WO2014200441A1 - Core-shell fluorescent upconversion nanoparticles for photoactivation of multiple biomolecules - Google Patents

Abstract

The invention provides, inter alia, upconversion nanoparticles (UCN) configured for near infrared (NIR) light excitation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission and compositions containing them. The invention also provides methods of making and using these UCNs, e.g., for delivery and photoactivation of target compounds, imaging biological tissues, and methods of treatment, e.g., of cancers, such as melanoma, by delivering chemotherapeutic agents, such as taxanes.

Description

CORE-SHELL FLUORESCENT UPCONVERSION NANOPARTICLES FOR PHOTO ACTIVATION OF MULTIPLE BIOMOLECULES

RELATED APPLICATION

[0001] This application claims priority under 35 U.S.C. § 119 or 365 to U.S.

Application No. 61/835,077, filed June 14, 2013. The entire teachings of the above application are incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] The past decade has seen an exponential growth in the field of gene therapy. Gene expression or silencing is now used routinely in various experimental settings, such as for gene mapping, developmental biology studies and recombinant DN A products for biotechnological applications as well as in a therapeutic setting to treat a variety of disorders. Despite early conceptual promise, gene and genetically mediated therapy have not truly entered medical practice, as various issues still prevent desired practical success. Though preferred due to their highly efficient transduction machinery, viral vectors convey immunogenicity and tumorigenicity. In that regard, non-viral vectors are safer but inefficient and yet unfit for clinical use. Various nanoparticles as engineered non-viral vectors have potential, but gene delivery via nanoparticles has two niggling issues: efficient delivery of genes and controlled expression. Therefore, a need exists for improved nanoparticles and methods of making and using them for, inter alia, gene therapy.

SUMMARY OF THE INVENTION

[0003] The present invention provides improved nanoparticles and methods of making and using them {e.g., for gene therapy) that overcome problems associated with existing viral and non- viral delivery systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0004] FIG. 1A shows fluorescence emission peaks for NIR to UV UCNs. FIG. IB is an MTS assay for the effect of varying concentrations of NIR to UV UCNs on cell viability of B16F0 cells. FIG. 1C shows the expression of STAT-3 in B16F0 cells after treatment with NIR-to-UV UCNs loaded with caged STAT-3 siRNA with (grey) and without (black) NIR irradiation.

[0005] FIG. 2A shows the fluorescence emission spectrum for NIR to Visible UCNs. FIG. 2B shows the effect of NIR to visible UCNs on the viability of B16F0 cells. FIG. 2C shows the effect of TPPS2a on the viability of B16F0 cells. FIG, 2D shows STAT3 knockdown with and without PCI.

[0006] FIG. 3A is a schematic showing the structure of core-shell UCNs and its various coatings. FIG. 3B is a transmission electron micrograph of NIR-to-UV core. FIG. 3C is a transmission electron micrograph of NIR-to-UV /Vis core-shell UCNs. FIG. 3D shows the fluorescence emission spectrum of NIR-to-UV UCN core. FIG. 3E shows the fluorescence emission spectrum of NIR-to-UV /Vis core-shell UCN. FIG. 3F shows the fluorescence emission spectrum of NIR-to-UV Vis Core-shell UCNs. FIG. 3 is substantially idential to FIG. 24.

[0007] FIG. 4A is a transmission electron micrograph of mesoporous silica coated NIR-to-UV Vis core shell UCNs. The inset shows a magnified image showing the mesopores. FIG. 4B shows the cumulative percentage release of siRNA (grey) and TPPS-2a (black) from UCNs over time. FIG. 4C shows the fluorescence stability of NIR-to-UV Vis core shell UCN exposed to different pH conditions. Black bars denote the UV emission peak at 350 nm and the grey bars denote the visible emission peak at 410 nm. FIGs. 4A, 4B, and 4C are substantially idential to FIGs. 24G, 26A, and 30, respectively.

[0008] FIG. 5 A shows the cytotoxicity of B 16FO cells exposed to different combinations of UCNs, TPPS-2a and NIR. FIG. 5B shows the phototoxicity of B16FO cells exposed to different durations of 980 nm NIR laser. FIG. 5C shows the toxicity of zebrafish embryos exposed to different concentrations of UCNs (heart rate @ 72 hpf). FIG. 5D shows the percentage hatching rate of zebrafish embryos. FIGs. 5E-5G are optical micrographs of embryos at 24 hours. FIGs. 5H-5J are optical micrographs of embryos at 72 hours. The embryos in FIGs. 5E and 5H were exposed to 0 ug/ml of UCNs. The embryos in FIGs. 5F and 51 were exposed to 50 ug/ml of UCNs. The embryos in FIGs. 5G and 5 J were exposed to 100 ug/ml of UCNs.

[0009] FIG. 6A shows ROS production by core-shell UCNs after irradiation with NIR and determined by APF. FIGs. 6B and 6C show fluorescence imaging of normal cells (FIG. 6B) and cells treated with UCNs+TPPS-2a with NIR irradiation (FIG. 6C) after incubation with Image-IT® LIVE Green Reactive Oxygen Species Detection reagent to detect the presence of singlet oxygen. Cells were counterstained with DAPI. Scale bar: 50 μπι. FIG. 6D shows photoactivation of caged siRNA by core-shell UCNs after NIR irradiation and determined by UV-Vis absorbance spectrophotometry. FIGs. 6E and 6F are a comparison of the photoactivation of TPPS-2a (FIG. 6E) and caged siRNA (FIG. 6F) by core-shell UCNs when the molecules loaded onto the UCNs are just incubated together. FIGs. 6G-6N show cellular distribution of UCNs (FIGs. 6G-6J) and their redistribution after 10 mins of NIR irradiation (FIGs. 6K-6N). Concanavalin was used to stain the cell membrane in FIGs. 6G and 6K, and DAPI was used to stain the nucleus in FIGs. 6H and 61. UCN fluorescence is shown in FIGs. 6J and 6M, and FIGs. 6J and 6N are the respective merged images. Scale bar: 50 μπι. FIGs. 6B and 6C are substantially identical to FIGs. 26D and 26E.

[0010] FIG. 7A is a schematic showing simultaneous activation of endosomal escape and uncaging of DNA siRNA by NIR-to-UV/Vis core-shell UCNs for enhanced and controlled gene expression/knockdown. FIG. 7B shows cellular uptake of UCNs into B16F0 cells with and without NIR irradiation (PO.05 when compared to control). FIG. 7C shows the percentage of STAT-3 expression in B16F0 cells exposed to different combinations of UCNs [U], siRNA [S], and TPPS-2a [T] (PO.05 for

U+S+T+N in comparison to U+S+N); N=NIR. [0011] FIGs. 8A-8I show GFP expression in H-226 without any transfection (FIGs. 8A-8C) or transfected with UCNs loaded with caged GFP (FIGs. 8D-8F) or UCNs co- loaded with TPPS-2a and caged GFP (FIGs. 8G-8I) and transplanted into adult zebrafish and irradiated using a NIR laser. FIGs. 8J-8L show in vivo imaging of zebrafish injected with TPPS-2a and caged GFP loaded UCNs and activated using a NIR laser for 8 mins. Scale bar: 2mm.

[0012] FIG. 9 shows the fluorescence emission spectrum of UCNs uptaken by embryos.

[0013] FIGs. 1 OA- 10C show the morphology of zebrafish at 24, 48 and 72 hpf. FIG. 1 OA shows the normal development of control zebrafish at 24, 48 and 72 hpf. FIG. 10B shows the normal development of zebrafish microinjected with UCNs loaded with morpholino and TPPS2a but not irradiated with NIR. FIG. IOC shows no tail morphology at 24, 48 and 72 hpf seen in zebrafish embryos microinjected with UCNs loaded with morpholino and irradiated with NIR (980 nm) for 8 mins at 5 hpf.

[0014] FIGs. 11 A-l 1C show the distribution of UCNs in zebrafish. FIG. 11 A shows the control embryo (no UCN). FIG. 1 IB shows the distribution of UCNs in a no tail embryo. These embryos were microinjected with UCNs co-loaded with no tail photomorpholino and TPPS2a and irradiated with NIR for 8 mins at 5 hpf. FIG. 11C shows the distribution of UCNs in a normal zebrafish. The specimen was microinjected with UCNs co-loaded with no tail photomorpholino and TPPS2a but was not irradiated, resulting in normal development.

[0015] FIG. 12 is a Z-stack image of zebrafish microinjected with UCNs.

[0016] FIG. 13 is a figure showing the percentage of no tail and normal

morphologies at 24 hpf of embryos in control and test.

[0017] FIG. 14 is a TPPS2a excitation curve with TPPS2a structure inset. FIG. 14 is substantially identical to FIG. 24F.

[0018] FIG. 15 shows the rise in temperature of water and DMEM with increasing durations of NIR exposure. [0019] FIG. 16 shows the zeta potential of mesoporous silica-coated core-shell NIR-to-UV/Vis UCNs.

[0020] FIG. 17 shows in vivo imaging of UCNs in adult zebrafish.

[0021] FIGs. 18A-18D show fluorescence microscopy of cancer cells injected with cancer cells transfected with UCNs. FIG. 18A shows control fish injected with non- transfected cancer cells. FIG. 18B shows fish injected with UCNs loaded with GFP plasmid and TPPS2a without NIR irradiation. FIG. 18C shows fish injected with UCNs loaded with GFP plasmid and irradiated with NIR. FIG. 18D shows fish injected with UCNs co-loaded with GFP plasmid and TPPS2a and irradiated with NIR Scale bar: 2 mm.

[0022] FIGs. 19A-C show characterization of UCNs. FIGs. 19A and 19 B are transmission electron micrographs of NIR-to-UV UCN core (FIG. 19A) and after coating with a layer of mesoporous silica (FIG. 19B). FIG. 19C shows the fluorescence emission spectrum of NIR-to-UV UCNs.

[0023] FIG. 20A provides FTIR spectra of NaYF4: Yb/Tm UCN core and UCN core coated with a layer of mesoporous silica. FIG. 20B is a bar graph showing

photostability of UCNs over time when irradiated continuously with a 980 nm NIR laser.

[0024] FIGs. 21 A-21H summarizes toxicity data. FIG. 21 A is a bar graph of cell ciability of ZFL cells exposed to different concentrations of UCNs. FIG. 21 B shows the percentage hatching rate of zebrafish embryos. FIGs. 21C-21E are optical micrographs of the embryos exposed to UCNs at 24 hrs (scale bar: 200 μηι). FIGs. 21F-21H are optical micrographs of the embryos exposed to UCNs at 48 hrs (scale bar: lmm). UCN concentration was 0 μg/ml for FIGs. 21 C and 2 IF, 50 μg/ml for FIGs. 21 D and 21 G and 100 μg/ml for FIGs. 21 E and 21 H.

[0025] FIGs. 22A-22N summarize photomorpholino studies. FIG. 22A is a bar graph showing percentage increase in absorbance due to photolysis of

photomorpholinos with increase in NIR irradiation. FIG. 22B is a bar graph of comparison of the percentage of no tail embryos across different samples (*P<0.05 between control and the sample exposed to UCNs and activated with NIR). FIGs. 22C- 22H show the morphology of zebrafish injected with UCNs loaded with morpholinos and irradiated with NIR (980 nm) for 8 mins. FIGs. 22C-22H show control embryos (FIGs. 22C and 22F), embryos microinjected with UCNs but without irradiation (FIGs. 22D and 22G) and embryos microinjected with UCNs and irradiated with NIR (FIGs. 22E and 22H) at 24 hpf (FIGs. 22C-22E) and 72 hpf (FIGs. 22F-22H). FIGs. 22I-22N show GFP expression in H-226 transfected with UCNs loaded with caged GFP and transplanted into adult zebrafish. FIGs. 22I-22K show control fish without NIR irradiation. FIGs. 22L-22N show test fish with NIR irradiation for 8 mins. Scale bar: 1 mm.

[0026] FIGs. 23A-23D are micrographs of in vivo imaging of zebrafish embryos using UCNs. FIG. 23 A shows the control embryo without UCN injection. FIG. 23 B shows a no tail embryo with injected UCNs. FIG. 23 C shows three-dimensional Z- stack images of an embryo microinjected with UCNs. Scale bar: 200 μπι. FIG. 23D shows in vivo imaging of UCNs in adult zebrafish. 20μ1 of UCNs (1 mg/mL) was injected intra-peritoneally and imaged using an animal imaging system equipped with a 980 nm NIR laser.

[0027] FIGs. 24A-24G provide an overview of UCNs. FIG. 24 A is a schematic showing the structure of core-shell UCNs and its various coatings. FIGs. 24B and 24C are transmission electron micrographs (TEM) of NIR-to-UV core (FIG. 24B) and NIR- to-UV/Vis core-shell UCNs (FIG. 24C). FIG. 24D shows the fluorescence emission spectrum of NIR-to-UV UCN core (inset shows the total fluorescence of the

nanoparticles in a cuvette) when irradiated with NIR at 980 nm. FIG. 24E shows the fluorescence emission spectrum of NIR-to-UV /Vis core-shell UCNs (inset shows the total fluorescence of the nanoparticles in a cuvette) when irradiated with NIR at 980 nm. FIG. 24F shows the absorbance spectrum of TPPS2a with its structure inset. FIG. 24G shows mesoporous silica coated NIR-to-UV/Vis core shell UCNs.

[0028] FIGs. 25A-25C provide bar graphs showing the effect of varying

concentrations of TPPS2a on the viability of B16F0 cells (FIG. 25 A), phototoxicity of B 16FO cells exposed to different durations of 980 nm NIR laser (FIG. 25B), and cytotoxicity of B16F0 cells exposed to different combinations of UCNs, TPPS2a and NIR (UCNs alone, TPPS2a alone, UCN+TPPS2a, UCN+NIR, TPPS2a+NIR and UCN+TPPS2a+NIR).

[0029] FIGs. 26A-G provide line graphs, bar graphs and micrographs on studies with morpholinos. FIG. 26A shows the cumulative percentage release of

photomorpholino (red) and TPPS2a (black) from core-shell UCNs over time. FIG. 26B shows absorbance readings at 260 nm of photomorpholinos incubated with and without UCNs post NIR irradiation. Increase in absorbance indicates the increase in

morpholino fragments due to (UCN-emitted) UV photolysis. FIG. 26C shows ROS production by UCNs (TPPS2a loaded) after irradiation with NIR and determined by APF. FIG. 26D shows fluorescence images after incubation with Image-IT® LIVE Green Reactive Oxygen Species detection reagent of untreated cells. FIG. 26E shows cells treated with UCNs+TPPS2a post NIR irradiation of 8 mins at a power density of 2.8 W/crn" Cells were counterstained with DAPI (scale bar: 50 μηι). Green

fluorescence indicates the production of ROS. FIGs. 26F and 26G show distribution of UCNs before (FIG. 26F) and after (FIG. 26G) NIR irradiation (scale bar: 5 μπι; UCNs: red (periphery in F, G); DAPI: blue (circular or oval staining). More diffuse pattern shows cytosolic release after endosomal escape.

[0030] FIGs. 27A-C provide bar graphs of fluorescence intensity of UCNs in B16F0 cell suspension with and without TPPS2a at normal temperature and 4°C 24 hours after irradiation with NIR at 980 nm (FIG. 27A), and percentage STAT-3 expression (FIG. 27B) and cell viability (FIG. 27C) of B16F0 cells exposed to different combinations of UCNs, TPPS2a, morpholinos and NIR. *P<0.05 between control and test groups. #P<0.05 between UCN+Morpholino and UCN+Morpholino+TPPS2a.

[0031] FIGs. 28A-28E show the effect of STAT-3 knockdown in a murine model of melanoma. FIGs. 28A and 28B show the change in tumor volume (FIG. 28A) and body weight (FIG. 28B) as a function of time to assess the effectiveness of treatment. Values are means ± s.e.m. (n = 6 mice per group); Group 1 : saline control; Group 2: UCNs loaded with photomorpholinos and irradiated with NIR laser; Group 3 : UCNs co-loaded with photomorpholinos and TPPS2a and irradiated with NIR laser. FlGs. 28C-28E are representative gross photos of a mouse from Groups 1-3, respectively. Scale bar: 1 cm; * p<0.05 between Group 1 and Groups 2 and 3; # p<0.05 between Group 2 and Group 3-

[0032] FIGs. 29A-29E provide bar graphs and micrographs of expression of STAT- 3 in tumor tissues from Groups 1-3 analyzed by ELISA after harvesting (FIG. 29A), hemolytic activity of different concentrations of UCNs in mice blood (FIG. 29B), and imaging of UCNs in tumor tissue sections with DAPI (FIG. 29C) and UCN

fluorescence (FIG. 29D). FIG. 29E is a merged image of FIGs. 29C and 29D. Scale bar: 50 μπι; * p<0.05 between Group 1 and Groups 2 and 3; # p<0.05 between Group 2 and Group 3.

