WO2014172340A1 - Immortalization of circulating tumor cells and methods of use - Google Patents
Immortalization of circulating tumor cells and methods of use Download PDFInfo
- Publication number
- WO2014172340A1 WO2014172340A1 PCT/US2014/034141 US2014034141W WO2014172340A1 WO 2014172340 A1 WO2014172340 A1 WO 2014172340A1 US 2014034141 W US2014034141 W US 2014034141W WO 2014172340 A1 WO2014172340 A1 WO 2014172340A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumor cells
- ctcs
- cells
- rock
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2500/00—Specific components of cell culture medium
- C12N2500/05—Inorganic components
- C12N2500/10—Metals; Metal chelators
- C12N2500/12—Light metals, i.e. alkali, alkaline earth, Be, Al, Mg
- C12N2500/14—Calcium; Ca chelators; Calcitonin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/70—Enzymes
- C12N2501/72—Transferases [EC 2.]
- C12N2501/727—Kinases (EC 2.7.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/999—Small molecules not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
- C12N2502/1323—Adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2533/00—Supports or coatings for cell culture, characterised by material
- C12N2533/30—Synthetic polymers
Definitions
- the present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium- containing medium while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during culturing.
- CTCs circulating tumor cells
- ROCK Rho kinase
- Circulating tumors cells constitute a blood born route for tumor dissemination. These cells are believed to arise from the primary tumor and travel to other sites in the body, where they can become established as metastatic lesions. Similarly, metastatic tumors may continue to shed CTCs into the circulation, enabling other metastatic sites to form additional tumor sites.
- CTCs are becoming an increasingly important diagnostic and prognostic tools, however the static nature of the current state of the art, i.e., the use of fixed cells and the previous inability to propagate the cells, limits their use. If CTCs can be isolated, propagated and even banked for later use, these cells could be invaluable as tools for understanding the genetic and molecular basis of tumor metastases at the level of individual patients, for patient-specific drug sensitivity testing, for understanding the molecular basis of tumor recurrence and for continuous refinement of personalized, precision cancer management and therapy.
- the present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium- containing medium while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during culturing.
- CTCs circulating tumor cells
- ROCK Rho kinase
- the present invention is also directed towards methods of producing conditionally immortalized CTCs, with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both. Culturing the CTCs in such conditions will produce conditionally immortalized CTCs.
- the present invention is also directed towards methods of producing at least partially differentiated CTCs comprising culturing for a set time CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both to produce conditionally immortalized CTCs. After culturing the conditionally immortalized CTCs in these conditions, the conditionally immortalized CTCs are placed in conditions that promote differentiation of the conditionally immortalized CTCs.
- the present invention is also directed towards methods of stimulating growth of CTCs, with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both. Culturing the CTCs in such conditions will stimulate the CTCs to grow, whereas otherwise the cells may not grow.
- FIGURE 1 depicts viable CTC capture and culture using the methods of the present invention.
- A Representative IF image (at 60X magnification) of a fixed CK (cytokeratin) +/CD45- CTC at (red) and CK- /CD45+ lymphocyte (green) with DAPI staining for nuclear identification (blue) captured using the round pore microfilter device.
- B cultured CTCs captured by the NextGen microfilter device are CK+/CD45-, demonstrating epithelial origin (at 10X magnification).
- C-F Representative IF image (at 60X magnification) of a fixed CK (cytokeratin) +/CD45- CTC at (red) and CK- /CD45+ lymphocyte (green) with DAPI staining for nuclear identification (blue) captured using the round pore microfilter device.
- B cultured CTCs captured by the NextGen microfilter device are CK+/CD45-, demonstrating epithelial origin (at 10X magnification).
- FIGURE 2 depicts via ble CTC capture and culture from a patient with prostate cancer. Left: cultured CTCs captured by the NextGen microfilter. Expansion of CTCs and migration onto other areas of the filter is observed at day 14 Right: Representative I F image of a fixed CK+/CD45- CTC used for enumeration of the CTCs in the patient blood, performed on day 1.
- FIGURE 3 depicts via ble CTC capture and culture of a patient with prostate cancer.
- Left cultured CTCs captured by the NextGen microfilter. Expansion of CTCs and migration onto other areas of the filter is observed at day 3
- Right Representative IF image of fixed CK+/CD45- DAPI stained day-3 cells, showing the epithelial lineage of the CTCs in culture. The arrow identifies an CTC undergoing mitosis
- FIGU RE 4 depicts via ble CTCs isolated from the blood of a patient with colon (A) or breast (B) cancer.
- the present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing maxim m while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the non- keratinocyte epithelial cells or both during culturing.
- CTCs circulating tumor cells
- ROCK Rho kinase
- Examples of CTCs include but are not limited to circulating prostate tumor cells, circulating mammary tumor cells, circulating prostate tumor cells, circulating liver tu mor cells, circulating pancreatic tumor cells, circulating lung tumor cells, circulating kidney tumor cells, circulating bladder tumor cells, circulating stomach epithelial tu mor cells, circulating colon tumor cells, circulating urethral tumor cells, circulating testicular tumor cells, circulating ovarian tumor cells, circulating cervical tumor cells, circulating thyroid tumor cells, circulating parathyroid tumor cells, circulating adrenal tumor cells, circulating thymus tumor cells, circu lating gall bladder tumor cells and circulating pituitary tumor cells to name a few.
- the invention is not limited to the tissue or organ source of the circulating tumor cells.
- the cells need not be epithelial in origin but can be circulating tumor cells from a non-epithelial tumor.
- non-epithelial derived tumors include but are not limited to tumors arising from connective tissue, muscle tissue and nervous tissue.
- non-epithelial-derived tumors include but a re not limited to leukemias and sarcomas, such as but not limited to osteosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, leiomyosarcoma, synovial sarcoma, Ewings sarcoma, Kaposi's sarcoma and Llymphosarcoma (lymphoma), to name a few.
- leukemias and sarcomas such as but not limited to osteosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, leiomyosarcoma, synovial sarcoma, Ewings sarcoma, Kaposi's sarcoma and Llymphosarcoma (lymphoma), to name a few.
- epithelial to mesenchymal transition EMT
- epithelial to mesenchymal transition EMT
- CTCs that are isolated and cultured according to the present methods of the invention are epithelioid.
- the CTCs that are isolated and cultured according to the present methods of the invention are not epithelioid.
- the CTCs that are isolated and cultured according to the present methods of the invention are mesenchymal.
- the cells can be from any animal, including but not limited to any mammal, such as mouse, rat, canine, feline, bovine, equine, porcine, non-human and human primates.
- Mammalian cells particularly suitable for cultivation in the present media include tumor cells of human origin, which may be primary cells derived from a tumors from tissues such as but not limited to mammary glands, prostate glands, liver, pancreas, kidney, bronchi and trachea.
- CTC circulating tumor cell
- body fluids such as but not limited to, blood, serum, plasma, urine, feces, lymph, placental fluid, saliva, bile, nipple exudates, pleural effusions, buccal and bronchial washes.
- the term “circulation” or “circulating” is not necessarily limited herein to the blood or lymphatic system of a living organism and is used herein to mean, in general, a body fluid.
- the CTCs are originally isolated from blood, serum, plasma or lymph.
- the CTCs are not isolated from blood, serum, plasma or lymph.
- the CTCs are originally isolated from urine.
- the CTCs are not isolated from urine.
- the CTCs are originally isolated from pleural effusions.
- the CTCs are not originally isolated from pleural effusions.
- a CTC need not be from a tumor, per se.
- tumor cell or “tumor” when used in connection with the phrase “circulating tumor cell” is not limited to clinically defined or diagnosed tumor-derived cells.
- the CTCs can be derived or originate from abnormal tissue or body fluids such as but not limited to neoplasias, hyperplasias, malignant tumors, benign tumors or "liquid tumors, such as but not limited to leukemia, lymphoma and myeloma.
- the cells are not primary cells, such as cells from an established cell line, transformed cells, thawed cells from a previously frozen collection and the like.
- primary cells are cells that have been taken directly from living tissue, such as a biopsy or isolated from circulation, and have not been passaged or only passaged one time. Thus, primary cells have been freshly isolated and plated. Provided the cells have been passaged one time or less, primary cells may or may not be frozen and then thawed at a later time. In addition, the body fluid samples from which the primary cells are isolated may or may not have been frozen or preserved in some other manner immediately prior to processing.
- the CTCs for use the present invention are not undifferentiated, embryonic stem cells.
- the phrase circulating tumor cell as used herein automatically excludes undifferentiated embryonic stem cells.
- embryonic stem cells are undifferentiated cells that have the capacity to regenerate or self-renew indefinitely.
- the CTCs used in the methods herein may or may not be adult stem cells.
- adult stem cells are isolated from tissues of an animal and are less differentiated than completely differentiated cells, but are more differentiated than embryonic stem cells.
- the CTCs isolated and cultured according to the methods of the present invention are not adult stem cells.
- the CTCs used in the present invention would not normally have the capacity for indefinite self-renewal. Moreover, the CTCs are, in general, not completely undifferentiated cells upon initial isolation and plating in that the cells may possess cell surface markers not typically associated with undifferentiated stem cells, or conversely the CTCs may not possess cell surface markers typically associated with undifferentiated stem cells.
- the body fluid such as but not limited to blood or plasma
- a single cell isolated from the circulation of a subject is sufficient material to begin the cell culture methods of the present invention.
- cells such as tumor cells may be isolated from the circulation of the organism using currently availa ble techniques for isolating cells that express cell markers that are specific for a specific type of tumor cell. See Lu. J., et al., Int'l. J. Cancer, 126(3):669-683 (2010) and Yu, M., et al., J. Cell Biol., 192(3): 373-382 (2011), which are incorporated by reference.
- Cells may or may not be counted using an electronic cell counter, such as a Coulter Counter, or they can be counted manually using a hemocytometer. Of course, the cells need not be counted at all.
- the CTCs are isolated from the circulation according to well-known methods in the art. For example, Lin, H., et al., Clin. Cancer Res., 16(20):5011-5018 (2010) and U.S. Pre- Grant Publication No. 2011/0294206, which are incorporated by reference, disclose methods of isolating CTCs from blood using a paylene filter.
- the CTCs are isolated from the circulation using a parylene-based filter system. The invention, however, is not limited by the procedures used to isolate the CTCs from the circulation.
- cells are no longer considered to be primary cells after the cells have been passaged more than once.
- cells passaged once or more are no longer considered to be primary cells after the cells have been passaged more than once.
- the CTCs are initially primary cells and, through the use of the methods of the present invention, become non-primary cells after passaging.
- parylene is a polymer having the formula I, II or III, or combinations thereof.
- the polymer can be a homopolymer, a copolymer, a polymer blend or combinations thereof.
- 1 , R 2 , R 7 and R 8 are each independently H, alkyl, heteroalkyl, aryl or halogen.
- the alkyl can be a Ci-C 6 hydrocarbon radical.
- the halogen is CI, F, Br, or I.
- Heteroalkyl is an alkyl substituent containing at least one heteroatom, such as O, S, N, Si or P.
- R 3 -R 6 are each independently H, alkyl, aryl, halogen, heteroalkyi, hydroxyl, amino, alkylamino, arylamino, aroylamino, carbamoylamino, aryloxy, acyl, thio, alkylthio, cyano, alkoxy.
- An alkyl group can be a substituted alkyl having up to 29 carbon atoms.
- a substituted alkyl can be mono- or polyunsaturated alkenyl or alkynyl radical having in each case up to 29 carbon atoms, i.e., a substituted C r C 2 9 alkyl, C 2 -C 29 alkenyl or C 2 -C 2 9 alkynyl radical.
- Suitable substitutents are also cyclic radicals.
- the substituted alkyls can be methyl, ethyl, or propyl radical, carrying one or more identical or different radicals. Depending on the nature of the substitutents, these can be attached via a single or multiple bond or in a Spiro form.
- substituents are halogen, such as CI, F, Br or I, amino, lower alkylamino, lower alkanoylamino, aroylamino, such as, in particular, benzoyl amino, hydroxyamino, hydroxyimino, lower alkoxyamino, aroxyamino, such as, in particular, phenoxyamino.
- Lower alkylthio includes Ci-C 6 alkylthiols.
- Aryloxycarbonyl includes phenoxycarbonyl, benzyloxycarbonyl, hydroxyaminocarbonyl, aminoacylamino, carbamoyl, amidino.
- Aryoxy can be phenyloxy, aminocarbonyl-oxy, oxo, aminosulfonyl and lower alkylsulfonyl-amino.
- Heteroalkyl is an alkyl substituent having one or more heteroatoms in the alkyl substitute nts, in particular, mercaptoalkyl having up to 29 carbon atoms, aminoalkyl, phosphinoalkyl, haloalkyl, hydroxyalkyl or silylalkyl.
- parylene has a structure represented by the formula I. In other embodiments, parylene also includes commercially available parylene, C, F, A, AM, N, and D.
- the parylene used in the methods of the present invention is parylene-C, parylene-HT or both, as shown below
- cell culture or “culture” is meant the maintenance of cells in an artificial, in vitro environment.
- cell culture also encompasses cultivating individual cells and tissues.
- the cells being cultured according to the present invention can be cultured and plated according to the experimental conditions as needed by the technician.
- the examples herein demonstrate at least one functional set of culture conditions that can be used in conjunction with the methods described herein. If not known, plating and culture conditions for a given animal cell type can be determined by one of ordinary skill in the art using only routine experimentation.
- Cells may or may not be plated onto the parylene surface of culture vessels using attachment factors. If attachment factors are used, the culture vessels can be precoated with other natural, recombinant or synthetic attachment factor or factors or peptide fragments thereof, such as but not limited to collagen, fibronectin and natural or synthetic fragments thereof.
- the cell seeding densities for each experimental condition can be manipulated for the specific culture conditions needed. For routine culture in plastic culture vessels, an initial seeding density of from about lxlO 4 to about 1-lOxlO 5 cells per cm 2 is fairly typical, e.g., 1 x 10 s cells are often cultured in a 75cm 2 culture flask. Using the methods of the present invention, however, even a single cell can be plated initially. Thus, the methods of the present invention can be performed using 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more cells for an initial cell seeding. Of course, higher cell seeding numbers can be used, such as but not limited to lxlO 3 , 1X10 4 , 1X10 5 and so on. Cell density can be altered as needed at any passage.
- Mammalian cells are typically cultivated in a cell incubator at about 37°C at normal atmospheric pressure.
- the incubator atmosphere is normally humidified and often contain about from about 3-10% carbon dioxide in air. Temperature, pressure and C0 2 concentration can be altered as necessary, provided the cells are still viable.
- Culture medium pH can be in the range of about 7.1 to about 7.6, in particular from about 7.1 to about 7.4, and even more particular from about 7.1 to about 7.3. It may be necessary in some cases, like colon cancer cells, to use incubators with low oxygen (2%) rather than the normal 20%.
- the incubator atmosphere may thus be from about 0.5% to about 30% oxygen.
- Cell culture medium is normally replaced every 1-2 days or more or less frequently as required by the specific cell type. As the CTCs approach confluence in the culture vessel, they are normally passaged. As used herein a cell passage is used as it is in the art and means splitting or dividing the cells and transferring a portion of the cells into a new culture vessel or culture environment. Most likely, the CTCs used in the methods of the present invention will be adherent to the parylene cell culture surface and will need to be detached. Methods of detaching adherent cells from the surface of parylene culture vessels are well-known and commonly employed and can include the use of enzymes such as trypsin. The ROCK inhibitor may or may nor be included when the cells are being detached from their surface during passage.
- a single passage refers to when a technician splits or manually divides the cells one time and transfers a smaller number of cells into a new vessel or environment.
- the cells can be split into any ratio that allows the cells to attach and grow.
- the cells can be split in a 1:2 ratio, 1:3, 1:4, 1:5 etc.
- Passaging cells therefore, is not equivalent to population doubling.
- a population doubling is when the cells divide in culture one time such that the number of cells in culture is approximately doubled. Cells need to be counted to determine if a population of cells has doubled, tripled or multiplied by some other factor. In other words, passaging the cells and splitting them in a 1:3 ratio for further culturing in vitro is not to be taken as the equivalent that the cell population has tripled.
- the CTCs are continuously cultured in vitro.
- continuous culturing is the notion that the cells continually divide and reach or approach confluence in the cell culture vessel such that the cells require passaging and fresh medium to maintain their health.
- the concept of "continuously culturing” is similar to the concept that the CTCs would be immortalized.
- the CTCs can continue to grow and divide for at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250 or 300 passages or more.
- the present invention is also directed towards methods of stimulating growth of CTCs in vitro, with the methods comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the NKE cells or both. Culturing the CTCs in such conditions will stimulate the CTCs to grow or proliferate, whereas otherwise the cells may not grow. In one specific embodiment, the cells grow in tight clusters, i.e., the cells become tightly adherent. In one embodiment, the cultured CTCs form junctions involving e- cadherin, non-muscle myosin, and pl20 catenin. These types of junctions can be assayed according to Li, D. et al., J. Cell Biol., 191(3):631-644 (2010), which is incorporated by reference.
- cell growth refers to cell division, such that one "mother cell” divides into two "daughter cells.” As used herein, “cell growth” does not refer to an increase in the actual size of the cells. Stimulation of cell growth can be assayed by plotting cell populations over time. A cell population with a steeper growth curve can be said to be growing faster than a cell population with a curve not as steep. Growth curves can be compared for various treatments between the same cell types, or growth curves can be compared for different cell types with the same conditions.
- Late passage CTCs of the present invention may or may not be characterized by their telomere length.
- the length of the telomeres generally shortens as cells divide.
- a cell will normally stop dividing when the average length of telomeres is reduced to a critical length, e.g., 4kb.
- the average telomere length of late passage cells may be reduced to a length of as little as 2kb and continue to grow. The average telomere length is readily determined using routine methods and techniques in the art.
