WO2014168874A2 - Compositions and methods for personalized neoplasia vaccines - Google Patents

Abstract

The invention provides a method of making a personalized neoplasia vaccine for a subject diagnosed as having a neoplasia, which includes identifying a plurality of mutations in the neoplasia, analyzing the plurality of mutations to identify a subset of at least five neo-antigenic mutations predicted to encode neo-antigenic peptides, the neo-antigenic mutations selected from the group consisting of missense mutations, neoORF mutations, and any combination thereof, and producing, based on the identified subset, a personalized neoplasia vaccine.

Description

COMPOSITIONS AND METHODS FOR PERSONALIZED NEOPLASIA VACCINES

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY

SPONSORED RESEARCH

This work was supported by the following grants from the National Institutes of Health, Grant No's: NIH/NCI-1R01CA155010-02 and NHLBI-5R01HL103532-03. The government has certain rights in the invention.

RELATED APPLICATIONS

This application claims the benefit of and priority to U.S. Provisional Patent Application No. 61/809,406, filed April 7, 2013 and U.S. Provisional Patent Application No. 61/869,721, filed August 25, 2013, the contents of which are incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates to personalized strategies for the treatment of neoplasia. More particularly, the present invention relates to the identification and use of a patient specific pool of tumor specific neo-antigens in a personalized tumor vaccine for treatment of the subject.

BACKGROUND

Approximately 1.6 million Americans are diagnosed with neoplasia every year, and approximately 580,000 people in the United States are expected to die of the disease in 2013. Over the past few decades there been significant improvements in the detection, diagnosis, and treatment of neoplasia, which have significantly increased the survival rate for many types of neoplasia. However, only about 60% of people diagnosed with neoplasia are still alive 5 years after the onset of treatment, which makes neoplasia the second leading cause of death in the United States.

Currently, there are a number of different existing cancer therapies, including ablation techniques (e.g., surgical procedures, cryogenic/heat treatment, ultrasound, radiofrequency, and radiation) and chemical techniques (e.g., pharmaceutical agents, cytotoxic/chemotherapeutic agents, monoclonal antibodies, and various combinations thereof). Unfortunately, such therapies are frequently associated with serious risk, toxic side effects, and extremely high costs, as well as uncertain efficacy.

There is a growing interest in cancer therapies that seek to target cancerous cells with a patient's own immune system (e.g., cancer vaccines) because such therapies may

mitigate/eliminate some of the above-described disadvantages. Cancer vaccines are typically composed of tumor antigens and immuno stimulatory molecules (e.g., cytokines or TLR ligands) that work together to induce antigen- specific cytotoxic T cells that target and destroy tumor cells. Current cancer vaccines typically contain shared tumor antigens, which are native proteins (i.e. - proteins encoded by the DNA of all the normal cells in the individual) that are selectively expressed or over-expressed in tumors found in many individuals. While such shared tumor antigens are useful in identifying particular types of tumors, they are not ideal as immunogens for targeting a T-cell response to a particular tumor type because they are subject to the immune dampening effects of self-tolerance. Accordingly, there is a need for methods of identifying more effective tumor antigens that may be used for neoplasia vaccines. SUMMARY OF THE INVENTION

The present invention relates to a strategy for the personalized treatment of neoplasia, and more particularly to the identification and use of a personalized cancer vaccine consisting essentially of a pool of tumor- specific and patient- specific neo-antigens for the treatment of tumors in a subject. As described below, the present invention is based, at least in part, on the discovery that whole genome/exome sequencing may be used to identify all, or nearly all, mutated neo-antigens that are uniquely present in a neoplasia/tumor of an individual patient, and that this collection of mutated neo-antigens may be analyzed to identify a specific, optimized subset of neo-antigens for use as a personalized neoplasia vaccine for treatment of the patient's neoplasia/tumor.

In one aspect, the invention provides a method of making a personalized neoplasia vaccine for a subject diagnosed as having a neoplasia, which includes identifying a plurality of mutations in the neoplasia, analyzing the plurality of mutations to identify a subset of at least five neo-antigenic mutations predicted to encode neo-antigenic peptides, the neo-antigenic mutations selected from the group consisting of missense mutations, neoORF mutations, and any combination thereof, and producing, based on the identified subset, a personalized neoplasia vaccine. In an embodiment, the invention provides that the identifying step further includes sequencing the genome, transcriptome, or proteome of the neoplasia.

In another embodiment, the analyzing step may further include determining one or more characteristics associated with the subset of at least five neo-antigenic mutations predicted to encode neo-antigenic peptides, the characteristics selected from the group consisting of molecular weight, cysteine content, hydrophilicity, hydrophobicity, charge, and binding affinity; and ranking, based on the determined characteristics, each of the neo-antigenic mutations within the identified subset of at least five neo-antigenic mutations. In an embodiment, the top 5-30 ranked neo-antigenic mutations are included in the personalized neoplasia vaccine. In another embodiment, the neo-antigenic mutations are ranked according to the order shown in FIG. 8.

In one embodiment, the personalized neoplasia vaccine comprises at least about 20 neo- antigenic peptides corresponding to the neo-antigenic mutations.

In another embodiment, the personalized neoplasia vaccine comprises one or more DNA molecules capable of expressing at least about 20 neo-antigenic peptides corresponding to the neo-antigenic mutations. In another embodiment, the personalized neoplasia vaccine comprises one or more RNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

In embodiments, the personalized neoplasia vaccine comprises neoORF mutations predicted to encode a neoORF polypeptide having a Kd of < 500 nM.

In another embodiment, the personalized neoplasia vaccine comprises missense mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein the native cognate protein has a Kd of > 1000 nM or < 150 nM.

In another embodiment, the at least about 20 neo-antigenic peptides range from about 5 to about 50 amino acids in length. In another embodiment, the at least about 20 neo-antigenic peptides range from about 15 to about 35 amino acids in length. In another embodiment, the at least about 20 neo-antigenic peptides range from about 18 to about 30 amino acids in length. In another embodiment, the at least about 20 neo-antigenic peptides range from about 6 to about 15 amino acids in length. In yet another embodiment, the at least about 20 neo-antigenic peptides are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

In one embodiment, the personalized neoplasia vaccine further includes an adjuvant. In other embodiments, the adjuvant is selected from the group consisting of poly-ICLC, 1018 ISS, aluminum salts, Amplivax, AS 15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact EV1P321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, Aquila's QS21 stimulon, vadimezan, and/or AsA404 (DMXAA). In a preferred embodiment, the adjuvant is poly-ICLC.

In another aspect, the invention includes a method of treating a subject diagnosed as having a neoplasia with a personalized neoplasia vaccine, which includes identifying a plurality of mutations in the neoplasia; analyzing the plurality of mutations to identify a subset of at least five neo-antigenic mutations predicted to encode expressed neo-antigenic peptides, the neo- antigenic mutations selected from the group consisting of missense mutations, neoORF mutations, and any combination thereof; producing, based on the identified subset, a

personalized neoplasia vaccine; and administering the personalized neoplasia vaccine to the subject, thereby treating the neoplasia.

In another embodiment, the identifying step may further include sequencing the genome, transcriptome, or proteome of the neoplasia.

In yet another embodiment, the analyzing step may further include determining one or more characteristics associated with the subset of at least five neo-antigenic mutations predicted to encode expressed neo-antigenic peptides, the characteristics selected from the group consisting of molecular weight, cysteine content, hydrophilicity, hydrophobicity charge, and binding affinity; and ranking, based on the determined characteristics, each of the neo-antigenic mutations within the identified subset of at least five neo-antigenic mutations.

In one embodiment, the top 5-30 ranked neo-antigenic mutations are included in the personalized neoplasia vaccine. In another embodiment, the neo-antigenic mutations are ranked according to the order shown in FIG. 8.

In one embodiment, the personalized neoplasia vaccine comprises at least 20 neo- antigenic peptides corresponding to the neo-antigenic mutations.

In another embodiment, the personalized neoplasia vaccine comprises one or more DNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo- antigenic mutations. In one embodiment, the personalized neoplasia vaccine comprises one or more RNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo- antigenic mutations.

In one embodiment, the personalized neoplasia vaccine comprises neoORF mutations predicted to encode a neoORF polypeptide having a Kd of < 500 nM.

In another embodiment, the personalized neoplasia vaccine comprises missense mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein the native cognate protein has a Kd of > 1000 nM or < 150 nM.

In one embodiment, the at least 20 neo-antigenic peptides range from about 5 to about 50 amino acids in length. In one embodiment, the at least 20 neo-antigenic peptides range from about 15 to about 35 amino acids in length. In one embodiment, the at least 20 neo-antigenic peptides range from about 18 to about 30 amino acids in length. In one embodiment, the at least 20 neo-antigenic peptides range from about 6 to about 15 amino acids in length. In one embodiment, the at least 20 neo-antigenic peptides are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

In one embodiment, the administering further includes dividing the produced vaccine into two or more sub-pools; and injecting each of the sub-pools into a different location of the patient. In one embodiment, each of the sub-pools injected into a different location comprises neo- antigenic peptides such that the number of individual peptides in the sub-pool targeting any single patient HLA is one, or as few above one as possible.

In one embodiment, the administering step further includes dividing the produced vaccine into two or more sub-pools, wherein each sub-pool comprises at least five neo-antigenic peptides selected to optimize intra-pool interactions.

In one embodiment, optimizing comprises reducing negative interaction among the neo- antigenic peptides in the same pool.

In another aspect, the invention includes a personalize neoplasia vaccine prepared according to the above-described methods.

Definitions

To facilitate an understanding of the present invention, a number of terms and phrases are defined below: Unless specifically stated or obvious from context, as used herein, the term "about" is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from context, all numerical values provided herein are modified by the term about.

By "agent" is meant any small molecule chemical compound, antibody, nucleic acid molecule, or polypeptide, or fragments thereof.

By "ameliorate" is meant decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease (e.g., a neoplasia, tumor, etc.).

By "alteration" is meant a change (increase or decrease) in the expression levels or activity of a gene or polypeptide as detected by standard art known methods such as those described herein. As used herein, an alteration includes a 10% change in expression levels, preferably a 25% change, more preferably a 40% change, and most preferably a 50% or greater change in expression levels.

By "analog" is meant a molecule that is not identical, but has analogous functional or structural features. For example, a tumor specific neo-antigen polypeptide analog retains the biological activity of a corresponding naturally- occurring tumor specific neo-antigen

polypeptide, while having certain biochemical modifications that enhance the analog's function relative to a naturally- occurring polypeptide. Such biochemical modifications could increase the analog's protease resistance, membrane permeability, or half-life, without altering, for example, ligand binding. An analog may include an unnatural amino acid.

The phrase "combination therapy" embraces the administration of a pooled sample of neoplasia/tumor specific neo-antigens and one or more additional therapeutic agents as part of a specific treatment regimen intended to provide a beneficial (additive or synergistic) effect from the co-action of these therapeutic agents. The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents. Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days, or weeks depending upon the combination selected). "Combination therapy" is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially

simultaneous administration can be accomplished, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents. For example, one combination of the present invention may comprise a pooled sample of tumor specific neo-antigens and at least one additional therapeutic agent (e.g., a chemotherapeutic agent, an anti-angiogenesis agent, an immunosuppressive agent, an anti-inflammatory agent, and the like) at the same or different times or they can be formulated as a single, co-formulated pharmaceutical composition comprising the two compounds. As another example, a combination of the present invention (e.g., a pooled sample of tumor specific neo-antigens and at least one additional therapeutic agent) may be formulated as separate pharmaceutical compositions that can be administered at the same or different time. Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, oral routes, intravenous routes, sub-cutaneous routes, intramuscular routes, direct absorption through mucous membrane tissues (e.g., nasal, mouth, vaginal, and rectal), and ocular routes (e.g., intravitreal, intraocular, etc.). The therapeutic agents can be administered by the same route or by different routes. For example, one component of a particular combination may be administered by intravenous injection while the other component(s) of the combination may be administered orally. The components may be administered in any therapeutically effective sequence.

The phrase "combination" embraces groups of compounds or non-drug therapies useful as part of a combination therapy.

In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean "includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments.

By "control" is meant a standard or reference condition.

By "disease" is meant any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ. By "effective amount" is meant the amount required to ameliorate the symptoms of a disease (e.g., a neoplasia/tumor) relative to an untreated patient. The effective amount of active compound(s) used to practice the present invention for therapeutic treatment of a disease varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician or veterinarian will decide the appropriate amount and dosage regimen. Such amount is referred to as an "effective" amount.

By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the entire length of the reference nucleic acid molecule or polypeptide. A fragment may contain 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more nucleotides or amino acids.

"Hybridization" means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. For example, adenine and thymine are complementary nucleobases that pair through the formation of hydrogen bonds.

By "inhibitory nucleic acid" is meant a double- stranded RNA, siRNA, shRNA, or antisense RNA, or a portion thereof, or a mimetic thereof, that when administered to a mammalian cell results in a decrease (e.g. , by 10%, 25%, 50%, 75%, or even 90- 100%) in the expression of a target gene. Typically, a nucleic acid inhibitor comprises at least a portion of a target nucleic acid molecule, or an ortholog thereof, or comprises at least a portion of the complementary strand of a target nucleic acid molecule. For example, an inhibitory nucleic acid molecule comprises at least a portion of any or all of the nucleic acids delineated herein.

By "isolated polynucleotide" is meant a nucleic acid (e.g. , a DNA) that is free of the genes which, in the naturally-occurring genome of the organism— or in the genomic DNA of a neoplasia/tumor derived from the organism— the nucleic acid molecule of the invention is derived. The term therefore includes, for example, a recombinant DNA (e.g., DNA coding for a neoORF, read-through, or InDel derived polypeptide identified in a patient' s tumor) that is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. In addition, the term includes an RNA molecule that is transcribed from a DNA molecule, as well as a recombinant DNA that is part of a hybrid gene encoding additional polypeptide sequence.

By an "isolated polypeptide" is meant a polypeptide of the invention that has been separated from components that naturally accompany it. Typically, the polypeptide is isolated when it is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated. Preferably, the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, a polypeptide of the invention. An isolated polypeptide of the invention may be obtained, for example, by extraction from a natural source, by expression of a recombinant nucleic acid encoding such a polypeptide; or by chemically synthesizing the protein. Purity can be measured by any appropriate method, for example, column chromatography, polyacrylamide gel electrophoresis, or by HPLC analysis.

A "ligand" is to be understood as meaning a molecule which has a structure

complementary to that of a receptor and is capable of forming a complex with the receptor.

According to the invention, a ligand is to be understood as meaning a peptide or peptide fragment that has a suitable length and suitable binding motifs in its amino acid sequence, so that the peptide or peptide fragment is capable of forming a complex with proteins of MHC class I or

MHC class II.

"Mutation" for the purposes of this document means a DNA sequence found in the tumor DNA sample of a patient that is not found in the corresponding normal DNA sample of that same patient. "Mutation" may also refer to patterns in the sequence of RNA from a patient that are not attributable to expected variations based on known information for an individual gene and are reasonably considered to be novel variations in, for example, the splicing pattern of one or more genes that has been specifically altered in the tumor cells of the patient.

"Neo-antigen" or "neo-antigenic" means a class of tumor antigens that arises from a tumor- specific mutation(s) which alters the amino acid sequence of genome encoded proteins.

By "neoplasia" is meant any disease that is caused by or results in inappropriately high levels of cell division, inappropriately low levels of apoptosis, or both. For example, cancer is an example of a neoplasia. Examples of cancers include, without limitation, leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease, non-Hodgkin's disease), Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endothelio sarcoma, lymphangio sarcoma,

lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas,

cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodenroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma). Lymphoproliferative disorders are also considered to be proliferative diseases.

Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive. Unless specifically stated or obvious from context, as used herein, the terms "a," "an," and "the" are understood to be singular or plural.

The term "patient" or "subject" refers to an animal which is the object of treatment, observation, or experiment. By way of example only, a subject includes, but is not limited to, a mammal, including, but not limited to, a human or a non-human mammal, such as a non-human primate, bovine, equine, canine, ovine, or feline.

"Pharmaceutically acceptable" refers to approved or approvable by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, including humans.

"Pharmaceutically acceptable excipient, carrier or diluent" refers to an excipient, carrier or diluent that can be administered to a subject, together with an agent, and which does not destroy the pharmacological activity thereof and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the agent. A "pharmaceutically acceptable salt" of pooled tumor specific neo-antigens as recited herein may be an acid or base salt that is generally considered in the art to be suitable for use in contact with the tissues of human beings or animals without excessive toxicity, irritation, allergic response, or other problem or complication. Such salts include mineral and organic acid salts of basic residues such as amines, as well as alkali or organic salts of acidic residues such as carboxylic acids. Specific pharmaceutical salts include, but are not limited to, salts of acids such as hydrochloric, phosphoric, hydrobromic, malic, glycolic, fumaric, sulfuric, sulfamic, sulfanilic, formic, toluenesulfonic, methanesulfonic, benzene sulfonic, ethane disulfonic, 2- hydroxyethylsulfonic, nitric, benzoic, 2-acetoxybenzoic, citric, tartaric, lactic, stearic, salicylic, glutamic, ascorbic, pamoic, succinic, fumaric, maleic, propionic, hydroxymaleic, hydroiodic, phenylacetic, alkanoic such as acetic, HOOC-(CH₂)_n-COOH where n is 0-4, and the like.

Similarly, pharmaceutically acceptable cations include, but are not limited to sodium, potassium, calcium, aluminum, lithium and ammonium. Those of ordinary skill in the art will recognize further pharmaceutically acceptable salts for the pooled tumor specific neo-antigens provided herein, including those listed by Remington's Pharmaceutical Sciences, 17th ed., Mack

Publishing Company, Easton, PA, p. 1418 (1985). In general, a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in an appropriate solvent.

As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment," and the like, refer to reducing the probability of developing a disease or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease or condition.

"Primer set" means a set of oligonucleotides that may be used, for example, for PCR. A primer set would consist of at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 80, 100, 200, 250, 300, 400, 500, 600, or more primers.

"Proteins or molecules of the major histocompatibility complex (MHC)," "MHC molecules," "MHC proteins" or "HLA proteins" are to be understood as meaning, in particular, proteins capable of binding peptides resulting from the proteolytic cleavage of protein antigens and representing potential T-cell epitopes, transporting them to the cell surface and presenting them to specific cells there, in particular naive T-cells, cytotoxic T-lymphocytes or T-helper cells. The major histocompatibility complex in the genome comprises the genetic region whose gene products are expressed on the cell surface and are important for binding and presenting endogenous and/or foreign antigens, and thus for regulating immunological processes. The major histocompatibility complex is classified into two gene groups coding for different proteins: molecules of MHC class I and MHC class II. The molecules of the two MHC classes are specialized for different antigen sources. The molecules of MHC class I typically present but are not restricted to endogenously synthesized antigens, for example viral proteins and tumor antigens. The molecules of MHC class II present protein antigens originating from exogenous sources, for example bacterial products. The cellular biology and the expression patterns of the two MHC classes are adapted to these different roles.

MHC molecules of class I consist of a heavy chain and a light chain and are capable of binding a peptide of about 8 to 11 amino acids, but usually 9 or 10 amino acids, if this peptide has suitable binding motifs, and presenting it to naive and cytotoxic T- lymphocytes. The peptide bound by the MHC molecules of class I typically but not exclusively originates from an endogenous protein antigen. The heavy chain of the MHC molecules of class I is preferably an HLA-A, HLA-B or HLA-C monomer, and the light chain is β-2-microglobulin.

MHC molecules of class II consist of an cc-chain and a β-chain and are capable of binding a peptide of about 15 to 24 amino acids if this peptide has suitable binding motifs, and presenting it to T-helper cells. The peptide bound by the MHC molecules of class II usually originates from an extracellular or exogenous protein antigen. The cc-chain and the β-chain are in particular HLA-DR, HLA-DQ and HLA-DP monomers.

Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, as well as all intervening decimal values between the aforementioned integers such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to sub-ranges, "nested sub-ranges" that extend from either end point of the range are specifically contemplated. For example, a nested sub-range of an exemplary range of 1 to 50 may comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.

A "receptor" is to be understood as meaning a biological molecule or a molecule grouping capable of binding a ligand. A receptor may serve, to transmit information in a cell, a cell formation or an organism. The receptor comprises at least one receptor unit and frequently contains two or more receptor units, where each receptor unit may consist of a protein molecule, in particular a glycoprotein molecule. The receptor has a structure that complements the structure of a ligand and may complex the ligand as a binding partner. Signaling information may be transmitted by conformational changes of the receptor following binding with the ligand on the surface of a cell. According to the invention, a receptor may refer to particular proteins of MHC classes I and II capable of forming a receptor/ligand complex with a ligand, in particular a peptide or peptide fragment of suitable length.

A "receptor/ligand complex" is also to be understood as meaning a "receptor/peptide complex" or "receptor/peptide fragment complex," in particular a peptide- or peptide fragment- presenting MHC molecule of class I or of class II.

By "reduces" is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.

By "reference" is meant a standard or control condition.

A "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of, or the entirety of, a specified sequence; for example, a segment of a full-length cDNA or genomic sequence, or the complete cDNA or genomic sequence. For polypeptides, the length of the reference polypeptide sequence will generally be at least about 10-2,000 amino acids, 10-1,500, 10-1,000, 10-500, or 10-100. Preferably, the length of the reference polypeptide sequence may be at least about 10-50 amino acids, more preferably at least about 10-40 amino acids, and even more preferably about 10-30 amino acids, about 10- 20 amino acids, about 15-25 amino acids, or about 20 amino acids. For nucleic acids, the length of the reference nucleic acid sequence will generally be at least about 50 nucleotides, preferably at least about 60 nucleotides, more preferably at least about 75 nucleotides, and even more preferably about 100 nucleotides or about 300 nucleotides or any integer thereabout or there between. By "specifically binds" is meant a compound or antibody that recognizes and binds a polypeptide of the invention, but which does not substantially recognize and bind other molecules in a sample, for example, a biological sample.

Nucleic acid molecules useful in the methods of the invention include any nucleic acid molecule that encodes a polypeptide of the invention or a fragment thereof. Such nucleic acid molecules need not be 100% identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Polynucleotides having "substantial identity" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double- stranded nucleic acid molecule. . By "hybridize" is meant pair to form a double- stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. (See, e.g., Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152:399; Kimmel, A. R. (1987) Methods Enzymol. 152:507).

For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30°C, more preferably of at least about 37°C, and most preferably of at least about 42°C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred: embodiment, hybridization will occur at 30°C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42°C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.

For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25°C, more preferably of at least about 42°C, and even more preferably of at least about 68°C. In a preferred embodiment, wash steps will occur at 25°C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68°C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al.,

Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least 60%, more preferably 80% or 85%, and more preferably 90%, 95% or even 99% identical at the amino acid level or nucleic acid to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e^"3 and e^"100 indicating a closely related sequence.

A "T-cell epitope" is to be understood as meaning a peptide sequence that can be bound by MHC molecules of class I or II in the form of a peptide-presenting MHC molecule or MHC complex and then, in this form, be recognized and bound by naive T-cells, cytotoxic T- lymphocytes or T-helper cells.

As used herein, the terms "treat," "treated," "treating," "treatment," and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith (e.g., a neoplasia or tumor). It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated.

The term "therapeutic effect" refers to some extent of relief of one or more of the symptoms of a disorder (e.g., a neoplasia or tumor) or its associated pathology. "Therapeutically effective amount" as used herein refers to an amount of an agent which is effective, upon single or multiple dose administration to the cell or subject, in prolonging the survivability of the patient with such a disorder, reducing one or more signs or symptoms of the disorder, preventing or delaying, and the like beyond that expected in the absence of such treatment.

"Therapeutically effective amount" is intended to qualify the amount required to achieve a therapeutic effect. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "therapeutically effective amount" (e.g., ED50) of the

pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in a pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

The pharmaceutical compositions typically should provide a dosage of from about 0.0001 mg to about 200 mg of compound per kilogram of body weight per day. For example, dosages for systemic administration to a human patient can range from 0.01-10 μg/kg, 20-80 μg/kg, 5-50 μg/kg, 75-150 μg/kg, 100-500 μg/kg, 250-750 μg/kg, 500-1000 μg/kg, 1-10 mg/kg, 5-50 mg/kg, 25-75 mg/kg, 50-100 mg/kg, 100-250 mg/kg, 50-100 mg/kg, 250-500 mg/kg, 500-750 mg/kg, 750-1000 mg/kg, 1000-1500 mg/kg, 1500-2000 mg/kg, 5 mg/kg, 20 mg/kg, 50 mg/kg, 100 mg/kg, of 200 mg/kg. Pharmaceutical dosage unit forms are prepared to provide from about 0.001 mg to about 5000 mg, for example from about 100 to about 2500 mg of the compound or a combination of essential ingredients per dosage unit form.

A "vaccine" is to be understood as meaning a composition for generating immunity for the prophylaxis and/or treatment of diseases (e.g., neoplasia/tumor). Accordingly, vaccines are medicaments which comprise antigens and are intended to be used in humans or animals for generating specific defense and protective substance by vaccination.

The recitation of a listing of chemical groups in any definition of a variable herein includes definitions of that variable as any single group or combination of listed groups. The recitation of an embodiment for a variable or aspect herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.

BRIEF DESCRIPTION OF THE DRAWINGS

The above-mentioned and other features and advantages of the present disclosure will be better understood when reading the following detailed description taken together with the following drawings in which:

Figure 1 depicts a flow process for making a personalized cancer vaccine according to an exemplary embodiment of the invention.

Figure 2 shows a flow process for pre-treatment steps for generating a cancer vaccine for a melanoma patient according to an exemplary embodiment of the invention.

Figure 3 is a flowchart depicting an approach for addressing an initial patient population study according to an exemplary embodiment of the invention. Five patients may be treated in the first cohort at an anticipated safe dose level. If fewer than two of these five patients develop a dose limiting toxicity at, or prior to, the primary safety endpoint, then 10 more patients may be recruited at that dose level to expand the analysis of the patient population (e.g., to assess efficacy, safety, etc.). If two or more dose limiting toxicities (DLTs) are observed, then the dose of poly-ICLC may be reduced by 50% and five additional patients may be treated. If fewer than two of these five patients develop a dose limiting toxicity, then 10 more patients may be recruited at that dose level. However, if two or more patients at the reduced poly-ICLC level develop a DLT, then the study will be stopped. Figures 4A and 4B show examples of different types of discrete mutations and neoORFs, respectively.

Figure 5 illustrates an immunization schedule based on a prime boost strategy according to an exemplary embodiment of the present invention. Multiple immunizations may occur over the first ~3 weeks to maintain an early high antigen exposure during the priming phase of immune response. Patients may then be rested for eight weeks to allow memory T cells to develop and these T cells will then be boosted in order to maintain a strong ongoing response.

Figure 6 shows a time line indicating the primary immunological endpoint according to an exemplary aspect of the invention.

Figure 7 illustrates a time line for administering a co-therapy with checkpoint blockade antibodies to evaluate the combination of relief of local immune suppression coupled with the stimulation of new immunity according to an exemplary embodiment of the invention. As shown in the scheme, patients who enter as appropriate candidates for checkpoint blockade therapy, e.g., anti-PDLl as shown here, may be entered and immediately treated with antibody, while the vaccine is being prepared. Patients may then be vaccinated. Checkpoint blockade antibody dosing can be continued or possibly deferred while the priming phase of vaccination occurs.

Figure 8 is a table that shows the ranking assignments for different neo-antigenic mutations according to an exemplary embodiment of the invention.

Figure 9 shows a schematic depicting drug product processing of individual neo- antigenic peptides into pools of 4 subgroups according to an exemplary embodiment of the invention.

Figure 10 shows a schematic representation of a strategy to systematically discover tumor neoantigens according to an exemplary embodiment of the invention. Tumor specific mutations in cancer samples may be detected using whole-exome (WES) or whole-genome sequencing (WGS) and identified through the application of mutation calling algorithms (e.g., Mutect). Subsequently, candidate neoepitopes may be predicted using well-validated algorithms (e.g., NetMHCpan) and their identification may be refined by experimental validation for peptide- HLA binding and by confirmation of gene expression at the RNA level. These candidate neoantigens may be subsequently tested for their ability to stimulate tumor- specific T cell responses. Figures 11 A-C show the frequency of classes of point mutations that have the potential to generate neoantigens in chronic lymphocytic leukemia (CLL). Analysis of WES and WGS data generated from 91 CLL cases reveals that (A) missense mutations are the most frequent class of the somatic alterations with the potential to generate neo-epitopes, while (B) frameshift insertions and deletions and (C) splice-site mutations constitute less common events.

Figures 12A-D depict the application of the NetMHCpan prediction algorithm to functionally-defined neoepitopes and CLL cases. FIG. 12 A shows the predicted binding (IC50) to their known restricting HLA allele of 33 functionally identified cancer neoepitopes reported in literature tested by NetMHCpan, sorted on the basis of predicted binding affinity. FIG. 12B shows the distribution of the number of predicted peptides with HLA binding affinity < 150 nM (black) and 150-500 nM (grey) across 31 CLL patients with available HLA typing information. FIG. 12C shows a graph comparing the predicted binding (IC50 < 500 nM by NetMHCpan) of peptides from 4 patients with the experimentally determined binding affinity for HLA-A and -B allele binding using a competitive MHC I allele -binding assay with synthesized peptides. The percent of predicted peptides with evidence of experimental binding (IC50 < 500 nM) are indicated. FIG. 12D shows that from 26 CLL patients for which HLA typing and Affymetrix U133 2.0+ gene expression data were available, the distribution of gene expression was examined for all somatically mutated genes (n=347), and for the subset of gene mutations encoding neoepitopes with predicted HLA binding scores of IC50 < 500 nM (n=180). No-low: genes within the lowest quartile expression; medium: genes within the 2 middle quartiles of expression; and high: genes within the highest quartile of expression.

Figures 13A-B show the same data as in Figure 12D but separately for 9-mer (FIG. 13A) and 10-mer peptides (FIG. 13B). In each case, percentages of peptides with predicted IC50 < 150 nM and 150-500 nM, with evidence of experimental binding are indicated.

Figures 14 A-C depict that mutations in ALMS! and C60RF89 in Pt I generate immunogenic peptides. FIG. 14A shows that 25 missense mutations were identified in Pt I CLL cells from which 30 peptides from 13 mutations were predicted to bind to Pt l's MHC class I alleles. A total of 14 peptides from 9 mutations were experimentally confirmed as HLA-binding. Post-transplant T cells (7 yrs) from Pt 1 were stimulated weekly ex vivo for 4 weeks with 5 pools of 6 mutated peptides with similar predicted HLA binding, per pool, and subsequently tested by IFN-γ ELISPOT assay. FIG. 14B shows that increased IFN-γ secretion by T cells was detected against Pool 2 peptides. Negative control - Irrelevant Tax peptide; positive control - PHA. FIG. 14C shows that of Pool 2 peptides, Pt 1 T cells were reactive to mutated ALMS] and C60RF89 peptides (right panel; averaged results from duplicate wells are displayed). Left panel-The predicted and experimental IC50 scores (nM) of mutated and wildtype ALMS1 and C60RF89 peptides.

Figure 15 illustrates that the sequence context around the sites of mutations in FNDC3B, C6orf89 and ALMS] lack evolutionary conservation. The neoepitopes generated from each of the genes are boxed. Red- conserved amino acids (aa) in all 4 species; blue- conserved aa in at least 2 of 4 species; black -absent conservation across species.

Figure 16 shows localization of somatic mutations reported in FNDC3B, C6orf89 and

ALMS! genes. Missense mutations identified in FNDC3B, C6orf89 and ALMS! in CLL Pts 1 and 2 compared to previously reported somatic mutations in these genes (COSMIC database) across cancers.

Figure 17 shows that mutated FNDC3B generates a naturally immunogenic neoepitope in Pt 2. FIG. 17A shows 26 missense mutations were identified in Pt 2 CLL cells from which 37 peptides from 16 mutations were predicted to bind to Pt 2's MHC class I alleles. A total of 18 peptides from 12 mutations were experimentally confirmed to bind. Post-transplant T cells (~3 yrs) from Pt 2 were stimulated with autologous DCs or B cells pulsed with 3 pools of experimentally validated binding mutated peptides (18 peptides total) for 2 weeks ex vivo (See table S6J. FIG. 17B shows increased IFN-γ secretion was detected by ELISPOT assay in T cells stimulated with Pool 1 peptides. FIG. 17C shows that of Pool 1 peptides, increased IFN-γ secretion was detected against the

peptide (bottom panel; averaged results from duplicated wells are displayed). Top panel - Predicted and experimental IC50 scores of mut- and wt- FNDC3B peptides. FIG. 17D illustrates that T cells reactive to

demonstrate specificity to the mutated epitope but not the corresponding wildtype peptide (concentrations:

0.1-10 μg/ml), and are polyfunctional, secreting IFN-γ, GM-CSF and IL-2 (Tukey post-hoc tests from two-way ANOVA modeling for comparisons between T cell reactivity against mut vs wt peptide). FIG. 17E shows that Mut-iWDCJfi-specific T cells are reactive in a class I-restricted manner (left), and recognize an endogenously processed and presented form of mutated

FNDC3B, since they recognized HLA-A2 APCs transfected with a plasmid encoding a minigene of 300bp encompassing the FNDC3B mutation (right) (two-sided t test). Top right - Western blot analysis-confirming expression of minigenes encoding mut- and wt- FNDC3B. FIG. 17F shows that T cells recognizing the m t-FNDC3B epitope as detected by HLA-A2⁺/mut FNDC3B tetramers are more frequently detected in T cells in Pt 2 compared to T cells from a normal donor. FIG. 17G shows expression of FNDC3B (based on Affymetrix U133Plus2 array data) in Pt 2 (triangle), CLL-B cells (n=182) and normal CD 19+ B cells from healthy adult volunteers (n=24).

Figure 18 illustrates kinetics of the

specific T cell response in relation to the transplant course. FIG. 18 shows molecular tumor burden was measured in Pt 2 using a patient tumor- specific Taqman PCR assay based on the clonotypic IgH sequence at serial time points before and after HSCT (top panel). Middle panel- Detection of mut- FNDC3B reactive T cells in comparison to wt-FNDC3B or irrelevant peptides from peripheral blood before and after allo-HSCT by IFN-γ ELISPOT following stimulation with peptide-pulsed autologous B cells. The number of IFN-y-secreting spots per cells at each time point was measured in triplicate (Welch t test; mut vs. wt). Inset - IFN-γ secretion of T cells from 6 months post-HSCT (purple) compared to 32 months post-HSCT (red) following exposure to APCs pulsed with 0.1-10 g/ml (log scale)

peptide. Bottom panel - Detection of mut-iWDCJfi-specific TCR νβΐ 1 cells by nested clone-specific CDR3 PCR before and after HSCT in peripheral blood of Pt 2 (See supplementary methods). Triangles - time points at which a sample was tested; NA- no amplification; black: amplification detected, where '+' indicates detectable amplification up to 2- fold and '++' indicates more than 2-fold greater amplification than the median level of all samples with detectable expression of the clone- specific νβΐ ΐ sequence.

Figures 19A-D show the design of

specific TCR νβ specific primers in Pt 2. FIG. 19A shows vX-FNDC3B specific T cells detected and isolated from Pt 2 PBMCs 6 months following HSCT using an IFN- γ catch assay. FIG. 19B shows RNA from FNDC3B- reactive T cells expressed TCR νβΐΐ, generating an amplicon of 350bp in length. FIG. 19C shows νβ 11 -specific real time primers were designed based on the sequence of the mut- FNDC3B clone- specific CDR3 rearrangement, such that the quantitative PCR probe was positioned in the region of junctional diversity (orange). FIG. 19D shows FNDC3B-reactive T cells were monoclonal for νβΐ 1, as detected by spectratyping.

Figures 20 A-G illustrate the application of the neoantigen discovery pipeline across cancers, FIG. 20A shows the comparison of overall somatic mutation rate detected across cancers by massively parallel sequencing. Red-CLL; blue-clear cell renal carcinoma (RCC) and green- melanoma. LSCC: Lung squamous cell carcinoma, Lung AdCa: Lung adenocarcinoma, ESO AdCa: Esophageal adenocarcinoma, DLBCL: Diffused large B- cell lymphoma, GBM: Glioblastoma, Papillary RCC: Papillary renal cell carcinoma. Clear Cell RCC: Clear cell renal carcinoma, CLL: Chronic lymphocytic leukemia, A ML: Acute myeloid leukemia. Distribution of FIG. 20B shows the number of missense, frameshift and splice-site mutations per case in melanoma, clear ceil RCC and CLL, FIG. 20C shows the average neoORF length generated per sample and FIG. 20D shows predicted neopeptides with IC50 < 150 nM (dashed lines) and < 500 nM (solid lines) generated from missense and frameshift mutations. FIGS. 20E depicts the distributions (shown by box plot) of the number of missense, frameshift and splice-site mutations per case across 13 cancers, FIG. 20F shows the summed neoORF length generated per sample. 20G shows the predicted neopeptides with IC50 < 150 nM and with < 500 nM generated from missense and frameshift mutations,. For all box plots, the left and right ends of the boxes represent the 25th and 75th percentile values, respectively, while the segment in the middle is the median. The left and right extremes of the bars extend to the minimum and maximum values..

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to personalized strategies for the treatment of neoplasia, and more particularly tumors, by administering a therapeutically effective amount of a

pharmaceutical composition (e.g., a cancer vaccine) comprising a plurality of neoplasia/tumor specific neo-antigens to a subject (e.g., a mammal such as a human). As described in more detail below, the present invention is based, at least in part, on the discovery that whole genome/ex ome sequencing may be used to identify all, or nearly all, mutated neo-antigens that are uniquely present in a neoplasia/tumor of an individual patient, and that this collection of mutated neo- antigens may be analyzed to identify a specific, optimized subset of neo-antigens for use as a personalized cancer vaccine for treatment of the patient's neoplasia/tumor. For example, as shown in FIG. 1, a population of neoplasia/tumor specific neo-antigens may be identified by sequencing the neoplasia/tumor and normal DNA of each patient to identify tumor- specific mutations, and determining the patient's HLA allotype. The population of neoplasia/tumor specific neo-antigens and their cognate native antigens may then be subject to bioinformatic analysis using validated algorithms to predict which tumor- specific mutations create epitopes that could bind to the patient's HLA allotype, and in particular which tumor- specific mutations create epitopes that could bind to the patient' s HLA allotype more effectively than the cognate native antigen. Based on this analysis, a plurality of peptides corresponding to a subset of these mutations may be designed and synthesized for each patient, and pooled together for use as a cancer vaccine in immunizing the patient. The neo-antigens peptides may be combined with an adjuvant (e.g., poly-ICLC) or another anti-neoplastic agent. Without being bound by theory, these neo-antigens are expected to bypass central thymic tolerance (thus allowing stronger antitumor T cell response), while reducing the potential for autoimmunity (e.g., by avoiding targeting of normal self-antigens).

The immune system can be classified into two functional subsystems: the innate and the acquired immune system. The innate immune system is the first line of defense against infections, and most potential pathogens are rapidly neutralized by this system before they can cause, for example, a noticeable infection. The acquired immune system reacts to molecular structures, referred to as antigens, of the intruding organism. There are two types of acquired immune reactions, which include the humoral immune reaction and the cell-mediated immune reaction. In the humoral immune reaction, antibodies secreted by B cells into bodily fluids bind to pathogen-derived antigens, leading to the elimination of the pathogen through a variety of mechanisms, e.g. complement-mediated lysis. In the cell-mediated immune reaction, T-cells capable of destroying other cells are activated. For example, if proteins associated with a disease are present in a cell, they are fragmented proteolytically to peptides within the cell. Specific cell proteins then attach themselves to the antigen or peptide formed in this manner and transport them to the surface of the cell, where they are presented to the molecular defense mechanisms, in particular T-cells, of the body. Cytotoxic T cells recognize these antigens and kill the cells that harbor the antigens.

The molecules that transport and present peptides on the cell surface are referred to as proteins of the major histocompatibility complex (MHC). MHC proteins are classified into two types, referred to as MHC class I and MHC class II. The structures of the proteins of the two MHC classes are very similar; however, they have very different functions. Proteins of MHC class I are present on the surface of almost all cells of the body, including most tumor cells. MHC class I proteins are loaded with antigens that usually originate from endogenous proteins or from pathogens present inside cells, and are then presented to naive or cytotoxic T-lymphocytes (CTLs). MHC class II proteins are present on dendritic cells, B- lymphocytes, macrophages and other antigen-presenting cells. They mainly present peptides, which are processed from external antigen sources, i.e. outside of the cells, to T-helper (Th) cells. Most of the peptides bound by the MHC class I proteins originate from cytoplasmic proteins produced in the healthy host cells of an organism itself, and do not normally stimulate an immune reaction. Accordingly, cytotoxic T-lymphocytes that recognize such self-peptide-presenting MHC molecules of class I are deleted in the thymus (central tolerance) or, after their release from the thymus, are deleted or inactivated, i.e. tolerized (peripheral tolerance). MHC molecules are capable of stimulating an immune reaction when they present peptides to non-tolerized T-lymphocytes. Cytotoxic T- lymphocytes have both T-cell receptors (TCR) and CD8 molecules on their surface. T-Cell receptors are capable of recognizing and binding peptides complexed with the molecules of MHC class I. Each cytotoxic T-lymphocyte expresses a unique T-cell receptor which is capable of binding specific MHC/peptide complexes.

The peptide antigens attach themselves to the molecules of MHC class I by competitive affinity binding within the endoplasmic reticulum, before they are presented on the cell surface. Here, the affinity of an individual peptide antigen is directly linked to its amino acid sequence and the presence of specific binding motifs in defined positions within the amino acid sequence. If the sequence of such a peptide is known, it is possible to manipulate the immune system against diseased cells using, for example, peptide vaccines.

One of the critical barriers to developing curative and tumor- specific immunotherapy is the identification and selection of highly specific and restricted tumor antigens to avoid autoimmunity. Tumor neo-antigens, which arise as a result of genetic change (e.g., inversions, translocations, deletions, missense mutations, splice site mutations, etc.) within malignant cells, represent the most tumor- specific class of antigens. Neo-antigens have rarely been used in cancer vaccines due to technical difficulties in identifying them, selecting optimized neo- antigens, and producing neo-antigens for use in a vaccine. According to the present invention, these problems may be addressed by:

• identifying all, or nearly all, mutations in the neoplasia/tumor at the DNA level using whole genome, whole exome (e.g., only captured exons), or RNA sequencing of tumor versus matched germline samples from each patient; • analyzing the identified mutations with one or more peptide-MHC binding prediction algorithms to generate a plurality of candidate neo-antigen T cell epitopes that are expressed within the neoplasia/tumor and may bind patient HLA alleles; and

• synthesizing the plurality of candidate neo-antigen peptides selected from the sets of all neoORF peptides and predicted binding peptides for use in a cancer vaccine.

For example, translating sequencing information into a therapeutic vaccine may include:

(1) Prediction of personal mutated peptides that can bind to HLA molecules of the individual. Efficiently choosing which particular mutations to utilize as immunogen requires identification of the patient HLA type and the ability to predict which mutated peptides would efficiently bind to the patient's HLA alleles. Recently, neural network based learning approaches with validated binding and non-binding peptides have advanced the accuracy of prediction algorithms for the major HLA-A and -B alleles.

(2) Formulating the drug as a multi-epitope vaccine of long peptides. Targeting as many mutated epitopes as practically possible takes advantage of the enormous capacity of the immune system, prevents the opportunity for immunological escape by down-modulation of a particular immune targeted gene product, and compensates for the known inaccuracy of epitope prediction approaches. Synthetic peptides provide a particularly useful means to prepare multiple immunogens efficiently and to rapidly translate identification of mutant epitopes to an effective vaccine. Peptides can be readily synthesized chemically and easily purified utilizing reagents free of contaminating bacteria or animal substances. The small size allows a clear focus on the mutated region of the protein and also reduces irrelevant antigenic competition from other components (unmutated protein or viral vector antigens).

(3) Combination with a strong vaccine adjuvant. Effective vaccines require a strong adjuvant to initiate an immune response. As described below, poly-ICLC, an agonist of TLR3 and the RNA helicase -domains of MDA5 and RIG3, has shown several desirable properties for a vaccine adjuvant. These properties include the induction of local and systemic activation of immune cells in vivo, production of stimulatory chemokines and cytokines, and stimulation of antigen-presentation by DCs. Furthermore, poly-ICLC can induce durable CD4⁺ and CD8⁺ responses in humans. Importantly, striking similarities in the upregulation of transcriptional and signal transduction pathways were seen in subjects vaccinated with poly-ICLC and in volunteers who had received the highly effective, replication-competent yellow fever vaccine. Furthermore, >90 of ovarian carcinoma patients immunized with poly- ICLC in combination with a NY- ESO-1 peptide vaccine (in addition to Montanide) showed induction of CD4⁺ and CD8⁺ T cell, as well as antibody responses to the peptide in a recent phase 1 study. At the same time, poly- ICLC has been extensively tested in more than 25 clinical trials to date and exhibited a relatively benign toxicity profile.

The above-described advantages of the invention are described in further detail below.

Identification of Tumor Specific Neo-antigen Mutations

The present invention is based, at least in part, on the ability to identify all, or nearly all, of the mutations within a neoplasia/tumor (e.g., translocations, inversions, large and small deletions and insertions, missense mutations, splice site mutations, etc.). In particular, these mutations are present in the genome of neoplasia/tumor cells of a subject, but not in normal tissue from the subject. Such mutations are of particular interest if they lead to changes that result in a protein with an altered amino acid sequence that is unique to the patient's

neoplasia/tumor (e.g., a neo-antigen). For example, useful mutations may include: (1) non- synonymous mutations leading to different amino acids in the protein; (2) read-through mutations in which a stop codon is modified or deleted, leading to translation of a longer protein with a novel tumor- specific sequence at the C-terminus; (3) splice site mutations that lead to the inclusion of an intron in the mature mRNA and thus a unique tumor- specific protein sequence; (4) chromosomal rearrangements that give rise to a chimeric protein with tumor- specific sequences at the junction of 2 proteins (i.e., gene fusion); (5) frameshift mutations or deletions that lead to a new open reading frame with a novel tumor- specific protein sequence; and the like. Peptides with mutations or mutated polypeptides arising from, for example, splice- site, frameshift, read-through, or gene fusion mutations in tumor cells may be identified by sequencing DNA, RNA or protein in tumor versus normal cells.

Also within the scope of the inventions is personal neo-antigen peptides derived from common tumor driver genes and may further include previously identified tumor specific mutations. For example, known common tumor driver genes and tumor mutations in common tumor driver genes may be found on the world wide web at (www)sanger.ac.uk/cosmic.

A number of initiatives are currently underway to obtain sequence information directly from millions of individual molecules of DNA or RNA in parallel. Real-time single molecule sequencing-by-synthesis technologies rely on the detection of fluorescent nucleotides as they are incorporated into a nascent strand of DNA that is complementary to the template being sequenced. In one method, oligonucleotides 30-50 bases in length are covalently anchored at the 5' end to glass cover slips. These anchored strands perform two functions. First, they act as capture sites for the target template strands if the templates are configured with capture tails complementary to the surface-bound oligonucleotides. They also act as primers for the template directed primer extension that forms the basis of the sequence reading. The capture primers function as a fixed position site for sequence determination using multiple cycles of synthesis, detection, and chemical cleavage of the dye-linker to remove the dye. Each cycle consists of adding the polymerase/labeled nucleotide mixture, rinsing, imaging and cleavage of dye. In an alternative method, polymerase is modified with a fluorescent donor molecule and immobilized on a glass slide, while each nucleotide is color-coded with an acceptor fluorescent moiety attached to a gamma-phosphate. The system detects the interaction between a fluorescently- tagged polymerase and a fluorescently modified nucleotide as the nucleotide becomes incorporated into the de novo chain. Other sequencing -by- synthesis technologies also exist.

Preferably, any suitable sequencing-by- synthesis platform can be used to identify mutations. Four major sequencing-by- synthesis platforms are currently available: the Genome Sequencers from Roche/454 Life Sciences, the HiSeq Analyzer from Illumina/Solexa, the SOLiD system from Applied BioSystems, and the Heliscope system from Helicos Biosciences. Sequencing-by- synthesis platforms have also been described by Pacific Biosciences and VisiGen Biotechnologies. Each of these platforms can be used in the methods of the invention. In some embodiments, a plurality of nucleic acid molecules being sequenced is bound to a support (e.g., solid support). To immobilize the nucleic acid on a support, a capture sequence/universal priming site can be added at the 3' and/or 5' end of the template. The nucleic acids may be bound to the support by hybridizing the capture sequence to a complementary sequence covalently attached to the support. The capture sequence (also referred to as a universal capture sequence) is a nucleic acid sequence complementary to a sequence attached to a support that may dually serve as a universal primer.

As an alternative to a capture sequence, a member of a coupling pair (such as, e.g., antibody/antigen, receptor/ligand, or the avidin-biotin pair as described in, e.g., U.S. Patent Application No. 2006/0252077) may be linked to each fragment to be captured on a surface coated with a respective second member of that coupling pair. Subsequent to the capture, the sequence may be analyzed, for example, by single molecule detection/sequencing, e.g., as described in the Examples and in U.S. Patent No. 7,283,337, including template-dependent sequencing-by- synthesis. In sequencing-by-synthesis, the surface-bound molecule is exposed to a plurality of labeled nucleotide triphosphates in the presence of polymerase. The sequence of the template is determined by the order of labeled nucleotides incorporated into the 3' end of the growing chain. This can be done in real time or in a step-and-repeat mode. For real-time analysis, different optical labels to each nucleotide may be incorporated and multiple lasers may be utilized for stimulation of incorporated nucleotides.

Any cell type or tissue may be utilized to obtain nucleic acid samples for use in the sequencing methods described herein. In a preferred embodiment, the DNA or RNA sample is obtained from a neoplasia/tumor or a bodily fluid, e.g., blood, obtained by known techniques (e.g. venipuncture) or saliva. Alternatively, nucleic acid tests can be performed on dry samples (e.g. hair or skin).

A variety of methods are available for detecting the presence of a particular mutation or allele in an individual's DNA or RNA. Advancements in this field have provided accurate, easy, and inexpensive large-scale SNP genotyping. Most recently, for example, several new techniques have been described including dynamic allele- specific hybridization (DASH), microplate array diagonal gel electrophoresis (MADGE), pyrosequencing, oligonucleotide- specific ligation, the TaqMan system as well as various DNA "chip" technologies such as the Affymetrix SNP chips. These methods require amplification of the target genetic region, typically by PCR. Still other newly developed methods, based on the generation of small signal molecules by invasive cleavage followed by mass spectrometry or immobilized padlock probes and rolling-circle amplification, might eventually eliminate the need for PCR. Several of the methods known in the art for detecting specific single nucleotide polymorphisms are summarized below. The method of the present invention is understood to include all available methods.

PCR based detection means may include multiplex amplification of a plurality of markers simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously.

Alternatively, it is possible to amplify different markers with primers that are

differentially labeled and thus can each be differentially detected. Of course, hybridization based detection means allow the differential detection of multiple PCR products in a sample. Other techniques are known in the art to allow multiplex analyses of a plurality of markers.

Several methods have been developed to facilitate analysis of single nucleotide polymorphisms in genomic DNA or cellular RNA. In one embodiment, the single base polymorphism can be detected by using a specialized exonuclease-resistant nucleotide, as disclosed, e.g., U.S. Patent No. 4,656,127. According to the method, a primer complementary to the allelic sequence immediately 3' to the polymorphic site is permitted to hybridize to a target molecule obtained from a particular animal or human. If the polymorphic site on the target molecule contains a nucleotide that is complementary to the particular exonuclease-resistant nucleotide derivative present, then that derivative will be incorporated onto the end of the hybridized primer. Such incorporation renders the primer resistant to exonuclease, and thereby permits its detection. Since the identity of the exonuclease-resistant derivative of the sample is known, a finding that the primer has become resistant to exonucleases reveals that the nucleotide present in the polymorphic site of the target molecule was complementary to that of the nucleotide derivative used in the reaction. This method has the advantage that it does not require the determination of large amounts of extraneous sequence data.

In another embodiment of the invention, a solution-based method is used for determining the identity of the nucleotide of a polymorphic site. Cohen et al. (French Patent No. 2,650,840; PCT Application No. WO1991/02087). As in the method of U.S. Patent No. 4,656,127, a primer may be employed that is complementary to allelic sequences immediately 3' to a polymorphic site. The method determines the identity of the nucleotide of that site using labeled dideoxynucleotide derivatives, which, if complementary to the nucleotide of the polymorphic site, will become incorporated onto the terminus of the primer.

An alternative method, known as Genetic Bit Analysis or GBA® is described in PCT Application No. WO 1992/ 15712). GBA® uses mixtures of labeled terminators and a primer that is complementary to the sequence 3' to a polymorphic site. The labeled terminator that is incorporated is thus determined by, and complementary to, the nucleotide present in the polymorphic site of the target molecule being evaluated. In contrast to the method of Cohen et al. (French Patent 2,650,840; PCT Application No. W01991/02087) the GBA® method is preferably a heterogeneous phase assay, in which the primer or the target molecule is immobilized to a solid phase. Recently, several primer-guided nucleotide incorporation procedures for assaying polymorphic sites in DN A have been described (Komher, J. S. et al., Nucl. Acids. Res.

17:7779- 7784 (1989); Sokolov, B. P., Nucl. Acids Res. 18:3671 (1990); Syvanen, A.-C, et al., Genomics 8:684-692 (1990); Kuppuswamy, M. N. et al., Proc. Natl. Acad. Sci. (U.S.A.) 88: 1143- 1147 (1991); Prezant, T. R. et al., Hum. Mutat. 1: 159-164 (1992); Ugozzoli, L. et al., GATA 9: 107- 112 (1992); Nyren, P. et al., Anal. Biochem. 208: 171-175 (1993)). These methods differ from GBA® in that they all rely on the incorporation of labeled deoxynucleotides to discriminate between bases at a polymorphic site. In such a format, since the signal is proportional to the number of deoxynucleotides incorporated, polymorphisms that occur in runs of the same nucleotide can result in signals that are proportional to the length of the run

(Syvanen, A.-C, et al., Amer. J. Hum. Genet. 52:46-59 (1993)).

An alternative method for identifying tumor specific neo-antigens is direct protein sequencing. Protein sequencing of enzymatic digests using multidimensional MS techniques (MSn) including tandem mass spectrometry (MS/MS)) can also be used to identify neo-antigens of the invention. Such proteomic approaches permit rapid, highly automated analysis (see, e.g., K. Gevaert and J. Vandekerckhove, Electrophoresis 21: 1145- 1154 (2000)). It is further contemplated within the scope of the invention that high-throughput methods for de novo sequencing of unknown proteins may be used to analyze the proteome of a patient' s tumor to identify expressed neo-antigens. For example, meta shotgun protein sequencing may be used to identify expressed neo-antigens (see e.g., Guthals et al. (2012) Shotgun Protein Sequencing with Meta-contig Assembly, Molecular and Cellular Proteomics 11(10): 1084-96).

Tumor specific neo-antigens may also be identified using MHC multimers to identify neo-antigen- specific T-cell responses. For example, highthroughput analysis of neo-antigen- specific T-cell responses in patient samples may be performed using MHC tetramer-based screening techniques (see e.g., Hombrink et al. (2011) High-Throughput Identification of

Potential Minor Histocompatibility Antigens by MHC Tetramer-Based Screening: Feasibility and Limitations 6(8): 1-11; Hadrup et al. (2009) Parallel detection of antigen- specific T-cell responses by multidimensional encoding of MHC multimers, Nature Methods, 6(7):520-26; van Rooij et al. (2013) Tumor exome analysis reveals neoantigen-specific T-cell reactivity in an Ipilimumab-responsive melanoma, Journal of Clinical Oncology, 31: 1-4; and Heemskerk et al. (2013) The cancer antigenome, EMBO Journal, 32(2): 194-203). It is contemplated within the scope of the invention that such tetramer-based screening techniques may be used for the initial identification of tumor specific neo-antigens, or alternatively as a secondary screening protocol to assess what neo-antigens a patient may have already been exposed to, thereby facilitating the selection of candidate neo-antigens for the vaccines of the invention.

Design of Tumor Specific Neo- Antigens

The invention further includes isolated peptides (e.g., neo-antigenic peptides containing the tumor specific mutations identified by the methods of the invention, peptides that comprise know tumor specific mutations, and mutant polypeptides or fragments thereof identified by the method of the invention). These peptides and polypeptides are referred to herein as "neo- antigenic peptides" or "neo-antigenic polypeptides." The term "peptide" is used interchangeably with "mutant peptide" and "neo-antigenic peptide" and "wildtype peptide" in the present specification to designate a series of residues, typically L-amino acids, connected one to the other, typically by peptide bonds between the alpha-amino and alpha-carboxyl groups of adjacent amino acids. The polypeptides or peptides can be of a variety of lengths and will minimally include the small region predicted to bind to the HLA molecule of the patient (the "epitope") as well as additional adjacent amino acids extending in both the N- and C-terminal directions. The polypeptides or peptides can be either in their neutral (uncharged) forms or in forms which are salts, and either free of modifications such as glycosylation, side chain oxidation, or phosphorylation or containing these modifications, subject to the condition that the modification not destroy the biological activity of the polypeptides as herein described.

In certain embodiments the size of the at least one neo-antigenic peptide molecule may comprise, but is not limited to, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120 or greater amino molecule residues, and any range derivable therein. In specific embodiments the neo-antigenic peptide molecules are equal to or less than 50 amino acids. In a preferred embodiment, the neo-antigenic peptide molecules are equal to about 20 to about 30 amino acids. A longer peptide may be designed in several ways. For example, when the HLA-binding regions (e.g., the "epitopes") are predicted or known, a longer peptide may consist of either: individual binding peptides with an extension of 0-10 amino acids toward the N- and C-terminus of each corresponding gene product. A longer peptide may also consist of a concatenation of some or all of the binding peptides with extended sequences for each. In another case, when sequencing reveals a long (>10 residues) neo-epitope sequence present in the tumor (e.g. due to a frameshift, read-through or intron inclusion that leads to a novel peptide sequence), a longer peptide may consist of the entire stretch of novel tumor- specific amino acids. In both cases, use of a longer peptide requires endogenous processing by professional antigen presenting cells such as dendritic cells and may lead to more effective antigen presentation and induction of T cell responses. In some cases, it is desirable or preferable to alter the extended sequence to improve the biochemical properties of the polypeptide (properties such as solubility or stability) or to improve the likelihood for efficient proteasomal processing of the peptide (Zhang et al (2012) Aminopeptidase substrate preference affects HIV epitope presentation and predicts immune escape patterns in HIV-infected individuals. J. Immunol 188:5924-34; Hearn et al (2010)

Characterizing the specificity and co-operation of aminopeptidases in the cytosol and ER during MHC Class I antigen presentation. J. Immunol 184(9):4725-32; Wiemerhaus et al (2012) Peptidases trimming MHC Class I ligands. Curr Opin Immunol 25: 1-7).

The neo-antigenic peptides and polypeptides may bind an HLA protein. In preferred aspects, the neo-antigenic peptides and polypeptides may bind an HLA protein with greater affinity than the corresponding native / wild-type peptide. The neo-antigenic peptide or polypeptide may have an IC50 of about less than 1000 nM, about less than 500 nM, about less than 250 nM, about less than 200 nM, about less than 150 nM, about less than 100 nM, or about less than 50 nM.

In a preferred embodiment, the neo-antigenic peptides and polypeptides of the invention do not induce an autoimmune response and/or invoke immunological tolerance when

administered to a subject.

The invention also provides compositions comprising a plurality of neo-antigenic peptides. In some embodiments, the composition comprises at least 5 or more neo-antigenic peptides. In some embodiments the composition contains at least about 6, about 8, about 10, about 12, about 14, about 16, about 18, or about 20 distinct peptides. In some embodiments the composition contains at least 20 distinct peptides. According to the invention, 2 or more of the distinct peptides may be derived from the same polypeptide. For example, if a preferred neo- antigenic mutation encodes a neoORF polypeptide, two or more of the neo-antigenic peptides may be derived from the neoORF polypeptide. In one embodiment, the two or more neo- antigenic peptides derived from the neoORF polypeptide may comprise a tiled array that spans the polypeptide (e.g., the neo-antigenic peptides may comprise a series of overlapping neo- antigenic peptides that spans a portion, or all, of the neoORF polypeptide). Without being bound by theory, each peptide is believed to have its own epitope; accordingly, a tiling array that spans one neoORF polypeptide may give rise to polypeptides that are targeted to different HLA molecules. Neo-antigenic peptides can be derived from any protein coding gene. Exemplary polypeptides from which the neo-antigenic peptides may be derived can be found for example at the COSMIC database (on the worldwide web at (www)sanger.ac.uk/cosmic). COSMIC curates comprehensive information on somatic mutations in human cancer. The peptide may contain the tumor specific mutation. In some aspects the tumor specific mutation is in a common driver gene or is a common driver mutation for a particular cancer type. For example, common driver mutation peptides may include, but are not limited to, the following: a SF3B1 polypeptide, a MYD88 polypeptide, a TP53 polypeptide, an ATM polypeptide, an Abl polypeptide, A FBXW7 polypeptide, a DDX3X polypeptide, a MAPK1 polypeptide, or a GNB1 polypeptide.

