WO2014194129A2 - Cell-free synthetic incorporation of non-natural amino acids into proteins - Google Patents
Cell-free synthetic incorporation of non-natural amino acids into proteins Download PDFInfo
- Publication number
- WO2014194129A2 WO2014194129A2 PCT/US2014/040078 US2014040078W WO2014194129A2 WO 2014194129 A2 WO2014194129 A2 WO 2014194129A2 US 2014040078 W US2014040078 W US 2014040078W WO 2014194129 A2 WO2014194129 A2 WO 2014194129A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- trna
- natural amino
- seq
- amino acids
- trnas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P21/00—Preparation of peptides or proteins
- C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
Definitions
- the present disclosure generally relates to the field of protein engineering and protein biosynthesis, and more particularly to the fields of methods and compositions for producing proteins or polypeptides that incorporate non-natural amino acids.
- non-natural amino acid with a chemically unique side chain at the desired location in the protein can selectively introduce unique chemical and physical properties to target proteins, while at the same time incorporation of a NNAA may also preserve the native structure and activity of the target proteins.
- non-natural amino acids add to the chemical diversity of protein, and thus can be used to create proteins with new functions. To date more than 50 non-natural amino acids have been incorporated into proteins produced in bacterial, yeast and mammalian systems.
- Non-natural amino acid incorporation into proteins thus is a promising and rapidly advancing way to expand the language of biology, however, conventional technology has several limitations. These limitations include: 1) inefficient and inaccurate AA incorporation due to competition from native components; 2) inefficient and inaccurate NNAA incorporation due to the challenge of controlling and optimizing the concentrations and activities of the exogenous machinery necessary for NNAA incorporation; 3) limited protein yields at the laboratory scale; and 4) toxicity of the non-natural product and intermediates (including the NNAA itself) to a host organism.
- a cell-free protein synthesis system may provide many advantages such as, but not limited to, improved monitoring and control, reduced reaction volumes, virtually silenced background expression, simplified purification, and removal of the effect of many toxins. Accordingly, a need exists for a cell-free synthesis system to overcome the limitations of the in vivo expression and enable the incorporation of many different NNAAs. Particularly, there is a need to overcome the lack of naturally occurring unique codons that are not employed by endogenous machinery and that can be used to encode for NNAA incorporation.
- a method for incorporating at least one non-natural amino acid into a polypeptide uses a cell-free protein synthesis system which includes a cell-free extract and is deficient in endogenous tRNA.
- the method includes providing the cell-free protein synthesis system with the at least one non- natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA corresponding to the at least one non-natural amino acid.
- the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
- the methods include removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA and providing the synthesis system with a set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon.
- a method for producing a set of tRNAs for one or more natural amino acids includes identifying gene sequences encoding for tRNAs for the one or more natural amino acids, and producing the tRNAs for the natural amino acids with RNA polymerase and tRNA gene templates that include the tRNA gene sequences.
- a minimal set of tRNA gene sequences for one or more natural or non-natural amino acids is also provided.
- the tRNA gene sequences for one or more natural amino acids are set forth in SEQ ID NOs: 1- 21 (Table 1).
- a method for synthesizing a polypeptide includes providing at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase, and an orthogonal tRNA corresponding to the at least one non-natural amino acid, wherein the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
- the method includes contacting a non-natural amino acid with an orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA.
- the method is conducted in a cell-free environment.
- the cell-free environment is deficient in endogenous tRNA.
- FIG. 1 illustrates a method for incorporating at least one non-natural amino acid into a polypeptide using a cell-free system according to an embodiment of the present disclosure
- FIG. 2 shows a comparison of protein expression level as measured by fluorescence activity of produced green fluorescent protein (GFP) with different treatment time of RNAse immobilized on matrix material or beads and/or addition of 0.4 mg/mL and 2 mg/mL purified bulk tRNA: (1) untreated cell-free protein synthesis (CFPS) system as a control; (2) addition of protease inhibitor phenylmethylsulfonyl fluoride (PMSF) to untreated CFPS as a control; and (3)-(7) 5 min, 10 min, 20 min, 30 min and 60 min treatment of the CFPS system with RNAse immobilized on matrix material or beads;
- CFPS cell-free protein synthesis
- PMSF protease inhibitor phenylmethylsulfonyl fluoride
- FIG. 3 is a schematic representation of a tRNA gene template illustrating an embodiment of the design of the tRNA gene to synthesize tRNAs with an RNA polymerase in vitro or in a tRNA-free cell-free system;
- FIG. 4 shows a gel electrophoresis pattern for PCR synthesized tranzyme tRNA via in vitro transcription: A) lanes from left to right: DNA ladder, negative and positive controls; B) lanes from left to right: DNA ladder, bulk purified tRNA, synthesized tranzyme tRNA from the T7-IVT (T7- In vitro transcription) reaction; Negative control.
- FIG. 5 shows a comparison of cell-free protein synthesis level of CI 4- labeled polyvaline in a cell-free tRNA-depleted extract with 1) coexpression of orthogonal tranzyme DNA (otDNA); 2) no presence of tRNA; 3) addition of purified bulk E. coli tRNA;
- FIG. 6 shows a comparison of protein expression level as measured by fluorescence activity of produced GFP with treatment of different recycled bead- immobilized RNAses for different incubation time
- FIG. 7 shows a comparison of protein expression level as measured by fluorescence activity of produced GFP with treatment of different multiple-recycled bead-immobilized RNAses and/or addition of purified bulk tRNA to the cell-free protein synthesis system with different incubation time;
- FIG. 8 shows a comparison of cell-free protein synthesis level of CI 4- labeled poly valine in a cell-free tRNA-depleted extract with 1) left: change of concentration of Val otDNA as concentration of fMet otDNA was held constant; 2) right: change of concentration of fMet otDNA as concentration of Val otDNA was held constant.
- the present disclosure relates to methods for incorporating non-natural amino acids into a polypeptide using a cell-free protein synthesis system, wherein the cell-free protein synthesis system is deficient in endogenous tRNA.
- the present disclosure also relates to methods for producing a set of tRNAs for one or more natural amino acids that can be used in the cell-free protein synthesis system.
- the present disclosure also describes tRNA gene sequences to synthesize both natural amino acids and non-natural amino acids in vivo and in a tRNA-free, cell-free system.
- the practice of methods disclosed herein will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology, recombinant DNA techniques, and RNA transcription by in vitro transcription within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, et al. Molecular Cloning: A Laboratory Manual (Current Edition); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., Current Edition); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., Current Edition); Transcription and Translation (B.
- genes include coding sequences and/or the regulatory sequences required for their expression.
- gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences.
- Genes also include non-expressed DNA segments that, for example, form recognition sequences for other proteins.
- Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
- orthogonal refers to a molecule (e.g., an orthogonal tRNA (O-tRNA) and or an orthogonal aminoacyl tR A synthetase (O- RS)) that is used with reduced efficiency by a system of interest (e.g., a translational system, e.g., a cell).
- Orthogonal refers to the inability or reduced efficiency, e.g., less than 20% efficient, less than 10% efficient, less than 5% efficient, or e.g., less than 1% efficient, of an O-tRNA and/or O-RS to function in the translation system of interest.
- An orthogonal molecule may function independently of or without interactions with the synthetases and tRNAs endogenous to the system of interest.
- an O-tRNA in a translation system of interest aminoacylates any endogenous RS of a translation system of interest with reduced or even zero efficiency, when compared to aminoacylation of an endogenous tRNA by the endogenous RS.
- preferentially aminoacylates refers to an efficiency of, e.g., about
- the unnatural amino acid is then incorporated into a growing polypeptide chain with high fidelity, e.g., at greater than about 75% efficiency for a given selector codon, at greater than about 80% efficiency for a given selector codon, at greater than about 90% efficiency for a given selector codon, at greater than about 95% efficiency for a given selector codon, or at greater than about 99% or more efficiency for a given selector codon.
- Non-specific base pairing refers to any base pairing between the tRNA anticodon loop and amino acids that is weaker than the Watson-Crick base-pairing. In most cases, except Met and Trp, a natural amino acid is encoded by two or more genetic codes (i.e. degenerate genetic codes). To recognize all the degenerate genetic codes for the natural amino acid, the anticodon loop of the wild-type tRNA(s) relies on both promiscuous base-pairing (e.g. wobble base-paring) and pure Watson-Crick base-pairing.
- Non-specific base pairing refers to base pairing between the tRNA anticodon loop and amino acids that is weaker than the Watson-Crick base-pairing. Non-specific base pairing may be facilitated by post-transcriptional modifications known in the art.
- Standard “canonical,” or “natural” amino acids are the 20 proteinogenic alpha-amino acids that in nature are the building-blocks of proteins within all domains of life, and that are also directly encoded by the genetic code. All others are known as “non-standard,” “non-canonical,” “non-natural” or “unnatural.”
- non-natural amino acid As used herein, the terms “non-natural amino acid,” “NNAA,” and
- unnatural amino acid interchangeably refer to any amino acid, modified amino acid, and/or amino acid analogue that is not one of the 20 naturally occurring amino acids or selenocysteine.
- unnatural amino acids include but not limited to: an unnatural analogue tyrosine, glutamine, phenylalanine, serine, threonine; an alkyl, aryl, acyl, azido, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynl, ether, thiol, sulfonyl, seleno, ester, thioacid, borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, hydroxylamine, keto, or amino substituted amino acid, or any combination thereof; an amino acid with a photoactivatable cross-linker; a spin-labeled amino acids with a photo
- the unnatural amino acid can be an O-methyl-L-tyrosine, an L-3-(2- naphthyl)alanine, a 3-methyl-phenylalanine, an 0-4-allyl-L-tyrosine, a 4-propyl-L- tyrosine, a tri-O-acetyl-GlcNAcp-serine, an L-Dopa, a fluorinated phenylalanine, an isopropyl-L-phenylalanine, a p-azido-L-phenylalanine, a p-acyl-L-phenylalanine, a p-benzoyl-L-phenylalanine, an L-phosphoserine, a phosphonoserine, a phosphonotyrosine, a p-iodo-phenylalanine, a p-bromophenylalanine, a p-amino-L- phen
- the at least one unnatural amino acid is an L-3-(2-naphthyl) alanine. In another set of specific examples, the at least one unnatural amino acid is an amino-, isopropyl-, or O-allyl-containing phenylalanine analogue.
- orthogonal aminoacyl-tRNA synthetase OFS
- O-tRNA orthogonal aminoacyl-tRNA synthetase
- NNAA which works in concert to charge the O-tRNA with the NNAA.
- the exogenous O-RS/O-tRNA pair is mutated to exclusively recognize and charge the corresponding NNAA to the exogenous tRNA.
- Such components are known in the art, for example as described in U.S. Pat. No. 7,045,337, issued May 16, 2006, incorporated herein by this reference.
- the orthogonal tRNA recognizes a selector codon, which may be nonsense codons such as, stop codons, e.g., amber, ochre, and opal codons; or four or more base codons; codons derived from natural or unnatural base pairs and the like. In almost all cases there is competition from endogenous components for the selector codon.
- the orthogonal tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates the NNAA at this site in the polypeptide.
- the term “tranzyme” refers to a ribozyme-tRNA complex.
- cell-free protein synthesis refers to an in vitro protein synthesis using a cell extract. This may be protein synthesis in a cell-free translation system for producing proteins on ribosome through reading of information of mRNA or protein synthesis in a coupled system comprising a cell- free transcription system that produces mRNA using DNA as a template and a cell- free translation system that translates the mRNA information into proteins.
- DNA is used for a template
- various kinds of template DNA can be prepared simultaneously and rapidly by the amplification reaction in vitro such as Polymerase Chain Reaction (PCR).
- the cell extracts may be derived from any eukaryotic or prokaryotic cells, such as E. coli, yeast, wheat germ extract, rabbit reticulocyte cells, insect cells, animal cells and human cell lines etc.
- derived from refers to a component that is isolated from an organism or isolated and modified, or generated, e.g., chemically synthesized, using information of the component from the organism.
- deficient in endogenous tRNA refers to a cell-free protein synthesis system where the endogenous tRNA has been removed or degraded to a minimal amount that the endogenous tRNA cannot compete with the exogenous tRNA.
- the cell-free protein synthesis systems also known as in vitro protein production systems, for the present disclosure may be cell-free translation systems based on cell extracts.
- a cell-free protein synthesis system which is deficient in endogenous tRNA is used.
- the CFPS may also include a combination of biomachinery from different organisms to create synthetic pathways and products known by a person skilled in the art.
- the CFPS is a combined reaction mix of biomachinery from different biological extracts and/or defined reagents.
- the reaction mix will comprise a template for production of the macromolecule, e.g. DNA, mRNA, etc.; monomers for the macromolecule to be synthesized, e.g. non- natural amino acids, nucleotides, etc., and such co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, polymerases, transcriptional factors, etc., except the endogenous tRNA, which can be removed from the biological extracts.
- a template for production of the macromolecule e.g. DNA, mRNA, etc.
- monomers for the macromolecule to be synthesized e.g. non- natural amino acids, nucleotides, etc.
- co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, polymerases, transcriptional
- the tRNA for either non-natural amino acids or natural amino acids or a combination of both can be synthesized exogenously, purified and added to the reaction mix of the invention.