- the present invention provides CTCs capable of dividing in the culture conditions of the present invention, wherein the average telomere length of the CTCs is shorter than the average telomere length of CTCs that would normally not divide when placed under different or heretofore routine culture conditions.
- the methods of the present invention are capable of generating conditionally immortalized CTCs, whereby the cells have an average telomere length that is less than the average telomere length of CTCs that are normally capable of dividing and whereby the conditionally immortalized CTCs are capable of still dividing in spite of their reduced telomere length.
- CTCs will normally stop dividing when the average telomere length is reduced to a certain length even when placed in culture conditions currently considered in the art to be acceptable or even optimal for culturing such cells.
- the average telomere length can vary from cell type to cell type.
- Such currently acceptable or optimal conditions for culturing cells generally include culturing cells in well-defined, or synthetic, serum-free medium.
- culturing prostate tumor cells normally involves culturing in prostate cell-specific medium, without added serum.
- prostate tumor cells are generally cultured in the absence of feeder cells.
- “currently acceptable” or “currently optimal” culture conditions are culture conditions where the medium does not include serum or a serum replacement and the conditions do not include the use of feeder cells.
- “Currently acceptable” or “currently optimal” culture conditions may also include the use of synthetic or well-defined medium, for example the use of prostate-specific cell medium for prostate tumor cells.
- conditionally immortalized indicates that the CTCs have a reduced average telomere length over the average telomere length of "normal” senescent CTCs yet are still capable of unlimited growth, provided the conditionally immortalized CTCs are maintained in the culture conditions of the present invention.
- the invention provides methods of conditionally immortalizing CTCs comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ho kinase (ROCK) in the feeder cells, the CTCs or both during culturing.
- the conditionally immortalized cells generated by the methods described herein retain the phenotype of the originally isolated CTCs.
- the CTCs can grow, become in need of continuous culturing and/or become conditionally immortalized in vitro without apparent change to the karyotype of the cells after any number of passages.
- the methods of the present invention comprise continuously culturing CTCs, whereby the cells' karyotype at any passage is not altered or is not substantially altered when compared to the karyotype of the same types of primary cells or early passage cells.
- An alteration of a cell's karyotype includes but is not limited to duplication or deletion of chromosomes or portions thereof and/or translocation of a portion of one chromosome to another. Identifying a karyotype and alterations thereof are common techniques in the art.
- one embodiment of the present invention is directed to late passage CTCs, wherein the late passage CTCs have (a) an unaltered karyotype when compared to the karyotype of the primary CTCs or (b) an unaltered karyotype when compared to the karyotype of initially thawed CTCs.
- a late passage CTC is defined as a CTC that has gone through at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250 or 300 passages or more.
- the present invention is also directed to conditionally immortalized CTCs. In select
- conditionally immortalized CTCs have (a) an unaltered karyotype when compared to the karyotype of primary (originally isolated) CTCs or (b) an unaltered karyotype when compared to the karyotype of initially thawed CTCs.
- the methods of the present invention comprise the use of feeder cells.
- feeder cells are cells that are cultured with the CTCs of the present invention.
- culturing with CTCs or “culturing with circulating tumor cells” means that the feeder cells are cultured sharing the same medium and sharing the same vessel with the CTCs.
- the feeder cells need not be in direct contact with the CTCs and, for example, can be physically separated from the CTCs, e.g., by a porous filter, although both sets of cells are in the same vessel sharing the same medium.
- the feeder cells are non-proliferating feeder cells.
- the feeder cells can be treated to inhibit proliferation of the feeders, while still keeping them alive and metabolically active.
- feeder cells can be irradiated with gamma irradiation and/or treated with mitomycin C, which will arrest cell division but maintain the cells in a metabolically active state. Methods of treating cells to arrest cell division but maintain a metabolically active state are well-known in the art.
- the feeder cells have not been treated to inhibit proliferation.
- feeder cells, placed on a porous filter that prevents physical contact with the CTCs can be cultured with the CTCs without the need to treat the feeder cells to inhibit their proliferation
- Feeder cells can be from any mammal and the animal source of the feeder cells need not be the same animal source as the CTCs being cultured.
- feeder cells may be, but are not limited to mouse, rat, canine, feline, bovine, equine, porcine, non-human and human primate feeder cells.
- the types of feeder cells used are typically spleenocytes, macrophages thymocytes and/or fibroblasts. In one embodiment, the spleenocytes, macrophages thymocytes and/or fibroblasts have been treated such that they are non-proliferating.
- a feeder cell that may be used in the methods of the present invention is a population of J2 cells.
- the J2 cells are a subclone of mouse fibroblasts derived from the esta blished Swiss 3T3 cell line. In one embodiment, the J2 cells are gamma irradiated. In another embodiment, the J2 cells are treated with mitomycin C.
- medium conditioned with feeder cells is used in place of culturing feeder cells with the CTCs.
- Preparing conditioned medium is routine in the art. Generally, preparation of conditioned medium involves culturing cells in a medium, e.g., F-medium as defined herein, for a few days and collecting this medium. The conditioned medium is often, but need not be, combined with fresh medium in a diluted fashion. Discovering the optimal dilution ratios of conditioned medium to "fresh medium” is routine, but the ratios can be from about 1:99 to about 99:1 of "conditioned medium” to "fresh medium.” As used herein, "conditioned medium” is any medium where all or a percentage of the medium has been previously used in culture.
- feeder cell extract can be added to the medium in place of feeder cells themselves.
- Methods of preparing feeder cell extract are common and are described in Graham, J. and Sandall J., Biochem. J., 182:157-164 (1979), Graham, J., Biochem. J., 130:1113-1124 (1972) and Dickson, ., et al., Proc. Nat'l Acad. Sci., U.S.A., 80:5335-5339 (1983) all of which are incorporated by reference herein.
- Discovering the optimal dilution feeder cell extract to medium is routine, but the ratios can be from about 1:99 to about 99:1 of extract to medium.
- the cell culture media of the present invention can be any aqueous-based medium and can include any "classic” media such as, but not limited to DMEM (Dulbecco's Modified Essential Medium), Ham's F12 medium, Ham's F-10 medium, PMI 1640, Eagle's Basal Medium (EBM), Eagle's Minimum Essential Medium (MEM), HEPES, Medium 199 and the like.
- DMEM Dulbecco's Modified Essential Medium
- Ham's F12 medium Ham's F-10 medium
- PMI 1640 Eagle's Basal Medium
- MEM Eagle's Minimum Essential Medium
- HEPES Medium 199 and the like.
- the culture medium can also be combinations of any of the classical medium, such as but not limited to, a combination of DMEM and F12 Media.
- Additional ingredients may be added to the culture medium used in the methods of the present invention.
- additional ingredients include but are not limited to, amino acids, vitamins, inorganic salts, adenine, ethanolamine, D-glucose, heparin, N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES), hydrocortisone, insulin, lipoic acid, phenol red, phosphoethanolamine, putrescine, sodium pyruvate, triiodothyronine (T3), thymidine and transferrin.
- insulin and transferrin may be replaced by ferric citrate or ferrous sulfate chelates.
- Amino acid ingredients which may be included in the media of the present invention include but are not limited to, L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L- glutamine, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine and L-valine.
- Vitamin that may be added include but are not limited to biotin, choline chloride, D-Ca +2 - pantothenate, folic acid, i-inositol, niacinamide, pyridoxine, riboflavin, thiamine and vitamin B12.
- Inorganic salt ingredients which may be added include but are not limited to calcium salt (e.g., CaCI 2 ), CuS0 4 , FeS0 4 , KCI, a magnesium salt, e.g., MgCI 2 , a manganese salt, e.g., MnCI 2 , sodium acetate, NaCI, NaHC0 3 , Na 2 HP0 4 , Na 2 S0 4 and ions of the trace elements selenium, silicon, molybdenum, vanadium, nickel, tin and zinc.
- trace elements may be provided in a variety of forms, preferably in the form of salts such as Na 2 Se0 3 , Na 2 Si0 3 , (NH 4 )6Mo 7 0 24 , NH V0 3 , NiS0 4 , SnCI and ZnSO.
- salts such as Na 2 Se0 3 , Na 2 Si0 3 , (NH 4 )6Mo 7 0 24 , NH V0 3 , NiS0 4 , SnCI and ZnSO.
- Additional ingredients include but are not limited to heparin, epidermal growth factor (EGF), at least one agent increasing intracellular cyclic adenosine monophosphate (cAMP) levels, and at least one fibroblast growth factor (FGF).
- EGF epidermal growth factor
- cAMP cyclic adenosine monophosphate
- FGF fibroblast growth factor
- Heparin, EGF, the cAMP-increasing agent(s) and FGF(s) may be added to the basal medium or they may be admixed in a solution of, for example, Dulbecco's Phosphate Buffered Saline (DPBS) and stored frozen until being added to basal medium to formulate the medium to be used in the methods of the present invention.
- DPBS Dulbecco's Phosphate Buffered Saline
- Heparin may be obtained commercially. Heparin is added to the present media primarily to sta bilize the activity of the growth factor components, for example FGF. If heparin is used, it may be added to the basal maxim m at a concentration of a bout 1-500 U.S. P. units/liter. EGF is availa ble commercially. If EGF is used, it may be added to the basal medium at a concentration of a bout 0.00001- 10 mg/L.
- FGF growth factor components
- agents that increase intracellular cAM P levels may be used in formulating the media of the present invention. Included are agents which induce a direct increase in intracellular cAM P levels (e.g., dibutyryl cAM P), agents which cause an increase in intracellular cAM P levels by an interaction with a cellular G-protein (e.g., cholera toxin and forskolin), agents which cause an increase in intracellular cAM P levels by acting as agonists of ⁇ -adrenergic receptors (e.g., isoproterenol) and agents which cause an increase in intracellular cAM P levels by inhibiting the activities of cAM P phosphodiesterases (e.g., isobutylmethylxanthine (I BMX) and theophylline). These cAM P-increasing agents are availa ble commercially.
- agents which induce a direct increase in intracellular cAM P levels e.g., dibutyryl cAM P
- the culture medium used in the methods of the present invention comprises a calcium source.
- the calcium source is serum or a serum replacement.
- the calcium source is a calcium-containing salt that is added to the medium. If serum is used as a calcium source, the serum can be in a concentration (v/v) of from a bout 1% to a bout 35%. In select
- the serum is at a concentration of from a bout 1% to a bout 20%, or from a bout 1% to a bout 15%, or from a bout 1% to a bout 10%, or from a bout 1% to a bout 5%.
- a serum su bstitute or serum replacement is used as the calcium source, these can be added to the maxim m according to the manufacturer's suggested protocol.
- serum su bstitutes include but are not limited to commercially availa ble su bstitutes such as UltroserTM from Pall Corporation, milk or milk fractions such as but not limited to nonfat d ry milk filtrate.
- the range of Ca +2 concentration used in the em bodiments of the present invention can vary according to cell type.
- the concentration of Ca +2 in the anterior m used in the methods of the present invention is from 0.1 mM to 10.0 m M.
- the concentration of Ca +2 in the medium used in the methods of the present invention can be from a bout 0.2 m M to a bout 8 mM, from a bout 0.4 m M to a bout 7 mM, from a bout 0.5 mM to a bout 5 m M, from a bout 0.8 m M to a bout 4 mM, from a bout 1.0 m M to a bout 3 m M, from a bout 1.2 m M to a bout 2.8 mM, from a bout 1.4 m M to a bout 2.6 m M and from a bout 1.5 m M to a bout 2.5 mM.
- Rho kinase belongs to the Rho GTPase family of proteins, which includes the Rho, Racl and Cdc42 kinases.
- Rho GTPase family of proteins which includes the Rho, Racl and Cdc42 kinases.
- One of the best-characterized effector molecule of Rho is ROCK, which is a serine/threonine kinase that binds to the GTP-bound form of Rho.
- the catalytic kinase domain of ROCK which comprises conserved motifs characteristic of serine/threonine kinases, is found at the N-terminus.
- ROCK proteins also have a central coiled-coil domain, which includes a Rho-binding domain (RBD).
- the C- terminus is made up of a pleckstrin-homology (PH) domain with an internal cysteine -rich domain.
- the coiled-coil domain is thought to interact with other a- helical proteins.
- the RBD located within the coiled-coil domain, interacts only with activated Rho GTPases, including RhoA, RhoB, and RhoC.
- the pH domain is thought to interact with lipid mediators such as arachidonic acid and sphingosylphosphorylcholine, and may play a role in protein localization. Interaction of the pH domain and RBD with the kinase domain results in an auto- inhibitory loop.
- the kinase domain is involved in binding to RhoE, which is a negative regulator of ROCK activity.
- ROCKl also known as ROKfi or pl60ROCK
- ROCK2 a lso known as ROKa
- ROCKl is a bout 1354 amino acids in length
- nd ROCK2 is a bout 1388 amino acids in length.
- the amino acid sequences of human ROCKl and human ROCK2 are well known.
- the amino acid sequence of ROCK 1 and ROCK2 can be found at UniProt Knowledgebase (UniProtKB) Accession Nu mber Q13464 and 075116, respectively.
- nucleotide sequences of human ROCKl and ROCK2 can be found at GenBank Accession Nu mber N M_005406.2 and N M_004850, respectively.
- nucleotide and amino acid sequences of ROCKl and ROCK2 proteins from a variety of animals are also well-known and can be found in both the UniProt and GenBank data bases.
- ROCK isoforms are u biquitously expressed in tissues, they exhibit differing intensities in some tissues.
- ROCK2 is more prevalent in brain and skeletal muscle
- ROCKl is more a bundant in liver, testes and kidney.
- Both isoforms are expressed in vascular smooth muscle and heart.
- both ROCKl and ROCK2 are primarily cytosolic, but a re translocated to the membrane upon Rho activation.
- ROCK activity is regulated by several different mechanisms, thus Rho-dependent ROCK activation is highly cell-type dependent, ranging from changes in contractility, cell permea bility, migration and proliferation to apoptosis. At least 20 ROCK su bstrates have been identified.
- ROCK has been associated with mediating cell-survival signals in vitro and in vivo.
- a ROCK-mediated pro-survival effect has been reported in epithelial cells, cancer cells and endothelial cells, as well as in other cell types.
- inhibition with Y-27632 or HA 1077 also known as fasudil induces membrane ruffling, loss of actin stress fibers and apoptosis (Moore et al., Am. J. Respir. Cell Mol. Biol. 30:379-387, 2004).
- Rho/ROCK activation may also play a pro-survival role during oxidative stress-induced intestinal epithelial cell injury (Song et al., Am. J. Physiol. Cell Physiol. 290:C1469-1476, 2006).
- ROCK has also been associated with pro-survival events in thyroid cancer cells (Zhong et al., Endocrinology 144:3852-3859, 2003), glioma cells (Rattan et al, J. Neurosci. Res. 83:243-255, 2006), human umbilical vein endothelial cells (Li et al., J. Biol. Chem.
- inhibiting ROCK can mean to reduce the activity, function or expression of at least one of ROCK1 or ROCK2.
- the activity, function or expression may be completely suppressed, i.e., no activity, function or expression, or the activity, function or expression may simply be lower in treated versus untreated cells.
- ROCK phosphorylates LIM kinase and myosin light chain (MLC) phosphatase after being activated through binding of GTP-bound Rho.
- MLC myosin light chain
- One embodiment of the present invention thus involves blocking the upstream pathway of ROCK1 and/or ROCK2, for example GTP- bound Rho, such that ROCK1 and/or ROCK2 is not activated or its activity is reduced over untreated cells.
- upstream effectors include but are not limited to, integrins, growth factor receptors, including but not limited to, TGF-beta and EGFR, cadherins, G protein coupled receptors and the like. Another embodiment of the present invention thus involves blocking the activity, function or expression of downstream effector molecules of activated ROCK1 and/or ROCK2 such that ROCK1 and/or ROCK2 can not propagate any signal or can only propagate a reduced signal over untreated cells.
- Downstream effectors include but are not limited to, Myosin phosphatase-targeting protein (MYPT), vimentin, LIMK, Myosin light chain kinase, NHE1, cofilin, Myosin II and the like.
- both C3 transferase, a ROCK upstream inhibitor that inhibits the activity of Rho, and blebbistatin, a ROCK downstream inhibitor that inhibits the activity of myosin II, when used in the culture conditions described herein in place of a ROCK inhibitor, affected the cells in such a manner as to allow the cells to bypass differentiation and allow proliferation in vitro.
- Upstream or downstream inhibition of ROCK, in place of direct ROCK inhibition and in conjunction with the other culture conditions described and required herein, may or may not generate conditionally immortalized CTCs.
- the methods of the present invention comprise inhibiting ROCK while culturing the CTCs.
- inhibiting ROCK is accomplished by addition of a ROCK inhibitor to the culture medium.
- a ROCK inhibitor is added to culture medium, it is possible that the ROCK inhibitor may also be having an effect on the feeder cells in addition to the CTCs.
- ROCK inhibitors include but are not limited to Y-27632, HA1100, HA1077,
- Rho kinase inhibitors include but are not limited to those described in PCT Publication Nos. WO
- RNAi RNA interference
- dsRNA double-stranded RNA
- one stand of the dsRNA corresponds to the coding strand of the mRNA that codes for ROCK1, and the other strand is complementary to the first strand.
- dsRNA double-stranded RNA
- the requirements of optimal RNAi species for a given nucleotide sequence are well-known or can be readily ascertained given the state of the art. For example, it is known that optimal dsRNA is about 20-25nt in length, with a 2 base overhand on the 3' end of each strand of the dsRNA, often referred to as short interfering RNAs (siRNA).
- shRNAs are one continuous RNA strand where a portion is self-complementary such that the molecule is double-stranded in at least one portion. It is believed that the cell processed shRNA into siRNA.
