WO2014189832A1 - Il-34 receptor assays and uses thereof - Google Patents
Il-34 receptor assays and uses thereof Download PDFInfo
- Publication number
- WO2014189832A1 WO2014189832A1 PCT/US2014/038590 US2014038590W WO2014189832A1 WO 2014189832 A1 WO2014189832 A1 WO 2014189832A1 US 2014038590 W US2014038590 W US 2014038590W WO 2014189832 A1 WO2014189832 A1 WO 2014189832A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- ρτρ
- cells
- csf
- agent
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
- G01N33/5058—Neurological cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/244—Interleukins [IL]
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/914—Hydrolases (3)
- G01N2333/916—Hydrolases (3) acting on ester bonds (3.1), e.g. phosphatases (3.1.3), phospholipases C or phospholipases D (3.1.4)
Definitions
- the invention relates to assays for activators and inhibitors of actions of interleukin-34 (IL-34) that are independent of the colony stimulating factor- 1 (CSF-1) receptor (CSF-1 R) and play a role in development, homeostasis and disease.
- IL-34 interleukin-34
- CSF-1 R colony stimulating factor-1 receptor
- the CSF-IR kinase (1,2) plays a critical role in the regulation of macrophage and osteoclast production and function (3-6) as well as the development and regulation of other cell types (7-11).
- the existence of an additional CSF-IR ligand was proposed based on the greater severity of phenotype of homozygous null CSF-IR mice, compared to the phenotype of homozygous CSF-l-null mutant mice (12).
- IL-34 interleukin-34
- IL-34 and CSF-1 compete for binding to the CSF-IR and have similar CSF-1 R-mediated effects, they exhibit significant tissue specific and developmental differences in their expression patterns (14).
- CSF-1- deficient mice exhibit partial loss of microglia
- CSF-lR-deficient mice have no microglia (15).
- IL-34-deficient mice were shown to exhibit severe deficits in microglia (16,76).
- IL34 mRNA is expressed at a significantly higher level than either Csfl or Csflr mRNA in several regions of the early postnatal and adult brain (14) and IL-34 protein is often expressed in regions where there is minimal expression of the CSF-1 R or CSF-1 -reporter proteins and IL-34 is significantly more active in suppressing neural progenitor cell proliferation and neuronal differentiation than CSF-1 (9).
- Protein tyrosine phosphatase receptor type zeta (18,19), a cell-surface receptor and a chondroitin sulfate (CS) proteoglycan (CSPG)
- CSPG chondroitin sulfate proteoglycan
- ⁇ - ⁇ The binding of some of these ligands involves the CS glycosaminoglycan (GAG)-moiety of ⁇ - ⁇ (25,29).
- GAG glycosaminoglycan
- SFK Src-family kinases
- FAK focal adhesion kinase
- Erk-1/2 extracellular signal- regulated kinase-1/2
- the present invention addresses the need for activators and inhibitors of actions of IL-34 that are independent of the CSF-1 R receptor and play a role in development, homeostasis and disease.
- the invention provides methods for determining whether or not an agent is a candidate agent for inhibiting interaction between interleukin-34 (IL-34) and protein tyrosine phosphatase receptor type zeta ( ⁇ - ⁇ ) comprising: contacting cells that express ⁇ - ⁇ on their surface and that do not express colony stimulating factor- 1 receptor (CSF-1R) with IL- 34 in the presence of the agent and in the absence of the agent, and measuring a cellular response induced by IL-34, wherein an agent that reduces a cellular response induced by IL- 34 is a candidate agent for inhibiting interaction between IL-34 and ⁇ - ⁇ , and wherein an agent that does not reduce a cellular response induced by IL-34 is not a candidate agent for inhibiting interaction between IL-34 and ⁇ - ⁇ .
- IL-34 interleukin-34
- ⁇ - ⁇ protein tyrosine phosphatase receptor type zeta
- FIG. 1A-1C Interaction of IL-34 with ⁇ - ⁇ in solubilized membrane fractions of mouse brain.
- OG N-octyl-p-D-glucoside
- OG N-octyl-p-D-glucoside
- the SDS eluates of the IL-34 immunoprecipitates or biotinylated IL-34 complexes (recovered with neutravidin beads) were analyzed by SDS-PAGE with silver staining.
- the IL-34-associated proteins identified with 99% certainty by mass spectrometry were ⁇ - ⁇ and TN-R (Fig. 7).
- Western blots (WB) indicate the ⁇ - ⁇ (L, long isoform, P, phosphacan/soluble isoform and the ⁇ 225-kDa short isoform) and TN-R staining bands.
- Multimeric (52) (slower migrating bands, -400 kDa) and alternatively spliced (faster migrating bands, 160/180 kDa) variants of TN-R were co-immunoprecipitated, or pulled down.
- (B) Scheme depicting various ⁇ - ⁇ isoforms. Upper panel, the long isoform (active) containing a carbonic anhydrase domain (CA) and a fibronectin type III repeat (F), a transmembrane domain (TM), protein tyrosine phosphatase domains (PTP1 and PTP2) and three glycosaminoglycan (GAG) addition sites.
- CA carbonic anhydrase domain
- F fibronectin type III repeat
- TM transmembrane domain
- PTP1 and PTP2 protein tyrosine phosphatase domains
- GAG glycosaminoglycan
- the OG-solubilized mouse brain membrane fraction was incubated with mIL-34 (4°C, 16h), immunoprecipitated with immobilized anti- ⁇ - ⁇ (3F8), or isotype control (mlgGl) antibodies and the immunoprecipitates analyzed by gradient SDS-PAGE and western blotting.
- L long isoform
- IL-34 binds cell-surface ⁇ - ⁇ in U251 human glioblastoma cells.
- A Interaction of IL-34 with ⁇ - ⁇ in OG-solubilized U251 cell membrane fractions. Membranes lysates were incubated with biotinylated hIL-34 (4°C, 16h), the complexes captured with neutravidin beads (4°C, 6h), eluted with SDS and analyzed by SDS-PAGE and silver staining, or by western blotting (WB) with antibodies to ⁇ - ⁇ .
- Fig. 3A-3B IL-34 inhibits growth and clonogenicity of U251 glioblastoma cells in a ⁇ - ⁇ -dependent manner.
- A Cell proliferation assay. Control (left panel) or PTP- ⁇ KD (right panel) cells were incubated with the indicated factors for the indicated times and the viable cell numbers assessed by trypan blue exclusion staining.
- B Clonogenic assay. Left panel, micrographs of colony forming assays of U251 cells incubated with vehicle or IL- 34. Right panel, histograms showing average colony counts from triplicate experiments.
- A) and (B), Means ⁇ SD; n 3; *, significantly different from cells incubated with vehicle alone, p ⁇ 0.05.
- IL-34 inhibits ⁇ - ⁇ -dependent U251 motility.
- C Inhibition of haptotactic migration by IL-34.
- Fig. 5A-5C IL-34 binding to ⁇ - ⁇ enhances tyrosine phosphorylation of FAK and Paxillin, in U251 cells.
- A Kinetics of tyrosine phosphorylation in response to IL- 34. SDS-PAGE and western blot analysis of NP-40 lysates from U251 cells treated with IL- 34 or PTN harvested at the indicated times and stained as shown. FAK, focal adhesion kinase; Pax, paxillin.
- IL-34 binds to ⁇ - ⁇ in a CS-dependent manner.
- A Effect of Chondroitinase ABC on specific ⁇ - ⁇ isoforms. Anti- ⁇ - ⁇ western blot of U251 membrane lysates incubated with and without chondroitinase ABC (0.3 U/ml, 37°C, lh). L, long isoform; NG, non-glycosaminoglycan isoform; S, short isoform.
- B CS is required for IL-34 binding to ⁇ - ⁇ .
- Serum-starved U251 cells were either incubated with, or without ChABC (4.2 U/ml) and subsequently with 2 ⁇ g/ml biotinylated hIL-34, prior to further incubation with streptavidin-conjugated APC-Cy7 and flow cytometric analysis, gating on viable cells.
- the vertical line defines the level of non-specific binding of biotinylated IL-34.
- Fig. 7A-7B LC-MS/MS peptide hits for TN-R and ⁇ - ⁇ .
- A TN-R protein sequence from mouse (SEQ ID NO: 10).
- B ⁇ - ⁇ / ⁇ protein sequence from mouse (SEQ ID NO: 1 1).
- CA carbonic anhydrase homology domain
- F fibronectin type III repeat
- PTP1 and PTP2 two phosphatase domains
- GAG consensus glycosaminoglycan
- the peptide stretch missing in the short isoform is bolded.
- Fig. 8A-8C U251 cells lack the CSF-IR.
- A Failure of hIL-34 to bind to CSF-IR on U251 cells.
- biotinylated IL- 34 complexes were recovered by incubation with neutravidin and SDS eluates containing the complexes analyzed by SDS-PAGE and western blotting (WB) with an antibody that equivalently recognizes both mCSF-lR and hCSF-lR.
- WB western blotting
- N-octyl- -D-glucoside (OG)-solubilized membrane fractions of U251 human glioblastoma (lane 1) and NIH-3T3-hCSF- 1R (lanes 2-4) cells were incubated overnight at 4°C with anti-hCSF-lR antibody (lanes 1, 2) or biotinylated hIL-34 (lanes 3, 4).
- the biotinylated IL-34 complexes were recovered by incubation with neutravidin and SDS eluates of IL-34 pull-down and CSF-IR immunoprecipitates analyzed by SDS-PAGE and western blotting (WB) with antibodies to hCSF-lR.
- the invention provides a method for determining whether or not an agent is a candidate agent for inhibiting interaction between interleukin-34 (IL-34) and protein tyrosine phosphatase receptor type zeta ( ⁇ - ⁇ ) comprising:
- CSF-IR colony stimulating factor- 1 receptor
- an agent that reduces a cellular response induced by IL-34 is a candidate agent for inhibiting interaction between IL-34 and ⁇ - ⁇ , and
- an agent that does not reduce a cellular response induced by IL-34 is not a candidate agent for inhibiting interaction between IL-34 and ⁇ - ⁇ .
- the cells can be, for example, glioblastoma cells, such as, e.g., U251 human glioblastoma cells.
- the cells can have been transfected with nucleic acid encoding human ⁇ - ⁇ .
- Human ⁇ - ⁇ has the amino acid sequence (ACCESSION P23471, VERSION P23471.4 GL229485537, SEQ ID NO: 12):
- Cellular response induced by IL-34 can include any of the following.
- IL-34 can inhibit, for example, one or more of cell proliferation, clonogenicity and/or motility.
- IL- 34 can induce tyrosine phosphorylation of a protein, such as, for example, focal adhesion kinase (FAK) and/or paxillin.
- FAK focal adhesion kinase
- IL-34 can also, for example, stimulate differentiation of neural progenitor cells.
- the agent can be, for example, an antibody, a monoclonal antibody, a polyclonal antibody, an antibody fragment, a F(ab')2 fragment, a Fab' fragment, a peptide, a peptide nucleic acid, or small chemical compound (e.g., have a molecular weight of 5,000 daltons or less).
- the agent can bind to a chondroitin sulfate glycosaminoglycan (GAG) moiety on ⁇ - ⁇ or to a GAG mimic.
- GAG chondroitin sulfate glycosaminoglycan
- the agent can be useful, for example, for treatment of a disease or disorder or a defect in neural or microglial development or a defect in homeostasis.
- the disease or disorder can be, for example, cancer, inflammation, a central nervous system disease, brain injury, neuro-degeneration, a memory deficit, glioblastoma, multiple sclerosis, schizophrenia, or autoimmune disease.
- ⁇ - ⁇ As an IL-34-interacting membrane protein in mouse brain.
- IL-34 was demonstrated to bind specifically to cell-surface ⁇ - ⁇ to initiate downstream signaling that leads to the inhibition of cell proliferation, clonogenicity and motility.
- IL-34-binding to ⁇ - ⁇ is dependent on the presence of the CS GAG moiety on ⁇ - ⁇ .
- the demonstration of the existence of a novel IL- 34 receptor increases the scope of biological effects of IL-34 in development, homeostasis and disease.
- mIL-34 mouse IL-34
- hIL-34 human IL-34
- purified polyclonal rabbit anti-mIL-34 antibodies were from FivePrime Therapeutics, Inc., CA, USA) and human PTN (hPTN) was from R&D (Minneapolis, MN). Growth factors were suspended in phosphate buffered saline (PBS) as vehicle.
- mIL-34 and hIL-34 were biotinylated using a 10 molar excess of EZ-Link Sulfo-NHS-LC-LC-Biotin (Thermo Scientific, MA, USA) (15', 20°C) following manufacturer's instructions.
- Bovine serum albumin was from Gemini (CA, USA), Puromycin dihydrochloride, trypan blue, crystal violet, DAPI, shark cartilage CS salts, Proteus vulgaris chondoitinase ABC (chABC) and phalloidin were from SIGMA (MO, USA).
- Polybrene was from Santa Cruz Biotechnology, Inc. (CA, USA).
- Neutravidin- Ultralink beads were from Thermo Scientific (MA, USA).
- Streptavidin-conjugated APC-Cy7 was from Biolegend (CA, USA).
- LIVE/DEAD ® Fixable dead cell stain kits were from Molecular Probes (NY, USA).
- HTS FluoroBlokTM inserts and 24-well and 6-well tissue culture dishes were from BD Biosciences, Franklin Lakes, NJ. Accutase was from Stem Cell Technologies (Vancouver, BC, Canada).
- Human ⁇ - ⁇ and CSF-1R extracellular domains (ECD) fused immunoglobulin Fc domains ( ⁇ - ⁇ -ECD-Fc and hCSF-lR-ECD-Fc) were prepared as described previously for the hCSF-lR-ECD-Fc (13).
- Human recombinant CSF-1 (hCSF-1) was a gift from Chiron Corp. (Emeryville, CA, USA).
- EDC/NHS, HBSP and HBSP+ buffers were from GE Healthcare Biosciences, Pittsburgh, PA, USA.
- Sample preparation for LC-MS/MS-identiflcation of the receptor - Subcellular fractionation was carried out to isolate the membrane fraction from a pool of 2 postnatal day 7 and 2 postnatal day 60 mouse brains. Briefly, mouse brain tissue was homogenized in homogenization buffer (65 mM Tris, 150 mM sodium chloride, 1 mM EDTA, 10 ⁇ g/ml aprotinin, 10 ⁇ g/ml leupeptin and 1 mM benzamidine, pH 7.4) and the homogenate centrifuged (lOOOxg, 3 min, 4°C).
- homogenization buffer 65 mM Tris, 150 mM sodium chloride, 1 mM EDTA, 10 ⁇ g/ml aprotinin, 10 ⁇ g/ml leupeptin and 1 mM benzamidine, pH 7.4
- the supernatant was further centrifuged (100,000xg, 30 min, 4°C) and the pellet dissolved in 2% N-octyl-p-D-glucoside (OG), prior to centrifugation (100,000xg, 30 min, 4°C).
- the supernatant, containing 26 mg of the OG- solubilized membrane lysate was first pre-cleared by incubation with 60 ⁇ g of anti-CSF-lR peptide antibody (C-15) (4°C, 16h) and then incubated with 24 ⁇ g of mIL-34 non-covalently bound to 40 ⁇ g of immobilized polyclonal rabbit anti-mIL-34 antibody (4°C, 16h).
- mIL-34- anti-mIL-34 antibody complex was serially washed using 0.1 M glycine-HCl, pH 2.2 and 8 M urea and subsequently eluted with 1% SDS.
- the glycine-HCl and urea washes did not result in dissociation of proteins from mIL-34-anti-mIL-34 antibody complex, as determined by SDS-PAGE and LC-MS/MS.
- the denatured, reduced and alkylated SDS eluate was further concentrated by ultracentrifugation using 100 kDa cut-off filters and subjected to SDS removal, concentration, trypsinization and detergent extraction with ethyl acetate, as described elsewhere (44,45) followed by LC-MS/MS.
- Nanoelectrospray LC-MS/MS analyses and protein identification- Tryptic digests were loaded and separated using the UltiMate, FAMOS, Switchos nano-HPLC system (LC Packings, Dionex; Sunnyvale, CA), connected on-line to a LTQ Linear Ion Trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA) and equipped with a nanospray source.
- the mobile phases consisted of 5% acetonitrile/water, 0.1% formic acid (A) and 80% acetonitrile/water, 0.1% formic acid (B). After injection (15 ⁇ of sample) and loading onto a CI 8 trap column, 0.3 mm I.D.
