature at which half of the nucleotide strands are in the random coil or single-stranded (e.g. ssDNA) state. Tm depends on the length of the nucleotide and its specific nucleotide sequence. DNA, when in a state where its two strands are dissociated (i.e., the dsDNA
molecule exists as two independent strands), is referred to as having been denatured by the high temperature.
Sequences miR-21 probes: 6C-21-8bp-miR-21 :
5'-GATGTTGACCCCCCTCAACATCAGTCTGATAAGCTA-3' (SEQ ID NO: 1) 6C-21-11 bp-miR-21 :
5'-ACTGATGTTGACCCCCCTCAACATCAGTCTGATAAGCTA-3' (SEQ ID NO:2) 6C-21-22bp-miR-21 :
5'- TAGCTTATCAGACTGATGTTGACCCCCCTCAACATCAGTCTGATAAGCTA-3' (SEQ ID NO:3) hsa-miR-21 :
5'-UAGCUUAUCAGACUGAUGUUGA -3' (SEQ ID NO:4) hsa-miR-200c :
5' - UAAUACUGCCGGGUAAUGAUGGA - 3' (SEQ ID NO:5) hsa-miR-122
5'- UGGAGUGUGACAAUGGUGUUUG - 3' (SEQ ID NO:6) hsa-miR-9
5'- UCUUUGGUUAUCUAGCUGUAUGA - 3' (SEQ ID NO:7) hsa-miR-210
5'- CUGUGCGUGUGACAGCGGCUGA - 3' (SEQ ID NO:8) hsa-miR-27b
5'- UUCACAGUGGCUAAGUUCUGC-3' (SEQ ID NO:9)
hsa-miR-Let-7a
5'- UGAGGUAGUAGGUUGUAUAGUU- 3' (SEQ ID NO: 10) Ath-miR166:
5'-UCGGACCAGGCUUCAUUCCCC-3' (SEQ ID NO: 11)
Ath-miR160:
5'-UGGCAUACAGGGAGCCAGGCA-3' (SEQ ID NO: 12)
Non-emissive miR-21 sensors without partial stem-loop structure:
5'-CCTCCTTCCTCCTCAACATCAGTCTGATAAGCTAGG-3' (SEQ ID NO: 13) 5'-CCCCTCAACATCAGTCTGATAAGCTAGGGG-3' (SEQ ID NO: 14)
5'-CCCCCCTCAACATCAGTCTGATAAGCTAGGGGGG-3' (SEQ ID NO: 15) 5'-CCTCCTTCAACATCAGTCTGATAAGCTAAGGAGG-3' (SEQ ID NO: 16) miR-196a probes: 6C-196a-11 bp-1 MM:
5'-ATGTTGTTGGACCCCCCCCCAACAACATGAAACTACCTA-3' (SEQ ID NO: 17)
6C-196a-11 bp-2MM:
5'-ATGTTGTTGAACCCCCCCCCAACAACATGAAACTACCTA-3' (SEQ ID NO: 18)
6C-196a-2bp:
5'-GGCCCCCCCCCAACAACATGAAACTACCTA-3' (SEQ ID NO: 19)
Detailed description of the invention
Recent studies have reported that miRNAs are involved in various biological processes and pathological responses, particularly in the development of organs and tissues. In plants, miRNAs are key regulators for the shape of leaves, flower development, flowering time, reproduction, stem development, apical dominancy and root
development. Profiling the levels of miRNAs has been an indispensable approach for detailed understanding of plant development and growth. In humans, in addition to the roles in development and growth, the expression levels of miRNAs have been especially correlated to cancer type, stage of tumour and treatment response. miRNAs have become a new class of biomarker for diagnostic analysis as well as therapeutic targets themselves.
For instance, miR-21 has been implicated in the prognosis of non-small-cell lung cancer, but the results are controversial. Recent study resolved this issue and showed that miR-21 can be used as a prognosis marker for lung cancer and lymphoid metastasis (Wang et al., 2013). Using microarrays or LNA RT-PCR panels,
comprehensive profiles of microRNAs from paired breast cancer tumours, normal tissue and serum samples derived from 32 patients were established and the results showed that miR-21 , miR-10b, and miR-145, previously shown to be dysregulated in breast cancer were differentially expressed in breast cancer tumours (Chan et al., 2013).
Several methods for miRNA detection have been developed for research purposes and clinical diagnosis. Those methods can be separated into several categories, each with its own advantages and drawbacks; microarray-based, nanotechnology-based, QRT- PCR-based, amplification-based, enzymatic assay-based and deep sequencing-based. These current methods offer good specificity and sensitivity but real practical application of them is still limited due to their high cost, time-consuming and complex procedures. For instance, the microarray-based method has been most widely used for the profiling of miRNAs and is based on the hybridization between target and complementary probe. In addition to the high cost, the sensitivity of the method is highly changeable due to the melting temperature of the designed probe and the labelling of target miRNA is also a difficult step in the procedure. To improve on these weak points, the locked nucleic acid (LNA) technique was developed to upgrade the
microarray method, however it still has limited accurate miRNA detection. Alternative strategies based on nanotechnology have been developed for miRNA detection such as Electrocatalytic Nanoparticle Tags (ENT), Surface Plasmon Resonance Imaging (SPRI), Gold-nanoparticles-based array and Surface Enhanced Raman Scattering (SERS)-based assays. In spite of their significant specificity and sensitivity to fM concentrations, these methods mostly require sophisticate instruments with very high running cost and also suffer from many skilled and difficult processing steps.
The present detection strategy is based on the emission properties of small silver nano-clusters. With the proper scaffold materials, small silver clusters (less than 100 atoms) can be stabilized, leading to bright and photo-stable fluorescence. These scaffolds include biological compounds (e.g. DNA, RNA, and proteins), polymers, dendrimers, organic compounds and inorganic matrices. Previously, we selected a DNA scaffold of 12 nucleotides that associates in creating a red emitting DNA/AgNC based on the work of Richard et al (Richards et al., 2008). By using the 12 nucleotide scaffold, a DNA probe was designed to have a complementary sequence to the target miRNA. As an example, we showed two DNA/AgNCs probes that target plant miR160 (involved in phytohormone regulations) and miR172 (important for flower
development). Addition of AgN03 and following reduction with NaBH4
(DNA/AgN03/NaBH4 in a 1 : 17: 17 ratio), the DNA/AgNCs probes generated a very bright red fluorescence within an hour. In the presence of their target miRNAs, the glowing red fluorescence of the DNA/AgNCs probes is selectively turned off. The proof of concept experiment demonstrated that rapid and precise miRNA detection can be achieved simply by monitoring the spectroscopic features of the AgNCs (Yang et al., 201 1 , Shah et al., 2012). However, our original method was not successful in designing DNA/AgNCs probes for some miRNAs, such as miR-21. MiR-21 has very low GC contents and Tm values compared to the other miRNAs in humans. Due to the thermodynamic disadvantage of miR-21 , we could not successfully create a highly emissive DNA/AgNC probe against miR-21 with our previous method.