- RNAi molecule is any double stranded double-stranded RNA (dsRNA), where one stand of the dsRNA corresponds to the coding strand of the mRNA that codes for the target gene to be silenced, and the other strand is complementary to the first strand.
- one embodiment of the present invention involves the use of at least one RNAi molecule and/or at least one antisense molecule, to inhibit the activity of ROCK.
- the RNAi molecule and/or antisense molecule is specific towards ROCKl.
- the RNAi molecule or antisense molecule is specific towards ROCK2.
- the RNAi molecule and/or antisense molecule is specific towards both ROCKl and ROCK2.
- at least two RNAi molecules and/or antisense molecules are used, where one is specific towards ROCKl and the other is specific towards ROCK2.
- RNAi molecules and/or antisense molecules may be part of the cell culture by simply soaking the cells with the naked RNAi molecules and/or antisense molecules as has been reported Clemens, J.C., et al., PNAS, 97(12):6499-6503 (2000), which is incorporated by reference.
- the RNAi molecules and/or antisense molecules may also be part of a complex, such as a liposomal complex that can be used to insert RNAi molecules or antisense/molecules into the cells.
- Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged dsRNA molecules to form a stable complex. The positively charged dsRNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et at., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
- Liposomes that are pH-sensitive or negatively-charged entrap dsRNA rather than complex with it. Since both the dsRNA and the lipid are similarly charged, repulsion rather than complex formation occurs. The dsRNA is thus entrapped in the aqueous interior of these liposomes. pH-sensitive liposomes have been used, for example, to deliver dsRNA encoding the thymidine kinase gene to cell monolayers in culture (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).
- One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
- Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC).
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyi phosphatidylethanolamine (DOPE).
- DOPE dioleoyi phosphatidylethanolamine
- Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- PC phosphatidylcholine
- Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
- Liposomes that include nucleic acids have been described, for example, in WO 96/40062, U.S. Pat. No. 5,264,221, U.S. Pat. No. 5,665,710 and Love et al., WO 97/04787 all of which are incorporated by reference.
- Transfersomes are lipid droplets which are so highly deformable that they can penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, for example, they are shape adaptive, self-repairing, frequently reach their targets without fragmenting, and often self-loading. Transfersomes can be made, for example, by adding surface edge-activators, usually surfactants, to a standard liposomal composition.
- ROCK1 and/or ROCK2 RNAi can gain access to the cells in the methods of the present invention is through the use of DNA expression vectors that encode the RNAi molecules and/or antisense molecules.
- Certain embodiments can utilize only one vector, for example when the RNAi molecule is a shRNA, or when opposing promoters are placed on either side there of the coding sequence for the RNAi molecule.
- inhibiting the activity of ROCK includes the use of DNA that, when transcribed, can block the activity, function or production of ROCK.
- the liposomal delivery systems described above are one way in which the DNA encoding an RNAi and/or antisense can enter the cell.
- the DNA encoding an RNAi and/or antisense can be prepared in a viral vector system that has the capability of entering into cells.
- viral vector system that has the capability of entering into cells.
- ROCK 1 and/or 2 are inhibited using genetic manipulation techniques, such as, but not limited to, transgenic techniques involving either knockout or dominant negative constructs. Such constructs are disclosed in Khyrul, W., et al., J. Biol. Chem., 279(52):54131-54139 (2004), which is incorporated by reference herein.
- any upstream effectors that could be inhibited include but are not limited to, integrins, growth factor receptors, including but not limited to, TGF-beta and EGFR, cadherins, G protein coupled receptors and the like.
- any downstream effectors that could be inhibited include but are not limited to, vimentin, LIMK, Myosin light chain kinase, NHE1, cofilin and the like.
- the cells may be removed from these conditions and placed in a cell culture environment where the environment is absent feeder cells, absent a calcium source and/or absent a ROCK inhibitor. Any combination of one, two, three or four of the feeder cells, the calcium source, the parylene and the ROCK inhibitor may be absent in the subsequent environment.
- a "subsequent environment" when used in connection with a cell culture environment is a cell culture environment in which at least one of the feeder cells, the calcium source, the parylene and the ROCK inhibitor is absent.
- the ROCK inhibitor, the calcium source, the parylene or the feeder cells are absent in the subsequent environment.
- the feeder cells and ROCK inhibitor are absent from the subsequent environment.
- the feeder cells and calcium source are absent from the subsequent environment.
- the calcium source and ROCK inhibitor are absent from the subsequent environment.
- the feeder cells and parylene are absent from the subsequent environment.
- the parylene and calcium source are absent from the subsequent environment.
- the parylene and ROCK inhibitor are absent from the subsequent environment.
- the feeder cells, the parylene and the calcium source are absent from the subsequent environment.
- the parylene, the calcium source and the ROCK inhibitor are absent from the subsequent environment.
- the calcium source, the feeder cells and the ROCK inhibitor are absent from the subsequent environment.
- the parylene, the ROCK inhibitor and the feeder cells are absent from the subsequent environment.
- the feeder cells, ROCK inhibitor, the parylene and calcium source are absent from the subsequent environment.
- the subsequent environment to the CTCs, the late passage CTCs and/or the conditionally immortalized CTCs are in an environment that can promote differentiation and/or does not allow for indefinite proliferation of the CTCs, the late passage CTCs and/or the conditionally
- the subsequent environment may be an in vivo environment that is similar or identical to the organ from which the cells were originally derived, i.e., an heterologous implant.
- an heterologous implant For example, circulating liver cells that have been isolated, cultured and grown up according to the methods of the present invention can be introduced into a test animal, such as but not limited to a SCID or nude mouse.
- the heterologous implants may or may not include additional components such as, but not limited to Matrigel ® .
- the subsequent environment may be an in vitro environment that is that more closely resembles the biochemical or physiological properties of the organ from which the cells were originally derived once placed in this subsequent environment.
- the subsequent environment may also be a "synthetic environment" such that factors known to promote differentiation in vitro are added to the cell culture.
- CTCs, the late passage CTCs and or the conditionally immortalized CTCs are placed into a subsequent environment that is specific to stimulate differentiation of cells into the cells of the organ from which the cells were originally derived.
- conditionally immortalized prostate tumor cells can be removed from the conditions of the present invention and placed into culture conditions designed to promote differentiation of prostate cells.
- Various environments for culturing epithelial cells are detailed in Culture of Epithelial Cells (Ian Freshney and Mary G. Freshney, Eds. Wiley-Liss, Inc.) (2 nd Ed. 2002), which is incorporated by reference.
- the cells can be seeded in a subsequent environment into or onto a natural or synthetic three-dimensional cell culture surfaces.
- a three-dimensional surface is a Matrigel e -coated culture surface.
- Other three dimensional culture environments include but are not limited to surfaces comprising collagen gel and/or a synthetic biopolymeric material in any configuration, such as but not limited to a hydrogel.
- a variety of three-dimensional culture surfaces may be used simultaneously with the methods the present invention. If a three-dimensional culture environment is used, the feeder cells may or may not be used as well.
- CTCs, the late passage CTCs and or the conditionally immortalized CTCs can be genetically modified to express a protein of interest.
- the genetic modification of the cells would not be a modification designed to immortalize the cells, such as the insertion of a viral protein. Rather, the genetic modification of the cells would be designed to, for example, insert a transgene that codes for a protein or mutant protein.
- liver tumor cells can be isolated and expanded using the cell culture methods of the present invention. These cells can su bsequently be manipulated and a transgene coding for Factor VIII or mutant Factor VIII can be inserted in the genome of the cells, such that the cells can produce Factor VIII or mutant Factor VIII.
- These cells can then be placed in a subsequent environment, such as a heterologous implant, such that the cells will produce Factor VIII or mutant Factor VIII.
- transgenes are introduced into the cells
- standard methods known from the literature for in vitro transfer of DNA into mammalian cells such as the use of viral vector carrying transgenes of interest, electroporation; calcium phosphate precipitation or methods based on receptor-mediated endocytosis, disclosed in WO 93/07283, which is incorporated by reference.
- Other methods and materials for inserting a gene of interest into cells are disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory Press, Third Edition (2001), which is incorporated by reference.
- genes of interest can be expressed in the CTCs, the late passage CTCs and or the conditionally immortalized CTCs. These genes of interest include, but are not limited to, sequences encoding toxins, clotting factors, enzymes, prodrug converting enzymes, antigens which stimulate immune responses, tumor necrosis factors, cytokines, and various proteins with therapeutic applications (e.g., growth hormones and regulatory factors).
- vectors introducing nucleotide mutations or changes to coding sequences of endogenous or exogenous proteins can also be introduced into the CTCs.
- the late passage CTCs and/or the conditionally immortalized CTCs of the present invention After transfecting the CTCs, the late passage CTCs and/or the conditionally immortalized CTCs of the present invention, these cells that were successfully transfected can be selected for using a markers that are well known in the art.
- the genetically modified CTCs, the late passage CTCs and/or the conditionally immortalized CTCs of the present invention can be cultured using the cell culture techniques of the present invention to produce a population of genetically modified CTCs, late passage CTCs and/or conditionally immortalized CTCs. These cells can subsequently be collected and placed into a subsequent environment as described above, including but not limited to being placed back into a test subject.
- the present invention is also directed to methods of identifying candidate treatments for a subject in need of treatments for which the subject has a condition marked by the presence of CTCs.
- Such conditions marked by the presence of CTCs include but are not limited to neoplasias, hyperplasias or malignant tumors or benign tumors.
- the methods comprising obtaining a sample of the CTCs from the subject and culturing the CTCs according to any of the culture methods of the present invention to produce an in vitro population of CTCs.
- CTCs may be isolated from the organism's circulation, and the methods of the present invention may be utilized to obtain a sufficient number of cells for further analysis, such as but not limited to, phenotypically or genetically characterizing the cells.
- CTCs One method of isolating CTCs is disclosed herein, but the invention is not limited to any method by which CTCs are isolated.
- CTCs were isolated but could not be kept in culture for any significant time to permit study and analysis.
- the present invention solves this problem by allowing a minimal number of CTCs, even a single cell, to be isolated and plated.
- the plated CTC(s) are/is then subjected to the inventive methods of the present invention to establish and maintain enough cells to permit subsequent genetic, functional and/or phenotypic analysis. Indeed, once a sufficient number of CTCs are obtained, these cells can also be assayed to determine a response profile, which can be used to identify a candidate treatment for the subject.
- a response profile is a collection of one or more data points that would indicate, e.g., to a clinician, the likelihood that a particular treatment will produce a desired response in the subject if the treatment were performed on the subject from which the CTCs were isolated.
- response profile as used in connection with a response profile may or may not be either cell death by any means (necrosis, toxicity, apoptosis etc) or a reduction of the growth rate of abnormal cells.
- the response profile need not predict a response with 100% accuracy.
- a response profile can be a single data point or it can be a collection of data.
- any method can be used to identify or determine the response profile of a given population of CTCs.
- the response profile may be assessed by sequencing at least part of the DNA or RNA that is isolated from the CTCs. This may be particularly useful when it is suspected that a virus, e.g., human papilloma virus (HPV), human immunodeficiency virus (HIV) may be causing the abnormal condition. It is not necessary that all of the DNA/RNA be sequenced to provide at least one data point for the response profile.
- HPV human papilloma virus
- HAV human immunodeficiency virus
- PCR polymerase chain reaction
- sequencing may or may not result in generating the entire nucleotide sequence of the isolated DNA/RNA.
- Other methods can also be used to determine the sequence of the isolated DNA/RNA such as, but not limited to Southern blots, Northern blots, RT-PCR, automated sequencing and the like. Methods of sequencing DNA/RNA are well known in the art and need not be repeated herein.
- the response profile may be assessed by identifying the presence or absence of at least a portion of one mRNA that may be produced in the CTCs in vitro.
- the precise sequence of the mRNA need not be determined for the entire mRNA isolated from the cells. Methods that can also be used to determine the presence or absence of the sequence of the isolated mRNA include but are not limited to Northern blots, RT-PCR, automated sequencing and the like. Methods of identifying the presence or absence of the at least one mRNA are well known in the art and need not be repeated herein.
- the response profile may be assessed by identifying the presence or absence of at least a portion of one protein that may be produced in the CTCs in vitro.
- the precise amino acid sequence of the present or absent protein need not be determined for the entire protein.
- Methods that can also be used to determine the presence or absence of the sequence of the isolated protein include but are not limited to Western blots, immunohistochemical methods, ELISA methods, and the like. Methods of identifying the presence or absence of the at least one protein are well known in the art and need not be repeated herein.
- the presence or a bsence of a protein, e.g., a receptor, may indicate that the cells are susceptible to a particular treatment that may, for example, result in cell death.
- the response profile may be assessed by subjecting the CTCs in vitro to a chemotherapeutic agent or a radiation treatment, and determining the response of the cells to the chemotherapeutic agent or radiation treatment.
- a chemotherapeutic agent is not limited to traditional cancer treatments but is used to indicate a therapeutic treatment of any kind using a chemical entity.
- the response to the therapeutic agent or radiation treatment can be assessed by determining the therapeutic index of the agent or treatment on the cells.
- Determining the therapeutic index of a chemotherapeutic agent or radiation treatment is common in the art and is simply the ratio of the LD50/EC50, with the LD 50 representing the median lethal dose and the EC 50 representing the half maximal dose of the agent on the cells.
- Other methods to assess a response to the agent or treatment include but are not limited to determining dose response curves, cell survival curves and the like.
- the agent or treatment that is used to determine the response of the CTCs to the agent or treatment can be the same or a different agent or treatment that is later administered to the subject.
- the present invention is also directed to methods of identifying an abnormal cell or cells in a subject. These methods comprise isolating and culturing at least one CTC isolated from the subject according to the cell culture methods of the present invention. Once the CTCs, the late passage CTCs and or the conditionally immortalized CTCs have been expanded, a tissue origin profile can be determined for the cells to determine the likely tissue of origin of the isolated CTC. At least one feature of the CTCs, the late passage CTCs and or the conditionally immortalized CTCs can be compared to the same feature of normal cells that are obtained from the same tissue as that of the determined tissue origin profile of the candidate abnormal NKE cells.
- any difference between abnormal or diseased cells and normal cells can be used, including but not limited to, cell growth characteristics, for example, colony formation on a cell surface, Matrigel ® or other three-dimensional surface.
- Other means of determining differences between diseased and normal cells include, but are not limited to, assessing the proteomic profile of the cells, assessing the metabolomic profile of the cells, assessing the genomic profile, and/or using other biological assays that will highlight a difference between diseased or abnormal cells and normal cells.
- a detected difference in the candidate abnormal NKE cells and the normal NKE cells would indicate that the candidate a bnormal NKE cells are abnormal compared to normal NKE cells.
- the same methods that are used to assess a response profile can be used to assess a tissue origin profile.
- the candidate abnormal cells can be assayed for m NA transcript production, protein expression and tissue origin can also be assessed visually through histological evaluation.
- Methods of assessing a tissue origin profile also include immunohistochemical staining.
- the cells can be assayed for at least one feature of normal cells from the same tissue. For example, if a candidate abnormal cell has been identified as originating from mammary tissue, these cells can be assayed for the B CA1 and/or BRCA2 mutation, overexpression of the HER-2/neu growth factor receptor and the like.
- the cell can then be confirmed as being an abnormal mammary cell.
- the invention is not limited to the types of assays used to identify the tissue of origin; nor is the invention limited to the types of assays used to determine differences in normal and potentially abnormal cells.
- the cell culture methods of the present invention enable the identification of these cells by providing methods for expanding the isolated cells.
- the present invention is also directed to methods of monitoring the progression of a disease or treatment of a disease in a subject.
- the phrase "monitor the progression" is used to indicate that the a bnormal condition in the su bject is being periodically checked to determine if an abnormal condition is progressing (worsening), regressing (improving) or remaining static (no detectable change) in the individual by assaying CTCs and/or their cellular contents for various markers of progression or regression.
- the methods of monitoring may be used in conjunction with other monitoring methods or treatment regimens for an abnormal condition and to monitor the efficacy of these treatments.
- monitoring the progression is also intended to indicate assessing the efficacy of a treatment regimen by periodically assaying CTCs and/or their cellular contents for various markers of progression or regression and correlating any differences in the subject over time with the progression, regression or stasis of the abnormal condition.
- the methods of the present invention may be used to monitor a subject during or after mastectomy.
- the methods may be used to monitor patients that have had a successful mastectomy, such that the methods can be used to isolate CTCs to culture and generate enough CTCs in vitro to perform various analyses on the patient's CTCs to determine, if for example, a follow-up mammogram or body scan would be necessary.
- the methods of monitoring can also be used to determine a suitable follow up therapeutic regimen, after an initial treatment. For example, after an initial treatment CTCs can be isolated and the culture methods can be used to generate enough cells in vitro to determine if the genetic makeup or phenotype of the remaining CTCs or suspected abnormal circulating cells is sufficiently different enough to warrant a new therapy.
- the present invention provides methods of individualizing a therapeutic regimen. Monitoring may also include assessing the levels of a specific marker on CTCs at two time points from which a sample is taken, or it may include more time points, where any of the levels the marker at one particular time point from a given subject may be compared with the levels of biomarker in the same subject, respectively, at one or more other time points.
- the methods comprising obtaining a sample of the CTCs from the subject and culturing the CTCs according to any of the culture methods of the present invention to produce an in vitro population of CTCs.
- kits for culturing CTCs and/or generating conditionally immortalized CTCs can include culture vessels, culture media in wet or dry form and/or individual media components such as serum or some other calcium source.
- the kit may or may not include frozen feeder cells, other chemicals, such as trypsin, for passaging cells, etc.
- Example 1 Establishment of a Cell Line from Circulating Tumor Cells (CTCs)
- CPT tube BD Vacutainer ® CPTTM Cell Preparation Tubes with Sodium HeparinN.
