WO2015003136A1 - Expression profiling reveals cathepsins involved in secretory vesicle maturation in tetrahymena thermophila - Google Patents
Expression profiling reveals cathepsins involved in secretory vesicle maturation in tetrahymena thermophila Download PDFInfo
- Publication number
- WO2015003136A1 WO2015003136A1 PCT/US2014/045414 US2014045414W WO2015003136A1 WO 2015003136 A1 WO2015003136 A1 WO 2015003136A1 US 2014045414 W US2014045414 W US 2014045414W WO 2015003136 A1 WO2015003136 A1 WO 2015003136A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- ciliate
- protein
- cth3
- tetrahymena
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
Definitions
- the present invention relates generally to the field of genetics and molecular biology. More particularly, it concerns methods for targeting and stabilizing proteins in desired compartments.
- DCVs dense core vesicles
- DCVs As typified by insulin granules, the formation of DCVs depends upon a multi-step pathway. First, proinsulin and other newly synthesized polypeptides are sorted as aggregates, at the level of the trans Golgi network, into vesicles that are distinct from those bearing soluble cargo destined for rapid constitutive secretion or for lysosomes. Subsequently, a maturation process remodels the aggregates into a highly condensed assembly, creating the eponymous dense core within the vesicle lumen. At a biochemical level, maturation is an interval during which the insulin peptide is generated from proinsulin by proteolytic processing.
- Maturation also includes the withdrawal, via vesicle budding, of both mis-sorted soluble constituents as well as DCV maturation factors, such as the convertases, which can thus be recycled.
- the mature DCV must also possess membrane proteins to permit docking at exocytic sites at the plasma membrane, followed by exocytic membrane fusion in response to extracellular stimuli.
- DCVs are found in just a subset of animal tissues, and organelles resembling
- DCVs have been documented in a variety of eukaryotic lineages, though few of these have been analyzed at the molecular level. The most extensive studies have been in the Ciliates, in which DCV organelles that undergo stimulated exocytosis can function in intercellular communication, documented for predator-prey and parasite -host interactions, and in cyst formation. Studies in Tetrahymena thermophila and Paramecium tetraurelia have established that the process of DCV formation in these species is strikingly similar to the steps outlined above for insulin granule formation in mammalian pancreatic ⁇ -cells. Notably, the process in Ciliates includes a central role for proteolytic maturation of proproteins during core formation.
- a key feature of DCVs is the presence of a macroscopic core consisting of aggregated cargo molecules, which facilitates storage at high concentration.
- aggregation also plays a key role in protein sorting in a multi-step pathway beginning at the trans-Golgi network (TGN) and continuing as a maturation process during which DCV cargo is refined, in part by withdrawal of mis-sorted extraneous proteins (Arvan et al., 2002; Chanat and Huttner, 1991; Kim et al., 2006; Kuliawat and Arvan, 1992; Morvan and Tooze, 2008; Tooze and Huttner, 1990).
- TGN trans-Golgi network
- a method of stabilizing a protein of interest in the mucocysts of a genetically altered ciliate wherein the ciliate lacks detectable expression (or has reduced expression) of one or more CTH or CAR gene product.
- the ciliate may be transformed with a polynucleotide comprising a sequence complementary to a gene corresponding to CTHl, CTH2, CTH3, CTH4, or CARl .
- the ciliate may lack detectable expression of a polypeptide or a RNA corresponding to CTHl, CTH2, CTH3, CTH4, and/or CARl .
- the ciliate lacks detectable expression of 2, 3 or 4 of the CTHl, CTH2, CTH3, CTH4, or CARl genes.
- a ciliate of the embodiments may lack detectable expression (or have reduced expression) of CTHl and CTH2; CTHl and CTH2; CTHl and CTH4; CTHl and CTH4; CTHl and CARl; CTH2 and CTH3; CTH2 and CTH4; CTH2 and CARl; CTH3 and CTH4; CTH3 and CTH4; CTH3 and CARl ; CTH4 and CARl; CTHl, CTH2, and CTH3; CTHl, CTH3, and CTH4; CTHl, CTH4, and CARl; CTHl, CTH3, and CARl; CTH2, CTH3, and CTH4; CTH2, CTH4, and CARl; CTH3, CTH4, and CARl; CTHl, CTH2, CTH3, and CTH4; CTH2,
- the gene corresponds to CARl .
- the stabilized protein of interest is not subject to cleavage by CAR proteases.
- the gene corresponds to CTHl, CTH2, CTH3, or CTH4.
- the stabilized protein of interest is not subject to cleavage by CTH proteases.
- the stabilized protein of interest is not subject to cleavage by CAR proteases or CTH proteases.
- the SOR gene product may be a product corresponding to SOR1 (SEQ ID NO: 1, 2), SOR2 (SEQ ID NO: 3, 4), SOR3 (SEQ ID NO: 5, 6) and/or SOR4 (SEQ ID NO: 7, 8; indicating the protein and nucleic acid coding sequence respectively).
- the ciliate may lack detectable expression of a SOR polypeptide or a SOR RNA corresponding to SOR1, SOR2, SOR3 and/or SOR4. In a further aspect, the ciliate lacks detectable expression of 2, 3 or 4 of the SOR1 , SOR2, SOR3, or SOR4 genes.
- a ciliate of the embodiments may lack detectable expression (or have reduced expression) of SOR1 and SOR2; SOR1 and SOR3; SOR1 and SOR4; SOR2 and SOR3; SOR2 and SOR4; SOR3 and SOR4; SOR1 , SOR2 and SOR3; SOR1 , SOR2 and SOR4; SOR1 , SOR3 and SOR4; SOR2, SOR3 and SOR4; or SOR1 , SOR2 SOR3 and SOR4.
- a ciliate of the embodiments comprises a genomic alteration, such as an insertion or a deletion in both copies of the germline genome that disrupts expression of one or more gene product.
- the ciliate can comprise an insertion or deletion located in the open reading frame of a gene corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4.
- a genomic insertion comprises a selectable marker, such a drug resistance marker (e.g., a gene for tetracycline or neomycin resistance).
- a ciliate of the embodiments comprises an insertion or a deletion in all macronuclear copies of a gene corresponding to SOR1 , SOR2, SOR3 and/or SOR4.
- a ciliate of the embodiments expresses a polynucleotide complementary to all or part of an RNA gene product corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4.
- the ciliate can express an antisense RNA or a double stranded RNA (dsRNA) molecule, such as a small interfering RNA (siRNA), short hairpin RNA (shRNA) or micro RNA (miRNA), complementary to all or part of an RNA gene product corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4.
- siRNA small interfering RNA
- shRNA short hairpin RNA
- miRNA micro RNA
- a ciliate of the embodiments comprises a transgenic expression cassette, such as an expression cassette encoding a polypeptide.
- the polypeptide can be a polypeptide for recombinant production in the ciliate.
- Polypeptides for use in accordance with the embodiments include, but are not limited to, enzymes, immunoglobulin (e.g., immunoglobulin light chains, immunoglobulin heavy chains or single chain antibodies), cytokines, chemokines, and antigens (e.g., bacterial or viral antigens).
- the polypeptide coding sequence can comprise a sequence for cellular trafficking, such as a mucocyst-targeting sequence.
- the polypeptide can encode a mucocyst-targeting sequence derived from a Tetrahymena Grl protein, such as Grll , Grl2, Grl3, Grl4, Grl5, Grl6, Grl7, Grl8, Grl9 or Grl 10.
- the polypeptide encodes a cleavable linker (e.g., between the polypeptide for expression and a mucocyst- targeting sequence).
- a ciliate of the embodiments is a Tetrahymena, such as a T. thermophila or T. pyriformis.
- the protein of interest is a mucocyst cargo protein.
- the protein of interest is a Grt-family protein.
- a method of producing a protein of interest comprising: (a) expressing a polynucleotide encoding the protein in a genetically altered ciliate, wherein the ciliate lacks detectable expression of one or more SOR gene product corresponding to CTHl, CTH2, CTH3, CTH4, or CARl or wherein the ciliate expresses enzymatically inactive CTHl, CTH2, CTH3, CTH4, or CARl, and (b) incubating the ciliate in a media under conditions permissible for expression of the protein, wherein the protein of interest is stabilized in the mucocysts of the transformed ciliate.
- the majority (or at least a portion) of the polypeptide is secreted from the ciliate and the method can comprise (c) purifying the expressed polypeptide from the media. In certain aspects, the majority (or at least a portion) of the polypeptide is not secreted by the ciliate and the method can comprise (c) purifying the ciliate from the media and, optionally, (d) purifying the protein from the ciliate. In still further aspects, a method of the embodiments further comprises transforming a ciliate with a polynucleotide encoding a polypeptide. Further methods for polypeptide expression in ciliates are detailed in PCT Patent Pub In. No. WO 2010/108182, the entirety of which is incorporated herein by reference.
- the ciliate does not comprise a CTHl, CTH2, CTH3, CTH4, or CARl gene. In some embodiments, the ciliate expresses enzymatically inactive CTHl, CTH2, CTH3, CTH4, or CARl .
- expressing a polynucleotide for expression in a ciliate is further defined as using an expression cassette encoding a polypeptide.
- the polypeptide can be a polypeptide of mammalian origin, such as a human polypeptide.
- the polypeptide comprises sequence encoding an enzyme, an immunoglobulin, a cytokine, a chemokine, or an antigen.
- the ciliate may overexpress (or have an increase in expression of) the processing enzymes (i.e., CTHl, CTH2, CTH3, CTH4, and/or CARl), individually or in combination. This may be done in any appropriate manner known to those of skill in the art.
- the terms “overexpress”, “overexpression”, “overexpressed”, “up-regulate”, or “up-regulated” interchangeably refer to a enzyme that is transcribed or translated at a detectably greater level in comparison to a wild type ciliate.
- the term includes overexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization, and/or RNA and protein stability, as compared to a wild type ciliate.
- Overexpression can be detected using conventional techniques for detecting mRNA (i.e., RT-PCR, PCR, hybridization) or proteins (i.e., ELISA, immunohistochemical techniques, mass spectroscopy). Overexpression can be or be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more (or any range derivable therein) in comparison to a wild type ciliate. In certain instances, overexpression is or is at least 1- fold, 2-fold, 3-fold, 4-fold 5, 6, 7, 8, 9, 10, or 15-fold or more higher levels of transcription or translation in comparison to a wild type ciliate.
- any of the methods provided herein may be performed in a large number of ciliates.
- the methods can be performed simultaneously or on a rolling basis.
- the method is performed in a plurality of ciliates.
- the method is performed in at least 100 ciliates.
- the method is performed in at least or more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 ciliates.
- FIG. 1A-1C - Expression profiling reveal a family of cathepsins involved in secretory granule maturation in Tetrahymena.
- CTHl-4 and CAR1 are co- expressed with genes (GRL1 and GRT1) encoding mucocyst contents in T. thermophila.
- the expression profiles of four Cathepsins (CTHl-4) and one Carboxpetidase (CAR1) are very similar to those of genes (GRL1 and GRT1) encoding mucocyst cargo proteins.
- Expression profiles are derived from the Tetrahymena Functional Genomics Database (available on the world wide web at tfgd.ihb.ac.cn), with each profile normalized to that gene's maximum expression level.
- Aspartic proteases TTHERM 00128320, TTHERM 00647470, TTHERM 01027660 and TTHERM 00437370
- C Diagram showing the features of Aspartic, Cysteine and Zinc Carboxypetidase proteases, including a predicted signal peptide, the catalytic triplet (DTG or DSG) of aspartic proteases, catalytic residues (C, H, N) of cysteine proteases and catalytic residue (E) of Zinc Carboxypetidase necessary for catalytic activity.
- FIG. 2A-2B Expression and localization of CFP-tagged CFP fusion proteases.
- Non specific band are marked by an asterisk (*) on the left.
- Predicated molecular weight of fusion proteases, Cthlp-CFP, Cth2p-CFP, Cth3p-CFP, Cth4p-CFP, Carlp-CFP and CthB-CFP are 79.6, 81.9, 77.8, 94, 67 and 64.8 kDa, respectively.
- FIG. 3A-3D Disruption of CTHl-5 and CAR1 through homologous recombination.
- A Schematic of the protease knockout constructs. Replacement of the CTHl-4 and CAR1 initial genie region (Table 1) with the neo4 drug resistance cassette is facilitated by homologous recombination. A detailed description of the construction and use of the CTHl-4 and CAR1 knockout constructs can be found in the Materials and methods section.
- each of the gene knockout lines lack the amplified product corresponding to the targeted gene, but shows WT levels of the other transcripts which therefore serve as loading controls.
- C To confirm amplification of equal amounts of cDNA, control RT-PCR with primers specific for SOR3 were run in parallel. Densitometric measurements were carried out using ImageJ software (available on the world wide web at rsbweb.nih.gov/ij). Data is normalized with SOR3 to determine % of knockdown of each Cathepsins and Carboxypetidase genes.
- D Cell growth is impaired in ACTH3.
- FIG. 4 Comparison of DCG secretion from wild-type and Knockout cells. Identical numbers of WT and KOs cells were resuspended, stimulated with dibucaine for 20 s, and recentrifuged to produce a pellet of cells with an overlying flocculent. The WT culture produces a two-layer pellet, in which a thick layer of flocculent (between lower and upper straight line) resulting from mucocyst discharge sits atop of the packed cells (below the lower straight line).
- FIG. 5A-5B - CTH3 is an essential for DCG formation and accumulation.
- FIG. 6A-6H Processed Grllp, Grl3p, Grl4p, and Grl8p from WT and
- KOs strains (A) Cell lysate of 5000 cells were resolved by 10% SDS-PAGE and western blotted with antibody against Grllp (a GRL family protein that undergoes processing during mucocyst maturation) and with (B) anti polyG antibody (to detect control protein tubulins). Cell lysate of 10,000 cells were separated by 4-20% SDS-PAGE and blots probed with monoclonal anti Grl3p (C), polyclonal anti Grl3p (D), polyclonal anti Grl4p (E), polyclonal anti Grl8p (F) and polyclonal anti polyG (G & H). The unprocessed and processed forms of Grl proteins are indicated by arrows.
- FIG. 7 Phylogeny separating Cathepsinsl-4 homologues. The maximum likelihood tree illustrates a phylogeny of Cathepsinsl-4 in Ciliates, Apicomplexans, Arabidopsis and Human.
- CTH1, CTH2, CTH3 (aspartic proteases) and CTH4 (cysteine protease) are Cathepsin family proteases of the T. thermophila.
- Figure Key Toxoplasma (Toxo), Plasmodium (Plas), Arabidopsis (Arab), Human (Hu), Tetrahymena thermophila (Tt), Paramecium (Para) Ichthyophthirius (Icht). See Figure 16 for (*) information and full length tree. See Table 5 and 6 for a list of accession numbers for all sequences.
- FIG. 8 Primary sequence alignment of Aspartic proteases of
- Tetrahymena with human Cysteine protease (Cathepsin B) — conserved catalytic motifs are highlighted in red. conserveed active site residues C, H, N are marked by arrow.
- GenBankTM Accession Number of Tetrahymena CTH4 is XM 001023356.
- UniProtKB/Swiss-Prot number of human cysteine protease (CTHC) is P53634.
- FIG. 10A-10F Cathepsin and Carboxypetidase family proteases are co- localized with DCG protein Grl3p— Cells were treated with ⁇ g/ml CdCl 2 for 2h to induce transgene expression. Cells were fixed and immunolabeled with mouse monoclonal antibody MAb 5E9 and rabbit anti GFP antibody. Images were captured in the green and red channels. Images shown are single slices, for clarity (A, B, and C) Cells expressing Cthlp-CFP, Cth2p- CFP, and Cth3p-CFP, respectively, each show nearly perfect co-localization of CFP and the mucocyst marker Grl3p.
- FIG. 11 Localization of CFP-tagged proteases - Shown is the localization in living immoibilized cells of a set of proteases tagged with CFP, after overnight (18h) induction of transgene expression.
- a single cell is shown in both cell surface and cross section.
- Cthlp, Cth2p, Cth3p, Cth4p, and Carlp the localization pattern indicates that the fiuorescent protein is localized to docked mucocysts.
- CthB-CFP shows no localization to mucocysts.
- FIG. 12A-12B Alcian blue assay for mucocyst discharge -
- A Cells, before and after stimulation with the secretatogue Alcian blue, were fixed, permeabilized, and immunolabeled with mAb against Grl3p, and then immediately analyzed by confocal microscopy or flow cytometry.
- A Top panel: Wildtype cells prior to stimulation display an array of docked mucocysts, but after stimulation they are surrounded by a translucent capsule of released mucocyst contents. Middle panel: An identical response is seen in Acarl cells.
- Bottom panel Acth3 cells prior to stimulation show primarily a small number of cytoplasmic puncta, and their appearance does not change after stimulation.
- FIG. 13 Processing of pro-Grllp is impaired in ACTH3 cells — Medium supernatants from WT and KO cell lines were processed for western blot as before. Blot was probed with anti Grllp antibody. The unprocessed and processed forms of Grllp proteins are indicated by arrows. Fully processed Grllp form is secreted by WT cells. Only unprocessed pro-Grllp form is seen in medium supernatant of ACTH3 cells while higher molecular weight unprocessed and processed forms of Grllp proteins are seen in culture media of ACTH4 cells.
- FIG. 14 - ACTH1, ACTH2 and ACAR1 are not involved in DCG lattice proteins processing ⁇ Wild-type (WT), ACTH1, ACTH2 and ACAR1 cultures were stimulated with dibucaine and the released mucocysts were purified by several rounds of pelleting and resuspension, as described in Materials and Methods section. The final pellets were suspended in SDS sample buffer and samples were resolved by 4-20% SDS-PAGE. Protein bands were visualized by Coomassie blue staining.
- FIG. 15A-15E - Rescue experiment ⁇ Expression of Cth3p-CFP in ACTH3 cells. Cells were treated with ⁇ g/ml CdCl 2 for 16h unless otherwise indicated.
- ACTH3 cells expressing wild type Cth3p-CFP (Re-WT) were treated with ⁇ g/ml CdCl 2 for 2h (A) or 16h (B).
- Cell lysate of 20,000 were separated by 4-20% SDS-PAGE and blot probed with monoclonal anti GFP antibody.
- C After induction, cells were fixed and immunolabeled with rabbit anti GFP antibody or
- D MAb 5E9 antibody.
- E Western blot samples were prepared from WT and ACTH3 cells (expressing wild type Cth3p-CFP) after CdCl 2 induction. Cell lysate of 10000 were separated by SDS-PAGE and blot was probed with anti Grllp antibody as before.
- FIG. 16 - A maximum likelihood phylogeny of the Ciliate CTHl-4 shown in Figure 8, together with the most highly related homo logs (a judged by BLAST scores) present in a variety of organisms from the other major eukaryotic lineages.
- FIG. 17 Expansion of the Carboxypetidase family in Ciliates — A maximum likelihood tree illustrates a phylogeny of Carboxypetidase in Ciliates.
- FIG. 18A-18C Expression profiling suggests a role for sortilin-family receptors in mucocyst biogenesis in Tetrahymena.
- Sortilins and AP-3 subunits are coexpressed with genes encoding mucocyst contents in T. thermophila.
- the expression profiles of the four Tetrahymena sortilins (SOR1-4), and of two subunits of the heterotetrameric AP-3 adaptor complex, are similar to those of genes (GRL1 and GRT1) encoding mucocyst cargo proteins.
- Expression profiles are derived from the Tetrahymena Functional Genomics Database (available on the world wide web at tfgd.ihb.ac.cn), with each profile normalized to that gene's maximum expression level. Points on the x-axis correspond to successive time -points and represent growing, starved, and mating cultures, including 3 different culture densities (low (LI), medium (Lm), and high (Lh)), 7 samples taken during 24 hours of starvation, and 10 samples subsequently taken during 18 hours following conjugation. (B) Expansion of the sortilin family in Ciliates.
- the maximum likelihood tree illustrates a phylogeny of VPS 10 domain-containing receptors (sortilins) in Alveolates, the taxonomic group consisting of Ciliates, Apicomplexans, and dino flagellates.
- sortilins VPS 10 domain-containing receptors
- Two of the T. thermophila sortilins marked by black circles, cluster with the sortilins from other Alveolates.
- T. thermophila SOR2 and SOR4 marked by maroon diamonds, belong to an expansion of sortilins restricted to Ciliates.
- C Verification of the non-essential sortilin knockouts.
- cDNA was prepared from WT, Asorl, Asor2, and Asor4 cells, and the SOR1, SOR2 and SOR4 sequences were PCR amplified using gene-specific primers. As shown in this 1% ethidium bromide stained agarose gel, each of the gene knockout lines lacks the amplified product corresponding to the targeted gene, but shows WT levels of the other transcripts that serve as loading controls. The lanes shown were all part of a single gel, but their order has been rearranged for this figure.
- FIG. 19A-19E Sortilin 4 is required for the sorting of Grtlp, a member of the Granule tip family of mucocyst cargo proteins.
- Grtlp localizes to a subdomain of mucocysts, while Grl3p is found through the mucocyst core.
- Grl3p and Grtlp in WT cells were simultaneously visualized using mAbs (5E9 and 4D11, respectively) directly conjugated to two different fluorophores.
- Grtlp is mis-targeted in Asor4 cells. Immuno localization of Grtlp in WT cells (top, left) shows that Grtlp accumulates in the expected array of docked mucocysts at the surface (illustrated by the red plane in the cartoon at the top), and the same pattern is seen in Asor2 cells (top, right). Grtlp was visualized using mAb 4D11.
- Sor4p was immunoprecipitated using anti-GFP antiserum from lysates of cells that express Sor4p- GFP from the endogenous SOR4 locus, and that were actively synthesizing new mucocysts. Immunoprecipitated samples were analyzed by Western blotting with anti-GFP antiserum (left), confirming that full-length Sor4p-GFP is expressed, and with anti-Grtlp antiserum (right) to show co-precipitation of Sor4p. (E) Sor4p-GFP localizes to mobile cytoplasmic vesicles but not to docked mucocysts.
- Sor4p-GFP was tracked in immobilized live cells. Sor4p-GFP is present in mobile cytoplasmic puncta and not present in docked mucocysts. The grey line traces the approximate outline of the cell.
- FIG. 20A-20C Asor4 cells are defective in regulated exocytosis and in sorting of a 2nd Grt family protein.
- A A qualitative assay for mucocyst discharge. Individual Tetrahymena cells, fixed and photographed after treatment with the secretagogue Alcian blue. The wildtype cell (left) is surrounded by a translucent capsule made up of the released contents of exocytosed mucocysts. In contrast, Asor4 cells (right) never form visible capsules following stimulation. Images are DIC micrographs.
- B A semi-quantitative assay for mucocyst discharge. Identical numbers of WT and Asor4 cells were stimulated with dibucaine, and immediately centrifuged.
- the wildtype culture produces a two-layer pellet, in which a thick layer of flocculent (below the dashed line) resulting from mucocyst discharge sits atop of the packed cells (below the dotted line).
- Stimulated Asor4 cultures in contrast, produce no flocculent layer.
- Stimulated Asorl cultures generate an intermediate amount of the mucocyst-derived flocculent.
- Asor4 cells show defective sorting to mucocysts of a 2nd Grt family protein, Igrlp.
- Igrlp-GFP expressed from an inducible promoter, accumulates in docked mucocysts in WT cells (left), but is absent from the periphery of Asor4, instead found in small highly mobile cytoplasmic puncta. Images are of GFP auto fluorescence in live, immobilized cells.
- FIG. 21A-21D Grl protein sorting to mucocysts, though not subsequent proteolytic processing, is independent of SOR4.
- A-B Grl3p localizes to mature mucocysts in the absence of Sor4p. Localization of Grl3p, one of a family of proteins that assembles to form the mucocyst core, in WT, Asor2, and Asor4 cells. Grl3p was visualized by indirect IF using mAb 5E9.
- FIG. 22A-22B Cth3p, an aspartyl protease, is targeted to mucocysts in a
- Cth3p-CFP was inducibly expressed with 0.75 ⁇ g/mL CdC12 for 2 hrs in WT and Asor4 cells.
- Cth3p-CFP was localized in fixed, permeabilized cells using a polyclonal anti-GFP antibody, and endogenous Grl3p was immunolocalized using mAb 5E9.
- (A) Cth3p-CFP expressed in WT cells colocalizes with Grl3p in mucocysts at the cell periphery (top panel).
- Cth3p-CFP expressed in Asor4 cells shows reduced co- localization with Grl3p (middle panel).
- Cth3p-CFP shows reduced co- localization with Grl3p in Asor4 vs. WT cells. Co-localization was quantified in 15 WT and Asor4 cells, using the Manders' correlation coefficient M2, and then an average M2 value for each population was determined from the sample.
- FIG. 23A-23B Generation of the sortilin knockouts.
- A Schematic of the SOR4 knockout construct. Replacement of the entire SOR4 genomic locus with the neo4 drug resistance cassette is facilitated by homologous recombination. An identical strategy was used for the remaining sortilins. A detailed description of the construction and use of the SORI-4 knockout constructs can be found in the Experimental Procedures.
- B Knockout of non-essential sortilins does not impair cell growth. A table of the average doubling times calculated from five measurements of culture density (3 measurements for Asorl), each after 3 hour periods of growth, indicating similar growth rates for the WT and mutant lines.
- FIG. 24 The Tetrahymena sortilins fall into two major groups. A maximum likelihood phylogeny of the Ciliate VPS 10 domains shown in Figure 1A, together with the most highly related homologs (as judged by BLAST scores) present in a variety of organisms from the other major eukaryotic lineages. VPS 10 domain-containing genes appear to have been entirely lost in numerous organisms including Arabidopsis thaliana and Drosophila melanogaster. In some Fungi, VPS 10 domains are present as tandem repeats, depicted as hi and h2.
- Aspergillus nidulans (An), Coccomyxa subellipsoidea (Cs), Daphnia pulex (Dap), Dictyostelium discoideum (Dd), Dictyostelium fasciculatum (Df), Dictyostelium purpureum (Dp), Homo sapiens (Hs), Ichthyophthirius multifiliis (Im), Micromonas pusilla (Mp), Micromonas sp.
- RCC299 Mus musculus (Mm), Naegleria gruberi (Ng), Naumovozyma castellii (Nac), Ostreococcus lucimarinus (01), Ostreococcus tauri (Ot), Paracoccidioides brasiliensis (Pab), Paramecium tetraurelia (Pt), Polysphondylium pallidum (Pp), Punctularia strigosozonata (Ps), Saccharomyces cerevisiae (Sc), Tetrahymena thermophile (Tt), Trichoplax adhaerens (Tra), Xenopus (Silurana) tropicalis (Xt), Yarrowia lipolytica (Yl). See also Table 9 for a list of accession numbers for the sequences used to assemble this phylogeny.
- FIG. 25A-25D ⁇ Asorl is not essential for mucocyst formation and secretion.
- A As in FIG 20B, a semi-quantitative assay for mucocyst discharge. Identical numbers of WT and Asorl cells were stimulated with the secretagogue dibucaine, and immediately centrifuged. The wildtype culture produces a two-layer pellet, in which a thick layer of flocculent (below the dashed line) resulting from mucocyst discharge sits atop of the packed cells (below the dotted line). Similar to the wildtype, stimulated Asorl cultures still produce a prominent flocculent layer.
- FIG. 26 The addition of a C-terminal GFP tag to endogenous Sor4p does not impair Sor4p function, as judged by mucocyst secretion.
- Fig. 20B identical numbers of WT and SOR4-GFV cells were stimulated with dibucaine and immediately centrifuged. A two-layer pellet was observed for both samples, consisting of an upper flocculent layer (below the dashed line) and lower cell pellet (below the dotted line).
- FIG 27 Sorting efficiency of the exogenously expressed mucocyst protease Cth3p-CFP is reduced in Asor4 cells.
- Cth3p-CFP was inducibly expressed with 0.75 ⁇ g/mL CdC12 for 2 hours.
- Cth3p-CFP was localized in fixed, permeabilized cells using a polyclonal anti-GFP antibody, and endogenous GrBp was immunolocalized using mAb 5E9.
- Co-localization was quantified in 15 Asor4 cells, using the Manders' correlation coefficient M2, and then an average M2 value was determined for the population from this sample.
- the average M2 value at the cell periphery for the population is 0.373 with a SEM of 0.054.
- FIG. 28 Analysis of the Tetrahymena genome indicates that it codes four sortilin/VpslO genes. Diagram shows the homology between the four sortilin genes (Tt SOR1-4) and structurally related genes. [0053] FIG. 29A-29H. Mucocyst formation, proGRL processing, and in vitro enzymatic activity require the conserved active site residues in Cth3p.
- A Schematic representation of wildtype and mutant Cth3p, both with C-terminal GFP tags, showing locations of mutations to change Asp ⁇ Asn at the two predicted catalytic sites.
- B Expression of GFP-tagged and Asp ⁇ Asn, GFP-tagged constructs (cth3-4 and cth3-5, respectively).
- Constructs were expressed at the native CTH3 locus, as gene replacements. Fusion proteins were immunoprecipitated from detergent lysates using polyclonal rabbit anti- GFP antiserum. Immunoprecipitates were subjected to SDS-PAGE, and PVDF transfers blotted with monoclonal anti-GFP Ab. Both of the transformed cell lines, but not wildtype, show immunoreactive bands of the size expected for the Cth3p-GFP fusion, as well as a band likely to correspond to monomeric GFP. (C) proGrl processing in wildtype and mutant cell lines. Cell lysates (10 4 cell equivalents) were separated by SDS-PAGE and blotted with anti- Grllp antibody.