- the tRNAs can be synthesized in the reaction mix.
- the cell free synthesis reaction may be performed as batch, continuous flow, semi-continuous flow, continuous exchange, or other methods as known in the art.
- Cell extracts as used herein may be any preparation comprising the components required for protein synthesis machinery.
- the cell-free protein synthesis system may include extracts from eukaryotic or prokaryotic cells, such as E-coli, yeast, wheat germ extract, rabbit reticulocyte cells, insect cells, animal cells and human cell lines etc.
- a bacterial cell extract that includes components capable of expressing a nucleic acid encoding a desired protein may be used.
- a bacterial extract includes components that are capable of translating messenger ribonucleic acid (mRNA) encoding a desired protein, and optionally includes components that are capable of transcribing DNA encoding a desired protein.
- mRNA messenger ribonucleic acid
- Such components include, for example, DNA-directed RNA polymerase (RNA polymerase), any transcription activators that are required for initiation of transcription of DNA encoding the desired protein, aminoacyl-tRNA synthetases, 70S ribosomes, N10-formyltetrahydro folate, formylmethionine- tRNAfJVIet synthetase, peptidyl transferase, initiation factors such as IF-1, IF -2 and IF-3, elongation factors such as EF-Tu, EF-Ts, and EF-G, release factors such as RF-1, RF-2, and RF-3, and the like.
- RNA polymerase DNA-directed RNA polymerase
- any transcription activators that are required for initiation of transcription of DNA encoding the desired protein
- aminoacyl-tRNA synthetases aminoacyl-tRNA synthetases
- 70S ribosomes N10-formyltetrahydro fo
- the reaction mixture includes extracts from bacterial cells, e.g. E. coli S12 extracts.
- the bacterial cells are modified such that the bacterial cells endogenously express an orthogonal tRNA.
- the organism used as a source of extracts may be referred to as the source organism. Exemplary methods for producing active extracts may be found in Pratt (1984), Coupled transcription-translation in prokaryotic cell-free systems, p. 179-209, in Hames, B. D. and Higgins, S. J. (ed.), Transcription and Translation: A Practical Approach, IRL Press, New York; Kudlicki et al.
- E. co/z ' -based CFPS may be modified to decrease background gene expression and increase protein production to levels to exceed 1 mg/mL (Liu et al. (2005) Biotechnol Progr. 21 :460-5; Yang et al. (2012) Biotechnol Progr. 28:413-20), incorporated by reference.
- Orthogonal aminoacyl-tRNA Synthetases are enzymes that charge (acylate) tRNAs with non-natural samino acids. These charged aminoacyl tRNAs then participate in mRNA translation and protein synthesis.
- the O-RS show high specificity for charging a specific orthogonal tRNA with the appropriate non-natural amino acid. For example, valyl-tRNA with valine by valyl-tRNA synthetase, or tryptophanyl-tRNA with tryptophan by tryptophanyl-tRNA synthetase.
- O-RS and tRNA pairs used in the present disclosures as examples are O-RS derived from Methanocaldococcus jannaschii and Tyrosyl derivative as described in U.S. Pat. No. 7,713,721, issued May 11, 2010; Methanosarcina barkeri and Pyrrolysyl (Genbank Accession Number: AY273828.1); and Saccharomyces cerevisiae and Tryptophanyl (modified based on NCBI Accession Number NM 001183351.1, Chatterjee et al. (2013) Angewandte Chemie Int. Ed. 52(19): 5106-09), all incorporated by reference.
- Orthogonal tRNA synthetase can be synthesized exogenously, purified and added to the reaction mix.
- the orthogonal tRNA synthetase as added to the reaction mix in a defined quantity, of at least about 10 ⁇ g/ml, at least about 20 ⁇ g/ml, at least about 30 ⁇ g/ml.
- the protein may be synthesized in bacterial or eukaryotic cells and purified, e.g. by affinity chromatography, PAGE, gel exclusion chromatography, reverse phase chromatography, and the like, as known in the art.
- the E. co/z ' -orthogonal synthetase can be produced in vivo and purified, as previously described Smith et al. (2013) Biotechnol Prog. 29:247-54 incorporated by reference.
- proteins comprising at least one unnatural amino acid can be produced at a concentration of at least about 10, 50, 100 or more micrograms per liter, e.g., in a composition comprising a cell extract, a buffer, a pharmaceutically acceptable excipient, and/or the like.
- the present disclosure provides a method for incorporating at least one NNAA into a protein using a cell-free system.
- the protein synthesized with the methods disclosed herein can be either a polypeptide with both natural amino acids and non-natural amino acids incorporated.
- the protein synthesized according to the method described herein can be an entirely synthetic protein construct which incorporates non-natural amino acids only.
- the cell-free synthesis reaction may involve both orthogonal tRNA/orthogonal aminoacyl-tRNA synthetase and natural tRNAs/natural aminoacyl-tRNA synthetase for natural amino acids.
- the methods include removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA and providing the synthesis system with a set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon.
- the ribonuclease can be RNase A, Onconase, Colicin D tRNase or other ribonuclease depending on the types of cell extract used for the cell-free synthesis reaction.
- the tRNAs for either the NNAAs or natural amino acids or both can be synthesized in the cell-free protein synthesis system. In some embodiments, these tRNAs can also be synthesized exogenously and added to the cell-free protein synthesis system.
- both the orthogonal tRNAs and tRNAs for natural amino acids can be made with an RNA polymerase and a tRNA gene template comprising the gene sequences of the tRNA.
- the tRNA gene template can be a linear expression template. The design of the synthetic tRNA can be produced such that the 5' and 3 ' ends of the final RNA product will include the appropriate termini for tRNA.
- the linear tRNA templates can be generated using single-step or two-step PCR.
- a hammerhead ribozyme cleaves the 5' end appropriately, while the 3' end is digested prior to transcription to allow the T7 RNAP to terminate transcription by releasing the DNA rather than using a T7 terminator sequence.
- the linear tRNA template can also terminate RNA-polymerase action by ending the tRNA-gene abruptly at the 3 ' terminus of the tRNA gene.
- a concentration ratio of the tRNAs and tRNA gene template can also be optimized to increase efficiency of the non-natural amino acid incorporation.
- the codons for the non-natural amino acids can be selected based on the codons of the one or more natural amino acids so that the competition between the natural amino acids and the non-natural amino acids to be attached to the orthogonal tRNAs is reduced.
- the codons for the non-natural amino acids can be selected based on frequency of codon use, frequency of being incorporated by natural tRNAs, and predicted promiscuity patterns.
- a minimal set of tRNA for natural amino acids can also be used to emancipate codons for unnatural amino acid incorporation.
- the tRNA for one or more natural or non-natural amino acids can be obtained through the steps: 1) identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids; and 2) producing the tRNAs for the natural or non-natural amino acids with an RNA polymerase and a tRNA gene template comprising the gene sequences.
- the gene sequences encoding for tRNAs that form wobble base pairing or other non-specific base pairing with the codons of natural amino acids can be removed.
- methods for incorporating one or more non-natural amino acid into a polypeptide can further include selecting a concentration of the orthogonal tRNA and the orthogonal aminoacyl-tRNA synthetase to increase efficiency of the non-natural amino acid incorporation.
- concentration of the non-natural amino acid can also be optimized to increase efficiency of the non-natural amino acid incorporation.
- the present invention provides a kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide, comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA, wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
- a kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA, wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal t
- Example 1 Methods for removing endogenous tRNA in the cell-free protein synthesis system
- Extract Pretreatment Escherichia coli strain BL21 Star DE3TM (Invitrogen, USA) cells were used to prepare the extract.
- the cell extract can be prepared, aliquoted, and flash-frozen in liquid nitrogen for storage at -80 degrees Celsius. (Calhoun et al. (2005) Biotechnol Progr. 21 : 1 146-53). Prior to use, the cell extract was thawed on ice and subsequently centrifuged at 16000 xg for 10 minutes. The resulting supernatant was used in the CFPS system described herein.
- RNAse A columns with RNAses immobilized on matrix material or Superparamagnetic beads were used to degrade the tRNAs in an E. coli cell-free extract.
- the ribonuclease which is immobilized on the beads can also be recycled.
- RNAse A Immobilization on Superparamagnetic Beads Bovine pancreas RNAse A (Sigma Aldrich, USA) was incubated with epoxy-functionalized M-270 Dynabeads (Life Technologies, USA) in the presence of ammonium sulfate. Reaction concentrations were performed in a 0.1 M sodium phosphate buffer pH 7.4 as follows: 6.06 mg/mL RNAse A, 2 billion beads per mL, and 3 M ammonium sulfate. Reactions volumes of 0.2 mL were tilted end-over-end at room temperature for 24 hours.
- RNAse -immobilized superparamagnetic beads were aggregated using a magnetic field and the reaction supernatant was removed.
- the RNAse -immobilized superparamagnetic beads were suspended, washed, and re-aggregated 3 times with 0.2 mL PBS pH 7.4 containing 0.5% v/v Tween2® and 1 time in 0.2 mL PBS. Finally, the beads were resuspended in 0.2 mL PBS and stored at 4 degrees Celsius until use.
- Extract RNAse Treatment To inhibit protease activity, 500 ⁇ protease inhibitor PMSF was placed into the thawed, pretreated extracts and incubated for at least 5 minutes.
- treatment reactions of the extracts with R ase were performed as follows: 70 million R Ase-decorated beads were added to 500 extract and incubated for at least 5, 10, 20, 30 or 60 minutes.
- beads were aggregated using a magnetic field and the treated extract was removed.
- CFPS Cell-free Protein Synthesis
- Reactions contained 25% v/v S12 Extract, 12 nmol/L pY71-sfGFP, 1.2 mM ATP, 86 mM each of GTP, CTP, and UTP, 1 mM 1,4-diaminobutane, 1.5 mM spermadine, 0.33 NAD, 0.27 mM CoA, 0.17 mM folinic acid, 2.7 mM potassium oxalate, 175 mM potassium glutamate, 10 mM ammonium glutamate, 33.33 mM
- GFP Quantifying extract Viability: GFP was expressed as a reported protein. The fluorescence level at the end of the CFPS reaction was used as a relative comparison of overall extract viability to produce GFP.
- the protein synthesized with the methods disclosed herein can be either a polypeptide with both natural amino acids and non-natural amino acids incorporated or can be an entirely synthetic protein construct which incorporate non-natural amino acids only.
- both the orthogonal tRNAs and tRNAs for natural amino acids can be made with an RNA polymerase and a tRNA gene template comprising the gene sequences of the tRNA.
- the tRNA gene template can be a linear expression template.
- the synthetic tRNA genes can be designed to produce the final RNA product with appropriate 5' and 3 ' termini for tRNA.
- the linear tRNA templates can be generated de novo with the desired anti-codon using a single-step or two-step PCR.
- a hammerhead ribozyme cleaves the 5' end appropriately, while the 3 ' end is digested prior to transcription to allow the T7 RNAP to terminate transcription by releasing the DNA rather than using a T7 terminator sequence.
- the linear tRNA template can also terminate RNA-polymerase action by ending the tRNA-gene abruptly at the 3 ' terminus of the tRNA gene.
- the tRNA gene template used as an example for the present invention was generated by custom synthesis and the linear tRNA DNA template was further amplified by PCR in preparation for cell-free protein synthesis. Plasmid and linear tRNA template were used immediately or stored in ddH 2 0 at -20°C until use. The primer sequences used for generating linear tRNA template are tabulated in Table 2 below (SEQ ID NOs 22-43).
- tDNAs in the linear tRNA templates are listed in Table 1.
- the tDNAs may include a hammerhead ribozyme and the corresponding tRNA sequence.
- sequences of the linear tRNA templates for the 20 natural amino acids and the initiation codon are listed in Table 1 (SEQ ID Os 1-21).
- RNA polymerase a gene that was designed to be promoted by the T7 promoter and contain a hammerhead ribozyme and sequence encoding for tRNA.
- the translated region is called a tranzyme, as it includes a ribozyme and the DNA to encode for respective transfer RNA.
- linear expression templates LETs
- the 3' end of the LET is blunt at the 3' end of the tranzyme gene, allowing for the RNA polymerase to end transcription in the absence of a RNA polymerase termination sequence.
- PCR reactions to produce LETs were as follows 2 ⁇ PFU DNA polymerase, 1 mM dNTPs, 5 mM of each sense and antisense primer, 5-500 pg template plasmid, 20 mM Tris-Cl pH 8.8, 2 mM magnesium sulfate, 10 mM potassium chloride, 10 mM ammonium sulfate, 0.1% v/v TritonTM X-100, and 0.1 mg/mL bovine serum albumin. Following 30 rounds of thermocycling, the PCR reaction is purified and concentrated via ethanol precipitation with a 70% ethanol wash. The resulting DNA is suspended in water for further use.
- IVTT In vitro Transcription
- IVT reactions were electrophoresed using TBE-Urea polyacrylamide gel electrophoresis (TU-PAGE). An oligonucleotides ladder was run simultaneously for size comparison. After electrophoresis, gels were washed for 20 minutes in TBE buffer and subsequently stained for 20 minutes in 0.1 mg/mL ethidium bromide. Stained gels were imaged under UV light.