The neo-antigenic peptides, polypeptides, and analogs can be further modified to contain additional chemical moieties not normally part of the protein. Those derivatized moieties can improve the solubility, the biological half-life, absorption of the protein, or binding affinity. The moieties can also reduce or eliminate any desirable side effects of the proteins and the like. An overview for those moieties can be found in Remington's Pharmaceutical Sciences, 20^th ed., Mack Publishing Co., Easton, PA (2000). For example, neo-antigenic peptides and polypeptides having the desired activity may be modified as necessary to provide certain desired attributes, e.g. improved pharmacological characteristics, while increasing or at least retaining substantially all of the biological activity of the unmodified peptide to bind the desired MHC molecule and activate the appropriate T cell. For instance, the neo-antigenic peptide and polypeptides may be subject to various changes, such as substitutions, either conservative or non-conservative, where such changes might provide for certain advantages in their use, such as improved MHC binding. Such conservative substitutions may encompass replacing an amino acid residue with another amino acid residue that is biologically and/or chemically similar, e.g., one hydrophobic residue for another, or one polar residue for another. The effect of single amino acid substitutions may also be probed using D- amino acids. Such modifications may be made using well known peptide synthesis procedures, as described in e.g., Merrifield, Science 232:341-347 (1986), Barany & Merrifield, The Peptides, Gross & Meienhofer, eds. (N.Y., Academic Press), pp. 1-284 (1979); and Stewart & Young, Solid Phase Peptide Synthesis, (Rockford, III., Pierce), 2d Ed. (1984).

The neo-antigenic peptide and polypeptides may also be modified by extending or decreasing the compound's amino acid sequence, e.g., by the addition or deletion of amino acids. The neo-antigenic peptides, polypeptides, or analogs can also be modified by altering the order or composition of certain residues. It will be appreciated by the skilled artisan that certain amino acid residues essential for biological activity, e.g., those at critical contact sites or conserved residues, may generally not be altered without an adverse effect on biological activity. The non- critical amino acids need not be limited to those naturally occurring in proteins, such as L-a- amino acids, or their D-isomers, but may include non-natural amino acids as well, such as β-γ-δ- amino acids, as well as many derivatives of L-a-amino acids.

Typically, a neo-antigen polypeptide or peptide may be optimized by using a series of peptides with single amino acid substitutions to determine the effect of electrostatic charge, hydrophobicity, etc. on MHC binding. For instance, a series of positively charged (e.g., Lys or Arg) or negatively charged (e.g., Glu) amino acid substitutions may be made along the length of the peptide revealing different patterns of sensitivity towards various MHC molecules and T cell receptors. In addition, multiple substitutions using small, relatively neutral moieties such as Ala, Gly, Pro, or similar residues may be employed. The substitutions may be homo-oligomers or hetero-oligomers. The number and types of residues which are substituted or added depend on the spacing necessary between essential contact points and certain functional attributes which are sought (e.g., hydrophobicity versus hydrophilicity). Increased binding affinity for an MHC molecule or T cell receptor may also be achieved by such substitutions, compared to the affinity of the parent peptide. In any event, such substitutions should employ amino acid residues or other molecular fragments chosen to avoid, for example, steric and charge interference which might disrupt binding. Amino acid substitutions are typically of single residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final peptide.

Substitutional variants are those in which at least one residue of a peptide has been removed and a different residue inserted in its place.

The neo-antigenic peptides and polypeptides may be modified to provide desired attributes. For instance, the ability of the peptides to induce CTL activity can be enhanced by linkage to a sequence which contains at least one epitope that is capable of inducing a T helper cell response. Particularly preferred immunogenic peptides/T helper conjugates are linked by a spacer molecule. The spacer is typically comprised of relatively small, neutral molecules, such as amino acids or amino acid mimetics, which are substantially uncharged under physiological conditions. The spacers are typically selected from, e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or neutral polar amino acids. It will be understood that the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo- oligomer. When present, the spacer will usually be at least one or two residues, more usually three to six residues. Alternatively, the peptide may be linked to the T helper peptide without a spacer.

The neo-antigenic peptide may be linked to the T helper peptide either directly or via a spacer either at the amino or carboxy terminus of the peptide. The amino terminus of either the neo-antigenic peptide or the T helper peptide may be acylated. Exemplary T helper peptides include tetanus toxoid 830-843, influenza 307-319, malaria circumsporozoite 382-398 and 378- 389.

Production of Tumor Specific Neo-antigens

The present invention is based, at least in part, on the ability to present the immune system of the patient with a pool of tumor specific neo-antigens. One of skill in the art will appreciate that there are a variety of ways in which to produce such tumor specific neo-antigens. In general, such tumor specific neo-antigens may be produced either in vitro or in vivo. Tumor specific neo-antigens may be produced in vitro as peptides or polypeptides, which may then be formulated into a personalized neoplasia vaccine and administered to a subject. As described in further detail below, such in vitro production may occur by a variety of methods known to one of skill in the art such as, for example, peptide synthesis or expression of a peptide/polypeptide from a DNA or RNA molecule in any of a variety of bacterial, eukaryotic, or viral recombinant expression systems, followed by purification of the expressed peptide/polypeptide.

Alternatively, tumor specific neo-antigens may be produced in vivo by introducing molecules (e.g., DNA, RNA, viral expression systems, and the like) that encode tumor specific neo- antigens into a subject, whereupon the encoded tumor specific neo-antigens are expressed.

In Vitro Peptide/Polypeptide Synthesis

Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides. The nucleotide and protein, polypeptide and peptide sequences corresponding to various genes have been previously disclosed, and may be found at

computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases located at the National Institutes of Health website. The coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art. Alternatively, various commercial preparations of proteins, polypeptides and peptides are known to those of skill in the art.

Peptides can be readily synthesized chemically utilizing reagents that are free of contaminating bacterial or animal substances (Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85:2149-54, 1963).

A further aspect of the invention provides a nucleic acid (e.g., a polynucleotide) encoding a neo-antigenic peptide of the invention, which may be used to produce the neo-antigenic peptide in vitro. The polynucleotide may be, e.g., DNA, cDNA, PNA, CNA, RNA, either single- and/or double- stranded, or native or stabilized forms of polynucleotides, such as e.g. polynucleotides with a phosphorothiate backbone, or combinations thereof and it may or may not contain introns so long as it codes for the peptide. A still further aspect of the invention provides an expression vector capable of expressing a polypeptide according to the invention. Expression vectors for different cell types are well known in the art and can be selected without undue experimentation. Generally, the DNA is inserted into an expression vector, such as a plasmid, in proper orientation and correct reading frame for expression. If necessary, the DNA may be linked to the appropriate transcriptional and translational regulatory control nucleotide sequences recognized by the desired host (e.g., bacteria), although such controls are generally available in the expression vector. The vector is then introduced into the host bacteria for cloning using standard techniques (see, e.g., Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.).

The invention further embraces variants and equivalents which are substantially homologous to the identified tumor specific neo-antigens described herein. These can contain, for example, conservative substitution mutations, i.e., the substitution of one or more amino acids by similar amino acids. For example, conservative substitution refers to the substitution of an amino acid with another within the same general class such as, for example, one acidic amino acid with another acidic amino acid, one basic amino acid with another basic amino acid, or one neutral amino acid by another neutral amino acid. What is intended by a conservative amino acid substitution is well known in the art.

The invention also includes expression vectors comprising the isolated polynucleotides, as well as host cells containing the expression vectors. It is also contemplated within the scope of the invention that the neo-antigenic peptides may be provided in the form of RNA or cDNA molecules encoding the desired neo-antigenic peptides. The invention also provides that the one or more neo-antigenic peptides of the invention may be encoded by a single expression vector. The invention also provides that the one or more neo-antigenic peptides of the invention may be encoded and expressed in vivo using a viral based system (e.g., an adenovirus system).

The term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequences for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequences. The polynucleotides of the invention can be in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA; and can be double-stranded or single-stranded, and if single stranded can be the coding strand or non-coding (anti-sense) strand.

In embodiments, the polynucleotides may comprise the coding sequence for the tumor specific neo-antigenic peptide fused in the same reading frame to a polynucleotide which aids, for example, in expression and/or secretion of a polypeptide from a host cell (e.g., a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell). The polypeptide having a leader sequence is a preprotein and can have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.

In embodiments, the polynucleotides can comprise the coding sequence for the tumor specific neo-antigenic peptide fused in the same reading frame to a marker sequence that allows, for example, for purification of the encoded polypeptide, which may then be incorporated into the personalized neoplasia vaccine. For example, the marker sequence can be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or the marker sequence can be a hemagglutinin (HA) tag derived from the influenza hemagglutinin protein when a mammalian host (e.g., COS-7 cells) is used. Additional tags include, but are not limited to, Calmodulin tags, FLAG tags, Myc tags, S tags, SBP tags, Softag 1, Softag 3, V5 tag, Xpress tag, Isopeptag, SpyTag, Biotin Carboxyl Carrier Protein (BCCP) tags, GST tags, fluorescent protein tags (e.g., green fluorescent protein tags), maltose binding protein tags, Nus tags, Strep-tag, thioredoxin tag, TC tag, Ty tag, and the like. In embodiments, the polynucleotides may comprise the coding sequence for one or more of the tumor specific neo-antigenic peptides fused in the same reading frame to create a single concatamerized neo-antigenic peptide construct capable of producing multiple neo-antigenic peptides.

In embodiments, the present invention provides isolated nucleic acid molecules having a nucleotide sequence at least 60% identical, at least 65% identical, at least 70% identical, at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, or at least 96%, 97%, 98% or 99% identical to a polynucleotide encoding a tumor specific neo-antigenic peptide of the present invention.

By a polynucleotide having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence can include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the amino- or carboxy-terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

As a practical matter, whether any particular nucleic acid molecule is at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments, at least 95%, 96%, 97%, 98%, or 99% identical to a reference sequence can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences. When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95% identical to a reference sequence according to the present invention, the parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence and that gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.

The isolated tumor specific neo-antigenic peptides described herein can be produced in vitro (e.g., in the laboratory) by any suitable method known in the art. Such methods range from direct protein synthetic methods to constructing a DNA sequence encoding isolated polypeptide sequences and expressing those sequences in a suitable transformed host. In some embodiments, a DNA sequence is constructed using recombinant technology by isolating or synthesizing a DNA sequence encoding a wild-type protein of interest. Optionally, the sequence can be mutagenized by site-specific mutagenesis to provide functional analogs thereof. See, e.g. Zoeller et al., Proc. Nat'l. Acad. Sci. USA 81:5662-5066 (1984) and U.S. Pat. No. 4,588,585.

In embodiments, a DNA sequence encoding a polypeptide of interest would be constructed by chemical synthesis using an oligonucleotide synthesizer. Such oligonucleotides can be designed based on the amino acid sequence of the desired polypeptide and selecting those codons that are favored in the host cell in which the recombinant polypeptide of interest will be produced. Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest. For example, a complete amino acid sequence can be used to construct a back-translated gene. Further, a DNA oligomer containing a nucleotide sequence coding for the particular isolated polypeptide can be synthesized. For example, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. The individual oligonucleotides typically contain 5' or 3' overhangs for

complementary assembly.

Once assembled (e.g., by synthesis, site-directed mutagenesis, or another method), the polynucleotide sequences encoding a particular isolated polypeptide of interest will be inserted into an expression vector and optionally operatively linked to an expression control sequence appropriate for expression of the protein in a desired host. Proper assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As well known in the art, in order to obtain high expression levels of a transfected gene in a host, the gene can be operatively linked to transcriptional and translational expression control sequences that are functional in the chosen expression host. Recombinant expression vectors may be used to amplify and express DNA encoding the tumor specific neo-antigenic peptides. Recombinant expression vectors are replicable DNA constructs which have synthetic or cDNA-derived DNA fragments encoding a tumor specific neo-antigenic peptide or a bioequivalent analog operatively linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral or insect genes. A transcriptional unit generally comprises an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, transcriptional promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (3) appropriate transcription and translation initiation and termination sequences, as described in detail below. Such regulatory elements can include an operator sequence to control

transcription. The ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transforaiants can additionally be incorporated. DNA regions are operatively linked when they are functionally related to each other. For example, DNA for a signal peptide (secretory leader) is operatively linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operatively linked to a coding sequence if it controls the transcription of the sequence; or a ribosome binding site is operatively linked to a coding sequence if it is positioned so as to permit translation. Generally, operatively linked means contiguous, and in the case of secretory leaders, means contiguous and in reading frame. Structural elements intended for use in yeast expression systems include a leader sequence enabling extracellular secretion of translated protein by a host cell. Alternatively, where recombinant protein is expressed without a leader or transport sequence, it can include an N-terminal methionine residue. This residue can optionally be subsequently cleaved from the expressed recombinant protein to provide a final product.

The choice of expression control sequence and expression vector will depend upon the choice of host. A wide variety of expression host/vector combinations can be employed. Useful expression vectors for eukaryotic hosts, include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from Escherichia coli, including pCR 1, pBR322, pMB9 and their derivatives, wider host range plasmids, such as M13 and filamentous single- stranded DNA phages.

Suitable host cells for expression of a polypeptide include prokaryotes, yeast, insect or higher eukaryotic cells under the control of appropriate promoters. Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli. Higher eukaryotic cells include established cell lines of mammalian origin. Cell-free translation systems could also be employed. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are well known in the art (see Pouwels et al., Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., 1985).

Various mammalian or insect cell culture systems are also advantageously employed to express recombinant protein. Expression of recombinant proteins in mammalian cells can be performed because such proteins are generally correctly folded, appropriately modified and completely functional. Examples of suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, described by Gluzman (Cell 23: 175, 1981), and other cell lines capable of expressing an appropriate vector including, for example, L cells, C127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors can comprise nontranscribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences. Baculovirus systems for production of heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio/Technology 6:47 (1988).

The proteins produced by a transformed host can be purified according to any suitable method. Such standard methods include chromatography (e.g., ion exchange, affinity and sizing column chromatography, and the like), centrifugation, differential solubility, or by any other standard technique for protein purification. Affinity tags such as hexahistidine, maltose binding domain, influenza coat sequence, glutathione-S-transferase, and the like can be attached to the protein to allow easy purification by passage over an appropriate affinity column. Isolated proteins can also be physically characterized using such techniques as proteolysis, nuclear magnetic resonance and x-ray crystallography.

For example, supernatants from systems which secrete recombinant protein into culture media can be first concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a suitable purification matrix. Alternatively, an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Finally, one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify a cancer stem cell protein-Fc composition. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein. Recombinant protein produced in bacterial culture can be isolated, for example, by initial extraction from cell pellets, followed by one or more concentration, salting-out, aqueous ion exchange or size exclusion chromatography steps. High performance liquid chromatography (HPLC) can be employed for final purification steps. Microbial cells employed in expression of a recombinant protein can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. In Vivo Peptide/Polypeptide Synthesis

The present invention also contemplates the use of nucleic acid molecules as vehicles for delivering neo-antigenic peptides/polypeptides to the subject in vivo in the form of, e.g., DNA/RNA vaccines (see, e.g., WO2012/159643, and WO2012/159754, hereby incorporated by reference in their entirety).

In one embodiment, the personalized neoplasia vaccine may include separate DNA plasmids encoding, for example, one or more neo-antigenic peptides/polypeptides as identified in according to the invention. As discussed above, the exact choice of expression vectors will depend upon the peptide/polypeptides to be expressed, and is well within the skill of the ordinary artisan. The expected persistence of the DNA constructs (e.g., in an episomal, non-replicating, non-integrated form in the muscle cells) is expected to provide an increased duration of protection.

In another embodiment, the personalized neoplasia vaccine may include separate RNA or cDNA molecules encoding neo-antigenic peptides/polypeptides of the invention.

In another embodiment the personalized neoplasia vaccine may include a viral based vector for use in a human patient such as, for example, and adenovirus system (see, e.g., Baden et al. First-in-human evaluation of the safety and immunogenicity of a recombinant adenovirus serotype 26 HIV-1 Env vaccine (IPCAVD 001). J Infect Dis. 2013 Jan 15;207(2):240-7, hereby incorporated by reference in its entirety).

Pharmaceutical Compositions/Methods of Delivery

The present invention is also directed to pharmaceutical compositions comprising an effective amount of one or more compounds according to the present invention (including a pharmaceutically acceptable salt, thereof), optionally in combination with a pharmaceutically acceptable carrier, excipient or additive.

A "pharmaceutically acceptable derivative or prodrug" means any pharmaceutically acceptable salt, ester, salt of an ester, or other derivative of a compound of this invention which, upon administration to a recipient, is capable of providing (directly or indirectly) a compound of this invention. Particularly favored derivatives and prodrugs are those that increase the bioavailability of the compounds of this invention when such compounds are administered to a mammal (e.g., by allowing an orally or ocularly administered compound to be more readily absorbed into the blood) or which enhance delivery of the parent compound to a biological compartment (e.g., the retina) relative to the parent species.

While the tumor specific neo-antigenic peptides of the invention can be administered as the sole active pharmaceutical agent, they can also be used in combination with one or more other agents and/or adjuvants. When administered as a combination, the therapeutic agents can be formulated as separate compositions that are given at the same time or different times, or the therapeutic agents can be given as a single composition.

The tumor specific neo-antigenic peptides of the present invention may be administered by injection, orally, parenterally, by inhalation spray, rectally, vaginally, or topically in dosage unit formulations containing conventional pharmaceutically acceptable carriers, adjuvants, and vehicles. The term parenteral as used herein includes, into a lymph node or nodes, subcutaneous, intravenous, intramuscular, intrasternal, infusion techniques, intraperitoneally, eye or ocular, intravitreal, intrabuccal, transdermal, intranasal, into the brain, including intracranial and intradural, into the joints, including ankles, knees, hips, shoulders, elbows, wrists, directly into tumors, and the like, and in suppository form.

The pharmaceutically active compounds of this invention can be processed in accordance with conventional methods of pharmacy to produce medicinal agents for administration to patients, including humans and other mammals.

Modifications of the active compound can affect the solubility, bioavailability and rate of metabolism of the active species, thus providing control over the delivery of the active species. This can easily be assessed by preparing the derivative and testing its activity according to known methods well within the routine practitioner's skill in the art.

Pharmaceutical compositions based upon these chemical compounds comprise the above- described tumor specific neo-antigenic peptides in a therapeutically effective amount for treating diseases and conditions (e.g., a neoplasia/tumor), which have been described herein, optionally in combination with a pharmaceutically acceptable additive, carrier and/or excipient. One of ordinary skill in the art will recognize that a therapeutically effective amount of one of more compounds according to the present invention will vary with the infection or condition to be treated, its severity, the treatment regimen to be employed, the pharmacokinetics of the agent used, as well as the patient (animal or human) treated.

To prepare the pharmaceutical compositions according to the present invention, a therapeutically effective amount of one or more of the compounds according to the present invention is preferably intimately admixed with a pharmaceutically acceptable carrier according to conventional pharmaceutical compounding techniques to produce a dose. A carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., ocular, oral, topical or parenteral, including gels, creams ointments, lotions and time released implantable preparations, among numerous others. In preparing pharmaceutical compositions in oral dosage form, any of the usual pharmaceutical media may be used. Thus, for liquid oral preparations such as suspensions, elixirs and solutions, suitable carriers and additives including water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like may be used. For solid oral preparations such as powders, tablets, capsules, and for solid preparations such as suppositories, suitable carriers and additives including starches, sugar carriers, such as dextrose, mannitol, lactose and related carriers, diluents, granulating agents, lubricants, binders, disintegrating agents and the like may be used. If desired, the tablets or capsules may be enteric- coated or sustained release by standard techniques.

The active compound is included in the pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount for the desired indication, without causing serious toxic effects in the patient treated.

Oral compositions will generally include an inert diluent or an edible carrier. They may be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound or its prodrug derivative can be incorporated with excipients and used in the form of tablets, troches, or capsules. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a dispersing agent such as alginic acid or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring. When the dosage unit form is a capsule, it can contain, in addition to material-of the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms can contain various other materials which modify the physical form of the dosage unit, for example, coatings of sugar, shellac, or enteric agents. Formulations of the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in- water liquid emulsion or a water-in-oil emulsion and as a bolus, etc. A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets optionally may be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein.

Methods of formulating such slow or controlled release compositions of pharmaceutically active ingredients, are known in the art and described in several issued US Patents, some of which include, but are not limited to, US Patent Nos. 3,870,790; 4,226,859; 4,369,172; 4,842,866 and 5,705,190, the disclosures of which are incorporated herein by reference in their entireties. Coatings can be used for delivery of compounds to the intestine (see, e.g., U.S. Patent Nos. 6,638,534, 5,541,171, 5,217,720, and 6,569,457, and references cited therein).

The active compound or pharmaceutically acceptable salt thereof may also be

administered as a component of an elixir, suspension, syrup, wafer, chewing gum or the like. A syrup may contain, in addition to the active compounds, sucrose or fructose as a sweetening agent and certain preservatives, dyes and colorings and flavors.

Solutions or suspensions used for ocular, parenteral, intradermal, subcutaneous, or topical application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid;

buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and polylactic-co-glycolic acid (PLGA). Methods for preparation of such formulations will be apparent to those skilled in the art.

A skilled artisan will recognize that in addition to tablets, other dosage forms can be formulated to provide slow or controlled release of the active ingredient. Such dosage forms include, but are not limited to, capsules, granulations and gel-caps.

Liposomal suspensions may also be pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art. For example, liposomal formulations may be prepared by dissolving appropriate lipid(s) in an inorganic solvent that is then evaporated, leaving behind a thin film of dried lipid on the surface of the container. An aqueous solution of the active compound are then introduced into the container. The container is then swirled by hand to free lipid material from the sides of the container and to disperse lipid aggregates, thereby forming the liposomal suspension. Other methods of preparation well known by those of ordinary skill may also be used in this aspect of the present invention.

The formulations may conveniently be presented in unit dosage form and may be prepared by conventional pharmaceutical techniques. Such techniques include the step of bringing into association the active ingredient and the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. Formulations and compositions suitable for topical administration in the mouth include lozenges comprising the ingredients in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the ingredient to be administered in a suitable liquid carrier. Formulations suitable for topical administration to the skin may be presented as ointments, creams, gels and pastes comprising the ingredient to be administered in a

pharmaceutical acceptable carrier. A preferred topical delivery system is a transdermal patch containing the ingredient to be administered.

Formulations for rectal administration may be presented as a suppository with a suitable base comprising, for example, cocoa butter or a salicylate.

Formulations suitable for nasal administration, wherein the carrier is a solid, include a coarse powder having a particle size, for example, in the range of 20 to 500 microns which is administered in the manner in which snuff is administered, i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable formulations, wherein the carrier is a liquid, for administration, as for example, a nasal spray or as nasal drops, include aqueous or oily solutions of the active ingredient.

Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active ingredient such carriers as are known in the art to be appropriate. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. If administered intravenously, preferred carriers include, for example, physiological saline or phosphate buffered saline (PBS). For parenteral formulations, the carrier will usually comprise sterile water or aqueous sodium chloride solution, though other ingredients including those which aid dispersion may be included. Of course, where sterile water is to be used and maintained as sterile, the compositions and carriers will also be sterilized. Injectable suspensions may also be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed.

Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described. Administration of the active compound may range from continuous (intravenous drip) to several oral administrations per day (for example, Q.I.D.) and may include oral, topical, eye or ocular, parenteral, intramuscular, intravenous, sub-cutaneous, transdermal (which may include a penetration enhancement agent), buccal and suppository administration, among other routes of administration, including through an eye or ocular route. Application of the subject therapeutics may be local, so as to be administered at the site of interest. Various techniques can be used for providing the subject compositions at the site of interest, such as injection, use of catheters, trocars, projectiles, pluronic gel, stents, sustained drug release polymers or other device which provides for internal access. Where an organ or tissue is accessible because of removal from the patient, such organ or tissue may be bathed in a medium containing the subject compositions, the subject compositions may be painted onto the organ, or may be applied in any convenient way.

The tumor specific neo-antigenic peptides may be administered through a device suitable for the controlled and sustained release of a composition effective in obtaining a desired local or systemic physiological or pharmacological effect. The method includes positioning the sustained released drug delivery system at an area wherein release of the agent is desired and allowing the agent to pass through the device to the desired area of treatment.

The tumor specific neo-antigenic peptides may be utilized in combination with at least one known other therapeutic agent, or a pharmaceutically acceptable salt of said agent. Examples of known therapeutic agents which can be used for combination therapy include, but are not limited to, corticosteroids (e.g., cortisone, prednisone, dexamethasone), non-steroidal antiinflammatory drugs (NSAIDS) (e.g., ibuprofen, celecoxib, aspirin, indomethicin, naproxen), alkylating agents such as busulfan, cis-platin, mitomycin C, and carboplatin; antimitotic agents such as colchicine, vinblastine, paclitaxel, and docetaxel; topo I inhibitors such as camptothecin and topotecan; topo II inhibitors such as doxorubicin and etoposide; and/or RNA/DNA antimetabolites such as 5-azacytidine, 5-fluorouracil and methotrexate; DNA antimetabolites such as 5-fluoro-2'-deoxy-uridine, ara-C, hydroxyurea and thioguanine; antibodies such as Herceptin® and Rituxan®.

It should be understood that in addition to the ingredients particularly mentioned above, the formulations of the present invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.

In certain pharmaceutical dosage forms, the pro-drug form of the compounds may be preferred. One of ordinary skill in the art will recognize how to readily modify the present compounds to pro-drug forms to facilitate delivery of active compounds to a targeted site within the host organism or patient. The routine practitioner also will take advantage of favorable pharmacokinetic parameters of the pro-drug forms, where applicable, in delivering the present compounds to a targeted site within the host organism or patient to maximize the intended effect of the compound. Preferred prodrugs include derivatives where a group which enhances aqueous solubility or active transport through the gut membrane is appended to the structure of formulae described herein. See, e.g., Alexander, J. et al. Journal of Medicinal Chemistry 1988, 31, 318-322;

Bundgaard, H. Design of Prodrugs; Elsevier: Amsterdam, 1985; pp 1-92; Bundgaard, H.;

Nielsen, N. M. Journal of Medicinal Chemistry 1987, 30, 451-454; Bundgaard, H. A Textbook of Drug Design and Development; Harwood Academic Publ.: Switzerland, 1991; pp 113-191; Digenis, G. A. et al. Handbook of Experimental Pharmacology 1975, 28, 86-112; Friis, G. J.; Bundgaard, H. A Textbook of Drug Design and Development; 2 ed.; Overseas Publ.:

Amsterdam, 1996; pp 351-385; Pitman, I. H. Medicinal Research Reviews 1981, 1, 189-214. The prodrug forms may be active themselves, or may be those such that when metabolized after administration provide the active therapeutic agent in vivo.

Pharmaceutically acceptable salt forms may be the preferred chemical form of compounds according to the present invention for inclusion in pharmaceutical compositions according to the present invention.

The present compounds or their derivatives, including prodrug forms of these agents, can be provided in the form of pharmaceutically acceptable salts. As used herein, the term

pharmaceutically acceptable salts or complexes refers to appropriate salts or complexes of the active compounds according to the present invention which retain the desired biological activity of the parent compound and exhibit limited toxicological effects to normal cells. Nonlimiting examples of such salts are (a) acid addition salts formed with inorganic acids (for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like), and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid, alginic acid, and polyglutamic acid, among others; (b) base addition salts formed with metal cations such as zinc, calcium, sodium, potassium, and the like, among numerous others.

The compounds herein are commercially available or can be synthesized. As can be appreciated by the skilled artisan, further methods of synthesizing the compounds of the formulae herein will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps may be performed in an alternate sequence or order to give the desired compounds. Synthetic chemistry transformations and protecting group methodologies

(protection and deprotection) useful in synthesizing the compounds described herein are known in the art and include, for example, those such as described in R. Larock, Comprehensive Organic Transformations, 2nd. Ed., Wiley- VCH Publishers (1999); T.W. Greene and P.G.M. Wuts, Protective Groups in Organic Synthesis, 3rd. Ed., John Wiley and Sons (1999); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1999); and L. Paquette, ed., Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent editions thereof.

The additional agents that may be included with the tumor specific neo-antigenic peptides of this invention may contain one or more asymmetric centers and thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such isomeric forms of these compounds are expressly included in the present invention. The compounds of this invention may also be represented in multiple tautomeric forms, in such instances, the invention expressly includes all tautomeric forms of the compounds described herein (e.g., alkylation of a ring system may result in alkylation at multiple sites, the invention expressly includes all such reaction products). All such isomeric forms of such compounds are expressly included in the present invention. All crystal forms of the compounds described herein are expressly included in the present invention.

Preferred unit dosage formulations are those containing a daily dose or unit, daily sub- dose, as hereinabove recited, or an appropriate fraction thereof, of the administered ingredient.

The dosage regimen for treating a disorder or a disease with the tumor specific neo- antigenic peptides of this invention and/or compositions of this invention is based on a variety of factors, including the type of disease, the age, weight, sex, medical condition of the patient, the severity of the condition, the route of administration, and the particular compound employed. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods.

The amounts and dosage regimens administered to a subject will depend on a number of factors, such as the mode of administration, the nature of the condition being treated, the body weight of the subject being treated and the judgment of the prescribing physician.

The amount of compound included within therapeutically active formulations according to the present invention is an effective amount for treating the disease or condition. In general, a therapeutically effective amount of the present preferred compound in dosage form usually ranges from slightly less than about 0.025 mg/kg/day to about 2.5 g/kg/day, preferably about 0.1 mg/kg/day to about 100 mg/kg/day of the patient or considerably more, depending upon the compound used, the condition or infection treated and the route of administration, although exceptions to this dosage range may be contemplated by the present invention. In its most preferred form, compounds according to the present invention are administered in amounts ranging from about 1 mg/kg/day to about 100 mg/kg/day. The dosage of the compound will depend on the condition being treated, the particular compound, and other clinical factors such as weight and condition of the patient and the route of administration of the compound. It is to be understood that the present invention has application for both human and veterinary use.

For oral administration to humans, a dosage of between approximately 0.1 to 100 mg/kg/day, preferably between approximately 1 and 100 mg/kg/day, is generally sufficient.

Where drug delivery is systemic rather than topical, this dosage range generally produces effective blood level concentrations of active compound ranging from less than about 0.04 to about 400 micrograms/cc or more of blood in the patient.

The compound is conveniently administered in any suitable unit dosage form, including but not limited to one containing 0.001 to 3000 mg, preferably 0.05 to 500 mg of active ingredient per unit dosage form. An oral dosage of 10-250 mg is usually convenient.

The concentration of active compound in the drug composition will depend on absorption, distribution, inactivation, and excretion rates of the drug as well as other factors known to those of skill in the art. It is to be noted that dosage values will also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition. The active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at varying intervals of time.

In certain embodiments, the compound is administered once daily; in other embodiments, the compound is administered twice daily; in yet other embodiments, the compound is administered once every two days, once every three days, once every four days, once every five days, once every six days, once every seven days, once every two weeks, once every three weeks, once every four weeks, once every two months, once every six months, or once per year. The dosing interval can be adjusted according to the needs of individual patients. For longer intervals of administration, extended release or depot formulations can be used.

The compounds of the invention can be used to treat diseases and disease conditions that are acute, and may also be used for treatment of chronic conditions. In certain embodiments, the compounds of the invention are administered for time periods exceeding two weeks, three weeks, one month, two months, three months, four months, five months, six months, one year, two years, three years, four years, or five years, ten years, or fifteen years; or for example, any time period range in days, months or years in which the low end of the range is any time period between 14 days and 15 years and the upper end of the range is between 15 days and 20 years (e.g., 4 weeks and 15 years, 6 months and 20 years). In some cases, it may be advantageous for the compounds of the invention to be administered for the remainder of the patient's life. In preferred embodiments, the patient is monitored to check the progression of the disease or disorder, and the dose is adjusted accordingly. In preferred embodiments, treatment according to the invention is effective for at least two weeks, three weeks, one month, two months, three months, four months, five months, six months, one year, two years, three years, four years, or five years, ten years, fifteen years, twenty years, or for the remainder of the subject's life. The invention provides for pharmaceutical compositions containing at least one tumor specific neo-antigen described herein. In embodiments, the pharmaceutical compositions contain a pharmaceutically acceptable carrier, excipient, or diluent, which includes any pharmaceutical agent that does not itself induce the production of an immune response harmful to a subject receiving the composition, and which may be administered without undue toxicity. As used herein, the term "pharmaceutically acceptable" means being approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopia, European Pharmacopia or other generally recognized pharmacopia for use in mammals, and more particularly in humans. These compositions can be useful for treating and/or preventing viral infection and/or autoimmune disease. A thorough discussion of pharmaceutically acceptable carriers, diluents, and other excipients is presented in Remington's Pharmaceutical Sciences (17th ed., Mack Publishing Company) and Remington: The Science and Practice of Pharmacy (21st ed., Lippincott Williams & Wilkins), which are hereby incorporated by reference. The formulation of the pharmaceutical composition should suit the mode of administration. In embodiments, the pharmaceutical composition is suitable for administration to humans, and can be sterile, non-particulate and/or non-pyrogenic.

Pharmaceutically acceptable carriers, excipients, or diluents include, but are not limited, to saline, buffered saline, dextrose, water, glycerol, ethanol, sterile isotonic aqueous buffer, and combinations thereof.

Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives, and antioxidants can also be present in the compositions.

Examples of pharmaceutically- acceptable antioxidants include, but are not limited to: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

In embodiments, the pharmaceutical composition is provided in a solid form, such as a lyophilized powder suitable for reconstitution, a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder.

In embodiments, the pharmaceutical composition is supplied in liquid form, for example, in a sealed container indicating the quantity and concentration of the active ingredient in the pharmaceutical composition. In related embodiments, the liquid form of the pharmaceutical composition is supplied in a hermetically sealed container.

Methods for formulating the pharmaceutical compositions of the present invention are conventional and well known in the art (see Remington and Remington's). One of skill in the art can readily formulate a pharmaceutical composition having the desired characteristics (e.g., route of administration, biosafety, and release profile).

Methods for preparing the pharmaceutical compositions include the step of bringing into association the active ingredient with a pharmaceutically acceptable carrier and, optionally, one or more accessory ingredients. The pharmaceutical compositions can be prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product. Additional methodology for preparing the pharmaceutical compositions, including the preparation of multilayer dosage forms, are described in Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems (9th ed., Lippincott Williams & Wilkins), which is hereby incorporated by reference.

Pharmaceutical compositions suitable for oral administration can be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound(s) described herein, a derivative thereof, or a pharmaceutically acceptable salt or prodrug thereof as the active ingredient(s). The active ingredient can also be administered as a bolus, electuary, or paste. In solid dosage forms for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules and the like), the active ingredient is mixed with one or more

pharmaceutically acceptable carriers, excipients, or diluents, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets, and pills, the pharmaceutical compositions can also comprise buffering agents. Solid compositions of a similar type can also be prepared using fillers in soft and hard-filled gelatin capsules, and excipients such as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

A tablet can be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using binders (for example, gelatin or hydroxypropylmethyl cellulose), lubricants, inert diluents, preservatives, disintegrants (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface- actives, and/ or dispersing agents. Molded tablets can be made by molding in a suitable machine a mixture of the powdered active ingredient moistened with an inert liquid diluent.

The tablets and other solid dosage forms, such as dragees, capsules, pills, and granules, can optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the art.

In some embodiments, in order to prolong the effect of an active ingredient, it is desirable to slow the absorption of the compound from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material having poor water solubility. The rate of absorption of the active ingredient then depends upon its rate of dissolution which, in turn, can depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally-administered active ingredient is accomplished by dissolving or suspending the compound in an oil vehicle. In addition, prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents that delay absorption such as aluminum mono stearate and gelatin.

Controlled release parenteral compositions can be in form of aqueous suspensions, microspheres, microcapsules, magnetic microspheres, oil solutions, oil suspensions, emulsions, or the active ingredient can be incorporated in biocompatible carrier(s), liposomes, nanoparticles, implants or infusion devices. Materials for use in the preparation of microspheres and/or microcapsules include biodegradable/bioerodible polymers such as polyglactin, poly-(isobutyl cyanoacrylate), poly(2- hydroxyethyl-L-glutamine) and poly(lactic acid).

Biocompatible carriers which can be used when formulating a controlled release parenteral formulation include carbohydrates such as dextrans, proteins such as albumin, lipoproteins or antibodies.

Materials for use in implants can be non-biodegradable, e.g., polydimethylsiloxane, or biodegradable such as, e.g., poly(caprolactone), poly(lactic acid), poly(glycolic acid) or poly(ortho esters).

In embodiments, the active ingredient(s) are administered by aerosol. This is

accomplished by preparing an aqueous aerosol, liposomal preparation, or solid particles containing the compound. A nonaqueous (e.g., fluorocarbon propellant) suspension can be used. The pharmaceutical composition can also be administered using a sonic nebulizer, which would minimize exposing the agent to shear, which can result in degradation of the compound.

Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of the active ingredient(s) together with conventional pharmaceutically-acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular compound, but typically include nonionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.

Dosage forms for topical or transdermal administration of an active ingredient(s) includes powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active ingredient(s) can be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants as appropriate.

Transdermal patches suitable for use in the present invention are disclosed in

Transdermal Drug Delivery: Developmental Issues and Research Initiatives (Marcel Dekker Inc., 1989) and U.S. Pat. Nos. 4,743,249, 4,906,169, 5,198,223, 4,816,540, 5,422,119, 5,023,084, which are hereby incorporated by reference. The transdermal patch can also be any transdermal patch well known in the art, including transscrotal patches. Pharmaceutical compositions in such transdermal patches can contain one or more absorption enhancers or skin permeation enhancers well known in the art (see, e.g., U.S. Pat. Nos. 4,379,454 and 4,973,468, which are hereby incorporated by reference). Transdermal therapeutic systems for use in the present invention can be based on iontophoresis, diffusion, or a combination of these two effects.

Transdermal patches have the added advantage of providing controlled delivery of active ingredient(s) to the body. Such dosage forms can be made by dissolving or dispersing the active ingredient(s) in a proper medium. Absorption enhancers can also be used to increase the flux of the active ingredient across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the active ingredient(s) in a polymer matrix or gel.

Such pharmaceutical compositions can be in the form of creams, ointments, lotions, liniments, gels, hydrogels, solutions, suspensions, sticks, sprays, pastes, plasters and other kinds of transdermal drug delivery systems. The compositions can also include pharmaceutically acceptable carriers or excipients such as emulsifying agents, antioxidants, buffering agents, preservatives, humectants, penetration enhancers, chelating agents, gel-forming agents, ointment bases, perfumes, and skin protective agents.

Examples of emulsifying agents include, but are not limited to, naturally occurring gums, e.g. gum acacia or gum tragacanth, naturally occurring phosphatides, e.g. soybean lecithin and sorbitan monooleate derivatives. Examples of antioxidants include, but are not limited to, butylated hydroxy anisole

(BHA), ascorbic acid and derivatives thereof, tocopherol and derivatives thereof, and cysteine.

Examples of preservatives include, but are not limited to, parabens, such as methyl or propyl p-hydroxybenzoate and benzalkonium chloride.

Examples of humectants include, but are not limited to, glycerin, propylene glycol, sorbitol and urea.

Examples of penetration enhancers include, but are not limited to, propylene glycol, DMSO, triethanolamine, N,N-dimethylacetamide, Ν,Ν-dimethylformamide, 2-pyrrolidone and derivatives thereof, tetrahydrofurfuryl alcohol, propylene glycol, diethylene glycol monoethyl or monomethyl ether with propylene glycol monolaurate or methyl laurate, eucalyptol, lecithin, Transcutol^®, and Azone^®.

Examples of chelating agents include, but are not limited to, sodium EDTA, citric acid and phosphoric acid.

Examples of gel forming agents include, but are not limited to, Carbopol, cellulose derivatives, bentonite, alginates, gelatin and polyvinylpyrrolidone.

In addition to the active ingredient(s), the ointments, pastes, creams, and gels of the present invention can contain excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

Powders and sprays can contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons, and volatile unsubstituted hydrocarbons, such as butane and propane.

Injectable depot forms are made by forming microencapsule matrices of compound(s) of the invention in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of compound to polymer, and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissue.

Subcutaneous implants are well known in the art and are suitable for use in the present invention. Subcutaneous implantation methods are preferably non-irritating and mechanically resilient. The implants can be of matrix type, of reservoir type, or hybrids thereof. In matrix type devices, the carrier material can be porous or non-porous, solid or semi-solid, and permeable or impermeable to the active compound or compounds. The carrier material can be biodegradable or may slowly erode after administration. In some instances, the matrix is non- degradable but instead relies on the diffusion of the active compound through the matrix for the carrier material to degrade. Alternative subcutaneous implant methods utilize reservoir devices where the active compound or compounds are surrounded by a rate controlling membrane, e.g., a membrane independent of component concentration (possessing zero-order kinetics). Devices consisting of a matrix surrounded by a rate controlling membrane also suitable for use.

Both reservoir and matrix type devices can contain materials such as

polydimethylsiloxane, such as Silastic™, or other silicone rubbers. Matrix materials can be insoluble polypropylene, polyethylene, polyvinyl chloride, ethylvinyl acetate, polystyrene and polymethacrylate, as well as glycerol esters of the glycerol palmitostearate, glycerol stearate, and glycerol behenate type. Materials can be hydrophobic or hydrophilic polymers and optionally contain solubilizing agents.

Subcutaneous implant devices can be slow-release capsules made with any suitable polymer, e.g., as described in U.S. Pat. Nos. 5,035,891 and 4,210,644, which are hereby incorporated by reference.

In general, at least four different approaches are applicable in order to provide rate control over the release and transdermal permeation of a drug compound. These approaches are: membrane-moderated systems, adhesive diffusion-controlled systems, matrix dispersion-type systems and microreservoir systems. It is appreciated that a controlled release percutaneous and/or topical composition can be obtained by using a suitable mixture of these approaches.

In a membrane-moderated system, the active ingredient is present in a reservoir which is totally encapsulated in a shallow compartment molded from a drug-impermeable laminate, such as a metallic plastic laminate, and a rate-controlling polymeric membrane such as a microporous or a non-porous polymeric membrane, e.g., ethylene- vinyl acetate copolymer. The active ingredient is released through the rate controlling polymeric membrane. In the drug reservoir, the active ingredient can either be dispersed in a solid polymer matrix or suspended in an unleachable, viscous liquid medium such as silicone fluid. On the external surface of the polymeric membrane, a thin layer of an adhesive polymer is applied to achieve an intimate contact of the transdermal system with the skin surface. The adhesive polymer is preferably a polymer which is hypoallergenic and compatible with the active drug substance. In an adhesive diffusion-controlled system, a reservoir of the active ingredient is formed by directly dispersing the active ingredient in an adhesive polymer and then by, e.g., solvent casting, spreading the adhesive containing the active ingredient onto a flat sheet of substantially drug-impermeable metallic plastic backing to form a thin drug reservoir layer.

A matrix dispersion-type system is characterized in that a reservoir of the active ingredient is formed by substantially homogeneously dispersing the active ingredient in a hydrophilic or lipophilic polymer matrix. The drug-containing polymer is then molded into disc with a substantially well-defined surface area and controlled thickness. The adhesive polymer is spread along the circumference to form a strip of adhesive around the disc.

A microreservoir system can be considered as a combination of the reservoir and matrix dispersion type systems. In this case, the reservoir of the active substance is formed by first suspending the drug solids in an aqueous solution of water-soluble polymer and then dispersing the drug suspension in a lipophilic polymer to form a multiplicity of unleachable, microscopic spheres of drug reservoirs.

Any of the above-described controlled release, extended release, and sustained release compositions can be formulated to release the active ingredient in about 30 minutes to about 1 week, in about 30 minutes to about 72 hours, in about 30 minutes to 24 hours, in about 30 minutes to 12 hours, in about 30 minutes to 6 hours, in about 30 minutes to 4 hours, and in about 3 hours to 10 hours. In embodiments, an effective concentration of the active ingredient(s) is sustained in a subject for 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, or more after administration of the pharmaceutical compositions to the subject.

Dosages

When the agents described herein are administered as pharmaceuticals to humans or animals, they can be given per se or as a pharmaceutical composition containing active ingredient in combination with a pharmaceutically acceptable carrier, excipient, or diluent. Actual dosage levels and time course of administration of the active ingredients in the pharmaceutical compositions of the invention can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. Generally, agents or pharmaceutical compositions of the invention are administered in an amount sufficient to reduce or eliminate symptoms associated with viral infection and/or autoimmune disease.

Exemplary dose ranges include 0.01 mg to 250 mg per day, 0.01 mg to 100 mg per day, 1 mg to 100 mg per day, 10 mg to 100 mg per day, 1 mg to 10 mg per day, and 0.01 mg to 10 mg per day. A preferred dose of an agent is the maximum that a patient can tolerate and not develop serious or unacceptable side effects. In embodiments, the agent is administered at a

concentration of about 10 micrograms to about 100 mg per kilogram of body weight per day, about 0.1 to about 10 mg/kg per day, or about 1.0 mg to about 10 mg/kg of body weight per day.

In embodiments, the pharmaceutical composition comprises an agent in an amount ranging between 1 and 10 mg, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mg. In embodiments, the therapeutically effective dosage produces a serum concentration of an agent of from about 0.1 ng/ml to about 50-100 μg/ml. The pharmaceutical compositions typically should provide a dosage of from about 0.001 mg to about 2000 mg of compound per kilogram of body weight per day. For example, dosages for systemic administration to a human patient can range from 1-10 μg/kg, 20-80 μg/kg, 5-50 μg/kg, 75-150 μg/kg, 100-500 μg/kg, 250- 750 μg/kg, 500-1000 μg/kg, 1-10 mg/kg, 5-50 mg/kg, 25-75 mg/kg, 50-100 mg/kg, 100-250 mg/kg, 50-100 mg/kg, 250-500 mg/kg, 500-750 mg/kg, 750-1000 mg/kg, 1000-1500 mg/kg, 1500-2000 mg/kg, 5 mg/kg, 20 mg/kg, 50 mg/kg, 100 mg/kg, 500 mg/kg, 1000 mg/kg, 1500 mg/kg, or 2000 mg/kg. Pharmaceutical dosage unit forms are prepared to provide from about 1 mg to about 5000 mg, for example from about 100 to about 2500 mg of the compound or a combination of essential ingredients per dosage unit form.

In embodiments, about 50 nM to about ΙμΜ of an agent is administered to a subject. In related embodiments, about 50-100 nM, 50-250 nM, 100-500 nM, 250-500 nM, 250-750 nM, 500-750 nM, 500 nM to 1 μΜ, or 750 nM to ΙμΜ of an agent is administered to a subject. Determination of an effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. Generally, an efficacious or effective amount of an agent is determined by first administering a low dose of the agent(s) and then incrementally increasing the administered dose or dosages until a desired effect (e.g., reduce or eliminate symptoms associated with viral infection or autoimmune disease) is observed in the treated subject, with minimal or acceptable toxic side effects. Applicable methods for

determining an appropriate dose and dosing schedule for administration of a pharmaceutical composition of the present invention are described, for example, in Goodman and Oilman's The Pharmacological Basis of Therapeutics, Goodman et al., eds., 11th Edition, McGraw-Hill 2005, and Remington: The Science and Practice of Pharmacy, 20th and 21st Editions, Gennaro and University of the Sciences in Philadelphia, Eds., Lippencott Williams & Wilkins (2003 and 2005), each of which is hereby incorporated by reference.

Combination Therapies

The tumor specific neo-antigen peptides and pharmaceutical compositions described herein can also be administered in combination with another therapeutic molecule. The

therapeutic molecule can be any compound used to mitigate neoplasia, or symptoms thereof.

Examples of such compounds include, but are not limited to, chemotherapeutic agents, anti— angiogenesis agents, checkpoint blockade antibodies or other molecules that reduce immune- suppression, and the like.

The tumor specific neo-antigen peptides can be administered before, during, or after administration of the additional therapeutic agent. In embodiments, the tumor specific neo-antigen peptides are administered before the first administration of the additional therapeutic agent. In embodiments, the tumor specific neo-antigen peptides are administered after the first administration of the additional therapeutic agent (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more). In embodiments, the tumor specific neo-antigen peptides are administered simultaneously with the first administration of the additional therapeutic agent.

Vaccines

In an exemplary embodiment, the present invention is directed to an immunogenic composition, e.g., a vaccine composition capable of raising a specific T-cell response. The vaccine composition comprises mutant neo-antigenic peptides and mutant neo-antigenic polypeptides corresponding to tumor specific neo-antigens identified by the methods described herein.

A suitable vaccine will preferably contain a plurality of tumor specific neo-antigenic peptides. In an embodiment, the vaccine will include between 1 and 100 sets peptides, more preferably between 1 and 50 such peptides, even more preferably between 10 and 30 sets peptides, even more preferably between 15 and 25 peptides. According to another preferred embodiment, the vaccine will include approximately 20 peptides, more preferably 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different peptides, further preferred 6, 7, 8, 9, 10 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different peptides, and most preferably 18, 19, 20, 21, 22, 23, 24, or 25 different peptides.

In one embodiment of the present invention the different tumor specific neo-antigenic peptides and/or polypeptides are selected for use in the neoplasia vaccine so as to maximize the likelihood of generating an immune attack against the neoplasia/tumor of the patient. Without being bound by theory, it is believed that the inclusion of a diversity of tumor specific neo- antigenic peptides will generate a broad scale immune attack against a neoplasia/tumor. In one embodiment, the selected tumor specific neo-antigenic peptides/polypeptides are encoded by missense mutations. In a second embodiment, the selected tumor specific neo-antigenic peptides/polypeptides are encoded by a combination of missense mutations and neoORF mutations. In a third embodiment, the selected tumor specific neo-antigenic

peptides/polypeptides are encoded by neoORF mutations.

In one embodiment in which the selected tumor specific neo-antigenic

peptides/polypeptides are encoded by missense mutations, the peptides and/or polypeptides are chosen based on their capability to associate with the particular MHC molecules of the patient. Peptides/polypeptides derived from neoORF mutations can also be selected on the basis of their capability to associate with the particular MHC molecules of the patient, but can also be selected even if not predicted to associate with the particular MHC molecules of the patient.

The vaccine composition is capable of raising a specific cytotoxic T-cells response and/or a specific helper T-cell response.

The vaccine composition can further comprise an adjuvant and/or a carrier. Examples of useful adjuvants and carriers are given herein below. The peptides and/or polypeptides in the composition can be associated with a carrier such as, e.g., a protein or an antigen-presenting cell such as e.g. a dendritic cell (DC) capable of presenting the peptide to a T-cell.

Adjuvants are any substance whose admixture into the vaccine composition increases or otherwise modifies the immune response to the mutant peptide. Carriers are scaffold structures, for example a polypeptide or a polysaccharide, to which the neo-antigenic peptides, is capable of being associated. Optionally, adjuvants are conjugated covalently or non-covalently to the peptides or polypeptides of the invention.

The ability of an adjuvant to increase the immune response to an antigen is typically manifested by a significant increase in immune-mediated reaction, or reduction in disease symptoms. For example, an increase in humoral immunity is typically manifested by a significant increase in the titer of antibodies raised to the antigen, and an increase in T-cell activity is typically manifested in increased cell proliferation, or cellular cytotoxicity, or cytokine secretion. An adjuvant may also alter an immune response, for example, by changing a primarily humoral or Th2 response into a primarily cellular, or Thl response.

Suitable adjuvants include, but are not limited to 1018 ISS, aluminum salts, Amplivax,

AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM. vector system, PLG microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, Aquila's QS21 stimulon (Aquila Biotech, Worcester, Mass., USA) which is derived from saponin, mycobacterial extracts and synthetic bacterial cell wall mimics, and other proprietary adjuvants such as Ribi's Detox. Quil or Superfos. Several immunological adjuvants (e.g., MF59) specific for dendritic cells and their preparation have been described previously (Dupuis M, et al., Cell Immunol. 1998; 186(1): 18-27; Allison A C; Dev Biol Stand. 1998; 92:3-11). Also cytokines may be used. Several cytokines have been directly linked to influencing dendritic cell migration to lymphoid tissues (e.g., TNF-alpha), accelerating the maturation of dendritic cells into efficient antigen -presenting cells for T-lymphocytes (e.g., GM- CSF, IL-1 and IL-4) (U.S. Pat. No. 5,849,589, specifically incorporated herein by reference in its entirety) and acting as immunoadjuvants (e.g., IL-12) (Gabrilovich D I, et al., J Immunother Emphasis Tumor Immunol. 1996 (6):414-418). Toll like receptors (TLRs) may also be used as adjuvants, and are important members of the family of pattern recognition receptors (PRRs) which recognize conserved motifs shared by many micro-organisms, termed "pathogen-associated molecular patterns" (PAMPS).

Recognition of these "danger signals" activates multiple elements of the innate and adaptive immune system. TLRs are expressed by cells of the innate and adaptive immune systems such as dendritic cells (DCs), macrophages, T and B cells, mast cells, and granulocytes and are localized in different cellular compartments, such as the plasma membrane, lysosomes, endosomes, and endolysosomes. Different TLRs recognize distinct PAMPS. For example, TLR4 is activated by LPS contained in bacterial cell walls, TLR9 is activated by unmethylated bacterial or viral CpG DNA, and TLR3 is activated by double stranded RNA. TLR ligand binding leads to the activation of one or more intracellular signaling pathways, ultimately resulting in the production of many key molecules associated with inflammation and immunity (particularly the transcription factor NF-κΒ and the Type-I interferons). TLR mediated DC activation leads to enhanced DC activation, phagocytosis, upregulation of activation and co- stimulation markers such as CD80, CD83, and CD86, expression of CCR7 allowing migration of DC to draining lymph nodes and facilitating antigen presentation to T cells, as well as increased secretion of cytokines such as type I interferons, IL-12, and IL-6. All of these downstream events are critical for the induction of an adaptive immune response.

Among the most promising cancer vaccine adjuvants currently in clinical development are the TLR9 agonist CpG and the synthetic double- stranded RNA (dsRNA) TLR3 ligand poly- ICLC. In preclinical studies poly-ICLC appears to be the most potent TLR adjuvant when compared to LPS and CpG due to its induction of pro-inflammatory cytokines and lack of stimulation of IL-10, as well as maintenance of high levels of co-stimulatory molecules in DCs. Furthermore, poly-ICLC was recently directly compared to CpG in non-human primates (rhesus macaques) as adjuvant for a protein vaccine consisting of human papillomavirus (HPV)16 capsomers (Stahl-Hennig C, Eisenblatter M, Jasny E, et al. Synthetic double- stranded RNAs are adjuvants for the induction of T helper 1 and humoral immune responses to human

papillomavirus in rhesus macaques. PLoS pathogens. Apr 2009;5(4)).

CpG immuno stimulatory oligonucleotides have also been reported to enhance the effects of adjuvants in a vaccine setting. Without being bound by theory, CpG oligonucleotides act by activating the innate (non- adaptive) immune system via Toll-like receptors (TLR), mainly TLR9. CpG triggered TLR9 activation enhances antigen- specific humoral and cellular responses to a wide variety of antigens, including peptide or protein antigens, live or killed viruses, dendritic cell vaccines, autologous cellular vaccines and polysaccharide conjugates in both prophylactic and therapeutic vaccines. More importantly, it enhances dendritic cell maturation and differentiation, resulting in enhanced activation of Thl cells and strong cytotoxic T- lymphocyte (CTL) generation, even in the absence of CD4 T-cell help. The Thl bias induced by TLR9 stimulation is maintained even in the presence of vaccine adjuvants such as alum or incomplete Freund's adjuvant (IFA) that normally promote a Th2 bias. CpG oligonucleotides show even greater adjuvant activity when formulated or co-administered with other adjuvants or in formulations such as microparticles, nano particles, lipid emulsions or similar formulations, which are especially necessary for inducing a strong response when the antigen is relatively weak. They also accelerate the immune response and enabled the antigen doses to be reduced by approximately two orders of magnitude, with comparable antibody responses to the full-dose vaccine without CpG in some experiments (Arthur M. Krieg, Nature Reviews, Drug Discovery, 5, Jun. 2006, 471-484). U.S. Pat. No. 6,406,705 Bl describes the combined use of CpG oligonucleotides, non-nucleic acid adjuvants and an antigen to induce an antigen- specific immune response. A commercially available CpG TLR9 antagonist is dSLIM (double Stem Loop Immunomodulator) by Mologen (Berlin, GERMANY), which is a preferred component of the pharmaceutical composition of the present invention. Other TLR binding molecules such as RNA binding TLR 7, TLR 8 and/or TLR 9 may also be used.

Xanthenone derivatives such as, for example, Vadimezan or AsA404 (also known as 5,6- dimethylaxanthenone-4-acetic acid (DMXAA)), may also be used as adjuvants according to embodiments of the invention. Alternatively, such derivatives may also be administered in parallel to the vaccine of the invention, for example via systemic or intratumoral delivery, to stimulate immunity at the tumor site. Without being bound by theory, it is believed that such xanthenone derivatives act by stimulating interferon (IFN) production via the stimulator of IFN gene ISTING) receptor (see e.g., Conlon et al. (2013) Mouse, but not Human STING, Binds and Signals in Response to the Vascular Disrupting Agent 5, 6-Dimethylxanthenone-4- Acetic Acid, Journal of Immunology, 190:5216-25 and Kim et al. (2013) Anticancer Flavonoids are Mouse- Selective STING Agonists, 8: 1396-1401). Other examples of useful adjuvants include, but are not limited to, chemically modified CpGs (e.g. CpR, Idera), Poly(I:C)(e.g. polyi:CI2U), non-CpG bacterial DNA or RNA as well as immunoactive small molecules and antibodies such as cyclophosphamide, sunitinib,

bevacizumab, celebrex, NCX-4016, sildenafil, tadalafil, vardenafil, sorafinib, XL-999, CP- 547632, pazopanib, ZD2171, AZD2171, ipilimumab, tremelimumab, and SC58175, which may act therapeutically and/or as an adjuvant. The amounts and concentrations of adjuvants and additives useful in the context of the present invention can readily be determined by the skilled artisan without undue experimentation. Additional adjuvants include colony- stimulating factors, such as Granulocyte Macrophage Colony Stimulating Factor (GM-CSF, sargramostim).

Poly-ICLC is a synthetically prepared double- stranded RNA consisting of polyl and polyC strands of average length of about 5000 nucleotides, which has been stabilized to thermal denaturation and hydrolysis by serum nucleases by the addition of polylysine and

carboxymethylcellulose. The compound activates TLR3 and the RNA helicase-domain of MDA5, both members of the PAMP family, leading to DC and natural killer (NK) cell activation and production of a "natural mix" of type I interferons, cytokines, and chemokines. Furthermore, poly-ICLC exerts a more direct, broad host-targeted anti-infectious and possibly antitumor effect mediated by the two IFN-inducible nuclear enzyme systems, the 2' 5 '-OAS and the Pl/eIF2a kinase, also known as the PKR (4-6), as well as RIG-I helicase and MDA5.

In rodents and non-human primates, poly-ICLC was shown to enhance T cell responses to viral antigens, cross-priming, and the induction of tumor-, virus-, and autoantigen-specific

CD8⁺ T-cells. In a recent study in non-human primates, poly-ICLC was found to be essential for the generation of antibody responses and T-cell immunity to DC targeted or non-targeted HIV Gag p24 protein, emphasizing its effectiveness as a vaccine adjuvant.