- LnCAP prostate cancer cell line
- the sample was centrifuged at room temperature in a horizontal rotor centrifuge for a minimum of 15 minutes at 1500 to 1800 CF (Relative Centrifugal Force). After centrifugation, mononuclear cells and platelets were located in the whitish layer just under the plasma layer (see CPT tube). Approximately half of the plasma was aspirated, taking care not to disturb the cell layer.
- the cell layer was then collected with a Pasteur Pipette and transferred to a 15 mL size conical centrifuge "U" bottom tube with a cap.
- Human Lineage Cell Depletion Cocktail (Cat #: 51-9005225) was added to the tube, mixed and allowed to sit at room temperature for about 15 minutes. After sitting, about 12 ml lxPBS was added to the tube and the tube was spun at about 1000 RPM. The supernatant was aspirated.
- IMag Streptavidin Particles Plus-DM (Becton, Dickinson: Cat #: 51-9003746) were vortexed and the cell pellet was mixed thoroughly with 75 ⁇ of IMag particles. The mixture was allowed to incubate at room temperature for about 30 minutes.
- Example 2 Establishment of a Cell Line from Circulating Tumor Cells (CTCs)
- Human Lineage Cell Depletion Cocktail (Cat #: 51-9005225) is added to the tube, mixed and allowed to sit at room temperature for about 15 minutes. After sitting, about 12 ml lxPBS is added to the tube and the tube was spun at a bout 1000 RPM. The supernatant is aspirated. IMag Streptavidin Particles Plus-DM (Becton, Dickinson: Cat #: 51-9003746) are vortexed and the cell pellet is mixed thoroughly with 75 ⁇ of IMag particles. The mixture is allowed to incubate at room temperature for about 30 minutes. After incubation, 1 ml lxPBS is added to the tube and mixed, and the tube is placed on the BD IMagnet for 6 min.
- IMag Streptavidin Particles Plus-DM Becton, Dickinson: Cat #: 51-9003746
- the supernatant is transferred to a new tube.
- the remaining portion of the tube attached to the BD IMagnet is again mixed with 1 ml PBS.
- This second supernatant is transferred to another new tube.
- the two tubes are spun down the pellets are resuspended 3 ml of F medium (+Y-27632) and placed into a 6 well plate with feeder cells.
- Total cellular RNA is isolated with TRIzol reagent (Invitrogen) and treated with a DNA-/ree kit (Ambion) according to the manufacturer's instructions.
- First-strand cDNA is synthesized with some modifications using 2 ⁇ g of total cellular RNA following the instructions of Superscript First-Strand Synthesis System for RT-PCR (Invitrogen).
- Taqman real-time QRT-PCR is performed on the Bio-Rad iCycler MyiQ for quantitation of hTERT mRNA using primers and probes sense primer 5'- TGACACCTCACCTCACCCAC-3', antisense primer 5'-CACTGTCTTCCGCAAGTTCAC-3' and Taqman probe 5'- ACCCTGGTCCGAGGTGTCCCTGAG-3' as previously reported in Fu et al., Cancer Research 63, 7815-7824, (2003), which is incorporated by reference. Genomic DNA is extracted from cells using Qiagen DNeasy Blood & Tissue Kit (Cat# 69506).
- telomere length is assessed by a modified method of the real- time PCR-based telomere assay described previously in Cawthon R., Nucleic Acids Res. 37(3):e21 (2009) and Cawthon R., Nucleic Acids Res., 30(10):e47(2002), which are incorporated by reference.
- telomere repeat copy num ber to single gene copy num ber (T/S) ratio is determined using a Bio-Rad IQ5 thermocycler in a 96-well format. Five nanograms of genomic DNA is su bjected to PCR reactions with Rio-Rad SYBR Green Super mixture.
- the primers for telomere length and HBG1 can be: Tel-1 5' CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT-3, and Tel-2 5'- G G CTTG CCTTACCCTT ACCCTTACCCTTACCCTTACCCT-3 ' ; HBG1 5'- TGTGCTGGCCCATCACTTTG, and H BG2 5'- ACCAGCCACCACTTTCTGATAGG-3'.
- the reactions proceed for 1 cycle at 95°C for 5 min, followed by 41 cycles at 95°C for 15s, 60°C for 45s. All samples for both the telomere and globin reactions can be done in triplicate.
- each 96-well plate contain a six-point standard curve from 0, 0.2, 1, 5, 25, 125 ng using genomic DNA (telomere length 10.4 kb) from Roche Telo-kit.
- the T/S ratio (dCt) for each sample is calculated by normalizing the average HBG Ct value from the average telomere Ct value.
- Circulating tumor cells from a patient a re isolated.
- at least one cell line is generated from the isolated CTCs, which is then used to determine, for example, if a specific type of human pa pillomavirus (H PV) or some other virus or if a genetic mutation is the etiologic agent in the patient's tumor.
- H PV human pa pillomavirus
- DNA is extracted from the esta blished CTC line and specific primers and PCR are used to evaluate whether low risk HPVs (HPV-6, H PV-11) or high risk HPVs (H PV-16 or H PV-18) are present.
- testing the CTCs for a "genetic mutation” would also include determining the presence of, for example, a mutation in a tumor suppressor gene such as, but not limited to, p53, Rb, Pten, as well as chromosomal translocations such as, but not limited to, TM PRSS/ERG and a mutation in activating oncogenes such as, but not limited to, Ras or myc.
- a mutation in a tumor suppressor gene such as, but not limited to, p53, Rb, Pten
- chromosomal translocations such as, but not limited to, TM PRSS/ERG
- a mutation in activating oncogenes such as, but not limited to, Ras or myc.
- a portion of the H PV DNA, if detected, is sequenced to determine if both the early and late regions of the genome a re intact. This sequencing will provide a clear indication that one or both of the E6 and E7 early transforming genes are present as well as any LI late gene (a viral capsid protein). "Primer walking" can also be utilized to evaluate whether the entire LI gene is present. The presence or a bsence of the LI gene is useful to determine if an anti-Ll vaccine might be used in the management of this patient.
- the filter was immediately placed into a well of a 12 well plate containing irradiated J2 cells and F-media plus Y-27632. Twice a week, the filters were moved to new 12 well plates containing freshly irradiated J2 feeders. In addition, the media was changed to fresh F-media +Y-27632 every two or three days, as necessary.
- CTC immunostaining cells were grown on new parylene filters and were fixed with 1% formalin for five minutes, washed three times with PBS, and placed on glass slides. Tumor cells were identified and distinguished from leukocytes based on morphology and differential antigen expression. For example, the CTCs were epithelial in origin and were shown to express cytokeratin, whereas leukocytes are nonepithelial and are negative for cytokeratin. Immunofluorescence was done directly on the filter membranes for the expression of cytokeratins and the marker CD45. Filter membranes were place on top of microscope slides and blocked with 5% bovine serum albumin and 0.25% triton for 30 minutes.
- a pan-cytokeratin rabbit polyclonal antibody (Dako Z0622) diluted 1:300 was used to detect epithelial cells.
- a mouse anti-CD45 antibody (Dako I 751) was used to stain for leukocytes.
- the slides were incubated for 1 hour in the cocktail of primary antibodies diluted in CheMate antibody diluent (DakoCyotmation). Subsequently, the slides were washed and incubated for 1 hour with fluorescent, Alexa Fluor 488 or 564-conjugated secondary antibodies (Invitrogen) for identification of epithelial or lymphoid cells.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during culturing.
Description
IMMORTALIZATION OF CIRCULATING TUMOR CELLS AND METHODS
OF USE
Statement Regarding Federally Sponsored Research or Development
[0001] N/A
Background of the Invention
Field of the Invention
[0002] The present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium- containing medium while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during culturing. The present invention is also directed towards methods of using these immortalized CTCs.
Background of the Invention
[0003] Circulating tumors cells (CTCs) constitute a blood born route for tumor dissemination. These cells are believed to arise from the primary tumor and travel to other sites in the body, where they can become established as metastatic lesions. Similarly, metastatic tumors may continue to shed CTCs into the circulation, enabling other metastatic sites to form additional tumor sites.
[0004] CTCs are becoming an increasingly important diagnostic and prognostic tools, however the static nature of the current state of the art, i.e., the use of fixed cells and the previous inability to propagate the cells, limits their use. If CTCs can be isolated, propagated and even banked for later use, these cells could be invaluable as tools for understanding the genetic and molecular basis of tumor metastases at the level of individual patients, for patient-specific drug sensitivity testing, for understanding the molecular basis of tumor recurrence and for continuous refinement of personalized, precision cancer management and therapy.
[0005] To date, however, repeat passaging has failed. What is needed in the art are methods of culturing continuously culturing and propagating CTCs for extended periods of time, without having to genetically alter the cells. The present invention solves the problems associated with long-term culturing of CTCs for extended periods of time without the need for genetic manipulation.
Summary of the Invention
[0006] The present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium- containing medium while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during culturing.
[0007] The present invention is also directed towards methods of producing conditionally immortalized CTCs, with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both. Culturing the CTCs in such conditions will produce conditionally immortalized CTCs.
[0008] The present invention is also directed towards methods of producing at least partially differentiated CTCs comprising culturing for a set time CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both to produce conditionally immortalized CTCs. After culturing the conditionally immortalized CTCs in these conditions, the conditionally immortalized CTCs are placed in conditions that promote differentiation of the conditionally immortalized CTCs.
[0009] The present invention is also directed towards methods of stimulating growth of CTCs, with the methods comprising culturing CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the CTCs or both. Culturing the CTCs in such conditions will stimulate the CTCs to grow, whereas otherwise the cells may not grow.
Brief Description of the Drawings
[0010] FIGURE 1 depicts viable CTC capture and culture using the methods of the present invention. A: Representative IF image (at 60X magnification) of a fixed CK (cytokeratin) +/CD45- CTC at (red) and CK- /CD45+ lymphocyte (green) with DAPI staining for nuclear identification (blue) captured using the round pore microfilter device. B: cultured CTCs captured by the NextGen microfilter device are CK+/CD45-, demonstrating epithelial origin (at 10X magnification). C-F. The progression of CTC growth in CRC culture is demonstrated, where cells are attached and visible at 24hrs, CTC colony formation occurs at day 7, expansion of CTCs and migration onto other areas of the filter is observed at day 21, and there is near confluent growth of CTCs on the filter at day 28.
[0011] FIGURE 2 depicts via ble CTC capture and culture from a patient with prostate cancer. Left: cultured CTCs captured by the NextGen microfilter. Expansion of CTCs and migration onto other areas of the filter is observed at day 14 Right: Representative I F image of a fixed CK+/CD45- CTC used for enumeration of the CTCs in the patient blood, performed on day 1.
[0012] FIGURE 3 depicts via ble CTC capture and culture of a patient with prostate cancer. Left: cultured CTCs captured by the NextGen microfilter. Expansion of CTCs and migration onto other areas of the filter is observed at day 3 Right: Representative IF image of fixed CK+/CD45- DAPI stained day-3 cells, showing the epithelial lineage of the CTCs in culture. The arrow identifies an CTC undergoing mitosis
[0013] FIGU RE 4 depicts via ble CTCs isolated from the blood of a patient with colon (A) or breast (B) cancer. A: cultured colon CTCs captured by the NextGen microfilter device are on day 1. B:
Representative I F image of a fixed CK+/CD45- CTC. C: cultured breast CTCs captured on day 3.
Detailed Description of the Invention
[0014] The present invention is directed towards methods of culturing circulating tumor cells (CTCs), with the methods comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing mediu m while inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the non- keratinocyte epithelial cells or both during culturing.
[0015] Examples of CTCs include but are not limited to circulating prostate tumor cells, circulating mammary tumor cells, circulating prostate tumor cells, circulating liver tu mor cells, circulating pancreatic tumor cells, circulating lung tumor cells, circulating kidney tumor cells, circulating bladder tumor cells, circulating stomach epithelial tu mor cells, circulating colon tumor cells, circulating urethral tumor cells, circulating testicular tumor cells, circulating ovarian tumor cells, circulating cervical tumor cells, circulating thyroid tumor cells, circulating parathyroid tumor cells, circulating adrenal tumor cells, circulating thymus tumor cells, circu lating gall bladder tumor cells and circulating pituitary tumor cells to name a few. The invention is not limited to the tissue or organ source of the circulating tumor cells.
[0016] The cells need not be epithelial in origin but can be circulating tumor cells from a non-epithelial tumor. Examples of non-epithelial derived tumors include but are not limited to tumors arising from connective tissue, muscle tissue and nervous tissue. Specific examples of non-epithelial-derived tumors include but a re not limited to leukemias and sarcomas, such as but not limited to osteosarcoma,
liposarcoma, fibrosarcoma, rhabdomyosarcoma, leiomyosarcoma, synovial sarcoma, Ewings sarcoma, Kaposi's sarcoma and Llymphosarcoma (lymphoma), to name a few.
[0017] In fact, the ability or propensity of epithelial cells to alter their differentiation/lineage phenotype from epithelioid to mesenchymal, termed an epithelial to mesenchymal transition (EMT), and back again, may have an important role to play in cancer initiation, its progression and metastasis. See Polyak and Weinberg, Nature Rev., 9:265-273 (2009), which is incorporated by reference.
[0018] Recent evidence from extensive genetic and morphological analyses of CTCs from various organs have provided additional evidence that EMT is a common occurrence in CTCs (Yokobori, T., et al., Cancer Res., 73(7):2059-2069 (2013); Yu, M., et al., Science, 339:580-584 (2013), both of which are incorporated by reference), possibly negatively influencing some of the current antibody-based CTC analytic devices sensitivity for enumerating CTCs. Thus, the distinction between epithelial-derived and non-epithelial derived tumor cells for the purposes of the present invention is not necessarily relevant. In one embodiment, the CTCs that are isolated and cultured according to the present methods of the invention are epithelioid. In another embodiment, the CTCs that are isolated and cultured according to the present methods of the invention are not epithelioid. In a specific embodiment, the CTCs that are isolated and cultured according to the present methods of the invention are mesenchymal.
[0019] The cells can be from any animal, including but not limited to any mammal, such as mouse, rat, canine, feline, bovine, equine, porcine, non-human and human primates. Mammalian cells particularly suitable for cultivation in the present media include tumor cells of human origin, which may be primary cells derived from a tumors from tissues such as but not limited to mammary glands, prostate glands, liver, pancreas, kidney, bronchi and trachea.
[0020] As used herein, the phrase "circulating tumor cell" ("CTC") is used to mean a cell that originates from abnormal tissue, such as from a neoplasia, a hyperplasia or malignant tumor or benign tumor, but is not taken directly from the abnormal tissue. In general, the CTCs are isolated from body fluids, such as but not limited to, blood, serum, plasma, urine, feces, lymph, placental fluid, saliva, bile, nipple exudates, pleural effusions, buccal and bronchial washes. Accordingly, the term "circulation" or "circulating" is not necessarily limited herein to the blood or lymphatic system of a living organism and is used herein to mean, in general, a body fluid. In one embodiment, the CTCs are originally isolated from blood, serum, plasma or lymph. In another embodiment, the CTCs are not isolated from blood, serum, plasma or lymph. In another embodiment, the CTCs are originally isolated from urine. In another
embodiment, the CTCs are not isolated from urine. In another embodiment, the CTCs are originally isolated from pleural effusions. In another embodiment, the CTCs are not originally isolated from pleural effusions.
[0021] A CTC need not be from a tumor, per se. As used herein, the term "tumor cell" or "tumor" when used in connection with the phrase "circulating tumor cell" is not limited to clinically defined or diagnosed tumor-derived cells. The CTCs can be derived or originate from abnormal tissue or body fluids such as but not limited to neoplasias, hyperplasias, malignant tumors, benign tumors or "liquid tumors, such as but not limited to leukemia, lymphoma and myeloma. In another embodiment, the cells are not primary cells, such as cells from an established cell line, transformed cells, thawed cells from a previously frozen collection and the like.
[0022] As used herein, primary cells are cells that have been taken directly from living tissue, such as a biopsy or isolated from circulation, and have not been passaged or only passaged one time. Thus, primary cells have been freshly isolated and plated. Provided the cells have been passaged one time or less, primary cells may or may not be frozen and then thawed at a later time. In addition, the body fluid samples from which the primary cells are isolated may or may not have been frozen or preserved in some other manner immediately prior to processing.
[0023] The CTCs for use the present invention are not undifferentiated, embryonic stem cells. Thus, the phrase circulating tumor cell as used herein automatically excludes undifferentiated embryonic stem cells. As used herein and in the art, embryonic stem cells are undifferentiated cells that have the capacity to regenerate or self-renew indefinitely. The CTCs used in the methods herein may or may not be adult stem cells. As used herein, adult stem cells are isolated from tissues of an animal and are less differentiated than completely differentiated cells, but are more differentiated than embryonic stem cells. In another embodiment of the present invention the CTCs isolated and cultured according to the methods of the present invention are not adult stem cells. The CTCs used in the present invention would not normally have the capacity for indefinite self-renewal. Moreover, the CTCs are, in general, not completely undifferentiated cells upon initial isolation and plating in that the cells may possess cell surface markers not typically associated with undifferentiated stem cells, or conversely the CTCs may not possess cell surface markers typically associated with undifferentiated stem cells.
[0024] When isolating primary cells, the body fluid, such as but not limited to blood or plasma, should ideally be handled using standard sterile techniques and a laminar flow safety cabinet. In one
embodiment, a single cell isolated from the circulation of a subject is sufficient material to begin the cell culture methods of the present invention. For example, cells such as tumor cells may be isolated from the circulation of the organism using currently availa ble techniques for isolating cells that express cell markers that are specific for a specific type of tumor cell. See Lu. J., et al., Int'l. J. Cancer, 126(3):669-683 (2010) and Yu, M., et al., J. Cell Biol., 192(3): 373-382 (2011), which are incorporated by reference. Cells may or may not be counted using an electronic cell counter, such as a Coulter Counter, or they can be counted manually using a hemocytometer. Of course, the cells need not be counted at all.