- the tryptic peptides were separated on a CI 8 analytical HPLC column (75 ⁇ I.D. X 15 cm; Pepmap, 3 ⁇ , 100 A; LC Packings, Dionex; Sunnyvale, CA).
- the flow rate for loading and desalting was 15 ⁇ /min for 30 minutes while the analytical separation was performed at 250 ⁇ /min.
- the gradient used was: 2% to 55% B in 65 min; held at 55% B for 10 minutes; increase to 95% B in 5 min and then held at 95% B for 5 minutes.
- the HPLC eluent was electrosprayed into the LTQ using the nanospray source.
- MS/MS scans were obtained from three most intense ions using a normalized collision-energy of 35%.
- DTA files were generated from the raw data files, merged and searched against all species of the NCBInr database (July 2, 2010) using Mascot (version 2.3).
- the search parameters were: fixed modification - carboxymethyl Cys; variable modifications - N/Q deamidation, oxidized Met, pyro-glu from Q and pyro-glu from E; 2 missed cleavages; peptide mass tolerance of +/- 3.5 Da and +/- 0.6 Da for the product ions.
- biotinylated IL-34 complexes were recovered by incubation with neutravidin-agarose and SDS eluates of IL-34 pull-down and immunoprecipitates analyzed by SDS-PAGE and western blotting (WB).
- WB western blotting
- mouse brain membrane lysates were pre-incubated with mIL-34 (4°C, 16h), prior to incubation with anti- ⁇ - ⁇ (3F8) antibodies.
- serum-starved U251 cells were incubated with hPTN or hIL-34 (120 ng/ml) at 37°C and NP-40 cell lysates (using 1% NP-40, 10 mM Tris- HC1, 50 mM NaCl, 30 mM Na 4 P 2 0 7 , 50 mM NaF, 100 ⁇ Na3V04, 5 ⁇ ZnCl 2 , 1 mM benzamidine, 10 ⁇ g/ml leupeptin, and 10 ⁇ g/ml aprotinin, pH 7.2) were subjected to immunoprecipitation using antibodies to FAK and paxillin.
- Flow cytometry For cell-surface IL-34 binding, serum-starved U251 cells were gently harvested with 2 mM EDTA in PBS, pH 7.4, washed and lxlO 6 cells were preincubated with a 10 molar excess of hIL-34 in Hank's Balanced Salt Solution (HBSS) (Life Technologies) in the presence of 1% BSA (4°C, 1 h). After extensive washing, specific IL-34 binding was detected by incubating the cells with 2 ⁇ g/ml biotinylated hIL-34 (4°C, 1 h), and, subsequently, with 5 ⁇ g/ml streptavidin-conjugated APC-Cy7.
- HBSS Hank's Balanced Salt Solution
- Flow cytometry was performed using FACS Canto II (BD Biosciences, NC, USA) (gating on viable cells).
- the Flow Jo software (Treestar, USA) was used for data analysis.
- serum-starved 2xl0 5 U251 cells were incubated with 5 ⁇ g/ml rat anti-hCSF-lR monoclonal antibody (2-4A5) or control rat IgGi (e-Biosciences, CA, USA) (4°C, 45'), then subsequently incubated with 5 ⁇ g/ml FITC-conjugated F(ab')2-anti-Rabbit IgG (e- Biosciences, CA, USA) prior to flow cytometric analysis as previously described.
- hPTN or hIL-34 (1 ⁇ g/ml) was added to both sides of the transwell chamber. Cells were scraped from the upper side of the chamber and the lower side was stained with DAPI and phalloidin. Phalloidin-stained cells were counted using a fluorescence microscope.
- Nanoelectrospray LC-MS/MS analyses and protein identification- Tryptic digests were loaded and separated using the UltiMate, FAMOS, Switchos nano-HPLC system (LC Packings, Dionex; Sunnyvale, CA), connected on-line to a LTQ Linear Ion Trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA) and equipped with a nanospray source.
- the mobile phases consisted of 5% acetonitrile/water, 0.1% formic acid (A) and 80% acetonitrile/water, 0.1% formic acid (B). After injection (15 ⁇ ⁇ of sample) and loading onto a CI 8 trap column, 0.3 mm I.D.
- the tryptic peptides were separated on a CI 8 analytical HPLC column (75 ⁇ I.D. X 15 cm; Pepmap, 3 ⁇ , 100 A; LC Packings, Dionex; Sunnyvale, CA).
- the flowrate for loading and desalting was 15 ⁇ / ⁇ for 30 minutes while the analytical separation was performed at 250 nL/min.
- the gradient used was: 2% to 55% B in 65 min; hold at 55% B for 10 minutes; increase to 95% B in 5 min and hold at 95% B for 5 minutes.
- the HPLC eluent was electrosprayed into the LTQ using the nanospray source.
- MS/MS scans were obtained from three most intense ions using a normalized collision-energy of 35%.
- DTA files were generated from the raw data files, merged and searched against all species of the NCBInr database (July 2, 2010) with Mascot (version 2.3).
- the search parameters used were: fixed modification - carboxymethyl Cys; variable modifications - N/Q deamidation, oxidized Met, pyro-glu from Q and pyro-glu from E; 2 missed cleavages; peptide mass tolerance of +/- 3.5 Da and +/- 0.6 Da for the product ions.
- ⁇ - ⁇ shRNA sequences are as follows- Hairpin sequence (SEQ ID NO: l):
- Antisense 5'-UAUGUUGACAGUUCCUUCGtt-3 ' (SEQ ID NO:9).
- SPR binding analyses were performed at 25°C on Biacore instruments.
- hIL-34 and hCSF-1 to immobilized hPTP- ⁇ - and hCSF-lR- ECD-Fcs (Biacore T100)
- all flow cells of a CM4 sensor chip were activated with EDC/NHS (7 min, 10 ⁇ /min) and recombinant Protein A (Pierce, 21184, 50 ⁇ g/ml in 10 mM Na acetate, pH 4.5) was applied (7 min, 10 ⁇ /min).
- Binding of hTN-R to IL-34 and to hPTP- ⁇ ECD-Fc was carried out at 25°C by immobilizing IL-34 (pH 7.0) and hPTP- ⁇ ECD-Fc (pH 4.05) directly onto flow cells of a CM5 sensor chip (> 2800RU per flow cell) and passing over different concentrations of hTN-R.
- Kds were calculated according to the steady state model using BIAevaluation Software (GE Lifesciences). All sensorgrams were double-referenced.
- mice were transcardially perfused with ice-cold 0.25 mg/ml heparin in PBS (10 ml) followed by 4% paraformaldehyde (50 ml), their brains harvested, post-fixed overnight in 4% PFA, equilibrated in 20% sucrose, flash frozen in a cryomatrix resin and stored at -80°C prior to use.
- Mouse IL-34 (mIL-34) associates with mouse brain ⁇ - ⁇ and TN-R - Compared with the expression patterns of CSF-1 and the CSF-1R, IL-34 expression in postnatal mouse brain, is spatially, temporally and quantitatively distinct (9, 14). This prompted a search for additional IL-34 receptor(s) in detergent-solubilized postnatal mouse brain membranes. To identify novel IL-34-interacting proteins, mouse brain membrane lysate, depleted of the known IL-34 receptor, CSF-1R, was subjected to affinity chromatography with mIL-34 non-covalently bound to an immobilized polyclonal rabbit anti- mIL-34 antibody.
- Bound proteins were eluted with SDS and processed for mass spectrometry (MS).
- MS mass spectrometry
- the two eluted proteins identified with highest certainty were ⁇ - ⁇ , a cell-surface RPTP and its ECM ligand, TN-R (Fig. 7).
- SDS-PAGE and silver staining of the SDS eluates of the mIL-34-anti-mIL-34 antibody affinity purification, or of IL-34-associated proteins prepared by the alternative approach of binding to biotinylated-mIL-34 and capturing the complexes with immobilized neutravidin contained a diffuse band of -400 kDa, another broad band at -225 kDa, as well as -160/180 kDa species (Fig. 1A, lanes 1-4, upper panel).
- ⁇ - ⁇ exists in three isoforms, one soluble and two membrane-spanning molecules (Fig. IB).
- the -400-kDa band was confirmed by western blotting to cover stainable bands corresponding to both the long (49) and phosphacan isoforms of ⁇ - ⁇ (50,51) as well as multimeric TN-R (52).
- the -225-kDa band co-migrated with a band that stained with the 473-HD antibody (42), that sensitively stains the short PTP- ⁇ isoform and which also stained in the region of the -400 kDa band corresponding to the long receptor and the phosphacan isoforms.
- mice brain membrane lysate was incubated with mIL-34 and a reciprocal co-immunoprecipitation experiment was performed, immunoprecipitating with 3F8, an antibody that recognizes both the soluble and the long membrane-spanning isoforms of rat ⁇ - ⁇ (53) (Fig. IB) and western blotting with anti-IL-34 and anti-TN-R antibodies (Fig. 1C).
- Human IL-34 (hIL-34) binds to cell-surface ⁇ - ⁇ on U251 glioblastoma cells - Since membrane-spanning ⁇ - ⁇ , rather than TN-R, is a known signal-transducing receptor for several ligands (24-28), it was determined whether ⁇ - ⁇ also functions as a receptor for IL-34. As ⁇ - ⁇ is upregulated in human glioblastomas (38-40), glioblastoma cell lines U251, SNB19 and U87MG were tested for ⁇ - ⁇ expression. All the tested cell lines expressed high levels of ⁇ - ⁇ . U251 was selected for human IL-34 (hIL-34)-binding studies since it does not express the CSF-1R (Fig.
- biotinylated-hIL-34 primarily formed complexes with the long, membrane-spanning, -400 kDa ⁇ - ⁇ (50) and to a lesser extent with the non- glycosaminoglycanylated 300 kDa (55) and the short 220 kDa (49) isoforms (Fig. 2A) in U251 membrane lysates.
- TN-R was not observed in the biotinylated-hIL-34 pulldown fractions of U251 membranes, suggesting that IL-34 probably binds to ⁇ - ⁇ in a TN- R-independent manner.
- Clones stably-expressing ⁇ - ⁇ shRNA (KD cells) expressed lower levels of ⁇ - ⁇ protein than clones expressing scrambled shRNA (scrambled cells) (Fig. 2B). Scrambled cells expressed higher levels of total soluble ⁇ - ⁇ than uninfected cells, indicating that lentiviral infection per se causes cellular ⁇ - ⁇ upregulation. Consistent with the dependence of IL-34 binding on ⁇ - ⁇ expression, flow cytometric studies demonstrated that the ability of biotinylated hIL-34 to bind to the cell-surface of intact U251 cells was reduced in ⁇ - ⁇ KD cells (Fig. 2C), particularly in KD2 cells.
- hIL-34 inhibits U251 proliferation, cionogenicity and motility in a ⁇ - ⁇ - dependent manner - ⁇ - ⁇ -signaling is involved in neuronal migration (56) and neuritogenesis (57) in mouse and in the in vitro and in vivo growth of human glioblastomas (39,58,59).
- neuronal migration 56)
- neuritogenesis 57
- human glioblastomas 39,58,59
- PTN inhibits the growth of glioblastomas, to determine the functional relevance of ⁇ - ⁇ receptor engagement by IL-34
- the effects of IL- 34 and PTN were tested on the U251 glioblastoma cells expressing either ⁇ - ⁇ or scrambled (control) shRNAs.
- the effects of IL-34 and PTN on the colony-forming- ability of infected U251 cells were also examined. After a 16 h pulse with IL-34 or PTN, cells were seeded at clonal density and the colonies formed at 8 days were stained and counted.
- IL-34 or PTN treatment strongly decreased the cionogenicity of scrambled U251 cells (reductions of 68% for IL-34 and 53% for PTN, vs vehicle control cells), without significantly affecting the cionogenicity of ⁇ - ⁇ KD cells (Fig. 3B, left and right panels).
- hIL-34 enhances ⁇ - ⁇ -mediated tyrosine phosphorylation of FAK and paxillin in U251 cells -
- IL-34 binding to cell surface ⁇ - ⁇ should trigger intracellular signaling. Consistent with the reduction of ⁇ - ⁇ phosphatase activity by ligand binding (30,33,60), ⁇ - ⁇ ligand binding has previously been shown to trigger intracellular protein tyrosine phosphorylation (31,32,34,35).
- hIL-34 binds to ⁇ - ⁇ in a chondroitin sulfate-dependent manner - ⁇ - ⁇ is a proteoglycan receptor for several ligands (24-28) Furthermore, the ⁇ - ⁇ CS chains are known to affect binding to some of these ligands (25,29). The possible requirement of CS for IL-34 binding was therefore tested. Consistent with the previously reported presence of CS on ⁇ - ⁇ (19,64), treatment of solubilized U251 membranes with chondroitinase ABC increased the mobility of a significant fraction of the large ⁇ - ⁇ isoform (Fig. 6A).
- IL-34 expression profiles are distinct from those of its cognate receptor, CSF- 1R and also of CSF-1, and that it is preferentially increased in specific areas of early postnatal and adult forebrain, thereby suggesting the presence of an alternative signaling receptor (9).
- ⁇ - ⁇ functions as a cell-surface receptor for IL-34 and also interacts with TN-R
- the expression profiles of IL-34, ⁇ - ⁇ and TN-R were analyzed in 8-10 week-old mouse brains. ⁇ - ⁇ and TN-R were co-localized in OB, cerebral cortex, RMS and the CA3 region of the hippocampus that have previously been shown to express IL-34 (9).
- ⁇ - ⁇ expression remained prominent in distinct subcortical structures (thalamic and subthalamic nuclei), midbrain and brain stem nuclei (inferior colliculus, pontine nuclei, locus coeruleus and vestibular nuclei), as well as the cerebellum, and displayed distinct co- localization patterns with both IL-34 and TN-R. Mature post-mitotic neurons of the cerebrum were labeled by all three of these markers. These observations are consistent with a previous study that localized IL-34 expression preferentially to mature neurons of the adult cerebral cortex, extending from layers 2-5. In addition, IL-34 and ⁇ - ⁇ co-localization was particularly prominent in layer 5 of the cortex.
- ⁇ - ⁇ expression was also observed in the ECM of the cerebral cortex in concert with IL-34.
- IL-34 and ⁇ - ⁇ appeared to be uniformly distributed in the ECM of layer 5 and at the periphery of mature neuronal cell bodies.
- cortical layer 6 ⁇ - ⁇ expression was reduced in the ECM and neuronal soma, whereas IL-34 expression was virtually absent.
- Expression of TN-R was evident in cerebral cortical layers 2-5, most prominently in layer 4, where it was co-localized with IL-34 in both the ECM and at the periphery of mature neuronal somas. Its cellular and extra-cellular expression decreased in cortical layer 5.
- ⁇ - ⁇ staining was also seen in GFAP+ adult neural stem cells present in the anterior SVZ, as well as in those neural species migrating through the RMS to the OB (21,23), but not in GFAP+ astrocytes in the CC.
- IL-34 The differential and higher expression of IL-34, compared to CSF-1 and CSF- IR expression in brain coupled with the more pronounced effects of IL-34 compared with CSF-1 on neural progenitor cell self-renewal and differentiation (9, 14), raised the possibility that IL-34 might signal via an alternate receptor.
- the present studies identified ⁇ - ⁇ , a cell- surface CSPG, as a second functional receptor for IL-34.
- IL-34 selectively interacts with ⁇ - ⁇ in membrane lysates from both mouse brain as well as U251 human glioblastoma cells. It binds to intact U251 cells, stimulates their phosphotyrosine signaling and suppresses their tumorigenic properties in a ⁇ - ⁇ -dependent manner.
- IL-34 but not CSF- 1, binds ⁇ - ⁇ in vitro (3 ⁇ 4 ⁇ 10 ⁇ 7 M) and at the cell surface and whereas IL-34 and CSF-1 compete for binding to the CSF-IR (14,65,66), pre-incubation with a 16-molar excess of CSF-1 failed to compete for IL-34 binding to U251 cells.
- ⁇ - ⁇ fulfills the criteria required for it to function as the postulated IL-34 receptor.
- ⁇ - ⁇ is primarily expressed on neural progenitor and glial cells (21-23), as well as on a subset of cortical neurons (22,25).
- IL-34 is expressed primarily on neurons (9, 16) and also in the regions of the brain where ⁇ - ⁇ is expressed (23).