- Wildtype and cth3-4 cells accumulate processed Grllp. In contrast, Acth3 cells and cth3-5 cells accumulate proGrllp.
- D The mucocyst discharge assay was performed on cell lines analyzed in panel C. Wildtype cells and cells expressing cth3-4p release a flocculent layer (between the solid and broken lines) after stimulation with secretagogue, while Acth3 cells and cells expressing cth3-5p show no release upon stimulation.
- E and F Immunostaining of fixed cells to visualize mucocyst protein Grl3p and GFP-fusion proteins.
- wildtype cells and cells expressing cth3-4p show the expected pattern of Grl3p in docked mucocysts, while cells expressing cth3-5p show chiefly cytoplasmic puncta.
- wildtype cells show background signal, while cells expressing cth3-4p show labeling consistent with extensive localization of the GFP-fusion protease to mucocysts.
- cth3-5p localizes largely in cytoplasmic puncta.
- the scale bars represent 10 ⁇ . Enzymatic activity of purified Cth3p.
- G 150 ml cell cultures of T.
- thermophila expressing cth3-4p or cth3-5p (3xl0 5 /ml) were washed and solubilized with detergent, and GFP-tagged fusion proteins were immunoprecipitated using bead-coupled polyclonal rabbit anti-GFP antiserum. After extensive washing, beads were resuspended in assay buffer. To roughly compensate for the difference in IP yields between cth3-4p and cth3-5p, the bead volume used for the former was half that used for that latter (10 vs 20 ⁇ ) in a total reaction volume of 100 ⁇ . The results are plotted as RFU ⁇ SD versus time.
- Bovine cathepsin D (10 ng) was assayed in parallel, as a positive control (inset).
- H SDS-PAGE and Western blotting, using anti-GFP mAb, of IP preparations (10 ⁇ cth3-4p and 20 ⁇ cth3-5p beads) assayed in panel G. [0054]
- FIG. 30A-30B Localization and secretion of wild type and enzymatically disabled Cth3p-GFP.
- A High density cultures of cells were washed twice with lOmM Tris (pH 7.4) and starved for 4h in lOmM Tris (pH 7.4).
- GFP- tagged wild type Cth3p (cth3-4p), but not the tagged enzymatically disabled variant (cth3- 5p), is secreted into the culture medium.
- FIG. 31A-31D Expression of enzymatically disabled cth3p-CFP (cth3-3p) does not rescue ⁇ cth3 defects.
- A Schematic representation of wildtype Cth3p and cth3-3p variant, which has Asp ⁇ Asn mutations at the two predicted catalytic sites and a C-terminal CFP tag.
- B cth3-3p was expressed under the control of the MTT1 promoter in Acth3 cells. Expression was induced with ⁇ g/ml CdC12 for 2h and lysates (2xl0 4 cell equivalents/lane) were separated by 4-20% SDS-PAGE and Western blotted with monoclonal anti GFP antibody.
- FIG. 32A-32C Non-mucocyst-localized Cth3p shows some overlap with endosomal and lysosomal markers.
- cth3p-GFP cth3-4p
- GFP autofluorescence was imaged in live cells.
- Optical sections shown are cell cross sections.
- FIG. 33A-33C The growth defect in Acth3 cells is suppressed by culturing in medium conditioned by wildtype cells and cells overexpressing cth3p-CFP.
- Wildtype and Acth3 cells were inoculated into medium previously harboring either wildtype or Acth3 cultures.
- the final culture density is shown for each condition. The lowest cell concentration is seen for ActhS cells in Acth3 conditioned medium, but this is significantly increased when Acth3 cells are grown in wildtype conditioned medium. Wildtype cells show a slight but significant decrease in final density when cultured in ActhS conditioned medium. The same differences in growth rates between cultures were also seen at intermediate culture densities, based on the measurements taken during culture growth (not shown).
- Acth3 cells were similarly inoculated, but also into a series of mixtures of WT and Acth3 conditioned media, at the ratios shown. Final culture densities are shown for each condition. The results are qualitatively similar to those in (A). The results also suggest that the rescuing factor(s) in WT conditioned medium act in a concentration-dependent fashion, since growth rescue of Acth3 cells is lessened when WT conditioned medium is diluted with Acth3 conditioned medium.
- Acth3 cells were inoculated into media previously harboring either wildtype, Acth3, or cells overexpressing cth3p-CFP (cth3-lp).
- FIGS. 34A-34E Expression of cth3p-6xHis rescues proGrl processing and mucocyst formation in the SB281 mutant.
- A,B Induced expression of cth3p-6xHis in SB281 cells.
- cth3p-6xHis was expressed under the control of the MTT1 promoter, and cultures were induced for 6h by adding CdC12 at the concentrations shown.
- Cell lysates (3x104 cell equivalents/lane) were separated by SDS-PAGE and Western blots were probed with anti-Grllp antibody (A) or anti-Grl3p antibody (B).
- these preproproteins are cleaved by signal peptidase in the ER (endoplasmic reticulum), but the location of the remaining maturation, or proprotein processing, varies both temporally and physically. (Burgess and Kelly, 1987; Tooze, 1991).
- the granule cores consist of highly organized protein crystals that undergo spring-like expansion upon exocytosis (Sperling et al, 1987). This expansion can drive rapid extrusion of the DCG contents, which may be essential for hunting or defensive behaviors (Harumoto and Miyake, 1991).
- GRL granule lattice
- tmp trichocyst matrix
- the animal and ciliate DCVs have few identified molecular components but share a striking number of biochemical and cell biological features (Turkewitz, 2004). Like many DCV proteins in animals, the most abundant ciliate DCV cargo proteins undergo self- aggregation that is important for their sorting both at the TGN and during maturation; the latter, as in animal DCVs, depends on proteolytic processing of cargo proproteins (Adoutte, 1988; Collins and Wilhelm, 1981; Turkewitz, 2004).
- proteins in the Grl (Granule /attice) family form obligate heterooligomers in the endoplasmic reticulum (Cowan et al., 2005) and then much larger aggregates while en route through the secretory pathway (Rahaman et al., 2009).
- the aggregates are then reorganized during DCV maturation to form a crystalline dense core, a process involving extensive proteolytic processing of core proteins (Cowan et al, 2005; Verbsky and Turkewitz, 1998).
- the embodiments may be practiced with a variety of different ciliates which include secretory granules called mucocysts.
- Heterologous polypeptides can be targeted to these secretory granules by encoding fusion proteins of the desired heterologous polypeptide and an appropriate targeting sequence.
- the heterologous polypeptide After exposing the ciliate to a secretory stimulus that causes the mucocysts to discharge their contents to the extracellular environment, the heterologous polypeptide can be recovered from the resulting matrix and medium.
- the mucocyst cargo proteins belongs to two multigene families, called GRL (for granule lattice) and GRT (for granule tip).
- the GRL proteins constitute the dense core, and undergo extensive proteolytic processing during mucocyst maturation.
- the free-living ciliate protists are a large and diverse phylum (Ciliata) whose members display a structural and functional complexity comparable to that of higher metazoa (Fankel (2000); Turkewitz et al. (2002)), and include over 7,000 species with 11 major subdivisions. Tetrahymenids and Paramecium belong to the Oligohymenophoreans. Ciliates that include mucocysts useful in the invention include Tetrahymena species such as Tetrahymena thermophila and Tetrahymena pyriformis. Paramecium has dense core granules but does not secrete a proteinaceous gel. Both Tetrahymena thermophila and Tetrahymena pyriformis produce mucocysts, and both secrete a proteinaceous gel.
- Tetrahymena spp. are amenable to genetic manipulation, can be grown on a large scale and have a doubling time of 1.5-3 hrs. Unlike T. thermophila, which has an optimal growth temperature of 35°C, the optimal growth temperature for T. pyriformis is lower (maximal growth temperature of 34°C). Cells reach high-density in a short time on a variety of inexpensive media and can be expanded for growth in bioreactors up to several thousand liters in size (Hellenbroich et al. (1999); de Coninck et al. (2000)).
- Tetrahymena spp. devote a large part of their metabolism to membrane protein production due to the hundreds of cilia that extend from its surface (Williams et al. (1980)). Additionally, Tetrahymena spp. lack a cell wall and display high-mannose N-glycan protein modifications that lack branched, immunogenic structures (Taniguchi et al. (1985); Becker and Rusing (2003); Weide et al. (2006)). Glycosylation patterns of secreted proteins in Tetrahymena spp. are uniform and consist of high-mannose N-glycan structures comprising Man3GlycNac2 core N-glycans similar to those which are produced in the endoplasmic reticulum of mammalian cells.
- This glycosylation pattern is unlike the glycosylation pattern produced in other microbial systems. For example, such glycosylation is non-existent in bacteria, and is highly branched and immunogenic in fungi. II. Genetic Alteration of Ciliates
- ciliates can be transformed with vectors that express nucleic acid to disrupt expression of a SOR gene (such as siRNAs).
- a SOR gene such as siRNAs
- the ciliates is transformed with a vector to disrupt an endogenous SOR gene (e.g., by generating an insertion of deletion in a genomic copy of the gene).
- a ciliate can be transformed with a vector for the expression of heterologous polypeptides, such as peptides that will be harvested from the cells.
- Certain aspects of the embodiments concern ciliates that lack detectable expression (or have reduced expression) of one or more SOR gene product corresponding to SOR1, SOR2, SOR3 or SOR4.
- the SOR gene product is an RNA at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SOR1 (SEQ ID NO: 2), SOR2 (SEQ ID NO: 4), SOR3 (SEQ ID NO: 6) or SOR4 (SEQ ID NO: 8).
- the SOR gene product is an polypeptide at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SOR1 (SEQ ID NO: 1), SOR2 (SEQ ID NO: 3), SOR3 (SEQ ID NO: 5) or SOR4 (SEQ ID NO: 7).
- the SOR gene product is an polypeptide comprising at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 or 900,
- the gene product corresponding to SORl, SOR2, SOR3 or SOR4 is one of the gene products listed in the NCBI accession numbers of FIG. 28, each of which is incorporated herein by reference.
- a ciliate of the embodiments comprises an insertion or a deletion in such a gene corresponding to Tetrahymena SORl, SOR2, SOR3 and/or SOR4.
- a ciliate can comprise an expression cassette encoding a polynucleotide (e.g., a dsRNA, siRNA, shRNA or miRNA) complementary to all or part of an RNA corresponding to a Tetrahymena SORl, SOR2, SOR3 and/or SOR4 RNA.
- a polynucleotide e.g., a dsRNA, siRNA, shRNA or miRNA
- Certain aspects of the embodiments concern ciliates that lack detectable expression (or have reduced expression) of one or more gene products corresponding to CTH1, CTH2, CTH3, CTH4, or CARL
- the gene product is an RNA at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of CTH1, CTH2, CTH3, CTH4, or CAR1 as listed in the Table below.
- the gene product is an polypeptide at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of CTH1, CTH2, CTH3, CTH4, or CAR1 as listed in the Table below.
- the SOR gene product is an polypeptide comprising at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 or 900 (
- a ciliate of the embodiments comprises an insertion or a deletion in such a gene corresponding to Tetrahymena CTH1, CTH2, CTH3, CTH4, and/or CARl .
- a ciliate can comprise an expression cassette encoding a polynucleotide (e.g., a dsRNA, siRNA, shRNA or miRNA) complementary to all or part of an RNA corresponding to a Tetrahymena CTH1 , CTH2, CTH3, CTH4, and/or CARl RNA.
- a polynucleotide e.g., a dsRNA, siRNA, shRNA or miRNA
- Genes can be introduced into ciliates using established protocols or any method known to one skilled in the art. Transformation of ciliates can be achieved by microinjection (Tondravi and Yao (1986)), electroporation (Gaertig and Gorovsky (1992)), or biolistically (Cassidy-Hanley et al. (1997)).
- ciliate cells can be transformed with a chimeric gene by particle bombardment (also known as biolistic transformation) (Cassidy-Hanley et al. (1997)).
- Particle bombardment transformation can be achieved by several ways. For example, inert or biologically active particles can be propelled at cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof.
- the vector can be introduced into the cell by coating the particles with the vector containing the chimeric gene.
- the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle.
- Other variations of particle bombardment now known or hereafter developed, can also be used.
- Microcarrier bombardment can also be used to transform ciliate cells by means of DNA-loaded gold particles (US Pat. No. 6,087,124; European Pat. EP 847 444; WO 1998/001572).
- DNA-loaded gold particles US Pat. No. 6,087,124; European Pat. EP 847 444; WO 1998/001572.
- microcarrier bombardment with DNA-coated gold is used as a means of introducing foreign genes into ciliates.
- microcarrier bombardment can be used to transform ciliates and introduce genes into the (germline) micronucleus
- the vector can further comprise a selectable cassette marker to permit selection for transformed cells ⁇ e.g., a neo 2 cassette) (Gaertig et al. (1994)).
- Selection of transformants can be achieved by growing the cultured ciliates in a medium which allows only the transformants to survive. Suitable selection agents include antibiotics which will kill most all non-transformants but allow transformants (which also possess an antibiotic resistance gene) to survive.
- antibiotics which will kill most all non-transformants but allow transformants (which also possess an antibiotic resistance gene) to survive.
- a number of antibiotic-resistance markers are known in the art. Any known antibiotic-resistance marker can be used to transform and select transformed host cells in accordance with the present invention.
- selection of the transformants can be performed by means of a resistance marker such as a point mutation in the 17s rDNA, which confers resistance to paromomycin, can allow for selection of rDNA transformants (Spangler and Blackburn (1985); Bruns et al. (1985)).
- Other methods include the use of a mutant cell line that allows targeting of genes to the beta tubulin- 1 locus of T. thermophila by homologous recombination, and allows efficient selection of transformed cell lines by growth in the microtubule-stabilizing agent (taxol) (U.S. Pat. No. 6,846,481).
- Another method for selection of transformed cells harboring foreign genes is to insert full length coding regions into the pD5HA vector (Cowan et al. (2005)). In this method, transcription is driven by the inducible MTTl promoter. Once cells have been transformed with the pD5HA vector selection of positive transformants is determined by paromomycin resistance (i.e., cell growth in media containing the drug). Presence of the transgene is then verified by PCR and then induced with cadmium chloride to over-express the recombinant gene product.
- selectable marker genes that confer resistance or tolerance to a normally toxic selection agent allow only successfully transfected cells to survive in the presence of the selection agent, and are referred to as positive selectable markers.
- positive selectable marker genes and their corresponding selection agents are: aminoglycoside phosphotransferase (APH) and G418; dihydro folate reductase (DHFR) and methotrexate (Mtx); hygromycin-B- phosphotransferase (HPH) and hygromycin-B; xanthine-guanine phosphoribosyltransferase (XGPRT) and mycophenolic acid; and adenosine deaminase (ADA) and 9-P-D-xylofuranosyl adenine (Xyl-A).
- APH aminoglycoside phosphotransferase
- DHFR dihydro folate reductase
- Mtx methotrexate
- HPH
- thymidine kinase (TK) and aminopterin can be used in cells that are initially thymidine kinase deficient (tk ⁇ ).
- the aminopterin will normally kill tk ⁇ cells and, therefore, only successful TK transfectants will survive.
- Selectable marker genes that confer sensitivity or susceptibility to a normally nontoxic selection agent cause only successfully transfected cells to die in the presence of the selection agent, and are referred to as negative selectable markers.
- TK thymidine kinase
- gancyclovir An example of a negative selectable marker system.
- Phenotypic selectable marker genes permit selection based upon morphological or biochemical traits rather than cell death or survival. In some cases, the phenotypic marker is detectable only in the presence of an additional selection agent.
- An example of a phenotypic selectable marker system is ⁇ - galactosidase (lacZ) and X-gal.
- Heterologous nucleic acids can be introduced into the ciliate host on an expression vector that is capable of integrating into the host's genome.
- expression vectors capable of homologous recombination with a highly expressed gene that is endogenous to the protozoan host, such as a P-tubulin gene are known in the art.
- a heterologous nucleic acid transformed into a ciliate can be maintained extrachromosomally on an autonomous plasmid.
- Expression vectors useful for transforming ciliates in accordance with the methods described herein include but are not limited to replacement vectors, rDNA vectors, and rDNA-based vectors.
- Replacement vectors accomplish DNA-mediated transformation by replacing or altering endogenous genes using homologous recombination. Integration of the heterologous nucleic acid into the host's genome at the targeted site is accomplished via homologous recombination involving a double crossover event with the vector containing the heterologous nucleic acid.
- An example of an expression vector useful for genomic incorporation of a heterologous nucleic acid by replacement is one that includes a heterologous coding sequence flanked by portions of the endogenous BTUl gene of Tetrahymena thermophila.
- a replacement vector can include a 5' region, followed by a heterologous coding region, followed by a 3' region, wherein at least a portion of each of the 5' and 3' regions is complementary to 5' and 3' regions on an endogenous gene of the host, to allow for genomic integration of the heterologous coding region via homologous recombination.
- the 5' and 3' regions of the vector can also comprise regulatory elements, such as a promoter and a terminator. The necessary regulatory elements can also be supplied by the endogenous gene into which the heterologous coding region integrates. Suitable regulatory regions include, but are not limited to promoters, termination sequences, signal peptides and proprotein domains involved in the expression and secretion of proteins.
- such regulatory elements can provide efficient heterologous expression of proteins in Tetrahymena spp. under control of promoters and/or terminators which are derived from genes in Tetrahymena ssp.
- Such vectors can comprise naturally occurring promoters and/or terminators from proteins secreted at a high level in Tetrahymena ssp.
- the expression of recombinant polypeptides in Tetrahymena spp. can be driven by strong promoters, pre/pro sequences and terminators.
- the promoters and/or terminators can be selected from proteins secreted at a high level independent of the cell-cycle in Tetrahymena spp.
- Inducible promoters from Tetrahymena spp. genes have also been described that allow robust expression of foreign genes.
- heat- inducible promoters of the heat shock protein family of the ciliate Tetrahymena spp. are also suitable for use with the methods described herein.
- Suitable heat shock promoters from Tetrahymena spp. are known in the art (see WO2007/006812).
- Methods for creating mitotically stable Tetrahymena spp. trans formants for example, by integration of a heterologous gene by homologous DNA recombination, are known in the art.
- Methods for generating Tetrahymena spp. having targeted gene knockouts by homologous DNA recombination are also known in the art (Bruns and Cassidy-Hanley (2000); Hai et al. (2000); Gaertig et al. (1999); Cassidy-Hanley et al. (1997)).
- the somatic macronucleus or the generative micronucleus can be transformed in alternation.
- sterile transformants which may provide improved safety parameters, can be obtained with macronucleus transformation.
- Expression vectors can also be maintained extrachromosomally in the ciliates.
- An expression vector maintained as an extrachromosomal element can be a rDNA-based vector containing an ori from Tetrahymena spp. rDNA, which is known to support extrachromosomal replication.
- a vector can further comprise a 5' regulatory region from an endogenous Tetrahymena spp. gene containing a promoter region operably linked to the heterologous coding region and, optionally, a 3' regulatory region from the same or a different Tetrahymena spp. gene.
- regulatory regions from ciliate genes in such vectors can include, but are not limited to, regulatory regions from genes such as HHFI, rpl29, BTU1, BTU2, SerH3, and actin.
- Tetrahymena spp. can be transformed with an rDNA vector (Tondravi and Yao (1986); Yu and Blackburn (1989)).
- the shuttle vector pXS76 allows insertion of transgenes downstream of a cadmium-inducible promoter from the MTT1 metallothionein gene of T. thermophila via homologous recombination and selection in paromomycin.
- inserts can be introduced into high copy number ribosomal DNA vectors (such as pD5H8) under control of the cadmium-inducible MTT1 promoter.
- the pD5H8 vector takes advantage of a biological feature of Tetrahymena spp. in which the ribosomal cistrons become amplified to extraordinarily high copy numbers following conjugation.
- An rDNA-based vector can be a circular vector that contains a 5 ' non-translated sequence comprising two or more ori sequences from Tetrahymena spp. rDNA.
- a nucleic acid fragment containing a heterologous coding region, for example a selectable marker or transgene, can also be added to the vector.
- the vector can further comprise a 5' untranslated region of a Tetrahymena spp. gene and a 3' untranslated region of a Tetrahymena spp.
- B- and C3- strains of T. thermophila convey a replicative advantage to the C3- form in B/C3 heterozygotes.
- both B- and C3- forms of rDNA are initially present in the macronucleus in approximately equal amounts, within 30 fissions only the C3 variant remains (Pan et al. (1982); Orias et al. (1988)).
- pIC19-based shuttle vectors containing the C3 origin of replication have been used as high-copy number vectors for the delivery of foreign DNA to Tetrahymena spp. (Yu and Blackburn (1989)) ( Figure 5).
- micronuclear versions of the C3 rDNA is accurately processed (to form a palindrome) following introduction into T. thermophila B cell lines.
- the micronuclear version is maintained as a stable linear chromosome over many generations (Bruns et al. (1985)).
- Functional transgenes can be inserted into the 3'-nontranscribed spacer (3'-NTS) of such vectors with no effect on rDNA processing.
- recombinant molecules can comprise 50-100% of the total rDNA complement, with as many as 18,000 copies of the transgene per cell (Blomberg et al. (1997)).
- rDNA-based vectors in combination with the MTT1 promoter can be used to drive expression of the endogenous granule lattice protein Grl Ip to approximately 20% of total cell protein (Lin et al. (2002)).
- pD5H8 rDNA-based vectors can be used to boost expression of proteins by at least 3-10 fold compared with trans formants in which respective transgenes are integrated at somatic gene loci.
- Other vectors suitable for use with the methods described here include vectors comprising a ribosomal DNA sequence. Such vectors can replicate at high copy numbers and can be used to deliver a heterologous DNA sequence to Tetrahymena spp. for purposes of RNA expression.
- Suitable heterologous polypeptides for use with these methods include, but are not limited to, antibodies, antibody fragments, cytokines, growth factors, protein kinases, proteases, protein hormones or any fragment thereof.
- the methods described herein are suitable for the production of specialty proteins.
- specialty proteins can include, but is not limited to, prototype vaccines for animal model studies, structural studies, or as therapeutic proteins.
- quantities of antigens can be produced according to the methods described herein. Isolation of Desired Polypeptides from the Mucocyst Matrix
- the invention provides methods for protein purification from the extracellular matrix formed by the discharge of mucocysts. Because heterologous polypeptides targeted to the mucocyst compartment will be associated within the matrix, the invention provides matrix-based purification strategies.
- the matrix can be used for rapid purification of recombinant polypeptides associated with it.
- Proteins within the gel matrix can be separated from cellular constituents by low-speed centrifugation (See Turkewitz et al. (2000)). Any other method known in the art suitable for separating intact cells, from the discharged material, including, but not limited to filtration harvesting using an appropriately selected mesh, can also be used in conjunction with the methods described herein.
- the desired heterologous polypeptide can be liberated from the secreted matrix gel. Methods for liberation of the protein can include chemical methods ⁇ e.g., high salt concentrations) and/or enzymatic methods ⁇ e.g., site-specific proteases).
- Proteins can also be isolated in intact secretory granules.
- an exocytosis-defective mutant, MN 173, of T. thermophila where granules accumulate in the cytoplasm has been described for such purposes (Melia et al. (1998)).
- the -25,000 genes of the T. thermophila macronuclear genome encode a large number of predicted proteases, including 43 aspartic proteases belonging to two families, 211 cysteine proteases belonging to 11 families, 139 metalloproteases belonging to 14 families, 73 serine proteases belonging to 12 families, and 14 threonine proteases (Eisen et al, 2006)(Coyne et al 2008)(unpublished). Many of these proteases have predicted signal sequences and are therefore likely to be secreted and/or function within digestive organelles, but a subset may be specialized for mucocyst biogenesis.
- the inventors analyzed a microarray-based dataset to detect any predicted proteases that were up-regulated when Tetrahymena were induced to synthesize a new cohort of mucocysts, since the GRL genes were also known to be induced under these conditions Table 2.
- the inventors selected four cathepsins (CTHl-4) and one carboxypeptidase (CAR1), whose expression profiles are striking similar to those of GRL genes (Fig 1A) but distinct from those of other closely- related proteases (Fig IB).
- DCGs DCGs.
- all of the enzymes possess signal sequences that would direct translocation into the secretory pathway.
- Three of the four cathepsins ⁇ CTHl-3) belong to the aspartyl-protease subgroup, while CTH4 belongs to the cysteine-protease subgroup (Cathepsin C family).
- Another cysteine protease, cathepsin B has previously been studied in Tetrahymena and shown to localize to food vacuoles (ref). The inventors added this gene in the analysis as an example of a non-mucocyst protease (ref).
- Fig 8, 9 sapiens aspartic and cysteine proteases
- Fig. 7 and S8 The phylogenetic relationships between the Tetrahymena proteases and a set of related enzymes from other eukaryotes is shown in Fig. 7 and S8.
- the aspartyl cathepsins CTHl-3 fall within a cluster of genes from Ciliates and the related Apicomplexan parasites, while the cysteine cathepsin CTH4 has clear homologs in more distantly related species including humans (Fig 7, 16).
- CAR1 has closely-related homologs in other ciliates (Ichthyopthirius and Paramecium) (Fig 17).
- Tetrahymena mucocysts are elongated (1 x 0.2 ⁇ ) vesicles that dock at regularly arrayed sites at the cell periphery, from where the contents can be rapidly released by exocytic fusion upon stimulation. Since enzymes that act upon mucocyst proproteins might themselves localize to mucocysts, the inventors determined the localization of the candidate cathepsins and carboxypeptidase by expressing each as a Cyan Fluorescent protein (CFP) fusion controlled by a cadmium-inducible metallothionein (MTT1) promoter (ref).
- CFP Cyan Fluorescent protein
- MTT1 cadmium-inducible metallothionein
- Fig. 11 shows localization in living cells of CFP-tagged copies of each of the proteases. Based on the localization patterns, one can conclude that the proteases are localized to the mucocysts. After 2 hours of induction (Fig.
- Cth4p does not co-localize with a mucocyst marker, while after 18 hours it is clearly localized to mucocysts.
- Cth4p is not initially transported to mucocysts or mucocyst intermediates, but ends up there after a longer period.
- the results for the other proteases is identical after 2 hr or 18 hr of induction, so they are more directly transported to mucocysts or mucocyst intermediates.
- the persistent RT-PCR remnants may reflect residual copies of the endogenous genes, or inefficient amplification of intact related members within these large gene families.
- >90%> knockdown was sufficient to analyze the potential roles of the candidate genes.
- the CTH1, 2 and 4 mutant strains showed flocculent release that was somewhat reduced compared to wildtype, while flocculent formation was completely absent from the CTH3 mutant strain (Fig 4A-D).
- EXAMPLE 4 - CATHEPSIN 3 IS REQUIRED FOR MUCOCYST FORMATION.
- mucocysts were formed in the mutant cell lines, the inventors labelled mucocysts in fixed permeabilized cells with two monoclonal antibodies (mAbs) that recognize, respectively, members of the two major families of mucocyst cargo proteins. All characterized GRL proteins, of which Grl3p is recognized by mAb 5E9, undergo proteolytic processing during mucocyst formation. The characterized GRT proteins, of which Grtlp is recognized by mAb 4D11, do not undergo proteolytic processing, and Grtlp in mature mucocysts localizes to the tip where docking occurs to the plasma membrane.
- mAbs monoclonal antibodies
- Grllp In wildtype cells, Grllp accumulates primarily as a polypeptide that migrates at ⁇ 40kDa (Fig 6A). This product is generated by protoeo lytic processing from a ⁇ 60kDa proprotein.
- the proprotein is the major species in lysates from SB281, a Mendelian mutant that lacks mucocysts and that fails to convert the 60kDa to the 40kDa form (Fig 6A).
- lysates of ACTH3 cells showed an almost complete absence of the processed Grllp product and an apparent over-accumulation of the precursor (Fig 6A).
- the CTH4 mutant showed a clear difference in GRL processing compared to the wildtype.
- both the pro-protein and processed forms of GRL proteins were present, but in all cases the processed product appeared larger than the corresponding product in wildtype cells (Fig6, Fig S5).
- the inventors obtained the clearest data for Grl3p, a protein the inventors could analyze using both polyclonal and monoclonal antibodies (Fig 6C, D).
- Western blots using either of those antibodies revealed that, in addition to the shift in the size of the processed product, there was also a change in the gel mobility of proGr p in the ACTH4 lysates.
- EXAMPLE 6 EXPRESSION PROFILING REVEALS CO-REGULATION OF MUCOCYST CARGO PROTEINS, SORTILIN-FAMILY RECEPTORS, AND OTHER PROTEINS PREDICTED TO FUNCTION IN PROTEIN TRAFFICKING.
- thermophila mucocysts are co-regulated over a wide range of physiological states. These include growth, starvation, and conjugation, as well as during synchronous mucocyst synthesis that can be triggered by stimulating cells to undergo complete exocytosis)(Haddad and Turkewitz, 1997; Rahaman et al, 2009).
- Sortilins are Type I transmembrane proteins first characterized in S. cerevisiae as the product of the VPS 10 gene, which functions as a sorting receptor for vacuolar hydrolases(Marcusson et al., 1994). Similarly, sortilins in animals are receptors for sorting to ly so some-related organelles, in addition to other functions(Hermey, 2009). In T. thermophila, all four of the sortilin genes have similar expression profiles, which are also strikingly similar to those of known mucocyst-associated genes (Fig. 18A). The four T.
- thermophila sortilins called SOR1-SOR4, have diverged significantly from one another as judged by amino acid sequence (-30% identity within the VPS10 domains; -12% identity within the cytosolic tails).