[0025] In one embodiment, the CTCs are isolated from the circulation according to well-known methods in the art. For example, Lin, H., et al., Clin. Cancer Res., 16(20):5011-5018 (2010) and U.S. Pre- Grant Publication No. 2011/0294206, which are incorporated by reference, disclose methods of isolating CTCs from blood using a paylene filter. In one embodiment of the present invention, the CTCs are isolated from the circulation using a parylene-based filter system. The invention, however, is not limited by the procedures used to isolate the CTCs from the circulation.
[0026] For the purposes of the present invention cells are no longer considered to be primary cells after the cells have been passaged more than once. In addition, cells passaged once or more and
immediately frozen after passaging are also considered not to be primary cells when thawed. In select embodiments of the present invention, the CTCs are initially primary cells and, through the use of the methods of the present invention, become non-primary cells after passaging.
[0027] Once isolated, the CTCs are placed in cell culture vessels coated with parylene in the cell culture conditions described herein. As used herein, parylene is a polymer having the formula I, II or III, or combinations thereof. The polymer can be a homopolymer, a copolymer, a polymer blend or combinations thereof. 1, R2, R7 and R8 are each independently H, alkyl, heteroalkyl, aryl or halogen. The alkyl can be a Ci-C6 hydrocarbon radical. The halogen is CI, F, Br, or I. Heteroalkyl is an alkyl substituent containing at least one heteroatom, such as O, S, N, Si or P.
R3-R6 are each independently H, alkyl, aryl, halogen, heteroalkyi, hydroxyl, amino, alkylamino, arylamino, aroylamino, carbamoylamino, aryloxy, acyl, thio, alkylthio, cyano, alkoxy. An alkyl group can be a substituted alkyl having up to 29 carbon atoms. A substituted alkyl can be mono- or polyunsaturated alkenyl or alkynyl radical having in each case up to 29 carbon atoms, i.e., a substituted CrC29 alkyl, C2-C29 alkenyl or C2-C29 alkynyl radical. Suitable substitutents are also cyclic radicals. The substituted alkyls can be methyl, ethyl, or propyl radical, carrying one or more identical or different radicals. Depending on the nature of the substitutents, these can be attached via a single or multiple bond or in a Spiro form. In select embodiments, substituents are halogen, such as CI, F, Br or I, amino, lower alkylamino, lower alkanoylamino, aroylamino, such as, in particular, benzoyl amino, hydroxyamino, hydroxyimino, lower alkoxyamino, aroxyamino, such as, in particular, phenoxyamino. Lower alkylthio includes Ci-C6 alkylthiols. Aryloxycarbonyl includes phenoxycarbonyl, benzyloxycarbonyl, hydroxyaminocarbonyl,
aminoacylamino, carbamoyl, amidino. Aryoxy can be phenyloxy, aminocarbonyl-oxy, oxo, aminosulfonyl and lower alkylsulfonyl-amino. Heteroalkyl is an alkyl substituent having one or more heteroatoms in the alkyl substitute nts, in particular, mercaptoalkyl having up to 29 carbon atoms, aminoalkyl, phosphinoalkyl, haloalkyl, hydroxyalkyl or silylalkyl. In select embodiments, parylene has a structure represented by the formula I. In other embodiments, parylene also includes commercially available parylene, C, F, A, AM, N, and D.
[0028] In certain other embodiments, the parylene used in the methods of the present invention is parylene-C, parylene-HT or both, as shown below
parylene-HT
[0029] By "cell culture" or "culture" is meant the maintenance of cells in an artificial, in vitro environment. The term "cell culture" also encompasses cultivating individual cells and tissues.
[0030] The cells being cultured according to the present invention, whether primary or not, can be cultured and plated according to the experimental conditions as needed by the technician. The examples herein demonstrate at least one functional set of culture conditions that can be used in conjunction with the methods described herein. If not known, plating and culture conditions for a given animal cell type can be determined by one of ordinary skill in the art using only routine experimentation. Cells may or may not be plated onto the parylene surface of culture vessels using attachment factors. If attachment factors are used, the culture vessels can be precoated with other natural, recombinant or synthetic attachment factor or factors or peptide fragments thereof, such as but not limited to collagen, fibronectin and natural or synthetic fragments thereof.
[0031] The cell seeding densities for each experimental condition can be manipulated for the specific culture conditions needed. For routine culture in plastic culture vessels, an initial seeding density of from about lxlO4 to about 1-lOxlO5 cells per cm2 is fairly typical, e.g., 1 x 10s cells are often cultured in a 75cm2 culture flask. Using the methods of the present invention, however, even a single cell can be plated initially. Thus, the methods of the present invention can be performed using 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more cells for an initial cell seeding. Of course, higher cell seeding numbers can be used, such as but not limited to lxlO3, 1X104, 1X105 and so on. Cell density can be altered as needed at any passage.
[0032] Mammalian cells are typically cultivated in a cell incubator at about 37°C at normal atmospheric pressure. The incubator atmosphere is normally humidified and often contain about from about 3-10% carbon dioxide in air. Temperature, pressure and C02 concentration can be altered as necessary, provided the cells are still viable. Culture medium pH can be in the range of about 7.1 to about 7.6, in particular from about 7.1 to about 7.4, and even more particular from about 7.1 to about 7.3. It may be necessary in some cases, like colon cancer cells, to use incubators with low oxygen (2%) rather than the normal 20%. The incubator atmosphere may thus be from about 0.5% to about 30% oxygen.
[0033] Cell culture medium is normally replaced every 1-2 days or more or less frequently as required by the specific cell type. As the CTCs approach confluence in the culture vessel, they are normally passaged. As used herein a cell passage is used as it is in the art and means splitting or dividing the cells and transferring a portion of the cells into a new culture vessel or culture environment. Most likely, the CTCs used in the methods of the present invention will be adherent to the parylene cell culture surface and will need to be detached. Methods of detaching adherent cells from the surface of parylene culture vessels are well-known and commonly employed and can include the use of enzymes such as trypsin. The ROCK inhibitor may or may nor be included when the cells are being detached from their surface during passage.
[0034] A single passage refers to when a technician splits or manually divides the cells one time and transfers a smaller number of cells into a new vessel or environment. When passaging, the cells can be split into any ratio that allows the cells to attach and grow. Thus, at a single passage the cells can be split in a 1:2 ratio, 1:3, 1:4, 1:5 etc. Passaging cells, therefore, is not equivalent to population doubling. As used herein a population doubling is when the cells divide in culture one time such that the number of cells in culture is approximately doubled. Cells need to be counted to determine if a population of
cells has doubled, tripled or multiplied by some other factor. In other words, passaging the cells and splitting them in a 1:3 ratio for further culturing in vitro is not to be taken as the equivalent that the cell population has tripled.
[0035] In one embodiment of the present invention, the CTCs are continuously cultured in vitro. As used herein, "continuous culturing" is the notion that the cells continually divide and reach or approach confluence in the cell culture vessel such that the cells require passaging and fresh medium to maintain their health. Thus, the concept of "continuously culturing" is similar to the concept that the CTCs would be immortalized. In one embodiment, when cultured using the present methods and conditions of the present invention, the CTCs can continue to grow and divide for at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250 or 300 passages or more.
[0036] The present invention is also directed towards methods of stimulating growth of CTCs in vitro, with the methods comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ROCK in the feeder cells, the NKE cells or both. Culturing the CTCs in such conditions will stimulate the CTCs to grow or proliferate, whereas otherwise the cells may not grow. In one specific embodiment, the cells grow in tight clusters, i.e., the cells become tightly adherent. In one embodiment, the cultured CTCs form junctions involving e- cadherin, non-muscle myosin, and pl20 catenin. These types of junctions can be assayed according to Li, D. et al., J. Cell Biol., 191(3):631-644 (2010), which is incorporated by reference.
[0037] As used herein and throughout the specification, "cell growth" refers to cell division, such that one "mother cell" divides into two "daughter cells." As used herein, "cell growth" does not refer to an increase in the actual size of the cells. Stimulation of cell growth can be assayed by plotting cell populations over time. A cell population with a steeper growth curve can be said to be growing faster than a cell population with a curve not as steep. Growth curves can be compared for various treatments between the same cell types, or growth curves can be compared for different cell types with the same conditions.
[0038] Late passage CTCs of the present invention may or may not be characterized by their telomere length. As normally happens, the length of the telomeres generally shortens as cells divide. A cell will normally stop dividing when the average length of telomeres is reduced to a critical length, e.g., 4kb. In the present invention, the average telomere length of late passage cells may be reduced to a length of as little as 2kb and continue to grow. The average telomere length is readily determined using routine
methods and techniques in the art. Thus in one embodiment, the present invention provides CTCs capable of dividing in the culture conditions of the present invention, wherein the average telomere length of the CTCs is shorter than the average telomere length of CTCs that would normally not divide when placed under different or heretofore routine culture conditions. Thus, the methods of the present invention are capable of generating conditionally immortalized CTCs, whereby the cells have an average telomere length that is less than the average telomere length of CTCs that are normally capable of dividing and whereby the conditionally immortalized CTCs are capable of still dividing in spite of their reduced telomere length. To be clear, CTCs will normally stop dividing when the average telomere length is reduced to a certain length even when placed in culture conditions currently considered in the art to be acceptable or even optimal for culturing such cells. The average telomere length can vary from cell type to cell type.
[0039] Such currently acceptable or optimal conditions for culturing cells, such as cells of epithelial origin, generally include culturing cells in well-defined, or synthetic, serum-free medium. For examples, culturing prostate tumor cells normally involves culturing in prostate cell-specific medium, without added serum. In addition, prostate tumor cells are generally cultured in the absence of feeder cells. Thus, "currently acceptable" or "currently optimal" culture conditions are culture conditions where the medium does not include serum or a serum replacement and the conditions do not include the use of feeder cells. "Currently acceptable" or "currently optimal" culture conditions may also include the use of synthetic or well-defined medium, for example the use of prostate-specific cell medium for prostate tumor cells. Thus the methods of the present invention provide the unexpected results of being able to culture and passage CTCs long after one would have been able to do so using currently acceptable or currently optimal conditions.
[0040] As used herein, the term "conditionally immortalized" indicates that the CTCs have a reduced average telomere length over the average telomere length of "normal" senescent CTCs yet are still capable of unlimited growth, provided the conditionally immortalized CTCs are maintained in the culture conditions of the present invention. When determining if a cell is conditionally immortalized, it may be necessary to compare the average telomere length of the conditionally immortalized cells with the average telomere length of non-conditionally immortalized CTCs that would normally be senescent in vitro. The phrase "normally senescent" is used to mean a population of cells that, but for the conditions outlined herein, would exhibit a reduced capacity of dividing further in vitro and thus would not need to be passaged any further. Therefore, the invention provides methods of conditionally immortalizing CTCs
comprising culturing the CTCs on parylene in the presence of feeder cells and a calcium-containing medium while inhibiting the activity of ho kinase (ROCK) in the feeder cells, the CTCs or both during culturing. In one embodiment of the present invention, the conditionally immortalized cells generated by the methods described herein retain the phenotype of the originally isolated CTCs.
[0041] The CTCs can grow, become in need of continuous culturing and/or become conditionally immortalized in vitro without apparent change to the karyotype of the cells after any number of passages. Accordingly, the methods of the present invention comprise continuously culturing CTCs, whereby the cells' karyotype at any passage is not altered or is not substantially altered when compared to the karyotype of the same types of primary cells or early passage cells. An alteration of a cell's karyotype includes but is not limited to duplication or deletion of chromosomes or portions thereof and/or translocation of a portion of one chromosome to another. Identifying a karyotype and alterations thereof are common techniques in the art. Accordingly, one embodiment of the present invention is directed to late passage CTCs, wherein the late passage CTCs have (a) an unaltered karyotype when compared to the karyotype of the primary CTCs or (b) an unaltered karyotype when compared to the karyotype of initially thawed CTCs. As used herein, a late passage CTC is defined as a CTC that has gone through at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 250 or 300 passages or more.
[0042] The present invention is also directed to conditionally immortalized CTCs. In select
embodiments, the conditionally immortalized CTCs have (a) an unaltered karyotype when compared to the karyotype of primary (originally isolated) CTCs or (b) an unaltered karyotype when compared to the karyotype of initially thawed CTCs.
[0043] The methods of the present invention comprise the use of feeder cells. The term "feeder cells" is used herein as it is in the art. Namely, feeder cells are cells that are cultured with the CTCs of the present invention. As used herein, "culturing with CTCs" (or "culturing with circulating tumor cells") means that the feeder cells are cultured sharing the same medium and sharing the same vessel with the CTCs. Thus, the feeder cells need not be in direct contact with the CTCs and, for example, can be physically separated from the CTCs, e.g., by a porous filter, although both sets of cells are in the same vessel sharing the same medium. In one embodiment, the feeder cells are non-proliferating feeder cells. In one embodiment of the present invention, the feeder cells can be treated to inhibit proliferation of the feeders, while still keeping them alive and metabolically active. For example, feeder
cells can be irradiated with gamma irradiation and/or treated with mitomycin C, which will arrest cell division but maintain the cells in a metabolically active state. Methods of treating cells to arrest cell division but maintain a metabolically active state are well-known in the art. In another embodiment, the feeder cells have not been treated to inhibit proliferation. For example, feeder cells, placed on a porous filter that prevents physical contact with the CTCs, can be cultured with the CTCs without the need to treat the feeder cells to inhibit their proliferation
[0044] Feeder cells can be from any mammal and the animal source of the feeder cells need not be the same animal source as the CTCs being cultured. For example feeder cells may be, but are not limited to mouse, rat, canine, feline, bovine, equine, porcine, non-human and human primate feeder cells. The types of feeder cells used are typically spleenocytes, macrophages thymocytes and/or fibroblasts. In one embodiment, the spleenocytes, macrophages thymocytes and/or fibroblasts have been treated such that they are non-proliferating. One example of a feeder cell that may be used in the methods of the present invention is a population of J2 cells. The J2 cells are a subclone of mouse fibroblasts derived from the esta blished Swiss 3T3 cell line. In one embodiment, the J2 cells are gamma irradiated. In another embodiment, the J2 cells are treated with mitomycin C.
[0045] In another embodiment, medium conditioned with feeder cells is used in place of culturing feeder cells with the CTCs. Preparing conditioned medium is routine in the art. Generally, preparation of conditioned medium involves culturing cells in a medium, e.g., F-medium as defined herein, for a few days and collecting this medium. The conditioned medium is often, but need not be, combined with fresh medium in a diluted fashion. Discovering the optimal dilution ratios of conditioned medium to "fresh medium" is routine, but the ratios can be from about 1:99 to about 99:1 of "conditioned medium" to "fresh medium." As used herein, "conditioned medium" is any medium where all or a percentage of the medium has been previously used in culture.
[0046] In yet another embodiment, feeder cell extract can be added to the medium in place of feeder cells themselves. Methods of preparing feeder cell extract are common and are described in Graham, J. and Sandall J., Biochem. J., 182:157-164 (1979), Graham, J., Biochem. J., 130:1113-1124 (1972) and Dickson, ., et al., Proc. Nat'l Acad. Sci., U.S.A., 80:5335-5339 (1983) all of which are incorporated by reference herein. Discovering the optimal dilution feeder cell extract to medium is routine, but the ratios can be from about 1:99 to about 99:1 of extract to medium.
[0047] The cell culture media of the present invention can be any aqueous-based medium and can include any "classic" media such as, but not limited to DMEM (Dulbecco's Modified Essential Medium), Ham's F12 medium, Ham's F-10 medium, PMI 1640, Eagle's Basal Medium (EBM), Eagle's Minimum Essential Medium (MEM), HEPES, Medium 199 and the like. The culture medium can also be combinations of any of the classical medium, such as but not limited to, a combination of DMEM and F12 Media.
[0048] Additional ingredients may be added to the culture medium used in the methods of the present invention. Such additional ingredients include but are not limited to, amino acids, vitamins, inorganic salts, adenine, ethanolamine, D-glucose, heparin, N-[2-hydroxyethyl]piperazine-N'-[2-ethanesulfonic acid] (HEPES), hydrocortisone, insulin, lipoic acid, phenol red, phosphoethanolamine, putrescine, sodium pyruvate, triiodothyronine (T3), thymidine and transferrin. Alternatively, insulin and transferrin may be replaced by ferric citrate or ferrous sulfate chelates. Each of these additional ingredients is
commercially available.
[0049] Amino acid ingredients which may be included in the media of the present invention include but are not limited to, L-alanine, L-arginine, L-asparagine, L-aspartic acid, L-cysteine, L-glutamic acid, L- glutamine, glycine, L-histidine, L-isoleucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L-serine, L-threonine, L-tryptophan, L-tyrosine and L-valine.
[0050] Vitamin that may be added include but are not limited to biotin, choline chloride, D-Ca+2- pantothenate, folic acid, i-inositol, niacinamide, pyridoxine, riboflavin, thiamine and vitamin B12.
[0051] Inorganic salt ingredients which may be added include but are not limited to calcium salt (e.g., CaCI2), CuS04, FeS04, KCI, a magnesium salt, e.g., MgCI2, a manganese salt, e.g., MnCI2, sodium acetate, NaCI, NaHC03, Na2HP04, Na2S04 and ions of the trace elements selenium, silicon, molybdenum, vanadium, nickel, tin and zinc. These trace elements may be provided in a variety of forms, preferably in the form of salts such as Na2Se03, Na2 Si03, (NH4)6Mo7 024, NH V03, NiS04, SnCI and ZnSO.