In human subjects, transcriptional analysis of serial whole blood samples revealed similar gene expression profiles among the 8 healthy human volunteers receiving one single s.c.

administration of poly-ICLC and differential expression of up to 212 genes between these 8 subjects versus 4 subjects receiving placebo. Remarkably, comparison of the poly-ICLC gene expression data to previous data from volunteers immunized with the highly effective yellow fever vaccine YF17D showed that a large number of transcriptional and signal transduction canonical pathways, including those of the innate immune system, were similarly upregulated at peak time points. More recently, an immunologic analysis was reported on patients with ovarian, fallopian tube, and primary peritoneal cancer in second or third complete clinical remission who were treated on a phase 1 study of subcutaneous vaccination with synthetic overlapping long peptides (OLP) from the cancer testis antigen NY-ESO-1 alone or with Montanide-ISA-51, or with 1.4 mg poly-ICLC and Montanide. The generation of NY-ESO- 1-specific CD4+ and CD8⁺ T-cell and antibody responses were markedly enhanced with the addition of poly-ICLC and Montanide compared to OLP alone or OLP and Montanide.

A vaccine composition according to the present invention may comprise more than one different adjuvant. Furthermore, the invention encompasses a therapeutic composition comprising any adjuvant substance including any of the above or combinations thereof. It is also contemplated that the peptide or polypeptide, and the adjuvant can be administered separately in any appropriate sequence.

A carrier may be present independently of an adjuvant. The function of a carrier can for example be to confer stability, to increase the biological activity, or to increase serum half-life. Furthermore, a carrier may aid presenting peptides to T-cells. The carrier may be any suitable carrier known to the person skilled in the art, for example a protein or an antigen presenting cell. A carrier protein could be but is not limited to keyhole limpet hemocyanin, serum proteins such as transferrin, bovine serum albumin, human serum albumin, thyroglobulin or ovalbumin, immunoglobulins, or hormones, such as insulin or palmitic acid. For immunization of humans, the carrier may be a physiologically acceptable carrier acceptable to humans and safe. However, tetanus toxoid and/or diptheria toxoid are suitable carriers in one embodiment of the invention. Alternatively, the carrier may be dextrans for example sepharose.

Cytotoxic T-cells (CTLs) recognize an antigen in the form of a peptide bound to an MHC molecule rather than the intact foreign antigen itself. The MHC molecule itself is located at the cell surface of an antigen presenting cell. Thus, an activation of CTLs is only possible if a trimeric complex of peptide antigen, MHC molecule, and APC is present. Correspondingly, it may enhance the immune response if not only the peptide is used for activation of CTLs, but if additionally APCs with the respective MHC molecule are added. Therefore, in some

embodiments the vaccine composition according to the present invention additionally contains at least one antigen presenting cell. The antigen-presenting cell (or stimulator cell) typically has an MHC class I or II molecule on its surface, and in one embodiment is substantially incapable of itself loading the MHC class I or II molecule with the selected antigen. As is described in more detail below, the MHC class I or II molecule may readily be loaded with the selected antigen in vitro.

Preferably, the antigen presenting cells are dendritic cells. Suitably, the dendritic cells are autologous dendritic cells that are pulsed with the neo-antigenic peptide. The peptide may be any suitable peptide that gives rise to an appropriate T-cell response. T-cell therapy using autologous dendritic cells pulsed with peptides from a tumor associated antigen is disclosed in Murphy et al. (1996) The Prostate 29, 371-380 and Tjua et al. (1997) The Prostate 32, 272-278.

Thus, in one embodiment of the present invention the vaccine composition containing at least one antigen presenting cell is pulsed or loaded with one or more peptides of the present invention. Alternatively, peripheral blood mononuclear cells (PBMCs) isolated from a patient may be loaded with peptides ex vivo and injected back into the patient. As an alternative the antigen presenting cell comprises an expression construct encoding a peptide of the present invention. The polynucleotide may be any suitable polynucleotide and it is preferred that it is capable of transducing the dendritic cell, thus resulting in the presentation of a peptide and induction of immunity.

Therapeutic Methods

The invention further provides a method of inducing a neoplasia/tumor specific immune response in a subject, vaccinating against a neoplasia/tumor, treating and or alleviating a symptom of cancer in a subject by administering the subject a neo-antigenic peptide or vaccine composition of the invention.

According to the invention, the above-described cancer vaccine may be used for a patient that has been diagnosed as having cancer, or at risk of developing cancer. In one embodiment, the patient may have a solid tumor such as breast, ovarian, prostate, lung, kidney, gastric, colon, testicular, head and neck, pancreas, brain, melanoma, and other tumors of tissue organs and hematological tumors, such as lymphomas and leukemias, including acute myelogenous leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, T cell lymphocytic leukemia, and B cell lymphomas.

The peptide or composition of the invention is administered in an amount sufficient to induce a CTL response. The neo-antigenic peptide, polypeptide or vaccine composition of the invention can be administered alone or in combination with other therapeutic agents. The therapeutic agent is for example, a chemotherapeutic or biotherapeutic agent, radiation, or immunotherapy. Any suitable therapeutic treatment for a particular cancer may be administered. Examples of chemotherapeutic and biotherapeutic agents include, but are not limited to, aldesleukin, altretamine, amifostine, asparaginase, bleomycin, capecitabine, carboplatin, carmustine, cladribine, cisapride, cisplatin, cyclophosphamide, cytarabine, dacarbazine (DTIC),

dactinomycin, docetaxel, doxorubicin, dronabinol, epoetin alpha, etoposide, filgrastim, fludarabine, fluorouracil, gemcitabine, granisetron, hydroxyurea, idarubicin, ifosfamide, interferon alpha, irinotecan, lansoprazole, levamisole, leucovorin, megestrol, mesna, methotrexate, metoclopramide, mitomycin, mitotane, mitoxantrone, omeprazole, ondansetron, paclitaxel (Taxol®), pilocarpine, prochloroperazine, rituximab, tamoxifen, taxol, topotecan hydrochloride, trastuzumab, vinblastine, vincristine and vinorelbine tartrate. For prostate cancer treatment, a preferred chemotherapeutic agent with which anti- CTLA-4 can be combined is paclitaxel (Taxol®).

In addition, the subject may be further administered an anti- immunosuppressive or immuno stimulatory agent. For example, the subject is further administered an anti-CTLA antibody or anti-PD-1 or anti-PD-Ll. Blockade of CTLA-4 or PD-1/PD-L1 by antibodies can enhance the immune response to cancerous cells in the patient. In particular, CTLA-4 blockade has been shown effective when following a vaccination protocol (Hodi et al 2005).

The optimum amount of each peptide to be included in the vaccine composition and the optimum dosing regimen can be determined by one skilled in the art without undue

experimentation. For example, the peptide or its variant may be prepared for intravenous (i.v.) injection, sub-cutaneous (s.c.) injection, intradermal (i.d.) injection, intraperitoneal (i.p.) injection, intramuscular (i.m.) injection. Preferred methods of peptide injection include s.c, i.d., i.p., i.m., and i.v. Preferred methods of DNA injection include i.d., i.m., s.c, i.p. and i.v. For example, doses of between 1 and 500 mg 50 μg and 1.5 mg, preferably 10 μg to 500 μg, of peptide or DNA may be given and will depend from the respective peptide or DNA. Doses of this range were successfully used in previous trials (Brunsvig P F, et al., Cancer Immunol Immunother. 2006; 55(12): 1553- 1564; M. Staehler, et al., ASCO meeting 2007; Abstract No 3017). Other methods of administration of the vaccine composition are known to those skilled in the art.

The inventive pharmaceutical composition may be compiled so that the selection, number and/or amount of peptides present in the composition is/are tissue, cancer, and/or patient- specific. For instance, the exact selection of peptides can be guided by expression patterns of the parent proteins in a given tissue to avoid side effects. The selection may be dependent on the specific type of cancer, the status of the disease, earlier treatment regimens, the immune status of the patient, and, of course, the HLA-haplotype of the patient. Furthermore, the vaccine according to the invention can contain individualized components, according to personal needs of the particular patient. Examples include varying the amounts of peptides according to the expression of the related neoantigen in the particular patient, unwanted side-effects due to personal allergies or other treatments, and adjustments for secondary treatments following a first round or scheme of treatment.

Pharmaceutical compositions comprising the peptide of the invention may be

administered to an individual already suffering from cancer. In therapeutic applications, compositions are administered to a patient in an amount sufficient to elicit an effective CTL response to the tumor antigen and to cure or at least partially arrest symptoms and/or

complications. An amount adequate to accomplish this is defined as "therapeutically effective dose." Amounts effective for this use will depend on, e.g., the peptide composition, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician, but generally range for the initial immunization (that is for therapeutic or prophylactic administration) from about 1.0 μg to about 50,000 μg of peptide for a 70 kg patient, followed by boosting dosages or from about 1.0 μg to about 10,000 μg of peptide pursuant to a boosting regimen over weeks to months depending upon the patient's response and condition and possibly by measuring specific CTL activity in the patient's blood. It should be kept in mind that the peptide and compositions of the present invention may generally be employed in serious disease states, that is, life-threatening or potentially life threatening situations, especially when the cancer has metastasized. For therapeutic use, administration should begin as soon as possible after the detection or surgical removal of tumors. This is followed by boosting doses until at least symptoms are substantially abated and for a period thereafter. The pharmaceutical compositions (e.g., vaccine compositions) for therapeutic treatment are intended for parenteral, topical, nasal, oral or local administration. Preferably, the pharmaceutical compositions are administered parenterally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly. The compositions may be administered at the site of surgical excision to induce a local immune response to the tumor. The invention provides compositions for parenteral administration which comprise a solution of the peptides and vaccine compositions are dissolved or suspended in an acceptable carrier, preferably an aqueous carrier. A variety of aqueous carriers may be used, e.g., water, buffered water, 0.9% saline, 0.3% glycine, hyaluronic acid and the like. These compositions may be sterilized by conventional, well known

sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.

The concentration of peptides of the invention in the pharmaceutical formulations can vary widely, i.e., from usually less than about 0.1%, to at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.

A liposome suspension containing a peptide may be administered intravenously, locally, topically, etc. in a dose which varies according to, inter alia, the manner of administration, the peptide being delivered, and the stage of the disease being treated. For targeting to the immune cells, a ligand, such as, e.g., antibodies or fragments thereof specific for cell surface

determinants of the desired immune system cells, can be incorporated into the liposome. .

For solid compositions, conventional or nanoparticle nontoxic solid carriers may be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For oral administration, a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10-95% of active ingredient, that is, one or more peptides of the invention, and more preferably at a concentration of 25%-75%.

For aerosol administration, the immunogenic peptides are preferably supplied in finely divided form along with a surfactant and propellant. Typical percentages of peptides are 0.01 %- 20% by weight, preferably 1%-10%. The surfactant will, of course, be nontoxic, and preferably soluble in the propellant. Representative of such agents are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters, such as mixed or natural glycerides may be employed. The surfactant may constitute 0. l%-20% by weight of the composition, preferably 0.25-5%. The balance of the composition is ordinarily propellant. A carrier can also be included as desired, as with, e.g., lecithin for intranasal delivery.

The peptides and polypeptides of the invention can be readily synthesized chemically utilizing reagents that are free of contaminating bacterial or animal substances (Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85:2149-54,

1963).

For therapeutic or immunization purposes, nucleic acids encoding the peptide of the invention and optionally one or more of the peptides described herein can also be administered to the patient. A number of methods are conveniently used to deliver the nucleic acids to the patient. For instance, the nucleic acid can be delivered directly, as "naked DNA". This approach is described, for instance, in Wolff et al., Science 247: 1465-1468 (1990) as well as U.S. Patent Nos. 5,580,859 and 5,589,466. The nucleic acids can also be administered using ballistic delivery as described, for instance, in U.S. Patent No. 5,204,253. Particles comprised solely of DNA can be administered. Alternatively, DNA can be adhered to particles, such as gold particles.

The nucleic acids can also be delivered complexed to cationic compounds, such as cationic lipids. Lipid- mediated gene delivery methods are described, for instance, in

W01996/18372; WO 1993/24640; Mannino & Gould-Fogerite , BioTechniques 6(7): 682-691 (1988); U.S. Patent No. 5,279,833; WO 1991/06309; and Feigner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7414 (1987). RNA encoding the peptide of interest can also be used for delivery (see, e.g., Kiken et al, 2011; Su et al , 2011).

The peptides and polypeptides of the invention can also be expressed by attenuated viral hosts, such as vaccinia or fowlpox. This approach involves the use of vaccinia virus as a vector to express nucleotide sequences that encode the peptide of the invention. Upon introduction into an acutely or chronically infected host or into a noninfected host, the recombinant vaccinia virus expresses the immunogenic peptide, and thereby elicits a host CTL response. Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No.

4,722,848,. Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover et al. (Nature 351:456-460 (1991)). A wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention, e.g., Salmonella typhi vectors and the like, will be apparent to those skilled in the art from the description herein.

A preferred means of administering nucleic acids encoding the peptide of the invention uses minigene constructs encoding multiple epitopes. To create a DNA sequence encoding the selected CTL epitopes (minigene) for expression in human cells, the amino acid sequences of the epitopes are reverse translated. A human codon usage table is used to guide the codon choice for each amino acid. These epitope-encoding DNA sequences are directly adjoined, creating a continuous polypeptide sequence. To optimize expression and/or immunogenicity, additional elements can be incorporated into the minigene design. Examples of amino acid sequence that could be reverse translated and included in the minigene sequence include: helper T lymphocyte, epitopes, a leader (signal) sequence, and an endoplasmic reticulum retention signal. In addition, MHC presentation of CTL epitopes may be improved by including synthetic (e.g. poly-alanine) or naturally- occurring flanking sequences adjacent to the CTL epitopes.

The minigene sequence is converted to DNA by assembling oligonucleotides that encode the plus and minus strands of the minigene. Overlapping oligonucleotides (30-100 bases long) are synthesized, phosphorylated, purified and annealed under appropriate conditions using well known techniques. The ends of the oligonucleotides are joined using T4 DNA ligase. This synthetic minigene, encoding the CTL epitope polypeptide, can then cloned into a desired expression vector.

Standard regulatory sequences well known to those of skill in the art are included in the vector to ensure expression in the target cells. Several vector elements are required: a promoter with a down-stream cloning site for minigene insertion; a polyadenylation signal for efficient transcription termination; an E. coli origin of replication; and an E. coli selectable marker (e.g. ampicillin or kanamycin resistance). Numerous promoters can be used for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, U.S. Patent Nos. 5,580,859 and 5,589,466 for other suitable promoter sequences.

Additional vector modifications may be desired to optimize minigene expression and immunogenicity. In some cases, introns are required for efficient gene expression, and one or more synthetic or naturally-occurring introns could be incorporated into the transcribed region of the minigene. The inclusion of mRNA stabilization sequences can also be considered for increasing minigene expression. It has recently been proposed that immuno stimulatory sequences (ISSs or CpGs) play a role in the immunogenicity of DNA' vaccines. These sequences could be included in the vector, outside the minigene coding sequence, if found to enhance immunogenicity.

In some embodiments, a bicistronic expression vector, to allow production of the minigene-encoded epitopes and a second protein included to enhance or decrease

immunogenicity can be used. Examples of proteins or polypeptides that could beneficially enhance the immune response if co-expressed include cytokines (e.g., IL2, IL12, GM-CSF), cytokine-inducing molecules (e.g. LeIF) or costimulatory molecules. Helper (HTL) epitopes could be joined to intracellular targeting signals and expressed separately from the CTL epitopes. This would allow direction of the HTL epitopes to a cell compartment different than the CTL epitopes. If required, this could facilitate more efficient entry of HTL epitopes into the MHC class II pathway, thereby improving CTL induction. In contrast to CTL induction, specifically decreasing the immune response by co-expression of immunosuppressive molecules (e.g. TGF- β) may be beneficial in certain diseases.

Once an expression vector is selected, the minigene is cloned into the polylinker region downstream of the promoter. This plasmid is transformed into an appropriate E. coli strain, and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements included in the vector, are confirmed using restriction mapping and DNA sequence analysis. Bacterial cells harboring the correct plasmid can be stored as a master cell bank and a working cell bank. Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS). A variety of methods have been described, and new techniques may become available. As noted above, nucleic acids are conveniently formulated with cationic lipids. In addition, glycolipids, fusogenic liposomes, peptides and compounds referred to collectively as protective, interactive, non-condensing (PINC) could also be complexed to purified plasmid DNA to influence variables such as stability, intramuscular dispersion, or trafficking to specific organs or cell types.

Target cell sensitization can be used as a functional assay for expression and MHC class I presentation of minigene-encoded CTL epitopes. The plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays. The transfection method used will be dependent on the final formulation. Electroporation can be used for "naked" DNA, whereas cationic lipids allow direct in vitro transfection. A plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of transfected cells using fluorescence activated cell sorting (FACS). These cells are then chromium-51 labeled and used as target cells for epitope- specific CTL lines. Cytolysis, detected by 51 Cr release, indicates production of MHC presentation of mini gene-encoded CTL epitopes.

In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations. Transgenic mice expressing appropriate human MHC molecules are immunized with the DNA product. The dose and route of administration are formulation dependent (e.g. IM for DNA in PBS, IP for lipid-complexed DNA). Twenty-one days after immunization, splenocytes are harvested and restimulated for 1 week in the presence of peptides encoding each epitope being tested. These effector cells (CTLs) are assayed for cytolysis of peptide-loaded, chromium-51 labeled target cells using standard techniques. Lysis of target cells sensitized by MHC loading of peptides corresponding to minigene-encoded epitopes demonstrates DNA vaccine function for in vivo induction of CTLs.

Peptides may be used to elicit CTL ex vivo, as well. The resulting CTL, can be used to treat chronic tumors in patients that do not respond to other conventional forms of therapy, or will not respond to a peptide vaccine approach of therapy. Ex vivo CTL responses to a particular tumor antigen are induced by incubating in tissue culture the patient's CTL precursor cells (CTLp) together with a source of antigen-presenting cells (APC) and the appropriate peptide.

After an appropriate incubation time (typically 1-4 weeks), in which the CTLp are activated and mature and expand into effector CTL, the cells are infused back into the patient, where they will destroy their specific target cell (i.e., a tumor cell). In order to optimize the in vitro conditions for the generation of specific cytotoxic T cells, the culture of stimulator cells is maintained in an appropriate serum-free medium.

Prior to incubation of the stimulator cells with the cells to be activated, e.g., precursor

CD8+ cells, an amount of antigenic peptide is added to the stimulator cell culture, of sufficient quantity to become loaded onto the human Class I molecules to be expressed on the surface of the stimulator cells. In the present invention, a sufficient amount of peptide is an amount that will allow about 200, and preferably 200 or more, human Class I MHC molecules loaded with peptide to be expressed on the surface of each stimulator cell. Preferably, the stimulator cells are incubated with >2μg/ml peptide. For example, the stimulator cells are incubates with > 3, 4, 5, 10, 15, or more μg/ml peptide.

Resting or precursor CD8+ cells are then incubated in culture with the appropriate stimulator cells for a time period sufficient to activate the CD8+ cells. Preferably, the CD8+ cells are activated in an antigen- specific manner. The ratio of resting or precursor CD8+

(effector) cells to stimulator cells may vary from individual to individual and may further depend upon variables such as the amenability of an individual's lymphocytes to culturing conditions and the nature and severity of the disease condition or other condition for which the within-described treatment modality is used. Preferably, however, the lymphocyte: stimulator cell ratio is in the range of about 30: 1 to 300: 1. The effector/stimulator culture may be maintained for as long a time as is necessary to stimulate a therapeutically useable or effective number of CD8+ cells.

The induction of CTL in vitro requires the specific recognition of peptides that are bound to allele specific MHC class I molecules on APC. The number of specific MHC/peptide complexes per APC is crucial for the stimulation of CTL, particularly in primary immune responses. While small amounts of peptide/MHC complexes per cell are sufficient to render a cell susceptible to lysis by CTL, or to stimulate a secondary CTL response, the successful activation of a CTL precursor (pCTL) during primary response requires a significantly higher number of MHC/peptide complexes. Peptide loading of empty major histocompatability complex molecules on cells allows the induction of primary cytotoxic T lymphocyte responses.

Since mutant cell lines do not exist for every human MHC allele, it is advantageous to use a technique to remove endogenous MHC- associated peptides from the surface of APC, followed by loading the resulting empty MHC molecules with the immunogenic peptides of interest. The use of non-transformed (non-tumorigenic), noninfected cells, and preferably, autologous cells of patients as APC is desirable for the design of CTL induction protocols directed towards development of ex vivo CTL therapies. This application discloses methods for stripping the endogenous MHC-associated peptides from the surface of APC followed by the loading of desired peptides.

A stable MHC class I molecule is a trimeric complex formed of the following elements: 1) a peptide usually of 8 - 10 residues, 2) a transmembrane heavy polymorphic protein chain which bears the peptide-binding site in its al and a2 domains, and 3) a non-covalently associated non-polymorphic light chain, p2microglobuiin. Removing the bound peptides and/or dissociating the p2microglobulin from the complex renders the MHC class I molecules nonfunctional and unstable, resulting in rapid degradation. All MHC class I molecules isolated from PBMCs have endogenous peptides bound to them. Therefore, the first step is to remove all endogenous peptides bound to MHC class I molecules on the APC without causing their degradation before exogenous peptides can be added to them.

Two possible ways to free up MHC class I molecules of bound peptides include lowering the culture temperature from 37°C to 26°C overnight to destabilize p2microglobulin and stripping the endogenous peptides from the cell using a mild acid treatment. The methods release previously bound peptides into the extracellular environment allowing new exogenous peptides to bind to the empty class I molecules. The cold-temperature incubation method enables exogenous peptides to bind efficiently to the MHC complex, but requires an overnight incubation at 26°C which may slow the cell's metabolic rate. It is also likely that cells not actively synthesizing MHC molecules (e.g., resting PBMC) would not produce high amounts of empty surface MHC molecules by the cold temperature procedure.

Harsh acid stripping involves extraction of the peptides with trifluoroacetic acid, pH 2, or acid denaturation of the immunoaffinity purified class I-peptide complexes. These methods are not feasible for CTL induction, since it is important to remove the endogenous peptides while preserving APC viability and an optimal metabolic state which is critical for antigen

presentation. Mild acid solutions of pH 3 such as glycine or citrate -phosphate buffers have been used to identify endogenous peptides and to identify tumor associated T cell epitopes. The treatment is especially effective, in that only the MHC class I molecules are destabilized (and associated peptides released), while other surface antigens remain intact, including MHC class II molecules. Most importantly, treatment of cells with the mild acid solutions do not affect the cell's viability or metabolic state. The mild acid treatment is rapid since the stripping of the endogenous peptides occurs in two minutes at 4°C and the APC is ready to perform its function after the appropriate peptides are loaded. The technique is utilized herein to make peptide- specific APCs for the generation of primary antigen- specific CTL. The resulting APC are efficient in inducing peptide- specific CD8+ CTL.

Activated CD8+ cells may be effectively separated from the stimulator cells using one of a variety of known methods. For example, monoclonal antibodies specific for the stimulator cells, for the peptides loaded onto the stimulator cells, or for the CD8+ cells (or a segment thereof) may be utilized to bind their appropriate complementary ligand. Antibody- tagged molecules may then be extracted from the stimulator-effector cell admixture via appropriate means, e.g., via well-known immunoprecipitation or immunoassay methods.

Effective, cytotoxic amounts of the activated CD8+ cells can vary between in vitro and in vivo uses, as well as with the amount and type of cells that are the ultimate target of these killer cells. The amount will also vary depending on the condition of the patient and should be determined via consideration of all appropriate factors by the practitioner. Preferably, however, about 1 X 10⁶ to about 1 X 10¹², more preferably about 1 X 10⁸ to about 1 X 10¹¹, and even more preferably, about 1 X 10⁹ to about 1 X 10¹⁰ activated CD8+ cells are utilized for adult humans, compared to about 5 X 10⁶ - 5 X 10⁷ cells used in mice.

Preferably, as discussed above, the activated CD8+ cells are harvested from the cell culture prior to administration of the CD8+ cells to the individual being treated. It is important to note, however, that unlike other present and proposed treatment modalities, the present method uses a cell culture system that is not tumorigenic. Therefore, if complete separation of stimulator cells and activated CD8+ cells is not achieved, there is no inherent danger known to be associated with the administration of a small number of stimulator cells, whereas

administration of mammalian tumor-promoting cells may be extremely hazardous.

Methods of re-introducing cellular components are known in the art and include procedures such as those exemplified in U.S. Patent No. 4,844,893 to Honsik, et al. and U.S. Patent No. 4,690,915 to Rosenberg. For example, administration of activated CD8+ cells via intravenous infusion is appropriate. CD8+ cell activity may be augmented through the use of CD4+ cells. The identification of CD4 T+ cell epitopes for tumor antigens has attracted interest because many immune based therapies against cancer may be more effective if both CD8+ and CD4+ T lymphocytes are used to target a patient's tumor. CD4+ cells are capable of enhancing CD8 T cell responses. Many studies in animal models have clearly demonstrated better results when both CD4+ and CD8+ T cells participate in anti-tumor responses (see e.g., Nishimura et al. (1999) Distinct role of antigen-specific T helper type 1 (TH1) and Th2 cells in tumor eradication in vivo. J Ex Med 190:617-27). Universal CD4+ T cell epitopes have been identified that are applicable to developing therapies against different types of cancer (see e.g., Kobayashi et al. (2008) Current Opinion in Immunology 20:221-27). For example, an HLA-DR restricted helper peptide from tetanus toxoid was used in melanoma vaccines to activate CD4+ T cells non- specifically (see e.g., Slingluff et al. (2007) Immunologic and Clinical Outcomes of a Randomized Phase II Trial of Two Multipeptide Vaccines for Melanoma in the Adjuvant Setting, Clinical Cancer Research 13(21):6386-95). It is contemplated within the scope of the invention that such CD4+ cells may be applicable at three levels that vary in their tumor specificity: 1) a broad level in which universal CD4+ epitopes (e.g., tetanus toxoid) may be used to augment CD8+ cells; 2) an intermediate level in which native, tumor-associated CD4+ epitopes may be used to augment CD8+ cells; and 3) a patient specific level in which neoantigen CD4+ epitopes may be used to augment CD8+ cells in a patient specific manner.

CD8+ cell immunity may also be generated with neo-antigen loaded dendritic cell (DC) vaccine. DCs are potent antigen-presenting cells that initiate T cell immunity and can be used as cancer vaccines when loaded with one or more peptides of interest, for example, by direct peptide injection. For example, patients that were newly diagnosed with metastatic melanoma were shown to be immunized against 3 HLA-A*0201 -restricted gplOO melanoma antigen - derived peptides with autologous peptide pulsed CD40L/IFN-g-activated mature DCs via an IL- 12p70-producing patient DC vaccine (see e.g., Carreno et al (2013) L-12p70-producing patient DC vaccine elicits Tcl-polarized immunity, Journal of Clinical Investigation, 123(8):3383-94 and Ali et al. (2009) In situ regulation of DC subsets and T cells mediates tumor regression in mice, Cancer Immunotherapy, 1(8): 1-10). It is contemplated within the scope of the invention that neo-antigen loaded DCs may be prepared using the synthetic TLR 3 agonist Polyinosinic- Polycytidylic Acid-poly-L-lysine Carboxymethylcellulose (Poly-ICLC) to stimulate the DCs. Poly-ICLC is a potent individual maturation stimulus for human DCs as assessed by an upregulation of CD83 and CD86, induction of interleukin-12 (IL-12), tumor necrosis factor (TNF), interferon gamma-induced protein 10 (IP- 10), interleukin 1 (IL-1), and type I interferons (IFN), and minimal interleukin 10 (IL-10) production. DCs may be differentiated from frozen peripheral blood mononuclear cells (PBMCs) obtained by leukapheresis, while PBMCs may be isolated by Ficoll gradient centrifugation and frozen in aliquots.

Illustratively, the following 7 day activation protocol may be used. Day 1— PBMCs are thawed and plated onto tissue culture flasks to select for monocytes which adhere to the plastic surface after 1-2 hr incubation at 37°C in the tissue culture incubator. After incubation, the lymphocytes are washed off and the adherent monocytes are cultured for 5 days in the presence of interleukin-4 (IL-4) and granulocyte macrophage-colony stimulating factor (GM-CSF) to differentiate to immature DCs. On Day 6, immature DCs are pulsed with the keyhole limpet hemocyanin (KLH) protein which serves as a control for the quality of the vaccine and may boost the immunogenicity of the vaccine. The DCs are stimulated to mature, loaded with peptide antigens, and incubated overnight. On Day 7, the cells are washed, and frozen in 1 ml aliquots containing 4-20 x 10(6) cells using a controlled-rate freezer. Lot release testing for the batches of DCs may be performed to meet minimum specifications before the DCs are injected into patients (see e.g., Sabado et al. (2013) Preparation of tumor antigen-loaded mature dendritic cells for immunotherapy, J. Vis Exp. Aug 1;(78). doi: 10.3791/50085).

A DC vaccine may be incorporated into a scaffold system to facilitate delivery to a patient. Therapeutic treatment of a patients neoplasia with a DC vaccine may utilize a biomaterial system that releases factors that recruit host dendritic cells into the device, differentiates the resident, immature DCs by locally presenting adjuvants (e.g., danger signals) while releasing antigen, and promotes the release of activated, antigen loaded DCs to the lymph nodes (or desired site of action) where the DCs may interact with T cells to generate a potent cytotoxic T lymphocyte response to the cancer neo-antigens. Implantable biomaterials may be used to generate a potent cytotoxic T lymphocyte response against a neoplasia in a patient specific manner. The biomaterial-resident dendritic cells may then be activated by exposing them to danger signals mimicking infection, in concert with release of antigen from the biomaterial. The activated dendritic cells then migrate from the biomaterials to lymph nodes to induce a cytotoxic T effector response. This approach has previously been demonstrated to lead to regression of established melanoma in preclinical studies using a lysate prepared from tumor biopsies (see e.g., Ali et al. (2209) In situ regulation of DC subsets and T cells mediates tumor regression in mice, Cancer Immunotherapy 1(8): 1-10; Ali et al. (2009) Infection-mimicking materials to program dendritic cells in situ. Nat Mater 8: 151-8), and such a vaccine is currently being tested in a Phase I clinical trial recently initiated at the Dana-Farber Cancer Institute. This approach has also been shown to lead to regression of glioblastoma, as well as the induction of a potent memory response to prevent relapse, using the C6 rat glioma model.24 In the current proposal. The ability of such an implantable, biomatrix vaccine delivery scaffold to amplify and sustain tumor specific dendritic cell activation may lead to more robust anti-tumor

immunosensitization than can be achieved by traditional subcutaneous or intra-nodal vaccine administrations.

The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory

Manual", second edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology" "Handbook of Experimental Immunology" (Wei, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction", (Mullis, 1994); "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Example 1: Cancer Vaccine Testing Protocol

The above-described compositions and methods may be tested on 15 patients with high- risk melanoma (fully resected stages IIIB, IIIC and IVMla,b) according to the general flow process shown in FIG. 2. Patients may receive a series of priming vaccinations with a mixture of personalized tumor- specific peptides and poly-ICLC over a 4 week period followed by two boosts during a maintenance phase. All vaccinations will be subcutaneously delivered. The vaccine will be evaluated for safety, tolerability, immune response and clinical effect in patients and for feasibility of producing vaccine and successfully initiating vaccination within an appropriate time frame. The first cohort will consist of 5 patients, and after safety is adequately demonstrated, an additional cohort of 10 patients may be enrolled (see, e.g., FIG. 3 depicting an approach for an initial population study). Peripheral blood will be extensively monitored for peptide- specific T-cell responses and patients will be followed for up to two years to assess disease recurrence.

As described above, there is a large body of evidence in both animals and humans that mutated epitopes are effective in inducing an immune response and that cases of spontaneous tumor regression or long term survival correlate with CD8⁺ T-cell responses to mutated epitopes (Buckwalter and Srivastava PK. "It is the antigen(s), stupid" and other lessons from over a decade of vaccitherapy of human cancer. Seminars in immunology 20:296-300 (2008);

Karanikas et al, High frequency of cytolytic T lymphocytes directed against a tumor- specific mutated antigen detectable with HLA tetramers in the blood of a lung carcinoma patient with long survival. Cancer Res. 61:3718-3724 (2001); Lennerz et al, The response of autologous T cells to a human melanoma is dominated by mutated neo-antigens. Proc Natl Acad Sci U S A.102: 16013 (2005)) and that "immunoediting" can be tracked to alterations in expression of dominant mutated antigens in mice and man (Matsushita et al, Cancer exome analysis reveals a T-cell-dependent mechanism of cancer immunoediting Nature 482:400 (2012); DuPage et al, Expression of tumor- specific antigens underlies cancer immunoediting Nature 482:405 (2012); and Sampson et al, Immunologic escape after prolonged progression-free survival with epidermal growth factor receptor variant III peptide vaccination in patients with newly diagnosed glioblastoma J Clin Oncol. 28:4722-4729 (2010)).

Next-generation sequencing can now rapidly reveal the presence of discrete mutations such as coding mutations in individual tumors, most commonly single amino acid changes (e.g., missense mutations; FIG. 4A) and less frequently novel stretches of amino acids generated by frame-shift insertions/deletions/gene fusions, read-through mutations in stop codons, and translation of improperly spliced introns (e.g., neoORFs; FIG. 4B). NeoORFs are particularly valuable as immunogens because the entirety of their sequence is completely novel to the immune system and so are analogous to a viral or bacterial foreign antigen. Thus, neoORFs: (1) are highly specific to the tumor (i.e. there is no expression in any normal cells); (2) can bypass central tolerance, thereby increasing the precursor frequency of neoantigen- specific CTLs. For example, the power of utilizing analogous foreign sequences in a therapeutic anti-cancer vaccine was recently demonstrated with peptides derived from human papilloma virus (HPV). -50% of the 19 patients with pre-neoplastic, viral-induced disease who received 3 - 4 vaccinations of a mix of HPV peptides derived from the viral oncogenes E6 and E7 maintained a complete response for >24 months ( Kenter et a, Vaccination against HPV- 16 Oncoproteins for Vulvar Intraepithelial Neoplasia NEJM 361: 1838 (2009)).

Sequencing technology has revealed that each tumor contains multiple, patient-specific mutations that alter the protein coding content of a gene. Such mutations create altered proteins, ranging from single amino acid changes (caused by missense mutations) to addition of long regions of novel amino acid sequence due to frame shifts, read-through of termination codons or translation of intron regions (novel open reading frame mutations; neoORFs). These mutated proteins are valuable targets for the host's immune response to the tumor as, unlike native proteins, they are not subject to the immune-dampening effects of self-tolerance. Therefore, mutated proteins are more likely to be immunogenic and are also more specific for the tumor cells compared to normal cells of the patient.

Utilizing recently improved algorithms for predicting which missense mutations create strong binding peptides to the patient's cognate MHC molecules, a set of peptides representative of optimal mutated epitopes (both neoORF and missense) for each patient will be identified and prioritized and up to 20 or more peptides will be prepared for immunization (Zhang et al, Machine learning competition in immunology - Prediction of HLA class I binding peptides J Immunol Methods 374: 1 (2011); Lundegaard et al Prediction of epitopes using neural network based methods J Immunol Methods 374:26 (2011)). Peptides -20-35 amino acids in length will be synthesized because such "long" peptides undergo efficient internalization, processing and cross-presentation in professional antigen-presenting cells such as dendritic cells, and have been shown to induce CTLs in humans (Melief and van der Burg, Immunotherapy of established (pre) malignant disease by synthetic long peptide vaccines Nature Rev Cancer 8:351 (2008)).

In addition to a powerful and specific immunogen, an effective immune response requires a strong adjuvant to activate the immune system (Speiser and Romero, Molecularly defined vaccines for cancer immunotherapy, and protective T cell immunity Seminars in Immunol

22: 144 (2010)). For example, Toll-like receptors (TLRs) have emerged as powerful sensors of microbial and viral pathogen "danger signals", effectively inducing the innate immune system, and in turn, the adaptive immune system (Bhardwaj and Gnjatic, TLR AGONISTS: Are They Good Adjuvants? Cancer J. 16:382-391 (2010)). Among the TLR agonists, poly-ICLC (a synthetic double-stranded RNA mimic) is one of the most potent activators of myeloid-derived dendritic cells. In a human volunteer study, poly-ICLC has been shown to be safe and to induce a gene expression profile in peripheral blood cells comparable to that induced by one of the most potent live attenuated viral vaccines, the yellow fever vaccine YF-17D (Caskey et al, Synthetic double- stranded RNA induces innate immune responses similar to a live viral vaccine in humans J Exp Med 208:2357 (2011)). Hiltonol®, a GMP preparation of poly-ICLC prepared by

Oncovir, Inc, will be utilized as the adjuvant.

Example 2: Target Patient Population

Patients with stage IIIB, IIIC and IVMla,b, melanoma have a significant risk of disease recurrence and death, even with complete surgical resection of disease (Balch et al, Final Version of 2009 AJCC Melanoma Staging and Classification J Clin Oncol 27:6199 - 6206 (2009)). An available systemic adjuvant therapy for this patient population is interferon-a (IFN ) which provides a measurable but marginal benefit and is associated with significant, frequently dose- limiting toxicity (Kirkwood et al, Interferon alfa-2b Adjuvant Therapy of High-Risk Resected Cutaneous Melanoma: The Eastern Cooperative Oncology Group Trial EST 1684 J Clin Oncol 14:7-17 (1996); Kirkwood et al , High- and Low-dose Interferon Alpha-2b in High-Risk

Melanoma: First Analysis of Intergroup Trial E1690/S9111/C9190 J Clin Oncol 18:2444 - 2458 (2000)). These patients are not immuno-compromised by previous cancer-directed therapy or by active cancer and thus represent an excellent patient population in which to assess the safety and immunological impact of the vaccine. Finally, current standard of care for these patients does not mandate any treatment following surgery, thus allowing for the 8 - 10 week window for vaccine preparation.

The target population will be cutaneous melanoma patients with clinically detectable, histologically confirmed nodal (local or distant) or in transit metastasis, who have been fully resected and are free of disease (most of stage IIIB (because of the need to have adequate tumor tissue for sequencing and cell line development, patients with ulcerated primary tumor but micrometastatic lymph nodes (Tl-4b, Nla or N2a) will be excluded.), all of stage IIIC, and stage IVMla, b). These may be patients at first diagnosis or at disease recurrence after previous diagnosis of an earlier stage melanoma.

Tumor harvest: Patients will undergo complete resection of their primary melanoma (if not already removed) and all regional metastatic disease with the intent of rendering them free of melanoma. After adequate tumor for pathological assessment has been harvested, remaining tumor tissue will be placed in sterile media in a sterile container and prepared for disaggregation. Portions of the tumor tissue will be used for whole-exome and transcriptome sequencing and cell line generation and any remaining tumor will be frozen.

Normal tissue harvest: A normal tissue sample (blood or sputum sample ) will be taken for whole exome sequencing.

Patients with clinically evident locoregional metastatic disease or fully resectable distant nodal, cutaneous or lung metastatic disease (but absence of unresectable distant or visceral metastatic disease) will be identified and enrolled on the study. Entry of patients prior to surgery is necessary in order to acquire fresh tumor tissue for melanoma cell line development (to generate target cells for in vitro cytotoxicity assays as part of the immune monitoring plan).

Example 3: Dose and Schedule

For patients who have met all pre-treatment criteria, vaccine administration will commence as soon as possible after the study drug has arrived and has met incoming

specifications. For each patient, there will be four separate study drugs, each containing 5 of 20 patient-specific peptides. Immunizations may generally proceed according to the schedule shown in FIG. 5.

Patients will be treated in an outpatient clinic. Immunization on each treatment day will consist of four 1 ml subcutaneous injections, each into a separate extremity in order to target different regions of the lymphatic system to reduce antigenic competition. If the patient has undergone complete axillary or inguinal lymph node dissection, vaccines will be administered into the right or left midriff as an alternative. Each injection will consist of 1 of the 4 study drugs for that patient and the same study drug will be injected into the same extremity for each cycle. The composition of each 1 ml injection is:

0.75 ml study drug containing 300 μg each of 5 patient- specific peptides

0.25 ml (0.5 mg) of 2 mg/ml poly-ICLC (Hiltonol®)

During the induction/priming phase, patients will be immunized on days 1, 4, 8, 15 and 22. In the maintenance phase, patients will receive booster doses at weeks 12 and 24.

Blood samples may be obtained at multiple time points: pre- (baseline; two samples on different days); day 15 during priming vaccination; four weeks after the induction/priming vaccination (week 8); pre- (week 12) and post- (week 16) first boost; pre- (week 24) and post- (week 28) second boost 50 - 150 ml blood will be collected for each sample (except week 16). The primary immunological endpoint will be at week 16, and hence patients will undergo leukapheresis (unless otherwise indicated based on patient and physician assessment).

Example 4: Immune Monitoring

The immunization strategy is a "prime-boost" approach, involving an initial series of closely spaced immunizations to induce an immune response followed by a period of rest to allow memory T-cells to be established. This will be followed by a booster immunization, and the T-cell response 4 weeks after this boost is expected to generate the strongest response and will be the primary immunological endpoint. Global immunological response will be initially monitored using peripheral blood mononuclear cells from this time point in an 18 hr ex vivo ELISPOT assay, stimulating with a pool of overlapping 15mer peptides (11 aa overlap) comprising all the immunizing epitopes. Pre-vaccination samples will be evaluated to establish the baseline response to this peptide pool. As warranted, additional PBMC samples will be evaluated to examine the kinetics of the immune response to the total peptide mix. For patients demonstrating responses significantly above baseline, the pool of all 15mers will be de- convoluted to determine which particular immunizing peptide(s) were immunogenic. In addition, a number of additional assays will be conducted on a case-by-case basis for appropriate samples: • The entire 15mer pool or sub-pools will be used as stimulating peptides for intracellular cytokine staining assays to identify and quantify antigen- specific CD4+, CD8+, central memory and effector memory populations

• Similarly, these pools will be used to evaluate the pattern of cytokines secreted by these cells to determine the T_HI VS T_H2 phenotype

• Extracellular cytokine staining and flow cytometry of unstimulated cells will be used to quantify Treg and myeloid-derived suppressor cells (MDSC).

• If a melanoma cell line is successfully established from a responding patient and the activating epitope can be identified, T-cell cytotoxicity assays will be conducted using the mutant and corresponding wild type peptide

• PBMC from the primary immunological endpoint will be evaluated for "epitope

spreading" by using known melanoma tumor associated antigens as stimulants and by using several additional identified mutated epitopes that were not selected to be among the immunogens, as shown in FIG. 6.

Immuno-histochemistry of the tumor sample will be conducted to quantify CD4+, CD8+, MDSC, and Treg infiltrating populations.

Example 5: Clinical Efficacy in Patients with Metastatic Disease

Vaccine treatment of patients with metastatic disease is complicated by their need for an effective therapy for the active cancer and the consequent absence of an off treatment time window for vaccine preparation. Furthermore, these cancer treatments may compromise the patient's immune system, possibly impeding the induction of an immune response. With these considerations in mind, settings may be chosen where timing of vaccine preparation fits temporally with other standard care approaches for the particular patient population and/or where such standard care is demonstrably compatible with an immunotherapeutic approach. There are two types of settings that may be pursued:

1. Combination with checkpoint blockade: Checkpoint blockade antibodies have emerged as an effective immunotherapy for metastatic melanoma (Hodi et al, Improved Survival with Ipilimumab in Patients with Metastatic Melanoma NEJM 363:711 - 723 (2010)) and are being actively pursued in other disease settings including non-small cell lung cancer (NSCLC) and renal cell carcinoma (Topalian et al, Safety, Activity, and Immune Correlates of Anti-PD-1 Antibody in Cancer NEJM 366:2443-2454 (2012); Brahmer et al, Safety and Activity of Anti- PD-L1 Antibody in Patients with Advanced Cancer NEJM 366:2455-2465(2012)). Although the mechanism of action is not proven, both reversal of relief from local immunosuppression and enhancement of an immune response are possible explanations. Integrating a powerful vaccine to initiate an immune response with checkpoint blockade antibodies may provide synergies, as observed in multiple animal studies (van Elsas et al Combination immunotherapy of B16 melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4)and

granulocyte/macrophage colony- stimulating factor (GM-CSF)-producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation J Exp Med 190:35- 366 (1999); Li et al, Anti-programmed death- 1 synergizes with granulocyte macrophage colony- stimulating factor -secreting tumor cell immunotherapy providing therapeutic benefit to mice with established tumors Clin Cancer Res 15: 1623 - 1634 (2009); Pardoll, D. M. The blockade of immune checkpoints in cancer immunotherapy Nature Reviews Cancer 12:252 - 264 (2012); Curran et al. PD-1 and CTLA-4 combination blockade expands infiltrating T cells and reduces regulatory T and myeloid cells within B16 melanoma tumors.

Proc Natl Acad Sci U S A. 2010 Mar 2;107(9):4275-80; Curran et al. Tumor vaccines expressing flt3 ligand synergize with ctla-4 blockade to reject preimplanted tumors. Cancer Res. 2009 Oct l;69(19):7747-55). Patients can be immediately started on checkpoint blockade therapy while vaccine is being prepared and once prepared, the vaccine dosing can be integrated with antibody therapy, as illustrated in FIG. 7; and

2. Combination with standard treatment regimens exhibiting beneficial immune properties.

a) Renal cell carcinoma (RCC) patients who present with metastatic disease typically undergo surgical de-bulking followed by systemic treatment, which is commonly with one of the approved tyrosine kinase inhibitors (TKI) such as sunitinib, pazopanib and sorafenib. Of the approved TKIs, sunitinib has been shown to increase T_HI responsiveness and decrease Treg and myeloid-derived suppressor cells (Finke et al, Sunitinib reverses Type-1 immune suppression and decreases T-regulatory cells in renal cell carcinoma patients Clin Can Res 14:6674 - 6682 (2008); Terme et al, VEGFA-VEGFR pathway blockade inhibits tumor- induced regulatory T cell proliferation in colorectal cancer (Cancer Research Author Manuscript published Online (2102)). The ability to immediately treat patients with an approved therapy that does not compromise the immune system provides the needed window to prepare the vaccine and could provide synergy with a vaccine therapy. In addition, cyclophosphamide (CTX) has been implicated in multiple animal and human studies to have an inhibitory effect on Treg cells and a single dose of CTX prior to a vaccine has been recently shown to improve survival in RCC patients who responded to the vaccine (Walter et al, Multipeptide immune response to a cancer vaccine IMA901 after single-dose cyclophosphamide associates with longer patient survival Nature Medicine 18: 1254- 1260 (2012)). Both of these immune- synergistic approaches have been utilized in a recently completed phase 3 study of a native peptide vaccine in RCC

(ClinicalTrials.gov, NCTO 1265901 EV1A901 in Patients Receiving Sunitinib for

Advanced/Metastatic Renal Cell Carcinoma);

b) Alternatively, standard treatment of glioblastoma (GBM) involves surgery, recovery and follow-up radiation and low dose temozolomide (TMZ) followed by a four week rest period before initiating standard dose TMZ. This standard treatment provides a window for vaccine preparation followed by initiation of vaccination prior to starting standard dose TMZ.

Interestingly, in a study in metastatic melanoma, peptide vaccination during standard dose TMZ treatment increased the measured immune responsiveness compared to vaccination alone, suggesting additional synergistic benefit (Kyte et al, Telomerase peptide vaccination combined with temozolomide: a clinical trial in stage IV melanoma patients Clin Cancer Res 17:4568 (2011)).

Example 6: Vaccine Preparation

Patient tumor tissue will be surgically resected, and tumor tissue will be disaggregated and separate portions used for DNA and RNA extraction and for patient- specific melanoma cell line development. DNA and/or RNA extracted from the tumor tissue will be used for whole- exome sequencing (e.g., by using the Illumina HiSeq platform) and to determine HLA typing information. It is contemplated within the scope of the invention that missense or neoORF neo- antigenic peptides may be directly identified by protein-based techniques (e.g., mass spectrometry).

Bioinformatics analysis will be conducted as follows. Sequence analysis of the Exome and RNA - SEQ fast Q files will leverage existing bioinformatic pipelines that have been used and validated extensively in large-scale projects such as the TCGA for many patient samples (e.g., Chapman et al, 2011, Stransky et al, 2011, Berger et al, 2012). There are two sequential categories of analyses: data processing and cancer genome analysis.

Data processing pipeline: The Picard data processing pipeline (picard.sourceforge.net/) was developed by the Sequencing Platform. Raw data extracted from (e.g., Illumina) sequencers for each tumor and normal sample is subjected to the following processes using various modules in the Picard pipeline:

(i) . Quality recalibration: Original base quality scores reported by the Illumina pipeline will be recalibrated based on the read-cycle, the lane, the flow cell tile, the base in question, and the preceding base.

(ii) . Alignment: BWA (Li and Durbin, 2009) will be used to align read pairs to the human genome (hgl9).

(iii) . Mark duplicates: PCR and optical duplicates will be identified based on read pair mapping positions and marked in the final bam file.

The output of Picard is a bam file (Li et al, 2009) (samtools.sourceforge.net/SAMl.pdf) that stores the base sequences, quality scores, and alignment details for all reads for the given sample.

Cancer Mutation Detection Pipeline: Tumor and matched normal bam files from the Picard pipeline will be analyzed as described below:

1. Quality Control

(i) . Sample mix-up during sequencing will be done by comparing initial SNP fingerprinting done on a sample at a few dozen sites with exome sequencing pileups at those sites.

(ii) . Intra-sample tumor/normal mixup will be checked by first comparing the insert size distribution of lanes that correspond to the same library for both tumor and normal samples, and discarding those lanes that have a different distribution. Bioinformatic analysis will be applied to tumor and matched normal exome samples to get the DNA copy number profiles. Tumor samples should also have more copy number variation than the corresponding normals. Lanes corresponding to normal samples that do not have flat profiles will be discarded, as will tumor lanes that don't have profiles consistent with other lanes from the same tumor sample will be discarded.

(iii) . Tumor purity and ploidy will be estimated based on the bioinformatic-generated copy number profiles.

(iv) . ContEst (Cibulskis et al, 2011) will be used to determine the level of cross- sample contamination in samples. Local realignment around putative indels

True somatic and germline small indels with respect to the reference genome often result in misalignment and miscalls of missense mutations and indels. This will be corrected for by doing a local realignment using the GATK IndelRealigner module (on the worldwide web at (www)broadinstitute.org/gatk) (McKenna et al, 2010, Depristo et al, 2011) of all reads that map in the vicinity of putative indels and evaluating them comprehensively to ensure consistency and correctness of indel calls. Identification of somatic single nucleotide variations (SSNVs)

Somatic base pair substitutions will be identified by analyzing tumor and matched normal samples from a patient using a Bayesian statistical framework called muTect (Cibulskis et al, 2013). In the preprocessing step, reads with a preponderance of low quality bases or mismatches to the genome are filtered out. Mutect then computes two log-odds (LOD) scores which encapsulate confidence in presence and absence of the variant in the tumor and normal samples respectively. In the post-processing stage candidate mutations are empirically filtered by various criteria to account for artifacts of capture, sequencing and alignment. One such filter, for example, tests for consistency between distributions of orientations of reads that harbor the mutation and the overall orientation distribution of reads that map to the locus to ensure that there is no strand bias. The final set of mutations will then be annotated with the Oncotator tool by several fields including genomic region, codon, cDNA and protein changes. Identification of somatic small insertions and deletions

The local realignment output from section 2.2 will be used to predict candidate somatic and germline indels based on assessment of reads supporting the variant exclusively in tumor or both in tumor and normal bams respectively. Further filtering based on number and distribution of mismatches and base quality scores will be done (McKenna et al, 2010, DePristo et al, 2011). All indels will be manually inspected using the Integrated Genomics Viewer (Robinson et al, 2011) (on the worldwide web at (www)broadinstitute.org/igv) to ensure high-fidelity calls. Gene fusion detection

The first step in the gene fusion detection pipeline is alignment of tumor RNA-Seq reads to a library of known gene sequences following by mapping of this alignment to genomic coordinates. The genomic mapping helps collapse multiple read pairs that map to different transcript variants that share exons to common genomic locations. The DNA aligned bam file will be queried for read pairs where the two mates map to two different coding regions that are either on different chromosomes or at least 1 MB apart if on the same chromosome. It will also be required that the pair ends aligned in their respective genes be in the direction consistent with coding— >coding 5'-> 3' direction of the (putative) fusion mRNA transcript. A list of gene pairs where there are at least two such 'chimeric' read pairs will be enumerated as the initial putative event list subject to further refinement. Next, all unaligned reads will be extracted from the original bam file, with the additional constraint that their mates were originally aligned and map into one of the genes in the gene pairs obtained as described above. An attempt will then be made to align all such originally unaligned reads to the custom "reference" built of all possible exon-exon junctions (full length, boundary-to-boundary, in coding 5'-> 3' direction) between the discovered gene pairs. If one such originally unaligned read maps (uniquely) onto a junction between an exon of gene X and an exon of gene Y, and its mate was indeed mapped to one of the genes X or Y, then such a read will be marked as a "fusion" read. Gene fusion events will be called in cases where there is at least one fusion read in correct relative orientation to its mate, without excessive number of mismatches around the exon:exon junction and with a coverage of at least 10 bp in either gene. Gene fusions between highly homologous genes (ex. HLA family) are likely spurious and will be filtered out.

Estimation of clonality

Bioinformatic analysis may be used to estimate clonality of mutations. For example, the ABSOLUTE algorithm (Carter et al, 2012, Landau et al, 2013) may be used to estimate tumor purity, ploidy, absolute copy numbers and clonality of mutations. Probability density distributions of allelic fractions of each mutation will be generated followed by conversion to cancer cell fractions (CCFs) of the mutations. Mutations will be classified as clonal or subclonal based on whether the posterior probability of their CCF exceeds 0.95 is greater or lesser than 0.5 respectively.

7. Quantification of expression

The TopHat suite (Langmead et al, 2009) will be used to align RNA-Seq reads for the tumor and matched normal bams to the hgl9 genome. The quality of RNA-Seq data will be assessed by the RNA-SeQC (DeLuca et al, 2012) package. The RSEM tool (Li et al, 2011) will then be used to estimate gene and isoform expression levels. The generated reads per kilobase per million and tau estimates will be used to prioritize neo-antigens identified in each patient as described elsewhere. 8. Validation of mutations in RNA-Seq

Mutations that will be identified by analysis of whole exome data (section 2.3) will be assessed for presence in the corresponding RNA-Seq tumor bam file of the patient. For each variant locus, a power calculation based on the beta-binomial distribution will be performed to ensure that there is at least 80% power to detect it in the RNA- Seq data. A capture identified mutation will be considered validated if there are at least 2 reads harboring the mutation for adequately powered sites. Selection of Tumor- Specific Mutation-Containing Epitopes: All missense mutations and neoORFs will be analyzed for the presence of mutation-containing epitopes using the neural- network based algorithm netMHC, provided and maintained by the Center for Biological Sequence Analysis, Technical University of Denmark, Netherlands. This family of algorithms were rated the top epitope prediction algorithms based on a competition recently completed among a series of related approaches (ref). The algorithms were trained using an artificial neural network based approach on multiple different human HLA A and B alleles utilizing over 100,000 measured binding and non-binding interactions.

The accuracy of the algorithms were evaluated by conducting predictions from mutations found in CLL patients for whom the HLA allotypes were known. The included allotypes were AO 101, A0201, A0310, A1101, A2402, A6801, B0702, B0801, B1501. Predictions were made for all 9mer and 10 mer peptides spanning each mutation using netMHCpan in mid-2011.

Based on these predictions, seventy-four (74) 9mer peptides and sixty-three (63) lOmer peptides, most with predicted affinities below 500 nM, were synthesized and the binding affinity was measured using a competitive binding assay (Sette).

The predictions for these peptides were repeated in March 2013 using each of the most up to date versions of the netMHC servers (netMHCpan, netMHC and netMHCcons). These three algorithms were the top rated algorithms among a group of 20 used in a competition in 2012 (Zhang et al). The observed binding affinities were then evaluated with respect to each of the new predictions. For each set of predicted and observed values, the % of correct predictions for each range is given, as well as the number of samples. The definition for each range is as follows: 0 - 150 Predicted to have an affinity equal to or lower than 150 nM and measured to have an affinity equal to or lower than 150 nM.

0 - 150*: Predicted to have an affinity equal to or lower than 150 nM and measured to have an affinity equal to or lower than 500 nM.

151 - 500 nM: Predicted to have an affinity greater than 150 nM but equal to or lower than 500 nM and measured to have an affinity equal to or below 500 nM.

FN (> 500 nM): False Negatives - Predicted to have an affinity greater than 500 nM but measured to have an affinity equal to or below 500 nM.

For 9mer peptides (Table 1) , there was little difference between the algorithms, with the slightly higher value for the 151- 500 nM range for netMHC cons not judged to be significant because of the low number of samples.

Table 1

For lOmer peptides (Table 2), again there was little difference between the algorithms except that netMHC produced significantly more false positives than netMHCpan or netMMHCcons. However, the precision of the lOmer predictions is slightly lower in the 0 - 150 nM and 0 - 150 nM ranges and significantly lower in the 151-500 nM range, compared to the 9mers. Table 2.

For lOmers, only predictions in the 0 - 150 nM range will be utilized due to the lower than 50% precision for binders in the 151-500 nM range.

The number of samples for any individual HLA allele was too small to draw any conclusions regarding accuracy of the prediction algorithm for different alleles. Data from the largest available subset (0 - 150* nM; 9mer) is shown in Table 3 as an example.

Table 3

Only predictions for HLA A and B alleles will be utilized as there is little available data on which to judge accuracy of predictions for HLA C alleles (Zhang et al). An evaluation of melanoma sequence information and peptide binding predictions was conducted using information from the TCGA database. Information from 220 melanomas from different patients revealed that on average there were approximately 450 missense and 5 neoORFs per patient. 20 patients were selected at random and the predicted binding affinities were calculated for all the missense mutations using netMHC (Lundegaard et al Prediction of epitopes using neural network based methods J Immunol Methods 374:26 (2011)). As the HLA allotypes were unknown for these patients, the number of predicted binding peptides per allotype was adjusted based on the frequency of that allotype (Bone Marrow Registry dataset for the expected affected dominant population in the geographic area [Caucasian for melanoma]) to generate a predicted number of actionable mutant epitopes per patient. For each of these mutant epitopes (MUT), the corresponding native (WT) epitope binding was also predicted. Utilizing a single peptide for predicted missense binders with Kd < 500 nM and a WT/MUT Kd ratio of >5X and over-lapping peptides spanning the full length of each neoORF, 80% (16 of 20) of patients were predicted to have at least 20 peptides appropriate for vaccination. For a quarter of the patients, neoORF peptides could constitute nearly half to all of the 20 peptides. Thus, there is an adequate mutational load in melanoma to expect a high proportion of patients to generate an adequate number of immunogenic peptides.

Example 7: Prioritization of Immunizing Peptides

Peptides for immunization may be prioritized based on a number of criteria: neoORF vs. missense, predicted Kd for the mutated peptide, the comparability of predicted affinity for the native peptide compared to the mutated peptide, whether the mutation occurs in an oncogenic driver gene or related pathway, and # of RNA-Seq reads (see e.g., FIG. 8).

As shown in FIG. 8, peptides derived from segments of neoORF mutations that are predicted to bind (Kd < 500 nM) may be given the highest priority based on the absence of tolerance for these entirely novel sequences and their exquisite tumor- specificity.

The similar class of missense mutations in which the native peptide is not predicted to bind (Kd > 1000 nM) and the mutated peptide is predicted to bind with strong/moderate affinity (Kd < 150 nM) may be given the next highest priority. This class (Group I discussed above) represents approximately 20% of naturally observed T-cell responses. The third highest priority may be given to the more tightly binding (< 150 nM) subset of the Group II class discussed above. This class is responsible for approximately almost 2/3 of naturally observed T-cell responses.

All the remaining peptides derived from the neoORF mutations may be given the fourth priority. Despite not being predicted to bind, these are included based on the known false negative rate, potential binding to HLA-C, potential for presence of Class II epitopes and the high value of utilizing totally foreign antigens.

The fifth priority may be given to the subset of Group II with lower predicted binding affinities (150 - 500 nM). This class is responsible for approximately 10% of the naturally observed T-cell responses.

As the predicted affinity decreases, higher stringency may be applied to expression levels. Within each grouping, peptides may be ranked based on binding affinity (e.g., the lowest Kd may have the highest priority). Within a given grouping of missense mutations, oncogenic driver mutations may be given higher priority. A normal human peptidome library of -12.6 million unique 9 and 10 mers curated from all known human protein sequences (HG19) has been created. Prior to final selection, any potential predicted epitopes derived from a missense mutation and all neoORF regions may be screened against this library, and perfect matches may be excluded. As discussed below, particular peptides predicted to have deleterious biochemical properties may be eliminated or modified.