- TBE-Urea polyacrylamide gel electrophoresis oligonucleotides ladder was run simultaneously for size comparison. After electrophoresis, gels were washed for 20 minutes in TBE buffer and subsequently stained for 20 minutes in 0.1 mg/mL ethidium bromide. Stained gels were imaged under UV light.
- PCR reactions yielded LETs of appropriate length.
- IVT using LETs produced oligonucleotides of expected length.
- the presence of two distinct cleavage products demonstrates the successful auto-cleavage of the tranzyme RNA.
- Example Gene A test gene was designed to produce poly-valine, with the specific nucleotide sequence ATG- (GTA) 2 o
- CFPS Reactions were performed as described in example 1 with RNAse treated extracts and the following modifications.
- the plasmid added for the gene of interest encoded for the test gene PolyVal 2 o.
- LETs encoding for tranzymes of fMetCAU and ValUAC were included in the reaction at 50 and 100 ⁇ g/mL, respectively.
- Radiolabeled 14-C Val was included in the reaction mixture at 5.25 ⁇ .
- no tRNA nor tranzyme LETs were added.
- bulk purified E. coli tRNA was added a 2 mg/mL.
- Protein Yield Quantification Total and incorporated radiolabeled protein was quantified using 5% v/v TCA precipitation and liquid scintillation counting.
- the negative control exhibited undetectable levels of protein synthesis.
- the positive control containing bulk tRNA yielded protein as much as 40 ⁇ g/mL.
- the coexpression of tranzyme RNA yielded protein as much as 9 ⁇ g/mL.
- tRNA depletion of cell-free extract was performed as detailed in example 1. Treatment reactions were repeated 5 times with the same beads. Following each treatment reaction, beads were recovered, suspended, washed and re-aggregated 2 times in 100 ⁇ ⁇ PBS containing 0.5% v/v Tween20 ® and 1 time with 100 ⁇ ⁇ PBS pH 7.4. Beads were then re-suspended in 35 ⁇ ⁇ PBS and reused or replaced into storage.
- the bead-immobilized RNAses can be recycled and no loss in performance of the beads if given sufficient treatment incubation time.
- Fig. 7 after 5 treatment reactions using the same beads, no loss in performance of the beads was observed.
- Gel electrophoresis of purified nucleic acids from treated extracts suggested degradation of the tRNA.
- Cell-free reactions of treated extracts showed similar recovery of protein production. This experiment demonstrated the potential to completely replace endogenous tRNA with either exogenous tRNA or synthetic tRNA constructs.
- Example 5 Optimization of tRNA and Tranzyme RNA for Protein Synthesis CFPS Results: The Poly Val gene relies on 2 tranzymes for production (fMet and Val). To demonstrate the dependence and optimization of these tranzymes, the levels of one LET (orthogonal tranzyme DNA or otDNA) was varied as the other was held constant. For example, Val otDNA was varied as fMet otDNA was held at 50 ⁇ g/mL. The ability to directly control tranzyme template concentrations allows for ready optimization of the protein expression. As shown in Fig. 8, cell-free protein synthesis production yields can be optimized by optimizing the two different tranzyme tRNA gene template concentrations, both of which are needed for the production of Methionine initiated polyvaline.
- CFPS of GFP will be performed using tRNA- depleted CPFS reaction conditions as specified in Example 1 with the following modifications: orthogonal amino-acyl tRNA synthetase, orthogonal tranzyme DNA, and a non-natural amino acid will be added to the synthesis reactions.
- orthogonal amino-acyl tRNA synthetase Orthogonal tranzyme DNA
- a non-natural amino acid For example, Methanocaldococcus jannaschii TyrRS mutated to accept the non-natural amino acid p-propargyloxyphenylalanine (pPa) and an appropriate Mj tRNA containing the amber stop anticodon will be included in the reaction at optimized concentrations as detailed in Example 5.
- pPa will be included as well at 2 mM.
- the Orthogonal tRNA can be produced from appropriate tranzyme genes by in vitro transcription, expression in a cell-free extract or co-expression during cell-free protein synthesis.
- the E. coli-orthogonal tRNA synthetase can be overexpressed from the plasmid pEVOL-pPrF harbored in BL21 StarTM (DE3) in shake flasks containing 1 L of 2xYT media at 378C and 280 rpm. Expression can be induced with 1 mM IPTG at 0.5 OD600 and incubated overnight. Cells can be lysed by Emusiflex B-15 French Press and the synthetase can be purified using HisTrapTM HP columns. Yield Analysis: In the specific case mentioned above, the amber stop codon will cause the GFP protein to terminate prematurely if the orthogonal tRNA does not present itself. GFP is fluorescent only when full length, therefore GFP fluorescence from CFPS includes proteins that contain pPa.
- Example 7 Cell-free Protein Synthesis by Coexpression of 21 Tranzyme
- a gene for Firefly luciferase is synthesized de novo such that the entirety of the gene is represented by a minimal set of codons, specifically, 20 codons.
- the start codon (ATG) for the initial methionine requires a specific tRNA (fMet) to initiate peptide elongation in the ribosome. Therefore, 21 tRNA are required to represent 20 codons.
- CFPS of a Firefly luciferase gene comprised from a minimal set of 20 codons will be performed using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the following modifications: 1) In addition to adding the Val and fMet tranzyme DNA linear expression templates, tranzyme DNA linear expression templates for the remaining 19 amino acids required for the complete proteomic canon will be included at optimized concentrations as detailed in Example 5; 2) the Firefly luciferase gene described above will be added to the reaction to template its production. Yield Analysis: Bioluminescence will be measured using a monochrometer
- An example gene is designed for the peptide: MYVWVVVVVV (SEQ ID NO: 46) with the nucleic acid sequence ATG TAC GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA GTA (SEQ ID NO: 47).
- the gene could contain more or fewer Val.
- This gene is similar to the gene expressed in Example 3 but with an insertion of a different codon after the initiating methionine codon.
- An orthogonal tranzyme in this case derived from Methanocaldococcus jannaschn, will be designed to contain an appropriate anticodon, in this case the anticodon for the tyrosine codon TAC (GTA).
- the example gene will be expressed in CFPS using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the following modifications: the extract orthogonal amino-acyl tRNA synthetase, orthogonal tranzyme DNA with the appropriate anticodon, and a non-natural amino acid will be added to the synthesis reactions.
- the extract orthogonal amino-acyl tRNA synthetase orthogonal tranzyme DNA with the appropriate anticodon
- a non-natural amino acid will be added to the synthesis reactions.
- Methanocaldococcus jannaschii TyrRS mutated to accept the non-natural amino acid p- propargyloxyphenylalanine (pPa) and an appropriate M.
- jannaschii tRNA containing the anticodon GUA are included in the reaction.
- pPa will be included as well at 2 mM.
- the codon typically reserved for tyrosine will be targeted by the orthogonal aminoacyl-tRNA, resulting in a peptide sequence of M-pPa-VVVVVVVVVVV (SEQ ID NO: 48).
- Yield Analysis C 14 -labeled valine and TCA precipitation of the CPFS product followed by scintillation counting to measure radiation will be employed to quantify polyvaline production. Gel electrophoresis and autoradiography can be employed to verify correct product production.
- Test proteins will have the template nucleic acid sequence ofATG-XYZ-(GTA) 20
- NNN represents the codon being probed for degeneracy. Exemplary pairing of “NNN” is described below using “XYZ” as exemplary codons.
- CFPS Cell-free Protein Synthesis: CFPS will be performed using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the exception of adding additional tranzyme DNA linear expression templates at optimized concentrations as in Example 5.
- the test protein will be coexpressed with tranzyme genes for fMetCAU, ValUAC, and the tranzyme of interest.
- the tranzyme may contain the anticodon " ⁇ ' ⁇ ' ⁇ '" - i.e. a standard Watson-Crick pairing for the codon "XYZ.”
- the anticodon sequence may be mutated to " ⁇ ' ⁇ '" for example. Protein expression will be dependent on the existence of sufficient pairing that the "XYZ" codon encodes.
- the codon:anticodon pairing may be considered degenerate or promiscuous when protein expression using the anticodon " ⁇ ' ⁇ ' ⁇ '” j s equal to or nearly equal to expression using " ⁇ ' ⁇ ' ⁇ '.”
- Codon: anticodon pairing may be considered orthogonal or exclusive when protein expression using the anticodon " ⁇ ' ⁇ ' ⁇ '” is significantly less than expression levels using " ⁇ ' ⁇ '.”
- Yield Analysis C 14 -labeled valine and TCA precipitation of the CPFS product followed by scintillation counting to measure radiation will be employed to quantify polyvaline production. Gel electrophoresis and autoradiography can be employed to verify correct product production.
- the synthesis system with the at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA corresponding to the at least one non-natural amino acid, wherein the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
- the set of tRNAs comprises tRNAs for at least 2 natural amino acids.
- RNA polymerase producing the tRNAs for the natural or non-natural amino acids with an RNA polymerase and a tRNA gene template comprising the gene sequences.
- steps further comprises removing the gene sequences encoding for tRNAs that form wobble base pairing or other nonspecific base pairing with the codons of natural amino acids.
- RNA polymerase is a T7 RNA polymerase.
- tRNA gene template comprises a gene sequence encoding a ribozyme.
- tRNA gene template comprises a hammerhead ribozyme.
- the tRNA gene template comprises a linear tRNA gene template without a transcription terminator sequence.
- the tRNAs for the natural amino acids are produced by PCR.
- ribonuclease is selected from the group consisting of RNase A, Onconase and Colicin D tRNase.
- a method for producing a set of tRNAs for one or more natural or non-natural amino acids comprising
- RNA polymerase producing the tRNAs for the natural or non-natural amino acids with RNA polymerase and tRNA gene templates comprising the gene sequences.
- a set of tRNA gene sequences for one or more natural amino acids comprising a gene sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21. 30.
- a kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA, wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present disclosure provides methods for incorporating at least one non- natural amino acid into a polypeptide using a cell-free protein synthesis which includes a cell-free extract and is deficient in endogenous tRNA. The methods include providing the synthesis system with at least one non-natural amino acid, at least one orthogonal tRNA and one orthogonal aminoacyl-tRNA synthetase which aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid. The methods may also include removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA and providing the synthesis system with a minimal set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, such that the lack of some tRNA will enable unique codons to encode for non-natural amino acid incorporation with no or a minimal amount of completion from the tRNA present.
Description
CELL-FREE SYNTHETIC INCORPORATION OF NON-NATURAL AMINO ACIDS INTO PROTEINS
CROSS REFERENCE TO RELATED APPLICATION
This application claims the benefit of the filing date under 35 U.S.C. § 119(e) of U.S. Provisional Patent Application No. 61/855,983, filed on May 29, 2013, which is incorporated by reference herein in its entirety.
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
The present invention was made with support under award instrument number D13AP00037 awarded by the U.S. Department of Defense (Defense Advanced Research Projects Agency). The government has certain rights in this invention.
FIELD OF THE TECHNOLOGY
The present disclosure generally relates to the field of protein engineering and protein biosynthesis, and more particularly to the fields of methods and compositions for producing proteins or polypeptides that incorporate non-natural amino acids.
BACKGROUND
Engineering the incorporation of a non-natural amino acid (NNAA) with a chemically unique side chain at the desired location in the protein can selectively introduce unique chemical and physical properties to target proteins, while at the same time incorporation of a NNAA may also preserve the native structure and activity of the target proteins. In addition, non-natural amino acids add to the chemical diversity of protein, and thus can be used to create proteins with new functions. To date more than 50 non-natural amino acids have been incorporated into proteins produced in bacterial, yeast and mammalian systems.
Non-natural amino acid incorporation into proteins thus is a promising and rapidly advancing way to expand the language of biology, however, conventional
technology has several limitations. These limitations include: 1) inefficient and inaccurate AA incorporation due to competition from native components; 2) inefficient and inaccurate NNAA incorporation due to the challenge of controlling and optimizing the concentrations and activities of the exogenous machinery necessary for NNAA incorporation; 3) limited protein yields at the laboratory scale; and 4) toxicity of the non-natural product and intermediates (including the NNAA itself) to a host organism.
Compared to in vivo expression, a cell-free protein synthesis system may provide many advantages such as, but not limited to, improved monitoring and control, reduced reaction volumes, virtually silenced background expression, simplified purification, and removal of the effect of many toxins. Accordingly, a need exists for a cell-free synthesis system to overcome the limitations of the in vivo expression and enable the incorporation of many different NNAAs. Particularly, there is a need to overcome the lack of naturally occurring unique codons that are not employed by endogenous machinery and that can be used to encode for NNAA incorporation.
SUMMARY OF THE INVENTION
In one aspect, a method for incorporating at least one non-natural amino acid into a polypeptide is provided. The method uses a cell-free protein synthesis system which includes a cell-free extract and is deficient in endogenous tRNA. The method includes providing the cell-free protein synthesis system with the at least one non- natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA corresponding to the at least one non-natural amino acid. The orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid. In some aspects, the methods include removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA and providing the synthesis system with a set of tRNAs for one or more natural amino
acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon.
In another aspect, a method for producing a set of tRNAs for one or more natural amino acids is provided. The method includes identifying gene sequences encoding for tRNAs for the one or more natural amino acids, and producing the tRNAs for the natural amino acids with RNA polymerase and tRNA gene templates that include the tRNA gene sequences.
