WO2014201454A2 - Dnazyme-nanoparticle conjugates and methods of use thereof - Google Patents

Dnazyme-nanoparticle conjugates and methods of use thereof Download PDF

Info

Publication number
WO2014201454A2
WO2014201454A2 PCT/US2014/042480 US2014042480W WO2014201454A2 WO 2014201454 A2 WO2014201454 A2 WO 2014201454A2 US 2014042480 W US2014042480 W US 2014042480W WO 2014201454 A2 WO2014201454 A2 WO 2014201454A2
Authority
WO
WIPO (PCT)
Prior art keywords
ddz
compound
virus
seq
aun
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2014/042480
Other languages
French (fr)
Other versions
WO2014201454A3 (en
Inventor
James R. Carter
Malcolm J. Fraser
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Notre Dame
Original Assignee
University of Notre Dame
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Notre Dame filed Critical University of Notre Dame
Priority to US14/757,293 priority Critical patent/US10287578B2/en
Publication of WO2014201454A2 publication Critical patent/WO2014201454A2/en
Publication of WO2014201454A3 publication Critical patent/WO2014201454A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983Viruses
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • G01N33/588Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with semiconductor nanocrystal label, e.g. quantum dots
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/127DNAzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3517Marker; Tag
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24111Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24122New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08RNA viruses
    • G01N2333/18Togaviridae; Flaviviridae
    • G01N2333/181Alphaviruses or Group A arboviruses, e.g. sindbis, VEE, EEE, WEE or semliki forest virus
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08RNA viruses
    • G01N2333/18Togaviridae; Flaviviridae
    • G01N2333/183Flaviviridae, e.g. pestivirus, mucosal disease virus, bovine viral diarrhoea virus, classical swine fever virus (hog cholera virus) or border disease virus
    • G01N2333/185Flaviviruses or Group B arboviruses, e.g. yellow fever virus, japanese encephalitis, tick-borne encephalitis, dengue
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to DNAzymes (also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ) which are conjugated to nanoparticles to facilitate the detection of nucleic acids.
  • DNAzymes also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ
  • the invention relates to compounds comprising DNAzymes conjugated to nanoparticles, methods for their synthesis, and methods of using the conjugated compounds to detect nucleic acids, such as genomic material or transcripts of viruses and other infectious agents.
  • DENV could be detected directly from cell culture supernatants without additional sample processing, when SDS was included in the reaction mixture. Specificity assays demonstrated detection is DENV-specific, while sensitivity assays confirm detection at levels of 1 x 10 1 TCI D 50 units. These results demonstrate DDZ-AuN P can be used to detect DENV genomes in a sequence specific manner and at concentrations that are practical for field use.
  • Dengue viruses members of the Flavivirus family of viruses, cause periodic explosive epidemics in many tropical and sub-tropical countries leading to 50-100 million infections per year [World Health Organization (2012)]. Approximately 500,000 of these are severe cases requiring hospitalization with a 2.5% fatality rate, most of which are children [Randolph et al. (2010)]. About half the world's population remains at risk for DENV infection making this pathogen one of the most dangerous viruses in the world [Clyde et al. (2006)]. In 2010 there were 1.6 million cases of dengue in the Americas alone, of which 49,000 were severe cases. Recent domestic outbreaks have occurred in the Hawaiian Islands in 2001, Brownsville, Texas in 2005 [Ramos et al.
  • CH IKV remained largely unknown until a series of large scale epidemics occurred on several islands in the Indian Ocean in 2005 and 2006 culminating in a catastrophic outbreak on the island of la Reunion, resulting in 265,000 infections and 237 deaths in a population of 775,000 [Tsetsarkin et al. (2006)].
  • CH I KV has since been imported into Europe by infected travelers returning from endemic areas as evidenced by a CH IKV introduction in the French Riviera [Cordel et al. (2006)]. Most recently, CH IKV outbreaks have occurred and are currently ongoing on multiple Caribbean Islands including St. Maart, British Virgin Islands, Guadeloupe, Martinique, Saint Barthelemy, and French Guiana [Van Bortel et al. (2014)].
  • DENV are maintained in a cycle that involves humans and the globally disseminated Aedes aegypti mosquito [Roberts et al. (2002)]. Infection with one of four antigenically-distinct, but genetically-related DENV serotypes (designated DENV-1, -2, -3, and -4) can result in dengue fever (DF), dengue hemorrhagic fever (DH F), which can be fatal, or both DF and DH F [Qi et al. (2008)]. These disease states are characterized by high fever, often with enlargement of the liver, and in severe cases, circulatory and respiratory failure [Rigau-Perez et al. (1998)].
  • the ability to detect DENV in a timely manner is essential to rapid recovery from disease symptoms. Detection of mosquito-borne viruses in infected humans is currently limited to plaque assays, antigen detection assays (e.g. NS1 antigen detection), or quantitation of viral production through PCR-based methods [Lanciotti et al. (1992); Gubler (1998)]. These assays are currently referred to as the "gold standards" for DENV detection [de Oliveira et al. (2005)]. Current methods of testing mosquito populations for arboviruses, particularly dengue and West Nile viruses, has been limited to RT-PCR assays on pools of mosquitos (approximately 50 insects) [Shu et al. (2004); Chisenhall et al. (2008)].
  • One aspect of the invention relates to a compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3' BA); wherein said 5' and 3' Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
  • DZ DNAzyme conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P
  • said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3
  • the invention is also directed to a method wherein said N P is an AuN P, and said aggregation is measured by absorbance or by visual inspection.
  • the invention is also directed to a kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising one or more types of DZ-N P conjugates described above.
  • FIG. 1 sets forth an illustration showing an overview of the DDZ-AuNP assay for dengue virus detection.
  • AuN Ps are conjugated with the sulfide-linked anti-DENV DNAzyme, DDZ, which is complimentary to the DENV RNA genome (shown in orange).
  • Black vertical lines indicate complimentary base pairing between DDZ and the target RNA.
  • the 5' and 3' arms of the anti-DENV DNAzyme, DDZ bind to the 3' and 5' ends of the targeted 5'-3' CS region, respectively (B).
  • FIG. 2 sets forth an illustration showing anatomy of the 10-23 anti-DENV DNAzyme (DDZ) and Schematic Diagram of the DENV genome.
  • DDZ was designed and produced as previously described [Cairns et al. (2003)]].
  • R Purine.
  • Y Pyrimidine.
  • the target RNA is in green with the anti-DENV DNAzyme 10-23 shown in black. The 5' and 3' ends of target RNA and DNAzymes are as indicated. Thin black vertical lines show complimentary base pairing. Arrows indicate cleavage site of the target RNA.
  • B) A representation of the 10,723 base DENV-2 NGC GC capped and polyadenylated genome is shown to illustrate the position of the region targeted by the anti-DENV DNAzyme, DDZ.
  • Non-structural (NS) genes 1 through 5 are shown in green. Structural genes encoding capsid, membrane glycoprotein precursor, and envelope proteins are shown in red.
  • UTR untranslated region
  • PA polyadenylation.
  • FIG. 3 sets forth an illustration showing in vitro DDZ activity assay.
  • DDZ-M-AuN Ps (1 ⁇ 10 5 particles/mL) were placed in a buffered solution containing 10 mM MgCI 2 , DENV-2 NGC RNAs (0.6 ⁇ ) isolated from Ae. alboplctus C6/36. Following incubation at 37°C for 30 minutes, RT-PCR was performed as described in EXAMPLE 1 to amplify digestion products. Fragments were then separated on a 1.75% TAE agarose gel in the presence of ethidium bromide and photographed under UV light. Arrows indicate digestion products of approximately 150 and 350 bases and the primer dimer, respectively. The results demonstrate digestion of full length DENV-2 genome by DDZ-M in spite of AuN P conjugation.
  • DDZ anti-dengue virus DNAzyme
  • DDZin inactive anti-dengue virus DNAzyme.
  • FIG. 4 sets forth an illustration showing colorimetric DDZ-AuNP detection of a synthetic DENV-2 NGC RNA target.
  • a synthetic stretch of ribonucleotides corresponding to the 5' 170 bases of the DENV-2 RNA genome was added to a buffered mixture containing 10 m M MgCI 2 , 1 ⁇ 10 5 DDZ-M-AuN P particles/mL, and 1.0 M NaCI. Samples were incubated at 37°C for 5 minutes and photographs were taken. Control samples were treated the same as experimental except 50 mM Tris-HCI was added in lieu of the synthetic DENV-2 RNA. Aggregation of DDZ-M tethered AuN Ps only occurred in the presence of synthetic DENV RNA. The results indicate that DDZ-AuN Ps have the ability to detect DENV.
  • FIG. 5 sets forth an illustration showing determination of optimal NaCI and SDS concentrations.
  • the optimal concentration of sodium, in the form of NaCI, for aggregation of DDZ-M-AuN P following interaction with the DENV-2 RNA genome was determined.
  • DENV-2 NGC strain genomic RNAs were isolated using the RNeasy Mini Kit (Qiagen) and 0.6 ⁇ was incubated in a reaction mix containing DDZ-M-AuN P (1 ⁇ 10 5 particles/mL), 10 mM MgCI 2 , and increasing concentrations of NaCI (0 to 2 M) for 30 minutes at 37°C.
  • a representative photograph of the reaction tubes is shown. The concentration of NaCI is indicated above each reaction tube. A full red to clear color transition indicates the optimum detection of the DENV-2 NGC genome.
  • 1.5 M NaCI was determined to be the minimal optimum concentration of NaCI to use in our DENV detection reactions.
  • 10 ⁇ of cell supernatants containing 1 ⁇ 10 6 DENV- 2 NGC/mL, as determined by TCI D 50 -IFA were added to a reaction mix containing 10 m M MgCI 2 , 1 ⁇ 10 5 DDZ- M-AuN P particles/mL, 1.5 M NaCI, and 0% (w/v) to 1% (w/v) SDS detergent.
  • FIG. 6 sets forth an illustration showing assessment of Mg 2+ Resistance of DDZ-tethered AuNPs.
  • DDZ-M tethered AuN Ps were incubated with increasing concentrations of MgCI 2 (0 to 20 mM). Following a 30 minute incubation period at room temperature ( ⁇ 25°C), UV/Vis spectrophotometry and photography were performed. These results demonstrate that DNAzyme conjugated AuN P aggregation is not driven by 10 mM MgCI 2 , which is used in all detection assays described in this report.
  • FIG. 7 sets forth an illustration showing an assessment of DDZ-AuNP specificity.
  • DENV-2 and CH IKV (1 x 10 6 /mL each) were placed in a buffered solution containing 10 mM MgCI 2 , 1 x 10 5 DDZ-AuN P particles/mL, 1.5 M NaCI, and 0.5% (w/v) SDS. Microcentrifuge tubes containing these mixes were incubated at 37°C for 30 minutes and photographed.
  • CH I KV chikungunya virus.
  • DENV-2 dengue virus serotype 2
  • DDZ-M anti-dengue virus DNAzyme
  • DDZin-M inactive anti-dengue virus DNAzyme.
  • FIG. 8 sets forth an illustration showing an analysis of DDZ-AuNP Sensitivity.
  • A) DDZ-M-AuN P colorimetric assays were performed on DENV-2 NGC titers of 1 ⁇ 10 1 , 1 ⁇ 10 2 , 1 ⁇ 10 4 , and 1 ⁇ 10 6 to determine the limits of detection. Samples were assembled as described earlier (see Fig. 7), incubated at 37°C for 30 minutes and photographed. Results show that the DDZ-M-AuN P colorimetric assay is capable of detecting DENV-2 at a titer as low as l x 10 1 .
  • DDZ-M anti-dengue virus DNAzyme
  • DDZin-M inactive anti-dengue virus DNAzyme.
  • UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer at an absorbance of 520 nm. Absorbance measurements were graphed in log scale to illustrate sensitivity and accuracy of the colorimetric DENV detection method.
  • FIG. 9 panels A-C set forth illustrations showing alignment of CHIKV genomic sequences to identify appropriate target regions and vitro analysis of CDZ-AuNP detection of CHIKV NA targets.
  • Panel 9A A synthetic stretch of ribonucleotides corresponding to the target site of the CH I KV RNA genome of each serotype were added to a buffered mixture containing 10 mM MgCI 2 , 2x10 s CDZ-AuN P particles, and 1.0 M NaCI. Samples were incubated at 37°C for 5 minutes and photographs were taken. Control samples were treated the same as the experimental samples, except that inactive versions of the DNAzymes were used in lieu of the active forms.
  • CDZ-AuN Ps Aggregation of CDZ-tethered AuN Ps only occurred in the presence of synthetic CH I KV RNA. Results indicate that CDZ-AuN Ps have the ability to detect CH IKV.
  • CDZ anti-CH I KV DNAzyme.
  • CDZin inactive anti-CH IKV DNAzyme.
  • Panel 9B CDZ-AuN Ps (2x10 s particles/mL) were placed in a buffered solution containing 10 mM MgCI 2 , CHI KV RNAs (0. 6 ⁇ ) isolated from Ae. albopictus C6/36. Following incubation at 37°C for 30 minutes, RT-PCR was performed as described in Methods to amplify digestion products.
  • FIG. 10 sets forth an illustration assessing the Mg 2+ Resistance of CDZ-AuNP Conjugates.
  • CDZ tethered AuN Ps were incubated with increasing concentrations of MgCI2 (0 to 20 mM) as described in Methods. Following a 30 minute incubation period at room temperature ( ⁇ 25°C), UV/Vis spectrophotometry were performed to assess MgCI 2 influence on CDZ conjugated AuN Ps. These results demonstrate that CDZ- AuN P aggregation is not driven by lOmM MgCI 2 , which is used in all detection assays described in this report.
  • FIG. 11 sets forth an illustration showing determination of optimal SDS concentrations for CHIKV detection.
  • FIG 12 sets forth an illustration showing Transmission Electron Microscopy (TEM) of CDZ-AuNP
  • TEM of unconjugated and DNAzyme-linked 15nm AuN Ps were performed as described in the Materials and Methods. TEM images were taken of the following samples: Unconjugated AuN Ps from the manufacturer (Cytodiagnostics) and CDZ-conjugated AuN Ps in reaction buffer containing 1.5 M NaCI. TEM images were taken at 80,000 x magnification. The scale bar is 20 nm.
  • FIG. 13 sets forth an illustration showing an assessment of CDZ-AuNP specificity.
  • NGC (lxl0 6 /mL each) were placed in separate reaction tubes possessing a buffered solution containing lOmM MgCI 2 , 2x10 s CDZ-AuN P particles, 1.5 M NaCI, and 0.5% (w/v) SDS. Microcentrifuge tubes containing these mixes were incubated at 37°C for 30 minutes and photographed.
  • CDZin refers to the anti-CH I KV DNAzyme that has been rendered inactive through inversion of the oligonucleotides encompassing the catalytic domain. The inversion mutation of the catalytic domain is designed to knock out cleavage function, providing a negative control.
  • CDZ-AuN P demonstrated CH I KV specificity in this assay since AuN P aggregation is only evident in the sample tube inoculated with CH IKV.
  • CH I KV chikungunya virus.
  • DENV-2 dengue virus serotype 2
  • CDZ anti-dengue virus DNAzyme
  • CDZin inactive anti-dengue virus DNAzyme.
  • FIG. 14 sets forth an illustration showing an analysis of the CDZ-AuNP Limits of CHIKV Detection.
  • A. CDZ-AuN P colorimetric assays were performed on CH I KV titers of lxlO 1 , lxlO 2 , lxlO 4 , and lxlO 6 to determine the limits of detection. Samples were assembled for CH I KV detection as described in EXAMPLE 1, incubated at 37°C for 30 minutes and photographed. Results show that the CDZ-AuN P colorimetric assay is capable of detecting CH IKV at a titer as low as lxlO 1 .
  • CDZ anti-dengue virus DNAzyme
  • CDZin inactive anti-dengue virus DNAzyme.
  • CDZ-AuNP sensitivity by UV/Vis spectrophotometry at 520nm.
  • UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer at an absorbance of 520 nm.
  • Figure 16 sets forth an illustration showing normalization of TCID 50 -IFA to copies of CHIKV NA.
  • Negative control samples consisted of samples containing RNA from uninfected C6/36 cells without primers (designated on the graph as "U”) and samples containing RNA from uninfected C6/36 cells with CH IKV-specific primers (designated on the graph as "U + primers").
  • cell refers to one or more cells which can be in an isolated or cultured state, as in a cell line comprising a homogeneous or heterogeneous population of cells, or in a tissue sample, or as part of an organism, such as a transgenic organism.
  • isolated when used with respect to a polynucleotide (e.g., single- or double-stranded RNA or DNA), an enzyme, or more generally a protein, means a polynucleotide, an enzyme, or a protein that is substantially free from the cellular components that are associated with the polynucleotide, enzyme, or protein as it is found in nature.
  • substantially free from cellular components means that the polynucleotide, enzyme, or protein is purified to a level of greater than 80% (such as greater than 90%, greater than 95%, or greater than 99%).
  • aa or AA amino acid
  • N P nanoparticle
  • AuN P gold nanoparticle
  • DDZ dengue virus targeting DNAzyme
  • L linker
  • DDZ-M universal dengue virus targeting DNAzyme
  • DDZ-1 DNAzyme targeting dengue virus serotype 1
  • DDZ-2 DNAzyme targeting dengue virus serotype 2
  • DDZ-3 DNAzyme targeting dengue virus serotype 3
  • DDZ-4 DNAzyme targeting dengue virus serotype 4.
  • CDZ CH I KV targeting DNAzyme.
  • the present invention relates to compounds comprising DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, methods of detecting nucleic acids having specific target sites using the DZ-N P conjugates, and stable compositions comprising the DZ-N P conjugates.
  • the conjugates encompass virus-specific DNAzymes, such as dengue virus-specific DNAzymes (DDZ), and chikungunya virus-specific DNAzymes (CDZ). Other types of virus-specific DNAzymes are also encompassed by the invention.
  • One aspect of the invention relates to a compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3' BA); wherein said 5' and 3' Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
  • DZ DNAzyme conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P
  • said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3
  • DZ-N P wherein said DNAzyme is an RNA-Cleaving DNAzyme selected from the group consisting of a 10-23 DNAzyme and a 8-17 DNAzyme.
  • Other aspects are directed to a DZ-N P wherein said DNAzyme is selected from U0 2 2+ -dependent and Mg 2+ -independent DNAzymes.
  • the nanoparticles used in the invention may be different shapes, typically a sphere, but also including shapes selected from a rod, a polygonal rod, rectangular block, cube, tetrapod, and pyramid.
  • Quantum dots are tiny particles, or 'nanoparticles', of a semiconductor material, traditionally chalcogenides, such as selenides or sulfides, of metals like cadmium or zinc (e.g., CdSe or ZnS), ranging in size from 2 nm to 10 nm in diameter.
  • Quantum dots have unique optical and electrical properties that are often different in character from those observed in the corresponding bulk material.
  • One prominent difference is the emission of photons under excitation, which are visible to the human eye as light. The wavelength of photon emissions depend on the size, and not on the material, from which the quantum dot is made.
  • the nanoparticles may be comprised of different substances, which may be homogeneous, or pure, such as a metal (designated a metallic nanoparticle, mN P), or a non-metallic substance (designated a non- metallic nanoparticle, nmN P), or they may be made of composite materials (designated a composite nanoparticle, cN P) comprised of two or more substances, such as a metallic and a non-metallic substance.
  • Non-metallic nanoparticles may comprise one or more substances selected from the group consisting of carbon, dextrose, solid lipid nanoparticles, dextran, chitosan.
  • a composite nanoparticle comprises a composite material comprising a metallic and a non-metallic substance.
  • the nanoparticles may also comprise one or more substances selected from the group consisting of: gold, silver, iron, titanium, platinum, cerium, silicon, palladium, transition metals, and oxides thereof.
  • Nanoparticles that comprise two or more metallic substances, or oxides thereof, are designated multi-metallic nanoparticles (mmN P).
  • Nanoparticles that comprise metal are designated metallic nanoparticles (mN P).
  • AuN P gold nanoparticles
  • AuN P gold nanoparticles
  • the range of sizes in a population of particles may vary, with a narrow or broad distribution of sizes in a sample, based on the source of the particles, and the process used to manufacture or purify particles of different shapes and sizes.
  • DZ-N P conjugates wherein the DZ is linked to said nanoparticle by a linker through two or more covalent bonds, designated a covalent linker (cL).
  • the covalent linker comprises -SH-(CH 2 ) 5 " .
  • said covalent linker comprises Streptavidin fluorescent conjugates, acridine and Azobenzene fluorescent conjugates, Biotin, Biotin Diol Linker, Biotin TEG, Biotin BB, Desthiobiotin TEG, DOTA (l,4,7,10-Tetraazacyclododecane-l,4,7,10-tetraacetic acid), Dual Biotin, Photocleavable (PC) Biotin, Psoralen C2, Psoralen C6, Fluorescein, FITC, TRITC, fluorescent proteins (e.g.
  • the DDZ is linked to said nanoparticle by a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL), such as a linker that comprises biotin.
  • a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL), such as a linker that comprises biotin.
  • the DZ-N P conjugates can be configured to target different nucleic acids.
  • a target nucleic acid which is an RNA, such as a viral RNA.
  • the viral RNA is a genomic viral RNA, and in another aspect the viral RNA is a viral RNA transcript. Different types of viral RNAs may be targeted.
  • the DZ-N P conjugate is designed to target a viral RNA is a Flavivirus RNA, such as a Flavivirus selected from a group consisting of in a mammalian tick-borne flaviviruses, mosquito-borne viruses, and viruses with no known arthropod vectors.
  • the Flavivirus is a mosquito-borne virus selected from the group consisting of Avian tembusu-related virus, Calbertado virus, Chaoyang virus, Aroa virus, dengue virus, Japanese encephalitis virus, Kokobera virus, Ntaya virus, Spondweni virus, Zika virus, and Yellow fever virus group.
  • Another aspect is directed to a viral RNA wherein said virus is a Flavivirus, exemplified by dengue virus, and said dengue virus RNA is a dengue virus genomic RNA.
  • the DZ-N P conjugate is designed to target a viral RNA is an Alphavirus RNA, such as an RNA from Alphavirus that is in a complex selected from the group consisting of Barmah Forest virus, Eastern equine encephalitis, Middleburg virus, Ndumu virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis, Western equine encephalitis, unclassified Alphaviruses, and recombinant viruses within each complex.
  • the DDZ-N P conjugate targets an Alphavirus is in the Semliki Forest Virus complex, such as chikungunya virus.
  • the DZ-N P conjugate may be designed to target specific residues within a target RNA.
  • target RNA comprises at least one purine-pyrimidine dinucleotide motif within a coding sequence which encodes a polypeptide.
  • target region of a ribonucleic acid (target RNA) comprises at least one purine-pyrimidine dinucleotide motif within a noncoding sequence.
  • target region is a viral 5'-3' Cyclization Sequence (CS).
  • the target region of the conjugates designated DDZ-M or DDZin-M is a viral 5'-3' Cyclization Sequence (CS), exemplified by the dengue virus
  • the target region of conjugates designated DDZ-1, DDZ-2, DDZ-3, and DDZ-4 is a conserved region, specific to each virus serotype, exemplified by
  • the DDZ-N P conjugate has a catalytic core, which may vary depending on the class of DNAzyme.
  • One aspect of the invention is directed to a DDZ-N P conjugate wherein said catalytic core (CC) is GGCTAGCTACAACGA (SEQ ID NO: 13) .
  • the DDZ-N P conjugate also comprise a pair of specific sequences, designated arms that facilitate the binding of the conjugate to a target nucleic acid sequence.
  • the DDZ-N P comprises a 5' Arm and a 3' Arm that are a pair of sequences selected from the group consisting of:
  • TTTCTCTCG SEQ ID NO: 1
  • GTTTCAGCA SEQ ID NO: 7
  • ATCGCTCCA (SEQ ID NO: 2) and TCTTCTTGA (SEQ ID NO: 8) ;
  • AAAGGCGTA SEQ ID NO: 3 and TTCTCGCCT (SEQ ID NO: 9) ; TAGCCAAGA ( SEQ ID NO: 4) and TCCTGCTGT (SEQ ID NO: 10); and
  • GTTGGTTCA (SEQ ID NO: 5) and TTTTCCAGA (SEQ ID NO: 11) .
  • Another aspect of the invention is directed to intermediate products, comprising a nucleic acid targeting sequence conjugated to a linker, which can be activated under appropriate chemical conditions to facilitate attachment of the intermediate to a nanoparticle.
  • One aspect of the invention is directed to a conjugate, or an intermediate, wherein said linker and said DNAzyme designated DDZ-1, DDZ-2, DDZ-3, DDZ- 4, DDZ-in-M, are selected from the group consisting of: thiol-DDZ-l (SH-DDZ-1)
  • Another aspect is directed to a conjugate wherein DNAzyme and linker are conjugated to a metallic nanoparticle, such as a metallic gold nanoparticle (DNAzyme-AuN P).
  • a metallic nanoparticle such as a metallic gold nanoparticle (DNAzyme-AuN P).
  • the invention is also directed a method of detecting a viral nucleic acid in a sample, comprising the steps of (a) adding the DNAzyme-N P conjugate to a sample comprising nucleic acid in a form which can react with a complementary nucleic acid; (b) heating said sample under conditions which permit the 5' and 3' Binding Arms to bind to the target region in said viral nucleic acid and said catalytic core to cleave at least one purine-pyrimidine dinucleotide motif in said target region; and (c) measuring the increase in aggregation of said nanoparticle conjugates compared to a sample comprising unreacted DNAzyme-N P conjugates in a dispersed form.
  • One aspect of the invention is directed to a method wherein said N P is an AuN P, and said aggregation is measured by absorbance. Another aspect relates to a method wherein said aggregation is detected by visual inspection.
  • the reaction may be carried out under different conditions, depending on the nature of the components, and the desired degree of sensitivity or speed of reaction. For convenience, the reaction may be carried out in volume of less than 50 ⁇ , in small tubes, for example, or in larger or smaller amounts depending on the number and format of samples being tested, and the instrument used, if required, to monitor the progress of the reaction. In one aspect, the reaction is carried out in the presence of sodium ion in an amount of about 0 to about 2 Moles/Liter, with magnesium ion in an amount of about 5 mM to about 20 mM.
  • the reaction may be supplemented with a variety of other compounds that facilitate the detection or exposure of nucleic acids in complex mixtures of cellular substances.
  • One aspect of the invention is directed to a method wherein the reaction is carried in the presence of a chaotropic agent or a detergent, such as sodium dodecyl sulfate (SDS), guanidine isothiocyanate, guanidinium chloride, lithium perchlorate, lithium acetate, urea, thiourea, Triton X-100, Triton X-114, Tween 20, Tween 80, N P 40, Brij 35, Brij 80, Octyl glucoside, Octyl thioglucoside, and a zwitterionic detergent selected from CHAPS and CHAPSO.
  • One aspect is directed to a reaction carried out in the presence of the detergent SDS, which may be present in an amount of about 0% to about 1% weight/volume.
  • the reactions may be carried out at different temperatures. It is convenient to carry out the reaction at room temperature (about 20°C), but it may also be carried out at higher temperatures, such as from about 20°C to about 80°C, depending on the stability of the conjugate at higher or lower temperatures, and the availability of thermal regulating equipment, to accelerate or decelerate the reaction as needed.
  • DZ-N P conjugates that are stable for long periods are desirable, to facilitate transport and storage of key components to diagnostic laboratories, or field locations, where the testing is performed.
  • One aspect of the invention is directed to a conjugate which is stable for a period of at least a year, although shorter or longer periods, one week, one month, one year, two or more years, may be adequate for particular applications, depending on the sensitivity of the assay and the ability of a supplier to produce and ship a conjugate to local or remote locations across the globe.
  • the invention is also directed to a kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising one or more types of DZ-N P conjugates described above.
  • a kit wherein the sample is obtained from mammalian tissue, cells, or extracellular fluid.
  • the sample may be blood, for example, or a sample is obtained from a virus-infected cell.
  • Another aspect is directed to a kit wherein the sample is obtained from insect tissue, cells, or extracellular fluid, such as a sample obtained from a virus-infected mosquito, or pool of mosquitos.
  • a further aspect is a kit, wherein the sample comprises nucleic acid from one or more viruses that are co-endemic with dengue virus.
  • the invention is also directed to DZ-N P conjugates wherein the target region of a chikungunya- specific DNAzyme (CDZ), is a conserved region, specific to each virus serotype.
  • CDZ chikungunya- specific DNAzyme
  • One aspect is directed to a compound designated CDZ, wherein said target region is
  • Another aspect is a compound wherein catalytic core (CC) is
  • GGCTAGCTACAACGA SEQ ID NO: 13
  • Another aspect is a compound wherein said 5' Arm and said 3' Arm are a pair of sequences selected from the group consisting of:
  • GCTCTAGCA (SEQ ID NO: 27) .
  • Another aspect is a compound wherein said linker and said DNAzyme designated CDZ is thiol-CDZ (SH-CDZ)
  • oligonucleotide target was synthesized and H PLC-purified by Life Science Technologies. Quantification of these oligonucleotides was performed with the N D-1000 spectrophotometer from NanoDrop (Wilmington, DE). Gold colloidal solutions containing 1.6 ⁇ 10 12 particles/m L gold nanoparticles (AuN Ps) with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA).
  • Ae. albopictus C6/36 cells were obtained from ATCC, and maintained in Leibovitz's L-15 media (Atlanta Biologicals) supplemented with 10% FBS (Atlanta Biologicals), 10% TPB (triptose phosphate broth; Invitrogen/ GIBCO), penicillin G (100 U/ml; Invitrogen/GI BCO) and streptomycin (100 ⁇ /ml; Invitrogen/ GI BCO).
  • the C6/36 cells used in this study were maintained in a 28°C incubator and passaged every 4 days. Viral stocks were prepared as previously described [Li et al. (2012)].
  • DENV type 2 strain New Guinea C (NGC) AF038403.1
  • DENV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of all four serotypes of dengue were aligned using ClustalX [Jeanmougin et al. (1998)].
  • the aligned sequences comprise the following GenBank Gen lnfo identifiers: 12018173, 12018169, 12018171, 12659201, 2909798, 2909788, 2909786, 2909796, 6841603, 6841595, 6841605, 6841591, 6841601, 6841597, 6841593, 6841599, 6841587, 6841585, 6841589, 1000740, 1000738, 2909784, 1000736, 4926937, 4926935, 4926927, 4926929, 4926931, 2909794, 2909792, 1000742, 4926933, 2155257, 2723944, 323447, 6581076, 6581078, 2723942, 323449, 323650,
  • the 5' arms of DDZ-M and DDZin-M were designed to bind to nucleotides 150 to 158 of the DENV genome.
  • the 3' arms were designed to bind to the 5' end of the target region of the DENV genome that corresponds to nucleotides 140 to 148.
  • These 5' and 3' arms of facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs G149 and C150.
  • the 5' arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome.
  • the 3' arm was designed to bind to the 5' end of the target region of the DENV genome that corresponds to nucleotides 309 to 317. These 5' and 3' arms facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs A318 and A319.
  • the 5' arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome.
  • the 3' arm was designed to bind the 5' end of the target region of the DENV-1 genome that corresponds to nucleotides 309 to 317. These 5' and 3' arms facilitated DDZ-1 cleavage of the substrate DENV-1 RNA between the purine-pyrimidine dinucleotide motifs A318 and A319.
  • the 5' arm of DDZ-2 was designed to bind nucleotides 126 to 134 of the DENV-2 genome.
  • the 3' arm was designed to bind the 5' end of the target region of the DENV-2 genome that corresponds to nucleotides 116 to 124. These 5' and 3' arms facilitated DDZ-2 cleavage of the substrate DENV-2 RNA between the purine-pyrimidine dinucleotide motifs A124 and A125.
  • the 5' arm of DDZ-3 was designed to bind nucleotides 288 to 296 of the DENV-3 genome.
  • the 3' arm was designed to bind the 5' end of the target region of the DENV-2 genome that corresponds to nucleotides 278 to 286.
  • the 5' arm of DDZ-4 was designed to bind nucleotides 95 to 103 of the DENV-4 genome.
  • the 3' arm was designed to bind the 5' end of the target region of the DENV-4 genome that corresponds to nucleotides 85 to 93.
  • the left column in Table E-2 lists the active (DDZ-M) and inactive (DDZin-M) DNAzymes used in this Example.
  • the second and third columns list the sequences of the 5' and 3' binding arms of the catalytically active DNAzymes and the inactive DDZin-M, respectively. Also shown are the sequences of the catalytic cores of each DNAzyme.
  • the right column lists the nucleotide sequence each binding arm binds to where applicable. All sequences are displayed in a 5' to 3' direction. See the methods section for a description of DNAzyme design.
  • the DDZ-M target site was selected by scanning the 5' CS domain for one of the purine- pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003)].
  • An alignment of all four known DENV serotypes was performed to determine the ideal target sites for the serotype specific DNAzymes in our DDZ-AuN P detection method (Fig. 7d).