According to the techniques herein, RNA levels may be analyzed to assess neoantigen expression. For example, RNA-Seq read-count may be used as a proxy to estimate neoantigen expression. However, there is no currently available information to assess the minimum RNA expression level required in a tumor cell needed to initiate cytolysis. Even the level of expression from "pioneer" translation of messages destined for nonsense mediated decay may be sufficient for target generation. Accordingly, the techniques herein initially set broad acceptance limits for RNA levels that may vary inversely with the priority group. As the predicted affinity decreases, higher stringency may be applied to expression levels. One of skill in the art will appreciate that as additional information becomes available, such limits may be adjusted.

Because of the high value of neoORFs as targets due to their novelty and exquisite tumor specificity, neoORFs with predicted binding epitopes (Kd < 500 nM) may be utilized even if there are no detectable mRNA molecules by RNA-Seq (Rank 1). Regions of neoORFs without predicted binding epitopes (> 500 nM), may generally be utilized only if some level of RNA expression is detected (Rank 4). All missense mutations with strong to intermediate predicted MHC binding affinity (<150 nM) may generally be utilized unless there were no RNA-Seq reads (Ranks 2 and 3). For missense mutations with lower predicted binding affinity (150 - < 500 nM), these will likely be utilized only if a slightly higher level of RNA expression is detected (Rank 5).

Oncogenic drivers may represent a high priority group. For example, within a given grouping of missense mutations, oncogenic driver mutations may be of higher priority. This approach is based on the observed down-regulation of genes that are targeted by immune pressure (e.g., immunoediting). In contrast to other immune targets where down-regulation may not have a deleterious effect of cancer cell growth, continued expression of oncogenic driver genes may be crucial to cancer cell survival, thus shutting off a pathway of immune escape. Exemplary oncogenic drivers are listed in Table 3-1 (see e.g., Vogelstein et al; GOTERM_BP Assignment of genes to Gene Ontology Term - Biological Function on the worldwide web at (www)geneontology.org; BIOCARTA Assignment of genes to signaling pathways, on the worldwide web at (www)biocarta.com; KEGG Assignment of genes to pathways according to KEGG pathway database, on the worldwide web at (www)genome.jp/krgg/pathway.html;

REACTOME Assignment of genes to pathways according to REACTOME pathways and gene interactions, on the worldwide web at (www)reactome.org).

Table 3-1 Exemplary Oncogenic Driver Genes

Gene Gene Name # Mutated OncoTumor Classification* Core Process Symbol Tumor gene Suppressor pathway

Samples** score* Gene

score*

FLT3 fms-related tyrosine 11520 98% 0% Oncogene RAS; PI3K; STAT Cell kinase 3 Survival

FOXL2 forkhead box L2 330 100% 0% Oncogene TGF-β Cell Fate

GATA2 GATA binding protein 45 53% 4% Oncogene NOTCH, TGF-β Cell Fate 2

GNA11 guanine nucleotide 110 92% 1% Oncogene PI3K; RAS; MAPK Cell binding protein (G Survival protein), alpha 11 (Gq

class)

GNAQ guanine nucleotide 245 95% 1% Oncogene PI3K;RAS; MAPK Cell binding protein (G Survival protein), q

polypeptide

GNAS GNAS complex locus 422 93% 2% Oncogene APC; PI3K; TGF- Cell β, RAS Survival/C ell Fate

H3F3A H3 histone, family 3B 122 93% 0% Oncogene Chromatin Cell Fate (H3.3B); H3 histone, Modification family 3A

pseudogene; H3

histone, family 3A;

similar to H3 histone,

family 3B; similar to

histone H3.3B

HIST1H3B histone cluster 1, H3j; 25 60% 0% Oncogene Chromatin Cell Fate histone cluster 1, H3i; Modification histone cluster 1,

H3h; histone cluster

1, H3g; histone

cluster 1, H3f; histone

cluster 1, H3e;

histone cluster 1,

H3d; histone cluster

1, H3c; histone

cluster 1, H3b;

histone cluster 1,

H3a; histone cluster

1, H2ad; histone

cluster 2, H3a;

histone cluster 2,

H3c; histone cluster

2, H3d

HRAS v-Ha-ras Harvey rat 812 96% 0% Oncogene RAS Cell sarcoma viral Survival oncogene homolog

IDH1 isocitrate 4509 100% 0% Oncogene Chromatin Cell Fate dehydrogenase 1 Modification

(NADP+), soluble

IDH2 isocitrate 1029 99% 0% Oncogene Chromatin Cell Fate dehydrogenase 2 Modification

(NADP+),

mitochondrial

JAK1 Janus kinase 1 61 26% 18% Oncogene STAT Cell

Survival

JAK2 Janus kinase 2 32692 100% 0% Oncogene STAT Cell

Survival

JAK3 Janus kinase 3 89 60% 6% Oncogene STAT Cell

Survival

Gene Gene Name # Mutated OncoTumor Classification* Core Process Symbol Tumor gene Suppressor pathway

Samples** score* Gene

score*

SETBPl SET binding protein 1 95 25% 4% Oncogene Chromatin Cell Fate

Modification;

Replication

SF3B1 splicing factor 3b, 516 91% 0% Oncogene Transcriptional Cell Fate subunit 1, 155kDa Regulation

SMO smoothened homolog 34 51% 3% Oncogene HH Cell Fate (Drosophila)

SPOP speckle-type POZ 35 66% 3% Oncogene Chromatin Cell Fate protein Modification;

HH

SRSF2 SRSF2 273 95% 2% Oncogene Transcriptional Cell Fate serine/arginine-rich Regulation

splicing factor 2

TSHR thyroid stimulating 301 86% 0% Oncogene PI3K; MAPK Cell hormone receptor Survival

U2AF1 U2 small nuclear RNA 96 92% 1% Oncogene Transcriptional Cell Fate auxiliary factor 1 Regulation

Example 8: Peptide Production and Formulation

GMP neo-antigenic peptides for immunization will be prepared by chemical synthesis Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85:2149-54, 1963) in accordance with FDA regulations. Three development runs have been conducted of 20 ~20-30mer peptides each. Each run was conducted in the same facility and utilized the same equipment as will be used for the GMP runs, utilizing draft GMP batch records. Each run successfully produced > 50 mg of each peptide, which were tested by all currently planned release tests (e.g., Appearance, Identify by MS, Purity by RP-HPLC, Content by

Elemental Nitrogen, and TFA content by RP-HPLC) and met the targeted specification where appropriate. The products were also produced within the timeframe anticipated for this part of the process (approximately 4 weeks). The lyophilized bulk peptides were placed on a long term stability study and will be evaluated at various time points up to 12 months.

Material from these runs has been used to test the planned dissolution and mixing approach. Briefly, each peptide will be dissolved at high concentration (50 mg/ml) in 100% DMSO and diluted to 2 mg/ml in an aqueous solvent. Initially, it was anticipated that PBS would be used as a diluent, however, a salting out of a small number of peptides caused a visible cloudiness. D5W (5% dextrose in water) was shown to be much more effective; 37 of 40 peptides were successfully diluted to a clear solution. The only problematic peptides are very hydrophobic peptides. The predicted biochemical properties of planned immunizing peptides will be evaluated and synthesis plans may be altered accordingly (using a shorter peptide, shifting the region to be synthesized in the N- or C-terminal direction around the predicted epitope, or potentially utilizing an alternate peptide). Ten separate peptides in DMSO/D5W were subjected to two freeze/thaw cycles and showed full recovery. Two individual peptides were dissolved in DMSO/D5W and placed on stability at two temperatures (-20°C and -80°C). These peptides will be evaluated (RP-HPLC, MS and pH) for up to 6 months. To date, both peptides are stable at the 12 week time point with additional time points at 24 weeks to be evaluated.

As shown in FIG. 9, the design of the dosage form process is to prepare 4 pools of patient-specific peptides consisting of 5 peptides each. A RP-HPLC assay has been prepared and qualified to evaluate these peptide mixes. This assay achieves good resolution of multiple peptides within a single mix and can also be used to quantitate individual peptides.

Membrane filtration (0.2 μιη pore size) will be used to reduce bioburden and conduct final filter sterilization. Four different appropriately sized filter types were initially evaluated and the Pall, PES filter (# 4612) was selected. To date, 4 different mixtures of 5 different peptides each have been prepared and individually filtered sequentially through two PES filters. Recovery of each individual peptide was evaluated utilizing the RP-HPLC assay. For 18 of the 20 peptides, the recovery after two filtrations was >90%. For two highly hydrophobic peptides, the recovery was below 60% when evaluated at small scale but were nearly fully recovered (87 and 97%) at scale. As stated above, approaches will be undertaken to limit the hydrophobic nature of the sequences selected.

GMP neo-antigenic peptides for immunization will be prepared by chemical synthesis Merrifield RB: Solid phase peptide synthesis. I. The synthesis of a tetrapeptide. J. Am. Chem. Soc. 85:2149-54, 1963) in accordance with FDA regulations. Example 9: Endpoint Assessment

The primary immunological endpoint of this study will be the assessment of T cell response measured by ex vivo IFN-γ ELISPOT. IFN-γ secretion occurs as a result of the recognition of cognate peptides or mitogenic stimuli by CD4⁺ and/or CD8⁺ T -cells. A multitude of different CD4⁺ and CD8⁺ determinants will likely be presented to T cells in vivo since the 20-30mer peptides used for vaccination should undergo processing into smaller peptides by antigen presenting cells. Without being bound by theory, it is believed that the combination of personalized neo-antigen peptides, which are novel to the immune system and thus not subject to the immune-dampening effects of self-tolerance, and the powerful immune adjuvant poly-ICLC will induce strong CD4⁺ and/or CD8⁺ responses. The expectation is therefore that T cell responses are detectable ex vivo i.e. without the need for in vitro expansion of epitope specific T cells through short-term culture. Patients will initially be evaluated using the total pool of peptide immunogens as stimulant in the ELISPOT assay. For patients demonstrating a robust positive response, the precise immunogenic peptide(s) will be determined in follow-up analysis. The IFN-γ ELISPOT is generally accepted as a robust and reproducible assay to detect ex vivo T cell activity and determine specificity. In addition to the analysis of the magnitude and determinant mapping of the T cell response in peripheral blood monocytes, other aspects of the immune response induced by the vaccine are critical and will be assessed. These evaluations will be performed in patients who exhibit an ex vivo IFN-γ ELISPOT response in the screening assay. They include the evaluation of T cell subsets (Thl versus Th2, T effector versus memory cells), analysis of the presence and abundance of regulatory cells such as T regulatory cells or myeloid derived suppressor cells, and cytotoxicity assays if patient-specific melanoma cells lines are successfully established.

Example 10: Peptide synthesis

GMP peptides will be synthesized by standard solid phase synthetic peptide chemistry and purified by RP-HPLC. Each individual peptide will be analyzed by a variety of qualified assays to assess appearance (visual), purity (RP-HPLC), identity (by mass spectrometry), quantity (elemental nitrogen), and trifluoroacetate counterion (RP-HPLC) and released.

The personalized neoantigen peptides may be comprised of up to 20 distinct peptides unique to each patient. Each peptide may be a linear polymer of -20 - -30 L-amino acids joined by standard peptide bonds. The amino terminus may be a primary amine (NH2-) and the carboxy terminus is a carbonyl group (-COOH). The standard 20 amino acids commonly found in mammalian cells are utilized (alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid , glycine, histidine, isoleucine, leucine lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine). The molecular weight of each peptide varies based on its length and sequence and is calculated for each peptide.

Personalized neoantigen peptides may be supplied as a box containing 2 ml Nunc Cryo vials with color-coded caps, each vial containing approximately 1.5 ml of a frozen DMSO/D5W solution containing up to 5 peptides at a concentration of 400 ug/ml. There may be 10 - 15 vials for each of the four groups of peptides. The vials are to be stored at -80oC until use. Ongoing stability studies support the storage temperature and time.

Storage and Stability: The personalized neoantigen peptides are stored frozen at -80oC. The thawed, sterile filtered, in process intermediates and the final mixture of personalized neoantigen peptides and poly-ICLC can be kept at room temperature but should be used within 4 hours .

Compatibility: The personalized neoantigen peptides will be mixed with 1/3 volume poly-ICLC just prior to use.

Example 11: Administration

Following mixing with the personalized neo-antigenic peptides/polypeptides, the vaccine (e.g., peptides + poly-ICLC) is to be administered subcutaneously.

Preparation of personalized neo-antigenic peptides/polypeptides pools: peptides will be mixed together in 4 pools of up to 5 peptides each. The selection criteria for each pool will be based on the particular MHC allele to which the peptide is predicted to bind.

Pool Composition: The composition of the pools will be selected on the basis of the particular HLA allele to which each peptide is predicted to bind. The four pools will be injected into anatomic sites that drain to separate lymph node basins. This approach was chosen in order to potentially reduce antigenic competition between peptides binding to the same HLA allele as much as possible and involve a wide subset of the patient's immune system in developing an immune response. For each patient, peptides predicted to bind up to four different HLA A and B alleles will be identified. Some neoORF derived peptides will not be associated with any particular HLA allele. The approach to distributing peptides to different pools will be to spread each set of peptides associated with a particular HLA allele over as many of the four pools as possible. It is highly likely there will be situations where there will be more than 4 predicted peptides for a given allele, and in these cases it will be necessary to allocate more than one peptide associated with a particular allele to the same pool. Those neoORF peptides not associated with any particular allele will be randomly assigned to the remaining slots. An example is shown below: Al HLA A0101 3 peptides

A2 HLA A1101 5 peptides

Bl HLA B0702 2 peptides

B2 HLA B6801 7 peptides

X NON E (neoORF) 3 peptides

Pool # 1 2 3 4

B2 B2 B2 B2

B2 B2 B2 A2

A2 A2 A2 A2

Al Al Al Bl

Bl X X X

Peptides predicted to bind to the same MHC allele will be placed into separate pools whenever possible. Some of the neoORF peptides may not be predicted to bind to any MHC allele of the patient. These peptides will still be utilized however, primarily because they are completely novel and therefore not subject to the immune-dampening effects of central tolerance and therefore have a high probability of being immunogenic. NeoORF peptides also carry a dramatically reduced potential for autoimmunity as there is no equivalent molecule in any normal cell. In addition, there can be false negatives arising from the prediction algorithm and it is possible that the peptide will contain a HLA class II epitope (HLA class II epitopes are not reliably predicted based on current algorithms). All peptides not identified with a particular HLA allele will be randomly assigned to the individual pools. The amounts of each peptide are predicated on a final dose of 300 μg of each peptide per injection.

For each patient, four distinct pools (labeled "A", "B", "C" and "D") of 5 synthetic peptides each will have been prepared manufacturer and stored at -80°C. On the day of immunization, the complete vaccine consisting of the peptide component(s) and poly-ICLC will be prepared in a laminar flow biosafety cabinet in the research pharmacy. One vial each (A, B, C and D) will be thawed at room temperature and moved into a biosafety cabinet for the remaining steps. 0.75 ml of each peptide pool will be withdrawn from the vial into separate syringes. Separately, four 0.25 ml (0.5 mg) aliquots of poly-ICLC will be withdrawn into separate syringes. The contents of each peptide-pool containing syringe will then be gently mixed with a 0.25 ml aliquot of poly-ICLC by syringe-to- syringe transfer. The entire one ml of the mixture will be used for injection. These 4 preparations will be labeled "study drug A", "study drug B", "study drug C", and "study drug D".

Injections: At each immunization, each of the 4 study drugs will be injected

subcutaneously into one extremity. Each individual study drug will be administered to the same extremity at each immunization for the entire duration of the treatment (i.e. study drug A will be injected into left arm on day 1, 4, 8 etc., study drug B will be injected into right arm on days 1, 4, 8 etc.). Alternative anatomical locations for patients who are status post complete axillary or inguinal lymph node dissection are the left and right midriff, respectively.

Vaccine will be administered following a prime/boost schedule. Priming doses of vaccine will be administered on days 1, 4, 8, 15, and 22 as shown above. In the boost phase, vaccine will be administered on days 85 (week 13) and 169 (week 25).

All patients receiving at least one dose of vaccine will be evaluable for toxicity. Patients will be evaluable for immunologic activity if they have received all vaccinations during the induction phase and the first vaccination (boost) during the maintenance phase.

Example 12: Pharmacodynamic Studies

The immunization strategy is a "prime-boost" approach, involving an initial series of closely spaced immunizations to induce an immune response followed by a period of rest to allow memory T-cells to be established. This will be followed by a booster immunization, and the T-cell response 4 weeks after this boost (16 weeks after the first vaccination) is expected to generate the strongest response and will be the primary immunological endpoint. Immune monitoring will be performed in a step-wise fashion as outlined below to characterize the intensity and quality of the elicited immune responses. Peripheral blood will be collected and PBMC will be frozen at two separate time points prior to the first vaccination (baseline) and at different time points thereafter as illustrated in Schema B and specified in the study calendar. Immune monitoring in a given patient will be performed after the entire set of samples from the induction phase and the maintenance phase, respectively, have been collected. If sufficient tumor tissue is available, a portion of the tumor will be used to develop autologous melanoma cell lines for use in cytotoxic T-cell assays.

Example 13: Screening ex vivo IFN-γ ELISPOT

For each patient, a set of screening peptides will be synthesized. The screening peptides will be 15 amino acids in length (occasionally a 16mer or 17mer will be used), overlapping by 11 amino acids and covering the entire length of each peptide or the entire length of the neoORF for neoORF-derived peptides. The entire set of patient- specific screening peptides will be pooled together at approximately equal concentration and a portion of each peptide will also be stored individually. Purity of the peptide pool will be ascertained by testing PBMC from 5 healthy donors with established low background in ex vivo IFN-γ ELISPOTs. Initially, PBMC obtained at baseline and at week 16 (the primary immunological endpoint) will be stimulated for 18 hours with the complete pool of overlapping 15-mer peptides (11 amino acids overlap) to examine the global response to the peptide vaccine. Subsequent assays may utilize PBMC collected at other time points as indicated. If no response is identified at the primary immunological endpoint using the ex vivo IFN-γ ELISPOT assay, PBMC will be stimulated with the peptide pool for a longer time period (up to 10 days) and re-analyzed.

Example 14: Deconvolution of epitopes in follow-up ex vivo IFN-γ ELISPOT assays.

Once an ex vivo IFN-γ ELISPOT response elicited by an overlapping peptide pool is observed (defined as at least 55 spot forming units / 10⁶ PBMC or increased at least 3 times over baseline), the particular immunogenic peptide eliciting this response will be identified by de- convoluting the peptide pool based into sub-pools based on the immunizing peptides and repeating the ex vivo IFN-γ ELISPOT assays. For some responses, an attempt will be made to precisely characterize the stimulating epitope by utilizing overlapping 8-10 mer peptides derived from confirmed, stimulating peptides in IFN-γ ELISPOT assays. Additional assays may be conducted on a case-by case basis for appropriate samples. For example, • The entire 15mer pool or sub-pools will be used as stimulating peptides for intracellular cytokine staining assays to identify and quantify antigen- specific CD4+, CD8+, central memory and effector memory populations

• Similarly, these pools will be used to evaluate the pattern of cytokines secreted by these cells to determine the T_H1 vs T_H2 phenotype

• Extracellular cytokine staining and flow cytometry of unstimulated cells will be used to quantify Treg and myeloid-derived suppressor cells (MDSC).

• If a melanoma cell line is successfully established from a responding patient and the activating epitope can be identified, T-cell cytotoxicity assays will be conducted using the mutant and corresponding wild type peptide

• PBMC from the primary immunological endpoint will be evaluated for "epitope spreading" by using known melanoma tumor associated antigens as stimulants and by using several additional identified mutated epitopes that were not selected to be among the immunogens

Immuno-histochemistry of tumor samples will be conducted to quantify CD4+, CD8+, MDSC, and Treg infiltrating populations.

Example 15: Pipeline for the systematic identification of tumor neoantigens

Recent advances in sequencing technologies and peptide epitope predictions were leveraged to generate a two-step pipeline to systematically discover candidate tumor- specific HLA-bound neoantigens. As depicted in FIG. 10, this approach starts with DNA sequencing of tumors (e.g., by either whole-exome (WES) or whole-genome sequencing (WGS)) in parallel with matched normal DNA to comprehensively identify non- synonymous somatic mutations (see e.g., Lawrence et al. 2013; Cibulski et al. 2012). Next, candidate tumor specific mutated peptides generated by tumor mutations with the potential to bind personal class I HLA proteins, and hence be presented to CD8⁺ T cells, may be predicted using prediction algorithms such as, for example, NetMHCpan (see e.g., Lin 2008; Zhang 2011). Candidate peptide antigens were further evaluated based on experimental validation of their binding to HLA and expression cognate mRNAs in autologous leukemia cells.

This pipeline was applied to a large dataset of sequenced CLL samples (see e.g., Wang et al. 2011). From 91 cases that were sequenced by either WES or WGS, a total of 1838 non- synonymous mutations were discovered in protein-coding regions, corresponding to a mean somatic mutation rate of 0.72 (+0.36 s.d.) per megabase (range, 0.08 to 2.70), and a mean of 20 non-synonymous mutations per patient (range, 2 to 76) (see e.g., Wang et al. 2011). Three general classes of mutations were identified that would be expected to generate regions of amino acid changes and hence potentially be recognized immunologically. The most abundant class included missense mutation that cause single amino acid (aa) changes, representing 90% of somatic mutations per CLL. Of 91 samples, 99% harbored missense mutations and 69% had between 10-25 missense mutations (see e.g., FIG. 2A). The other two classes of mutations, frameshifts and splice- site mutations (mutations at exon-intron junctions) have the potential to generate longer stretches of novel amino acid sequences entirely specific to the tumor (neo-open reading frames, or neoORFs), with a higher number of neoantigen peptides per given alteration (compared to missense mutations). However, consistent with data from other cancer types, neoORF-generating mutations were approximately 10 fold less abundant than missense mutations in CLL (see e.g., FIGS. 2B-C). Given the prevalence of missense mutations, subsequent experimental studies was focused on the analysis of neoepitopes generated by missense mutations.

Example 16: Somatic missense mutations generate neopeptides predicted to bind to personal HLA class I alleles T cell recognition of peptide epitopes by the T cell receptor (TCR) requires the display of peptides bound within the binding groove of HLA molecules on the surface of antigen- presenting cells. Recent comparative studies across the >30 available class I prediction algorithms have shown NetMHCpan to consistently perform with high sensitivity: and specificity across HLA alleles (see e.g., Zhang et al. 2011). The NetMHCpan algorithm was tested against a set of 33 known mutated epitopes that were originally identified in the literature on the basis of their functional activity (i.e., ability to stimulate antitumor cytolytic T cell responses) or were characterized as immunogenic minor histocompatibility antigens to determine whether the algorithm would correctly predict binding for the 33 known mutated epitopes (see e.g., Tables 4 and 5). Tables 4 and 5 show HLA-peptide binding affinities of known functionally derived immunogenic mutated epitopes across human cancers using NetMHCpan. Table 4 shows epitopes from missense mutations (NSCLC: non- small cell lung cancer; MEL: melanoma; CLL: chronic lymphocytic leukemia; RCC: clear cell renal carcinoma; BLD: bladder cancer; NR: not reported;). Yellow: IC50 < 150 nM, green: IC50 150-500 nM and grey: IC50 > 500 nM.

Table 5 shows epitopes from minor histocompatibility antigens (MM: multiple myeloma; HM: hematological malignancy; B-ALL: B cell acute lymphocytic leukemia).

Table 5

Among all tiled 9-mer and 10-mer possibilities, NetMHCpan identified all 33 functionally validated mutated epitopes as the best binding peptide among the possible choices for the given mutation. The median predicted binding affinity (IC50) to the known reported HLA restricting elements of each of the 33 mutated epitopes was 32 nM (range, 3-11, 192 nM). By setting the predicted IC50 cut-offs to 150 and 500 nM, 82 and 91% of the functionally validated peptides, respectively, were captured (see e.g., Tables 4 and 5 and FIG. 12A).

On the basis of its high degree of sensitivity and specificity, NetMHCpan was then applied to the 31 of 91 CLL cases for which HLA typing information was available. By convention, peptides with IC50 < 150 nM were considered as strong to intermediate binders, IC50 150-500 nM as weak binders, and IC50 > 500 nM as non-binders, respectively (see e.g., Cai et al. 2012). For all 91 CLL cases, a median of 10 strong binding peptides (range, 2-40) and 12 intermediate to weak binding peptides (range, 2-41) was found. In total, a median of 22 (range, 6-81) peptides per case was predicted with IC50 < 500 nM (see e.g., FIG. 12B and Table 6). In particular, Table 6 shows that the numbers and affinity distributions of peptides predicted from 31 CLL cases with available HLA typing. Patients expressing the 8 most common HLA - A, -B alleles in the Caucasian population are marked in grey.

Table 6.

Example 17: More than half of predicted HLA-binding neopeptides showed direct binding to HLA proteins in vitro

As shown in Table 7, IC50 nM scores generated by HLA -peptide binding predictions were validated using a competitive MHC I allele binding assay and focused on class I-A and -B alleles. To this end, 112 mutated peptides (9 or 10-mer mutated peptides) with predicted IC50 scores of less than 500 nM that were identified from 4 CLL cases (Pt 1-4) were synthesized. The experimental results correlated with the binding predictions. Experimental binding (defined as IC 50 < 500 NM) was confirmed in 76.5% and 36% of peptides predicted with IC50 of < 150 nM or 150-500 nM, respectively (see e.g., FIG. 12C). In total, -54.5% (61/112) of predicted peptides were experimentally validated as binders to personal HLA alleles. Overall, the predictions for 9-mer peptides were more sensitive than for 10-mer peptides, as 60% vs 44.5% of predicted peptides (IC50 < 500 nM) could be experimentally validated, respectively, as shown in (FIG. 13).

Table 7. Predicted and experimental HLA- binding results of candidate neoepitopes generated from 4 CLL cases.

** An experimental binding assay for A*68: 12 was not available. Because A*68: 12 and A*68:01 have identical primary structures in the B and F main peptide binding pockets and have been predicted to have similar binding specificity (Sidney and Sette, 2007), experimental binding for peptides predicted to bind A*68: 12 were assayed against A*68:01.

Example 18: Neoantigens are expressed in CLL tumors

CTL responses against an epitope would only be useful if the gene encoding the epitope is expressed in the target cells. Of the 31 patient samples sequenced and typed for HLA, 26 were subjected to genome-wide expression profiling (see e.g.. Brown et al. 2012). The expression level of 347 genes with mutations in CLL samples was classified as having low/absent (lowest quartile), medium (middle two quartiles), or high (highest quartile) expression. As shown in FIG. 12D, 80% of the 347 mutated genes (or 79% of the 180 mutations with predicted HLA- binding) were expressed at medium or high expression levels. A similar high frequency of expression was observed among the subset of 221 mutated genes (88.6%) with predicted class I binding epitopes.

R A levels may be determined based on the number of reads per gene product, and ranked by quartiles. "H" - Top quartile; "M" - Middle two quartiles; "L" - Lowest quartile (excluding genes with no reads; "-" - no reads detectable. As the predicted affinity decreases, higher stringency may be applied to expression levels. NeoORFs with predicted binders were utilized even if there was no detectable mRNA molecules by RNA-Seq. There is no data currently available to assess what, if any, the minimum expression level required in a rumor cell would be for a neoORF to be useful as a target for activated T-cells. Even the level of expression of "pioneer" translation of messages destined for nonsense mediated decay may be sufficient for target generation ((Chang YF, Imam JS, Wilkinson MF: The nonsense-mediated decay RN A surveillance pathway. Annu Rev Biochem 76:51-74, 2007). Therefore, because of the high value of neoORFs as targets due to their novelty and exquisite tumor specificity, neoORFs may be utilized as immunogens even if expression at the RNA level is low or undetectable.

Example 19: T cells targeting candidate neoepitopes were detected in CLL Patient 1 following HSCT

The post-allogeneic hematopoietic stem cell transplantation (HSCT) setting in CLL was analyzed to determine whether an immune response against the predicted mutated peptides could develop in patients. Reconstitution of T cells from a healthy donor following HSCT can overcome endogenous immune defects of the host, and also allow priming against leukemia cells in the host in vivo. Analysis focused on two patients who had both undergone unrelated reduced intensity conditioning allo-HSCT for advanced CLL and had achieved continuous remission for greater than 4 years following HSCT (see e.g., Table 8). Post-transplant T cells were collected 7 years (Patient 1) and 4 years (Patient 2) from the time of transplant. Table 8 shows the clinical characteristics of CLL Pts 1 and 2. Both patients have achieved ongoing continuous remission following HSCT of greater than 7 (Pt 1) and 4 years (Pt 2). M: male; HSCT: hematopoietic stem cell transplantation; RIC: reduced intensity

conditioning; Flu/Bu: Fludarabine/Busulfan; GvHD: graft vs host disease; URD: unrelated donor; Mis: missense; FS: frameshift.

Table 8.

t

oo

For Patient (Pt 1), 25 missense mutations were identified by WES. In total, 30 peptides from 13 mutations were predicted to bind to personal HLA (13 peptides with IC50 < 150; 17 peptides with IC50 150-500 nM). As shown in FIG. 14A, experimental validation of peptide predictions confirmed HLA binding for 14 peptides derived from 9 mutations. All 30 predicted HLA binding peptides were selected for T cell priming studies, and were organized into 5 pools of 6 peptides/pool (see e.g., Table 9). Peptides with similar predicted binding scores were put together within the same pool.

Table 9 provides a summary of peptides from Pt 1 missense mutations that were included in peptide pools for T cell stimulation studies. In Pt 1, all predicted peptides with IC50 < 500 nM binding to HLA -A and -B alleles were used. 5 pools of mutated peptides with 6 peptides/pool listed in decreasing order of predicted binding affinities to MHC class I alleles. The

corresponding experimental HLA-peptide binding affinities, wildtype peptides and their predicted IC50 scores are included in the far right columns.

Table 9.

C6orf89 10 B^*35:01 MPIEPGDIGC 132 131 MPIEPGDIGY 3

STRAP 10 A^*68:12 LISACKDGKR 163 15845 LISACKDGKP 38499

CRYBA1 9 B^*35:01 YQYSGYRGY 170 9851 YQYPGYRGY 171

3 WHSC1L1 9 A^*68:12 LLNEVQASK 197 7440 LLNEVQASE 21454

RALGAPB 10 A^*68:12 DWIMVLVLPK 222 2956 DWIMALVLPK 299

STRAP 9 A^*68:12 ISACKDGKR 224 6671 ISACKDGKP 39393

XP01 9 A^*68:12 KTVVNKLFK 253 25393 KTVVNKLFE 18346

HMGN2 9 A^*68:12 NSAENGDAK 258 141 NPAENGDAK 3679

THOC6 9 A^*33:01 LWCRQPPYR 297 915 LWRRQPPYR 222

4

POLR2A 10 A^*33:01 VQKIFHINPR 308 17699 AQKIFHINPR 738

CDC25A 10 A^*33:01 QSYCEPSSYR 309 53 QSYCEPPSYR 398

ALMS1 9 A^*68:12 SSSFSHREK 314 1496 SGSFSHREK 3554

CDC25A 9 A^*68:12 SYCEPSSYR 314 812 SYCEPPSYR 597

ALMS1 10 A^*33:01 TVPSSSFSHR 335 237 TVPSGSFSHR 378

THNSL2 9 A^*68:12 TIESVQGAK 338 953 AIESVQGAK 3861

5

POLR2A 9 B^*35:01 MIWNVQKIF 393 541 MIWNAQKIF 294

CDC25A 9 B^*35:01 QSYCEPSSY 478 50000 QSYCEPPSY 472

DSCAML1 10 B^*35:01 SSIRSFVLQY 480 9195 SSIRGFVLQY 391

T cells were tested for neoantigen reactivity by expanding them using autologous antigen presenting cells (APCs) pulsed with candidate neoantigen peptide pools (once per week X 4 weeks). As shown in FIG. 14B, reactivity in a IFN-y ELISPOT assay was detected against Pool 2, but not against an irrelevant peptide (Tax peptide). Deconvolution of the pool revealed that the mutated (mut) ALMS1 and C6orf89 peptides within Pool 2 were immunogenic. ALMS1 plays a role in ciliary function, cellular quiescence and intracellular transport, and mutations in this gene have been implicated in type II diabetes. C6orf89 encodes a protein that interacts with bombesin receptor subtype-3, which is involved in cell cycle progression and wound repair of bronchial epithelial cells. Both mutated sites were not in conserved regions of the gene, and were not within genes previously reported to be mutated in cancer. Both of the target peptides were among the subset of 14 predicted peptides that could be experimentally confirmed to bind Pt l's HLA alleles. The experimental binding scores of mut and wildtype (wt) ALMS1 were 91 and 666 nM, respectively; and of mut- and wt-C60RF89, 131 and 1.7 nM, respectively (see e.g., FIG. 14C and Table 9). Both mutated genes localized to poorly conserved regions and did not localize to previously reported mutation sites in cancers (see e.g., FIGS. 15-16). Example 20: CLL Patient 2 exhibited immunity against a mutated FNDC3B peptide that is naturally processed

In Patient 2, the ability personal neoantigens to contribute to memory T responses in the setting of long-lived remission was tested. From this individual, 26 non- synonymous missense mutations were identified. In total, 37 peptides from 16 mutations were predicted to bind to personal HLA alleles, of which 18 peptides from 12 mutations could be experimentally validated (15 with IC50 < 150; 3 with IC50 150-500 nM) (see e.g., FIG. 17A). In Pt 2, all 18

experimentally validated HLA-binding peptides were studied. T cell stimulations were performed using 3 pools of 6 peptides/pool (see e.g., Table 10). Table 10 shows a summary of peptides from Pt 2 missense mutations that were included in peptide pools for T cell stimulation studies. In Pt 2, all peptides that were experimentally confirmed to bind to HLA -A and -B alleles were used. 3 pools of peptides with 6 peptides/pool listed in decreasing order of experimental binding affinity of mutated peptides. The corresponding wildtype peptides and their predicted IC50 scores are included in the far right columns.

Table 10.

ACSM2A 10 A^*02:01 SLMEHWALGA 5.67 40 SLMEPWALGA 9.8

TBC1D9B 9 A^*02:01 KMTFLFPNL 63.7 62 KMTFLFANL 93

SF3B1 9 A^*02:01 GLVDEQQEV 22.26 94 GLVDEQQKV 51

LRRC41 10 A^*02:01 ALPDPILQSI 28.18 107 ALPGPILQSI 99

LRRC41 9 A^*02:01 GVWALPDPI 382.07 122 GVWALPGPI 963

FNDC3B 10 A^*02:01 AVVMSWAPPV 98.15 123 AVVLSWAPPV 89

F2R 9 B^*080:1 TSIDRFLAV 245.43 130 ISIDRFLAV 252

KIAA0467 9 B^*07:02 GPSWGLSLM 179.31 137 GPSRGLSLM 39

3

C16orf57 9 A^*02:01 LLRVHTEHV 454.23 175 LLRVHTEQV 433.02

C22orf28 10 A^*02:01 WVNCSSMTFL 302.94 274 WVNRSSMTFL 835

FNDC3B 10 A^*02:01 VMSWAPPVGL 37.77 378 VLSWAPPVGL 48

Peptides with similar experimental binding scores were combined within the same pool. Responses were assessed after 2 rounds of weekly stimulations of T cells against mutated peptide pool-pulsed autologous APCs, and T cells were found to be reactive against Pool 1, as shown in FIG. 17B. Deconvolution of the pool revealed

to be the dominant immunogenic peptide among others within this pool (experimental IC50 of mut- and wt-FNDC3B were 6.2 and 2.7 nM, respectively; see e.g., FIG. 17C). The function of FNDC3B in blood malignancies is unclear, although down-regulation of FNDC3B expression is known to upregulate miR-143 expression, which has been shown to differentiate prostate cancer stem cells and promote prostate cancer metastasis. Similar to ALMS1 and C6orf89, the mutation in FNDC3B neither localized to evolutionarily conserved regions nor was it previously reported in other cancers (see e.g., FIGS. 15 and 16).

T cell reactivity against

was polyfunctional (secreting GM-CSF, IFN-γ and IL-2), and specific to the

peptide but not its wildtype counterpart. Testing T cell reactivity against different concentrations of mut- and wt-FNDC3B peptides revealed a high avidity and specificity of

reactive T cells. T cell reactivity was abrogated by the presence of class I blocking antibody (W6/32), indicating that T cell reactivity was class I restricted (see e.g., FIGS. 17D-E). Moreover, the

peptide appeared to be a naturally processed and presented peptide since T cell reactivity was detected against HLA-A2- expressing APCs that were transfected with a 300 basepair minigene encompassing the region of gene mutation but not the wildtype minigene, as shown in FIG. 17E, right panel.

Using a mut-iWDCJfi/A2⁺-specific tetramer, a discrete population of

reactive CD8⁺ T cells was detected within Pool 1-stimulated T cells (2.42% of the population) compared to control PBMCs from a healthy adult HLA-A2+ volunteer (0.38%), as shown in FIG. 17F. Gene expression analysis of FNDC3B in a large dataset of 182 CLL cases (including Pt 2) and 24 CD19⁺ B cells collected from normal volunteers revealed this gene to be relatively overexpressed in Patient 2 compared to other CLLs and normal B cells, as shown in FIG. 17G. Accordingly, it is clear that long-lived neoantigen- specific T cells could be tracked in CLL Patient 2.

To define the kinetics of

specific T cells in relationship to post-HSCT course, Pt 2 T cells isolated from different time points before and after HSCT were stimulated for 2 weeks and then tested for IFN-γ reactivity on ELISPOT. The emergence of

specific T cells coincided with molecular remission and was sustained over time with continuous remission. As shown in FIG. 18 (top and middle panel),

T cell responses were not detected before or up to 3 months following HSCT. Molecular remission was first achieved 4 months following HSCT, and

T cells were then first detected 6 months following HSCT. Antigen- specific reactivity subsequently waned (between 12 and 20 months post-HSCT), but was again strongly detected at 32 months post-HSCT. Based on molecular analysis of the TCR of the mut-iWDCJfi-specific T cells, νβΐ 1 was identified as the

predominant CDR3 νβ subfamily used by the reactive T cells, as shown in FIG. 19 and Table 11). Table 11 shows primers used for amplification of the TCR Υβ subfamily.

Table 11.

νβ2 TCATCAACCATGCAAGCCTGACCT 349 νβ3 GTCTCTAGAGAGAAGAAGGAGCGC 346 νβ4 ACATATGAGAGTGGATTTGTCATT 378 νβ5.1 ATACTTCAGTGAGACACAGAGAAAC 396 νβ5.2 TTCCCTAACTATAGCTCTGAGCTG 343 νβ6 AGGCCTGAGGGATCCGTCTC 340 νβ7 CCTGAATGCCCCAACAGCTCTC 347 νβδ ATTTACTTTAACAACAACGTTCCG 404 νβ9 CCTAAATCTCCAGACAAAGCTCAC 348 νβΐ ο CCACGGAGTCAGGGGACACAGCAC 313 νβ1 1 TCCAACCTGCAAAGCTTGAGGACT 312 νβ12 CATGGGCTGAGGCTGATC 417 νβ13.1 CAAGGAGAAGTCCCCAAT 372 νβ13.2 GGTGAGGGTACAACTGCC 390 νβ14 GTCTCTCGAAAAGAGAAGAGGAAT 349 νβ15 AGTGTCTCTCGACAGGCACAGGCT 352 νβ16 AAAGAGTCTAAACAGGATGAGTCC 395 νβ17 GGAGATATAGCTGAAGGGTA 372 νβ18 GATGAGTCAGGAATGCCAAAGGAA 380 νβ19 TCCTCTCACTGTGACATCGGCCCA 322

Υβ20 AGCTCTGAGGTGCCCCAGAATCTC 370 νβ22 AAGTGATCTTGCGCTGTGTCCCCA 490

νβ23 AGGACCCCCAGTTCCTCATTTC 435

νβ24 CCCAGTTTGGAAAGCCAGTGACCC 509

νβ25 TCAACAGTCTCCAGAATAAGGACG 352

Name Reverse primer sequence (5'-3')

External Οβ GACAGCGGAAGTGGTTGCGGGGT

Internal Οβ FAM-CGGGCTGCTCCTTGAGGGGCTGCG

This molecular information was used to develop a clone- specific nested PCR assay. Applying this assay, it was observed that T cells with the same specificity for

were not detected in PBMCs (n=3) and CD8⁺ T cells of normal healthy volunteers (see e.g., Table 12), but could be detected with similar kinetics as detection of IFN-γ secretion following HSCT in the patient as shown in FIG. 18, bottom panel. Although relative numbers of clone- specific T cells declined over time, lower concentrations of peptide antigen could stimulate T cell reactivity at 32 months compared to 6 months post-HSCT, indicating the emergence of potentially more antigen- sensitive memory T cells over time (see e.g., FIG. 18, inset).

Table 12 shows detection of

specific TCR νβΐ 1, using T cell receptor- specific primers in Pt 2. A real-time PCR assay was designed to detect the

specific TCR νβΐ 1 clone. This clone was not detectable in healthy donor PBMCs (n=3) or CD8 T cells, but clearly detectable in cDNA from

reactive T cells from Pt 2 (at 6 months post-HSCT). The PCR products were normalized over 18S ribosomal RNA. -, negative: no amplification; +, positive: amplification detected; ++, double positive: amplification detected and amplification level is more than median level of all positive samples. Table 12.

Example 21: Large numbers of candidate neoantigens were predicted across diverse cancers The overall somatic mutation rate of CLL is similar to other blood malignancies, but low in comparison to solid tumor malignancies (see e.g., FIG. 20A). To examine how tumor type and mutation rate impacts the abundance and quality of candidate neoantigens, the pipeline was applied to publicly available WES data from 13 malignancies - including high (melanoma (MEL)), lung squamous (LUSC) and adeno (LUAD) carcinoma, head and neck cancer (HNC), bladder cancer, colon and rectum adenocarcinoma, medium (glioblastoma (GBM), ovarian, clear cell renal carcinoma (clear cell RCC), and breast cancer) and low (CLL and acute myeloid leukemia (AML) cancers. To perform this analysis, a recently described algorithm that enables inference of HLA typing from the WES data was also implemented (Liu et al. 2013).

The overall mutation rate in these solid malignancies was an order of magnitude higher than for CLL and was associated with an increased median number of missense mutations. For example, melanoma displayed a median of 300 (range, 34-4276) missense mutations per case, while RCC had 41 (range, 10-101), respectively. Frameshift and splice-site mutations in RCC and melanoma were increased by only 2-3 fold in frequency as compared to CLL and summed neoORF length per sample were increased only moderately (by 5-13 fold). Overall, the median number of predicted neopeptides with IC50 < 500 nM generated from missense and frameshift events per sample was proportional to the mutation rate; this was approximately 20- and 4-fold higher for melanoma (488; range, 18-5811) and RCC (80; range, 6-407)), respectively, compared to CLL (24; range 2-124). With a more stringent threshold of IC50 < 150 nM, the corresponding numbers of predicted neopeptides were 212, 35 and 10 for melanoma, RCC and CLL, respectively, as shown in FIG. 20B and Table 13).

Table 13 shows the distribution of mutation classes, summed neoORF sizes and number of predicted binding peptides across 13 cancers. MEL:melanoma, LUSC: lung squamous cell carcinoma, LUAD: lung adenocarcinoma, BLCA: bladder, HNSC: head and neck cancer, COAD: colon adenocarcinoma, READ: renal adenocarcinoma, GBM: glioblastoma, OV:

ovarian, RCC: clear cell renal carcinoma, BRCA: breast, CLL: chronic lymphocytic leukemia, AML: acute myeloid leukemia. * -predicted number of peptides based on missense and frameshift mutations.

Table 13.

Refers only to predicted epitopes arising from missense mutations.

Example 22: Clinical strategies for addressing clonal mutations

"Clonal" mutations are those that are found in all cancer cells within a tumor, while "subclonal" mutations are those that statistically are not in all cancer cells and therefore are derived from a sub population within the tumor.

According to the techniques herein, bioinformatic analysis may be used to estimate clonality of mutations. For example, the ABSOLUTE algorithm (Carter et al, 2012, Landau et al, 2013) may be used to estimate tumor purity, ploidy, absolute copy numbers and clonality of mutations. Probability density distributions of allelic fractions of each mutation may be generated followed by conversion to cancer cell fractions (CCFs) of the mutations. Mutations may be classified as clonal or subclonal based on whether the posterior probability of their CCF exceeds 0.95 is greater or lesser than 0.5 respectively.

It is contemplated within the scope of the disclosure that a neoantigen vaccine may include peptides to clonal, sub-clonal or both types of mutations. The decision may depend on the disease stage of the patient and the tumor sample(s) sequenced. For an initial clinical study in the adjuvant setting, it may not be necessary to distinguish between the two mutations types during peptide selection, however, one of skill in the art will appreciate that such information may be useful in guiding future studies for a number of reasons.

First, subject tumor cells may be genetically heterogeneous. Multiple studies have been published in which tumors representing different stages of disease progression have been evaluated for heterogeneity. These include examining the evolution from a pre-malignant disease (Myelodysplasia syndrome) to leukemia (secondary acute myelogenous leukemia [AML]) (Walter et al 2012), relapse following therapy-induced remission of AML(Ding et al 2012), evolution from primary to metastatic breast cancer and medulloblastomas (Ding et al 2012; Wu et al Nature 2012), and evolution from primary to highly metastatic pancreatic and renal cancers (Yachida et al 2012; Gerlinger et al 2012). Most studies utilized genome or exome sequencing but one study also evaluated copy number variations and CpG methylation pattern variations. These studies have shown that genetic events are acquired during cancer cell growth which alter the profile of mutations. Many, and usually most (40 % - 90%), of the earliest detectable mutations ("founder mutations") persist in all evolved variants but new mutations unique to evolved clones do arise and these may be distinct between different evolved clones. These changes can be driven by host/cancer cell "environmental" pressures and/or therapeutic intervention and thus more highly metastatic disease or prior therapeutic intervention generally lead to more significant heterogeneity.

Second, it is contemplated that a single tumor for each patient may be initially sequenced, which may provide a snapshot of the profile of genetic variation for that particular point in time. The sequenced tumor may be derived from a clinically evident lymph node, in transit/satellite metastasis, or resectable visceral metastasis. None of the initially tested patients will have disease that has clinically progressed to multiple sites; however, it is contemplated that the techniques described herein in will be broadly applicable to patients have cancer that has progressed to multiple sites. Within this tumor cell population, "clonal mutations" may be comprised of both founder mutations and any novel mutations present in the cell that seeded the resected tumor and sub-clonal mutations represent those that evolved during growth of the resected tumor.

Third, the clinically important tumor cells for the vaccine induced T-cells to target are frequently not the resected tumor cells but rather other currently undetectable tumor cells within a given patient. These cells may have spread directly from the primary tumor or from the resected tumor, may have derived from a dominant or sub-dominant population within the seeding tumor and may have genetically evolved further at the surgically resected site. These events are currently unpredictable.

Thus, for the surgically resected adjuvant setting, there is no a priori way to decide whether mutations found in the resected tumor that are clonal or subclonal represent the optimal choice for targeting other non-resected cancer cells. For example, mutations that are subclonal within the resected tumor may be clonal at other sites if those other sites were seeded from a subpopulation of cells containing the sub-clonal mutation within the resected tumor.

In other disease settings however, such as settings in which patients carry multiple and metastatic lesions, sequencing of more than one lesion (or parts of lesion) or lesions from different time points may provide more information relative to effective peptide selection.

Clonal mutations may typically be prioritized in the design of neo-antigen epitopes for the vaccine. In some instances, especially as the tumor evolves and sequencing details from metastatic lesions are evaluated for an individual patient, certain subclonal mutations may be prioritized for consideration as part of peptide selection.

Example 23: Personalized cancer vaccines stimulate immunity against tumor neoantigens

The above-described detailed integration of comprehensive bioinformatics with functional data in CLL and other cancers provides several novel biological insights. First, although CLL is a relatively low mutation rate cancer, it was nonetheless possible to identify epitopes generated by somatic mutations that elicited long-term T cell responses. Whole-exome sequencing data from 31 CLL samples revealed that per case, a median of 22 peptides (range, 6- 81) were predicted to bind to personal HLA-A and -B alleles with IC50 < 500nM originating from a median of 16 (range, 2-75) missense mutations. Approximately 75% and half (54.5%) of predicted peptides with IC50 < 150 nM and 500 nM, respectively, were experimentally validated to bind to the patient's HLA alleles. RNA expression analysis showed that nearly 90% of the cognate genes corresponding to the predicted mutated peptides were confirmed to be expressed in CLL cells and expression of a transcript from the mutated allele was detected in each of the three (data not shown) examples tested. Only a fraction of all neoepitopes had generated a spontaneous T-cell response although this response was still detectable years after transplant; -6% (3/48) of all predicted and tested mutated peptides or 9% (3/32) of experimentally validated and tested mutated peptides stimulated IFN-γ secretion responses from patient T cells. This rate of neo-epitope discovery in CLL, a low mutation rate tumor, is remarkably similar to the rates recently reported in melanoma (4.5%, or 11/247 peptides; Robbins PF, Lu YC, El-Gamil M, et al: Mining exomic sequencing data to identify mutated antigens recognized by adoptively transferred tumor-reactive T cells. Nat Med, 2013), a high mutation rate cancer. Hence, functional neoepitopes can be systematically discovered across the broad range of cancers including low mutation rate tumors.

A second key finding is that T cell responses against CLL neoepitopes were long-lived

(on the order of several years), associated with continuous disease remission and were generated during in vitro stimulation in a timeframe consistent with memory T cell responses. These studies add to the growing literature that responses against tumor neoantigens contribute to efficacious immune responses. Thus, although approximately 5% of predicted peptides generated from missense mutations yielded detectable T cell responses, the kinetics of the response suggest a possible role in ongoing anti-leukemia surveillance functions. The functional impact of neoantigen-directed T-cell responses is supported by a recent study from Castle et al. (Castle JC, Kreiter S, Diekmann J, et al: Exploiting the mutanome for tumor vaccination. Cancer Res 72: 1081-1091, 2012) who identified candidate neoepitopes by WES of B16 murine melanoma and prediction of peptide-HLA allele binders. A subset of these predicted epitopes not only elicited immune responses that were specific to the mutated peptide and not the wildtype counterpart, but could also control the disease both therapeutically and prophylactically. While it was difficult to directly compare the relative contributions of tumor neoantigens versus other types of CLL antigens such as overexpressed or shared native antigens (in contrast to melanoma, CLL tumor antigens are not well characterized) or to the GvL response, prior characterization of antigen-specific T cell responses from a melanoma patient with prolonged survival suggest that anti-neoantigen immunity is more prolonged and sustained over time than that against shared overexpressed tumor antigens.

Third, these results highlight the concept that targeting tumor- specific "trunk" mutations can be impactful from the immunologic standpoint. All three of the immunogenic neoantigens (mutated FND3CB, ALMS1, C6orf89) in the two patients appeared to be passenger mutations, not directly contributory to the oncogenic process, and were clonal, affecting the bulk of the cancer mass. Several features of these immunogenic mutations suggest them to be passenger mutations: lack of sequence conservation around the mutation and lack of previously reported mutations in other cancers at the observed sites. Because clonal evolution is a fundamental feature of cancer, it has been posited that immunologic targeting of cancer drivers would have the advantage of minimal antigenic drift, given their essentiality in tumor function that would require them to be maintained in the face of selective pressure. Although such an advantage may be possible, it is apparently not a requirement. Additionally, driver mutations may not necessarily generate immunogenic peptides. For example, the TP53-S83R mutation in Patient 2 did not generate a predicted epitope of < 500 nM against any of its class I HLA-A or -B alleles. Finally, analysis of the binding characteristics of the neoantigen data from the literature (Table 4) as well as the candidate neoepitopes from the data in CLL revealed conceptual insights into the types of point mutations most likely to effectively create a T cell response. It was found that a consistent feature of immunogenic neoepitopes was a predicted binding affinity < 500 nM (3 of 3 of immunogenic CLL peptides and 30 of 33 [91 ] of the historical functional neoepitopes) and the majority of these (92%) displayed predicted affinities < 150 nM.

Unexpectedly however, in most cases (3 of 3 immunogenic CLL peptides and 27 of 33 [82%] historical functional epitopes), the corresponding wild type epitopes were also predicted to bind with comparable strong/intermediate (< 150 nM, Group 1 in Table 4) or weak (150 - 500 nM, Group 2 in Table 4) affinity. The data support the idea that two types of mutations are commonly observed among naturally occurring T-cell responses to neoantigens: (1) mutations at positions that lead to substantially better binding to the MHC allele (mutated ALMS1 as well as 6 of 33 (18%) of the historical functionally-identified neoepitopes ['Group 3', Table 4]), presumably due to improved interaction with MHC, or (2) mutations at positions that do not significantly interact with MHC but instead presumably alter the T cell receptor binding ((2 of 3 CLL epitopes [FNDC3B and C6orf89] and 24 of 33 (73%) naturally immunogenic neoepitopes ['Group and 'Group 2', Table 4]). The distinction between these two types of mutations fits with the concept that the peptide can be considered as a "key', which must fit both the MHC and the TCR "locks" in order to stimulate cytolysis, allowing mutations to independently vary MHC or TCR binding. Excepting the contribution of minor histocompatiblility antigens to graft-vs- host disease, there are no reports of auto-immune sequelae linked to neoantigens in these patients, even in those patients where a reaction occurs to a mutated peptide and the cognate native peptide is predicted to be a tight binder. This result is consistent with the idea that MHC- binding native peptides are normally involved in the negative selection process in which T cells bearing TCRs reactive to these native peptides are thymically deleted or rendered anergic, and yet the T cell repertoire can accommodate the development of a specific immune response to a neoeptiope peptide due to an altered presentation of the mutated peptide to the T cell receptor. It is clear that each individual tumor in a patient may harbor a broad spectrum of both shared and personal genetic alterations that may continue to evolve in response to the environment, and that this progression may often lead to resistance to therapy. Given the uniqueness and plasticity of tumors, an optimal therapy may need to be customized based on the exact mutations present in each tumor, and may need to target multiple nodes to avoid resistance. The vast repertoire of human CTLs has the potential to create such a therapy that targets multiple, personalized tumor antigens. As discussed above, the present disclosure shows that it is possible to systematically identify CTL target antigens harboring tumor- specific mutations by using massively parallel sequencing in combination with algorithms that effectively predict HLA -binding peptides.

Advantageously, the present disclosure allows tumor neoantigens in a variety of low and high mutation rate cancers to be predicted, and experimentally identifies long-lived CTLs that target leukemia neoantigens in CLL patients. The present disclosure supports the existence of protective immunity targeting tumor neoantigens, and provides a method for selecting neoantigens for personalized tumor vaccines.

As discussed in detail above, the techniques described herein were applied to a unique group of CLL patients who developed clinically evident durable remission associated with antitumor immune responses following allogeneic-HSCT. These graft- versus-leukemia responses have typically been attributed to allo-reactive immune responses targeting hematopoietic cells. However, the above described results indicate that the GvL response is also associated with CTLs that recognize personal leukemia neoantigens. These results are consistent with data indicating that the existence of GvL-associated CTLs with specificity for tumor, rather than allo- antigens. It has been postulated that neoantigen-reactive CTLs are important in cancer surveillance because the study of a long-term melanoma survivor found that CTLs targeting neoantigens are significantly more abundant and sustained than those against non-mutated overexpressed tumor antigens (Lennerz V, Fatho M, Gentilini C, et al: The response of autologous T cells to a human melanoma is dominated by mutated neoantigens. Proc Natl Acad Sci U S A 102: 16013-8, 2005). The data presented above is consistent with this melanoma study because neoantigen-specific T cell responses in CLL patients were found to be long-lived (on the order of several years) memory T cells (based on their rapid stimulation kinetics in vitro) and associated with continuous disease remission. Accordingly, neoantigen-reactive CTLs likely play an active role in controlling leukemia in transplanted CLL patients.

More generally, the abundance of neoantigens across many tumors was estimated and found to be -1.5 HLA-binding peptides with IC50<500nM per point mutation and ~ 4 binding peptides per frameshift mutation. As expected, the rate of predicted HLA binding peptides mirrored the somatic mutation rate per tumor type (see e.g., FIG. 20). Two approaches were used to study the relationship between predicted binding affinity and immunogenic neoantigens that induce CTLs. The above-described techniques were applied to published immunogenic tumor neoantigens (i.e. in which reactive CTLs were observed in patients) demonstrated that the vast majority (91%) of functional neoantigens are predicted to bind HLA with IC50<500nM (with

-70% of wild type counterpart epitopes predicted to bind at a similar affinity) (see e.g., Table 4). This test used a gold standard set of neoantigens confirmed that the techniques described herein correctly classify true positives. A prospective prediction of neoepitopes followed by functional validation showed that 6% (3/48) of predicted epitopes were associated with neoantigen-specific T cell responses in patients— comparable to the rate of 4.8% found recently for melanoma. The low proportion does not necessarily imply low prediction accuracy for the algorithm. Rather, the number of true neoantigens is greatly underestimated because: (i) allo-HSCT is a general cellular therapy likely to induce only a small number of neoantigen-specific T cell memory clones; and (ii) standard T cell expansion methods are not sensitive enough to detect naive T cells that represent a much larger part of the repertoire but with much lower precursor frequencies.

Although the frequency of CTLs that target neoORFs has yet to be measured, it is specifically contemplated within the scope of the invention that this class of neoantigens may be an excellent candidate neoepitope because it is likely to be more specific (for lack of a wild type counterpart) and immunogenic (as a result of bypassing thymic tolerance).

With the ongoing development of highly powerful vaccination reagents, the present disclosure provides techniques that make it feasible to generate personalized cancer vaccines that effectively stimulate immunity against tumor neoantigens.

MATERIALS AND METHODS

Patient samples: Heparinized blood was obtained from patients enrolled on clinical research protocols at the Dana-Farber Cancer Institute (DFCI). All clinical protocols were approved by the DFCI Human Subjects Protection Committee. Peripheral blood mononuclear cells (PBMCs) from patient samples were isolated by Ficoll/Hypaque density-gradient centrifugation, cryopreserved with 10% DMSO, and stored in vapor-phase liquid nitrogen until the time of analysis. For a subset of patients, HLA typing was performed by either molecular or serological typing (Tissue Typing Laboratory, Brigham and Women's Hospital, Boston, MA). Whole exome capture sequencing data for CLL and other cancers: The list for melanoma was obtained from dbGaP database (phs000452.vl.pl) and for the 11 other cancers, through TCGA (available through the Sage Bionetworks' Synapse resource (on the worldwide web at (www)synapse.org/#!Synapse:synl729383)). The HLA-A, HLA-B and HLA-C loci in 2488 samples across these 13 tumor types were sequenced using a two-stage likelihood based approach, and this data is summarized in Table 14. Briefly, a dedicated sequence library consisting of all known HLA alleles (6597 unique entries), based on the IMGT database, was constructed. From this resource, a secondary library of 38-mers was generated, and putative reads emanating from the HLA locus were extracted from total sequence reads based on perfect matches against it. The extracted reads were then aligned to the IMGT-based HLA sequence library using the Novoalign software (on the worldwide web at (www)novocraft.com), and HLA alleles were inferred through a two-stage likelihood calculation. In the first stage, population- based frequencies were used as priors for each allele and the posterior likelihoods were calculated based on quality and insert size distributions of aligned reads. Alleles with the highest likelihoods for each of HLA-A, B and C genes were identified as the first set of alleles. A heuristic weighting strategy of the computed likelihoods in conjunction with the first set of winners were then used to identify the second set of alleles.