- IL-34 signaling via ⁇ - ⁇ in U251 glioblastoma cells causes a suppression of clonogenicity, similar to the effect of CSF-1 or IL-34 on isolated CSF-1 R-expressing neural progenitors (9). This suppression of clonogenicity is correlated with stimulation of cellular tyrosine phosphorylation in either setting.
- IL-34 was shown to be significantly more active in suppressing neural progenitor cell proliferation than CSF-1 (9), consistent with an additional action of IL-34 via the ⁇ - ⁇ receptor on the neural progenitor cells.
- ⁇ - ⁇ -signaling plays a contrasting role in hematopoietic stem cells, leading to their expansion (67).
- a positive regulatory role of ⁇ - ⁇ in proliferation and migration was also reported in some glioblastomas (31,40), which could reflect the role of other known ⁇ - ⁇ co-receptors, such as the integrins ⁇ (63) and ⁇ 3 (38), in governing these biological responses.
- IL-34 Like IL-34, PTN also exhibits GAG-dependent binding to ⁇ - ⁇ . However, in contrast to IL-34, CS-C, but not shark cartilage CS, inhibits this binding (25). Furthermore, competition experiments showed that PTN fails to compete for the binding of IL-34 (Fig. 6C), suggesting that IL-34 binding could involve a different ⁇ - ⁇ CS GAG-moiety, not recognized by PTN. Interestingly, the CS-A replaces CS-C on the ⁇ - ⁇ receptor during development from embryonic to post-natal brain and this is correlated with a decrease in the expression of PTN (64,70). In contrast, IL-34 expression increases progressively during brain development (9).
- ⁇ - ⁇ as a novel receptor for IL-34 necessitates a reevaluation of the possible role of IL-34/ ⁇ - ⁇ signaling in tissues in which both ligand and receptor are expressed.
- the CNS is an important organ system because of the significant expression of both IL-34 and ⁇ - ⁇ in brain and because ⁇ - ⁇ has been implicated in several disease settings in the CNS. For example, it is expressed in remyelinating oligodendrocytes (OL) and PTP- ⁇ -deficient mice display a delayed recovery from demyelinating lesions in a model of experimental autoimmune encephalomyelitis (71).
- soluble ⁇ - ⁇ isoform has been shown to be necessary for maturation for OL progenitors to differentiated myelin-secreting oligodendrocytes in vitro (72) and ⁇ - ⁇ - deficient mice exhibit increased myelin breakdown (73).
- PTPRZ1 gene in humans is a schizophrenia-susceptibility gene (74) and ⁇ - ⁇ regulates tyrosine phosphorylation of voltage-gated sodium channels in neurons (75).
- IL-34 modulates tumorigenic properties of glioblastoma cell line U251, the fact that ⁇ - ⁇ is expressed in neuroblastomas (18) and other tumors (37,40), such as prostate and lung cancer, is highly relevant. IL-34 is also important for Langerhans cell development (16, 76), probably via RPTP-zeta.
- the c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-1. Cell 41, 665-676
- the trophoblast is a component of the innate immune system during pregnancy. Nat Med 6, 589-593
- IL-34 is a tissue-restricted ligand of CSF 1R required for the development of Langerhans cells and microglia. Nat Immunol 13, 753- 760
- Receptor tyrosine phosphatase beta is expressed in the form of proteoglycan and binds to the extracellular matrix protein tenascin. J Biol Chem 269, 14349-14352
- a receptor-like protein-tyrosine phosphatase PTPzeta/RPTPbeta binds a heparin-binding growth factor midkine. Involvement of arginine 78 of midkine in the high affinity binding to PTPzeta. J Biol Chem 274, 12474-12479
- Pleiotrophin stimulates tyrosine phosphorylation of beta-adducin through inactivation of the transmembrane receptor protein tyrosine phosphatase beta/zeta. Biochem Biophys Res Commun 335, 232-239
- Fyn is a downstream target of the pleiotrophin/receptor protein tyrosine phosphatase beta/zeta- signaling pathway: regulation of tyrosine phosphorylation of Fyn by pleiotrophin. Biochem Biophys Res Commun 332, 664-669
- Integrin alpha(v)beta(3) is a pleiotrophin receptor required for pleiotrophin-induced endothelial cell migration through receptor protein tyrosine phosphatase beta/zeta. Faseb J23, 1459-1469
- DSD- 1 -proteoglycan is the mouse homolog of phosphacan and displays opposing effects on neurite outgrowth dependent on neuronal lineage.
- Elongation factor- 1 alpha is an overexpressed actin binding protein in metastatic rat mammary adenocarcinoma.
- alpha4betal- and alpha6betal-integrins are functional receptors for midkine, a heparin-binding growth factor. J Cell Sci 1 17, 5405-5415
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Toxicology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Methods are disclosed for identifying activators and inhibitors of actions of interleukin-34 (IL-34) that are independent of the colony stimulating factor- 1 (CSF-1) receptor (CSF-1R) and play a role in development, homeostasis and disease.
Description
IL-34 RECEPTOR ASSAYS AND USES THEREOF
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional Patent Application No. 61/826,356, filed May 22, 2013, the content of which is herein incorporated by reference in its entirety.
STATEMENT OF GOVERNMENT SUPPORT
[0002] This invention was made with government support under grant numbers CA32551, 5P30-CA13330 and SIG 1 S10RR019352 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
[0003] The invention relates to assays for activators and inhibitors of actions of interleukin-34 (IL-34) that are independent of the colony stimulating factor- 1 (CSF-1) receptor (CSF-1 R) and play a role in development, homeostasis and disease.
BACKGROUND OF THE INVENTION
[0004] Throughout this application various publications are referred to in parentheses. Full citations for these references may be found at the end of the specification before the claims. The disclosures of these publications are hereby incorporated by reference in their entireties into the subject application to more fully describe the art to which the subject application pertains.
[0005] The CSF-IR kinase (1,2) plays a critical role in the regulation of macrophage and osteoclast production and function (3-6) as well as the development and regulation of other cell types (7-11). The existence of an additional CSF-IR ligand was proposed based on the greater severity of phenotype of homozygous null CSF-IR mice, compared to the phenotype of homozygous CSF-l-null mutant mice (12). A second ligand for the CSF-IR, interleukin-34 (IL-34), with no apparent sequence similarity to any other growth factor, was subsequently identified (13). While IL-34 and CSF-1 compete for binding to the CSF-IR and have similar CSF-1 R-mediated effects, they exhibit significant tissue specific and developmental differences in their expression patterns (14). In addition, whereas CSF-1-
deficient mice exhibit partial loss of microglia, CSF-lR-deficient mice have no microglia (15). This observation, together with the high expression of IL-34 in brain suggested an important role of IL-34 in microglial development. In agreement with this, IL-34-deficient (IL-34-/-) mice were shown to exhibit severe deficits in microglia (16,76). Despite the similarity of IL-34 and CSF-1 in their CSF-lR-mediated effects (14, 17), IL34 mRNA is expressed at a significantly higher level than either Csfl or Csflr mRNA in several regions of the early postnatal and adult brain (14) and IL-34 protein is often expressed in regions where there is minimal expression of the CSF-1 R or CSF-1 -reporter proteins and IL-34 is significantly more active in suppressing neural progenitor cell proliferation and neuronal differentiation than CSF-1 (9).
[0006] Protein tyrosine phosphatase receptor type zeta (ΡΤΡ-ζ) (18,19), a cell-surface receptor and a chondroitin sulfate (CS) proteoglycan (CSPG), is highly abundant in the brain (20), primarily expressed on neural progenitors and glial cells (21-23) and binds to and signals through the action of multiple ligands (24) including the growth factor, pleiotrophin (PTN) (25,26), the cell-surface protein, contactin (CNTN) (27) and the extracellular matrix (ECM) protein, tenascin-R (TN-R) (28). The binding of some of these ligands involves the CS glycosaminoglycan (GAG)-moiety of ΡΤΡ-ζ (25,29). Ligand binding to ΡΤΡ-ζ leads to increased tyrosine phosphorylation of down-stream targets, including β-catenin, β-adducin, Src-family kinases (SFK), focal adhesion kinase (FAK), paxillin and extracellular signal- regulated kinase-1/2 (Erk-1/2) (30-37), ΡΤΡ-ζ is up-regulated in many human cancers, including glioblastomas, and regulates their proliferation and migration (38-40).
[0007] The present invention addresses the need for activators and inhibitors of actions of IL-34 that are independent of the CSF-1 R receptor and play a role in development, homeostasis and disease.
SUMMARY OF THE INVENTION
[0008] The invention provides methods for determining whether or not an agent is a candidate agent for inhibiting interaction between interleukin-34 (IL-34) and protein tyrosine phosphatase receptor type zeta (ΡΤΡ-ζ) comprising: contacting cells that express ΡΤΡ-ζ on their surface and that do not express colony stimulating factor- 1 receptor (CSF-1R) with IL- 34 in the presence of the agent and in the absence of the agent, and measuring a cellular response induced by IL-34, wherein an agent that reduces a cellular response induced by IL- 34 is a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ, and wherein an
agent that does not reduce a cellular response induced by IL-34 is not a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ.
BRIEF DESCRIPTION OF THE DRAWINGS
[0009] Fig. 1A-1C. Interaction of IL-34 with ΡΤΡ-ζ in solubilized membrane fractions of mouse brain. (A) N-octyl-p-D-glucoside (OG)-solubilized membrane fractions of mouse brain were incubated (4°C, 16h) with either immobilized polyclonal rabbit anti-mlL- 34 antibody beads that had been preincubated with mIL-34 (lanes 1 & 2), or with biotinylated mIL-34 (lanes 3, 4). The SDS eluates of the IL-34 immunoprecipitates or biotinylated IL-34 complexes (recovered with neutravidin beads) were analyzed by SDS-PAGE with silver staining. The IL-34-associated proteins identified with 99% certainty by mass spectrometry were ΡΤΡ-ζ and TN-R (Fig. 7). Western blots (WB) indicate the ΡΤΡ-ζ (L, long isoform, P, phosphacan/soluble isoform and the ~225-kDa short isoform) and TN-R staining bands. Multimeric (52) (slower migrating bands, -400 kDa) and alternatively spliced (faster migrating bands, 160/180 kDa) variants of TN-R were co-immunoprecipitated, or pulled down. (B) Scheme depicting various ΡΤΡ-ζ isoforms. Upper panel, the long isoform (active) containing a carbonic anhydrase domain (CA) and a fibronectin type III repeat (F), a transmembrane domain (TM), protein tyrosine phosphatase domains (PTP1 and PTP2) and three glycosaminoglycan (GAG) addition sites. Middle, phosphacan or the secreted isoform lacking the TM and PTP domains. Lower, the short isoform (active) missing 860 amino acids of the long isoform. 3F8 and C-209 antibodies recognize the extracellular and intracellular regions of ΡΤΡ-ζ, respectively and the 473-HD antibody all three isoforms. 3F8 is directed against rat phosphacan and is not as effective in detecting mouse ΡΤΡ-ζ. C-209 antibody recognizes the short isoform from the mouse brain membrane lysates infrequently. (C) Co- immunoprecipitation of ΡΤΡ-ζ with IL-34. The OG-solubilized mouse brain membrane fraction was incubated with mIL-34 (4°C, 16h), immunoprecipitated with immobilized anti- ΡΤΡ-ζ (3F8), or isotype control (mlgGl) antibodies and the immunoprecipitates analyzed by gradient SDS-PAGE and western blotting. L, long isoform; P, phosphacan and S, short isoform.
[0010] Fig. 2A-2C. IL-34 binds cell-surface ΡΤΡ-ζ in U251 human glioblastoma cells. (A) Interaction of IL-34 with ΡΤΡ-ζ in OG-solubilized U251 cell membrane fractions. Membranes lysates were incubated with biotinylated hIL-34 (4°C, 16h), the complexes captured with neutravidin beads (4°C, 6h), eluted with SDS and analyzed by SDS-PAGE and
silver staining, or by western blotting (WB) with antibodies to ΡΤΡ-ζ. Arrowhead, nonspecific band; asterisk, ΡΤΡ-ζ proteolytic product (51); L, long isoform; NG, non- glycosaminoglycan form; S, short isoform. (B) Reduced ΡΤΡ-ζ expression in ΡΤΡ-ζ KD U251 clones. Left panel; ΡΤΡ-ζ and control (EFla) western blots of OG-solubilized whole cell lysate from cells expressing scrambled, or ΡΤΡ-ζ (KD1 and KD2) shRNAs. Right panel, quantitation of the combined intensities of the three bands (L, NG, S) from two independent experiments (average ± range). (C) Flow cytometric analysis of hIL-34 binding to ΡΤΡ-ζ KD U251 lines. Serum-starved control (scrambled) and KD (1 & 2) cells were either untreated, incubated with 5 μg/ml biotinylated hIL-34, then subsequently incubated with streptavidin- conjugated APC-Cy7 prior to flow cytometric analysis, gating on viable cells. G.M., geometric means of signal intensities of duplicate experiments (average ± range).
[0011] Fig. 3A-3B. IL-34 inhibits growth and clonogenicity of U251 glioblastoma cells in a ΡΤΡ-ζ-dependent manner. (A) Cell proliferation assay. Control (left panel) or PTP- ζ KD (right panel) cells were incubated with the indicated factors for the indicated times and the viable cell numbers assessed by trypan blue exclusion staining. (B) Clonogenic assay. Left panel, micrographs of colony forming assays of U251 cells incubated with vehicle or IL- 34. Right panel, histograms showing average colony counts from triplicate experiments. (A) and (B), Means ± SD; n=3; *, significantly different from cells incubated with vehicle alone, p < 0.05.
[0012] Fig. 4A-4D. IL-34 inhibits ΡΤΡ-ζ-dependent U251 motility. (A) Inhibition of U251 monolayer wound healing by IL-34. Left panel, numbers above the horizontal lines indicate the fraction of the initial wound width at the time of scratching. Scale bar, 100 μΜ. Right panel, quantitation (means ± SD; n=3). (B) Quantitation of wound healing by control and ΡΤΡ-ζ KD U251 cells at 9h, in the presence of PTN or IL-34 (means ± SD; n=3). (C) Inhibition of haptotactic migration by IL-34. Migration is expressed as a percent of cells migrated in the BSA control (means ± SD; n=3, >15 fields per condition). (D) Inhibition of random migration by IL-34. Migration is expressed as a percent of cells migrated in no GF (vehicle) control (means ± SD; n=3, >10 fields per condition). *, p<0.05 and **, p<0.01.
[0013] Fig. 5A-5C. IL-34 binding to ΡΤΡ-ζ enhances tyrosine phosphorylation of FAK and Paxillin, in U251 cells. (A) Kinetics of tyrosine phosphorylation in response to IL- 34. SDS-PAGE and western blot analysis of NP-40 lysates from U251 cells treated with IL- 34 or PTN harvested at the indicated times and stained as shown. FAK, focal adhesion
kinase; Pax, paxillin. (B) Immunoprecipitates of FAK (left panel) and paxillin (right panel) from NP-40 lysates of serum-starved U251 cells incubated with hPTN or hIL-34 (0.1 nM) western blotted with antibodies to phosphotyrosine (pY), FAK or Pax. (C) Abrogation of the IL-34 and PTN-induced phosphorylation of FAK and paxillin in U251 cells expressing ΡΤΡ-ζ shRNA. Normalized to the total FAK and Pax expression and expressed as fold stimulation of levels in control (vehicle-treated) cells (dotted line).
[0014] Fig. 6A-6C. IL-34 binds to ΡΤΡ-ζ in a CS-dependent manner. (A) Effect of Chondroitinase ABC on specific ΡΤΡ-ζ isoforms. Anti-ΡΤΡ-ζ western blot of U251 membrane lysates incubated with and without chondroitinase ABC (0.3 U/ml, 37°C, lh). L, long isoform; NG, non-glycosaminoglycan isoform; S, short isoform. (B) CS is required for IL-34 binding to ΡΤΡ-ζ. Serum-starved U251 cells were either incubated with, or without ChABC (4.2 U/ml) and subsequently with 2 μg/ml biotinylated hIL-34, prior to further incubation with streptavidin-conjugated APC-Cy7 and flow cytometric analysis, gating on viable cells. The vertical line defines the level of non-specific binding of biotinylated IL-34. (C) Competition with CS and the failure to compete with CSF-1 and PTN. 2xl05 serum- starved U251 cells were pre-incubated with a 16 molar excess of IL-34 in the presence of increasing concentrations of CS, or with a 16 molar excess of CSF-1 or PTN, prior to washing and binding of biotinylated-IL-34 (2 μg/ml). Geometric means (G.M.) of signal intensities of duplicate experiments (average ± range) were used to calculate percentage inhibition. *, p<0.05.