  • Each serotype specific DNAzyme was designed to target each serotype independently of the others.
  • the primary criterion for selection was that a purine-pyrimidine motif located within the target site must be present in all strains of a given DENV serotype.
  • Another important criterion for selecting suitable sites for DDZ cleavage was that the length of conserved flanking arms be long enough to insure specificity of the DNAzyme for the target site.
  • the 5' and 3' arms of each DDZ were 9 bases in length since this was determined to be optimal for DNAzyme catalysis and provides a sufficient level of specificity to insure minimal off-target effects [Cairns et al. (2003)].
  • SUBSTITUTE SHEET (RULE 26) to remove unreacted SH-DDZ-M.
  • the nanoparticles were redispersed in 1 m L of buffer containing 100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.01% SDS, centrifuged again at 16,110 x g at room temperature for 15 min. The supernatant was removed and the nanoparticles were dispersed in 500 ⁇ of buffer containing 300 mM NaCI and 25 mM Tris acetate (pH 8.2), and re-centrifuged for 15 min to remove the remaining unreacted SH-DDZ-M.
  • the cleaned DDZ-M-AuN P were redispersed into 200 ⁇ of buffer containing 100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS. This same procedure was followed for the coupling of DENV serotype-specific DTT-reduced DNAzymes:
  • DDZ-AuN Ps (1 x 10 5 /mL) were combined in a 1.5 mL m icrocentrifuge tube with 10 mM MgCI 2 for optimal DNAzyme activity, 1.0 M NaCI to drive aggregation of AuNPs, and synthetic DENV-2 RNA target (7.5 nM) corresponding to the 5' 170 nucleotides of the virus genome was added [Cairns et al. (2003); Ogawa et al. (2008)]. Reaction mixes were incubated at 37°C and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon Cool Pix S3300 camera (Nikon USA, Melville, NY).
  • DENV RNA was isolated from DENV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol. 10 ⁇ of eluted DENV RNA was incubated with 1 x 10 5 DDZ-AuN P/ml for 30 min at 37°C. 15 ul of this reaction mixture was added to an RT-PCR mix (Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels.
  • DENV -2 NGC RNA were isolated from Aedes albopictus C6/36 cells using the QiaAmp Viral RNA mini kit, and added at a concentration of 0.6 ⁇ ( ⁇ 10 ⁇ ) to a reaction mixture containing 150 mM Tris-HCI (pH 7.5), 10 mM 10 mM MgCI 2 , 1 x 10 5 DDZ-AuN P particles/mL, 0.5% (w/v) SDS, and NaCI (0 M to 2 M). Mixes were incubated at 37°C for 30 minutes and analyzed every 5 min by visual inspection for aggregation of AuN Ps. Samples were analyzed by visual inspection, and photographs taken. Positive detection of DENV-2 NGC RNAs was evident with a complete red to clear color transition occurring with the addition of 1.5 M NaCI.
  • DENV-2 NGC of the titers indicated ( Figure 8) were produced as follows. A titer of 1 ⁇ 10 6 /mL was obtained following inoculation of Ae. albopictus C6/36 cells with 0.1 MOI and incubated at 28°C for 6 dpi. DENV-2 NGC were grown to titers of 1 ⁇ 10 4 /m L and 1 ⁇ 10 2 /mL at 3 dpi and 6 dpi, respectively, following inoculation of Vero cells with MOI of 0.1. DENV-2 NGC at a titer of 1 ⁇ loVmL were produced by serial dilution of the 1 ⁇ 10 2 /m L stock. Titers were determined by TCID 50 -IFA as described [Carter et al.
  • the DENV-2 NGC titers described above served as substrates for DDZ-AuN P colorimetric assays to determine their limits of DENV detection.
  • Ten microliters (10 ⁇ ) of each dilution stock was added to a buffered reaction mix containing 150 mM Tris-HCI (pH 7.5), 10 mM 10 mM MgCI 2 , 1 x 10 5 DDZ-M-AuN P particles/mL, 1.5 M NaCI, and 0.5% (w/v) SDS. Samples were mixed and incubated at 37°C for 5 minutes and photographs were taken Nikon Cool Pix S3300 camera. UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer.
  • the dengue virus detection method described below is based upon RNA aptazyme- mediated detection of small molecules, such as theophylline [Ferapontova and Gothelf (2009)].
  • RNAzymes and aptazymes for virus detection is the inherent instability these catalytic RNAs, increasing the attractiveness of DNAzymes for use in detection assays.
  • the colorimetric detection of DENV by DDZ-AuN P can be divided into three phases: targeting/cleavage of the DENV RNA genome by DDZ, activation of AuN Ps, and aggregation of AuN Ps and detection ( Figure 1).
  • the 5' and 3' arms of DDZ bind to the 3' and 5' ends of a fully conserved segment that includes the 5'-3' CS region, respectively, and in the presence of Mg 2+ and heat (37°C) the viral RNA is cleaved at G149.
  • the 10-23 DNAzyme is capable of cleaving RNA with high sequence specificity at target sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)].
  • R-Y purine-pyrimidine
  • the design of the anti-DENV 10-23 DNAzyme, DDZ-M ( Figure 2a) was based on a 10-23 DNAzyme clone that was discovered through SELEX (Systematic Evolution of Ligands by Exponential Enrichment).
  • AuN Ps Gold nanoparticles ranging from 15 nm to 100 nm in diameter have been used in a number of detection assays [Cao et al. (2010)].
  • AuN Ps Gold nanoparticles
  • AuN P-conjugated DDZs were analyzed for their ability to cleave the DENV-2 NGC RNA in vitro.
  • DENV-2 NGC viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a buffered solution containing 1 ⁇ 10 5 DDZ-M-tethered AuN Ps/mL for 30 minutes at 37°C. Digestion products were then amplified by RT-PCR using heterologous and hexamer primers designed to aid in the amplification of DDZ digestion products.
  • Sodium in the form of NaCI, is an essential component of AuN P colorimetric detection assays because this monovalent salt drives aggregation of oligonucleotide-conjugated AuN Ps following the interaction of the AuN P conjugated probes with complimentary oligonucleotide targets [Ogawa and Maeda (2008); Ogawa (2011)]. NaCI concentrations greater than 2 M have been reported to cause instability of conjugated AuN Ps [Ogawa and Maeda (2008)]. Published reports also indicate that NaCI concentrations for effective AuN P aggregation can vary from 1.0 M to 1.5 M [Ogawa and Maeda (2009); Weil et al. (2004)]. In light of these observations, we evaluated the optimal NaCI concentration necessary to initiate aggregation of DDZ-M-AuN P following interaction with the DENV-2 genome.
  • DENV genomic RNAs ( ⁇ 0.6 ⁇ ), isolated from infected C6/36 cell supernatants, were added to a buffered reaction mixture containing DDZ-M-AuN P ( ⁇ 1 ⁇ 10 5 particles/mL), 10 mM MgCI 2 and NaCI at concentrations ranging from 0 M to 2 M (Figure 5A). Samples were incubated at 37°C for 30 min. A red to clear color transition confirming optimal detection of the DENV genome was observed in as little as 5 minutes in the presence of 1.5 M NaCI.
  • the optimal concentration of SDS was determined by adding cellular supernatants containing 1 ⁇ 10 6 DENV-2/mL to buffered reaction mixes containing DDZ -tethered AuN Ps (DDZ-AuN P), 10 mM MgCI 2 and SDS at concentrations of 0% (w/v), 0.5% (w/v) or 1.0% (w/v) ( Figure 5B). Detection of DENV-2 NGC RNAs from cell culture fluid was not possible in the absence of SDS following incubation at 37°C for 30 min. Similarly, controls involving mock infected cell supernatants with or without SDS showed no red to clear color change distinctive of AuN P aggregation.
  • infected cell culture supernatants displayed positive detection in as little as 5 minutes, and only in the presence of SDS and DENV-2 NGC.
  • AuN P aggregation in the presence of 0.5% SDS and absence of DENV-2 virus particles was undetectable.
  • DDZ-M-AuN P Since DDZ is activated by 10 mM MgCI 2 , we needed to confirm that the positive detection of DENV-2 was due to specific recognition of the viral genome by DDZ-M-AuN P and not the result of a false positive from Mg 2+ ion destabilization of DDZ-AuN Ps [Ogawa and Maeda (2008)].
  • the stability of DDZ-M-AuN P was tested against increasing concentrations of MgCI 2 (0 m M to 20 m M) at room temperature every 5 minutes for up to 30 minutes (Figure 6), and absorbencies were measured with a NanoDrop spectrophotometer at 520 nm.
  • concentrations equal to or less than 10 mM MgCI 2 did not display a detectable effect on the stability of the oligonucleotides-tethered AuN Ps as evidenced by a lack of aggregation and absorbance, while those above 10 mM resulted in rapid instability of DDZ-AuN P, leading to aggregation of the nanoparticles as evidenced by the rapid decrease in absorbance.
  • Yellow Fever (YFV; [Reed et al. (1900)]), Japanese Encephalitis (J EV; Kuwayama et al. (2005)), and Zika (ZV; [Macnamara (1954)]) viruses. These viruses also co-circulate with DENV and are often misdiagnosed as dengue. Therefore, a DENV detection method must demonstrate the ability to distinguish DENV, from other mosquito-borne flaviviruses.
  • the left column lists the active (DDZ-M-AuN P and DDZ-l-AuN P through DDZ-4-AuN P) and inactive negative control (DDZin-M-AuN P) devices used in this report.
  • the second column lists the serotype each device was designed to detect.
  • the right column summarizes the results of the DENV detection devices and the negative control DDZin-M-AuN P.
  • the DENV-1 serotype-specific DDZ-l-AuN P positively detected the DENV-1 serotype as signified by a distinctive red to clear/colorless color transition.
  • DDZ-l-AuN P did not detect DENV-2, -3, or -4, illustrating the serotype-specific nature of this approach ( Figure 7e).
  • each of the other serotype specific DNAzyme tethered AuN Ps detected only the corresponding DENV serotype ( Figure 7e and Table E-3).
  • the amount of DENV RNA corresponds to approximately 0.6 ⁇ (for 10 6 /ml), 6 nm (for 10 4 /ml), 0.6 nM (for 10 2 /ml), or 0.06 nM (for lOVml) of DENV RNA per reaction.
  • Simple and rapid diagnostic methods to screen mosquito and patient samples for the presence of viral pathogens can significantly facilitate diagnosis and treatment of virus borne diseases in field environments where sophisticated methods of virus detection are impractical.
  • An ideal virus detection method must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results, be inexpensive, easy to use, and stable at temperatures greater than 30°C for use in a field environment [Peeling et al. (2010)].
  • DENV detection methods must show utility in epidemiological surveillance and outbreak monitoring by allowing independent detection of each serotype, and must have the ability to distinguish between primary and secondary infection [Peeling et al. (2010)].
  • DDZ-M DENV serotype targeting DNAzyme
  • DENV- serotype specific DNAzymes coupled to AuN Ps for detecting DENV.
  • DDZ was designed to target the most conserved region of the DENV genome that includes the 5'-3' CS ( Figures 2A and 2B).
  • DENV serotype-specific DNAzymes (designated DDZ-1 through DDZ-4) were engineered to bind regions of DENV that are conserved within each serotype.
  • DDZ-AuN P colorimetric detection system demonstrates the capacity to target the highly conserved DENV 5' CS region
  • the utility of these molecules as detection agents requires a minimal subset of anti-DENV DNAzymes (DDZs) to be occupied for aggregation of AuN Ps to occur.
  • DDZs anti-DENV DNAzymes
  • the high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce (1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants.
  • Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)].
  • We have demonstrated that under optimal reaction conditions the full length genome of DENV-2 can also be detected through the aggregation of DDZ-tethered AuN Ps following the interaction of the DDZ component with the DENV-2 RNA genome.
  • DDZ anti-DENV DNAzyme
  • AuN Ps When conjugated with AuN Ps, readily detects its cognate target sequence within a synthetic 170 base segment of the DENV-2 NGC RNA corresponding to the 5' UTR, 5' CS and the 5' 74 bases of the capsid open reading frame ( Figure 4). Aggregation events result from deshielding AuN Ps from sodium ions following DDZ binding to the synthesized DENV-2 target [Williams (1995)].
  • the DDZ-AuN P conjugate also detects purified viral RNAs or genomic RNA liberated from cell culture derived DENV-2 NGC virions.
  • the simplicity of the DDZ-AuN P disclosed herein, provides distinct advantages over other virus detection methods.
  • the assay can be packaged as a pre-mixed reaction solution in microcentrifuge tubes, and may be performed without any specialized equipment or training. This assay is also inexpensive, costing about $0.80 per sample, compared to serological testing or PCR- based methods which can cost $2 per sample or more to perform. Key assay components are stable for months at room temperature [Liu and Lu (2006)], and exhibit stability at temperatures greater than 30°C.
  • this assay will enable sensitive detection and discrimination of individual DENV serotypes in mosquito populations and patient derived samples as well as other virus derived RNAs. Detection prior to the onset of symptoms could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from the disease. The simplicity of the assay makes it ideal as a means of early surveillance to target locations for more effective mosquito suppression strategies.
  • the DNAzyme-Nanoparticle technology can be applied to facilitate the detection of other viruses or nucleic acids
  • DNAzymes coupled to nanoparticles can be used as a highly versatile tool to facilitate the detection of oligonucleotides, and not just viral RNAs, such as DENV and CH IKV (chikungunya virus) exemplified in the Examples, noted above.
  • aggregation of AuN P provides a visual, colorimetric readout of the nucleic acid detected, regardless of the catalytic oligonucleotide appended.
  • the effectiveness of our method in using DNAzyme-nanoparticle conjugates to detect other types of viral genomes (whether RNA or DNA) or other oligonucleotide molecules, whether originating from a pathogenic agent or a host cell lies in the design of the DNAzyme.
  • Host cells for example, can be prokaryotic or eukaryotic, particularly non-human animal, and human cells.
  • DDZ-AuN Ps to facilitate the detection of nucleic acids obtained from any pathogen or cell requires: (1) that the nucleic acid composition of the 5' and 3' binding arms of the DDZ must be modified to complimentary to and base pair with the 3' and 5' ends of the target sequence of interest, respectively, such that the only nucleotide on the target sequence that is not bound by the DNAzyme binding arms is the purine of the purine-pyrimidine dinucleotide motif on the target sequence; and (2) the target sequence in question must contain a purine-pyrimidine dinucleotide motif to activate the corresponding DNAzyme. These criteria apply to any RNA or DNA segment of interest one wishes to detect using methods involving DNAzymes.
  • the DNAzyme-Nanoparticle technology can be performed in other test formats
  • test formats can also be used to facilitate the detection of nucleic acids with DNAzyme- nanoparticle conjugates.
  • Use of a handheld spectrophotometer could increase speed of diagnosis, as well as the overall sensitivity and accuracy of the method. Our results show that a spectrophotometer can detect aggregation of AuN Ps resulting from DDZ interaction with virus genomes at levels that would not be detected visually.
  • the use of a handheld spectrophotometer would enable the administration of treatments prior to the onset of symptoms since the concentration of pathogen derived RNA detected would be too low to display any definitive pathology.
  • Dipstick formats based on DNAzyme- nanoparticle conjugates that are less sensitive, or even slower, could be used in field locations, where sample tubes or handheld equipment are not available, or are inconvenient or expensive to use.
  • CH IKV Chikungunya virus
  • Example 1 we described a simple, rapid, and cost effective gold nanoparticle coupled DNAzyme-based detection assay for dengue viruses (later published as Carter et al, 2013).
  • this example we adapted this technology for the rapid, sensitive, and cost effective detection method for CH IKV, that couples the robust catalysis of a CH I KV- specific DNAzyme (CDz) with the salt-induced aggregation of gold nanoparticles (AuN Ps).
  • CDz CH I KV-specific DNAzyme
  • AuN Ps gold nanoparticles
  • Gold colloidal solutions containing 1.6 ⁇ 10 12 gold nanoparticles (AuN Ps)/mL with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA). Synthesized and desalted thiol-modified and unmodified DNAzymes and oligoribonucleotide CH I KV target molecules were purchased from Life Science Technologies (Grand Island, NY, USA). Quantification was performed with the N D-1000 spectrophotometer from NanoDrop (Wilmington, DE).
  • CDZ and CDZin 5' arms were designed to bind to nucleotides 202 to 210 of the CH I KV genome: (5 '-AATGCTAGAGCGTTCTCGCAT-3 ' ) SEQ ID NO (25) .
  • the 3' arms were designed to complimentarily base pair to the 5' end of the target region of the CH IKV genome that corresponds to nucleotides 192 to 200. These 5' and 3' arms of CDZ facilitated cleavage of the substrate CH I KV RNA between the purine-pyrimidine dinucleotide motifs at 201 and 202.
  • CH IKV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of twenty five chikungunya viruses were aligned using ClustalX [Jeanmougin et al. (1998)] (FIG. 9C)..
  • the aligned sequences comprise the following GenBank Gen lnfo identifiers: FN295483.3, H E806461.1, FR717336, FR717337.1, JF274082.1, L37661, EF452493.1, DQ443544.2, JN558836.1,JN558835.1, JN558834.1, JX088705.1, EU372006.1, H M045823.1, H M045822.1, H M045821.1, H M045814.1, H M045813.1, H M045812.1, H M045811.1, H M045794.1, H M045792.1, H M045791.1, H M045810.1, AF369024.2.
  • the CDZ target site was selected by scanning the NS1 region for one of the purine-pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003); Jeanmougin et al. (1998); Larkin et al. (2007)].
  • the primary criterion for selection was that a purine-pyrimidine motif located within the target site must be present in all CH IKV sequences analyzed.
  • Another important criterion for selecting suitable sites for CDZ cleavage was that the length of conserved flanking arms be long enough to insure specificity of the DNAzyme for the target site.
  • the optimal length for the 5' and 3' arms of CDZ was previously determined to be 9 bases for effective DNAzyme catalysis, which provides a high level of specificity, with minimal off-target effects [Cairns et al., (2003)].
  • CDZ and CDZin 5' 5 ' -AATGCTAGAGCGTTCTCGCAT-3 ' 21 DNA 25 arm target Corresponding to nucleotides 202 to 210 of
  • 5 ' -SH- (CH 2 ) 6-d (TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA) -3 ' (SEQ ID NO: 29) was purified by ethanol precipitation.
  • a volume of 3 ml of AuN P and 5 mM acetate buffer (pH 5.2) were transferred to a NaOH-washed glass scintillation vial, capped and incubated for 24 hours at room temperature.
  • 5 mM Tris acetate (pH 8.2) buffer and 100 m M NaCI were added and the resulting mixture was incubated once again at room temperature for an additional 24 hours.
  • the supernatant was removed and the nanoparticles were resuspended in 500 ⁇ of redispersal buffer 2 [300 mM NaCI and 25 mM Tris acetate (pH 8.2)], and re- centrifuged for 15 min to remove the remaining unreacted SH-CDZ.
  • the cleaned CDZ-AuN P were redispersed into 200 ⁇ redispersal buffer 3 [100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS] and stored at room temperature.
  • CDZ-AuN Ps (2xl0 8 /mL) were combined in a 1.5mL microcentrifuge tube with lOmM MgCI 2 for optimal DNAzyme activity [Liu et al. (2006)], 1.0M NaCI to drive aggregation of AuN Ps , and synthetic CH I KV RNA target (7.5 nM) corresponding to the 5' 200 nucleotides of the CH I KV RNA genome was added [Ogawa and Maeda (2008)]. Reaction mixes were incubated at 37°C and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon CoolPix S3300 camera (Nikon USA, Melville, NY).
  • CH IKV RNA was isolated from CH I KV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol.
  • a volume of 10 ⁇ of eluted CH I KV RNA was incubated with 2x10 s DDZ-AuN P/ml for 30 min at 37°C.
  • a volume of 15ul of this reaction mixture was added to a RT-PCR mix (Super Script I II, Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels.
  • TEM of CDZ conjugated and unconjugated AuN Ps was performed using the JEOL 1220 transmission electron microscope fitted with a tungsten electron source. Samples for TEM (2 ⁇ ) were placed on TEM grids coated with a thin carbon support film, air dried, and images were taken. For AuN P applications, images were captured at 80kV using 80,000X magnification.
  • CDZ-AuN P specificity assays were performed as previously described for DENV detection with the anti-DENV DNAzyme (DDZ) conjugated AuN Ps [Carter et al. 2013].
  • CH IKV samples (Figs. 14, 15 and 16) were produced as follows. A titer of lxl0 6 /mL wa s obtained following inoculation of Ae. albopictus C6/36 cells with 0.1 MOI and incubated at 28°C for 2 dpi. Serial dilutions were produced to obtain titers of lxl0 4 /mL, ixio 2 /mL, and lxloVmL. Titers were determined by TCID 50 -I FA as described [Carter et al. (2011)]. The CH IKV samples described above served as substrates for CDZ-AuN P colorimetric assays to determine their limits of CH IKV detection.
  • the reaction mixture (final volume of 25ul) contained 2X SYBR green qRT-PCR Mastermix with Superscript I II RT/Platinum Taq, 10 pmol of each primer, and 5 ul of extracted RNA from C6/36 cells infected with CH I KV vaccine strain 181/25, or uninfected C6/36 cells as a negative control.
  • An additional negative control reaction was assembled that included RNA from uninfected C6/36 cells, but without CH I KV specific primers. Amplification of a fragment from the CH IKV RNA genome of 168 nt in length was performed using the following two primers:
  • qRT-PCR amplification assays were performed on the 7500 Real-Time PCR System (Applied Biosystems) with the following settings: 50°C for 15 min, 95°C for 2 min, followed by 45 cycles of 95°C for 15s, 60°C for 40s. Data was collected at the 60°C step.
  • the amount of viral RNA was calculated from a standard curve using a synthetic RNA transcript (Gene Script). The values of the quantity of CH I KV RNA/ml for each standard used was obtained using the in vitro transcript as a standard. The coefficient of determination for the standard curve that was generated had a value of (R 2 ) > 0.97. Results
  • DNAzymes i.e., catalytic DNAs
  • a cofactor e.g., Pb 2+ or Mg 2+
  • the 10-23 DNAzyme [Cairns et al (2003)] is capable of cleaving substrate RNAs with high sequence specificity at sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)].
  • R-Y purine-pyrimidine
  • the anti-CH I KV 10-23 DNAzyme, CDZ (Fig. 2A) was designed with 5' and 3' arms that target a highly conserved sequence present in all CH I KV that were identified through ClustalX alignments. This DNAzyme construct was conjugated to 15nm AuN Ps which we previously determined were effective for the positive detection of dengue viruses [Carter et al. (2013)]. Assessment of CDZ-AuNP Targeting
  • the colorimetric detection of CH I KV by CDZ-AuNP can be divided into three phases: targeting/cleavage, activation of AuN Ps, and aggregation/detection (Fig. 9B).
  • the 5' and 3' arms of the AuN P-conjugated anti-CH IKV DNAzyme (CDZ) bind to the 3' and 5' ends of the targeted region, respectively.
  • the Mg 2+ 'DDZ digests the viral RNA.
  • these AuN Ps aggregate; leading to a rapid and visually detectable red to clear/colorless color transition[Ogawa and Maeda (2008); Song et al.
  • the control mix substituted the CDZ- AuN Ps with the negative control CDZin-AuN P, which was created through inversion of the catalytic domain to render the DNAzyme catalytically inactive [Auslander et al. (2010)] .
  • Reaction mixes were incubated at 37°C and monitored for the distinctive red to clear color transition, indicating positive detection of the CH I KV RNA substrate. Aggregation of the CDZ-tethered AuN Ps, was evident within the first 5 minutes of incubation. This aggregation event occurred only in the presence of the synthetic substrate and active CDZ-AuN Ps, demonstrating a positive test for the presence of CHI KV.
  • AuN P-conjugated CDZs were analyzed for their ability to target and cleave RNAs derived from CH I KV strain 181/25 in vitro.
  • Viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a reaction mix containing 2x10 s CDZ-tethered AuN Ps for 30 minutes at 37°C. Digestion products were then amplified by RT-PCR, as previously described [Carter et al. 2013], using heterologous and hexamer primers designed to aid in the amplification of CDZ digestion products.
  • DNAzymes are typically activated in these assays by lOmM MgCI 2 .
  • MgCI 2 We determined the necessity for MgCI 2 on the overall stability of our CDZ conjugated AuN Ps by incubating the conjugated nanoparticles in increasing concentrations of MgCI 2 (0 mM to 20 mM) at room temperature, and assessed the activity every 5 minutes for up to 30 minutes (Fig. 3) by measuring absorbance at 520nm.
  • concentrations equal to or less than lOmM MgCI 2 did not display a detectable effect on the stability CDZ-AuN Ps, as previously described for DNAzyme conjugated AuN Ps designed to detect dengue viruses [Carter et al. 2013].
  • magnesium ion concentrations above lOm M resulted in rapid instability of CDZ-AuN P, leading to aggregation of the CDZ conjugated gold nanoparticles, as evidenced by a rapid decrease in absorbance (Fig. 10).
  • CDZ conjugated AuNPs maintain their spherical shape in a high salt environment
  • Basic morphology of AuN Ps can be altered due to the conjugation procedure that is performed when
  • DNAzymes are conjugated to AuN Ps. Misshapen AuN Ps can compromise the efficacy of virus detection methods that employ conjugated AuN Ps.
  • Transmission electron microscopy (TEM) is the best method to determine the structural integrity of spherical AuN Ps, whether unconjugated or conjugated, by assessing their overall morphology. Consequently, we assessed the general structural integrity of unconjugated AuN Ps and CDZ conjugated AuN Ps in the storage buffer described in Materials and Methods, and CDZ conjugated AuN Ps in the reaction buffer used in this CH IKV detection assay at 80,000X magnification (Fig. 12). Unsurprisingly, the generally round appearance of the 15nm unconjugated AuN Ps remained unchanged whether these AuN Ps are CDZ conjugated or placed in our high salt (1.5 M) or high SDS (0.5%) containing reaction buffer.
  • TEM Transmission electron microscopy
  • the sensitivity of our CH IKV detection system was assessed using standardized titers of CH IKV (Fig. 14A). Titers of 10 1 , 10 2 ,10 4 and 10 6 TCI D 50 units/ml, as determined by TCI D 50 -I FA (Fig. 14B), were assayed along with a mock negative control, , or were analyzed with the catalytically-inactive CDZin-AuN Ps instead of CDZ-AuN Ps. Following the addition of 1.5 M NaCI and incubation at 37°C for 5 minutes samples, were analyzed by visual inspection.
  • Spectrophotometric results also demonstrated our colorimetric CH I KV detection assay is capable of detecting the presence of CH IKV RNA even in very dilute samples (DM4).
  • DM4 very dilute samples
  • Earlier reports have also detected colorimetric change associated with AuN P aggregation in samples containing only femtomole amounts of substrate using spectrophotometry [Liu and Lu (2012)].
  • the ability to detect a co-circulating Flavivirus, DENV, at such low infectious unit titers may be due to the presence of immature/inactive virions, and RNA species that are not detected by TCID 50 -IFA, or even RT-PCR.
  • DENV and other viruses produce aberrant RNA species called "defective RNAs" [Li et al.
  • RNAs contain defects in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Li et al. (2011)]. Some of the defective RNAs appear to be maintained during natural cycles of transmission, potentially due to complementation with fully functional DENV RNA genomes [Li et al. (2011)].
  • RNA copy number relative to infectious units
  • Negative control qRT-PCR samples consisting of RNA from uninfected cells with and without CH IKV specific primers were included to demonstrate the RNA detected was a product of CH IKV infection [Fronhoffs et al. (2002)].
  • the results demonstrate an approximate average 2,000: 1 ratio of CH I KV RNA to infectious units. Similar ratios were previously demonstrated for CH IKV [Nougairede et al. (2013)] and provide insight into why our RNA- based colorimetric detection method can detect this pathogen at such low uninfectious titers.
  • virus detection methods must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results enabling early detection, be cost effective, easy to use, and stable at temperatures greater than 30°C for use in a field environment, and must show utility in epidemiological surveillance and outbreak prediction [Peeling et al. (2011)].
  • diseases exhibiting similar symptoms such as malaria, leptospirosis, typhoid, typhus and chikungunya
  • Example 1 illustrated our efforts to address the need for a more sensitive method to detect dengue virus.
  • DDZ-AuN P colorimetric DENV detection method is capable of detecting all four DENV serotypes directly from Aedes albopictus C6/36 cell culture fluids in a matter of minutes, without RNA isolation procedures [Carter et al.
  • the 5' and 3' binding arms of the previously described anti-DENV DNAzyme were changed to an oligonucleotide sequence of the 5' and 3' binding arms that would permit complimentary base pairing, allowing targeting of the most conserved region of the CH I KV genomic RNAs encompassing nucleotides 192 to 210, of the NS1 gene [Carter et al. (2013)].
  • the demonstrated ability of DNAzymes to successfully target small stretches of RNA makes these catalytic oligonucleotides highly useful for targeting conserved regions of virus genomes.
  • CDZ-AuN P colorimetric detection system demonstrates the capacity to target the highly conserved region located within the CH I KV NS1 gene
  • the utility of these molecules as detection agents requires a minimal subset of anti-CH I KV DNAzymes (CDZs) to be occupied for aggregation of AuN Ps to occur.
  • CDZs anti-CH I KV DNAzymes
  • the high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce(1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants.
  • Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)].
  • the aggregation events result from deshielding of AuN Ps from sodium ions following CDZ catalysis of the synthesized CH I KV target [Williams et al. (1995)].
  • the CDZ-AuN P conjugate also detects purified viral RNAs or genomic RNA liberated from cell culture derived CH I KV virions.
  • RT-PCR analysis (Fig. 9) demonstrated that our CDZ DNAzyme, while conjugated to AuN Ps, retains the ability to target and cleave CH I KV RNA into 2 fragments, as expected.
  • CH IKV infected cell culture supernatants were analyzed instead of patient blood samples or infected mosquitoes because it is more convenient to determine optimal experimentation parameters using a less complex cell culture system.
  • SDS Sodium dodecyl sulfate
  • the CDZ-AuN P colorimetric assay is capable of distinguishing between CH I KV and DENV-2 NGC (Fig. 13), two symptomatically related viral pathogens, and indicates the utility of this detection approach in regions of the world that are endemic to both of these viral pathogens CH I KV in regions that are endemic to multiple pathogens that display similar symptoms.
  • the inclusion of the more closely related alphavirus, Sindbis virus (Sind) further establishes the specificity of our colorimetric CH IKV detection method.
  • RNA species that are not detected by TCI D 50 -I FA, or even RT-PCR [Rodenhuis-Zybert et al. (2010) van der Schaar et al. (2007); van der Schaar et al. (2008)].
  • DENV and other viruses produce aberrant RNA species called "defective RNAs" in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Aaskov et al. (2006); Marriott et al. (2009); Wang et al. (2002)].
  • colorimetric detection assays will enable sensitive identification of virus derived RNAs in mosquito and patient samples. Bedside virus detection could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from disease symptoms. Furthermore, the simplicity of colorimetric AuN P-driven detection methods make these approaches optimal in early surveillance to target locations for more effective vector control strategies. While the preferred embodiments of the invention have been illustrated and described in detail, it will be appreciated by those skilled in the art that various changes can be made therein without departing from the spirit and scope of the invention. Accordingly, the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the invention, which is to be given the full breadth of the appended claims and any equivalent thereof.
  • Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells.
  • Dengue type 3 virus in plasma is a population of closely related genomes: quasispecies. J Virol 76, 4662-4665.
  • Williams DHaF I Spectroscopic Methods in Organic Chemistry. 5th edition. Blacklick, Ohio, U.S. A:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Virology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Plant Pathology (AREA)
  • Materials Engineering (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Nanotechnology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to DNAzymes (also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ), which are conjugated to nanoparticles (NP) to facilitate the detection of nucleic acids. One aspect of the invention relates to compounds comprising DNAzymes conjugated to nanoparticles (DZ-NP), such as metallic or gold nanoparticles, and methods for their synthesis. Another aspect of the invention relates to methods of using the conjugated compounds to detect nucleic acids, such as genomic material or transcripts of infectious agents, such as viruses, exemplified by applications demonstrating visual detection of Flavivirus RNA molecules, such as dengue virus, or Alphavirus RNA molecules, such as chikungunya virus, in short time periods, using compositions comprising stable components.