To overcome this problem, we designed the partial stem-loop AgNC probe of the present disclosure which doesn't require a 12nt scaffold DNA and its structure formation can be modulated by anchoring sequences. In the present disclosure, we combined a poly-cytosine loop (Driehorst et al., 201 1) for the encapsulation of a highly emissive species with DNA complementary sequences against the target of interest.
We have found that the length of the anchoring sequence complementary to the DNA complementary sequence of target miRNA is important for both the generation of fluorescence and target accessibility.
MicroRNA detection probe
The present invention provides a novel oligonucleotide probe for simple, inexpensive and instant miRNA detection in biological samples.
The silver nanocluster (AgNC) oligonucleotide probe of the present invention comprises or consists of:
a) a polycytosine loop sequence consisting of from 6 to 12 cytosine nucleotides,
b) a target complementary sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA, and
c) an anchoring sequence consisting of from 2 to 12 nucleotides, said
anchoring sequence being complementary to at least a part of the target complementary sequence in b) and being capable of hybridising thereto, wherein the polycytosine loop functions as a scaffold for silver
nanoclustering.
The total length of the AgNC oligonucleotide probe of the present invention is at least 29 nucleotides. In one embodiment, the AgNC oligonucleotide probe is an
oligonucleotide comprising or consisting of 31 nucleotides, such as 33 nucleotides, for example 35 nucleotides, such as 37 nucleotides, for example 39 nucleotides, such as 41 nucleotides, for example 43 nucleotides, such as 45 nucleotides, for example 47 nucleotides, such as 50 nucleotides. In a preferred embodiment the total length of the AgNC oligonucleotide probe of the present invention is between 29 to 50 nucleotides, more preferred between 31 and 40 nucleotides, such as 36 nucleotides.
The polycytosine (poly-C) loop functions as a scaffold for silver nanoclustering. The length of the poly-C loop plays an important role for the thermodynamic properties of
the probe as a whole, the fluorescence intensity and the emission wavelength generated by the silver nanoclustering.
In one embodiment the poly-C loop consists of at least 6 cytosine residues, such as at least 7 or 8 cytosine residues.
In one embodiment the poly-C loop consists of 6 cytosine residues.
In an alternative embodiment, the poly-C loop is even longer than 8 residues, such as a 9-12 C-loop.
In one embodiment, a part of the C residues in the poly-C loop are exchanged for another base, such as thymine or guanine, such as one or more bases, for example two, three or more bases. Exchange of one or more of the bases in the poly-C loop can affect the emission wavelength, which can e.g. be used for multiplex detection.
In one embodiment, the size of the loop can be functionally increased without changing the length of the poly-C loop itself by the introduction of one or more mismatches nucleotides in the anchor sequence most proximal to the loop as described herein below.
Usually, the target complementary sequence is the same length as the target miRNA and 100% complementary thereto. In other embodiments, the target complementary sequence is longer than the target miRNA.
In one embodiment the target complementary sequence is a nucleotide sequence consisting of 22 consecutive nucleotides being 100% complementary to the sequence of a target miRNA. In one embodiment the target complementary sequence is a nucleotide sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 40 nucleotides, for example from 21 to 30 nucleotides, more preferred between 21 to 25 nucleotides.
The target complementary sequence may be either at the 5' termini or the 3' termini of the polycytosine loop sequence, the anchoring sequence being in the opposite position. In one embodiment the anchoring sequence is 100% complementary to the target complementary sequence in the overlapping, i.e. base-pairing, region.
The anchoring sequence is complementary to at least a part of the target
complementary sequence and is capable of hybridising thereto. Preferably, the anchoring sequence hybridises to the part of the target complementary sequence positioned most proximal to the C-loop.
The length and melting temperature (Tm) of the anchoring sequence is an important determinant for both emission intensity and sensitivity of the probe. Generally, the longer the anchor sequence, the brighter the fluorescence of the probe, however, the sensitivity of the probe decreases the longer the anchor sequence becomes (Figures 14-15). The length/Tm of the anchoring sequence must be so that the stem-loop structure is maintained until exposure to the specific target miRNA. Upon contact with target miRNA, the stem-loop structure is disrupted due to hybridisation of the target complementary sequence to the miRNA target (Figure 1).
In one embodiment, the anchor sequence is a nucleotide sequence consisting of from 2 to 12 nucleotides. In one embodiment, the anchor sequence is a nucleotide sequence consisting of from 4 to 12 nucleotides, such as from 6 to 10 nucleotides, for example 8 nucleotides.
If the anchor sequence is short, e.g. less than 4 nucleotides, it is preferably 100% complementary to the target complementary sequence, i.e. no mismatches.
In one embodiment, the Tm of the anchor sequence is about 15-30°C, such as about 20°C. One way of manipulating the Tm of the anchor sequence is by changing the length of the anchor. For instance, for miRNA targets having a relatively high A and U content, the optimal anchor length may be longer than for miRNA targets having a relatively high G and C content.
Changing the length of the anchor sequence is one way of manipulating the Tm value of the anchor. Alternatively, one or more mismatches may be introduced into the sequence of the anchor to decrease the strength of hybridisation of anchor and target complementary sequence. Thus, in one embodiment, the anchoring sequence is at least 70%, such as at least 75%, for example at least 80%, such as at least 85%, for example at least 90% complementary to the target complementary sequence.
In one embodiment, the anchor sequence contains one or more mismatches in the anchor sequence most proximal to the C-loop, such as one or two mismatched nucleotides. The effect of introducing one or more mismatches next to the loop is that the size of the loop is functionally increased since there will be no base-pairing between the mismatched nucleotides as illustrated in figure 21. In one embodiment the anchoring sequence contains a single mismatched nucleotide positioned most proximal to the C-loop. An anchoring sequence consisting of
1 1 nucleotides having a single mismatched nucleotide would be 91 % complementary to the target complementary sequence. In one embodiment the anchoring sequence contains two mismatched nucleotides positioned most proximal to the C-loop. An anchoring sequence consisting of
1 1 nucleotides having a single mismatched nucleotide would be 82% complementary to the target complementary sequence. The length and base composition of the anchoring sequence may be further adjusted by the skilled person to provide favourable thermodynamic conditions for specific hybridisation to target miRNA, while retaining good initial AgNC emission of the probe.
Manipulation of the length and complementarity of the anchor sequence can change the emission spectra of the probes, thus allowing for multiplex miRNA detection, i.e. detection of different miRNA's in a single sample.