[0015] Fig. 7A-7B. LC-MS/MS peptide hits for TN-R and ΡΤΡ-ζ. (A) TN-R protein sequence from mouse (SEQ ID NO: 10). (B) ΡΤΡ-β/ζ protein sequence from mouse (SEQ ID NO: 1 1). The carbonic anhydrase homology domain (CA), the fibronectin type III repeat (F) and the two phosphatase domains (PTP1 and PTP2), are boxed. The consensus glycosaminoglycan (GAG)-addition sites are underlined and the transmembrane domain is italicized. The several N-linked glycosylation sites are not indicated. The peptide stretch missing in the short isoform is bolded.
[0016] Fig. 8A-8C. U251 cells lack the CSF-IR. (A) Failure of hIL-34 to bind to CSF-IR on U251 cells. N-octyl- -D-glucoside (OG)-solubilized membrane fractions of BAC1.2F5 (lanes 1 & 2) and U251 (lanes 3 & 4) cells were incubated overnight at 4°C with biotinylated mIL-34 (lanes 1 & 2) or biotinylated hIL-34 (lanes 3 & 4). The biotinylated IL- 34 complexes were recovered by incubation with neutravidin and SDS eluates containing the complexes analyzed by SDS-PAGE and western blotting (WB) with an antibody that
equivalently recognizes both mCSF-lR and hCSF-lR. (B) Absence of the CSF-IR in U251 cells. N-octyl- -D-glucoside (OG)-solubilized membrane fractions of U251 human glioblastoma (lane 1) and NIH-3T3-hCSF- 1R (lanes 2-4) cells were incubated overnight at 4°C with anti-hCSF-lR antibody (lanes 1, 2) or biotinylated hIL-34 (lanes 3, 4). The biotinylated IL-34 complexes were recovered by incubation with neutravidin and SDS eluates of IL-34 pull-down and CSF-IR immunoprecipitates analyzed by SDS-PAGE and western blotting (WB) with antibodies to hCSF-lR. (C) Further verification of the lack of CSF-IR expression on U251 cells. Flow cytometric analyses of 2xl05 viable 3T3-hCSF-lR and U251 cells were incubated with 5 μg/ml of rat monoclonal anti-hCSF-lR antibody, or rat IgGl (isotype control) for 30 min at 4°C, washed with PBS and further incubated with 5 μg/ml of anti-rat IgGl -conjugated FITC for 30 min at 4°C.
DETAILED DESCRIPTION OF THE INVENTION
[0017] The invention provides a method for determining whether or not an agent is a candidate agent for inhibiting interaction between interleukin-34 (IL-34) and protein tyrosine phosphatase receptor type zeta (ΡΤΡ-ζ) comprising:
contacting cells that express ΡΤΡ-ζ on their surface and that do not express colony stimulating factor- 1 receptor (CSF-IR) with IL-34 in the presence of the agent and in the absence of the agent, and
measuring a cellular response induced by IL-34,
wherein an agent that reduces a cellular response induced by IL-34 is a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ, and
wherein an agent that does not reduce a cellular response induced by IL-34 is not a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ.
[0018] The terms ΡΤΡ-ζ. and ΡΤΡ-β/ζ are used interchangeably in this application.
[0019] The cells can be, for example, glioblastoma cells, such as, e.g., U251 human glioblastoma cells.
[0020] The cells can have been transfected with nucleic acid encoding human ΡΤΡ-ζ. Human ΡΤΡ-ζ has the amino acid sequence (ACCESSION P23471, VERSION P23471.4 GL229485537, SEQ ID NO: 12):
1 mrilkrflac iqllcvcrld wangyyrqqr klveeigwsy tgalnqknwg kkyptcnspk
61 qspinidedl tqvnvnlkkl kfqgwdktsl entfihntgk tveinltndy rvsggvsemv
121 fkaskitfhw gkcnmssdgs ehslegqkfp lemqiycfda drfssfeeav kgkgklrals
181 ilfevgteen ldfkaiidgv esvsrfgkqa aldpfillnl lpnstdkyyi yngsltsppc
241 tdtvdwivfk dtvsisesql avfcevltmq qsgyvmlmdy lqnnfreqqy kfsrqvfssy
301 tgkeeiheav cssepenvqa dpenytsllv twerprvvyd tmiekfavly qqldgedqtk
361 hefltdgyqd lgailnnllp nmsyvlqiva ictnglygky sdqlivdmpt dnpeldlfpe
421 ligteeiike eeegkdieeg aivnpgrdsa tnqirkkepq isttthynri gtkyneaktn
481 rsptrgsefs gkgdvpntsl nstsqpvtkl atekdislts qtvtelppht vegtsaslnd
541 gsktvlrsph mnlsgtaesl ntvsiteyee eslltsfkld tgaedssgss patsaipfis
601 enisqgyifs senpetityd vlipesama sedstssgse eslkdpsmeg nvwfpsstdi
661 taqpdvgsgr esflqtnyte irvdesektt ksfsagpvms qgpsvtdlem phystfayfp
721 tevtphaftp ssrqqdlvst vnwysqttq pvyngetplq psyssevfpl vtpllldnqi
781 lnttpaasss dsalhatpvf psvdvsfesi lssydgapll pfssasfsse lfrhlhtvsq
841 ilpqvtsate sdkvplhasl pvaggdllle pslaqysdvl stthaasetl efgsesgvly
901 ktlmfsqvep pssdammhar ssgpepsyal sdnegsqhif tvsyssaipv hdsvgvtyqg
961 slfsgpship ipksslitpt asllqpthal sgdgewsgas sdsefllpdt dgltalniss
1021 pvsvaeftyt tsvfgddnka lskseiiygn etelqipsfn emvypsestv mpnmydnvnk
1081 lnaslqetsv sisstkgmfp gslahtttkv fdheisqvpe nnfsvqptht vsqasgdtsl
1141 kpvlsansep assdpassem lspstqllfy etsasfstev llqpsfqasd vdtllktvlp
1201 avpsdpilve tpkvdkisst mlhlivsnsa ssenmlhsts vpvfdvspts hmhsaslqgl
1261 tisyasekye pvllksessh qvvpslysnd elfqtanlei nqahppkgrh vfatpvlsid
1321 eplntlinkl ihsdeiltst kssvtgkvfa giptvasdtf vstdhsvpig nghvaitavs
1381 phrdgsvtst kllfpskats elshsaksda glvgggedgd tdddgddddd drgsdglsih
1441 kcmscssyre sqekvmndsd thenslmdqn npisyslsen seednrvtsv ssdsqtgmdr
1501 spgkspsang lsqkhndgke endiqtgsal lplspeskaw avltsdeesg sgqgtsdsln
1561 enetstdfsf adtnekdadg ilaagdseit pgfpqsptss vtsensevfh vseaeasnss
1621 hesriglaeg lesekkavip lvivsaltfi clwlvgili ywrkcfqtah fyledstspr
1681 vistpptpif pisddvgaip ikhfpkhvad lhassgftee fetlkeiyqe vqsctvdlgi
1741 tadssnhpdn khknryiniv aydhsrvkla qlaekdgklt dyinanyvdg ynrpkayiaa
1801 qgplkstaed fwrmiwehnv evivmitnlv ekgrrkcdqy wpadgseeyg nflvtqksvq
1861 vlayytvrnf tlrntkikkg sqkgrpsgrv vtqyhytqwp dmgvpeyslp vltfvrkaay
1921 akrhavgpw vhcsagvgrt gtyivldsml qqiqhegtvn ifgflkhirs qmylvqtee
1981 qyvfihdtlv eailsketev ldshihayvn allipgpagk tklekqfqll sqsniqqsdy
2041 saalkqcnre knrtssiipv ersrvgissl sgegtdyina syimgyyqsn efiitqhpll
2101 htikdfwrmi wdhnaqlwm ipdgqnmaed efvywpnkde pincesfkvt lmaeehkcls
2161 neekliiqdf ileatqddyv levrhfqcpk wpnpdspisk tfelisvike eaanrdgpmi
2221 vhdehggvta gtfcalttlm hqlekensvd vyqvakminl mrpgvfadie qyqflykvil
2281 slvstrqeen pstsldsnga alpdgniaes leslv
[0021] Cellular response induced by IL-34 can include any of the following. IL-34 can inhibit, for example, one or more of cell proliferation, clonogenicity and/or motility. IL- 34 can induce tyrosine phosphorylation of a protein, such as, for example, focal adhesion kinase (FAK) and/or paxillin. IL-34 can also, for example, stimulate differentiation of neural progenitor cells.
[0022] The agent can be, for example, an antibody, a monoclonal antibody, a polyclonal antibody, an antibody fragment, a F(ab')2 fragment, a Fab' fragment, a peptide, a peptide nucleic acid, or small chemical compound (e.g., have a molecular weight of 5,000 daltons or less).
[0023] The agent can bind to a chondroitin sulfate glycosaminoglycan (GAG) moiety on ΡΤΡ-ζ or to a GAG mimic.
[0024] The agent can be useful, for example, for treatment of a disease or disorder or a defect in neural or microglial development or a defect in homeostasis. The disease or disorder can be, for example, cancer, inflammation, a central nervous system disease, brain
injury, neuro-degeneration, a memory deficit, glioblastoma, multiple sclerosis, schizophrenia, or autoimmune disease.
[0025] This invention will be better understood from the Experimental Details that follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims that follow thereafter.
EXPERIMENTAL DETAILS
Introduction
[0026] An unbiased proteomic approach identified ΡΤΡ-ζ as an IL-34-interacting membrane protein in mouse brain. Using shRNA-mediated suppression of ΡΤΡ-ζ expression in a CSF-lR-less U251 human glioblastoma cell line, IL-34 was demonstrated to bind specifically to cell-surface ΡΤΡ-ζ to initiate downstream signaling that leads to the inhibition of cell proliferation, clonogenicity and motility. IL-34-binding to ΡΤΡ-ζ is dependent on the presence of the CS GAG moiety on ΡΤΡ-ζ. The demonstration of the existence of a novel IL- 34 receptor increases the scope of biological effects of IL-34 in development, homeostasis and disease.
Materials and Methods
[0027] Reagents - Purified mouse IL-34 (mIL-34), human IL-34 (hIL-34) and purified polyclonal rabbit anti-mIL-34 antibodies were from FivePrime Therapeutics, Inc., CA, USA) and human PTN (hPTN) was from R&D (Minneapolis, MN). Growth factors were suspended in phosphate buffered saline (PBS) as vehicle. mIL-34 and hIL-34 were biotinylated using a 10 molar excess of EZ-Link Sulfo-NHS-LC-LC-Biotin (Thermo Scientific, MA, USA) (15', 20°C) following manufacturer's instructions. The rabbit anti-C- terminal CSF-1R peptide antibody (C-15) to the mouse CSF-1R (mCSF-lR) and human CSF- 1R (hCSF-lR), used for western blotting and immunoprecipitation, has been previously reported (41). Other antibodies used for western blotting were directed against phosphotyrosine (pY-100) and β-catenin (Cell Signaling), pY 118paxillin and pY397FAK (Life Technologies, NY, USA); hCSF IR (2-4A5), β-adducin, FAK and TN-R (Santa Cruz Biotechnology Inc., CA, USA); paxillin and ΡΤΡ-ζ (C-209) (BD Biosciences), ΡΤΡ-ζ (3F8) (DSHB, the University of Iowa); ΡΤΡ-ζ (473-HD) (Santa Cruz Biotechnology Inc., CA, USA)(42); EFla (43). Bovine serum albumin (BSA), was from Gemini (CA, USA), Puromycin dihydrochloride, trypan blue, crystal violet, DAPI, shark cartilage CS salts,
Proteus vulgaris chondoitinase ABC (chABC) and phalloidin were from SIGMA (MO, USA). Polybrene was from Santa Cruz Biotechnology, Inc. (CA, USA). Neutravidin- Ultralink beads were from Thermo Scientific (MA, USA). Streptavidin-conjugated APC-Cy7 was from Biolegend (CA, USA). LIVE/DEAD® Fixable dead cell stain kits were from Molecular Probes (NY, USA). HTS FluoroBlok™ inserts and 24-well and 6-well tissue culture dishes were from BD Biosciences, Franklin Lakes, NJ. Accutase was from Stem Cell Technologies (Vancouver, BC, Canada). Human ΡΤΡ-ζ and CSF-1R extracellular domains (ECD) fused immunoglobulin Fc domains (ΙιΡΤΡ-ζ-ECD-Fc and hCSF-lR-ECD-Fc) were prepared as described previously for the hCSF-lR-ECD-Fc (13). Human recombinant CSF-1 (hCSF-1) was a gift from Chiron Corp. (Emeryville, CA, USA). EDC/NHS, HBSP and HBSP+ buffers were from GE Healthcare Biosciences, Pittsburgh, PA, USA.
[0028] Sample preparation for LC-MS/MS-identiflcation of the receptor - Subcellular fractionation was carried out to isolate the membrane fraction from a pool of 2 postnatal day 7 and 2 postnatal day 60 mouse brains. Briefly, mouse brain tissue was homogenized in homogenization buffer (65 mM Tris, 150 mM sodium chloride, 1 mM EDTA, 10 μg/ml aprotinin, 10 μg/ml leupeptin and 1 mM benzamidine, pH 7.4) and the homogenate centrifuged (lOOOxg, 3 min, 4°C). The supernatant was further centrifuged (100,000xg, 30 min, 4°C) and the pellet dissolved in 2% N-octyl-p-D-glucoside (OG), prior to centrifugation (100,000xg, 30 min, 4°C). The supernatant, containing 26 mg of the OG- solubilized membrane lysate was first pre-cleared by incubation with 60 μg of anti-CSF-lR peptide antibody (C-15) (4°C, 16h) and then incubated with 24 μg of mIL-34 non-covalently bound to 40 μg of immobilized polyclonal rabbit anti-mIL-34 antibody (4°C, 16h). mIL-34- anti-mIL-34 antibody complex was serially washed using 0.1 M glycine-HCl, pH 2.2 and 8 M urea and subsequently eluted with 1% SDS. The glycine-HCl and urea washes did not result in dissociation of proteins from mIL-34-anti-mIL-34 antibody complex, as determined by SDS-PAGE and LC-MS/MS. The denatured, reduced and alkylated SDS eluate was further concentrated by ultracentrifugation using 100 kDa cut-off filters and subjected to SDS removal, concentration, trypsinization and detergent extraction with ethyl acetate, as described elsewhere (44,45) followed by LC-MS/MS.
[0029] Nanoelectrospray LC-MS/MS analyses and protein identification- Tryptic digests were loaded and separated using the UltiMate, FAMOS, Switchos nano-HPLC system (LC Packings, Dionex; Sunnyvale, CA), connected on-line to a LTQ Linear Ion Trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA) and equipped with a nanospray
source. The mobile phases consisted of 5% acetonitrile/water, 0.1% formic acid (A) and 80% acetonitrile/water, 0.1% formic acid (B). After injection (15 μΐ of sample) and loading onto a CI 8 trap column, 0.3 mm I.D. X 5 mm, the tryptic peptides were separated on a CI 8 analytical HPLC column (75 μιη I.D. X 15 cm; Pepmap, 3 μιη, 100 A; LC Packings, Dionex; Sunnyvale, CA). The flow rate for loading and desalting was 15 μΐ/min for 30 minutes while the analytical separation was performed at 250 ηΐ/min. The gradient used was: 2% to 55% B in 65 min; held at 55% B for 10 minutes; increase to 95% B in 5 min and then held at 95% B for 5 minutes. The HPLC eluent was electrosprayed into the LTQ using the nanospray source. After an initial MS-survey scan, m/z 300-1800, MS/MS scans were obtained from three most intense ions using a normalized collision-energy of 35%. DTA files were generated from the raw data files, merged and searched against all species of the NCBInr database (July 2, 2010) using Mascot (version 2.3). The search parameters were: fixed modification - carboxymethyl Cys; variable modifications - N/Q deamidation, oxidized Met, pyro-glu from Q and pyro-glu from E; 2 missed cleavages; peptide mass tolerance of +/- 3.5 Da and +/- 0.6 Da for the product ions. Scaffold (version 3, Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95% probability and protein identifications were accepted at greater than 99% probability and with unique significant peptide hits (p < 0.05). Utilizing these criteria 9 proteins were identified excluding trypsin and keratin (6 of them were membrane proteins). The two proteins identified with the highest protein score were TN-R and ΡΤΡ-ζ. The Mascot protein score for TN-R (3 matching protein accession numbers: gi| 148707401, gi|226958549 or gi|61216646; 139 kDa) was 932 with protein sequence coverage of 15% protein. The protein score for ΡΤΡ-ζ (gi| 124486807) was 555 with 5% coverage.