- the four genes fall into two clades. SOR1 and 3 belong to a clade including members from non-Ciliates, while SOR2 and 4 belong to a Ciliate -restricted clade, and therefore are likely to have arisen via gene duplications that occurred within the Ciliate lineage (Fig. 18B; 24).
- thermophila also expresses AP-1, AP-2, and AP-4 adaptor complexes, but none of these is co-regulated with mucocyst-associated genes (Elde et al, 2005; Nusblat et al, 2012).
- the GFP-fusion protein is functional, since cells expressing Sor4p-GFP in lieu of the wildtype protein were fully exocytosis-competent, i.e., did not manifest any SOR4 deficiency (Fig. 26).
- the 5Oi?4-dependent mis-sorting of Grtlp was specific, since disruption of the related T. thermophila paralog, SOR2, did not produce any apparent defect in the accumulation of Grtlp (Fig. 2B).
- Alcian blue binds to acidic mucocyst proteins as they exit, entrapping each wildtype cell in a blue-stained capsule (Tiedtke, 1976), but Asor4 cells showed no trace of capsule formation (Fig. 20A).
- the mucocyst contents released from dibucaine -treated wildtype cells form large pelletable aggregates (Satir, 1977), but these were entirely absent in dibucaine -treated Asor4 cultures, and greatly reduced in Asor2 cultures (Fig. 20B).
- SOR4 function is also essential for processing, but not sorting, of the 2nd major family of mucocyst proteins in Tetrahymena, and disruption of processing is itself expected to inhibit mucocyst maturation and exocytosis (Verbsky and Turkewitz, 1998).
- Cth3p Cyan Fluorescent Protein
- CTH3 The role of CTH3 in mucocyst maturation is likely to require its predicted enzymatic activity.
- the inventors used homologous recombination to replace endogenous CTH3 in the macronucleus of wildtype cells either with itself (cth3-4) or with a variant in which the inventors made mutations in both conserved catalytic motifs (Aspl39-to- Asn; Asp324- to-Asn; cth3-5). These mutations have been shown in other systems to cripple the activities of homologous cathepsins (Tyynela et al, 2000; Glondu et al, 2001).
- Some structures appear to consist of a Lysotracker-positive zone tightly apposed to the cth3p-GFP-positive zone, suggesting that a fraction of cth3p-GFP resides in an organelle that communicates with lysosomes.
- Tetrahymena mutants with defects in mucocyst assembly or exocytosis have been isolated following nitrosoguanidine mutagenesis (Orias et al, 1983; Melia et al, 1998; Bowman et al, 2005a). A large subset were found to have defects in pro-Grl processing, though it is not yet known in any case whether this represents the primary defect.
- the mutant with the most severe defect in pro-Grl processing is SB281, which shows neither detectible pro-Grl processing nor mucocyst formation (Bowman and Turkewitz, 2001).
- the SB281 mutation cannot fall within CTH3, since SB281 has been genetically mapped to micronuclear chromosome 4, whereas the CTH3 gene is on chromosome 5 (Gutierrez and Orias, 1992)(E. Hamilton, pers. comm.). Nonetheless, it seemed possible that overexpression of CTH3 could suppress the SB281 defect.
- the inventors integrated the wildtype CTH3 open reading frame, including a C-terminal 6xHis epitope tag, at the RPL29 locus in SB281 cells, under the control of the inducible MTTl promoter. High-level expression of Cth3p partially rescued the SB281 pro-Grl processing defect ( Figure 34, A and B).
- Wild-type T. thermophila strains CU428.1 and B2086 were grown at 30°C with agitation in SPP medium (1% proteose peptone 0.2% dextrose, 0.1% yeast extract, 0.003% ferric EDTA). All reagents were from Sigma Chemical Co. unless otherwise indicated. Culture densities were measured using a Zl Coulter Counter (Beckman Coulter Inc., Indianapolis, IN). Phenotypic analysis was from cell cultures at 2-4 xlO 5 cells/ml unless otherwise indicated.
- CTH Cathepsins
- CAR Carboxypetidase
- the Gateway (Invitrogen) system was used to engineer CFP (Cyan Fluorescent Protein) fusions with Cthlp-Cth4p, CthBp, and Carlp. Briefly, PCR-amplified CTH1 (TTHERM 00052190), CTH2 (TTHERM 00011710), CTH3 (TTHERM 00321680), CTH4 (TTHERM 00445920) CTHB (TTHERM 00083480) and CAR1 (TTHERM 00410180) (minus the stop codon) were TOPO cloned (Invitrogen, Grand Island, NY) into the pENTR- D-TOPO entry vector.
- CFP Cyan Fluorescent Protein
- thermophila expression vector pICC- GTW a gift from Doug Chalker (Yao et ah, 2007; Bright et ah, 2010).
- Genes subcloned into pICC-GTW are fused at their N-terminus to the CFP gene, with the fusion under the transcriptional control of the cadmium-inducible MTTl promoter (ref for MTTl).
- the vector is amplifiied and maintained as a Microclear minichromosome, and confers paromomycin resistance.
- Biolistic Transformations were as described previously (Chilcoat et ah, 1996), with the following modifications: gold particles (Seashell Technology, San Diego, CA) were prepared as recommended with 15 ⁇ g of total linearized plasmid DNA. To select for positive transformants, drug was added 4h after bombardment to cultures shaken at 30°C. Transformants were selected in paromomycin sulfate (PMS, 120 ⁇ g/ml) and CdCl 2 (1 ⁇ g/ml). PMS-resistant transformants were identified after 3d. Transformants were then serially transferred daily in increasing amounts of PMS for at least 4 weeks before further testing.
- PMS paromomycin sulfate
- the concentration of PMS was increased up to 15 mg/ml and CdCl 2 was maintained at 0.5 ⁇ g/ml for CTH1 & CTH4 knockout cultures, while PMS was increased up to 6 mg/ml and CdCl 2 was maintained at 0.3 ⁇ g/ml for CTH2, CTH3 and CARl knockout cultures.
- the cultures were returned to 10 mg/ml PMS and 0.5 CdCl 2 (for CTH1 and CTH4 knockouts) and 4 mg/ml PMS and 0.4 CdCl 2 ( for CTH2, CTH3 and CARl knockouts).
- the forward and reverse primers used for CTHl-4 and CARl are given in Table 4.
- the presence/absence of the CTHl-4 and CARl transcripts were assayed by one-step RT PCR (Qiagen) using primers (Table 4) to amplify 400-5 OObp of each gene.
- Gene knockouts were confirmed by the continued absence of the corresponding transcripts after 3 weeks of growth in the absence of drug selection (4-5 serial transfers/week).
- Dibucaine Stimulation Assay Dibucaine stimulation of exocytosis was performed as described previously (Rahaman et al, 2009).
- TCA trichloroacetic acid
- T. thermophila CTH1, CTH2, CTH3 and CTH4 genes were used to identify potential homo logs in Ciliates, Apicomplexans, Arabidopsis thaliana and Homo sapiens, listed in Table 5.
- the T. thermophila CAR1 sequence was used to identify homologs in Ciliates, listed in Table 6.
- the top hits were selected from each lineage, assembled, aligned with CLUSTALX (1.8) and Maximum likelihood trees were constructed with MEGA5 (Molecular Evolutionary Genetics Analysis: available on the world wide web at megasoftware.net). Gapped regions were excluded in a complete fashion and percentage bootstrap values from 1000 replicates were derived. Only values above 50% are shown.
- Plasmodium cynomolgi strain B Plas8 XP_004222389.1
- pmEGFP-neo4 Vector Construction.
- pmEGFP-neo4 is a modification the vector pEGFP-neo4 (provided by Kazufumi Mochizuki), which is designed to GFP-tag genes at their endogenous loci.
- the inventors site-specifically mutagenized the ORF of GFP in the original vector to create a variant of GFP that is largely monomeric, in order to avoid localization artifacts due to oligomerization.
- the monomeric mutation of pmEGFP-neo4 encoding an alanine-to-lysine substitution at position 207 of the GFP ORF (Zacharias et al., 2002), was introduced into pEGFP-NE04 by QuickChange® Site-directed Mutagenesis (Stratagene, La Jolla, Ca) with the primer pair 067A and 067B (Table 7).
- mEGFP was fused at the C-terminus of the SOR4 (TTHERM 00313130) macronuclear ORF via homologous recombination, using linearized pSOR4-mEGFP-neo4.
- This construct contains the C-terminal ⁇ 700bp of the SOR4 genomic locus (minus the stop codon) followed by mEGFP, the BTU1 terminator, a neo4 drug resistance cassette, and ⁇ 600bp of SOR4 downstream genomic sequence.
- the C-terminal region of the SOR4 genomic locus lacking the stop codon was amplified with the primer pair 093 A and 093B (Table 7).
- the 5' region of these primers contain ⁇ 15bp of homology to pmEGP-neo4 linearized with BamHI for In-Fusion® (Clontech, Mountain View, CA) mediated insertion into the vector.
- the genomic region downstream of the SOR4 locus amplified with the primer pair 094A and 094B (Table 7), was inserted into the preceding construct linearized with Hindlll.
- Wild type CU428 cells were then biolistically transformed with the final construct, pSOR4-mEGFPneo4, which was first linearized with Xhol and Nhel .
- Initial trans formants were selected based on paromomycin resistance, and then serially transferred for 3-4 weeks in increasing drug to drive fixation of the GFP-tagged allele. Consistent with the complete replacement of the endogenous locus by the tagged allele, the transformants maintained both Sor4p-GFP expression as well as drug resistance for at least 1 year after initial selection.
- SOR1-4 Disruption.
- the SOR4 macronuclear locus was replaced with a neo4 drug resistance cassette via homologous recombination with the linearized construct pSOR4MACKO-neo4.
- This construct contains a neo4 construct flanked by ⁇ 750bp of the genomic regions immediately upstream and downstream of SOR4.
- pSOR4MACKO-neo4 was derived from the pSOR4-mEGFP-NE04 construct described above.
- the genomic region upstream of SOR4 was first amplified with the primer pair 109A and 109B (Table 7).
- the 5' region of both of these primers also contains a ⁇ 15bp 5' sequence homologous to the ends of pSOR4-mEGFP-neo4 linearized with Pstl and Notl (which removes the 3' genomic coding region of SOR4, mEGFP, and the3'BTUl terminator) for In-Fusion® mediated insertion into the vector.
- Pstl and Notl which removes the 3' genomic coding region of SOR4, mEGFP, and the3'BTUl terminator
- Igrlp-GFP construct (Cowan et al, 2005) was linearized with Sfil and biolistically transformed into CU428 and ASOR4.
- CTH3 TTHERM 00321680 ORF was cloned into the pBSICC Gateway vector, a gift from Doug Chalker, with primer pair S001 and S002 with Invitrogen's Gateway cloning system. Briefly, the CTH3 ORF was first cloned into the entry vector PENTRTM/D-TOPO® and then inserted into the pBSICC Gateway destination vector with the LR Clonase II® recombinase.
- the CTH3 ORF is flanked upstream in the destination vector by the cadmium inducible MTT1 promoter (Shang et al., 2002) followed by the 3' end of the RPL29 locus, modified to contain a mutation that confers cycloheximide resistance(Yao and Yao, 1991), and flanked downstream by the 3' RPL29 genomic region. After linearization, this construct can integrate at the end of the RPL29 locus for the transient expression of the cloned ORF. The construct was linearized with Hindlll and biolistically transformed into CU428 and ASOR4.
- Target cultures were grown to log phase and starved for 18-24 hours in lOMm Tris pH 7.0.
- Gold particles (Seashell Technology, San Diego, CA) were prepared as recommended with 15 "g of total linearized plasmid DNA and then applied to the macrocarrier flying disk for use in a Biolistic PDS-100000/He device (BioRad, Hercules, CA) with the following settings; 27-28 in Hg vacuum, 1/4 in gap distance, 8 mm macrocarrier travel, and a target distance of 9 cm.
- Cells were concentrated to lmL (from 30mL) and loaded into the apparatus on filter paper.
- the cells were transferred on the filter paper to a pre-warmed flask containing 50mL of SPP.
- drug was added 4h after bombardment to cultures shaken at 30°C.
- Transformants were selected in paromomycin sulfate (120 "g/ml + 1 "g/ml CdCb), blasticidin (60 “g/ml + 2 "g/ml CdCb), or cycloheximide (12 "g/ml).
- Drug resistant transformants were identified after 3-6 days. Transformants were then serially transferred every 2-3 days in decreasing concentrations of CdCb for at least 2 weeks before further testing. At least two independent transformants were tested for each line.
- SORI-4 transcripts was assayed by PCR amplification of purified cDNA with the same primer pair used to amplify the C-terminal coding region used to construct the GFP fusions (Table 7). Knockouts were confirmed by the persistent absence of the corresponding transcript after four weeks of growth in the absence of drug selection (3-4 serial transfers/week).
- Dibucaine Stimulation Cultures were grown to stationary phase and then incubated for an additional 24h before being concentrated, at least 10-fold, into a loose pellet and stimulated with 2.5 mM Dibucane. Stimulated cultures were mixed gently for ⁇ 30sec and restored to their original volume with lOmM HEPES, 5mM CaCb. After gently mixing, the culture was then centrifuged at 1200 x g for 2 min, resulting in the formation of a cell pellet/flocculent bilayer.
- Immunofluorescence Cells were washed and fixed ( ⁇ 3mL of culture) in an equal volume of ice-cold 4% paraformaldehyde (in 50mM HEPES pH 7.0 for lOmin. After two washes in icecold HEPES, cells were then permeablized in ice-cold 0.1% Triton X-100 in HEPES for 8 min on ice. After two more washes with ice-cold HEPES, cells were resuspended in blocking solution (1% BSA in TBS (lOmM Tris pH 7.5, 154 mM NaCl)) and warmed to room temperature while rotating slowly for 30min.
- blocking solution 1% BSA in TBS (lOmM Tris pH 7.5, 154 mM NaCl)
- the cells were washed once with 0.1% BSA in TBS and twice with lOmM HEPES pH 7.0. Cells were resuspended in a final volume of 150 "L of lOmM HEPES pH 7.0 and then mixed with an equal volume of Mounting Media (30% Glycerol, 0.1% Trolox) immediately before slide preparation.
- Mounting Media (30% Glycerol, 0.1% Trolox) immediately before slide preparation.
- the former was decorated using mAb 5E9 as described above, the latter using polyclonal anti- GFP antibody (Life Technologies, Carlsbad, Ca) diluted 1 :400.
- the 2° antibodies which were similarly co-incubated with samples, were Texas Red-coupled goat anti-mouse IgG and 488-coupled donkey anti-rabbit IgG (Life Technologies, Carlsbad, Ca), diluted 1 :250.
- Cells were imaged with a Leica (Buffalo Grove, IL) TCS SP5 II STED-CW super-resolution laser scanning confocal microscope with a lOOx/1.40 NA oil objective at room temperature. Images were captured with the LAS AF Lecia confocal software on Windows 7. Image data were colored, denoised, and adjusted in brightness/contrast with the program ImageJ (available on the world wide web at rsbweb.nih.gov/ij).
- the images of the protease expressing cells were also colored, but only their brightness/contrast was additionally adjusted. All cells, as shown in Fig. 5, were treated identically, adjusted to the same brightness/contrast values established by a representative WT image.
- the simultaneous localization of Grtlp and Grl3p was performed as described above, but the mAbs 4D11 and 5E9 were directly conjugated to Dylight 488 and 649 respectively (Thermo Scientific, Rockford,IL), and mixed 1 : 1 prior to incubation with samples. These images were then processed with Huygens Pro from SVI. [00149] Co-localization Measurement.
- the M2 correlation coefficient was determined with the Image J plugin JACoP(Bolte and Cordelieres, 2006).
- Proteins were resolved with the Novex® NuPAGE® SDS-PAGE Gel System (4-12% Bis-Tris Gels) (Life Technologies, Carlsbad, Ca) and transferred to 0.45 ⁇ PVDF membranes (Thermo Scientific, Rockford, IL) at 100V for lh. Protein was then reversibly stained with Ponceau S and the blot was then blocked with 5% dried milk, 50mM Tris pH 7.8, 0.02% NP-40, and 2 mM CaCb for 1 hour. The 1° antibody incubation, diluted in the blocking buffer, was at least one hour. The blot was then washed 4x, for 5min each, in 50mM Tris pH 7.8, 0.02% NP-40, and 2 mM CaCb.
- Electron Microscopy Cells grown to stationary phase were fixed in 2% Glutaraldehyde, 1% sucrose and 1% osmium at 25°C in 0.1M sodium cacodylate buffer and section-stained with uranyl acetate and lead citrate post embedding. Thin sections were viewed on a FEI (Hillsboro, OR) Tecnai G2 F30 Super Twin microscope.
- Sor4p-GFP was immunoprecipitated with polyclonal anti-GFP antibody coupled to magnetic Dynabeads (Life Technologies, Carlsbad, CA), from lysates of cells expressing Sor4p-GFP that were undergoing regranulation following Alcian Bluestimulated degranulation (Haddad and Turkewitz, 1997).
- VPS 10 domains were assembled and aligned with MUSCLE (available on the world wide web at ebi.ac.uk/Tools/msa/muscle) and Maximum likelihood trees were constructed with MEGA5 (Molecular Evolutionary Genetics Analysis; available on the world wide web at megasoftware.net/) using the WAG amino acid substitution model and 1000 bootstrap replicates. Accession numbers from which VPS 10 domain sequences were obtained to create the phylogeny in FIG. 18B and listed in Table 8.
- Images were captured with an Evolve-backthinned CCD camera (Photometries, Tuscon, AZ) in SlideBook (3i, Santa Monica, CA).
- the SOR4-GFP lines were imaged using a Marianas Yokogawa type spinning disk inverted confocal microscope (3i, Santa Monica, CA) with the lOOx/1.45 NA oil objective at room temperature.
- Images were captured with an Evolve-backthinned air chilled CCD camera in SlideBook. The brightness/contrast of the images were adjusted in Image J.
- Cth3 activity was assayed in vitro using the SensoLyte® 520 Cathepsin D Assay Kit Fluorimetric (AnaSpec, Fremont, CA) as per manufacture's instruction, and including the cathepsin D positive control provided by the manufacturer.
- Cth3p, in parallel with the active site mutant were isolated as GFP-fusions (cth3-4p and cth3-5-p, respectively) by immunoprecipitation from Tetrahymena whole cell Triton X-100 lysate using polyclonal rabbit anti-GFP antiserum as described above, except that the following protease inhibitors were included in the lysis buffer: 10 ⁇ E-64, ImM PMSF and ⁇ Leupeptin. Enzyme assays were carried out in ⁇ in 96 well plates.
- Activity was recorded as the rate of hydrolysis of substrate, at 5 min intervals for 60 min at RT, using a Gemini XPS Fluorescence Microplate Reader (Molecular Devices, Sunnyvale, CA; excitation, 485 nm; emission, 515 nm).
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Ciliate organisms are provided that comprise reduced proteolytic processing in granules. For example, ciliates are provided that lack detectable expression of or overexpress one or more sortilin (SOR) gene product. Methods for producing such genetically altered ciliates and methods for protein production, targeting, and stabilization in a these organisms are also provided.
Description
DESCRIPTION
EXPRESSION PROFILING REVEALS CATHEPSINS INVOLVED IN SECRETORY VESICLE MATURATION IN TETRAHYMENA THERMOPHILA
CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims priority to U.S. Application No. 61/843,206 filed on
July 5, 2013, the entire contents of which are hereby incorporated by reference without disclaimer.
BACKGROUND OF THE INVENTION
1. Field of the Invention
[0002] The present invention relates generally to the field of genetics and molecular biology. More particularly, it concerns methods for targeting and stabilizing proteins in desired compartments.
2. Description of Related Art
[0003] In humans and other animals, a large and diverse set of secreted peptides, including hormones and neuropeptides, play key roles in intercellular communication and tissue coordination. The peptides are generated, stored, and released upon demand from secretory organelles called dense core vesicles (DCVs). DCVs in animal cells are critical to both development and behavior, since they underlie extracellular signaling based on the release of peptide hormones like insulin, growth factors like bone-derived neurotrophic factor, as well as neuropeptides.
[0004] As typified by insulin granules, the formation of DCVs depends upon a multi- step pathway. First, proinsulin and other newly synthesized polypeptides are sorted as aggregates, at the level of the trans Golgi network, into vesicles that are distinct from those bearing soluble cargo destined for rapid constitutive secretion or for lysosomes. Subsequently, a maturation process remodels the aggregates into a highly condensed assembly, creating the eponymous dense core within the vesicle lumen. At a biochemical level, maturation is an interval during which the insulin peptide is generated from proinsulin by proteolytic processing. Maturation also includes the withdrawal, via vesicle budding, of both mis-sorted soluble constituents as well as DCV maturation factors, such as the convertases, which can thus be recycled. The mature DCV must also possess membrane
proteins to permit docking at exocytic sites at the plasma membrane, followed by exocytic membrane fusion in response to extracellular stimuli.
[0005] DCVs are found in just a subset of animal tissues, and organelles resembling
DCVs have been documented in a variety of eukaryotic lineages, though few of these have been analyzed at the molecular level. The most extensive studies have been in the Ciliates, in which DCV organelles that undergo stimulated exocytosis can function in intercellular communication, documented for predator-prey and parasite -host interactions, and in cyst formation. Studies in Tetrahymena thermophila and Paramecium tetraurelia have established that the process of DCV formation in these species is strikingly similar to the steps outlined above for insulin granule formation in mammalian pancreatic β-cells. Notably, the process in Ciliates includes a central role for proteolytic maturation of proproteins during core formation. Analysis of the proprotein substrates as well the the processed products led to identification of conserved motifs that are likely to be targets of multiple distinct proteases, an inference also consistent with studies using class-specific protease inhibitors. However, the ciliate processing enzymes have not been identified at the molecular level. Ciliate genomes do not encode any obvious homologs of the mammalian prohormone convertases, and the very large number of predicted proteases encoded in ciliate genomes has made it challenging to select likely candidates for the convertases in this lineage.
[0006] A key feature of DCVs is the presence of a macroscopic core consisting of aggregated cargo molecules, which facilitates storage at high concentration. Pioneering work on DCV biogenesis, drawing largely on cell biological and biochemical approaches in mammalian cells, established that aggregation also plays a key role in protein sorting in a multi-step pathway beginning at the trans-Golgi network (TGN) and continuing as a maturation process during which DCV cargo is refined, in part by withdrawal of mis-sorted extraneous proteins (Arvan et al., 2002; Chanat and Huttner, 1991; Kim et al., 2006; Kuliawat and Arvan, 1992; Morvan and Tooze, 2008; Tooze and Huttner, 1990).
[0007] More recently, a 2nd family of Tetrahymena DCV proteins came to light, and two members of the 13-member gene family, named Grtlp and Igrlp (for Granule rip, and induced upon granule regeneration, respectively), have been characterized (Bowman et al, 2005a; Bowman et al, 2005b; Haddad et al, 2002). Neither undergoes aggregation or proteolytic processing, suggesting that their sorting depends on different mechanisms from those of the Grl proteins.
SUMMARY OF THE INVENTION
[0008] In a first embodiment, provided is a method of stabilizing a protein of interest in the mucocysts of a genetically altered ciliate, wherein the ciliate lacks detectable expression (or has reduced expression) of one or more CTH or CAR gene product. In some embodiments, the ciliate may be transformed with a polynucleotide comprising a sequence complementary to a gene corresponding to CTHl, CTH2, CTH3, CTH4, or CARl . In some aspects, the ciliate may lack detectable expression of a polypeptide or a RNA corresponding to CTHl, CTH2, CTH3, CTH4, and/or CARl . In a further aspect, the ciliate lacks detectable expression of 2, 3 or 4 of the CTHl, CTH2, CTH3, CTH4, or CARl genes. For example, a ciliate of the embodiments may lack detectable expression (or have reduced expression) of CTHl and CTH2; CTHl and CTH2; CTHl and CTH4; CTHl and CTH4; CTHl and CARl; CTH2 and CTH3; CTH2 and CTH4; CTH2 and CARl; CTH3 and CTH4; CTH3 and CARl ; CTH4 and CARl; CTHl, CTH2, and CTH3; CTHl, CTH3, and CTH4; CTHl, CTH4, and CARl; CTHl, CTH3, and CARl; CTH2, CTH3, and CTH4; CTH2, CTH4, and CARl; CTH3, CTH4, and CARl; CTHl, CTH2, CTH3, and CTH4; CTHl, CTH3, CTH4, and CARl; CTHl, CTH2, CTH4, and CARl; CTHl, CTH2, CTH3, and CARl; CTH2, CTH3, CTH4, and CTH5; or CTHl, CTH2, CTH3, CTH4, and CARl .
[0009] In some embodiments, the gene corresponds to CARl . In some embodiments, the stabilized protein of interest is not subject to cleavage by CAR proteases. In some embodiments, the gene corresponds to CTHl, CTH2, CTH3, or CTH4. In some embodiments, the stabilized protein of interest is not subject to cleavage by CTH proteases. In some embodiments, the stabilized protein of interest is not subject to cleavage by CAR proteases or CTH proteases.
[0010] In another embodiment, there is a method of targeting a protein of interest to the mucocysts of a ciliate comprising transforming the ciliate with a polynucleotide comprising a sequence complementary to a SOR gene corresponding to SOR1, SOR2, SOR3 or SOR4, wherein the protein of interest is targeted to the mucocysts of the transformed ciliate. For example, the SOR gene product may be a product corresponding to SOR1 (SEQ ID NO: 1, 2), SOR2 (SEQ ID NO: 3, 4), SOR3 (SEQ ID NO: 5, 6) and/or SOR4 (SEQ ID NO: 7, 8; indicating the protein and nucleic acid coding sequence respectively). In some aspects, the ciliate may lack detectable expression of a SOR polypeptide or a SOR RNA corresponding to SOR1, SOR2, SOR3 and/or SOR4. In a further aspect, the ciliate lacks
detectable expression of 2, 3 or 4 of the SOR1 , SOR2, SOR3, or SOR4 genes. For example, a ciliate of the embodiments may lack detectable expression (or have reduced expression) of SOR1 and SOR2; SOR1 and SOR3; SOR1 and SOR4; SOR2 and SOR3; SOR2 and SOR4; SOR3 and SOR4; SOR1 , SOR2 and SOR3; SOR1 , SOR2 and SOR4; SOR1 , SOR3 and SOR4; SOR2, SOR3 and SOR4; or SOR1 , SOR2 SOR3 and SOR4.
[001 1] In certain aspects, a ciliate of the embodiments comprises a genomic alteration, such as an insertion or a deletion in both copies of the germline genome that disrupts expression of one or more gene product. For instance, the ciliate can comprise an insertion or deletion located in the open reading frame of a gene corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4. In some aspects, a genomic insertion comprises a selectable marker, such a drug resistance marker (e.g., a gene for tetracycline or neomycin resistance). Accordingly, in some aspects, a ciliate of the embodiments comprises an insertion or a deletion in all macronuclear copies of a gene corresponding to SOR1 , SOR2, SOR3 and/or SOR4. [0012] In further aspects a ciliate of the embodiments expresses a polynucleotide complementary to all or part of an RNA gene product corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4. For example, the ciliate can express an antisense RNA or a double stranded RNA (dsRNA) molecule, such as a small interfering RNA (siRNA), short hairpin RNA (shRNA) or micro RNA (miRNA), complementary to all or part of an RNA gene product corresponding to CTH1 , CTH2, CTH3, CTH4, CAR1 , SOR1 , SOR2, SOR3 and/or SOR4.
[0013] In still further aspects, a ciliate of the embodiments comprises a transgenic expression cassette, such as an expression cassette encoding a polypeptide. For example, the polypeptide can be a polypeptide for recombinant production in the ciliate. Polypeptides for use in accordance with the embodiments include, but are not limited to, enzymes, immunoglobulin (e.g., immunoglobulin light chains, immunoglobulin heavy chains or single chain antibodies), cytokines, chemokines, and antigens (e.g., bacterial or viral antigens). In some aspects the polypeptide coding sequence can comprise a sequence for cellular trafficking, such as a mucocyst-targeting sequence. For example, the polypeptide can encode a mucocyst-targeting sequence derived from a Tetrahymena Grl protein, such as Grll , Grl2, Grl3, Grl4, Grl5, Grl6, Grl7, Grl8, Grl9 or Grl 10. In still further aspects, the polypeptide encodes a cleavable linker (e.g., between the polypeptide for expression and a mucocyst- targeting sequence).
[0014] In some specific aspects, a ciliate of the embodiments is a Tetrahymena, such as a T. thermophila or T. pyriformis.
[0015] In some aspects, the protein of interest is a mucocyst cargo protein. In some aspects, the protein of interest is a Grt-family protein. [0016] In yet a further embodiment, provided is a method of producing a protein of interest comprising: (a) expressing a polynucleotide encoding the protein in a genetically altered ciliate, wherein the ciliate lacks detectable expression of one or more SOR gene product corresponding to CTHl, CTH2, CTH3, CTH4, or CARl or wherein the ciliate expresses enzymatically inactive CTHl, CTH2, CTH3, CTH4, or CARl, and (b) incubating the ciliate in a media under conditions permissible for expression of the protein, wherein the protein of interest is stabilized in the mucocysts of the transformed ciliate. In some aspects, the majority (or at least a portion) of the polypeptide is secreted from the ciliate and the method can comprise (c) purifying the expressed polypeptide from the media. In certain aspects, the majority (or at least a portion) of the polypeptide is not secreted by the ciliate and the method can comprise (c) purifying the ciliate from the media and, optionally, (d) purifying the protein from the ciliate. In still further aspects, a method of the embodiments further comprises transforming a ciliate with a polynucleotide encoding a polypeptide. Further methods for polypeptide expression in ciliates are detailed in PCT Patent Pub In. No. WO 2010/108182, the entirety of which is incorporated herein by reference. In some embodiments, the ciliate does not comprise a CTHl, CTH2, CTH3, CTH4, or CARl gene. In some embodiments, the ciliate expresses enzymatically inactive CTHl, CTH2, CTH3, CTH4, or CARl .