[0033] FIG. 30 is a bar graph of UV (black) and visible (grey) fluorescence of core shell UCNs with varying pH.

[0034] FIG. 31 is a bar graph of siRNA and TPPS2a co-stability. To determine whether co-loading of siRNA and TPPS2a would affect the stability of siRNA, siRNA and TPPS2a were incubated together for 24 hours and the absorbance of siRNA was measured at time points of 0, 2, 4, 6, and 24 hours. The absorbance value was almost stable, indicating that the co-loading with TPPS2a does not affect its stability.

[0035] FIG. 32 is a bar graph illustrating functional integrity of morpholinos post ROS exposure. To study the effect of ROS on the functional integrity of morpholinos, morpholinos were subjected to ROS produced by TPPS-2a. This was done in two ways: the TPPS-2a was excited by a visible laser to produce ROS or the TPPS-2a was excited through UCNs by a NIR laser. In both cases, it was observed that there was no change in the efficiency of morpholinos in knocking down STAT-3, as shown in FIG. 32. FIGs. 27b and 32 are substantially identical. In FIG. 27b, the graph represents %age expression, while in FIG. 32, the graph represents %age knockdown (100 - %age expression). [0036] FIG. 33 is a bar graph of UCN fluorescence in cells after overnight incubation of UCNs with cells and before NIR irradiation.

[0037] FIG. 34 is a bar graph of UCN fluorescence in the supernatant measured 24 hours post irradiation. From FIG. 34, it can be seen that the UCN fluorescence is lower (lesser UCN concentration of UCNs) in the supernatant in wells incubated with TPPS2a loaded UCNs as compared to wells incubated with UCNs alone. This indicates that cells in the former case expel lesser UCNs, possibly because of better endosomal escape (through PCI) and thus higher concentration of UCNs in the cytoplasm, as opposed to greater concentration of UCNs in the endocytic vesicles in the latter.

[0038] FIGs. 35A-35C provide micrographs of brightfield images of B16F0 cells. FIG. 35A shows the control. FIG. 35B shows cells transfected with UCN+Morpholinos and activated with NIR. FIG. 35C shows cells transfected with

UCN+Morpholinos+TPPS-2a and activated with NIR. Scale bar: 10 μιη.

[0039] FIGs. 36A-36D provide micrographs and line graphs of tumors at day 12 in mice treated with Morpholino loaded UCNs (without NIR) (FIG. 36A), NIR alone (FIG. 36B), UCNs loaded with Morpholino and TPPS2a but without NIR irradation (FIG. 36C) and NIR irradiation alone (FIG. 36D). FIGs. 36E and 36F show the tumor volumes from FIGs. 36A-36D (FIG. 36E) and bodyweight across 12 days (FIG. 36F). Scale bar: 1cm. From FIGs. 36A-36F, it can be seen that the progression in tumor volume was similar for all control groups across the duration of the study. This highlights the specific nature of this therapy, since the different components of the therapy do not individually result in a therapeutic effect. A combination of the above results in a marked decrease in tumor progression (shown in FIGs. 27A-27C).

[0040] FIGs. 37A-37B provide transmission electron micrographs of NIR-to-Vis UCN core (FIG. 37A) and after mesoporous silica coating (FIG. 37B).

[0041] FIG. 38 is a graph of the fluorescence emission spectrum of NIR-to-Vis UCNs. FIG. 28 is substantially identical to FIG. 2A. [0042] FIG. 39 is a schematic showing the comparison between natural nanoparticle delivery process and enhanced nanoparticle delivery through photochemical internalization.

[0043] FIGs. 40A-40D illustrate the drop in ABDA fluorescence intensity showing the production of singlet oxygen with increase in dose of NIR irradiation (FIG. 40 A), and fluorescence imaging of normal cells (FIG. 40B) and cells treated with

UCNs+TPPS2a without NIR irradiation (FIG. 40C) and with NIR irradiation (FIG. 40D) after incubation with Image- IT® LIVE Green Reactive Oxygen Species

Detection reagent to detect the presence of singlet oxygen. Cells were counterstained with DAPI. FIG. 40 is substantially identical to FIGs. 6B, 6C, 26D and 26E.

[0044] FIG. 41 is a bar graph comparison of the cell viability of cells loaded with Paclitaxel loaded UCNs. with and without photochemical internalization.

DETAILED DESCRIPTION OF THE INVENTION

[0045] A description of example embodiments of the invention follows.

[0046] In one aspect, the invention provides a composition comprising an upconversion nanoparticle (UCN) configured for near infrared (NIR) light excitation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission.

[0047] An "upconversion nanoparticle" (UCN) is nanometer-sized particle adapted for anti-Stokes emission of light. In certain embodiments, a UCN has a host lattice of ceramics (such as LaF₃, YF₃, Y₂0₃, LaP0₄, NaYF₄, Y₂0₂S, Gd₂0₂S, La₂0₂S, YOF, Y₃OCl₇, YF₃, GdF₃, BaYF₅, BaY₂F₈, YSi₂0₅, YGa0₃, and NaGdF₄) doped with one or more trivalent lanthanides (such as Yb³⁺, Er³⁺, Tm³⁺, Tb ⁺, Eu³⁺, Sm³⁺, Ho³⁺, and Dy³⁺). UCNs can be substantially solid or porous and may be substantially spherical or have other shapes, such as oblong spheroid, rectangular, rod, hexagonal, et cetera. In more particular embodiments, the UCNs are substantially spherical. In particular

embodiments, the host lattice is NaYF₄, such as β- NaYF₄. In certain embodiments, the host lattice is doped with Yb³⁺, Er³⁺, Tm³⁺, or a combination thereof, such as Yb³⁺ and Er³⁺ or Yb³⁺ and Tm³⁺. [0048] UCNs, in some embodiments, have a "core-shell" structure, where the core and shell of the UCN are ceramics doped with one or more lanthanides. In different embodiments, the core and the shell of the UCN may have the same lanthanides or different lanthanides. In some embodiments, the core and shell of the UCN are ceramics doped with two or more different lanthanides to produce different emission peaks (e.g., UV or visible). In some embodiments, the core is doped with Yb³⁺ and Er³⁺ or Yb³⁺ and Tm³⁺. In certain embodiments, the shell is doped with Yb³⁺ and Er³⁺. In more particular embodiments, the core is doped with Yb³⁺ and Tm³⁺and the shell is doped with Yb and Er . Numerous shells can be used, and core-shell UCNs need not be limited to a single shell on the core, as UCNs with multiple shells, to emit multiple wavelengths, are encompassed by the present invention. In certain embodiments, the UCN has 1, 2, 3, 4, or more shells. Individual shells can contain more than one doping— with the same or a different lanthanide(s)— to enhance the fluorescence intensity and quantum yield. In certain embodiments, multiple shells have the same doping, e.g., shells 1 and 3 or 2 and 3 in a UCN with 3 or more shells. In some embodiments, the UCN has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, or more emission peaks.

[0049] Typically, the core of the UCNs provided by the invention have an average diameter of less than about 30 nm, e.g., about 17, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 nm. UCNs comprising a shell and functionalizeable outer layer can have an average size, for example, of about 50 nm to about 180 nm (e.g., about 40 nm to about 200 nm). In some embodiments, the average size of the UCN is about: 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nm. In more particular embodiments, the average size of the UCN is less than about 100 nm, e.g., about 60 nm to about 100 nm. UCNs consonant with the present invention can be substantially uniform in size (monodipserse) or non-uniform in size (polydisperse)— e.g. about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95% polydispersity (100 x polydispersity index). In certain embodiments, the UCNs are substantially monodisperse, e.g. , with less than about: 40, 35, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 10, 5, 1% polydispersity. [0050] UCNs provided by the invention have, in certain embodiments, a primary excitation wavelength of about 980 nm +/- about 80 nm; e.g., an excitation peak of about 890, 900, 920, 940, 960, 980, 1000, 1020, 1040, 1060, or 1080 nm. In certain embodiments, an excitation wavelength of about 915nm can be used, e.g., to lower any heating effect on cells or tissues. As shown herein, emission spectra for UCNs can be tuned throughout the UV and visible spectrum for particular applications, e.g., from about 300 nm to about 700 nm, such as about 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, or 700 nm. In certain particular embodiments, emission peaks include peaks at 350nm, 410nm, e.g., both 350 and 410 nm.

[0051] In some embodiments, the UCN can have multiple emission peaks, e.g. , in the UV and/or visible spectra. In certain embodiments, the core and shell have different emission spectra, while in other embodiments, they may have the same emission spectra. In certain particular embodiments, the core has one or more UV emission peaks and the shell has one or more visible light emission peaks. In other particular embodiments, the shell has one or more UV emission peaks and the core has one or more visible light emission peaks.

[0052] UCNs according to the invention, in some embodiments, include a

"functionalizeable outer layer", which improve stability of UCNs in physiological solutions, and also allow for surface functionalization, e.g., association, such as adsorption or conjugation (covalent (e.g. , N-Hydroxysuccinimide (NHS) and ethyl(dimethylaminopropyl) carbodiimide (EDC) or dicyclohexylcarbodiimide (DCC) chemistry), ionic, et cetera), of a payload, such as a bioactive molecule or amphiphilic photosensitizer. In certain embodiments, the functionalizable outer layer is an amorphous layer, such as an amorphous silica coating. In some particular

embodiments, the functionalized outer layer is a "mesoporous outer layer." In particular embodiments, the mesoporous outer layer increases the solubility of UCNs in an aqueous solution, as well as optionally provides a substrate for attachment of a payload, such as a photosensitizer and/or a bioactive molecule, such as a caged bioactive molecule. In some embodiments, the mesoporous outer layer is a silica. UCNs comprising, e.g., contained within, functionalized outer layers are encompassed by the invention. Exemplary functionalizable outer layers for use in the invention include amorphous silica coating, silane-PEG coating, polymer coating, dendrimer coating, citric acid ligand exchange, et cetera. UCNs can include additional outer layers, such as titanium oxide {e.g., for use in radiotherapy), but typically the outermost layer is a functionalizable outer layer, such as a mesoporous outer layer. So, for example, where a UCN includes a titanium oxide layer, such as the next to most outer layer, the UCN still includes a functionalizable outer layer, such as silica. In some embodiments, UCNs provided by the invention can include multiple outer layers, such as an amorphous outer layer and an outermost mesoporous outer layer— e.g., an amorphous silica coating and an outermost mesoporous silica coating.

[0053] Functionalizable outer layers, such as a mesoporous outer layer, are about 4 nm in thickness; e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10 nm in thickness, or more. Pore sizes can be varied by modifying the coating procedure. In certain embodiments, the average pore size for the mesoporous outer layer is about: 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, or 8.0 nm. in more particular embodiments the average pore size for the mesoporous outer layer is about 1.5nm to about 2.5nm, e.g., about 2.0 nm.

[0054] The UCNs provided by the invention can further comprise one or more compounds associated with {e.g. adsorbed or bound (covalently or non-covalently)) the functional izeable outer layer. One or more of a variety of molecules can be associated with the functionalizeable outer layer for, e.g. delivery to a cell or tissue, and/or to facilitate uptake or delivery of the UCN and any associated compounds.

[0055] In some embodiments, a molecule in a composition with a UCN, e.g. , a molecule associated with a UCN, is an amphiphilic photosensitizer. "Amphiphilic photosensitizers" for use in the present invention are capable of light-induced release of reactive oxygen species (ROS), such as singlet oxygen, and include meso- tetraphenylporphine with two sulfonate groups on adjacent phenyl rings (TPPS2a) or Al(III) phthalocyanine disulfonate chloride (adjacent isomer) (AlPcS₂a)- In some embodiments, the amphiphilic photosensitizer is adsorbed to a mesoporous outer layer of the UCN. Amphiphilic photosensitizers can be used in the methods provided by the invention to facilitate release of UCNs from intracellular compartments, such as endosomes, e.g., when UCNs are contacted with cells for uptake by an endosomal pathway (e.g. , clatharin-mediated endocytosis, caveolae, macropinocytosis,

phagocytosis, et cetera). The working range of such photosensitisers is about 0.1 to 1 μg/ml. The release rate of TPPS2a from the UCNs is about 50-70% over 72 hours, which makes the effective concentration of exposure about 0.8-1.2 μg/mg. The concentration of UCNs usually used is about 500 μg/ml (e.g., about 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 μ^πιΐ), thus, the effective concentration of TPPS2a to which cells are exposed is about 0.4-0.6 μg/ml. Any suitable delivery mechanism for UCNs is encompassed by the invention, including gene guns, tissue-site administration (such as injection), as well as administration of moieties comprising the UCNs, such as cells (e.g., stem cells, fibroblasts, and combinations thereof) containing UCNs (by any means), e.g. , administering UCN-containing cells to a tissue.

[0056] In another embodiment, the compound associated with a UCN is a bioactive molecule. A "bioactive molecule" in this invention includes molecules that elicit a biological effect, and includes nucleic acids, plasmids (including expression plasmids), morpholinos or siRNAs for knocking down gene expression, proteins (e.g., growth factors or other signaling proteins, hormones, as well as immunoglobulins and immunoglobulin-like molecules), peptides, amino acids, neurotransmitters, non-peptide hormones, coenzymes, vitamins, as well as small molecule drugs (e.g., organic or inorganic), and combinations of any of the foregoing. Exemplary small molecule drugs include, for example, chemotherapeutic agents, including anti-neoplastics, such as diterpenes, which include taxanes, such as paclitaxel (ChemID CID 36314) and docetaxel (Chem ID CID 148124), as well as their various salts, esters, or derivatives (such as conjugates). [0057] Other chemotherapeutic agents for use consonant with the invention include alkylating agents, such as, nitrogen mustards (e.g. mechlorethamine, cyclophosphamide, melphalan, chlorambucil, ifosfamide and busulfan, and their salts, esters, and

derivatives), nitrosoureas (e.g N-Nitroso-N-methylurea (MNU), carmustine (BCNU), lomustine (CCNU) and semustine (MeCCNU), fotemustine and streptozotocin, and their salts, esters, and derivatives), tetrazines (e.g dacarbazine, mitozolomide and temozolomide, and their salts, esters, and derivatives), aziridines (e.g. thiotepa, mytomycin and diaziquone (AZQ), and their salts, esters, and derivatives), cisplatins and derivatives (e.g., cisplatin, carboplatin and oxaliplatin, and their salts, esters, and derivatives), and non-classical alkylating agents (e.g. procarbazine and

hexamethylmelamine, and their salts, esters, and derivatives); anti-metabolites

(including anti-folates such as methotrexate and pemetrexed, and their salts, esters, and derivatives; fluoropyrimidines such as fluorouracil and capecitabine and their salts, esters, and derivatives; deoxynucleoside analogues such as cytarabine, gemcitabine, decitabine, Vidaza, fiudarabine, nelarabine, cladribine, clofarabine and pentostatin and their salts, esters, and derivatives; thiopurines such as thioguanine and mercaptopurine and their salts, esters, and derivatives); anti-microtubule agents (including vinca alkaloids (such as vincristine, vinblastine, vinorelbine, vindesine, and vinflunine and their salts, esters, and derivatives) and taxanes, as described above); topoisomerase inhibitors (such as irinotecan, topotecan, etoposide, doxorubicin, mitoxantrone, teniposide, novobiocin, merbarone, and aclarubicin, and their salts, esters, and derivatives); and cytotoxic antibiotics (e.g., actinomycin, bleomycin, plicamycin, mitomycin, doxorubicin, daunorubicin, epirubicin and idarubicin, pirarubicin, aclarubicin, and mitoxantrone, and their salts, esters, and derivatives).

[0058] In certain embodiments, the bioactive molecule is a caged bioactive molecule. A "caged" bioactive molecule is an inactive form of the bioactive molecule where the bioactive molecule is attached or linked to a caging group, e.g. a photolabile caging group that is subject to photoactivation— i.e., the caging group is photolabile. Exemplary caging molecules include l-(4,5-dimethoxy-2-nitrophenyl) diazoethane, NPE [ ³-(l-(2-Nitrophenyl)Ethyl) Ester, Disodium Salt)], CNB [a-Carboxy-2- Nitrobenzyl Ester], ATFB, [SE (4-azido-2,3,5,6-tetrafluorobenzoic acid, succinimidyl ester)], CMNB [(5-Carboxymethoxy-2-Nitrobenzyl) Ether, Dipotassium Salt], DMNB [4,5-Dimethoxy-2-Nitrobenzyl ester], et cetera. For additional description of methods of caging molecules and means of delivering them to cells, see Humphrey et al., 2007 (//cshprotocols.cshlp.org/content/2007/l/pdb.prot4659.abstract) and Matsuzaki et al., Nat. Chem Bio. 6:255-57 (2010).