Description

DN AZYM E-N ANOPA TICLE CONJUGATES AND METHODS OF USE THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
The pending application claims priority under 35 U.S.C. § 119(e) to United States Provisional Patent Application Number as USSN 61/835,173, filed on 6/14/2013, and USSN 61/835,758, filed on 6/17/2013, the disclosures of which are incorporated herein by reference.
STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with U.S. Government Support under grant RO1-AI-048561 awarded by the N IH/N IAID to Malcolm J. Fraser, Jr. The U.S. Government has certain rights in the invention. INCORPORATION-BY-REFERENCE OF A SEQUENCE LISTING
The sequence listing contained in the files 127191_0014_WO_ST25.txt", created on 2014-06-13, modified on 2014-06-13, file size (7,413 bytes, and "127191_0013_US_ST25.txt", created on 2013-06-14, modified on 2013-06-14, file size 5,586 bytes, and the file "127191_0014_US_ST25.txt", created on 2013-06- 17, modified on 2013-06-17, file size 5,586 bytes, are both incorporated by reference in their entirety herein. FIELD OF THE INVENTION
The present invention relates to DNAzymes (also known as deoxyribozymes, DNA enzymes, catalytic DNA, or DZ) which are conjugated to nanoparticles to facilitate the detection of nucleic acids. In particular, the invention relates to compounds comprising DNAzymes conjugated to nanoparticles, methods for their synthesis, and methods of using the conjugated compounds to detect nucleic acids, such as genomic material or transcripts of viruses and other infectious agents.
Recent epidemics of dengue viruses (DENV) coupled with new outbreaks on the horizon have renewed the demand for novel detection methods that have the ability to identify this viral pathogen prior to the manifestation of symptoms. The ability to detect DENV in a timely manner is essential for rapid recovery from disease symptoms. A modified DNAzyme of the 10-23 family of DNAzymes having RNA endonuclease activity, which is conjugated to gold nanoparticles by a linker, provides a powerful tool for the detection of viruses, such as DENV.
We examined the effectiveness of coupling the activation DNAzymes to the salt-induced aggregation of gold nanoparticles (AuN P) to detect dengue virus progeny in mosquito cells. A DNAzyme was designed to recognize the 5' cyclization sequence (5' CS) that is conserved among all DENV, and conjugated to AuN Ps. We demonstrated that DDZ-AuN P conjugates have the ability to detect the genomic RNA of our model dengue strain, DENV-2 NGC, isolated from infected Aedes albopictus C6/36 cells. These targeting events lead to the rapid aggregation of AuN Ps, resulting in a red to clear color transition of the reaction mixes, providing positive evidence for detection of the RNA genome of dengue virus. DENV could be detected directly from cell culture supernatants without additional sample processing, when SDS was included in the reaction mixture. Specificity assays demonstrated detection is DENV-specific, while sensitivity assays confirm detection at levels of 1 x 101 TCI D50 units. These results demonstrate DDZ-AuN P can be used to detect DENV genomes in a sequence specific manner and at concentrations that are practical for field use.
We have developed an effective detection assay using DNAzyme catalysis coupled with AuN P aggregation for the detection of DENV genomes in a sequence specific manner. Full development of our novel DDZ-AuN P detection method will provide a practical, rapid, and low cost alternative for the detection of DENV in mosquito cells and tissues, and possibly infected patient serum, in a matter of minutes with little to no specialized training required.
BACKGROUND OF THE INVENTION
Dengue viruses (DENV), members of the Flavivirus family of viruses, cause periodic explosive epidemics in many tropical and sub-tropical countries leading to 50-100 million infections per year [World Health Organization (2012)]. Approximately 500,000 of these are severe cases requiring hospitalization with a 2.5% fatality rate, most of which are children [Randolph et al. (2010)]. About half the world's population remains at risk for DENV infection making this pathogen one of the most dangerous viruses in the world [Clyde et al. (2006)]. In 2010 there were 1.6 million cases of dengue in the Americas alone, of which 49,000 were severe cases. Recent domestic outbreaks have occurred in the Hawaiian Islands in 2001, Brownsville, Texas in 2005 [Ramos et al. (2008)], the Florida Keys in 2010, and other parts of southern Florida including Miami-Dade in 2011 [Anez et al. (2012); Adalja et al. (2012); Effler et al. (2005); World health Organization (2012)]. Devastating outbreaks continue to occur in Puerto Rico, Brazil , and Pakistan [Anez et al. (2012); Figueiredo et al. (2012); Rai (2011)].
CH IKV remained largely unknown until a series of large scale epidemics occurred on several islands in the Indian Ocean in 2005 and 2006 culminating in a catastrophic outbreak on the island of la Reunion, resulting in 265,000 infections and 237 deaths in a population of 775,000 [Tsetsarkin et al. (2006)]. CH I KV has since been imported into Europe by infected travelers returning from endemic areas as evidenced by a CH IKV introduction in the French Riviera [Cordel et al. (2006)]. Most recently, CH IKV outbreaks have occurred and are currently ongoing on multiple Caribbean Islands including St. Maarten, British Virgin Islands, Guadeloupe, Martinique, Saint Barthelemy, and French Guiana [Van Bortel et al. (2014)]. These statistics, coupled with the worldwide distribution of Aedes aegypti and Aedes albopictus mosquitoes, demonstrate a risk of importing CH IKV into new areas, including the United States[Thiboutot et al.(2010)], through infected travelers.
The CH I KV outbreaks on La Reunion Island are believed to have been primarily facilitated by an Ala to Val (El A226V) amino acid substitution in the CH I KV glycoprotein El [Tsetsarkinet al. (2009)]. This mutation allowed the virus to traverse the A. albopictus gut membrane barrier more efficiently, resulting in a greater degree of dissemination through local swarms [Tsetsarkin et al. (2006)]. This likely provided a selective advantage for A. albopictus over Ae. aegypti as the insect vector , which accelerated the transmission of CH IKV to an immunological naive population on la Reunion lsland[Tsetsarkin et al. (2009)].
DENV are maintained in a cycle that involves humans and the globally disseminated Aedes aegypti mosquito [Roberts et al. (2002)]. Infection with one of four antigenically-distinct, but genetically-related DENV serotypes (designated DENV-1, -2, -3, and -4) can result in dengue fever (DF), dengue hemorrhagic fever (DH F), which can be fatal, or both DF and DH F [Qi et al. (2008)]. These disease states are characterized by high fever, often with enlargement of the liver, and in severe cases, circulatory and respiratory failure [Rigau-Perez et al. (1998)].
While DF and DH F are endemic to tropical and subtropical regions of the world, collapse of effective vector control programs, rapid dispersal of viruses due to ease of global travel, and migration of humans from tropical to non-tropical regions has resulted in DENV outbreaks in regions that were once non-endemic to these viral pathogens.
The ability to detect DENV in a timely manner is essential to rapid recovery from disease symptoms. Detection of mosquito-borne viruses in infected humans is currently limited to plaque assays, antigen detection assays (e.g. NS1 antigen detection), or quantitation of viral production through PCR-based methods [Lanciotti et al. (1992); Gubler (1998)]. These assays are currently referred to as the "gold standards" for DENV detection [de Oliveira et al. (2005)]. Current methods of testing mosquito populations for arboviruses, particularly dengue and West Nile viruses, has been limited to RT-PCR assays on pools of mosquitos (approximately 50 insects) [Shu et al. (2004); Chisenhall et al. (2008)].
The approaches mentioned above are limited by a number of pitfalls including low-throughput, labor- intensiveness, low stability of assay components at or above room temperature, and lack of portability. The requirement for specialized training and equipment and the time consuming nature of these assays limits their widespread utility for virus detection. These limitations compromise rapid diagnosis of viral infections. These methods are not easily adapted to field environments where reliable and effective detection methods are needed. Rapid, low-tech virus detection methods that require no specialized training or education are sorely needed to provide remote areas of the world the ability to detect highly pathogenic viruses for both clinical diagnosis and epidemiological surveillance.
In this report, we describe the development and initial validation of a colorimetric method for detecting DENV that couples the RNA targeting ability of a DENV-specific DNAzyme (DDZ) with the aggregation properties of oligonucleotide-tethered, non-crosslinking gold nanoparticles (AuN Ps). Our new DENV detection system, called DDZ-AuN P (Figure 1), should be an invaluable tool for the detection of DENV since it solves many of the limitations of current virus detection assays. This assay and subsequent analysis is cost-effective, simple to perform, and the assay components are highly stable at temperatures above 30°C, enabling easy storage at room temperature. The use of DNAzymes in the assay increases the specificity and versatility of detection permitting the design and incorporation of additional virus or strain-specific DNAzymes and probes.
Full development of this detection assay would greatly enhance virus diagnostics and epidemiology by providing an assay that is more rapid, easier to use, has greater portability, and is more cost effective than current DENV detection methods.
BRIEF SUMMARY OF THE INVENTION
One aspect of the invention relates to a compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3' BA); wherein said 5' and 3' Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
The invention is also directed to a method wherein said N P is an AuN P, and said aggregation is measured by absorbance or by visual inspection.
The invention is also directed to a kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising one or more types of DZ-N P conjugates described above.
A better understanding of the invention will be obtained from the following detailed descriptions and accompanying drawings, which set forth illustrative embodiments that are indicative of the various ways in which the principals of the invention may be employed.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing aspects and many of the attendant advantages of this invention will become more readily appreciated as the same become better understood by reference to the following detailed description, when taken in conjunction with the accompanying drawings, wherein:
FIG. 1 sets forth an illustration showing an overview of the DDZ-AuNP assay for dengue virus detection. Schematic of the DENV detection system using DENV-specific DNAzyme (DDZ) catalysis coupled with gold nanoparticle (AuN P) aggregation. AuN Ps are conjugated with the sulfide-linked anti-DENV DNAzyme, DDZ, which is complimentary to the DENV RNA genome (shown in orange). Black vertical lines indicate complimentary base pairing between DDZ and the target RNA. In the presence of DENV RNA (A), the 5' and 3' arms of the anti-DENV DNAzyme, DDZ, bind to the 3' and 5' ends of the targeted 5'-3' CS region, respectively (B). When Mg2+ and heat (37°C) are introduced, the DDZ digests the viral RNA (C). The digestion results in deshielding of the AuN P, leading to aggregation of AuN Ps in the presence of NaCI and heat (D), allowing a rapid and visually-detectable color transition from red to clear (E). The color transition indicates successful detection of DENV, which can be detected visually or quantified by UV/Vis spectrophotometry at 520 nm AuN Ps = red, tethered DNA probe = orange, DENV genome = purple. FIG. 2 sets forth an illustration showing anatomy of the 10-23 anti-DENV DNAzyme (DDZ) and Schematic Diagram of the DENV genome. A) DDZ was designed and produced as previously described [Cairns et al. (2003)]]. R = Purine. Y = Pyrimidine. The target RNA is in green with the anti-DENV DNAzyme 10-23 shown in black. The 5' and 3' ends of target RNA and DNAzymes are as indicated. Thin black vertical lines show complimentary base pairing. Arrows indicate cleavage site of the target RNA. B) A representation of the 10,723 base DENV-2 NGC GC capped and polyadenylated genome is shown to illustrate the position of the region targeted by the anti-DENV DNAzyme, DDZ. Non-structural (NS) genes 1 through 5 are shown in green. Structural genes encoding capsid, membrane glycoprotein precursor, and envelope proteins are shown in red. UTR = untranslated region, PA = polyadenylation.
FIG. 3 sets forth an illustration showing in vitro DDZ activity assay. DDZ-M-AuN Ps (1 χ 105 particles/mL) were placed in a buffered solution containing 10 mM MgCI2, DENV-2 NGC RNAs (0.6 μΜ) isolated from Ae. alboplctus C6/36. Following incubation at 37°C for 30 minutes, RT-PCR was performed as described in EXAMPLE 1 to amplify digestion products. Fragments were then separated on a 1.75% TAE agarose gel in the presence of ethidium bromide and photographed under UV light. Arrows indicate digestion products of approximately 150 and 350 bases and the primer dimer, respectively. The results demonstrate digestion of full length DENV-2 genome by DDZ-M in spite of AuN P conjugation. DDZ = anti-dengue virus DNAzyme, DDZin = inactive anti-dengue virus DNAzyme.
FIG. 4 sets forth an illustration showing colorimetric DDZ-AuNP detection of a synthetic DENV-2 NGC RNA target. A synthetic stretch of ribonucleotides corresponding to the 5' 170 bases of the DENV-2 RNA genome was added to a buffered mixture containing 10 m M MgCI2, 1 χ 105 DDZ-M-AuN P particles/mL, and 1.0 M NaCI. Samples were incubated at 37°C for 5 minutes and photographs were taken. Control samples were treated the same as experimental except 50 mM Tris-HCI was added in lieu of the synthetic DENV-2 RNA. Aggregation of DDZ-M tethered AuN Ps only occurred in the presence of synthetic DENV RNA. The results indicate that DDZ-AuN Ps have the ability to detect DENV.
FIG. 5 sets forth an illustration showing determination of optimal NaCI and SDS concentrations. A)
The optimal concentration of sodium, in the form of NaCI, for aggregation of DDZ-M-AuN P following interaction with the DENV-2 RNA genome was determined. DENV-2 NGC strain genomic RNAs were isolated using the RNeasy Mini Kit (Qiagen) and 0.6 μΜ was incubated in a reaction mix containing DDZ-M-AuN P (1 χ 105 particles/mL), 10 mM MgCI2, and increasing concentrations of NaCI (0 to 2 M) for 30 minutes at 37°C. A representative photograph of the reaction tubes is shown. The concentration of NaCI is indicated above each reaction tube. A full red to clear color transition indicates the optimum detection of the DENV-2 NGC genome. 1.5 M NaCI was determined to be the minimal optimum concentration of NaCI to use in our DENV detection reactions. B) The optimal concentration of SDS was determined in the presence of DENV-2 NGC virions. C6/36 cells were infected with DENV-2-NGC (MOI = 0.1). At 6 dpi, 10 μΙ of cell supernatants containing 1 χ 106 DENV- 2 NGC/mL, as determined by TCI D50-IFA, were added to a reaction mix containing 10 m M MgCI2, 1 χ 105 DDZ- M-AuN P particles/mL, 1.5 M NaCI, and 0% (w/v) to 1% (w/v) SDS detergent. Samples were incubated at 37°C for 30 minutes and photographs were taken. Results demonstrate that the DDZ-M-AuN P colorimetric method for DENV detection occurs optimally in 0.5% SDS. The percent SDS used is indicated above each microcentrifuge tube. SDS = sodium dodecyl sulfate.
FIG. 6 sets forth an illustration showing assessment of Mg2+ Resistance of DDZ-tethered AuNPs.
DDZ-M tethered AuN Ps were incubated with increasing concentrations of MgCI2 (0 to 20 mM). Following a 30 minute incubation period at room temperature (~25°C), UV/Vis spectrophotometry and photography were performed. These results demonstrate that DNAzyme conjugated AuN P aggregation is not driven by 10 mM MgCI2, which is used in all detection assays described in this report.
FIG. 7 sets forth an illustration showing an assessment of DDZ-AuNP specificity. A) DENV-2 and CH IKV (1 x 106/mL each) were placed in a buffered solution containing 10 mM MgCI2, 1 x 105 DDZ-AuN P particles/mL, 1.5 M NaCI, and 0.5% (w/v) SDS. Microcentrifuge tubes containing these mixes were incubated at 37°C for 30 minutes and photographed. CH I KV = chikungunya virus. DENV-2 = dengue virus serotype 2, DDZ-M = anti-dengue virus DNAzyme, DDZin-M = inactive anti-dengue virus DNAzyme. B) Analysis of DENV detection by UV/Vis Spectrophotometry. Samples were assembled as was performed for in A., mixed, incubated at 37°C for 5 minutes, and spectrophotometric analysis was performed using the N D-1000 spectrophotometer. C) Detection of DENV by DDZ-M-AuN P in comparison to several other flaviviruses. The specificity of our DDZ-M-AuN P conjugate to detect DENV and no other fellow Flavivirus members YFV, JEV or ZV was determined as described earlier (see Figure 4). D) An alignment was performed on consensus sequences of each of the four DENV serotypes to determine the most optimal regions for the design of serotype specific DDZ- AuN P devices by determining the region of least conservation one serotype has with the other DENV serotypes. E) Colorimetric serotype-specific detection of DENV. Cell culture supernatants from C6/36 cells mock infected (Mock), or from cells infected with either DENV serotypes 1 through 4 or CH IKV (1 x 106/mL each) were placed in buffered solutions containing the necessary cofactors and AuN Ps tethered with our all-purpose DENV serotype specific DNAzyme, DDZ-M, or one of the serotype-specific DDZs (designated DDZ-1 through-4) designed to specifically target the corresponding DENV serotype (Table E-3). Microcentrifuge tubes containing these mixes were incubated at 37°C for 5 minutes and photographed.
FIG. 8 sets forth an illustration showing an analysis of DDZ-AuNP Sensitivity. A) DDZ-M-AuN P colorimetric assays were performed on DENV-2 NGC titers of 1 χ 101, 1 χ 102, 1 χ 104, and 1 χ 106 to determine the limits of detection. Samples were assembled as described earlier (see Fig. 7), incubated at 37°C for 30 minutes and photographed. Results show that the DDZ-M-AuN P colorimetric assay is capable of detecting DENV-2 at a titer as low as l x 101. DDZ-M = anti-dengue virus DNAzyme, DDZin-M = inactive anti-dengue virus DNAzyme. B) Analysis of DDZ-AuN P sensitivity by UV/Vis spectrophotometry. Ten microliters (10 μΐ) of cell culture fluid from Mock, DENV-2 NGC (titers of 1 x lO1, 1 x 102, 1 x 106/mL), or CH I KV vaccine strain 181/25 (1 x 106/mL) infected C6/36 cells, or DENV serially diluted from 1 χ 101 (Dil l through DM5) or were added to separate mixtures as described in A). UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer at an absorbance of 520 nm. Absorbance measurements were graphed in log scale to illustrate sensitivity and accuracy of the colorimetric DENV detection method.
FIG. 9, panels A-C set forth illustrations showing alignment of CHIKV genomic sequences to identify appropriate target regions and vitro analysis of CDZ-AuNP detection of CHIKV NA targets. Panel 9A. A synthetic stretch of ribonucleotides corresponding to the target site of the CH I KV RNA genome of each serotype were added to a buffered mixture containing 10 mM MgCI2, 2x10s CDZ-AuN P particles, and 1.0 M NaCI. Samples were incubated at 37°C for 5 minutes and photographs were taken. Control samples were treated the same as the experimental samples, except that inactive versions of the DNAzymes were used in lieu of the active forms. Aggregation of CDZ-tethered AuN Ps only occurred in the presence of synthetic CH I KV RNA. Results indicate that CDZ-AuN Ps have the ability to detect CH IKV. CDZ = anti-CH I KV DNAzyme. CDZin = inactive anti-CH IKV DNAzyme. Panel 9B. CDZ-AuN Ps (2x10s particles/mL) were placed in a buffered solution containing 10 mM MgCI2, CHI KV RNAs (0. 6 μΜ) isolated from Ae. albopictus C6/36. Following incubation at 37°C for 30 minutes, RT-PCR was performed as described in Methods to amplify digestion products. Fragments were then separated on a 1.75% TAE agarose gel in the presence of ethidium bromide and photographed under UV light. Arrows indicate digestion products of approximately 200 and 300 bases and the primer dimer, respectively. Results demonstrate CDZ digestion of full length CH I KV genome in spite of AuN P conjugation. CDZ = anti-dengue virus DNAzyme, CDZin = inactive anti-dengue virus DNAzyme. Panel 9C. An alignment was performed of twenty five (25) CH I KV genomic sequences to determine the most optimal regions for the design of the chikungunya virus specific CDZ- AuN P device by determining the region of the greatest conservation within the CH I KV serotypes. CH I KV Con = Chikungunya virus conserved region. Contains the CDZ target sequence. Nucleotide sequences in yellow indicate complete conservation. Nucleotide sequences in blue indicate partial conservation. Nucleotide sequence position is indicated at the top of the figure. GenBank Accession Numbers at the left of the figure indicate the CH IKV sequence aligned.
FIG. 10 sets forth an illustration assessing the Mg2+ Resistance of CDZ-AuNP Conjugates. CDZ tethered AuN Ps were incubated with increasing concentrations of MgCI2 (0 to 20 mM) as described in Methods. Following a 30 minute incubation period at room temperature (~25°C), UV/Vis spectrophotometry were performed to assess MgCI2 influence on CDZ conjugated AuN Ps. These results demonstrate that CDZ- AuN P aggregation is not driven by lOmM MgCI2 , which is used in all detection assays described in this report.
FIG. 11 sets forth an illustration showing determination of optimal SDS concentrations for CHIKV detection. The optimal SDS concentration was determined in the presence of CH IKV virions. C6/36 cells were infected with CH IKV (MOI=0.1). At 2dpi, 10 μΙ of cell supernatants containing lxlO6 CH I KV/mL, as determined by TCID50-IFA, were added to a reaction mix containing 10 mM MgCI2, 2x10 CDz-AuN P particles, 1.5 M NaCI, and 0% (w/v) to 1% (w/v) SDS detergent. Samples were incubated at 37°C for 30 minutes and photographs were taken. CDz-AuN P colorimetric method for CH IKV detection occurs optimally in 0.5% SDS. The percent SDS used is indicated above each microcentrifuge tube. SDS = sodium dodecyl sulfate.
FIG 12 sets forth an illustration showing Transmission Electron Microscopy (TEM) of CDZ-AuNP
Conjugates. TEM of unconjugated and DNAzyme-linked 15nm AuN Ps were performed as described in the Materials and Methods. TEM images were taken of the following samples: Unconjugated AuN Ps from the manufacturer (Cytodiagnostics) and CDZ-conjugated AuN Ps in reaction buffer containing 1.5 M NaCI. TEM images were taken at 80,000 x magnification. The scale bar is 20 nm.
FIG. 13 sets forth an illustration showing an assessment of CDZ-AuNP specificity. CH I KV and DENV-2
NGC (lxl06/mL each) were placed in separate reaction tubes possessing a buffered solution containing lOmM MgCI2, 2x10s CDZ-AuN P particles, 1.5 M NaCI, and 0.5% (w/v) SDS. Microcentrifuge tubes containing these mixes were incubated at 37°C for 30 minutes and photographed. CDZin refers to the anti-CH I KV DNAzyme that has been rendered inactive through inversion of the oligonucleotides encompassing the catalytic domain. The inversion mutation of the catalytic domain is designed to knock out cleavage function, providing a negative control. CDZ-AuN P demonstrated CH I KV specificity in this assay since AuN P aggregation is only evident in the sample tube inoculated with CH IKV. CH I KV = chikungunya virus. DENV-2 = dengue virus serotype 2, CDZ = anti-dengue virus DNAzyme, CDZin = inactive anti-dengue virus DNAzyme.
FIG. 14 sets forth an illustration showing an analysis of the CDZ-AuNP Limits of CHIKV Detection. A. CDZ-AuN P colorimetric assays were performed on CH I KV titers of lxlO1, lxlO2, lxlO4, and lxlO6 to determine the limits of detection. Samples were assembled for CH I KV detection as described in EXAMPLE 1, incubated at 37°C for 30 minutes and photographed. Results show that the CDZ-AuN P colorimetric assay is capable of detecting CH IKV at a titer as low as lxlO1. CDZ = anti-dengue virus DNAzyme, CDZin = inactive anti-dengue virus DNAzyme. B. Titers of CH I KV containing samples were confirmed by TCI D50-immunofluorescence assays (I FA). We used immunofluorescence detection of cell surface expressed CH I KV E protein in C6/36 cultures infected with serial 10 fold dilutions to assess CH I KV titer as previously described [Nawtaisong et al. (2009)]. 10 fold serial dilutions of infected C6/36 cell culture supernatants were harvested at 48 hpi and used as inoculum for 96 well plate cultures of nal've C6/36 cells. Plates were incubated for 4 days at 28°C without C02, washed, fixed with acetone:DPBS (3:1), and stained with a primary CH I KV envelope (E) antibody (1:200) [Henchal et al. (1985)], followed by a biotinylated-streptavidin detection system conjugated with FITC (Amersham Biosciences, Piscataway, NJ). Wells displaying cellular fluorescence were scored as positive for CH IKVV infection. The number of positive wells were counted and the virus titers calculated according to Karber's method [Karber (1931)]. FIG. 15 sets forth an analysis of CDZ-AuNP sensitivity by UV/Vis spectrophotometry at 520nm. Cell culture fluids (10 μί) from mock, CH I KV vaccine strain 181/25 (titers of 1 x 101, 1 x 102 and 1 χ 106/mL), or DENV-2 NGC (1 x 106/mL) infected C6/36 cells, or CH IKV serially diluted from 1 x 101 (Dil l through DN5) or were added to separate mixtures. UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer at an absorbance of 520 nm. Absorbance measurements were graphed in log scale to illustrate sensitivity and accuracy of the colorimetric CH I KV detection method. B. Titers of CH I KV containing samples were confirmed by TCI D50-immunofluorescence assays (IFA). We used immunofluorescence detection of cell surface expressed CH I KV E protein in C6/36 cultures infected with serial 10 fold dilutions to assess CH IKV titer as previously described [Nawtaisong et al. (2009)]. 10 fold serial dilutions of infected C6/36 cell culture supernatants were harvested at 48 hours post infection (hpi) and used as inoculum for 96 well plate cultures of nal've C6/36 cells. Plates were incubated for 4 days at 28°C without C02, washed, fixed with acetone: DPBS (3: 1), and stained with a primary CH IKV envelope (E) antibody (1:200) [Henchal et al. (1985)], followed by a biotinylated-streptavidin detection system conjugated with FITC (Amersham Biosciences, Piscataway, NJ). Wells displaying cellular fluorescence were scored as positive for CH IKVV infection. The number of positive wells were counted and the virus titers calculated according to Karber's method [Karber (1931)].
Figure 16 sets forth an illustration showing normalization of TCID50-IFA to copies of CHIKV NA.
C6/36 cells in T-25 flasks were infected with CH I KV vaccine strain 181/25 (MOI=0.001). At 4 dpi cell supernatants were collected, ten-fold serial dilutions were produced and analyzed by TCID50-IFA and RT-PCR for the relation of infectious units to RNA copies, respectively, as described in Materials and Methods and in the text. Results were expressed as titers of 101 through 106 TCI D50 units/ml against RNA copy number (xl0n). Negative control samples consisted of samples containing RNA from uninfected C6/36 cells without primers (designated on the graph as "U") and samples containing RNA from uninfected C6/36 cells with CH IKV-specific primers (designated on the graph as "U + primers").
The following is a list of terms and their definitions used throughout the specification and the claims:
The terms "cell" and "cells", which are meant to be inclusive, refer to one or more cells which can be in an isolated or cultured state, as in a cell line comprising a homogeneous or heterogeneous population of cells, or in a tissue sample, or as part of an organism, such as a transgenic organism.
The term "isolated" when used with respect to a polynucleotide (e.g., single- or double-stranded RNA or DNA), an enzyme, or more generally a protein, means a polynucleotide, an enzyme, or a protein that is substantially free from the cellular components that are associated with the polynucleotide, enzyme, or protein as it is found in nature. In this context, "substantially free from cellular components" means that the polynucleotide, enzyme, or protein is purified to a level of greater than 80% (such as greater than 90%, greater than 95%, or greater than 99%). General abbreviations and their corresponding meanings include: aa or AA = amino acid; mg = milligram(s); ml or mL = milliliter(s); mm = millimeter(s); mM = millimolar; nmol = nanomole(s); pmol = picomole(s); ppm = parts per million; RT = room temperature; U = units; ug, μg = micro gram(s); ul, μΙ = micro liter(s); uM, μΜ = micromolar.
Specific abbreviations and their corresponding meanings include: N P = nanoparticle; AuN P = gold nanoparticle; DDZ = dengue virus targeting DNAzyme; L = linker; DDZ-M = universal dengue virus targeting DNAzyme; DDZ-1 = DNAzyme targeting dengue virus serotype 1; DDZ-2 = DNAzyme targeting dengue virus serotype 2; DDZ-3 = DNAzyme targeting dengue virus serotype 3; DDZ-4 = DNAzyme targeting dengue virus serotype 4. CDZ = CH I KV targeting DNAzyme.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to compounds comprising DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, methods of detecting nucleic acids having specific target sites using the DZ-N P conjugates, and stable compositions comprising the DZ-N P conjugates. The conjugates encompass virus-specific DNAzymes, such as dengue virus-specific DNAzymes (DDZ), and chikungunya virus-specific DNAzymes (CDZ). Other types of virus-specific DNAzymes are also encompassed by the invention.
One aspect of the invention relates to a compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3' BA); wherein said 5' and 3' Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
Related aspects are directed to a DZ-N P wherein said DNAzyme is an RNA-Cleaving DNAzyme selected from the group consisting of a 10-23 DNAzyme and a 8-17 DNAzyme. Other aspects are directed to a DZ-N P wherein said DNAzyme is selected from U02 2+-dependent and Mg2+-independent DNAzymes.
The nanoparticles used in the invention may be different shapes, typically a sphere, but also including shapes selected from a rod, a polygonal rod, rectangular block, cube, tetrapod, and pyramid.
Related aspects are directed to a DZ-N P wherein nanoparticle is a quantum dot. Quantum dots are tiny particles, or 'nanoparticles', of a semiconductor material, traditionally chalcogenides, such as selenides or sulfides, of metals like cadmium or zinc (e.g., CdSe or ZnS), ranging in size from 2 nm to 10 nm in diameter. Quantum dots have unique optical and electrical properties that are often different in character from those observed in the corresponding bulk material. One prominent difference is the emission of photons under excitation, which are visible to the human eye as light. The wavelength of photon emissions depend on the size, and not on the material, from which the quantum dot is made. Gold quantum dots can also be produced by a variety of methods [Goho (2004)]. The nanoparticles may be comprised of different substances, which may be homogeneous, or pure, such as a metal (designated a metallic nanoparticle, mN P), or a non-metallic substance (designated a non- metallic nanoparticle, nmN P), or they may be made of composite materials (designated a composite nanoparticle, cN P) comprised of two or more substances, such as a metallic and a non-metallic substance. Non-metallic nanoparticles may comprise one or more substances selected from the group consisting of carbon, dextrose, solid lipid nanoparticles, dextran, chitosan. A composite nanoparticle comprises a composite material comprising a metallic and a non-metallic substance. The nanoparticles may also comprise one or more substances selected from the group consisting of: gold, silver, iron, titanium, platinum, cerium, silicon, palladium, transition metals, and oxides thereof. Nanoparticles that comprise two or more metallic substances, or oxides thereof, are designated multi-metallic nanoparticles (mmN P). Nanoparticles that comprise metal are designated metallic nanoparticles (mN P). One aspect of the invention is directed to gold nanoparticles (AuN P), which are typically spherical, ranging in size from about 1 nm to about 400 nm in diameter. The range of sizes in a population of particles may vary, with a narrow or broad distribution of sizes in a sample, based on the source of the particles, and the process used to manufacture or purify particles of different shapes and sizes.
Related aspects are directed to DZ-N P conjugates wherein the DZ is linked to said nanoparticle by a linker through two or more covalent bonds, designated a covalent linker (cL). In one aspect, the covalent linker comprises -SH-(CH2)5 ". In other aspects, said covalent linker comprises Streptavidin fluorescent conjugates, acridine and Azobenzene fluorescent conjugates, Biotin, Biotin Diol Linker, Biotin TEG, Biotin BB, Desthiobiotin TEG, DOTA (l,4,7,10-Tetraazacyclododecane-l,4,7,10-tetraacetic acid), Dual Biotin, Photocleavable (PC) Biotin, Psoralen C2, Psoralen C6, Fluorescein, FITC, TRITC, fluorescent proteins (e.g. GFP, YFP, and RFP), 2 modified NTPs (e.g.2' fluoro dC (fC), 2' amino and 2' OMe analogs), polyethylene glycol (PEG) transport molecules, acetyl-PEG-amine, Carboxy-PEG-Amine. In other aspects, the DDZ is linked to said nanoparticle by a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL), such as a linker that comprises biotin.
The DZ-N P conjugates can be configured to target different nucleic acids. One aspect is directed to a target nucleic acid which is an RNA, such as a viral RNA. In one aspect, the viral RNA is a genomic viral RNA, and in another aspect the viral RNA is a viral RNA transcript. Different types of viral RNAs may be targeted.
In one aspect the DZ-N P conjugate is designed to target a viral RNA is a Flavivirus RNA, such as a Flavivirus selected from a group consisting of in a mammalian tick-borne flaviviruses, mosquito-borne viruses, and viruses with no known arthropod vectors. In one aspect the Flavivirus is a mosquito-borne virus selected from the group consisting of Avian tembusu-related virus, Calbertado virus, Chaoyang virus, Aroa virus, dengue virus, Japanese encephalitis virus, Kokobera virus, Ntaya virus, Spondweni virus, Zika virus, and Yellow fever virus group. Another aspect is directed to a viral RNA wherein said virus is a Flavivirus, exemplified by dengue virus, and said dengue virus RNA is a dengue virus genomic RNA.
In one aspect the DZ-N P conjugate is designed to target a viral RNA is an Alphavirus RNA, such as an RNA from Alphavirus that is in a complex selected from the group consisting of Barmah Forest virus, Eastern equine encephalitis, Middleburg virus, Ndumu virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis, Western equine encephalitis, unclassified Alphaviruses, and recombinant viruses within each complex. In another aspect, the DDZ-N P conjugate targets an Alphavirus is in the Semliki Forest Virus complex, such as chikungunya virus.
The DZ-N P conjugate may be designed to target specific residues within a target RNA. In one aspect the target region of a ribonucleic acid (target RNA) comprises at least one purine-pyrimidine dinucleotide motif within a coding sequence which encodes a polypeptide. In another aspect, the target region of a ribonucleic acid (target RNA) comprises at least one purine-pyrimidine dinucleotide motif within a noncoding sequence. In another aspect, the target region is a viral 5'-3' Cyclization Sequence (CS). The target region of the conjugates designated DDZ-M or DDZin-M is a viral 5'-3' Cyclization Sequence (CS), exemplified by the dengue virus
5'-3' CS UGCTGAAACGCGAGAGAAA (SEQ ID NO: 15) .
In other aspects, the target region of conjugates designated DDZ-1, DDZ-2, DDZ-3, and DDZ-4 is a conserved region, specific to each virus serotype, exemplified by
DDZ-1 UCAAGAAGAAUGGAGCGAU (SEQ ID NO: 16);
DDZ-2 AGGCGAGAAAUACGCCUUU (SEQ ID NO: 17);
DDZ-3 ACAGCAGGAGUCUUGGCUA (SEQ ID NO: 18); and
DDZ-4 UCUGGAAAAAUGAACCAAC (SEQ ID NO: 19), respectively.
The DDZ-N P conjugate has a catalytic core, which may vary depending on the class of DNAzyme. One aspect of the invention is directed to a DDZ-N P conjugate wherein said catalytic core (CC) is GGCTAGCTACAACGA (SEQ ID NO: 13) .
The DDZ-N P conjugate also comprise a pair of specific sequences, designated arms that facilitate the binding of the conjugate to a target nucleic acid sequence. In one aspect, the DDZ-N P comprises a 5' Arm and a 3' Arm that are a pair of sequences selected from the group consisting of:
TTTCTCTCG (SEQ ID NO: 1) and GTTTCAGCA (SEQ ID NO: 7) ;
ATCGCTCCA (SEQ ID NO: 2) and TCTTCTTGA (SEQ ID NO: 8) ;
AAAGGCGTA (SEQ ID NO: 3) and TTCTCGCCT (SEQ ID NO: 9) ; TAGCCAAGA ( SEQ ID NO: 4) and TCCTGCTGT (SEQ ID NO: 10); and
GTTGGTTCA (SEQ ID NO: 5) and TTTTCCAGA (SEQ ID NO: 11) .
Another aspect of the invention is directed to intermediate products, comprising a nucleic acid targeting sequence conjugated to a linker, which can be activated under appropriate chemical conditions to facilitate attachment of the intermediate to a nanoparticle. One aspect of the invention is directed to a conjugate, or an intermediate, wherein said linker and said DNAzyme designated DDZ-1, DDZ-2, DDZ-3, DDZ- 4, DDZ-in-M, are selected from the group consisting of: thiol-DDZ-l (SH-DDZ-1)
5 ' -SH- (CH2) 6-d (ATCGCTCCAGGCTAGCTACAACGATCTTCTTGA) -3 ' (SEQ ID NO: 22); thiol-DDZ-2 (SH-DDZ-2)
5 ' -SH- (CH2) 6-d (AAAGGCGTAGGCTAGCTACAACGATTCTCGCCT) -3 ' (SEQ ID NO: 23); thiol-DDZ-3 (SH-DDZ-3)
5 ' -SH- (CH2) 6-d (TAGCCAAGAGGCTAGCTACAACGATCCTGCTGT) -3 ' (SEQ ID NO: 24); thiol DDZ-4 (SH-DDZ-4)
5 ' -SH- (CH2) 6-d (GTTGGTTCAGGCTAGCTACAACGAGTTTCAGCA) -3 ' (SEQ ID NO: 25); and thiol-DDZin-M (SH-DDZin-M)
5 ' -SH- (CH2) 6-d (TTTCTCTCGAGCAACATCGATCGGGTTTCAGCA) -3 ' (SEQ ID NO: 26), respectively.
Another aspect is directed to a conjugate wherein DNAzyme and linker are conjugated to a metallic nanoparticle, such as a metallic gold nanoparticle (DNAzyme-AuN P).
The invention is also directed a method of detecting a viral nucleic acid in a sample, comprising the steps of (a) adding the DNAzyme-N P conjugate to a sample comprising nucleic acid in a form which can react with a complementary nucleic acid; (b) heating said sample under conditions which permit the 5' and 3' Binding Arms to bind to the target region in said viral nucleic acid and said catalytic core to cleave at least one purine-pyrimidine dinucleotide motif in said target region; and (c) measuring the increase in aggregation of said nanoparticle conjugates compared to a sample comprising unreacted DNAzyme-N P conjugates in a dispersed form. One aspect of the invention is directed to a method wherein said N P is an AuN P, and said aggregation is measured by absorbance. Another aspect relates to a method wherein said aggregation is detected by visual inspection. The reaction may be carried out under different conditions, depending on the nature of the components, and the desired degree of sensitivity or speed of reaction. For convenience, the reaction may be carried out in volume of less than 50 μΙ, in small tubes, for example, or in larger or smaller amounts depending on the number and format of samples being tested, and the instrument used, if required, to monitor the progress of the reaction. In one aspect, the reaction is carried out in the presence of sodium ion in an amount of about 0 to about 2 Moles/Liter, with magnesium ion in an amount of about 5 mM to about 20 mM.
The reaction may be supplemented with a variety of other compounds that facilitate the detection or exposure of nucleic acids in complex mixtures of cellular substances. One aspect of the invention is directed to a method wherein the reaction is carried in the presence of a chaotropic agent or a detergent, such as sodium dodecyl sulfate (SDS), guanidine isothiocyanate, guanidinium chloride, lithium perchlorate, lithium acetate, urea, thiourea, Triton X-100, Triton X-114, Tween 20, Tween 80, N P 40, Brij 35, Brij 80, Octyl glucoside, Octyl thioglucoside, and a zwitterionic detergent selected from CHAPS and CHAPSO. One aspect is directed to a reaction carried out in the presence of the detergent SDS, which may be present in an amount of about 0% to about 1% weight/volume.
The reactions may be carried out at different temperatures. It is convenient to carry out the reaction at room temperature (about 20°C), but it may also be carried out at higher temperatures, such as from about 20°C to about 80°C, depending on the stability of the conjugate at higher or lower temperatures, and the availability of thermal regulating equipment, to accelerate or decelerate the reaction as needed.
DZ-N P conjugates that are stable for long periods are desirable, to facilitate transport and storage of key components to diagnostic laboratories, or field locations, where the testing is performed. One aspect of the invention is directed to a conjugate which is stable for a period of at least a year, although shorter or longer periods, one week, one month, one year, two or more years, may be adequate for particular applications, depending on the sensitivity of the assay and the ability of a supplier to produce and ship a conjugate to local or remote locations across the globe.
The invention is also directed to a kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising one or more types of DZ-N P conjugates described above. One aspect is direct to a kit, wherein the sample is obtained from mammalian tissue, cells, or extracellular fluid. The sample may be blood, for example, or a sample is obtained from a virus-infected cell. Another aspect is directed to a kit wherein the sample is obtained from insect tissue, cells, or extracellular fluid, such as a sample obtained from a virus-infected mosquito, or pool of mosquitos. A further aspect is a kit, wherein the sample comprises nucleic acid from one or more viruses that are co-endemic with dengue virus. The invention is also directed to DZ-N P conjugates wherein the target region of a chikungunya- specific DNAzyme (CDZ), is a conserved region, specific to each virus serotype. One aspect is directed to a compound designated CDZ, wherein said target region is
AAUGCUAGAGCGUUCUCGCAU SEQ ID NO (28) .
Another aspect is a compound wherein catalytic core (CC) is
GGCTAGCTACAACGA (SEQ ID NO: 13) .
Another aspect is a compound wherein said 5' Arm and said 3' Arm are a pair of sequences selected from the group consisting of:
ATGCGAGAA (SEQ ID NO: 26); and
GCTCTAGCA (SEQ ID NO: 27) .
Another aspect is a compound wherein said linker and said DNAzyme designated CDZ is thiol-CDZ (SH-CDZ)
5 ' -SH- (CH2 ) 6-d (TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA) -3 ' (SEQ ID NO: 28)
While specific aspects of the invention have been described in detail, it will be appreciated by those skilled in the art that various modifications and alternatives to those details could be developed in light of the overall teachings of the disclosure. Accordingly, the particular arrangements disclosed are meant to be illustrative only, and not limiting as to the scope of the invention, which is to be given the full breadth of the appended claims, and any equivalent, thereof.
EXAMPLES
The foregoing discussion may be better understood in connection with the following representative examples which are presented for purposes of illustrating the principle methods and compositions of the invention, and not by way of limitation. Various other examples will be apparent to the person skilled in the art after reading the present disclosure without departing from the spirit and scope of the invention. It is intended that all such other examples be included within the scope of the appended claims.
General Materials and Methods Sources of Materials
All parts are by weight (e.g., % w/w), and temperatures are in degrees centigrade (°C), unless otherwise indicated. Table E-l presents a summary of the nucleotide and amino acid sequences described in this application.
Table E-l
Table of Sequences and Conjugated Compounds for DENV Targets
Description Length Type SEQ ID
NO:
DDZ-M 5' Arm tttctctcg 9 DNA 1
DDZ-1 5' Arm atcgctcca 9 DNA 2
DDZ-2 5' Arm aaaggcgta 9 DNA 3
DDZ-3 5' Arm tagccaaga 9 DNA 4
DDZ-4 5' Arm gttggttca 9 DNA 5
DDZin-M 5' Arm tttctctcg 9 DNA 6
DDZ-M 3' Arm gtttcagca 9 DNA 7
DDZ-1 3' Arm tcttcttga 9 DNA 8
DDZ-2 3' Arm ttctcgcct 9 DNA 9
DDZ-3 3' Arm tcctgctgt 9 DNA 10
DDZ-4 3' Arm ttttccaga 9 DNA 11
DDZin-M 3' Arm gtttcagca 9 DNA 12
DDZ-(M, 1,2,3,4) ggctagctac aacga 15 DNA 13 Catalytic Core DDZin-M (Inactive agcaacatcg atcgg 15 DNA 14 Catalytic Core)
DDZ-M Target ugcugaaacg cgagagaaa 19 RNA 15
DDZ-1 Target ucaagaagaa uggagcgau 19 RNA 16
DDZ-2 Target aggcgagaaa uacgccuuu 19 RNA 17
DDZ-3 Target acagcaggag ucuuggcua 19 RNA 18
DDZ-4 Target ucuggaaaaa ugaaccaac 19 RNA 19
DDZin-M Target ugcugaaacg cgagagaaa 19 RNA 20
SH-DDZ-M (n) tttctctcg ggctagctac aacgagtttc agca 33+ DNA 21 where Thiol linker HS-(CH2)6- represented by (n) at
position 1 is conjugated to DNAzyme sequence,
residues 2-end
SH-DDZ-1 (n) atcgctcca ggctagctac aacga tcttcttga 33+ Linker- 22
DNA
where Thiol linker HS-(CH2)6- represented by (n) at
position 1 is conjugated to DNAzyme sequence, residues
2-end
SH-DDZ-2 (n) aaaggcgta ggctagctac aacga ttctcgcct 33+ Linker- 23
DNA
where Thiol linker HS-(CH2)6- represented by (n) at
position 1 is conjugated to DNAzyme sequence, residues
2-end
SH-DDZ-3 (n) tagccaaga ggctagctac aacga tcctgctgt 33+ Linker- 24
DNA
where Thiol linker HS-(CH2)5- represented by (n) at
position 1 is conjugated to DNAzyme sequence, residues
2-end
SH-DDZ-4 (n) gttggttca ggctagctac aacga gtttcagca 33+ Linker- 25
DNA
where Thiol linker HS-(CH2)5- represented by (n) at
position 1 is conjugated to DNAzyme sequence, residues
2-end
SH-DDZin-M (n) tttctctcg agcaacatcg atcgg gtttcagca 33+ Linker- 26 where Thiol linker HS-(CH2)6- represented by (n) at
position 1 is conjugated to DNAzyme sequence, residues
2-end
DNAzyme, RNA probes, and AuNP
Thiol-modified and unmodified DNAzymes were synthesized and desalted by Life Science Technologies (Grand Island, NY, USA). The oligoribonucleotide target was synthesized and H PLC-purified by Life Science Technologies. Quantification of these oligonucleotides was performed with the N D-1000 spectrophotometer from NanoDrop (Wilmington, DE). Gold colloidal solutions containing 1.6 χ 1012 particles/m L gold nanoparticles (AuN Ps) with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA).
Cells, virus and antibody
Ae. albopictus C6/36 cells were obtained from ATCC, and maintained in Leibovitz's L-15 media (Atlanta Biologicals) supplemented with 10% FBS (Atlanta Biologicals), 10% TPB (triptose phosphate broth; Invitrogen/ GIBCO), penicillin G (100 U/ml; Invitrogen/GI BCO) and streptomycin (100 μΙΙ/ml; Invitrogen/ GI BCO). The C6/36 cells used in this study were maintained in a 28°C incubator and passaged every 4 days. Viral stocks were prepared as previously described [Li et al. (2012)].
The DENV strains and GenBank Gen lnfo identifiers for the four serotypes used in this study are as follows: DENV type 1 Hawaii: DQ672564.1, DENV type 2 strain New Guinea C (NGC): AF038403.1, DENV type 3 strain ThD3 0010 87(strain H87): AY676352.1, DENV 4 strain DENV-4/SG/06K2270DK1/2005 (strain H241): GQ398256.1.
Design of the anti-DENV DNAzyme (DDZ) and Catalytically-lnactive form (DDZin)
DENV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of all four serotypes of dengue were aligned using ClustalX [Jeanmougin et al. (1998)]. The aligned sequences comprise the following GenBank Gen lnfo identifiers: 12018173, 12018169, 12018171, 12659201, 2909798, 2909788, 2909786, 2909796, 6841603, 6841595, 6841605, 6841591, 6841601, 6841597, 6841593, 6841599, 6841587, 6841585, 6841589, 1000740, 1000738, 2909784, 1000736, 4926937, 4926935, 4926927, 4926929, 4926931, 2909794, 2909792, 1000742, 4926933, 2155257, 2723944, 323447, 6581076, 6581078, 2723942, 323449, 323650, 18644123, 1864412, 11119731, 19744844, 18644125, 18644127, 18643733, 4337012, 13386495, 1881708, 19071809, 13926152, 9280544, 14585842, 4926947, 4926939, 323654, 4926945, 4926943, 7329983, 7329981, 13540386, 14328931, 14485523, 323660, 17129645, 22901065, 22901063, 22901061, 1854040, 1854038, 1854036, 17129647, 24417519, 24417517, 24417515, 27656962, 24417513, 19071807, 14195698, 8927332, 14328929, 12711599, 323468, 25992053, 25992047, 25992041, 25992029, 25992025, 25992055, 25992033, 19071811, 25992043, 25992039, 25992037, 25992051, 25992031, and 25992057.
The 5' arms of DDZ-M and DDZin-M (Table E-2) were designed to bind to nucleotides 150 to 158 of the DENV genome. The 3' arms were designed to bind to the 5' end of the target region of the DENV genome that corresponds to nucleotides 140 to 148. These 5' and 3' arms of facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs G149 and C150.
The 5' arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome. The 3' arm was designed to bind to the 5' end of the target region of the DENV genome that corresponds to nucleotides 309 to 317. These 5' and 3' arms facilitated DDZ cleavage of the substrate DENV RNA between the purine-pyrimidine dinucleotide motifs A318 and A319. The 5' arm of DDZ-1 was designed to bind nucleotides 319 to 327 of the DENV-1 genome. The 3' arm was designed to bind the 5' end of the target region of the DENV-1 genome that corresponds to nucleotides 309 to 317. These 5' and 3' arms facilitated DDZ-1 cleavage of the substrate DENV-1 RNA between the purine-pyrimidine dinucleotide motifs A318 and A319.
The 5' arm of DDZ-2 was designed to bind nucleotides 126 to 134 of the DENV-2 genome. The 3' arm was designed to bind the 5' end of the target region of the DENV-2 genome that corresponds to nucleotides 116 to 124. These 5' and 3' arms facilitated DDZ-2 cleavage of the substrate DENV-2 RNA between the purine-pyrimidine dinucleotide motifs A124 and A125.
The 5' arm of DDZ-3 was designed to bind nucleotides 288 to 296 of the DENV-3 genome. The 3' arm was designed to bind the 5' end of the target region of the DENV-2 genome that corresponds to nucleotides 278 to 286. These 5' and 3' arms facilitated DDZ-3 cleavage of the substrate DENV-3 RNA between the purine-pyrimidine dinucleotide motifs A287 and G288.
The 5' arm of DDZ-4 was designed to bind nucleotides 95 to 103 of the DENV-4 genome. The 3' arm was designed to bind the 5' end of the target region of the DENV-4 genome that corresponds to nucleotides 85 to 93. These 5' and 3' arms facilitated DDZ-4 cleavage of the substrate DENV-4 RNA between the purine- pyrimidine dinucleotide motifs A94 and A95.
Table E-2
Nucleotide sequences of active and negative control DNAzymes and corresponding DENV targets
DNAzyme 5'Arm (5'- > 3') 3'Arm (5'- > 3') Catalytic Core RNA Target
DDZ-M TTTCTCTCG GTTTCAGCA GGCTAGCTACAACGA UGCUGAAACGCGAGAGAAA
(SEQ ID NO: l) (SEQ ID NO: 7) (SEQ ID NO: 13) (SEQ ID NO: 15)
DDZ-1 ATCGCTCCA TCTTCTTGA GGCTAGCTACAACGA UCAAGAAGAAUGGAGCGAU
(SEQ ID NO: 2) (SEQ ID NO: 8) (SEQ ID NO: 13) (SEQ ID NO: 16)
DDZ-2 AAAGGCGTA TTCTCGCCT GGCTAGCTACAACGA AGGCGAGAAAUACGCCUUU
(SEQ ID NO: 3) (SEQ ID NO: 9) (SEQ ID NO: 13) (SEQ ID NO: 17) DNAzyme 5'Arm (5'- > 3') 3'Arm (5'- > 3') Catalytic Core RNA Target
DDZ-3 TAGCCAAGA TCCTGCTGT GGCTAGCTACAACGA ACAGCAGGAGUCUUGGCUA
(SEQ ID NO: 4) (SEQ ID O: 10) (SEQ ID NO: 13) (SEQ ID NO: 18)
DDZ-4 GTTGGTTCA TTTTCCAGA GGCTAGCTACAACGA UCUGGAAAAAUGAACCAAC
(SEQ ID NO: 5) (SEQ ID NO: ll) (SEQ ID NO: 13) (SEQ ID NO: 19)
NEGATIVE CONTROL
DDZin-M TTT TCTCG GTTTCAGCA AGCAACATCGATCGG UGCUGAAACGCGAGAAA
(SEQ ID NO: 6) (SEQ ID NO: 12) (SEQ ID NO: 14) (SEQ ID NO: 20)
The left column in Table E-2 lists the active (DDZ-M) and inactive (DDZin-M) DNAzymes used in this Example. The second and third columns list the sequences of the 5' and 3' binding arms of the catalytically active DNAzymes and the inactive DDZin-M, respectively. Also shown are the sequences of the catalytic cores of each DNAzyme. The right column lists the nucleotide sequence each binding arm binds to where applicable. All sequences are displayed in a 5' to 3' direction. See the methods section for a description of DNAzyme design.
The DDZ-M target site was selected by scanning the 5' CS domain for one of the purine- pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003)]. An alignment of all four known DENV serotypes was performed to determine the ideal target sites for the serotype specific DNAzymes in our DDZ-AuN P detection method (Fig. 7d). Each serotype specific DNAzyme was designed to target each serotype independently of the others. The primary criterion for selection was that a purine-pyrimidine motif located within the target site must be present in all strains of a given DENV serotype. Another important criterion for selecting suitable sites for DDZ cleavage was that the length of conserved flanking arms be long enough to insure specificity of the DNAzyme for the target site. The 5' and 3' arms of each DDZ were 9 bases in length since this was determined to be optimal for DNAzyme catalysis and provides a sufficient level of specificity to insure minimal off-target effects [Cairns et al. (2003)].
Preparation of DDZ-tethered AuNP (DDZ-AuNP)
Preparation of DDZ-M-AuN P was performed as previously described with a few modifications [Liu and Lu (2006)]. The DTT-reduced
thiol—DDZ—M 5'—SH-(CH2) 6- d ( TTCTCTCGGGCTAGCTACAACGAGTTTCAGCA)—3' (SH-DDZ-M) (SEQ ID NO: 21) was purified by ethanol precipitation. 3 ml of AuN P and 5 mM acetate buffer (pH 5.2) were transferred to a glass scintillation vial, capped and incubated for 24 hours at room temperature. Following incubation 5 mM Tris acetate (pH 8.2) buffer and 100 mM NaCI were added and the resulting mixture was incubated at room temperature for an additional 24 hours. These functionalized particles (500 μΙ) were transferred into 1.7-ml microcentrifuge tubes and centrifuged at 16,110 x g at room temperature for 15 min
SUBSTITUTE SHEET (RULE 26) to remove unreacted SH-DDZ-M. The nanoparticles were redispersed in 1 m L of buffer containing 100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.01% SDS, centrifuged again at 16,110 x g at room temperature for 15 min. The supernatant was removed and the nanoparticles were dispersed in 500 μΙ of buffer containing 300 mM NaCI and 25 mM Tris acetate (pH 8.2), and re-centrifuged for 15 min to remove the remaining unreacted SH-DDZ-M. The cleaned DDZ-M-AuN P were redispersed into 200 μί of buffer containing 100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS. This same procedure was followed for the coupling of DENV serotype-specific DTT-reduced DNAzymes:
thiol-DDZ-l (SH-DDZ-l)
5'—SH- (CH2) d (ATCGCTCCAGGCTAGCTACAACGATCTTCTTGA) -3' (SEQ ID NO : 22); thiol-DDZ-2 (SH-DDZ-2)
5'-SH-(CH2)6-d(AAAGGCGTAGGCTAGCTACAACGATTCTCGCCT)-3' (SEQ ID NO: 23); thiol-DDZ-3 (SH-DDZ-3)
5'—SH- (CH2) s—d (TAGCCAAGAGGCTAGCTACAACGATCCTGCTGT) -3' (SEQ ID NO: 24); thiol DDZ-4 (SH-DDZ-4)
5'—SH- (CH2) (GTTGGTTCAGGCTAGCTACAACGAGTTTCAGCA)—3' (SEQ ID NO: 25); and thiol-DDZin-M (SH-DDZin-M)
5'—SH- (CH2) 6—d (TTTCTCTCGAGCAACATCGATCGGGTTTCAGCA) -3' (SEQ ID NO : 26).
Analysis of DDZ-tethered AuNPs in detecting a synthetic DENV-2 artificial target
DDZ-AuN Ps (1 x 105/mL) were combined in a 1.5 mL m icrocentrifuge tube with 10 mM MgCI2 for optimal DNAzyme activity, 1.0 M NaCI to drive aggregation of AuNPs, and synthetic DENV-2 RNA target (7.5 nM) corresponding to the 5' 170 nucleotides of the virus genome was added [Cairns et al. (2003); Ogawa et al. (2008)]. Reaction mixes were incubated at 37°C and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon Cool Pix S3300 camera (Nikon USA, Melville, NY).
Measurement ofMg2* resistance of oligonucleotide-tethered AuNPs