[0017] In some aspects, expressing a polynucleotide for expression in a ciliate is further defined as using an expression cassette encoding a polypeptide. For example, the polypeptide can be a polypeptide of mammalian origin, such as a human polypeptide. In some aspects, the polypeptide comprises sequence encoding an enzyme, an immunoglobulin, a cytokine, a chemokine, or an antigen.
[0018] In any of the embodiments discussed above, the ciliate may overexpress (or have an increase in expression of) the processing enzymes (i.e., CTHl, CTH2, CTH3, CTH4, and/or CARl), individually or in combination. This may be done in any appropriate manner known to those of skill in the art. The terms "overexpress", "overexpression", "overexpressed", "up-regulate", or "up-regulated" interchangeably refer to a enzyme that is
transcribed or translated at a detectably greater level in comparison to a wild type ciliate. The term includes overexpression due to transcription, post transcriptional processing, translation, post-translational processing, cellular localization, and/or RNA and protein stability, as compared to a wild type ciliate. Overexpression can be detected using conventional techniques for detecting mRNA (i.e., RT-PCR, PCR, hybridization) or proteins (i.e., ELISA, immunohistochemical techniques, mass spectroscopy). Overexpression can be or be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more (or any range derivable therein) in comparison to a wild type ciliate. In certain instances, overexpression is or is at least 1- fold, 2-fold, 3-fold, 4-fold 5, 6, 7, 8, 9, 10, or 15-fold or more higher levels of transcription or translation in comparison to a wild type ciliate.
[0019] Any of the methods provided herein may be performed in a large number of ciliates. The methods can be performed simultaneously or on a rolling basis. In some embodiments, the method is performed in a plurality of ciliates. In some embodiments, the method is performed in at least 100 ciliates. In some embodiments, the method is performed in at least or more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 ciliates.
[0020] As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one.
[0021] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used herein "another" may mean at least a second or more.
[0022] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0023] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0024] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0025] FIG. 1A-1C - Expression profiling reveal a family of cathepsins involved in secretory granule maturation in Tetrahymena. (A) CTHl-4 and CAR1 are co- expressed with genes (GRL1 and GRT1) encoding mucocyst contents in T. thermophila. The expression profiles of four Cathepsins (CTHl-4) and one Carboxpetidase (CAR1) are very similar to those of genes (GRL1 and GRT1) encoding mucocyst cargo proteins. Expression profiles are derived from the Tetrahymena Functional Genomics Database (available on the world wide web at tfgd.ihb.ac.cn), with each profile normalized to that gene's maximum expression level. The expression profiles of genes at successive time points in growing (L-l, L-m, and L-h), starved (S-0, S-3, S-6, S-9, S-12, S-15, and S-24), and conjugating (C-0, C-2, C-4, C-6, C-8, C-10, C-12, C-14, C-16, and C-18) cultures, as determined by hybridization of stage-specific cDNAs to whole-genome microarrays. Details on the sampling times are found in Miao et al, 2009. (B) Aspartic proteases (TTHERM 00128320, TTHERM 00647470, TTHERM 01027660 and TTHERM 00437370) and cysteine protease (CTHB) are not co- regulated with GRLl . (C) Diagram showing the features of Aspartic, Cysteine and Zinc Carboxypetidase proteases, including a predicted signal peptide, the catalytic triplet (DTG or DSG) of aspartic proteases, catalytic residues (C, H, N) of cysteine proteases and catalytic residue (E) of Zinc Carboxypetidase necessary for catalytic activity. Note that cutoff values for CTH1 and CTHB was found 0.476 and 0.346, respectively by SignallP, which is lower than default cutoff value (0.5). [0026] FIG. 2A-2B - Expression and localization of CFP-tagged CFP fusion proteases. (A) Cells surface section and cell cross section of cells expressing CFT tagged proteases are shown left hand panel and right hand panel, respectively. Bar=10 μιη. Cells were treated with ^g/ml CdCl2 as indicated time point. The cell surface section, in which the regular array of granules reflects the highly organized cortex of these cells while cell cross section on the right hand demonstrates that virtually all granules are docked. Linearly arranged and docked DCGs were not detected in negative control (cells expressing CFP tagged CthBp). (B) Cells were treated with ^g/ml CdCl2 for 16h (followed by 4h in lOmM Tris pH 7.4 containing 0^g/ml CdCl2 at room temperature) or 2h (C) and then sample were
processed for western blot as described in Materials and methods section. Samples of the total protein fractions were separated by 4-20% SDS-PAGE and blotted on to PVDF membrane. Blots were probed with monoclonal anti-GFP antibody to detect CFP tagged protein. The molecular weight standards are shown on the left. CFP protein bands are indicated by arrow. Non specific band are marked by an asterisk (*) on the left. Predicated molecular weight of fusion proteases, Cthlp-CFP, Cth2p-CFP, Cth3p-CFP, Cth4p-CFP, Carlp-CFP and CthB-CFP are 79.6, 81.9, 77.8, 94, 67 and 64.8 kDa, respectively.
[0027] FIG. 3A-3D - Disruption of CTHl-5 and CAR1 through homologous recombination. (A) Schematic of the protease knockout constructs. Replacement of the CTHl-4 and CAR1 initial genie region (Table 1) with the neo4 drug resistance cassette is facilitated by homologous recombination. A detailed description of the construction and use of the CTHl-4 and CAR1 knockout constructs can be found in the Materials and methods section. (B) Verification of the knockouts by RT-PCR. RNA was extracted from WT, ACTH1, ACTH2, ACTH3, ACTH4 and ACAR1, subjected to coupled reverse transcription and PCR amplification by using specific primers are listed in Table 4. As shown in this 1% ethidium bromide stained agarose gel, each of the gene knockout lines lack the amplified product corresponding to the targeted gene, but shows WT levels of the other transcripts which therefore serve as loading controls. (C) To confirm amplification of equal amounts of cDNA, control RT-PCR with primers specific for SOR3 were run in parallel. Densitometric measurements were carried out using ImageJ software (available on the world wide web at rsbweb.nih.gov/ij). Data is normalized with SOR3 to determine % of knockdown of each Cathepsins and Carboxypetidase genes. (D) Cell growth is impaired in ACTH3. A table of the average doubling times calculated from 7 measurements of culture density, each after 3 hour periods of growth, indicating different growth rates for the WT ACTH3. [0028] FIG. 4 - Comparison of DCG secretion from wild-type and Knockout cells. Identical numbers of WT and KOs cells were resuspended, stimulated with dibucaine for 20 s, and recentrifuged to produce a pellet of cells with an overlying flocculent. The WT culture produces a two-layer pellet, in which a thick layer of flocculent (between lower and upper straight line) resulting from mucocyst discharge sits atop of the packed cells (below the lower straight line). Stimulated ACTH3 cultures, in contrast, produce no flocculent layer. Stimulated ACTHl-2 cultures generate an intermediate amount of the mucocyst-derived flocculent while ACTH4 cultures generate small amount of the mucocyst-derived flocculent.
[0029] FIG. 5A-5B - CTH3 is an essential for DCG formation and accumulation.
Shown are cell surface and cell cross section of WT and KOs cells (ACTHl-4 and ACAR1). Visualization of docked DCGs by indirect immunofluorescence using a MAb 4D11 (A) and MAb 5E9 (B) directed against the DCG lattice protein Grtlp and Grl3p, respectively. Similar numbers of elongated DCGs are present, predominantly docked at the plasma membrane in the ACTHl-2, ACTH4 and ACAR1 cells while only few DCGs are seen in the ACTH3 cells compared to WT cells. The scale bars represent 10 μιη.
[0030] FIG. 6A-6H - Processed Grllp, Grl3p, Grl4p, and Grl8p from WT and
KOs strains. (A) Cell lysate of 5000 cells were resolved by 10% SDS-PAGE and western blotted with antibody against Grllp (a GRL family protein that undergoes processing during mucocyst maturation) and with (B) anti polyG antibody (to detect control protein tubulins). Cell lysate of 10,000 cells were separated by 4-20% SDS-PAGE and blots probed with monoclonal anti Grl3p (C), polyclonal anti Grl3p (D), polyclonal anti Grl4p (E), polyclonal anti Grl8p (F) and polyclonal anti polyG (G & H). The unprocessed and processed forms of Grl proteins are indicated by arrows. In WT cells, Grl proteins accumulate primarily in its fully processed form. In ACTH3 cells, most Grl proteins remains as an incompletely processed precursor while higher molecular weight processed Grl proteins are seen in ACTH4 cells, suggesting alternative processing was occur in ACTH4 cells. Fig 6B-control blot for Fig 6A, Fig G- control blot for Fig 6C & E, Fig 6H-control blot for Fig 6D & F. [0031] FIG. 7 - Phylogeny separating Cathepsinsl-4 homologues. The maximum likelihood tree illustrates a phylogeny of Cathepsinsl-4 in Ciliates, Apicomplexans, Arabidopsis and Human. CTH1, CTH2, CTH3 (aspartic proteases) and CTH4 (cysteine protease) are Cathepsin family proteases of the T. thermophila. Figure Key: Toxoplasma (Toxo), Plasmodium (Plas), Arabidopsis (Arab), Human (Hu), Tetrahymena thermophila (Tt), Paramecium (Para) Ichthyophthirius (Icht). See Figure 16 for (*) information and full length tree. See Table 5 and 6 for a list of accession numbers for all sequences.
[0032] FIG. 8 - Primary sequence alignment of Aspartic proteases of
Tetrahymena with human Aspartic protease (Cathepsin D) — Alignment of protein sequences was done using ClustalX. Conserved catalytic triplet amino acids are highlighted in red. Conserved active site aspartic residue is marked by arrow. GenBank™ Accession Number of Tetrahymena CTHl-3 are XM 001014915, XM 001008250 and XM 001012968, respectively. UniProtKB/Swiss-Prot number of human aspartic protease (CTHD) is P07339.
[0033] FIG. 9 - Primary sequence alignment of Cysteine proteases of
Tetrahymena with human Cysteine protease (Cathepsin B) — Conserved catalytic motifs are highlighted in red. Conserved active site residues C, H, N are marked by arrow. GenBank™ Accession Number of Tetrahymena CTH4 is XM 001023356. UniProtKB/Swiss-Prot number of human cysteine protease (CTHC) is P53634.
[0034] FIG. 10A-10F - Cathepsin and Carboxypetidase family proteases are co- localized with DCG protein Grl3p— Cells were treated with ^g/ml CdCl2 for 2h to induce transgene expression. Cells were fixed and immunolabeled with mouse monoclonal antibody MAb 5E9 and rabbit anti GFP antibody. Images were captured in the green and red channels. Images shown are single slices, for clarity (A, B, and C) Cells expressing Cthlp-CFP, Cth2p- CFP, and Cth3p-CFP, respectively, each show nearly perfect co-localization of CFP and the mucocyst marker Grl3p. (D) Cells expressing Cth4p-CFP for 2 hrs show limited co- localization between CFP and the mucocyst marker Grl3p, indicating that the initial targeting of Cth4p is not predominantly to a mucocyst intermediate. (E) Cells expressing Carlp-CFP show near perfect co-localization of CFP and Grl3p. (F) In contrast, Grl3p showed little colocalization with CthB-CFP, a protease that does not localize to mucocysts.
[0035] FIG. 11 - Localization of CFP-tagged proteases - Shown is the localization in living immoibilized cells of a set of proteases tagged with CFP, after overnight (18h) induction of transgene expression. For each protease-CFP fusion, a single cell is shown in both cell surface and cross section. For Cthlp, Cth2p, Cth3p, Cth4p, and Carlp, the localization pattern indicates that the fiuorescent protein is localized to docked mucocysts. In contrast, CthB-CFP shows no localization to mucocysts.
[0036] FIG. 12A-12B - Alcian blue assay for mucocyst discharge - (A) Cells, before and after stimulation with the secretatogue Alcian blue, were fixed, permeabilized, and immunolabeled with mAb against Grl3p, and then immediately analyzed by confocal microscopy or flow cytometry. (A) Top panel: Wildtype cells prior to stimulation display an array of docked mucocysts, but after stimulation they are surrounded by a translucent capsule of released mucocyst contents. Middle panel: An identical response is seen in Acarl cells. Bottom panel: Acth3 cells prior to stimulation show primarily a small number of cytoplasmic puncta, and their appearance does not change after stimulation. (B) For flow cytometry, 104 Acth3 cells were analyzed in each sample and fluorescence signals were gated by marking a cell population on FSC versus SSC dot plots. All data were collected and evaluated by
CellQuest software (BD, USA). Grey- fill: no 1° antibody; green line: unstimulated cells; red line: Alcian blue-treated cells.
[0037] FIG. 13 - Processing of pro-Grllp is impaired in ACTH3 cells — Medium supernatants from WT and KO cell lines were processed for western blot as before. Blot was probed with anti Grllp antibody. The unprocessed and processed forms of Grllp proteins are indicated by arrows. Fully processed Grllp form is secreted by WT cells. Only unprocessed pro-Grllp form is seen in medium supernatant of ACTH3 cells while higher molecular weight unprocessed and processed forms of Grllp proteins are seen in culture media of ACTH4 cells.
[0038] FIG. 14 - ACTH1, ACTH2 and ACAR1 are not involved in DCG lattice proteins processing ~ Wild-type (WT), ACTH1, ACTH2 and ACAR1 cultures were stimulated with dibucaine and the released mucocysts were purified by several rounds of pelleting and resuspension, as described in Materials and Methods section. The final pellets were suspended in SDS sample buffer and samples were resolved by 4-20% SDS-PAGE. Protein bands were visualized by Coomassie blue staining. [0039] FIG. 15A-15E - Rescue experiment ~ Expression of Cth3p-CFP in ACTH3 cells. Cells were treated with ^g/ml CdCl2 for 16h unless otherwise indicated. ACTH3 cells, expressing wild type Cth3p-CFP (Re-WT) were treated with ^g/ml CdCl2 for 2h (A) or 16h (B). Cell lysate of 20,000 were separated by 4-20% SDS-PAGE and blot probed with monoclonal anti GFP antibody. (C) After induction, cells were fixed and immunolabeled with rabbit anti GFP antibody or (D) MAb 5E9 antibody. (E) Western blot samples were prepared from WT and ACTH3 cells (expressing wild type Cth3p-CFP) after CdCl2 induction. Cell lysate of 10000 were separated by SDS-PAGE and blot was probed with anti Grllp antibody as before.
[0040] FIG. 16 - A maximum likelihood phylogeny of the Ciliate CTHl-4 shown in Figure 8, together with the most highly related homo logs (a judged by BLAST scores) present in a variety of organisms from the other major eukaryotic lineages.
[0041] FIG. 17 - Expansion of the Carboxypetidase family in Ciliates — A maximum likelihood tree illustrates a phylogeny of Carboxypetidase in Ciliates.
[0042] FIG. 18A-18C ~ Expression profiling suggests a role for sortilin-family receptors in mucocyst biogenesis in Tetrahymena. (A) Sortilins and AP-3 subunits are coexpressed with genes encoding mucocyst contents in T. thermophila. The expression profiles of the four Tetrahymena sortilins (SOR1-4), and of two subunits of the
heterotetrameric AP-3 adaptor complex, are similar to those of genes (GRL1 and GRT1) encoding mucocyst cargo proteins. Expression profiles are derived from the Tetrahymena Functional Genomics Database (available on the world wide web at tfgd.ihb.ac.cn), with each profile normalized to that gene's maximum expression level. Points on the x-axis correspond to successive time -points and represent growing, starved, and mating cultures, including 3 different culture densities (low (LI), medium (Lm), and high (Lh)), 7 samples taken during 24 hours of starvation, and 10 samples subsequently taken during 18 hours following conjugation. (B) Expansion of the sortilin family in Ciliates. The maximum likelihood tree illustrates a phylogeny of VPS 10 domain-containing receptors (sortilins) in Alveolates, the taxonomic group consisting of Ciliates, Apicomplexans, and dino flagellates. Two of the T. thermophila sortilins, marked by black circles, cluster with the sortilins from other Alveolates. In contrast, T. thermophila SOR2 and SOR4, marked by maroon diamonds, belong to an expansion of sortilins restricted to Ciliates. Fig. Key: Babesia microti (Bm), Cryptosporidium hominis (Ch), Cryptosporidium muris (Cm), Ichthyophthirius multifiliis (Im), Neospora caninum (Nc), Paramecium tetraurelia (Pt), Perkinsus marinus (Pm), Plasmodium berghei (Pb), Plasmodium cynomolgi (Pc), Plasmodium falciparum (Pf), Plasmodium knowlesi (Pkj, Plasmodium vivax (Pv), Plasmodium yoelii yoelii (Py), Tetrahymena thermophila (Tt), Theileria annulata (Ta), Theileria orientalis (To), Theileria parva (Tp), Toxoplasma gondii (Tg). See Fig. 24 and Table 8 and 9 for a list of accession numbers for all sequences. (C) Verification of the non-essential sortilin knockouts. cDNA was prepared from WT, Asorl, Asor2, and Asor4 cells, and the SOR1, SOR2 and SOR4 sequences were PCR amplified using gene-specific primers. As shown in this 1% ethidium bromide stained agarose gel, each of the gene knockout lines lacks the amplified product corresponding to the targeted gene, but shows WT levels of the other transcripts that serve as loading controls. The lanes shown were all part of a single gel, but their order has been rearranged for this figure.
[0043] FIG. 19A-19E ~ Sortilin 4 is required for the sorting of Grtlp, a member of the Granule tip family of mucocyst cargo proteins. (A) Grtlp localizes to a subdomain of mucocysts, while Grl3p is found through the mucocyst core. Grl3p and Grtlp in WT cells were simultaneously visualized using mAbs (5E9 and 4D11, respectively) directly conjugated to two different fluorophores. Visualization along the long mucocyst axis (demonstrated best in a cross section of the cell, illustrated by the red plane in the cartoon at the top for reference) demonstrates that Grtlp is concentrated at the pole where docking occurs (right
panels). (B) Grtlp is mis-targeted in Asor4 cells. Immuno localization of Grtlp in WT cells (top, left) shows that Grtlp accumulates in the expected array of docked mucocysts at the surface (illustrated by the red plane in the cartoon at the top), and the same pattern is seen in Asor2 cells (top, right). Grtlp was visualized using mAb 4D11. In contrast, there is only background staining of Grtlp in Asor4 cells, comparable to the signal in Agrtl/Agrt2 cells that lack the mAb target entirely (bottom panel). Images of Asor4 and Agrtl/Agrtl cells were auto adjusted to show the cell outlines. The scale bars represent 5 um. (C) Grtlp is absent from Asor4 cells. Western blotting of whole cell lysates, using polyclonal anti-Grtlp antiserum, confirms the defect in Grtlp accumulation in Asor4 relative to WT. (D) Biochemical interaction betweenSor4p and Grtlp: coprecipitation of Sor4p and Grtlp. Sor4p was immunoprecipitated using anti-GFP antiserum from lysates of cells that express Sor4p- GFP from the endogenous SOR4 locus, and that were actively synthesizing new mucocysts. Immunoprecipitated samples were analyzed by Western blotting with anti-GFP antiserum (left), confirming that full-length Sor4p-GFP is expressed, and with anti-Grtlp antiserum (right) to show co-precipitation of Sor4p. (E) Sor4p-GFP localizes to mobile cytoplasmic vesicles but not to docked mucocysts. A frame from Video 1, in which Sor4p-GFP was tracked in immobilized live cells. Sor4p-GFP is present in mobile cytoplasmic puncta and not present in docked mucocysts. The grey line traces the approximate outline of the cell.
[0044] FIG. 20A-20C ~ Asor4 cells are defective in regulated exocytosis and in sorting of a 2nd Grt family protein. (A) A qualitative assay for mucocyst discharge. Individual Tetrahymena cells, fixed and photographed after treatment with the secretagogue Alcian blue. The wildtype cell (left) is surrounded by a translucent capsule made up of the released contents of exocytosed mucocysts. In contrast, Asor4 cells (right) never form visible capsules following stimulation. Images are DIC micrographs. (B) A semi-quantitative assay for mucocyst discharge. Identical numbers of WT and Asor4 cells were stimulated with dibucaine, and immediately centrifuged. The wildtype culture produces a two-layer pellet, in which a thick layer of flocculent (below the dashed line) resulting from mucocyst discharge sits atop of the packed cells (below the dotted line). Stimulated Asor4 cultures, in contrast, produce no flocculent layer. Stimulated Asorl cultures generate an intermediate amount of the mucocyst-derived flocculent. (C) Asor4 cells show defective sorting to mucocysts of a 2nd Grt family protein, Igrlp. Igrlp-GFP, expressed from an inducible promoter, accumulates in docked mucocysts in WT cells (left), but is absent from the periphery of
Asor4, instead found in small highly mobile cytoplasmic puncta. Images are of GFP auto fluorescence in live, immobilized cells.
[0045] FIG. 21A-21D ~ Grl protein sorting to mucocysts, though not subsequent proteolytic processing, is independent of SOR4. (A-B) Grl3p localizes to mature mucocysts in the absence of Sor4p. Localization of Grl3p, one of a family of proteins that assembles to form the mucocyst core, in WT, Asor2, and Asor4 cells. Grl3p was visualized by indirect IF using mAb 5E9. At the cell surface (A) (illustrated by the red plane in the cartoon at the top and in the DIC micrographs to the left), Grl3p can be seen localized to mucocysts in both WT (top panel) and Asor4 (bottom panel) cells. When seen in cross section (B) the mucocysts of Asor4 cells appear roughly spherical, in contrast to the elongated WT mucocysts (compare bottom insets of IF panel). Asor2 mucocysts show an intermediate morphology. Bar = 5 μιη. (C) Ultrastructure of Asor4 mucocysts. Electron micrographs of docked mucocysts (labeled *) in WT (top), and Asor2 and Asor4 cells (bottom). The mucocyst cores in Asor2 and Asor4 cells do not contain the visible lattice that is characteristic of WT mucocyst cores. Bar = 200nM (D) Grl pro-protein processing is defective in Asor4 cells. Whole cell lysates of WT and Asor4 cells were separated by SDS-PAGE and Western blotted with an antibody against Grllp, which undergoes proteolytic processing during mucocyst maturation. In WT cells, Grllp accumulates primarily in its fully processed form. In Asor4 cells, most Grllp remains as an incompletely processed precursor. The unprocessed and processed forms of Grllp are indicated by arrows.
[0046] FIG. 22A-22B— Cth3p, an aspartyl protease, is targeted to mucocysts in a
Sor4pdependent manner. Cth3p-CFP was inducibly expressed with 0.75 μg/mL CdC12 for 2 hrs in WT and Asor4 cells. Cth3p-CFP was localized in fixed, permeabilized cells using a polyclonal anti-GFP antibody, and endogenous Grl3p was immunolocalized using mAb 5E9. (A) Cth3p-CFP expressed in WT cells colocalizes with Grl3p in mucocysts at the cell periphery (top panel). By contrast, Cth3p-CFP expressed in Asor4 cells shows reduced co- localization with Grl3p (middle panel). Bar = 5 μιη (B) Cth3p-CFP shows reduced co- localization with Grl3p in Asor4 vs. WT cells. Co-localization was quantified in 15 WT and Asor4 cells, using the Manders' correlation coefficient M2, and then an average M2 value for each population was determined from the sample. Reduced colocalization was observed whether measuring all puncta (M2 values for WT: ean=0.615, SEM=0.036; for Asor4: =0.337, SEM=0.049) (P<0.01 as determined by one-tailed t-test) or the subset near the cell
periphery, which is enriched in docked mucocysts ( WT: =0.731, SEM=0.036; Asor4: =0.373, SEM=0.054). (P<0.01). (right chart). Details of the image analysis are provided in Materials and Methods, and a range of representative images is shown in Fig. 27.
[0047] FIG. 23A-23B ~ Generation of the sortilin knockouts. (A) Schematic of the SOR4 knockout construct. Replacement of the entire SOR4 genomic locus with the neo4 drug resistance cassette is facilitated by homologous recombination. An identical strategy was used for the remaining sortilins. A detailed description of the construction and use of the SORI-4 knockout constructs can be found in the Experimental Procedures. (B) Knockout of non-essential sortilins does not impair cell growth. A table of the average doubling times calculated from five measurements of culture density (3 measurements for Asorl), each after 3 hour periods of growth, indicating similar growth rates for the WT and mutant lines.
[0048] FIG. 24 ~ The Tetrahymena sortilins fall into two major groups. A maximum likelihood phylogeny of the Ciliate VPS 10 domains shown in Figure 1A, together with the most highly related homologs (as judged by BLAST scores) present in a variety of organisms from the other major eukaryotic lineages. VPS 10 domain-containing genes appear to have been entirely lost in numerous organisms including Arabidopsis thaliana and Drosophila melanogaster. In some Fungi, VPS 10 domains are present as tandem repeats, depicted as hi and h2. Figure Key: Aspergillus nidulans (An), Coccomyxa subellipsoidea (Cs), Daphnia pulex (Dap), Dictyostelium discoideum (Dd), Dictyostelium fasciculatum (Df), Dictyostelium purpureum (Dp), Homo sapiens (Hs), Ichthyophthirius multifiliis (Im), Micromonas pusilla (Mp), Micromonas sp. RCC299 (Mr), Mus musculus (Mm), Naegleria gruberi (Ng), Naumovozyma castellii (Nac), Ostreococcus lucimarinus (01), Ostreococcus tauri (Ot), Paracoccidioides brasiliensis (Pab), Paramecium tetraurelia (Pt), Polysphondylium pallidum (Pp), Punctularia strigosozonata (Ps), Saccharomyces cerevisiae (Sc), Tetrahymena thermophile (Tt), Trichoplax adhaerens (Tra), Xenopus (Silurana) tropicalis (Xt), Yarrowia lipolytica (Yl). See also Table 9 for a list of accession numbers for the sequences used to assemble this phylogeny.
[0049] FIG. 25A-25D ~ Asorl is not essential for mucocyst formation and secretion. (A) As in FIG 20B, a semi-quantitative assay for mucocyst discharge. Identical numbers of WT and Asorl cells were stimulated with the secretagogue dibucaine, and immediately centrifuged. The wildtype culture produces a two-layer pellet, in which a thick layer of flocculent (below the dashed line) resulting from mucocyst discharge sits atop of the
packed cells (below the dotted line). Similar to the wildtype, stimulated Asorl cultures still produce a prominent flocculent layer. (B) As in Figure 19B, Grtlp properly localizes to mature mucocysts. Localization of Grtlp by IF shows the expected array of docked mucocysts at the surface (illustrated by the red plane in the cartoon at the top) of WT (left) and Asorl cells (right). The scale bars represent 5 μιη. (C) As in Figure 2 IB, GrBp localizes to mature mucocysts. Visualization of mucocysts in WT and Asorl cells, by indirect immunofluorescence (IF) using mAb 5E9 against GrBp, one of a family of proteins that assemble to form the mucocyst core. As seen in cross section the mucocysts of Asorl cells appear similar to the WT. (D) As in Figure 21C Asorl cells produce mucocysts similar to those in WT. Electron micrographs of docked mucocysts (labeled *) in WT (left) and Asorl (right) cells. Bar = 200nM.
[0050] FIG. 26 ~ The addition of a C-terminal GFP tag to endogenous Sor4p does not impair Sor4p function, as judged by mucocyst secretion. As in Fig. 20B, identical numbers of WT and SOR4-GFV cells were stimulated with dibucaine and immediately centrifuged. A two-layer pellet was observed for both samples, consisting of an upper flocculent layer (below the dashed line) and lower cell pellet (below the dotted line). Similar amounts of flocculent are secreted by the SOR4-GFV and WT lines, demonstrating that SOR4-GFV cells do not show a Asor4 phenotype and that Sor4p-GFP can provide wildtype Sor4p function in mucocyst formation. [0051] FIG 27 ~ Sorting efficiency of the exogenously expressed mucocyst protease Cth3p-CFP is reduced in Asor4 cells. As in Figure 22A, Cth3p-CFP was inducibly expressed with 0.75 μg/mL CdC12 for 2 hours. Cth3p-CFP was localized in fixed, permeabilized cells using a polyclonal anti-GFP antibody, and endogenous GrBp was immunolocalized using mAb 5E9. Co-localization was quantified in 15 Asor4 cells, using the Manders' correlation coefficient M2, and then an average M2 value was determined for the population from this sample. The average M2 value at the cell periphery for the population is 0.373 with a SEM of 0.054. A range of sample M2 values is shown as indicated in the lower left corner of the merged image. Bar = 5 μιη
[0052] FIG. 28 — Analysis of the Tetrahymena genome indicates that it codes four sortilin/VpslO genes. Diagram shows the homology between the four sortilin genes (Tt SOR1-4) and structurally related genes.