In one embodiment, the AgNC oligonucleotide probe of the present invention comprises 100% DNA nucleotides. Alternatively the AgNC oligonucleotide probe of the invention may comprise 100% RNA nucleotides or a suitable mixture of DNA and RNA
nucleotides, thus creating a DNA/RNA chimeric partial stem-loop oligonucleotide probe.
In one embodiment, the miRNA target is a human miRNA, such as one or more of the human miRNAs listed in the below table. Thus, in one embodiment, the target miRNA is one of more of the miRNAs selected from the group consisting of: hsa-miR-21 , hsa- miR-Let-7a, hsa-miR-200c, hsa-miR-122, hsa-miR-9, hsa-miR-27b and hsa-miR-210. miRNA Sequence Diseases
Name
hsa-miR- 5' - UAAUACUGCCGGGUAAUGAUGGA - 3' Ovarian cancer, Colorectal cancer, 200c (SEQ ID NO:5) breast cancer, lung cancer,
melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE
hsa-miR- 5'- UGGAGUGUGACAAUGGUGUUUG - 3' Oral Squamous Cell carcinoma, 122 (SEQ ID NO:6) Hepatocellular Carcinoma, HCV infection, Breast Cancer, Gastric cancer, Lung cancer,
hsa-miR- 5'- UGAGGUAGUAGGUUGUAUAGUU- 3' Lung cancer, hepatocellular Let-7a (SEQ ID NO:10) carcinoma, Oral Squamous cell carcinoma, Prostate cancer, Breast cancer, Pancreatic cancer hsa-miR-9 5'- UCUUUGGUUAUCUAGCUGUAUGA - 3' Hodgkin's lymphoma, Epithelial
(SEQ ID NO:7) Ovarian Cancer, Lung cancer,
Neuroblastoma, Ovarian Cancer, Hepatocellular Carcinoma, Gastric Cancer
hsa-miR- 5'- CUGUGCGUGUGACAGCGGCUGA - 3' Breast Cancer, diffuse large B-cell 210 (SEQ ID NO:8) lymphoma (DLBCL), acute
lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Breast Cancer, Duchenne muscular dystrophy (DMD), Lung cancer, Pancreatic Cancer, Prostate cancer, Kidney cancer, Head and Neck Cancer, cervical
cancer, Gastric cancer, hsa-miR- 5'- UAGCUUAUCAGACUGAUGUUGA - 3' Colorectal Cancer, diffuse large B-
21 (SEQ ID NO:4) cell lymphoma (DLBCL), lung cancer, Pancreatic cancer, Breast
Cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden
Syndrome, glioblastoma, hepatocellular carcinoma (HCC),
Vascular disease, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), autism spectrum disorder (ASD),
Cervical cancer, chronic lymphocytic leukemia (CLL),
Duchenne muscular dystrophy
(DMD), epithelial ovarian cancer
(EOC), esophageal cancer,
Gastric Cancer, Glioblastoma,
Ovarian Cancer, uterine leiomyoma (ULM), Bladder cancer,
Oral Squamous Cell Carcinoma
(OSCC), head and neck squamous cell carcinoma
(HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Hodgkin's lymphoma, Colon Carcinoma, hsa-miR- 5'- UUCACAGUGGCUAAGUUCUGC-3' (SEQ Dysregulation of miRNA-27b has
27b ID NO:9) been reported in Prostate cancer,
Lung cancer, Non small cell lung cancer, Neuroblastoma, Leukemia, esophageal cancer, breast cancer, colorectal cancer, glioblastoma, cardiac hypertrophy and oral squamous cell carcinoma. miR-27b is located on chromosome 9 and has been shown to function as a tumor suppressor in neuroblastoma
via targeting the peroxisome
proliferator-activated receptor c (PPARc). miR-27b targets vascular endothelial growth factor C (VEGFC) and functioned as an inhibitor of tumor progression and angiogenesis through targeting VEGFC in Colorectal cancer.
In a particularly preferred embodiment, the AgNC oligonucleotide probe is a probe capable of detecting miRNA-21 (miR-21). In one embodiment, the miR-21 specific AgNC oligonucleotide probe comprises or consists of SEQ ID NO:1 , 2 or 3.
In a preferred embodiment, miR-21 specific AgNC oligonucleotide probe comprises or consists of SEQ ID NO: 1.
In one embodiment, the present invention relates to a variant of SEQ ID NO: 1 , wherein the loop length and/or base composition of the polycytosine loop is altered as described herein above. In one embodiment, the present invention relates to a variant of SEQ ID NO: 1 , wherein the anchor length and/or base composition of the anchor sequence is altered as described herein above.
Thus, in one embodiment, the present invention relates to an AgNC oligonucleotide probe comprising or consisting of an oligonucleotide sequence of from 29 to 45 nucleotides comprising or consisting of:
a) SEQ ID NO:1 , or
b) a variant of SEQ ID NO: 1 , wherein the loop length and/or base composition of the polycytosine loop is altered as described herein above,
and/or
wherein the anchor length and/or base composition of the anchor sequence is altered as described herein above.
In one embodiment, the present invention relates to use of the AgNC oligonucleotide probe of the present invention for diagnosing a disease. Preferably, the diagnostic method is an in vitro diagnostic method performed on a biological sample isolated from a subject as described further herein below.
In one embodiment, the present invention relates to use of the AgNC oligonucleotide probe of the present invention for classifying a disease based on miRNA expression.
The disease may be selected from ovarian cancer, Colorectal cancer, breast cancer, lung cancer, melanoma, Prostate cancer, Neuroblastoma, cardiomyopathy, SLE, Oral Squamous Cell carcinoma, Hepatocellular Carcinoma, HCV infection, Gastric cancer, Lung cancer, Pancreatic cancer. Hodgkin's lymphoma, Epithelial Ovarian Cancer, Gastric Cancer, diffuse large B-cell lymphoma (DLBCL), acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), Duchenne muscular dystrophy (DMD), Kidney cancer, Head and Neck Cancer, cervical cancer, cardiac hypertrophy, cholangiocarcinoma, Cowden Syndrome, glioblastoma, Vascular disease, autism spectrum disorder (ASD), Cervical cancer, chronic lymphocytic leukemia (CLL), esophageal cancer, Glioblastoma, uterine leiomyoma (ULM), Bladder cancer, head and neck squamous cell carcinoma (HNSCC), heart failure, non-small cell lung cancer (NSCLC), cholesteatoma, Colon Carcinoma, leukemia, Alzheimer's disease and diabetes.