Table 14 shows TCGA patient IDs for neoantigen load estimates across cancers. LUSC (lung squamous carcinoma), LUAD (lung adeno carcinoma), BLCA (bladder), HNSC (head and neck), COAD (colon) and READ (rectum), GBM (glioblastoma), OV (ovarian), RCC (clear cell renal carcinoma), AML (acute myeloid leukemia) and BRCA (breast), Table 14

TCGA-CU- A3KJ-01 A- 11D-A21 A-08 BLCA e22c6a44-4f8e-44eb-8ca8-dff0f2fc5575

TCGA-DK- A 1 A3-01 A- 11 D- Al 3 W-08 BLCA 2322f7cd-7d55-4a9f-b7f3-da3068089383

TCGA-DK- A 1 A5-01 A- 11 D- Al 3 W-08 BLCA 448fe471-3f4e-4dc8-a4e0-6fl47dc93abe

TCGA-DK- A 1 A6-01 A- 11 D- Al 3 W-08 BLCA df8a913c-5160-4fc5-950d-7c890e24e820

TCGA-DK- A 1 A7-01 A- 11 D- Al 3 W-08 BLCA 91f458e6-64b7-454d-a542-b0aa23638fd8

TCGA-DK- A 1 A A-01 A- 11 D- A 13 W-08 BLCA 804ffa2e-158b-447d-945c-707684134c87

TCGA-DK- A 1 AB-01 A- 11 D- A 13 W-08 BLCA 5f0fb2ba-035 l-4ce0-8b74-31 aa3deecael

TCGA-DK- A 1 AC-01 A- 11 D- A 13 W-08 BLCA a5dcl7f5-abda-4534-b0f8-34b59ed4faa3

TCGA-DK- A 1 AD-01 A- 11 D- A 13 W-08 BLCA 32398d56-8668-41bl-9c0b-c6aea6e3e787

TCGA-DK- A 1 AE-01 A- 11 D- A 13 W-08 BLCA abd2d959-d5ed-4eb3-9759-67eb 1 aa23325

TCGA-DK- A 1 AF-01 A- 11 D- Al 3 W-08 BLCA fbdcd7f9-1901-4e90-8e3c-71b05dc96dal

TCGA-DK- A 1 AG-01 A- 11 D- A 13 W-08 BLCA 7d2a22eb-7344-4cba-ad7d-94c3f9ef3d7c

TCGA-DK- A2HX-01 A- 12D- A 18F-08 BLCA a8f0d416-2102-43ea-9cfl-465c37f9642a

TCGA-DK- A2I1 -01 A- 11 D- A 17 V-08 BLCA f350676a-e308-42fe-8297-9dl 8ba7027b 1

TCGA-DK- A2I2-01 A- 11 D- A 17 V-08 BLCA 537e0d59-ddlc-479e-877f-eb9523c0967e

TCGA-DK- A2I4-01 A- 11 D- A21 A-08 BLCA d68074b8-ce96-4dc5-bl4c-3bbc7ba92ad9

TCGA-DK- A2I6-01 A- 12D- A 18F-08 BLCA 97a755af-ca00-4116-8a32-0984dbfbl585

TCGA-DK- A3IK-01 A-32D- A21 A-08 BLCA f730e341-8102-4405-95e2-46a3455a35cc

TCGA-DK-A3IL-01 A-l 1D-A20D-08 BLCA 4838b5a9-968c-4178-bffb-3fafelf6dc09

TCGA-DK- Α3ΓΜ-01 A-l 1D-A20D-08 BLCA 780f4201-4e59-47b8-b3b7-d322a6162b2d

TCGA-DK-A3TN-01 A-l 1D-A20D-08 BLCA 173cl518-6bcb-4e25-al l9-de32dab91286

TCGA-DK- A3IQ-01 A-31 D-A20D-08 BLCA c3da3cc2-2299-4a3e-9de8-7ald0al0345d

TCGA-DK- A3IS-01 A-21 D- A21 A-08 BLCA 92a59313-dal2-4896-bl64-fd2d50684638

TCGA-DK- A3IT-01 A-31 D-A20D-08 BLCA 07db4596-cb49-4a32-bc99-3b202ffe61 a2

TCGA-DK-A3IU-01 A-l 1D-A20D-08 BLCA 52de410f-3ce3-4ee6-87f3-8ec2e829962f

TCGA-DK- A3IV-01 A-22D- A21 A-08 BLCA 7cecfbbc-5fe4-4413-95fd-07533 aacbb73

TCGA-E5- A2PC-01 A- 11 D- A202-08 BLCA 62b9f71c-2dab-455a-a454-579e8843f712

TCGA-FD- A3B 3-01 A- 12D- A202-08 BLCA 8e9fb61d-c90d-440b-857a-12el048435ea

TCGA-FD- A3B4-01 A- 12D- A202-08 BLCA df922c85-5al0-487f-a9d5-220d5090e2e4

TCGA-FD- A3B5-01 A-l 1D-A20D-08 BLCA d05f9b81-7ba9-4231-aae6-ld2cl4df22d7

TCGA-FD- A3B 6-01 A-21 D-A20D-08 BLCA 36524c53-ac54-4a42-a982-bed2e4354268

TCGA-FD- A3B7-01 A-31 D-A20D-08 BLCA fc76c5bd-315d-4981-ae53-705f40d2c078

TCGA-FD- A3B 8-01 A-31 D-A20D-08 BLCA 7957bb77-8329-43a0-b 1 a8-140f2cb6b9 lb

TCGA-FD- A3N5-01 A- 11 D- A21 A-08 BLCA 418a3dec-96ff-4719-becb-el a8260cce2f

TCGA-FD- A3N6-01 A- 11 D- A21 A-08 BLCA d4615ca0-b5c7-4a5c-8593-bd50034a78ae

TCGA-FD- A3NA-01 A- 11 D- A21 A-08 BLCA d079a32c-270b-4c43-8372-884e8d0c48ed

TCGA-G2- A2EC-01 A- 11D-A17V-08 BLCA 1376c881-cea5-4470-8dcl-63c69f201570

TCGA-G2- A2EF-01 A- 12D- Al 8F-08 BLCA 4e5917bd-2cb 1 -438c-a46c-5d8ca5b2fd0e

TCGA-G2- A2EJ-01 A- 11 D- A 17 V-08 BLCA 82f98ff9-7161-45c3-8107-033b47e25f21

TCGA-G2- A2EK-01 A-22D- Al 8F-08 BLCA eb73bb35-af99-47b8-8bbb-33b5374e5c74

TCGA-G2- A2EL-01 A- 12D- Al 8F-08 BLCA 56924619-0724-4b3e-9c53-27c27d3789d6 TCGA-G2-A2EO-01 A-l 1D-A17V-08 BLCA ebb5cdb6-df4a-436d-b4a6-1655d263e3dd

TCGA-G2- A2ES-01 A- 11D-A17V-08 BLCA 5c628df6-a848-4177-87b8-714788118980

TCGA-G2-A3IE-01 A-l 1D-A20D-08 BLCA ebacd09f-c204-4cd2-a087-07bc4f2c5b74

TCGA-GC- A3I6-01 A- 11 D-A20D-08 BLCA 372feefe-ee84-4833-8651-8f023f38a56a

TCGA-GC- A3RB-01 A- 12D- A21 Z-08 BLCA eaf54383-4286-4416-9bl8-bel081797df2

TCGA-GD- A2C5-01 A- 12D- Al 7 V-08 BLCA 2bl42863-b963-4cc9-8f8f-c72503c93390

TCGA-GD- A3OP-01 A-21 D- A21Z-08 BLCA 3e02d723-691a-448c-85e2-4e39a3696ba5

TCGA-GD- A3OQ-01A-32D-A21Z-08 BLCA fb985b3d-b0f7-42a0-bc3c-f71d9c5f78d8

TCGA-GD- A3OS-01 A- 12D- A21Z-08 BLCA 9b3el64d-aaa0-4bb5-b7b8-6264b2746a47

TCGA-GV- A3JV-01 A- 11D-A21Z-08 BLCA 5fed4b8a-4b59-4424-bbfl-bc73ce041361

TCGA-GV- A3 JW-01 A- 11 D-A20D-08 BLCA 4534413b-d0d0-4b34-a3d4-f821705485ae

TCGA-GV- A3 JX-01 A-l 1D-A20D-08 BLCA 21525d6f-4222-4e0a-9f07-8adbbd55c54f

TCGA-GV- A3 JZ-01 A- 11 D- A21 A-08 BLCA 074fc904-0a0e-4114-b569-89d51e7a89db

TCGA-GV- A3QG-01 A- 11 D-A21Z-08 BLCA 90534196-b 1 d8-4054-b4d5- 1 d29943b52bc

TCGA-GV- A3QI-01 A-l 1D-A21Z-08 BLCA 33 a9da52-5471 -456f-84cb- 13c5de5b0994

TCGA-H4-A2HO-01 A-l 1D-A17V-08 BLCA 2e327841-eef0-42dd-883e-7d5b5a0d3a93

TCGA-H4- A2HQ-01 A- 11D-A17V-08 BLCA 94108975-b7a0-40ba-ad39-e44cc62e8cc0

TCGA-HQ- A2OE-01 A- 11 D- A202-08 BLCA 61324839-e90a-49f2-a9c9-629d7b 125fe9

TCGA-Al-AOSB-01 A-l 1D-A142-09 BRCA db9d40fb-bfce-4c3b-a6c2-41 c5c88982f 1

TCGA-Al-AOSD-01 A-l 1D-A10Y-09 BRCA 1847727f-ea57-4e2e-84e5-al0e764c9096

TCGA-Al-AOSE-01 A-l 1D-A099-09 BRCA 0539776c-3943-41d0-972c-8dc833a603e5

TCGA-Al-AOSF-01 A-l 1D-A142-09 BRCA b291200e-3c22-411 a-85d0-fbe 1570acda2

TCGA-Al-AOSG-01 A-l 1D-A142-09 BRCA 39642c6d-919 l-4746-8a9d-62d437bfdce8

TCGA-Al-AOSH-01 A-l 1D-A099-09 BRCA 473d6ae4-162a-4136-b44f-fad42529a31a

TCGA- Al - AOSI-01 A- 11 D- A 142-09 BRCA e218c272-a7e 1 -4bc9-b8c5-d2d 1 c903550f

TCGA- Al - AOS J-01 A- 11 D- A099-09 BRCA a55c6a44-c0f5-4300-8df4-4a70befe2d3b

TCGA- Al - AOSK-01 A- 12D- A099-09 BRCA d lb43161 -cbcl -4bf 6-b8bb-a72a2e5el 150

TCGA- Al - AOSM-01 A- 11 D- A099-09 BRCA 2057b341 -ff5c-45ef-83bb-005e29b2e740

TCGA-Al-AOSN-01 A-l 1D-A142-09 BRCA Ib8d93f4-acc2-48ee-9ca8-a327eb0463c2

TCGA- Al - AOSO-01 A-22D- A099-09 BRCA b3568259-c63c-4eb l-bbc7-af71 lddd33db

TCGA-Al-AOSP-01 A-l 1D-A099-09 BRCA d3ae9617-b6cd-4d98-b631-39bd4afd3c4e

TCGA-A1-A0SQ-01A-21D-A142-09 BRCA 9055ddce-a0ff-4980-af86-c07f949acbc3

TCGA-A2-A04N-01 A-l 1D-A10Y-09 BRCA 389dd52b-a7b7-46f0-83ae-308e485466a8

TCGA- A2- A04P-01 A-31 D- Al 28-09 BRCA a85cf239-ff51-46e7-9b88-4c2cb49c66b9

TCGA- A2- A04Q-01 A-21 W- A050-09 BRCA 02ebl7d4-9e9e-4e32-96b0-90ccdda3fl67

TCGA-A2-A04R-01 A-41D-A117-09 BRCA lf8e4326-dfc7-4635-a9b7-a9207a392748

TCGA-A2-A04U-01 A-l 1D-A10Y-09 BRCA f819433a-44db-4022-abdb-d6123cfa30b2

TCGA-A2-A04V-01A-21W-A050-09 BRCA 89501861-2778-4b88-9a44-939fed99850d

TCGA- A2- A04W-01 A-31 D- Al 0 Y-09 BRCA 7822a6bl-68c8-4675-993c-c4b54a510c09

TCGA-A2-A04X-01A-21W-A050-09 BRCA 66a73891-2fea-450c-8224-0865d98b4346

TCGA- A2- A04 Y-01 A-21 W- A050-09 BRCA 3669bbbd-2e75-4b57-a5a8-8eebc25a97c2 TCGA-A2-A0CL-01 A-l 1D-A10Y-09 BRCA a630ed59-dd23-45el-aal6-4f7a98e32728

TCGA- A2- AOCM-01 A- 31W-A050-09 BRCA fe8023d4-5476-4c58-bf70-cbf65cdd4327

TCGA- A2- AOCP-01 A- 11W-A050-09 BRCA a776e274-fe9f-49a9-83ab-95ca6819c96b

TCGA- A2- AOCQ-01 A-21 W- A050-09 BRCA fa0d7183-8757-4f95-87b2-2366aldbd508

TCGA- A2-A0CS-01 A-l 1D-A10Y-09 BRCA fe96b832-cb86-4499-948a-5124a43d5c95

TCGA- A2- AOCT-01 A- 31 W- A071 -09 BRCA 2b412ad8-abda-4cf 8-8f 68-59dbce80031 e

TCGA- A2- AOCU-01 A- 12W- A050-09 BRCA a9aa68af-f5fe-4ac0-987f-8af49b85c231

TCGA- A2- AOC V-01 A- 31 D- A 1 OY-09 BRCA 5dldead5-d9a5-42d3-a703-4c38ad6e8f57

TCGA- A2- AOCW-01 A-21 D- A 1 OY-09 BRCA da4f0f85-b 16f-40f a-95c6-524d70d7ac4d

TCGA- A2- AOCX-01 A-21 W- AO 19-09 BRCA 975adb76-3561-41a0-959a-68da470816c7

TCGA- A2- AOCZ-01 A- 11W-A050-09 BRCA 95d5c606-367a-46b5-b663-dcea3f42e2a2

TCGA-A2-A0D0-01 A-l 1W-A019-09 BRCA 3f20d0fe-aaal-40fl-b2cl-7f070f93aef5

TCGA-A2-A0D 1-01 A-l 1W-A050-09 BRCA a762809c-15c9-485e-ad7a-ef28427750e9

TCGA- A2- A0D2-01 A-21 W- A050-09 BRCA 05656575-69e7-4745-a89d-ca0568eb5559

TCGA- A2-A0D3-01 A-l 1D-A10Y-09 BRCA 8183420e-7f44-4024-b3db-6b53ad293988

TCGA-A2-A0D4-01 A-l 1W-A019-09 BRCA f 3 accede- 1716-4d44-bad4-5427a9ebd675

TCGA-A2-A0EM-01 A-l 1W-A050-09 BRCA OeO 1 c6b8-9edd-4965-b247-ee7e68124f48

TCGA- A2- AOEN-01 A- 13D- A099-09 BRCA 12362ad7-6866-4e7a-9ec6-8a0a68df8896

TCGA-A2-A0EO-01 A-l 1W-A050-09 BRCA 8e2f9eb7-0660-47ae-b86e-652e99fa69ca

TCGA- A2- AOEQ-01 A- 11W-A050-09 BRCA 2c449ea9-c3ff-4726-8566-5933e2b7056d

TCGA- A2- AOER-01 A-21 W- A050-09 BRCA 31 edl 87e-9bfe-4ca3-8cbb- 10c 1 eO 184331

TCGA- A2-A0ES-01 A-l 1D-A10Y-09 BRCA 64d42c62-5c2d-49f5-856e-72beef88044d

TCGA-A2-A0ET-01 A- 31D-A045-09 BRCA f7b40023-4adc-4c7d-ae73-5cl0ddcbc0fb

TCGA- A2- AOEU-01 A-22W- A071 -09 BRCA de30da8f-903f-428e-a63d-59625fc858a9

TCGA- A2-A0EV-01 A-l 1W-A050-09 BRCA 9433bf4f-23ba-4fe7-9503-lad243d74225

TCGA- A2- AOEW-01 A-21 D- A 1 OY-09 BRCA a045a04e-4f7b-4f9a-a733-47ad24475496

TCGA-A2-A0EX-01A-21W-A050-09 BRCA 9308f50c-1320-4c45-acc7-38f43b6f9a36

TCGA- A2- AOE Y-01 A- 11W-A050-09 BRCA a8cde596-e3f5-4b20-9e7f-45d079893176

TCGA- A2- AOST-01 A- 12D- A099-09 BRCA dd669f44-f64d-4afc-a5ac-5f7769dldb43

TCGA- A2-A0SU-01 A-l 1D-A099-09 BRCA 6ceaf20f-1458-4f7f-954a-e2f58edl63bf

TCGA- A2- AOS V-01 A-l 1D-A099-09 BRCA 6d3206c6-0ca8-4b2b-al 60-b 1719217f9c7

TCGA- A2- AOS W-01 A- 11 D- A099-09 BRCA 7fbd2807-a5bb-4030-a299-524ec3ab4543

TCGA- A2- AOSX-01 A- 12D- A099-09 BRCA b54bc31e-bdcc-4ad5-998e-5a9c542f83bb

TCGA- A2- AOS Y-01 A-31 D- A099-09 BRCA efaa9c0b-cl4b-4141-b48c-cc2c6b89ab73

TCGA- A2- AOTO-01 A-22D- A099-09 BRCA 3cl07ce4-a6ac-469b-blc0-cd86674b5766

TCGA- A2- A0T1 -01 A-21 D- A099-09 BRCA 9515373a-d982-45fa-b8f9-363f9ba8649f

TCGA-A2-A0T2-01 A-l 1W-A097-09 BRCA C7918143-dbce-45b3-8d24-2993a9e2b7f4

TCGA- A2- A0T3-01 A-21 D- A 1 OY-09 BRCA 0ca029bb-3b3a-48ec-8ade-5591e8e8629f

TCGA- A2- A0T4-01 A-31 D- A099-09 BRCA 0flblfda-4956-498a-b8ff-e98b5d64e509

TCGA- A2- A0T6-01 A- 11 D- A099-09 BRCA e4dcb280-c309-4ebb-a58d-e6389a0306ee

TCGA- A2- A0T7-01 A-21 D- A099-09 BRCA 3ea4d98d-f 8d9-433e-94f 1 -bO 199bfdb 198 TCGA- A2- AO YC-01 A- 11D-A117-09 BRCA 4cccf7dc-7c53-409f-a6bl-f86e0f07250b

TCGA- A2- AO YD-01 A- 11D-A10G-09 BRCA 30c9f9e5-90b2-4c73-bce5-eb6a3d31f496

TCGA- A2- AO YF-01 A-21 D-A10G-09 BRCA 11571107-fe70-4140-afff-f4792a4fd473

TCGA- A2- AO YG-01 A-21 D-A10G-09 BRCA bf82035c-9cdl-4355-acdd-8a007708e976

TCGA- A2- AO YH-01 A- 11D-A10G-09 BRCA e5558a39-eab2-4216-ba88-b63c2de48b01

TCGA- A2- AO YI-01 A- 31 D- A 1 OM-09 BRCA 6d2ae968-c977-4b65-869a-5e96ff3216e9

TCGA- A2- AO YJ-01 A- 11 D- A 1 OG-09 BRCA 3fe8e99f-dce5-4df9-983e-efe63d56bdd5

TCGA- A2- AO YK-01 A-22D- Al 17-09 BRCA 7c27f81e-62fb-478c-9cee-8e20db9300f2

TCGA- A2- AO YL-01 A-21 D- Al OG-09 BRCA 3cc80b41-603d-4735-85c7-71f540dc6e5c

TCGA- A2- AO YM-01 A- 11 D- A 1 OG-09 BRCA 1125ec93-6d24-4537-9c89-526f2d6b2299

TCGA- A2- AO YT-01 A- 11D-A10G-09 BRCA 827c6a2f-fb lb-4845-9cb 1 - 11013a 16da3f

TCGA- A2- A IF V-01 A- 11 D- Al 3L-09 BRCA 51b7064c-d9fc-4312-ad25-b014ef81c821

TCGA- A2- A lFW-01 A- 11 D- Al 3L-09 BRCA 6ccdb42e- 1 ad 1 -4175-b83 a-a24b019dc640

TCGA- A2- A lFX-01 A- 11 D- Al 3L-09 BRCA 0d3dd7a0-ad8d-46cc-86c4-cl994a7b4b74

TCGA- A2- A lFZ-01 A-51 D- Al 7G-09 BRCA Of7038bb-fd25-468e-8bd9-dcd4312d 13cb

TCGA- A2- A 1 GO-01 A- 11 D- Al 3L-09 BRCA f7eacf95-478d-4d81-a5e3-f5a8938c83ec

TCGA- A2- A 1 Gl -01 A-21 D- Al 3L-09 BRCA afe70076- 1044-4fdd-bebc- 14a97b 1 a8363

TCGA- A2- A 1 G4-01 A- 11 D- Al 3L-09 BRCA 420a4771-6376-4b52-a2e3-e62aaf4d4ed6

TCGA- A2- A 1 G6-01 A- 11 D- Al 3L-09 BRCA C012bce9-del3-4e32-a29e-8ab64el6ea96

TCGA- A2- A259-01 A- 11 D- A 16D-09 BRCA 93febb0a-587c-47f2-9a59-117f7aa475c5

TCGA- A2- A25 A-01 A- 12D- Al 6D-09 BRCA 5739a7el-7fa3-434c-blc3-cOa9e570c858

TCGA- A2- A25B-01 A- 11 D- Al 67-09 BRCA 6e839eaf-ldbb-43f5-8846-c980e05540c7

TCGA- A2- A25C-01 A- 11 D- Al 67-09 BRCA 2411 fc4a-c0d7-4a60-a861 -f4d954ef 1 ed5

TCGA- A2- A25D-01 A- 12D- Al 6D-09 BRCA 56b 152c3-9de5-4b 1 c-b6b4-0116cb7ce097

TCGA- A2- A25E-01 A- 11 D- Al 67-09 BRCA 8dce6a9d-ecb7-4699-9fda-lb09blblde43

TCGA- A2- A25F-01 A- 11 D- Al 67-09 BRCA Ied40576-4flc-4cf6-8eea-e816c5d73d90

TCGA- A7- AOCD-01 A- 11W-A019-09 BRCA d29ba065-28ca-4dfb-9588-06be857f67b2

TCGA- A7- AOCG-01 A- 11W-A019-09 BRCA 351275c7-70ca-4ddc-be76-a6ff4dc7655e

TCGA- A7- AOCJ-01 A-21 W- AO 19-09 BRCA C9f6a65e-ae20-410d-a397-34aef0818ff3

TCGA- A7-A0D A-01 A-31 D- Al 0 Y-09 BRCA 878337fe-9f41-44f5-9760-3977e7d75308

TCGA- A7- A 13D-01 A- 13D- Al 2Q-09 BRCA 418e916b-7a4e-4f ab-8616- 15dcec4d79f 8

TCGA- A7- A 13G-01 A- 11 D- Al 3L-09 BRCA ef847b83-eb88-435b-bcfd-4b51d4dfa5fe

TCGA- A7- A26E-01 A- 11 D- Al 67-09 BRCA 73651880-cfbd-4f8d-8031-al4b3ac65454

TCGA- A7- A26F-01 A-21 D- Al 67-09 BRCA fc73db72-d0ac-48d0-b809-2f7540482ec5

TCGA- A7- A26G-01 A-21 D- Al 67-09 BRCA 36dla85e-a09b-4537-86eO-eafleb03aed8

TCGA- A7- A26H-01 A- 11 D- Al 67-09 BRCA fbeade79-28ef-4e85-8282-67e691630ca3

TCGA- A7- A26I-01 A- 11 D- A 167-09 BRCA 81fff2dl-d6ed-4963-a5f6-5899cde6b359

TCGA- A7- A26 J-01 A- 11 D- A 167-09 BRCA be2ca34f-5cl5-4b38-a207-52df296a98ee

TCGA-A8-A06N-01 A-l 1W-A019-09 BRCA 03d266a3-eb3e-4893-af6b-cb70dl97d98f

TCGA-A8-A06O-01 A-l 1W-A019-09 BRCA 29cd408e-a04b-418a-85e2-6ef95840ddbc

TCGA-A8-A06P-01 A-l 1W-A019-09 BRCA 239b3d55-c5d6-4478-9b7b-lcbad3c03c81 TCGA-A8-A06Q-01 A-l 1W-A050-09 BRCA 473d5422-978a-48be-be32-2b7516d6d2d5

TCGA- A8- A06R-01 A- 11 D- AO 15-09 BRCA c6b00eff-6c4e-4d79-a9b 1 -8fb 1 f 3090816

TCGA- A8- A06T-01 A- 11 W- AO 19-09 BRCA I lec4a6f-f2dc-4b0b-9ba5-6fea8222e2d7

TCGA-A8-A06U-01 A-l 1W-A019-09 BRCA 277c2e8a-dd28-4b8f-96d3-ea790al986b6

TCGA- A8- A06X-01 A-21 W- AO 19-09 BRCA dc306402-3a55-4996-b786-f3f738fl3dd3

TCGA- A8- A06 Y-01 A-21 W- AO 19-09 BRCA 3bede568-d8b6-44c0-99e0-a9b6c7d4ce80

TCGA-A8-A06Z-01 A-l 1W-A019-09 BRCA f540c4f8-75b3-47d7-a7cf-53cbf7a2c814

TCGA- A8- A075-01 A- 11 D- A099-09 BRCA 085ddl25-lf95-46aa-a480-2965090e8591

TCGA- A8- A076-01 A-21 W- AO 19-09 BRCA dfa06058-320b-4cc6-acl8-a42e59019blc

TCGA- A8- A079-01 A-21 W- AO 19-09 BRCA 06221 ce8-ab65-4694-945b-059b9cl 5ede4

TCGA- A8-A07B-01 A-l 1W-A019-09 BRCA 734421b9-ed55-45b0-9ad5-51bc754ebe90

TCGA- A8- A07C-01 A- 11 D- A045-09 BRCA 6ab33f67-b69d-4a2d-a424-841f5fbflee7

TCGA-A8-A07E-01 A-l 1W-A050-09 BRCA fa018a20-2c26-4d47-831f-75280b6464df

TCGA-A8-A07F-01 A-l 1W-A019-09 BRCA 73d907e6-4ba0-431f-a009-8366644ffaf0

TCGA-A8-A07G-01 A-l 1W-A050-09 BRCA 49f77aa5-446b-49f6-bdlb-02d3ff7b9dfc

TCGA- A8- A07I-01 A- 11 W- AO 19-09 BRCA 7718c3fO- lc90-4940-bc30-ea4f41785 lbb

TCGA- A8- A07 J-01 A- 11 W- AO 19-09 BRCA C8eac36c-c3a7-4c88-b928-832ab279045b

TCGA- A8- A07L-01 A- 11 W- AO 19-09 BRCA 4cc86f29-061 e-4058-8e8f-4c48191 f52aa

TCGA-A8-A07O-01 A-l 1W-A019-09 BRCA 4574b64d-8848-46e4-913e-5d318c 1 f 6162

TCGA-A8-A07P-01 A-l 1W-A019-09 BRCA 2b88ff64-bf43-43e8-9ea9-0de571520d72

TCGA- A8- A07R-01 A-21 W- A050-09 BRCA f377217c-399f-4b3f-9090-fa5189b2bfc6

TCGA-A8-A07U-01 A-l 1W-A050-09 BRCA e6409415-8453-489d-a731 -49257cade2a3

TCGA-A8-A07W-01 A-l 1W-A019-09 BRCA 9bc8dbab-c700-498c-8ff7-ccc62c911349

TCGA-A8-A07Z-01 A-l 1W-A019-09 BRCA e4af33f9-f5fe-4e52-8ca0-991bbce2270d

TCGA- A8- A081 -01 A- 11 W- AO 19-09 BRCA d29c3a5b-aab5-4dlb-bdaf-eb6fa405bc80

TCGA- A8- A082-01 A- 11 W- AO 19-09 BRCA 575d25ea-eae7-423a-9464-d3b2806bf9eb

TCGA- A8- A083-01 A-21 W- AO 19-09 BRCA 1904e458-la6c-4e91-88cc-10eel54ded5b

TCGA- A8- A084-01 A-21 W- AO 19-09 BRCA 6f6f7048-5b7a-4827-af2b-cfecc4a60025

TCGA- A8- A085-01 A- 11 W- AO 19-09 BRCA Cbdea951-3dc9-42c2-bfdd-3796c30e928e

TCGA- A8- A086-01 A- 11 W- AO 19-09 BRCA 13d89926-9e4c-434f-80b4-4fb 15e4426f 6

TCGA- A8- A08 A-01 A- 11 W- AO 19-09 BRCA 0257d030-6d78-452c-9dcc-79fe50533543

TCGA- A8-A08B-01 A-l 1W-A019-09 BRCA 267a951b-29b7-4849-9ea7-d2205838fcc7

TCGA-A8-A08F-01 A-l 1W-A019-09 BRCA 4975eeda-984e-4a7 a-8193-43d8b6e0271 c

TCGA- A8- A08G-01 A- 11 W- AO 19-09 BRCA 8da61928-e935-4a33-8e46-840e637163d7

TCGA- A8- A08H-01 A-21 W- AO 19-09 BRCA 2616 Ic06-f816-489a-8800-e0a68a4ce78a

TCGA- A8- A08I-01 A- 11 W- AO 19-09 BRCA 4525400d-0a2c-4cc7-9c71-9ad6d9faf93f

TCGA- A8-A08 J-01 A- 11 W- AO 19-09 BRCA ae458901-e900-4aaa-bde6-3eda8912fbd5

TCGA- A8- A08L-01 A- 11 W- AO 19-09 BRCA 8b819a59-fOc 1 -456a-9e81 -64b5bed025c 1

TCGA- A8- A08O-01 A-21 W- A071 -09 BRCA bcl398b9-d4ec-43e8-86bc-7025afaf93d5

TCGA-A8-A08P-01 A-l 1W-A019-09 BRCA 2fbe3da3-ce62-4edf-933b-367f983e221a TCGA-A8-A08R-01 A-l 1W-A050-09 BRCA 05362091 -8e04-46e2-81 e7- 1 efddcOd8c63

TCGA-A8-A08S-01 A-l 1W-A050-09 BRCA 9c981525-80af-4f79-b94a-be00131 ab872

TCGA- A8- A08T-01 A-21 W- AO 19-09 BRCA af5f43d9-5ff3-4fd8-9clc-30a88d2bab8e

TCGA- A8- A08X-01 A-21 W- AO 19-09 BRCA 67c7d350-5c82-49b0-a7eb-6ca829ffcbc9

TCGA- A8- A08Z-01 A-21 W- AO 19-09 BRCA 96afb6d0-29ea-4bd5-8a9d-130e42954707

TCGA- A8- A090-01 A- 11 W- AO 19-09 BRCA 783e4cl3-8fa5-4591-9453-le59cal67elO

TCGA- A8- A091 -01 A- 11 W- AO 19-09 BRCA 6618f367-c782-43aO-b5c8-a53d9bda6722

TCGA- A8- A092-01 A- 11 W- AO 19-09 BRCA 732ddOab-c869-4d35-973f-9db064680fbl

TCGA- A8- A093-01 A- 11 W- AO 19-09 BRCA 8f64ba22-0958-4fdb-8161-f83cfe57c95d

TCGA- A8- A094-01 A- 11 W- AO 19-09 BRCA ab9bf7a6-688e-4388-9682-6bl616723fde

TCGA- A8- A095-01 A- 11 W- AO 19-09 BRCA dl6f025a-4187-4632-b833-02a3ffa54210

TCGA- A8- A096-01 A- 11 W- AO 19-09 BRCA 8a411a0a-ec66-4d9f-b0e4-flclf969d605

TCGA-A8-A097-01 A-l 1W-A050-09 BRCA 15ca7c47- 131 a-4dd7-b0a7-584577b4b02c

TCGA- A8- A099-01 A- 11 W- AO 19-09 BRCA 1066cb38-e051-42fa-a8bc-20b659cl7al3

TCGA- A8- A09 A-01 A- 11 W- AO 19-09 BRCA ecfedc29-5c31 -4d3d-b599-fcOa 1 cObeaf a

TCGA- A8-A09B-01 A-l 1W-A019-09 BRCA a8be37d2-2743-4fde-9aae-2623b5a03b60

TCGA-A8-A09C-01 A-l 1W-A019-09 BRCA b56cf2cb-bb2a-46b6-b3b4-84dd8b364984

TCGA-A8-A09D-01 A-l 1W-A019-09 BRCA d0ef396f-4e9f-40ba-a09c-0a96832cabf9

TCGA-A8-A09E-01 A-l 1W-A019-09 BRCA d6465963-5ea6-44a5-96b0-dff0b0fae4c4

TCGA- A8- A09G-01 A-21 W- AO 19-09 BRCA 3bd68e94-d902-4079-8fdb-16edcc90delc

TCGA- A8- A09I-01 A-22W- A050-09 BRCA 96d5070d- 1 f a9-4f a5-b2c9-472240dfd3b9

TCGA-A8-A09K-01 A-l 1W-A019-09 BRCA d8cd75f2-5ee5-4296-a781-a6al6ee94506

TCGA- A8- A09M-01 A- 11 W- AO 19-09 BRCA 8e92515a-8049-4ebb-9117-a 137c06e5d04

TCGA-A8-A09N-01 A-l 1W-A019-09 BRCA 304a2945-fl34-45c7-9eaa-c6c9c2435552

TCGA-A8-A09Q-01 A-l 1W-A019-09 BRCA 51a8ac83-bafa-4df7-a52d-alelfb45799d

TCGA-A8-A09R-01 A-l 1W-A019-09 BRCA 35ebf91d-6fec-4d28-9b21-493d0el4f8db

TCGA- A8- A09T-01 A- 11 W- AO 19-09 BRCA e565da2b-4a3f-4bel-9cf7-2845145dldbc

TCGA- A8-A09V-01 A-l 1D-A045-09 BRCA 818f 1 a34- 17c5-409a-b5f5-4a8576db0d44

TCGA-A8-A09W-01 A-l 1W-A019-09 BRCA 9a2690ce-485f-4d4f-9673-d86f91be27a4

TCGA- A8-A09X-01 A-l 1W-A019-09 BRCA 48e532ea-2af5-427a-a784-781e208cced6

TCGA-A8-A0A 1-01 A-l 1W-A019-09 BRCA 73aa20fe-b74b-41ae-88d3-2d5a66908c25

TCGA-A8-A0A2-01 A-l 1W-A050-09 BRCA b681dba3-a608-47c2-9ae8-5d761dle800e

TCGA-A8-A0A4-01 A-l 1W-A019-09 BRCA Ifc4d542-86ac-42bc-9fbb-272c23e6aa72

TCGA-A8-A0A7-01 A-l 1W-A019-09 BRCA 28be7bl4-730d-44f7-bf93-a7590b4a08f8

TCGA-A8-A0A9-01 A-l 1W-A019-09 BRCA 228e66eb-ldc6-4c01-8252-c557a8f53916

TCGA- A8-A0AB-01 A-l 1W-A050-09 BRCA ad2a2f5d-dad6-4c03-b235-20810d6d34dc

TCGA- A8- AO AD-01 A- 11 W- A071 -09 BRCA 6e6511fa-4f6e-4184-84b8-9e9e7a863632

TCGA- AC- A23C-01 A- 12D- Al 67-09 BRCA 91766158-el75-4270-bc01-8e853fc9f391

TCGA- AC- A23E-01 A- 11D-A159-09 BRCA 137cb73f-394a-459a-83e6-0b3c85c955cd

TCGA- AN- A03X-01 A-21 W- AO 19-09 BRCA fl77234e-e0a7-4f85-b73d-48e0080c805d

TCGA- AN- A03 Y-01 A-21 W- AO 19-09 BRCA f4849adc-b6e8-40bd-9de4-dc5bb37d2a79 TCGA-AN-A041-01 A-l 1W-A050-09 BRCA fl8c7389-6c8d-485f-a7f7-a450a42e3719

TCGA- AN- A049-01 A-21 W- AO 19-09 BRCA ld0c87ef-6840-4051-85d5-7fc2c544578c

TCGA- AN- A04 A-01 A-21 W- A050-09 BRCA 7e8f250c-6162-4049-8559-5bfdf054b021

TCGA- AN- A04C-01 A-21 W- A050-09 BRCA c 1302f79-cc50-487 a-9db5-016df 85e67d7

TCGA- AN- A04D-01 A-21 W- A050-09 BRCA 9407735f-19e3-49d0-b783-cd9672dfa6a9

TCGA-AN-AOAJ-01 A-l 1W-A019-09 BRCA 97fbce82-0eed-4d70-9af2-57918a4ea8da

TCGA- AN- AO AL-01 A- 11W-A019-09 BRCA 47849ee3-b59e-4ccf-a261-65f7e252b885

TCGA-AN-AOAM-01 A-l 1W-A050-09 BRCA a238f21 f-ca46-4759-b5b7-f 8c381 Odfbdb

TCGA- AN- AO AR-01 A- 11W-A019-09 BRCA a2d77acd-89db-4d2d-89d7-dlcc58cf576b

TCGA-AN-AOAS-01 A-l 1W-A019-09 BRCA 2257c942-1274-47e7-86ad-b92ecfafc205

TCGA- AN- AO AT-01 A- 11 D- A045-09 BRCA f848b66f-bd9e-4fba-afd4-eb58848dlef4

TCGA- AN- AOFD-01 A- 11W-A050-09 BRCA abae6f4c-2378-4fbd-adea-f739e6629b22

TCGA- AN- AOFF-01 A- 11W-A050-09 BRCA cd45e46c-50bf-449e-bb40-29ccffbbd49c

TCGA-AN-AOFJ-01 A-l 1W-A019-09 BRCA 6b988737-0504-42bb-8c75-d70d7a312e68

TCGA- AN- AOFK-01 A- 11W-A050-09 BRCA a765959e-b234-427d-aade-855d6d4981d9

TCGA- AN- AOFL-01 A- 11W-A050-09 BRCA 18ee29ae-fe36-49a3-9843-e0757c69a7dd

TCGA- AN- AOFN-01 A- 11W-A050-09 BRCA 8f583981-b257-43ee-9c9e-71al92a49d38

TCGA-AN-AOFS-01 A-l 1W-A050-09 BRCA 9bb76d20-cefb-4f7a-80c2-aa2178e302a9

TCGA- AN- AOFT-01 A- 11W-A050-09 BRCA 0598fc5f-9651-4ace-bf4e-56759d544e52

TCGA-AN-AOFV-01 A-l 1W-A019-09 BRCA c70259cl-f561-43d7-9829-6852815baa87

TCGA-AN-AOFW-01 A-l 1W-A050-09 BRCA 5afde43 a- 194c-4876-b244-2132aef2f505

TCGA-AN-AOFX-01 A-l 1W-A050-09 BRCA 2523cf22- 1 al 6-42be-8560-833ed203 le3c

TCGA- AN- AOF Y-01 A- 11W-A050-09 BRCA a6a8bd08-0e60-442d-adce-de020177f82c

TCGA-AN-AOFZ-01 A-l 1W-A050-09 BRCA d77f59f7-8cff-41f3-albb-0del4524d4f4

TCGA-AN-AOGO-01 A-l 1W-A050-09 BRCA 9eb55dd2-a956-4dfe-8631-04722c49819f

TCGA- AN- AOXL-01 A- 11 D- A 1 OM-09 BRCA lb08al81-a73b-4506-aaa3-3521f2c57207

TCGA- AN- AOXN-01 A-21 D- A 1 OG-09 BRCA 94a6cl72-25e2-4438-945c-9b310f89ae22

TCGA- AN- AOXO-01 A- 11 D- A 1 OG-09 BRCA f63863f5-cb60-4961-a5b4-ed5ealfb3dc8

TCGA- AN- AOXP-01 A- 11 D- A 117-09 BRCA 6179b498-2cea-4f7 a-82a8-b7ec71431 ea8

TCGA- AN- AOXR-01 A- 11 D- A 1 OG-09 BRCA e7dc7492-3a84-49c7-8dea-8f508b53dc40

TCGA- AN- AOXS-01 A-22D- A 1 OG-09 BRCA flb5268d-556f-404f-a956-770df4ale7aa

TCGA- AN- AOXT-01 A- 11 D- A 1 OG-09 BRCA 353d9161-95fd-4bec-abb7-859d9eel9785

TCGA- AN- AOXU-01 A- 11 D- A 1 OG-09 BRCA 537c5818-eb89-4b46-8915-2bb2b9e4545f

TCGA- AN- AOX V-01 A- 11 D- A 1 OG-09 BRCA 6f0e5a39-e2c7-4a93-bd63-flbable7cl6e

TCGA-AN-AOXW-01 A-l 1D-A10G-09 BRCA 200dba9e-201b-4634-a2cf-666elf6710dc

TCGA- AO- A03L-01 A-41 W- A071 -09 BRCA 743a29c4-elcc-457a-8406-765flalbcl l4

TCGA- AO- A03N-01 B- 11 D- A 1 OM-09 BRCA ef5987fl-46ac-430a-b94a-49afa0e286d4

TCGA-AO-A03O-01 A-l 1W-A019-09 BRCA 1578b356-7f42-4722-bc54-cd5f37954f6a

TCGA-AO-A03P-01 A-l 1W-A019-09 BRCA 185c5el5-c068-4a72-8d5e-468624bf958a

TCGA- AO- A03R-01 A-21 W- A050-09 BRCA 6d2dc4e3-fled-4ef0-ae83-e09c87756d56

TCGA- AO- A03T-01 A-21 W- A050-09 BRCA Cbea866d-da66-4f7c-994b-clec35aa2d4b TCGA- AO- A03U-01 B-21 D- A 10M-09 BRCA le0ecd57-5c7d-4495-874d-9e286c999c22

TCGA- AO- A03 V-01 A- 11 D- A 10Y-09 BRCA d88c365f-366a-49d5-9860-b930aab3eblb

TCGA-AO-A0J2-01 A-l 1W-A050-09 BRCA 84b66e02-lb37-4424-b752-363f7861fe74

TCGA-AO-A0J3-01 A-l 1W-A050-09 BRCA ff706355-867e-4968-99ad-0af4e24ece51

TCGA-AO-A0J4-01 A-l 1W-A050-09 BRCA 7667f49c-449d-44ce-bab8-02a491bb6775

TCGA-AO-A0J5-01 A-l 1W-A050-09 BRCA 93ae73f6-c355-47be-a355-faa78c0632d4

TCGA-AO-A0J6-01 A-l 1W-A050-09 BRCA 7d21a0c4-03c7-4641-8b4d-7a5877960360

TCGA-AO-A0J7-01 A-l 1W-A050-09 BRCA a53056d9-e8bd-4cbl-ad67-85879ccc925d

TCGA- AO- A0J8-01 A-21 D- A045-09 BRCA 24ba5501 -8097-4af 6-b 12c-bb6dcbe 1 Ocac

TCGA-AO-A0J9-01 A-l 1W-A050-09 BRCA 9932232f-a7b0-4962-9bl4-adb8316a4661

TCGA-AO-AOJA-01 A-l 1W-A071-09 BRCA 0215d4f 1 -6697-4e8f-afc4-f f7c6439e56d

TCGA-AO-AOJB-01 A-l 1W-A071-09 BRCA 8f4f06be-2a 16-4ae2-9dd4-5d87f480810b

TCGA-AO-AOJC-01 A-l 1W-A071-09 BRCA 120f55df-5d 1 d-4073-a21 a-632c892d3da9

TCGA-AO-AOJD-01 A-l 1W-A071-09 BRCA 9d3ad8d0-ddd3-44d2-ba0e-0b283a4fbf32

TCGA-AO-AOJE-01 A-l 1W-A071-09 BRCA 4f 311714-ebb4-47fb-b471 -62c6951 d9066

TCGA-AO-AOJF-01 A-l 1W-A071-09 BRCA 191caala-5ab8-4db5-b42a-flc5964b0b0d

TCGA- AO- AOJG-01 A-31 D- A099-09 BRCA cf7ec093-5040-43db-949c-f426795a7488

TCGA- AO- AOJI-01 A-21 W- A 100-09 BRCA 861297ec-2c88-4717-ae63-eb8e21fe8c52

TCGA-AO-AOJJ-01 A-l 1W-A071-09 BRCA 812191 d 1 -6711 -4efd-8932-c76159b60ffb

TCGA-AO-AOJL-01 A-l 1W-A071-09 BRCA 56a22648-be92-402c-a225-bcaa44a7e612

TCGA- AO- AOJM-01 A-21 W- A071 -09 BRCA f070142b-f44e-4264-8919-dde7d02ad835

TCGA-AO-A 124-01 A-l 1D-A10M-09 BRCA 987528ac-437a-4eb8-a335-4f2076d5c006

TCGA-AO-A 125-01 A-l 1D-A10M-09 BRCA 17669c6d-2eeb-4d56-ac72-f06bfafb7e42

TCGA-AO-A 126-01 A-l 1D-A10M-09 BRCA 85b39644-6fl9-40dc-94cl-0afc93ee4981

TCGA-AO-A 129-01 A-21 D-A10M-09 BRCA cdf43c25-3ba7-4073-a92d-4a97f651f4a8

TCGA-AO-A 12 A-01 A-21 D- Al 0 Y-09 BRCA 77e7b41 a-d4c8-42ee-ae6e-da 15ea3634d9

TCGA- AO-A12B-01 A-l 1D-A10M-09 BRCA 865ebd77-7b7d-4a27-b945-df5ec8dlf86a

TCGA-AO-A 12D-01 A-l 1D-A10Y-09 BRCA b3065cfe-3067-4f08-8c82-46fl0clec279

TCGA-AO-A 12E-01 A-l 1D-A10M-09 BRCA b3990b59-e2f4-4759-8eb0-l lad3c34ac50

TCGA-AO-A 12F-01 A-l 1D-A10Y-09 BRCA dl617673-57c2-40cl-a970-f3692eel3cf3

TCGA-AO-A 12G-01 A-l 1D-A10M-09 BRCA 5b9d3741-2aa3-489b-93e6-3b5376b80d48

TCGA-AO-A 12H-01 A-l 1D-A10Y-09 BRCA 5a535c49-d42e-43c6-9d32-dc76f28d4f0f

TCGA-AO-A 1 KO-01 A-31 D- A 188-09 BRCA 2cdecb2b-40b 1 -4419-bcd9- 101 cee78966c

TCGA-AO-A 1 KP-01 A- 11 D- A 13L-09 BRCA bc36db60-3f6b-42c4-b03e-b7c74c3dda5c

TCGA-AO-A 1 KR-01 A- 12D- A 142-09 BRCA d3b598d8-8a3b-4506-aa98-9fbc5b51 afd4

TCGA-AO-A 1 KS-01 A- 11 D- Al 3L-09 BRCA 21074661-4b0f-4adc-b406-5801688a3ae9

TCGA-AO-A 1 KT-01 A- 11 D- A 13L-09 BRCA 97b33dc3-6a62-419a-aa6c-cb84c9f92102

TCGA- AQ- A04H-01 B- 11 D- A 10M-09 BRCA 73cl3e04-1400-4ebb-aa80-f54becbe036c

TCGA- AQ- A04J-01 A-02W- A050-09 BRCA cce21f2b-784b-4fa0-9809-ae532c528f8e

TCGA- AQ- A04L-01 B-21 D- Al 0M-09 BRCA e8d7feb0-981b-4ba0-b4d4-fa985064444b

TCGA- AQ- AO Y5-01 A- 11D-A14K-09 BRCA 4aa80fbd-a337-49b6-9371-223cbcfbc85d TCGA-AQ-A 1 H2-01 A- 11 D-A13L-09 BRCA 1 ab2dc63-51 ce-4a96-b7ad-f0d9eb 198d 10

TCGA-AQ-A 1 H3-01 A-31 D-A13L-09 BRCA 1 f a2017e-ce08-4al 6-bdf 6-f9bf 1296c834

TCGA- AR- AOTP-01 A- 11 D- A099-09 BRCA bee5b9c8-739e-4530-bl40-cd2b898d7afd

TCGA- AR- AOTQ-01 A- 11 D- A099-09 BRCA b266fffc-263d-4b0f-a781-7437e41061b2

TCGA- AR- AOTR-01 A- 11 D- A099-09 BRCA 58cal lbf-17b0-4cff-b210-5b85d8e66ef5

TCGA-AR-AOTS-01 A-l 1D-A10Y-09 BRCA c9253ecc-cf ac-4cc5-8dab- 1 e502d34d 103

TCGA- AR- AOTT-01 A-31 D- A099-09 BRCA 29cfdcl l-2f20-436e-8913-340909684c06

TCGA- AR- AOTU-01 A-31 D-A10G-09 BRCA 31922dbe-3b4a-4acl-98fc-db88ae851462

TCGA- AR- AOT V-01 A-21 D- A099-09 BRCA 0ec80200-12fe-479c-8ea0-982a9995f55a

TCGA- AR- AOTW-01 A- 11 D- A099-09 BRCA b40d49ed-bc30-4656-9f36-ffc280de2fb8

TCGA- AR- AOTX-01 A- 11 D- A099-09 BRCA 63d635fa-dl36-4e8a-a534-966ee678bb66

TCGA- AR- AOT Y-01 A- 12W-A 12T-09 BRCA f915733b-aaf4-406d-af52-00del l3e8e0c

TCGA- AR- AOTZ-01 A- 12D- A099-09 BRCA 90a26d5e-356b-424c-80bc-4723d24c594f

TCGA-AR-AOUO-01 A-l 1D-A10G-09 BRCA 79e2c073-7727-4c34-ac28-5d7895144743

TCGA-AR-AOU 1-01 A-l 1D-A10Y-09 BRCA 265ceec6-e9a8-499e-adf6-0cl8c598532e

TCGA- AR- A0U2-01 A- 11D-A10G-09 BRCA f0194733-2347-43c4-a4a3-131642c27798

TCGA- AR-A0U3-01 A-l 1D-A10G-09 BRCA c8251555-77d3-4a20-9cc0-f7df0f da5955

TCGA- AR- A0U4-01 A- 11D-A117-09 BRCA ed064e31 -8f ae-4f9c-8455-d7517f94e 16b

TCGA-AR-A1 AH-01 A-l 1D-A12B-09 BRCA ff4a0f5a-9f30-4a2b-9915-62f2df5adl55

TCGA- AR- A 1 AI-01 A- 11 D-A12Q-09 BRCA 842846ea-881c-4d79-88d2-fcl703c58350

TCGA- AR- A 1 AJ-01 A-21 D-A12Q-09 BRCA 4e 1 f9084-4729-4b3f-b036-6226d64fd25b

TCGA- AR- A 1 AK-01 A-21 D- A 12Q-09 BRCA 52f7c22f-84cb-4263-93bf-lae8cf8abbd2

TCGA- AR- A 1 AL-01 A-21 D-A12Q-09 BRCA 8495c66e-dc95-4eae-909b-b51b8bc84889

TCGA- AR- A 1 AN-01 A- 11 D- A 12Q-09 BRCA 9c879ced-92e8-4292-9b24-46005acab0f4

TCGA- AR- A 1 AO-01 A- 11 D- A 12Q-09 BRCA b841db95-2eff-4181-8d44-3cde2f2f9e70

TCGA- AR- A 1 AP-01 A- 11 D- A 12Q-09 BRCA 597e37c9-f0c9-4839-800e-6e9519ec3add

TCGA- AR- A 1 AQ-01 A- 11 D- A 12Q-09 BRCA 88ff7728-ecc9-4ec5-817e-4793619ab5a4

TCGA- AR- A 1 AR-01 A-31 D- A 135-09 BRCA 008ba655-a0a3-42c4-8c72-fl341365ef02

TCGA- AR- A 1 AS-01 A- 11D-A12Q-09 BRCA 3f26f93c-el la-4ec9-b73b-98fcadc209f4

TCGA-AR-A1 AT-01 A-l 1D-A12Q-09 BRCA 7e00d4f a-b951 -44d8-8fbf-fc7b9f 19772e

TCGA- AR- A 1 AU-01 A- 11 D- A 12Q-09 BRCA d7cfeb04-ce20-4aab-8e5b-8al483bcaaa5

TCGA- AR- A 1 A V-01 A-21 D- A 12Q-09 BRCA 0a0dd89c-5ec8-4015-9616-733e41361 a64

TCGA- AR- A 1 AW-01 A-21 D- A 12Q-09 BRCA 33c6b6b5-1484-4002-8f84-ba67525a8777

TCGA- AR- A 1 AX-01 A- 11 D- A 12Q-09 BRCA 71a3cf72-3539-4ade-97dl-6albdlee4205

TCGA- AR- A 1 A Y-01 A-21 D- A 12Q-09 BRCA 15f90ef0-831b-40a3-98bd-ec226a9e8b26

TCGA- AR- A24H-01 A- 11 D- Al 67-09 BRCA 6bb61dce-289d-4e39-8298-df5abe8049a2

TCGA- AR- A24K-01 A- 11D-A167-09 BRCA df692383-ld6d-4caa-b44c-7al33ec4b7ee

TCGA-AR-A24L-01 A-l 1D-A167-09 BRCA 2a93298a-d272-487c-ae4a-ec385844536e

TCGA- AR- A24M-01 A- 11 D- A 167-09 BRCA 722a8960-3 a69-4f 66-b972-74e6de94al e8

TCGA- AR- A24N-01 A- 11D-A167-09 BRCA b85b311c-lb29-44e3-8585-6995f9259221

TCGA- AR- A24O-01 A- 11 D- Al 67-09 BRCA 2c9fc77f-95 lb-4764-911 a-fOcf f 3174fb 1 TCGA- AR- A24P-01 A- 11 D- Al 67-09 BRCA dbdcf82a-3d37-4cfb-a70b-9b69ada0e732

TCGA- AR- A24Q-01 A- 12D- Al 67-09 BRCA a9d691f2-ad2a-4a3b-ae30-ed4af96d75f2

TCGA- AR- A24R-01 A- 11D-A167-09 BRCA baf43433-0001-4495-a37f-9132eb213157

TCGA- AR- A24S-01 A- 11 D- Al 67-09 BRCA aad32a56-5b98-433e-bb6e-48e09a027db6

TCGA- AR- A24T-01 A- 11 D- Al 67-09 BRCA 09991de6-2e8e-476f-987b-98d9a85dac7d

TCGA- AR- A24U-01 A- 11 D- Al 67-09 BRCA 567cdc6c-df03-4642-8cbc-a269769celal

TCGA- AR- A24 V-01 A-21 D- A 167-09 BRCA bb77af66-bb8f-4590-9be8-5f729373c555

TCGA- AR- A24W-01 A- 11 D- A 17G-09 BRCA 454e7cd4-8424-4cad-8fbb-f69affa5dlbf

TCGA- AR- A24X-01 A- 11 D- A 167-09 BRCA 53d55f5a-df86-44d7-a3a2-2dccc2557b7b

TCGA- AR- A24Z-01 A- 11D-A167-09 BRCA c 11 f2060-d3fb-4e3 d-8058-b8cce44af519

TCGA- AR- A250-01 A-31 D- Al 67-09 BRCA f7d9a372-fcdl-4462-9e0b-7eb46ddb68fd

TCGA- AR- A251 -01 A- 12D- Al 67-09 BRCA 68b4de6d-352d-44e8-911 a-f4541f28fc78

TCGA- AR- A252-01 A- 11 D- Al 67-09 BRCA e800d9b3-32al-48eb-840b-9a3bec9dlf6e

TCGA- AR- A254-01 A-21 D- Al 67-09 BRCA fe2bdac0-832e-4268-bd8f-5dcfffdal979

TCGA- AR- A255-01 A- 11 D- Al 67-09 BRCA 505f 1398-0bd8-4f 1 c-al42-651605158bf3

TCGA- AR- A256-01 A- 11 D- Al 67-09 BRCA _ea43434b-197e-48ac-ae2e-46bc7f3776de

TCGA-B6-A0I2-01 A-l 1W-A050-09 BRCA a9cae7c8-a62b-46ad-a98b-82e6b5fddf00

TCGA-B 6- A0I5-01 A- 11 W- A 100-09 BRCA f 1139266-fade-4d27-ac67-60870e666295

TCGA-B 6- A0I6-01 A- 11 D- A 128-09 BRCA a876398c-5bld-444f-a360-5fe2db697480

TCGA-B 6- A0I8-01 A-l 1W-A050-09 BRCA ba80bl3a-e20a-441b-b845-b617cc861ce7

TCGA-B 6- A0I9-01 A-l 1W-A050-09 BRCA d2291482-9bbb-4f8f-a65b-c0737cf3acea

TCGA-B 6- AOIA-01 A-l 1W-A050-09 BRCA f7e5ada6-8f53-4765-a874-5ee9d258ad6a

TCGA-B6-A0IB-01 A-l 1W-A050-09 BRCA ff80d5cd-7aed-499f-a472-153cc40f65de

TCGA-B 6- AOIC-01 A-l 1W-A050-09 BRCA f23fd730-0al8-4e3b-a2ed-fla4231c2b53

TCGA-B 6- AOIE-01 A-l 1W-A050-09 BRCA 4cb39f50-5031-4b08-baa3-la366ada6514

TCGA-B 6- AOIG-01 A-l 1W-A050-09 BRCA e8046519-d928-4fd3-b3e2-84585aa4f022

TCGA-B 6- AOIH-01 A- 11 D- A 10 Y-09 BRCA 4a4488b9-74d9-4ebl-a7ef-c894c32db942

TCGA-B 6-A0IJ-01 A-l 1W-A050-09 BRCA c63f9ddb-6301-400e-a0e8-197eea2efe75

TCGA-B 6- AOIK-01 A- 12W- A071 -09 BRCA C5blf426-562e-44e4-bcce-ce2ff6d969c8

TCGA-B 6-Α0ΓΜ-01 A-l 1W-A050-09 BRCA e99a4753-10db-4823-953d-e878a90e6b01

TCGA-B 6- Α0ΓΝ-01 A-l 1W-A050-09 BRCA ee2c9198-cea3-4a54-b96b-834a70c30d2f

TCGA-B 6- AOIO-01 A-l 1W-A050-09 BRCA 648cee86-f2e7-45a0-abf2-0ab0037e2eee

TCGA-B 6- AOIP-01 A- 11 D- A045-09 BRCA 94250flc-d514-4dd2-b488-a93fbfl 11784

TCGA-B 6- AOIQ-01 A-l 1W-A050-09 BRCA 583964cf-84ad-4efl-90dl-2f6bfbeb245a

TCGA-B 6- AORE-01 A- 11 W- A071 -09 BRCA db2bd5cf-f0a7-4874-89eb-15029447dael

TCGA-B 6- AORG-01 A- 11 W- A071 -09 BRCA 9431c642-610e-4325-97b8-8b4c5c81cacd

TCGA-B 6- AORH-01 A-21 D- Al 0 Y-09 BRCA 6e59b987-b4f0-4078-af2d-482c299103b6

TCGA-B 6- AORI-01 A- 11 W- A071 -09 BRCA 50d83050-b98c-4ala-a673-91dbc67c37c6

TCGA-B 6- AORL-01 A- 11 D- A099-09 BRCA 0d28966d-e03b-4b2a-ba07-b8fl95efc29b

TCGA-B 6- AORM-01 A- 11 D- A099-09 BRCA 3e03385e-f0fa-4el l-8bed-c6316802ela9

TCGA-B 6- AORN-01 A- 12D- A099-09 BRCA bbbcb493-2937-4a7b-8454-0abbbb379927 TCGA-B 6- AORO-01 A-22D- A099-09 BRCA 05el2ff8-023b-4acl-b35d-f97b42e3da7a

TCGA-B 6- AORP-01 A-21 D- A099-09 BRCA efbdb449-b885-44bb-9054-9e97d6603cad

TCGA-B 6-A0RQ-01 A- 11D-A10Y-09 BRCA f425edf3-0d08-49bf-94f6-f03343873a6c

TCGA-B 6- AORS-01 A- 11D-A099-09 BRCA 6b3ff733-402d-4390-8f57-57a9ad9b9969

TCGA-B 6- AORT-01 A-21 D- A099-09 BRCA ela297ed-1951-4d97-978c-56b452111ba5

TCGA-B 6- AORU-01 A- 11 D- A099-09 BRCA 251371ac-ef46-4el l-b45e-a2aaa986a2d2

TCGA-B 6- AORV-01 A- 11 D- A099-09 BRCA 39b0b605-29ae-4e2c-81dc-319446c807dd

TCGA-B 6- AOWS-01 A- 11D-A10Y-09 BRCA 271dl985-lbl5-4828-8261-4415ab048de9

TCGA-B 6-A0WT-01 A- 11D-A10G-09 BRCA 5fb780fb-12bc-4195-8f0c-2c6e3cc36b49

TCGA-B 6- AOWV-01 A- 11 D- A 1 OG-09 BRCA b92107c5-c46f-4606-b4e9-2dab55ca4e9c

TCGA-B 6- AOWW-01 A- 11 D- A 1 OG-09 BRCA e9d6f59d-7d87-4fda-ab6f-e9c2501b8600

TCGA-B 6- AOWX-01 A- 11 D- A 1 OG-09 BRCA 47b5d831 -5287-4f 62-b 17a-6e5eff2e4184