[0053] FIG. 29A-29H. Mucocyst formation, proGRL processing, and in vitro enzymatic activity require the conserved active site residues in Cth3p. (A) Schematic representation of wildtype and mutant Cth3p, both with C-terminal GFP tags, showing locations of mutations to change Asp→Asn at the two predicted catalytic sites. (B) Expression of GFP-tagged and Asp→Asn, GFP-tagged constructs (cth3-4 and cth3-5, respectively). Constructs were expressed at the native CTH3 locus, as gene replacements. Fusion proteins were immunoprecipitated from detergent lysates using polyclonal rabbit anti- GFP antiserum. Immunoprecipitates were subjected to SDS-PAGE, and PVDF transfers blotted with monoclonal anti-GFP Ab. Both of the transformed cell lines, but not wildtype, show immunoreactive bands of the size expected for the Cth3p-GFP fusion, as well as a band likely to correspond to monomeric GFP. (C) proGrl processing in wildtype and mutant cell lines. Cell lysates (104 cell equivalents) were separated by SDS-PAGE and blotted with anti- Grllp antibody. Wildtype and cth3-4 cells accumulate processed Grllp. In contrast, Acth3 cells and cth3-5 cells accumulate proGrllp. (D) The mucocyst discharge assay was performed on cell lines analyzed in panel C. Wildtype cells and cells expressing cth3-4p release a flocculent layer (between the solid and broken lines) after stimulation with secretagogue, while Acth3 cells and cells expressing cth3-5p show no release upon stimulation. (E and F) Immunostaining of fixed cells to visualize mucocyst protein Grl3p and GFP-fusion proteins. In panel E, wildtype cells and cells expressing cth3-4p show the expected pattern of Grl3p in docked mucocysts, while cells expressing cth3-5p show chiefly cytoplasmic puncta. In panel F, wildtype cells show background signal, while cells expressing cth3-4p show labeling consistent with extensive localization of the GFP-fusion protease to mucocysts. In contrast, cth3-5p localizes largely in cytoplasmic puncta. The scale bars represent 10 μιη. Enzymatic activity of purified Cth3p. (G) 150 ml cell cultures of T. thermophila expressing cth3-4p or cth3-5p (3xl05/ml) were washed and solubilized with detergent, and GFP-tagged fusion proteins were immunoprecipitated using bead-coupled polyclonal rabbit anti-GFP antiserum. After extensive washing, beads were resuspended in assay buffer. To roughly compensate for the difference in IP yields between cth3-4p and cth3-5p, the bead volume used for the former was half that used for that latter (10 vs 20 μΐ) in a total reaction volume of 100 μΐ. The results are plotted as RFU±SD versus time. Bovine cathepsin D (10 ng) was assayed in parallel, as a positive control (inset). (H) SDS-PAGE and Western blotting, using anti-GFP mAb, of IP preparations (10 μΐ cth3-4p and 20 μΐ cth3-5p beads) assayed in panel G.
[0054] FIG. 30A-30B. Localization and secretion of wild type and enzymatically disabled Cth3p-GFP. (A) High density cultures of cells were washed twice with lOmM Tris (pH 7.4) and starved for 4h in lOmM Tris (pH 7.4). Cell-free supernatants were precipitated with TCA and processed for SDS-PAGE and western blotting, using mAb anti GFP. GFP- tagged wild type Cth3p (cth3-4p), but not the tagged enzymatically disabled variant (cth3- 5p), is secreted into the culture medium. (B) Tetrahymena expressing wild type (cth3-4p) and enzymatically disabled (cth3-5p) GFPfusions, at the endogenous loci, were imaged to capture cell surface sections and crosssections in PEO-immobilized cells. Cells expressing cth3-4p show the expected regular array of docked granules. Reflects the highly organized cortex of these cells while cell cross section on the right hand demonstrates that virtually all granules are docked in wild type cth3-4p. In contrast, cells expressing enzymatically disabled cth3-5p showed a small number of irregularlyarranged puncta at the cell surface, and few or no docked mucocysts in cross sections.
[0055] FIG. 31A-31D. Expression of enzymatically disabled cth3p-CFP (cth3-3p) does not rescue \cth3 defects. (A) Schematic representation of wildtype Cth3p and cth3-3p variant, which has Asp→Asn mutations at the two predicted catalytic sites and a C-terminal CFP tag. (B) cth3-3p was expressed under the control of the MTT1 promoter in Acth3 cells. Expression was induced with ^g/ml CdC12 for 2h and lysates (2xl04 cell equivalents/lane) were separated by 4-20% SDS-PAGE and Western blotted with monoclonal anti GFP antibody. After 2h of induction, a band of the expected size for the fusion protein is seen (marked by arrowhead). A non-specific band, also seen in WT controls, is marked with an asterisk. (C) Cell lysates (lxlO4 cell equivalents/lane) of WT, Acth3, and Acth3 cells expressing cth3-3p (16h induction) were separated by SDS-PAGE and Western blotted with anti-Grllp antibody. Processed Grllp accumulates in WT cells, but not in Acth3 cells or Acth3 cells expressing cth3-3p, both of which accumulate the Grllp precursor. (D) After 16h induction, Acth3 cells expressing mutant cth3-3p were fixed, permeabilized, and immunolabeled with anti-Grl3p mAb, followed by 2° fluorophorecoupled Abs. No mucocysts are visible in these cells, and instead Grl3p is principally seen in large cytoplasmic puncta.
[0056] FIG. 32A-32C. Non-mucocyst-localized Cth3p shows some overlap with endosomal and lysosomal markers. In all panels, cth3p-GFP (cth3-4p) is expressed at the native CTH3 locus, and GFP autofluorescence was imaged in live cells. Optical sections shown are cell cross sections. (A) Cth3p shows variable localization depending on cell culture density. Cell cultures were sampled at low (l-1.5xl05/ml), medium (2.5-3.5xl05/ml
and high (5-6.5xl05/ml) density. An increasing number of heterogeneous cytoplasmic puncta are seen in cells from denser cultures. (B) Cells from a culture at 6xl05/ml were incubated for 5min with 200nM Lysotracker. Live images were captured within 30min after addition of Lysotracker. (C) Cells from a culture at 6xl05/ml were incubated for 5min with 5μΜ FM4- 64, which labels endosomes, and then pelleted and resuspended in fresh medium. The times shown represent minutes post resuspension. The scale bars represent 10 μιη.
[0057] FIG. 33A-33C. The growth defect in Acth3 cells is suppressed by culturing in medium conditioned by wildtype cells and cells overexpressing cth3p-CFP. (A)
Wildtype and Acth3 cells were inoculated into medium previously harboring either wildtype or Acth3 cultures. The final culture density is shown for each condition. The lowest cell concentration is seen for ActhS cells in Acth3 conditioned medium, but this is significantly increased when Acth3 cells are grown in wildtype conditioned medium. Wildtype cells show a slight but significant decrease in final density when cultured in ActhS conditioned medium. The same differences in growth rates between cultures were also seen at intermediate culture densities, based on the measurements taken during culture growth (not shown). (B) Wildtype cells were inoculated, as above, into medium previously harboring either wildtype or Acth3 cultures. Acth3 cells were similarly inoculated, but also into a series of mixtures of WT and Acth3 conditioned media, at the ratios shown. Final culture densities are shown for each condition. The results are qualitatively similar to those in (A). The results also suggest that the rescuing factor(s) in WT conditioned medium act in a concentration-dependent fashion, since growth rescue of Acth3 cells is lessened when WT conditioned medium is diluted with Acth3 conditioned medium. (C) Acth3 cells were inoculated into media previously harboring either wildtype, Acth3, or cells overexpressing cth3p-CFP (cth3-lp). Cells were inoculated to reach a final density of ~5xl05/ml, assuming a 2.5h doubling time. Final culture densities are shown. Wildtype conditioned medium provided partial rescue of the Acth3 growth defect, and stronger rescue was provided by medium conditioned by cells overexpressing cth3-lp.
[0058] FIGS. 34A-34E. Expression of cth3p-6xHis rescues proGrl processing and mucocyst formation in the SB281 mutant. (A,B) Induced expression of cth3p-6xHis in SB281 cells. cth3p-6xHis was expressed under the control of the MTT1 promoter, and cultures were induced for 6h by adding CdC12 at the concentrations shown. Cell lysates (3x104 cell equivalents/lane) were separated by SDS-PAGE and Western blots were probed with anti-Grllp antibody (A) or anti-Grl3p antibody (B). Cells were fixed and immunolabeled after 6h CdC12 (2μg/ml) induction. (C) Mucocysts in fixed wildtype cells
were immunolabeled using mAb 5E9 (anti-Grl3p) (left panels) and mAb 4D11 (anti-Grtlp) (right panels). (D, E) SB281 and SB281 cells expressing cth3p-6xHis were immunostained with (D) mAb 5E9 and (E) mAb 4D11. Shown are surface sections.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS [0059] In Tetrahymena thermophila and other ciliates, subsets of newly synthesized polypeptides are targeted to dense core secretory granules, from which they are secreted via regulated exocytosis. Core assembly occurs during granule maturation, in which the best characterized feature is site-specific proteolytic processing of DCG cargo proteins (Urbe et al, 1997). Proteins destined for regulated secretion are synthesized as preproproteins that contain a signal peptide and a separate cleavable prosequence. First, these preproproteins are cleaved by signal peptidase in the ER (endoplasmic reticulum), but the location of the remaining maturation, or proprotein processing, varies both temporally and physically. (Burgess and Kelly, 1987; Tooze, 1991).
[0060] In many ciliates, the granule cores consist of highly organized protein crystals that undergo spring-like expansion upon exocytosis (Sperling et al, 1987). This expansion can drive rapid extrusion of the DCG contents, which may be essential for hunting or defensive behaviors (Harumoto and Miyake, 1991). The proteins that form the granule cores are encoded by homologous families of genes named GRL (granule lattice) in Tetrahymena (Collins and Wilhelm, 1981; Maihle and Satir, 1986; Verbsky and Turkewitz, 1998) and tmp (trichocyst matrix) in Paramecium (Steers et al, 1969; Tindall et al, 1989; Shih and Nelson, 1991; Madeddu et al, 1995).
[0061] The animal and ciliate DCVs have few identified molecular components but share a striking number of biochemical and cell biological features (Turkewitz, 2004). Like many DCV proteins in animals, the most abundant ciliate DCV cargo proteins undergo self- aggregation that is important for their sorting both at the TGN and during maturation; the latter, as in animal DCVs, depends on proteolytic processing of cargo proproteins (Adoutte, 1988; Collins and Wilhelm, 1981; Turkewitz, 2004). In Tetrahymena, proteins in the Grl (Granule /attice) family form obligate heterooligomers in the endoplasmic reticulum (Cowan et al., 2005) and then much larger aggregates while en route through the secretory pathway (Rahaman et al., 2009). The aggregates are then reorganized during DCV maturation to form a crystalline dense core, a process involving extensive proteolytic processing of core proteins (Cowan et al, 2005; Verbsky and Turkewitz, 1998). DCV proteins in Paramecium, called
tmps, as well as in other ciliates that have been studied, show similar behavior (Madeddu et al, 1995), including forming large aggregates during sorting (Garreau de Loubresse, 1993; Peck et aL, 1993).
I. Ciliates
[0062] The embodiments may be practiced with a variety of different ciliates which include secretory granules called mucocysts. Heterologous polypeptides can be targeted to these secretory granules by encoding fusion proteins of the desired heterologous polypeptide and an appropriate targeting sequence. After exposing the ciliate to a secretory stimulus that causes the mucocysts to discharge their contents to the extracellular environment, the heterologous polypeptide can be recovered from the resulting matrix and medium. The mucocyst cargo proteins belongs to two multigene families, called GRL (for granule lattice) and GRT (for granule tip). The GRL proteins constitute the dense core, and undergo extensive proteolytic processing during mucocyst maturation.
[0063] The free-living ciliate protists are a large and diverse phylum (Ciliata) whose members display a structural and functional complexity comparable to that of higher metazoa (Fankel (2000); Turkewitz et al. (2002)), and include over 7,000 species with 11 major subdivisions. Tetrahymenids and Paramecium belong to the Oligohymenophoreans. Ciliates that include mucocysts useful in the invention include Tetrahymena species such as Tetrahymena thermophila and Tetrahymena pyriformis. Paramecium has dense core granules but does not secrete a proteinaceous gel. Both Tetrahymena thermophila and Tetrahymena pyriformis produce mucocysts, and both secrete a proteinaceous gel.
[0064] Tetrahymena spp. are amenable to genetic manipulation, can be grown on a large scale and have a doubling time of 1.5-3 hrs. Unlike T. thermophila, which has an optimal growth temperature of 35°C, the optimal growth temperature for T. pyriformis is lower (maximal growth temperature of 34°C). Cells reach high-density in a short time on a variety of inexpensive media and can be expanded for growth in bioreactors up to several thousand liters in size (Hellenbroich et al. (1999); de Coninck et al. (2000)). Methods for transformation, along with robust, inducible promoters for driving high-level gene expression have recently been described for this system (Bruns and Cassidy-Hanley (2000); Gaertig and Kapler (2000); Shang et al. (2002); Boldrin et al. (2006)).
[0065] Tetrahymena spp. devote a large part of their metabolism to membrane protein production due to the hundreds of cilia that extend from its surface (Williams et al. (1980)).
Additionally, Tetrahymena spp. lack a cell wall and display high-mannose N-glycan protein modifications that lack branched, immunogenic structures (Taniguchi et al. (1985); Becker and Rusing (2003); Weide et al. (2006)). Glycosylation patterns of secreted proteins in Tetrahymena spp. are uniform and consist of high-mannose N-glycan structures comprising Man3GlycNac2 core N-glycans similar to those which are produced in the endoplasmic reticulum of mammalian cells.
[0066] This glycosylation pattern is unlike the glycosylation pattern produced in other microbial systems. For example, such glycosylation is non-existent in bacteria, and is highly branched and immunogenic in fungi. II. Genetic Alteration of Ciliates
[0067] Methods for genetic alteration of ciliates are well known in the art and may be used in accordance with the instant embodiments. For example, ciliates can be transformed with vectors that express nucleic acid to disrupt expression of a SOR gene (such as siRNAs). In some aspects, the ciliates is transformed with a vector to disrupt an endogenous SOR gene (e.g., by generating an insertion of deletion in a genomic copy of the gene). In still further aspects, a ciliate can be transformed with a vector for the expression of heterologous polypeptides, such as peptides that will be harvested from the cells.
[0068] Certain aspects of the embodiments concern ciliates that lack detectable expression (or have reduced expression) of one or more SOR gene product corresponding to SOR1, SOR2, SOR3 or SOR4. In some aspects the SOR gene product is an RNA at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SOR1 (SEQ ID NO: 2), SOR2 (SEQ ID NO: 4), SOR3 (SEQ ID NO: 6) or SOR4 (SEQ ID NO: 8). In a further aspect, the SOR gene product is an polypeptide at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SOR1 (SEQ ID NO: 1), SOR2 (SEQ ID NO: 3), SOR3 (SEQ ID NO: 5) or SOR4 (SEQ ID NO: 7). In yet further aspects the SOR gene product is an polypeptide comprising at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 or 900, contiguous amino acids identical to the amino acid sequence of SOR1 (SEQ ID NO: 1), SOR2 (SEQ ID NO: 3), SOR3 (SEQ ID NO: 5) or SOR4 (SEQ ID
NO: 7). In some specific aspects, the gene product corresponding to SORl, SOR2, SOR3 or SOR4 is one of the gene products listed in the NCBI accession numbers of FIG. 28, each of which is incorporated herein by reference. Thus, in some aspects, a ciliate of the embodiments comprises an insertion or a deletion in such a gene corresponding to Tetrahymena SORl, SOR2, SOR3 and/or SOR4. In yet further aspects, a ciliate can comprise an expression cassette encoding a polynucleotide (e.g., a dsRNA, siRNA, shRNA or miRNA) complementary to all or part of an RNA corresponding to a Tetrahymena SORl, SOR2, SOR3 and/or SOR4 RNA.
[0069] Certain aspects of the embodiments concern ciliates that lack detectable expression (or have reduced expression) of one or more gene products corresponding to CTH1, CTH2, CTH3, CTH4, or CARL In some aspects the gene product is an RNA at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the sequence of CTH1, CTH2, CTH3, CTH4, or CAR1 as listed in the Table below. In a further aspect, the gene product is an polypeptide at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of CTH1, CTH2, CTH3, CTH4, or CAR1 as listed in the Table below. In yet further aspects the SOR gene product is an polypeptide comprising at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890 or 900 (or any range derivable therein) contiguous amino acids identical to the amino acid sequence of CTH1, CTH2, CTH3, CTH4, or CAR1 as listed in the Table below. Thus, in some aspects, a ciliate of the embodiments comprises an insertion or a deletion in such a gene corresponding to Tetrahymena CTH1, CTH2, CTH3, CTH4, and/or CARl . In yet further aspects, a ciliate can comprise an expression cassette encoding a polynucleotide (e.g., a dsRNA, siRNA, shRNA or miRNA) complementary to all or part of an RNA corresponding to a Tetrahymena CTH1 , CTH2, CTH3, CTH4, and/or CARl RNA.
cDNA se uences
amino acid se uences
Transformation
[0070] Genes can be introduced into ciliates using established protocols or any method known to one skilled in the art. Transformation of ciliates can be achieved by microinjection (Tondravi and Yao (1986)), electroporation (Gaertig and Gorovsky (1992)), or biolistically (Cassidy-Hanley et al. (1997)).
[0071] Thus, in some embodiments, ciliate cells can be transformed with a chimeric gene by particle bombardment (also known as biolistic transformation) (Cassidy-Hanley et al. (1997)). Particle bombardment transformation can be achieved by several ways. For example, inert or biologically active particles can be propelled at cells under conditions effective to penetrate the outer surface of the cell and to be incorporated within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the chimeric gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Other variations of particle bombardment, now known or hereafter developed, can also be used. [0072] Microcarrier bombardment can also be used to transform ciliate cells by means of DNA-loaded gold particles (US Pat. No. 6,087,124; European Pat. EP 847 444; WO 1998/001572). In this approach, microcarrier bombardment with DNA-coated gold is used as a means of introducing foreign genes into ciliates. In one embodiment, microcarrier bombardment can be used to transform ciliates and introduce genes into the (germline) micronucleus
[0073] Methods for selection of transformed cells harboring foreign genes are known in the art. For example, the vector can further comprise a selectable cassette marker to permit selection for transformed cells {e.g., a neo 2 cassette) (Gaertig et al. (1994)).
[0074] Selection of transformants can be achieved by growing the cultured ciliates in a medium which allows only the transformants to survive. Suitable selection agents include antibiotics which will kill most all non-transformants but allow transformants (which also possess an antibiotic resistance gene) to survive. A number of antibiotic-resistance markers are known in the art. Any known antibiotic-resistance marker can be used to transform and select transformed host cells in accordance with the present invention. For example, selection of the transformants can be performed by means of a resistance marker such as a point mutation in the 17s rDNA, which confers resistance to paromomycin, can allow for selection of rDNA transformants (Spangler and Blackburn (1985); Bruns et al. (1985)). Other methods
include the use of a mutant cell line that allows targeting of genes to the beta tubulin- 1 locus of T. thermophila by homologous recombination, and allows efficient selection of transformed cell lines by growth in the microtubule-stabilizing agent (taxol) (U.S. Pat. No. 6,846,481). Another method for selection of transformed cells harboring foreign genes is to insert full length coding regions into the pD5HA vector (Cowan et al. (2005)). In this method, transcription is driven by the inducible MTTl promoter. Once cells have been transformed with the pD5HA vector selection of positive transformants is determined by paromomycin resistance (i.e., cell growth in media containing the drug). Presence of the transgene is then verified by PCR and then induced with cadmium chloride to over-express the recombinant gene product.
[0075] Many other selectable marker systems are known in the art. Selectable marker genes that confer resistance or tolerance to a normally toxic selection agent allow only successfully transfected cells to survive in the presence of the selection agent, and are referred to as positive selectable markers. Examples of positive selectable marker genes and their corresponding selection agents are: aminoglycoside phosphotransferase (APH) and G418; dihydro folate reductase (DHFR) and methotrexate (Mtx); hygromycin-B- phosphotransferase (HPH) and hygromycin-B; xanthine-guanine phosphoribosyltransferase (XGPRT) and mycophenolic acid; and adenosine deaminase (ADA) and 9-P-D-xylofuranosyl adenine (Xyl-A). In another example of a positive selectable marker system, thymidine kinase (TK) and aminopterin (included, e.g., in hypoxanthine-aminopterin-thymidine (HAT) medium) can be used in cells that are initially thymidine kinase deficient (tk~). The aminopterin will normally kill tk~ cells and, therefore, only successful TK transfectants will survive. Selectable marker genes that confer sensitivity or susceptibility to a normally nontoxic selection agent cause only successfully transfected cells to die in the presence of the selection agent, and are referred to as negative selectable markers. An example of a negative selectable marker system is thymidine kinase (TK) and gancyclovir. Phenotypic selectable marker genes permit selection based upon morphological or biochemical traits rather than cell death or survival. In some cases, the phenotypic marker is detectable only in the presence of an additional selection agent. An example of a phenotypic selectable marker system is β- galactosidase (lacZ) and X-gal.
III. Vectors and Polypeptide Expression
[0076] Heterologous nucleic acids can be introduced into the ciliate host on an expression vector that is capable of integrating into the host's genome. For example,
expression vectors capable of homologous recombination with a highly expressed gene that is endogenous to the protozoan host, such as a P-tubulin gene are known in the art. Alternatively, a heterologous nucleic acid transformed into a ciliate can be maintained extrachromosomally on an autonomous plasmid. [0077] Expression vectors useful for transforming ciliates in accordance with the methods described herein include but are not limited to replacement vectors, rDNA vectors, and rDNA-based vectors. Replacement vectors accomplish DNA-mediated transformation by replacing or altering endogenous genes using homologous recombination. Integration of the heterologous nucleic acid into the host's genome at the targeted site is accomplished via homologous recombination involving a double crossover event with the vector containing the heterologous nucleic acid. An example of an expression vector useful for genomic incorporation of a heterologous nucleic acid by replacement is one that includes a heterologous coding sequence flanked by portions of the endogenous BTUl gene of Tetrahymena thermophila. [0078] A replacement vector can include a 5' region, followed by a heterologous coding region, followed by a 3' region, wherein at least a portion of each of the 5' and 3' regions is complementary to 5' and 3' regions on an endogenous gene of the host, to allow for genomic integration of the heterologous coding region via homologous recombination. The 5' and 3' regions of the vector can also comprise regulatory elements, such as a promoter and a terminator. The necessary regulatory elements can also be supplied by the endogenous gene into which the heterologous coding region integrates. Suitable regulatory regions include, but are not limited to promoters, termination sequences, signal peptides and proprotein domains involved in the expression and secretion of proteins. For example, such regulatory elements can provide efficient heterologous expression of proteins in Tetrahymena spp. under control of promoters and/or terminators which are derived from genes in Tetrahymena ssp. Such vectors can comprise naturally occurring promoters and/or terminators from proteins secreted at a high level in Tetrahymena ssp. The expression of recombinant polypeptides in Tetrahymena spp. can be driven by strong promoters, pre/pro sequences and terminators. In one embodiment, the promoters and/or terminators can be selected from proteins secreted at a high level independent of the cell-cycle in Tetrahymena spp. (US Patent Application 2006/0127973; WO2003/078566). Inducible promoters from Tetrahymena spp. genes have also been described that allow robust expression of foreign genes. For example, heat- inducible promoters of the heat shock protein family of the ciliate Tetrahymena spp. are also
suitable for use with the methods described herein. Suitable heat shock promoters from Tetrahymena spp. are known in the art (see WO2007/006812).
[0079] Methods for creating mitotically stable Tetrahymena spp. trans formants, for example, by integration of a heterologous gene by homologous DNA recombination, are known in the art. Methods for generating Tetrahymena spp. having targeted gene knockouts by homologous DNA recombination are also known in the art (Bruns and Cassidy-Hanley (2000); Hai et al. (2000); Gaertig et al. (1999); Cassidy-Hanley et al. (1997)). The somatic macronucleus or the generative micronucleus can be transformed in alternation. For example, sterile transformants, which may provide improved safety parameters, can be obtained with macronucleus transformation.
[0080] Expression vectors can also be maintained extrachromosomally in the ciliates.
An expression vector maintained as an extrachromosomal element can be a rDNA-based vector containing an ori from Tetrahymena spp. rDNA, which is known to support extrachromosomal replication. Such a vector can further comprise a 5' regulatory region from an endogenous Tetrahymena spp. gene containing a promoter region operably linked to the heterologous coding region and, optionally, a 3' regulatory region from the same or a different Tetrahymena spp. gene. For example, regulatory regions from ciliate genes in such vectors can include, but are not limited to, regulatory regions from genes such as HHFI, rpl29, BTU1, BTU2, SerH3, and actin. [0081] There are a number of suitable vectors suitable for transformation of ciliates known in the art. For example, Tetrahymena spp. can be transformed with an rDNA vector (Tondravi and Yao (1986); Yu and Blackburn (1989)). The shuttle vector pXS76 allows insertion of transgenes downstream of a cadmium-inducible promoter from the MTT1 metallothionein gene of T. thermophila via homologous recombination and selection in paromomycin. Alternatively, inserts can be introduced into high copy number ribosomal DNA vectors (such as pD5H8) under control of the cadmium-inducible MTT1 promoter. The pD5H8 vector takes advantage of a biological feature of Tetrahymena spp. in which the ribosomal cistrons become amplified to extraordinarily high copy numbers following conjugation. An rDNA-based vector can be a circular vector that contains a 5 ' non-translated sequence comprising two or more ori sequences from Tetrahymena spp. rDNA. A nucleic acid fragment containing a heterologous coding region, for example a selectable marker or transgene, can also be added to the vector. The vector can further comprise a 5' untranslated region of a Tetrahymena spp. gene and a 3' untranslated region of a Tetrahymena spp. gene,
inserted upstream and downstream of the selectable marker and/or the transgene. Methods for transformation, along with robust, inducible promoters for driving high-level gene expression have recently been described for this system (Bruns and Cassidy-Hanley (2000); Gaertig and Kapler (2000); Shang et al. (2002); Boldrin et al. (2006)). [0082] Sequence variations within the origins of replication of rDNA from wild-type
B- and C3- strains of T. thermophila convey a replicative advantage to the C3- form in B/C3 heterozygotes. Although both B- and C3- forms of rDNA are initially present in the macronucleus in approximately equal amounts, within 30 fissions only the C3 variant remains (Pan et al. (1982); Orias et al. (1988)). pIC19-based shuttle vectors containing the C3 origin of replication have been used as high-copy number vectors for the delivery of foreign DNA to Tetrahymena spp. (Yu and Blackburn (1989)) (Figure 5).
[0083] Although such vectors can become unstable and be lost within about 50 to about 80 generations, micronuclear versions of the C3 rDNA is accurately processed (to form a palindrome) following introduction into T. thermophila B cell lines. The micronuclear version is maintained as a stable linear chromosome over many generations (Bruns et al. (1985)). Functional transgenes can be inserted into the 3'-nontranscribed spacer (3'-NTS) of such vectors with no effect on rDNA processing. Within 6-10 generations, recombinant molecules can comprise 50-100% of the total rDNA complement, with as many as 18,000 copies of the transgene per cell (Blomberg et al. (1997)). The use of this approach enables an increase in the number of cloned genes in transformed cell lines by orders of magnitude and leads to increased expression at the protein level. For example, the use of rDNA-based vectors in combination with the MTT1 promoter can be used to drive expression of the endogenous granule lattice protein Grl Ip to approximately 20% of total cell protein (Lin et al. (2002)). Similarly, pD5H8 rDNA-based vectors (Blomberg et al. (1997)) can be used to boost expression of proteins by at least 3-10 fold compared with trans formants in which respective transgenes are integrated at somatic gene loci. Other vectors suitable for use with the methods described here include vectors comprising a ribosomal DNA sequence. Such vectors can replicate at high copy numbers and can be used to deliver a heterologous DNA sequence to Tetrahymena spp. for purposes of RNA expression. Heterologous Polypeptides
[0084] Suitable heterologous polypeptides for use with these methods include, but are not limited to, antibodies, antibody fragments, cytokines, growth factors, protein kinases, proteases, protein hormones or any fragment thereof. Similarly, the methods described herein
are suitable for the production of specialty proteins. The use of such specialty proteins can include, but is not limited to, prototype vaccines for animal model studies, structural studies, or as therapeutic proteins. For example, quantities of antigens can be produced according to the methods described herein. Isolation of Desired Polypeptides from the Mucocyst Matrix
[0085] In one aspect, the invention provides methods for protein purification from the extracellular matrix formed by the discharge of mucocysts. Because heterologous polypeptides targeted to the mucocyst compartment will be associated within the matrix, the invention provides matrix-based purification strategies. Advantageously, the matrix can be used for rapid purification of recombinant polypeptides associated with it.
[0086] Proteins within the gel matrix can be separated from cellular constituents by low-speed centrifugation (See Turkewitz et al. (2000)). Any other method known in the art suitable for separating intact cells, from the discharged material, including, but not limited to filtration harvesting using an appropriately selected mesh, can also be used in conjunction with the methods described herein. After isolation of the matrix, the desired heterologous polypeptide can be liberated from the secreted matrix gel. Methods for liberation of the protein can include chemical methods {e.g., high salt concentrations) and/or enzymatic methods {e.g., site-specific proteases).
[0087] Proteins can also be isolated in intact secretory granules. For example, the use of an exocytosis-defective mutant, MN 173, of T. thermophila where granules accumulate in the cytoplasm has been described for such purposes (Melia et al. (1998)).