In another aspect, a minimal set of tRNA gene sequences for one or more natural or non-natural amino acids is also provided. The tRNA gene sequences for one or more natural amino acids are set forth in SEQ ID NOs: 1- 21 (Table 1).
In another aspect, a method for synthesizing a polypeptide is provided. The method includes providing at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase, and an orthogonal tRNA corresponding to the at least one non-natural amino acid, wherein the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
In yet another aspect, a method for synthesizing a polypeptide is provided.
The method includes contacting a non-natural amino acid with an orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA. In some embodiments, the method is conducted in a cell-free environment. In some embodiments, the cell-free environment is deficient in endogenous tRNA.
Advantages of the present disclosure will become more apparent to those skilled in the art from the following description of embodiments and prophetic examples that have been shown and described by way of illustration. The invention is capable of other and different embodiments, and its details are capable of modification in various respects. Accordingly, the drawings and description are to be regarded as illustrative in nature and not as restrictive.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates a method for incorporating at least one non-natural amino acid into a polypeptide using a cell-free system according to an embodiment of the present disclosure;
FIG. 2 shows a comparison of protein expression level as measured by fluorescence activity of produced green fluorescent protein (GFP) with different treatment time of RNAse immobilized on matrix material or beads and/or addition of 0.4 mg/mL and 2 mg/mL purified bulk tRNA: (1) untreated cell-free protein synthesis (CFPS) system as a control; (2) addition of protease inhibitor phenylmethylsulfonyl fluoride (PMSF) to untreated CFPS as a control; and (3)-(7) 5 min, 10 min, 20 min, 30 min and 60 min treatment of the CFPS system with RNAse immobilized on matrix material or beads;
FIG. 3 is a schematic representation of a tRNA gene template illustrating an embodiment of the design of the tRNA gene to synthesize tRNAs with an RNA polymerase in vitro or in a tRNA-free cell-free system;
FIG. 4 shows a gel electrophoresis pattern for PCR synthesized tranzyme tRNA via in vitro transcription: A) lanes from left to right: DNA ladder, negative and positive controls; B) lanes from left to right: DNA ladder, bulk purified tRNA, synthesized tranzyme tRNA from the T7-IVT (T7- In vitro transcription) reaction; Negative control.
FIG. 5 shows a comparison of cell-free protein synthesis level of CI 4- labeled polyvaline in a cell-free tRNA-depleted extract with 1) coexpression of orthogonal tranzyme DNA (otDNA); 2) no presence of tRNA; 3) addition of purified bulk E. coli tRNA;
FIG. 6 shows a comparison of protein expression level as measured by fluorescence activity of produced GFP with treatment of different recycled bead- immobilized RNAses for different incubation time;
FIG. 7 shows a comparison of protein expression level as measured by fluorescence activity of produced GFP with treatment of different multiple-recycled
bead-immobilized RNAses and/or addition of purified bulk tRNA to the cell-free protein synthesis system with different incubation time; and
FIG. 8 shows a comparison of cell-free protein synthesis level of CI 4- labeled poly valine in a cell-free tRNA-depleted extract with 1) left: change of concentration of Val otDNA as concentration of fMet otDNA was held constant; 2) right: change of concentration of fMet otDNA as concentration of Val otDNA was held constant. This demonstrates optimization of protein production yields in the cell-free protein synthesis system by optimizing the two different tranzyme tRNA gene template concentrations, both of which are needed for the production of Methionine-initiated polyvaline.
DETAILED DESCRIPTION
The present disclosure relates to methods for incorporating non-natural amino acids into a polypeptide using a cell-free protein synthesis system, wherein the cell-free protein synthesis system is deficient in endogenous tRNA. The present disclosure also relates to methods for producing a set of tRNAs for one or more natural amino acids that can be used in the cell-free protein synthesis system. The present disclosure also describes tRNA gene sequences to synthesize both natural amino acids and non-natural amino acids in vivo and in a tRNA-free, cell-free system.
The practice of the methods disclosed herein will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g. Calhoun and Swartz (2005) Biotechnol Bioeng 90(5):606-13; Jewett and Swartz (2004) Biotechnol Bioeng 86(1): 19-26; Jewett et al. (2002) Prokaryotic Systems for In Vitro Expression. In: Weiner M, Lu Q, editors. Gene cloning and expression technologies. Westborough, Mass.: Eaton Publishing, p 391-41 1; Lin et al. (2005) Biotechnol Bioeng 89(2): 148-56; Wang et al. (2001) Science 292(5516):498-500; Wang et al. (2003) Proc Natl Acad Sci USA 100(1):56-61 ; Chin et al. (2002) J Am Chem Soc 124(31):9026-7; Farrell et al.
(2005) Nat Methods, 2005. 2(5):377-84; Liu et al. (2003) J Am Chem Soc 125(7): 1702-3; Albayrak and Swartz (2013) Nucleic Acids Res 41(1 1):5949-5963; Fechter et al. (1998) FEBS Letters 436(1):99-103; Smith et al. (2014) Protein Biochem. 49(2): 217-222; Shrestha et al. (2014) New Biotech. 31(l):28-34. All references cited herein are incorporated by reference.
In some embodiments, the practice of methods disclosed herein will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology, recombinant DNA techniques, and RNA transcription by in vitro transcription within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, et al. Molecular Cloning: A Laboratory Manual (Current Edition); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., Current Edition); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., Current Edition); Transcription and Translation (B. Hames & S. Higgins, eds., Current Edition); CRC Handbook of Parvoviruses, vol. I & II (P. Tijssen, ed.); Fundamental Virology, 2nd Edition, vol. I & II (B. N. Fields and D. M. Knipe, eds.) All references cited herein are incorporated by reference.
Definitions
The term "gene" is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression. For example, "gene" refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences. "Genes" also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. "Genes" can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
The terms "protein," "peptide," and "polypeptide" are used interchangeably herein.
As used herein, the term "orthogonal" refers to a molecule (e.g., an orthogonal tRNA (O-tRNA) and or an orthogonal aminoacyl tR A synthetase (O- RS)) that is used with reduced efficiency by a system of interest (e.g., a translational system, e.g., a cell). Orthogonal refers to the inability or reduced efficiency, e.g., less than 20% efficient, less than 10% efficient, less than 5% efficient, or e.g., less than 1% efficient, of an O-tRNA and/or O-RS to function in the translation system of interest. An orthogonal molecule may function independently of or without interactions with the synthetases and tRNAs endogenous to the system of interest. For example, an O-tRNA in a translation system of interest aminoacylates any endogenous RS of a translation system of interest with reduced or even zero efficiency, when compared to aminoacylation of an endogenous tRNA by the endogenous RS. In another example, an O-RS aminoacylates any endogenous tRNA in the translation system of interest with reduced or even zero efficiency, as compared to aminoacylation of the endogenous tRNA by an endogenous RS.
The term "preferentially aminoacylates" refers to an efficiency of, e.g., about
70% efficient, about 75% efficient, about 85% efficient, about 90% efficient, about 95% efficient, or about 99% or more efficient, at which an O-RS aminoacylates an O-tRNA with an unnatural amino acid compared to a naturally occurring tRNA or starting material used to generate the O-tRNA. The unnatural amino acid is then incorporated into a growing polypeptide chain with high fidelity, e.g., at greater than about 75% efficiency for a given selector codon, at greater than about 80% efficiency for a given selector codon, at greater than about 90% efficiency for a given selector codon, at greater than about 95% efficiency for a given selector codon, or at greater than about 99% or more efficiency for a given selector codon.
"Non-specific base pairing" refers to any base pairing between the tRNA anticodon loop and amino acids that is weaker than the Watson-Crick base-pairing. In most cases, except Met and Trp, a natural amino acid is encoded by two or more genetic codes (i.e. degenerate genetic codes). To recognize all the degenerate genetic codes for the natural amino acid, the anticodon loop of the wild-type tRNA(s) relies
on both promiscuous base-pairing (e.g. wobble base-paring) and pure Watson-Crick base-pairing. Non-specific base pairing refers to base pairing between the tRNA anticodon loop and amino acids that is weaker than the Watson-Crick base-pairing. Non-specific base pairing may be facilitated by post-transcriptional modifications known in the art.
"Standard," "canonical," or "natural" amino acids are the 20 proteinogenic alpha-amino acids that in nature are the building-blocks of proteins within all domains of life, and that are also directly encoded by the genetic code. All others are known as "non-standard," "non-canonical," "non-natural" or "unnatural."
As used herein, the terms "non-natural amino acid," "NNAA," and
"unnatural amino acid" interchangeably refer to any amino acid, modified amino acid, and/or amino acid analogue that is not one of the 20 naturally occurring amino acids or selenocysteine. Examples of unnatural amino acids that can be used include but not limited to: an unnatural analogue tyrosine, glutamine, phenylalanine, serine, threonine; an alkyl, aryl, acyl, azido, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynl, ether, thiol, sulfonyl, seleno, ester, thioacid, borate, boronate, phospho, phosphono, phosphine, heterocyclic, enone, imine, aldehyde, hydroxylamine, keto, or amino substituted amino acid, or any combination thereof; an amino acid with a photoactivatable cross-linker; a spin-labeled amino acid; a fluorescent amino acid; an amino acid with a novel functional group; an amino acid that covalently or noncovalently interacts with another molecule; a metal binding amino acid; a metal-containing amino acid; a radioactive amino acid; a photocaged and/or photoisomerizable amino acid; a biotin or biotin-analogue containing amino acid; a glycosylated or carbohydrate modified amino acid; a keto containing amino acid; amino acids comprising polyethylene glycol or polyether; a heavy atom substituted amino acid; a chemically cleavable or photocleavable amino acid; an amino acid with an elongated side chain; an amino acid containing a toxic group; a sugar substituted amino acid, e.g., a sugar substituted serine or the like; a carbon- linked sugar-containing amino acid; a redox-active amino acid; an a-hydroxy
containing acid; an amino thio acid containing amino acid; an α,α disubstituted amino acid; a β-amino acid; a cyclic amino acid other than proline, etc. For example, the unnatural amino acid can be an O-methyl-L-tyrosine, an L-3-(2- naphthyl)alanine, a 3-methyl-phenylalanine, an 0-4-allyl-L-tyrosine, a 4-propyl-L- tyrosine, a tri-O-acetyl-GlcNAcp-serine, an L-Dopa, a fluorinated phenylalanine, an isopropyl-L-phenylalanine, a p-azido-L-phenylalanine, a p-acyl-L-phenylalanine, a p-benzoyl-L-phenylalanine, an L-phosphoserine, a phosphonoserine, a phosphonotyrosine, a p-iodo-phenylalanine, a p-bromophenylalanine, a p-amino-L- phenylalanine, and an isopropyl-L-phenylalanine.in one embodiment, the at least one unnatural amino acid is an O-methyl-L-tyrosine. In one specific example embodiment, the at least one unnatural amino acid is an L-3-(2-naphthyl) alanine. In another set of specific examples, the at least one unnatural amino acid is an amino-, isopropyl-, or O-allyl-containing phenylalanine analogue.
As used herein, the term "orthogonal components" refers to an exogenous orthogonal aminoacyl-tRNA synthetase (O-RS), an exogenous O-tRNA (i.e. aminoacylated), and a NNAA which works in concert to charge the O-tRNA with the NNAA. The exogenous O-RS/O-tRNA pair is mutated to exclusively recognize and charge the corresponding NNAA to the exogenous tRNA. Such components are known in the art, for example as described in U.S. Pat. No. 7,045,337, issued May 16, 2006, incorporated herein by this reference. The orthogonal tRNA recognizes a selector codon, which may be nonsense codons such as, stop codons, e.g., amber, ochre, and opal codons; or four or more base codons; codons derived from natural or unnatural base pairs and the like. In almost all cases there is competition from endogenous components for the selector codon. The orthogonal tRNA anticodon loop recognizes the selector codon on the mRNA and incorporates the NNAA at this site in the polypeptide.
As used herein, the term "tranzyme" refers to a ribozyme-tRNA complex. The term "cell-free protein synthesis" as used herein refers to an in vitro protein synthesis using a cell extract. This may be protein synthesis in a cell-free
translation system for producing proteins on ribosome through reading of information of mRNA or protein synthesis in a coupled system comprising a cell- free transcription system that produces mRNA using DNA as a template and a cell- free translation system that translates the mRNA information into proteins. When DNA is used for a template, various kinds of template DNA can be prepared simultaneously and rapidly by the amplification reaction in vitro such as Polymerase Chain Reaction (PCR). The cell extracts may be derived from any eukaryotic or prokaryotic cells, such as E. coli, yeast, wheat germ extract, rabbit reticulocyte cells, insect cells, animal cells and human cell lines etc.
The term "derived from" refers to a component that is isolated from an organism or isolated and modified, or generated, e.g., chemically synthesized, using information of the component from the organism.
The term "deficient in endogenous tRNA" as used herein refers to a cell-free protein synthesis system where the endogenous tRNA has been removed or degraded to a minimal amount that the endogenous tRNA cannot compete with the exogenous tRNA.
Unless otherwise defined herein or below in the remainder of the specification, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs.