In one embodiment, the disease is a cancer, such as breast cancer. Method for detection of miRNA
The present invention further provides a method for detecting one or more miRNAs in a sample. The method for miRNA detection comprises the steps of:
a) providing a sample comprising one or more miRNAs,
b) providing one or more AgNC oligonucleotides according to the present invention,
c) contacting said one or more AgNC oligonucleotides with said sample, d) generating AgNC's by addition of a suitable Ag-containing composition, and
e) measuring the emitted fluorescence,
wherein an altered fluorescence indicates an altered expression of said miRNA.
If the sample has an increased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be lower than the control. Vice versa, if the sample has a decreased expression of a miRNA compared to the control, the emitted fluorescence of the sample will be higher than the control.
The Ag-containing composition is preferably AgN03. In a preferred embodiment, the Ag-containing composition further comprises NaBH4. Addition of AgN03 and NaBH4 results in the generation of AgNC's with DNA or RNA working as a scaffold.
The reaction is performed in the presence of a suitable buffer. Exemplary buffer solutions include TAPS, Bicine, Tris, Tricine, TAPSO, HEPES, TES, MOPS, PIPES, Cacodylate, SSC, MES, Succinic acid. In one embodiment, the buffer is a Tris-acetate buffer, for example a Tris-acetate buffer such as a 20 mM or a 40 mM Tris-acetate buffer solution. In one embodiment, the buffer further comprises NaN03. The concentration of NaN03 is usually in the range of 1 to 50 mM, for example 5-30 mM, such 5 mM or 25 mM NaN03.
The present method is preferably an in vitro miRNA detection method capable of detecting one or more miRNAs in a sample obtained from a plant or an animal, preferably from a human, such as in a tissue or cell sample or body fluid such as urine obtained from the human.
The present method may be applied to any sample comprising RNA. For instance, the sample may be whole blood or a biopsy obtained from a relevant organ or tissue of the human body, such as a tumour biopsy comprising cancer cells. In one embodiment the sample comprising one or more miRNAs is a biological sample selected from the group consisting of whole cell lysate and isolated total RNA obtained from a tissue or cells.
The quantification provided by the method of the present invention is usually a relative quantification seen in comparison to the expression level of the particular miRNA in a relevant control sample. The excitation/emission spectra of the miRNA probes of the present invention depend on the specific nucleotide sequence and length of the probe. The emission peaks of particular miRNA AgNC probes can be determined by measuring the emitted fluorescence after excitation at different wavelengths as previously described by e.g. Yang et al., 201 1.
The emitted fluorescence may be measured after excitation at an appropriate wavelength with any equipment capable of measuring fluorescence, such as a fluorimeter. In one embodiment the present method is a multiplex miRNA detection method that allows for the detection of two or more miRNAs simultaneously in the same sample. Different maximal excitation/emission wavelengths of individual miRNA probes allows for detection of more than one miRNA in the same reaction. In one embodiment two or more different miRNAs are detected in the same reaction.
In one embodiment three or more different miRNAs are detected in the same reaction.
In an alternative embodiment, the present method is used for the specific and sensitive detection and quantification of a single-stranded nucleotide species, different from a miRNA, in a sample, such as siRNA, intermediate non-coding RNA and long non- coding RNA. In such cases the probe will be an oligonucleotide comprising a target complementary sequence comprising at least 21 nucleotides or more being 100% complementary to the target sequence.
Kit of parts
The invention also provides a kit of parts comprising one or more AgNC oligonucleotide miRNA detection probes and the reagents needed for testing samples.
Thus, the invention further relates to a kit of parts for detection of one or more miRNAs in a sample comprising:
a) one or more partial stem-loop silver nanocluster oligonucleotide miRNA detection probes comprising a 21 nucleotide sequence being 100% complementary to target miRNA,
b) AgN03,
c) NaBH4, and
d) optionally instructions for use.
The kit of parts optionally comprises instructions for use of the kit. The instructions for use may be essentially as described in Example 1.
The kit of parts may further comprise a buffer solution suitable for detection of miRNAs.
References
Chan M , Liaw CS, Ji SM, Tan HH, Wong CY, Thike AA, Tan PH, Ho GH, Lee AS. Identification of Circulating MicroRNA Signatures For Breast Cancer Detection. Clin Cancer Res. 2013 Jun 24. [Epub ahead of print]
Driehorst T, O'Neill P, Goodwin PM, Pennathur S, Fygenson DK. Distinct
conformations of DNA-stabilized fluorescent silver nanoclusters revealed by electrophoretic mobility and diffusivity measurements. Langmuir. 201 1 Jul
19;27(14):8923-33.
Richards CI, Choi S, Hsiang JC, Antoku Y, Vosch T, Bongiorno A, Tzeng YL, Dickson RM. Oligonucleotide-stabilized Ag nanocluster fluorophores. J Am Chem Soc. 2008 Apr 16; 130(15):5038-9.
Schubert M , Spahn M , Kneitz S, Scholz CJ, Joniau S, Stroebel P, Riedmiller H, Kneitz B. Distinct microRNA Expression Profile in Prostate Cancer Patients with Early Clinical Failure and the Impact oflet-7 as Prognostic Marker in High-Risk Prostate Cancer. PLoS One. 2013 Jun 14;8(6):e65064.
Shah P, R0rvig-Lund A, Chaabane SB, Thulstrup PW, Kjaergaard HG, Fron E, Hofkens J, Yang SW, Vosch T. Design aspects of bright red emissive silver nanoclusters/DNA probes for microRNA detection. ACS Nano. 2012 Oct
23;6(10):8803-14.
Sun X, Qin S, Fan C, Xu C, Du N, Ren H. Let-7: a regulator of the ERct signaling pathway in human breast tumors and breast cancer stem cells. Oncol Rep. 2013 May;29(5):2079-87. Wang Y, Li J, Tong L, Zhang J, Zhai A, Xu K, Wei L, Chu M. The Prognostic Value of miR-21 and miR-155 in Non-small-cell Lung Cancer: A Meta-analysis. Jpn J Clin Oncol. 2013 Jun 30. [Epub ahead of print]
Yang SW, Vosch T. Rapid detection of microRNA by a silver nanocluster DNA probe. Anal Chem. 201 1 Sep 15;83(18):6935-9.
Examples
Example 1. Sensitivity and specificity of stem-loop AgNC miR-21 probe Based on the data depicted in figures 4-15 testing the emitted fluorescence and target recognition of stem-loop probes with varying anchor stem lengths, the 6C-21-8bp miR- 21 probe was selected for further analysis.
The nomenclature "6C-21-8bp" means a 6C loop, a 100% complementary sequence to miR-21 (22nt), and an 8bp anchor sequence.