[0030] Cell lines, cell culture conditions and cell treatments - The U251, SNB19 and U87MG human glioblastoma cell lines were a gift of Dr. J. Segall, Albert Einstein College of Medicine, NY, USA). NIH-3T3-hCSF-lR cells (46) were a gift from Dr. Martine Roussel, St. Jude Children's Research Hospital, Memphis, TN. Mouse BAC1.2F5 macrophages (47) were cultured in 36 ng/ml hCSF-1 as described (48). U251 cells were cultured in DMEM-high glucose (GIBCO, Grand Island, NY, USA) supplemented with 10% FCS and passaged when confluent. Prior to stimulation with hIL-34 or hPTN, cells were depleted of growth factors by incubation in DMEM-high glucose supplemented with 0.2% BSA for 16h, except where otherwise indicated. Following stimulation, cells were washed in ice-cold PBS and recovered
by scraping and centrifugation, except where otherwise indicated. For chABC-treatment, serum-starved U251 cells were incubated with 4.2 U/ml chABC (37°C, lh 30') and washed extensively, before processing for flow cytometry as described below. For treating membrane lysates, 0.3 U/ml chABC was used.
[0031] Generation of U251 PTP-C, knock-down (KD) cells - Lentiviral particles (5xl04 IFU) carrying a pool of three different ΡΤΡ-ζ shRNA or scrambled shRNA plasmids (Santa Cruz Biotechnology, CA, USA) were used to infect 3xl04 U251 cells (50% confluent) in the presence of 5 μg/ml polybrene in 6-well dishes (37°C, 16h). Vector-containing cells were selected using 5 μg/ml of puromycin dihydrochloride and the resistant colonies were further sub-cloned by serial dilution method in 96-well plates. The efficiency of knock-down was estimated by western blotting whole cell lysates from the puromycin resistant clones.
[0032] Immunoprecipitation and Western blot analysis - Membrane fractions of mouse brain and of BAC1.2F5 macrophages, NIH-3T3-hCSF-lR cells or U251 cells were solubilized in homogenization buffer (65 mM Tris, 150 mM sodium chloride, 1 mM EDTA, 10 μg/ml aprotinin, 10 μg/ml leupeptin and 1 mM benzamidine, pH 7.4) containing the appropriate concentration of OG (brain membrane 2%; cell membrane 1%) and incubated (4°C, 16h) with either immobilized purified polyclonal rabbit anti-mIL-34 antibody beads (preincubated with mIL-34), biotinylated mIL-34, biotinylated hIL-34 (a gift from FivePrime Therapeutics, Inc., CA, USA), or anti-hCSF-lR antibodies. The biotinylated IL-34 complexes were recovered by incubation with neutravidin-agarose and SDS eluates of IL-34 pull-down and immunoprecipitates analyzed by SDS-PAGE and western blotting (WB). For co- immunoprecipitation experiments, mouse brain membrane lysates were pre-incubated with mIL-34 (4°C, 16h), prior to incubation with anti-ΡΤΡ-ζ (3F8) antibodies. For stimulation and/or immunoprecipitation experiments, serum-starved U251 cells were incubated with hPTN or hIL-34 (120 ng/ml) at 37°C and NP-40 cell lysates (using 1% NP-40, 10 mM Tris- HC1, 50 mM NaCl, 30 mM Na4P207, 50 mM NaF, 100 μΜ Na3V04, 5 μΜ ZnCl2, 1 mM benzamidine, 10 μg/ml leupeptin, and 10 μg/ml aprotinin, pH 7.2) were subjected to immunoprecipitation using antibodies to FAK and paxillin.
[0033] Flow cytometry - For cell-surface IL-34 binding, serum-starved U251 cells were gently harvested with 2 mM EDTA in PBS, pH 7.4, washed and lxlO6 cells were preincubated with a 10 molar excess of hIL-34 in Hank's Balanced Salt Solution (HBSS) (Life Technologies) in the presence of 1% BSA (4°C, 1 h). After extensive washing, specific IL-34 binding was detected by incubating the cells with 2 μg/ml biotinylated hIL-34 (4°C, 1 h), and,
subsequently, with 5 μg/ml streptavidin-conjugated APC-Cy7. Flow cytometry was performed using FACS Canto II (BD Biosciences, NC, USA) (gating on viable cells). The Flow Jo software (Treestar, USA) was used for data analysis. For detection of hCSF-lR expression, serum-starved 2xl05 U251 cells were incubated with 5 μg/ml rat anti-hCSF-lR monoclonal antibody (2-4A5) or control rat IgGi (e-Biosciences, CA, USA) (4°C, 45'), then subsequently incubated with 5 μg/ml FITC-conjugated F(ab')2-anti-Rabbit IgG (e- Biosciences, CA, USA) prior to flow cytometric analysis as previously described. For the analysis of FLAG-tagged IL-34 and CSF-1 binding to U251 cells by flow cytometry, the expression, purification and quantitation of the concentrations of IL-34-FLAG and CSF-1- FLAG proteins in the medium of the transfected 293T cells, as well as the detection of cell binding with biotin-labeled anti-FLAG M2 antibody, were carried out as described (17).
[0034] Cell proliferation and clonogenic assays - U251 cells were seeded at 25% confluency in DMEM-high glucose supplemented with 10% FCS in 24-well tissue culture dishes. 24h later, cells were washed twice with PBS and medium was replaced with DMEM- high Glucose supplemented with 1% FCS and vehicle (PBS) or hIL-34 (20 ng/ml) or hPTN (20 ng/ml). Cell proliferation was assessed by counting viable (Trypan-Blue excluding) cells harvested at the indicated times. For the clonogenic assays, semi-confluent U251 cells were exposed to a 16h pulse of hPTN (20 ng/ml), hIL-34 (20 ng/ml) or vehicle (PBS). After that, cells where harvested by Accutase digestion, filtered through a 40 μιη mesh to ensure single cellularity and subsequently seeded at 1000 cells/well into 6-well dishes in the presence of 25% conditioned medium (from the 16h pulse). The number of colonies composed of >50 cells was scored by crystal violet staining 8 days later.
[0035] Cell migration assays - For wound healing assays, serum-starved (16 h) monolayer cultures of U251 cells were scratched and the wound allowed to heal in the continued absence of serum and in the presence of either hPTN or hIL-34 (200 ng/ml). For haptotactic migration assays, 105 serum-starved U251 cells were assayed (37°C, 4h) in a 24- well transwell chamber. Inserts were pre-coated with BSA (20 μg/ml, no growth factor) or hPTN (5 μg/ml) or hIL-34 (10 μg/ml) for 2 h at room temperature prior to the assay. For the random migration studies (37°C, 4h), hPTN or hIL-34 (1 μg/ml) was added to both sides of the transwell chamber. Cells were scraped from the upper side of the chamber and the lower side was stained with DAPI and phalloidin. Phalloidin-stained cells were counted using a fluorescence microscope.
[0036] Nanoelectrospray LC-MS/MS analyses and protein identification- Tryptic digests were loaded and separated using the UltiMate, FAMOS, Switchos nano-HPLC system (LC Packings, Dionex; Sunnyvale, CA), connected on-line to a LTQ Linear Ion Trap mass spectrometer (Thermo Fisher Scientific, Waltham, MA) and equipped with a nanospray source. The mobile phases consisted of 5% acetonitrile/water, 0.1% formic acid (A) and 80% acetonitrile/water, 0.1% formic acid (B). After injection (15 μϊ^ of sample) and loading onto a CI 8 trap column, 0.3 mm I.D. X 5 mm, the tryptic peptides were separated on a CI 8 analytical HPLC column (75 μιη I.D. X 15 cm; Pepmap, 3 μιη, 100 A; LC Packings, Dionex; Sunnyvale, CA). The flowrate for loading and desalting was 15 μί/ηιίη for 30 minutes while the analytical separation was performed at 250 nL/min. The gradient used was: 2% to 55% B in 65 min; hold at 55% B for 10 minutes; increase to 95% B in 5 min and hold at 95% B for 5 minutes. The HPLC eluent was electrosprayed into the LTQ using the nanospray source. After an initial MS-survey scan, m/z 300-1800, MS/MS scans were obtained from three most intense ions using a normalized collision-energy of 35%. DTA files were generated from the raw data files, merged and searched against all species of the NCBInr database (July 2, 2010) with Mascot (version 2.3). The search parameters used were: fixed modification - carboxymethyl Cys; variable modifications - N/Q deamidation, oxidized Met, pyro-glu from Q and pyro-glu from E; 2 missed cleavages; peptide mass tolerance of +/- 3.5 Da and +/- 0.6 Da for the product ions. Scaffold (version 3, Proteome Software Inc., Portland, OR) was used to validate MS/MS based peptide and protein identifications. Peptide identifications were accepted if they could be established at greater than 95.0% probability and protein identifications were accepted at greater than 99.0% probability and unique significant peptide hits (p < 0.05). With these criteria 9 proteins were identified excluding trypsin and keratin (6 of them were membrane proteins). The 2 proteins identified with the highest protein score were TN-R and ΡΤΡ-ζ. The Mascot protein score for TN-R (3 matching protein accession numbers: gi| 148707401, gi|226958549 or gi|61216646; 139 kDa) is 932 with protein sequence coverage of 15% protein. The protein score for ΡΤΡ-ζ (gi| 124486807) is 555 with 5% coverage.
[0037] ΡΤΡ-ζ shRNA sequences are as follows- Hairpin sequence (SEQ ID NO: l):
5 ' -GATCCCCAGATTTCTACCACAACATTCAAGAGATGTTGTGGTAGAAATCTGGTTTTT-3 ' Corresponding siRNA sequences:
• Sense: 5'-CCAGAUUUCUACCACAACATT-3 ' (SEQ ID NO:2)
• Antisense: 5'-UGUUGUGGUAGAAAUCUGGTT-3' (SEQ ID NO:3)
Hairpin sequence (SEQ ID N0:4):
5 ' -GATCCCC ACAGAGATGGTTCTGTATTC AAGAG ATAC AG AACC ATCTCTGTGGTTTTT-3 ' Corresponding siRNA sequences:
• Sense: 5'-CCACAGAGAUGGUUCUGUAtt-3 ' (SEQ ID NO:5)
• Antisense: 5'-UACAGAACCAUCUCUGUGGtt-3' (SEQ ID NO:6)
Hairpin sequence (SEQ ID NO:7):
5 ' -GATCCCGAAGGAACTGTC AAC AT ATTCAAGAGATATGTTGACAGTTCCTTCGTTTTT-3 ' Corresponding siRNA sequences:
• Sense: 5 ' -CGAAGGAACUGUCAACAUAtt-3 ' (SEQ ID NO:8)
• Antisense: 5'-UAUGUUGACAGUUCCUUCGtt-3 ' (SEQ ID NO:9).
[0038] Surface plasmon resonance (SPR) binding analyses - SPR binding analyses were performed at 25°C on Biacore instruments. For binding of hIL-34 and hCSF-1 to immobilized hPTP-ζ- and hCSF-lR- ECD-Fcs (Biacore T100), all flow cells of a CM4 sensor chip were activated with EDC/NHS (7 min, 10 μΐ/min) and recombinant Protein A (Pierce, 21184, 50 μg/ml in 10 mM Na acetate, pH 4.5) was applied (7 min, 10 μΐ/min). Following immobilization (> 2500RU of Protein A per flow cell), all flow cells were blocked with 1M ethanolamine-HCl, pH 8.5. hPTP- ζ -ECD-Fc (25 μg/ml) and hCSF-lR-ECD-Fc (7 μ^πιΐ) in HBSP were captured (-300 RU and -97RU respectively) on individual flow cells and binding analyses performed with different concentrations of recombinant hCSF-1 or hIL-34 in HBSP+ or HBSP+ with 3μg/ml CS (shark cartilage, Sigma, C4384). The protein A surface was regenerated with 10 mM Glycine-HCl, pH 1.5. For binding of hIL-34 to brevican, different concentrations of hIL-34 in HBSP+ were passed over brevican immobilized on the chip. Binding of hTN-R to IL-34 and to hPTP-ζ ECD-Fc (Biacore 3000) was carried out at 25°C by immobilizing IL-34 (pH 7.0) and hPTP-ζ ECD-Fc (pH 4.05) directly onto flow cells of a CM5 sensor chip (> 2800RU per flow cell) and passing over different concentrations of hTN-R. Kds were calculated according to the steady state model using BIAevaluation Software (GE Lifesciences). All sensorgrams were double-referenced.
[0039] Immunofluorescence microscopy - Anesthetized mice were transcardially perfused with ice-cold 0.25 mg/ml heparin in PBS (10 ml) followed by 4% paraformaldehyde (50 ml), their brains harvested, post-fixed overnight in 4% PFA, equilibrated in 20% sucrose, flash frozen in a cryomatrix resin and stored at -80°C prior to use. For immunofluorescence
microscopy, specimens were cryosectioned (30 μm sections), immunostained with a mature neuronal marker (NeuN, mlgGl, 1 : 100, Millipore); an adult neural stem cell marker (GFAP, mouse IgG2b, 1 :300, Millipore); IL-34 (polyclonal rabbit IgG, 1 :500, Five Prime Therapeutics, CA, USA); ΡΤΡ-ζ (3F8, mouse IgGl, 1 : 1250, Developmental Studies Hybridoma Bank, IA); TN-R (polyclonal rabbit IgG, 1 :50, Santa Cruz Biotechnology, CA); photographed either with an Olympus BX51 microscope (Tokyo Japan) coupled with a Sensicam digital camera (Cooke Corporation, Michigan, USA), or with a Zeiss Duo V2 Laser Confocal Microscope. Images were subsequently processed with Image J and Photoshop CS5 software programs.
[0040] Statistics - Student's t test was used to assess the statistical significance of the data sets.
Results
[0041] Mouse IL-34 (mIL-34) associates with mouse brain ΡΤΡ-ζ and TN-R - Compared with the expression patterns of CSF-1 and the CSF-1R, IL-34 expression in postnatal mouse brain, is spatially, temporally and quantitatively distinct (9, 14). This prompted a search for additional IL-34 receptor(s) in detergent-solubilized postnatal mouse brain membranes. To identify novel IL-34-interacting proteins, mouse brain membrane lysate, depleted of the known IL-34 receptor, CSF-1R, was subjected to affinity chromatography with mIL-34 non-covalently bound to an immobilized polyclonal rabbit anti- mIL-34 antibody. Bound proteins were eluted with SDS and processed for mass spectrometry (MS). The two eluted proteins identified with highest certainty were ΡΤΡ-ζ, a cell-surface RPTP and its ECM ligand, TN-R (Fig. 7). SDS-PAGE and silver staining of the SDS eluates of the mIL-34-anti-mIL-34 antibody affinity purification, or of IL-34-associated proteins prepared by the alternative approach of binding to biotinylated-mIL-34 and capturing the complexes with immobilized neutravidin contained a diffuse band of -400 kDa, another broad band at -225 kDa, as well as -160/180 kDa species (Fig. 1A, lanes 1-4, upper panel).
[0042] Due to alternative splicing, ΡΤΡ-ζ exists in three isoforms, one soluble and two membrane-spanning molecules (Fig. IB). The -400-kDa band was confirmed by western blotting to cover stainable bands corresponding to both the long (49) and phosphacan isoforms of ΡΤΡ-ζ (50,51) as well as multimeric TN-R (52). The -225-kDa band co-migrated with a band that stained with the 473-HD antibody (42), that sensitively stains the short PTP- ζ isoform and which also stained in the region of the -400 kDa band corresponding to the long receptor and the phosphacan isoforms. The 160/180-kDa proteins, with the apparent Mr
of the monomeric TN-R isoforms (52), co-migrated with the faster bands western blotted with the anti-TN-R antibody (Fig. 1A, lanes 1-4, lower panels), corresponding to the monomeric TN-R isoforms. To confirm the ΡΤΡ-ζ binding results, mouse brain membrane lysate was incubated with mIL-34 and a reciprocal co-immunoprecipitation experiment was performed, immunoprecipitating with 3F8, an antibody that recognizes both the soluble and the long membrane-spanning isoforms of rat ΡΤΡ-ζ (53) (Fig. IB) and western blotting with anti-IL-34 and anti-TN-R antibodies (Fig. 1C). These results show that mIL-34 forms a complex with the larger membrane-spanning isoform of ΡΤΡ-ζ and with TN-R. However, consistent with earlier reports that the TN-R binding to ΡΤΡ-ζ is ligand-independent (28,54), TN-R binding to ΡΤΡ-ζ was IL-34-independent (Fig. 1C).