TCGA-B 6- AOWY-01 A- 11 D- A 1 OG-09 BRCA c973 a902-abdf-41 a3-8250-5701 ldfef 1 f4

TCGA-B 6-A0WZ-01 A- 11D-A10G-09 BRCA f6b8b 1 a9-370c-4023-b8bd-934e2a3d913a

TCGA-B 6- AOXO-01 A-21 D- Al 0 Y-09 BRCA 264fb6ef-65be-48fd-8216-6c493b620ad8

TCGA-B 6-AOX 1-01 A- 11D-A10G-09 BRCA a492abf9-0cd3-402c-89e2-c49d650ef540

TCGA-B 6-A0X4-01 A- 11D-A10G-09 BRCA edbe95af-e727-4d0f-a2a4-a3c9f2afa901

TCGA-B 6- A0X5-01 A-21 D- Al OG-09 BRCA da42fl0b-d515-4678-a038-ed9c92a8b56b

TCGA-B 6-A0X7-01 A- 11D-A10M-09 BRCA be5f93af-844a-4adb-ad89-05bfeefa58cd

TCGA-B 6- A 1 KC-01 B- 11 D- A 159-09 BRCA fc3e822f- 150d-47a7-a346- 10919b42aa8c

TCGA-B 6- A 1 KF-01 A- 11 D- Al 3L-09 BRCA fbfbcb76-0524-4772-b918-le8599a09d7f

TCGA-B 6- A 1 KI-01 A- 11 D- A 14K-09 BRCA d9374702-8fc6-48c0-bec5-5cl l05e641dc

TCGA-B 6- A 1 KN-01 A- 11 D- Al 3L-09 BRCA clad09c8-4237-48f0-b04c-7ee8ccaf8cfl

TCGA-B H-AOAU-01 A-l 1D-A12Q-09 BRCA d06209b8-8aba-44d8-b94a-990861c2324a

TCGA-BH-A0AV-01A-31D-A10Y-09 BRCA 9032b7fe-e38a-4641-a45e-67041668adc4

TCGA-B H-AOAW-01 A- 11 W- A071 -09 BRCA 82057159-dd32-49fd-9ee7-82b4668f39c3

TCGA-B H-AOAZ-01 A-21 D- Al 2Q-09 BRCA e6d90bb8-ad96-4cb8-a96f-a8202fcbc58f

TCGA-BH-A0B0-01A-21D-A10Y-09 BRCA 4680fd93-33c8-4aee-942b-5c616acd02cf

TCGA-B H-AOB 1 -01 A- 12W- A071 -09 BRCA de20290a- 1560-41 f d-896b-a3 ae 1103423e

TCGA-B H-A0B4-01 A-l 1W-A019-09 BRCA 83bee702-eb97-4216-a47e-d4e4eece279a

TCGA-B H-A0B5-01 A-l 1D-A12Q-09 BRCA dfa0f8ea-ae94-4673-9751-f6cdad26022a

TCGA-BH-A0B9-01A-11W-A071-09 BRCA c57595bb-7953-4611-bOdl-3c2c40feb3b9

TCGA-B H-AOB D-01 A-l 1W-A050-09 BRCA eba2178f-6235-49cl-a49e-98de8ffdc6a0

TCGA-B H-AOBF-01 A-21 D- Al 2Q-09 BRCA 39221056-704b-4a23-9b8d-3178dd9e790d

TCGA-B H-AOBG-01 A-l 1D-A10Y-09 BRCA 923eel6a-2c42-46ee-b2cb-82075f2dd603

TCGA-B H-AOB P-01 A- 11 D- A 1 OY-09 BRCA 51405cf 1 -e844-4316-bel 7-85e8ad 1 de4a3

TCGA-BH-A0BR-01A-21W-A12T-09 BRCA df82226e-2242-418b-9f5f-0a5e531826a4

TCGA-B H-AOBS-01 A-l 1D-A12Q-09 BRCA 81 e4b7a4-8d94-4d31 -9c08-325ee04f5f 36

TCGA-B H-AOBT-01 A-l 1D-A12Q-09 BRCA 2299036e-7099-4b53-9143-5935442c3310

TCGA-B H-AOBZ-01 A-31 D- Al 2Q-09 BRCA If07765a-3f2b-4b6f-88ef-0d7aabl7a758

TCGA-BH-A0C1-01B-11D-A12B-09 BRCA adebc709-8059-43c3-adOe-al02fal536ff TCGA-BH- A0C3-01 A-21 D-A12Q-09 BRCA ec57ee0f-949e-4eee-91 c2-dd 129d657065

TCGA-BH- A0C7-01 B- 11 D- A 10Y-09 BRCA ba3b30c5-8179-49bd-aacd-53326bf356f8

TCGA-BH- AODD-01 A-31 D- A 12Q-09 BRCA 1 a59cd97-2ee8-4f82-b542-e2f3517 lbcOl

TCGA-BH- AODG-01 A-21 D- A 12Q-09 BRCA ec4d4cbc-d5dl-418d-a292-cad9576624fd

TCGA-BH- AODI-01 A-21 D-A12Q-09 BRCA 3777748c-5614-4826-8cde-eb7ecefb8101

TCGA-BH-A0DO-01B-11D-A12B-09 BRCA 14649437-79a6-40bd-87bl-a278bfb2dcda

TCGA-BH-A0DS-01A-11W-A071-09 BRCA 6cfb5de9-ef59-4bc0-9ec2-f9bd5a9f2aee

TCGA-BH-A0DT-01A-21D-A12B-09 BRCA 30dbe353-86d5-40ed-84c2-dbddf7bebl7b

TCGA-BH- AODV-01 A-21 D- A 12Q-09 BRCA 24ee6bld-3594-4dl2-91b3-8adlb3c98f28

TCGA-BH- AODX-01 A- 11 D- A 10 Y-09 BRCA bca403d9-48ff-4534-ba33-94b8fb9fee0f

TCG A-B H-A0E2-01A-11W-A071-09 BRCA 2703ce22-3ffa-4094-b3fl-lf573b5204a9

TCGA-BH- A0E6-01 A- 11W-A050-09 BRCA Ic55939a-ae58-4ed9-8a6e-01bae8acl2f7

TCGA-BH- A0E7-01 A- 11W-A050-09 BRCA Iddc3a98-e0b9-4b8e-b3d3-9d39eb7d8264

TCGA-BH- A0E9-01 B- 11 D- Al 0 Y-09 BRCA 48ccd30d-0c71-4117-8ccb-013986fl4e95

TCG A-B H-AOEA-OlA-11D-A10Y-09 BRCA 56 lb8777-801 a-49ed-a306-e7dafeb044b6

TCG A-B H-AOEB-OlA-11W-A050-09 BRCA 3861ca01-bcc3-42a9-835d-lef9fla053bd

TCGA-BH- AOEE-01 A-l 1W-A050-09 BRCA 68dl6e6a-20a5-428f-89d0-a8a0deda80cc

TCGA-BH- AOEI-01 A- 11 D- A 10 Y-09 BRCA ee8e93e0-d08c-400e-8ed7-ae56d7aefbec

TCGA-BH-A0GY-01A-11W-A071-09 BRCA db589949-1630-45b2-b09b-0312d3efd60b

TCGA-BH-AOGZ-01 A-l 1W-A071-09 BRCA 068bd892-6fee-46c2-945f-34a6c6804070

TCGA-BH-A0H0-01A-11W-A071-09 BRCA 69110467-4cf5-4b5d-a2dd-b lc9 le786959

TCGA-BH- A0H3-01 A-l 1D-A12Q-09 BRCA 12d7dc75-2e4f-42f6-a067-fe6d7118a0b6

TCGA-BH- A0H6-01 A-21 W- A071 -09 BRCA bbed00d2-9791-464d-alba-28fd56a0504e

TCG A-B H-AOHA-OlA-11D-A12Q-09 BRCA 95f2ee35-a485-4995-8205-01623d97da2d

TCGA-BH-A0HB-01A-11W-A071-09 BRCA ed5fl077-62cl-43d8-8a27-56521bbdd8a5

TCGA-BH-AOHI-01 A-l 1D-A099-09 BRCA 507213d0-eflc-400c-8724-24cd6a39feb8

TCGA-BH- AOHL-01 A-l 1W-A050-09 BRCA 1 fd 1 db26-79e0-4018-8548-8fd20a96c479

TCGA-BH- AOHN-01 A-l 1D-A099-09 BRCA adal 99c5-8015-481 f-a46e-46f a42646cd8

TCGA-BH- AOHO-01 A-l 1W-A050-09 BRCA 354172e7-3e54-4ec4-88fa-fd7781cc86ae

TCGA-BH- AOHP-01 A- 12D- A099-09 BRCA ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2

TCG A-B H-AOHQ-OlA-11W-A050-09 BRCA f03af67f-3119-4ee4-a4b0-227d36f493ba

TCGA-BH- AOHU-01 A-l 1W-A050-09 BRCA b46f2619-5937-4847-bb38-fe6022225ab9

TCGA-BH-AOHW-01 A-l 1W-A050-09 BRCA 706ec3be-bd65-4f42-b5cc-603f7f62c91a

TCGA-BH- AOHX-01 A-21 W- A071 -09 BRCA 27df78cd-lf39-42f3-92e6-56664d4c472c

TCGA-BH-A0HY-01A-11W-A071-09 BRCA a63c2000-9e41-4897-8b01-4723c382096e

TCGA-BH- AORX-01 A-21 D- A099-09 BRCA 48115e9a-5027-455a-a88e-c3d991dbf966

TCGA-BH- A0W3-01 A- 11 D- A 1 OG-09 BRCA 3fal4183-e0c5-4dc2-bb4a-d8dd42f6578b

TCGA-BH-A0W4-01 A-l 1D-A10G-09 BRCA fdafddde-affl-42b4-bf94-a95861eacf53

TCGA-BH- A0W5-01 A- 11 D- A 1 OG-09 BRCA acald737-c24c-49fd-86c0-ab2b29cd28de

TCGA-BH- A0W7-01 A- 11 D- A 10 Y-09 BRCA 7d20774c-6aac-4eb0-a876-lbel4e0f3004

TCGA-BH-AOWA-01 A-l 1D-A10G-09 BRCA 4076f947-alf0-4101-9a79-79828eb3bbe3 TCGA-BH-A18F-01A-11D-A12B-09 BRCA d414b3fe-b768-4a98-b285-5284bffa66f9

TCGA-BH- A 18H-01 A- 11 D- Al 2B-09 BRCA d3clb990-aae2-45f8-be28-8ccdl92a0fab

TCGA-BH- A 181-01 A- 11 D- A 12B-09 BRCA f0ca4831-d56d-4bae-b304-bb43c5d2f09b

TCGA-BH-A18J-01A-11D-A12B-09 BRCA fd9923db-2a27-432e-a0c6-4c44e6eelf53

TCGA-BH- A 18K-01 A- 11 D- Al 2B-09 BRCA f75de986-bc8a-4ffe-9b35-011eee3al446

TCGA-BH-A18L-01A-32D-A12B-09 BRCA 883cd3c9-268 l-4822-8b22-29149a027514

TCGA-BH-A18M-01A-11D-A12B-09 BRCA 0e548c 1 e-cbb7-4432-8112-bb262al ef9d9

TCGA-BH-A18N-01A-11D-A12B-09 BRCA 13c38ac4-c410-4602-83e3-9b80b4f93839

TCGA-BH-A18P-01A-11D-A12B-09 BRCA add624a3-57e9-46be-9bcc-3e53d7c2dfb7

TCGA-BH- A 18Q-01 A- 12D- Al 2B-09 BRCA a4de6680-33c3-4f6f-8696-453470a00bcb

TCGA-BH- A 18R-01 A- 11 D- Al 2B-09 BRCA 42facac2-81d9-4a9f-b4f6-lde89a7662fc

TCGA-BH-A18S-01A-11D-A12B-09 BRCA aO 1 cl 2fc-a33e-4a06-8b69-ebe6d4f59c2b

TCGA-BH-A18T-01A-11D-A12B-09 BRCA 4e0ddfcb-e847-4132-bdce-aaee2e027b28

TCGA-BH- A 18U-01 A-21 D- Al 2B-09 BRCA a8400863-cl45-4c6c-bcf3-e4cc4d816d22

TCGA-BH- A 18 V-01 A- 11 D- A 12B-09 BRCA 6150dd25-a8f4-4d9f-9da0-f956855ab67d

TCG A-B H- A 1 EN-01 A- 11D-A17G-09 BRCA cal 00ef0-be45-415f-909d-7172261 d0084

TCGA-BH-A1EO-01A-11D-A135-09 BRCA 20131381 -8al 1 -425d-8954-980e6ec7c427

TCGA-BH-A1ES-01A-11D-A135-09 BRCA 7ecda44b-e942-4077-9dl8-2a844ec53c9d

TCGA-BH-A1ET-01A-11D-A135-09 BRCA 9bd66613-68ad-42cl-ab43-dacl 386027f9

TCGA-BH-A1EU-01A-11D-A135-09 BRCA dc578e75-e63c-4bdf-abfa-e2d063c9cd6d

TCGA-BH- A IE V-01 A- 11 D- A 135-09 BRCA 43fbe2a9-078a-4be2-b67c-b855329091f0

TCGA-BH-A1EW-01A-11D-A135-09 BRCA c6f4b Ib6-a8dd-4a9 a-a500-b 14a738fe 18f

TCG A-B H- A 1 EX-01 A- 11 D- A 13L-09 BRCA 537bl685-0882-48ee-a38a-a05b5dlc8bal

TCGA-BH-A1EY-01A-11D-A13L-09 BRCA 7c035023-8ea9-4504-8f03-9573745cb6ef

TCGA-BH-A1F0-01A-11D-A135-09 BRCA 3903b485-366d-4318-bl7d-a0194f032bd8

TCGA-BH- A 1F2-01 A-31 D- Al 3L-09 BRCA a5c67494-d843-4bl4-ba9c-d077396ed2dc

TCGA-BH- A 1F5-01 A- 12D- Al 3L-09 BRCA 82121518-98d6-4db6-8be4-74bbe232a9ed

TCGA-BH- A 1F6-01 A- 11 D- Al 3L-09 BRCA 34eb095d-3d44-4c59-9ef5-94592ba97900

TCGA-BH- A 1F8-01 A- 11 D- Al 3L-09 BRCA 030cfc8a-7b43-4d73-8bfa-b68a47749e49

TCGA-BH-A1FC-01A-11D-A13L-09 BRCA 84c77098-03d0-4b22-afbl-797703e85c6c

TCG A-B H-AIFD-OIA-11W-A14Q-09 BRCA b372b5cd-4c38-4cd3-95e0-8708ce5437e7

TCGA-BH-A1FE-01A-11D-A13L-09 BRCA 5e71 fc3 a-a2f4-4899-9cl f-8fee 1 ef29e2e

TCGA-BH-A1FG-01A-11D-A13L-09 BRCA 311 f2f 1 a-75c8-4fee-b31 d-0815d71 a3173

TCGA-BH-A1FH-01A-12D-A13L-09 BRCA fd6bd486-6371-4892-863e-64838fcea624

TCGA-BH- A lFJ-01 A- 11 D- A 13L-09 BRCA dc62eafd-b5ad-42b4-9665-l lba6b22cff5

TCGA-BH-A1FL-01A-11D-A13L-09 BRCA bb84cbbl-7244-4d92-8977-a37dbafc47b4

TCGA-BH- A lFM-01 A- 11 D- A 13L-09 BRCA 7cbl7736-03da-4f77-8397-145585a25ble

TCG A-B H- A 1 FN-01 A- 11 D- A 13L-09 BRCA bf92d76e-31ff-4273-82ea-982c4c26394b

TCGA-BH-A1FR-01A-11D-A13L-09 BRCA a589f5ac-105c-45d6-96el-55e3080f999c

TCGA-BH-AlFU-01 A-l 1D-A14G-09 BRCA 9efd4bfb-d4e4-487e-8dlc-al9c2d62e3cf

TCGA-BH- A201-01 A-l 1D-A14K-09 BRCA df6e619f-67a5-49f3-9768-4826aa2c9dlb TCGA-BH-A202-01 A-l 1D-A14K-09 BRCA e6feb69a-8827-4d43-94aa-036cf5150549

TCGA-BH- A203-01 A- 12D- Al 67-09 BRCA 128b9209-2201-428c-87e7-65690bfe3875

TCGA-BH-A204-01 A-l 1D-A159-09 BRCA 2454d30f-lca5-4f01-bfce-6ael0e84e75a

TCGA-BH- A208-01 A-l 1D-A159-09 BRCA ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29

TCGA-BH- A209-01 A-l 1D-A17G-09 BRCA 4eaf8116-4733-4865-8e22-5d03887bbc9b

TCGA-BH- A28Q-01 A- 11 D- Al 6D-09 BRCA 0698379c-8f4e-460d-b7da-d3f6179dafd7

TCGA-C8- A 12K-01 A-21 D- Al 0 Y-09 BRCA bcf92c27-3aa7-4449-9c7a-fc715789788f

TCGA-C8- A 12L-01 A- 11 D- A 10 Y-09 BRCA 998a465a-d084-4d7f-8c02-8c5belelee27

TCGA-C8- A 12M-01 A- 11 D- A 135-09 BRCA 9a0a7b93-da6e-45b7-9a6f-190d79552b49

TCGA-C8-A12N-01 A-l 1D-A10Y-09 BRCA e2af7f0c-3cf4-4ffe-b764-b4fd83bf7694

TCGA-C8-A 120-01 A-l 1D-A10Y-09 BRCA 51dbda2a-106b-4597-aa49-609b677866c8

TCGA-C8-A12P-01 A-l 1D-A10Y-09 BRCA 540fe594-0186-40d3-b519-c 1 ccebe82247

TCGA-C8-A12Q-01 A-l 1D-A10Y-09 BRCA b6b4af38-7ebb-4fa8-9876-6d88d2ble7e4

TCGA-C8- A 12T-01 A- 11 D- A 10 Y-09 BRCA 961fae8a-d944-4866-bl98-ea6fle59a979

TCGA-C8-A12U-01 A-l 1D-A10Y-09 BRCA 444alef9-819a-41dc-baef-22057225efcd

TCGA-C8-A12V-01 A-l 1D-A10Y-09 BRCA b8728982-8254-4aa8-baa5-aaeb6d852260

TCGA-C8-A12W-01 A-l 1D-A10Y-09 BRCA 5fb924d9-3201-491b-90bl-fe8a6320b2d7

TCGA-C8-A12X-01 A-l 1D-A10Y-09 BRCA f 133 a2e3-73 a2-40b 8-855f-e819e4d 11630

TCGA-C8-A12Y-01 A-l 1D-A12B-09 BRCA d5cOalaO-3d38-497b-9f47-107f06659cbl

TCGA-C8-A12Z-01 A-l 1D-A10Y-09 BRCA ae68cac5-e561-4094-98fa-2303cdaa6dbb

TCGA-C8- A 130-01 A- 31 D- A 10 Y-09 BRCA da70101 d- 10c2-47ab-bce 1 -7757dcbb08a2

TCGA-C8- A 131 -01 A- 11 D- A 10 Y-09 BRCA df8c72f3-ca4f-4al5-8d58-976d9c796570

TCGA-C8- A 132-01 A- 31 D- A 10 Y-09 BRCA C038ab30-af2f-4771-bf82-dcfl9f32efab

TCGA-C8-A133-01A-32D-A12B-09 BRCA 641e848d-e3e2-46a7-ad42-5e5672639816

TCGA-C8- A 134-01 A- 11 D- A 10 Y-09 BRCA a3e8738b-2456-4f08-bb3d-5debb4265f85

TCGA-C8- A 135-01 A- 11 D- A 10 Y-09 BRCA 6b47c22f-8b4e-40fd-9a 12- 18b539521224

TCGA-C8- A 137-01 A- 11 D- A 10 Y-09 BRCA 08778f40-d895-46f 1 -8e7b- 122fc598418b

TCGA-C8- A 138-01 A- 11 D- A 10 Y-09 BRCA f3474e56-8457-4f0b-8a2f-58fdd8f58607

TCGA-C8- A 1 HE-01 A- 11 D- Al 88-09 BRCA 8314bada-5bd3-4cd2-b308-4cb2db64de94

TCGA-C8- A 1 HF-01 A- 11 D- Al 35-09 BRCA 508a26f2-dl 17-44aa-b579-00al 19b8bcc4

TCGA-C8- A 1 HG-01 A- 11 D- Al 35-09 BRCA ba937e3d-30b7-4446-84fb-5f77831a4843

TCGA-C8- A 1 HI-01 A- 11 D- A 135-09 BRCA 75dc3bff-75da-4734-b930-al8fd3dlebfe

TCGA-C8- A 1 HJ-01 A- 11 D- A 13L-09 BRCA a62c3601 -b90f-402f-8212-ffdfde3c6df 8

TCGA-C8- A 1 HK-01 A-21 D- Al 3L-09 BRCA 357eOb08-fa33-4f58-92bO-d7293b63c01d

TCGA-C8- A 1 HL-01 A- 11 D- Al 35-09 BRCA 88c9ef88-5d85-4a4b-9c68-d9ec709alf07

TCGA-C8- A 1 HM-01 A- 12D- A 135-09 BRCA a2f9165d-9fe7-492e-9b4c-3cb4200c6e85

TCGA-C8- A 1 HN-01 A- 11 D- Al 35-09 BRCA a2576147-28eb-460f-9b97-916892d801 e2

TCGA-C8- A 1 HO-01 A- 11 D- Al 3L-09 BRCA c6fb921 c-78fe-4852-b2a5-edd5a02ae923

TCGA-C8- A26 V-01 A- 11 D- Al 6D-09 BRCA 6c5a83f5-983f-434c-ac29-ddb84a7fl019

TCGA-C8- A26W-01 A- 11 D- Al 6D-09 BRCA d3db354e-f22c-4576-a7d7-6515flcl l002

TCGA-C8- A26X-01 A-31 D- Al 6D-09 BRCA a5bc549a-lalf-41b4-b548-14c448fed6c7 TCGA-C8- A26Z-01 A- 11 D-A16D-09 BRCA fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c

TCGA-C8- A273-01 A- 11 D- A 16D-09 BRCA C5e6f325-5fd0-4cff-8eaf-6e23e016f605

TCGA-C8- A274-01 A- 11 D- A 16D-09 BRCA 5e6e7c20-47b3-4f0e-a3c7-8293993e39cf

TCGA-C8- A275-01 A-21 D- A 16D-09 BRCA 7751 a837-2656-4e3b-9182-556314c4f6a3

TCGA-C8- A278-01 A- 11 D- A 167-09 BRCA 7bc48524- 1 f 69-4d85-9d 16-6db7844543bd

TCGA-C8- A27 A-01 A- 11 D- A 167-09 BRCA d0fd3dcc-4ac7-4fe9-9fb8-c0676b6faabb

TCGA-C8- A27B-01 A- 11 D- Al 67-09 BRCA He43e41-54b8-4232-b078-5062288d3868

TCGA-D8- A 13 Y-01 A- 11 D- Al 0 Y-09 BRCA 8bb90325-028e-491a-bbaf-2cf4b3b87cd6

TCGA-D8- A 13Z-01 A- 11 D- Al 0 Y-09 BRCA c3722c97-80f5-4eea-bf50-5a214134bbcc

TCGA-D8- A 140-01 A- 11 D- A 10 Y-09 BRCA 795f051 e-01 c4-4b49-b 179-bd 18ba24433c

TCGA-D8- A 141 -01 A- 11 D- A 10 Y-09 BRCA 807791d8-b6c0-4722-bf5c-d5fa30baffc6

TCGA-D8- A 143-01 A- 11 D- A 10 Y-09 BRCA dbl763dl-fcae-4a01-a0cb-3019e292aal0

TCGA-D8- A 145-01 A- 11 D- A 10 Y-09 BRCA af6ca646-499a-4e0a-al94-cacf72e5810b

TCGA-D8- A 146-01 A- 31 D- A 10 Y-09 BRCA 9a7548dc-fc79-4ad4-a324-0e9f63c91a20

TCGA-D8- A 147-01 A- 11 D- A 10 Y-09 BRCA If292323-cafc-4e45-bb4e-f5428ela3276

TCGA-D8- A 1J9-01 A- 11 D- A 13L-09 BRCA 6627e4bl-b34c-4aa2-836e-093061442a6d

TCGA-D8- A lJB-01 A- 11 D- A 13L-09 BRCA 54621 c54-b7ef-48e4-aa68-e2fe 1 ObfOafb

TCGA-D8- A lJC-01 A- 11 D- A 13L-09 BRCA 63a9dl4f-d91a-47af-8ef6-8124193aal l0

TCGA-D8- A lJD-01 A- 11 D- A 13L-09 BRCA 7df92725-fa63-494d-af9d-65c6ed76e023

TCGA-D8- A 1 JE-01 A- 11 D- A 13L-09 BRCA bb34512b-2432-4256-968c-d7fdf38fl26a

TCGA-D8-A1JF-01 A- 11 D- A 13L-09 BRCA d31358da-639c-4fe5-9f7c-c 17c31 fd2865

TCGA-D8- A lJG-01 B- 11 D- Al 3L-09 BRCA 0M5c6f7-8e3e-48ad-a4a2-97d2ada56c44

TCGA-D8- A lJH-01 A- 11 D- A 188-09 BRCA 9f5948 ld-be89-436 l-8cc3-3f ld46702016

TCGA-D8- A lJI-01 A- 11 D- Al 3L-09 BRCA 2c6a885b-0452-492c-8829-13ba4b2ac455

TCGA-D8- A 1 JJ-01 A-31 D- A14K-09 BRCA 412f96a6-6599-40a6-9dd2-afba8c643910

TCGA-D8- A lJK-01 A- 11 D- A 13L-09 BRCA fadaa39d-ebd2-4887-ae54-lfcal2287fcf

TCGA-D8- A 1 JL-01 A- 11 D- A 13L-09 BRCA 425dbc9f-6bee-412a-b77a-22a2724ea4c6

TCGA-D8- A lJM-01 A- 11 D- Al 3L-09 BRCA f66d4178-34f3-4f5d-aa0a-7fdd03801033

TCGA-D8- A 1 JN-01 A- 11 D- A 13L-09 BRCA C83c7d48-8671-4f27-b3dd-05411fa2f784

TCGA-D8- A lJP-01 A- 11 D- A 13L-09 BRCA Ie21a355-0cb6-4a43-bl34-50ff88dacf92

TCGA-D8- A lJS-01 A- 11 D- A 13L-09 BRCA 4a9181 d0-d3df-479 l-99f0-4db076c22a3 a

TCGA-D8- A lJT-01 A-31 D- A 13L-09 BRCA 3be3972f-4125-44c3-94d6-0ddba2008fcf

TCGA-D8- A lJU-01 A- 11 D- A 13L-09 BRCA 7bff4f75-749d-4a63-9a64-0bcflcd615ea

TCGA-D8-A1X5-01 A-l 1D-A14G-09 BRCA db4526d4-e344-4b5a-bb66-fd43b41764ca

TCGA-D8-A1X6-01 A-l 1D-A14K-09 BRCA 1951aa38-481b-464c-9a78-0819312a0a93

TCGA-D8-A1X7-01 A-l 1D-A14K-09 BRCA 7acb4232-db95-4889-942e-flbe897b4f2a

TCGA-D8-A1X8-01 A-l 1D-A14K-09 BRCA 78c3c787-5731-4c38-8d7a-e5b503bl lc36

TCGA-D8-A1X9-01A-12D-A159-09 BRCA b5f65c3a-b922-4a81-863d-59b72b08dlbf

TCGA-D8- A IX A-01 A- 11D-A14G-09 BRCA a362780b-8917-4438-9693-ec9fa84c352a

TCGA-D8- A lXB-01 A- 11 D- A 14G-09 BRCA e5ca0f 82-6f a9-4d54-adc7-385721 f 351 f 3

TCGA-D8- A lXC-01 A- 11 D- A 14G-09 BRCA 68fd3045-073d-4242-8a41-41b707fca625 TCGA-D8-A1XF-01 A-l 1D-A14G-09 BRCA el587f32-2ff9-40f3-97dd-b45b0fl4be46

TCGA-D8- A lXG-01 A- 11D-A14G-09 BRCA 800ff536-ald2-4213-b85e-7780851c6378

TCGA-D8- A lXJ-01 A- 11D-A14K-09 BRCA a37b27a2-c3b0-4f62-82a2-94e9205bld6e

TCGA-D8- A lXL-01 A- 11D-A14K-09 BRCA 28d44e6e-c73f-4788-8ad4-2bd6572f643d

TCGA-D8- A lXM-01 A-21 D- A 14K-09 BRCA 07418962-0a82-43a2-a66f-614903ea8380

TCGA-D8- A lXO-01 A- 11 D- A 14K-09 BRCA b5ff68a2-da74-4608-941e-dbac40153077

TCGA-D8- A lXR-01 A- 11 D- A 14K-09 BRCA 5913c8ff-26ce-4f26-909e-3ed292d3c538

TCGA-D8-A1XS-01 A-l 1D-A14K-09 BRCA 5d302c04-302e-4040-9429-37cd672e8d53

TCGA-D8- A lXT-01 A- 11D-A14K-09 BRCA bcl3601e-3e03-4d7d-8e6e-5b05ff500ea3

TCGA-D8- A lXU-01 A- 11 D- A 14K-09 BRCA 55c547ee-7cc9-4b7 a-aaca-22f2a8c8c3 a4

TCGA-D8- A IX V-01 A- 11 D- A 14K-09 BRCA a76adfdl-8c89-4cl3-b570-5ccc47043a70

TCGA-D8- A lXW-01 A- 11 D- A 14K-09 BRCA f29405cc-d712-4562-ac02-ca3c89fb82af

TCGA-D8- A IX Y-01 A- 11 D- A 14K-09 BRCA edb6dl61-8f50-4cl l-8246-487c4ea9a55d

TCGA-D8-A1XZ-01 A-l 1D-A14K-09 BRCA 381 a9211 - 1 f2b-4c 14-895b-ee7fb6eb8c7f

TCGA-D8- A 1 YO-01 A- 11D-A14K-09 BRCA 33ff7870-fa76-4e48-a223-a8e2441d8f53

TCGA-D8- A 1 Y 1 -01 A-21 D- A14K-09 BRCA 2ea6e540-6e2f-48a5-99e3-27a0107d07b7

TCGA-D8- A 1 Y2-01 A- 11D-A159-09 BRCA 9dbf62eb-0de7-4410-b44b-fdf59026d8e6

TCGA-D8- A 1 Y3-01 A- 11D-A159-09 BRCA 64fa29ff-534f-4b22-b0c4-513e8657edb 1

TCGA-D8- A27E-01 A- 11 D-A16D-09 BRCA eab47cbb-eab0-4dd6-9cd0-f2700e5b6227

TCGA-D8- A27F-01 A- 11 D-A16D-09 BRCA fc6d77a9-121b-48ab-a899-713c3dl319a2

TCGA-D8- A27H-01 A- 11 D- Al 6D-09 BRCA 78e51220-c9f8-44b2-bclc-b34a56af3b54

TCGA-D8- A27I-01 A- 11 D- A 16D-09 BRCA 47c0db0a-fc37-4fa0-832c-e67f089d3889

TCGA-D8- A27K-01 A- 11 D- Al 6D-09 BRCA 09fa0bc7-acb3-45b0-b687-977869c31dl2

TCGA-D8- A27L-01 A- 11 D- A 16D-09 BRCA 10666107-dffb-4c51-b3ee-71e70cde7c88

TCGA-D8- A27M-01 A- 11 D- A 16D-09 BRCA Cb9257f9-ca3f-4cl4-a680-6632175dd526

TCGA-D8- A27N-01 A- 11 D- Al 6D-09 BRCA 6a411174-582a-4c68-bb04-5ea2e504bf7c

TCGA-D8- A27P-01 A- 11 D- Al 6D-09 BRCA 9401 lb46-74e3-41 c 1 -a3f 6-6db 1821 d 1778

TCGA-D8- A27R-01 A- 11 D- Al 6D-09 BRCA 27741cl3-8d5f-43b8-8651-caf69acef0e4

TCGA-D8- A27T-01 A- 11 D- A 16D-09 BRCA ecabcc6a-2767-4ad8-ac4f-54cc3d081b6e

TCGA-D8- A27W-01 A- 11 D- Al 6D-09 BRCA b045d675-286b-4cf 8-aed4-c7f f 81 a78919

TCGA-E2- A 105-01 A- 11 D- A 10M-09 BRCA 2441f3e0-2016-4313-8c05-486759f5dd0f

TCGA-E2- A 107-01 A- 11 D- A 10M-09 BRCA 5804fclc-063b-429d-a652-22b0de416bd6

TCGA-E2- A 108-01 A- 13D- A 10M-09 BRCA e3e394d4-2593-4bf9-86e4-2e79d8cb8dab

TCGA-E2- A 109-01 A- 11 D- A 10M-09 BRCA 3585el33-b3cl-4d90-b5f2-2b867e0ae0ec

TCGA-E2- A 10 A-01 A-21 D- A 10 Y-09 BRCA cd49ccc5-a776-4307-930c-298ba6cfdf79

TCGA-E2-A10B-01 A-l 1D-A10M-09 BRCA 9d712002-74cb-459a-b350-e9a4b49aacl3

TCGA-E2- A 1 OC-01 A-21 D- Al 0M-09 BRCA 2750ed41-0bd4-4cf4-98f5-762957cf80b7

TCGA-E2- A 1 OF-01 A- 11 D- A 10M-09 BRCA 530b7e22-e70a-46ef-a0e8-bf2ef814850a

TCGA-E2- A 14N-01 A-31 D- Al 35-09 BRCA 00c8d 151 -2223-4e36-8c66-6c09e42d8777

TCGA-E2- A 14O-01 A-31 D- Al 0 Y-09 BRCA d6ab6f8d-0e65-40a3-bf98-7249e4075395

TCG A-E2- A 14P-01 A- 31 D- A 12B -09 BRCA 35a96eee-l 13b-45cb-a999-8 lcl 3545b 104 TCGA-E2-A14Q-01 A-l 1D-A12B-09 BRCA ee51cf6d-351f-48f8-ab93-639c27c50e9f

TCGA-E2-A14R-01 A-l 1D-A10Y-09 BRCA c7212115- 1007-40cf-b9b5-7b25e2f5f2a4

TCGA-E2-A14S-01A-11D-A12B-09 BRCA 78f39325-eld0-4181-87f4-cb7f00e886d7

TCGA-E2- A 14T-01 A- 11 D- A 10 Y-09 BRCA 14c 1 c6b6-575e-416b-b219-15552b62ea74

TCGA-E2-A14V-01 A-l 1D-A12B-09 BRCA 703314fe-bfd5-45d5-9ed5-fcdce8a 19fd6

TCGA-E2-A14W-01 A-l 1D-A12B-09 BRCA fbdc8659-e9cc-483 f-bdOa- 1 a24b5ada 1 cf

TCGA-E2-A14X-01 A-l 1D-A10Y-09 BRCA 74039acd-5aca-4c65-818c-3b577d295be0

TCG A-E2- A 14Z-01 A- 11 D- A 10 Y-09 BRCA c83eaaca-ced5-4630-abb5-ef34db888753

TCGA-E2- A 150-01 A- 11 D- A 12B-09 BRCA 446064de-ff 64-4113-9080-360e5bf6d5e4

TCGA-E2- A 152-01 A- 11 D- A 12B-09 BRCA b266b370-425c-4146-8b72-59248436618e

TCGA-E2- A 154-01 A- 11 D- A 10 Y-09 BRCA 336e39fb-d407-4ced-b7bb-e8ff5329abdb

TCGA-E2- A 155-01 A- 11 D- A 12B-09 BRCA a966904f-e8dd-473c-8626-84c25d7e0d6c

TCGA-E2-A156-01A-11D-A12B-09 BRCA 26003dce-0fc6-4538-a392-c80elebaale4

TCGA-E2- A 159-01 A- 11 D- A 10 Y-09 BRCA 757c8a2d-90cf-4dab-a4dd-45f3cbdeaeeb

TCGA-E2- A 15 A-01 A- 11 D- A 12B-09 BRCA b7e3effl-65d5-491f-a726-35dc6752b370

TCGA-E2- A 15C-01 A-31 D-A12B-09 BRCA 10c594a 1 -0843-4740-9d96-00211 a9509fb

TCGA-E2-A15D-01 A-l 1D-A10Y-09 BRCA 891295d6-4dd0-4ab4-bbce-13da7f3c30d0

TCGA-E2-A15E-01A-11D-A12B-09 BRCA c6fl07df-1186-4d6d-b5b5-2393e9369ddl

TCGA-E2- A 15F-01 A- 11 D- A 10 Y-09 BRCA 33edf937-b09f-49ec-8f4c-e05dee7ece 1 f

TCGA-E2- A 15G-01 A- 11 D- A 12B-09 BRCA d45bb60a-e73b-4b95-8637-e8dl7fcca745

TCGA-E2-A15H-01 A-l 1D-A12B-09 BRCA 7875c5b3-ced2-4669-a3d5-45739b850af7

TCGA-E2- A 151-01 A-21 D- A 135-09 BRCA 9bec02b4-7cf0-4797-b 1 ac-253ef78a34af

TCGA-E2- A 15 J-01 A- 11 D- A 12Q-09 BRCA e5fd7cbd-8fce-49e9-8d2c-d2a2e61367a5

TCGA-E2-A 150-01 A-l 1D-A10Y-09 BRCA 39cldf91-b670-4f6b-b5ff-dbb6b66d30af

TCGA-E2- A 15P-01 A- 11 D- A 10 Y-09 BRCA 5fl853c2-6579-42d0-adc2-636b5de543e4

TCGA-E2-A15R-01 A-l 1D-A10Y-09 BRCA 11799240-0275-48fe-84ef-85el88839bbe

TCGA-E2-A15S-01A-11D-A10Y-09 BRCA 01f78efa-ba0b-4263-81fd-d3d8ealbc5fd

TCGA-E2- A 15T-01 A- 11 D- A 10 Y-09 BRCA eff74709-36af-4da4-91 cl -01100ddc7735

TCGA-E2- A 1 AZ-01 A- 11 D- Al 2Q-09 BRCA f961c932-cf37-47c8-8520-8d0d444dc94f

TCGA-E2-A1B0-01 A-l 1D-A12Q-09 BRCA 14e3b00c-cbec-4733-8fa4-829b8e7d9808

TCGA-E2- A 1 B 1 -01 A-21 D- Al 2Q-09 BRCA a6e77al4-e5e5-452e-a46f-5629ee8228e3

TCGA-E2-A1B4-01 A-l 1D-A12Q-09 BRCA a6aa4529-7996-4b66-9632-2559293db35d

TCGA-E2- A 1 B 6-01 A-31 D- Al 2Q-09 BRCA laaf88fc-f7cb-4239-a420-224352194160

TCG A-E2- A lBD-OlA-11D-A12Q-09 BRCA f5acl986-272b-48d2-9a73-4a550e38a997

TCGA-E2- A 1 IE-01 A- 11 D- A 188-09 BRCA e416f05b-c7d2-479b-8068-803492e86d86

TCGA-E2- A 1 IF-01 A- 11 D- A 142-09 BRCA 7751c2d5-e548-4439-aacl-e7b9dce97583

TCGA-E2-A1IG-01 A-l 1D-A142-09 BRCA 84da47a3-49el-4f94-bea9-dd20b6627adb

TCGA-E2- A 1 IH-01 A- 11 D- A 188-09 BRCA cd886e35-4201-4732-90c6-142d8fe309bl

TCGA-E2- A 111-01 A-l 1D-A142-09 BRCA 698c8a73-c6b6-45bd-82fc-9bd0fl40729d

TCGA-E2-A1IJ-01 A-l 1D-A142-09 BRCA 3 aff2da 1 - 1647-4b95-abdb-c9db923cfc22

TCGA-E2- A 1 IK-01 A- 11 D- A 17G-09 BRCA 8577ac01 - 1274-4bd5-ab04-380eaa78d95b TCGA-E2-A1IL-01 A-l 1D-A14G-09 BRCA 1540ae03-7bb4-418b-afbc-44bf 3 ad60a31

TCGA-E2- A 1 IN-01 A- 11 D- A 13L-09 BRCA 9e85559f-098e-4b0f-8034-4798789e710b

TCGA-E2- A 1 IO-01 A- 11 D- A 142-09 BRCA 986e9b9f-ael5-4743-al50-d6eellf3c077

TCGA-E2- A 1 IU-01 A- 11 D- A 14G-09 BRCA 7fcd5fda-8155-4b48-afb9-9e7958627113

TCGA-E2- A 1L6-01 A- 11 D- A 13L-09 BRCA f610239f-5610-4d7b-bc31-ae3ccb9c425d

TCGA-E2- A 1L7-01 A- 11 D- A 142-09 BRCA 33 a09072-6554-4d46-b738-0852624940af

TCGA-E2- A 1L8-01 A- 11 D- A 13L-09 BRCA 04a7762f-2cbb-498b-ab4e-921406claec0

TCGA-E2- A 1L9-01 A- 11 D- A 13L-09 BRCA a50cd2b2-913d-41bf-94ad-45464547b348

TCGA-E2- A 1L A-01 A- 11 D- A142-09 BRCA bdcd4800-3258-446f-b6e5-3c8e2f46c656

TCG A-E2- A 1 LB -01 A- 11 D- A 142-09 BRCA 377b 1816-61 el -431 a-9952-71 e4d58bbd48

TCGA-E2- A lLG-01 A-21 D- A14K-09 BRCA 7cdbe0e8-f614-4f54-b864-fd6b39e8eflc

TCG A-E2- A 1 LH-01 A- 11 D- A 14G-09 BRCA 605fld27-db45-449a-a68f-4888b8c786al

TCGA-E2- A lLI-01 A- 12D- Al 59-09 BRCA c812374c-8bc9-4ccf-9157-fbd9d 162ee 1 e

TCGA-E2- A lLK-01 A-21 D- A14G-09 BRCA 4e84eed6-82a8-4e91-b0fd-61ec6ef69ce9

TCG A-E2- A 1 LL-01 A- 11 D- A 142-09 BRCA 47312f61-5ef4-4f25-9320-8fbb4758790e

TCGA-E2- A lLS-01 A- 12D- A 159-09 BRCA 40087f80-85f6-4cc4-95c9-0639153dd3f4

TCGA-E9- A 1N3-01 A- 12D- Al 59-09 BRCA 6c3891 a9-baa9-4309-9974-d82fd5f97417

TCGA-E9-A1N4-01 A-l 1D-A14K-09 BRCA a3784a48-47a7-4587-91dd-5b8873a24ca9

TCGA-E9-A1N5-01 A-l 1D-A14G-09 BRCA 432a9f5e-0f2a-4cd2-a910-ee9ee30c 1 ff 3

TCGA-E9-A1N8-01 A-l 1D-A142-09 BRCA cac57844-0e46-489b-8d94-ceea5788c050

TCGA-E9-A1N9-01 A-l 1D-A14G-09 BRCA 2aa7a 1 db-40a5-42 lb-97ab- 1031 e6f a7f04

TCGA-E9- A lNA-01 A- 11D-A142-09 BRCA a3d223eb-20e6-40b9-9f07-e5f865bd2439

TCGA-E9- A lNC-01 A- 12W- Al 6L-09 BRCA 2ba4c398-b94b-49f8-bb88-9d0cb3347d2c

TCGA-E9- A lND-01 A- 11D-A142-09 BRCA 8e72652d-3b99-47b2-87fe-04b96b243722

TCGA-E9- A lNE-01 A-21 D- A14K-09 BRCA dbd34322-ac40-41f0-acc7-7bfd06afdf67

TCGA-E9- A lNF-01 A- 11D-A14G-09 BRCA Cd428bec-fc31-4d2d-9e6c-c8f30608d797

TCGA-E9- A lNG-01 A-21 D- A14K-09 BRCA lcbf389d-lec8-4543-880f-4ef64c55a44b

TCGA-E9- A lNH-01 A- 11D-A14G-09 BRCA 13c312ec-0add-4758-ab8d-cl93e2e08c6d

TCGA-E9- A lNI-01 A- 11 W- A 16H-09 BRCA 3bf0b 169-f 870-4887-be06-414f20f 1 dcfO

TCGA-E9- A 1 QZ-01 A-21 D- Al 67-09 BRCA 2d47b244-e5e4-4645-91cb-71deld685a95

TCGA-E9- A 1 RO-01 A-22D- Al 6D-09 BRCA C09eaa03-cl4c-4a96-a505-4d999e45270e

TCGA-E9-A1R2-01 A-l 1D-A14G-09 BRCA b321a2d9-5345-4891-b450-bfd696c6cfb0

TCGA-E9- A 1 R3-01 A-31 D- A14K-09 BRCA ba6af877-7a23-4738-a867-01 a5dd8a8050

TCGA-E9- A 1 R4-01 A-21 D- A14G-09 BRCA 15d9c916-al2e-48a0-8a0f-8c240c54bd37

TCGA-E9-A1R5-01 A-l 1D-A14K-09 BRCA a04ba6e9-2bc4-4cab-96d8-0820e0390d84

TCGA-E9-A1R6-01 A-l 1D-A14G-09 BRCA b8a 1805d-a43 a-4433-a90b-01715e8cc554

TCGA-E9-A1R7-01 A-l 1D-A14K-09 BRCA b3991854-6634-4428-bef7-a7d9ad9cca30

TCGA-E9- A 1 RA-01 A- 11 D- A14G-09 BRCA 6d067461 -2002-468e-934d-2721 f 6cb97ff

TCGA-E9- A 1 RB-01 A- 11D-A17G-09 BRCA 2ce0333c-deca-4199-a06c-ede43c5575fc

TCGA-E9- A 1 RC-01 A- 11D-A159-09 BRCA 5b5e7eb2-8efc-4681-ab8c-49a9cc4ac6d6

TCGA-E9- A 1 RD-01 A- 11D-A159-09 BRCA 23f7a698-eab 1 -40f 1 -926c-c95d4ed8213d TCGA-E9- A 1 RE-01 A- 11D-A159-09 BRCA 4a9c0873-f496-48a4-853c-2b41b2dbaa9e

TCGA-E9- A 1 RF-01 A- 11D-A159-09 BRCA 43983619-d863-4816-a334-445f6ca36541

TCGA-E9- A 1 RG-01 A- 11 D- A14G-09 BRCA 81896525-0e3f-47ff-9b0d-95b45aef718c

TCGA-E9- A 1 RH-01 A-21 D- Al 67-09 BRCA 2ecb84c0-c307-4fa9-85e3-2f722dd365a3

TCGA-E9- A 1 RI-01 A- 11 D- A 167-09 BRCA 661c0074-dac9-44c6-bebc-202cfb9fb735

TCGA-E9- A226-01 A-21 D- A 159-09 BRCA 866e5e9b-4e6c-49e2-9ea6-560f9bd99c2b

TCGA-E9- A227-01 A- 11 D- A 159-09 BRCA 15eb25c4-f4a7-446e-b654-ae39ccd2cf00

TCGA-E9- A228-01 A-31 D- A 159-09 BRCA 4a804a8d-7dc8-4b5b-9537-b7f8f7133bda

TCGA-E9- A229-01 A-31 D- A 17G-09 BRCA a27fa57d-dlad-4534-a933-0fdcc5f06a8c

TCGA-E9- A22 A-01 A- 11 D- A 159-09 BRCA 25bf7831-6878-4bac-b23d-e94a555b2232

TCGA-E9-A22B-01 A-l 1D-A159-09 BRCA e46a5dl9-2dd7-4c34-8fff-6276278c58b3

TCGA-E9-A22D-01 A-l 1D-A159-09 BRCA 3dfdc7fd-3f69-4297-a4cf-la05b75d302f

TCGA-E9- A22E-01 A- 11 D- A 159-09 BRCA ald7dafc-a755-44a6-b45b-dc6aae309d3e

TCGA-E9- A22G-01 A- 11 D- A 159-09 BRCA 2be lb92a-6041 -4d2b-9cf 8-b9723921987f

TCGA-E9-A22H-01 A-l 1D-A159-09 BRCA 42993dbb-b99b-4b48-8038-05cfl4fec886

TCGA-E9- A243-01 A-21 D- A 167-09 BRCA C6bbl6c6-cb0f-44c6-93e7-6c55d0958f82

TCGA-E9- A244-01 A- 11 D- A 167-09 BRCA 9edf63e8-ae94-4b2f-8521-b56dadc21cd5

TCGA-E9- A245-01 A-22D- A 16D-09 BRCA bdd591 f9-21 d 1 -4ce5-bfde-30e7ac3d440a

TCGA-E9- A247-01 A- 11 D- A 167-09 BRCA 7c 184a2b-d857-444a-936c-43e38a 196df9

TCGA-E9- A248-01 A- 11 D- A 167-09 BRCA fee90b4e-f005-4b40-a9af-d 1 e590b 1 e8a8

TCGA-E9- A249-01 A- 11 D- A 167-09 BRCA 2799ad7e-d6f0-4919-b7f 6- 1 c957b4c74f 8

TCGA-E9- A24 A-01 A- 11 D- A 167-09 BRCA d 11 d3770-a4f4-4d 15-94f4- 149cca27d391

TCGA-E9- A295-01 A- 11 D- A 16D-09 BRCA f3d5e986-046f-4f75-8abc-67a3b99f742d

TCGA-EW- Al IW-01 A- 11 D- A 13L-09 BRCA 8b8732c3-78b l-409b-bc8c-c48257536 lbb

TCGA-EW- Al IX-01 A- 12D- A 142-09 BRCA 01 eal 94f-dc06-4el 5-9b9e- 1 c73668040e0

TCGA-EW- Al I Y-01 A- 11 D- Al 88-09 BRCA 01d3fddf-b447-4925-a5cb-c5fd70c97278

TCGA-EW- Al IZ-01 A- 11 D- Al 88-09 BRCA 18db4143-48cc-424c-8d23-46cf23056528

TCGA-EW-A1J1-01A-11D-A188-09 BRCA 4b8d51b3-8393-45d4-a73d-3c22c561d6f3

TCGA-EW- A 1J2-01 A-21 D- A 13L-09 BRCA c906931e-dcla-434c-96cd-58088762fle7

TCGA-EW-A1J3-01A-11D-A13L-09 BRCA acl 3b81 a-ca05-432c-918a-0c9c8170bf46

TCGA-EW- A1J5-01 A- 11 D- Al 3L-09 BRCA 98bb3025-0637-4106-8621-12df7b5d662f

TCGA-EW-A1J6-01A-11D-A188-09 BRCA d95c5cb 1 -d081 -47f a-8ac0- 1 ade7652a0af

TCGA-EW-AlOV-01 A-l 1D-A142-09 BRCA e27ca8f5-3f76-4531-87ea-ba3a44f6830d

TCGA-EW-AlOX-01 A-l 1D-A142-09 BRCA 7828f9cf-aa93-44a0-8070-efdf90a677f0

TCGA-EW- A 10 Y-01 A- 11 D- A 142-09 BRCA 925323a2-ca03-48f4-8c37-la8a6f8a6daa

TCGA-EW- A 1 OZ-01 A- 11 D- A 142-09 BRCA a73152be-2293-403d-940b-74ac05810808

TCGA-EW- Al PO-01 A- 11 D- A 142-09 BRCA 6475f4dd-782c-411a-b7ce-9c9ebd0753b8

TCG A-E W- A 1 P 1 -01 A- 31 D- A 14G-09 BRCA 28a56927-bab8-4a8c-bel l-f46e37ea34cl

TCGA-EW-A1P3-01A-11D-A142-09 BRCA e783933d-lc24-4cd5-82b7-0d680f9c3c22

TCGA-EW- Al P4-01 A-21 D- A 142-09 BRCA 204e4ef3-e6b8-469f-9024-56c6f6f07afd

TCGA-EW- Al P5-01 A- 11 D- A 142-09 BRCA 84b4da42-9b73-4448-9185-al2857ab422f TCG A-E W- A 1 P 6-01 A- 11 D- A 142-09 BRCA eef5cea9-82f6-4001-8e2c-701e43a9787a

TCGA-EW- Al P7-01 A-21 D- A 142-09 BRCA 402abf40-5a01 -467d-a5be-b9101743f 34b

TCG A-E W- A 1 P 8-01 A- 11 D- A 142-09 BRCA e55f338f-97e2-4394-ae23-c92606069485

TCGA-EW- Al PA-01 A- 11 D- A 142-09 BRCA 56c8aca4-b3bd-4791-b05d-0b2338b6346d

TCG A-E W- A 1 PB -01 A- 11 D- A 142-09 BRCA 9ddf2119-a222-4fa5-a9f3-0bec7eeea36b

TCG A-E W- A 1 PD-01 A- 11 D- A 142-09 BRCA 5a288561-bfl4-4cb9-b2f5-9ece0e038319

TCG A-E W- A 1 PE-01 A- 11 D- A 142-09 BRCA 54377bac-8f52-4116-b7e5-b71a8a721ac4

TCGA-EW- Al PG-01 A- 11 D- A 142-09 BRCA bd3801e2-c5bb-4116-9ce3-97903fc6956e

TCG A-E W- A 1 PH-01 A- 11 D- A 14K-09 BRCA Ce860c6f-c87a-4a45-92df-ca34bfb2e8b2

TCGA-GI- A2C8-01 A- 11 D- A 16D-09 BRCA 535a899d-67ca-4500-8dda-63a331a3611c

TCG A- A A-3664-01 A-01 W-0900-09 COAD 9cffl22a-9960-4f2e-ba5b-94736bad7f2b

TCGA-AA-3666-01A-02W-0900-09 COAD d7065ea5-88b0-4b56-a367-5defa0d9ed27

TCG A- A A-3667-01 A-01 W-0900-09 COAD C2799cdc-c6f7-44ba-a72c-el632b434575

TCG A- A A-3672-01 A-01 W-0900-09 COAD 04dc0b 16-834c-435 l-b3b9-58fe558c634d

TCGA-AA-3673-01A-01W-0900-09 COAD 7952f001-8901-44b4-833e-824282967118

TCG A- A A-3678-01 A-01 W-0900-09 COAD 968fea30-df40-425f-87ba-935942dbd450

TCG A- A A-3679-01 A-02W-0900-09 COAD 94cfbc05-df22-4db0-9aa0-808faab01c61

TCG A- A A-3680-01 A-01 W-0900-09 COAD 20ddld44-2321-4a84-b8b9-894073c6acd3

TCG A- A A-3681 -01 A-01 W-0900-09 COAD e5fea94c-f2ab-4476-b641-f2764eb0d026

TCG A- A A-3684-01 A-02W-0900-09 COAD 6ecc0812-6ce3-4569-9868-6c4936236682

TCG A- A A-3685-01 A-02W-0900-09 COAD db8d5d6c-c200-4ffc-albb-8465044cefad

TCGA-AA-3688-01A-01W-0900-09 COAD 7224118e-b762-4e72-8bee-9e87c37aac7f

TCG A- A A-3692-01 A-01 W-0900-09 COAD 6e2f4d01-6413-473e-98f4-9256ca4285d5

TCGA-AA-3693-01A-01W-0900-09 COAD 45ea6cb9-8d5e-4470-bd07-a2c59ddc5cf0

TCG A- A A-3695-01 A-01 W-0900-09 COAD db 143 a45-b2c5-4dce-98d4-d 15dccc5b757

TCG A- A A-3696-01 A-01 W-0900-09 COAD 9elfl824-12e2-42be-aa57-e0d0b4079a4c

TCG A- A A-3715-01 A-01 W-0900-09 COAD 554258ce-99c3-49a3-bfbf-131ec867a0e9

TCG A- A A-3812-01 A-01 W-0900-09 COAD 28087364-af53-4ac4-blb2-bbe54b71c040

TCG A- A A-3814-01 A-01 W-0900-09 COAD 733e8b21 -718b-405d-b860-ed36c70a8411

TCG A- A A-3818-01 A-01 W-0900-09 COAD 9ddb06a8-300e-40d2-8f6a-c851e2f90d90

TCG A- A A-3819-01 A-01 W-0900-09 COAD 0192a572-a235-400d-8fbl-af81e40d3763

TCG A- A A-3831 -01 A-01 W-0900-09 COAD 7843d5cl-373d-4a55-82b8-db2f8ead890c

TCGA-AA-3833-01A-01W-0900-09 COAD 9ea5c555-6e44-4313-8572-779a099efaaa

TCGA-AA-3837-01A-01W-0900-09 COAD 888cl 825-a44b-49cb-bed 1 -09db01 e54b75

TCG A- A A-3848-01 A-01 W-0900-09 COAD 729fbad4-0152-44e5-b26b-dffc 1 f7dcf70

TCG A- A A-3852-01 A-01 W-0900-09 COAD Ieelab0a-cd8c-49d5-ab8c-0d2a2f94724f

TCG A- A A-3854-01 A-01 W-0900-09 COAD 2a7ecd84-d49c-484c-a918-381769835ebc

TCG A- A A-3856-01 A-01 W-0900-09 COAD 7a07dl37-7936-486d-aeb5-6d9598fe4660

TCG A- A A-3858-01 A-01 W-0900-09 COAD 99e41fl7-b760-4b34-8230-39aa42db46fd

TCG A- A A-3860-01 A-02W-0900-09 COAD 57869735-96fd-4439-ba2d-583df6fc32a0

TCG A- A A-3875-01 A-01 W-0900-09 COAD 06e6b2e8-634e-4b03-989e-0dl92b60b64a TCGA-AA-3966-01A-01W-1073-09 COAD 689fla40-4315-48bc-8b05-75d800el7b44

TCGA-AA-3994-01A-01W-1073-09 COAD 4348f66a-el04-4fdd-bdee-2f346832835d

TCGA- A A- A004-01 A-01 W- A00E-09 COAD 0b856311-aa63-44b7-al91-9d6d8308c3d0

TCGA- A A- AOON-01 A-02W- A00E-09 COAD dfb 1 aec9-d 196-49e6-bdb 1-9318222b8121

TCGA- A A- AOOO-01 A-02W- A00E-09 COAD 0328eea5-c89c-4462-8af8-48a28ed38537

TCGA- A A- AO 10-01 A-01 W- A00E-09 COAD 77cdcb 19- 16f a-4330-921 c-e21 f 17c2298e