This analysis was performed as previously described [Ogawa et al. (2008)]. A mixture composed of 1 μΐ of DDZ-tethered AuNPs, 50 mM Tris-HCI (pH 7.5), and increasing concentrations of MgCI2 (5 mM to 20 mM) 10 μ_ were incubated at room temperature for 0 to ~30 min. Photos of these AuN Ps at each incubation time were taken with a Nikon Cool Pix S3300 camera, and absorbance units were measured with a ND-1000 spectrophotometer.
SUBSTITUTE SHEET (RULE 26) In vitro analysis of DDZ-tethered AuNPs
DENV RNA was isolated from DENV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol. 10 μΜ of eluted DENV RNA was incubated with 1 x 105 DDZ-AuN P/ml for 30 min at 37°C. 15 ul of this reaction mixture was added to an RT-PCR mix (Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels.
Sodium dodecyl sulfate (SDS) titration analysis
Ten microliters (10 μΙ) of cell suspension containing 1 χ 106 DENV-2 NGC/mL, as determined by TCID50-I FA, was added to a mixture containing 150 mM Tris-HCI (pH 7.5), 10 mM MgCI2, 1 x 105 DDZ-AuNP particles/m L, 1.5 M NaCI and SDS at concentrations ranging from 0% to 1% (w/v). Samples were incubated at 37°C for 30 minutes and analyzed every 5 min by visual inspection for aggregation of AuN Ps, an indicator of positive detection of in cell culture DENV-2. Photographs were taken with a Nikon CoolPix S3300 camera.
NaCI titration assay
DENV -2 NGC RNA were isolated from Aedes albopictus C6/36 cells using the QiaAmp Viral RNA mini kit, and added at a concentration of 0.6 μΜ (~10 μΐ) to a reaction mixture containing 150 mM Tris-HCI (pH 7.5), 10 mM 10 mM MgCI2, 1 x 105 DDZ-AuN P particles/mL, 0.5% (w/v) SDS, and NaCI (0 M to 2 M). Mixes were incubated at 37°C for 30 minutes and analyzed every 5 min by visual inspection for aggregation of AuN Ps. Samples were analyzed by visual inspection, and photographs taken. Positive detection of DENV-2 NGC RNAs was evident with a complete red to clear color transition occurring with the addition of 1.5 M NaCI.
Determination of DDZ-AuNP specificity
Ten microliters (10 μ_) of cell culture fluid containing 1 χ 106/mL DENV-2 NGC or, as a negative control, CH IKV vaccine strain 181/25 [Plante et al. (2011)] was added to a mixture containing 150 mM Tris-HCI (pH 7.5), 10 mM 10 mM MgCI2, 1 x 105 DDZ-M-AuN P, DDZin-M-AuN P or any of the serotype- specific DDZ tethered AuN Ps/mL, 0.5% (w/v) SDS, and 1.5 M NaCI. Samples were mixed and incubated at 37°C for 5 minutes, photographs were taken using the Nikon CoolPix S3300 camera, and spectrophotometric analysis was performed using the N D- 1000 spectrophotometer.
Analysis of DDZ-AuNP imits of DENV detection
DENV-2 NGC of the titers indicated (Figure 8) were produced as follows. A titer of 1 χ 106/mL was obtained following inoculation of Ae. albopictus C6/36 cells with 0.1 MOI and incubated at 28°C for 6 dpi. DENV-2 NGC were grown to titers of 1 χ 104/m L and 1 χ 102/mL at 3 dpi and 6 dpi, respectively, following inoculation of Vero cells with MOI of 0.1. DENV-2 NGC at a titer of 1 χ loVmL were produced by serial dilution of the 1 χ 102/m L stock. Titers were determined by TCID50-IFA as described [Carter et al.
(2010) ].
The DENV-2 NGC titers described above served as substrates for DDZ-AuN P colorimetric assays to determine their limits of DENV detection. Ten microliters (10 μΙ) of each dilution stock was added to a buffered reaction mix containing 150 mM Tris-HCI (pH 7.5), 10 mM 10 mM MgCI2, 1 x 105 DDZ-M-AuN P particles/mL, 1.5 M NaCI, and 0.5% (w/v) SDS. Samples were mixed and incubated at 37°C for 5 minutes and photographs were taken Nikon Cool Pix S3300 camera. UV/Vis spectrophotometric analysis was performed using the N D-1000 spectrophotometer.
EXAMPLE 1
METHOD OF DETECTING DENGUE VIRUS WITH DNAZYME NANOPARTICLE CONJUGATES
Results
Overview of the colorimetric detection of DENV by DNAzyme activity coupled with non-crosslinking AuNP aggregation (DDZ-AuNP)
The dengue virus detection method described below (see Figure 1) is based upon RNA aptazyme- mediated detection of small molecules, such as theophylline [Ferapontova and Gothelf (2009)]. A key limitation of using RNAzymes and aptazymes for virus detection is the inherent instability these catalytic RNAs, increasing the attractiveness of DNAzymes for use in detection assays.
The colorimetric detection of DENV by DDZ-AuN P can be divided into three phases: targeting/cleavage of the DENV RNA genome by DDZ, activation of AuN Ps, and aggregation of AuN Ps and detection (Figure 1). In the presence of DENV the 5' and 3' arms of DDZ bind to the 3' and 5' ends of a fully conserved segment that includes the 5'-3' CS region, respectively, and in the presence of Mg2+ and heat (37°C) the viral RNA is cleaved at G149. This cleavage results in deshielding and aggregation of the AuN Ps in the presence of NaCI and heat [Ogawa and Maeda (2008)], causing a visually detectable red to clear color transition [Song et al. (2011)] that can be quantified by UV/Vis spectrophotometry at 520 nm [32Song et al.
(2011) ]. If DENV are not present in the sample, the DNAzyme -tethered AuN Ps remain in a dispersed state and no color loss should occur [Song et al. (2011)]. Likewise, if any of the essential components such as magnesium or sodium are not present in the reaction mixture, no aggregation is possible.
Design and in vitro cleavage assessment of the DENV detection system DDZAuN P DNAzymes are lab- derived, auto catalytic DNAs consisting of three intimately connected domains (Figure 2a): A catalytic core that is activated by binding a cofactor (e.g., Pb2+ or Mg2+) (though a few DNAzymes do not require a cofactor), and 5' and 3' binding arms that bind to the 3' and 5' regions of the target sequence, respectively [Cieslak et al. (2003); Geyer and Sen (1997)]. DNAzymes have demonstrated impressive sensitivity in detecting metal ions or RNA [Jing et al. (2006); Sun et al. 1999].
The 10-23 DNAzyme is capable of cleaving RNA with high sequence specificity at target sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)]. We chose the 10-23 DNAzyme for use in our DENV detection system, because this DNAzyme is less dependent on secondary structure formation for its activity than other types of DNAzymes, and would be expected to perform better in our in vitro assays where biomolecular folding would be quite variable [Baum and Silverman (2008)]. The design of the anti-DENV 10-23 DNAzyme, DDZ-M (Figure 2a), was based on a 10-23 DNAzyme clone that was discovered through SELEX (Systematic Evolution of Ligands by Exponential Enrichment). We designed the 5' and 3' arms to target the highly conserved region that includes the 5'-3' cyclization sequence (CS) that is present in all DENV serotypes, and is required for replication of genomic RNA (Figure 2b; [Alvarez et al. (2005)]).
Gold nanoparticles (AuN Ps) ranging from 15 nm to 100 nm in diameter have been used in a number of detection assays [Cao et al. (2010)]. We chose to conjugate DDZ to 15 nm AuN Ps, since fewer copies of single-stranded DNA are required to cover the surface of a 15 nm AuN P than any AuN P of larger size [Sato et al. (2005)], and interaction of only 7.5% of DNAs conjugated to the 15 nm AuN Ps with the substrate RNA is required to initiate aggregation of the AuN Ps [Ogawa and Maeda (2008)].
AuN P-conjugated DDZs were analyzed for their ability to cleave the DENV-2 NGC RNA in vitro. DENV-2 NGC viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a buffered solution containing 1 χ 105 DDZ-M-tethered AuN Ps/mL for 30 minutes at 37°C. Digestion products were then amplified by RT-PCR using heterologous and hexamer primers designed to aid in the amplification of DDZ digestion products. Successful digestion of the DENV-2 NGC RNA genome by DDZ-M was demonstrated by the positive detection of 2 fragments of approximately 150 and 350 bases in size, indicative of DDZ-M catalysis (Figure 3). DNAzyme catalytic activity against the DENV-2 RNA genome was validated by the inclusion of an inactive DNAzyme negative control, DDZin-M, that was created by inverting the catalytic domain which has been previously shown to render the DNAzyme catalytically inactive [Carter et al. (2013)]. As expected, the catalytically inactive DDZin-M did not digest the DENV-2 NGC genome due to this alteration in the catalytic domain.
Addition of an artificial DENV-2 RNA target initiates aggregation of DDZ tethered AuNPs
As an initial test of the utility of our colorimetric detection method, a synthetic target was designed and synthesized that corresponds to the 5' 170 bases of the DENV-2 NGC genome. This stretch of nucleotides included the highly conserved 5' CS domain and the initial 74 bases of the capsid gene [Alvarez et al. (2005)]. Synthetic target (7.5 nM) was added to a buffered mixture containing 1 χ 105 DDZAuN Ps/mL, 10 m M MgCI2 and 1.0 M NaCI (Figure 4) as previously described [Song et al. (2011)]. The control mix contained the same components except 50 mM Tris HCI was substituted for the synthetic DENV-2 target. Reaction mixes were incubated at 37°C to initiate the detection reaction. Aggregation of the DDZ-M-tethered AuN Ps, observed by a red to clear color transition, was evident within the first 5 minutes of incubation. This aggregation event occurred only in the presence of the synthetic DENV-2 RNA, and therefore demonstrated a positive test for the presence of DENV-2 RNA.
Optimization of NaCI concentration
Sodium, in the form of NaCI, is an essential component of AuN P colorimetric detection assays because this monovalent salt drives aggregation of oligonucleotide-conjugated AuN Ps following the interaction of the AuN P conjugated probes with complimentary oligonucleotide targets [Ogawa and Maeda (2008); Ogawa (2011)]. NaCI concentrations greater than 2 M have been reported to cause instability of conjugated AuN Ps [Ogawa and Maeda (2008)]. Published reports also indicate that NaCI concentrations for effective AuN P aggregation can vary from 1.0 M to 1.5 M [Ogawa and Maeda (2009); Weil et al. (2004)]. In light of these observations, we evaluated the optimal NaCI concentration necessary to initiate aggregation of DDZ-M-AuN P following interaction with the DENV-2 genome.
DENV genomic RNAs (~0.6 μΜ), isolated from infected C6/36 cell supernatants, were added to a buffered reaction mixture containing DDZ-M-AuN P (~1 χ 105 particles/mL), 10 mM MgCI2 and NaCI at concentrations ranging from 0 M to 2 M (Figure 5A). Samples were incubated at 37°C for 30 min. A red to clear color transition confirming optimal detection of the DENV genome was observed in as little as 5 minutes in the presence of 1.5 M NaCI. The 0 M NaCI control provided confirmation that the red to clear color transitions observed were not the result of destabilization of aggregates from DNAzyme activity against the AuN Ps, nor were they caused by non-specific interaction of the DNAzymes with cell derived oligonucleotides. Our results also demonstrate the high stability and utility of our DDZ-AuN P assay at temperatures greater than 30°C, a critical criterion for any DENV detection assay [Peeling et al. 2010].
Determination of the optimal SDS concentration for colorimetric DDI- AuNP detection of DENV
Our DDZ-AuN P assay system demonstrated utility in detecting purified DENV-2 RNAs. However, to improve this assay for field use we needed a protocol that has speed, efficacy, and simplicity in detecting DENV RNA directly from virions. Liberating the DENV RNA genome from virion particles using a low cost, nontoxic RNA extraction reagent that is stable in the reaction buffer and does not interfere with the assay would be ideal. Sodium dodecyl sulfate (SDS) is an effective non-ionic detergent for lysing virus particles [Becker et al. (1975)]. SDS may be considered an ideal component for our colorimetric detection assays because it is non-toxic, stable in the reaction buffer, and does not require additional manipulation during lysis.
The optimal concentration of SDS was determined by adding cellular supernatants containing 1 χ 106 DENV-2/mL to buffered reaction mixes containing DDZ -tethered AuN Ps (DDZ-AuN P), 10 mM MgCI2 and SDS at concentrations of 0% (w/v), 0.5% (w/v) or 1.0% (w/v) (Figure 5B). Detection of DENV-2 NGC RNAs from cell culture fluid was not possible in the absence of SDS following incubation at 37°C for 30 min. Similarly, controls involving mock infected cell supernatants with or without SDS showed no red to clear color change distinctive of AuN P aggregation. However, infected cell culture supernatants displayed positive detection in as little as 5 minutes, and only in the presence of SDS and DENV-2 NGC. AuN P aggregation in the presence of 0.5% SDS and absence of DENV-2 virus particles was undetectable.
Measurement ofMg2* resistance of oligonucleotide-tethered AuNPs
Since DDZ is activated by 10 mM MgCI2, we needed to confirm that the positive detection of DENV-2 was due to specific recognition of the viral genome by DDZ-M-AuN P and not the result of a false positive from Mg2+ ion destabilization of DDZ-AuN Ps [Ogawa and Maeda (2008)]. The stability of DDZ-M-AuN P was tested against increasing concentrations of MgCI2 (0 m M to 20 m M) at room temperature every 5 minutes for up to 30 minutes (Figure 6), and absorbencies were measured with a NanoDrop spectrophotometer at 520 nm. As expected, concentrations equal to or less than 10 mM MgCI2 did not display a detectable effect on the stability of the oligonucleotides-tethered AuN Ps as evidenced by a lack of aggregation and absorbance, while those above 10 mM resulted in rapid instability of DDZ-AuN P, leading to aggregation of the nanoparticles as evidenced by the rapid decrease in absorbance.
Specificity of DDZ-AuNP for DENV
Because chikungunya virus (CH IKV) and DENV co-infections have become more prevalent in South Asia and Africa [Caron et al. (2012)], we tested our DDZ-AuN P detection method for its specificity for DENV in the presence of CH IKV (Figure 7a). Cellular supernatants containing 1 χ 106 DENV-2 or 1 χ 106 CH IKV/mL, as determined by TCID50-IFA [Carter et al. (2010)] (l TCID50 unit = 0.7 virus plaque forming units (pfu)) were added to a buffered reaction mixture containing 1 χ 105 DDZ-M or DDZin-M tethered AuN P/mL, 10 mM MgCI2, 1.5 M NaCI and 0.5% (w/v) SDS. As expected when gold nanoparticles tethered with DDZ-M DNAzymes were incubated with either mock infected or CH IKV infected cell supernatants, AuN P aggregation did not occur. Furthermore, the substitution of DDZ-M-AuN P with the negative control DDZin-M-AuN Ps also resulted in negative detection of DENV. However, positive detection of DENV-2 NGC was observed in as little as 5 minutes, when DDZ-M-AuN P was incubated with DENV infected C6/36 cell derived supernatants. These results demonstrated DDZ-M-Au N P could specifically detect DENV in these mixed virus samples.
An important feature of using gold nanoparticles in colorimetric detection schemes is that the aggregation of AuN Ps can be detected by UV/Vis spectroscopy. Since the absorption maximum of the 15 nm AuN Ps used in this detection method is 520 nm, a decrease in absorbance at 520 nm can also be used to detect and quantitate aggregation. This was tested using reaction mixtures containing cell culture supernatants from DENV infected cells (Figure 7b). UV/Vis spectrophotometric analysis at A520 showed a decrease in absorbance when DDZ-M-AuN P positively detected DENV-2, suggesting the ability to quantitate these aggregation events. Mock or CH IKV infected cell culture fluids, or AuN Ps tethered with the catalytically inactive DDZin-M do not elicit a detectible change in absorbance. These results show that our colorimetric DDZ-AuN P method for DENV detection possesses utility in a UV/Vis spectrophotometric platform.
DENV shares similar symptoms with other closely related mosquito-borne flaviviruses, such as
Yellow Fever (YFV; [Reed et al. (1900)]), Japanese Encephalitis (J EV; Kuwayama et al. (2005)), and Zika (ZV; [Macnamara (1954)]) viruses. These viruses also co-circulate with DENV and are often misdiagnosed as dengue. Therefore, a DENV detection method must demonstrate the ability to distinguish DENV, from other mosquito-borne flaviviruses. Although the 5'-3' CS domains are largely (but not fully) conserved among flaviviruses, the entire DDZ-M binding site is not conserved among all these flaviviruses as demonstrated by a sequence alignment of our DDZ-M binding site with corresponding regions in YFV, J EV, and ZV viruses. We also performed a experimental analysis of our DDZ-M-AuN P assay to verify its ability to distinguish DENV over other flaviviruses. Separate reaction mixtures were assembled as previously described (see Figure 4), except that artificial RNA substrates comprised of the 5' 220 nucleotides of the YFV, J EV, ZV, and DENV genomes were used as targets (Figure 7c). This stretch of nucleotides included the highly conserved 5' CS domain and the initial 74 bases of the capsid genes of each flavivirus. Aggregation of the DDZ-M-tethered AuN Ps was evident only in the presence of the artificial DENV-2 RNA substrates and not YFV, J EV, or ZV. AuN Ps tethered with the catalytically inactive DDZin-M did not aggregate in the presence of any flavivirus RNA substrate tested illustrating that mere binding of an RNA substrate is not enough to elicit an aggregation response by AuN Ps. These results further validated the specificity of our DENV detection method.
Lastly, to be effective in epidemiological surveillance efforts, a DENV detection method must demonstrate the ability to detect each serotype independently of the other. An alignment of all four known DENV serotypes was performed to determine the ideal target sites for the design of serotype specific DNAzymes (Figure 7d) and appropriate targeting sequences were assembled (Table E - 3 ). Serotype-DNAzyme-tethered AuN Ps were tested for their ability to detect viral genomic RNAs of DENV serotypes 1 through 4 (Figure 7e). AuN Ps-tethered with either a serotype-specific DDZ or the multiple serotype detecting DDZ- M were placed in separate mixtures containing the DENV serotype indicated, 0.1% SDS to lyse virus particles, and 1.5 M NaCI (Figure 7e). Mixes were incubated at 37°C for 5 min. Table E-3
Summary of active and negative control DDZ-AuNP devices
Devices Designed to detect Serotype detected
DENV-1 DENV-2 DENV-3 DENV-4 DDZ-M-AuN P All Serotypes + + + +
DDZ-l-AuN P DENV-1 + - - -
DDZ-2-AuN P DENV-2 - + - -
DDZ-3-AuN P DENV-3 - - + -
DDZ-4-AuN P DENV-4 - - - +
Negative Control
DDZin-M-AuN P None - - - -
The left column lists the active (DDZ-M-AuN P and DDZ-l-AuN P through DDZ-4-AuN P) and inactive negative control (DDZin-M-AuN P) devices used in this report. The second column lists the serotype each device was designed to detect. The right column summarizes the results of the DENV detection devices and the negative control DDZin-M-AuN P.
The DENV-1 serotype-specific DDZ-l-AuN P positively detected the DENV-1 serotype as signified by a distinctive red to clear/colorless color transition. As expected, DDZ-l-AuN P did not detect DENV-2, -3, or -4, illustrating the serotype-specific nature of this approach (Figure 7e). Likewise, each of the other serotype specific DNAzyme tethered AuN Ps detected only the corresponding DENV serotype (Figure 7e and Table E-3). These results demonstrated a DENV detection method that couples DNAzyme activity with AuN P aggregation to identify DENV in a serotype-specific manner. Cell culture supernatants containing the negative control CH IKV were added in lieu of DENV to further demonstrate the specificity of the serotype specific AuN Ps and overall feasibility of our DENV detection assay. As expected, neither mock infected nor CH I KV infected cell culture supernatants yielded the red to clear color transition typically observed for the positive detection of DENV, showing our conjugated AuN Ps were not influenced by cell or CH IKV derived oligonucleotides. The limits of DDZ-AuNP colorimetric detection of DENV-2
The sensitivity of our DENV detection system was assessed using standardized titers of DENV-2 (Figure 8). Titers of 101, 102,104 and 106 viruses/ml, as determined by TCID50-I FA (data not shown), were assayed using our colorimetric DDZ-M-AuN P detection method as described above. The negative controls consisted of the same reaction mixture as the experimental samples lacking DENV-2 (mock), or with the catalytically inactive DDZin-M substituted for DDZ-M. Following the addition of 1.5 M NaCI and incubation at 37°C for 5 minutes samples were analyzed by visual inspection.
Positive DENV-2 detection was evident after only 5 minutes at 37°C, and demonstrated as little as 101 DENV/ml could cause a color transition, although the samples containing 101 and 102 transitioned to a very pale purple rather than completely clear. In addition, we calculated the amount of DENV RNA corresponds to approximately 0.6 μΜ (for 106/ml), 6 nm (for 104/ml), 0.6 nM (for 102/ml), or 0.06 nM (for lOVml) of DENV RNA per reaction.
Further assessment of the sensitivity of our colorimetric DENV detection assay was further assessed by UV/Vis spectrophotometry using standardized titers of DENV-2 (Figure 8b). Titers of 101, 102, and 106, viruses/ml, as determined by TCID50-IFA (data not shown) and five serial dilutions originating from 101 (Dil l through DM5) were assayed using our colorimetric DDZ-M-AuN P assay and analyzed by UV/Vis spectrophotometry at an absorbance of 520. Positive detection of DENV-2 was evident with each sample that contained DENV-2 RNA, as demonstrated by a decrease in A520. This result is displayed as a greater -log10(520) value than the negative control Mock or CH IKV infected samples. Logarithmic interpretation of the resulting spectrophotometric measurements was performed to derive detection assay sensitivity. A linear relationship (R2 = 0.92; Figure 8b) demonstrates this assay is both sensitive and accurate. Spectrophotometric results also demonstrate our colorimetric DENV detection assay possesses the sensitivity to detect the presence of the DENV genome, even in very dilute samples (DM4) which is of no surprise since researchers have previously detected colorimetric change associated with AuN P aggregation, by spectrophotometry, in samples containing only femtomole amounts of substrate [Bai et al. (2010)].
Discussion
Simple and rapid diagnostic methods to screen mosquito and patient samples for the presence of viral pathogens can significantly facilitate diagnosis and treatment of virus borne diseases in field environments where sophisticated methods of virus detection are impractical. An ideal virus detection method must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results, be inexpensive, easy to use, and stable at temperatures greater than 30°C for use in a field environment [Peeling et al. (2010)]. Furthermore, DENV detection methods must show utility in epidemiological surveillance and outbreak monitoring by allowing independent detection of each serotype, and must have the ability to distinguish between primary and secondary infection [Peeling et al. (2010)].
In light of the caveats and pitfalls of the virus detection methods currently in use , the aim of this research was to explore the utility of a multiple DENV serotype targeting DNAzyme, called DDZ-M, and DENV- serotype specific DNAzymes , coupled to AuN Ps for detecting DENV. DDZ was designed to target the most conserved region of the DENV genome that includes the 5'-3' CS (Figures 2A and 2B). DENV serotype-specific DNAzymes (designated DDZ-1 through DDZ-4) were engineered to bind regions of DENV that are conserved within each serotype. The demonstrated ability of DNAzymes to successfully target small stretches of RNA makes these catalytic oligonucleotides highly useful for targeting conserved regions of virus genomes. Our results suggest that DNAzyme targeting coupled with non-crosslinking Au N P aggregation satisfies many of the criteria required to have an ideal method for DENV detection.
While our DDZ-AuN P colorimetric detection system demonstrates the capacity to target the highly conserved DENV 5' CS region, the utility of these molecules as detection agents requires a minimal subset of anti-DENV DNAzymes (DDZs) to be occupied for aggregation of AuN Ps to occur. The high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce (1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants. Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)]. We have demonstrated that under optimal reaction conditions the full length genome of DENV-2 can also be detected through the aggregation of DDZ-tethered AuN Ps following the interaction of the DDZ component with the DENV-2 RNA genome.
Our anti-DENV DNAzyme (DDZ), when conjugated with AuN Ps, readily detects its cognate target sequence within a synthetic 170 base segment of the DENV-2 NGC RNA corresponding to the 5' UTR, 5' CS and the 5' 74 bases of the capsid open reading frame (Figure 4). Aggregation events result from deshielding AuN Ps from sodium ions following DDZ binding to the synthesized DENV-2 target [Williams (1995)]. The DDZ-AuN P conjugate also detects purified viral RNAs or genomic RNA liberated from cell culture derived DENV-2 NGC virions. In our analyses we utilized cell culture supernatants instead of patient blood sample or infected mosquitoes because it is more convenient to determine optimal experimentation parameters (e.g. SDS and NaCI concentrations (Figures 5A and 5B, respectively) and limits of detection (Figure 8)) using a less complex cell culture system. These results provide the first confirmation of effective DENV detection using our DDZ-AuN P assay, and represent for the first time a catalytic nucleotide-based method can be used to detect DENV in fluid. Subsequent analyses will be required to optimize procedures for applications with infected patient serum or mosquito tissues.
Previous studies using oligonucleotide-tethered AuN Ps have determined optimal aggregation occurs with NaCI concentrations from 1.0 M to 1.5 M, while concentrations > 2.0 M destabilized conjugated AuN Ps [Carter et al. 2013]. In our hands, a NaCI concentration of 1.5 M allows full aggregation of DDZ-AuN P in the presence of 0.6 μΜ DENV-2 RNA (Figure 5A). We may infer that the color transition observed in samples containing DENV was not due to DNAzyme activity against the AuN P or non-specific interaction with cell derived oligonucleotides since the control solution containing 0 M NaCI did not yield a false positive result.
DDZ-AuN P aggregation in our DENV detection assays was not driven by the loss of AuN P stability in the presence of 10 mM MgCI2 (Figure 6). This was not a surprising result since resistance of DNA-probe- tethered AuN Ps to MgCI2 concentrations < 10 mM have been reported [Ogawa and Maeda (2009)]. Sodium dodecyl sulfate (SDS) proved to be an effective, low cost, detergent for directly lysing virus particles in our assay [Becker et al. (1975)]. SDS titration experiments on cell culture fluids containing DENV-2 NGC (Figure 5A.) demonstrated a concentration of 0.5% (w/v) was sufficient to completely lyse DENV-2 particles without interfering with AuN P aggregation reactions. Addition of this detergent to the assay components has no effect on the cleavage or aggregation reactions.
Our DDZ-AuN P colorimetric assay is capable of distinguishing between DENV-2 NGC and CH IKV (Figure 7), two symptomatically related viral pathogens, and indicates the utility of this detection approach in regions of the world that are endemic to both DENV and CH IKV [Caron et al. (2012)]. This increases the attractiveness and utility of the assay in epidemiological surveillance of dengue viruses in regions that are endemic to multiple pathogens that display similar symptoms. UV/Vis spectrophotometric analysis of these samples showed a fifty fold decrease in absorbance at 520 nm in the presence of DENV, demonstrating our DENV detection method has the sensitivity required for use with a spectrophotometer.