Stem-loop AgNC 6C-21-8bp miR-21 probe - Stock-Ι ΟΟμΜ:
5'-GATGTTGACCCCCCTCAACATCAGTCTGATA AGCTA-3' (SEQ ID NO:1) hsa-miR-21- Stock-Ι ΟΟμΜ
5'-UAGCUUAUCAGACUGAUGUUGA -3' (SEQ ID NO:4) Solutions:
500mM Tris Acetate Buffer (Stock)
500mM NaN03 Solution (Stock)
MilliQ Water- 18.2ΜΏ
1 mM AgN03 solution
1 mM NaBH4 solution
The NaBH4 solution may be prepared by pre-measuring 2mg of NaBH4 in 50ml conical tube. Just before the NaBH4 is to be used, 50ml water is added to the tube and the contents are mixed by brief vortexing. The solution is used within about 5 minutes of addition of water.
For stem-loop miRNA probe:
1. Take 7.5μΙ of 100μΜ DNA Solution.
2. Add 7.5μΙ of MilliQ Water
3. Add 2μΙ of Tris Acetate Solution
4. Add 2.5μΙ of NaN03 solution
5. Add 5.5μΙ of MilliQ Water to make up to 25μΙ reaction volume
6. Vortex and briefly spin down.
7. Denature 25μΙ reaction mixture by heating at 95°C for 10 minutes
8. Briefly spin down to collect evaporated volume.
9. Allow reaction mixture to anneal by incubating at 25°C for 20 minutes
10. Add 12.5μΙ of AgN03 and 12.5μΙ of freshly prepared NaBH4.
1 1. Incubate the 50μΙ reaction volume at 25°C for 1 hr.
12. After 1 hr the reaction volume is added 450μΙ of MilliQ water to make up to 500μΙ volume (The used fluorimeter apparatus requires at least 500μΙ volume)
For microRNA detection:
1. Take 7.5μΙ of 100μΜ DNA Solution.
2. Add corresponding volume of the miRNA (Refer to table).
3. Add 2μΙ of Tris Acetate Solution
4. Add 2.5μΙ of NaN03 solution
5. Add MilliQ Water to make up to 25μΙ reaction volume
6. Vortex and briefly spin down.
7. Denature 25μΙ reaction mixture by heating at 95°C for 10 minutes
8. Briefly spin down to collect evaporated volume.
9. Allow reaction mixture to anneal by incubating at 25°C for 20 minutes
10. Add 12.5μΙ of AgN03 and 12.5μΙ of freshly prepared NaBH4.
1 1. Incubate the 50μΙ reaction volume at 25°C for 1 hr.
12. After 1 hr the reaction volume is added 450μΙ of MilliQ water to make up to 500μΙ volume (The used fluorimeter apparatus requires at least 500μΙ volume)
Buffer Concentration in 50μΙ reaction volume is 20mM Tris Acetate and 25mM NaN03.
The volumes of miRNA and their corresponding concentration in 50μΙ and 500μΙ is shown in the below table.
miRNA volume added Concentration in 50μΙ Concentration in 500μΙ
7.5μΙ 15μΜ 1.5μΜ
5μΙ 10μΜ 1 μΜ
2.5μΙ 5μΜ 0.5μΜ
1 μΙ 2μΜ 0.2μΜ
5μΙ (1 : 10 diluted miR-21 1 μΜ 0.1 μΜ
stock)
Stock of miRNA-Ι ΟΟμΜ (10μΜ stock to detect 1 μΜ miRNA concentration) Results and discussion
We started to construct a 6C stem-loop probe (6C-21-22bp) with a 22bp anchoring sequences that emitted a strong fluorescence 3 fold higher than the intensity of 60-21- 8bp (Figure 14). When we reduced the length of anchoring sequences, the high emission was gradually reduced in fluorescence suggesting that length of the anchor sequence is important for emission intensity (Figures 4-9) - The longer the anchor sequence, the higher the fluorescence. Simultaneously, we observed that longer anchor sequences were negatively correlated to the target sensitivity. The fluorescence drop in the presence of target miRNA versus the initial fluorescence (I0/I ratio) is an important parameter for probe sensitivity. The 6C-21-22bp (SEQ ID NO: 3) showed the ratio of 1 indicating no accessibility to its target. 60-21-11 bp (SEQ ID NO: 2) and 6C- 21-8bp (SEQ ID NO:1) recognized the target in the ratio of 2 and 6, respectively (Figure 14). The results demonstrate that the balance between the formation of a strong fluorescence and target accessibility can be modulated by the length of the anchor sequence. Best-fit adjustment of the anchor length is the key factor of our partial stem and loop AgNCs probe.
We further test the feasibility of the selected probe, 6C-21-8bp (SEQ ID NO:1) under various buffer conditions (Figures 12 and 13). The selected 6C-21-8bp probe successfully generated a strong fluorescence when it was excited 480 nm.
Using the strong emission, we tested whether the 6C-21-8bp probe is able to recognize miR-21 in a concentration dependent manner ranging from 0.1 uM to 1.5 uM (Figure 16). The target recognition of 6C-21-8bp is verified by the Stern-Volmer plot, which follows a linear dependence of the I0/I intensity versus miR-21 target concentration with a value for the slope of ~6 (Figure 17).
In a next step, the specificity of the probe was tested by adding different miRNA target sequences to the 6C-8bp-21 probe. Figure 18 shows an overview of the observed red AgNC fluorescence, 1 h after AgN03 and NaBH4 are added to solutions containing final concentrations of 1.5 μΜ (7.5 μΙ_) 6C-8bp-21 probe and 1.5 μΜ 1.5 μΙ_ of miR-210 target (open circle curve), miR-200C target (open triangle), miR-122 target (inverted open triangle), miR-9 target (diamond with cross), miR166 target (triangle with X), miR- 160 target (triangle with cross) and miR-21 target (Hexagon). The 6C-21-8bp target (miR-21) has the largest effect on l0/l ratio as can be seen in Figure 19 (~6 times drop in the fluorescence intensity), while the presence of other non-specific targets only had a limited effect on the observed fluorescence intensity of the 6C-21-8bp probe. This clearly opens perspectives toward designing and creating stem-loop AgNCs probes with a high specificity toward detecting specific miRNA sequences, especially some miRNAs, which cannot be detected by our previous designing strategies.
One of the most important features of the 6C-21-8bp probe for miR-21 detection is a partially complemented stem structure. When a probe is fully complemented by 21 nt anchoring sequences, even though it generated very strong fluorescence two times higher than that of 6C-21-8bp, it is not able to access its target. Therefore, to design a best-fit probe, the balance between structural stability of stem region and target accessibility have to be primarily considered. For example, when an anchoring region of a loop and stem junction contains many GC bases, one should reduce the length of anchor, e.g. down to 4 bp or even lower. On the other hand, if few GC bases are present in the anchoring region, one should extend the length of the anchor.