[0043] SPR analysis of hIL-34 binding to the full-length hPTP-ζ ECD-Fc (Kd -10- 7M) and the hCSF-lR-ECD-Fc (Kd -10-12M) revealed dose-dependent binding to both, whereas hCSF-1 only bound to the hCSF-lR-ECD-Fc (Kd -10-11M). Similar analyses of the binding of IL-34 to two other proteoglycans identified by MS, hTN-R (Kd -10-6M) and human brevican (Kd = 3 x 10-6M), revealed lower affinity binding, whereas the interaction of TN-R with the hPTP-ζ ECD-Fc was of higher affinity (Kd -10-8M), but lower than previously reported (28,54).
[0044] Human IL-34 (hIL-34) binds to cell-surface ΡΤΡ-ζ on U251 glioblastoma cells - Since membrane-spanning ΡΤΡ-ζ, rather than TN-R, is a known signal-transducing receptor for several ligands (24-28), it was determined whether ΡΤΡ-ζ also functions as a receptor for IL-34. As ΡΤΡ-ζ is upregulated in human glioblastomas (38-40), glioblastoma cell lines U251, SNB19 and U87MG were tested for ΡΤΡ-ζ expression. All the tested cell lines expressed high levels of ΡΤΡ-ζ. U251 was selected for human IL-34 (hIL-34)-binding studies since it does not express the CSF-1R (Fig. 8). Supporting the observations in mouse brain membrane (Fig. 1A), biotinylated-hIL-34 primarily formed complexes with the long, membrane-spanning, -400 kDa ΡΤΡ-ζ (50) and to a lesser extent with the non- glycosaminoglycanylated 300 kDa (55) and the short 220 kDa (49) isoforms (Fig. 2A) in U251 membrane lysates. However, TN-R was not observed in the biotinylated-hIL-34 pulldown fractions of U251 membranes, suggesting that IL-34 probably binds to ΡΤΡ-ζ in a TN- R-independent manner. Clones stably-expressing ΡΤΡ-ζ shRNA (KD cells) expressed lower levels of ΡΤΡ-ζ protein than clones expressing scrambled shRNA (scrambled cells) (Fig. 2B). Scrambled cells expressed higher levels of total soluble ΡΤΡ-ζ than uninfected cells,
indicating that lentiviral infection per se causes cellular ΡΤΡ-ζ upregulation. Consistent with the dependence of IL-34 binding on ΡΤΡ-ζ expression, flow cytometric studies demonstrated that the ability of biotinylated hIL-34 to bind to the cell-surface of intact U251 cells was reduced in ΡΤΡ-ζ KD cells (Fig. 2C), particularly in KD2 cells. Thus these results show that hIL-34 binds to ΡΤΡ-ζ at the surface of intact U251 cells. The specificity and binding of IL- 34 to U251 cells was also investigated in binding experiments with FLAG-tagged human IL- 34 and FLAG-tagged human CSF-1 (17). At equivalent concentrations, IL-34-FLAG showed robust binding, whereas CSF-1-FLAG failed to bind and IL-34-FLAG exhibited dose- dependent binding, covering a wide concentration range (0.1 pM-1 nM).
[0045] hIL-34 inhibits U251 proliferation, cionogenicity and motility in a ΡΤΡ-ζ- dependent manner - ΡΤΡ-ζ-signaling is involved in neuronal migration (56) and neuritogenesis (57) in mouse and in the in vitro and in vivo growth of human glioblastomas (39,58,59). As previous studies have shown that PTN inhibits the growth of glioblastomas, to determine the functional relevance of ΡΤΡ-ζ receptor engagement by IL-34, the effects of IL- 34 and PTN were tested on the U251 glioblastoma cells expressing either ΡΤΡ-ζ or scrambled (control) shRNAs. Either IL-34 or PTN treatment slightly, but significantly, reduced the growth of scrambled U251 cells over a 96 h time period (-20% reduction in IL-34 vs vehicle- treated control cells, Fig. 3A left panel), while not affecting the growth of the ΡΤΡ-ζ KD U251 cell lines (Fig. 3 A right panel). The effects of IL-34 and PTN on the colony-forming- ability of infected U251 cells were also examined. After a 16 h pulse with IL-34 or PTN, cells were seeded at clonal density and the colonies formed at 8 days were stained and counted. IL-34 or PTN treatment strongly decreased the cionogenicity of scrambled U251 cells (reductions of 68% for IL-34 and 53% for PTN, vs vehicle control cells), without significantly affecting the cionogenicity of ΡΤΡ-ζ KD cells (Fig. 3B, left and right panels).
[0046] As PTN was also previously shown to affect glioblastoma cell migration (38- 40), to investigate the role of IL-34 in ΡΤΡ-ζ-mediated glioblastoma cell migration, the effects of IL-34 and PTN were first compared on the wound-healing rates of scrambled and ΡΤΡ-ζ KD cells (Fig. 4A). In the absence of added ligand(s), KD clones exhibited a slower rate of wound healing, indicating that the constitutively active ΡΤΡ-ζ receptor facilitates U251 migration (e.g. time taken for 50% wound closure [t50] for KD2 cells was >20 h, compared to 5.5 h for scrambled cells). Consistent with ligand-induced inactivation of the receptor (30,32,60), PTN (t50 = 10 h), or IL-34 (t50 = 11.5 h) significantly inhibited wound
healing in uninfected cells (vehicle tso = 7.5 h). Furthermore, neither IL-34, nor PTN could suppress ΡΤΡ-ζ KD cell wound healing (Fig. 4B), thereby indicating that suppression of healing by either ligand is mediated through ΡΤΡ-ζ. To determine whether IL-34 and PTN suppress directed migration a haptotaxis assay was used (Fig. 4C), in which ΡΤΡ-ζ ligands were shown to be more effective in regulating migration than in a conventional chemotaxis assay (61,62). Both IL-34 as well as PTN, when coated on the bottom of the membrane, suppressed migration of U251 cells (Fig. 4C). To determine whether IL-34 and PTN also inhibit random migration, migration of the cells was examined through membranes containing these growth factors on both sides. Both IL-34 as well as PTN inhibited the random migration of the cells (Fig. 4D). Together, these results demonstrate that IL-34 suppresses proliferation, clonogenicity and motility of U251 cells in vitro, in a ΡΤΡ-ζ- dependent manner.
[0047] hIL-34 enhances ΡΤΡ-ζ-mediated tyrosine phosphorylation of FAK and paxillin in U251 cells - To function as a receptor for IL-34, IL-34 binding to cell surface ΡΤΡ-ζ should trigger intracellular signaling. Consistent with the reduction of ΡΤΡ-ζ phosphatase activity by ligand binding (30,33,60), ΡΤΡ-ζ ligand binding has previously been shown to trigger intracellular protein tyrosine phosphorylation (31,32,34,35). Following incubation of U251 cells with PTN or IL-34 for various times at 37°C, a similar ligand- induced tyrosine phosphorylation of proteins was observed, including those with apparent Mrs of -190, -125, -120, -70 and -42 kDa, that peaked within the first 5 minutes of stimulation (Fig. 5A). ΡΤΡ-ζ ligands have been shown to increase the tyrosine phosphorylation of FAK, in lung and prostate carcinomas and endothelial cells (31,37,40) and of paxillin, in osteoblastic cells (63). Either PTN or IL-34 also increased the tyrosine phosphorylation of FAK (-125 kDa) and paxillin (-70 kDa) in U251 cells (Figs. 5 A, B). In contrast, there was no detectable increase in the tyrosine phosphorylation of the putative PTP- ζ substrates, β-catenin or β-adducin (32,34), in response to either ligand. IL-34-mediated activations of FAK and paxillin were abolished in the ΡΤΡ-ζ-Κ02 cell lines (Fig. 5C), demonstrating that tyrosine phosphorylation of these proteins, induced by IL-34, is mediated by ΡΤΡ-ζ.
[0048] hIL-34 binds to ΡΤΡ-ζ in a chondroitin sulfate-dependent manner - ΡΤΡ-ζ is a proteoglycan receptor for several ligands (24-28) Furthermore, the ΡΤΡ-ζ CS chains are known to affect binding to some of these ligands (25,29). The possible requirement of CS for
IL-34 binding was therefore tested. Consistent with the previously reported presence of CS on ΡΤΡ-ζ (19,64), treatment of solubilized U251 membranes with chondroitinase ABC increased the mobility of a significant fraction of the large ΡΤΡ-ζ isoform (Fig. 6A). To determine the requirement of CS for cell surface binding, intact U251 cells were incubated with enzyme buffer alone, or with chondroitinase ABC, to remove cell surface CS. Treatment with chondroitinase ABC reduced binding of biotinylated IL-34 to the level seen in IL-34 competed cells (background levels) (Fig. 6B). Pre-incubation of U251 cells with a 16 molar excess of IL-34 blocked the subsequent binding of biotinylated IL-34, whereas preincubations with a 16 molar excess of CSF-1, or of PTN, were without effect (Fig. 6C). Consistent with the removal of binding sites by preincubation with chondroitinase ABC, preincubation of IL-34 with 3 μg/ml of shark cartilage CS blocked IL-34 inhibition of biotinylated IL-34 binding (Fig. 6C). Thus the CS GAG moiety of ΡΤΡ-ζ is involved in IL-34 binding. SPR analysis further confirmed the inhibition by CS.
[0049] Comparative expression profiles of ΡΤΡ-ζ TN-R and IL-34 in adult brain - Previous studies have shown that ΡΤΡ-ζ is primarily expressed in neural progenitors and glial cells (21-23) as well as in a subset of cortical neurons (22,25). The expression of TN-R overlaps with ΡΤΡ-ζ expression in rostral brain regions (77-79). IL-34 expression is primarily observed on mature neurons (9,16,76), including regions of the brain where ΡΤΡ-ζ is expressed (23). IL-34 expression profiles are distinct from those of its cognate receptor, CSF- 1R and also of CSF-1, and that it is preferentially increased in specific areas of early postnatal and adult forebrain, thereby suggesting the presence of an alternative signaling receptor (9). As ΡΤΡ-ζ functions as a cell-surface receptor for IL-34 and also interacts with TN-R, the expression profiles of IL-34, ΡΤΡ-ζ and TN-R were analyzed in 8-10 week-old mouse brains. ΡΤΡ-ζ and TN-R were co-localized in OB, cerebral cortex, RMS and the CA3 region of the hippocampus that have previously been shown to express IL-34 (9). In addition, ΡΤΡ-ζ expression remained prominent in distinct subcortical structures (thalamic and subthalamic nuclei), midbrain and brain stem nuclei (inferior colliculus, pontine nuclei, locus coeruleus and vestibular nuclei), as well as the cerebellum, and displayed distinct co- localization patterns with both IL-34 and TN-R. Mature post-mitotic neurons of the cerebrum were labeled by all three of these markers. These observations are consistent with a previous study that localized IL-34 expression preferentially to mature neurons of the adult cerebral cortex, extending from layers 2-5. In addition, IL-34 and ΡΤΡ-ζ co-localization was
particularly prominent in layer 5 of the cortex. Consistent with the existence of the secreted ΡΤΡ-ζ isoform, ΡΤΡ-ζ expression was also observed in the ECM of the cerebral cortex in concert with IL-34. IL-34 and ΡΤΡ-ζ appeared to be uniformly distributed in the ECM of layer 5 and at the periphery of mature neuronal cell bodies. In contrast, in cortical layer 6, ΡΤΡ-ζ expression was reduced in the ECM and neuronal soma, whereas IL-34 expression was virtually absent. Expression of TN-R was evident in cerebral cortical layers 2-5, most prominently in layer 4, where it was co-localized with IL-34 in both the ECM and at the periphery of mature neuronal somas. Its cellular and extra-cellular expression decreased in cortical layer 5. Finally, in contrast to the expression profiles of IL-34 and TN-R, ΡΤΡ-ζ staining was also seen in GFAP+ adult neural stem cells present in the anterior SVZ, as well as in those neural species migrating through the RMS to the OB (21,23), but not in GFAP+ astrocytes in the CC.
Discussion
[0050] The differential and higher expression of IL-34, compared to CSF-1 and CSF- IR expression in brain coupled with the more pronounced effects of IL-34 compared with CSF-1 on neural progenitor cell self-renewal and differentiation (9, 14), raised the possibility that IL-34 might signal via an alternate receptor. The present studies identified ΡΤΡ-ζ, a cell- surface CSPG, as a second functional receptor for IL-34. IL-34 selectively interacts with ΡΤΡ-ζ in membrane lysates from both mouse brain as well as U251 human glioblastoma cells. It binds to intact U251 cells, stimulates their phosphotyrosine signaling and suppresses their tumorigenic properties in a ΡΤΡ-ζ-dependent manner. Furthermore, IL-34, but not CSF- 1, binds ΡΤΡ-ζ in vitro (¾ ~10~7M) and at the cell surface and whereas IL-34 and CSF-1 compete for binding to the CSF-IR (14,65,66), pre-incubation with a 16-molar excess of CSF-1 failed to compete for IL-34 binding to U251 cells. Thus ΡΤΡ-ζ fulfills the criteria required for it to function as the postulated IL-34 receptor.
[0051] ΡΤΡ-ζ is primarily expressed on neural progenitor and glial cells (21-23), as well as on a subset of cortical neurons (22,25). In contrast, IL-34 is expressed primarily on neurons (9, 16) and also in the regions of the brain where ΡΤΡ-ζ is expressed (23). Interestingly, IL-34 signaling via ΡΤΡ-ζ in U251 glioblastoma cells causes a suppression of clonogenicity, similar to the effect of CSF-1 or IL-34 on isolated CSF-1 R-expressing neural progenitors (9). This suppression of clonogenicity is correlated with stimulation of cellular tyrosine phosphorylation in either setting. Indeed, IL-34 was shown to be significantly more
active in suppressing neural progenitor cell proliferation than CSF-1 (9), consistent with an additional action of IL-34 via the ΡΤΡ-ζ receptor on the neural progenitor cells.
[0052] ΡΤΡ-ζ-signaling plays a contrasting role in hematopoietic stem cells, leading to their expansion (67). A positive regulatory role of ΡΤΡ-ζ in proliferation and migration was also reported in some glioblastomas (31,40), which could reflect the role of other known ΡΤΡ-ζ co-receptors, such as the integrins βΐ (63) and β3 (38), in governing these biological responses. Addition of IL-34 to U251 cells led to an increase in the tyrosine phosphorylation of FAK and paxillin and a suppression of cell motility. Although an increase in tyrosine phosphorylation of FAK is associated with an increase in proliferation and motility in other cells, it has been shown to inhibit these responses in glioblastomas (68). Also, similar to the present observations in U251 cells, increased tyrosine phosphorylation of paxillin is correlated with inhibition of motility in macrophages (69) and FAK (Y397) dephosphorylation promotes tumor metastasis (68). Thus, signaling via the ΡΤΡ-ζ receptor can have contrasting biological effects in specific cellular contexts, possibly dependent on the differential expression of ΡΤΡ-ζ co-receptors and the activation of specific signaling pathways.
[0053] In view of the striking dependence of the IL-34-ΡΤΡ-ζ interaction on the CS GAG chain, it was of interest that IL-34 also bound to other CS and HS proteoglycans with low affinity. The CS inhibition of ΡΤΡ-ζ binding and the finding that binding to brevican and glypican was effectively blocked by heparin, suggest that the low affinity binding of IL-34 to proteoglycans involves the electrostatic interactions between IL-34 and the proteoglycan GAG chains and that the nature of the GAG chain is the likely determinant of this interaction. This electrostatic interaction may also be an important part, but not the sole component, of the high affinity interaction of IL-34 with ΡΤΡ-ζ and the reason for the CS inhibition that was observed.