This DDZ-AuN P system allows for visual detection of DENV at titers as low as loVmL, which translates to a concentration of 0.06 nM DENV RNA (Figure 8a). This compares quite favorably to a previously reported RNA aptazyme-AuN P system that exhibits a sensitivity of 7.5 nM [Becker et al. (1975)]. Further assessment of the limits of DENV detection by UV/Vis spectrophotometric analysis (Figure 8b) demonstrates this assay displays sensitivity that is consistent with previous reports of RNA detection at sub-femtomole levels using gold nanoparticle detection systems [Liu et al. (2012)]. Though detection of DENV RNAs at this low concentration is not physiologically relevant to what is present in mosquitoes or humans, our ability to detect at this level demonstrates the power of AuN Ps in detection schemes.
Despite the fact that we are detecting 1 χ 106 TCID50 units, there are substantially more inactive virus particles present in a given sample [Aaskov et al (2006);Li et al. (2011)]. Adding SDS to lyse DENV particles en ha nced the sensitivity of our DDZ-AuN P detection method for real world applications. DENV- infected patients exhibit titers of 107 to 108'5 TCID50 units [Vaughn (2000)]. Since we can detect approximately 6 to 7 orders of magnitude or more below this, our assay could potentially allow detection of DENV in infected patients prior to the manifestation of symptoms. Current methods for the detection of DENV lack consistent bedside detection of DENV prior to the manifestation of symptoms, a drawback of NS-1 antigen detection methods [Kabra et al. (1999); Tricou et al. (2010)]. Individual Ae. aegypti mosquitoes are typically infected at a titer of 101 to 102 TCID50 units [Apte et al. (2012)], well within the limits of detection for this assay, making it potentially ideal for surveillance of DENV in mosquito populations.
We have demonstrated that our multi-DENV serotype detecting DDZ-M-AuN P device can detect all four DENV serotypes directly from cell culture fluid without sample processing (Figure 7e). Serotype- specific DDZ-tethered AuN Ps have demonstrated utility in detecting each of the corresponding four DENV serotypes in a serotype-specific manner (Figure 7e). For example, DDZ-1 tethered Au N Ps detected the presence of DENV-1, and only the DENV-1 serotype, due to the designed specificity of the DDZ-1 DNAzyme to a region in the DENV-1 Capsid gene that is fully conserved solely among the DENV-1 serotype. The other serotype specific DDZ-tethered AuN Ps possess this same feature in the detection of their corresponding DENV serotype (Figure 7e, see results summarized in Table E-3). Full development of this system will provide a valuable method for the detection of DENV in a serotype-specific manner in mosquito populations leading to enhanced speed and accuracy of epidemiological surveillance.
The simplicity of the DDZ-AuN P disclosed herein, provides distinct advantages over other virus detection methods. The assay can be packaged as a pre-mixed reaction solution in microcentrifuge tubes, and may be performed without any specialized equipment or training. This assay is also inexpensive, costing about $0.80 per sample, compared to serological testing or PCR- based methods which can cost $2 per sample or more to perform. Key assay components are stable for months at room temperature [Liu and Lu (2006)], and exhibit stability at temperatures greater than 30°C.
Further development of this assay will enable sensitive detection and discrimination of individual DENV serotypes in mosquito populations and patient derived samples as well as other virus derived RNAs. Detection prior to the onset of symptoms could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from the disease. The simplicity of the assay makes it ideal as a means of early surveillance to target locations for more effective mosquito suppression strategies.
The DNAzyme-Nanoparticle technology can be applied to facilitate the detection of other viruses or nucleic acids
DNAzymes coupled to nanoparticles, such as AuN P can be used as a highly versatile tool to facilitate the detection of oligonucleotides, and not just viral RNAs, such as DENV and CH IKV (chikungunya virus) exemplified in the Examples, noted above. In the examples, aggregation of AuN P provides a visual, colorimetric readout of the nucleic acid detected, regardless of the catalytic oligonucleotide appended. The effectiveness of our method in using DNAzyme-nanoparticle conjugates to detect other types of viral genomes (whether RNA or DNA) or other oligonucleotide molecules, whether originating from a pathogenic agent or a host cell lies in the design of the DNAzyme. Host cells, for example, can be prokaryotic or eukaryotic, particularly non-human animal, and human cells.
The successful use of DDZ-AuN Ps to facilitate the detection of nucleic acids obtained from any pathogen or cell requires: (1) that the nucleic acid composition of the 5' and 3' binding arms of the DDZ must be modified to complimentary to and base pair with the 3' and 5' ends of the target sequence of interest, respectively, such that the only nucleotide on the target sequence that is not bound by the DNAzyme binding arms is the purine of the purine-pyrimidine dinucleotide motif on the target sequence; and (2) the target sequence in question must contain a purine-pyrimidine dinucleotide motif to activate the corresponding DNAzyme. These criteria apply to any RNA or DNA segment of interest one wishes to detect using methods involving DNAzymes.
The DNAzyme-Nanoparticle technology can be performed in other test formats
Other test formats can also be used to facilitate the detection of nucleic acids with DNAzyme- nanoparticle conjugates. Use of a handheld spectrophotometer, for example, could increase speed of diagnosis, as well as the overall sensitivity and accuracy of the method. Our results show that a spectrophotometer can detect aggregation of AuN Ps resulting from DDZ interaction with virus genomes at levels that would not be detected visually. The use of a handheld spectrophotometer would enable the administration of treatments prior to the onset of symptoms since the concentration of pathogen derived RNA detected would be too low to display any definitive pathology. Dipstick formats based on DNAzyme- nanoparticle conjugates, that are less sensitive, or even slower, could be used in field locations, where sample tubes or handheld equipment are not available, or are inconvenient or expensive to use.
Conclusions
The results presented here show that the DDZ-M-AuN P, designed to be active against all forms of dengue virus, is capable of effectively detecting the DENV 2-NGC genome in a sequence specific manner. Serotype specific DNAzymes tethered to AuN Ps demonstrate utility in the independent identification of DENV serotypes. Coupling DNAzyme catalysis with gold nanoparticle aggregation provides an attractive alternative to other DENV detection approaches for the identification of DENV in transformed mosquito cells and tissues.
EXAMPLE 2
METHOD OF DETECTING CHIKUNGUNYA VIRUS WITH DNAZYME NANOPARTICLE CONJUGATES
Introduction
Chikungunya virus (CH IKV) was first detected in Tanzania in 1952, and is an emerging human pathogen responsible for significant disease outbreaks annually[Higgs and Ziegler (2010)]. Aedes aegypti, Ae. albopictus, and Ae. vigilax serve as the principle mosquito vectors for CH I KV, while also playing a role in dengue virus dissemination [van den Hurk (2009); Jansen et al. (2009)].
The increasing incidence of this emerging pathogen necessitate the need for a rapid and cost effective CH IKV detection method that can facilitate surveillance of mosquito populations. In Example 1, we described a simple, rapid, and cost effective gold nanoparticle coupled DNAzyme-based detection assay for dengue viruses (later published as Carter et al, 2013). In this example, we adapted this technology for the rapid, sensitive, and cost effective detection method for CH IKV, that couples the robust catalysis of a CH I KV- specific DNAzyme (CDz) with the salt-induced aggregation of gold nanoparticles (AuN Ps). The limits of sensitivity for this assay in terms of molar RNA concentrations, or as infectious units of virus, are described below.
Materials and Methods AuNPs and DNAzymes.
Gold colloidal solutions containing 1.6 χ 1012 gold nanoparticles (AuN Ps)/mL with a diameter of 15 nm were purchased from Cytodiagnostics (Burlington, ON, CA). Synthesized and desalted thiol-modified and unmodified DNAzymes and oligoribonucleotide CH I KV target molecules were purchased from Life Science Technologies (Grand Island, NY, USA). Quantification was performed with the N D-1000 spectrophotometer from NanoDrop (Wilmington, DE).
Design of the anti-CHI KV DNAzyme (CDZ) and catalytically inactive form (CDZin)
CDZ and CDZin 5' arms were designed to bind to nucleotides 202 to 210 of the CH I KV genome: (5 '-AATGCTAGAGCGTTCTCGCAT-3 ' ) SEQ ID NO (25) .
The 3' arms were designed to complimentarily base pair to the 5' end of the target region of the CH IKV genome that corresponds to nucleotides 192 to 200. These 5' and 3' arms of CDZ facilitated cleavage of the substrate CH I KV RNA between the purine-pyrimidine dinucleotide motifs at 201 and 202.
CH IKV sequence data was obtained from the National Center of Biotechnology Information (NCBI). Sequences representative of twenty five chikungunya viruses were aligned using ClustalX [Jeanmougin et al. (1998)] (FIG. 9C).. The aligned sequences comprise the following GenBank Gen lnfo identifiers: FN295483.3, H E806461.1, FR717336, FR717337.1, JF274082.1, L37661, EF452493.1, DQ443544.2, JN558836.1,JN558835.1, JN558834.1, JX088705.1, EU372006.1, H M045823.1, H M045822.1, H M045821.1, H M045814.1, H M045813.1, H M045812.1, H M045811.1, H M045794.1, H M045792.1, H M045791.1, H M045810.1, AF369024.2.
The CDZ target site was selected by scanning the NS1 region for one of the purine-pyrimidine dinucleotide motifs required for DNAzyme catalysis [Cairns et al. (2003); Jeanmougin et al. (1998); Larkin et al. (2007)]. The primary criterion for selection was that a purine-pyrimidine motif located within the target site must be present in all CH IKV sequences analyzed. Another important criterion for selecting suitable sites for CDZ cleavage, was that the length of conserved flanking arms be long enough to insure specificity of the DNAzyme for the target site. The optimal length for the 5' and 3' arms of CDZ was previously determined to be 9 bases for effective DNAzyme catalysis, which provides a high level of specificity, with minimal off-target effects [Cairns et al., (2003)].
Table E-4
Table of Sequences and Conjugated Compounds for CHIKV targets
Name Description Length Type SEQ
ID NO:
CDZ and CDZin 5' 5 ' -AATGCTAGAGCGTTCTCGCAT-3 ' 21 DNA 25 arm target Corresponding to nucleotides 202 to 210 of
the CHIKV genome
5'Arm (5'~ > 3' ATGCGAGAA 9 DNA 26 3'Arm (5'~ > 3') GCTCTAGCA 9 DNA 27 CDZ catalytic core GGCTAGCTACAACGA 15 DNA 13
Same as the DDZ catalytic core
CH I KV RNA AAUGCUAGAGCGUUCUCGCAU 21 RNA 28 Target
thiol-CDZ 5'-SH-(CH2)6- 33 29 d (TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA) -3 '
forward primers TGACCGCCATTGTGTCATCGTTG 23 DNA 30 binds to nucleotide positions 2631-2653
reverse primers GACCTCGTATCCACGATAGTCA 22 DNA 31 binds to nucleotide position 2788-2809
CH I KV Cognate TGCTAGAGCGTTCTCGCAT 19 DNA 32 target sequence corresponding to nucleotides 192 to 210 of the
NS1 gene
Table E-5
Nucleotide sequences of active and negative control DNAzymes and corresponding targets for CHIKV
DNAzyme 5'Arm (5'-- > 3') 3'Arm (5'-- > 3') Catalytic Core RNA Target
CDZ ATGCGAGAA GCTCTAGCA GGCTAGCTACAACGA AAUGCUAGAGCGUUCUCGCAU
(SEQ ID NO: 26) (SEQ ID NO: 27) (SEQ ID NO: 13) (SEQ ID NO: 28) CDZ-tethered AuNP Preparation (CDZ-AuNP)
Preparation of CDZ-AuN P was performed as previously described [Carter et al. 2013]. Briefly, the DTT-reduced thiol-CDZ (SH-CDZ)
5 ' -SH- (CH2) 6-d (TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA) -3 ' (SEQ ID NO: 29) was purified by ethanol precipitation. A volume of 3 ml of AuN P and 5 mM acetate buffer (pH 5.2) were transferred to a NaOH-washed glass scintillation vial, capped and incubated for 24 hours at room temperature. Following incubation, 5 mM Tris acetate (pH 8.2) buffer and 100 m M NaCI were added and the resulting mixture was incubated once again at room temperature for an additional 24 hours. These functionalized particles (500 μΙ) were transferred into 1.7-ml microcentrifuge tubes and centrifuged at 16,110 x g at room temperature for 15 min to remove unreacted SH-CDZ. The nanoparticles were resuspended in lmL of redispersal buffer 1 [100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.01% SDS], centrifuged again at 16,110 x g at room temperature for 15 min. The supernatant was removed and the nanoparticles were resuspended in 500 μΙ of redispersal buffer 2 [300 mM NaCI and 25 mM Tris acetate (pH 8.2)], and re- centrifuged for 15 min to remove the remaining unreacted SH-CDZ. The cleaned CDZ-AuN P were redispersed into 200 μΐ redispersal buffer 3 [100 mM NaCI, 25 mM Tris acetate, (pH 8.2) and 0.05% SDS] and stored at room temperature.
Detection of a synthetic CHIKV RNA target
CDZ-AuN Ps (2xl08/mL) were combined in a 1.5mL microcentrifuge tube with lOmM MgCI2 for optimal DNAzyme activity [Liu et al. (2006)], 1.0M NaCI to drive aggregation of AuN Ps , and synthetic CH I KV RNA target (7.5 nM) corresponding to the 5' 200 nucleotides of the CH I KV RNA genome was added [Ogawa and Maeda (2008)]. Reaction mixes were incubated at 37°C and inspected every 5 minutes over a 30 minute period. Photographs were taken with a Nikon CoolPix S3300 camera (Nikon USA, Melville, NY).
In vitro digestion analysis of CDZ-tethered AuNPs
This analysis was performed as described in Example 1. Briefly, CH IKV RNA was isolated from CH I KV infected Ae. albopictus C6/36 cells using the QiaAmp viral RNA Mini Kit (Qiagen) according to the manufacturer's protocol. A volume of 10 μΜ of eluted CH I KV RNA was incubated with 2x10s DDZ-AuN P/ml for 30 min at 37°C. A volume of 15ul of this reaction mixture was added to a RT-PCR mix (Super Script I II, Life Science Technologies) containing heterologous and random hexametric primers to amplify the digested fragments. These RT-PCR fragments were then separated on 1.75% agarose gels. Nig Resistance of CDZ-tethered AuNPs
This analysis was performed as previously described [Carter et al. (2013)]. A mixture composed of 1 μ_ CDZ-tethered AuN Ps, 50 mM Tris-HCI (pH 7.5), and increasing concentrations of MgCI2 (5 mM to 20 mM) 10 μΐ were incubated at room temperature for 0 to ~30 min. Absorbance units were measured with a N D-1000 spectrophotometer.
Transmission Electron Microscopy (TEM)
TEM of CDZ conjugated and unconjugated AuN Ps was performed using the JEOL 1220 transmission electron microscope fitted with a tungsten electron source. Samples for TEM (2 μΙ) were placed on TEM grids coated with a thin carbon support film, air dried, and images were taken. For AuN P applications, images were captured at 80kV using 80,000X magnification.
Determination of Optimal Sodium dodecyl sulfate (SDS) Concentration
This was performed as previously described (Carter et al. 2013). Ten microliters (10 μΙ) of cell suspension containing lxlO6 CH IKV TCI D50 units/mL was added to a mixture containing 150 mM Tris-HCI (pH 7.5), 10 mM MgCI2, 2x10s CDZ-AuN P particles, 1.5M NaCI and SDS at concentrations ranging from 0% to 1% (w/v). Samples were incubated at 37°C for 30 minutes, and analyzed every 5 min by visual inspection for aggregation of AuN Ps, an indicator of positive CH I KV detection in cell culture. Photographs were taken with a Nikon CoolPix S3300 camera.
CDZ-AuNP Specificity Determination
CDZ-AuN P specificity assays were performed as previously described for DENV detection with the anti-DENV DNAzyme (DDZ) conjugated AuN Ps [Carter et al. 2013]. Ten microliters (lOuL) of cell culture fluid containing lxl06/mL CH I KV vaccine strain 181/25 [Plante et al. (2011)], or DENV-2 NGC as a negative control, were added to a mixture containing 150 mM Tris-HCI (pH 7.5), lOmM MgCI2, 2x10s CDZ-AuN P or CDZin-AuN P particles, 0.5% (w/v) SDS, and 1.5M NaCI. Following incubated at 37°C for 5 minutes, photographs were taken using the Nikon Cool Pix S3300 camera, and spectrophotometric analysis was performed using the N D-1000 spectrophotometer.
Limits of CHIKV Detection with CDZ conjugated AuNPs
CH IKV samples (Figs. 14, 15 and 16) were produced as follows. A titer of lxl06/mL was obtained following inoculation of Ae. albopictus C6/36 cells with 0.1 MOI and incubated at 28°C for 2 dpi. Serial dilutions were produced to obtain titers of lxl04/mL, ixio2/mL, and lxloVmL. Titers were determined by TCID50-I FA as described [Carter et al. (2011)]. The CH IKV samples described above served as substrates for CDZ-AuN P colorimetric assays to determine their limits of CH IKV detection. Ten microliters (10 μΙ) of each dilution stock was added to a buffered reaction mix containing 150mM Tris-HCI (pH 7.5), lOmM MgCI2, 2x10s CDZ-AuN P particles, 1.5M NaCI, and 0.5% (w/v) SDS. Samples were mixed and incubated at 37°C for 5 minutes, and photographs were taken with a Nikon CoolPix S3300 camera.
Real-time RT-PCR assays
The reaction mixture (final volume of 25ul) contained 2X SYBR green qRT-PCR Mastermix with Superscript I II RT/Platinum Taq, 10 pmol of each primer, and 5 ul of extracted RNA from C6/36 cells infected with CH I KV vaccine strain 181/25, or uninfected C6/36 cells as a negative control. An additional negative control reaction was assembled that included RNA from uninfected C6/36 cells, but without CH I KV specific primers. Amplification of a fragment from the CH IKV RNA genome of 168 nt in length was performed using the following two primers:
A forward primer of the sequence
TGACCGCCATTGTGTCATCGTTG SEQ ID NO: (30)
(which binds to nucleotide position 2631-2653), and a reverse primer of the sequence
GACCTCGTATCCACGATAGTCA SEQ ID NO: (31)
(which binds to nucleotide position 2788-2809).
qRT-PCR amplification assays were performed on the 7500 Real-Time PCR System (Applied Biosystems) with the following settings: 50°C for 15 min, 95°C for 2 min, followed by 45 cycles of 95°C for 15s, 60°C for 40s. Data was collected at the 60°C step.
The amount of viral RNA was calculated from a standard curve using a synthetic RNA transcript (Gene Script). The values of the quantity of CH I KV RNA/ml for each standard used was obtained using the in vitro transcript as a standard. The coefficient of determination for the standard curve that was generated had a value of (R2) > 0.97. Results
Design of anti-CHI KV 10-23 DNAzyme conjugated gold nanoparticles
DNAzymes (i.e., catalytic DNAs) have demonstrated utility and impressive sensitivity in detecting metal ions or RNA [Cairns et al. (2003); Geyer and Sen (1998)]. DNAzymes possess a catalytic core that is activated by binding a cofactor (e.g., Pb2+ or Mg2+) Cairns et al. (2003); Geyer and Sen (1998). Some DNAzymes, however, do not require cofactors for catalysis [Geyer et al. (1997)]. The 10-23 DNAzyme [Cairns et al (2003)] is capable of cleaving substrate RNAs with high sequence specificity at sites containing purine-pyrimidine (R-Y) junctions [Santoro and Joyce (1997)]. We chose this particular DNAzyme for use in our CH I KV detection system because of its decreased dependence on secondary structure for its activity versus other DNAzymes [Carter et al. (2013)], which was predicted to increase catalysis in our in vitro assays where biomolecular folding would be very erratic. The anti-CH I KV 10-23 DNAzyme, CDZ (Fig. 2A), was designed with 5' and 3' arms that target a highly conserved sequence present in all CH I KV that were identified through ClustalX alignments. This DNAzyme construct was conjugated to 15nm AuN Ps which we previously determined were effective for the positive detection of dengue viruses [Carter et al. (2013)]. Assessment of CDZ-AuNP Targeting using In vitro Cleavage Assays
The colorimetric detection of CH I KV by CDZ-AuNP can be divided into three phases: targeting/cleavage, activation of AuN Ps, and aggregation/detection (Fig. 9B). In the presence of CH IKV RNA, the 5' and 3' arms of the AuN P-conjugated anti-CH IKV DNAzyme (CDZ) bind to the 3' and 5' ends of the targeted region, respectively. In the presence of the Mg2+'DDZ digests the viral RNA. During the catalysis, and in the presence of NaCI and heat , these AuN Ps aggregate; leading to a rapid and visually detectable red to clear/colorless color transition[Ogawa and Maeda (2008); Song et al. (2011)]. This color transition, detected visually with ease, signifies the successful detection of CH IKV. As an added benefit, this color transition is quantifiable by spectrophotometry at 520nm [Englebienne, (1998); Song et al. (2011)].
Initial examination of the utility of our CDZ-AuN P colorimetric detection method was performed against a synthetic 19 base CH IKV substrate corresponding to nucleotides 188 to 207 of the NS1 gene. Our CDZ was designed to complimentarily base pair with this target sequence(Carter et al. 2013). In vitro assessment of the activity of CDZ-AuN P in the presence of CH IKV artificial substrate RNAs was performed as in Example 1 (Carter et al. 2013). The synthetic CH I KV substrate (7.5 nM) was combined with a buffered mixture containing 1.0 M NaCI, 10 mM MgCI2, and 2x10s CDZ-AuN Ps (Fig 9A). The control mix substituted the CDZ- AuN Ps with the negative control CDZin-AuN P, which was created through inversion of the catalytic domain to render the DNAzyme catalytically inactive [Auslander et al. (2010)] . Reaction mixes were incubated at 37°C and monitored for the distinctive red to clear color transition, indicating positive detection of the CH I KV RNA substrate. Aggregation of the CDZ-tethered AuN Ps, was evident within the first 5 minutes of incubation. This aggregation event occurred only in the presence of the synthetic substrate and active CDZ-AuN Ps, demonstrating a positive test for the presence of CHI KV.
AuN P-conjugated CDZs were analyzed for their ability to target and cleave RNAs derived from CH I KV strain 181/25 in vitro. Viral RNAs were isolated from infected Ae. albopictus C6/36 cells, and incubated in a reaction mix containing 2x10s CDZ-tethered AuN Ps for 30 minutes at 37°C. Digestion products were then amplified by RT-PCR, as previously described [Carter et al. 2013], using heterologous and hexamer primers designed to aid in the amplification of CDZ digestion products.
Successful digestion of the CH I KV RNA genome by CDZ was demonstrated by the detection of 2 fragments of approximately 200 and 300 bases in size by RT-PCR (Fig. 9B). Validation of DNAzyme catalytic activity against the CH IKV genome was achieved by the inclusion of the inactive DNAzyme negative control, CDZin.
Assessment of Mg2* sensitivity
DNAzymes are typically activated in these assays by lOmM MgCI2. We determined the necessity for MgCI2 on the overall stability of our CDZ conjugated AuN Ps by incubating the conjugated nanoparticles in increasing concentrations of MgCI2 (0 mM to 20 mM) at room temperature, and assessed the activity every 5 minutes for up to 30 minutes (Fig. 3) by measuring absorbance at 520nm. As expected, concentrations equal to or less than lOmM MgCI2 did not display a detectable effect on the stability CDZ-AuN Ps, as previously described for DNAzyme conjugated AuN Ps designed to detect dengue viruses [Carter et al. 2013]. Furthermore, magnesium ion concentrations above lOm M resulted in rapid instability of CDZ-AuN P, leading to aggregation of the CDZ conjugated gold nanoparticles, as evidenced by a rapid decrease in absorbance (Fig. 10).
Determination of optimal SDS concentration in CHIKV detection
The efficiency of our colorimetric CDZ-AuN P assay for detection of CH I KV should be increased substantially by liberating the CH IKV RNA from virions. Sodium dodecyl sulfate (SDS), an effective nonionic detergent for lysing virus particles [Becker et al. (1975)], was previously demonstrated to be an ideal component for our colorimetric detection method [Carter et al. 2013] because it does not require additional manipulations during cell lysis, is non-toxic, low cost, stable in the reaction buffer, and does not interfere with the assay.
Cellular supernatants were added to a buffered reaction mix containing CDZ- AuN Ps, lOmM MgCI2 and SDS at concentrations ranging from 0% (w/v) to 1.0% (w/v) (Fig. 11). Although samples were incubated at 37°C for 30 minutes positive detection of the CH I KV genome was observed in as little as 5 minutes, in the presence of SDS, resulting in a red to clear/colorless color transition of the sample tubes. This color transition occurred only when both CH IKV and SDS were present in the sample tubes.
CDZ conjugated AuNPs maintain their spherical shape in a high salt environment Basic morphology of AuN Ps can be altered due to the conjugation procedure that is performed when
DNAzymes are conjugated to AuN Ps. Misshapen AuN Ps can compromise the efficacy of virus detection methods that employ conjugated AuN Ps. Transmission electron microscopy (TEM) is the best method to determine the structural integrity of spherical AuN Ps, whether unconjugated or conjugated, by assessing their overall morphology. Consequently, we assessed the general structural integrity of unconjugated AuN Ps and CDZ conjugated AuN Ps in the storage buffer described in Materials and Methods, and CDZ conjugated AuN Ps in the reaction buffer used in this CH IKV detection assay at 80,000X magnification (Fig. 12). Unsurprisingly, the generally round appearance of the 15nm unconjugated AuN Ps remained unchanged whether these AuN Ps are CDZ conjugated or placed in our high salt (1.5 M) or high SDS (0.5%) containing reaction buffer.
Specificity Assay
Patients dually infected with CH I KV and DENV have increased in prevalence in South Asia and Africa [Caron et al. (2012] reflecting the co-incidence of these two viruses in mosquito populations. In light of this, we tested our CDZ-AuN P detection method for its specificity in detecting CH IKV in the presence of DENV (Fig. 13). Cell culture fluids containing lxlO6 CH I KV/mL, lxlO6 Sindbis virus, or lxlO6 DENV-2 NGC/mL, as determined by TCID50-I FA, were added to a buffered reaction mixture containing 2x10s CDZ- or CDZin-tethered AuN P, lOmM MgCI2, 1.5M NaCI and 0.5% (w/v) SDS. Incubation of samples in the presence of mock infected cell supernatants or the inactive DNAzyme, CDZin, did not result in a red to clear color change. However, this color change was evident in samples containing CH I KV, but not DENV, or Sind. These results validate the specificity of CDZ-AuN P in detecting CH IKV in these virus samples.
Limits of Detection
The sensitivity of our CH IKV detection system was assessed using standardized titers of CH IKV (Fig. 14A). Titers of 101, 102,104 and 106 TCI D50 units/ml, as determined by TCI D50-I FA (Fig. 14B), were assayed along with a mock negative control, , or were analyzed with the catalytically-inactive CDZin-AuN Ps instead of CDZ-AuN Ps. Following the addition of 1.5 M NaCI and incubation at 37°C for 5 minutes samples, were analyzed by visual inspection.
Positive CH IKV detection was evident after only 5 minutes at 37°C, and demonstrated as little as 101 CH IKV TCI D50 units/ml could cause a color transition, although the samples containing 101 and 102 transitioned to a very pale purple rather than completely clear. Though it should be noted these concentrations are based on infectious units, and not copies of RNA. Nevertheless, we are greatly encouraged since these results demonstrate we can detect CH IKV approximately 6.5 orders of magnitude below the viremia of patients who present with symptoms of CH I KV infection [Vaughn et al. (2000)].