[0059] As will be appreciated by the skilled artisan, the UCNs and UCN-containing compositions provided by the invention can be used in a variety of methods that make up additional aspects provided by the invention. In one aspect, the invention provides methods of visualizing a biological tissue. The methods entail contacting the tissue with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission, exposing the tissue to NIR light; and detecting UV light, visible light, or UV and visible light emitted from the UCN. In some embodiments, the visualizing of the tissue is non-destructive.

[0060] In another aspect, the invention provides methods of photochemical internalization of a UCN. These methods include the steps of contacting a cell with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission, wherein the UCN has a mesoporous outer layer with an adsorbed amphiphilic photosensitizer and exposing the cell to NIR light to release the UCN to the cytosol of the cell. In certain embodiments, the photochemical internalization is non-destructive to the cell. In some embodiments, the cell comprises a photosensitive ion channel and in more particular embodiments, the photosensitive ion channel is Channelrhodopsin. In still more particular embodiments, the photosensitive ion channel is stimulateable by light with the wavelength of an emission peak of the UCN. [0061] In some embodiments, the methods further include detecting UV light, visible light, or UV and visible light emitted from the UCN.

[0062] In certain embodiments, the UCN comprises a caged bioactive molecule adsorbed to the mesoporous outer layer of the UCN.

[0063] In another aspect, the invention provides methods of delivering a target compound to a cell. The methods include the steps of contacting the cell with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission, where the UCN has a mesoporous outer layer with an adsorbed target compound (optionally, in some embodiments, further including an adsorbed

amphiphilic photosensitizer) and exposing the tissue to NIR light to release the UCN to the cytosol of the cell. In some embodiments, the target compound is a bioactive molecule (such as a chemotherapeutic agent).

[0064] In more particular embodiments, the bioactive molecule is a caged bioactive molecule, e.g., releasable by light with the wavelength of an emission peak of the UCN. In certain particular embodiments, the caged biomolecule is released substantially simultaneously with the activation of the amphipillic photosensitizer.

[0065] In other aspects, the invention provides methods of modulating (e.g.

enhancing or inhibiting— either partially or completely) nucleic acid (DNA, RNA, mRNA, gene, siRNA, or morpholino) expression and/or activity in a cell. These methods include the steps of exposing a cell contacted with an upconversion

nanoparticle (UCN) configured for near infrared (NIR) light excitation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission and further comprising a functionalizeable outer layer with an associated bioactive molecule to NIR light to release the bioactive molecule to the cytosol of the cell, where the bioactive molecule modulates nucleic acid expression and/or activity, e.g. by binding or association with a target nucleic acid. In related aspects, the invention also provides methods of modulating protein expression and/or activity in a cell, where the bioactive molecule modulates protein expression and/or activity, e.g. by binding or association with a target protein. In certain embodiments, the cell is an isolated cell. In more particular embodiments, the isolated cell is administered to a tissue. In more particular embodiments, the tissue is in a multicellular organism. In still more particular embodiments, the multicellular organism is a chordate, such as a zebrafish, or a vertebrate, such as a mammal, such as a human.

[0066] In yet another aspect, the invention provides methods of treating cancer or reducing tumor volume in a subject in need thereof. These methods entail

administering a therapeutically effective amount of a UCN-containing composition provided by the invention to the subject, wherein the UCN is loaded with a

chemotherapeutic agent (as described above), e.g., on a functionalized outer layer, such as a mesoporous outer layer). The UCN-containing composition can be administered systemically (e.g., intravenously) or at the site of a tumor and, optionally, the method can entail the uncaging of a caged chemotherapeutic agent and/or photochemical internalization (e.g., with enhanced endosomal release) of the chemotherapeutic agent as described herein. In particular embodiments, the chemotherapeutic agent is a taxane, such as paclitaxel. In certain embodiments, the cancer is a solid tumor, in other embodiments, the caner is a hematological cancer. In particular embodiments, the cancer is melanoma. A "subject" is a mammal, including primates (e.g., humans or monkeys), cows, sheep, goats, horses, dogs, cats, rabbits, guinea pigs, rats, mice or other bovine, ovine, equine, canine, feline, rodent or murine species. Examples of suitable subjects include, but are not limited to, human patients (e.g., a human with, suspected of having, a cancer). The subject can be at any stage of development, including prenatal, perinatal, infant, toddler, child, young adult, adult, middle-aged, or geriatric. EXEMPLIFICATION

Example 1

[0067] There have been a variety of light-based technologies which have been developed for a variety of biological applications like light-controlled gene expression, light-activated endosomal escape, light-controlled drug delivery and light-controlled ion channels. Even though these techniques are very efficient and help solve a variety of issues, they have a major drawback which confines them to research use and prevents them from being used in a clinical/commercial level. The drawback of these technologies is the requirement of a UV/Visible light source for activation. However, both UV and Visible light have very poor tissue penetration capabilities and UV light is highly toxic and mutagenic. This prevents the use of these techniques in animal models. Here, we solve the current problems of light-based therapies by developing a fluorescent nanoparticle system known as upconversion nanoparticles (UCNs). The UCNs are excited by near-infrared (NIR) radiation at 980 nm and emit in the UV/visible ranges. The nanoparticles are synthesized in a core-shell format making them have multiple emission peaks in the UV and Visible range. Thus, it can be used as a remote nano-transducer for simultaneously activating multiple light-sensitive molecules simultaneously. UCNs are excited by NIR light which has excellent tissue penetration properties since the absorption of NIR by the tissue components is very minimal. Since it has excellent penetration, UCNs can be activated in deep tissues for photoactivation of different molecules. Also NIR light is very safe for use when compared to UV light. The UCNs show excellent photostability, chemical stability and thermal stability. The synthesized core-shell UCNs were used for simultaneous activation of endosomal escape and gene expression/knockdown by using deep penetrating NIR irradiation. Endosomal escape was achieved by photochemical internalization (PCI) by using the visible emission of UCNs for activating a photosensitiser TPPS-2a that can disrupt the endosomal membrane and deliver the nanoparticles to the cytosol, thereby enhancing the intracellular uptake of UCNs. Control of gene expression was achieved by using the UV emission of UCNs to activate photocaged nucleic acids to make them functional only at the intended site. This technique has been demonstrated to be successful in vitro as well as in vivo in a zebrafish model. Believed to be the first demonstration of remote controlled photoactivation of endosomal escape and gene expression/knockdown in vitro and in vivo, this may serve as a platform for a wide range of applications.

[0068] Gene expression can be photo-controlled by caging transcriptional activators/plasmid for gene expression or short interfering RNAs (siR As) for RNA interference (RNAi) with a light sensitive molecule— dubbed "photocaging"— that renders the nucleic acid (NA) non-functional. Photocaging is commonly done by modifying certain base pairs or chemical bonds. Interestingly, upon irradiation with UV light (λ ~ 350 nm), the photocaging modification is destroyed-termed "uncaging"— rendering the NA functional. DMNPE (l-(4,5-Dimethoxy-2-nitrophenyl) diazoethane) has been used very effectively to photocage NA and subsequently uncage with UV irradiation (lmax=360nm). Apart from using light for control of gene expression, they could also be used to enhance gene delivery by improving endosomal escape through Photochemical Internalization (PCI). In PCI, amphiphilic photosensitizers (PS) like TPPS-2a (meso-tetraphenylporphine with two sulfonate groups on adjacent phenyl rings) accumulate in the membranes of the endosomes and subsequently lyse their membranes upon illumination with visible light via generation of cytotoxic reactive oxygen species, mostly, singlet oxygen. This promotes endosomal escape, a critical component of PCI, by preventing clearing or degradation of nanoparticles and nucleic acids due to highly acidic pH (~4.5) and nucleases in lysosomes and effectively increasing free cytosolic nanoparticle concentration. Luckily, TPPS-2a has a short range of action and short lifetime, confining the damaging effect of singlet oxygen to endosomes. Even though the use of these two techniques should theoretically solve the issues pertaining to nanoparticle-based gene therapy, practical use of these techniques is limited by various factors. UV light necessary for uncaging photocaged nucleic acids is toxic as it can cause the formation of DNA lesions and UV photoproducts which can be potentially carcinogenic. Also the UV/Visible light required for activation of caged nucleic acids/TPPS2a has very low tissue penetration capabilities and thus limits these techniques to in vitro use. Compared to UV/Visible light, NIR light is ideal for photoactivation as it has very good tissue penetrating capabilities and is very safe for in vivo use. However, NIR light cannot be used directly for photoactivation, and hence a system is required to convert NIR light to different wavelengths in the UV/Visible range for efficient deep-tissue photoactivation. A class of lanthanide based

nanoparticles known as upconversion nanoparticles have the ability to convert near- infrared (NIR) to ultraviolet (UV) or visible light via an anti-Stokes emission. UCNs have host lattices of ceramics (LaF₃, YF₃, Y₂0₃, LaP0₄, NaYF₄) and doped with trivalent lanthanides (Yb³⁺, Er³⁺, Tm³⁺). Upconversion fluorescence can be generated using inexpensive, commercial continuous wave laser diodes, is exceptionally photostable with low photodamage to cells and proteins. Moreover, UCNs have the ability to be activated in deep tissues due to absence of upconversion property in biological molecules and the penetration capability of NIR light, thus enabling photoactivation of molecules and long-term live imaging in deep tissues. Here we have enhanced the effect of non-viral gene delivery by using UCNs for enhanced endosomal escape through PCI and photoactivation of caged NA. Special Mesoporous core-shell UCNs that could emit in both UV and visible ranges were synthesized for these purposes. Both the core and the shell are P-NaYF₄ crystallines with the core doped with Ytterbium (Yb) and Thulium (Tm) and the shell doped with Yb and Erbium (Er) to achieve UV and visible emissions, respectively. Caged nucleic acids (plasmid DNA or siRNA) and TPPS-2a were loaded onto the mesoporous silica layer. The enhanced intracellular delivery of caged nucleic acids and controlled gene expression/knockdown by NIR photoactivation were studied in vitro in B16F0 cells and in vivo in Zebrafish. The core-shell UCNs had excellent control over deep tissue activation of TPPS 2a and caged nucleic acids. This novel technique is not limited to activate caged nucleic acids and photosensitizers but can be used for a wide range of other applications which requires deep tissue photoactivation. RESULTS

NIR to UV and NIR to Vis Upconversion Nanoparticles

[0069] Initially, NIR-to-UV UCNs was used to check if it can be used efficiently for nucleic acid delivery and for photocontrollable gene expression. Photoiabile groups such as 4,5-dimethoxy-2-nitroacetophenone (DMNPE) can be cleaved from 'Caged' DNA or siRNA due to the UV emission (FIGs. 1 A-IC) of such nanoparticles upon excitation with NIR at 980nm. We then synthesized NIR-to-Vis UCNs with an emission peak at this wavelength (FIGs. 2A-2D) and then demonstrated that the light emitted from these particles could indeed activate TPPS-2a. We used these NIR to Vis UCNs to deliver STAT3 siRNA into B16F0 cells and found that STAT3 knockdown was significantly higher in the presence of TPPS-2a.

Core Shell UCNs

[0070] Having independently demonstrated that NIR to UV and NIR to VIS UCNs can be used for photocontrollable gene expression and Photosensitizer activation (TPPS-2a), respectively, we developed UCNs with core shell structure that had emissions in the UV and visible range. FIG. 3A shows a diagrammatic representation of the core-shell UCN with various coatings. FIGs. 3B and 3C show TEM images of the core and core shell UCNs, respectively. From these images we can see that the nanoparticle core is below 30 nm in size and there is a slight increase in size with the shell. The core of the nanoparticles is Yb/Tm doped NaYF₄, which emits in the UV- Blue range as can be seen from FIG. 3D. The shell of the UCNs is Yb/Er doped and emits in the visible (green) range (FIG. 3E), and the core shell UCNs emit across the entire range from UV to blue and green in the visible range (FIG. 3F).

[0071] The core shell nanoparticles were coated with a mesoporous silica layer (FIG. 4A) in order to improve the solubility in aqueous solutions and to enable loading of biomolecules and other chemicals on to their surface. To show that biomolecules like siRNA and other chemicals such as photosensitisers (in this case TPPS-2a) could be loaded on to these core shell UCNs efficiently and released in a controlled manner, we conducted loading and release experiments with TPPS-2a and siRNA independently as well as co-loading and co-release studies of the two by UV-Vis absorbance spectrophotometry. The loading of TPPS-2a and nucleic acids for co-loaded core-shell UCNs was found to be 1.61 μg TPPS-2a/mg UCN and 49.2 μg siRNA/mg UCN, respectively. To ascertain the ability of these UCNs to release the molecules loaded on to them, we conducted an in vitro release study in PBS. FIG. 4B shows a cumulative release profile for UCNs co-loaded with siRNA and TPPS-2a. From the graph, we can see that the release is not immediate but takes place over several hours.

[0072] Since the UCNs are exposed to conditions of varying pH ranging from physiological pH to acidic pH conditions in endosomes, we conducted a pH stability test to determine whether the fluorescence of UCNs would be affected with differing conditions. If the fluorescence of these UCNs is affected, then the ability to

photoactivate compounds can be compromised leading to suboptimal effects. We incubated UCNs with solutions of pH 7.4, 6.0, 5.5 and 4.8, corresponding to pH values in the cytosol, early endosome, late endosome and lysosome, respectively. We found that the fluorescence emission was not affected in either the UV or visible range (FIG. 4C), indicating that the photoactivation ability of these UCNs remains intact over a wide range of pH values and hence differing conditions in the cells/body.

[0073] Before carrying out in vitro studies in cells, we tested the effect of UCNs, NIR and TPPS-2a on the viability of B16F0 cells. We tested the cytotoxicity of core shell UCNs with or without NIR exposure, TPPS-2a in combination with NIR exposure, UCNs in combination with TPPS-2a and UCNs loaded with TPPS-2a with NIR exposure and found that in all 4 cases the cell death was minimal (FIG. 5 A). We also incubated B16F0 cells with increasing concentrations of TPPS-2a and found that cytotoxicity is minimal up to 0.8 μg/mL. We thus chose to use 0.7 μg/mL of TPPS-2a for further experiments. In addition, we also conducted an experiment to determine whether NIR exposure alone could result in cell death. The cells were exposed to increasing durations of NIR at 980 nm and cell viability was determined via the MTS assay, the next day. The cell viability was close to 100% at all exposure durations indicating that NIR is not harmful for the cells (FIG. 5B). [0074] We also tested the nanotoxicity of UCNs on zebrafish embryos. The toxicity of UCNs has been tested on different cell lines and in vivo models but their toxicity in zebrafish has not been evaluated so far. Although the heart rate of the embryos at 72 hpf decreased with increasing concentrations of UCN exposure, it was still comparable to the heart rate of control embryos as shown in FIG. 5C. Incubating zebrafish embryos with different concentrations of UCNs did not affect their hatching rate significantly (FIG. 5D), nor did it induce malformations as shown in FIGs. 5E-5J.

Simultaneous photochemical internalization and photocontrolled gene expression

[0075] Since TPPS-2a works by producing reactive oxygen species, we first determined whether the emission from core-shell UCNs was sufficient to induce ROS production by TPPS-2a. We demonstrated ROS production by TPPS-2a in two ways. The first method employed APF (Amino phenyl Fluorescein) dye to detect ROS production by TPPS-2a in solution. A solution containing TPPS-2a loaded UCNs and APF was exposed to NIR at 980 nm for increasing durations of time and fluorescence response (at 515 nm) was recorded. From FIG. 6A, we can see that with increasing irradiation time, the amount of ROS produced increased indicating that the emissions from UCNs are sufficient to induce ROS production by TPPS-2a.

[0076] The second method used the Image-iT LIVE Reactive Oxygen Species (ROS) Kit to determine whether TPPS-2a loaded onto the core shell UCNs was capable of producing ROS in cells. The assay is based on 5-(and-6)- carboxy-2',7'- dichlorodihydrofluorescein diacetate (carboxy- H2DCFDA), a reliable fluorogenic marker for ROS in live cells. Upon ROS production, the reduced fluorescein compound is oxidized and emits bright green fluorescence. B16F0 cells incubated with core shell UCNs loaded with TPPS-2a were treated with the Image-iT LIVE Reactive Oxygen Species (ROS) reagent and then subjected to irradiation by 980 nm NIR laser irradiation for 8 min. The nuclei were stained using DAPI. From FIGs. 6B and 6C, it can be seen that TPPS-2a, when excited, produces ROS in cells (seen in green). The staining is not very dark, which is in keeping with the theory that the production of ROS is localized and minimal. Also, the ROS production is indeed because of the TPPS-2a and not an artifact because in the negative control (with cells only, FIG. 6B), no staining was observed.