[0052] Additional ingredients include but are not limited to heparin, epidermal growth factor (EGF), at least one agent increasing intracellular cyclic adenosine monophosphate (cAMP) levels, and at least one fibroblast growth factor (FGF). Heparin, EGF, the cAMP-increasing agent(s) and FGF(s) may be added to the basal medium or they may be admixed in a solution of, for example, Dulbecco's Phosphate Buffered
Saline (DPBS) and stored frozen until being added to basal medium to formulate the medium to be used in the methods of the present invention.
[0053] Heparin may be obtained commercially. Heparin is added to the present media primarily to sta bilize the activity of the growth factor components, for example FGF. If heparin is used, it may be added to the basal mediu m at a concentration of a bout 1-500 U.S. P. units/liter. EGF is availa ble commercially. If EGF is used, it may be added to the basal medium at a concentration of a bout 0.00001- 10 mg/L.
[0054] A variety of agents that increase intracellular cAM P levels may be used in formulating the media of the present invention. Included are agents which induce a direct increase in intracellular cAM P levels (e.g., dibutyryl cAM P), agents which cause an increase in intracellular cAM P levels by an interaction with a cellular G-protein (e.g., cholera toxin and forskolin), agents which cause an increase in intracellular cAM P levels by acting as agonists of β-adrenergic receptors (e.g., isoproterenol) and agents which cause an increase in intracellular cAM P levels by inhibiting the activities of cAM P phosphodiesterases (e.g., isobutylmethylxanthine (I BMX) and theophylline). These cAM P-increasing agents are availa ble commercially.
[0055] The culture medium used in the methods of the present invention comprises a calcium source. In one em bodiment, the calcium source is serum or a serum replacement. In another embodiment, the calcium source is a calcium-containing salt that is added to the medium. If serum is used as a calcium source, the serum can be in a concentration (v/v) of from a bout 1% to a bout 35%. In select
embodiments, the serum is at a concentration of from a bout 1% to a bout 20%, or from a bout 1% to a bout 15%, or from a bout 1% to a bout 10%, or from a bout 1% to a bout 5%. If a serum su bstitute or serum replacement is used as the calcium source, these can be added to the mediu m according to the manufacturer's suggested protocol. Examples of serum su bstitutes include but are not limited to commercially availa ble su bstitutes such as Ultroser™ from Pall Corporation, milk or milk fractions such as but not limited to nonfat d ry milk filtrate.
[0056] The range of Ca+2 concentration used in the em bodiments of the present invention can vary according to cell type. In one em bodiment, the concentration of Ca+2 in the mediu m used in the methods of the present invention is from 0.1 mM to 10.0 m M. In more specific em bodiments, the concentration of Ca+2 in the medium used in the methods of the present invention can be from a bout 0.2 m M to a bout 8 mM, from a bout 0.4 m M to a bout 7 mM, from a bout 0.5 mM to a bout 5 m M, from
a bout 0.8 m M to a bout 4 mM, from a bout 1.0 m M to a bout 3 m M, from a bout 1.2 m M to a bout 2.8 mM, from a bout 1.4 m M to a bout 2.6 m M and from a bout 1.5 m M to a bout 2.5 mM.
[0057] The methods of the present invention comprise inhibiting rho associated coiled-coil protein kinase (ROCK) in the culture. Rho kinase belongs to the Rho GTPase family of proteins, which includes the Rho, Racl and Cdc42 kinases. One of the best-characterized effector molecule of Rho is ROCK, which is a serine/threonine kinase that binds to the GTP-bound form of Rho. The catalytic kinase domain of ROCK, which comprises conserved motifs characteristic of serine/threonine kinases, is found at the N-terminus. ROCK proteins also have a central coiled-coil domain, which includes a Rho-binding domain (RBD). The C- terminus is made up of a pleckstrin-homology (PH) domain with an internal cysteine -rich domain. The coiled-coil domain is thought to interact with other a- helical proteins. The RBD, located within the coiled-coil domain, interacts only with activated Rho GTPases, including RhoA, RhoB, and RhoC. The pH domain is thought to interact with lipid mediators such as arachidonic acid and sphingosylphosphorylcholine, and may play a role in protein localization. Interaction of the pH domain and RBD with the kinase domain results in an auto- inhibitory loop. In addition, the kinase domain is involved in binding to RhoE, which is a negative regulator of ROCK activity.
[0058] The ROCK family currently consists of two mem bers, ROCKl (also known as ROKfi or pl60ROCK) and ROCK2 (a lso known as ROKa). ROCKl is a bout 1354 amino acids in length a nd ROCK2 is a bout 1388 amino acids in length. The amino acid sequences of human ROCKl and human ROCK2 are well known. For example, the amino acid sequence of ROCK 1 and ROCK2 can be found at UniProt Knowledgebase (UniProtKB) Accession Nu mber Q13464 and 075116, respectively. The nucleotide sequences of human ROCKl and ROCK2 can be found at GenBank Accession Nu mber N M_005406.2 and N M_004850, respectively. The nucleotide and amino acid sequences of ROCKl and ROCK2 proteins from a variety of animals are also well-known and can be found in both the UniProt and GenBank data bases.
[0059] Although both ROCK isoforms are u biquitously expressed in tissues, they exhibit differing intensities in some tissues. For example, ROCK2 is more prevalent in brain and skeletal muscle, while ROCKl is more a bundant in liver, testes and kidney. Both isoforms are expressed in vascular smooth muscle and heart. In the resting state, both ROCKl and ROCK2 are primarily cytosolic, but a re translocated to the membrane upon Rho activation. ROCK activity is regulated by several different mechanisms, thus Rho-dependent ROCK activation is highly cell-type dependent, ranging from changes in contractility, cell permea bility, migration and proliferation to apoptosis. At least 20 ROCK su bstrates
have been identified. See Hu and Lee, Expert Opin. Ther. Targets 9:715-736 (2005) and Loirand et al, Cir. Res. 98:322-334 (2006) and Riento and Ridley, Nat. Rev. Mol. Cell Biol. 4:446-456 (2003) all of which are incorporated by reference.
[0060] The role of ROCK in regulating apoptotic signaling is highly cell-type dependent and stimulus dependent. On the other hand, ROCK has also been associated with mediating cell-survival signals in vitro and in vivo. A ROCK-mediated pro-survival effect has been reported in epithelial cells, cancer cells and endothelial cells, as well as in other cell types. In airway epithelial cells, inhibition with Y-27632 or HA 1077 (also known as fasudil) induces membrane ruffling, loss of actin stress fibers and apoptosis (Moore et al., Am. J. Respir. Cell Mol. Biol. 30:379-387, 2004).
[0061] Rho/ROCK activation may also play a pro-survival role during oxidative stress-induced intestinal epithelial cell injury (Song et al., Am. J. Physiol. Cell Physiol. 290:C1469-1476, 2006). ROCK has also been associated with pro-survival events in thyroid cancer cells (Zhong et al., Endocrinology 144:3852-3859, 2003), glioma cells (Rattan et al, J. Neurosci. Res. 83:243-255, 2006), human umbilical vein endothelial cells (Li et al., J. Biol. Chem. 277:15309-15316, 2002), hepatic stelate cells (Ikeda et al., Am. J. Physiol. Gastrointest. Liver Physiol. 285:G880-886, 2003) and human neuroblastoma cells (De Sarno et al., Brain Res. 1041: 112-115, 2005). Evidence of ROCK playing a pro-survival role has also been reported in vivo, for example in vascular smooth muscle cells (Shibata et al, Circulation 103:284-289, 2001) and spinal motor neurons (Kobayashi et al, J. Neurosci. 24:3480-3488, 2004).
[0062] As used herein, inhibiting ROCK can mean to reduce the activity, function or expression of at least one of ROCK1 or ROCK2. The activity, function or expression may be completely suppressed, i.e., no activity, function or expression, or the activity, function or expression may simply be lower in treated versus untreated cells. In general, ROCK phosphorylates LIM kinase and myosin light chain (MLC) phosphatase after being activated through binding of GTP-bound Rho. One embodiment of the present invention thus involves blocking the upstream pathway of ROCK1 and/or ROCK2, for example GTP- bound Rho, such that ROCK1 and/or ROCK2 is not activated or its activity is reduced over untreated cells. Other upstream effectors include but are not limited to, integrins, growth factor receptors, including but not limited to, TGF-beta and EGFR, cadherins, G protein coupled receptors and the like. Another embodiment of the present invention thus involves blocking the activity, function or expression of downstream effector molecules of activated ROCK1 and/or ROCK2 such that ROCK1 and/or ROCK2 can not propagate any signal or can only propagate a reduced signal over untreated cells. Downstream
effectors include but are not limited to, Myosin phosphatase-targeting protein (MYPT), vimentin, LIMK, Myosin light chain kinase, NHE1, cofilin, Myosin II and the like. For example, both C3 transferase, a ROCK upstream inhibitor that inhibits the activity of Rho, and blebbistatin, a ROCK downstream inhibitor that inhibits the activity of myosin II, when used in the culture conditions described herein in place of a ROCK inhibitor, affected the cells in such a manner as to allow the cells to bypass differentiation and allow proliferation in vitro. Upstream or downstream inhibition of ROCK, in place of direct ROCK inhibition and in conjunction with the other culture conditions described and required herein, may or may not generate conditionally immortalized CTCs.
[0063] The methods of the present invention comprise inhibiting ROCK while culturing the CTCs. In one embodiment, inhibiting ROCK is accomplished by addition of a ROCK inhibitor to the culture medium. In this embodiment where a ROCK inhibitor is added to culture medium, it is possible that the ROCK inhibitor may also be having an effect on the feeder cells in addition to the CTCs.
[0064] Examples of ROCK inhibitors include but are not limited to Y-27632, HA1100, HA1077,
Thiazovivin and GSK429286, the structures of which are well known and disclosed in the art. See, for example, Figure 11 from PCT Publication No. WO 2012/065067, the contents of which are incorporated by reference. These compounds are well known and commercially available. Additional small molecule Rho kinase inhibitors include but are not limited to those described in PCT Publication Nos. WO
03/059913, WO 03/064397, WO 05/003101, WO 04/112719, WO 03/062225 and WO 03/062227, and described in U.S. Patent Nos. 7,217,722 and 7,199,147, and U.S. Patent Application Publication Nos. 2003/0220357, 2006/0241127, 2005/0182040 and 2005/0197328, the contents of all of which are incorporated by reference.
[0065] Another way of inhibiting ROCK kinase would be through the use of RNA interference (RNAi). RNAi techniques are well known and rely of double-stranded RNA (dsRNA), where one stand of the dsRNA corresponds to the coding strand of the mRNA that codes for ROCK1, and the other strand is complementary to the first strand. The requirements of optimal RNAi species for a given nucleotide sequence are well-known or can be readily ascertained given the state of the art. For example, it is known that optimal dsRNA is about 20-25nt in length, with a 2 base overhand on the 3' end of each strand of the dsRNA, often referred to as short interfering RNAs (siRNA). Of course, other well-known configurations such as short hairpin RNA (shRNA) may also work. shRNAs are one continuous RNA strand where a portion is self-complementary such that the molecule is double-stranded in at least one
portion. It is believed that the cell processed shRNA into siRNA. The term RNAi molecule, as used herein, is any double stranded double-stranded RNA (dsRNA), where one stand of the dsRNA corresponds to the coding strand of the mRNA that codes for the target gene to be silenced, and the other strand is complementary to the first strand.
[0066] Accordingly, one embodiment of the present invention involves the use of at least one RNAi molecule and/or at least one antisense molecule, to inhibit the activity of ROCK. In one specific embodiment, the RNAi molecule and/or antisense molecule is specific towards ROCKl. In another embodiment, the RNAi molecule or antisense molecule is specific towards ROCK2. In yet another embodiment, the RNAi molecule and/or antisense molecule is specific towards both ROCKl and ROCK2. In still another embodiment, at least two RNAi molecules and/or antisense molecules are used, where one is specific towards ROCKl and the other is specific towards ROCK2.
[0067] The RNAi molecules and/or antisense molecules may be part of the cell culture by simply soaking the cells with the naked RNAi molecules and/or antisense molecules as has been reported Clemens, J.C., et al., PNAS, 97(12):6499-6503 (2000), which is incorporated by reference. The RNAi molecules and/or antisense molecules may also be part of a complex, such as a liposomal complex that can be used to insert RNAi molecules or antisense/molecules into the cells.
[0068] Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged dsRNA molecules to form a stable complex. The positively charged dsRNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et at., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).
[0069] Liposomes that are pH-sensitive or negatively-charged entrap dsRNA rather than complex with it. Since both the dsRNA and the lipid are similarly charged, repulsion rather than complex formation occurs. The dsRNA is thus entrapped in the aqueous interior of these liposomes. pH-sensitive liposomes have been used, for example, to deliver dsRNA encoding the thymidine kinase gene to cell monolayers in culture (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274). One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily
from dioleoyi phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol. Liposomes that include nucleic acids have been described, for example, in WO 96/40062, U.S. Pat. No. 5,264,221, U.S. Pat. No. 5,665,710 and Love et al., WO 97/04787 all of which are incorporated by reference.
[0070] Another type of liposome, a transfersome, is a highly deformable lipid aggregate which is attractive for drug delivery vehicles. (Cevc et al., 1998, Biochim Biophys Acta. 1368(2): 201-15.) Transfersomes may be described as lipid droplets which are so highly deformable that they can penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, for example, they are shape adaptive, self-repairing, frequently reach their targets without fragmenting, and often self-loading. Transfersomes can be made, for example, by adding surface edge-activators, usually surfactants, to a standard liposomal composition.
[0071] Another way ROCK1 and/or ROCK2 RNAi can gain access to the cells in the methods of the present invention is through the use of DNA expression vectors that encode the RNAi molecules and/or antisense molecules. Certain embodiments can utilize only one vector, for example when the RNAi molecule is a shRNA, or when opposing promoters are placed on either side there of the coding sequence for the RNAi molecule. Thus "inhibiting the activity of ROCK" includes the use of DNA that, when transcribed, can block the activity, function or production of ROCK. The liposomal delivery systems described above are one way in which the DNA encoding an RNAi and/or antisense can enter the cell.
[0072] Alternatively, the DNA encoding an RNAi and/or antisense can be prepared in a viral vector system that has the capability of entering into cells. These are well-known in the art and include Madzak et al., J. Gen. Virol., 73: 1533-36 (1992) (papovavirus SV40); Berkner et al., Curr. Top. Microbiol. Immunol., 158: 39-61 (1992) (adenovirus); Moss et al., Curr. Top. Microbiol. Immunol., 158: 25-38 (1992) (vaccinia virus); Muzyczka, Curr. Top. Microbiol. Immunol., 158: 97-123 (1992) (adeno-associated virus); Margulskee, Curr. Top. Microbiol. Immunol., 158: 67-93 (1992) (herpes simplex virus (ISV) and Epstein- Barr virus (HBV)); Miller, Curr. Top. Microbiol. Immunol., 158: 1-24 (1992) (retrovirus); Brandyopadhyay et al., Mol. Cell. Biol., 4: 749-754 (1984) (retrovirus); Miller et al., Nature, 357: 455-450 (1992)
(retrovirus); Anderson, Science, 256: 808-813 (1992) (retrovirus); C. Hofmann et al., Proc. Natl. Acad. Sci. USA, 1995; 92, pp. 10099-10103 (baculovirus).
[0073] In another embodiment, ROCK 1 and/or 2 are inhibited using genetic manipulation techniques, such as, but not limited to, transgenic techniques involving either knockout or dominant negative constructs. Such constructs are disclosed in Khyrul, W., et al., J. Biol. Chem., 279(52):54131-54139 (2004), which is incorporated by reference herein.
[0074] As mentioned above, one embodiment of blocking ROCK would be to individually or collectively block or inhibit the upstream or downstream effectors molecules of ROCK using any of the methods described herein, such as but not limited to small molecule inhibitors, RNAi techniques, antisense techniques and/or genetic manipulation. Accordingly, any upstream effectors that could be inhibited include but are not limited to, integrins, growth factor receptors, including but not limited to, TGF-beta and EGFR, cadherins, G protein coupled receptors and the like. In addition, any downstream effectors that could be inhibited include but are not limited to, vimentin, LIMK, Myosin light chain kinase, NHE1, cofilin and the like.
[0075] After culturing in the conditions of the present invention, the cells may be removed from these conditions and placed in a cell culture environment where the environment is absent feeder cells, absent a calcium source and/or absent a ROCK inhibitor. Any combination of one, two, three or four of the feeder cells, the calcium source, the parylene and the ROCK inhibitor may be absent in the subsequent environment. As used herein, a "subsequent environment" when used in connection with a cell culture environment is a cell culture environment in which at least one of the feeder cells, the calcium source, the parylene and the ROCK inhibitor is absent. In one embodiment, the ROCK inhibitor, the calcium source, the parylene or the feeder cells are absent in the subsequent environment. In another embodiment, the feeder cells and ROCK inhibitor are absent from the subsequent environment. In another embodiment, the feeder cells and calcium source are absent from the subsequent environment. In another embodiment, the calcium source and ROCK inhibitor are absent from the subsequent environment. In another embodiment, the feeder cells and parylene are absent from the subsequent environment. In another embodiment, the parylene and calcium source are absent from the subsequent environment. In another embodiment, the parylene and ROCK inhibitor are absent from the subsequent environment. In another embodiment, the feeder cells, the parylene and the calcium source are absent from the subsequent environment. In another embodiment, the parylene, the calcium source and the ROCK inhibitor are absent from the subsequent environment. In another embodiment, the calcium source, the feeder cells and the ROCK inhibitor are absent from the subsequent environment. In another embodiment, the parylene, the ROCK inhibitor and the feeder cells
are absent from the subsequent environment. In another embodiment, the feeder cells, ROCK inhibitor, the parylene and calcium source are absent from the subsequent environment.