IV. Examples
[0088] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1 - EXPRESSION PROFILING REVEALS CANDIDATES FOR PROPROTEIN PROCESSING ENZYMES IN T. THERMOPHILE.
[0089] The -25,000 genes of the T. thermophila macronuclear genome encode a large number of predicted proteases, including 43 aspartic proteases belonging to two families, 211 cysteine proteases belonging to 11 families, 139 metalloproteases belonging to 14 families, 73 serine proteases belonging to 12 families, and 14 threonine proteases (Eisen et al, 2006)(Coyne et al 2008)(unpublished). Many of these proteases have predicted signal sequences and are therefore likely to be secreted and/or function within digestive organelles, but a subset may be specialized for mucocyst biogenesis. To identify this last set, the inventors began with the previous observation that genes encoding several classes of mucocyst components are co-regulated under a variety of conditions (Haddad, Rahaman). The inventors used the online tools at TGD ( available on the world wide web at ciliate.org) to ask whether any genes that are annotated as proteases, are also co-regulated with GRL genes that encode the major mucocyst cargo. An example of such a query is shown in Table 1. At the same time, the inventors analyzed a microarray-based dataset to detect any predicted proteases that were up-regulated when Tetrahymena were induced to synthesize a new cohort of mucocysts, since the GRL genes were also known to be induced under these conditions Table 2. On the basis of these combined approaches, the inventors selected four cathepsins (CTHl-4) and one carboxypeptidase (CAR1), whose expression profiles are striking similar to those of GRL genes (Fig 1A) but distinct from those of other closely- related proteases (Fig IB).
Table 1 - Proteases, which are co-regulated with GRL genes
Table 2 - Proteases, which are up-regulated with GRL genes during regranulation of
DCGs.
[0090] Based on in silico analysis, all of the enzymes possess signal sequences that would direct translocation into the secretory pathway. Three of the four cathepsins {CTHl-3) belong to the aspartyl-protease subgroup, while CTH4 belongs to the cysteine-protease subgroup (Cathepsin C family). Another cysteine protease, cathepsin B, has previously been studied in Tetrahymena and shown to localize to food vacuoles (ref). The inventors added this gene in the analysis as an example of a non-mucocyst protease (ref). Both the aspartyl- and cysteine-protease cathepsins in Tetrahymena, as well as the carboxypeptidase, maintained the conserved catalytic motifs that are characteristic of their subfamilies. For the aspartyl proteases, these include two catalytic aspartic acid residues in the conserved motifs DTG/DTG or DTG/DSG (Fig 1C panel a). The cysteine proteases possess conserved triad catalytic residues (C,H,N) (Fig 1C panel b), while the Carlp sequence contains the predicted catalytic glutamate (E) at a conserved position (Fig 1C panel c). The conserved motifs could also be unambiguously assigned by primary sequence alignment with H. sapiens aspartic and cysteine proteases (Fig 8, 9). The phylogenetic relationships between the Tetrahymena proteases and a set of related enzymes from other eukaryotes is shown in Fig. 7 and S8. The aspartyl cathepsins CTHl-3 fall within a cluster of genes from Ciliates and the related Apicomplexan parasites, while the cysteine cathepsin CTH4 has clear homologs in more distantly related species including humans (Fig 7, 16). CAR1 has closely-related homologs in other ciliates (Ichthyopthirius and Paramecium) (Fig 17).
EXAMPLE 2 - LOCALIZATION OF GFP- TAGGED PROCESSING PROTEASE
CANDIDATES REVEALS MUCOCYST LOCALIZATION.
[0091] Tetrahymena mucocysts are elongated (1 x 0.2μιη) vesicles that dock at regularly arrayed sites at the cell periphery, from where the contents can be rapidly released by exocytic fusion upon stimulation. Since enzymes that act upon mucocyst proproteins might themselves localize to mucocysts, the inventors determined the localization of the candidate cathepsins and carboxypeptidase by expressing each as a Cyan Fluorescent protein (CFP) fusion controlled by a cadmium-inducible metallothionein (MTT1) promoter (ref). Overnight induction of all constructs resulted in clear mucocyst localization of CFP (Fig 2A, panel a-e). In contrast, cathepsin B, when expressed in the identical construct, localized primarily to food vacuoles, consistent with a prior report (Jacobs et ah, 2006) (Fig 2A, panel f). Taken together, the results suggest that each of the candidate proteases contains mucocyst targeting signals.
[0092] Interestingly, Western blotting of cell lysates from the clones sampled in Fig
2A, in which fusion protein expression had been induced overnight, suggested that the fusion proteins had themselves undergone proteolytic processing. That is, CFP immunoreactivity was detected predominantly in a band of the size expected for a CFP monomer rather than the sizes expected for the engineered fusion proteins (Fig 2B). To confirm that monomeric CFP was derived from a protein of the expected size, the inventors repeated the Western blotting analysis but with cells in which transgene expression was induced for just 2h. Under those conditions, most CFP immunoreactivity was present in bands of the sizes expected for the full fusion proteins (Fig 2C). The inventors therefore repeated the localization experiments after just 2h of transgene induction. At this time point, the aspartyl proteases Cthlp, 2p and 3p, as well as Carlp, showed extensive co-localization with the mucocyst core protein Grt3p (Fig 10 panel a-c,e). In contrast, there was little co-localization of the cysteine protease Cth4p-CFP with Grl3p (Fig 10 panel d). As expected, CthB-CFP showed no co-localization with the mucocyst marker (Fig 10 panel f). Taken together, these results suggest that all of the candidate processing enzymes, but not CthB, are trafficked to mucocysts or an intermediate in mucocyst maturation, since endoproteolytic cleavage of the fusion protein leads to CFP accumulation within mucocysts. The data after 2h of induction suggest that Cth4p is initially targeted to a distinct compartment from the other enzymes and from the mucocyst core proteins. [0093] Fig. 11 shows localization in living cells of CFP-tagged copies of each of the proteases. Based on the localization patterns, one can conclude that the proteases are localized to the mucocysts. After 2 hours of induction (Fig. 10), Cth4p does not co-localize with a mucocyst marker, while after 18 hours it is clearly localized to mucocysts. Thus, Cth4p is not initially transported to mucocysts or mucocyst intermediates, but ends up there after a longer period. The results for the other proteases is identical after 2 hr or 18 hr of induction, so they are more directly transported to mucocysts or mucocyst intermediates.
EXAMPLE 3 - GENE DISRUPTION IMPLICATES EACH OF THE CATHEPSIN- FAMILY CANDIDATE GENES IN MUCOCYST BIOGENESIS.
[0094] To directly test the implications of the co-regulation and localization results, the inventors targeted each of the candidate protease genes for disruption via homologous recombination with a drug-resistance cassette. This standard approach results in gradual replacement, over roughly 3-4 weeks growth in drug, of all -45 intact copies of each gene in the polyploid macronucleus with the disrupted allele, producing a functional knockout. The
process of allele replacement depends upon the random assortment of alleles to the two daughters at each cell division, a feature of Tetrahymena macronuclei. If a gene is essential for cell viability, one cannot recover daughters in which all intact macronuclear copies have been replaced. [0095] The precise sequences deleted in each gene are shown in Table 3. To confirm the loss of gene expression, the inventors used RT-PCR to monitor the knockout strains. For CAR1, no RT-PCR product could be detected in the putative knockouts, indicating that the disruption was complete (Fig 3A). The cathepsin genes all showed low levels of RT-PCR product, even after extended growth in drug. In all cases, the apparent reduction in the gene transcript was >90% (CTH1: 92%; CTH2: 96%; CTH3: 95%; CTH4: 94%)(Fig 3A). Among these, only the CTH3 knockouts showed an increase in doubling time, which was confirmed for multiple clones, suggesting that CTH3 may potentially be essential for growth(Fig 3C). For CTH1, 2 and 4, the persistent RT-PCR remnants may reflect residual copies of the endogenous genes, or inefficient amplification of intact related members within these large gene families. For practical purposes, the inventors concluded that >90%> knockdown was sufficient to analyze the potential roles of the candidate genes.
Table 3 - Regions deleted in disruptions of cathepsin and carboxypeptidase genes.
[0096] As a first test of whether each of these genes were required for normal mucocyst biogenesis, the inventors tested the exocytic response of the mutant lines using a semi-quantitative assay based on stimulation by dibucaine, a local anaesthetic that triggers mucocyst exocytosis (Satir, 1977). When wildtype cells are exposed briefly to dibucaine, the mucocyst contents, which are released as large protein aggregates, can be visualized after low- speed centrifugation as a thick flocculent layer (Fig 4A, left). Parallel treatment of the mutant lines showed that the ACAR1 mutant was identical to wildtype (Fig 4E). The CTH1, 2 and 4 mutant strains showed flocculent release that was somewhat reduced compared to wildtype, while flocculent formation was completely absent from the CTH3 mutant strain
(Fig 4A-D). The results suggested that CTH3 plays a key role in mucocyst formation or function.
EXAMPLE 4 - CATHEPSIN 3 IS REQUIRED FOR MUCOCYST FORMATION.
[0097] To determine whether mucocysts were formed in the mutant cell lines, the inventors labelled mucocysts in fixed permeabilized cells with two monoclonal antibodies (mAbs) that recognize, respectively, members of the two major families of mucocyst cargo proteins. All characterized GRL proteins, of which Grl3p is recognized by mAb 5E9, undergo proteolytic processing during mucocyst formation. The characterized GRT proteins, of which Grtlp is recognized by mAb 4D11, do not undergo proteolytic processing, and Grtlp in mature mucocysts localizes to the tip where docking occurs to the plasma membrane. Staining of wildtype cells with either the anti-Grtlp or anti-Grl3p antibodies reveals the array of mucocysts, with nearly the entire set docked at the cell periphery as seen in cell cross section (Fig 5A,B).
[0098] Staining of the experimental cell lines showed that while mutants in CTH1, 2, and 4, and CAR1 all accumulated docked mucocysts, the CTH3 mutant showed a dramatic reduced accumulation of either of the mucocyst cargo proteins (Fig 5A,B). The CTH3 mutant also shows notable accumulation of GrBp, but not Grtlp, in intracellular puncta. These results are consistent with the exocytosis data, and further indicate that CTH3 plays a key role in mucocyst formation. [0099] To ask whether the small number of mucocysts present in ACTH3 cells could undergo regulated exocytosis, the inventors treated the cells with the polycationic dye Alcian blue. When wild-type cells are exposed to Alcian blue, they become entrapped in robust capsules formed by the dye-dependent cross-linking of the exocytosed mucocyst contents (Tiedtke, 1976). When the inventors treated wild-type, ACAR1 (as a control) and ACTH3 cells in parallel with Alcian blue, virtually 100% of cells from wild-type and ACAR1 cultures were surrounded by capsules that were strongly labeled using the mAb against GrBp (Fig 12A,B). In contrast, ACTH3 cells showed no capsule formation and no visibly released mucocyst contents. However, flow cytometric analysis of Acth3 cells, before and after stimulation, indicated that stimulation did result in some loss of GrBp staining in the cells (Fig 12B). Taken together, these results suggest that ACTH3 cells assemble few, if any, exocytosis-competent mucocysts.
EXAMPLE 5 - CATHEPSIN FAMILY PROTEASES ARE REQUIRED FOR GRL PROPROTEIN PROCESSING AND CTH3 IS ESSENTIAL.
[00100] Based on a large number of prior studies in Tetrahymena and the related ciliate Paramecium, the assembly of dense cores in ciliate secretory vesicles correlates strongly with processing of pro-GRL proteins. The phenotypes described above therefore suggested that CTH3 might be required for GRL proprotein processing, while the localization data suggest that the other candidate enzymes may also be involved in this process. The inventors therefore analyzed cell lysates by Western blotting using anti-GRL antisera, to ask whether the mutants accumulated GRL processing intermediates rather than the fully mature forms.
[00101] In wildtype cells, Grllp accumulates primarily as a polypeptide that migrates at ~40kDa (Fig 6A). This product is generated by protoeo lytic processing from a ~60kDa proprotein. The proprotein is the major species in lysates from SB281, a Mendelian mutant that lacks mucocysts and that fails to convert the 60kDa to the 40kDa form (Fig 6A). Remarkably, lysates of ACTH3 cells showed an almost complete absence of the processed Grllp product and an apparent over-accumulation of the precursor (Fig 6A). This processing defect was not specific for pro-Grllp, since parallel Western blots using antibodies against three other proteins in the GRL family yielded similar results (Fig. 6C-F). Thus Cth3p is required for pro-Grl protein processing, and this is likely to explain the mucocyst accumulation defect shown above.
[00102] To confirm that the observed defects in the ACTH3 were due to disruption of CTH3, rather than perturbation of flanking loci, the inventors introduced into the ACTH3 cells an exogenous copy of CTH3, as a CFP fusion integrated at the RPL29 locus, and under the control of the inducible MTT1 promoter. Expression of the expected fusion protein was detected by western blot (Fig 15 A) and by anti-GFP antibody staining (Fig 15C). As discussed above, prolonged induction led to the appearance of monomeric CFP, presumably due to endoproteolytic processing (Fig 15B). Importantly, expression of Cth3p-CFP rescued the mucocyst biosynthesis defect (Fig 15D) as well as pro-Grl 1 protein processing (Fig 15E), in the ACTH3 cells. [00103] Similar analysis of the CTH1, CTH2, and CAR1 mutants failed to reveal any dramatic differences from the wildtype pattern of GRL protein processing, consistent with the ability of these mutants to release mucocyst contents upon stimulation (Fig 6). Moreover, the pattern of SDS-PAGE-resolved Coomassie-stained proteins released upon dibucaine
stimulation appeared very similar between the wildtype and ACTH1, ACTH2, or ACAR1 mutants (Fig 14). Since the released proteins are primarily processed GRL products (Chilcoat et ah, 1996; Verbsky and Turkewitz, 1998), this result indicates that the absence of Cthlp, Cth2p or Carlp does not inhibit normal mucocyst accumulation and exocytosis of the full complement of Grl proteins. Nonetheless, subtle differences from wildtype were detected in some mutant cell lysates. In particular, the CTH1 and 2 mutants appeared to accumulate processing intermediates for Grl4p and Grl8p that were distinct from those seen in wildtype or other mutants (Fig 6E,F).
[00104] In contrast, the CTH4 mutant showed a clear difference in GRL processing compared to the wildtype. In Western blots of ACTH4 lysates, both the pro-protein and processed forms of GRL proteins were present, but in all cases the processed product appeared larger than the corresponding product in wildtype cells (Fig6, Fig S5). The inventors obtained the clearest data for Grl3p, a protein the inventors could analyze using both polyclonal and monoclonal antibodies (Fig 6C, D). Western blots using either of those antibodies revealed that, in addition to the shift in the size of the processed product, there was also a change in the gel mobility of proGr p in the ACTH4 lysates. In particular, while WT lysates contained a closely-spaced ladder of proGrlp bands, the ACTH4 lysates showed predominantly the largest form (Fig 6C,D). Similarly, the Grll proprotein appeared subtly larger in ACTH4 compared to WT lysates (Fig 6A). In contrast, the inventors detected no difference in the pro-forms of Grl4p or Grl8p. These results suggest that Cth4p is required for a processing step in at least a subset of the GRL proproteins. This processing event may be required for full mucocyst function, since ACTH4 cells showed a sharp reduction in the formation of a flocculent layer after dibucaine stimulation, as shown above.
EXAMPLE 6 - EXPRESSION PROFILING REVEALS CO-REGULATION OF MUCOCYST CARGO PROTEINS, SORTILIN-FAMILY RECEPTORS, AND OTHER PROTEINS PREDICTED TO FUNCTION IN PROTEIN TRAFFICKING.
[00105] To investigate the sorting of Grt proteins to mucocysts, the inventors followed up on previous observations that genes encoding the lumenal and membrane proteins in T. thermophila mucocysts are co-regulated over a wide range of physiological states. These include growth, starvation, and conjugation, as well as during synchronous mucocyst synthesis that can be triggered by stimulating cells to undergo complete exocytosis)(Haddad and Turkewitz, 1997; Rahaman et al, 2009). To extend these findings, the inventors used tools available through the Tetrahymena Gene Expression Database (TGED (available on the
world wide web at tged.ihb.ac.cn)(Xiong et al, 2011), subsequently re -organized at tfgd.ihb.ac.cn) to ask whether additional co-regulated genes might encode the machinery required for mucocyst synthesis, including proteins involved in the sorting of Grt cargo. Surprisingly, this informatics-based screen advanced the sortilin/VpslO receptors as candidate actors in mucocyst biogenesis.
[00106] Sortilins are Type I transmembrane proteins first characterized in S. cerevisiae as the product of the VPS 10 gene, which functions as a sorting receptor for vacuolar hydrolases(Marcusson et al., 1994). Similarly, sortilins in animals are receptors for sorting to ly so some-related organelles, in addition to other functions(Hermey, 2009). In T. thermophila, all four of the sortilin genes have similar expression profiles, which are also strikingly similar to those of known mucocyst-associated genes (Fig. 18A). The four T. thermophila sortilins, called SOR1-SOR4, have diverged significantly from one another as judged by amino acid sequence (-30% identity within the VPS10 domains; -12% identity within the cytosolic tails). The four genes fall into two clades. SOR1 and 3 belong to a clade including members from non-Ciliates, while SOR2 and 4 belong to a Ciliate -restricted clade, and therefore are likely to have arisen via gene duplications that occurred within the Ciliate lineage (Fig. 18B; 24).
[00107] In S. cerevisiae and in mammalian cells, sortilin-dependent trafficking to lysosome -related organelles depends on the heterotetrameric AP-3 adapter (Odorizzi et al., 1998). Interestingly, the inventors found that two subunits of the Tetrahymena AP-3 adapter were top hits, together with the sortilins, for mucocyst-coregulated genes, and the AP-3 expression profiles are also shown in Fig. 18 A. T. thermophila also expresses AP-1, AP-2, and AP-4 adaptor complexes, but none of these is co-regulated with mucocyst-associated genes (Elde et al, 2005; Nusblat et al, 2012). EXAMPLE 7 - THE TWO CILIATE-RESTRICTED SORTILINS, SOR2 AND SOR4, ARE NON-ESSENTIAL GENES THAT ARE REQUIRED FOR SECRETION FROM
MUCOCYSTS.
[00108] To test whether any of the sortilin genes is required for mucocyst function, the inventors targeted each of them by homologous recombination, using standard approaches that result in disruption of all macronuclear (expressed) copies for non-essential genes (Fig. 23A)(Cassidy-Hanley et al, 1997). The inventors obtained complete knockouts for SOR1, 2 and 4 (Fig. 18C); the inability to obtain complete knockouts of SOR3, and the slow growth of cells after even partial knockdown, suggested that SOR3 is an essential gene. Preliminary
analysis of the Asorl, Asor2, and Asor4 knockout lines indicated that SOR2 and SOR4, but not SOR1, were essential for mucocyst formation and/or exocytosis (Fig. 25, and below). The inventors focused primarily on Asor4 because it showed stronger deficiencies in secretion. Importantly, Asor4 cells grew at a similar rate to wildtype, strongly suggesting that the absence of SOR4 does not lead to a general disruption of membrane traffic or compromise the function of any essential organelle (Fig. 23B). Mucocysts themselves are dispensable for normal growth of T. thermophila under laboratory conditions (Melia et al., 1998a; Orias et al, 1983).
EXAMPLE 8 - SOR4P IS REQUIRED FOR SORTING OF GRT1P TO
MUCOCYSTS.
[00109] To ask whether the SOR4 gene product, Sor4p, played a role in sorting of mucocyst cargo proteins, the inventors immunolocalized members of the Grt and Grl families (Grtlp and Grl3p, respectively) using previously characterized monoclonal antibodies. In wildtype cells, Grtlp localizes in a polarized fashion to the docked end of mucocysts(Bowman et al., 2005a) (Fig. 19A). Remarkably, the inventors found that Asor4 cells were completely defective in accumulation of Grtlp in mucocysts, as judged by indirect immunofluorescence (Fig. 19B), and confirmed by Western blotting of whole cell lysates using a polyclonal antibody (Fig. 19C). The Asor4 cells had no defect in Grtlp synthesis per se, since Grtlp was readily detected in cell culture medium. Since sortilins function as ligand- binding receptors, these results suggested that Sor4p acts as a sorting receptor for Grtlp. Consistent with this idea, the inventors could immunoprecipitate Grtlp using an antibody against GFP in cells that were expressing Sor4p-GFP at the endogenous SOR4 locus (Fig. 19D). Importantly, the GFP-fusion protein is functional, since cells expressing Sor4p-GFP in lieu of the wildtype protein were fully exocytosis-competent, i.e., did not manifest any SOR4 deficiency (Fig. 26). The robust interaction between Sor4p and Grtlp indicated by co- precipitation suggests that the interaction between these proteins is likely to be direct. Moreover, the 5Oi?4-dependent mis-sorting of Grtlp was specific, since disruption of the related T. thermophila paralog, SOR2, did not produce any apparent defect in the accumulation of Grtlp (Fig. 2B). [00110] The results could also be explained if Sor4p-Grtlp binding were required to retain Grtlp during mucocyst maturation. However, GFP-tagged Sor4p showed no localization to mucocysts but instead appeared in numerous cytoplasmic puncta, many of which are highly mobile (Fig. 19E, Video 1). The localization also indicates that Sor4p is not
primarily associated with the Golgi, which has a distinct cortical distribution in these cells (Bright et al, 2010; Kurz and Tiedtke, 1993).
EXAMPLE 9 - SOR4P IS REQUIRED FOR SORTING OF OTHER GRT FAMILY
MEMBERS.
[00111] Mis-sorting of Grtlp would not by itself produce a dramatic mucocyst defect, since cells in which GRT1 was deleted together with the closely-related GRT2 showed only a mild secretion phenotype (Rahaman et al., 2009). In contrast, Asor4 cells showed a complete absence of mucocyst discharge on stimulation, as assessed by two different methods. In wildtype Tetrahymena, the entire set of docked mucocysts will undergo exocytosis after cells are exposed to either the polycation Alcian Blue or dibucaine. Alcian blue binds to acidic mucocyst proteins as they exit, entrapping each wildtype cell in a blue-stained capsule (Tiedtke, 1976), but Asor4 cells showed no trace of capsule formation (Fig. 20A). The mucocyst contents released from dibucaine -treated wildtype cells form large pelletable aggregates (Satir, 1977), but these were entirely absent in dibucaine -treated Asor4 cultures, and greatly reduced in Asor2 cultures (Fig. 20B). Both the capsule-formation defect and the absence of flocculent are comparable to mutants in mucocyst formation or exocytosis that have previously been characterized in this organism(Cowan et al., 2005; Melia et al., 1998b; Orias et al, 1983). The disparity between the strong Asor4 and mild Agrtl phenotypes indicated that Grtlp was unlikely to be the only ligand that depends on Sor4p for sorting to mucocysts. Since Grtlp belongs to a 13-member family of mucocyst content proteins, the other members were obvious candidates for Sor4p ligands.
[00112] The inventors expressed a GFP-tagged copy of a second family member, Igrlp
(Bowman et al, 2005b; Haddad et al, 2002), in wildtype and in Asor4 cells. Strikingly, Igrlp-GFP accumulated in mucocysts in wildtype but not Asor4 cells (Fig. 20C). These results indicate that Sor4p acts as a sorting receptor to mucocysts for multiple, and perhaps all, proteins in the Grt family. The mucocyst secretion defect in Asor4 cells may therefore be related to mis-sorting of multiple Grt-family proteins. In addition, as shown below, SOR4 function is also essential for processing, but not sorting, of the 2nd major family of mucocyst proteins in Tetrahymena, and disruption of processing is itself expected to inhibit mucocyst maturation and exocytosis (Verbsky and Turkewitz, 1998).
EXAMPLE 10 - A GRL-FAMILY PROTEIN IS SORTED IN MUCOCYSTS
INDEPENDENTLY OF SORTILIN RECEPTORS.
[00113] Previous work suggests that the major core DCV proteins in ciliates are sorted via aggregation, and would therefore not be expected to depend on receptors. The inventors therefore tested the prediction that delivery of Grl proteins to mucocysts in T. thermophila would be independent of SOR4 function. In both wildtype and Asor4 cells, Grl3p immunofluorescence was concentrated in linear arrays of puncta at the cell surface, representing the cohort of docked mucocysts(Cowan et al, 2005)(Fig. 21A). Similarly, Grl3p accumulated in docked mucocysts in Asor2 cells (Fig. 21 A). Thus Grl3p targeting does not depend on either of the sortilin receptors that are associated, based on their knockout phenotypes, with mucocyst function.
EXAMPLE 11 - THOUGH NOT REQUIRED FOR SORTING OF GRL PROTEINS, SORTILIN FUNCTION IS REQUIRED FOR PROTEOLYTIC MATURATION OF
GRL PROPROTEINS IN MUCOCYSTS.
[00114] The docked mucocysts in Asor4 cells did not exhibit the elongated form of wildtype mucocysts. Instead, Asor4 mucocysts seen in profile appeared spherical, as well as smaller than elongated wildtype mucocysts (Fig. 2 IB). The aberrant mucocyst morphology was confirmed by electron microscopy, which also revealed that Asor4 mucocysts lack any discernible crystalline structure within the dense core (Fig. 21C). In wildtype mucocysts, formation of the dense core is strongly correlated with proteolytic maturation of Grl proproteins(Collins and Wilhelm, 1981; Cowan et al, 2005; Turkewitz et al, 1991), suggesting that the morphological defects in Asor4 mucocysts might be due to processing defects. Comparison of the lysates of wildtype and Asor4 cells, by Western blotting with an antibody against Grllp, indicated that proteolytic maturation was indeed defective, since much of Grllp was still present in the unprocessed form (Fig. 21D). These results raised the possibility that Sor4p, in addition to acting as sorting receptor for Grt family proteins, is also required to deliver one or more factors required for the proteolytic processing of pro-Grl cargo.
[00115] The simplest hypothesis was that Sor4p was required to deliver the proteases that process pro-Grl proteins. Those proteases have been studied indirectly but had not yet been identified in any ciliate. However, strong candidates for these enzymes emerged from the same expression screening approach, described above, which led us to focus on sortilins. Four of the putative processing enzymes are cathepsins, named CTHl-4, and disruption of the
CTH3 gene in particular resulted in a near-complete failure to process Grl proproteins or synthesize mucocysts (Kumar et al, in preparation). To validate the inference that Cth3p functioned directly in mucocyst maturation, the inventors transiently expressed the protein as a Cyan Fluorescent Protein (CFP) fusion. Consistent with a role in proGrl processing, Cth3p- CFP showed significant localization to mucocysts (Fig. 22). This is likely due to specific targeting signals, since neither an unrelated cathepsin that has been studied in Tetrahymena, nor GFP attached to a signal sequence, accumulates in mucocysts(Haddad et al, 2002; Jacobs et al, 2006). Importantly, the targeting of Cth3p-CFP to mucocysts, as measured by the co- localization of Cth3p-CFP with Grl3p, was reduced in Asor4 cells (Fig. 22). These results support the hypothesis that Asor4 cells are deficient in mucocyst delivery of both Grt-family proteins and also one or more processing enzymes needed for Grl proprotein processing, with the latter defect sufficient to explain the aberrant mucocyst morphology shown in Fig. 21C. Sor2p may also be involved in delivery to DCVs of proteins required for proGrl processing, since Asor2 cells showed comparable, though less severe, defects in Grl-based core formation (Fig. 21A-C).
EXAMPLE 12 - CTH3P ACTIVITY IN VIVO AND IN VITRO DEPENDS UPON THE
CONSERVED CATALYTIC RESIDUES
[00116] The role of CTH3 in mucocyst maturation is likely to require its predicted enzymatic activity. To test this idea, the inventors used homologous recombination to replace endogenous CTH3 in the macronucleus of wildtype cells either with itself (cth3-4) or with a variant in which the inventors made mutations in both conserved catalytic motifs (Aspl39-to- Asn; Asp324- to-Asn; cth3-5). These mutations have been shown in other systems to cripple the activities of homologous cathepsins (Tyynela et al, 2000; Glondu et al, 2001). In both cases, the replacement allele included a C-terminal fusion to GFP (Figure 29A), and transformants were passaged extensively in selective media to drive the replacement alleles to fixation or near-fixation. Western blotting of whole cell lysates using an anti- GFP antibody indicated that the expected fusion protein was synthesized in each strain (Figure 29B). In addition, a minor band of the size expected for monomeric GFP was present, suggesting that some endoproteolytic cleavage of the fusion proteins had occurred. Interestingly, monomeric GFP was present both in cells expressing the enzymatically-active cth3-4p as well as the enzymatically-disabled cth3-5p, though more abundant in the former (Figure 29B). In cells expressing cth3-4p, both the fusion protein and monomeric GFP were secreted into the cell
culture medium, but neither species was secreted in cells expressing the enzymatically- disabled cth3-5p (Figure 30).
[00117] Importantly, cells expressing cth3-5p were indistinguishable from Acth3 in their failure to process proGrllp (Figure 29C) or to release mucocyst contents on stimulation (Figure 29D). Indeed, like Acth3 cells, the cth3-5 cells fail to synthesize Grl3p-positive mucocysts (Figure 29E, middle row). In contrast, cells expressing cth3-4p were indistinguishable from wildtype in proprotein processing, and mucocyst synthesis and exocytosis. The GFP signal in cells expressing cth3-4p accumulated in mucocysts (Figure 29F, bottom row), as expected. In contrast, the GFP signal in cells expressing cth3-5p accumulated in heterogeneous cytoplasmic puncta (Figure 29F, middle row). This difference could also be seen via live imaging of the same cultures (Figure 2B). Taken together, these results strongly support the conclusion that the key role of Cth3p in mucocyst biogenesis depends upon its enzymatic activity. Consistent with this conclusion, the expression of a catalytically-disabled CTH3 variant from the RPL29 locus in Acth3 cells, failed to rescue any of the Acth3 defects (Figure 31).