[0077] We also conducted experiments to determine whether the UV emission from core shell UCNs was sufficient to 'uncage' siRNA, thus allowing photocontrollable gene expression. We loaded DMNPE caged STAT3 siRNA onto UCNs and measured the absorbance after different durations of NIR exposure to determine the extent of uncaging. Caged siRNA has a peak at 350 ran in addition to the characteristic nucleic acid peak at 260 nm. Upon uncaging, this peak at 350 nm reduces or disappears depending upon the extent of uncaging. From FIG. 6D, we can see that there is a drop in absorbance at 350 nm with increasing durations of NIR irradiation confirming the uncaging of nucleic acids by UCNs.

[0078] Having already demonstrated the ability of these UCNs to excite TPPS-2a loaded onto them, we wanted to ascertain whether they were capable of exciting TPPS- 2a even after it is released. Thus, we conducted the APF ROS production experiment but with TPPS-2a added into the solution directly instead of it being loaded onto the UCNs. From FIG. 6E, we can see that UCNs are capable of activating TPPS-2a in solution, even when it is not loaded onto them. An experiment was also done in parallel to show that caged nucleic acids can be uncaged even if they are not loaded onto the UCNs as shown in FIG. 6F.

[0079] Next, we wanted to ascertain whether the use of TPPS-2a resulted in an enhanced endosomal release. We imaged UCNs in cells incubated with TPPS-2a loaded UCNs (for 8 hrs) immediately after irradiation with NIR and 10 mins after irradiation. FIGs. 6J and 6N show the distribution of core shell UCNs in B16F0 cells at time 0 and 10 mins after irradiation with NIR, respectively. From FIG. 6 J, we can see that the UCNs are present in clumps and are not very well dispersed inside the cells. However, only 10 mins after irradiation, we can see a marked change in the distribution of UCNs. In FIG. 6N, we can see that the UCNs are not as clumped as in FIG. 6J and are better dispersed in the cells, indicating better endosomal release. [0080] Having independently demonstrated the ability of these core shell UCNs to uncage nucleic acids and activate TPPS-2a, we endeavored to combine PCI and photocontrollable gene expression. The mechanism of how this would work is as follows: core-shell UCNs co-loaded with TPPS-2a and caged siRNA enter the cell by endocytosis. Once inside the endosomes, the TPPS-2a released from the UCNs embeds itself in the walls of the endosomal vesicles. When the cells are irradiated with NIR at 980 nm, the UCNs emit UV and visible light. Visible light at 413 nm causes the TPPS- 2a to become activated, upon which it produces reactive oxygen species (ROS). This localized production of ROS causes the disruption of the walls of the endosomal vesicles, causing the contents of the endosomes to be released into the cytoplasm. Simultaneously, the UV emission of the UCNs results in the uncaging of the siRNA. In this way, core shell UCNs, by the virtue of their emissions, can be used for targeted and enhanced delivery of nucleic acids. The mechanism is illustrated in the schematic given in FIG. 7A. We further proceeded to show that this mechanism works in vitro and in vivo.

In vitro

[0081] We incubated B 16F0 cells with TPPS-2a loaded UCNs for 8 hours and then irradiated the sample with NIR for 8 mins. The cells were then washed thoroughly with PBS, trypsinised and the cell suspension taken in a cuvette. As a control, cells incubated (8 hours) with TPPS-2a loaded UCNs but not irradiated with NIR were trypsinised and taken in a cuvette. Upon measuring the fluorescence emission

(excitation at 980 nm, emission corresponded to one of the emission wavelengths of core shell UCNs) in the above two samples, we found that the fluorescence intensity was about 5 times higher for the sample that had been irradiated (FIG. 7B), indicating increased uptake/retention of UCNs. This also indicated that TPPS-2a could be activated via the visible emission of these UCNs resulting in improved endosomal release.

[0082] We used B16F0 cells as an in vitro model to demonstrate that core shell UCNs could be used for simultaneous PCI and photocontrollable gene expression and targeted the STAT3 gene via RNAi. In one column, cells were incubated with core shell UCNs co-loaded with caged siRNA and TPPS-2a, and in another column, cells were incubated with core shell UCNs loaded with caged siRNA alone. Cells in both columns were irradiated with NIR. From FIG. 7C, we can see that there is a marked increase in STAT3 knockdown in the presence of TPPS-2a. This indicates that core shell UCNs emit light, which is sufficient to activate TPPS-2a and the enhanced endosomal release resulting from PCI causes an increase in the amount of siRNA released into the cytoplasm, thereby resulting in an improved knockdown. Control cells delivered with core-shell UCNs loaded with TPPS-2a and caged siRNA but without NIR irradiation did not show any significant knockdown, showing that the caged siRNA is activated only with NIR irradiation.

In-vivo

[0083] We demonstrated the ability of UCNs to activate caged nucleic acids and TPPS-2a simultaneously under in vivo conditions by using zebrafish as a model organism. Experiments were designed in different ways to prove the concept. In the first study, H-226 cancer cells were pre-labeled with UCNs, which were either loaded with caged EGFP plasmids or co-loaded with caged EGFP plasmids and TPPS-2a and injected into adult zebrafish. The injected site was then irradiated with a 980 nm NIR laser to activate the loaded molecules. The expression of GFP was then imaged using an in vivo imaging system, 24 hours after injection. FIGs. 8A-8I show the comparison of GFP expression with and without endosomal escape in comparison to control zebrafish injected with saline. The fish were also monitored by fluorescence

microscopy as shown in FIGs. 18A-18D. It can be seen that the delivery of co-loaded UCNs without NIR activation does not show significant GFP expression indicating the successful caging of plasmids, thus enabling control over the whole process.

[0084] In the second experiment, UCNs co-loaded with caged EGFP and TPPS-2a were injected directly into the peritoneal cavity of adult zebrafish and their transfection efficacy was assessed. It was seen that significant amount of GFP expression was seen in the fishes 24 hours after injection as shown in FIGs. 8J-8L. Apart from being able to be used simultaneously for photoactivation of caged nucleic acid and TPPS-2a, UCNs can also be used for good resolution, background-free in vivo imaging as shown in FIG. 17.

[0085] Finally, the ability of UCNs to activate photo-morpholinos in zebrafish embryos was tested by microinjecting UCNs loaded with No-tail morpholinos. The No- tail morpholino knocks down the ntla gene, which is responsible for the development of tail in zebrafish. The UCNs injected embryos were irradiated with UV light or NIR light at 5 hpf and the development of the embryos were monitored over a period of 72 hours. The embryos injected with UCNs and irradiated with a NIR laser showed no-tail morphology, whereas the embryos without NIR irradiation developed normally as seen in FIGs. 1 OA- IOC. Also, NIR irradiated samples had lower phototoxicity when compared to samples exposed to conventional UV light. The UCNs were also distributed well in the embryos, as seen in FIGs. 11 A-l 1C and 12A and 12B.

SUMMARY

[0086] In this study, a unique solution was provided to overcome problems in gene delivery like poor endosomal escape of nanoparticles and lack of control of gene expression by employing core-shell NIR-to UV/Vis upconversion nanoparticles. This is the first report of using a nanoparticle for simultaneous gene delivery, photo-controlled gene activation and photochemical internalization in vitro and in vivo along with additional imaging capabilities. The use of UCNs overcomes the limitations of traditional photo-controlled gene expression and photochemical internalization and enables these techniques to be used in deep tissues with minimal toxicity.

[0087] The basic requirement for a nanoparticle system which is used for biological applications is very good biocompatibility. We demonstrated the safety of UCNs in cells and also in zebrafish embryos for the first time. The toxicity of the UCNs was nil or very minimal. Another concern while using UCNs is the potential hazards of NIR phototoxicity and heating effects induced due to NIR exposure, but through cytotoxicity studies in B16F0 we showed that irradiation with NIR was not harmful to cells, and also that the increase in temperature with prolonged irradiation was very minimal. The toxicity arising from the UV emissions of UCNs have already been reported and that was also found to be very minimal.

[0088] In addition to experiments demonstrating the safety of UCNs, we also optimized the concentration of TPPS-2a that was sufficient for PCI while at the same time being minimally toxic for cells. We found that concentrations below 0.8 μg/mL were safe for usage with cells. Since TPPS-2a was loaded on to the UCNs, we also conducted experiments to ascertain its loading and release efficiencies. The

concentration of TPPS-2a used for loading was determined according to these values such that the concentration that the cells were exposed to was below 0.8 μg/mL.

[0089] We demonstrated that nucleic acids like plasmids/siRNA and small molecules like TPPS-2a can be efficiently co-loaded on to mesoporous silica coated UCNs. Cumulative release profiles for siRNA and TPPS-2a showed a gradual release over several hours, ensuring that nucleic acids and TPPS-2a are delivered efficiently to the cells.

[0090] After having established the safety of UCNs and TPPS-2a, we conducted experiments to determine whether TPPS-2a/caged nucleic acids loaded on to core-shell NIR-to-UV/Vis UCNs was capable of photoactivating the loaded molecules. It was shown that they can indeed uncage caged nucleic acids and produce singlet oxygen when irradiated with a NIR laser on a dose-dependent manner. Sufficient controls were included to show that the photoactivation occurred due to the UCNs. We showed that efficient photoactivation is possible regardless of whether the caged nucleic acids/TPPS 2a are loaded on to the UCNs or are in solution with UCNs, thus showing that photoactivation can take place efficiently even if the molecules are in the vicinity of the UCNs and do not necessarily have to be loaded onto the UCNs.

[0091] Having established that the core shell UCNs are capable of exciting TPPS- 2a, we went on to study whether this led to an improvement in endosomal escape. We did this by studying the redistribution of TPPS-2a loaded UCNs before and after NIR irradiation in B16F0 cells. Before irradiation, the UCNs were present in clumps and were not very well dispersed inside the cells. However, only 10 mins after irradiation, a marked change in the distribution of UCNs could be seen— the UCNs were better dispersed in the cells, indicating better endosomal release, and this was similar to other reports on endosomal escape. Fluorescence spectrometry also showed that the cellular uptake was significantly higher in cells irradiated with NIR when compared to non- irradiated control after 24 hours. These results re-affirmed our hypothesis that core shell UCNs could excite TPPS-2a in cells resulting in enhanced endosomal escape of these UCNs.

[0092] After validating the ability of core-shell NIR-to-UV/Vis UCNs to individually photoactivate both caged nucleic acids and TPPS-2a, we tested whether these UCNs could simultaneously activate caged nucleic acids and TPPS-2a. Co-loaded UCNs with TPPS-2a and caged siRNA against STAT-3 was used for experiments in vitro in B16F0 cells. Our efforts to demonstrate simultaneous PCI and

photocontroUable gene expression using core shell UCNs showed promising results. In cells incubated with UCNs co- loaded with TPPS-2a and caged siRNA (anti STAT3), the knockdown was higher as compared to cells in which only caged siRNA loaded UCNs were used. Also, uncaging was successful since, in the absence of NIR irradiation, the knockdown was substantially reduced. Thus, core shell UCNs could simultaneously excite TPPS-2a and uncage siRNA, resulting in enhanced and targeted nucleic acid delivery in vitro.

[0093] Finally, the simultaneous photoactivation of caged nucleic acids and photochemical internalization by UCNs was also demonstrated in vivo. Zebrafish was used as a model organism, but this could be extended to any animal model.

Experiments were designed to demonstrate the usefulness of UCNs in various scenarios where gene delivery and control of gene expression is necessary. First, it was shown that UCNs can be used for photoactivation of cells after transplantation to the animal model. Second, there are only few reports on direct transfection of adult zebrafish as the transfection efficiency is very low. But, it was shown that UCNs can be used for direct transfection of adult zebrafish with good efficiency and good control over gene expression after delivery. Finally, it was shown that UCNs can activate photo- morpholinos in zebrafish embryos with excellent efficiency. In addition to that, it was also shown that UCNs can be used for background-free in vivo imaging. Thus, the major bottlenecks of in vivo gene delivery have been addressed and UCNs have shown excellent promise in overcoming these bottlenecks and could be used for a wide range of photoactivation applications.

METHODS

Synthesis of mesoporous coated Core-shell UCNs

[0094] P-NaY _4.7F4:Yb25,Tm₀₃ core was synthesized using thermal decomposition method and then purified and dispersed in cyclohexane. Briefly, 0.78 M of YC1₃, 0.20 M of YbCl₃, and 0.2 M of ErCl₃ was taken in a 50 ml three-necked flask and heated till dryness. Then, 6ml of Oleic Acid and 15ml of 10-Octadecene was added and the solution was heated till 150°C. After 30 minutes, the solution was cooled to 50°C and the previously synthesized NaYF₄:Yb,Tm core was added and the resulting mixture was heated to 110°C for 30 minutes to remove cyclohexane. Once the cyclohexane was removed, the solution was cooled to 50°C and 0. lg of NaOH and 0.1482 g of NH₄F in 5ml methanol each were added. Subsequently, the solution was heated to 110°C for 15 minutes and then degassed at the same temperature for next 20 minutes. The solution was then heated at 300°C under argon atmosphere for 1 hour, cooled to room

temperature, purified and redispersed in cyclohexane.

[0095] Mesoporous coating of the as-synthesized core-shell UCNs was done by calcination method as described previously. Briefly, the UCNs were coated with a silica layer as follows: 1ml of Igepal CO-520 and 18.4ml of cyclohexane were added to 1.6ml of 0.05M UCNs, homogenized under ultrasonication. To the solution, 160ul of 30% NH₄OH and 40ul of TEOS (Tetraethyl orthosilicate) was added and shaken for 2 days. After 2 days, the resulting silica coated UCNs were purified using acetone and ethanol. Subsequently, a second coating of mesoporoous silica was done. To the as- synthesized silica coated UCNs, 2.6 ml of 30% NH₄OH, 13 mL ethanol, 260uL TEOS (Tetraethyl orthosilicate) and 104uL CI 8 TMS (Octadecyltrimethoxysilane 90%) were added and shaken for 6 hours. The resulting homogeneous white solution was dried in hot-air oven at 60°C overnight and then subsequently calcinated at 500°C in a furnace for 6 hours. The dried powder was then milled and subsequently dissolved in deionized water.

Characterization of UCNs

[0096] Transmission electron microscopy (TEM) images were recorded on a JEOL 201 OF transmission electron microscope (Jeol Ltd., Tokyo, Japan) operating at an acceleration voltage of 200 kV. Fluorescence spectra of UCNs were recorded on a Hitachi F-500 fluorescence spectrophotometer (Hitachi High-Technologies

Corporation, Tokyo, Japan) equipped with an NIR continuous wave laser with emission at 980 nm (Photonitech (Asia) Pte. Ltd., Singapore).

Embryo toxicity

[0097] Healthy zebrafish embryos were collected immediately after spawning from the aquarium at Institute of Biochemistry & Cell Biology, Shanghai, China. Ten embryos were taken for each concentration of nanoparticle exposure and they were thoroughly rinsed three times using E3 medium. The embryos were then incubated in a 24-well microplate containing different concentrations of UCNs in E3 medium for 72 hours in 28°C. All the experiments were done in triplicate. The hatching rate of the embryos was noted and the heart rate was monitored at 72 hpf using a stopwatch. The embryos were imaged at 24 and 72 hpf using a Nikon microscope.

Cell culture

[0098] NCI-H226 cells and B16-F0 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and grown in DMEM culture medium (Invitrogen) supplemented with 10 % FBS (Invitrogen), 100 units/mL of penicillin and 100 μg/mL of streptomycin, and maintained in a humidified, 5 % carbon dioxide (C0₂) atmosphere at 37°C.

Cell viability assay

[0099] B 16F0 cells were treated with different conditions and then incubated for 24 hours before being assayed for cell viability using CellTiter 96^® AQ_ueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA) as per manufacturer's instructions.

Co-loading TPPS-2a and caged siRNA onto UCNPs

[00100] To lmL of 1 mg/mL UCNPs, 20 nM of caged siRNA was added and shaken at 1000 rpm for 2 hours protected from light. Then, 24 μΐ of TPPS-2a (PCI Biotech, Norway) was added and shaken for another hour. The solution was then centrifuged at 8000rpm for 15 mins to separate the loaded UCNs. The supernatant was discarded and the co-loaded UCNs were used for further experiments.