[0076] In one embodiment, the subsequent environment to the CTCs, the late passage CTCs and/or the conditionally immortalized CTCs are in an environment that can promote differentiation and/or does not allow for indefinite proliferation of the CTCs, the late passage CTCs and/or the conditionally
immortalized CTCs. The subsequent environment may be an in vivo environment that is similar or identical to the organ from which the cells were originally derived, i.e., an heterologous implant. For example, circulating liver cells that have been isolated, cultured and grown up according to the methods of the present invention can be introduced into a test animal, such as but not limited to a SCID or nude mouse. The heterologous implants may or may not include additional components such as, but not limited to Matrigel®.
[0077] The subsequent environment may be an in vitro environment that is that more closely resembles the biochemical or physiological properties of the organ from which the cells were originally derived once placed in this subsequent environment. The subsequent environment may also be a "synthetic environment" such that factors known to promote differentiation in vitro are added to the cell culture.
[0078] In one embodiment, CTCs, the late passage CTCs and or the conditionally immortalized CTCs are placed into a subsequent environment that is specific to stimulate differentiation of cells into the cells of the organ from which the cells were originally derived. For example, conditionally immortalized prostate tumor cells can be removed from the conditions of the present invention and placed into culture conditions designed to promote differentiation of prostate cells. Various environments for culturing epithelial cells are detailed in Culture of Epithelial Cells (Ian Freshney and Mary G. Freshney, Eds. Wiley-Liss, Inc.) (2nd Ed. 2002), which is incorporated by reference.
[0079] Alternatively, the cells can be seeded in a subsequent environment into or onto a natural or synthetic three-dimensional cell culture surfaces. One non-limiting example of a three-dimensional surface is a Matrigele-coated culture surface. Other three dimensional culture environments include but are not limited to surfaces comprising collagen gel and/or a synthetic biopolymeric material in any configuration, such as but not limited to a hydrogel. Of course, a variety of three-dimensional culture surfaces may be used simultaneously with the methods the present invention. If a three-dimensional culture environment is used, the feeder cells may or may not be used as well.
[0080] In one embodiment, CTCs, the late passage CTCs and or the conditionally immortalized CTCs can be genetically modified to express a protein of interest. The genetic modification of the cells would not be a modification designed to immortalize the cells, such as the insertion of a viral protein. Rather, the genetic modification of the cells would be designed to, for example, insert a transgene that codes for a protein or mutant protein. For example, liver tumor cells can be isolated and expanded using the cell culture methods of the present invention. These cells can su bsequently be manipulated and a transgene coding for Factor VIII or mutant Factor VIII can be inserted in the genome of the cells, such that the cells can produce Factor VIII or mutant Factor VIII. These cells can then be placed in a subsequent environment, such as a heterologous implant, such that the cells will produce Factor VIII or mutant Factor VIII.
[0081] The methods by which the transgenes are introduced into the cells are standard methods known from the literature for in vitro transfer of DNA into mammalian cells, such as the use of viral vector carrying transgenes of interest, electroporation; calcium phosphate precipitation or methods based on receptor-mediated endocytosis, disclosed in WO 93/07283, which is incorporated by reference. Other methods and materials for inserting a gene of interest into cells are disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory Press, Third Edition (2001), which is incorporated by reference.
[0082] A wide variety of genes of interest can be expressed in the CTCs, the late passage CTCs and or the conditionally immortalized CTCs. These genes of interest include, but are not limited to, sequences encoding toxins, clotting factors, enzymes, prodrug converting enzymes, antigens which stimulate immune responses, tumor necrosis factors, cytokines, and various proteins with therapeutic applications (e.g., growth hormones and regulatory factors). In addition, vectors introducing nucleotide mutations or changes to coding sequences of endogenous or exogenous proteins can also be introduced into the CTCs.
[0083] After transfecting the CTCs, the late passage CTCs and/or the conditionally immortalized CTCs of the present invention, these cells that were successfully transfected can be selected for using a markers that are well known in the art. After selection of the successfully transfected cells, the genetically modified CTCs, the late passage CTCs and/or the conditionally immortalized CTCs of the present invention can be cultured using the cell culture techniques of the present invention to produce a population of genetically modified CTCs, late passage CTCs and/or conditionally immortalized CTCs.
These cells can subsequently be collected and placed into a subsequent environment as described above, including but not limited to being placed back into a test subject.
[0084] The present invention is also directed to methods of identifying candidate treatments for a subject in need of treatments for which the subject has a condition marked by the presence of CTCs. Such conditions marked by the presence of CTCs include but are not limited to neoplasias, hyperplasias or malignant tumors or benign tumors. The methods comprising obtaining a sample of the CTCs from the subject and culturing the CTCs according to any of the culture methods of the present invention to produce an in vitro population of CTCs. For example, CTCs may be isolated from the organism's circulation, and the methods of the present invention may be utilized to obtain a sufficient number of cells for further analysis, such as but not limited to, phenotypically or genetically characterizing the cells. One method of isolating CTCs is disclosed herein, but the invention is not limited to any method by which CTCs are isolated. In the past, CTCs were isolated but could not be kept in culture for any significant time to permit study and analysis. The present invention, however, solves this problem by allowing a minimal number of CTCs, even a single cell, to be isolated and plated. The plated CTC(s) are/is then subjected to the inventive methods of the present invention to establish and maintain enough cells to permit subsequent genetic, functional and/or phenotypic analysis. Indeed, once a sufficient number of CTCs are obtained, these cells can also be assayed to determine a response profile, which can be used to identify a candidate treatment for the subject.
[0085] A response profile, as used herein, is a collection of one or more data points that would indicate, e.g., to a clinician, the likelihood that a particular treatment will produce a desired response in the subject if the treatment were performed on the subject from which the CTCs were isolated. A
"response" as used in connection with a response profile may or may not be either cell death by any means (necrosis, toxicity, apoptosis etc) or a reduction of the growth rate of abnormal cells. The response profile need not predict a response with 100% accuracy. A response profile can be a single data point or it can be a collection of data.
[0086] Any method can be used to identify or determine the response profile of a given population of CTCs. For example, the response profile may be assessed by sequencing at least part of the DNA or RNA that is isolated from the CTCs. This may be particularly useful when it is suspected that a virus, e.g., human papilloma virus (HPV), human immunodeficiency virus (HIV) may be causing the abnormal condition. It is not necessary that all of the DNA/RNA be sequenced to provide at least one data point
for the response profile. For example, using well-known techniques involving polymerase chain reaction (PCR), it would currently be a matter of simple procedure to use PCR primers with sequences specific for the DNA/RNA suspected of being present, e.g., HPV or HIV, in a PCR reaction to determine if a product is made. If no detectable product is generated after the PCR reaction using specific primers, it may be possible to conclude that the portion of the virus for which the PCR primers are specific may not be present. Likewise, determining the absence of a particular DNA/RNA sequence could also be a data point in a response profile. In this manner, the DNA or RNA is "sequenced" for the purposes of the present invention, although the precise sequence is not determined for the entire DNA/RNA sequence isolated from the cells. Thus, "sequencing" as used herein may or may not result in generating the entire nucleotide sequence of the isolated DNA/RNA. Other methods can also be used to determine the sequence of the isolated DNA/RNA such as, but not limited to Southern blots, Northern blots, RT-PCR, automated sequencing and the like. Methods of sequencing DNA/RNA are well known in the art and need not be repeated herein.
[0087] Similarly, the response profile may be assessed by identifying the presence or absence of at least a portion of one mRNA that may be produced in the CTCs in vitro. Like determining the sequence of the DNA/RNA above, the precise sequence of the mRNA need not be determined for the entire mRNA isolated from the cells. Methods that can also be used to determine the presence or absence of the sequence of the isolated mRNA include but are not limited to Northern blots, RT-PCR, automated sequencing and the like. Methods of identifying the presence or absence of the at least one mRNA are well known in the art and need not be repeated herein.
[0088] Similarly, the response profile may be assessed by identifying the presence or absence of at least a portion of one protein that may be produced in the CTCs in vitro. Like determining the sequence of the DNA/RNA above, the precise amino acid sequence of the present or absent protein need not be determined for the entire protein. Methods that can also be used to determine the presence or absence of the sequence of the isolated protein include but are not limited to Western blots, immunohistochemical methods, ELISA methods, and the like. Methods of identifying the presence or absence of the at least one protein are well known in the art and need not be repeated herein. The presence or a bsence of a protein, e.g., a receptor, may indicate that the cells are susceptible to a particular treatment that may, for example, result in cell death.
[0089] The response profile may be assessed by subjecting the CTCs in vitro to a chemotherapeutic agent or a radiation treatment, and determining the response of the cells to the chemotherapeutic agent or radiation treatment. As used herein, a chemotherapeutic agent is not limited to traditional cancer treatments but is used to indicate a therapeutic treatment of any kind using a chemical entity. In one embodiment, the response to the therapeutic agent or radiation treatment can be assessed by determining the therapeutic index of the agent or treatment on the cells. Determining the therapeutic index of a chemotherapeutic agent or radiation treatment is common in the art and is simply the ratio of the LD50/EC50, with the LD50 representing the median lethal dose and the EC50 representing the half maximal dose of the agent on the cells. Other methods to assess a response to the agent or treatment include but are not limited to determining dose response curves, cell survival curves and the like. In one embodiment, the agent or treatment that is used to determine the response of the CTCs to the agent or treatment can be the same or a different agent or treatment that is later administered to the subject.
[0090] The present invention is also directed to methods of identifying an abnormal cell or cells in a subject. These methods comprise isolating and culturing at least one CTC isolated from the subject according to the cell culture methods of the present invention. Once the CTCs, the late passage CTCs and or the conditionally immortalized CTCs have been expanded, a tissue origin profile can be determined for the cells to determine the likely tissue of origin of the isolated CTC. At least one feature of the CTCs, the late passage CTCs and or the conditionally immortalized CTCs can be compared to the same feature of normal cells that are obtained from the same tissue as that of the determined tissue origin profile of the candidate abnormal NKE cells. Any difference between abnormal or diseased cells and normal cells can be used, including but not limited to, cell growth characteristics, for example, colony formation on a cell surface, Matrigel® or other three-dimensional surface. Other means of determining differences between diseased and normal cells include, but are not limited to, assessing the proteomic profile of the cells, assessing the metabolomic profile of the cells, assessing the genomic profile, and/or using other biological assays that will highlight a difference between diseased or abnormal cells and normal cells. A detected difference in the candidate abnormal NKE cells and the normal NKE cells would indicate that the candidate a bnormal NKE cells are abnormal compared to normal NKE cells.
[0091] The same methods that are used to assess a response profile can be used to assess a tissue origin profile. For example, the candidate abnormal cells can be assayed for m NA transcript production, protein expression and tissue origin can also be assessed visually through histological
evaluation. Methods of assessing a tissue origin profile also include immunohistochemical staining. Once a likely tissue of origin has been established for the candidate abnormal cells, the cells can be assayed for at least one feature of normal cells from the same tissue. For example, if a candidate abnormal cell has been identified as originating from mammary tissue, these cells can be assayed for the B CA1 and/or BRCA2 mutation, overexpression of the HER-2/neu growth factor receptor and the like. If the candidate abnormal cell has the BRCA1 mutation, the cell can then be confirmed as being an abnormal mammary cell. The invention is not limited to the types of assays used to identify the tissue of origin; nor is the invention limited to the types of assays used to determine differences in normal and potentially abnormal cells. The cell culture methods of the present invention enable the identification of these cells by providing methods for expanding the isolated cells.
[0092] The present invention is also directed to methods of monitoring the progression of a disease or treatment of a disease in a subject. As used herein, the phrase "monitor the progression" is used to indicate that the a bnormal condition in the su bject is being periodically checked to determine if an abnormal condition is progressing (worsening), regressing (improving) or remaining static (no detectable change) in the individual by assaying CTCs and/or their cellular contents for various markers of progression or regression. The methods of monitoring may be used in conjunction with other monitoring methods or treatment regimens for an abnormal condition and to monitor the efficacy of these treatments. Thus, "monitor the progression" is also intended to indicate assessing the efficacy of a treatment regimen by periodically assaying CTCs and/or their cellular contents for various markers of progression or regression and correlating any differences in the subject over time with the progression, regression or stasis of the abnormal condition. For example, the methods of the present invention may be used to monitor a subject during or after mastectomy. In particular, the methods may be used to monitor patients that have had a successful mastectomy, such that the methods can be used to isolate CTCs to culture and generate enough CTCs in vitro to perform various analyses on the patient's CTCs to determine, if for example, a follow-up mammogram or body scan would be necessary. The methods of monitoring can also be used to determine a suitable follow up therapeutic regimen, after an initial treatment. For example, after an initial treatment CTCs can be isolated and the culture methods can be used to generate enough cells in vitro to determine if the genetic makeup or phenotype of the remaining CTCs or suspected abnormal circulating cells is sufficiently different enough to warrant a new therapy. Thus, in one embodiment, the present invention provides methods of individualizing a therapeutic regimen. Monitoring may also include assessing the levels of a specific marker on CTCs at
two time points from which a sample is taken, or it may include more time points, where any of the levels the marker at one particular time point from a given subject may be compared with the levels of biomarker in the same subject, respectively, at one or more other time points.
[0093] The methods comprising obtaining a sample of the CTCs from the subject and culturing the CTCs according to any of the culture methods of the present invention to produce an in vitro population of CTCs.
[0094] The present invention also provides kits for culturing CTCs and/or generating conditionally immortalized CTCs. The kits can include culture vessels, culture media in wet or dry form and/or individual media components such as serum or some other calcium source. The kit may or may not include frozen feeder cells, other chemicals, such as trypsin, for passaging cells, etc.
Examples
[0095] Example 1 - Establishment of a Cell Line from Circulating Tumor Cells (CTCs)
[0096] 7 ml of human blood sample was drawn from a healthy donor and injected into CPT tube (BD Vacutainer® CPTTM Cell Preparation Tubes with Sodium HeparinN). LnCAP (a prostate cancer cell line) cells (between 50-1000 total cells) were spiked into blood sample after collection. The sample was centrifuged at room temperature in a horizontal rotor centrifuge for a minimum of 15 minutes at 1500 to 1800 CF (Relative Centrifugal Force). After centrifugation, mononuclear cells and platelets were located in the whitish layer just under the plasma layer (see CPT tube). Approximately half of the plasma was aspirated, taking care not to disturb the cell layer. The cell layer was then collected with a Pasteur Pipette and transferred to a 15 mL size conical centrifuge "U" bottom tube with a cap. Human Lineage Cell Depletion Cocktail (Cat #: 51-9005225) was added to the tube, mixed and allowed to sit at room temperature for about 15 minutes. After sitting, about 12 ml lxPBS was added to the tube and the tube was spun at about 1000 RPM. The supernatant was aspirated. IMag Streptavidin Particles Plus-DM (Becton, Dickinson: Cat #: 51-9003746) were vortexed and the cell pellet was mixed thoroughly with 75 μΙ of IMag particles. The mixture was allowed to incubate at room temperature for about 30 minutes. After incubation, 1 ml lxPBS was added to the tube and mixed, and the tube was placed on the BD IMagnet for 6 min. The supernatant was transferred to a new tube. The remaining portion of the tube attached to the BD IMagnet was again mixed with 1 ml PBS. This second supernatant was
transferred to another new tu be. The two tubes were spun down the pellets were resuspended 3 ml of F medium (+Y-27632) and placed into a 6 well plate with feeder cells.
[0097] Example 2 - Establishment of a Cell Line from Circulating Tumor Cells (CTCs)
[0098] 7 ml of human blood sample is drawn from a donor into blood collection tube containing EDTA. The sample is centrifuged at room temperature in a horizontal rotor centrifuge for a minimum of 15 minutes at 1500 to 1800 CF (Relative Centrifugal Force). After centrifugation, mononuclear cells and platelets are located in the whitish layer just under the plasma layer (see CPT tube). Approximately half of the plasma is aspirated, taking care not to disturb the cell layer. The cell layer is then collected with a Pasteur Pipette and transferred to a 15 mL size conical centrifuge "U" bottom tube with a cap. Human Lineage Cell Depletion Cocktail (Cat #: 51-9005225) is added to the tube, mixed and allowed to sit at room temperature for about 15 minutes. After sitting, about 12 ml lxPBS is added to the tube and the tube was spun at a bout 1000 RPM. The supernatant is aspirated. IMag Streptavidin Particles Plus-DM (Becton, Dickinson: Cat #: 51-9003746) are vortexed and the cell pellet is mixed thoroughly with 75 μΙ of IMag particles. The mixture is allowed to incubate at room temperature for about 30 minutes. After incubation, 1 ml lxPBS is added to the tube and mixed, and the tube is placed on the BD IMagnet for 6 min. The supernatant is transferred to a new tube. The remaining portion of the tube attached to the BD IMagnet is again mixed with 1 ml PBS. This second supernatant is transferred to another new tube. The two tubes are spun down the pellets are resuspended 3 ml of F medium (+Y-27632) and placed into a 6 well plate with feeder cells.
[0099] Example 3 - Telomerase Activity and Telomere Length of Conditionally Immortalized Cells
[00100]Total cellular RNA is isolated with TRIzol reagent (Invitrogen) and treated with a DNA-/ree kit (Ambion) according to the manufacturer's instructions. First-strand cDNA is synthesized with some modifications using 2 μg of total cellular RNA following the instructions of Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). Taqman real-time QRT-PCR is performed on the Bio-Rad iCycler MyiQ for quantitation of hTERT mRNA using primers and probes sense primer 5'- TGACACCTCACCTCACCCAC-3', antisense primer 5'-CACTGTCTTCCGCAAGTTCAC-3' and Taqman probe 5'- ACCCTGGTCCGAGGTGTCCCTGAG-3' as previously reported in Fu et al., Cancer Research 63, 7815-7824, (2003), which is incorporated by reference. Genomic DNA is extracted from cells using Qiagen DNeasy Blood & Tissue Kit (Cat# 69506). Average telomere length is assessed by a modified method of the real-
time PCR-based telomere assay described previously in Cawthon R., Nucleic Acids Res. 37(3):e21 (2009) and Cawthon R., Nucleic Acids Res., 30(10):e47(2002), which are incorporated by reference.