TCGA- A A- AO 17-01 A-01 W- A00E-09 COAD a0ad6347-d20c-494a-a094-b816c4fec5de

TCGA- A A- AO 1 D-01 A-01 W- A00E-09 COAD e00404be-0bea-4893-89cf-cc24073fl0bl

TCGA- A A- AO 11-01 A-02W- A00E-09 COAD ee78a7e5-6ddb-4d06-8fbl-ba7300af59el

TCGA- A A- AO 1 K-01 A-01 W- A00E-09 COAD 7b7c405e-65c8-4633-ac54-0al l2fb478ac

TCGA- A A- A024-01 A-02W- A00E-09 COAD 45a6b8e2-a4a7-400e-ba7a-f93c29f50fe4

TCGA- A A- A029-01 A-01 W- A00E-09 COAD 41be5565-479e-4c56-b48b-lde52dad2299

TCGA- A A- A02F-01 A-01 W- A00E-09 COAD 68c4226b-dfbd-4130-b50e-94839bcb lbOf

TCGA- A A- A02H-01 A-01 W- A00E-09 COAD Icbf3771-fb49-4517-83ba-8el l2fcbld00

TCGA- A A- A02J-01 A-01 W- A00E-09 COAD 5d03450f-b249-4dcd-927b-713158acc8b2

TCGA- A A- A02W-01 A-01 W- A00E-09 COAD 2104138f-b09d-4452-91 e 1 -c4al 0382f009

TCGA- AY-4070-01 A-01 W- 1073-09 COAD a7a74785-31cf-4527-bae2-991d7df97b5f

TCGA- AY-4071 -01 A-01 W- 1073-09 COAD 80aa3fl7-b072-4e59-a6fc-lafe016fa477

TCGA-02-0003-01 A-01 D- 1490-08 GBM 458fl3e0-34f3-4a92-b3b3-9a3c2ee3ef23

TCGA-02-0033-01A-01D- 1490-08 GBM 39d 1 f 122-31 d0-4e 1 c-95a7-0e65e75b 1457

TCGA-02-0047-01 A-01 D- 1490-08 GBM ce03026e-b756-43a2-972d-b3a4dcda5491

TCGA-02-0055-01 A-01 D- 1490-08 GBM 9cd89af4-5118-4adb-aald-fbd03bf42a33

TCGA-02-2470-01 A-01 D- 1494-08 GBM 0b35f2ff-2a08-4585-ala9-cfc6a9f5b224

TCGA-02-2483-01 A-01 D- 1494-08 GBM 4d7f2c74-862b-4aad-98el-fa831fl4a905

TCGA-02-2485-01 A-01 D- 1494-08 GBM 0332b017- 17d5-4083-8fc4-9d6f 8fdbbbde

TCGA-02-2486-01 A-01 D- 1494-08 GBM 3331813c-f538-4833-b5eb-a214b7d52334

TCGA-06-0119-01 A-08D- 1490-08 GBM 0cda6181 -c62b-4ced-a543-d6138fd2e94a

TCGA-06-0122-01 A-01 D- 1490-08 GBM 08c54819-32fa-455d-a443-fc71dfd3f03a

TCGA-06-0124-01 A-01 D- 1490-08 GBM 6ae82bf8-7076-43fb-a541-4c7db5d49280

TCGA-06-0125-02 A- 11 D-2280-08 GBM 96e3dbl4-2bbl-4f68-aed6-5e794750c96e

TCGA-06-0126-01 A-01 D- 1490-08 GBM C3c3059d-e2fb-45ea-80b5-99fb040cba29

TCGA-06-0128-01 A-01 D- 1490-08 GBM c5688535-bda4-4831-aaba-e0cl9101d7b0

TCGA-06-0129-01 A-01 D- 1490-08 GBM 73e7aa35-91b4-4392-bbb9-9ec21f30250c

TCGA-06-0130-01 A-01 D- 1490-08 GBM c09f0ebd-d604-49a3-9738-0c65fd47fbf9

TCGA-06-0132-01 A-02D- 1491 -08 GBM 53c2el59-5774-499f-b0dl-e04fa3faf5c3

TCGA-06-0137-01 A-01 D- 1490-08 GBM 37clldfc-c37c-4cb6-bd81-9e0a7789b0fl

TCGA-06-0139-01 A-01 D- 1490-08 GBM C84ffl7d-436d-49cl-aef2-b998ffe4a693

TCGA-06-0140-01 A-01 D- 1490-08 GBM 18c94086-d2cc-45cd-9bad-f8968a042d5e

TCGA-06-0141 -01 A-01 D- 1490-08 GBM 5af25 ld5-e76b-480c-8142-6d6fbfce0b2a

TCGA-06-0142-01 A-01 D- 1490-08 GBM 4bce79ce-c59c-4d86-b25f-28c8eddal651 TCGA-06-0145-01A-01W-0224-08 GBM 8f904068-2967-4b38-8813-3ad0a99e4af8

TCGA-06-0151 -01 A-01 D- 1491 -08 GBM 5fea9ebc-8clb-4078-af87-79c7f5b5470b

TCGA-06-0152-01A-02W-0323-08 GBM 79062efd-2b09-4798-a504-0al8ca30ef2d

TCGA-06-0154-01 A-03D- 1491 -08 GBM f5045707-3ddd-4ade-959a-b368437752fb

TCGA-06-0155-01B-01D- 1492-08 GBM 2dc59e9b-3 a60-4178-9f a0-81 cf5171622d

TCGA-06-0157-01 A-01 D- 1491 -08 GBM b 1 e62d8e-24d2-4118-8cd0-3142acebdd5b

TCGA-06-0158-01 A-01 D- 1491 -08 GBM 14580533-4a0c-47ca-bb51-c233700de35c

TCGA-06-0165-01 A-01 D- 1491 -08 GBM 1728988e-0877-4194-92c5-92cl ee6c5f5b

TCGA-06-0166-01 A-01 D- 1491 -08 GBM 70157018-a3c5-4ef8-9314-f8715a3438a4

TCGA-06-0167-01 A-01 D- 1491 -08 GBM d530c696-235d-4a41 -944d-e7f7ae21 aa 17

TCGA-06-0168-01 A-01 D- 1491 -08 GBM 2b3bable-dddd-4c2c-b5ec-7bb6e700e070

TCGA-06-0169-01 A-01 D- 1490-08 GBM 06053al4-2d9a-4df0-a79b-81bda36bf3c3

TCGA-06-0171 -02 A- 11 D-2280-08 GBM 39520be3-a2af-4189-acf4-9d239363333a

TCGA-06-0173-01 A-01 D- 1491 -08 GBM 0908aacl-d3b7-4eec-96f2-a28c3738388c

TCGA-06-0174-01 A-01 D- 1491 -08 GBM 017c9167-0354-41 e4-ad50-fb38fcb5668c

TCGA-06-0178-01 A-01 D- 1491 -08 GBM a4f a779b-dl 16-4696-b 170-60f 3e215e9fb

TCGA-06-0184-01 A-01 D- 1491 -08 GBM a5a2e50f-dc7e-44cc-bffe-b675a707bf53

TCGA-06-0185-01 A-01 W-0254-08 GBM bc62d57d-b536-41ab-a344-e765fd3f7439

TCGA-06-0188-01 A-01 W-0254-08 GBM Cc0c78e7-ld76-45e6-b043-dc209bb9a32a

TCGA-06-0189-01 A-01 D- 1491 -08 GBM 25c64c53-746c-4e92-976a-8bd947fb9c7f

TCGA-06-0190-02 A-01 D-2280-08 GBM c065761 d-f775-457f-bda0-4c7c257a701 e

TCGA-06-0192-01B-01W-0348-08 GBM 43d7bc6f-be9b-4d5e-bcec-4fb30b0d9b65

TCGA-06-0195-01B-01D- 1491-08 GBM 2a2fac52-44aa-41f7-ae27-de6b7eba8ffl

TCGA-06-0209-01 A-01 D- 1491 -08 GBM b4a7de67-14b6-4b8c-abbe-9eaa990d905e

TCGA-06-0210-02 A-01 D-2280-08 GBM b60392fb-43d9-4c9c-b9 Ib-ded40492e6 lc

TCGA-06-0211 -02 A-02D-2280-08 GBM 3914c02e-44ad-4c96-8464-61 aa95b42c49

TCGA-06-0213-01 A-01 D- 1491 -08 GBM 885f9df7-fc27-43c2-9acc-833c410b2dbl

TCGA-06-0214-01 A-02D- 1491 -08 GBM 08ac57ec-0036-4134-a9bb-f22eaa27ab0d

TCGA-06-0216-01B-01D- 1492-08 GBM eac73 a02-b2e0-4601 -9bd6-aceb07594fe8

TCGA-06-0219-01 A-01 D- 1491 -08 GBM a6c6c454-058f-41ec-93c3-3cff44bedl49

TCGA-06-0221-02A-11D-2280-08 GBM b2dl7671-d2el-4c97-8b01-a976d5abeld6

TCGA-06-0237-01 A-02D- 1491 -08 GBM a50b5271 -484a-436e-ac6f-6074071015fd

TCGA-06-0238-01A-02D- 1492-08 GBM 7e8c6b9f-0fec-49ea-9ecb-c9ba 1 fb4cb74

TCGA-06-0240-01A-03D- 1491-08 GBM 20f74001-lcb8-451d-8173-5795fa93432b

TCGA-06-0241 -01 A-02D- 1491 -08 GBM 4dd4035a-c800-41b0-85c9-02531d2910ed

TCGA-06-0644-01A-02D- 1492-08 GBM 2553c4d2-5f6a-4eba-84b6-04c4761ebf5c

TCGA-06-0645-01 A-01 D- 1492-08 GBM 3f458a3c-baac-427d-b3d6-6fl5104a8886

TCGA-06-0646-01 A-01 D- 1492-08 GBM 89742b5d-0256-48c7-8d8f-41b6e5e5b561

TCGA-06-0648-01A-01W-0323-08 GBM 33f8304e-llc3-4a9d-ad21-ffea555309dc

TCGA-06-0649-01B-01W-0348-08 GBM 27af6a5f-993d-41f0-a9af-65e5a8cc41d4

TCGA-06-0650-01A-02D-1696-08 GBM 89af56db-b7f9-41d2-af62-c9b2ee7b540f TCGA-06-0686-01A-01W-0348-08 GBM 4af220fa-c00b-40bl-ae82-b2c256a3d3fe

TCGA-06-0743-01 A-01 D- 1492-08 GBM 430e6cal-d678-4373-8d8d-9d93412c8012

TCGA-06-0744-01A-01W-0348-08 GBM d80afd62-48a6-4da4-8026-e6384e86cf62

TCGA-06-0745-01A-01W-0348-08 GBM 188c837e-6389-48eb-8b77-91c8a2f099ac

TCGA-06-0747-01A-01W-0348-08 GBM 7773738f-f5dd-48ae-870c-aa89aea77450

TCGA-06-0749-01A-01W-0348-08 GBM 1121aced-04ae-4ba2-a467-c5b8445a0a76

TCGA-06-0750-01A-01W-0348-08 GBM fcl5ced3-5edl-4f88-8789-09ec713bd613

TCGA-06-0875-01A-01W-0424-08 GBM 862cc896-a0dc-4f02-9940-8c9a5016027b

TCGA-06-0876-01A-01W-0424-08 GBM c2f27319-4e84-4bl2-bcel-623ea20722be

TCGA-06-0877-01A-01W-0424-08 GBM dda2b842-fd8b-4dl4-9aa5-3cd3abc0a0el

TCGA-06-0878-01A-01W-0424-08 GBM 07869e29-9ced-4be5-9a6c-8fd3c29ae487

TCGA-06-0879-01A-01W-0424-08 GBM f96b8966-e0c2-4fb6-b3f6-e76d7953d537

TCGA-06-0881 -01 A-02W-0424-08 GBM 1069a9d0-9978-4c01-8516-947200264314

TCGA-06-0882-01A-01W-0424-08 GBM 385a3692-3208-479f-9f39-37fb65501b80

TCGA-06- 1804-01 A-01 D- 1696-08 GBM d9a 1 ff46-8d28-451 e-937f-bdad42bddd64

TCGA-06- 1806-01 A-02D- 1845-08 GBM beb40d7c-3861-4efe-9bld-34ba68a66c9d

TCGA-06-2557-01 A-01 D- 1494-08 GBM c27290e4-6835-448a-abdc-df8ddd5f4630

TCGA-06-2558-01 A-01 D- 1494-08 GBM 19f41 e2f-cff9-4f04-ba65-6d945bf05edd

TCGA-06-2559-01 A-01 D- 1494-08 GBM 8df5560b-9f8f-4636-bdb2-laf8b45dflba

TCGA-06-2561 -01 A-02D- 1494-08 GBM f9898ad3-f9b6-4061 -90ef-30e0eab0a706

TCGA-06-2562-01 A-01 D- 1494-08 GBM 6cb3467e-0ad8-4dd9-8b9b-9103629fdl6f

TCGA-06-2563-01A-01D- 1494-08 GBM 1 d81086c-bf 8b-4459-abcf- 1 f f905c6bf74

TCGA-06-2564-01 A-01 D- 1494-08 GBM 9225f366-b08b-4c43-a09f-al6b3bcfb5aa

TCGA-06-2565-01 A-01 D- 1494-08 GBM C866726d-2d95-4d23-b3d4-0e28a0b3da00

TCGA-06-2567-01 A-01 D- 1494-08 GBM d40a4861-b8c4-4fb8-815a-4e82801eedca

TCGA-06-2569-01 A-01 D- 1494-08 GBM 617eec0b-78e9-4663 -946c-c01 e7e00a7de

TCGA-06-2570-01 A-01 D- 1495-08 GBM 04339769-517c-448d-a7ca-951 f 83608c60

TCGA-06-5408-01 A-01 D- 1696-08 GBM ed8ca267-0153-475b-9154-361af62ff767

TCGA-06-5410-01 A-01 D- 1696-08 GBM 67244284-dc40-46cb-a2ac-3f4a38f7bbe4

TCGA-06-5411 -01 A-01 D- 1696-08 GBM 2fdab641-d73b-4f9a-aa4c-cl944fl31a69

TCGA-06-5412-01 A-01 D- 1696-08 GBM b6be0866-b8ae-4767-8cdc-eldd4f78f440

TCGA-06-5413-01 A-01 D- 1696-08 GBM 72cl3e51-0dd2-4e96-af37-aa471407436f

TCGA-06-5414-01 A-01 D- 1486-08 GBM 7aal6ff4-169a-4206-83dl-a2495fb56f62

TCGA-06-5415-01A-01D- 1486-08 GBM fca08ee9-b480-4dc7-be56-fleb03b56f7c

TCGA-06-5417-01A-01D- 1486-08 GBM 66350d36-6662-4d4c-9cf8-e052al7cddba

TCGA-06-5418-01A-01D- 1486-08 GBM ae28fd78-d254-46fa-abal-1353931aa414

TCGA-06-5856-01A-01D-1696-08 GBM 0bd9b573-712b-4dal-9c33-7b7f43d4af31

TCGA-06-5858-01A-01D-1696-08 GBM 951799e6- 12f0-4cf 6-8732-f2e044db7210

TCGA-06-5859-01A-01D-1696-08 GBM bb404507-ab63-4d82-99c6-f3297bffc46f

TCGA-06-6388-01 A- 12D- 1845-08 GBM c9214f8b-6684-4e29-812c-2a44963e8914

TCGA-06-6389-01A-11D-1696-08 GBM 10911471 -5404-42d5-817e-f9616e7dacfc TCGA-06-6390-01A-11D-1696-08 GBM f04b6bde-63e0-41c9-89f7-07673f9de0f6

TCGA-06-6391-01A-11D-1696-08 GBM 40fc77dc-46df-4487-925f-ld87c5326661

TCGA-06-6693-01A-11D-1845-08 GBM 45ca8f53-6d0e-4659-a8 lf-258184b7a70e

TCGA-06-6694-01 A- 12D- 1845-08 GBM b5a5717d-0e3d-4b44-82f3-5b68187beb52

TCGA-06-6695-01 A- 11 D- 1845-08 GBM 13817acd-8cle-4154-8b88-7cdc5f2660a7

TCGA-06-6697-01 A- 11 D- 1845-08 GBM 7d947ed 1-1315-459e-b973-f 3dd624d9e39

TCGA-06-6698-01 A- 11 D- 1845-08 GBM d605a279-c0ea-467c-a423-cdf21547f87e

TCGA-06-6699-01 A- 11 D- 1845-08 GBM 90ba858d-e3bb-40d8-98ee-eebl27c58409

TCGA-06-6700-01 A- 12D- 1845-08 GBM 6da42a38-94dd-49b7-8a03-df0f7174ca6f

TCGA-06-6701 -01 A- 11 D- 1845-08 GBM f ad 178f 1 -385b-4f94-bd29-567cl aa0a8fc

TCGA-08-0386-01 A-01 D- 1492-08 GBM 90bf7f8f-4b8c-410f-afa6-2b439ec82f97

TCGA- 12-0615-01 A-01 D- 1492-08 GBM a6068793-5 le4-4762-9150-cdfb030e8ade

TCGA- 12-0616-01 A-01 D- 1492-08 GBM b0e2fed7-38bd-48d8-a786-ac574c9fa5be

TCGA- 12-0618-01 A-01 D- 1492-08 GBM 390fc5e9-787e-4a3f-86c8-e3e0e7e43824

TCGA- 12-0619-01 A-01 D- 1492-08 GBM 79c65ab5-1924-4710-96e4-31e9a615a53e

TCGA- 12-0688-01 A-02D- 1492-08 GBM 143dc738- 1694-4105-8115-9cc0902ef 35b

TCGA- 12-0692-01 A-01 W-0348-08 GBM 937fb2a6-3856-4086-a327-8d8e593b7b7b

TCGA- 12-0821 -01 A-01 W-0424-08 GBM 357e3a3c-cceb-4b38-bc35-6fe8f5be5ac8

TCGA-12-1597-01B-01D- 1495-08 GBM 7d35c610-cc06-4aa5-8c96-2f7b7465069f

TCGA- 12-3649-01 A-01 D- 1495-08 GBM 2580567a-8f51-4cb7-9525-bba987c55e36

TCGA- 12-3650-01 A-01 D- 1495-08 GBM 8b 1 d52e2-489b-4972-9bef- 1690ccd2bac9

TCGA- 12-3652-01 A-01 D- 1495-08 GBM ab460bc2-e504-4b7f-8533-ab06448a55bc

TCGA- 12-3653-01 A-01 D- 1495-08 GBM fdc52d48-828e-481 f-ba 1 c-0264f 1 da38a5

TCGA- 12-5295-01 A-01 D- 1486-08 GBM 796f5741-3b2d-46e5-b74f-e5a76604a401

TCGA- 12-5299-01 A-02D- 1486-08 GBM _a44954fc-49f2-489a-8593-7de98963e4f8

TCGA-12-5301-01A-01D- 1486-08 GBM 891 fc6bc-d0a7-4064-842c-43d500b4ef5d

TCGA-14-0740-01B-01D-1845-08 GBM f49859c4-adf9-4c53-8288-8a7ad65a940d

TCGA-14-0781-01B-01D-1696-08 GBM 13878ec6-fce7-423e-b545-6656145e9d2c

TCGA-14-0786-01B-01D- 1492-08 GBM 75fa4del-29fd-4b54-b63a-add459fld69c

TCGA-14-0787-01A-01W-0424-08 GBM 184b240c-ebf 1 -4ecf-87eb-aae0718cd81 f

TCGA-14-0789-01A-01W-0424-08 GBM 3462087f-f791 -43b4-b9d9-b 11 cc48eaf9e

TCGA-14-0790-01B-01D- 1494-08 GBM d63d49a0-9413-4583-a7a5-cb2c202cc085

TCGA-14-0813-01A-01W-0424-08 GBM 754cdl9e-a319-4ddf-887b-ddca4914cdf9

TCGA-14-0817-01A-01W-0424-08 GBM a5f06dfc-e9b2-46a6-bee5-604d2839baad

TCGA-14-0862-01B-01D-1845-08 GBM f0b7d451-8190-45a4-8242-bf698f05243d

TCGA- 14-0871 -01 A-01 W-0424-08 GBM 0cc45f48-0967-42dc-8035-e76c6bd0a3fd

TCGA-14-1034-02B-01D-2280-08 GBM 7cae6c0b-36fe-411b-bbba-093a4c846d84

TCGA-14-1043-01B-11D-1845-08 GBM a439c422-8728-42f5-8dda-6e9el590478c

TCGA-14-1395-01B-11D-1845-08 GBM 8825b7a5-df ac-4e21 -b4ec-0516 lb 1341 e9

TCGA-14-1450-01B-01D-1845-08 GBM 7ec7fl74-13f6-44bl-83e3-6f35a244f00e

TCGA-14-1456-01B-01D- 1494-08 GBM e525e774-f925-41 cd-9822- 15aeeee29190 TCGA-14-1823-01A-01W-0643-08 GBM Ic3ddf6a-e496-4b87-833b-084d814b6876

TCGA-14-1825-01A-01W-0643-08 GBM f0d7cb8b-995c-419b-a366-aadbl56879bc

TCGA-14-1829-01A-01W-0643-08 GBM C69ca476-9el l-4f6e-a4f5-6952f792a580

TCG A- 14-2554-01 A-01 D- 1494-08 GBM 53dec97d-0464-4ffd-8e2e-95b2b9a03af0

TCGA- 15-0742-01 A-01 W-0348-08 GBM 3c015456-02f0-4473-be25-b53166da41ea

TCGA-15-1444-01A-02D-1696-08 GBM cbd4d4e7-f 1 c4-446c-8dbc-ce06c872ec 14

TCGA- 16-0846-01 A-01 W-0424-08 GBM cf3eb226-36c2-4498-a5cl-3fl61de6fa3f

TCGA- 16-0861 -01 A-01 W-0424-08 GBM deab6efd-8213-4f35-a897-060c605ce58b

TCGA-16-1045-01B-01W-0611-08 GBM C92cld87-0df9-4c5a-baef-2dd26ad6d75a

TCGA- 19- 1390-01 A-01 D- 1495-08 GBM d7e8e408-0a8f-4177-ad38-08c5da484ed0

TCGA-19-2619-01A-01D- 1495-08 GBM b765a4c7-4fe8-444c-95bd-6a4d03afl432

TCGA- 19-2620-01 A-01 D- 1495-08 GBM 6de41acl-229b-40b9-a494-5588c284351d

TCGA-19-2623-01A-01D- 1495-08 GBM al4ae5c3-fee0-4ed7-9080-51056ce62ef2

TCGA- 19-2624-01 A-01 D- 1495-08 GBM a8f86b64-914c-4d89-897b-33bcddl759f7

TCGA- 19-2625-01 A-01 D- 1495-08 GBM b0833912-0cb6-4d2a-bdl8-9fc211793b30

TCGA- 19-2629-01 A-01 D- 1495-08 GBM 56ffaa35-814c-4c0b-b3c6-d4514d34fec2

TCGA- 19-5947-01 A- 11 D- 1696-08 GBM d5e7dd90-ead0-40fe-94c5-bc740cb509ab

TCGA-19-5950-01A-11D-1696-08 GBM 8d6626e2-ea32-4b ld-8f2b-389294121692

TCGA-19-5951-01A-11D-1696-08 GBM 57cf584c-8c95-42ec-9cb0-707228b70010

TCGA-19-5952-01A-11D-1696-08 GBM 483cad63-ca73-4b31-b4c7-9d73f2cb4186

TCGA-19-5953-01B-12D-1845-08 GBM a0180465-3685-4735-a76e-acbeebfa635a

TCGA- 19-5954-01 A- 11 D- 1696-08 GBM Cfd4e06e-203f-4a6f-8aa9-60828e0d4d68

TCGA-19-5955-01A-11D-1696-08 GBM C8abde95-f4d7-4d48-879b-bd584eaf8a25

TCGA-19-5958-01A-11D-1696-08 GBM fd385a8e-d6dc-4e65-a023-ce485793c410

TCGA-19-5959-01A-11D-1696-08 GBM dd3e4733-7154-4162-9a61-a3a685e5f561

TCGA- 19-5960-01 A- 11 D- 1696-08 GBM b8151614-b08f-49a3-ab6f-2e780f765al7

TCG A-26- 1442-01 A-01 D- 1696-08 GBM 17e25583-886e-4dc9-802b-35e67971073d

TCGA-26-5132-01A-01D- 1486-08 GBM dl l32127-1250-43af-9cl6-425798a3dla7

TCGA-26-5133-01A-01D- 1486-08 GBM 533051f3-5ea5-41a4-8727-l ldc6d786607

TCGA-26-5134-01 A-01 D- 1486-08 GBM 11956d98-4ba5-486f-ae79-05aacebe0631

TCGA-26-5135-01A-01D- 1486-08 GBM 2ce48f01-2f61-49d9-a56a-7438bf4a37d7

TCGA-26-5136-01B-01D- 1486-08 GBM 39e0587b-lb04-4c68-8ae4-3ae7781e8017

TCGA-26-5139-01A-01D- 1486-08 GBM 8199001b-a3c9-47el-97cf-943fa8030f46

TCGA-26-6173-01A-11D-1845-08 GBM af373e42-cbbf-4a89-8479-bdd413011885

TCGA-26-6174-01 A-21 D- 1845-08 GBM 3ba04f 15-48f4-4851 -a21 f-8f a7cc9eac6b

TCGA-27-1830-01A-01W-0643-08 GBM b391392a-9865-4bf4-b5f l-fa4fb2adl 343

TCGA-27- 1831 -01 A-01 D- 1494-08 GBM 9880c3c9-5685-42a7-8fe9-7585ealald37

TCGA-27-1832-01A-01W-0643-08 GBM 7ea7ee22-55a6-4748-9607-d93 a6a367122

TCGA-27-1833-01A-01W-0643-08 GBM 4d8d34d9-7069-436c-84d6-ace5760c2aec

TCGA-27-1834-01A-01W-0643-08 GBM a6c0824e-3d2a-498a-af77-44ea96ba5ce4

TCGA-27- 1835-01 A-01 D- 1494-08 GBM 6d5fd73b-4cad-44ae-8c79-67f2b9d30328 TCGA-27-1836-01A-01D- 1494-08 GBM 8c58f090-31 a3-4b2f-93e7- 1 ae6f6d73350

TCGA-27- 1837-01 A-01 D- 1494-08 GBM 61 adl d55-21 a9-49c4-925b-54a24703 afda

TCGA-27-1838-01A-01D- 1494-08 GBM 881afld2-3fbc-44dd-8362-e6c386345cf6

TCGA-27-2518-01 A-01 D- 1494-08 GBM dae099ff-330f-492b-a06d-6f975e9e5aea

TCGA-27-2519-01 A-01 D- 1494-08 GBM b0daafab-b783-4cfc-9f7d-8017d98e80bb

TCGA-27-2521 -01 A-01 D- 1494-08 GBM 3678d5f3-9a29-4750-b0a9-20e971ff6aa4

TCGA-27-2523-01 A-01 D- 1494-08 GBM d60f54f5-b 154-42c4-99fb-cea4e7a33dc7

TCGA-27-2524-01 A-01 D- 1494-08 GBM ce679bfd-fbf9-4c78-822e-37d2322d544b

TCGA-27-2526-01 A-01 D- 1494-08 GBM be 1 abcb7-b4e9-4447-b0c5-0fc09401 eecO

TCGA-27-2527-01 A-01 D- 1494-08 GBM b8b00995-ada6-493b-bafc-0f6c9def41c9

TCGA-27-2528-01 A-01 D- 1494-08 GBM 374cbd87-428e-4509-85cl-b7d3302c30a0

TCGA-28- 1747-01 C-01 D- 1494-08 GBM 7c746081-acl4-4ae2-9564-d67d52f2627c

TCGA-28- 1753-01 A-01 D- 1494-08 GBM C7143fle-458c-4129-aa91-61b8e4b90e53

TCGA-28-2499-01 A-01 D- 1494-08 GBM 28583f40-c3fc-4213-91cl-99d7d536551e

TCGA-28-2501 -01 A-01 D- 1696-08 GBM 2a2cb25d-4069-4824-b09d-2d49634ed284

TCGA-28-2502-01B-01D- 1494-08 GBM 707466c8-138a-4ed0-b806-6579464595cb

TCGA-28-2509-01 A-01 D- 1494-08 GBM f4a62fe0-cee2-487a-9a8a-4cd98d8380df

TCGA-28-2510-01 A-01 D- 1696-08 GBM 5f2dc303-9859-4b63-8aab-c387da4b2ccl

TCGA-28-2513-01 A-01 D- 1494-08 GBM 52ddl50e-abd7-4fd2-abe9-09428c5a610c

TCGA-28-2514-01 A-02D- 1494-08 GBM 6eef4a0e-3fef-4529-8193-21b380d96344

TCGA-28-5204-01 A-01 D- 1486-08 GBM e9590ee4-92d8-4afb-908e-0c816d2b82f3

TCGA-28-5207-01 A-01 D- 1486-08 GBM 2d795al6-bdc3-44f0-8c01-6eeec0ela0bl

TCGA-28-5208-01A-01D- 1486-08 GBM 76209124-b3f0-4bb2-8b2c-e268abdefe2b

TCGA-28-5209-01 A-01 D- 1486-08 GBM ef8b63f3-b820-46ac-a99c-3d401a6203d7

TCGA-28-5211 -01 C- 11 D- 1845-08 GBM f 8dc846b- lb 17-4699 -9dc5-3f79e21 eee94

TCGA-28-5213-01A-01D- 1486-08 GBM b866e742-5ed0-4d7d-b96c-52f8f6f37142

TCGA-28-5214-01A-01D- 1486-08 GBM C992e603-30c9-4e30-a425-8050189db4f8

TCGA-28-5215-01A-01D- 1486-08 GBM 34c77b5d-c3a6-4e83-96f4-fadd729362d9

TCGA-28-5216-01A-01D- 1486-08 GBM Cde8518a-ce8e-4b54-ab21-5ad4171ablb3

TCGA-28-5218-01A-01D- 1486-08 GBM 68008a98-3889-4dd2-bcf9-flf6cbca6355

TCGA-28-5219-01A-01D- 1486-08 GBM f016e9f7-66a3-4f50-b9cd-58blc8a955e9

TCGA-28-5220-01 A-01 D- 1486-08 GBM f7b80486-fal9-49c7-8ace-ea61338677d7

TCGA-28-6450-01 A- 11 D- 1696-08 GBM 5fl0d0c5-05b8-44bb-98ce-bbea41820850

TCGA-32- 1970-01 A-01 D- 1494-08 GBM 65723119-bdfe-46f0-b629-c 171023 abd71

TCGA-32- 1979-01 A-01 D- 1696-08 GBM 0c81 ebb9-20a6-40cl -9be2- 17b99517e988

TCGA-32-1980-01A-01D-1696-08 GBM 9b267205-1994-46ff-8d0f-56625dae7clb

TCGA-32- 1982-01 A-01 D- 1494-08 GBM 9cf7c4cb-cel9-4b79-9163-b74369603e22

TCGA-32- 1986-01 A-01 D- 1494-08 GBM 5afe3ffc-ba3a-49bb-9837-091b600cbb35

TCGA-32-2615-01A-01D- 1495-08 GBM 65e3c804-b 1 a3-4e21 -9407-90a6edc4e290 TCGA-32-2632-01A-01D- 1495-08 GBM 27203el 8-af27-478c-a224-8bca77a8 lc90

TCGA-32-2634-01A-01D- 1495-08 GBM 52b2al l4-4f8c-4e02-af9d-24c4a05d4ca0

TCGA-32-2638-01A-01D- 1495-08 GBM 1 e 103221 -ab46-4a5c-9b96-5e34f0d49fc2

TCGA-32-5222-01A-01D- 1486-08 GBM f48abf4d-flfb-48bf-97al-0c38435b6af7

TCGA-41 -2571 -01 A-01 D- 1495-08 GBM 36349a22-17eb-48d8-9b69-1921ee7576ff

TCGA-41 -2573-01 A-01 D- 1495-08 GBM fadc9e2a-d97d-4e86-a814-4f32f8cfd7a5

TCGA-41 -2575-01 A-01 D- 1495-08 GBM 4943e80a-d098-49cd-8261-ld53d42f8223

TCGA-41 -3392-01 A-01 D- 1495-08 GBM c08b37a5-9938-4ab0-8183-d73b01cb9a89

TCGA-41 -5651 -01 A-01 D- 1696-08 GBM 5fd77ba9-5015-4d8b-86a0-582e5c76bdd6

TCGA-41 -6646-01 A- 11 D- 1845-08 GBM 6272bb0c-c47b-4cd2-9f59-398fla75f020

TCGA-74-6573-01 A- 12D- 1845-08 GBM 0941 e50e- 1205-49ed-8735- 1 f 86eaf 87718

TCGA-74-6575-01 A- 11 D- 1845-08 GBM f4ec96d6-d7fc-4892-9a36-80802f387al2

TCGA-74-6577-01 A- 11 D- 1845-08 GBM 5bel42d5-b6f7-4ele-ae75-49b302b332a2

TCGA-74-6578-01 A- 11 D- 1845-08 GBM a2ae2128-4d95-4261 -a30d-bd6be58de8e0

TCGA-74-6584-01 A- 11 D- 1845-08 GBM cedd2d49-371b-4bl2-8aac-6a9bd38f2ccb

TCGA-76-4925-01A-01D- 1486-08 GBM Ca2fa3da-18d6-4e8b-8081-b07022ead6a8

TCGA-76-4926-01B-01D- 1486-08 GBM 3c93cb58-d39b-4a5e-907a-8b5438630d21

TCGA-76-4927-01A-01D- 1486-08 GBM 2dc69425-dbfd-4228-ab78-541062b5c445

TCGA-76-4928-01B-01D- 1486-08 GBM 6e30f277-875e-4ab8-bc7c-0a5121cde6dl

TCGA-76-4929-01A-01D- 1486-08 GBM af4f8b89-837a-48b7-b0e7-12aec23fc285

TCGA-76-4931-01A-01D- 1486-08 GBM d4a27742-ca69-4f54-9bce-ec33d8481 fed

TCGA-76-4932-01A-01D- 1486-08 GBM 81656daa-af7c-430c-afa3-0eb 10eb9a695

TCGA-76-4934-01A-01D- 1486-08 GBM e9bc4701-562e-4d35-a949-53a61fd96651

TCGA-76-4935-01A-01D- 1486-08 GBM c8d06abf-437d-4bc9-804b-44345af74f36

TCGA-76-6191-01A-12D-1696-08 GBM 4dbf66ef-4108-4a86-a8eb-6ba8cdefb4a2

TCGA-76-6192-01A-11D-1696-08 GBM c29754bc-44e8-4980-98al-b8d69700f4a3

TCGA-76-6193-01A-11D-1696-08 GBM 6a751d65-5fcf-4c03-8253-8flb8faccab2

TCGA-76-6280-01 A-21 D- 1845-08 GBM 9096e339-7730-4d7a-acab-a6c4d26c52c3

TCGA-76-6282-01A-11D-1696-08 GBM Ic7f63d2-a2a4-42c3-928b-319695a66443

TCGA-76-6283-01A-11D-1845-08 GBM a4083f8b-0c39-4d65-a372-b494caf84f8d

TCGA-76-6285-01A-11D-1696-08 GBM 28380a2f-d302-45fb-a4c5-31b2fdl50bc3

TCGA-76-6286-01 A- 11 D- 1845-08 GBM 45d03116-6cff-4074-9c26-2e5f 1 a8854d3

TCGA-76-6656-01A-11D-1845-08 GBM fe66fl la-e03d-49c5-befe-db74ef55ce61

TCGA-76-6657-01A-11D-1845-08 GBM 6ba47878-126c-420d-b3cl-ca7ea8cl82d0

TCGA-76-6660-01A-11D-1845-08 GBM f4960945-c464-49c2-8ad6-d73a6fa47b20

TCGA-76-6661-01B-11D-1845-08 GBM 8329c910-7ccf-4e84-b468-bd6cf23327a2

TCGA-76-6662-01A-11D-1845-08 GBM 7f7c80ca-6ad9-4820-83ca-5248b3873eea

TCGA-76-6663-01A-11D-1845-08 GBM 624864ad-3178-4a6d-a0cf-7fa3e9bdf8da

TCGA-76-6664-01A-11D-1845-08 GBM 6a8fl7c6-060d-492e-8a39-53d9ac7035a4

TCGA-81-5910-01A-11D-1696-08 GBM bcf79a66-30e6-4554-982e-38d8eab46114

TCGA-81 -5911 -01 A- 12D- 1845-08 GBM a501e01b-249c-43cb-aee2-f355c3c697dd TCGA-87-5896-01A-01D-1696-08 GBM 640c33a6-a7df-4dba-9c21-367a9a839fOf

TCGA-B A-4074-01 A-01 D- 1434-08 HNSC 2c84e904-0cbc-4645-b7e5-94ec45e61268

TCGA-B A-4075-01 A-01 D- 1434-08 HNSC 5b3fec35-dl27-4cb5-859b-edac003acdf3

TCGA-B A-4076-01 A-01 D- 1434-08 HNSC 93dda6a6-907d-4dc2-9391-36dd09c767c6

TCGA-B A-4077-01 B-01 D- 1434-08 HNSC 9b37211a-2150-4d33-bc6a-9d6a0a429708

TCGA-B A-4078-01 A-01 D- 1434-08 HNSC f02d0332-d7c8-4d2a-98ca-dbe7826437ae

TCGA-B A-5149-01 A-01 D- 1512-08 HNSC 6e98841c-ce33-4b7e-882d-ce65707d4cl0

TCGA-B A-5151 -01 A-01 D- 1434-08 HNSC dacl5d7e-3930-4fcb-b752-4a4f00449ddd

TCGA-B A-5152-01 A-02D- 1870-08 HNSC 18da68fd-3bfb-45a3-ba28-4c90555b4e68

TCGA-B A-5153-01 A-01 D- 1434-08 HNSC 363ccc6f-dabO-413 e-bc42-d738ee25abcd

TCGA-B A-5555-01 A-01 D- 1512-08 HNSC 65dcl531-713b-41ba-a567-caal2340cOcf

TCGA-B A-5556-01 A-01 D- 1512-08 HNSC d31fda32-363b-44e4-8f2c-834a66f46b87

TCGA-B A-5557-01 A-01 D- 1512-08 HNSC 7caa2a2f-3b77-46f0-9886-37f6e4278d83

TCGA-B A-5558-01 A-01 D- 1512-08 HNSC 97a47f a4-c857-4483-9572-07012c 1 Oe9d5

TCGA-B A-5559-01 A-01 D- 1512-08 HNSC c0845927-fc9a-41b2-9431-619952878el8

TCGA-BA-6868-01B-12D-1912-08 HNSC 51647474-f538-4e96-babd-e742flfb793f

TCGA-B A-6869-01A-11D-1870-08 HNSC b78a2501-f312-41a2-abl9-7cl8d8dfbac6

TCGA-B A-6870-01 A- 11 D- 1870-08 HNSC 2fdd3f42-cb2f-4faf-8a47-b8bfee058265

TCGA-B A-6871 -01 A- 11 D- 1870-08 HNSC a8a04117-0ebc-4c27-83d6-441be47e5fd3

TCGA-B A-6872-01 A- 11 D- 1870-08 HNSC 182b2a39-488 l-402a-a907-b51 aal 14584a

TCGA-B A-6873-01A-11D-1870-08 HNSC f 65b842c-257e-4ac7-al 55-23d3 ac 12d41 c

TCGA-B A-7269-01 A- 11 D-2012-08 HNSC 2e8ffdfc-48f5-41 eO-9192-d761 f 3b518ef

TCGA-BB-4217-01 A- 11 D-2078-08 HNSC 5916efl9-7838-4621-a869-de8c2b34931c

TCGA-BB-4223-01A-01D-1434-08 HNSC c4799ee4-3014-4b2f-ba7e-9771 ab5dc3f 1

TCGA-BB-4224-01A-01D-1434-08 HNSC cf a7d658-031 d-4cd4-9ca3-ceaa201 f702d

TCGA-BB-4225-01 A-01 D- 1434-08 HNSC 85fb5611-0dee-4a73-8aal-1629ad929173

TCGA-BB-4227-01 A-01 D- 1870-08 HNSC clb315bb-773b-4fd0-88ec-dll044996adc

TCGA-BB-4228-01 A-01 D- 1434-08 HNSC 6fd93146-1026-4362-982b-dlfc70e3c65d

TCGA-BB-7861-01A-11D-2229-08 HNSC 77cb5c69-fl5e-45de-a060-0e8b52648209

TCGA-BB-7862-01A-21D-2229-08 HNSC 84c57a23-1428-488e-9275-9f2bc3673476

TCGA-BB-7863-01A-11D-2229-08 HNSC Obf356d5-1259-4042-9860-2f793f5fe32c

TCGA-BB-7864-01A-11D-2229-08 HNSC Id6324a3-8bb4-45dl-89b3-134ffca01aec

TCGA-BB-7866-01A-11D-2229-08 HNSC 8d6ae619-b33e-453c-aa6d-ddal4cd5a337

TCGA-BB-7870-01A-11D-2229-08 HNSC d584f4ec-09b0-40fe-bba2-256b6cf6974e

TCGA-BB-7871-01A-11D-2229-08 HNSC 8el3f8a5-5d80-4e34-bffa-54ae808114e7

TCGA-BB-7872-01A-11D-2229-08 HNSC C05cb0b5-b288-48fb-bdc0-ee9acd6643a8

TCGA-CN-4723-01 A-01 D- 1434-08 HNSC d5d71 c48- 1 a2d-4d7d-8f2c-e3 a68352776b

TCGA-CN-4725-01 A-01 D- 1434-08 HNSC 57ffef9d-193b-48f6-8d5b-3c2eca854d93

TCGA-CN-4726-01 A-01 D- 1434-08 HNSC 2201e681-a727-4fd2-adec-cbcb543b2232

TCGA-CN-4727-01 A-01 D- 1434-08 HNSC b24fc60a-fe83-4743-a6d3-d90b807412el

TCGA-CN-4728-01 A-01 D- 1434-08 HNSC e450fec8-66dd-4798-8197-4206b8ba7c4d TCGA-CN-4729-01 A-01 D- 1434-08 HNSC 7240e742-9315-4fb 8-b6f7-28bfe6941 Oa8

TCGA-CN-4730-01 A-01 D- 1434-08 HNSC 543bbfe3-4al l-49af-b445-303f0912bfc3

TCGA-CN-4731 -01 A-01 D- 1434-08 HNSC 31ffd2d8-ee97-4002-9737-08c044878ace

TCGA-CN-4733-01 A-02D- 1870-08 HNSC 12880a34-83dl-4075-b62a-9fc61dl8ca09

TCGA-CN-4734-01 A-01 D- 1434-08 HNSC fd54bbfa-62a2-4d8b-88fb-b74b91elb958

TCGA-CN-4735-01 A-01 D- 1434-08 HNSC 369ebdf4-ee27-414d-978d-3698711 f ae98

TCGA-CN-4736-01 A-01 D- 1434-08 HNSC 788337f5-722c-45d6-8ca4-8037c489cb64

TCGA-CN-4737-01 A-01 D- 1434-08 HNSC 4c6857bb-f20f-4ac9-9c2c-cb83c5387a74

TCGA-CN-4738-01 A-02D- 1512-08 HNSC Id3bl6fd-f98b-45ef-a423-861975f098b6

TCGA-CN-4739-01 A-02D- 1512-08 HNSC 7d6cc6ef-6bb0-44ab-bacl -c8f7198d 1 d8a

TCGA-CN-4740-01 A-01 D- 1434-08 HNSC 40308868-8d79-484b-85a4-257142763d72

TCGA-CN-4741 -01 A-01 D- 1434-08 HNSC 3486c689-d7ae-4ce8-8df5-ac827 lb466 Id

TCGA-CN-4742-01 A-02D- 1512-08 HNSC 1 f a89bda-b719-445 a-85d2-76ce8c484b 15

TCGA-CN-5355-01 A-01 D- 1434-08 HNSC 0d93e8bc-69d5-47aa-b4bb-bf7b0ade92d6

TCGA-CN-5356-01A-01D-1434-08 HNSC aadl3fa4-b2e7-4c89-9936-57cf7a5el6a4

TCGA-CN-5358-01 A-01 D- 1512-08 HNSC 498c0blf-678f-4f70-b0dl-aad89bfa2a23

TCGA-CN-5359-01 A-01 D- 1434-08 HNSC dcfle53d-22dc-4bl l-9b3f-e421bc28b835

TCGA-CN-5360-01 A-01 D- 1434-08 HNSC 174flea8-abcf-44ee-bl7b-9687b3ab6dae

TCGA-CN-5361 -01 A-01 D- 1434-08 HNSC 5eea0205-e539-48de-b94c-4bb68c74ec96

TCGA-CN-5363-01A-01D-1434-08 HNSC 203f8426-6ec5-427a-9ccf-ec2b4683504d

TCGA-CN-5364-01 A-01 D- 1434-08 HNSC 22078e53-2c9e-4ae4-al66-34488f259ee8

TCGA-CN-5365-01 A-01 D- 1434-08 HNSC a419a54c-58b4-4682-aaca-ed85697dd2a0

TCGA-CN-5366-01 A-01 D- 1434-08 HNSC 161342fd-4cf a-4fc8-9708-7bb815b 137c6

TCGA-CN-5367-01 A-01 D- 1434-08 HNSC 57adb398-48c5-4al4-a43e-f79al9befbda

TCGA-CN-5369-01 A-01 D- 1434-08 HNSC 4c8e6937-9fd7-41cc-ac74-d8b75235d4b3

TCGA-CN-5370-01 A-01 D-2012-08 HNSC f4ca6755-68ca-4702-b08b-65005d31e9be

TCGA-CN-5373-01A-01D-1434-08 HNSC 00988676-le9b-4e00-b4aa-a8f86c21b206

TCGA-CN-5374-01 A-01 D- 1434-08 HNSC 28d5a97b-3f3d-4595-9034-8491999fcf40

TCGA-CN-6010-01A-11D-1683-08 HNSC 2d9693f3-0917-42be-97b8-4dcl5cc4d3f6

TCGA-CN-6011-01A-11D-1683-08 HNSC 0e0aa5da-2cb2-47b8-b000-83a07d68ed29

TCGA-CN-6012-01A-11D-1683-08 HNSC c5d99faa-ef68-4f08-af97-d722bcc383f5

TCGA-CN-6013-01A-11D-1683-08 HNSC 992de9b5-c394-48e7-b4e3-4c4aeacb4a23

TCGA-CN-6016-01A-11D-1683-08 HNSC fcb6e29c-864d-483f-a848-8a61202d9516

TCGA-CN-6017-01A-11D-1683-08 HNSC 7cd89cbe-6bd9-41a2-a042-345fa0a09866

TCGA-CN-6018-01A-11D-1683-08 HNSC 33815edd-bb4f-4f05-bc82-94eafe423652

TCGA-CN-6019-01A-11D-1683-08 HNSC 00769a89-ffc5-46f5-a42e-25b3eae886c2

TCGA-CN-6020-01A-11D-1683-08 HNSC 1 f 33c4c7-4f08-44a2-91 f5-7ed2d7da68f0

TCGA-CN-6021-01A-11D-1683-08 HNSC e62a2c4d-18e3-4ec8-8d93-40e055e65be4

TCGA-CN-6022-01A-21D-1683-08 HNSC 90cd2296-7133-4cbe-99cb-84b084eb88cd

TCGA-CN-6023-01A-11D-1683-08 HNSC d03b8f96-c932-4abf-b508-f4elb50739ee

TCGA-CN-6024-01A-11D-1683-08 HNSC 0604584e-0654-4b00-94fc-45e76588000c TCGA-CN-6988-01A-11D-1912-08 HNSC 230b06a8-5f 6e-41 db-bb59- 19e4e6c9af af

TCGA-CN-6989-01 A- 11 D- 1912-08 HNSC 61 cd2198-d85e-4eae-b9c6-e36be372595b

TCGA-CN-6992-01 A- 11 D- 1912-08 HNSC 7a70356c-74a3-40c3-bd32-3049da642831

TCGA-CN-6994-01 A- 11 D- 1912-08 HNSC 157b67ad-f092-4ea3-b557-0406839e6905

TCGA-CN-6995-01 A- 31 D-2012-08 HNSC C0b6813d-4b3e-479e-81a7-le5c2de89b0d

TCGA-CN-6996-01 A- 11 D- 1912-08 HNSC c063bec5-c716-4ea2-843 a-e9fObec3b540

TCGA-CN-6997-01 A- 11 D-2012-08 HNSC Hb531cc-d9d9-496a-8448-e654ba71c414

TCGA-CN-6998-01 A-23D-2012-08 HNSC 9c364f7e-5b90-44ef-9f80-250e428989ef

TCGA-CQ-5323-01A-01D-1683-08 HNSC 892067ef-c465-46ea-8f91-10636dd0081b

TCGA-CQ-5324-01A-01D-1683-08 HNSC 67bl84fe-c4f4-49f3-938e-5370eb6246b9

TCGA-CQ-5325-01A-01D-1683-08 HNSC 22b6abf5-aad8-46ab-9b87-e3cl2309cb59

TCGA-CQ-5326-01 A-01 D- 1870-08 HNSC 199249f9-808d-4565-bb6b-82724f61edaa

TCGA-CQ-5327-01A-01D-1683-08 HNSC da 19d7bc-9748-4cd4-bd54-4792894838fO

TCGA-CQ-5329-01A-01D-1683-08 HNSC 5aa9b6fc-4169-4346-98fb-4c711d08d701

TCGA-CQ-5330-01A-01D-1683-08 HNSC 4ce7e702-9b62-459e-b2b4-a26cabba3a93

TCGA-CQ-5331 -01 A-02D- 1870-08 HNSC d2c2d3db-dbc0-44fl-b625-17f3f819cl22

TCGA-CQ-5332-01A-01D-1683-08 HNSC 4fdf4f0d-0a55-4b5e-8545-65flaad37cl0

TCGA-CQ-5334-01A-01D-1683-08 HNSC 39978192-2119-4910-a2f6-53834a2blbf2

TCGA-CQ-6218-01 A- 11 D- 1912-08 HNSC d3717097-7cdb-446f-a020-78c770362656

TCGA-CQ-6219-01 A- 11 D- 1912-08 HNSC c6263b94-0ffe-40e7-9184-deb427c67802

TCGA-CQ-6220-01 A- 11 D- 1912-08 HNSC 65e67eda-16a4-4dfd-94a9-546c76d94a02

TCGA-CQ-6221 -01 A- 11 D-2078-08 HNSC d6166f0d-c0b5-44a3-814d-0c94c5bc41b0

TCGA-CQ-6222-01 A- 11 D- 1912-08 HNSC de2c492f-5cd8-4330-a5de-36f693ec31af

TCGA-CQ-6223-01 A- 11 D- 1912-08 HNSC be7cb5b4-ld09-479c-8bf2-a9e7abde575f

TCGA-CQ-6224-01 A- 11 D- 1912-08 HNSC c03d51 aO-8731 -430d-a792-280e01629e8f

TCGA-CQ-6225-01 A- 11 D- 1912-08 HNSC cd311590-3c69-4ff 2-8fbd-cb5b0f21975e

TCGA-CQ-6227-01 A- 11 D- 1912-08 HNSC ca62509e-d477-41 ca-9bc2-3f20c2dd4e49

TCGA-CQ-6228-01 A- 11 D- 1912-08 HNSC 655e502b- 1 a6e-4eab-a948-4120d6c31 c29

TCGA-CQ-6229-01 A- 11 D- 1912-08 HNSC 07e76152-9e83-42a5-911 l-c39a2310a2e4

TCGA-CQ-7065-01 A- 11 D-2078-08 HNSC 64c422bb-a531 -4636-8e68-bdaf212df 6dc

TCGA-CQ-7067-01 A- 11 D-2229-08 HNSC 01f46aa2-el5b-4544-add5-c783868b6c26

TCGA-CQ-7068-01 A- 11 D-2078-08 HNSC 97a96e61-f2dc-4af4-807a-3925clffbf43

TCGA-CR-5243-01 A-01 D- 1512-08 HNSC 297e8b35-5b8b-4d5b-b812-86165f949a20

TCGA-CR-5247-01 A-01 D-2012-08 HNSC 3b5b07b4-29ef-4a55-b6ab-93352613f631

TCGA-CR-5248-01 A-01 D-2012-08 HNSC e5af63d7-e8b2-4a76-8b39-6ee652ad8e5f

TCGA-CR-5249-01 A-01 D- 1512-08 HNSC 42bf9ca3-47d8-45ff-bccf-bda80af58d22

TCGA-CR-5250-01 A-01 D- 1512-08 HNSC 49e54f5a-9b3a-47ff-b6cc-aleaf54fdl36

TCGA-CR-6467-01 A- 11 D- 1870-08 HNSC 2a7f5al6-9330-45al-9024-lcfflcdb5714

TCGA-CR-6470-01 A- 11 D- 1870-08 HNSC 30bc4dle-f0cb-44c5-a32c-b4b690cd6cc5

TCGA-CR-6471 -01 A- 11 D- 1870-08 HNSC c087e87f-867c-45dd-8645-5ab774e4827c

TCGA-CR-6472-01 A- 11 D- 1870-08 HNSC 52fl2c71-2473-4411-aad6-318a3496e82c TCGA-CR-6473-01A-11D-1870-08 HNSC 9f3396aO-a38d-4069-b65a-c4c4dd6187ad

TCGA-CR-6474-01 A- 11 D- 1870-08 HNSC 6b4369el-cf03-4a40-9a66-fc67bfb946b3

TCGA-CR-6477-01 A- 11 D- 1870-08 HNSC e02f3646-a500-478 l-ad44-2f62661 a883d

TCGA-CR-6478-01 A- 11 D- 1870-08 HNSC c21f40c6-4260-4def-8cca-lcl l895b35b0

TCGA-CR-6480-01 A- 11 D- 1870-08 HNSC 7ee5501e-5463-4481-b798-3d23bfb4fl l3

TCGA-CR-6481 -01 A- 11 D- 1870-08 HNSC 5e7d2531-81cl-48bb-9cOa-1867dlf83f92

TCGA-CR-6482-01 A- 11 D- 1870-08 HNSC 684bcd80-30fb-49e5-b72a-09502a9dl468

TCGA-CR-6484-01 A- 11 D- 1870-08 HNSC e72df726-1575-4789-afac-3bl5a7643401

TCGA-CR-6487-01 A- 11 D- 1870-08 HNSC d4df06d7-97e 1 -4f22-83 a7-993fdcd3 a4da

TCGA-CR-6488-01 A- 12D-2078-08 HNSC 8bfa9606-b24d-4803-b551-2e86fb02ae5e

TCGA-CR-6491 -01 A- 11 D- 1870-08 HNSC a32853ad-b6a3-4147-ae5a-f48fad71581e

TCGA-CR-6492-01 A- 12D-2078-08 HNSC d4550d39-4f32-48ab-b049-2fe623332d07

TCGA-CR-6493-01A-11D-1870-08 HNSC f061 abfa-4554-4328-9e8f-b84dd2aa4b45

TCGA-CR-7364-01A-11D-2012-08 HNSC f5047f 1 e-5088-4d30-927d-e64147fe661 d

TCGA-CR-7365-01 A- 11 D-2012-08 HNSC ecl l4413-a950-4e74-abc8-98857af8b9ad

TCGA-CR-7367-01 A- 11 D-2012-08 HNSC b82e34db-7b0e-4bbd-bc42-ba063ac42409

TCGA-CR-7368-01 A- 11 D-2129-08 HNSC 4b 194ab3-d213-4a7a-be46-909b4f0c7291

TCGA-CR-7369-01 A- 11 D-2129-08 HNSC fl6a5c08-c9f8-442e-bal3-45681cacda40

TCGA-CR-7370-01 A- 11 D-2129-08 HNSC 9f8ec337-85f7-4b01-a2b6-5db9a9e62f30

TCGA-CR-7371-01A-11D-2012-08 HNSC 68201be8-ala9-4c78-ad99-3c767ca8366b

TCGA-CR-7372-01A-11D-2012-08 HNSC 9032c525-9bed-47f9-b9f2-ecce4593ea37

TCGA-CR-7373-01A-11D-2012-08 HNSC 9blf5f6d-503c-4933-944a-b4fdlcc3fa93

TCGA-CR-7374-01A-11D-2012-08 HNSC 2cf33b63-464e-49aO-88fO-6a6d5b0393c4

TCGA-CR-7376-01 A- 11 D-2129-08 HNSC a6b 11 f 68-79da-4542-818d-f404116cObf 8

TCGA-CR-7377-01 A- 11 D-2012-08 HNSC 93e4eb9a-7643-411b-be90-94b801f23566

TCGA-CR-7379-01 A- 11 D-2012-08 HNSC 8cc45c01-a363-4151-9ea0-32c404b79da4

TCGA-CR-7380-01 A- 11 D-2012-08 HNSC ac968fdd-970b-41fc-99f7-5670c741bc06

TCGA-CR-7382-01 A- 11 D-2129-08 HNSC fdde6828-b9f4-4648-a86b-157c5d46abb2

TCG A-CR-7383 -01 A- 11 D-2129-08 HNSC 203629ed-2791 -4e22-a9da-be647b0cdef5

TCGA-CR-7385-01 A- 11 D-2012-08 HNSC 2c00b622-c4a4-4862-bl4a-a97b7261f46f

TCGA-CR-7386-01A-11D-2012-08 HNSC dac99486-00bc-41 ad-92b4-8bed 1 a28b 122

TCGA-CR-7388-01A-11D-2012-08 HNSC 3eddb2ad-6c75-4ae7-9d27-8ec0e7b4aa55

TCGA-CR-7389-01 A- 11 D-2012-08 HNSC 37149937-813 l-4dbf-916b-d599d203eba7

TCGA-CR-7390-01A-11D-2012-08 HNSC 714399af-e425-43bb-a82a-b62ca6fd735d

TCGA-CR-7391-01A-11D-2012-08 HNSC 7236609c-34dd-425a-b882-2dff36983f7b

TCGA-CR-7392-01A-11D-2012-08 HNSC 0616d3e5-9641-4329-a65a-19f4c6918elc

TCGA-CR-7393-01A-11D-2012-08 HNSC f59efld2-2fc0-44a0-9d2f-c4efd9e79f5d

TCGA-CR-7394-01A-11D-2012-08 HNSC Ife9a612-4c9a-432d-bl75-eld8bdbc7c56

TCGA-CR-7395-01 A- 11 D-2012-08 HNSC bdOblbl6-ee20-48e5-bel l-70eac9cl5630

TCGA-CR-7397-01 A- 11 D-2012-08 HNSC b93863c2-4657-4ca2-8fce-094fe5dfl63a

TCGA-CR-7398-01A-11D-2012-08 HNSC 12c391 dc-3138-4e73-bdc7-b06512dd0f a7 TCGA-CR-7399-01 A- 11 D-2012-08 HNSC Oa76bal5-f6e5-484f-8a52-9be8351ebdb7

TCGA-CR-7401 -01 A- 11 D-2012-08 HNSC f8d6968c-2648-4dcf-a0da-77e46878581c

TCGA-CR-7402-01 A-l 1D-2012-08 HNSC 015blcc4-6fa5-43cl-9444-4alaf7663f7e

TCGA-CR-7404-01 A- 11 D-2129-08 HNSC Icla8920-9163-4d56-a982-61c4e792cee7

TCGA-CV-5430-01A-02D-1683-08 HNSC 4dfcbe35-9e78-4629-8a00-96fee7062dle

TCGA-C V-5431 -01 A-01 D- 1512-08 HNSC fla234f0-8890-4cf3-891f-c7a7423ble75

TCGA-CV-5432-01A-02D-1683-08 HNSC 9 le9ac70-5524-4b 13-9d53-7cec52b38ea5

TCGA-C V-5434-01 A-01 D- 1683-08 HNSC 69ef7b45-cdOe-4d59-aOee-35a8c830120c

TCGA-CV-5435-01A-01D-1683-08 HNSC ec0a719b-3c3a-4797-9ec5-90d3474da727

TCGA-C V-5436-01 A-01 D- 1512-08 HNSC 34dc613e-e4b4-4897-ac4b-l 3ff46e46d7e

TCGA-CV-5439-01A-01D-1683-08 HNSC 42a06486-b084-4497-8fe0-a8cffl94e020

TCGA-C V-5440-01 A-01 D- 1512-08 HNSC 5f5ba5a9-8089-4fe7-92e3-6c31c5fb32d4

TCGA-C V-5441 -01 A-01 D- 1512-08 HNSC f57f2873-a4ae-4fc0-9d4c-elf4ef47482e

TCGA-C V-5442-01 A-01 D- 1512-08 HNSC 4d42594f-cl f4-45ed-8bd2-7701 f914d33c

TCGA-C V-5443-01 A-01 D- 1512-08 HNSC 9d279797-4464-4ef5-8858-640978ccc258

TCGA-C V-5444-01 A-02D- 1512-08 HNSC cf975479- 13 lb-4b37-927e-cacb If 13e62d

TCGA-CV-5966-01A-11D-1683-08 HNSC 24ad5336-f5ee-49c0-al76-48411285fbe8

TCGA-CV-5970-01A-11D-1683-08 HNSC a52dcl5f-d06d-46ed-a73e-aa004a2a736a

TCGA-CV-5971-01A-11D-1683-08 HNSC 881 a530b-fdd2-4674-b95d-fded0dfce4ff

TCGA-CV-5973-01A-11D-1683-08 HNSC b848fbad-leb3-4bc2-9006-2d0ca559cee8

TCGA-CV-5976-01A-11D-1683-08 HNSC 7b643ce3-43bc-4al4-942a-0d6fcffa0312

TCGA-CV-5977-01A-11D-1683-08 HNSC 81f3c96a-54bb-4629-a64e-7c8dae66el la

TCGA-CV-5978-01A-11D-1683-08 HNSC 791d4f3f-90e0-4fa5-9671-9b5f04ed3eca

TCGA-CV-5979-01A-11D-1683-08 HNSC C2c31b58-c5b3-4fc3-be99-b978d2961f86

TCGA-CV-6003-01A-11D-1683-08 HNSC 9a040a5e-3d2b-433a-9786-7c26b433c0c2

TCGA-CV-6433-01A-11D-1683-08 HNSC 16b220fa-a554-43c9-85bO-315331e5ba6e

TCGA-CV-6436-01A-11D-1683-08 HNSC a5214457-3a86-4b29-bll6-3baaa0aa5099

TCGA-CV-6441-01A-11D-1683-08 HNSC 22b32736-3b91-4542-affa-46fa90819e69

TCGA-C V-6933-01 A- 11 D- 1912-08 HNSC 8ef4b02e-4d34-4d58-aa2d-65a7f73982d5

TCGA-C V-6934-01 A- 11 D- 1912-08 HNSC f5abf385-0372-4faa-9558-8bf02381b68b

TCGA-C V-6935-01 A- 11 D- 1912-08 HNSC fdcOebce-5ba2-4cl8-b594-50b33ef6dl l6

TCGA-C V-6936-01 A- 11 D- 1912-08 HNSC 2d4bdd75-d967-40b2-b55d-99e59cc7e 125

TCGA-C V-6937-01 A- 11 D-2012-08 HNSC Ic78a20e-150f-4cl2-8abe-b941f90e730f

TCGA-C V-6938-01 A- 11 D- 1912-08 HNSC bldcb76e-b98f-4989-90a2-885e50d8174c

TCGA-C V-6939-01 A- 11 D- 1912-08 HNSC e2e84ccl-2944-489e-belb-0018a4e723e4

TCGA-C V-6940-01 A- 11 D- 1912-08 HNSC 39f2e005-79f9-4c63-a6d6-0b378481 a3ba

TCGA-C V-6941 -01 A- 11 D- 1912-08 HNSC 87071681-0058-4081-91f3-f689al50fc94

TCGA-C V-6942-01 A-21 D-2012-08 HNSC c5409f 12-e438-4979-b40e- 120899c 1 f al 5

TCGA-C V-6943-01 A- 11 D- 1912-08 HNSC 4fa37ade-3451-406d-bObb-el35el591b70

TCGA-C V-6945-01 A- 11 D- 1912-08 HNSC fcfc9b74-5b8a-45b7-97ca-4e477e941e7c

TCGA-C V-6948-01 A- 11 D- 1912-08 HNSC 03eb2650-4b9f-46d2-b09f-378d8e919ae2 TCGA-C V-6950-01 A- 11 D- 1912-08 HNSC 4a341860-44fb-493e-bd46-aeb6610842de