Cell-free protein synthesis systems
The cell-free protein synthesis systems (CFPS), also known as in vitro protein production systems, for the present disclosure may be cell-free translation systems based on cell extracts. In some embodiments, a cell-free protein synthesis system which is deficient in endogenous tRNA is used. The CFPS may also include a combination of biomachinery from different organisms to create synthetic pathways and products known by a person skilled in the art.
In some embodiments, the CFPS is a combined reaction mix of biomachinery from different biological extracts and/or defined reagents. The
reaction mix will comprise a template for production of the macromolecule, e.g. DNA, mRNA, etc.; monomers for the macromolecule to be synthesized, e.g. non- natural amino acids, nucleotides, etc., and such co-factors, enzymes and other reagents that are necessary for the synthesis, e.g. ribosomes, polymerases, transcriptional factors, etc., except the endogenous tRNA, which can be removed from the biological extracts. In some embodiments, the tRNA for either non-natural amino acids or natural amino acids or a combination of both, can be synthesized exogenously, purified and added to the reaction mix of the invention. Alternatively, the tRNAs can be synthesized in the reaction mix. The cell free synthesis reaction may be performed as batch, continuous flow, semi-continuous flow, continuous exchange, or other methods as known in the art.
Cell extracts as used herein may be any preparation comprising the components required for protein synthesis machinery. The cell-free protein synthesis system may include extracts from eukaryotic or prokaryotic cells, such as E-coli, yeast, wheat germ extract, rabbit reticulocyte cells, insect cells, animal cells and human cell lines etc. By way of non-limiting example, a bacterial cell extract that includes components capable of expressing a nucleic acid encoding a desired protein may be used. Thus, a bacterial extract includes components that are capable of translating messenger ribonucleic acid (mRNA) encoding a desired protein, and optionally includes components that are capable of transcribing DNA encoding a desired protein. Such components include, for example, DNA-directed RNA polymerase (RNA polymerase), any transcription activators that are required for initiation of transcription of DNA encoding the desired protein, aminoacyl-tRNA synthetases, 70S ribosomes, N10-formyltetrahydro folate, formylmethionine- tRNAfJVIet synthetase, peptidyl transferase, initiation factors such as IF-1, IF -2 and IF-3, elongation factors such as EF-Tu, EF-Ts, and EF-G, release factors such as RF-1, RF-2, and RF-3, and the like., In some embodiments, the transfer ribonucleic acids (tRNAs) in the cell extracts can be removed.
In some embodiments, the reaction mixture includes extracts from bacterial cells, e.g. E. coli S12 extracts. In some embodiments, the bacterial cells are modified such that the bacterial cells endogenously express an orthogonal tRNA. The organism used as a source of extracts may be referred to as the source organism. Exemplary methods for producing active extracts may be found in Pratt (1984), Coupled transcription-translation in prokaryotic cell-free systems, p. 179-209, in Hames, B. D. and Higgins, S. J. (ed.), Transcription and Translation: A Practical Approach, IRL Press, New York; Kudlicki et al. (1992) Anal Biochem 206(2):389- 93, incorporated herein by reference. Examples of cell extracts as used herein were based on crude extracts prepared from Escherichia coli (E. coli) (Shrestha et al. (2014) New Biotech. 31(l):28-34). In some embodiments, the bacterial strain from which the extract is derived may be further modified. By way of non-limiting example, the E. co/z'-based CFPS may be modified to decrease background gene expression and increase protein production to levels to exceed 1 mg/mL (Liu et al. (2005) Biotechnol Progr. 21 :460-5; Yang et al. (2012) Biotechnol Progr. 28:413-20), incorporated by reference.
Orthogonal aminoacyl-tRNA Synthetases
Orthogonal aminoacyl-tRNA Synthetases (O-RS) are enzymes that charge (acylate) tRNAs with non-natural samino acids. These charged aminoacyl tRNAs then participate in mRNA translation and protein synthesis. The O-RS show high specificity for charging a specific orthogonal tRNA with the appropriate non-natural amino acid. For example, valyl-tRNA with valine by valyl-tRNA synthetase, or tryptophanyl-tRNA with tryptophan by tryptophanyl-tRNA synthetase. The non- natural O-RS and tRNA pairs used in the present disclosures as examples are O-RS derived from Methanocaldococcus jannaschii and Tyrosyl derivative as described in U.S. Pat. No. 7,713,721, issued May 11, 2010; Methanosarcina barkeri and Pyrrolysyl (Genbank Accession Number: AY273828.1); and Saccharomyces
cerevisiae and Tryptophanyl (modified based on NCBI Accession Number NM 001183351.1, Chatterjee et al. (2013) Angewandte Chemie Int. Ed. 52(19): 5106-09), all incorporated by reference.
Orthogonal tRNA synthetase can be synthesized exogenously, purified and added to the reaction mix. In some embodiments, the orthogonal tRNA synthetase as added to the reaction mix in a defined quantity, of at least about 10 μg/ml, at least about 20 μg/ml, at least about 30 μg/ml. The protein may be synthesized in bacterial or eukaryotic cells and purified, e.g. by affinity chromatography, PAGE, gel exclusion chromatography, reverse phase chromatography, and the like, as known in the art.
In some embodiments, the E. co/z'-orthogonal synthetase can be produced in vivo and purified, as previously described Smith et al. (2013) Biotechnol Prog. 29:247-54 incorporated by reference.
The cell-free protein synthesis system described herein provides the ability to synthesize proteins that comprise unnatural amino acids in usefully large quantities. For example, proteins comprising at least one unnatural amino acid can be produced at a concentration of at least about 10, 50, 100 or more micrograms per liter, e.g., in a composition comprising a cell extract, a buffer, a pharmaceutically acceptable excipient, and/or the like.
As shown in Fig. 1, the present disclosure provides a method for incorporating at least one NNAA into a protein using a cell-free system. The protein synthesized with the methods disclosed herein can be either a polypeptide with both natural amino acids and non-natural amino acids incorporated. In some embodiments, the protein synthesized according to the method described herein can be an entirely synthetic protein construct which incorporates non-natural amino acids only. The cell-free synthesis reaction may involve both orthogonal tRNA/orthogonal aminoacyl-tRNA synthetase and natural tRNAs/natural aminoacyl-tRNA synthetase for natural amino acids.
In some aspects, the methods include removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA and providing the synthesis system with a set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon. In some embodiments, the ribonuclease can be RNase A, Onconase, Colicin D tRNase or other ribonuclease depending on the types of cell extract used for the cell-free synthesis reaction.
In some embodiments, the tRNAs for either the NNAAs or natural amino acids or both can be synthesized in the cell-free protein synthesis system. In some embodiments, these tRNAs can also be synthesized exogenously and added to the cell-free protein synthesis system.
In some embodiments, both the orthogonal tRNAs and tRNAs for natural amino acids can be made with an RNA polymerase and a tRNA gene template comprising the gene sequences of the tRNA. In some embodiments, the tRNA gene template can be a linear expression template. The design of the synthetic tRNA can be produced such that the 5' and 3 ' ends of the final RNA product will include the appropriate termini for tRNA. In some aspects, the linear tRNA templates can be generated using single-step or two-step PCR. In some embodiments, a hammerhead ribozyme cleaves the 5' end appropriately, while the 3' end is digested prior to transcription to allow the T7 RNAP to terminate transcription by releasing the DNA rather than using a T7 terminator sequence. In some embodiments, the linear tRNA template can also terminate RNA-polymerase action by ending the tRNA-gene abruptly at the 3 ' terminus of the tRNA gene. In some embodiments, a concentration ratio of the tRNAs and tRNA gene template can also be optimized to increase efficiency of the non-natural amino acid incorporation.
In some embodiments, the codons for the non-natural amino acids can be selected based on the codons of the one or more natural amino acids so that the competition between the natural amino acids and the non-natural amino acids to be attached to the orthogonal tRNAs is reduced. In some aspect, the codons for the non-natural amino acids can be selected based on frequency of codon use, frequency of being incorporated by natural tRNAs, and predicted promiscuity patterns.
In some embodiments, a minimal set of tRNA for natural amino acids can also be used to emancipate codons for unnatural amino acid incorporation. In some embodiments, the tRNA for one or more natural or non-natural amino acids can be obtained through the steps: 1) identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids; and 2) producing the tRNAs for the natural or non-natural amino acids with an RNA polymerase and a tRNA gene template comprising the gene sequences. In some embodiments, the gene sequences encoding for tRNAs that form wobble base pairing or other non-specific base pairing with the codons of natural amino acids can be removed.
In some embodiments, methods for incorporating one or more non-natural amino acid into a polypeptide can further include selecting a concentration of the orthogonal tRNA and the orthogonal aminoacyl-tRNA synthetase to increase efficiency of the non-natural amino acid incorporation. In some aspects, the concentration of the non-natural amino acid can also be optimized to increase efficiency of the non-natural amino acid incorporation.
In some aspects, the present invention provides a kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide, comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA, wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
EXAMPLES
The following examples serve to illustrate the invention without limiting the invention in its scope.
Example 1: Methods for removing endogenous tRNA in the cell-free protein synthesis system
Extract Pretreatment: Escherichia coli strain BL21 Star DE3™ (Invitrogen, USA) cells were used to prepare the extract. The cell extract can be prepared, aliquoted, and flash-frozen in liquid nitrogen for storage at -80 degrees Celsius. (Calhoun et al. (2005) Biotechnol Progr. 21 : 1 146-53). Prior to use, the cell extract was thawed on ice and subsequently centrifuged at 16000 xg for 10 minutes. The resulting supernatant was used in the CFPS system described herein.
In an exemplary embodiment, RNAse A columns with RNAses immobilized on matrix material or Superparamagnetic beads were used to degrade the tRNAs in an E. coli cell-free extract. In some embodiments, the ribonuclease which is immobilized on the beads can also be recycled.
RNAse A Immobilization on Superparamagnetic Beads: Bovine pancreas RNAse A (Sigma Aldrich, USA) was incubated with epoxy-functionalized M-270 Dynabeads (Life Technologies, USA) in the presence of ammonium sulfate. Reaction concentrations were performed in a 0.1 M sodium phosphate buffer pH 7.4 as follows: 6.06 mg/mL RNAse A, 2 billion beads per mL, and 3 M ammonium sulfate. Reactions volumes of 0.2 mL were tilted end-over-end at room temperature for 24 hours. Following the reaction, the RNAse -immobilized superparamagnetic beads were aggregated using a magnetic field and the reaction supernatant was removed. The RNAse -immobilized superparamagnetic beads were suspended, washed, and re-aggregated 3 times with 0.2 mL PBS pH 7.4 containing 0.5% v/v Tween2® and 1 time in 0.2 mL PBS. Finally, the beads were resuspended in 0.2 mL PBS and stored at 4 degrees Celsius until use.
Extract RNAse Treatment: To inhibit protease activity, 500 μΜ protease inhibitor PMSF was placed into the thawed, pretreated extracts and incubated for at least 5 minutes. In an exemplary embodiment, treatment reactions of the extracts with R ase were performed as follows: 70 million R Ase-decorated beads were added to 500 extract and incubated for at least 5, 10, 20, 30 or 60 minutes.
Following incubation, beads were aggregated using a magnetic field and the treated extract was removed.
Cell-free Protein Synthesis (CFPS): A super-folder green fluorescent protein (GFP) variant was expressed in CFPS using treated extracts and untreated extracts as controls. CFPS was performed using a PANOx system or a modified PANOx-SP system (Jewett et al. (2004) Biotechnol Bioeng. 86: 19-26) as follows: 20 reactions were incubated in sealed 96-well plates for 3 hours at 37 degrees Celsius. Reactions contained 25% v/v S12 Extract, 12 nmol/L pY71-sfGFP, 1.2 mM ATP, 86 mM each of GTP, CTP, and UTP, 1 mM 1,4-diaminobutane, 1.5 mM spermadine, 0.33 NAD, 0.27 mM CoA, 0.17 mM folinic acid, 2.7 mM potassium oxalate, 175 mM potassium glutamate, 10 mM ammonium glutamate, 33.33 mM
phosphoenolpyruvate, and 9 mM magnesium glutamate. Bulk purified E. coli tRNA (Roche Applied Sciences, USA) was added to CFPS reactions as indicated.
Quantifying extract Viability: GFP was expressed as a reported protein. The fluorescence level at the end of the CFPS reaction was used as a relative comparison of overall extract viability to produce GFP.
As shown in Fig. 2, treating a CFPS system with RNAse immobilized on matrix material or beads removes the endogenous tRNA. Also, addition of purified bulk E. coli tRNA to the CFPS system with untreated extract maintains protein production capability albeit with a slight decrease in protein yield. Addition of
PMSF to otherwise untreated extracts maintains protein production capability albeit with a slightly decreased overall protein yield. Extracts treated with RNAse- decorated beads yielded undetectable levels of protein production as measured by fluorescence. Also shown in Fig. 2, addition of purified bulk tRNA to the treated
extracts restored in part the extract's viability, which was measured by produced protein green fluorescent protein (GFP).
Example 2: In vitro synthesis of tRNA
The protein synthesized with the methods disclosed herein can be either a polypeptide with both natural amino acids and non-natural amino acids incorporated or can be an entirely synthetic protein construct which incorporate non-natural amino acids only.