ROS detection in Solution

[00101] 2 mL of 1 mg/mL TPPS-2a loaded UCN solution was taken in a cuvette. For control, 2 other cuvettes contained water and unloaded UCN solution, respectively. To each of the three cuvettes, 2 μΐ of APF was added. 100 μΐ of sample was taken from each of the cuvettes and spun down at 12000 rpm for 5 mins. 50 μΐ of supernatant was taken from each and put in a dark (opaque) 96 well plate (protected from light). The fluorescence of the samples was recorded (490/515 ex/em). The three cuvettes were then irradiated at different time points and after each time point 100 μΐ of sample was taken from each of the cuvettes and processed as mentioned above. The fluorescence readings were then plotted against time to indicate amount of ROS produced by TPPS- 2a with increasing duration of NIR exposure.

Using Image it Green Live ROS detection kit

[00102] B 16F0 cells were incubated with 0.5 mg/mL of UCNs loaded with TPPS-2a overnight. The excess nanoparticles were then washed off the cells and the cells were irradiated using a 980 nm NIR laser. The ROS generated in the cells was detected using an Image-iT LIVE Reactive Oxygen Species (ROS) Kit (Molecular Probes, OR, USA) as per manufacturer's instruction. The cells were also counterstained with DAPI and imaged using a confocal laser-scanning microscope (Nikon CI Confocal, Nikon, Tokyo, Japan) specially fitted with a CW 980 nm laser excitation source (Opto-Link Corp., Hong Kong). Endosomal release of UCNPs

Through Fluorescence Emission

[00103] Bl 6F0 cells were incubated with TPPS-2a loaded UCNs in a 96 well plate and different columns were irradiated at 4 time points (6, 8, 10 and 12 hrs, respectively) with NIR at 980 nm for 8 mins per well. As controls, 4 other columns contained cells incubated with UCNs without any TPPS-2a. These columns were also irradiated with NIR at time points of 6, 8, 10 and 12 hours. The wells were washed thoroughly and cells trypsined. The cells from each of the 8 columns were taken in different cuvettes, i.e., 4 cuvettes containing cells that had been irradiated at 6, 8, 10, 12 hrs, respectively, with TPPS-2a and 4 without. We then measured the fluorescence emission upon excitation at 980 nm. Fluorescence response was recorded using a Hitachi F-500 fluorescence spectrophotometer (Hitachi High-Technologies Corporation, Tokyo, Japan) equipped with an NIR continuous wave laser with emission at 980 nm

(Photonitech (Asia) Pte. Ltd., Singapore).

Confocal Imaging

[00104] B16F0 cells were plated on a 24 well plate. After overnight incubation, TPPS-2a loaded UCNPs were added to the test and control wells. After 8 hours of incubation, the media was removed and the cells were incubated with O.lmg/mL Concanavalin A-Alexa Fluor 488 in culture medium and 0.01 mg/mL DAPI for 30 min at 37°C. They were then washed thrice with PBS and replenished with fresh culture medium. The cells were then imaged using a confocal microscope (Nikon CI Confocal, Nikon, Tokyo, Japan) (UCNs, the cell stained with Concanavalin A and nuclei stained with DAPI). Concanavalin emission was pseudo-coloured to red to distinguish from the green emission of UCNs. Merging of the two images showed localization of UCNPs in the cells. Another set of wells were irradiated with a CW 980 nm NIR laser for 8 mins and was imaged similarly after 10 mins.

Tumor cell injection and photoactivation

[00105] NCI-H226 cells were incubated with 0.5 mg/mL of UCNs loaded with caged EGFP or co-loaded with caged EGFP and TPPS-2a. Control cells were not incubated with any nanoparticles. After 8 hours, adult zebrafishes were anesthetized with 0.2% Tricaine in E3 medium. Then, 10,000 cells from each group were injected into the fishes (n=3). The injected site was then irradiated with a NIR laser for 8 mins and the fishes were immediately returned to fresh fish water. After 24 hours, the fishes were anaesthetized and imaged in an IBOX® SPECTRA™ Small Animal Imaging System (UVP, LLC, CA, USA) and the images were analyzed using ImageJ. Wild-type adult zebrafishes were obtained from Institute of Biochemistry & Cell Biology, Shanghai, China and maintained according to the protocol approved by the Institutional Animal Care and Use Committee, Hefei University of Technology.

Direct injection of UCNs into zebrafish and photoactivation

[00106] UCNs co-loaded with caged EGFP and TPPS-2a (0.1 mg/mL) were injected into the peritoneal cavity of adult zebrafish (n=6). Control fishes received saline injection. The fishes were then irradiated with a NIR laser for 8 mins and immediately returned to fish water. The fishes were checked for GFP expression after 24 hours as mentioned previously.

Statistical Analysis

[00107] To compare the mean values of experimental group to that of control ones, oiie-way ANOVA, at an alpha level of 0.05 (a P value of less than 0.05 is considered as statistically significant), was performed using OriginPro 8.5.

Example 2: Mesoporous Silica Coated Upconversion Nanocrystals for Near Infrared Light-Triggered Control of Gene Expression in Zebrafish

[00108] This example demonstrates the use of nanoparticles as carriers and nanotransducers for light controlled gene knockdown in Zebrafish embryos and light controlled gene expression in adult Zebrafish. This example includes data presented in Example 1 , as well as new data. The no tail gene, involved in mesoderm patterning and notochord formation was successfully knocked down in Zebrafish embryos and GFP expression using UCNs was demonstrated in cancer cells injected into adult Zebrafish. In addition, the absence of photobleaching and low autofluorescence of these nanoparticles allowed for background free NIR based imaging in both the embryos and adult fish.

Materials and Methods

Synthesis of mesoporous silica coated UCNs

[00109] UCNs were synthesized with a NaYF₄ core and codoped with Yb³⁺ (25%) and Tm³⁺ (0.3%) using the method as previously reported. YC1₃, YbCl₃ and TmCl₃ were taken in the ratio mentioned above and mixed with 6 ml of Oleic acid and 15 ml of Octadecene and heated to 160°C to form a homogenous solution. Then, a solution of 0.4 mmol sodium hydroxide (0.1 g) and 0.25 mmol ammonium fluoride (0.148 g) in 10 ml of methanol was slowly added and stirred for 30 min. Methanol was then

evaporated from the solution and subsequently the solution was degassed and heated at 300°C for 90 min under argon atmosphere. The solution was then cooled and the nanocrystals were purified using ethanol and water and finally suspended in

cyclohexane.

Mesoporous silica coating

[00110] Mesoporous coating of UCNs were done by calcination as described previously. Briefly, the UCNs were coated with a silica layer as follows: 1ml of Igepal CO-520 and 18.4ml of cyclohexane were added to 1.6ml of O.05M UCNs,

homogenized under ultrasonication. To the solution, 160ul of 30% Nh40H and 40ul of TEOS (Tetraethyl orthosilicate) was added and shaken for 2 days. After 2 days, the resulting silica coated UCNs were purified using acetone and Ethanol. Subsequently, a second coating of mesoporoous silica was done. To the as-synthesized silica coated UCNs, 2.6 ml of 30% NH40H, 13 mL ethanol, 260uL TEOS(Tetraethyl orthosilicate) and 104uL CI 8 TMS (Octadecyltrimethoxysilane 90 %) were added and shaken for 6 hours. The resulting homogeneous white solution was dried in hot-air oven at 60°C overnight and then subsequently calcinated at 500°C in a furnace for 6 hours. The dried powder was then milled and subsequently dissolved in deionized water. Characterization of UCNs

[00111] Transmission electron microscopy (TEM) images were recorded on a JEOL 201 OF transmission electron microscope (Jeol Ltd., Tokyo, Japan) operating at an acceleration voltage of 200 kV. Fluorescence spectra of UCNs were recorded on a Hitachi F-500 fluorescence spectrophotometer (Hitachi High-Technologies

Corporation, Tokyo, Japan) equipped with an NIR continuous wave laser with emission at 980 nm (Photonitech (Asia) Pte. Ltd., Singapore).

Fourier Transform Infrared (FTIR) Spectroscopy

[00112] FTIR spectroscopy study was performed by KBr-disc pellet method using Shimadzu IRPrestige-21 model spectrometer (Shimadzu Corporation, Kyoto, Japan). With an agate mortar, sample was thoroughly ground with some KBr salt that acts as a non-absorbing matrix and background in the disc pellet preparation. The ground mixture was then pressed using a Mini Hand Press MHP-1 (Shimadzu Corporation, Kyoto, Japan) to produce highly transparent KBr-disc pellets. FTIR spectra of these discs containing the samples were recorded by averaging 45 scans at a resolution of 4 cm¹ and drawn in transmittance mode. This was performed for the UCN core as well as mesoporous silica coated UCNs to confirm presence of mesoporous silica coating.

UCN Photostability

[00113] Mesoporous silica coated UCNs were continuously irradiated with near infrared light (NIR) at 3.2 W/cm and the fluorescence emission (upconverted light) spectrum recorded at 0.5, 1, 2, 4, 8 and 16 mins of irradiation. The fluorecence intensity of upconverted light at 350 nm for these time points was compared to the value before irradiation. This was done to ascertain whether these nanoparticles were photostable for the duration of NIR irradiation used in subsequent experiments (8 mins).

Cell viability assay

[00114] ZFL cells were grown in complete growth medium at 28°C without carbon- di-oxide. The media consisted of 50% L-15 medium, 35 % DMEM high-glucose medium and 15 % Ham's F12 medium supplemented with O.Olmg/ml bovine insulin, 50 ng/ml mouse EGF, 5% heat-inactivated fetal bovine serum and 0.5% Trout Serum. The celles were treated with different concentrations of UCNs and then incubated for 24 hours before being assayed for cell viability using CellTiter 96^® AQ_ue0us One Solution Cell Proliferation Assay (Promega, Madison, WI, USA) as per manufacturer's instructions.

Loading of Nucleic acids onto UCNs

[00115] To lmg/ml of mesoporous silica coated UCNs, a solution containing the desired amount of nucleic acids (either photomorpholino or caged DNA) was added. The solution was then shaken at 800 rpm for 3 hours and then spun down at 8000 rpm for 10 mins. The supernatant was discarded or measured for nucleic acid concentration to estimate the loading efficiency. The pellet was resuspended in saline or DI water for microinjection or in vitro experiments respectively. The amount of photomorpholino needed per embryo to cause knockdown is about 6 ng. Taking this into consideration the loading and release rates of nucleic acids from the UCNs, we incubated 1 mg of UCNs with 0.025 mg of the photomorpholino duplex. To prepare the no tail photomorpholino duplex, equal parts of the sense photomorpholino and unmodified anti sense morpholino were incubated together and allowed to hybridise for 15 mins. For plasmids, lmg of UCNs were incubated with 0.02 mg of the caged EGFP plasmid. Caging of plasmid has been reported previously.

No tail knockdown

[00116] The mesoporous silica coated mesoporous UCNs loaded with

photomorpholino duplex were resuspended in saline. About 120 embryos was injected with 300 ng of UCNs loaded with the photomorpholino duplex, 60 with the UCNs loaded with a scrambled sequence and another 50-60 were untreated. This was done immediately post fertilization. At 2 hpf, all embryos except one group injected with UCNs loaded with photomorpholino, were irradiated with NIR at 2.8W/cm² for 8 mins. The embryos were kept in E3 medium at 28°C and the medium was replenished twice a day. The morphology of the embryos was observed at 24, 48 and 72 hpf for the no tail phenotype.

In-vivo studies

[00117] Wild-type adult zebrafishes and zebrafish embryos were obtained from Institute of Biochemistry & Cell Biology, Shanghai, China and maintained according to the protocol approved by the Institutional Animal Care and Use Committee, Hefei University of Technology.

Embryo toxicity

[00118] Healthy zebrafish embryos were collected immediately after spawning from the aquarium. Ten embryos were taken for each concentration of nanoparticle exposure and they were thoroughly rinsed three times using E3 medium. The embryos were then incubated in a 24-well microplate containing different concentrations of UCNs in E3 medium for 72 hours in 28°C. All the experiments were done in triplicate. The hatching rate of the embryos was noted. The embryos were also imaged at 24 and 72 hpf using a Nikon microscope.

Imaging of UCNs in embryos and adult zebrafish

[00119] Zebrafish embryos were placed on a petridish and imaged using a fluorescence confocal microscope (Nikon CI Confocal, Nikon, Tokyo, Japan) modified with a 980 nm NIR laser. The adult zebrafishes were imaged in an iBox® Spectra™ Small Animal Imaging System (UVP, LLC, CA, USA) equipped with a 980 nm NIR laser.

Tumor cell injection and photoactivation

[00120] NCI-H226 cells were incubated with 0.5 mg/mL of UCNs loaded with caged EGFP or co-loaded with caged EGFP and TPPS-2a. Control cells were not incubated with any nanoparticles. After 8 hours, adult zebrafishes were anesthetized with 0.2% Tricaine in E3 medium. Then, 10,000 cells from each group were injected into the fishes (n=3). The injected site was then irradiated with a NIR laser for 8 mins and the fishes were immediately returned to fresh fish water. After 24 hours, the fishes were anaesthetized and imaged using a fluorescence microscope.

Direct injection and activation of caged plasmids in adult zebrafish

[00121] UCNs co-loaded with caged EGFP and TPPS-2a (0.1 mg/mL) was injected into the peritoneal cavity of adult zebrafish (n=6). Control fishes received saline injection. The fishes were then irradiated with a NIR laser for 8 mins and immediately returned to fish water. The fishes were checked for GFP expression after 24 hours using an iBox® Spectra™ Small Animal Imaging System (UVP, LLC, CA, USA) equipped with a 980 nm NIR laser.

Statistical Analysis

[00122] To compare the mean values of experimental group to that of control ones, one-way ANOVA, at an alpha level of 0.05 (a P value of less than 0.05 is considered as statistically significant), was performed using OriginPro 8.5.

Results and Discussion

UCN synthesis and modification

[00123] NIR to UV UCNs were synthesized, with a P-NaYF₄ crystalline structure doped with Ytterbium (Yb³⁺) and Thulium (Tm³⁺). These UCNs were about 20 nm in diameter (FIG. 19 A) before coating with mesoporous silica. After coating, the size increased to about 30 nm (FIG. 19B). This coating was done to improve the aqueous solubility of the UCN core (previously in cyclohexane), to improve physiological stability and safety for biological use. These nanoparticles could be excited by NIR at 980 nm and emitted in the UV and blue visible ranges (FIG. 19C). This UV emission of the UCNs allowed uncaging or cleaving of the photolabile groups used to 'inactivate' nucleic acids. With the visible emission, the embryos and the adult Zebrafish could be imaged. The pore size of these mesoporous silica coated UCNs was about 2 nm.

[00124] FTIR was performed for both the UCN core and mesoporous silica coated particles to ascertain whether the particles had indeed been coated. Characteristic FTIR spectra were observed for both the core and the coated particles (FIG. 20A). This confirmed the presence of the mesoporous coating on the UCNs. After coating, the mesoporous silica coated UCNs were subjected to a photostability test to determine whether their upconverted UV emission remains stable over the irradiation duration (8 mins) used in subsequent experiments. From FIG. 20B, it can be seen that up to 16 mins of irradiation with NIR, the UV emission of the UCNs remains stable, indicating excellent photostability of these particles.

Cytotoxicity studies

[00125] Before studying the ability of these UCNs to control gene

expression/knockdown in vivo, the safety of these nanoparticles was evaluated in both Zebrafish cells and embryos. FIG. 21 A depicts the effect of increasing UCN concentrations on the viability of ZFL cells (Zebrafish liver).

[00126] The toxicity was negligible even at 0.5 mg/ml nanoparticle concentration. One of the ways in which the developmental toxicity of a foreign material is tested in Zebrafish is by analyzing the affect that material has on the hatching rate of the embryos. If the hatching rate is retarded, the material can be deemed to be toxic. In terms of embryo toxicity, incubation with UCNs did not affect the hatching rate (FIG. 2 IB). Nearly 100% of embryos hatched even at the highest UCN concentration (0.1 mg/ml). In addition, incubation with these nanoparticles did not cause any

morphological or developmental changes in the embryos as the embryos incubated with UCNs were identical to the control at 24hpf (FIGs. 21C-21E) and 72 hpf (FIGs. 21F- 21H). A higher concentration of UCNs was chosen for cytotoxicity studies in vitro as compared to those in embryos in keeping with the concentration of UCNs used for studies later on. These results indicated that UCNs were safe for use in Zebrafish as there was minimal cytotoxicity in vitro in ZFL cells incubated with these nanoparticles and no observable development changes in embryos when they were exposed to these nanoparticles. NIR controlled gene knockdown in Zebrafish embryos using UCNs

[00127] To study the potential of these nanoparticles for photocontrollable gene expression in Zebrafish embryos, the no tail gene was chosen primarily because of its role in early development and the startling phenotype resulting from its knockdown. When this gene is knocked down early in the development, the resulting embryos are formed without a 'tail' causing them to take on a stunted appearance with a poorly developed caudal region. A photomorpholino duplex directed against this gene was used. This duplex consists of a sense strand containing a photolabile group in its backbone (e.g. between or on nucleotides 10 and 1 1 in SEQ ID NO: 1) and an antisense strand that is unmodified. This sense strand sequesters the antisense strand and prevents it from participating in RNA interference (RNAi) mediated gene knockdown. The sequence is GATCGTCGGATTATCTCAAG (SEQ ID NO: 1) and was obtained from GeneTools LLC. However, upon irradiation with UV light, the sense strand gets cleaved, releasing the antisense strand and resulting in RNAi-mediated knockdown of this gene. As mentioned earlier, the use of mass UV irradiation is undesirable and with our UCNs, we wanted to ascertain whether NIR induced, localized UV production (by these UCNs) could be used for efficient knockdown.