In contrast to the original designing method, this strategy for AgNC probe design for miRNA detection has the further advantage of allowing for easier prediction of functional high-emitting, sensitive and specific miRNA probes. By manipulating the length and base content of the polycytosine loop, probes with different emission wavelengths can be constructed.
Example 2. Detection of target miRNA's in cell lines
Detection of miR-21 levels in cancer cell lines was performed essentially by the protocol in Yang and Vosch (2011) with minor modification (used Tris-acetate buffer). Briefly, the sensor (6C-21-8bp (SEQ ID NO: 1)) was incubated with total RNA from each cell line for 20 min and the creation of AgNCs were commenced as previously described in Yang and Vosch (201 1). The results are shown in figure 20. MCF7 cell lines highly accumulated miR-21 while HEK293 and HELA control cell lines showed barely detectable levels of miR-21. By applying the sensor, we found that the emission intensity was correlated to the level of the miRNA. When the total RNA of MCF7 cell line was added to the sensor, the emission of the sensor was dramatically reduced. On the other hand, the addition of total RNA of HEK293 and HELA cell lines enhanced the emission, showing the emission drop is clearly correlated to the presence of target miRNA. This result strongly support that the functionality of the sensor is valid enough to discriminate the level of target miRNA both in vitro and in vivo.
Example 3. Multiplex target detection
By modulating the size of the loop and anchor, we observed that the emission wavelength could be shifted into three different colors. These findings allow us to tune the color of sensors by simply modulating the size and base-composition of the poly- cytosine loop and anchoring sequences, thus allowing for multiplex target detection. For instance, by adding mismatched nucleotides in the anchoring region most proximal to the C-loop, the size of the loop can be functionally increased without addition of extra sequences in the loop itself.
We designed two mismatched stem-loop sensors, 6C-196a-11 bp-1 MM (SEQ ID NO: 17) with a single mismatch (MM) and 6C-196a-11 bp-2MM (SEQ ID NO: 18) with two mismatches, which generated green and red colors respectively. For a 6C loop having a two nucleotide anchor sequence (SEQ ID NO: 19), we observed far-red fluorescence. The results are shown in figure 21.
The results show that by modulating the anchor sequence length and the complementarity of the anchor sequence to the target complementary sequence, probes exhibiting different emission spectra can be generated, thus allowing for multiplex target detection.
Claims
A silver nanocluster (AgNC) oligonucleotide miRNA detection probe comprising: a) a polycytosine loop sequence consisting of from 6 to 12 cytosine nucleotides,
b) a target complementary sequence comprising at least 21 consecutive nucleotides being 100% complementary to the sequence of a target miRNA, and
c) an anchoring sequence consisting of from 2 to 12 nucleotides, said
anchoring sequence being complementary to at least a part of the target complementary sequence in b) and being capable of hybridising thereto, wherein the polycytosine loop functions as a scaffold for silver
nanoclustering.
The AgNC oligonucleotide probe according to claim 1 , wherein the probe comprises or consists of from 29 to 45 nucleotides.
The AgNC oligonucleotide probe according to any of the preceding claims, wherein the target complementary sequence is a nucleotide sequence comprising or consisting of from 21 to 50 nucleotides, such as from 21 to 25 nucleotides.
The AgNC oligonucleotide probe according to any of the preceding claims, wherein the target complementary sequence is at the 5' termini of the polycytosine loop sequence and the anchoring sequence is at the 3' termini of the loop sequence or wherein the target complementary sequence is at the 3' termini of the polycytosine loop sequence and the anchoring sequence is at the 5' termini of the loop sequence.
The AgNC oligonucleotide probe according to any of the preceding claims, wherein the polycytosine loop sequence consists of 6 cytosine nucleotides.
The AgNC oligonucleotide probe according to any of the preceding claims, wherein the anchoring sequence consists of from 4 to 12 nucleotides.
7. The AgNC oligonucleotide probe according to any of the preceding claims, wherein the anchoring sequence is 100% complementary to the the target complementary sequence.
8. The AgNC oligonucleotide probe according to any of claims 1 to 6, wherein the anchoring sequence is at least 70%, such as at least 75%, for example at least 80%, such as at least 85%, for example at least 90% complementary to the target complementary sequence.
9. The AgNC oligonucleotide probe according to any of claims 1 to 6, wherein the anchoring sequence contains one or more mismatched nucleotides positioned most proximal to the polycytosine loop.
10. The AgNC oligonucleotide probe according to any of the preceding claims, wherein the anchoring sequence has a Tm value of from about 15°C to 30°C, such as about 20°C.
1 1. The AgNC oligonucleotide probe according to any of the preceding claims, wherein the AgNC oligonucleotide probe comprises 100% DNA nucleotides, 100% RNA nucleotides or a mixture of DNA and RNA nucleotides.
12. The AgNC oligonucleotide probe according to any of the preceding claims, wherein the AgNC oligonucleotide is capable of detecting miR-21.
13. The AgNC oligonucleotide probe according to claim 12 comprising or consisting of:
a) SEQ ID NO:1 , or
b) a variant of SEQ I D NO: 1 , wherein the loop length and/or base
composition of the polycytosine loop is altered,
and/or
wherein the anchor length and/or base composition of the anchor sequence is altered.
14. A method for detecting one or more miRNAs in a sample comprising:
a) providing a sample comprising one or more miRNAs,
b) providing one or more AgNC oligonucleotide probes according to any of the preceding claims,
c) contacting said one or more AgNC oligonucleotide probes with said sample,
d) generating AgNC's by addition of a suitable Ag-containing composition, and
e) measuring the emitted fluorescence,
wherein an altered fluorescence indicates an altered expression of said miRNA.
15. The method according to claim 14, wherein the Ag-containing composition is AgN03.
16. The method according to claim 15, wherein the Ag-containing composition
further comprises NaBH4.
17. The method according to any of claims 14-16, wherein a decreased
fluorescence intensity compared to control indicates an increased expression of the one or more miRNAs.
18. The method according to any of claims 14-16, wherein an increased
fluorescence intensity compared to control indicates a decreased expression of the one or more miRNAs.
19. The method according to any of claims 14-18, wherein the sample comprising RNA is a biological sample obtained from a plant or an animal, such as a human.
20. The method according to claim 19, wherein the biological sample is a tumour sample comprising cancer cells.
21. The method according to any of claims 19-20, wherein the biological sample is whole cell lysate or isolated total RNA.
22. The method according to any of claims 14-21 , wherein the method provides a relative quantification compared to a control.
23. The method according to any of claims 14-22, wherein two or more miRNAs are detected simultaneously.
24. The method according to any of claims 14-23, wherein the miRNA is miR-21.
25. The method according to any of claims 14-24, wherein the AgNC
oligonucleotide probe comprises or consists of SEQ ID NO: 1.