In some embodiments, both the orthogonal tRNAs and tRNAs for natural amino acids can be made with an RNA polymerase and a tRNA gene template comprising the gene sequences of the tRNA. In some embodiments, as shown in Fig. 3, the tRNA gene template can be a linear expression template. The synthetic tRNA genes can be designed to produce the final RNA product with appropriate 5' and 3 ' termini for tRNA. The linear tRNA templates can be generated de novo with the desired anti-codon using a single-step or two-step PCR. In some embodiments, a hammerhead ribozyme cleaves the 5' end appropriately, while the 3 ' end is digested prior to transcription to allow the T7 RNAP to terminate transcription by releasing the DNA rather than using a T7 terminator sequence. In some embodiments, the linear tRNA template can also terminate RNA-polymerase action by ending the tRNA-gene abruptly at the 3 ' terminus of the tRNA gene. The tRNA gene template used as an example for the present invention was generated by custom synthesis and the linear tRNA DNA template was further amplified by PCR in preparation for cell-free protein synthesis. Plasmid and linear tRNA template were used immediately or stored in ddH20 at -20°C until use. The primer sequences used for generating linear tRNA template are tabulated in Table 2 below (SEQ ID NOs 22-43).
Exemplary sequences for the tDNAs in the linear tRNA templates are listed in Table 1. The tDNAs may include a hammerhead ribozyme and the corresponding tRNA sequence. The sequences of the linear tRNA templates for the 20 natural
amino acids and the initiation codon (formyl-methionine, fMet) are listed in Table 1 (SEQ ID Os 1-21).
Table 1
Amino tDNA SEQ ID # Acid
Ala TAATACGACTCACTATAGGGAGAGCCCCCTGATGAGTCC SEQ ID NO: 1
GTGAGGACGAAACGGTACCCGGTACCGTCGGGGCTATA GCTCAGCTGGGAGAGCGCCTGCTTTGCACGCAGGAGGTC TGCGGTTCGATCCCGCATAGCTCCACCAGGAAGCT
Arg TAATACGACTCACTATAGGGAGAATGCCTGATGAGTCCG SEQ ID NO: 2
TGAGGACGAAACGGTACCCGGTACCGTCGCATCCGTAG CTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTC GGAGGTTCGAATCCTCCCGGATGCACCAGGAAGCT
Asn TAATACGACTCACTATAGGGAGAAGAGGACTGATGAGT SEQ ID NO: 3
CCGTGAGGACGAAACGGTACCCGGTACCGTCTCCTCTGT AGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGT CACTGGTTCGAGTCCAGTCAGAGGAGCCAGGAAGCT
Asp TAATACGACTCACTATAGGGAGAGCTCCCTGATGAGTCC SEQ ID NO: 4
GTGAGGACGAAACGGTACCCGGTACCGTCGGAGCGGTA GTTCAGTCGGTTAGAATACCTGCCTGTCACGCAGGGGGT CGCGGGTTCGAGTCCCGTCCGTTCCGCCAGGAAGCT
Cys TAATACGACTCACTATAGGGAGACGCCCTGATGAGTCCG SEQ ID NO: 5
TGAGGACGAAACGGTACCCGGTACCGTCGGCGCGTTAA CAAAGCGGTTATGTAGCGGATTGCAAATCCGTCTAGTCC GGTTCGACTCCGGAACGCGCCTCCAGGAAGCT
Gin TAATACGACTCACTATAGGGAGAACCCCACTGATGAGTC SEQ ID NO: 6
CGTGAGGACGAAACGGTACCCGGTACCGTCTGGGGTAT CGCCAAGCGGTAAGGCACCGGATTCTGATTCCGGCATTC CGAGGTTCGAATCCTCGTACCCCAGCCAGGAAGCT
Glu TAATACGACTCACTATAGGGAGAGGACCTGATGAGTCC SEQ ID NO: 7
GTGAGGACGAAACGGTACCCGGTACCGTCGTCCCCTTCG TCTAGAGGCCCAGGACACCGCCCTTTCACGGCGGTAACA GGGGTTCGAATCCCCTAGGGGACGCCAGGAAGCT
Gly TAATACGACTCACTATAGGGAGACCCGCCTGATGAGTCC SEQ ID NO: 8
GTGAGGACGAAACGGTACCCGGTACCGTCGCGGGAATA GCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTC GCGAGTTCGAGTCTCGTTTCCCGCTCCAGGAAGCT
ffis TAATACGACTCACTATAGGGAGACACCCTGATGAGTCCG SEQ ID NO: 9
TGAGGACGAAACGGTACCCGGTACCGTCGGTGGCTATA GCTCAGTTGGTAGAGCCCTGGATTGTGATTCCAGTTGTC GTGGGTTCGAATCCCATTAGCCACCCCAGGAAGCT
fMet TAATACGACTCACTATAGGGAGACGCGCTGATGAGTCCG SEQ ID NO: 10
TGAGGACGAAACGGTACCCGGTACCGTCCGCGGGGTGG AGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTC GTCGGTTCAAATCCGGCCCCCGCAACCAGGAAGCT
Met TAATACGACTCACTATAGGGAGAAGCCCTGATGAGTCCG SEQ ID NO: 11
TGAGGACGAAACGGTACCCGGTACCGTCGGCTACGTAG CTCAGTTGGTTAGAGCACATCACTCATAATGATGGGGTC ACAGGTTCGAATCCCGTCGTAGCCACCAGGAAGCT
He TAATACGACTCACTATAGGGAGAAGCCTCTGATGAGTCC SEQ ID NO: 12
GTGAGGACGAAACGGTACCCGGTACCGTCAGGCTTGTA GCTCAGGTGGTTAGAGCGCACCCCTGATAAGGGTGAGG TCGGTGGTTCAAGTCCACTCAGGCCTACCAGGAAGCT
Amino tDNA SEQ ID # Acid
Leu TAATACGACTCACTATAGGGAGATCGCCTGATGAGTCCG SEQ ID NO: 13
TGAGGACGAAACGGTACCCGGTACCGTCGCGAAGGTGG
CGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCC
TTACGGACGTGGGGGTTCAAGTCCCCCCCCTCGCACCAG
GAAGCT
Lys TAATACGACTCACTATAGGGAGAGACCCCTGATGAGTCC SEQ ID NO: 14
GTGAGGACGAAACGGTACCCGGTACCGTCGGGTCGTTA GCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTC GCAGGTTCGAATCCTGCACGACCCACCAGGAAGCT
Phe TAATACGACTCACTATAGGGAGAGGGCCTGATGAGTCC SEQ ID NO: 15
GTGAGGACGAAACGGTACCCGGTACCGTCGCCCGGATA GCTCAGTCGGTAGAGCAGGGGATTGAAAATCCCCGTGTC CTTGGTTCGATTCCGAGTCCGGGCACCAGGAAGCT
Pro TAATACGACTCACTATAGGGAGAACCGCTGATGAGTCCG SEQ ID NO: 16
TGAGGACGAAACGGTACCCGGTACCGTCCGGTGATTGG CGCAGCCTGGTAGCGCACTTCGTTCGGGACGAAGGGGTC GGAGGTTCGAATCCTCTATCACCGACCAGGAAGCT
Ser TAATACGACTCACTATAGGGAGACACCCTGATGAGTCCG SEQ ID NO: 17
TGAGGACGAAACGGTACCCGGTACCGTCGGTGAGGTGT
CCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATA
CGGCAACGTATCGGGGGTTCGAATCCCCCCCTCACCGCC
AGGAAGCT
Thr TAATACGACTCACTATAGGGAGACAGCCTGATGAGTCCG SEQ ID NO: 18
TGAGGACGAAACGGTACCCGGTACCGTCGCTGATATGG CTCAGTTGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCC CCAGTTCGACTCTGGGTATCAGCACCAGGAAGCT
Trp TAATACGACTCACTATAGGGAGAGCCCCTCTGATGAGTC SEQ ID NO: 19
CGTGAGGACGAAACGGTACCCGGTACCGTCAGGGGCGT AGTTCAATTGGTAGAGCACCGGTCTCCAAAACCGGGTGT TGGGAGTTCGAGTCTCTCCGCCCCTGCCAGGAAGCT
Tyr TAATACGACTCACTATAGGGAGACACCCTGATGAGTCCG SEQ ID NO: 20
TGAGGACGAAACGGTACCCGGTACCGTCGGTGGGGTTC
CCGAGCGGCCAAAGGGAGCAGACTGTAAATCTGCCGTC
ACAGACTTCGAAGGTTCGAATCCTTCCCCCACCACCAGG
AAGCT
Val TAATACGACTCACTATAGGGAGACACCCCTGATGAGTCC SEQ ID NO: 21
GTGAGGACGAAACGGTACCCGGTACCGTCGGGTGATTA GCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGT CGGCGGTTCGATCCCGTCATCACCCACCAGGAAGCT
Table 2
Description PCR Primer Sequence SEQ ID #
Forward tRNA TGT CGC CCT TTA CAC GTA CT SEQ ID NO: 22
Reverse Ala tRNA TGG TGG AGC TAT GCG GGA TC SEQ ID NO: 23
Reverse Arg tRNA TGG TGC ATC CGG GAG GAT SEQ ID NO: 24
Reverse Asn tRNA TGG CTC CTC TGA CTG GAC SEQ ID NO: 25
Reverse Asp tRNA TGG CGG AAC GGA CGG GAC SEQ ID NO: 26
Reverse Cys tRNA TGG AGG CGC GTT CCG GAG SEQ ID NO: 27
Reverse Gin tRNA TGG CTG GGG TAC GAG GAT SEQ ID NO: 28
Reverse Glu tRNA TGG CGT CCC CTA GGG GAT SEQ ID NO: 29
Description PCR Primer Sequence SEQ ID #
Reverse Gly tRNA TGG AGC GGG AAA CGA GAC SEQ ID NO: 30
Reverse His tRNA TGG GGT GGC TAA TGG GAT SEQ ID NO: 31
Reverse fMet tRNA TGG TTG CGG GGG CCG GAT SEQ ID NO: 32
Reverse Met tRNA GG TGG CTA CGA CGG GAT SEQ ID NO: 33
Reverse He tRNA TGG TAG GCC TGA GTG GAC SEQ ID NO: 34
Reverse Leu tRNA TGG TGC GAG GGG GGG GAC SEQ ID NO: 35
Reverse Lys tRNA TGG TGG GTC GTG CAG GAT SEQ ID NO: 36
Reverse Phe tRNA TGG TGC CCG GAC TCG GAA SEQ ID NO: 37
Reverse Pro tRNA TGG TCG GTG ATA GAG GAT TCG SEQ ID NO: 38
Reverse Ser tRNA TGG CGG TGA GGG GGG GAT SEQ ID NO: 39
Reverse Thr tRNA TGG TGC TGA TAC CCA GAG TC SEQ ID NO: 40
Reverse Trp tRNA TGG CAG GGG CGG AGA GAC SEQ ID NO: 41
Reverse Tyr tRNA TGG TGG GGG AAG GAT TCG SEQ ID NO: 42
Reverse Val tRNA TGG TGG GTG ATG ACG GGA SEQ ID NO: 43
Production of Tranzyme RNA and Post-transcriptional Cleavage
PCR Production of Linear Expression Templates: To replace the depleted tRNA, genes were designed to be promoted by the T7 promoter and contain a hammerhead ribozyme and sequence encoding for tRNA. The translated region is called a tranzyme, as it includes a ribozyme and the DNA to encode for respective transfer RNA. To facilitate appropriate termination of transcription, linear expression templates (LETs) were produced to contain the T7 promoter and tranzyme gene. The 3' end of the LET is blunt at the 3' end of the tranzyme gene, allowing for the RNA polymerase to end transcription in the absence of a RNA polymerase termination sequence. PCR reactions to produce LETs were as follows 2 μΕ PFU DNA polymerase, 1 mM dNTPs, 5 mM of each sense and antisense primer, 5-500 pg template plasmid, 20 mM Tris-Cl pH 8.8, 2 mM magnesium sulfate, 10 mM potassium chloride, 10 mM ammonium sulfate, 0.1% v/v Triton™ X-100, and 0.1 mg/mL bovine serum albumin. Following 30 rounds of thermocycling, the PCR reaction is purified and concentrated via ethanol
precipitation with a 70% ethanol wash. The resulting DNA is suspended in water for further use.
In vitro Transcription (IVT): tRNA was synthesized via in vitro
transcription. Linear expression templates detailed above were combined with T7 RNA polymerase, 5 mM of each ATP, UTP, GTP, and CTP, 5 mM spermadine, 2 mM 1,4-diaminobutane, 800 units/mL murine RNAse Inhibitor (Sigma Aldrich, USA), 15 mM magnesium chloride, 5 mM dithiothreitol, and 50 mM Tris-Cl pH 7.5. After transcription of RNA, the tranzyme sequence is designed to anneal to itself and auto-cleave at the 5" end of the tRNA sequence, resulting in two cleavage products: 1) hammerhead ribozyme and 2) transfer RNA.
Transcription and Tranzyme Cleavage Analaysis: IVT reactions were electrophoresed using TBE-Urea polyacrylamide gel electrophoresis (TU-PAGE). An oligonucleotides ladder was run simultaneously for size comparison. After electrophoresis, gels were washed for 20 minutes in TBE buffer and subsequently stained for 20 minutes in 0.1 mg/mL ethidium bromide. Stained gels were imaged under UV light.