[00101] Briefly, the telomere repeat copy num ber to single gene copy num ber (T/S) ratio is determined using a Bio-Rad IQ5 thermocycler in a 96-well format. Five nanograms of genomic DNA is su bjected to PCR reactions with Rio-Rad SYBR Green Super mixture. The primers for telomere length and HBG1 (a single copy gene) can be: Tel-1 5' CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT-3, and Tel-2 5'- G G CTTG CCTTACCCTT ACCCTTACCCTTACCCTTACCCT-3 ' ; HBG1 5'- TGTGCTGGCCCATCACTTTG, and H BG2 5'- ACCAGCCACCACTTTCTGATAGG-3'. The reactions proceed for 1 cycle at 95°C for 5 min, followed by 41 cycles at 95°C for 15s, 60°C for 45s. All samples for both the telomere and globin reactions can be done in triplicate. In addition to the samples, each 96-well plate contain a six-point standard curve from 0, 0.2, 1, 5, 25, 125 ng using genomic DNA (telomere length 10.4 kb) from Roche Telo-kit. The T/S ratio (dCt) for each sample is calculated by normalizing the average HBG Ct value from the average telomere Ct value.
[00102] fxamp/e 4 -Identification of Candidate Therapeutic Agents for an Individual
[00103] Circulating tumor cells from a patient a re isolated. Using the cell culture methods described herein, at least one cell line is generated from the isolated CTCs, which is then used to determine, for example, if a specific type of human pa pillomavirus (H PV) or some other virus or if a genetic mutation is the etiologic agent in the patient's tumor. For example, DNA is extracted from the esta blished CTC line and specific primers and PCR are used to evaluate whether low risk HPVs (HPV-6, H PV-11) or high risk HPVs (H PV-16 or H PV-18) are present. As another example, testing the CTCs for a "genetic mutation" would also include determining the presence of, for example, a mutation in a tumor suppressor gene such as, but not limited to, p53, Rb, Pten, as well as chromosomal translocations such as, but not limited to, TM PRSS/ERG and a mutation in activating oncogenes such as, but not limited to, Ras or myc.
[00104] A portion of the H PV DNA, if detected, is sequenced to determine if both the early and late regions of the genome a re intact. This sequencing will provide a clear indication that one or both of the E6 and E7 early transforming genes are present as well as any LI late gene (a viral capsid protein). "Primer walking" can also be utilized to evaluate whether the entire LI gene is present. The presence or a bsence of the LI gene is useful to determine if an anti-Ll vaccine might be used in the management of this patient. For example, if the data show that the early E6 and E7 transforming genes are being transcribed but that the LI gene is not, this can guide treatment options, since the use of an H PV
vaccine based on the presence of an LI protein would not be helpful for this patient since the LI protein is not being produced. Accordingly, based on this genetic analysis using the culture methods of the present invention, alternative ways to treat the tumor can be considered earlier in treatment.
[00105] Example 5 - Capture, Growth and Analysis of CTCs from Blood
[00106] For CTC capture, blood was diluted with PBS with final blood to buffer ratio of 1:1 and passed through the Nextgen device as described in Lin, H., et al., Clin. Cancer Res., 16:5011-5018 (2010) and U.S. Pre-Grant Publication No. 2011/0294206.
[00107] For CTC enumeration, formalin was added to the PBS to a final concentration of 1% formalin. Enumeration samples underwent partial fixation for 10 minutes with constant rotation. The sample was dispensed through the filter with a syringe, and the filter containing captured cells was fixed in 10% neutral buffered formalin (NBF) for 10 minutes followed by permeabilization of cell membrane with 0.25% triton X-100 (Bio ad). Each filter was allowed to air-dry overnight at room temperature and was subjected to immunofluorescence analysis to identify CTCs and distinguish them from the background of nontarget blood cells.
[00108] Once the CTCs were captured, the filter was immediately placed into a well of a 12 well plate containing irradiated J2 cells and F-media plus Y-27632. Twice a week, the filters were moved to new 12 well plates containing freshly irradiated J2 feeders. In addition, the media was changed to fresh F-media +Y-27632 every two or three days, as necessary.
[00109] Passaging of cells was performed by gentle trypsinization, followed by pelleting of the CTCs by centrifugation for five minutes at 1500 rpm at 4°C. Pellet was resuspended in F-media +Y-27632, and replated in fresh wells containing irradiated J2 cells and F-media plus Y-27632 on either a new parylene filter or a parylene coated tissue culture plate. In addition, CTCs grown in continuous culture were placed into parylene coated tissue culture plates surface modified with 12 or 24 micron thick coatings of parylene C. Surface modifications were performed by Parylene Engineering (Redmond, Wa).
[00110] For CTC immunostaining, cells were grown on new parylene filters and were fixed with 1% formalin for five minutes, washed three times with PBS, and placed on glass slides. Tumor cells were identified and distinguished from leukocytes based on morphology and differential antigen expression. For example, the CTCs were epithelial in origin and were shown to express cytokeratin, whereas
leukocytes are nonepithelial and are negative for cytokeratin. Immunofluorescence was done directly on the filter membranes for the expression of cytokeratins and the marker CD45. Filter membranes were place on top of microscope slides and blocked with 5% bovine serum albumin and 0.25% triton for 30 minutes. A pan-cytokeratin rabbit polyclonal antibody (Dako Z0622) diluted 1:300 was used to detect epithelial cells. A mouse anti-CD45 antibody (Dako I 751) was used to stain for leukocytes. The slides were incubated for 1 hour in the cocktail of primary antibodies diluted in CheMate antibody diluent (DakoCyotmation). Subsequently, the slides were washed and incubated for 1 hour with fluorescent, Alexa Fluor 488 or 564-conjugated secondary antibodies (Invitrogen) for identification of epithelial or lymphoid cells.
[00111] Membranes on slides were coverslipped using Vectashield (Vector Laboratories) mounting medium containing 4',6-diamidino-2-phenylindole (DAPI) for nuclear staining and sealed with nail polish. Immunofluorescent images were obtained using a Nikon E600 fluorescence microscope workstation with DAPI/Hoechst: (EX=330-380nm, DM=400nm, EM=420nm), FITC: (EX=480nm, DM=505nm,
EM=535nm), TRITC: (EX=540nm, DM=565nm, EM=605nm) and CY5: (EX=620nm, DM=660nm,
EM=700nm) filter cubes.
Claims
1. A method of continuously culturing circulating tumor cells (CTCs), the method comprising a) culturing isolated CTCs on parylene in the presence of feeder cells and a calcium-containing medium, and b) inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during
culturing.
2. The method of claim 1, wherein the CTCs are primary cells.
3. The method of claim 1, wherein the CTCs are not primary cells.
4. The method of claim 1, wherein CTCs are selected from the group consisting of prostate tumor cells, mammary tumor cells, liver tumor cells, pancreatic tumor cells, lung tumor cells, kidney tumor cells, bladder tumor cells, stomach tumor cells, colon tumor cells, urethral tumor cells, testicular tumor cells, ovarian tumor cells, thyroid tumor cells, parathyroid tumor cells, adrenal tumor cells, thymus tumor cells, gall bladder tumor cells and pituitary tumor cells.
5. The method of claim 4, wherein the calcium-containing medium comprises serum or a serum replacement.
6. The method of claim 5, wherein the feeder cells are proliferating or non-proliferating
fibroblasts.
7. The method of claim 8, wherein the non-proliferating fibroblasts are mouse fibroblasts or human fibroblasts.
8. The method of claim 7, wherein the ROCK is Rho kinase inhibitor 1 (ROCK 1), Rho kinase
inhibitor 2 (ROCK 2) or both.
9. The method of claim 8, wherein inhibiting the activity of ROCK comprises culturing the CTCs in the presence of a small molecule ROCK inhibitor.
10. The method of claim 9, wherein the small molecule ROCK inhibitor is selected from the group consisting of Y-27632, HA1100 hydrochloride, HA1077 and GSK429286.
11. The method of claim 8, wherein inhibiting the activity of ROCK comprises culturing the CTCs in the presence of an RNA interference (RNAi) molecule specific for ROCK 1, ROCK 2 or both.
12. The method of claim 1, further comprising a) passaging the CTCs after inhibiting ROCK, and b) placing the passaged cells in cell culture environment in which ROCK is not being inhibited.
13. A population of conditionally immortalized circulating tumor cells (CTCs).
14. The cell population of claim 13, wherein the conditionally immortalized CTCs are selected from the group consisting of prostate tumor cells, mammary tumor cells, liver tumor cells, pancreatic tumor cells, lung tumor cells, kidney tumor cells, bladder tumor cells, stomach tumor cells, colon tumor cells, urethral tumor cells, testicular tumor cells, ovarian tumor cells, thyroid tumor cells, parathyroid tumor cells, adrenal tumor cells, thymus tumor cells, gall bladder tumor cells and pituitary tumor cells.
15. A method of stimulating growth of circulating tumor cells (CTCs), the method comprising a) culturing the CTCs in the presence of feeder cells and a calcium-containing medium, and b) inhibiting the activity of Rho kinase (ROCK) in the feeder cell, the CTCs or both during
culturing, whereby culturing the CTCs while inhibiting the activity of the Rho kinase will stimulate the growth of CTCs.
16. The method of claim 15, wherein the CTCs are primary cells.
17. The method of claim 15, wherein the CTCs are not primary cells.
18. The method of claim 15, wherein CTCs are selected from the group consisting of prostate tumor cells, mammary tumor cells, liver tumor cells, pancreatic tumor cells, lung tumor cells, kidney tumor cells, bladder tumor cells, stomach tumor cells, colon tumor cells, urethral tumor cells, testicular tumor cells, ovarian tumor cells, thyroid tumor cells, parathyroid tumor cells, adrenal tumor cells, thymus tumor cells, gall bladder tumor cells and pituitary tumor cells.
19. The method of claim 15, wherein the calcium-containing medium comprises serum or a serum replacement.
20. The method of claim 19, wherein the feeder cells are non-proliferating fibroblasts.
21. The method of claim 20, wherein the non-proliferating fibroblasts are mouse fibroblasts or human fibroblasts.
22. The method of claim 20, wherein the ROCK is Rho kinase inhibitor 1 (ROCK 1), Rho kinase
inhibitor 2 (ROCK 2) or both.
23. The method of claim 22, wherein inhibiting the activity of ROCK comprises culturing the CTCs in the presence of a small molecule ROCK inhibitor.
24. The method of claim 23, wherein the small molecule ROCK inhibitor is selected from the group consisting of Y-27632, HA1100 hydrochloride, HA1077 and GSK429286.
25. The method of claim 22, wherein inhibiting the activity of ROCK comprises culturing the CTCs in the presence of an RNA interference (RNAi) molecule specific for ROCK 1, ROCK 2 or both.
26. A method of identifying a candidate treatment for a subject in need of treatment of a condition that is marked by the presence of abnormal non-keratinocyte epithelial (NKE) cells, the method comprising a) obtaining at least one circulating tumor cell (CTC) from the subject, b) culturing the at least one CTC in the presence of feeder cells, a calcium-containing medium and at least one Rho kinase (ROCK) inhibitor, to produce a population of CTCs in vitro, c) determining a response profile of at least a portion of the CTCs in vitro, and d) identifying a candidate treatment for the subject based on the determined response profile.
27. The method of claim 28, wherein the response profile is at least partially determined by
identifying the sequence of at least one portion of DNA extracted from the CTCs in vitro.
28. The method of claim 28, wherein the response profile is at least partially determined by identifying at least one m NA that is produced in the CTCs in vitro.
29. The method of claim 28, wherein the response profile is at least partially determined by
identifying at least one mRNA that is not produced in the CTCs in vitro.
30. The method of claim 28, wherein the response profile is at least partially determined by
identifying one or more proteins that the CTCs in vitro express.
31. The method of claim 28, wherein the response profile is at least partially determined by
identifying one or more proteins that the CTCs in vitro do not express.
32. The method of claim 28, wherein the response profile is at least partially determined by
subjecting the CTCs in vitro to a chemotherapeutic agent and determining the therapeutic index of the chemotherapeutic agent on the CTCs in vitro.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361812153P | 2013-04-15 | 2013-04-15 | |
| US61/812,153 | 2013-04-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2014172340A1 true WO2014172340A1 (en) | 2014-10-23 |
Family
ID=51731790
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2014/034141 Ceased WO2014172340A1 (en) | 2013-04-15 | 2014-04-15 | Immortalization of circulating tumor cells and methods of use |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2014172340A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017066624A1 (en) * | 2015-10-15 | 2017-04-20 | President And Fellows Of Harvard College | Cell immortalization via vortex electroporation gene delivery |
| CN110945359A (en) * | 2017-08-18 | 2020-03-31 | 西托根有限公司 | Screening methods for prostate cancer patients based on androgen receptor variants |
| US10987670B2 (en) | 2015-04-14 | 2021-04-27 | President And Fellows Of Harvard College | Electrode array for vortex-assisted electroporation |
| WO2021222143A3 (en) * | 2020-04-26 | 2021-12-02 | Georgetown University | Methods for isolating and culturing tumor cells |
| CN114921414A (en) * | 2022-07-22 | 2022-08-19 | 北京和沛生物科技有限公司 | Method for in vitro separation culture of circulating tumor cells |
| US11753626B2 (en) | 2016-03-09 | 2023-09-12 | Beijing Percans Oncology Co., Ltd. | Tumor cell suspension cultures and related methods |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012065067A2 (en) * | 2010-11-12 | 2012-05-18 | Georgetown University | Immortalization of epithelial cells and methods of use |
| US8288170B2 (en) * | 2005-04-21 | 2012-10-16 | California Institute Of Technology | Uses of parylene membrane filters |
| US20130059308A1 (en) * | 2010-05-03 | 2013-03-07 | Olga V. Makarova | Polymer microfilters and methods of manufacturing the same |
-
2014
- 2014-04-15 WO PCT/US2014/034141 patent/WO2014172340A1/en not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8288170B2 (en) * | 2005-04-21 | 2012-10-16 | California Institute Of Technology | Uses of parylene membrane filters |
| US20130059308A1 (en) * | 2010-05-03 | 2013-03-07 | Olga V. Makarova | Polymer microfilters and methods of manufacturing the same |
| WO2012065067A2 (en) * | 2010-11-12 | 2012-05-18 | Georgetown University | Immortalization of epithelial cells and methods of use |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10987670B2 (en) | 2015-04-14 | 2021-04-27 | President And Fellows Of Harvard College | Electrode array for vortex-assisted electroporation |
| WO2017066624A1 (en) * | 2015-10-15 | 2017-04-20 | President And Fellows Of Harvard College | Cell immortalization via vortex electroporation gene delivery |
| US11753626B2 (en) | 2016-03-09 | 2023-09-12 | Beijing Percans Oncology Co., Ltd. | Tumor cell suspension cultures and related methods |
| CN110945359A (en) * | 2017-08-18 | 2020-03-31 | 西托根有限公司 | Screening methods for prostate cancer patients based on androgen receptor variants |
| CN110945359B (en) * | 2017-08-18 | 2024-01-05 | 西托根有限公司 | Screening methods for prostate cancer patients based on variants of the androgen receptor |
| WO2021222143A3 (en) * | 2020-04-26 | 2021-12-02 | Georgetown University | Methods for isolating and culturing tumor cells |
| CN114921414A (en) * | 2022-07-22 | 2022-08-19 | 北京和沛生物科技有限公司 | Method for in vitro separation culture of circulating tumor cells |
| CN114921414B (en) * | 2022-07-22 | 2022-09-27 | 北京和沛生物科技有限公司 | Method for in vitro separation culture of circulating tumor cells |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11001808B2 (en) | Immortalization of epithelial cells and methods of use | |
| KR102598772B1 (en) | In vitro proliferation of epithelial cells | |
| US11530385B2 (en) | Hormone responsive tissue culture system and uses thereof | |
| US10100285B2 (en) | Ex vivo proliferation of epithelial cells | |
| WO2014172340A1 (en) | Immortalization of circulating tumor cells and methods of use | |
| JP2014508540A (en) | Compositions and methods for culturing cells from normal human tubular ovarian epithelium and human tubular ovarian tumors | |
| JP2010500878A (en) | Co-culture method of stem cells and feeder cells using polymer membrane | |
| Liu et al. | Conditionally immortalized brown preadipocytes can switch between proliferative and differentiated states | |
| Wouters et al. | Protein kinase Cγ mediates regulation of proliferation by the serotonin 5-hydroxytryptamine receptor 2B | |
| US11884935B2 (en) | Method for inducing trans-differentiation of cardiomyocytes based on exosome | |
| Shinohara et al. | Unstable side population phenotype of mouse spermatogonial stem cells in vitro | |
| US20190151371A1 (en) | Process for continuous cell culture of islet cells | |
| US20230167414A1 (en) | Methods for isolating and culturing tumor cells | |
| WO2015192035A1 (en) | Compositions and methods for immortalization of epithelial cells | |
| HK40015712A (en) | Immortalization of epithelial cells and methods of use | |
| HK1189626A (en) | Immortalization of epithelial cells and methods of use | |
| HK1189626B (en) | Immortalization of epithelial cells and methods of use | |
| Regan | Cell Fate in the Mouse Mammary Gland | |
| WO2019104036A1 (en) | Process for continuous cell culture of gpscs | |
| KR20150133314A (en) | Methods of Monitoring Substances Controlling Intercellular Junction of Epithelial Tumor Cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 14784981 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 14784981 Country of ref document: EP Kind code of ref document: A1 |