[00128] To ascertain whether the upconverted light from the UCNs was sufficient to cause photomorpholino lysis, irradiated solutions containing UCNs (0.5 mg/ml), and 10 μΜ of the photomorpholino in water for increasing durations of NIR (0,4,8 mins) were used and the change in absorbance post irradiation was measured. If the photolysis had occurred, an increase in absorbance at 260 nm would be expected since there would be an increase in the number of nucleic acid fragments upon lysis. It was found that with increasing irradiation duration, there was indeed an increase in the absorbance of the photomorpholino solution as seen in FIG. 22A. This indicated that the upconverted UV light from the UCNs could effectively cause photolysis of the photomorpholino.

[00129] Mesoporous UCNs were loaded with the no tail photomorpholino duplex. These photomorpholino loaded UCNs were then microinjected into Zebrafish embryos immediately after fertilization. For controls, untreated embryos and embryos injected with UCNs were loaded with a scrambled photomorpholino (not no tail). At 2 hpf (hours post fertilization), all groups were irradiated with NIR at 2.8 W/cm² for 8 mins. In addition, there was a control group with embryos injected with UCNs loaded with no tail photomorpholinos but not irradiated with NIR. Each of these 4 groups had 60 embryos. The morphology of these embryos was examined at 24 hpf, 48 hpf and 72 hpf. The number of no tail embryos were counted in each category and groups that were untreated or treated with a scrambled morpholino, all embryos developed normally and there were none formed without a tail. This indicated that NIR alone or exposure to UCNs does not result in this phenotype. In the group treated with UCNs loaded with no tail photomorpholino but not subjected to NIR, about 10% of the embryos were formed with the no tail phenotype, this is possibly due to the nonspecific cleavage of the sense photomorpholino or spontaneous dehybridisation. In the test group, a majority of the embryos (>50%) showed this phenotype (p value 0.04354 between the groups) (FIG. 22B). FIGs. 22C-22E, show embryos from the untreated, UCN loaded with

photomorpholino treated (without NIR) and test group respectively at 24 hpf. While embryos in FIGs. 22C and 22D show normal development, the no tail phenotype is evident in FIG. 22E. FIGs. 22F-22H, show embryos from the same groups at 72 hpf. Again, the no tail phenotype was evident in the test group as the embryo appears stunted with a poorly developed caudal region. This led to the conclusion that NIR to UV emission of these UCNs could be used effectively for photocontrolled gene knockdown in Zebrafish embryos.

NIR controlled gene expression in adult Zebrafish using UCNs

[00130] To ascertain whether such activation could be achieved in adult fish as well, caged EGFP (enhanced green fluorescent protein) was used as the nucleic acid to evaluate whether UCNs could be used for photocontrolled expression of this gene. 'Caging' of a plasmid involves modifying it with a photolabile caging group that prevents it from getting expressed in the cell. Upon irradiation with light of a suitable wavelength, usually UV, the photolabile caging group gets released, thereby allowing the plasmid to get expressed again. [00131] For this study, H-226 cancer cells were treated with caged plasmid loaded UCNs and injected them into adult fish intraperitoneally. The aim was to ascertain whether UCNs could effectively transfect the cells and if GFP expression could be induced via irradiating the fish with NIR. This study consisted of two groups, the first group consisted of Zebrafish that were injected with cells treated with caged EGFP loaded UCNs but not subjected to NIR (control) and the second group consisted of similarly treated fish but with 8 mins of NIR exposure (test). The expression of GFP was then observed by imaging this protein using an in vivo imaging system, 24 hours after injection. FIGs. 22I-22N shows the comparison of GFP expression between the control and test animals. It can be seen that the test group (FIGs. 22L-22N) shows bright GFP fluorescence in the irradiated region, which is absent in the control fish (FIGs. 22I-22K). These results suggested that the GFP expression was due to the NIR to UV UCN emission mediated uncaging of caged EGFP and not due to non-specific or spontaneous uncaging or due to the presence of residual uncaged plasmid molecules. Thus, it was concluded that UCNs could be used to transfect cells with caged plasmid and also as nanotransducers to control expression of desired genes using the

biologically friendly NIR light.

UCN imaging in Zebrafish embryos

[00132] In addition to photocontrolled gene knockdown, the visible emission of these UCNs could be used for imaging. The UCNs injected immediately post fertilization could be detected via a confocal microscope at even 72 hpf. FIGs. 23 A and 23B show Zebrafish embryos at 72 hpf for control (untreated) and test embryos, respectively. It could be seen that UCNs were distributed throughout the body in the test group and that there was no signal in the control group. This showed that the signal was due to UCNs alone and not due to background. Z-stack imaging confirmed that these nanoparticles were distributed throughout the body and not present on the surface alone (FIG. 23C). These results suggested that these nanoparticles provided a biologically safe and controllable platform for studying genes involved in Zebrafish development with potentially widespread implications in the field of development biology. In addition, the absence of photobleaching and biological transparency at NIR, allowed the use these nanoparticles for long term, background free imaging in Zebrafish embryos.

UCN imaging in adult Zebrafish

[00133] Finally, it was also showed that these nanoparticles could be used for good resolution, background free imaging in adult fish (FIG. 23D). The fish were injected with UCNs and the region in which the nanoparticles were injected could be visualized clearly using the imaging system. The color gradient indicates reducing signal intensity from the center outwards.

Example 3: Near Infrared Light Based Nano-Platform Boosts Endosomal Escape and Controls Gene Knockdown In-vivo

[00134] In this study, UCNs were evaluated for the ability to deliver and excite TPPS2a ((meso-tetraphenylporphine with two sulfonate groups on adjacent phenyl rings), a photosensitiser used in PCI (photochemical internalization)) and a

photomorpholino (in this case anti STAT3) simultaneously in order to achieve PCI mediated endosomal escape of the photomorpholino and thus enhance photocontrolled gene knockdown. The data in this example includes data presented in Example 1 as well as new data. The core shell UCNs were coated with a layer of mesoporous silica and then co-loaded with TPPS2a and photomorpholinos. TPPS2a is a photosensitiser that absorbs maximally at 413 nm and is used for photochemical internalization. It should not be confused with photosensitisers used for PDT {e.g. Merocyanine 540, Zinc phthalocyanine et cetera), where the purpose of the photosensitiser is to cause cell death. The photomorpholino loaded is a duplex consisting of a sense photomorpholino and an antisense morpholino hybridized together. Upon irradiation with UV light, the sense photomorpholino gets cleaved, resulting in the release of the antisense

morpholino, which can then participate in RNAinterference (RNAi). This allows us to achieve spatial and temporal control over gene knockdown using light since without UV irradiation, the antisense morpholino is effectively sequestered and cannot participate in RNAi. These TPPS2a and photomorpholino duplex loaded UCNs enter the cell by endocytosis. When these cells are irradiated with NIR at 980 nm, the UCNs emit both UV and visible light simultaneously. The visible light at 413 nm causes TPPS2a to become activated upon which it produces reactive oxygen species (ROS) locally. This localized ROS production disrupts the walls of the endosomal vesicles, causing the contents of the endosomes to be released into the cytoplasm. Simultaneously, the UV emission of the UCNs results in the cleavage of the sense photomorpholino, thereby releasing the antisense photomorpholino which can then cause RNAi mediated knockdown of the target gene, in this case STAT3.

Core-Shell UCN synthesis and characterization

[00135] To achieve simultaneous PCI and photocontrolled gene knockdown, UCNs that could emit both UV (to cleave the sense morpholino) and visible light (413 nm to excite TPPS2a) were required. Core-shell UCNs were synthesized using a one-pot synthesis method. FIG. 24A shows a diagrammatic representation of this core-shell UCN with various coatings. Both the core and the shell are P-NaYF₄ crystalline structures with the core doped with Ytterbium (Yb ) and Thulium (Tm ) and the shell doped with Yb and Erbium (Er ) to achieve multiple UV and visible emissions respectively. FIGs. 24B and 24C show transmission electron microscope (TEM) images of the core and core-shell UCNs respectively. These images illustrated that the nanoparticle core was below 30 nm in size with a slight increase in size due to the shell. This size was suitable for endosomal uptake. Although the core alone could emit in the UV and blue regions (FIG. 24D), emission at 413 nm needed for TPPS2a excitation was absent. The core shell UCNs however, had multiple UV and visible emission peaks (FIG. 24E), two of which coincided with the photomorpholino and TPPS2a absorption maxima respectively (FIG. 24F). The insets in FIGs. 24D and 24E show the visible fluorescence of the NIR to UV core and NIR to UV-Vis core-shell UCNs when irradiated with an NIR laser at 980 nm.

[00136] The core-shell nanoparticles were coated with a mesoporous silica layer (FIG. 24G) in order to improve their solubility in aqueous solutions and enable loading of molecules onto their surface. The mesoporous silica coating has a pore size of about 2 nm. This coating also significantly increased the surface area, which was suitable for loading nucleic acids and photosensitisers. Henceforth, throughout this example all references to UCNs stand for mesoporous silica-coated NIR-to-UV/ Visible core-shell UCNs. It was also found that exposure to solutions of different pH values varying from 4.8 (lysosome) to 7.4 (cytosol) did not affect the fluorescence of these nanoparticles (FIG. 30) significantly. This was significant since the UCNs are exposed to conditions of varying pH ranging from physiological pH to acidic pH conditions in endosomes and if the fluorescence of these UCNs is affected, the ability to photoactivate compounds could be compromised leading to suboptimal effects.

Cytotoxicity

[00137] Cytotoxicity studies were conducted before investigating their therapeutic potential. The safety of TPPS2a in B16F0 cells was evaluated using an MTS assay and it was found that it was minimally cytotoxic to the cells up to the concentration of 0.8 μg/ml (FIG. 25 A). 0.7 μg/ml of TPPS2a was chosen for future experiments as this concentration produced significant ROS with UCNs as well as being minimally toxic. Another concern while using UCNs was the potential hazard of NIR phototoxicity. Studies on B16F0 cells showed that irradiation with NIR was not harmful to cells since the cell viability was close to 100% at all exposure durations (FIG. 25B). The cytotoxicity of all combinations of UCNs with TPPS2a/NIR (UCNs, TPPS2a,

UCN+TPPS2a, UCN+NIR, TPPS2a+NIR and UCN+TPPS2a+NIR) was tested and it was found that in all 6 cases the cell death was minimal (FIG. 25C). The concentration of UCNs used was 500 g/mL, TPPS 2a- 0.7 μg/mL and irradiation was done using a CW 980 nm NIR laser at a power density of 2.8 W/cm² for 8 min.

Loading and Release of TPPS2a and Photomorpholino

[00138] The loading and release of nucleic acids and TPPS2a from the UCNs was studied. The loading of TPPS2a and photomorpholino for co- loaded UCNs was found to be 1.61 μg TPPS2a/mg UCN and 49.2 μg photomorpholino/mg UCN respectively (Table 1). These values were calculated by measuring the initial amount of TPPS2a and the photomorpholino in the solution used for loading and subtracting from it the amount of the two in the supernatant post loading. The UCNs were vacuum dried after loading and stored at 4°C and re-suspended only prior to use. The cumulative release of both the molecules in deionised (DI) water was sustained over several hours and is shown in

FIG. 26A.

Table 1: Characteristics of mesoporous silica-coated NIR-to-UV Vis core-shell UCNs

UCN mediated Photomorpholino cleavage and TPPS2a activation

[00139] Experiments to determine whether the UV emission from UCNs was sufficient to cleave the sense photomorpholino were conducted. Photomorpholinos were taken in two separate cuvettes, with one containing UCNs and one without. Both samples were irradiated with NIR at 980 nm. The sample that contained UCNs showed a higher absorption at 260 nm post irradiation. This was possibly due to the presence of more nucleic acid fragments in solution due to the photolysis of the sense

photomorpholino upon exposure to the upconverted UV light produced by the UCNs when irradiated with NIR (FIG. 26B), indicating successful photolysis via UCN-UV emission.

[00140] The visible emission peak of UCNs coincides with the excitation peak of TPPS2a (413 nm). To determine whether these core shell UCNs could indeed activate TPPS2a, the ROS produced after NIR irradiation for UCNs loaded with TPPS2a was measured in distilled water (FIG. 26C) and in cells (FIGs. 26D and 26 E). Increase in ROS production was observed with increase in the duration of NIR irradiation in distilled water; however in cells, the ROS production was localized and minimal (as can be seen from the faint green fluorescence of the ROS indicator). This was desirable as the goal of using this photosensitiser was not to cause cell death but to enhance endosomal escape via localized production of ROS in the endosomes. Also, TPPS2a did not affect the stability of the photomorpholino (FIG. 31) since the absorbance of the nucleic acid remained unchanged even after 24 hours of co-incubation with TPPS2a. In addition, the ROS produced by TPPS2a did not affect the functional integrity of the nucleic acid (FIG. 32).

Endosomal Escape

[00141] It was next evaluated whether UCNs localized in the endosome and whether the use of TPPS2a resulted in an enhanced endosomal release. FIGs. 26F and 26G show the distribution of core-shell UCNs loaded with TPPS2a in the same field of cells at time 0 and 10 mins after irradiation with NIR respectively. Initially the UCNs are present in clumps and not very well dispersed inside the cells. However, only 10 mins after irradiation, we could see a marked change in the distribution of UCNs, indicating improved endosomal release.

In vitro STAT3 knockdown

[00142] To test this system in vitro, B16F0 cells in which STAT-3 is aberrantly activated were used. Consistent activation of STAT-3 plays a major role in cancer progression and knockdown of STAT-3 has been found to enhance cell death, improve immune response and bring about tumor regression. UCNs co-loaded with TPPS2a and anti-STAT3 photomorpholino (double stranded: sense photomorpholino and

unmodified antisense strand) were used to target STAT3 in a specific manner. Initially the effect of TPPS2a on the cytosolic release of nanoparticles and the mechanism of action was studied by incubating B16F0 cells with TPPS2a loaded UCNs and UCNs alone for 8 hours at 37°C and 4°C respectively. After 8 hours of incubation, the cells were washed thoroughly and trypsinised. Using fluorescence spectrometry, the UCN concentration was then estimated in the cell suspension. The fluorescence intensity was similar for cells with UCNs alone and those incubated with TPPS2a and UCNs, indicating similar uptake (FIG. 33). These samples were then irradiated with NIR for 8 mins, replated and after overnight incubation, the concentration of nanoparticles inside the cells and in the media (supernatant) were quantified using fluorescence

spectrophotometry. The samples incubated at 4°C (endocytosis is arrested) had very minimal uptake with or without TPPS2a indicating that endocytosis is required for cellular uptake of UCNs. For the samples incubated at 37°C, there was an increase in cellular concentration of the UCNs loaded with TPPS2a when compared to those without TPPS2a as shown in FIG. 27A. Also the extracellular concentration of UCNs (in the supernatant) in cells treated with UCNs alone was higher than those with UCNs loaded with TPPS2a (FIG. 34). Since the initial UCN uptake amount was similar for both groups, the results when taken together suggested greater UCN retention in the cells with the use of TPPS2a. A larger amount of UCNs in the supernatant of the control group (UCNs only) suggested that the cells could indeed exocytose the nanoparticles if endosomal escape does not occur. These results indicated that UCNs enter the cells through endocytosis and escape the endosome via PCI, thereby effectively increasing the intracellular concentration of UCNs.