[0054] Like IL-34, PTN also exhibits GAG-dependent binding to ΡΤΡ-ζ. However, in contrast to IL-34, CS-C, but not shark cartilage CS, inhibits this binding (25). Furthermore, competition experiments showed that PTN fails to compete for the binding of IL-34 (Fig. 6C), suggesting that IL-34 binding could involve a different ΡΤΡ-ζ CS GAG-moiety, not recognized by PTN. Interestingly, the CS-A replaces CS-C on the ΡΤΡ-ζ receptor during development from embryonic to post-natal brain and this is correlated with a decrease in the
expression of PTN (64,70). In contrast, IL-34 expression increases progressively during brain development (9).
[0055] The identification of ΡΤΡ-ζ as a novel receptor for IL-34 necessitates a reevaluation of the possible role of IL-34/ ΡΤΡ-ζ signaling in tissues in which both ligand and receptor are expressed. Obviously the CNS is an important organ system because of the significant expression of both IL-34 and ΡΤΡ-ζ in brain and because ΡΤΡ-ζ has been implicated in several disease settings in the CNS. For example, it is expressed in remyelinating oligodendrocytes (OL) and PTP- ^-deficient mice display a delayed recovery from demyelinating lesions in a model of experimental autoimmune encephalomyelitis (71). Furthermore, the soluble ΡΤΡ-ζ isoform has been shown to be necessary for maturation for OL progenitors to differentiated myelin-secreting oligodendrocytes in vitro (72) and ΡΤΡ-ζ- deficient mice exhibit increased myelin breakdown (73). In addition, PTPRZ1 gene in humans is a schizophrenia-susceptibility gene (74) and ΡΤΡ-ζ regulates tyrosine phosphorylation of voltage-gated sodium channels in neurons (75). Given the present demonstration that IL-34 modulates tumorigenic properties of glioblastoma cell line U251, the fact that ΡΤΡ-ζ is expressed in neuroblastomas (18) and other tumors (37,40), such as prostate and lung cancer, is highly relevant. IL-34 is also important for Langerhans cell development (16, 76), probably via RPTP-zeta.
REFERENCES
1. Sherr, C. J., Rettenmier, C. W., Sacca, R., Roussel, M. F., Look, A. T., and Stanley, E.
R. (1985) The c-fms proto-oncogene product is related to the receptor for the mononuclear phagocyte growth factor, CSF-1. Cell 41, 665-676
2. Yeung, Y. G., Jubinsky, P. T., Sengupta, A., Yeung, D. C, and Stanley, E. R. (1987) Purification of the colony-stimulating factor 1 receptor and demonstration of its tyrosine kinase activity. Proc Natl Acad Sci USA 84, 1268-1271
3. Dai, X. M., Zong, X. FL, Akhter, M. P., and Stanley, E. R. (2004) Osteoclast deficiency results in disorganized matrix, reduced mineralization, and abnormal osteoblast behavior in developing bone. J Bone Miner Res 19, 1441-1451
4. Yoshida, FL, Hayashi, S., Kunisada, T., Ogawa, M., Nishikawa, S., Okamura, FL, Sudo, T., Shultz, L. D., and Nishikawa, S. (1990) The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature 345, 442-444
Wiktor-Jedrzejczak, W., Bartocci, A., Ferrante, A. W., Jr., Ahmed-Ansari, A., Sell, K. W., Pollard, J. W., and Stanley, E. R. (1990) Total absence of colony-stimulating factor 1 in the macrophage-deficient osteopetrotic (op/op) mouse. Proc Natl Acad Sci USA 87, 4828-4832
Cecchini, M. G., Dominguez, M. G., Mocci, S., Wetterwald, A., Felix, R., Fleisch, H., Chisholm, O., Hofstetter, W., Pollard, J. W., and Stanley, E. R. (1994) Role of colony stimulating factor- 1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse. Development 120, 1357-1372
Huynh, D., Dai, X. M., Nandi, S., Lightowler, S., Trivett, M., Chan, C. K., Bertoncello, I., Ramsay, R. G., and Stanley, E. R. (2009) Colony stimulating factor- 1 dependence of paneth cell development in the mouse small intestine. Gastroenterology 137, 136-144, 144 el31-133
Guleria, I., and Pollard, J. W. (2000) The trophoblast is a component of the innate immune system during pregnancy. Nat Med 6, 589-593
Nandi, S., Gokhan, S., Dai, X. M., Wei, S., Enikolopov, G., Lin, FL, Mehler, M. F., and Stanley, E. R. (2012) The CSF-1 receptor ligands IL-34 and CSF-1 exhibit distinct developmental brain expression patterns and regulate neural progenitor cell maintenance and maturation. Dev Biol 367, 100-1 13
Pixley, F. J., and Stanley, E. R. (2004) CSF-1 regulation of the wandering macrophage: complexity in action. Trends Cell Biol 14, 628-638
Chitu, V., and Stanley, E. R. (2006) Colony-stimulating factor- 1 in immunity and inflammation. Curr Opin Immunol 18, 39-48
Dai, X. M., Ryan, G. R., Hapel, A. J., Dominguez, M. G., Russell, R. G., Kapp, S., Sylvestre, V., and Stanley, E. R. (2002) Targeted disruption of the mouse colony- stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. Blood 99, 1 11-120
Lin, FL, Lee, E., Hestir, K., Leo, C, Huang, M., Bosch, E., Halenbeck, R., Wu, G., Zhou, A., Behrens, D., Hollenbaugh, D., Linnemann, T., Qin, M., Wong, J., Chu, K., Doberstein, S. K., and Williams, L. T. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science 320, 807-81 1
Wei, S., Nandi, S., Chitu, V., Yeung, Y. G., Yu, W., Huang, M., Williams, L. T., Lin, H., and Stanley, E. R. (2010) Functional overlap but differential expression of CSF-1
and IL-34 in their CSF-1 receptor-mediated regulation of myeloid cells. J Leukoc Biol 88, 495-505
Ginhoux, F., Greter, M., Leboeuf, M., Nandi, S., See, P., Gokhan, S., Mehler, M. F., Conway, S. J., Ng, L. G., Stanley, E. R., Samokhvalov, I. M., and Merad, M. (2010) Fate mapping analysis reveals that adult microglia derive from primitive macrophages. Science 330, 841-845
Wang, Y., Szretter, K.J., Vermi, W., Gilfillan, S., Rossini, C, Cella, M., Barrow, A.D., Diamond, M.S., Colonna, M. (2012) IL-34 is a tissue-restricted ligand of CSF 1R required for the development of Langerhans cells and microglia. Nat Immunol 13, 753- 760
Chihara, T., Suzu, S., Hassan, R., Chutiwitoonchai, N., Hiyoshi, M., Motoyoshi, K., Kimura, F., and Okada, S. (2010) IL-34 and M-CSF share the receptor Fms but are not identical in biological activity and signal activation. Cell Death Differ 17, 1917-1927 Levy, J. B., Canoll, P. D., Silvennoinen, O., Barnea, G., Morse, B., Honegger, A. M., Huang, J. T., Cannizzaro, L. A., Park, S. H., Druck, T., and et al. (1993) The cloning of a receptor-type protein tyrosine phosphatase expressed in the central nervous system. J Biol Chem 268, 10573-10581
Barnea, G., Grumet, M., Milev, P., Silvennoinen, O., Levy, J. B., Sap, J., and Schlessinger, J. (1994) Receptor tyrosine phosphatase beta is expressed in the form of proteoglycan and binds to the extracellular matrix protein tenascin. J Biol Chem 269, 14349-14352
Krueger, N. X., and Saito, H. (1992) A human transmembrane protein-tyrosine- phosphatase, PTP zeta, is expressed in brain and has an N-terminal receptor domain homologous to carbonic anhydrases. Proc Natl Acad Sci USA 89, 7417-7421 von Hoist, A., Sirko, S., and Faissner, A. (2006) The unique 473HD-Chondroitinsulfate epitope is expressed by radial glia and involved in neural precursor cell proliferation. J Neurosci 26, 4082-4094
Shintani, T., Watanabe, E., Maeda, N., and Noda, M. (1998) Neurons as well as astrocytes express proteoglycan-type protein tyrosine phosphatase zeta/RPTPbeta: analysis of mice in which the PTPzeta/RPTPbeta gene was replaced with the LacZ gene. Neurosci Lett 247, 135-138
Lafont, D., Adage, T., Greco, B., and Zaratin, P. (2009) A novel role for receptor like protein tyrosine phosphatase zeta in modulation of sensorimotor responses to noxious stimuli: evidences from knockout mice studies. Behav Brain Res 201, 29-40
Peles, E., Schlessinger, J., and Grumet, M. (1998) Multi-ligand interactions with receptor-like protein tyrosine phosphatase beta: implications for intercellular signaling. Trends Biochem Sci 23 , 121-124
Maeda, N., Nishiwaki, T., Shintani, T., Hamanaka, H., and Noda, M. (1996) 6B4 proteoglycan/phosphacan, an extracellular variant of receptor-like protein-tyrosine phosphatase zeta/RPTPbeta, binds pleiotrophin/heparin-binding growth-associated molecule (HB-GAM). J Biol Chem 271, 21446-21452
Li, Y. S., Milner, P. G., Chauhan, A. K., Watson, M. A., Hoffman, R. M., Kodner, C. M., Milbrandt, J., and Deuel, T. F. (1990) Cloning and expression of a developmentally regulated protein that induces mitogenic and neurite outgrowth activity. Science 250, 1690-1694
Peles, E., Nativ, M., Campbell, P. L., Sakurai, T., Martinez, R., Lev, S., Clary, D. O., Schilling, J., Barnea, G., Plowman, G. D., Grumet, M., and Schlessinger, J. (1995) The carbonic anhydrase domain of receptor tyrosine phosphatase beta is a functional ligand for the axonal cell recognition molecule contactin. Cell 82, 251-260
Milev, P., Chiba, A., Haring, M., Rauvala, H., Schachner, M., Ranscht, B., Margolis, R. K., and Margolis, R. U. (1998) High affinity binding and overlapping localization of neurocan and phosphacan/protein-tyrosine phosphatase-zeta/beta with tenascin-R, amphoterin, and the heparin-binding growth-associated molecule. J Biol Chem 273, 6998-7005
Maeda, N., Ichihara-Tanaka, K., Kimura, T., Kadomatsu, K., Muramatsu, T., and Noda, M. (1999) A receptor-like protein-tyrosine phosphatase PTPzeta/RPTPbeta binds a heparin-binding growth factor midkine. Involvement of arginine 78 of midkine in the high affinity binding to PTPzeta. J Biol Chem 274, 12474-12479
Majeti, R., Bilwes, A. M., Noel, J. P., Hunter, T., and Weiss, A. (1998) Dimerization- induced inhibition of receptor protein tyrosine phosphatase function through an inhibitory wedge. Science 279, 88-91
Polykratis, A., Katsoris, P., Courty, J., and Papadimitriou, E. (2005) Characterization of heparin affin regulatory peptide signaling in human endothelial cells. J Biol Chem 280, 22454-22461
Meng, K., Rodriguez-Pena, A., Dimitrov, T., Chen, W., Yamin, M., Noda, M., and Deuel, T. F. (2000) Pleiotrophin signals increased tyrosine phosphorylation of beta beta- catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta/zeta. Proc Natl Acad Sci USA 97, 2603-2608
Fukada, M., Fujikawa, A., Chow, J. P., Ikematsu, S., Sakuma, S., and Noda, M. (2006) Protein tyrosine phosphatase receptor type Z is inactivated by ligand-induced oligomerization. FEBS Lett 580, 4051-4056
Pariser, FL, Perez-Pinera, P., Ezquerra, L., Herradon, G., and Deuel, T. F. (2005) Pleiotrophin stimulates tyrosine phosphorylation of beta-adducin through inactivation of the transmembrane receptor protein tyrosine phosphatase beta/zeta. Biochem Biophys Res Commun 335, 232-239
Pariser, FL, Ezquerra, L., Herradon, G., Perez-Pinera, P., and Deuel, T. F. (2005) Fyn is a downstream target of the pleiotrophin/receptor protein tyrosine phosphatase beta/zeta- signaling pathway: regulation of tyrosine phosphorylation of Fyn by pleiotrophin. Biochem Biophys Res Commun 332, 664-669
Fujikawa, A., Fukada, M., Makioka, Y., Suzuki, R., Chow, J. P., Matsumoto, M., and Noda, M. (201 1) Consensus substrate sequence for protein-tyrosine phosphatase receptor type Z. J Biol Chem 286, 37137-37146
Diamantopoulou, Z., Kitsou, P., Menashi, S., Courty, J., and Katsoris, P. (2012) Loss of Receptor Protein Tyrosine Phosphatase beta/zeta (RPTPbeta/zeta) Promotes Prostate Cancer Metastasis. J Biol Chem 287, 40339-40349
Mikelis, C, Sfaelou, E., Koutsioumpa, M., Kieffer, N., and Papadimitriou, E. (2009) Integrin alpha(v)beta(3) is a pleiotrophin receptor required for pleiotrophin-induced endothelial cell migration through receptor protein tyrosine phosphatase beta/zeta. Faseb J23, 1459-1469
Muller, S., Kunkel, P., Lamszus, K., Ulbricht, U., Lorente, G. A., Nelson, A. M., von Schack, D., Chin, D. J., Lohr, S. C, Westphal, M., and Melcher, T. (2003) A role for receptor tyrosine phosphatase zeta in glioma cell migration. Oncogene 22, 6661-6668 Feng, Z. J., Gao, S. B., Wu, Y., Xu, X. F., Hua, X., and Jin, G. H. (2010) Lung cancer cell migration is regulated via repressing growth factor PTN/RPTP beta/zeta signaling by menin. Oncogene 29, 5416-5426
Yu, W., Chen, J., Xiong, Y., Pixley, F. J., Yeung, Y. G., and Stanley, E. R. (2012) Macrophage proliferation is regulated through CSF-1 receptor tyrosines 544, 559, and 807. J Biol Chem 287, 13694-13704
Garwood, J., Schnadelbach, O., Clement, A., Schutte, K., Bach, A., and Faissner, A. (1999) DSD- 1 -proteoglycan is the mouse homolog of phosphacan and displays opposing effects on neurite outgrowth dependent on neuronal lineage. JNeurosci 19, 3888-3899 Edmonds, B. T., Wyckoff, J., Yeung, Y. G., Wang, Y., Stanley, E. R., Jones, J., Segall, J., and Condeelis, J. (1996) Elongation factor- 1 alpha is an overexpressed actin binding protein in metastatic rat mammary adenocarcinoma. J Cell Sci 109 ( Pt 1 1), 2705-2714 Yeung, Y.G., Nieves, E., Angeletti, R.H., Stanley, E.R. (2008) Removal of detergents from protein digests for mass spectrometry analysis. Anal Biochem 382, 135-137 Yeung, Y.G., Stanley, E.R. (2003) Proteomic approaches to the analysis of early events in colony-stimulating factor- 1 signal transduction. Mol Cell Proteomics 2, 1 143-1155 Roussel, M. F., Dull, T. J., Rettenmier, C. W., Ralph, P., Ullrich, A., and Sherr, C. J. (1987) Transforming potential of the c-fms proto-oncogene (CSF-1 receptor). Nature 325, 549-552
Morgan, C, Pollard, J. W., and Stanley, E. R. (1987) Isolation and characterization of a cloned growth factor dependent macrophage cell line, BAC1.2F5. J Cell Physiol 130, 420-427
Li, W, Stanley, ER. (1991) Role of dimerization and modification of the CSF-1 receptor in its activation and internalization during the CSF-1 response. Embo J 10, 277-88 Nishiwaki, T., Maeda, N., and Noda, M. (1998) Characterization and developmental regulation of proteoglycan-type protein tyrosine phosphatase zeta/RPTPbeta isoforms. J Biochem 123, 458-467
Sakurai, T., Friedlander, D. R., and Grumet, M. (1996) Expression of polypeptide variants of receptor-type protein tyrosine phosphatase beta: the secreted form, phosphacan, increases dramatically during embryonic development and modulates glial cell behavior in vitro. JNeurosci Res 43, 694-706
Chow, J. P., Fujikawa, A., Shimizu, H., Suzuki, R., and Noda, M. (2008) Metalloproteinase- and gamma-secretase-mediated cleavage of protein-tyros ine phosphatase receptor type Z. J Biol Chem 283, 30879-30889
Woodworm, A., Pesheva, P., Fiete, D., and Baenziger, J. U. (2004) Neuronal-specific synthesis and glycosylation of tenascin-R. J Biol Chem 279, 10413-10421
Maurel, P., Rauch, U., Flad, M., Margolis, R. K., and Margolis, R. U. (1994) Phosphacan, a chondroitin sulfate proteoglycan of brain that interacts with neurons and neural cell-adhesion molecules, is an extracellular variant of a receptor-type protein tyrosine phosphatase. Proc Natl Acad Sci US A 91, 2512-2516
Xiao, Z. C, Bartsch, U., Margolis, R. K., Rougon, G., Montag, D., and Schachner, M. (1997) Isolation of a tenascin-R binding protein from mouse brain membranes. A phosphacan-related chondroitin sulfate proteoglycan. J Biol Chem 272, 32092-32101 Shitara, K., Yamada, FL, Watanabe, K., Shimonaka, M., and Yamaguchi, Y. (1994) Brain-specific receptor-type protein-tyrosine phosphatase RPTP beta is a chondroitin sulfate proteoglycan in vivo. J Biol Chem 269, 20189-20193
Maeda, N., and Noda, M. (1998) Involvement of receptor-like protein tyrosine phosphatase zeta/RPTPbeta and its ligand pleiotrophin/heparin-binding growth- associated molecule (HB-GAM) in neuronal migration. J Cell Biol 142, 203-216 Fukazawa, N., Yokoyama, S., Eiraku, M., Kengaku, M., and Maeda, N. (2008) Receptor type protein tyrosine phosphatase zeta-pleiotrophin signaling controls endocytic trafficking of DNER that regulates neuritogenesis. Mol Cell Biol 28, 4494-4506
Ulbricht, U., Eckerich, C, Fillbrandt, R., Westphal, M., and Lamszus, K. (2006) RNA interference targeting protein tyrosine phosphatase zeta/receptor-type protein tyrosine phosphatase beta suppresses glioblastoma growth in vitro and in vivo. J Neurochem 98, 1497-1506
Foehr, E. D., Lorente, G., Kuo, J., Ram, R., Nikolich, K., and Urfer, R. (2006) Targeting of the receptor protein tyrosine phosphatase beta with a monoclonal antibody delays tumor growth in a glioblastoma model. Cancer Res 66, 2271-2278
Barr, A. J., Ugochukwu, E., Lee, W. FL, King, O. N., Filippakopoulos, P., Alfano, I., Savitsky, P., Burgess-Brown, N. A., Muller, S., Knapp, S. (2009) Large-scale structural analysis of the classical human protein tyrosine phosphatome. Cell 136, 352-363 Lu, K. V., Jong, K. A., Kim, G. Y., Singh, J., Dia, E. Q., Yoshimoto, K., Wang, M. Y., Cloughesy, T. F., Nelson, S. F., and Mischel, P. S. (2005) Differential induction of glioblastoma migration and growth by two forms of pleiotrophin. J Biol Chem 280, 26953-26964
Qi, M., Ikematsu, S., Maeda, N., Ichihara-Tanaka, K., Sakuma, S., Noda, M., Muramatsu, T., and Kadomatsu, K. (2001) Haptotactic migration induced by midkine.