As shown in Fig. 4, PCR reactions yielded LETs of appropriate length. IVT using LETs produced oligonucleotides of expected length. The presence of two distinct cleavage products demonstrates the successful auto-cleavage of the tranzyme RNA.
Example 3: Cell-free Protein Synthesis by Coexpression of Tranzyme RNA in tRNA-Depleted Extract
Example Gene: A test gene was designed to produce poly-valine, with the specific nucleotide sequence ATG- (GTA) 2o
(ATGGTAAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA GTAGTAGTAGTAGTA) (SEQ ID NO: 44) for the protein Met-(Val)20
(MWWWVVVVVWWWWV) (SEQ ID NO: 45).
CFPS Reaction: Reactions were performed as described in example 1 with RNAse treated extracts and the following modifications. The plasmid added for the
gene of interest encoded for the test gene PolyVal2o. LETs encoding for tranzymes of fMetCAU and ValUAC were included in the reaction at 50 and 100 μg/mL, respectively. Radiolabeled 14-C Val was included in the reaction mixture at 5.25 μΜ. In the negative control case, no tRNA nor tranzyme LETs were added. For the positive control, bulk purified E. coli tRNA was added a 2 mg/mL.
Protein Yield Quantification: Total and incorporated radiolabeled protein was quantified using 5% v/v TCA precipitation and liquid scintillation counting.
As shown in Fig. 5, the negative control exhibited undetectable levels of protein synthesis. The positive control containing bulk tRNA yielded protein as much as 40 μg/mL. The coexpression of tranzyme RNA (fMet and Val) yielded protein as much as 9 μg/mL.
Example 4: Recycle of Magnetic Beads Decorated with RNAse
Recycled Treatment and CFPS Reactions: tRNA depletion of cell-free extract was performed as detailed in example 1. Treatment reactions were repeated 5 times with the same beads. Following each treatment reaction, beads were recovered, suspended, washed and re-aggregated 2 times in 100 μΐ^ PBS containing 0.5% v/v Tween20® and 1 time with 100 μΐ^ PBS pH 7.4. Beads were then re-suspended in 35 μΐ^ PBS and reused or replaced into storage.
As shown in Fig. 6, the bead-immobilized RNAses can be recycled and no loss in performance of the beads if given sufficient treatment incubation time. As also shown in Fig. 7, after 5 treatment reactions using the same beads, no loss in performance of the beads was observed. Gel electrophoresis of purified nucleic acids from treated extracts suggested degradation of the tRNA. Cell-free reactions of treated extracts showed similar recovery of protein production. This experiment demonstrated the potential to completely replace endogenous tRNA with either exogenous tRNA or synthetic tRNA constructs.
Example 5: Optimization of tRNA and Tranzyme RNA for Protein Synthesis
CFPS Results: The Poly Val gene relies on 2 tranzymes for production (fMet and Val). To demonstrate the dependence and optimization of these tranzymes, the levels of one LET (orthogonal tranzyme DNA or otDNA) was varied as the other was held constant. For example, Val otDNA was varied as fMet otDNA was held at 50 μg/mL. The ability to directly control tranzyme template concentrations allows for ready optimization of the protein expression. As shown in Fig. 8, cell-free protein synthesis production yields can be optimized by optimizing the two different tranzyme tRNA gene template concentrations, both of which are needed for the production of Methionine initiated polyvaline. Prophetic Examples
Example 6: Non-natural Amino Acid Incorporation in CFPS using a tRNA-depleted Extract
Cell-free Protein Synthesis: CFPS of GFP will be performed using tRNA- depleted CPFS reaction conditions as specified in Example 1 with the following modifications: orthogonal amino-acyl tRNA synthetase, orthogonal tranzyme DNA, and a non-natural amino acid will be added to the synthesis reactions. For example, Methanocaldococcus jannaschii TyrRS mutated to accept the non-natural amino acid p-propargyloxyphenylalanine (pPa) and an appropriate Mj tRNA containing the amber stop anticodon will be included in the reaction at optimized concentrations as detailed in Example 5. pPa will be included as well at 2 mM. The Orthogonal tRNA can be produced from appropriate tranzyme genes by in vitro transcription, expression in a cell-free extract or co-expression during cell-free protein synthesis.
The E. coli-orthogonal tRNA synthetase can be overexpressed from the plasmid pEVOL-pPrF harbored in BL21 StarTM (DE3) in shake flasks containing 1 L of 2xYT media at 378C and 280 rpm. Expression can be induced with 1 mM IPTG at 0.5 OD600 and incubated overnight. Cells can be lysed by Emusiflex B-15 French Press and the synthetase can be purified using HisTrapTM HP columns.
Yield Analysis: In the specific case mentioned above, the amber stop codon will cause the GFP protein to terminate prematurely if the orthogonal tRNA does not present itself. GFP is fluorescent only when full length, therefore GFP fluorescence from CFPS includes proteins that contain pPa. Example 7: Cell-free Protein Synthesis by Coexpression of 21 Tranzyme
RNAs in tRNA-Depleted Extract
Gene Design: A gene for Firefly luciferase is synthesized de novo such that the entirety of the gene is represented by a minimal set of codons, specifically, 20 codons. The start codon (ATG) for the initial methionine requires a specific tRNA (fMet) to initiate peptide elongation in the ribosome. Therefore, 21 tRNA are required to represent 20 codons.
Cell-free Protein Synthesis: CFPS of a Firefly luciferase gene comprised from a minimal set of 20 codons will be performed using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the following modifications: 1) In addition to adding the Val and fMet tranzyme DNA linear expression templates, tranzyme DNA linear expression templates for the remaining 19 amino acids required for the complete proteomic canon will be included at optimized concentrations as detailed in Example 5; 2) the Firefly luciferase gene described above will be added to the reaction to template its production. Yield Analysis: Bioluminescence will be measured using a monochrometer
(i.e. Synergy MX, Biotek, USA) measuring at 570 nm wavelength. In a 96-well plate, 20 of CFPS reaction will be mixed with 40 ONE-GLO™ Luciferase assay mix (Promega, USA), the plate will shake for 15 seconds and the luminescence will be measured. Example 8: Sense Codon Reassignment for Non-natural Amino Acid
Incorporation
Gene Design: An example gene is designed for the peptide: MYVWVVVVVV (SEQ ID NO: 46) with the nucleic acid sequence ATG TAC GTA GTA GTA GTA GTA GTA GTA GTA GTA (SEQ ID NO: 47). The gene could contain more or fewer Val. This gene is similar to the gene expressed in Example 3 but with an insertion of a different codon after the initiating methionine codon. An orthogonal tranzyme, in this case derived from Methanocaldococcus jannaschn, will be designed to contain an appropriate anticodon, in this case the anticodon for the tyrosine codon TAC (GTA).
Cell-free Protein Synthesis: The example gene will be expressed in CFPS using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the following modifications: the extract orthogonal amino-acyl tRNA synthetase, orthogonal tranzyme DNA with the appropriate anticodon, and a non-natural amino acid will be added to the synthesis reactions. For example, Methanocaldococcus jannaschii TyrRS mutated to accept the non-natural amino acid p- propargyloxyphenylalanine (pPa) and an appropriate M. jannaschii tRNA containing the anticodon GUA are included in the reaction. pPa will be included as well at 2 mM. In one specific example peptide, the codon typically reserved for tyrosine (TAC) will be targeted by the orthogonal aminoacyl-tRNA, resulting in a peptide sequence of M-pPa-VVVVVVVVV (SEQ ID NO: 48). Yield Analysis: C14-labeled valine and TCA precipitation of the CPFS product followed by scintillation counting to measure radiation will be employed to quantify polyvaline production. Gel electrophoresis and autoradiography can be employed to verify correct product production.
Example 9: Probing Codon: Anticodon Promiscuity for Optimal Minimal Codon Set
Gene Design: Codon:anticodon pairing naturally exhibits some amount of promiscuity or degeneracy. To verify that pairs are exclusive and non-promiscuous, test proteins are designed. Test proteins will have the template nucleic acid sequence
ofATG-XYZ-(GTA)20
(ATGNNNGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG TAGTAGTAGTAGTAGTA) (SEQ ID NO: 49) where "NNN" represents the codon being probed for degeneracy. Exemplary pairing of "NNN" is described below using "XYZ" as exemplary codons.
Cell-free Protein Synthesis: CFPS will be performed using tRNA-depleted CFPS reaction conditions as specified in Example 3 with the exception of adding additional tranzyme DNA linear expression templates at optimized concentrations as in Example 5. The test protein will be coexpressed with tranzyme genes for fMetCAU, ValUAC, and the tranzyme of interest. For example, the tranzyme may contain the anticodon "Ζ'Υ'Χ'" - i.e. a standard Watson-Crick pairing for the codon "XYZ." To examine degeneracy, the anticodon sequence may be mutated to "ΥΎ'Χ'" for example. Protein expression will be dependent on the existence of sufficient pairing that the "XYZ" codon encodes. The codon:anticodon pairing may be considered degenerate or promiscuous when protein expression using the anticodon "γ'γ'χ'" js equal to or nearly equal to expression using "Ζ'Υ'Χ'." Codon: anticodon pairing may be considered orthogonal or exclusive when protein expression using the anticodon "γ'Υ'Χ'" is significantly less than expression levels using "ΖΎ'Χ'." Yield Analysis: C14-labeled valine and TCA precipitation of the CPFS product followed by scintillation counting to measure radiation will be employed to quantify polyvaline production. Gel electrophoresis and autoradiography can be employed to verify correct product production.
Although the invention herein has been described in connection with a preferred embodiment thereof, it will be appreciated by those skilled in the art that additions, modifications, substitutions, and deletions not specifically described may be made without departing from the spirit and scope of the invention as defined in the appended claims. It is therefore intended that the foregoing detailed description
be regarded as illustrative rather than limiting, and that it be understood that it is the following claims, including all equivalents, that are intended to define the spirit and scope of this invention.
STATEMENT
1. A method for incorporating at least one non-natural amino acid into a polypeptide using a cell-free protein synthesis system, wherein the cell-free protein synthesis system comprises a cell-free extract and is deficient in endogenous tRNA, the method comprising:
providing the synthesis system with the at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA corresponding to the at least one non-natural amino acid, wherein the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
2. The method of claim 1, further comprising:
removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA.
3. The method of claim 1 or 2, further comprising:
providing the synthesis system with a set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon.
4. The method of claim 3, wherein the set of tRNAs comprises tRNAs for at least 2 natural amino acids.
5. The method of claim 3, wherein the set of tRNAs for one or more natural amino acids are produced in the cell-free protein synthesis system with a tRNA gene as template.
6. The method of any one of claims 1 to 5, further comprising:
selecting codons for the non-natural amino acids based on the codons of the one or more natural amino acids so that the competition between the natural amino acids and the non-natural amino acids to be attached to the orthogonal tRNAs is reduced.
7. The method of claim 6, further comprising:
selecting codons for the non-natural amino acids based on frequency of codon use and frequency of being incorporated by natural tRNAs. 8. The method of any one of claims 1 to 7, wherein the tRNAs for one or more natural or non-natural amino acids are obtained through the steps comprising:
identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids; and
producing the tRNAs for the natural or non-natural amino acids with an RNA polymerase and a tRNA gene template comprising the gene sequences.
9. The method of claim 8, wherein the steps further comprises removing the gene sequences encoding for tRNAs that form wobble base pairing or other nonspecific base pairing with the codons of natural amino acids.
10. The method of any one of claims 6 to 7, wherein the RNA polymerase is a T7 RNA polymerase.
11. The method of any one of claims 8 to 10, wherein the tRNA gene template comprises a gene sequence encoding a ribozyme.
12. The method of any one of claims 8 to 1 1, wherein the tRNA gene template comprises a hammerhead ribozyme. 13. The method of any one of claims 8 to 12, wherein the tRNA gene template comprises a linear tRNA gene template without a transcription terminator sequence.
14. The method of any one of claims 8 to 13, wherein the tRNAs for the natural amino acids are produced by PCR.
15. The method of any one of claims 2 to 14, wherein the ribonuclease is selected from the group consisting of RNase A, Onconase and Colicin D tRNase.
16. The method of any one of claims 2 to 15, wherein the ribonuclease is immobilized on a carrier or surface. 17. The method of any one of claims 2 to 16, wherein the ribonuclease is immobilized onto magnetic beads.
18. The method of any one of claims 2 to 17, wherein the ribonuclease is recycled. 19. The method of any one of claims 1 to 18, wherein the cell-free protein synthesis system is an E. co/z'-based cell-free protein synthesis system.
20. The method of any one of claims 1 to 19, wherein the orthogonal aminoacyl- tRNA synthetase is derived from one or more of M. jannaschii, M. barkeri, and . horikoshii.
21. The method of any one of claims 1 to 20, further comprising selecting a concentration of the orthogonal tRNA and the orthogonal aminoacyl-tRNA synthetase to increase efficiency of the non-natural amino acid incorporation.
22. The method of any one of claims 1 to 21, further comprising selecting a concentration of the non-natural amino acid to increase efficiency of the non-natural amino acid incorporation.
23. The method of any one of claims 3 to 22, wherein the set of tRNAs for one or more natural amino acids are produced in the cell-free protein synthesis system with tRNA genes as template, the method further comprising selecting a concentration
ratio of the tRNAs and tRNA gene template to increase efficiency of the non-natural amino acid incorporation.