[00143] Next, experiments were conducted to determine if UCNs could be used for photocontrolled gene knockdown and whether enhancement in cellular uptake of UCNs via PCI increased the effectiveness of gene knockdown. For this B16F0 cells were treated with UCNs loaded with STAT-3 photo-morpholino, with or without TPPS2a and irradiated with NIR. FIG. 27B shows that UCNs were able to activate photo- morpholinos in both cases; however the STAT3 knockdown is significantly higher in the sample with TPPS2a (p=0.0063). The corresponding cytotoxicity of the samples after STAT-3 knockdown is given in FIG. 27C and their brightfield images are given in FIG. 35. It can be seen that there is a significant increase in cell death with PCI as compared to without, which is in line with the STAT3 knockdown results(p=0.0285). However it was seen that for both STAT-3 knockdown and STAT-3 induced

cytotoxicity, control groups namely cells treated with NIR irradiation alone, UCNs and UCNs loaded with TPPS2a did not cause significant changes. In vivo STAT3 Knockdown

[00144] To demonstrate the efficacy of this system in vivo mouse was chosen as a model organism. The STAT-3 photomorpholinos mentioned previously were used to knockdown STAT-3 in a tumor model of melanoma. Tumors were induced in mice by injecting B16F0 cells subcutaneously. UCNs loaded with STAT-3 photomorpholinos with or without TPPS2a, were administered on Day 5 and Day 8 and the tumors were irradiated with a NIR laser. Control mice received saline injections. FIG. 28 A illustrates that there was a significant reduction in tumor volume in mice that had been treated with UCNs loaded with photomorpholino (group 2) and with co-loaded (with photomorpholino and TPPS2a) UCNs (group 3) as compared to mice that had been given saline (group 1) with a p value of 0.14351 and 0.04134 respectively. Also, there was a marked decline in tumor volume in mice treated with UCNs co-loaded with photomorpholino and TPPS2a (group 3) as compared to those treated with

photomorpholino loaded UCNs alone (p value 0.00383). This indicated that core shell UCNs could be used for simultaneous PCI and photo-controllable gene expression and that this significantly enhanced the therapeutic effect. The mice in all these groups were otherwise healthy as shown by their body weight in FIG. 28B. Representative photographs of mice in different groups are given in FIGs. 28C-28E.

[00145] Several other controls were also included (treatment with UCNs alone, NIR alone, UCNs loaded with photomorpholino but without NIR irradiation, UCNs co- loaded with photomorpholino and TPPS2a but without NIR irradiation), as shown in FIG. 36. There was no significant reduction in tumor size in any of these control groups as compared to the saline treated mice. Analysis of the tissue samples harvested from these mice indicated lower STAT3 levels in mice treated with photomorpholino loaded UCNs (group 2) and co-loaded (photomorpholino and TPPS2a) UCNs (group 3) as compared to the control (p value 1.87187E-7 and 1.87187E-7 respectively) as shown in FIG. 29A. Also, STAT3 levels were significantly lower in case of co-loaded

(photomorpholino and TPPS2a) UCNs than photomorpholino loaded UCNs (p value 1.28959E-5), which re-affirmed the previous results. Also, UCNs did not result in significant hemolysis (FIG. 29B), re-affirming the relative safety of their use. From FIGs. 29C-29E, it can be seen that UCNs can be detected in the tumor tissue thus potentially enabling background free in-vivo imaging.

[00146] Nanoparticle-based gene therapy faces debilitating hurdles like poor endosomal escape and limited control over gene expression. In this study, a unique solution was provided to address existing limitations by developing a nano-platform, which could utilize highly penetrating NIR light for photoactivation. This is believed to be the first report of using such a system for simultaneous gene delivery, photo- controlled gene expression and photochemical internalization in-vitro and in-vivo with negligible toxicity and additional background free imaging capabilities.

[00147] The present results demonstrate that this UCN based system significantly enhances the delivery of photomorpholinos via PCI in vitro as well as in complex in vivo environments thereby improving the therapeutic efficacy of such nucleic acid based treatment modalities. Thus, these results have addressed major bottlenecks of in vivo gene delivery, primarily that of endosomal escape and non-specificity and demonstrated the tremendous potential of this system in furthering such RNAi based treatment modalities from the bench to bedside. In addition, the versatility of this nano- platform potentially allows it to be used in other disease models where gene therapy could be applicable.

Experimental Section

Materials

[00148] B16F0 cells were purchased from the American Type Culture Collection (ATCC). All chemicals for nanoparticle synthesis and surface coating like Yttrium chloride, Thulium chloride, Ytterbium chloride, N-[3-

(trimethoxysilyl)propyl]ethylenediamine (AEAPTMS), acetic acid and cyclohexane were purchased from Sigma-Aldrich (Singapore). Photo-morpholinos were purchased from Gene Tools, LLC, USA. TPPS2a was purchased from PCI Biotech, Oslo, Norway. CellTiter 96^® AQ_ue0us One Solution Cell Proliferation Assay for cytotoxicity testing was purchased from Promega, Madison, WI, USA. Image-iT LIVE Reactive Oxygen Species (ROS) Kit was purchased from Molecular Probes, OR, USA. Thermo

Scientific Pierce STAT3 In-Cell ELISA Kit was used for in-vitro STAT-3 analysis and STAT3 InstantOne™ ELISA kit (eBioscience, Inc.Belgium) for in-vivo STAT-3 analysis.

Synthesis of mesoporous coated Core-shell UCNs

[00149] Synthesis of core-shell UCNs was done by slight modification of an earlier method. In brief, P-NaY₇₄.₇F4:Yb2₅,Tmo_.3 core was synthesized using thermal decomposition method, and then purified and dispersed in cyclohexane. Briefly, 0.78 M of YC1₃, 0.20 M of YbCl₃, and 0.2 M of ErCl₃ was taken in a 50 ml three-necked flask and heated till dryness. Then, 6ml of Oleic Acid and 15ml of 10-Octadecene was added and the solution was heated till 150°C. After 30 minutes, the solution was cooled to 50°C and the previously synthesized NaYF₄:Yb,Tm core was added and the resulting mixture was heated to 110°C for 30 minutes to remove cyclohexane. Once the cyclohexane was removed, the solution was cooled to 50°C and O.lg of NaOH and 0.1482 g of NH4F in 5ml methanol each were added. Subsequently, the solution was heated to 110°C for 15 minutes and then degassed at the same temperature for next 20 minutes. The solution was then heated at 300°C under argon atmosphere for 1 hour, cooled to room temperature, purified and redispersed in cyclohexane.

[001S0] Mesoporous coating of the synthesized core-shell UCNs were done by calcination method. Briefly, the UCNs were coated with a silica layer as follows: 1ml of Igepal CO-520 and 18.4ml of cyclohexane were added to 1.6ml of O.05M UCNs, homogenized under ultrasonication. To the solution, 160ul of 30% Nh40H and 40ul of TEOS (Tetraethyl orthosilicate) was added and shaken for 2 days. After 2 days, the resulting silica coated UCNs were purified using acetone and Ethanol. Subsequently, a second coating of mesoporoous silica was done. To the as-synthesized silica coated UCNs, 2.6 ml of 30% NH40H, 13 mL ethanol, 260uL TEOS (Tetraethyl orthosilicate) and 104uL CI 8 TMS (Octadecyltrimethoxysilane 90%) were added and shaken for 6 hours. The resulting homogeneous white solution was dried in hot-air oven at 60°C overnight and then subsequently calcinated at 500°C in a furnace for 6 hours. The dried powder was then milled and subsequently dissolved in deionized water. Due to the multiple coating steps and possible UCN losses in these steps, it is often difficult to express the molarity of the UCNs obtained, instead the concentration in μg/ml

(weight/volume) is often used.

Characterization of UCNs

[00151] Transmission electron microscopy (TEM) images were recorded on a JEOL 201 OF transmission electron microscope (Jeol Ltd., Tokyo, Japan) operating at an acceleration voltage of 200 kV. Fluorescence spectra of UCNs were recorded on a Hitachi F-500 fluorescence spectrophotometer (Hitachi High-Technologies

Corporation, Tokyo, Japan) equipped with an NIR continuous wave laser with emission at 980 nm (Photonitech (Asia) Pte. Ltd., Singapore).

Cell culture

[00152] B 16F0 were grown in DMEM culture medium supplemented with 10% FBS, 100 units/mL of penicillin and 100 μg/mL of streptomycin, and maintained in a humidified, 5% carbon dioxide (C02) atmosphere at 37°C.

Cell viability assay

[00153] B16F0 cells were treated with different conditions and then incubated for 24 hours before being assayed for cell viability using an MTS assay as per manufacturer's instructions.

Co-loading onto and release of TPPS2a and Photomorpholino from UCNs

[00154] To lmL of 1 mg/n L UCNs, 25 nmoles each of sense photomorpholino and antisense morpholino against STAT3 (Gene Tools, LLC) were added and the mixture shaken at 1000 rpm for 2 hours protected from light. Then, 24 μΐ of TPPS2a (PCI Biotech, Norway) was added and shaken for another hour. The solution was then centrifuged at 8000rpm for 10 mins to separate the loaded UCNs. The supernatant was removed and the absorbance of photomorpholinos and TPPS2a measured. Comparing the amount of the two in the supernatant to the initial concentration added, we were able to calculate the amount of TPPS2a and photomorpholino loaded / mg of these core shell UCNs. After loading, the UCNs are vacuum dried and stored at 4°C and re-suspended immediately prior to use.

[00155] For release studies, the UCNs co-loaded with TPPS2a and photomorpholino were resuspended in DI water. After 2 hours, these UCNs were spun down, the supernatant collected and the amount of photomorpholino and TPPS2a measured in the supernatant. This was done at 2, 4, 6, 24 and 48 hours. Using the data obtained and comparing it to the amount of the two molecules loaded initially, a cumulative release graph was plotted to indicate the release profile of the two molecules. This experiment was repeated twice for independent validation.

Photolysis of Photomorpholino through UCN UV emission

[00156] To ascertain whether the UV emission form mesoporous silica coated core shell UCNs was sufficient to cause photolysis of the sense photomorpholino, two samples of these photomorpholinos were prepared, with one containing 0.5 mg/ml UCNs and one without. The concentration of photomorpholinos in the two samples was the same. These samples were then irradiated with NIR for 8 mins and then the absorbance measured at 260 nm (absorption maximum for nucleic acids). Photolysis would typically cause an increase in the number of nucleic acid fragments and subsequently an increase in the absorbance at 260 nm.

ROS detection in Solution

[00157] 2 mL of 1 mg/mL TPPS2a loaded UCN solution was taken in a cuvette. For control, 2 other cuvettes contained water and unloaded UCN solution respectively. To each of the three cuvettes 2 μΐ of APF was added. 100 μΐ of sample was taken from each of the cuvettes and spun down at 12000 rpm for 5 mins. 50 μΐ of supernatant was taken from each and put in a dark (opaque) 96 well plate (protected from light). The fluorescence of the samples was recorded (490/515 ex/em). The three cuvettes were then irradiated at different time points and after each time point 100 μΐ of sample was taken from each of the cuvettes and processed as mentioned above. The fluorescence readings were then plotted against time to indicate amount of ROS produced by TPPS2a with increasing duration of NIR exposure.

Using Image it Green Live ROS detection kit

[00158] B 16F0 cells were incubated with 0.5 mg/mL of UCNs loaded with TPPS2a overnight. The excess nanoparticles were then washed off the cells and the cells were irradiated using a 980 nm NIR laser. The ROS generated in the cells was detected using an Image-iT LIVE Reactive Oxygen Species (ROS) kit as per manufacturer's instruction. The cells were also counterstained with DAPI and imaged using a confocal laser-scanning microscope (Nikon CI Confocal, Nikon, Tokyo, Japan) specially fitted with a CW 980 nm laser excitation source (Opto-Link Corp., Hong Kong). All images were taken using the same gain and pixel dwell (30 β).

Cellular uptake of UCNs

[00159] B16F0 cells were incubated with mesoporous silica coated core-shell UCNs either loaded with TPPS2a or without. One set of the above said sample was incubated at 4°C and another at 37°C. After 8 hours of incubation, all the samples were irradiated with a 980 nm CW NIR laser for 8 mins. The samples were then incubated overnight at the respective temperatures. The cells were washed thrice to remove the UCNs present in the supernatant and the surface of the cells. The cells were then trypsinized and the fluorescence emission of the UCNs was recorded using a Hitachi F-500 fluorescence spectrophotometer (Hitachi High-Technologies Corporation, Tokyo, Japan) equipped with an NIR continuous wave laser with emission at 980 nm (Photonitech (Asia) Pte. Ltd., Singapore).

Redistribution of UCNs following PCI

[00160] B16F0 cells were plated on a 24 well plate. After overnight incubation, TPPS2a loaded UCNs were added to the test and control wells. After 8 hours of incubation, the media was removed and the cells were incubated with 0.1 mg/mL Concanavalin A-Alexa Fluor 488 in culture medium and 0.01 mg/mL DAPI for 30 min at 37°C. They were then washed thrice with PBS and replenished with fresh culture medium. The cells were then imaged using a confocal microscope (Nikon CI Confocal, Nikon, Tokyo, Japan) (UCNs, the cell stained with Concanavalin A and nuclei stained with DAP I). Concanavalin emission was pseudo-coloured to red to distinguish from the green emission of UCNs. Merging of the two images showed localization of UCNs in the cells. Another set of wells was irradiated with a CW 980 nm NIR laser for 8 mins and was imaged similarly after 10 mins.

ELISA for STAT3 knockdown

[00161] B16F0 cells (in which STAT3 is aberrantly activated) were incubated with UCNs loaded with double stranded (sense and antisense) anti STAT3 photomorpholino in 2 columns (3 wells/ column) of a 96 well plate and UCNs co-loaded with

photomorpholino and TPPS2a in 2 other columns. The concentration of UCNs/well was 500 μg/ml. For control, cells were plated without the nanoparticles. After 6-8 hours of incubation, the cells in 2 columns (one with UCNs loaded with

photomorpholino alone and one with co-loaded UCNs) were irradiated for 8 minutes with 980nm (NIR) radiation respectively. After this the plate was incubated for another 72 hours and then ELISA was performed according to the manufacturer's instructions.

In vivo studies

[00162] This study conforms to the Guide for the Care and Use of Laboratory

Animals published by the National Institutes of Health, USA and protocol approved by the Institutional Animal Care and Use Committee (IACUC), National University of Singapore. All experiments used C57BL/6 mice of 4-6 weeks old and anesthesia was done by intraperitoneal injection of ketamine (75 mg/kg body weight) and

medetomidine (1 mg/kg body weight).

In-vivo gene therapy using UCNs

[00163] Tumors were first developed in C57BL/6 mice by subcutaneously

implanting 3 x 10⁶ B16-F0 cells suspended in 100 of serum-free DMEM in the lower flanks of the mice. Six days after inoculation of tumor cells, the mice were randomly divided into different groups. Each groups were then injected with 100 μΐ of the following intra-tumorally. Group 1 - Saline, Group 2 - UCNs loaded with anti- STAT 3 photo morpholinos, Group 3 - UCNs co-loaded with TPPS2a and anti-STAT 3 photo morpholinos. Laser treatment was performed on groups 2 and 3, 6 hours after injection by irradiating the tumor region with a CW 980 nm laser (EINST Technology Pte Ltd, Singapore) at a laser power density of 300 mW/cm² and exposure time of 40 min. A second dose of the above PDT treatment was repeated three days following the first. Tumor size and body weight was measured thrice a week. The tumor volume, V, was calculated using the formula V = (LxW²)/2, where L is the longest dimension of the tumor and W is the perpendicular width to L.

Evaluating the expression of STAT-3 in tumors

[00164] At the end of study, 3 mice were chosen randomly from each group and euthanized. The tumors (50 mg each) were then homogenized and the homogenate was centrifuged at 12,000 rpm for 20 min. The supernatant was taken and used for further analysis. Expression of STAT-3 was measured using ELIS A.

UCN imaging in tumors

[00165] The tumors were harvested and snap frozen using liquid nitrogen. They were cryosectioned at 10-μηι thickness onto slides and fixed using paraformaldehyde. The sections were then counter-stained with DAPI and the fluorescence of DAPI and UCNS was imaged using a fluorescence confocal microscope (Nikon CI Confocal, Nikon, Tokyo, Japan).

Hemolytic activity test

[00166] rRBCs were washed with PBS thrice and subjected to 25 ^χ volumetric dilutions in PBS to achieve 4% blood content (by volume). Different concentrations of mesoporous silica coated UCNs were diluted in saline. Equal volume of blood and the UCN solution was mixed together and the mixture was incubated at 37°C for 1 h to allow for the interactions between rRBC and UCNs. After incubation, the mixture was centrifuged at 4000 rpm for 5 min and the supernatant was transferred into a 96-well microplate. The haemoglobin release was measured spectrophotometrically by measuring the absorbance of the samples at 576 nm using a microplate reader. Two control groups were provided for this assay: untreated rRBC suspension (as negative control), and rRBC suspension treated with 0.1% Triton-X (as positive control). Each assay was performed in triplicates.

Statistical Analysis

[00167] The normality of the populations was initially tested. The mean values of the different treatment groups were then statistically compared to that of the control group using AN OVA for normally distributed populations and Kruskal-Wallis ANOVA for populations that were not normally distributed using OriginPro 8.1. P < 0.05 was considered statistically significant.