Although positive detection of CH I KV can be determined by the color change of the sample tubes, the desired full red to clear/colorless color change was not evident for loVml or 102/ml, but rather a red to pale purple color change was achieved. Though this color change signifies positive detection of CH IKV, further assessment of the sensitivity of our colorimetric CH I KV detection assay was performed by UV/Vis spectrophotometry using standardized titers of CH I KV (Fig. 15A). Titers of 101, 102, and 106 viruses/ml, as determined by TCI D50-I FA (Fig. 15 B), and five serial dilutions originating from RNA containing samples isolated from cells possessing 101 CH I KV TCI D50 units/ml (Dil l through DM5) were assessed using our colorimetric CDZ- M-AuN P assay for CH I KV, and analyzed by UV/Vis spectrophotometry at an absorbance setting of 520nm. Positive detection of CH IKV was evident for each sample that contained CH I KV RNA, demonstrated by a decrease in A520. This resulted in a greater -loglO(A520) value than the negative control, Mock, or DENV- infected samples. Logarithmic interpretation of the resulting spectrophotometric measurements was performed to validate assay reliability. A linear relationship (R2 = 0.93; Fig. 15A) demonstrated this assay is sensitive and accurate.
Spectrophotometric results also demonstrated our colorimetric CH I KV detection assay is capable of detecting the presence of CH IKV RNA even in very dilute samples (DM4). Earlier reports have also detected colorimetric change associated with AuN P aggregation in samples containing only femtomole amounts of substrate using spectrophotometry [Liu and Lu (2012)]. The ability to detect a co-circulating Flavivirus, DENV, at such low infectious unit titers may be due to the presence of immature/inactive virions, and RNA species that are not detected by TCID50-IFA, or even RT-PCR. For example, DENV and other viruses produce aberrant RNA species called "defective RNAs" [Li et al. (2011); Marriott and Dimmock et al. (2009); van der Schaar et al. (2008)] These RNAs contain defects in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Li et al. (2011)]. Some of the defective RNAs appear to be maintained during natural cycles of transmission, potentially due to complementation with fully functional DENV RNA genomes [Li et al. (2011)]. Our dengue virus and CH I KV colorimetric detection methods, DDZ-AuN P and CDZ-AuN P, take advantage of the presence of immature/inactive virions and aberrant RNA species due to the presence of detergent in the reaction mixture, the catalytic nature of DNAzymes and the effect of this RNA-induced catalysis on AuN P aggregation dynamics [Carter et al. (2013)].
To assess the limits of detection with respect to RNA copy number, supernatants were collected at 4dpi from C6/36 cells infected with the 181/25 vaccine strain of CH I KV (MOI=0.001) and were serially diluted for qRT-PCR and TCI D50 assays to determine RNA copy number relative to infectious units (Fig. 16). Negative control qRT-PCR samples consisting of RNA from uninfected cells with and without CH IKV specific primers were included to demonstrate the RNA detected was a product of CH IKV infection [Fronhoffs et al. (2002)]. The results demonstrate an approximate average 2,000: 1 ratio of CH I KV RNA to infectious units. Similar ratios were previously demonstrated for CH IKV [Nougairede et al. (2013)] and provide insight into why our RNA- based colorimetric detection method can detect this pathogen at such low uninfectious titers.
Conclusions
Simple and rapid diagnostic methods to screen mosquito and patient samples for the presence of viral pathogens can significantly facilitate prevention, diagnosis, and treatment of virus borne diseases in field environments where sophisticated methods of virus detection are impractical. Ideally virus detection methods must distinguish the target pathogen from other diseases exhibiting similar symptoms (such as malaria, leptospirosis, typhoid, typhus and chikungunya), be highly sensitive during the acute stage of infection, provide rapid results enabling early detection, be cost effective, easy to use, and stable at temperatures greater than 30°C for use in a field environment, and must show utility in epidemiological surveillance and outbreak prediction [Peeling et al. (2011)].
Example 1 illustrated our efforts to address the need for a more sensitive method to detect dengue virus. We demonstrated the effctiveness of a rapid, portable, low-tech method of virus detection that requires no specialized training, education, or equipment by coupling the RNA targeting ability of a DENV- specific DNAzyme (DDZ) with the aggregation properties of gold nanoparticles (Au N P). The DDZ-AuN P colorimetric DENV detection method is capable of detecting all four DENV serotypes directly from Aedes albopictus C6/36 cell culture fluids in a matter of minutes, without RNA isolation procedures [Carter et al. (2013)], and serves as an initial proof of concept for catalytic oligonucleotide tethered AuN P driven technologies that can be applied to the detection of viruses. In this example, we demonstrate the versitility of this method, by changing the oliginucleotide sequence of the 5' and 3' binding arms of the DNAzyme congjugates such that targeting of the CH I KV-specific RNAs would occur by way of complimentary base pairing. Our results suggest that DNAzyme targeting, coupled with non-crosslinking AuN P aggregation, satisfies many of these criteria, and is an attractive method for CH I KV detection.
The 5' and 3' binding arms of the previously described anti-DENV DNAzyme were changed to an oligonucleotide sequence of the 5' and 3' binding arms that would permit complimentary base pairing, allowing targeting of the most conserved region of the CH I KV genomic RNAs encompassing nucleotides 192 to 210, of the NS1 gene [Carter et al. (2013)]. The demonstrated ability of DNAzymes to successfully target small stretches of RNA makes these catalytic oligonucleotides highly useful for targeting conserved regions of virus genomes.
While our CDZ-AuN P colorimetric detection system demonstrates the capacity to target the highly conserved region located within the CH I KV NS1 gene, the utility of these molecules as detection agents requires a minimal subset of anti-CH I KV DNAzymes (CDZs) to be occupied for aggregation of AuN Ps to occur. The high tolerance of DNAzymes to mismatched binding of the target oligonucleotides [Santoro and Joyce(1998)] makes DNAzymes ideal for detection of viruses because they will be able to detect many closely related variants. Prior studies have demonstrated aptazymes can detect synthetically produced segments of virus genomes [Cho et al. (2005)]. We have demonstrated that under optimal reaction conditions the genomic CH IKV RNAs can also be detected through the aggregation of CDZ-tethered AuN Ps following the interaction of the CDZ component with the CH IKV RNA genome. Our anti-CH I KV DNAzyme (CDZ), when conjugated with AuN Ps, readily detects its cognate target sequence within a synthetic 19 base segment of the CH I KV RNA corresponding to nucleotides 192 to 210 of the NS1 gene.
5' TGCTAGAGCGTTCTCGCAT ( SEQ ID NO: 32)
The aggregation events result from deshielding of AuN Ps from sodium ions following CDZ catalysis of the synthesized CH I KV target [Williams et al. (1995)]. The CDZ-AuN P conjugate also detects purified viral RNAs or genomic RNA liberated from cell culture derived CH I KV virions. RT-PCR analysis (Fig. 9) demonstrated that our CDZ DNAzyme, while conjugated to AuN Ps, retains the ability to target and cleave CH I KV RNA into 2 fragments, as expected. These results demonstrate the utility of CDZ to target and cleave CH I KV derived RNAs.
CH IKV infected cell culture supernatants were analyzed instead of patient blood samples or infected mosquitoes because it is more convenient to determine optimal experimentation parameters using a less complex cell culture system. These results provide the first confirmation of effective CH IKV detection using our CDZ-AuN P assay, by providing a catalytic nucleotide-based method can be used to detect CH I KV in fluids, and demonstrate the versatility of our colorimetric virus detection method. Though optimizing this system using a cell culture platform was successful, full development will include optimizing procedures for applications with infected patient serum or mosquito tissues.
Sodium dodecyl sulfate (SDS) has proved to be an effective, low cost, detergent for directly lysing virus particles [Becker et al. (1975)]. SDS titration experiments on cell culture fluids containing CH IKV (Fig. 11) demonstrate a concentration of 0.5% (w/v) is sufficient to completely lyse CH I KV particles without interfering with AuN P aggregation, as was previously described [Carter et al. (2013)].
The CDZ-AuN P colorimetric assay is capable of distinguishing between CH I KV and DENV-2 NGC (Fig. 13), two symptomatically related viral pathogens, and indicates the utility of this detection approach in regions of the world that are endemic to both of these viral pathogens CH I KV in regions that are endemic to multiple pathogens that display similar symptoms. The inclusion of the more closely related alphavirus, Sindbis virus (Sind), further establishes the specificity of our colorimetric CH IKV detection method.
Transmission electron microscopy of our CDZ-conjugated AuN Ps (Fig. 12) demonstrated structural stability is maintained in the high salt/high SDS content of the reaction buffer used in CDZ-AuN P mediated detection of CH IKV. Structural stability of these conjugated AuN Ps was established by the observance of the general spherical shape of the CDZ-conjugated AuN Ps. Loss of structural stability could compromise CDZ activity, and thus CH IKV detection. The basic morphology of AuN Ps can be altered due to the conjugation procedure that is performed when DNAzymes are conjugated to AuN Ps. Misshapen AuN Ps, for example, can compromise the efficacy of virus detection methods that employ conjugated AuN Ps. Our CDZ-AuN P system has the ability to detect CH IKV at titers as low as loVmL, and is consistent with previous reports of RNA detection at sub-femtomole levels using gold nanoparticle detection systems [Bai et al. (2010)]. Moreover though we are detecting in the range of lxlO1 to lxlO6 virus particles, there are substantially more inactive virus particles present in a given sample [Aaskov et al. (2006)]. Consequently adding SDS to lyse CH I KV particles enhances the effectiveness of our colorimetric CDZ-AuN P detection method for real world applications. CH I KV-infected patients exhibit a viral load of 109 or more [Parida et al. (2007)]. Since we can detect > 8 orders of magnitude below this, our assay could potentially allow detection of CH I KV in infected patients prior to the manifestation of symptoms. Current CH I KV detection methods lack this feature. Secondly, Ae. albopictus mosquito larvae are typically infected with CH I KV at a titer of 106 TCID50/larva, well within the sensitivity for this colorimetric CHI KV detection assay, making it potentially ideal for surveillance of CH IKV in mosquito populations [Reiskind et al. (2010); Westbrook et al. (2009)].
The detection of so few infectious units may be attributable to the presence of immature/inactive virions and RNA species that are not detected by TCI D50-I FA, or even RT-PCR [Rodenhuis-Zybert et al. (2010) van der Schaar et al. (2007); van der Schaar et al. (2008)]. For example, DENV and other viruses produce aberrant RNA species called "defective RNAs" in the form of intragenic stop codons, nucleotide insertions, or deletions, rendering many virions produced non-infectious [Aaskov et al. (2006); Marriott et al. (2009); Wang et al. (2002)]. Our colorimetric method for CH IKV detection, CDZ-AuN P, takes advantage of immature/inactive virions and aberrant RNA species because of the placement of detergent in the reaction mixture, the choice of target sequence, the catalysis promoted by DNAzymes and the effect of this RNA-induced catalysis on Au N P aggregation kinetics.
Prior demonstration of DNAzyme conjugated AuN Ps as a sensitive DENV detection method, coupled with the demonstrated ability to detect CH IKV with a similar DNAzyme-AuN P approach further validates the versatility of this method for the potential detection of a number of viruses [Carter et al. (2013)]. The simplicity of these colorimetric assays for virus detection provides distinct advantages over other detection methods. The colorimetric assay for virus detection can be packaged as a pre-mixed reaction solution, and may be performed without any specialized equipment. Furthermore, this assay is inexpensive as compared to serological testing or PCR-based methods. Components for detection are stable for months at room temperature (data not shown), and have displayed stability at temperatures greater than 30°C, making this assay ideal for CH I KV detection in tropical climates.
Further development of these colorimetric detection assays will enable sensitive identification of virus derived RNAs in mosquito and patient samples. Bedside virus detection could allow more effective diagnosis and treatment of infected patients, and more rapid recovery from disease symptoms. Furthermore, the simplicity of colorimetric AuN P-driven detection methods make these approaches optimal in early surveillance to target locations for more effective vector control strategies. While the preferred embodiments of the invention have been illustrated and described in detail, it will be appreciated by those skilled in the art that various changes can be made therein without departing from the spirit and scope of the invention. Accordingly, the particular arrangements disclosed are meant to be illustrative only and not limiting as to the scope of the invention, which is to be given the full breadth of the appended claims and any equivalent thereof.
REFERENCES
All references, patents, or applications cited herein are incorporated by reference in their entirety, as if written herein.
Aaskov J, Buzacott K, Thu H M, Lowry K, Holmes EC: Long-term transmission of defective RNA viruses in humans and Aedes mosquitoes. Science 2006, 311:236-238.
Adalja AA, Sell TK, Bouri N, Franco C: Lessons learned during dengue outbreaks in the United States, 2001-2011. Emerg Infect Dis 2012, 18:608-614.
Alvarez DE, Lodeiro M F, Luduena SJ, Pietrasanta LI, Gamarnik AV: Long-range RNA- RNA interactions circularize the dengue virus genome. J Virol 2005, 79:6631-6643.
Anez G, Heisey DA, Espina LM, Stramer SL, Rios M : Phylogenetic analysis of dengue virus types 1 and 4 circulating in Puerto Rico and Key west, Florida, during 2010 epidemics. AmJTrop Med Hyg 2012, 87:548-553.
Apte-Deshpande A, Paingankar M, Gokhale M D, Deobagkar DN : Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus. PLoS One 2012, 7:e40401.
Auslander S, Ketzer P, Hartig JS: A ligand-dependent hammerhead ribozyme switch for controlling mammalian gene expression. Mol Biosyst 2010, 6:807-814.
Bai X, Shao C, Han X, Li Y, Guan Y, Deng Z: Visual detection of sub-femtomole DNA by a gold nanoparticle seeded homogeneous reduction assay: toward a generalized sensitivity-enhancing strategy. Biosens Bioelectron 2010, 25: 1984-1988.
Baum DA, Silverman SK: Deoxyribozymes: useful DNA catalysts in vitro and in vivo. Cell Mol Life Sci 2008, 65:2156-2174.
Becker R, Helenius A, Simons K: Solubilization of the Semliki forest virus membrane with sodium dodecyl sulfate. Biochemistry 1975, 14: 1835-1841.
Cairns MJ, King A, Sun LQ: Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites. N ucleic Acids Res 2003, 31:2883- 2889.
Cao X, Ye Y, Liu S: Gold nanoparticle-based signal amplification for biosensing. Anal Biochem 2010, 417:1-16.
Caron M, Paupy C, Grard G, Becquart P, Mombo I, Nso BB, Kassa Kassa F, Nkoghe D, Leroy EM: Recent introduction and rapid dissemination of chikungunya virus and dengue virus serotype 2 associated with human and mosquito coinfections in Gabon, central Africa. Clin Infect Dis 2012, 55:e45-e53. Carter JR, Keith JH, Barde PV, Fraser TS, Fraser MJ Jr: Targeting of highly conserved dengue virus sequences with anti-dengue virus trans-splicing group I introns. BMC Mol Biol 2010, 11:84. 14. Carter, J.R., Balaraman, V., Kucharski, C.A., Fraser, T.S., and Fraser, M.J., Jr. A novel dengue virus detection method that couples DNAzyme and gold nanoparticle approaches. Virol J 10, 201.
15. Chisenhall DM, Vitek CJ, Richards SL, Mores CN : A method to increase efficiency in testing pooled field-collected mosquitoes. J Am Mosq Control Assoc 2008, 24:311-314.
16. Cho S, Kim JE, Lee BR, Kim JH, Kim BG : Bis-aptazyme sensors for hepatitis C virus replicase and helicase without blank signal. Nucleic Acids Res 2005, 33:el77.
17. Cieslak M, Szymanski J, Adamiak RW, Cierniewski CS: Structural rearrangements of the 10-23 DNAzyme to beta 3 integrin subunit mRNA induced by cations and their relations to the catalytic activity. J Biol Chem 2003, 278:47987-47996.
18. Clyde K, Kyle JL, Harris E: Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol 2006, 80:11418- 11431.
19. Cordel, H., Quatresous, I., Paquet, C, and Couturier, E. (2006). Imported cases of chikungunya in metropolitan France, April 2005 - February 2006. Euro Surveill 11, E060420 060423.
20. de Oliveira PC, Pavoni DP, Queiroz M H, de Borba L, Goldenberg S, dos Santos CN, Krieger MA: Dengue virus infections: comparison of methods for diagnosing the acute disease. J Clin Virol 2005, 32:272-
277.
21. de Silva C, Walter NG: Leakage and slow allostery limit performance of single drug- sensing aptazyme molecules based on the hammerhead ribozyme. RNA 2009, 15:76-84.
22. Effler PV, Pang L, Kitsutani P, Vorndam V, Nakata M, Ayers T, Elm J, Tom T, Reiter P, Rigau-Perez JG, et al: Dengue fever, Hawaii, 2001-2002. Emerg Infect Dis 2005, 11:742- 749.
23. Englebienne P: Use of colloidal gold surface plasmon resonance peak shift to infer affinity constants from the interactions between protein antigens and antibodies specific for single or multiple epitopes. Analyst 1998, 123:1599-1603.
24. Ferapontova EE, Gothelf KV: Effect of serum on an RNA aptamer-based electrochemical sensor for theophylline. Langmuir 2009, 25:4279-4283.
25. Figueiredo LT: Dengue in Brazil. Rev Soc Bras Med Trop 2012, 45:285.
26. Fronhoffs, S., Totzke, G., Stier, S., Wernert, N., Rothe, M., Bruning, T., Koch, B., Sachinidis, A., Vetter, H., and Ko, Y. (2002). A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Molecular and cellular probes 16, 99-110. 27. Geyer CR, Sen D: Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme. Chem Biol 1997, 4:579-593.
28. Geyer CR, Sen D: Lanthanide probes for a phosphodiester-cleaving, lead-dependent, DNAzyme. J Mol Biol 1998, 275:483-489.
29. Goho, A: Gold quantum dots. Science News September 11, 2004, 166(11): 174.
30. Gubler DJ : Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 1998, 11:480- 496. 31. Hall B, Hesselberth JR, Ellington AD: Computational selection of nucleic acid biosensors via a slip structure model. Biosens Bioelectron 2007, 22:1939-1947.
32. Higgs, S., and Ziegler, S.A. A nonhuman primate model of chikungunya disease. J Clin Invest (2010) 120, 657-660.
33. Jansen, C.C., Prow, N.A., Webb, C. E., Hall, R.A., Pyke, A.T., Harrower, B.J., Pritchard, I. L, Zborowski, P., Ritchie, S.A., Russell, R.C., et al. (2009). Arboviruses isolated from mosquitoes collected from urban and peri-urban areas of eastern Australia. J Am Mosq Control Assoc 25, 272-278.
34. Jeanmougin, F., Thompson, J.D., Gouy, M., Higgins, D.G., and Gibson, T.J. (1998). Multiple sequence alignment with Clustal X. Trends Biochem Sci 23, 403-405.
35. Jing L, Yi Lu: A Highly Sensitive and Selective Catalytic DNA Biosensor for Lead Ions J Am Chem Soc 2006, 122:10466-10467.
36. Kabra SK, Jain Y, Singhal T, Ratageri VH : Dengue hemorrhagic fever: clinical manifestations and management. Indian J Pediatr 1999, 66:93-101.
37. Knudsen SM, Lee J, Ellington AD, Savran CA: Ribozyme-mediated signal augmentation on a mass- sensitive biosensor. J Am Chem Soc 2006, 128: 15936-15937.
38. Kuwayama M, Ito M, Takao S, Shimazu Y, Fukuda S, Miyazaki K, Kurane I, Takasaki T: Japanese encephalitis virus in meningitis patients, Japan. Emerg Infect Dis 2005, 11:471- 473.
39. Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV: Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase- polymerase chain reaction. J Clin Microbiol 1992, 30:545-551.
40. Li D, Lott WB, Lowry K, Jones A, Thu H M, Aaskov J : Defective interfering viral particles in acute dengue infections. PLoS One 2011, 6:el9447.
41. Liu J, Lu Y: Preparation of aptamer-linked gold nanoparticle purple aggregates for colorimetric sensing of analytes. Nat Protoc 2006, 1:246-252.
42. Liu Y, Wu Z, Zhou G, He Z, Zhou X, Shen A, Hu J: Simple, rapid, homogeneous oligonucleotides colorimetric detection based on non-aggregated gold nanoparticles. Chem Commun (Camb) 2012, 48:3164-3166.
43. Macnamara FN : Zika virus: a report on three cases of human infection during an epidemic of jaundice in Nigeria. Trans R Soc Trop Med Hyg 1954, 48:139-145.
44. Marchette NJ, Garcia R, Rudnick A: Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia.
AmJTrop Med Hyg 1969, 18:411-415.
45. Marriott, A.C., and Dimmock, N.J. Defective interfering viruses and their potential as antiviral agents.
Rev Med Virol 20, 51-62.
46. Nawtaisong P, Keith J, Fraser T, Balaraman V, Kolokoltsov A, Davey RA, Higgs S, Mohammed A, Rongsriyam Y, Komalamisra N, Fraser MJ Jr: Effective suppression of dengue fever virus in mosquito cell cultures using retroviral transduction of hammerhead ribozymes targeting the viral genome. Virol J 2009, 6:73.
47. Nougairede, A., De Fabritus, L, Aubry, F., Gould, E.A., Holmes, E.C., and de Lamballerie, X. (2013).
Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells. PLoS Pathog 9, el003172.
48. Ogawa A, Maeda M : Easy design of logic gates based on aptazymes and noncrosslinking gold nanoparticle aggregation. Chem Commun (Camb) 2009, 21:4666- 4668.
49. Ogawa A, Maeda M : Simple and rapid colorimetric detection of cofactors of aptazymes using noncrosslinking gold nanoparticle aggregation. Bioorg Med Chem Lett 2008, 18:6517-6520.
50. Ogawa A: RNA aptazyme-tethered large gold nanoparticles for on-the-spot sensing of the aptazyme ligand. Bioorg Med Chem Lett 2011, 21:155-159.
51. Parida, M.M., Santhosh, S. R., Dash, P.K., Tripathi, N. K., Lakshmi, V., Mamidi, N., Shrivastva, A., Gupta,
N., Saxena, P., Babu, J. P., et al. (2007). Rapid and real-time detection of Chikungunya virus by reverse transcription loop-mediated isothermal amplification assay. J Clin Microbiol 45, 351-357.
52. Peeling RW, Artsob H, Pelegrino JL, Buchy P, Cardosa MJ, Devi S, Enria DA, Farrar J, Gubler DJ,
Guzman MG, et al : Evaluation of diagnostic tests: dengue. Nat Rev Microbiol 2010, 8:S30-S38.
53. Plante K, Wang E, Partidos CD, Weger J, Gorchakov R, Tsetsarkin K, Borland EM, Powers AM, Seymour
R, Stinchcomb DT, et al : Novel chikungunya vaccine candidate with an IRES-based attenuation and host range alteration mechanism. PLoS Pathog 2011, 7:el002142.
54. Qi RF, Zhang L, Chi CW: Biological characteristics of dengue virus and potential targets for drug design. Acta Biochim Biophys Sin (Shanghai) 2008, 40:91-101.
55. Rai MA: Epidemic: Control of dengue fever in Pakistan. Nature 2011, 479:41.
56. Ramos M M, Mohammed H, Zielinski-Gutierrez E, Hayden MH, Lopez JL, Fournier M, Trujillo AR, Burton R, Brunkard JM, Anaya-Lopez L, et al : Epidemic dengue and dengue hemorrhagic fever at the Texas-Mexico border: results of a household-based seroepidemiologic survey, December 2005.
AmJTrop Med Hyg 2008, 78:364-369.
57. Randolph SE, Rogers DJ: The arrival, establishment and spread of exotic diseases: patterns and predictions. Nat Rev Microbiol 2010, 8:361-371.
58. Reed W, Carroll J, Agramonte A, Lazear JW: The etiology of yellow fever-a preliminary note. Publ Health Pap Rep 1900, 26:37-53.
59. Reiskind, M. H., Westbrook, C.J., and Lounibos, L.P. Exposure to chikungunya virus and adult longevity in Aedes aegypti (L.) and Aedes albopictus (Skuse). (2010)J Vector Ecol 35, 61-68.
60. Rigau-Perez JG, Clark GG, Gubler DJ, Reiter P, Sanders EJ, Vorndam AV: Dengue and dengue haemorrhagic fever. Lancet 1998, 352:971-977.
61. Roberts L: Mosquitoes and disease. Science 2002, 298:82-83. 62. Rodenhuis-Zybert, I.A., van der Schaar, H. M., da Silva Voorham, J.M., van der Ende-Metselaar, H., Lei, H.Y., Wilschut, J., and Smit, J. M. Immature dengue virus: a veiled pathogen? PLoS Pathog 6, e 1000718.
63. Rueda D, Walter NG: Fluorescent energy transfer readout of an aptazyme-based biosensor. Meth Mol Biol 2006, 335:289-310.
64. Santoro SW, Joyce GF: A general purpose RNA-cleaving DNA enzyme. Proc Natl Acad Sci U S A 1997, 94:4262-4266.
65. Santoro SW, Joyce GF: Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry 1998, 37:13330-13342.
66. Sato K, Hosokawa K, Maeda M : Non-cross-linking gold nanoparticle aggregation as a detection method for single-base substitutions. Nucleic Acids Res 2005, 33:e4.
67. Shu PY, Huang JH : Current advances in dengue diagnosis. Clin Diagn Lab Immunol 2004, 11:642-650.
68. Song KM, Cho M, Jo H, Min K, Jeon SH, Kim T, Han MS, Ku JK, Ban C: Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer. Anal Biochem 2011, 415: 175-181.
69. Sun, LQ, Cairns, MJ, Gerlach, WL., Witherington, C, Wang, L, King, A: Suppression of smooth muscle cell proliferation by a c-myc RNA-cleaving deoxyribozyme. J Biol Chem 1999, 274:17236-17241. 70. Thiboutot, M.M., Kannan, S., Kawalekar, O. U., Shedlock, D.J., Khan, A.S., Sarangan, G., Srikanth, P., Weiner, D.B., and Muthumani, K. Chikungunya: a potentially emerging epidemic? PLoS Negl Trop Dis 4, e623.
71. Thompson KM, Syrett HA, Knudsen SM, Ellington AD: Group I aptazymes as genetic regulatory switches. BMC Biotechnol 2002, 2:21.
72. Tricou V, Vu HT, Quynh NV, Nguyen CV, Tran HT, Farrar J, Wills B, Simmons CP: Comparison of two dengue NS1 rapid tests for sensitivity, specificity and relationship to viraemia and antibody responses. BMC Infect Dis 2010, 10:142.
73. Tsetsarkin, K., Higgs, S., McGee, C.E., De Lamballerie, X., Charrel, R. N., and Vanlandingham, D. L.
(2006). Infectious clones of Chikungunya virus (La Reunion isolate) for vector competence studies.
Vector Borne Zoonotic Dis 6, 325-337.
74. Tsetsarkin, K.A., McGee, C.E., Volk, S.M., Vanlandingham, D.L., Weaver, S.C., and Higgs, S. (2009).
Epistatic roles of E2 glycoprotein mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti mosquitoes. PLoS One 4, e6835.
75. Van Bortel, W., Dorleans, F., Rosine, J., Blateau, A., Rousset, D., Matheus, S., Leparc-Goffart, I., Flusin, O., Prat, C, Cesaire, R., et al. (2014). Chikungunya outbreak in the Caribbean region, December 2013 to March 2014, and the significance for Europe. Euro Surveill 19.
76. van den Hurk, A.F., Hall-Mendelin, S., Pyke, A.T., Smith, G.A., and Mackenzie, J.S. Vector competence of Australian mosquitoes for chikungunya virus. Vector Borne Zoonotic Dis 10, 489-495. 77. van der Schaar, H.M., Rust, M.J., Chen, C, van der Ende-Metselaar, H., Wilschut, J., Zhuang, X., and Smit, J.M. (2008). Dissecting the cell entry pathway of dengue virus by single-particle tracking in living cells. PLoS Pathog 4, el000244.
78. van der Schaar, H.M., Rust, M.J., Waarts, B.L., van der Ende-Metselaar, H., Kuhn, R.J., Wilschut, J., Zhuang, X., and Smit, J. M. (2007). Characterization of the early events in dengue virus cell entry by biochemical assays and single-virus tracking. J Virol 81, 12019-12028.
79. Vaughn DW, Green S, Kalayanarooj S, Innis BL, Nimmannitya S, Suntayakorn S, Endy TP, Raengsakulrach B, Rothman AL, Ennis FA, Nisalak A: Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. J Infect Dis 2000, 181:2-9.
80. Wang, W.K., Lin, S. R., Lee, C M., King, C.C., and Chang, S.C. (2002). Dengue type 3 virus in plasma is a population of closely related genomes: quasispecies. J Virol 76, 4662-4665.
81. Weill L, Louis D, Sargueil B: Selection and evolution of NTP-specific aptamers. Nucleic Acids Res 2004, 32:5045-5058.
82. Westbrook, C.J., Reiskind, M. H., Pesko, K.N., Greene, K.E., and Lounibos, L. P. Larval environmental temperature and the susceptibility of Aedes albopictus Skuse (Diptera: Culicidae) to Chikungunya virus. Vector Borne Zoonotic Dis 10, 241-247.
83. WHO: Dengue and dengue haemorrhagic fever, Fact sheet N°117. Geneva, Switzerland: WHO:
Dengue and dengue haemorrhagic fever; 2012.
84. Wieland M, Berschneider B, Erlacher MD, Hartig JS: Aptazyme-mediated regulation of 16S ribosomal RNA. Chem Biol 2010, 17:236-242.
85. Williams DHaF I: Spectroscopic Methods in Organic Chemistry. 5th edition. Blacklick, Ohio, U.S. A:
McGraw-Hill; 1995.