26. A kit of parts for detection of a miRNA in a sample comprising:
a) a silver nanocluster oligonucleotide probe according to any of claims 1-
13,
b) AgN03,
c) NaBH4, and
d) optionally instructions for use.
27. The kit of parts according to claim 26, wherein the AgNC oligonucleotide probe comprises or consists of SEQ ID NO: 1.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DKPA201370410 | 2013-07-19 | ||
| DKPA201370410 | 2013-07-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015007293A1 true WO2015007293A1 (en) | 2015-01-22 |
Family
ID=51302879
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/DK2014/050226 Ceased WO2015007293A1 (en) | 2013-07-19 | 2014-07-18 | Stem-loop silver nanocluster probes for mirna detection |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015007293A1 (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107037218A (en) * | 2017-05-04 | 2017-08-11 | 中南大学 | A kind of memebrane protein detection preparation, non-marked tumour nano-probe and application method |
| CN110330512A (en) * | 2019-07-30 | 2019-10-15 | 山东大学 | A kind of ag nano-cluster fluorescence nano stick and preparation method thereof and the application in white light LEDs |
| CN111351944A (en) * | 2020-03-17 | 2020-06-30 | 江苏省原子医学研究所 | Fluorescent biological probe and sensor for detecting mucin 1, application and detection method |
| CN112143779A (en) * | 2020-10-10 | 2020-12-29 | 天津中医药大学 | Multiple microRNA detection method of silver nanocluster based on entropy-driven amplification system as template |
| CN112210588A (en) * | 2020-10-15 | 2021-01-12 | 江苏省原子医学研究所 | Dual-signal amplification probe, sensor, detection method and application |
| WO2022031154A1 (en) | 2020-08-05 | 2022-02-10 | Grīnbergs Kaspars | A system for indoor microclimate control and a method for control thereof |
| CN114934099A (en) * | 2022-06-07 | 2022-08-23 | 中国人民解放军陆军军医大学第一附属医院 | DNAzyme allosteric regulation-based DNA tetrahedral nano machine, miRNA detection method and application |
| CN116200492A (en) * | 2022-11-08 | 2023-06-02 | 浙江大学 | Small nucleic acid detection kit based on probe anchored double chains and application thereof |
| EP4311861A1 (en) * | 2022-07-27 | 2024-01-31 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Dna-stabilized metal cluster-based nucleic acid-sensor |
-
2014
- 2014-07-18 WO PCT/DK2014/050226 patent/WO2015007293A1/en not_active Ceased
Non-Patent Citations (16)
| Title |
|---|
| C.M. RITCHIE ET AL: "Ag Nanocluster Formation Using a Cytosine Oligonucleotide Template", JOURNAL OF PHYSICAL CHEMISTRY C, vol. 111, no. 1, 11 January 2007 (2007-01-11), pages 175 - 181, XP055148292, ISSN: 1932-7447, DOI: 10.1021/jp0648487 * |
| CHAN M; LIAW CS; JI SM; TAN HH; WONG CY; THIKE AA; TAN PH; HO GH; LEE AS: "Identification of Circulating MicroRNA Signatures For Breast Cancer Detection", CLIN CANCER RES., 24 June 2013 (2013-06-24) |
| DRIEHORST T; O'NEILL P; GOODWIN PM; PENNATHUR S; FYGENSON DK: "Distinct conformations of DNA-stabilized fluorescent silver nanoclusters revealed by electrophoretic mobility and diffusivity measurements", LANGMUIR, vol. 27, no. 14, 19 July 2011 (2011-07-19), pages 8923 - 33 |
| MIN ZHANG ET AL: "Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters", THE ANALYST, vol. 138, no. 17, 4 June 2013 (2013-06-04), pages 4812, XP055148422, ISSN: 0003-2654, DOI: 10.1039/c3an00666b * |
| PATRICK R. O'NEILL ET AL: "Hairpins with Poly-C Loops Stabilize Four Types of Fluorescent Ag n :DNA", JOURNAL OF PHYSICAL CHEMISTRY C, vol. 113, no. 11, 19 March 2009 (2009-03-19), pages 4229 - 4233, XP055148490, ISSN: 1932-7447, DOI: 10.1021/jp809274m * |
| PRATIK SHAH ET AL: "Design Aspects of Bright Red Emissive Silver Nanoclusters/DNA Probes for MicroRNA Detection", ACS NANO, vol. 6, no. 10, 23 October 2012 (2012-10-23), pages 8803 - 8814, XP055146138, ISSN: 1936-0851, DOI: 10.1021/nn302633q * |
| RICHARDS CHRIS I ET AL: "Oligonucleotide-stabilized Ag nanocluster fluorophores", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, ACS PUBLICATIONS, US, vol. 130, no. 15, 1 April 2008 (2008-04-01), pages 5038 - 5039, XP009105196, ISSN: 0002-7863, DOI: 10.1021/JA8005644 * |
| RICHARDS CI; CHOI S; HSIANG JC; ANTOKU Y; VOSCH T; BONGIORNO A; TZENG YL; DICKSON RM: "Oligonucleotide-stabilized Ag nanocluster fluorophores", J AM CHEM SOC., vol. 130, no. 15, 16 April 2008 (2008-04-16), pages 5038 - 9 |
| SCHUBERT M; SPAHN M; KNEITZ S; SCHOLZ CJ; JONIAU S; STROEBEL P; RIEDMILLER H; KNEITZ B: "Distinct microRNA Expression Profile in Prostate Cancer Patients with Early Clinical Failure and the Impact of let-7 as Prognostic Marker in High-Risk Prostate Cancer", PLOS ONE, vol. 8, no. 6, 14 June 2013 (2013-06-14), pages E65064 |
| SEONG WOOK YANG ET AL: "Rapid Detection of MicroRNA by a Silver Nanocluster DNA Probe", ANALYTICAL CHEMISTRY, vol. 83, no. 18, 15 September 2011 (2011-09-15), pages 6935 - 6939, XP055147213, ISSN: 0003-2700, DOI: 10.1021/ac201903n * |
| SHAH P; RORVIG-LUND A; CHAABANE SB; THULSTRUP PW; KJAERGAARD HG; FRON E; HOFKENS J; YANG SW; VOSCH T: "Design aspects of bright red emissive silver nanoclusters/DNA probes for microRNA detection", ACS NANO, vol. 6, no. 10, 23 October 2012 (2012-10-23), pages 8803 - 14 |
| SUN X; QIN S; FAN C; XU C; DU N; REN H: "Let-7: a regulator of the ERa signaling pathway in human breast tumors and breast cancer stem cells", ONCOL REP., vol. 29, no. 5, May 2013 (2013-05-01), pages 2079 - 87 |
| TIL DRIEHORST ET AL: "Distinct Conformations of DNA-Stabilized Fluorescent Silver Nanoclusters Revealed by Electrophoretic Mobility and Diffusivity Measurements", LANGMUIR, vol. 27, no. 14, 19 July 2011 (2011-07-19), pages 8923 - 8933, XP055148495, ISSN: 0743-7463, DOI: 10.1021/la200837z * |
| WANG Y; LI J; TONG L; ZHANG J; ZHAI A; XU K; WEI L; CHU M: "The Prognostic Value of miR-21 and miR-155 in Non-small-cell Lung Cancer: A Meta-analysis", JPN J CLIN ONCOL., 30 June 2013 (2013-06-30) |