24. A method for producing a set of tRNAs for one or more natural or non-natural amino acids, comprising
identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids;
removing the gene sequences with overlapping anticodon sequences for each of the one or more natural or non-natural amino acid; and
producing the tRNAs for the natural or non-natural amino acids with RNA polymerase and tRNA gene templates comprising the gene sequences.
25. The method of claim 24, further comprising
removing the gene sequences encoding for tRNAs that form wobble base pairing or otherwise non-specific base pairing with the codons of natural or non-natural amino acids.
26. The method of any of claims 24 to 25, wherein the tRNA gene templates comprise a linear tRNA gene template without a transcription terminator sequence.
27. The method of any of claims 24 to 26, wherein the tRNA gene templates comprise a gene sequence encoding a ribozyme.
28. The method of any of claims 24 to 27, wherein the tRNA gene templates comprise a hammerhead ribozyme.
29. A set of tRNA gene sequences for one or more natural amino acids comprising a gene sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21.
30. A kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide, comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA, wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
Claims
1. A method for incorporating at least one non-natural amino acid into a polypeptide using a cell-free protein synthesis system, wherein the cell-free protein synthesis system comprises a cell-free extract and is deficient in endogenous tRNA, the method comprising:
providing the synthesis system with the at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and an orthogonal tRNA corresponding to the at least one non-natural amino acid, wherein the orthogonal aminoacyl-tRNA synthetase aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
2. The method of claim 1, further comprising:
removing the endogenous tRNA in the cell-free protein synthesis system by treating the synthesis system with a ribonuclease to degrade the endogenous tRNA.
3. The method of claim 1, further comprising:
providing the synthesis system with a set of tRNAs for one or more natural amino acids and the corresponding amino-acyl tRNA synthetases, wherein each of the one or more natural amino acids corresponds to a single unique codon.
4. The method of claim 3, wherein the set of tRNAs comprises tRNAs for at least 2 natural amino acids.
5. The method of claim 3, wherein the set of tRNAs for one or more natural amino acids are produced in the cell-free protein synthesis system with a tRNA gene as template.
6. The method of claim 1, further comprising:
selecting codons for the non-natural amino acids based on the codons of the one or more natural amino acids so that the competition between the natural amino
acids and the non-natural amino acids to be attached to the orthogonal tRNAs is reduced.
7. The method of claim 6, further comprising:
selecting codons for the non-natural amino acids based on frequency of codon use and frequency of being incorporated by natural tRNAs.
8. The method of claim I, wherein the tRNAs for one or more natural or non- natural amino acids are obtained through the steps comprising:
identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids; and
producing the tRNAs for the natural or non-natural amino acids with an RNA polymerase and a tRNA gene template comprising the gene sequences.
9. The method of claim 8, wherein the steps further comprises removing the gene sequences encoding for tRNAs that form wobble base pairing or other nonspecific base pairing with the codons of natural amino acids.
10. The method of claim 6, wherein the RNA polymerase is a T7 RNA polymerase.
11. The method of claim 8, wherein the tRNA gene template comprises a gene sequence encoding a ribozyme.
12. The method of claim 8, wherein the tRNA gene template comprises a hammerhead ribozyme.
13. The method of claim 8, wherein the tRNA gene template comprises a linear tRNA gene template without a transcription terminator sequence.
14. The method of claim 8, wherein the tRNAs for the natural amino acids are produced by PCR.
15. The method of claim 2, wherein the ribonuclease is selected from the group consisting of RNase A, Onconase and Colicin D tRNase.
16. The method of claim 2, wherein the ribonuclease is immobilized on a carrier or surface.
17. The method of claim 2, wherein the ribonuclease is immobilized onto magnetic beads.
18. The method of claim 2, wherein the ribonuclease is recycled.
19. The method of claim 1, wherein the cell-free protein synthesis system is an E. co/z'-based cell-free protein synthesis system.
20. The method of claim 1, wherein the orthogonal aminoacyl-tRNA synthetase is derived from one or more of M. jannaschii, M. barkeri, and P. horikoshii.
21. The method of claim 1, further comprising selecting a concentration of the orthogonal tRNA and the orthogonal aminoacyl-tRNA synthetase to increase efficiency of the non-natural amino acid incorporation.
22. The method of claim 1, further comprising selecting a concentration of the non-natural amino acid to increase efficiency of the non-natural amino acid incorporation.
23. The method of claim 3, wherein the set of tRNAs for one or more natural amino acids are produced in the cell-free protein synthesis system with tRNA genes as template, the method further comprising selecting a concentration ratio of the tRNAs and tRNA gene template to increase efficiency of the non-natural amino acid incorporation.
24. A method for producing a set of tRNAs for one or more natural or non- natural amino acids, comprising
identifying gene sequences encoding for tRNAs for the one or more natural or non-natural amino acids;
removing the gene sequences with overlapping anticodon sequences for each of the one or more natural or non-natural amino acid; and
producing the tRNAs for the natural or non-natural amino acids with RNA polymerase and tRNA gene templates comprising the gene sequences.
25. The method of claim 24, further comprising
removing the gene sequences encoding for tRNAs that form wobble base pairing or otherwise non-specific base pairing with the codons of natural or non- natural amino acids.
26. The method of claim 24, wherein the tRNA gene templates comprise a linear tRNA gene template without a transcription terminator sequence.
27. The method of claim 24, wherein the tRNA gene templates comprise a gene sequence encoding a ribozyme.
28. The method of claim 24, wherein the tRNA gene templates comprise a hammerhead ribozyme.
29. A set of tRNA gene sequences for one or more natural amino acids comprising a gene sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 1 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21.
30. A kit for producing a polypeptide with at least one non-natural amino acid incorporated into the polypeptide, comprising a cell-free protein synthesis system wherein endogenous tRNA is removed, at least one non-natural amino acid, at least one orthogonal aminoacyl-tRNA synthetase and its corresponding orthogonal tRNA,
wherein the orthogonal aminoacyl-tRNA synthetase preferentially aminoacylates the corresponding orthogonal tRNA with the non-natural amino acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/894,638 US20160115487A1 (en) | 2013-05-29 | 2014-05-29 | Cell-free synthetic incorporation of non-natural amino acids into proteins |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361855983P | 2013-05-29 | 2013-05-29 | |
| US61/855,983 | 2013-05-29 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2014194129A2 true WO2014194129A2 (en) | 2014-12-04 |
| WO2014194129A3 WO2014194129A3 (en) | 2015-02-19 |
Family
ID=51989532
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/040078 Ceased WO2014194129A2 (en) | 2013-05-29 | 2014-05-29 | Cell-free synthetic incorporation of non-natural amino acids into proteins |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20160115487A1 (en) |
| WO (1) | WO2014194129A2 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016154675A1 (en) * | 2015-03-27 | 2016-10-06 | The University Of Queensland | Platform for non-natural amino acid incorporation into proteins |
| EP3699276A4 (en) * | 2017-10-16 | 2021-07-28 | The University Of Tokyo | MODIFICATION OF D- AND T-ARMS OF TRNA FOR INCREASED UTILIZATION OF D-AMINO ACID AND BETA-AMINO ACID |
| CN113388654A (en) * | 2021-06-04 | 2021-09-14 | 清华大学 | Linear template based cell-free system unnatural amino acid embedding method |
| WO2021211178A1 (en) * | 2020-04-15 | 2021-10-21 | Brigham Young University | In vitro transcription-translation metabolic networks to measure quantity or activity of enzymes |
| WO2025216584A1 (en) * | 2024-04-11 | 2025-10-16 | 포항공과대학교 산학협력단 | Genome-processed strain for efficient synthesis of non-natural amino acid-introduced protein and method for producing cell lysate |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018148199A1 (en) * | 2017-02-09 | 2018-08-16 | Carrier Corporation | Dongle for a building management system and method of operating |
| CN115135771A (en) * | 2019-10-25 | 2022-09-30 | 西北大学 | Cell-free extract preparation protocol for membrane bubble enrichment and glycoprotein production increase |
| CN114634958B (en) * | 2021-12-22 | 2024-08-16 | 清华大学 | Method for inserting unnatural amino acids using cell-free protein synthesis system |
| CN119913187A (en) * | 2023-10-31 | 2025-05-02 | 康码(上海)生物科技有限公司 | A genetically engineered strain based on tRNA modification and its preparation method and application |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007061136A1 (en) * | 2005-11-24 | 2007-05-31 | Riken | Method for production of protein having non-natural type amino acid integrated therein |
| MX2008011477A (en) * | 2006-03-07 | 2008-09-23 | Cargill Inc | Aldolases, nucleic acids encoding them and methods for making and using them. |
| US8178340B2 (en) * | 2007-08-16 | 2012-05-15 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Human specific Escherichia coli strains |
| JP5798489B2 (en) * | 2009-01-12 | 2015-10-21 | ストロ バイオファーマ, インコーポレイテッド | Monocharge system for selectively introducing unnatural amino acids into proteins using in vitro protein synthesis system |
| JP5948673B2 (en) * | 2011-03-10 | 2016-07-06 | ジーンフロンティア株式会社 | COMPOSITION FOR PROTEIN SYNTHESIS WITH REDUCED LIPO POLUCHIsaccharide CONTENT AND METHOD FOR PRODUCING PROTEIN USING THE COMPOSITION |
-
2014
- 2014-05-29 US US14/894,638 patent/US20160115487A1/en not_active Abandoned
- 2014-05-29 WO PCT/US2014/040078 patent/WO2014194129A2/en not_active Ceased
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016154675A1 (en) * | 2015-03-27 | 2016-10-06 | The University Of Queensland | Platform for non-natural amino acid incorporation into proteins |
| CN107614689A (en) * | 2015-03-27 | 2018-01-19 | 昆士兰大学 | For the platform being incorporated to alpha-non-natural amino acid in protein |
| JP2018509172A (en) * | 2015-03-27 | 2018-04-05 | ザ ユニバーシティ オブ クィーンズランド | Platform for unnatural amino acid incorporation into proteins |
| EP3699276A4 (en) * | 2017-10-16 | 2021-07-28 | The University Of Tokyo | MODIFICATION OF D- AND T-ARMS OF TRNA FOR INCREASED UTILIZATION OF D-AMINO ACID AND BETA-AMINO ACID |
| US11946042B2 (en) | 2017-10-16 | 2024-04-02 | The University Of Tokyo | Modification of D- and T-arms of tRNA enhancing D-amino acid and β-amino acid uptake |
| WO2021211178A1 (en) * | 2020-04-15 | 2021-10-21 | Brigham Young University | In vitro transcription-translation metabolic networks to measure quantity or activity of enzymes |
| CN113388654A (en) * | 2021-06-04 | 2021-09-14 | 清华大学 | Linear template based cell-free system unnatural amino acid embedding method |
| WO2025216584A1 (en) * | 2024-04-11 | 2025-10-16 | 포항공과대학교 산학협력단 | Genome-processed strain for efficient synthesis of non-natural amino acid-introduced protein and method for producing cell lysate |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014194129A3 (en) | 2015-02-19 |
| US20160115487A1 (en) | 2016-04-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20160115487A1 (en) | Cell-free synthetic incorporation of non-natural amino acids into proteins | |
| EP2906592B1 (en) | Proteolytic inactivation of select proteins in bacterial extracts for improved expression | |
| EP1999259B1 (en) | Site-specific incorporation of amino acids into molecules | |
| JP7825552B2 (en) | Compositions and methods for the in vivo synthesis of non-natural polypeptides | |
| ES2991825T3 (en) | Cell-free protein expression using a rolling circle amplification product | |
| JP7093417B2 (en) | How to regulate in vitro biosynthetic activity by knocking out the nuclease system | |
| US20220228148A1 (en) | Eukaryotic semi-synthetic organisms | |
| Ohtsuki et al. | Multiple incorporation of non-natural amino acids into a single protein using tRNAs with non-standard structures | |
| KR20080106430A (en) | System for Expression of Orthogonal Translation Components in Genuine Bacterial Host Cells | |
| JP2025172162A (en) | Composition for translation and method for producing peptide | |
| Kawarasaki et al. | A long-lived batch reaction system of cell-free protein synthesis | |
| US20240384267A1 (en) | Compositions and methods for multiplex decoding of quadruplet codons | |
| JP4936290B2 (en) | Method for producing a protein incorporating an unnatural amino acid | |
| EP1373570B1 (en) | Improved in vitro synthesis system | |
| US20220002719A1 (en) | Oligonucleotide-mediated sense codon reassignment | |
| CN114787350B (en) | mRNA and method for producing the same, device for producing protein, and method for producing protein | |
| WO2024172058A1 (en) | TRANSLATION INITIATION WITH EXOTIC AMINO ACIDS USING EF-P-RESPONSIVE ARTIFICIAL INITIATOR tRNA | |
| KR101646728B1 (en) | A method of synthesizing unnatural protein using degenercy reprogramming | |
| Röhrig et al. | In vitro non-natural amino acid mutagenesis using a suppressor tRNA generated by the cis-acting hepatitis delta virus ribozyme | |
| AU2002247274A1 (en) | Improved in vitro synthesis system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14804379 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14804379 Country of ref document: EP Kind code of ref document: A2 |