[00118] To demonstrate more directly that Cth3p possesses enzymatic activity, the inventors used anti-GFP antibodies to immunoprecipitate cth3-4p and cth3-5p from detergent lysates of Tetrahymena expressing these constructs. The immunoprecipitates, adjusted for yield differences for the two proteins, were then assayed for activity against a fluorogenic Cathepsin D substrate (Figure 29, G and H). Cth3-4p, but not cth3-5p, displayed clear activity in this assay, consistent with and confirming the in vivo results.
EXAMPLE 12 - CTH3P PARTIALLY CO-LOCALIZES WITH BOTH
ENDOSOMAL AND LYSOSOMAL PROBES.
[00119] As detailed above, while cth3p-GFP co-localizes strongly with the mucocyst marker Grl3p, there is also significant GFP signal in non-mucocyst structures, as judged by their morphology and distribution. These non-mucocyst structures are relatively prominent in high density cultures, while almost undetectible in low density cultures (Figure 32A). Some of these structures may be intermediates in mucocyst maturation, including compartments involved in the delivery of processing enzymes to immature mucocysts. In addition, Cth3p may play roles unrelated to mucocyst formation, since one would not expect a gene dedicated to mucocysts to have a growth phenotype.
[00120] To gain some insight into the nature of the cth3p-GFP-positive structures, the inventors incubated cells expressing cth3p-GFP from the endogenous locus with Lysotracker- Red (Figure 32B). Consistent with previous studies, docked mature mucocysts did not stain with the Lysotracker probe (Bright et al., 2010). Simultaneous imaging in the red and green channels showed that the majority of Lysotracker-positive structures also contained cth3p- GFP. Some structures appear to consist of a Lysotracker-positive zone tightly apposed to the cth3p-GFP-positive zone, suggesting that a fraction of cth3p-GFP resides in an organelle that communicates with lysosomes.
[00121] To ask whether Cth3p localized to endosomes, the inventors incubated cth3p- GFP- expressing cells with FM4-64, which has previously been used in this system to label endosomes derived from clathrin-coated vesicles (Elde et al., 2005). At a variety of chase times following an initial pulse of FM4-64, the inventors observed multiple structures showing near co-localization of FM4-64 and cth3p-GFP (Figure 32C). Taken together, the results support the idea that Cth3p is associated with the endolysosomal pathway. [00122] The partial localization of Cth3p to an endosomal compartment begged the question whether the enzyme could be delivered to that compartment via endocytosis. If so, this might provide an experimental approach to resolving the hypothesized distinct functions of Cth3p. The inventors therefore tested whether any phenotypes in Acth3 cells might be suppressed by incubating the cells in medium containing Cth3p. As shown above, Cth3p is found in the medium of wildtype cells. Remarkably, the inventors found that the Acth3 growth phenotype could be suppressed, and in a concentration-dependent fashion, by growing cells in medium previously harboring either wildtype cells, or cells that were overexpressing cth3p-CFP, but not medium from Acth3 cultures (Figures 5). However, there was no detectible rescue of pro-Grl processing or mucocyst formation in these cultures (data not shown). The inventors hypothesize that the endo-lysosomal activity of Cth3p is essential for rapid growth, and this pool of enzyme can be provided via endocytosis, but proGrl processing occurs in a different compartment that is either less accessible via endocytosis or requires a higher concentration of enzyme.
EXAMPLE 14 - CTH3 EXPRESSION SUPPRESSES THE PRO-GRL PROCESSING
DEFECT IN A NON-ALLELIC MUTANT
[00123] Tetrahymena mutants with defects in mucocyst assembly or exocytosis have been isolated following nitrosoguanidine mutagenesis (Orias et al, 1983; Melia et al, 1998; Bowman et al, 2005a). A large subset were found to have defects in pro-Grl processing, though it is not yet known in any case whether this represents the primary defect. The mutant with the most severe defect in pro-Grl processing is SB281, which shows neither detectible pro-Grl processing nor mucocyst formation (Bowman and Turkewitz, 2001). The SB281 mutation cannot fall within CTH3, since SB281 has been genetically mapped to micronuclear chromosome 4, whereas the CTH3 gene is on chromosome 5 (Gutierrez and Orias, 1992)(E. Hamilton, pers. comm.). Nonetheless, it seemed possible that overexpression of CTH3 could suppress the SB281 defect. To test this, the inventors integrated the wildtype CTH3 open reading frame, including a C-terminal 6xHis epitope tag, at the RPL29 locus in SB281 cells, under the control of the inducible MTTl promoter. High-level expression of Cth3p partially rescued the SB281 pro-Grl processing defect (Figure 34, A and B). Interestingly, the distribution of a putative Cth3p substrate, the mucocyst core protein Grl3p, was also affected by expression of cth3p-6His in SB281 cells. In growing SB281 cells, Grl3p is found in large heterogeneous cytoplasmic puncta (Figure 34 C and D, top row). SB281 transformed to overexpress cth3p-6HIS still contain Grl3p-positive large heterogenous structures, but in addition contain abundant smaller and more homogeneous Grl3p-positive puncta (Figure 34D, 2nd row). These do not have the elongated shape of mucocysts and are unlikely to represent viable mucocyst intermediates since they do not contain a 2nd mucocyst core marker, Grtlp, whose distribution in SB281 cells is unchanged by overexpression of Cth3p (Figure 34E, bottom two rows). As pointed out earlier, Grtlp is not processed and therefore not a potential substrate for Cth3p. Thus the overexpression of Cth3p in SB281 cells leads to both processing and redistribution of Grl3p, suggesting that Grl processing is a key step in driving reorganization of core proteins during mucocyst formation.
EXAMPLE 15 - MATERIAL AND METHODS
[00124] Tetrahymena strains and culture conditions. Wild-type T. thermophila strains CU428.1 and B2086 were grown at 30°C with agitation in SPP medium (1% proteose peptone 0.2% dextrose, 0.1% yeast extract, 0.003% ferric EDTA). All reagents were from Sigma Chemical Co. unless otherwise indicated. Culture densities were measured using a Zl
Coulter Counter (Beckman Coulter Inc., Indianapolis, IN). Phenotypic analysis was from cell cultures at 2-4 xlO5 cells/ml unless otherwise indicated.
[00125] Expression of Cathepsins (CTH) and Carboxypetidase (CAR) gene fusions.
The Gateway (Invitrogen) system was used to engineer CFP (Cyan Fluorescent Protein) fusions with Cthlp-Cth4p, CthBp, and Carlp. Briefly, PCR-amplified CTH1 (TTHERM 00052190), CTH2 (TTHERM 00011710), CTH3 (TTHERM 00321680), CTH4 (TTHERM 00445920) CTHB (TTHERM 00083480) and CAR1 (TTHERM 00410180) (minus the stop codon) were TOPO cloned (Invitrogen, Grand Island, NY) into the pENTR- D-TOPO entry vector. CACC was added to each forward primer in order to allow directional cloning into pENTR-D. The pENTR clones were sequenced and the genes recombined using the Clonase reaction into the target Gateway-based T. thermophila expression vector pICC- GTW, a gift from Doug Chalker (Yao et ah, 2007; Bright et ah, 2010). Genes subcloned into pICC-GTW are fused at their N-terminus to the CFP gene, with the fusion under the transcriptional control of the cadmium-inducible MTTl promoter (ref for MTTl). When introduced into Tetrahymena, the vector is amplifiied and maintained as a Macronuclear minichromosome, and confers paromomycin resistance.
[00126] Expression of CFP-fusions was confirmed by microscopy (below) and by
Western blotting. For the latter, cells were treated with ^g/ml CdCl2 for 2h or 16h. After 16h induction, cells were further induced in starvation buffer (lOmM Tris pH 7.4) containing 0^g/ml CdCl2 at 22° for 4h. Samples were then processed for Western blotting, as described below.
[00127] Generation of Cathepsin and Carboxypetidase knockout strains. The inventors PCR amplified the CTHl-4 and CAR1 upstream regions (1.5-2kb) and gene plus downstream 1.5-2kb fragment, cloned it into the Sacl and Xhol sites of the NE04 cassette respectively, using In-Fusion cloning kit® (Clontech, Mountain View, CA) The sequences of the primers are listed in Table 4. The constructs were linearized by digestion with Kpnl and Sapl and transformed into CU428.1 cells by biolistic transformation.
[00128] Biolistic Transformations. Biolistic transformations were as described previously (Chilcoat et ah, 1996), with the following modifications: gold particles (Seashell Technology, San Diego, CA) were prepared as recommended with 15 μg of total linearized plasmid DNA. To select for positive transformants, drug was added 4h after bombardment to cultures shaken at 30°C. Transformants were selected in paromomycin sulfate (PMS, 120 μg/ml) and CdCl2 (1 μg/ml). PMS-resistant transformants were identified after 3d. Transformants were then serially transferred daily in increasing amounts of PMS for at least 4 weeks before further testing. The concentration of PMS was increased up to 15 mg/ml and CdCl2 was maintained at 0.5 μg/ml for CTH1 & CTH4 knockout cultures, while PMS was increased up to 6 mg/ml and CdCl2 was maintained at 0.3 μg/ml for CTH2, CTH3 and CARl knockout cultures. When cell growth appeared to be slowing at these most stringent conditions, the cultures were returned to 10 mg/ml PMS and 0.5 CdCl2 (for CTH1 and CTH4 knockouts) and 4 mg/ml PMS and 0.4 CdCl2 ( for CTH2, CTH3 and CARl knockouts).
[00129] RT-PCR Assessment of CTHl-4 and CARl Disruption. Total RNA was isolated as per manufacturer's instructions using RNeasy Mini Kit (Qiagen, Valencia, CA). The forward and reverse primers used for CTHl-4 and CARl are given in Table 4. The presence/absence of the CTHl-4 and CARl transcripts were assayed by one-step RT PCR (Qiagen) using primers (Table 4) to amplify 400-5 OObp of each gene. Gene knockouts were confirmed by the continued absence of the corresponding transcripts after 3 weeks of growth in the absence of drug selection (4-5 serial transfers/week). To confirm that equal amounts of cDNA were being amplified, control RT-PCR with primers specific for Sortilin3 (SOR3) were run in parallel. The specific band intensity was measured using ImageJ software (available on the world wide web at rsbweb.nih.gov/ij).
[00130] Live cell microscopy. For imaging, transformants were grown overnight in SPP media and then transferred to S medium (to reduce autofluorescence in Tetrahymena food vacuoles: 0.2% yeast extract, 0.003% iron EDTA) containing ^g/ml CdCl2 for 16h at 30°C, followed by 4h in lOmM Tris pH 7.4 with O^g/ml CdCl2 at 22°. Live Tetrahymena expressing CFP-fusions were immobilized using 6%> polyethylene oxide (PEO: MW = ca.900,000) and imaged at 22° on a Leica SP5 II STED-CW Super resolution Laser Scanning Confocal Microscope. Image data were saved as JPEGs that were colored, denoised and adjusted in brightness/contrast with the program Fiji (available on the world wide web at fiji.sc/Fiji).
[00131] Dibucaine Stimulation Assay. Dibucaine stimulation of exocytosis was performed as described previously (Rahaman et al, 2009).
[00132] Immunofluorescence. Cells were fixed and immunolabeled as described previously (Bowman and Turkewitz, 2001). Grl3p and Grtlp were visualized using monoclonal antibody MAb 5E9 (1 :9) (Bowman et al, 2005) and 4D11 (1 :5) (Turkewitz and Kelly, 1992), respectively, followed by Texas Red-conjugated goat anti-mouse antibody (1 : 100) (Life Technologies, Carlsbad, Ca). Cells were imaged on a Leica SP5 II STED-CW Super resolution Laser Scanning Confocal Microscope. Image data were analyzed as described above. [00133] SDS-PAGE and Western blotting. To prepare whole cell lysates, ~3x 105 cells were pelleted, washed twice with lOmM Tris pH 7.4, and precipitated with 10% trichloroacetic acid (TCA). TCA precipitates were incubated on ice for 30min, centrifuged (18k x g, lOmin, 4°), washed with ice-cold acetone, re-pelleted (18k x g, 5min, 4°) and then dissolved in 2.5x SDS-PAGE sample buffer. 104 cell equivalents/lane were resolved by SDS- PAGE unless otherwise indicated.
[00134] To starve the cells and collect secreted protein, cells were washed twice and then resuspend in lOmM Tris (pH 7.4) for 4h. Then 4 ml cell cultures were transferred to a 5 ml tube and pelleted at high speed in clinical centrifuge into a 400μ1 glycerol (2% w/v) pad. 1.7ml of the supernatants was then removed and precipitated with TCA after the addtion of 17 μΐ of 2% deoxycholate (DOC).
[00135] For western blots, samples were resolved by SDS-PAGE and transferred to
0.45 μιη PVDF membrane (Thermo Scientific, Rockford, IL). Blots were blocked and probed as previously described (Turkewitz et al, 1991). The rabbit anti-Grllp, rabbit anti-Grl3p, mouse monoclonal anti-Grl3p (5E9), rabbit anti-Grl4p, rabbit anti-Grl8p, rabbit anti polyG (Xie et al, 2007) and mouse monoclonal anti-GFP (Covance, Princeton, New Jersey) primary antibodies were diluted 1 :2000, 1 :800, 1 :200, 1 :250, 1 :3000, 1 : 10,000 and 1 :5000 respectively. Protein was visualized with either ECL Horseradish Peroxidase linked anti- rabbit (NA934) or anti-mouse (NA931) (Amersham Biosciences, Buckinghamshire, England) secondary antibody diluted 1 :20,000 and SuperSignal® West Femto Maximum Sensitivity Substrate (Thermo Scientific, Rockford, IL).
[00136] Gene expression Profile. Expression profiles are derived from the Tetrahymena Functional Genomics Database (available on the world wide web at tfgd.ihb.ac.cn), with each profile normalized to that gene's maximum expression level.
[00137] In silico analyses. The coding sequence of the aspartic proteases, cysteine proteases and zinc carboxypeptidase were analyzed for conserved active site residues by the NCBI Conserved Domain Database (Marchler-Bauer et al., 2009) and for signal peptides by SignalP (Emanuelsson et al, 2007). Alignment of protein sequences was performed using CLUSTALX (1.8) with default parameters.
[00138] Phylogenetic Tree Construction. Using protein BLAST (blastp), the T. thermophila CTH1, CTH2, CTH3 and CTH4 genes were used to identify potential homo logs in Ciliates, Apicomplexans, Arabidopsis thaliana and Homo sapiens, listed in Table 5. Similarly, the T. thermophila CAR1 sequence was used to identify homologs in Ciliates, listed in Table 6. For tree building, the top hits were selected from each lineage, assembled, aligned with CLUSTALX (1.8) and Maximum likelihood trees were constructed with MEGA5 (Molecular Evolutionary Genetics Analysis: available on the world wide web at megasoftware.net). Gapped regions were excluded in a complete fashion and percentage bootstrap values from 1000 replicates were derived. Only values above 50% are shown.
Table 5 ~ Accession numbers from which Cathepsin sequences were obtained to create the phylogeny in FIG. 16
Organism Abbreviation Accession
Toxoplasma gondii ME49 Toxo1 XP_002365394.1
Toxoplasma gondii ME49 Toxo2 XP_002367480.1
Toxoplasma gondii GT1 Toxo3 EEE22405.1
Toxoplasma gondii GT1 Toxo4 AAT10592.1
Toxoplasma gondii ME49 Toxo5 XP_002367043.1
Toxoplasma gondii ME49 Toxo6 XP_002371619.1
Toxoplasma gondii GT1 Toxo7 EEE21304.1
Toxoplasma gondii VEG Toxo8 EEE29592.1
Plasmodium falciparum Plasl 1 LS5
Plasmodium falciparum Plas2 AAW71461 .1
Plasmodium falciparum Plas3 AAW71459.1
Plasmodium falciparum Plas4 AAW71460.1
Plasmodium falciparum 3D7 Plas5 XP_001351 190.1
Plasmodium knowlesi strain H Plas6 XP_002258928.1
Plasmodium falciparum Plas7 3F9Q
Plasmodium cynomolgi strain B Plas8 XP_004222389.1
Plasmodium knowlesi strain H Plas9 XP_002259168.1
Plasmodium vivax Sal-1 PlaslO XP_001615284.1
Homo sapiens Hu1 AAI71897.1
Homo sapiens Hu2 NP_055039.1
Homo sapiens Hu3 NP_001073276.1
Homo sapiens Hu4 BAF84553.1
Homo sapiens Hu5 NP_001901.1
Homo sapiens Hu6 NP_001900.1
Homo sapiens Hu7 1 TZS
Homo sapiens Hu8 EAW59363.1
Homo sapiens Hu9 BAG58920.1
Homo sapiens Hu10 21 18248A
Arabidopsis thaliana Arabl NP_193936.2
Arabidopsis thaliana Arab2 CAA18108.1
Arabidopsis thaliana Arab3 AAC49730.1
Arabidopsis lyrata subsp. lyrata Arab4 XP_002892661 .1
Arabidopsis thaliana Arab5 NP_176419.2
Arabidopsis lyrata subsp. lyrata Arab6 XP_002872693.1
Arabidopsis thaliana Arab7 NP_192355.1
Arabidopsis lyrata subsp. lyrata Arab8 XP_002889395.1
Arabidopsis thaliana Arab9 NP_563648.1
Arabidopsis thaliana Arabl 0 NP_567215.1
Tetrahymena thermophila CTH1 XP_001014915.1
Tetrahymena thermophila CTH2 XP_001008250.2
Tetrahymena thermophila CTH3 XP_001012968.1
Tetrahymena thermophila CTH4 XP_001023356.1
Table 5 (continued) -- Accession numbers from which Cathepsin sequences were obtained to create the phylogeny in FIG. 16
Organism Abbreviation Accession
Tetrahymena thermophila Tt1 XP 001016313.1
Tetrahymena thermophila Tt2 XP 001017733.1
Tetrahymena thermophila Tt3 XP 001027456.1
Tetrahymena thermophila Tt4 XP 001030703.1
Tetrahymena thermophila Tt5 XP 001026655.1
Tetrahymena thermophila Tt6 XP 001026656.1
Tetrahymena thermophila Tt7 XP 001010205.1
Tetrahymena thermophila Tt8 XP 001010694.1
Tetrahymena thermophila Tt9 XP 001010693.1
Tetrahymena thermophila Tt10 XP 001012969.1
Tetrahymena thermophila Tt1 1 XP 001022323.1
Tetrahymena thermophila Tt12 XP 001029901.1
Tetrahymena thermophila Tt13 XP 001471259.1
Tetrahymena thermophila Tt14 XP 001015806.1
Tetrahymena thermophila Tt15 XP 001022043.11
Tetrahymena thermophila Tt16 XP 001031483.1
Tetrahymena thermophila Tt17 XP 001020178.1
Tetrahymena thermophila Tt18(CTHB) XP 001012594.1
Tetrahymena thermophila Tt19 XP 001015333.1
Paramecium tetraurelia strain d4-2 Paral XP 001452128.1
Paramecium tetraurelia strain d4-2 Para2 XP 001459126.1
Paramecium tetraurelia strain d4-2 Para3 XP 001453245.1
Paramecium tetraurelia strain d4-2 Para4 XP 001454430.1
Paramecium tetraurelia strain d4-2 Para5 XP 001456226.1
Paramecium tetraurelia strain d4-2 Para6 XP 001442519.1
Paramecium tetraurelia strain d4-2 Para7 XP 001452716.1
Paramecium tetraurelia strain d4-2 Para8 XP 001438277.1
Paramecium tetraurelia strain d4-2 Para9 XP 001455775.1
Paramecium tetraurelia strain d4-2 Paral 0 XP 001431306.1
Paramecium tetraurelia strain d4-2 Paral 1 XP 001429095.1
Paramecium tetraurelia strain d4-2 Paral 2 XP 001459019.1
Paramecium tetraurelia strain d4-2 Paral 3 XP 001448556.1 lchthyophthirius multifiliis Ichtl EGR30663.1 lchthyophthirius multifiliis Icht2 EGR30870.1 lchthyophthirius multifiliis Icht3 EGR34063.1 lchthyophthirius multifiliis Icht4 EGR291 14.1 lchthyophthirius multifiliis Icht5 EGR31334.1 lchthyophthirius multifiliis Icht6 EGR32788.1 lchthyophthirius multifiliis Icht7 EGR301 16.1 lchthyophthirius multifiliis lchte EGR34799.1 lchthyophthirius multifiliis Icht9 EGR34889.1 lchthyophthirius multifiliis Ichtl 0 EGR28345.1 lchthyophthirius multifiliis Ichtl 1 EGR34021.1
Table 6 ~ Accession numbers from which Carboxypeptidase sequences were obtained to create the phylogeny in FIG. 17
Organism Abbreviation Accession
Tetrahymena thermophila CAR1 XP 00102081 1.2
Tetrahymena thermophila Tt20 XP 001025716.1
Tetrahymena thermophila Tt21 XP 00101 1257.1
Tetrahymena thermophila Tt22 XP 001021403.1
Paramecium tetraurelia strain d4-2 Para 14 XP 001426519.1
Paramecium tetraurelia strain d4-2 Para 15 XP 001457020.1
Paramecium tetraurelia strain d4-2 Para 16 XP 001430375.1
lchthyophthirius multifiliis Icht12 EGR33430.1
lchthyophthirius multifiliis Icht13 EGR28029.1
lchthyophthirius multifiliis Icht14 EGR32378.1
[00139] Cell Culture. All T. thermophila strains were cultured in SPP media (1% proteose peptone, 0.2% dextrose, 0.1 % yeast extract, 0.009%> ferric EDTA) at 30°C while shaking at 99 rpm. Experimental cultures were grown to medium density (log phase: 150- 300,000 cells/mL) during an overnight incubation (at least 12h) in a volume of SPP equivalent to l/5th of the total volume of the culture flask. Culture densities were determined with a Zl Coulter Counter (Beckman Coulter Inc., Indianapolis, IN).
[00140] pmEGFP-neo4 Vector Construction. pmEGFP-neo4 is a modification the vector pEGFP-neo4 (provided by Kazufumi Mochizuki), which is designed to GFP-tag genes at their endogenous loci. The inventors site-specifically mutagenized the ORF of GFP in the original vector to create a variant of GFP that is largely monomeric, in order to avoid localization artifacts due to oligomerization. The monomeric mutation of pmEGFP-neo4, encoding an alanine-to-lysine substitution at position 207 of the GFP ORF (Zacharias et al., 2002), was introduced into pEGFP-NE04 by QuickChange® Site-directed Mutagenesis (Stratagene, La Jolla, Ca) with the primer pair 067A and 067B (Table 7).
Table 7 - Master rimer list
54 084B TAG AAA CCA TGG ATC CAT CAT AAT GAC TCT CTT CAT CTT Sortilin 1 c-terminus GGT TAT CAG minus stop codon
55 087 ATG CGC TAG CGG ATC AAC AAG AAT CTG TTT GCT TAA ATG
GAG AAG
56 088A ATT CGA TAT CAA GCT TAA TTA ACT AAT TGA TTT TTT GTT TTT Sortilin 1 3' genomic
TCA TAA ATT TCT TTG TAG flank
57 088B CGG TAT CGA TAA GCT TGA TTT ACG ACA AAT TCA ATA TGC
CAT TTC
58 089A ATG CGC TAG CGG ATC GGA ATG TGA CTT CGG TTT CTA CAG Sortilin 2 c-terminus
59 089B TAG AAA CCA TGG ATC CAT CGT AAT CTT CTT AAT AAT AGT minus stop codon
AAT CTT CTT GAT CTC
60 090A ATT CGA TAT CAA GCT TAT TAA AAT AAC AAA TTT CTT CAT Sortilin 2 3' genomic
TTT AAT TAA TTT GTA AG flank
61 090B CGG TAT CGA TAA GCT AAC TAG AAT ATT AAT TGC TAA AGT
CAA AAA TCT
62 091A ATG CGC TAG CGG ATC TGC TAA AGA CGA TAG CAA AGA AAG Sortilin 3 c-terminus
AAC minus stop codon
63 091B TAG AAA CCA TGG ATC CAT TTC TAG GAT CAA AAG GAT CTT
CTT CAC
64 092A ATT CGA TAT CAA GCT TAA AAT AAT TGA CTG AAT AAT ATT Sortilin 3 3' genomic
GCT AAT TTA TTT TTT TAC flank
65 092C CGG TAT CGA TAA GCT GAA GAT AAA TTA TTG CTT CAA TCA
TTT GCT CAG
66 106 A TAG AGC ATG CGC TAG CCT CAG TCT GGA TTA GGC AGC TAG Sortilin 1 5' genomic
67 106B TGT ATA TCG AAT TCC TGC AGA AGA TAT TTA ATC ACT TAA flank
TAA CTA AGT CTG TTT CTC ATG
68 107 A TAG AGC ATG CGC TAG CGT ATT CTA ATT GAA GAA TAA GTA Sortilin 2 5' genomic
AAT TCC TTT TTA TCA TAA CAC flank
69 107B TGT ATA TCG AAT TCC TGC AGC AGA CTT CCT CTG ATT TCC
TAA CAA AGT AAT TC
70 108 A TAG AGC ATG CGC TAG CTT CCA CTT TTA TGA TTG GAT AAT Sortilin 3 5' genomic
TGT ATA GAA GAA TTA TG flank
71 108B TGT ATA TCG AAT TCC TGC AGA TCT ATT TTT TCT CTC AAT TAT
TTT CTT TTC AAG GAT TTG
72 S001 CACCATGAGAAGAAGCTTGCTTACAGTAG CTH3 ORF minus stop
73 S002 ATGTCTTGCCAAAGCAAAACC codon
[00141] Expression ofSor4p-GFP. mEGFP was fused at the C-terminus of the SOR4 (TTHERM 00313130) macronuclear ORF via homologous recombination, using linearized pSOR4-mEGFP-neo4. This construct contains the C-terminal ~700bp of the SOR4 genomic locus (minus the stop codon) followed by mEGFP, the BTU1 terminator, a neo4 drug resistance cassette, and ~600bp of SOR4 downstream genomic sequence. To create pSOR4- mEGFP-neo4, the C-terminal region of the SOR4 genomic locus lacking the stop codon was amplified with the primer pair 093 A and 093B (Table 7). The 5' region of these primers contain ~15bp of homology to pmEGP-neo4 linearized with BamHI for In-Fusion® (Clontech, Mountain View, CA) mediated insertion into the vector. Similarly, the genomic region downstream of the SOR4 locus, amplified with the primer pair 094A and 094B (Table 7), was inserted into the preceding construct linearized with Hindlll. Wild type CU428 cells were then biolistically transformed with the final construct, pSOR4-mEGFPneo4, which was first linearized with Xhol and Nhel . Initial trans formants were selected based on paromomycin resistance, and then serially transferred for 3-4 weeks in increasing drug to
drive fixation of the GFP-tagged allele. Consistent with the complete replacement of the endogenous locus by the tagged allele, the transformants maintained both Sor4p-GFP expression as well as drug resistance for at least 1 year after initial selection.
[00142] SOR1-4 Disruption. The SOR4 macronuclear locus was replaced with a neo4 drug resistance cassette via homologous recombination with the linearized construct pSOR4MACKO-neo4. This construct contains a neo4 construct flanked by <750bp of the genomic regions immediately upstream and downstream of SOR4. pSOR4MACKO-neo4 was derived from the pSOR4-mEGFP-NE04 construct described above. To complete the KO construct, the genomic region upstream of SOR4 was first amplified with the primer pair 109A and 109B (Table 7). The 5' region of both of these primers also contains a ~15bp 5' sequence homologous to the ends of pSOR4-mEGFP-neo4 linearized with Pstl and Notl (which removes the 3' genomic coding region of SOR4, mEGFP, and the3'BTUl terminator) for In-Fusion® mediated insertion into the vector. The same strategy was used to disrupt the other sortilins (SOR1: TTHERM 00420610, SOR2: TTHERM 00410210, and SOR3: TTHERM 00467390), using primers listed in Table 7.
[00143] Expression of Igrlp-GFP. The IGRl-eGFP construct (Cowan et al, 2005) was linearized with Sfil and biolistically transformed into CU428 and ASOR4.
[00144] Expression of Cth3p-CFP. The CTH3 (TTHERM 00321680) ORF was cloned into the pBSICC Gateway vector, a gift from Doug Chalker, with primer pair S001 and S002 with Invitrogen's Gateway cloning system. Briefly, the CTH3 ORF was first cloned into the entry vector PENTRTM/D-TOPO® and then inserted into the pBSICC Gateway destination vector with the LR Clonase II® recombinase. The CTH3 ORF is flanked upstream in the destination vector by the cadmium inducible MTT1 promoter (Shang et al., 2002) followed by the 3' end of the RPL29 locus, modified to contain a mutation that confers cycloheximide resistance(Yao and Yao, 1991), and flanked downstream by the 3' RPL29 genomic region. After linearization, this construct can integrate at the end of the RPL29 locus for the transient expression of the cloned ORF. The construct was linearized with Hindlll and biolistically transformed into CU428 and ASOR4.