| WEIWEI GUO ET AL: "Highly Sequence-Dependent Formation of Fluorescent Silver Nanoclusters in Hybridized DNA Duplexes for Single Nucleotide Mutation Identification", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, vol. 132, no. 3, 27 January 2010 (2010-01-27), pages 932 - 934, XP055148449, ISSN: 0002-7863, DOI: 10.1021/ja907075s * |
| YANG SW; VOSCH T: "Rapid detection of microRNA by a silver nanocluster DNA probe", ANAL CHEM., vol. 83, no. 18, 15 September 2011 (2011-09-15), pages 6935 - 9 |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107037218A (en) * | 2017-05-04 | 2017-08-11 | 中南大学 | A kind of memebrane protein detection preparation, non-marked tumour nano-probe and application method |
| CN110330512A (en) * | 2019-07-30 | 2019-10-15 | 山东大学 | A kind of ag nano-cluster fluorescence nano stick and preparation method thereof and the application in white light LEDs |
| CN110330512B (en) * | 2019-07-30 | 2021-05-14 | 山东大学 | A kind of silver nanocluster fluorescent nanorod and its preparation method and application in white light LED |
| CN111351944A (en) * | 2020-03-17 | 2020-06-30 | 江苏省原子医学研究所 | Fluorescent biological probe and sensor for detecting mucin 1, application and detection method |
| CN111351944B (en) * | 2020-03-17 | 2023-04-14 | 江苏省原子医学研究所 | Fluorescent biological probe and sensor for detecting mucin 1, application and detection method |
| WO2022031154A1 (en) | 2020-08-05 | 2022-02-10 | Grīnbergs Kaspars | A system for indoor microclimate control and a method for control thereof |
| CN112143779A (en) * | 2020-10-10 | 2020-12-29 | 天津中医药大学 | Multiple microRNA detection method of silver nanocluster based on entropy-driven amplification system as template |
| CN112143779B (en) * | 2020-10-10 | 2023-09-26 | 天津中医药大学 | Multi-microRNA detection method of silver nanoclusters based on entropy driving amplification system as template |
| CN112210588A (en) * | 2020-10-15 | 2021-01-12 | 江苏省原子医学研究所 | Dual-signal amplification probe, sensor, detection method and application |
| CN112210588B (en) * | 2020-10-15 | 2023-06-09 | 江苏省原子医学研究所 | Dual signal amplification probe, sensor, detection method and application |
| CN114934099A (en) * | 2022-06-07 | 2022-08-23 | 中国人民解放军陆军军医大学第一附属医院 | DNAzyme allosteric regulation-based DNA tetrahedral nano machine, miRNA detection method and application |
| EP4311861A1 (en) * | 2022-07-27 | 2024-01-31 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Dna-stabilized metal cluster-based nucleic acid-sensor |
| CN116200492A (en) * | 2022-11-08 | 2023-06-02 | 浙江大学 | Small nucleic acid detection kit based on probe anchored double chains and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2015007293A1 (en) | Stem-loop silver nanocluster probes for mirna detection | |
| Cheng et al. | Recent advances in microRNA detection | |
| Wang et al. | A copper-free and enzyme-free click chemistry-mediated single quantum dot nanosensor for accurate detection of microRNAs in cancer cells and tissues | |
| Li et al. | MicroRNAs as novel biological targets for detection and regulation | |
| Lin et al. | Luminescence switch-on detection of protein tyrosine kinase-7 using a G-quadruplex-selective probe | |
| Zhao et al. | Simple and sensitive quantification of microRNAs via PS@ Au microspheres-based DNA probes and DSN-assisted signal amplification platform | |
| Ma et al. | Sensitive detection of microRNAs by duplex specific nuclease-assisted target recycling and pyrene excimer switching | |
| Zeng et al. | A quantum dot-based microRNA nanosensor for point mutation assays | |
| Ma et al. | An oligonucleotide-based label-free luminescent switch-on probe for RNA detection utilizing a G-quadruplex-selective iridium (III) complex | |
| Yang et al. | Branched DNA junction-enhanced isothermal circular strand displacement polymerization for intracellular imaging of microRNAs | |
| Xue et al. | Stimuli-responsive autonomous-motion molecular machine for sensitive simultaneous fluorescence imaging of intracellular microRNAs | |
| Wijesinghe et al. | Single-molecule sensor for high-confidence detection of miRNA | |
| Xu et al. | Cascade DNA nanomachine and exponential amplification biosensing | |
| Kang et al. | Ultra‐Specific Zeptomole MicroRNA Detection by Plasmonic Nanowire Interstice Sensor with Bi‐Temperature Hybridization | |
| CN114196733B (en) | Telomere G quadruplex DNA and thioflavin T mediated fluorescence biosensor and application thereof in lncRNA detection | |
| Jiang et al. | Target-triggered assembly of functional G-quadruplex DNAzyme nanowires for sensitive detection of miRNA in lung tissues | |
| Wei et al. | Target-initiated cascade signal amplification lights up a G-Quadruplex for a label-free detection of circular ribonucleic acids | |
| Fang et al. | A novel fluorescent enhancing platform based on DNA-scaffolded silver nanoclusters for potential inflammatory bowel disease-associated microRNA detection | |
| Zhang et al. | Dual-signal amplification strategy based on catalytic hairpin assembly and APE1-assisted amplification for high-contrast miRNA imaging in living cells | |
| WO2015007294A1 (en) | Chimera silver nanocluster probes for mirna detection | |
| Liu et al. | Hairpin/DNA ring ternary probes for highly sensitive detection and selective discrimination of microRNA among family members | |
| Wei et al. | RCA-mediated tandem assembly of DNA molecular probes on lipid particles surface for efficient detection and imaging of intracellular miRNA | |
| CN111518874A (en) | A Raman-enhanced substrate and its preparation method and method for detecting miRNA | |
| Xu et al. | Intelligent DNA machine for the ultrasensitive colorimetric detection of nucleic acids | |
| Huang et al. | Dual nucleases-assisted cyclic amplification using polydopamine nanospheres-based biosensors for one-pot detection of microRNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14750435 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14750435 Country of ref document: EP Kind code of ref document: A1 |