Example 4: Light-activated endosomal escape using upconversion nanoparticles for enhanced delivery of drugs

[00168] Nanoparticle-based delivery of drugs has gained a lot of prominence recently but the main problem hampering efficient delivery of payload is the clearing or degradation of nanoparticles by endosomes. Various strategies have been used to overcome this issue and one such effective solution is Photochemical Internalization (PCI). This technique involves the activation of certain photosensitizing compounds by light, which accumulate specifically in the membranes of endocytic vesicles. The activated photosensitizers induce the formation of reactive oxygen species which in turn induces localized disruption of endosomal membranes. But the drawback of this technique is that it needs blue light for activation and hence confined to be used only in in- vitro systems due to the poor tissue penetration of blue light. This example describes the use of Upconversion nanoparticles (UCNs) as a transducer for activation of the photosensitizer, TPPS 2a. NIR light has good tissue penetrating ability and thus enables PCI in greater depths. Highly monodisperse, uniformly-sized, sub- 100 nm,

biocompatible upconversion nanoparticles were synthesized with a mesoporous silica coating. These UCNs activated TPPS 2a efficiently in solution and in cells. Paclitaxel, an anti-cancer drug was used as a model drug and was loaded into the mesoporous silica coating. B16F0 cells transfected with drug-loaded UCNs and irradiated with NIR showed significantly higher nanoparticle uptake and in turn higher cell death caused by the delivered drug. This technique can be used to enhance the delivery of any therapeutic molecule and thus increase the therapeutic efficiency considerably.

Materials and Methods

Synthesis and surface modification of nanoparticles

[00169] Yb/Er (Ytterbium/Erbium) doped NaYF₄ upconversion nanoparticles were synthesized in a one pot process and they were then coated with a mesoporous silica layer as reported previously in Qian HS, Guo HC, Ho PC-L, Mahendran R, Zhang Y. Mesoporous-Silica-Coated Up-Conversion Fluorescent Nanoparticles for Photodynamic Therapy. Small. 2009;5:2285-90. The silica coating, because of its stability in physiologic solutions, reduces the risk of a toxic affect due to leaching of lanthanide ions in to the body and also allows for controlled surface functionalization.

Nanoparticle Characterization

[00170] The UCNs were characterized by measuring size and zeta potential using Malvern Nano ZS (Zeta Sizer). TEM images of NIR-to-UV UCNs were recorded on a JEOL 201 OF TEM and fluorescence emission spectrum of the same was acquired on a SpetraPro 2150i fluorescence spectrometer equipped with a commercial 980 nm NIR laser.

Detection of singlet oxygen

Singlet Oxygen production by TPPS2a: using ABDA

[00171] 1 ml of lmg/ml UCNPs was sonicated for 1-2 hours, after which the solution was transferred to a cuvette. Then 100 μΐ of 10μΜ ABDA (9, 10-anthracenediyl-bis (methylene) dimalonic acid) and 3μ1 of 0.35mg/ml TPPS2a were added to the cuvette (final concentration of TPPS2a becomes 1 μg/ml). Light at 390 nm was used for excitation and the resulting fluorescence was measured in the 400-450 range. The solution was irradiated for 2 mins with NIR and the fluorescence measured

(alternatively, the solution can be irradiated directly with light in the 375-450 nm range). Following this, the solution was irradiated till 8 mins, 2 mins at a time and fluorescence measured each time i.e. at 0, 2, 4, 8 mins. ABDA had a characteristic fluorescence at 431nm, with production of singlet oxygen, more and more ABDA is consumed and this results in the decline in fluorescence. The fluorescence values at 431 run were noted and a graph of fluorescence intensity versus irradiation time was plotted.

ROS Production By TPPS2a in cells

[00172] ROS (reactive oxygen species) generated in cells treated with TPPS2a (incubated with UV-visible UCNPs and 1 μg/ml TPPS2a) were detected immediately after irradiation (8 minutes) using an Image-iT LIVE Reactive Oxygen Species (ROS) Kit (Molecular Probes, OR, USA) as per manufacturer's instruction. The culture medium of cells was first replaced with HBSS (Hanks balanced salt solution) containing 25μΜ carboxy-H2DCFDA and 0.1 mg/ml DAP1 that sufficiently covers the adhering cells. The cells were then subjected to irradiation by 980 nm NIR laser irradiation for 8 min before they were washed thrice with plain HBSS. Immediately after that, fluorescent images of carboxy-H2DCFDA, and DAPI stainings on the cells were promptly captured by excitation at 488, and 408 nm respectively using a confocal laser- scanning microscope (Nikon C 1 Confocal, Nikon, Tokyo, Japan).

Drug Delivery

Loading of Paclitaxel onto UCNs

[00173] To 1ml of 1 mg/ml UCNs, 0.5 mg of Paclitaxel was added. The solution was then shaken at 1000 rpm for 3 hours and then centrifuged at 8000rpm for 15 mins. The tubes containing the pellet (UCNPs loaded with paclitaxel) were then subjected to 1 hour of vacuum (this is done to improve the loading of the drug in to the pores of the mesoporous silica coated nanoparticles). The pellet was then resuspended in media to the stock concentration of 2 mg/ml. Drug delivery and PCI

[00174] To determine the efficacy of PCI in improving endosomal escape of nanoparticles and hence drug delivery, the cell death resulting from drug loaded nanoparticle alone was compared to cell death in the presence of drug loaded nanoparticles and TPPS2a (0.7 μg/ml). Two controls were used, in the first control, cells were plated without the nanoparticles (and without TPPS2a) and in the second control, cells were incubated with unloaded nanoparticles. In one of the test column cells (10000/well) were plated with 50(^g/ml of paclitaxel loaded nanoparticles (no TPPS2a) and in the other test column cells were plates with paclitaxel loaded nanoparticles and TPPS2a. After 24 hours of incubation, the cells in the 4 columns were irradiated with 8 minutes of 980nm (NIR) radiation respectively. The next day, an MTS assay was performed to determine cell viability. All measurements were done in triplicate.

Results and Discussion

[00175] To characterize the mesoporous silica coated UCNPs, their size, zeta potential and fluorescence emission were measured. The results are shown in FIG. 37.

[00176] FIG. 37 shows a TEM image of the Yb/Er UCN core (FIG. 37A), UCN with silica coating (FIG. 37B) and UCN core with a mesoporous silica coating (FIG. 37C). The particles are uniform in size and are less than lOOnm.

[00177] In order to study the fluorescence of these particles, they were excited with a 980nm laser and the fluorescence emission spectrum was obtained using a

spectrofluorometer. From FIG. 38 it can be seen that the particle emitted light in the visible range as expected.

[00178] One of the problems associated with use of nanoparticles for drug delivery is the low uptake of the nanoparticles by the cells and degradation of nanoparticles in the acidic endosomal compartment. PCI is a technique that can be used to overcome this problem. A mild photosensitizer TPPS2a that localizes in the endosomes was identified. Its excitation range is 375-450 nm, which falls in the emission range of the UCNs being used. Thus, PCI could be integrated with the system. A schematic below portrays the difference between normal UCN delivery and delivery in the presence of PCI. When cells incubated with TPPS2a and UCNs are irradiated with NIR, the UCNs emit visible light, which excites the photosensitizer embedded in the walls of the endosomal vesicles. Upon excitation, TPPS2a produces ROS, which cause the disruption of the endosomal vesicle thereby enhancing the release of the UCNs into the cytoplasm.

[00179] Since the photosensitizer TPPS2a acts through the localized production of reactive oxygen species, experiments were first conducted to confirm whether the emission from UCNs was sufficient to excite TPPS2a to produce ROS. This was done by two methods. In the first method, ABDA (singlet oxygen scavenger) was used to detect singlet oxygen production and in the second method a dye that stains for ROS in cells was used. In FIG. 40A it can be seen that the fluorescence intensity of ABDA at 431 nm declines with increasing irradiation time (roughly 20% after 2 mins of irradiation). This indicates that singlet oxygen is being produced by TPPS2a and is consumed by the ABDA.

[00180] Image it Green live staining in FIGs. 40B-40D is an indicator of ROS production by TPPS2a in cells (upon excitation). It can be seen that TPPS2a when excited does indeed produce ROS as can be seen by the green staining in FIG. 40D. The staining is not very dark which is in keeping with the theory that the production of ROS is localized. Also, the ROS production is because of the TPPS2a and not an artifact because in the negative control (with cells only), there is no staining. Also, in the second control (with TPPS2a but without excitation/irradiation), the staining is minimal.

[00181] After having established that emission from UCNs is sufficient to excite TPPS2a in cells and produce ROS, experiments were conducted to ascertain whether PCI in combination with UCNs enhanced the delivery of the drug paclitaxel in to the cells. This was done by comparing cell viability after treatment with drug loaded nanoparticle alone to the cell viability after tretament with drug loaded nanoparticles and TPPS2a (0.7 μg/ml). From FIG. 41 it is evident that cell viability is reduced significanlty ( about 25%) when the photosensitiser TPPS2a is used. Thus, PCI using TPPS2a is a simple way of improving nanoparticle mediated drug delivery.

[00182] In sum, fluorescent upconversion nanoparticles offer good promise in overcoming the current hurdles in photochemical internalization. This technique can be further used to deliver other macromolecules efficiently. Further studies will be performed to demonstrate UCN-based photochemical internalization in an in- vivo model.

[00183] It should be understood that for all numerical bounds describing some parameter in this application, such as "about," "at least," "less than," and "more than," the description also necessarily encompasses any range bounded by the recited values. Accordingly, for example, the description at least 1, 2, 3, 4, or 5 also describes, inter alia, the ranges 1-2, 1-3, 1-4, 1-5, 2-3, 2-4, 2-5, 3-4, 3-5, and 4-5, et cetera.

[00184] For all patents, applications, and other references cited herein, such as nonpatent literature and reference sequence or chemical information, it should be understood that it is incorporated by reference in its entirety for all purposes as well as for the proposition that is recited. Where any conflict exits between a document incorporated by reference and the present application, this application will control.

[00185] Headings used in this application are for convenience only and do not affect the interpretation of this application.

[00186] Preferred features of each of the aspects provided by the invention are applicable to all of the other aspects of the invention mutatis mutandis and, without limitation, are exemplified by the dependent claims and also encompass combinations and permutations of individual features {e.g., elements, including numerical ranges and exemplary embodiments) of particular embodiments and aspects of the invention including the working examples. For example, particular experimental parameters exemplified in the working examples can be adapted for use in the claimed invention piecemeal without departing from the invention. For example, for materials that are disclosed, while specific reference of each various individual and collective

combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein, as are methods of making and using such compounds. Thus, if a class of elements A, B, and C are disclosed as well as a class of elements D, E, and F and an example of a combination of elements, A-D, is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specifically contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. This concept applies to all aspects of this application, including elements of a composition of matter and steps of method of making or using the compositions.

[00187] The forgoing aspects of the invention, as recognized by the person having ordinary skill in the art following the teachings of the specification, can be claimed in any combination or permutation to the extent that they are novel and non-obvious over the prior art. Thus, to the extent an element is described in one or more references known to the person having ordinary skill in the art, they may be excluded from the claimed invention by, inter alia, a negative proviso or disclaimer of the feature or combination of features.

[00188] While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.

Claims

CLAIMS What is claimed is:

1. A composition comprising an upconversion nanoparticle (UCN) configured for near infrared (NIR) light excitation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission.

2. The composition of Claim 1 , wherein the UCN further comprises a mesoporous outer layer.

3. The composition of Claim 2, wherein the mesoporous outer layer comprises silica.

4. The composition of any one of Claims 1 to 3, wherein the UCN is a core-shell UCN.

5. The composition of Claim 4, wherein the core-shell UCN comprises a UV light emitting core and a visible light emitting shell.

6. The composition of Claim 4 or 5, wherein the core-shell UCN comprises 2, 3 , 4, 5, or more shells.

7. The composition of any one of the preceding claims, wherein the composition further comprises an amphiphilic photosensitizer.

8. The composition of Claim 7, wherein the photosensitizer is meso- tetraphenylporphine with two sulfonate groups on adjacent phenyl rings

(TPPS2a) or Al(III) phthalocyanine disulfonate chloride (adjacent isomer) (AlPcS_2a).

9. The composition of Claim 7 or 8, wherein the photosensitizer is adsorbed to a mesoporous outer layer of the UCN.

10. The composition of any one of the preceding claims, further comprising a caged bioactive molecule.

11. The composition of Claim 10, wherein the caged bioactive molecule is

associated with a mesoporous outer layer of the UCN.

12. The composition of Claim 10 or 11, wherein the caged bioactive molecule is selected from a siRNA, a morpholino, a plasmid, a protein, a peptide, an amino acid, a neurotransmitter, a coenzyme, a small molecule, or a combination thereof.

13. A composition comprising an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission and visible light emission, wherein the UCN is contained within a mesoporous outer layer and further wherein the mesoporous outer layer comprises an adsorbed amphiphilic photosensitizer and an adsorbed caged bioactive molecule.

14. A method of visualizing a biological tissue comprising exposing tissue

previously contacted with the composition of any one of the preceding claims to NIR light, and detecting UV, visible light, or UV and visible light emitted from the UCN.

15. The method of Claim 14, wherein the issue is a tissue contained in a live

chordate.

16. The method of Claim 15, wherein the chordate is a zebrafish.

17. The method of Claim 15, wherein the chordate is a vertebrate.

18. The method of Claim 17, wherein the vertebrate is a mammal, such as a primate, such as a human.

19. A method of visualizing a biological tissue comprising: contacting the tissue with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission;

exposing the tissue to NIR light; and

detecting UV light, visible light, or UV and visible light emitted from the

UCN.

20. The method of any one of Claims 14-19, wherein the visualizing of the tissue is non-destructive.

21. A method of photochemical internalization of a UCN comprising exposing a cell previously contacted with the composition of Claim 7 to NIR light to release the UCN to the cytosol of the cell.

22. The method of Claim 21 , wherein the cell comprises a photosensitive ion

channel.

23. The method of Claim 22, wherein the photosensitive ion channel is

Channelrhodopsin.

24. The method of Claim 22 or 23, wherein the photosensitive ion channel is

stimulateable by light with the wavelength of an emission peak of the UCN.

25. A method of photochemical internalization of a UCN comprising:

contacting a cell with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission, wherein the UCN has a mesoporous outer layer with an adsorbed amphiphilic photosensitizer; and

exposing the cell to NIR light to release the UCN to the cytosol of the cell.

26. The method of Claim 25, further comprising detecting UV light, visible light, or UV and visible light emitted from the UCN.

27. The method of Claim 25 or 26, wherein the UCN comprises a caged bioactive molecule adsorbed to the mesoporous outer layer of the UCN.

28. The method of any one of Claims 21-27, wherein the photochemical

internalization is non-destructive to the cell.

29. A method of delivering a target compound to a cell comprising:

contacting the cell with an upconversion nanoparticle (UCN) configured for near infrared (NIR) light activation and ultraviolet (UV) light emission, visible light emission, or UV and visible light emission, wherein the UCN has a mesoporous outer layer with an adsorbed amphiphilic photosensitizer and an adsorbed target compound; and

exposing the tissue to NIR light to release the UCN to the cytosol of the cell.

30. The method of Claim 29, wherein the target compound is a bioactive molecule.

31. The method of Claim 30, wherein the bioactive molecule is a caged bioactive molecule releasable by light with the wavelength of an emission peak of the UCN.

32. The method of Claim 31 , wherein the caged biomolecule is released

substantially simultaneously with the activation of the amphipillic

photosensitizer.

33. The method of Claim 30 or 31 , wherein the bioactive molecule is a

chemotherapeutic agent.

34. The method of Claim 33, wherein the chemotherapeutic agent is taxane.

35. A method of modulating nucleic acid expression in a cell comprising exposing a cell previously contacted with the composition of any one of Claims 10 to 13 to NIR light to release the bioactive molecule to the cytosol of the cell, wherein the bioactive molecule modulates nucleic acid expression.

36. The method of Claim 35, wherein the cell is an isolated cell.

37. The method of Claim 35, further comprising administering the isolated cell to a tissue.

38. The method of Claim 37, wherein the tissue is in a multicellular organism.

39. The method of Claim 38, wherein the multicellular organism is a chordate, such as a zebrafish, or a vertebrate, such as a mammal, such as a human.

40. A method of treating cancer or reducing tumor volume in a subject in need

thereof, comprising administering a therapeutically effective amount of the composition of any one of Claims 1 -13 to the subject, wherein the UCNs in the composition have a chemotherapeutic agent on their outer surface.

41. The method of Claim 40, wherein the cancer is melanoma, the chemotherapeutic agent is paclitaxel, and the subject is human.