[00145] Biolistic Transformations. Target cultures were grown to log phase and starved for 18-24 hours in lOMm Tris pH 7.0. Gold particles (Seashell Technology, San Diego, CA) were prepared as recommended with 15 "g of total linearized plasmid DNA and then applied to the macrocarrier flying disk for use in a Biolistic PDS-100000/He device
(BioRad, Hercules, CA) with the following settings; 27-28 in Hg vacuum, 1/4 in gap distance, 8 mm macrocarrier travel, and a target distance of 9 cm. Cells were concentrated to lmL (from 30mL) and loaded into the apparatus on filter paper. After the shot, the cells were transferred on the filter paper to a pre-warmed flask containing 50mL of SPP. To select for positive transformants, drug was added 4h after bombardment to cultures shaken at 30°C. Transformants were selected in paromomycin sulfate (120 "g/ml + 1 "g/ml CdCb), blasticidin (60 "g/ml + 2 "g/ml CdCb), or cycloheximide (12 "g/ml). Drug resistant transformants were identified after 3-6 days. Transformants were then serially transferred every 2-3 days in decreasing concentrations of CdCb for at least 2 weeks before further testing. At least two independent transformants were tested for each line.
[00146] RT-PCR Assessment of SORI-4 Disruption. RNA was harvested with the RNeasy Mini Kit (Qiagen, Valencia, CA) from 106 cells grown to 1.5-3.0 x 10s cells/mL, washed and starved for 2h in 10 mM Tris pH 7.0, and lysed after resuspension in buffer RLT by passage (5-7x) through a 1 mL tuberculin syringe. cDNA was generated from the harvested RNA with the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The presence of SORI-4 transcripts was assayed by PCR amplification of purified cDNA with the same primer pair used to amplify the C-terminal coding region used to construct the GFP fusions (Table 7). Knockouts were confirmed by the persistent absence of the corresponding transcript after four weeks of growth in the absence of drug selection (3-4 serial transfers/week).
[00147] Dibucaine Stimulation. Cultures were grown to stationary phase and then incubated for an additional 24h before being concentrated, at least 10-fold, into a loose pellet and stimulated with 2.5 mM Dibucane. Stimulated cultures were mixed gently for ~30sec and restored to their original volume with lOmM HEPES, 5mM CaCb. After gently mixing, the culture was then centrifuged at 1200 x g for 2 min, resulting in the formation of a cell pellet/flocculent bilayer.
[00148] Immunofluorescence Cells were washed and fixed (~3mL of culture) in an equal volume of ice-cold 4% paraformaldehyde (in 50mM HEPES pH 7.0 for lOmin. After two washes in icecold HEPES, cells were then permeablized in ice-cold 0.1% Triton X-100 in HEPES for 8 min on ice. After two more washes with ice-cold HEPES, cells were resuspended in blocking solution (1% BSA in TBS (lOmM Tris pH 7.5, 154 mM NaCl)) and warmed to room temperature while rotating slowly for 30min. For 1° antibody incubation, fixed cells were resuspended in 100 #L of hybridoma supernatant diluted 1 :5 for 4D11 or 1 :9
for 5E in the 1% BSA blocking solution. After 30 min, with mild agitation every 5 min to prevent the cells from settling, the cells were washed 3X with 0.1% BSA in TBS, pelleted, and then resuspended in 100 #L Texas-Red® -X coupled goat anti-mouse IgG (Life Technologies, Carlsbad, CA) diluted 1 : 100 in 1% BSA blocking solution. After 30 min, with mild agitation every 5 min, the cells were washed once with 0.1% BSA in TBS and twice with lOmM HEPES pH 7.0. Cells were resuspended in a final volume of 150 "L of lOmM HEPES pH 7.0 and then mixed with an equal volume of Mounting Media (30% Glycerol, 0.1% Trolox) immediately before slide preparation. For the co-localization of Grl3p and Cth3p-CFP, the former was decorated using mAb 5E9 as described above, the latter using polyclonal anti- GFP antibody (Life Technologies, Carlsbad, Ca) diluted 1 :400. The 2° antibodies, which were similarly co-incubated with samples, were Texas Red-coupled goat anti-mouse IgG and 488-coupled donkey anti-rabbit IgG (Life Technologies, Carlsbad, Ca), diluted 1 :250. Cells were imaged with a Leica (Buffalo Grove, IL) TCS SP5 II STED-CW super-resolution laser scanning confocal microscope with a lOOx/1.40 NA oil objective at room temperature. Images were captured with the LAS AF Lecia confocal software on Windows 7. Image data were colored, denoised, and adjusted in brightness/contrast with the program ImageJ (available on the world wide web at rsbweb.nih.gov/ij). The images of the protease expressing cells were also colored, but only their brightness/contrast was additionally adjusted. All cells, as shown in Fig. 5, were treated identically, adjusted to the same brightness/contrast values established by a representative WT image. The simultaneous localization of Grtlp and Grl3p was performed as described above, but the mAbs 4D11 and 5E9 were directly conjugated to Dylight 488 and 649 respectively (Thermo Scientific, Rockford,IL), and mixed 1 : 1 prior to incubation with samples. These images were then processed with Huygens Pro from SVI. [00149] Co-localization Measurement. The M2 correlation coefficient was determined with the Image J plugin JACoP(Bolte and Cordelieres, 2006). For this analysis, a representative WT image was selected to establish the threshold values that were then used to determine the M2 value for all other images. To limit the analysis to the cell periphery, each cell outline was traced based on the docked mucocyst signal, and this line was broadened to create a band that encompassed all fluorescent signals at the cell periphery. The broadening factor was 60% larger for WT cells than for Asor4 cells, to compensate for the larger size of mucocysts in the former. The signal outside of this selected band was then cleared and the resulting images were then processed with JACoP using the same threshold values identified
above. A macro for the above, entitled "JACoP band measure macro" was created in ImageJ and is available for download on the world wide web at digital.bsd.uchicago . edu/%5 Cimagej_macros .html.
[00150] Western Blots. Whole cell ly sates were prepared from 10s cells starved for 2h in lOmM Tris pH 7.0, washed once and then resuspended in an equal volume, and precipitated with trichloroacetic acid (TCA) (10% [final]). TCA precipitates were incubated on ice for 30min, centrifuged (18,000 x g, lOmin, 4°C), washed with ice-cold acetone, centrifuged (18,000 x g, lOmin, 4°C) and resuspended in 2x sample buffer. Proteins were resolved with the Novex® NuPAGE® SDS-PAGE Gel System (4-12% Bis-Tris Gels) (Life Technologies, Carlsbad, Ca) and transferred to 0.45 μιη PVDF membranes (Thermo Scientific, Rockford, IL) at 100V for lh. Protein was then reversibly stained with Ponceau S and the blot was then blocked with 5% dried milk, 50mM Tris pH 7.8, 0.02% NP-40, and 2 mM CaCb for 1 hour. The 1° antibody incubation, diluted in the blocking buffer, was at least one hour. The blot was then washed 4x, for 5min each, in 50mM Tris pH 7.8, 0.02% NP-40, and 2 mM CaCb. The 2° antibody incubation, diluted in the blocking buffer, was also at least one hour. After 4 more washes the blot was then incubated with the appropriate substrate and imaged. The anti-Grllp, anti-Grtlp, and monoclonal anti-GFP (Covance, Princeton, New Jersey) 1° antibodies were diluted 1 :5000, 1 :500, and 1 :5000 respectively. Protein was visualized with either ECL Horseradish Peroxidase linked rabbit (NA934) or mouse (NA931) (Amersham Biosciences, Buckinghamshire, England) secondary antibody diluted 1 :20,000 and SuperSignal® West Femto Maximum Sensitivity Substrate (Thermo Scientific, Rockford, IL).
[00151] Electron Microscopy. Cells grown to stationary phase were fixed in 2% Glutaraldehyde, 1% sucrose and 1% osmium at 25°C in 0.1M sodium cacodylate buffer and section-stained with uranyl acetate and lead citrate post embedding. Thin sections were viewed on a FEI (Hillsboro, OR) Tecnai G2 F30 Super Twin microscope.
[00152] Alcian Blue stimulation/Co-Immunoprecipitation. Sor4p-GFP was immunoprecipitated with polyclonal anti-GFP antibody coupled to magnetic Dynabeads (Life Technologies, Carlsbad, CA), from lysates of cells expressing Sor4p-GFP that were undergoing regranulation following Alcian Bluestimulated degranulation (Haddad and Turkewitz, 1997). Briefly, lOOmL cultures were starved for 6h in lOmM Tris pH7.0, concentrated to 6mL, transferred to a 500 mL flask, stimulated for 15 sec with 2mL of 0.2% Alcian Blue, rescued with 92mL of 0.25%> proteose peptone + 0.5mM CaCb, washed once
and suspended in 36 mL of lOmM Tris and allowed to recover for 20min in 50 mL conical tubes. After 20min, ~30mL of swimming cells were withdrawn, pelleted, and resuspended in 9mL of lysis buffer (25mM Tris pH 7.4, 150mM NaCl, lmM EDTA, 1% NP-40, 5% glycerol) plus 2 complete Ultra protease inhibitor tablets per sample (Roche, Indianapolis, IN). After 30min on ice, lysates were cleared by centrifugation at 13,000 rpm for 20min, and split into two aliquots. 1.5mg of anti-GFP-coupled Dynabeads, or rabbit anti-mouse IgG as negative control, were added to each aliquot and mixed for 8h at 4°C. The beads were then washed 3 times with lysis buffer and suspended in 70"L 100°C SDS-PAGE sample buffer.
[00153] Phylogenetic Tree Construction. Using a protein BLAST (blastp) the T. thermophila SOR4 VPS 10 domain was used to identify homo logs in Ciliates and other Alveolates as documented in Table 8 and then homologs in other eukaryotic lineages as documented in Table 9. For tree building the top hits were selected from each lineage plus the VPS 10 domains from sortilins in humans and budding yeast. These VPS 10 domains were assembled and aligned with MUSCLE (available on the world wide web at ebi.ac.uk/Tools/msa/muscle) and Maximum likelihood trees were constructed with MEGA5 (Molecular Evolutionary Genetics Analysis; available on the world wide web at megasoftware.net/) using the WAG amino acid substitution model and 1000 bootstrap replicates. Accession numbers from which VPS 10 domain sequences were obtained to create the phylogeny in FIG. 18B and listed in Table 8.
Table 8
[00154] Accession numbers (see Table 9) from which VPS 10 domain sequences were obtained to create the phylogeny in FIG. 24.
Table 9
[00155] Live Cell Imaging. Cultures grown to 150-300,000 cells/mL were starved for 2h in lOmM Tris pH 7.0 before being pelleted and resuspended in 6% polyethylene oxide (Sigma Aldrich, St. Louis, MO) to immobilize the swimming cells. For cells expressing Igrlp-GFP under the control of the MTT1 promoter, 0.1 "g/mL of CdCb was added for 2h
toinduce transgene expression. The IGR1 -GFP lines were imaged on an Olympus (Center Valley, PA) DSU spinning disk inverted confocal microscope with a lOOx/1.35 NA oil objective at room temperature. Images were captured with an Evolve-backthinned CCD camera (Photometries, Tuscon, AZ) in SlideBook (3i, Santa Monica, CA). The SOR4-GFP lines were imaged using a Marianas Yokogawa type spinning disk inverted confocal microscope (3i, Santa Monica, CA) with the lOOx/1.45 NA oil objective at room temperature. Images were captured with an Evolve-backthinned air chilled CCD camera in SlideBook. The brightness/contrast of the images were adjusted in Image J. Additionally, background/noise in Video 1 was edited using a variation on the 3x3 2D Median Hybrid Filter ImageJ plugin (available on the world wide web at rsbweb.nih.gov/ij/plugins/hybrid2dmedian.html).
[00156] In vitro enzyme assay for Cth3p activity: Cth3 activity was assayed in vitro using the SensoLyte® 520 Cathepsin D Assay Kit Fluorimetric (AnaSpec, Fremont, CA) as per manufacture's instruction, and including the cathepsin D positive control provided by the manufacturer. Cth3p, in parallel with the active site mutant were isolated as GFP-fusions (cth3-4p and cth3-5-p, respectively) by immunoprecipitation from Tetrahymena whole cell Triton X-100 lysate using polyclonal rabbit anti-GFP antiserum as described above, except that the following protease inhibitors were included in the lysis buffer: 10μΜ E-64, ImM PMSF and ΙΟΟμΜ Leupeptin. Enzyme assays were carried out in ΙΟΟμΙ in 96 well plates. Activity was recorded as the rate of hydrolysis of substrate, at 5 min intervals for 60 min at RT, using a Gemini XPS Fluorescence Microplate Reader (Molecular Devices, Sunnyvale, CA; excitation, 485 nm; emission, 515 nm).
* * *
[00157] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
Adoutte, et al, JMol Biol. 180: 1065-1081, 1984.
Adoutte, Paramecium. Springer- Verlag, Berlin. Pp:325-363, 1998.
Arvan, et al, Curr Opin Cell Biol. 14:448-53, 2002.
Asensio, et al, J cell Biol. 191 : 1173-87, 2010.
Bolte & Cordelieres, J Microsc. 224:213-232, 2006.
Bowman, et al, Traffic. 6:303-323, 2005a.
Bowman & Turkewitz, Genetics. 159: 1605-1616, 2001.
Bowman, et al, J Eukaryot Microbiol. 52:291-297, 2005b.
Bradshaw, et al, J Biol Chem. 278:4087-4095, 2003.
Braulke & Bonifacino, Biochim Biophys Acta. 1793:605-14, 2009.
Bright, et al, PLoS Genet. 6:el001155, 2010.
Burgess, & Kelly, Annu Rev Cell Biol. 3:243-293, 1987.
Canuel, Libin & Morales, Histol Histopathol. 24:481-492, 2009.
Cassidy-Hanley, et al, Genetics. 146: 135-147, 1997.
Chanat & Huttner, J. Cell Biol. 115: 1505-1519, 1991.
Chen, et al, JNeurosci. 25:6156-6166, 2005.
Che, et al, Proc Natl Acad Sci USA. 98:9971-9976, 2001.
Chilcoat, et al, J Cell Biol. 135: 1775-1787, 1996.
Collette, et al, Int Rev Cytol 241 : 1 -51 , 2004.
Collins & Wilhelm, J5zo/ Chem. 256:10475-10484, 1981.
Cowan, et al, Mol Biol Cell 16:4046-4060, 2005.
Dowse & Soldati, Curr Opin Microbiol. 7:388-396, 2004.
Dunn, Chem Rev. 102:4431-4458, 2002.
Edwards, et al, J Cell Biol. 186:881-895, 2009.
Eisen, et al PLoS Biol. 4:e286, 2006.
Elde, Long & Turkewitz, Trends Cell Biol. 17: 157-164, 2007.
Elde, et al, PLoS Genet. 1 :e52, 2005.
Emanuelsson, et al, Nat Protoc. 2:953-971 , 2007.
Funkelstein, et al, Neuropeptides. 44:457-466, 2010.
Garreau de Loubresse, Membrane Traffic in Protozoa. Vol. 2. JAI Press, Greenwich, CT. 27- 60, 1993.
Gautier, et al, J Cell Biol. 124:893-902, 1994.
Grabner, et al, Proc Natl Acad Sci USA. 103: 10035-10040, 2006.
Gunay-Aygun, Huizing & Gahl, Semin Thromb Hemost. 30:537-547, 2004.
Gurkan, et al, Mol Biol Cell 16:3847-3864, 2005.
Haddad, et al, Eukaryot Cell 1 :583-593, 2002.
Haddad & Turkewitz, Proc. Natl. Acad. Sci. U.S.A. 94: 10675-10680, 1997.
Harumoto & Miyake, J Exp Zool. 260:84-92, 1991.
Hermey, Cell Mo I Life Sci, 2009.
Hook, et al, J Neurochem. 81 :237-256, 2002.
Hunseler, Tiedtke & von Figura, Biochem J. 252:837-842, 1988.
Jacobs, et al, E karyot Cell. 5:1990-2000, 2006.
Kim, Physiology (Bethesda). 21 : 124-133, 2006.
Koumandou, J Ce// &z. 124: 1496-1509, 2011.
Kronforst, Pigment Cell Melanoma Res. 25:411-433, 2012.
Kuliawat & Arvan, J. Cell Biol. 118:521-529, 1992.
Kurz & Tiedtke, J Eukaryot Microbiol. 40: 10-13, 1993.
Madeddu, et al, Biochimie. 76:329-335, 1994.
Madeddu, et al, Mol Biol Cell. 6:649-659, 1995.
Marcusson, Cell. 77:579-586, 1994.
Maihle & Satir, JBiol Chem. 261 :7566-7570, 1986.
Marchler-Bauer, Acids Res. 37:D205-210, 2009.
McGrath, Annu Rev Biophys Biomol Struct. 25: 181 -204, 1999.
Melia, Cole & Turkewitz, J Cell Sci. 1 1 l(Pt 1):131-140, 1988a.
Melia, Cole & Turkewitz, J. Cell Sci. 1 1 1 :131-140, 1998b.
Morvan & Tooze, Histochem Cell Biol 129:243-252, 2008.
Ngo, Yang & Joiner, Mo I Microbiol. 52: 1531-1541, 2004.
Nusblat, Bright & Turkewitz, Methods Cell Biol. 109: 141-175, 2012.
Odorizzi, Cowles & Emr, Trends Cell Biol. 8:282-288, 1998.
Orias, et al, J Cell Sci. 64:49-67, 1983.
Peck, et al., In Membrane Traffic in Protozoa. Vol. 2. JAI Press, Greenwich, CT. 1-26, 1993.
Rahaman, et al, Eukaryot Cell. 8: 1575-1583, 2009.
Rosati & Modeo. J Eukaryot Microbiol. 50:383-402, 2003.
Rouille, et al, Front Neuroendocrinal. 16:322-361, 1995.
Satir, Cell Biol Int Rep. 1 :69-73, 1977.
Shang, Proc Natl Acad Sci USA. 99:3734-3739, 2002.
Shaw, et al, Microbes Infect. 4: 119-132, 2002.
Shea, et al, Traffic. 8: 1018-1034, 2007.
Shih, et al, J Cell Sci. 100(Pt l):85-97, 1991.
Shih, et al, Protein Sci. 14:936-941, 2005.
Sloves, Cell Host Microbe. 11 :515-527, 2012.
Sperling, et al, J Cell Biol. 105:1649-1662, 1987.
Stechmann & Cavalier-Smith, JMol Evol, 57:408-419, 2003.
Steers, et al, Exp Cell Res. 57:392-396, 1969.
Steiner, Nature. 243:528-530, 1973.
Sumakovic, et al, J Cell Biol. 186:897-914, 2009.
Tiedtke, Naturwissenschaften. 63:93, 1976.
Tindall, et al, J Cell Sci. 92(Pt 3):441-447, 1989.
Tooze, FEBS Lett. 285:220-224, 1991.
Turkewitz & Kelly, Dev Genet. 13: 151-159, 1992.
Turkewitz, et al, EMBO J. 10: 1979-1987, 1991.
Urbe, et al, Biochim Biophys Acta. 1358:6-22, 1997.
van der Zand, et al, Cell. 149:397-409, 2012.
Vayssie, et al, J Cell Sci. 114:875-886, 2001.
Verbsky & TurkQwitz, Mol Biol Cell. 9:497-511, 1998.
Xie, et al, Eukaryot Cell. 6:388-397, 2007.
Xiong, et al, Sci China Life Sci. 54:65-67, 2001.
Yao, et al, J Cell Sci. 120: 1978-1989, 2007.
Yates & Campbell, Nat Rev Genet. 13:795-806, 2012.
Zacharias, et al, Science. 296:913-916, 2002.
Zakon, Proc Natl Acad Sci USA. 109 Suppl 1 : 10619-10625, 2012.
Claims
1. A method of stabilizing a protein of interest in the mucocysts of a ciliate comprising transforming the ciliate with a polynucleotide comprising a sequence complementary to a gene corresponding to CTHl, CTH2, CTH3, CTH4, or CARl, wherein the protein of interest is stabilized in the mucocysts of the transformed ciliate.
2. The method of claim 1 , wherein the gene corresponds to CARl .
3. The method of claim 2, wherein the stabilized protein of interest is not subject to cleavage by CAR proteases.
4. The method of claim 1 , wherein the gene corresponds to CTHl, CTH2, CTH3, or CTH4.
5. The method of claim 4, wherein the stabilized protein of interest is not subject to cleavage by CTH proteases.
6. The method of any of claims 1-5, wherein the ciliate is Tetrahymena.
7. The method of claim 6, wherein the Tetrahymena is T. thermophila or T. pyriformis.
8. A method of producing a protein of interest comprising:
(a) expressing a polynucleotide encoding the protein in a genetically altered ciliate, wherein the ciliate lacks detectable expression of one or more SOR gene product corresponding to CTHl, CTH2, CTH3, CTH4, or CARl or wherein the ciliate expresses enzymatically inactive CTHl, CTH2, CTH3, CTH4, or CARl, and
(b) incubating the ciliate in a media under conditions permissible for expression of the protein,
wherein the protein of interest is stabilized in the mucocysts of the transformed ciliate.
9. The method of claim 8, wherein the ciliate does not comprise a CTHl, CTH2, CTH3, CTH4, or CARl gene.
10. The method of claim 8, wherein the ciliate expresses enzymatically inactive CTH1, CTH2, CTH3, CTH4, or CARL
11. The method of claim 8, wherein the stabilized protein of interest is not subject to cleavage by CTH proteases.
12. The method of any of claims 8-11, wherein the ciliate is Tetrahymena.
13. The method of claim 12, wherein the Tetrahymena is T. thermophila or T. pyriformis.
14. The method of any of claims 8-13, wherein the method is performed in a plurality of ciliates.
15. The method of claim 14, wherein the method is performed in at least 100 ciliates.
16. A method of targeting a protein of interest to the mucocysts of a ciliate comprising transforming the ciliate with a polynucleotide comprising a sequence complementary to a SOR gene corresponding to SORl, SOR2, SOR3 or SOR4, wherein the protein of interest is targeted to the mucocysts of the transformed ciliate.
17. The method of claim 16, wherein the SOR gene is SOR2 or SOR4.
18. The method of any of claims 16-17, wherein the ciliate is Tetrahymena.
19. The method of claim 18, wherein the Tetrahymena is T. thermophila or T. pyriformis.
20. The method of any of claims 16-19, wherein the protein of interest is a mucocyst cargo protein.
21. The method of claim 20, wherein the protein of interest is a Grt- family protein.
22. The method of any of claims 16-21, wherein the method is performed in a plurality of ciliates.
23. The method of claim 22, wherein the method is performed in at least 100 ciliates.
24. A method of producing a protein of interest comprising:
(a) expressing a polynucleotide encoding the protein in a genetically altered ciliate, wherein the ciliate has increased expression of one or more SOR gene product corresponding to CTH1, CTH2, CTH3, CTH4, or CAR1 when compared to a wild type ciliate, and
(b) incubating the ciliate in a media under conditions permissible for expression of the protein.
25. The method of claim 24, wherein the ciliate is Tetrahymena.
26. The method of claim 25, wherein the Tetrahymena is T. thermophila or T. pyriformis.
27. The method of any of claims 24-26, wherein the method is performed in a plurality of ciliates.
28. The method of claim 27, wherein the method is performed in at least 100 ciliates.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361843206P | 2013-07-05 | 2013-07-05 | |
| US61/843,206 | 2013-07-05 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2015003136A1 true WO2015003136A1 (en) | 2015-01-08 |
Family
ID=52144212
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/045414 Ceased WO2015003136A1 (en) | 2013-07-05 | 2014-07-03 | Expression profiling reveals cathepsins involved in secretory vesicle maturation in tetrahymena thermophila |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2015003136A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040235091A1 (en) * | 1998-10-13 | 2004-11-25 | University Of Georgia Research Foundation, Inc. | Stabilized bioactive peptides and methods of identification, synthesis and use |
| US20120107343A1 (en) * | 2009-03-20 | 2012-05-03 | Clark Theodore G | Production of recombinant proteins in ciliates and uses thereof |
| US20130224796A1 (en) * | 2012-02-22 | 2013-08-29 | The University Of Chicago | Genetically altered ciliates and uses thereof |
-
2014
- 2014-07-03 WO PCT/US2014/045414 patent/WO2015003136A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040235091A1 (en) * | 1998-10-13 | 2004-11-25 | University Of Georgia Research Foundation, Inc. | Stabilized bioactive peptides and methods of identification, synthesis and use |
| US20120107343A1 (en) * | 2009-03-20 | 2012-05-03 | Clark Theodore G | Production of recombinant proteins in ciliates and uses thereof |
| US20130224796A1 (en) * | 2012-02-22 | 2013-08-29 | The University Of Chicago | Genetically altered ciliates and uses thereof |
Non-Patent Citations (9)
| Title |
|---|
| BRIGUGLIO ET AL.: "Lysosomal sorting receptors are essential for secretory granule biogenesis in Tetrahymena", J CELL BIOL., vol. 203, no. 3, 11 November 2013 (2013-11-11), pages 537 - 50 * |
| DATABASE GENBANK 1 June 2012 (2012-06-01), "XM_001008250, Tetrahymena thermophila Eukaryotic aspartyl protease family protein, mRNA.", retrieved from http://www.ncbi.nlm.nih.gov/nuccore/XM_001008250 accession no. M_001008250 * |
| DATABASE GENBANK 1 June 2012 (2012-06-01), "XM_001023356, Tetrahymena thermophila Papain family cysteine protease containing protein, mRNA.", accession no. M_001023356 * |
| DATABASE GENBANK 7 May 2009 (2009-05-07), "XM_001012968, Tetrahymena thermophila Eukaryotic aspartyl protease family protein, mRNA.", accession no. M_001012968 * |
| DATABASE GENBANK 7 May 2009 (2009-05-07), "XM_001014915, Tetrahymena thermophila Eukaryotic aspartyl protease family protein, mRNA.", accession no. M_001014915 * |
| HERRMANN ET AL.: "Biochemical and molecular characterisation of Tetrahymena thermophila extracellular cysteine proteases.", B MC MICROBIOL, vol. 6, 28 February 2006 (2006-02-28), pages 19, XP021014848, DOI: doi:10.1186/1471-2180-6-19 * |
| KABA ET AL.: "Development of a chitinase and v-cathepsin negative bacmid for improved integrity of secreted recombinant proteins", JOURNAL OF VIROLOGICAL METHODS, vol. 122, 22 March 2004 (2004-03-22), pages 113 - 118, XP004603081, DOI: doi:10.1016/j.jviromet.2004.07.006 * |
| RAHAMAN ET AL.: "Independent Transport and Sorting of Functionally Distinct Protein Families in Tetrahymena thermophila Dense Core Secretory Granules", EUKARYOTIC CELL, vol. 8, no. 10, 23 May 2009 (2009-05-23), pages 1575 - 1583 * |
| SHORT: "Sortilins get a new delivery route.", J CELL BIOL., vol. 203, no. 3, 11 November 2013 (2013-11-11), pages 377 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10209239B1 (en) | Method of making an aromagraph comprising ectopic olfactory receptors | |
| Kragt et al. | Endoplasmic reticulum-directed Pex3p routes to peroxisomes and restores peroxisome formation in a Saccharomyces cerevisiae pex3Δ strain | |
| US20230323419A1 (en) | Vertebrate cells and methods for recombinantly expressing a polypeptide of interest | |
| Briguglio et al. | Lysosomal sorting receptors are essential for secretory granule biogenesis in Tetrahymena | |
| EP2921551A2 (en) | Host cells and methods of use | |
| ES2843679T3 (en) | Host cells and methods of use | |
| BE1023841A1 (en) | MAMMAL CELLS EXPRESSING ANTIGENS OF CYTOMEGALOVIRUS | |
| Kalel et al. | Identification and functional characterization of Trypanosoma brucei peroxin 16 | |
| Horáková et al. | The Trypanosoma brucei TbHrg protein is a heme transporter involved in the regulation of stage-specific morphological transitions | |
| Bassarak et al. | Functional characterization of three aquaglyceroporins from Trypanosoma brucei in osmoregulation and glycerol transport | |
| Kumar et al. | An aspartyl cathepsin, CTH3, is essential for proprotein processing during secretory granule maturation in Tetrahymena thermophila | |
| KR20120017046A (en) | Eukaryotic Host Cells Containing Expression Enhancers | |
| WO2015003136A1 (en) | Expression profiling reveals cathepsins involved in secretory vesicle maturation in tetrahymena thermophila | |
| Bosch et al. | Two neuronal peptides encoded from a single transcript regulate mitochondrial complex III in Drosophila | |
| CA3098039C (en) | Parasite vaccine | |
| Sawamiphak et al. | Functional expression of the rat organic anion transporter 1 (rOAT1) in Saccharomyces cerevisiae | |
| KR20140148027A (en) | Method for screening yeast strains with enhanced recombinant protein secretion using yeast variants having cell-wall defect | |
| Gilson et al. | Deakin Resear Ch Online | |
| US20210213113A1 (en) | Parasite vaccine | |
| Chamberlain | Essential or redundant? Disentangling the (GR) ESAG families of Trypanosoma brucei | |
| Dhivya et al. | A bioactive peptide amidating enzyme is required for ciliogenesis | |
| Strating | The role of the p24 family in ER-to-Golgi protein transport: Functional studies using transgenic Xenopus intermediate pituitary cells | |
| Fu et al. | Characterization of the Neurospora crassa Cell Fusion Proteins | |
| WO2005054471A1 (en) | Novel centromeric protein shugoshin | |
| NZ769259B2 (en) | Parasite vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14819361 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14819361 Country of ref document: EP Kind code of ref document: A1 |