Claims

CLAIMS What is claimed is:
1. A compound comprising a DNAzyme (DZ) conjugated to a nanoparticle (N P) by a linker (L), designated DZ-N P, wherein said DNAzyme comprises: a deoxyribonucleic acid (DNA) sequence comprising a 5' Binding Arm (5' BA), a Catalytic Core (CC), and a 3' Binding Arm (3' BA); wherein said 5' and 3' Binding Arms are complementary to two target sequences on a target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif.
2. The compound of claim 1, wherein said DNAzyme is an RNA-Cleaving DNAzyme selected from the group consisting of a 10-23 DNAzyme and a 8-17 DNAzyme.
3. The compound of claim 1, wherein said DNAzyme is selected from U02 2+-dependent and Mg2+- independent DNAzymes.
4. The compound of claim 1, wherein said nanoparticle is in a shape selected from a sphere, rod, a polygonal rod, rectangular block, cube, tetrapod, and pyramid.
5. The compound of claim 4, wherein said nanoparticle is in the shape of a sphere.
6. The compound of claim 1, wherein said nanoparticle comprises a quantum dot.
7. The compound of claim 1, wherein said nanoparticle comprises a non-metallic substance, designated a non-metallic nanoparticle (nmN P).
8. The compound of claim 1, wherein said nonmetallic nanoparticle is comprised of one or more
substances selected from the group consisting of carbon, dextrose, solid lipid nanoparticles, dextran, chitosan.
9. The compound of claim 1, wherein said nanoparticle comprises a composite material comprising a metallic and a non-metallic substance, designated a composite nanoparticle (cN P).
10. The compound of claim 1, wherein said nanoparticle comprises one or more substances selected from the group consisting of: gold, silver, iron, titanium, platinum, cerium, silicon, palladium, transition metals, and oxides thereof.
11. The compound of claim 1, wherein said nanoparticle comprises two or more metallic substances, or oxides thereof, designated multi-metallic nanoparticles (mmN P).
12. The compound of claim 1, wherein said nanoparticle comprises a metallic substance, designated a metallic nanoparticle (mN P).
13. The compound of claim 12, wherein said metallic nanoparticle is a gold nanoparticle (AuN P).
14. The compound of claim 13, wherein said gold nanoparticle is spherical.
15. The compound of claim 14, wherein said spherical gold nanoparticle has a size ranging from about 1 nm to about 400 nm in diameter.
16. The compound of claim 1, wherein the DDZ is linked to said nanoparticle by a linker through two or more covalent bonds, designated a covalent linker (cL).
17. The compound of claim 16, wherein said covalent linker comprises -SH-(CH2)6-.
18. The compound of claim 16, wherein said covalent linker comprises Streptavidin fluorescent
conjugates, acridine and Azobenzene fluorescent conjugates, Biotin, Biotin Diol Linker, Biotin TEG, Biotin BB, Desthiobiotin TEG, DOTA (l,4,7,10-Tetraazacyclododecane-l,4,7,10-tetraacetic acid), Dual Biotin, Photocleavable (PC) Biotin, Psoralen C2, Psoralen C6, Fluorescein, FITC, TRITC, fluorescent proteins (e.g. GFP, YFP, and RFP), 2' modified NTPs (e.g.2' fluoro dC (fC), 2' amino and 2' OMe analogs), polyethylene glycol (PEG) transport molecules, acetyl-PEG-amine, Carboxy-PEG-Amine.
19. The compound of claim 1, wherein the DZ is linked to said nanoparticle by a linker through one or more high-affinity noncovalent bonds, designated a high affinity noncovalent linker (hancL).
20. The compound of claim 19, wherein said high affinity noncovalent linker comprises biotin.
21. The compound of claim 1, wherein said target RNA is a viral RNA.
22. The compound of claim 21, wherein said viral RNA is a genomic viral RNA.
23. The compound of claim 21, wherein said viral RNA is a viral RNA transcript.
24. The compound of claim 21, wherein said viral RNA is a Flavivirus RNA.
25. The compound of claim 24, wherein said viral RNA is a Flavivirus selected from a group consisting of in a mammalian tick-borne flaviviruses, mosquito-borne viruses, and viruses with no known arthropod vectors.
26. The compound of claim 24, wherein said Flavivirus is a mosquito-borne virus selected from the group consisting of Avian tembusu-related virus, Calbertado virus, Chaoyang virus, Aroa virus, dengue virus,
Japanese encephalitis virus, Kokobera virus, Ntaya virus, Spondweni virus, Zika virus, and Yellow fever virus group.
27. The compound of claim 26, wherein said Flavivirus is a dengue virus.
28. The compound of claim 27, designated DDZ, wherein said dengue virus RNA is a dengue virus
genomic RNA.
29. The compound of claim 21, wherein said viral RNA is an Alphavirus RNA.
30. The compound of claim 29, wherein said Alphavirus is in a complex selected from the group
consisting of Barmah Forest virus, Eastern equine encephalitis, Middleburg virus, Ndumu virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis, Western equine encephalitis, unclassified Alphaviruses, and recombinant viruses within each complex.
31. The compound of claim 30, wherein said Alphavirus is in the Semliki Forest Virus complex.
32. The compound of claim 31, wherein said Alphavirus in the Semliki Forest Virus complex is
chikungunya virus.
33. The compound of claim 1, wherein said target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif is within a coding sequence which encodes a polypeptide.
34. The compound of claim 1, wherein said target region of a ribonucleic acid (target RNA) comprising at least one purine-pyrimidine dinucleotide motif is within a noncoding sequence.
35. The compound of claim 1, wherein said target region is a viral 5'-3' Cyclization Sequence (CS).
36. The compound of claim 1, wherein the target region of a Dengue-specific DNAzyme (DDZ) selected from the group consisting of DDZ-M and DDZin-M, is a viral 5'-3' Cyclization Sequence (CS).
37. The compound of claim 36, wherein said target region for DDZ-M is the dengue virus 5'-3' CS is UGCUGAAACGCGAGAGAAA (SEQ ID NO: 15) and the target region for DDZin-M is
UGCUGAAACGCGAGAGAAA (SEQ ID NO: 20) .
38. The compound of claim 1, wherein the target region of Dengue-specific DNAzymes selected from the group consisting of DDZ-1, DDZ-2, DDZ-3, and DDZ-4 is a conserved region, specific to each virus serotype.
39. The compound of claim 38, wherein said target region for DDZ-1, DDZ-2, DDZ-3, and DDZ-4 is selected from the group consisting of: DDZ-1 UCAAGAAGAAUGGAGCGAU (SEQ ID NO: 16);
DDZ-2 AGGCGAGAAAUACGCCUUU (SEQ ID NO: 17);
DDZ-3 ACAGCAGGAGUCUUGGCUA (SEQ ID NO: 18); and
DDZ-4 UCUGGAAAAAUGAACCAAC (SEQ ID NO: 19), respectively.
40. The compound of claim 1, wherein said catalytic core (CC) is GGCTAGCTACAACGA (SEQ ID NO: 13) .
41. The compound of claim 1, wherein said 5' Arm and said 3' Arm are a pair of sequences selected from the group consisting of:
TTTCTCTCG (SEQ ID NO: 1) and GTTTCAGCA (SEQ ID NO: 7) ;
ATCGCTCCA (SEQ ID NO: 2) and TCTTCTTGA (SEQ ID NO: 8) ; AAAGGCGTA (SEQ ID NO: 3) and TTCTCGCCT (SEQ ID NO: 9) ;
TAGCCAAGA (SEQ ID NO: 4) and TCCTGCTGT (SEQ ID NO: 10) ; and
GTTGGTTCA (SEQ ID NO: 5) and TTTTCCAGA (SEQ ID NO: 11) .
42. The compound of claim 1, wherein said linker and said DNAzyme designated DDZ-1, DDZ-2, DDZ-3, DDZ-4, DDZ-in-M, are selected from the group consisting of:
SUBSTITUTE SHEET (RULE 26) thiol-DDZ-l 5' -SH- (CH2) 6—d(ATCGCTCCAGGCTAGCTACAACGATCTTCTTGA) -3' (SH-DDZ-1) (SEQ ID NO: 22) ;
thiol-DDZ-2 5'—SH- (CH2) 6-d(AAAGGCGTAGGCTAGCTACAACGATTCTCGCCT) -3' (SH-DDZ-2) (SEQ ID NO: 23) ;
thiol-DDZ-3 5' -SH- (CH2) 6-d(TAGCCAAGAGGCTAGCTACAACGATCCTGCTGT) -3' (SH-DDZ-3) (SEQ ID NO: 24) ;
thiol DDZ-4 5'—SH- (CH2) s—d(GTTGGTTCAGGCTAGCTACAACGAGTTTCAGCA) -3' (SH-DDZ-4) (SEQ ID NO: 25) ; and thiol-DDZin-M 5' -SH- (CH2) 6-d (TTTCTCTCGAGCAACATCGATCGGGTTTCAGCA) -3' (SH-DDZin-M) (SEQ ID NO: 26), respectively.
43. The compound of claim 1, wherein said DNAzyme and linker are conjugated to a metallic
nanoparticle.
44. The compound of claim 1, wherein said DNAzyme and linker are conjugated to a metallic gold
nanoparticle (DNAzyme-AuN P).
45. A method of detecting a viral nucleic acid in a sample, comprising
(a) adding the DNAzyme-N P conjugate of claim 1 to a sample comprising nucleic acid in a form which can react with a complementary nucleic acid;
(b) heating said sample under conditions which permit the 5' and 3' Binding Arms to bind to the target region in said viral nucleic acid and said catalytic core to cleave at least one purine- pyrimidine dinucleotide motif in said target region; and
(c) measuring the increase in aggregation of said nanoparticle conjugates compared to a sample comprising unreacted DNAzyme-N P conjugates in a dispersed form.
46. The method of claim 45, wherein said NP is an AuN P.
47. The method of claim 45, wherein said aggregation is measured by absorbance or visual inspection of a color change.
48. The method of claim 45, wherein said reaction is carried out in a volume of less than 50 μΙ.
49. The method of claim 45, wherein said reaction is carried in the presence of sodium ion in an amount of about 0 to about 2 Moles/Liter.
SUBSTITUTE SHEET (RULE 26)
50. The method of claim 45, wherein said reaction is carried in the presence of magnesium ion in an amount of about 5 mM to about 20 mM.
51. The method of claim 45, wherein said reaction is carried in the presence of a chaotropic agent or a detergent.
52. The method of claim 51, wherein said chaotropic agent or detergent is selected from the group consisting of sodium dodecyl sulfate (SDS), guanidine isothiocyanate, guanidinium chloride, lithium perchlorate, lithium acetate, urea, thiourea, Triton X-100, Triton X-114, Tween 20, Tween 80, N P 40, Brij 35, Brij 80, Octyl glucoside, Octyl thioglucoside, and a zwitterionic detergent selected from CHAPS and CHAPSO.
53. The method of claim 51, wherein said detergent is SDS.
54. The method of claim 53, wherein said SDS is present in an amount of about 0% to about 1%
weight/volume.
55. The method of claim 1, wherein said reaction is carried out at a temperature from about 20°C to about 80°C.
56. A composition comprising the compound of claim 1, wherein said compound is stable at a
temperature from about 20°C to about 80°C.
57. A composition comprising the compound of claim 1, wherein said compound is stable for a period of at least one year.
58. A kit for detecting the presence, absence, or relative amount of a target nucleic acid in a sample comprising the compound of claim 1.
59. The kit of claim 58, wherein said sample is obtained from mammalian tissue, cells, or extracellular fluid.
60. The kit of claim 59, wherein said sample is obtained from blood.
61. The kit of claim 59, wherein said sample is obtained from a virus-infected cell.
62. The kit of claim 58, wherein said sample is obtained from insect tissue, cells, or extracellular fluid.
63. The kit of claim 62, wherein said sample is obtained from a virus-infected mosquito. The kit of claim 58, wherein said sample comprises nucleic acid from one or more viruses that are co- endemic with dengue virus.
The compound of claim 31, wherein the target region of a chikungunya-specific DNAzyme (CDZ) is a conserved region, specific to each virus serotype.
The compound of claim 65, wherein said target region for CDZ is
AAUGCUAGAGCGUUCUCGCAU SEQ ID NO (28) .
The compound of claim 65, wherein said catalytic core (CC) is
GGCTAGCTACAACGA (SEQ ID NO: 13) .
The compound of claim 65, wherein said 5' Arm and said 3' Arm are a pair of sequences selected from the group consisting of:
ATGCGAGAA (SEQ ID NO: 26); and GCTCTAGCA (SEQ ID NO: 27) .
The compound of claim 65, wherein said linker and said DNAzyme designated CDZ are selected from the group consisting of: thiol-CDZ (SH-CDZ)
5 ' -SH- (CH2 ) 6-d (TTTCTCTCGGGCTAGCTACAACGAGTTTCAGCA) -3 ' (SEQ ID NO: 28) .
PCT/US2014/042480 2013-06-14 2014-06-16 Dnazyme-nanoparticle conjugates and methods of use thereof Ceased WO2014201454A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/757,293 US10287578B2 (en) 2013-06-14 2014-06-16 DNAzyme-nanoparticle conjugates and methods of use thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201361835173P 2013-06-14 2013-06-14
US61/835,173 2013-06-14
US201361835758P 2013-06-17 2013-06-17
US61/835,758 2013-06-17

Publications (2)

Publication Number Publication Date
WO2014201454A2 true WO2014201454A2 (en) 2014-12-18
WO2014201454A3 WO2014201454A3 (en) 2015-03-12

Family

ID=52022959

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/042480 Ceased WO2014201454A2 (en) 2013-06-14 2014-06-16 Dnazyme-nanoparticle conjugates and methods of use thereof

Country Status (2)

Country Link
US (1) US10287578B2 (en)
WO (1) WO2014201454A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105203757A (en) * 2015-09-21 2015-12-30 山东农业大学 Colloidal gold test strip for fast diagnosing tembusu viruses
WO2017013468A1 (en) * 2015-07-20 2017-01-26 Universidade Federal De Minas Gerais - Ufmg Functionalised gold nanorods, use and kit for immunodiagnosis of dengue disease
CN107400735A (en) * 2016-05-19 2017-11-28 中国科学院上海巴斯德研究所 Detect the real-time fluorescent quantitative RT-PCR method of zika virus
WO2018068060A1 (en) * 2016-10-07 2018-04-12 Navidea Biopharmaceuticals, Inc. Compounds and methods for diagnosis and treatment of viral infections

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017205506A1 (en) * 2016-05-24 2017-11-30 Emory University Particles with rna cleaving nucleobase polymers and uses for managing inflammatory disorders
US10767069B2 (en) 2018-05-01 2020-09-08 Xerox Corporation Aqueous carbon nanoparticle ink composition for resistors
CN118957050A (en) * 2022-04-01 2024-11-15 海南医学院 Application of a naked eye detection platform for dengue virus NS1 gene fragment in the preparation of a kit for screening dengue virus infection
CN115452787B (en) * 2022-09-22 2025-01-17 山东理工大学 Construction of silver nanoclusters and gold palladium nanoparticles for fluorescence detection of streptomycin in milk

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2308514T3 (en) 2007-03-23 2013-11-29 To Bbb Holding B V Conjugates for targeted drug delivery across the blood-brain barrier
EP2496268A4 (en) * 2009-11-06 2013-06-19 Univ Chung Ang Ind GENE DELIVERY SYSTEMS BASED ON NANOPARTICLES
US8685649B2 (en) * 2010-06-10 2014-04-01 The United States Of America As Represented By The Secretary Of The Navy RT-LAMP assay for the detection of pan-serotype dengue virus

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017013468A1 (en) * 2015-07-20 2017-01-26 Universidade Federal De Minas Gerais - Ufmg Functionalised gold nanorods, use and kit for immunodiagnosis of dengue disease
CN105203757A (en) * 2015-09-21 2015-12-30 山东农业大学 Colloidal gold test strip for fast diagnosing tembusu viruses
CN107400735A (en) * 2016-05-19 2017-11-28 中国科学院上海巴斯德研究所 Detect the real-time fluorescent quantitative RT-PCR method of zika virus
WO2018068060A1 (en) * 2016-10-07 2018-04-12 Navidea Biopharmaceuticals, Inc. Compounds and methods for diagnosis and treatment of viral infections
CN110139655A (en) * 2016-10-07 2019-08-16 纳维迪亚生物制药有限公司 The Compounds and methods for of diagnosing and treating viral infection

Also Published As

Publication number Publication date
US10287578B2 (en) 2019-05-14
US20170166890A1 (en) 2017-06-15
WO2014201454A3 (en) 2015-03-12
US20170298346A9 (en) 2017-10-19

Similar Documents

Publication Publication Date Title
US10287578B2 (en) DNAzyme-nanoparticle conjugates and methods of use thereof
Carter et al. A novel dengue virus detection method that couples DNAzyme and gold nanoparticle approaches
Zheng et al. A toggle switch controls the low pH-triggered rearrangement and maturation of the dengue virus envelope proteins
Teles et al. Trends in dengue diagnosis
Nambala et al. Role of Zika virus prM protein in viral pathogenicity and use in vaccine development
KR20090087890A (en) Immunization Protocols for Four Dengue Serotypes
Yang et al. A cDNA clone-launched platform for high-yield production of inactivated Zika vaccine
Mantel et al. Standardized quantitative RT-PCR assays for quantitation of yellow fever and chimeric yellow fever–dengue vaccines
KR20090064593A (en) Immunization Methods for Four Dengue Serotypes
Cabrera-Romo et al. Experimental inoculation of Artibeus jamaicensis bats with dengue virus serotypes 1 or 4 showed no evidence of sustained replication
Silva et al. Viral load in COVID-19 patients: implications for prognosis and vaccine efficacy in the context of emerging SARS-CoV-2 variants
KR20090027759A (en) Methods of immunization against four serotypes of dengue fever
Yamanaka et al. Evaluation of single-round infectious, chimeric dengue type 1 virus as an antigen for dengue functional antibody assays
Li et al. A replication-defective Japanese encephalitis virus (JEV) vaccine candidate with NS1 deletion confers dual protection against JEV and West Nile virus in mice
Yang et al. Substantial attenuation of virulence of Tembusu virus strain PS is determined by an arginine at residue 304 of the envelope protein
Gyawali et al. Diagnosis of Dengue: Strengths and Limitations of Current Techniques and Prospects for Future
Devhare et al. Analysis of helicase domain mutations in the hepatitis E virus derived from patients with fulminant hepatic failure: effects on enzymatic activities and virus replication
Carossino et al. Evaluation of a field-deployable reverse transcription-insulated isothermal PCR for rapid and sensitive on-site detection of Zika virus
Tomar et al. Polymerase spiral reaction assay for rapid and real time detection of West Nile virus from clinical samples
Araf et al. Dengue outbreak is a global recurrent crisis: Review of the literature
ES2969020T3 (en) Compositions and procedures for the detection of Zika virus
Kim et al. Therapeutic application of RNA interference against foot-and-mouth disease virus in vitro and in vivo
Grinev et al. Genetic variability of West Nile virus in US blood donors, 2002–2005
CN101570797B (en) Fluorescent quantitative RT-PCR kit for detecting yellow fever virus, detection method and application thereof
WO2017192701A1 (en) Reverse genetics system of zika virus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14810923

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 14810923

Country of ref document: EP

Kind code of ref document: A2