Involvement of protein-tyros ine phosphatase zeta. Mitogen-activated protein kinase, and phosphatidylinositol 3-kinase. J Biol Chem 276, 15868-15875
Muramatsu, FL, Zou, P., Suzuki, FL, Oda, Y., Chen, G. Y., Sakaguchi, N., Sakuma, S., Maeda, N., Noda, M., Takada, Y., and Muramatsu, T. (2004) alpha4betal- and alpha6betal-integrins are functional receptors for midkine, a heparin-binding growth factor. J Cell Sci 1 17, 5405-5415
Maeda, N., Hamanaka, H., Oohira, A., and Noda, M. (1995) Purification, characterization and developmental expression of a brain-specific chondroitin sulfate proteoglycan, 6B4 proteoglycan/phosphacan. Neuroscience 67, 23-35
Ma, X., Lin, W. Y., Chen, Y., Stawicki, S., Mukhyala, K., Wu, Y., Martin, F., Bazan, J. F., and Starovasnik, M. A. (2012) Structural basis for the dual recognition of helical cytokines IL-34 and CSF-1 by CSF-1R. Structure 20, 676-687
Liu, H., Leo, C, Chen, X., Wong, B. R., Williams, L. T., Lin, H., and He, X. (2012) The mechanism of shared but distinct CSF-1R signaling by the non-homologous cytokines IL-34 and CSF-1. Biochim Biophys Acta 1824, 938-945
Himburg, H. A., Muramoto, G. G., Daher, P., Meadows, S. K., Russell, J. L., Doan, P., Chi, J. T., Salter, A. B., Lento, W. E., Reya, T., Chao, N. J., and Chute, J. P. (2010) Pleiotrophin regulates the expansion and regeneration of hematopoietic stem cells. Nat Med 16, 475-482
Zheng, Y., Xia, Y., Hawke, D., Halle, M., Tremblay, M. L., Gao, X., Zhou, X. Z., Aldape, K., Cobb, M. H., Xie, K., He, J., and Lu, Z. (2009) FAK phosphorylation by ERK primes ras-induced tyrosine dephosphorylation of FAK mediated by ΡΓΝ1 and PTP-PEST. Mol Cell 35, 11-25
Pixley, F. J., Lee, P. S., Condeelis, J. S., and Stanley, E. R. (2001) Protein tyrosine phosphatase phi regulates paxillin tyrosine phosphorylation and mediates colony- stimulating factor 1 -induced morphological changes in macrophages. Mol Cell Biol 21, 1795-1809
Rauch, U., Gao, P., Janetzko, A., Flaccus, A., Hilgenberg, L., Tekotte, H., Margolis, R. K., and Margolis, R. U. (1991) Isolation and characterization of developmentally regulated chondroitin sulfate and chondroitin/keratan sulfate proteoglycans of brain identified with monoclonal antibodies. J Biol Chem 266, 14785-14801
71. Harroch, S., Furtado, G. C, Brueck, W., Rosenbluth, J., Lafaille, J., Chao, M., Buxbaum, J. D., and Schlessinger, J. (2002) A critical role for the protein tyrosine phosphatase receptor type Z in functional recovery from demyelinating lesions. Nat Genet 32, 411-14
72. Lamprianou, S., Chatzopoulou, E., Thomas, J. L., Bouyain, S., and Harroch, S. (201 1) A complex between contactin-1 and the protein tyrosine phosphatase PTPRZ controls the development of oligodendrocyte precursor cells. Proc Natl Acad Sci U S A 108, 17498- 17503
73. Harroch, S., Palmeri, M., Rosenbluth, J., Custer, A., Okigaki, M., Shrager, P., Blum, M., Buxbaum, J. D., and Schlessinger, J. (2000) No obvious abnormality in mice deficient in receptor protein tyrosine phosphatase beta. Mol Cell Biol 20, 7706-7715
74. Buxbaum, J. D., Georgieva, L., Young, J. J., Plescia, C, Kajiwara, Y., Jiang, Y., Moskvina, V., Norton, N., Peirce, T., Williams, H., Craddock, N. J., Carroll, L., Corfas, G., Davis, K. L., Owen, M. J., Harroch, S., Sakurai, T., and O'Donovan, M. C. (2008) Molecular dissection of NRG1-ERBB4 signaling implicates PTPRZ 1 as a potential schizophrenia susceptibility gene. Mol Psychiatry 13, 162-172
75. Ratcliffe, C. F., Qu, Y., McCormick, K. A., Tibbs, V. C, Dixon, J. E., Scheuer, T., and Catterall, W. A. (2000) A sodium channel signaling complex: modulation by associated receptor protein tyrosine phosphatase beta. Nat Neurosci 3, 437-444.
76. Greter, M., Lelios, I., Pelczar, P., Hoeffel, G., Price, J., Leboeuf, M., Kundig, T. M., Frei, K., Ginhoux, F., Merad, M., and Becher, B. (2012) Stroma-derived interleukin-34 controls the development and maintenance of langerhans cells and the maintenance of microglia. Immunity 37, 1050-1060.
77. El Ayachi, I., Fernandez, C, Baeza, N., De Paula, A. M., Pesheva, P., and Figarella- Branger, D. (201 1) Spatiotemporal distribution of tenascin-R in the developing human cerebral cortex parallels neuronal migration. J Comp Neurol 519, 2379-2389.
78. Saghatelyan, A., de Chevigny, A., Schachner, M., and Lledo, P. M. (2004) Tenascin-R mediates activity-dependent recruitment of neuroblasts in the adult mouse forebrain. Nat Neurosci 7, 347-356.
79. Woodworth, A., Fiete, D., and Baenziger, J. U. (2002) Spatial and temporal regulation of tenascin-R glycosylation in the cerebellum. J Biol Chem 277, 50941-50947.
Claims
1. A method for determining whether or not an agent is a candidate agent for inhibiting interaction between interleukin-34 (IL-34) and protein tyrosine phosphatase receptor type zeta (ΡΤΡ-ζ) comprising:
contacting cells that express ΡΤΡ-ζ on their surface and that do not express colony stimulating factor- 1 receptor (CSF-IR) with IL-34 in the presence of the agent and in the absence of the agent, and
measuring a cellular response induced by IL-34,
wherein an agent that reduces a cellular response induced by IL-34 is a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ, and
wherein an agent that does not reduce a cellular response induced by IL-34 is not a candidate agent for inhibiting interaction between IL-34 and ΡΤΡ-ζ.
2. The method of claim 1, wherein the cells are glioblastoma cells.
3. The method of claim 1, wherein the cells are U251 human glioblastoma cells.
4. The method of claim 1, wherein the cells have been transfected with nucleic acid encoding human ΡΤΡ-ζ.
5. The method of any of claims 1-4, wherein IL-34 inhibits one or more of cell proliferation, clonogenicity and/or motility.
6. The method of any of claims 1-4, wherein IL-34 induces tyrosine phosphorylation of a protein.
7. The method of claim 6, wherein IL-34-induces tyrosine phosphorylation of focal adhesion kinase (FAK) and/or paxillin.
8. The method of claim 1, wherein IL-34 stimulates differentiation of neural progenitor cells.
9. The method of any of claims 1-8, wherein the agent binds to a chondroitin sulfate glycosaminoglycan (GAG) moiety on ΡΤΡ-ζ.
10. The method of any of claims 1-9, wherein the agent is useful for treatment of a disease or disorder or a defect in neural or microglial development or a defect in homeostasis.
1 1. The method of claim 10, wherein the disease or disorder is cancer, inflammation, a central nervous system disease, brain injury, neuro-degeneration, a memory deficit, glioblastoma, multiple sclerosis, schizophrenia, or autoimmune disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/891,405 US9671391B2 (en) | 2013-05-22 | 2014-05-19 | IL-34 receptor assays and uses thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361826356P | 2013-05-22 | 2013-05-22 | |
| US61/826,356 | 2013-05-22 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014189832A1 true WO2014189832A1 (en) | 2014-11-27 |
Family
ID=51934013
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/038590 Ceased WO2014189832A1 (en) | 2013-05-22 | 2014-05-19 | Il-34 receptor assays and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US9671391B2 (en) |
| WO (1) | WO2014189832A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109613132A (en) * | 2018-12-06 | 2019-04-12 | 上海景峰制药有限公司 | A kind of detection method of heterozygosis chondroitin sulfate |
| CN110499295A (en) * | 2019-09-11 | 2019-11-26 | 宝船生物医药科技(上海)有限公司 | A kind of CSF-1R reporter gene cell strain and its preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100130527A1 (en) * | 2008-11-18 | 2010-05-27 | Lehrer Raphael | Individualized cancer treatment |
| WO2013011021A1 (en) * | 2011-07-18 | 2013-01-24 | The University Of Melbourne | Use of c-fms antagonists |
-
2014
- 2014-05-19 WO PCT/US2014/038590 patent/WO2014189832A1/en not_active Ceased
- 2014-05-19 US US14/891,405 patent/US9671391B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20100130527A1 (en) * | 2008-11-18 | 2010-05-27 | Lehrer Raphael | Individualized cancer treatment |
| WO2013011021A1 (en) * | 2011-07-18 | 2013-01-24 | The University Of Melbourne | Use of c-fms antagonists |
Non-Patent Citations (4)
| Title |
|---|
| MAEDA ET AL.: "A Receptor-like Protein-tyrosine Phosphatase PTP zeta/RPTPbeta Binds a Heparin-binding Growth Factor Midkine: INVOLVEMENT OF ARGININE 78 OF MIDKINE IN THE HIGH AFFINITY BINDING TO PTPz", J. BIOL. CHEM., vol. 274, 1999, pages 12474 - 12479 * |
| NAKAMICHI ET AL.: "Spleen serves as a reservoir of osteoclast precursors through vitamin D- induced IL -34 expression in osteopetrotic op/op mice", PNAS, vol. 109, no. 25, 19 June 2012 (2012-06-19), pages 10006 - 10011 * |
| NANDI ET AL.: "Receptor-type Protein-tyrosine Phosphatase zeta Is a Functional Receptor for Interleukin-34", J. BIOL. CHEM., vol. 288, 2013, pages 21972 - 21986 * |
| ULRIKE: "RNA interference targeting protein tyrosine phosphatase zeta/receptor-type protein tyrosine phosphatase beta suppresses glioblastoma growth in vitro and in vivo", JOURNAL OF NEUROCHEMISTRY, vol. 98, 2006, pages 1497 - 1506 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109613132A (en) * | 2018-12-06 | 2019-04-12 | 上海景峰制药有限公司 | A kind of detection method of heterozygosis chondroitin sulfate |
| CN110499295A (en) * | 2019-09-11 | 2019-11-26 | 宝船生物医药科技(上海)有限公司 | A kind of CSF-1R reporter gene cell strain and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| US20160123962A1 (en) | 2016-05-05 |
| US9671391B2 (en) | 2017-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TWI822760B (en) | Fusion protein binding cd47 protein and the use thereof | |
| US11174309B2 (en) | Anti-ANG2 antibody | |
| Capsoni et al. | Intranasal “painless” human nerve growth factors slows amyloid neurodegeneration and prevents memory deficits in App X PS1 mice | |
| Hu et al. | Netrin-4 promotes glioblastoma cell proliferation through integrin β4 signaling | |
| Whiteford et al. | Syndecan-2 is a novel ligand for the protein tyrosine phosphatase receptor CD148 | |
| Shemesh et al. | NKp44-derived peptide binds proliferating cell nuclear antigen and mediates tumor cell death | |
| Osterfield et al. | Interaction of amyloid precursor protein with contactins and NgCAM in the retinotectal system | |
| Belleudi et al. | Monoclonal antibody-induced ErbB3 receptor internalization and degradation inhibits growth and migration of human melanoma cells | |
| KR20150032075A (en) | Anticancer composition containing an anti-Ang2 antibody inducing binding to Tie2 receptor | |
| Kim et al. | Del-1, an endogenous inhibitor of TGF-β activation, attenuates fibrosis | |
| US11136383B2 (en) | Methods and compositions for modulaton of transforming growth factor beta-regulated functions | |
| Jin et al. | Alternate receptor usage of neuropilin-1 and glucose transporter protein 1 by the human T cell leukemia virus type 1 | |
| US9671391B2 (en) | IL-34 receptor assays and uses thereof | |
| JP2024038346A (en) | How to diagnose cancer from blood | |
| Wang et al. | Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function | |
| Wu et al. | Identification of function-regulating antibodies targeting the receptor protein tyrosine phosphatase sigma ectodomain | |
| CN112851819A (en) | Bispecific antibody combining mouse PD-L1 and TGF-beta and preparation method and application thereof | |
| Huang et al. | GPR56/ADGRG1 induces biased Rho-ROCK-MLC and JAK-STAT3 signaling to promote amoeboid-like morphology and IL-6 upregulation in melanoma cells | |
| Geng et al. | Sorting protein-related receptor SorLA controls regulated secretion of glial cell line-derived neurotrophic factor | |
| Muramatsu et al. | Potential involvement of kinesin-1 in the regulation of subcellular localization of Girdin | |
| Guillemard et al. | An agonistic mAb directed to the TrkC receptor juxtamembrane region defines a trophic hot spot and interactions with p75 coreceptors | |
| Nandi | Interleukin-34 Is a Functional Receptor for! Phosphatase Receptor-type Protein-tyrosine Signal Transduction | |
| JP6187960B2 (en) | Cancer treatment or prevention agent | |
| Washburn | Molecular Mechanisms of the EphB-NMD Receptor Extracellular Interaction | |
| RU2787521C2 (en) | Binding of fused protein to cd47 protein and its use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14800732 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14891405 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14800732 Country of ref document: EP Kind code of ref document: A1 |