TCGA-C V-6951 -01 A- 11 D- 1912-08 HNSC 9elbf26c-6a68-44d2-aaa8-9af2f67828aa

TCGA-C V-6952-01 A- 11 D- 1912-08 HNSC 2d859062-3655-471 e-b3dd-e6ff0671 c076

TCGA-C V-6953-01 A- 11 D- 1912-08 HNSC fb79f2be-3dec-4b5a-b5f3-e29e0fb05a98

TCGA-C V-6954-01 A- 11 D- 1912-08 HNSC 08f56645-763e-4864-al45-c0136dacd4f5

TCGA-C V-6955-01 A- 11 D-2012-08 HNSC f2c7fbel-af36-4c42-b5ae-b9bfle88fe36

TCGA-C V-6956-01 A-21 D-2012-08 HNSC 9ccee056-124e-40d5-a07d-c208765d8640

TCGA-C V-6959-01 A- 11 D- 1912-08 HNSC ff4cc4fl-9897-4d04-a3f6-c28a9b928b7a

TCGA-C V-6960-01 A-41 D-2012-08 HNSC 750da72e-cabd-4b97-8160-8c4e39272b8b

TCGA-C V-6962-01 A- 11 D- 1912-08 HNSC 0b2767d9-10b4-4ec4-9437-5a5186e284ca

TCGA-C V-7089-01 A- 11 D-2012-08 HNSC 125ccb76-bf8d-4ce7-a04c-4424d6da0322

TCGA-C V-7090-01 A- 11 D-2012-08 HNSC 5c636c2d-f426-43a9-984d-b4455e4388e5

TCGA-C V-7091 -01 A- 11 D-2012-08 HNSC 563c5a89-6dad-467e-b2ea-e07677574a08

TCGA-C V-7095-01 A-21 D-2012-08 HNSC e4aba 107-a048-46e5-b0aa-901 f076b6f 61

TCGA-C V-7097-01 A- 11 D-2012-08 HNSC 23336d44-bb79-4361 -b661 -ce26eae06692

TCGA-C V-7099-01 A-41 D-2012-08 HNSC 12a04e68-c814-4al8-a469-d7edc76e362d

TCGA-C V-7100-01 A- 11 D-2012-08 HNSC f21a5elf-84b8-4e6f-8230-03d31cc7c431

TCGA-C V-7101 -01 A- 11 D-2012-08 HNSC 51 Ic3fa8-476b-4ee8-8e93- 1 ab46bc40dbe

TCGA-C V-7102-01 A- 11 D-2012-08 HNSC eda5514f-3aal-447c-ad07-55ec307c26e3

TCGA-C V-7103-01 A-21 D-2012-08 HNSC e04f3556-ael6-410d-bc03-1057ae308329

TCGA-C V-7104-01 A- 11 D-2012-08 HNSC 4f429401-f71e-4908-9663-2e66bacbebdd

TCGA-C V-7177-01 A- 11 D-2012-08 HNSC c984165c-88ea-4840-a980-be818db 16820

TCGA-C V-7178-01 A-21 D-2012-08 HNSC 3f30774f-2b8c-4057-abdl-a9ddle49ec78

TCGA-C V-7180-01 A- 11 D-2012-08 HNSC 4233a363-ba28-495c-8590-644199c33d64

TCGA-CV-7183-01A-11D-2012-08 HNSC 172e7b30-829e-40b2-976e-4971 cd 1724a9

TCGA-C V-7235-01 A- 11 D-2012-08 HNSC 1758147b-cb09-430b-a8cb-6al44744a79f

TCGA-C V-7236-01 A- 11 D-2012-08 HNSC dc220a9d-lfl6-4fe3-8196-d837a909f038

TCGA-C V-7238-01 A- 11 D-2012-08 HNSC e9619e49-7185-4158-9e8b-45d446960b60

TCGA-C V-7242-01 A- 11 D-2012-08 HNSC 9e07albc-f7c7-4cb4-b3bl-92162a79de0e

TCGA-C V-7243-01 A- 11 D-2012-08 HNSC bc6a2b7c-8a6c-4084-8551-8dldb9072ec2

TCGA-C V-7245-01 A- 11 D-2012-08 HNSC 56291b3c-595c-4388-a264-9037a48401d8

TCGA-C V-7247-01 A- 11 D-2012-08 HNSC b0ce56d2-8e2b-42b4-ac59-d37ba5a7a2c3

TCGA-C V-7248-01 A- 11 D-2012-08 HNSC 8ffc7f9d- 16da-4cff-b845-f2ff8df 87569

TCGA-C V-7250-01 A- 11 D-2012-08 HNSC 14516d2b-47dc-4768-977b-bc3clfe93722

TCGA-C V-7252-01 A- 11 D-2012-08 HNSC 9692c6b2-ce97-4c92-a0dd-f27d01a94e6e

TCGA-C V-7253-01 A- 11 D-2012-08 HNSC d501 a7e5-70e7-4f 80-851 a-efe8859d603 a

TCGA-C V-7254-01 A- 11 D-2012-08 HNSC fd22e861 -571 e-44da-82b6-b 128e07d 1963

TCGA-C V-7255-01 A- 11 D-2012-08 HNSC 4dedba61-el 37-4ae4-8312-9423 le3b ldl 6

TCGA-C V-7261 -01 A- 11 D-2012-08 HNSC 9fa7bc79-d05b-41da-8bcc-8d5ad4451b0c

TCGA-C V-7263-01 A- 11 D-2012-08 HNSC 19a07472-c8b9-4a34-b2cb-l lace35e7903

TCGA-CV-7406-01 A-l 1D-2078-08 HNSC 8c9effa8-acb6-4db0-874a-8f0df386924c TCGA-CV-7407-01 A-l 1D-2078-08 HNSC 94631dc8-6dcb-49ed-bb68-ela57a65flcb

TCGA-C V-7409-01 A- 31 D-2229-08 HNSC 47f a56f 1 -0802-403 a-a644-913f 1 aOfdeca

TCGA-C V-7410-01 A-21 D-2078-08 HNSC b89c4f94-b07c-485b-95ba-ffe815616d78

TCGA-C V-7411 -01 A- 11 D-2078-08 HNSC 790e387e-9e87-48d0-bc9d-2bc92f20abc5

TCGA-C V-7413-01 A- 11 D-2078-08 HNSC be482al9-0de0-4e60-a831-9ebe8545a6f3

TCGA-C V-7414-01 A- 11 D-2078-08 HNSC 7137f980-5301-4b 18-9664-d887eaced75e

TCGA-C V-7415-01 A- 11 D-2078-08 HNSC bble4188-130c-4206-8671-d7ce3eb8ee74

TCGA-C V-7418-01 A- 11 D-2078-08 HNSC 25a70d04-f533-4e60-b9fc-e74d600db296

TCGA-C V-7421 -01 A- 11 D-2078-08 HNSC ee675976-b447-48c8-bc67-6878a0d35e07

TCGA-C V-7422-01 A-21 D-2078-08 HNSC 5eb3f291-082c-48a8-b653-09264342adee

TCGA-C V-7423-01 A- 11 D-2078-08 HNSC a99653e0-2751-4423-93f7-abcf258c9868

TCGA-CV-7424-01 A-l 1D-2078-08 HNSC 76d5fc22-fd06-43f6-94a8-943a09db5fd6

TCGA-CV-7425-01 A-l 1D-2078-08 HNSC f 8cc6696-91 d0-4eb a-a765-ef7d044238ce

TCGA-CV-7427-01 A-l 1D-2078-08 HNSC 3fdb4698-4a38-4a81-a403-dlce5568c225

TCGA-C V-7429-01 A- 11 D-2129-08 HNSC 14b42e59-e519-4efc-8105-6f6b83d33353

TCGA-C V-7430-01 A- 11 D-2129-08 HNSC 29a4027f-4d4f-4133-b40a-3bfab6d2ac9e

TCGA-C V-7432-01 A- 11 D-2129-08 HNSC 60da7e3f-4d9c-4cb3-856d-6cc02e381028

TCGA-C V-7433-01 A- 11 D-2129-08 HNSC 15380da5-6a0b-4649-b21b-celed7d61b67

TCGA-C V-7434-01 A- 11 D-2129-08 HNSC d64e4e80-e6c6-42c8-8bc6-0fafb6475c51

TCGA-C V-7435-01 A- 11 D-2129-08 HNSC 16b7fd85-3664-4c4a-9a43-48bl07dbcf7f

TCGA-C V-7437-01 A-21 D-2129-08 HNSC 53413980-80cc-4c73-8bb6-31a01d6df86e

TCGA-C V-7438-01 A-21 D-2129-08 HNSC 6fd3ecf3-c87c-46c3-81f0-l le2f8936d61

TCGA-C V-7440-01 A- 11 D-2129-08 HNSC 901 c2ed5-8348-4dd9-a84c-6c0b 18d6525e

TCGA-CX-7082-01 A- 11 D-2012-08 HNSC 4c6c96b8-958e-4235-9673-8bf4ce0e6b38

TCGA-CX-7085-01 A-21 D-2012-08 HNSC 4f6eel0b-246d-49cd-8b60-01dcbl75e634

TCGA-CX-7086-01 A- 11 D-2078-08 HNSC dfcb7c6e-b0f4-4557-9669-4c580dl093a0

TCGA-CX-7219-01 A- 11 D-2012-08 HNSC 83f92af6-60ab-402e-8990-el060ca3cc4c

TCGA-D6-6515-01 A-21 D- 1870-08 HNSC 15c4d640-884c-4d55-897e-2f68314423fe

TCGA-D6-6516-01 A- 11 D- 1870-08 HNSC 5ab94b24- 1 al f-4df7-a5c6-b 1 dce8ee9be5

TCGA-D6-6517-01 A- 11 D- 1870-08 HNSC c553e4a2-cbea-43d6-8937-a48836856b5a

TCGA-D6-6823-01A-11D-1912-08 HNSC e 1 f4d8ef-f24a-417b-bf22-c03cdb6b5275

TCGA-D6-6824-01A-11D-1912-08 HNSC b658aa3f-0812-4812-8254-816d9a4d7c04

TCGA-D6-6825-01 A-21 D- 1912-08 HNSC 01f44db3-84dc-4f96-888d-b0370bf582a5

TCGA-D6-6826-01A-11D-1912-08 HNSC 368030ac-f855-452a-a3d3-3698ab9a00dd

TCGA-D6-6827-01A-11D-1912-08 HNSC 059be8f9-9536-40c0-a751 -5fe529a2f01 f

TCGA-DQ-5624-01 A-01 D- 1870-08 HNSC 01282192-5bb6-44d6-bbc7-33 a42eba416b

TCGA-DQ-5625-01 A-01 D- 1870-08 HNSC 4e042eld-8604-484a-b229-94b85745a478

TCGA-DQ-5629-01 A-01 D- 1870-08 HNSC e748f828-0b80-47f3-aa92-fb3b2be0dcc2

TCGA-DQ-5630-01 A-01 D- 1870-08 HNSC 5aa7ff44-d4ff-4163-81db-9f09bec8d5b0

TCGA-DQ-5631 -01 A-01 D- 1870-08 HNSC e389975a-e588-48d4-9ed3-548e8ed9delc

TCGA-DQ-7588-01A-11D-2078-08 HNSC 6aad9b01-6a99-4f21-955f-7938af25al88 TCGA-DQ-7589-01 A- 11 D-2229-08 HNSC de34e28e-942b-442b-b745-7f2a0e56f3ff

TCGA-DQ-7590-01 A- 11 D-2229-08 HNSC 5cbcfa67-f062-4a03-84ad-dabfbcfl4514

TCGA-DQ-7591 -01 A- 11 D-2078-08 HNSC 4068a2fc-452d-4b2c-88d8-72d30097527b

TCGA-DQ-7592-01 A- 11 D-2078-08 HNSC d8e20b3b-2666-4b53-aa85-a5056028df98

TCGA-DQ-7594-01 A- 11 D-2229-08 HNSC 92e689c0-08ab-472b-aedc-6344fedcbbc0

TCGA-DQ-7595-01 A- 11 D-2229-08 HNSC 7d504cd7-09f0-4691-alb2-55fc7d206439

TCGA-F7-7848-01 A-l 1D-2129-08 HNSC ba8a3e47-ee55-4c88-b29f-6dl61ffaeld0

TCGA-H7-7774-01 A-21 D-2078-08 HNSC 0eb5b79a-e3be-4bl9-aef6-74247986aaf6

TCGA-HD-7229-01 A- 11 D-2012-08 HNSC 26b27991-540f-47f4-95f3-a59a493da593

TCGA-HD-7753-01A-11D-2078-08 HNSC 7dc33525-6f57-4bl2-9b72-c9c845296ae3

TCGA-HD-7754-01 A-l 1D-2078-08 HNSC 233ecdc4-0b42-4533-8908-64ac7d3 ac33b

TCGA-HD-7831 -01 A- 11 D-2129-08 HNSC ae914215-3b 1 a-4edb-9f5a-ce4al 7154178

TCGA-HD-7832-01A-11D-2129-08 HNSC 374f3e37-87e5-4450-a89f-0bde3981a31e

TCGA-HD-7917-01 A- 11 D-2229-08 HNSC 451948c9-3dl 6-477 l-b006-28b98580db2c

TCGA-HL-7533-01 A- 11 D-2229-08 HNSC fbf8f4a8-be9e-4713-884d-c80ef662d622

TCGA-IQ-7630-01 A-l 1D-2078-08 HNSC 80442509-c2f0-4047-956e-a3633dfd472b

TCGA-IQ-7631-01 A-l 1D-2078-08 HNSC b2266f 1 c- 1642-4849-9278-41 e827691 aa7

TCGA-IQ-7632-01 A-l 1D-2078-08 HNSC 9fcfc377-al53-401c-95b4-8a4569866096

TCGA-A3-3311 -01 A-01 D-0966-08 RCC 9c095b70-9a64-48b0-8alc-45dd00a70019

TCGA-A3-3316-01 A-01 D-0966-08 RCC e 1241 cff-4071 -482e-be5b-adb9c46a480a

TCGA-A3-3317-01 A-01 D-0966-08 RCC Cdl2847f-695b-4b97-9a56-a4alddc58ec4

TCGA-A3-3319-01 A-01 D-0966-08 RCC a771 a7ad-8dfa-46ee-849d-4478798c46a6

TCGA-A3-3320-01A-01D-0966-08 RCC 5c4cc718-d7b5-453c-89d8-186ab0869e68

TCGA-A3-3322-01A RCC 6f329d07-3308-4c84-9113-2bf000e9be3b

TCGA-A3-3323-01A-01D-0966-08 RCC 21 c50574-7496-4be5-b723- 1 fdb980fb208

TCGA-A3-3326-01A-01D-0966-08 RCC 60ed222b-cd0c-4bc5-acd0-39f207be3289

TCGA-A3-3346-01 A-01 D-0966-08 RCC c8a52cll-2278-4fl5-80bb-c7115c2cd737

TCGA-A3-3347-01 A-02D- 1386-10 RCC 2f4a6bd7-16ff-4689-b41d-c5fabb87823b

TCGA-A3-3349-01A-01D-1251-10 RCC c2b257f6-9cb5-4598-89c7-f0b55e24dbb3

TCGA-A3-3357-01A-02D-1421-08 RCC db6f5ad9-ae6e-4689-bl46-f733f8352c54

TCGA-A3-3358-01A-01D-1534-10 RCC fd42afa7-6f0f-48e8-a947-bb9c9f4770ef

TCGA-A3-3362-01 A-02D- 1386-10 RCC 03c9042a-0206-4fl2-b444-62f435140e8d

TCGA-A3-3363-01A-01D-0966-08 RCC 34dac639-c2e5-447d-99c5-c6a3el5538fe

TCGA-A3-3365-01A RCC 8bc46a09-7328-42e0-ad97-e557ec81048e

TCGA-A3-3367-01A-02D-1421-08 RCC 83a091b9-35cc-4f3b-9d5f-d699b79ac421

TCGA-A3-3370-01A-02D-1421-08 RCC 21 ce7121 -87b4-4686-9bf 6-aff71 d8b2223

TCGA-A3-3372-01A-01D-0966-08 RCC f9f50073-ald3-4c52-be78-529bd05cbce4

TCGA-A3-3373-01A-02D-1421-08 RCC 6cbaac72-ca6e-4c4b-a016- 1836959344c8

TCGA-A3-3376-01A-02D-1421-08 RCC 31031387-393f-4bf9-ba87-cfe7330afcl3

TCGA-A3-3378-01A-01D-0966-08 RCC f04f3a00-e743-4fed-a0b0-e6a81bdd6ddd

TCGA-A3-3380-01 A-01 D-0966-08 RCC 269d4e2a-a425-4fde-bb51-5880f7f8b2b9 TCGA-A3-3382-01 A-01 D-0966-08 RCC fl0el718-6fb8-4c08-bc28-439f26355cd2

TCGA-A3-3383-01A-01D-0966-08 RCC 2ea06f57-c7fa-4881-b9c0-dd3f9clc4ca0

TCGA-A3-3385-01A RCC f780aef6-lc9c-4167-9f55-48885d6e5874

TCGA-A3-3387-01A-01D-1534-10 RCC e9el49ff-79e0-48f9-9262-lfbbad865e77

TCGA- AK-3429-01 A-02D- 1386-10 RCC f a51 dce9-2101 -4af7-9280-4bad56b6848e

TCGA-AK-3430-01A RCC M6a82ca-2eaf-4b7a-b469-2be4a023fc2a

TCGA- AK-3436-01 A-02D- 1386-10 RCC 714cdl l8-7f2b-47a5-83f6-41b20674ad03

TCGA- AK-3444-01 A-01 D-0966-08 RCC ea794170- 156d-4251 -b899-abfd60b213b0

TCGA-AK-3451-01A RCC 242777f6-a875-4072-9696-8d7f7d718906

TCGA- AK-3455-01 A-01 D-0966-08 RCC 3fbeeda4-a6c4-45a4-a963-dc6ca3f7e0ba

TCGA- AK-3456-01 A-02D- 1386-10 RCC d36felbe-96a5-4001-a95e-d499a6087146

TCGA- AK-3458-01 A-01 D- 1501 - 10 RCC 0198f3c3-78f2-4cl9-90d5-c77b74044ca2

TCGA-AS-3778-01A-01D-0966-08 RCC 7b56e923-2bc5-4368-8e28-42649d3bfl69

TCGA-BO-4700-01 A-02D- 1534-10 RCC 32cb433f-359c-44c3 -b2df-d2a64df90175

TCGA-BO-4706-01 A-01 D- 1501 - 10 RCC 040fdd9b-db76-4357-9aed-77a8cbde058d

TCGA-B0-4710-01A RCC 6fc8cb4b-ldc0-46b8-ae80-7dbd022c9431

TCGA-B0-4712-01A-01D-1501-10 RCC 032b33f8-ff79-47de-8cb2-d744eab8bdla

TCGA-BO-4810-01 A-01 D- 1501 - 10 RCC e014eeeb-c48e-42bb-a683-93299087a3cf

TCGA-BO-4811 -01 A-01 D- 1501 - 10 RCC a46182dc-2481-4911-9f6b-9532666f9f8c

TCGA-BO-4815-01 A-01 D- 1501 - 10 RCC fe091054-41d3-44fa-86a2-fad3ae58423f

TCGA-B0-4816-01A RCC d05c3419-4164-4a69-8b 11 -ce 1 f5c29b5d4

TCGA-BO-4818-01 A-01 D- 1501 - 10 RCC 213bf382-c2ca-45d4-95ae-329e6653620f

TCGA-BO-4823-01 A-02D- 1421 -08 RCC 9f790e7e-3475-4242-82fc-cbdd461ce5ef

TCGA-BO-4827-01 A-02D- 1421 -08 RCC 02f83f9a-4e4d-44f3-8d67-b4fc2d35102b

TCGA-BO-4842-01 A-02D- 1421 -08 RCC ae765ade-6a06-439c-alcd-67222a70f44e

TCGA-BO-4852-01 A-01 D- 1501 - 10 RCC 28dbeb57-c919-4f91 -aa3c-7b8f 3809011 e

TCGA-BO-4945-01 A-01 D- 1421 -08 RCC 9fae377f-6c63-4f47-a769-al396fbl5f56

TCGA-B0-5075-01A RCC 200819c3-826e-49al-8824-6d4752e6eb6f

TCGA-BO-5077-01 A-01 D- 1462-08 RCC 587f2bd8-952a-4f31-98e7-7654c80b8a99

TCGA-BO-5080-01 A-01 D- 1501 - 10 RCC 9adf0a63-ld5c-403a-9e78-cb9d62a249a4

TCGA-BO-5081 -01 A-01 D- 1462-08 RCC 71 a9d096-0e27-4585-b54a-48214d83cd6c

TCGA-BO-5085-01 A-01 D- 1462-08 RCC a36e36ee-48f3-4674-a9f3-al21a09535c5

TCGA-BO-5088-01 A-01 D- 1462-08 RCC e56245d6-c681-44e0-9eb2-504bee3elb32

TCGA-BO-5092-01 A-01 D- 1421 -08 RCC 76b9d9e3-6010-4894-8435-debe95a376b5

TCGA-BO-5094-01 A-01 D- 1421 -08 RCC 8b910c03-86a9-488d-80b4-lf8c214c2941

TCGA-BO-5095-01 A-01 D- 1421 -08 RCC 93c714f8-acea-4550-92fe-aad4aad65ac9

TCGA-BO-5096-01 A-01 D- 1421 -08 RCC 261 de0a2-6006-4b3b-aac0-37d9b33840aa

TCGA-BO-5097-01 A-01 D- 1421 -08 RCC 3af2978e-b892-4817-be05-39f020c06b5e

TCGA-BO-5099-01 A-01 D- 1421 -08 RCC c3150136-ae55-49d0-9212-86728464167d

TCGA-BO-5100-01 A-01 D- 1421 -08 RCC b20bd619-59c9-4e2a-8e64-7bb44eaa75ce

TCGA-BO-5102-01 A-01 D- 1421 -08 RCC abea5e3e-705a-4d2c-b207- 1 ab43767al9b TCGA-B0-5104-01A RCC ac2cfbde-9d62-49db-9a07-e8166003 f 1 Of

TCGA-BO-5106-01 A-01 D- 1421 -08 RCC c0e28603-7204-416d-ba3d-5377a38f677d

TCGA-B0-5107-01A RCC 4c6f4edb-9a29-48e6-8521 -9c5fd2572e2d

TCGA-BO-5108-01 A-01 D- 1421 -08 RCC dld37af8-d2c3-4825-8e47-la2e52e3acbb

TCGA-BO-5109-01 A-02D- 1421 -08 RCC 58d6e408-ed00-4elf-bffa-e73250cfe4a0

TCGA-B0-5110-01A RCC 38041aeb-60fe-4784-a5d8-fd04b5c0c5f8

TCGA-BO-5113-01 A-01D-1421-08 RCC 64b234e0-74f6-453f-b5cb-280e01fba09b

TCGA-BO-5115-01 A-01 D- 1421 -08 RCC fl22b61c-d537-4456-84e8-54e541eec531

TCGA-BO-5116-01 A RCC 9742 ld06-b 199-4246-b2da-80a9ba313335

TCGA-BO-5119-01 A-02D- 1421 -08 RCC 414d47c7-41bb-4c83-8cdf-703fa0a46f01

TCGA-BO-5120-01 A-01 D- 1421 -08 RCC 6ce58fbc-6742-4ade-84b0-cd025266e030

TCGA-BO-5121-01 A-02D- 1421 -08 RCC a2751cb2-8545-490c-92d9-edb9775d32b8

TCGA-B0-5399-01A RCC aldddbed-c780-412a-b563-914f71e5c75d

TCGA-BO-5400-01 A-01 D- 1501 - 10 RCC e7128330-77bl-48be-b9f0-be986aa63ea8

TCGA-BO-5402-01 A-01 D- 1501 - 10 RCC Ca62bea0-a008-481e-8a91-d0f3a9598255

TCGA-BO-5691 -01 A- 11 D- 1534- 10 RCC ac2e 1 d29-e239-4dab-9d81 -77c8d45970eb

TCGA-BO-5692-01 A- 11 D- 1534- 10 RCC laf40135-8357-40b7-b711-478633a70f97

TCGA-B0-5693-01A-11D-1534-10 RCC be92eel6-6288-46c0-aaa7-7a27020cd7ca

TCGA-BO-5694-01 A- 11 D- 1534- 10 RCC 6edbaa05-b935-4f82-b070-8fc80ea6b609

TCGA-B0-5695-01A RCC 86e4862c-7405-40b5-b73f-be0c6c52ea6d

TCGA-BO-5696-01 A- 11 D- 1534- 10 RCC 48b270af-07f2-4cb5-ace2-e2676ffaccd9

TCGA-BO-5697-01 A- 11 D- 1534- 10 RCC 9ca4e638-5a95-4eeb-bfc4-257e8ea8fa66

TCGA-B0-5698-01A-11D-1669-08 RCC 2ddf2f a6-7871 -49fb-be2c-8fce6f 8e41 ed

TCGA-B0-5699-01A RCC 086554a9-2172-43a7-9f52-aab7d0888429

TCGA-BO-5701 -01 A- 11 D- 1534- 10 RCC 0elc563a-ee60-478b-9286-ed90e7561892

TCGA-BO-5702-01 A- 11 D- 1534- 10 RCC 780b3f3e-lc49-40de-9131-65c4df9ebba6

TCGA-BO-5703-01 A- 11 D- 1534- 10 RCC 963400a2-d939-41a5-8c42-9fc3a04b8362

TCGA-BO-5705-01 A- 11 D- 1534- 10 RCC d3095df5-5466-4b98-9f6d-f8ae8916ccca

TCGA-BO-5706-01 A- 11 D- 1534- 10 RCC b60cf910-2d2e-483 a-a9de-ce 1 e5f 8d3825

TCGA-BO-5707-01 A- 11 D- 1534- 10 RCC eb2f9f38-bce2-4746-a3c8-40abc3379b32

TCGA-BO-5709-01 A- 11 D- 1534- 10 RCC bfeaecbe-7148-4642-b69a-b908a248f328

TCGA-BO-5710-01 A- 11 D- 1669-08 RCC 12f 1 e370-c269-4b95-a89b-a 1 f 3 ae42e876

TCGA-BO-5711 -01 A- 11 D- 1669-08 RCC cf09ae91-5523-494c-8f30-c26f6ba37624

TCGA-BO-5713-01 A- 11 D- 1669-08 RCC 2f35dbf4-3223-4550-951b-1409a30ece68

TCGA-BO-5812-01 A- 11 D- 1669-08 RCC 6327ce2c-8a24-45b9-9577-7b7d7b603e68

TCGA-B2-3924-01A RCC 21527594-ed75-4654-9caf-83d31f248e67

TCGA-B2-4098-01A RCC 6463ae73-a885-4d69-9345-7110ddac0c7e

TCGA-B2-4099-01A RCC e242adb8-db67-475e-a0e4-52a622666bl2

TCGA-B2-4101-01A RCC a9947b6c-dbc7-4ba5-af61-7647el le2973

TCGA-B4-5377-01 A-01 D- 1501 - 10 RCC a615b02d-fdl 8-47ef-bd66-6dba56de6981

TCGA-B 8-4143-01 A-01 D- 1806- 10 RCC bbl86c78-1052-48ec-97f4-c94bddf0df72 TCGA-B 8-4146-01 B- 11 D- 1669-08 RCC 380bdba7-8al2-4136-877a-f54346d2d8a5

TCGA-B 8-4148-01 A-02D- 1386-10 RCC fe752e2b-e694-4fa9-99d6-46d5bff9e8cf

TCGA-B 8-4151 -01 A-01 D- 1806- 10 RCC 3f847558-8bc7-49b0-899d-2a7b8f0e3dla

TCGA-B 8-4153-01 B- 11 D- 1669-08 RCC a66078d8-a6b2-4dc4-bfa3-def5a2e4504f

TCGA-B 8-4154-01 A-01 D- 1251 - 10 RCC e48f5cl4-4b64-4d4b-8273-bebc74182181

TCGA-B 8-4620-01 A RCC e4ecl484-4f77-4520-9ff5-bc4dc8a0fbl5

TCGA-B 8-4621-01 A RCC 242a72ad-5968-4bbf-936d-75b398a61b96

TCGA-B 8-4622-01 A RCC lc86e0f6-a019-47a5-8325-bbb82f76488c

TCGA-B 8-5158-01 A-01 D- 1421 -08 RCC 9d730534-98e7-464e-945c-5964cec5362a

TCGA-B 8-5159-01 A-01 D- 1421 -08 RCC ed8a9bel-31c6-40e2-9af2-8abd80d00995

TCGA-B 8-5163-01 A-01 D- 1421 -08 RCC 903132ef-877f-4207-ba28-2e9dd765c824

TCGA-B 8-5164-01 A RCC 471ce542-e85b-4bdb-b365-4562a93efle5

TCGA-B 8-5165-01 A-01 D- 1421 -08 RCC dl579785-5c42-4bda-9825-15ead235f7f4

TCGA-B 8-5545-01 A-01 D- 1669-08 RCC 514d2342-64ba-4c9f-9866-63bdbc26fda3

TCGA-B 8-5550-01 A RCC dafed455-98a2-419a-bebc-f90b731e2813

TCGA-B 8-5552-01 B- 11 D- 1669-08 RCC 13b52e49-20df-4e39-9dc9-cf8f7cl57bd7

TCGA-B 8-5553-01 A-01 D- 1534- 10 RCC 7cl9e63c-770b-4289-aa47-9b2cf261b4ca

TCGA-BP-4161-01A RCC 154de511-2bba-4959-970b-6a8429f29793

TCGA-BP-4162-01A RCC ca4eac28-22c9-48d8-8139-7cda2cfe4ae2

TCGA-BP-4163-01A RCC e44de28c-bce0-471d-bd4c-bea710f7c3cc

TCGA-BP-4164-01A RCC a8fab76e-ae69-43d6-972b-5837aec668fd

TCGA-BP-4167-01 A-02D- 1386-10 RCC 79b810el-4de4-496d-9f70-ab62246e781b

TCGA-BP-4770-01 A-01 D- 1501 - 10 RCC aecbc5db-f75a-42d0-a84d-aa0369b08eec

TCGA-BP-4782-01A RCC a6c21bf2-dd9b-4243-863e-9d53b056666f

TCGA-BP-4801 -01 A-02D- 1421 -08 RCC d3e62cbl-5ced-42cb-a360-479ee01877aa

TCGA-BP-4960-01 A-01 D- 1462-08 RCC 36d2 Ibe3-2f46-47af-84aa-2305f2513 aa 1

TCGA-BP-4961-01A RCC f207131d-8db7-464b-a3e5-44218dalcafc

TCGA-BP-4962-01 A-01 D- 1462-08 RCC 3454a6fe-2547-4531 -a0be-cb27cl 879e72

TCGA-BP-4963-01A-01D-1462-08 RCC 154bf a5d-0d9a-40c6-a2a5-bde 1054702c3

TCGA-BP-4964-01 A-01 D- 1462-08 RCC 5b838251-67f5-4e22-a291-8a9e206d56db

TCGA-BP-4967-01 A-01 D- 1462-08 RCC 75866dl4-47d5-4560-a5a0-32ba3el5ac63

TCGA-BP-4968-01A-01D-1462-08 RCC d777d5ec-4632-446e-aeac-8ae3e5273fe2

TCGA-BP-4970-01 A-01 D- 1462-08 RCC 205e81c6-235a-450f-blf8-80c518eb3478

TCGA-BP-4971 -01 A-01 D- 1462-08 RCC c07945e8-8133-4237-9dlf-18c023bc9d2c

TCGA-BP-4972-01 A-01 D- 1462-08 RCC b2da5d39-33f6-4807-9dld-92b7cef2a8df

TCGA-BP-4973-01A-01D-1462-08 RCC 5db95dcc-97e3-42a5-87dd-75a09b9cl64a

TCGA-BP-4974-01A RCC a75c92b2-c67b-42b5-a8c2-7eealb567ed0

TCGA-BP-4975-01 A-01 D- 1462-08 RCC 109d2752- 17f 8-4b00-a61 f-dfd8e2e3ca81

TCGA-BP-4976-01 A-01 D- 1462-08 RCC 95bd81 ec-3c06-4c4d-9915-5cc3dd7a7155

TCGA-BP-4977-01 A-01 D- 1462-08 RCC 7c3bf7cl-07d9-4540-9a5e-614fd60b63ec

TCGA-BP-4981 -01 A-01 D- 1462-08 RCC 64a 1 f085-50cc-4129-a617-eOf 691 a58039 TCGA-BP-4982-01 A-01 D- 1462-08 RCC 84591a73-bed0-4ad5-9acd-8f31acf27af0

TCGA-BP-4983-01A-01D-1462-08 RCC beaafdf9-d5c0-4bc4-b08b-833c3c91c9ae

TCGA-BP-4985-01 A-01 D- 1462-08 RCC e56acfea-aec6-4102-8fe0-25df396cl0ae

TCGA-BP-4986-01A-01D-1462-08 RCC 4465171 a-d048-4078-b 1 ae-021b2c635ff4

TCGA-BP-4987-01 A-01 D- 1462-08 RCC 7924f8ff-8e78-4910-9dc5-dbl4d5ee7011

TCGA-BP-4988-01A-01D-1462-08 RCC 792c9867-ceea-4520-bbb7-5dabe290664f

TCGA-BP-4989-01 A-01 D- 1462-08 RCC 7096085b-cd5b-4cdl-8957-a6adcf7e818a

TCGA-BP-4991 -01 A-01 D- 1462-08 RCC d54c714e-blc4-4669-986d-5el3d2fc3cc3

TCGA-BP-4992-01A RCC 212717dd-25fl-4c76-a648-b8a7d65caecf

TCGA-BP-4993-01A-02D-1421-08 RCC 34315bea-6ef2-42ec-bl7e-c73eed40647f

TCGA-BP-4995-01 A-01 D- 1462-08 RCC 93b9afac-el2e-49d2-96ac-274da6581d76

TCGA-BP-4998-01 A-01 D- 1462-08 RCC e646f930-967b-43 a3 -bd70- 184e5c38efe5

TCGA-BP-4999-01 A-01 D- 1462-08 RCC 86ffb814-7c65-426b-b7b5-7250322c4d01

TCGA-BP-5000-01 A-01 D- 1462-08 RCC b9816eaa-3c60-4fbf-abd6-6d869ca9cca7

TCGA-BP-5001-01A RCC e863bd35-0382-4979-b599-033a06alf50b

TCGA-BP-5004-01 A-01 D- 1462-08 RCC e3d82fe4-b491 -4172-86da-429cf 16508de

TCGA-BP-5006-01 A-01 D- 1462-08 RCC I lfb962b-b4b8-46f4-bde4-3f87309e94f3

TCGA-BP-5007-01A RCC a44eb 1 d6-3b5c-42e8-b 17a-d71 ff c0503d5

TCGA-BP-5008-01A RCC 41c094e9-6c23-4993-8d90-338b66efefcl

TCGA-BP-5009-01 A-01 D- 1462-08 RCC 3baa3cdc-c63e-4556-bafl-c3b03175bOfa

TCGA-BP-5010-01 A-02D- 1421 -08 RCC 553cbel8-6dd3-4b34-b7fe-96a6dd2e6943

TCGA-BP-5168-01A-01D-1421-08 RCC 9930560d-22e6-43aa-a6fO-02515f7af8fO

TCGA-BP-5169-01 A-01 D- 1429-08 RCC 3527b21 e-972b-4c31 -b5de-8c394ceOe500

TCGA-BP-5170-01 A-01 D- 1429-08 RCC 6876 Ib2c-66b9-4adf-9b60-955f79ed0f 11

TCGA-BP-5173-01A-01D-1429-08 RCC 3ce0a5fc-09ae-412a-8a5b-56d9a44433aa

TCGA-BP-5174-01 A-01 D- 1429-08 RCC 53b5cf 8d-f 3cf-4e7e-91 ec-b0c907d 1 c 13f

TCGA-BP-5175-01 A-01 D- 1429-08 RCC 30e58ale-e7db-43ce-a7e8-alfd21f4438e

TCGA-BP-5176-01 A-01 D- 1429-08 RCC 607eb48b- 1647-4e35-ac60-f 6c50341 e304

TCGA-BP-5177-01 A-01 D- 1429-08 RCC ad4cc7e3-c4dl-4cc0-9c93-33b47dadaaae

TCGA-BP-5178-01 A-01 D- 1429-08 RCC 60888dc5-1408-4bfb-bf27-f3e22f5488e4

TCGA-BP-5180-01 A-01 D- 1429-08 RCC a776bde5-7503-459c-8419-dc0d744a651 e

TCGA-BP-5182-01 A-01 D- 1429-08 RCC 00523547-dalc-4bbl-a627-c0946849b376

TCGA-BP-5183-01A-01D-1429-08 RCC Cd4c37c3-95f2-4612-b6a8-9d6dldfb5fd4

TCGA-BP-5184-01 A-01 D- 1429-08 RCC ddebedl4-f47f-46e6-ac39-c74ed3363211

TCGA-BP-5185-01 A-01 D- 1429-08 RCC 42dc6d82-f52a-4bl3-b3bc-c63002b47e98

TCGA-BP-5186-01 A-01 D- 1429-08 RCC 02b98f85-07df-4fb2-b27e-efd368c84ec8

TCGA-BP-5187-01A RCC 3257e690-9306-434f-b6ac-17da58abl243

TCGA-BP-5189-01 A-02D- 1429-08 RCC ca98342a-65ec-468a-9ccl-44c7d31a67d6

TCGA-BP-5190-01 A-01 D- 1429-08 RCC 5491645b-552c-47a9-b08 l-e8e508dldf3d

TCGA-BP-5191 -01 A-01 D- 1429-08 RCC 64dd8a08-483e-4dce-90b0-64a751fdbebd

TCGA-BP-5192-01 A-01 D- 1429-08 RCC 4db23b76-46dd-4ed9-al68-fee43b2fc7d7 TCGA-BP-5194-01 A-02D- 1429-08 RCC 5b52c97e-fdd2-4ae2-b036-297feeb 1 c7e2

TCGA-BP-5195-01 A-02D- 1429-08 RCC c2ab2f01-3744-434a-b5b6-0f22599c9al7

TCGA-BP-5196-01 A-01 D- 1429-08 RCC 20 Ibf07d-0be9-442f-ad66- 15ea8c7e812d

TCGA-BP-5198-01 A-01 D- 1429-08 RCC ac66d658-97d4-416b-8028-0077alc8a01d

TCGA-BP-5199-01 A-01 D- 1429-08 RCC 135f3b77-1474-40d8-87al-15939136e8cd

TCGA-BP-5200-01A RCC e2557bba-b331-40c2-8389-c52324630bca

TCGA-BP-5201 -01 A-01 D- 1429-08 RCC 243c77a9-1591-45ac-b048-a5687a77c764

TCGA-BP-5202-01 A-02D- 1429-08 RCC accc7214-d441 -4a72-a2eb-9f2811 c38a3e

TCGA-CJ-4634-01A-02D-1386-10 RCC 59fl8fac-c6f8-4cbf-9259-8c22d6ba0c58

TCGA-CJ-4636-01A RCC 5889076d-0a5f-4c3a-8254-a941df3186f7

TCGA-CJ-4637-01A-02D-1386-10 RCC b8480571 -ee08-4f a 1 -b509- 1331 a8fbc075

TCGA-CJ-4638-01A-02D-1386-10 RCC cbcl 87b0-fafe-4b lf-9af0-6714942414ab

TCGA-CJ-4639-01A-02D-1386-10 RCC 9df6dlbl-5a09-4082-8ec0-61bl2b3c8801

TCGA-CJ-4640-01A-02D-1386-10 RCC e406036a-eecb-474e-8c76-0fa8b64225be

TCGA-CJ-4641-01A-02D-1386-10 RCC c00265ac-c6cc-4349-ac30-e2e44582015a

TCGA-CJ-4643-01A-02D-1386-10 RCC 5e00e420-94fd-4115-9cd9-cef24f6df0eb

TCGA-CJ-4644-01A-02D-1386-10 RCC 2f2888fb-ae20-4347-87dc-f0eeeeb9b0d5

TCGA-CJ-4882-01A-02D-1429-08 RCC blb7b8e8-cc87-4a52-900a-lf3ef7d449d7

TCGA-CJ-4897-01A-03D-1429-08 RCC c 1331 eec-e2df-4924-918b-7e5134e933c2

TCGA-CJ-4899-01 A-01 D- 1462-08 RCC 943ca428-39f6-4ad2-8ca5-220628a6b5bb

TCGA-CJ-4901 -01 A-01 D- 1429-08 RCC a8a8f3ff-0514-4bca-be75-16ad58eb9e72

TCGA-CJ-4902-01 A-01 D- 1429-08 RCC 3ef9ea62-85c4-4261 -af23-ecb86f 192cdf

TCGA-CJ-4903-01A-01D-1429-08 RCC 3b685193-flfa-4clb-949b-bcdb2dlb934c

TCGA-CJ-4904-01A-02D-1429-08 RCC 9bedcded-0c33-4199-bdce-18681595c2d8

TCGA-CJ-4905-01A-02D-1429-08 RCC 22eb9dc5-8d5e-4158-8edc- 12ff 62a612be

TCGA-CJ-4907-01 A-01 D- 1429-08 RCC 7c69fcb9-4b94-478a-bcb3-6ebdl62d9482

TCGA-CJ-4908-01 A-01 D- 1429-08 RCC dbc5420c-5c60-4d 1 e-8554-9d2f 6e55c502

TCGA-CJ-4912-01 A-01 D- 1429-08 RCC 894ade93-8feb-4f93-a31a-d9el6eb81743

TCGA-CJ-4913-01A-01D-1429-08 RCC 0635f266-c4be-45ea-8347-455ef7ad5648

TCGA-CJ-4916-01 A-01 D- 1429-08 RCC 81b0e02c-069c-4c4b-b56f-79c2ebec9927

TCGA-CJ-4918-01 A-01 D- 1429-08 RCC 2c5d4600-0271-4c03-ab44-239acl9d8b4d

TCGA-CJ-4920-01 A-01 D- 1429-08 RCC 12bf3338-f541-45a9-9fb7-e84931ba5ed8

TCGA-CJ-4923-01A-01D-1429-08 RCC 19171ala-6483-4bf3-b0b4-8cd441303c55

TCGA-CJ-5671 -01 A- 11 D- 1534- 10 RCC 5bl084bb-3fb2-4f3f-9ca7-7108b0f77994

TCGA-CJ-5672-01 A- 11 D- 1534- 10 RCC 61497c42-78f2-43d4-b2ab-2b le655271 a8

TCGA-CJ-5675-01A RCC 26f77108-c3b0-4833-9ala-df457d7415a9

TCGA-CJ-5676-01 A- 11 D- 1534- 10 RCC 2e8aa293-650b-4661-bl30-8b70f0949b86

TCGA-CJ-5677-01 A- 11 D- 1534- 10 RCC 70fe0b 18-52d 1 -40f7-b2a3-c808b3009610

TCGA-CJ-5678-01 A- 11 D- 1534- 10 RCC d49759a2-d2a9-48ba-9447-e42c9d3d64c7

TCGA-CJ-5679-01A RCC 17313700-6052-4901-8850-981fead99d6c

TCGA-CJ-5680-01 A- 11 D- 1534- 10 RCC 2c718814-9d25-49a6-a430-2019071ec0ab TCGA-CJ-5681-01A-11D-1534-10 RCC 9ae0744a-9bcl-4cd7-b7cf-c6569ed9e4aa

TCGA-CJ-5682-01 A- 11 D- 1534- 10 RCC deceb0ba-600f-491a-a207-2e0205ff89d2

TCGA-CJ-5683-01A-11D-1534-10 RCC b85e29c5-0206-4d65-aa46-179a55c0ceae

TCGA-CJ-5684-01A-11D-1534-10 RCC 24ee4b71-c2e0-44c3-aaeb-3c488cd26ce7

TCGA-CJ-5686-01A-11D-1669-08 RCC 695e2a72-6b97-4f a 1 -9f57-d7c6el 0438ee

TCGA-CJ-6027-01 A- 11 D- 1669-08 RCC b0483455-4cde-408f-b831-17223c03241a

TCGA-CJ-6028-01 A- 11 D- 1669-08 RCC dl65717a-cc3d-4533-8194-0029cl86flbb

TCGA-CJ-6030-01 A- 11 D- 1669-08 RCC c904299c-09a8-4a4c-9378-2fee0ac4cd33

TCGA-CJ-6031 -01 A- 11 D- 1669-08 RCC a47debc7-700e-4c64-a9b3-1113609alddf

TCGA-CJ-6032-01 A- 11 D- 1669-08 RCC 8c9823f0-69af-474d-adb7-5ec8ef4e5af7

TCGA-CJ-6033-01 A- 11 D- 1669-08 RCC C7ce9042-f63c-4a93-a82d-f21977bd9bcb

TCGA-CW-5580-01 A-01 D- 1669-08 RCC 6e4ed3ae-aa80-453a-95be-0af96a7bc4e3

TCGA-CW-5581-01A RCC 22be4bab-231e-4784-aaa9-45ael58a5153

TCGA-CW-5583-01A-02D-1534-10 RCC 2cb6b578-8543-4al2-8331-1721ddc47303

TCGA-CW-5585-01 A-01 D- 1534- 10 RCC bd6d9aa8-d0ef-4810-a43c-eacdd846c44e

TCGA-CW-5591 -01 A-01 D- 1534- 10 RCC 02ac80cd-caa3-4dbc-9b57-4a324cec0ad4

TCGA-CW-6087-01 A- 11 D- 1669-08 RCC 65c23a97-1763-47d5-8648-df24cf0226f3

TCGA-CW-6090-01 A- 11 D- 1669-08 RCC 3b2e654a-4cl3-4dab-9el8-1445a43af3e6

TCGA-CW-6093-01 A- 11 D- 1669-08 RCC 9blbeb37-led7-43c0-a532-56df794111 If

TCGA-CZ-4853-01 A-01 D- 1429-08 RCC bdef62dl-a036-43b4-811b-bf4beab7eca8

TCGA-CZ-4856-01 A-02D- 1429-08 RCC 85e26450-4cb 1 -4a91 -ad86-a6d44890ee97

TCGA-CZ-4859-01 A-02D- 1429-08 RCC 82c0b6e4-cb0f-4870-81c9-b45a93d6f5d3

TCGA-CZ-4863-01A-01D-1501-10 RCC 4286d73b-lfb9-41a3-baba-46f23100586a

TCGA-CZ-4865-01 A-02D- 1501-10 RCC f 8eac30d- 1155-44cc-a2ad-95427fecf4bf

TCGA-CZ-4866-01 A-01 D- 1501 - 10 RCC a3 a06421 -7838-4ac2-b5d5-45d2ea651368

TCGA-CZ-5451 -01 A-01 D- 1501 - 10 RCC bl923d68-ldl e-4b59-b643-09e2c5969efd

TCGA-CZ-5452-01 A-01 D- 1501 - 10 RCC 96bd68cb-5d8e-4del-88ca-5f30fbdde036

TCGA-CZ-5453 -01 A-01 D- 1501 - 10 RCC 605079f6-2d6e-4c38-a214-b4c8875ddl66

TCGA-CZ-5454-01 A-01 D- 1501 - 10 RCC d9fdl928-7b7d-4147-aeff- 1618393ba26c

TCGA-CZ-5455-01A RCC d6a730ef-3f0d-47cl-977e-5c80647356d4

TCGA-CZ-5456-01 A-01 D- 1501 - 10 RCC 45d5c746-60e3-4531-8db0-fd648811d45f

TCGA-CZ-5457-01A RCC 8d54b22b-ee4b-45e0-922e-24e3c20c4cla

TCGA-CZ-5458-01 A-01 D- 1501 - 10 RCC 1737382a-alc9-45el-b009-a29beld93749

TCGA-CZ-5459-01 A-01 D- 1501 - 10 RCC 5711cdaa-7368-4a4f-8639-5df60a2fedac

TCGA-CZ-5460-01 A-01 D- 1501 - 10 RCC a6del551-2ala-4a43-ba7f-caa436f5f6dd

TCGA-CZ-5461 -01 A-01 D- 1501 - 10 RCC 79feee74-7bl4-48d9-9be7-8d7671c79c83

TCGA-CZ-5462-01 A-01 D- 1501 - 10 RCC 74eed0c6-b3cc-4666-8ef0-194elbbel048

TCGA-CZ-5463-01 A-01 D- 1501 - 10 RCC 3732539b-eb77-485b-81 al-83be956a9a87

TCGA-CZ-5465-01 A-01 D- 1806- 10 RCC 062b7e63-bb4e-4eaa-9aa4-f2af44c2ab37

TCGA-CZ-5466-01A RCC 694ca445-7bac-4216-acf5-e227650ae973

TCGA-CZ-5467-01 A-01 D- 1501 - 10 RCC 99c640a3-660f-4723-bf82-36fcb3134356 TCGA-CZ-5468-01 A-01 D- 1501 - 10 RCC 50c6b5a2-cd0e-4adf-b85f-0f9cl847477f

TCGA-CZ-5469-01 A-01 D- 1501 - 10 RCC 3df654a0-48b0-45ff-bfel-b5f78f63b30d

TCGA-CZ-5470-01 A-01 D- 1501 - 10 RCC C9a7ca9e-c36e-46cl-926f-4a57a0584cb0

TCGA-CZ-5982-01 A- 11 D- 1669-08 RCC 2c3c0f78-lc0a-48df-856e-0afbc2b5bceb

TCGA-CZ-5984-01 A- 11 D- 1669-08 RCC 89e8e486-0c93-4056-88ed-83fd0d5a7f2c

TCGA-CZ-5985-01 A- 11 D- 1669-08 RCC ad5eae3d-2f73-49d2-be47-5891e7772bc6

TCGA-CZ-5986-01A-11D-1669-08 RCC 0abded91-5a5f-4923-bcf0-7fdda64ae232

TCGA-CZ-5987-01 A- 11 D- 1669-08 RCC 84a 1 a8d2-54c6-4771 -9092-27c5f7fc4e5c

TCGA-CZ-5988-01A-11D-1669-08 RCC 668172b3-le6f-4362-8432-3651925b86a6

TCGA-CZ-5989-01 A- 11 D- 1669-08 RCC 852el614-35c0-4ba7-a29c-e8e2a91aalb7

TCGA-D V-5565-01 A-01 D- 1534- 10 RCC ee24d408-6043-4ca0-8bde-f29e798cc479

TCGA-D V-5566-01 A-01 D- 1534- 10 RCC 39a321cd-dbdf-474b-aead-6e69795470e0

TCGA-D V-5568-01 A-01 D- 1534- 10 RCC ecb 100d4-24da-40d9-aeel -2901 cf 3 a655a

TCGA-EU-5904-01 A- 11 D- 1669-08 RCC M3e89fl-683b-4261-94al-e371d797237f

TCGA-EU-5905-01 A- 11 D- 1669-08 RCC 091cl8b6-bfc2-4353-9eba-ebc46c2cl8c5

TCGA-EU-5906-01 A- 11 D- 1669-08 RCC 050dc3b7-e560-44f4-a05c-8c792d8467a8

TCGA-EU-5907-01 A- 11 D- 1669-08 RCC 5fded36e-05ba-4cce-8303-738f5b04adl6

TCGA-AB-2807-03D-01W-0755-09 AML 3dl5bdda-bbb7-4e3d-bdd6-7546d2905e95

TCGA-AB-2809-03D-01W-0755-09 AML d86f567d-84f8-4a95-afld-5a26ada92830

TCGA-AB-2814-03D-01W-0755-09 AML 604f0c72-efc7-4868-bc54-79d8f3f3507b

TCGA-AB-2822-03D-01W-0755-09 AML 68b67026-2f30-4839-8579-7a07341b8976

TCGA-AB-2825-03D-01W-0755-09 AML e6e4b579-9ddf-4fbl-bb65-db8321294852

TCGA-AB-2840-03D-01W-0755-09 AML Cbl22429-5b01-4fad-b498-b0342230b567

TCGA-AB-2845-03D-01W-0755-09 AML 98d27719-6f38-433a-ba0a-al4cb32958d8

TCGA-AB-2853-03D-01W-0755-09 AML 9e238bbc-61ba-4966-b30e-ba7abla5bl lb

TCGA-AB-2858-03D-01W-0755-09 AML b9dcb0aa-0098-49a9-a0c8-790a06dadea8

TCGA-AB-2863-03D-01W-0755-09 AML d4ba0ac2-9d98-430b-bb0d-elbada2d5486

TCGA-AB-2864-03D-01W-0755-09 AML 07f07406-597d-40b7-b218-ef40aad6f0bc

TCGA-AB-2872-03A-01W-0732-08 AML 495c3e6d-76fl-499d-894b-761d50b70566

TCGA-AB-2909-03A-01W-0755-09 AML 39ad6508-a476-4a33-ae8d-6e25fa36369e

TCGA-AB-2912-03A-01W-0732-08 AML da01cad7-961b-46e2-8a80-9c846694ad5b

TCGA- AB-2918-03 A-01 W-0745-08 AML d0833641-77al-41fd-b635-d216b00d007b

TCGA-AB-2921-03A-01W-0755-09 AML 779697fe-899a-4bfb-ald3-44a847487b6b

TCGA-AB-2926-03A-01W-0732-08 AML 890ea799-3156-40c3-839c-0c60179006d7

TCGA-AB-2927-03A-01W-0755-09 AML 46bbbl9d-2bc9-4f0a-ac4e-cad7327cal42

TCGA-AB-2934-03A-01W-0755-09 AML 7791el40-fe03-44d0-8250-47826ea993df

TCGA-AB-2946-03A-01W-0755-09 AML f24b41b4-79bf-4736-96c8-83921811bb95

TCGA-AB-2948-03A-01W-0755-09 AML 7b0fbl97-8465-430b-9da7-322f2d218729

TCGA-05-4244-01 A-01 D- 1105-08 LUAD 738c514d-ff0f-4220-9326-236119891df5

TCGA-05-4249-01 A-01 D- 1105-08 LUAD 8be717b5-5b65-4631-al75-lf4c063d447e

TCGA-05-4250-01 A-01 D- 1105-08 LUAD 41 c4fe84-8beb-4a3 a-920c-e74c7edd2182 TCGA-05-4382-01 A-01 D- 1265-08 LUAD 005b918d-e4a9-4971-9588-656a35c33dec

TCGA-05-4384-01A-01D-1753-08 LUAD 4c7 lb66b-813f-472b-b866-b34b5b9199e7

TCGA-05-4389-01 A-01 D- 1265-08 LUAD c6f382d4-a522-4333-88b5-be7f55fe80f5

TCGA-05-4390-01A-02D-1753-08 LUAD d0854b5b-69be-4b84-aa37-ecdd0bcl4de9

TCGA-05-4395-01A-01D-1265-08 LUAD dc45b4de-4c03-4fe4-89e0-dlcf378084b6

TCGA-05-4396-01 A-21 D- 1855-08 LUAD 0176cfld-0760-4769-a493-277f4bb7585e

TCGA-05-4397-01A-01D-1265-08 LUAD 4b7bel 21 -49af-4a44-95dd-0a487d47228f

TCGA-05-4398-01A-01D-1265-08 LUAD 9e4b2be6-el49-4c22-93el-512c3c6bbea8

TCGA-05-4402-01 A-01 D- 1265-08 LUAD 75475a84-582d-4949-a428-le28ad526d8c

TCGA-05-4403-01A-01D-1265-08 LUAD 7e25ac0e-94e4-42f6-ae6f-89d0d21ce09f

TCGA-05-4405-01 A-21 D- 1855-08 LUAD 3efl0eb8-d713-4fda-9e03-bc594b356d77

TCGA-05-4410-01 A-21 D- 1855-08 LUAD f85d0d42-436b-4251-a7fd-7d0f5fddd397

TCGA-05-4415-01 A-22D- 1855-08 LUAD 128f52c7-49dc-4a9f-a5bc-lcl4684edc9c

TCGA-05-4417-01 A-22D- 1855-08 LUAD 57e3657d-7a3c-4d80-a2c2-2de0293f5f05

TCGA-05-4418-01 A-01 D- 1265-08 LUAD b07397ae-592b-4eb4-98b3-7c7e81ecb5e0

TCGA-05-4420-01 A-01 D- 1265-08 LUAD 0536b000-eaf3-4cb2-b46b-8dd9f23c8199

TCGA-05-4422-01 A-01 D- 1265-08 LUAD a5370fl8-e8a9-43d8-9eb8-be678ccd4669

TCGA-05-4424-01 A-22D- 1855-08 LUAD fc500ff5-24c8-4965-94da-b4afafafe2dd

TCGA-05-4425-01A-01D-1753-08 LUAD 4a367804-9934-4241-90da-0ba0245564bd

TCGA-05-4426-01 A-01 D- 1265-08 LUAD 117c6aff-8899-48f4-9328-746207d38eff

TCGA-05-4427-01 A-21 D- 1855-08 LUAD 736e0134-8bla-4ffl-9106-ca09c9812ef6

TCGA-05-4430-01A-02D-1265-08 LUAD 23398531-3f4c-45e6-980b-755165c04974

TCGA-05-4432-01 A-01 D- 1265-08 LUAD 377ab4af-0958-4b8b-ac0c-4cd49cle4c2e

TCGA-05-4433-01A-22D-1855-08 LUAD fab4flca-1605-4c30-8b3e-badb44eb6580

TCGA-05-4434-01 A-01 D- 1265-08 LUAD f529778c-5968-4d87-80c0-bdl4ba2311d0

TCGA-05-5420-01 A-01 D- 1625-08 LUAD 8371b6a4-ffea-4fe5-b997-76ece85064a7

TCGA-05-5423-01 A-01 D- 1625-08 LUAD 209d853d-6c50-4223-a572-a90d58aee51e

TCGA-05-5425-01 A-02D- 1625-08 LUAD 70a3e96b-dd26-419c-9a68-97dea0465d6e

TCGA-05-5428-01 A-01 D- 1625-08 LUAD 7744a93b-0565-4d83-afad-caa02358f258

TCGA-05-5429-01 A-01 D- 1625-08 LUAD 37d0cf lb- 1743-4852-8073-372b 16b5cl7d

TCGA-05-5715-01 A-01 D- 1625-08 LUAD 62fdal7b-lde0-4b7e-bd28-a6793bc36d37

TCGA- 17-Z000-01 A-01 W-0746-08 LUAD ba9d9630-fc6c-4ffb-8464-cla2ddec6579

TCGA- 17-Z001 -01 A-01 W-0746-08 LUAD d5e77555-9412-4e64-a6aa-65c996e3d521

TCGA- 17-Z003-01 A-01 W-0746-08 LUAD 443d768f-b871-4149-9ef0-2d49bc0d05al

TCGA- 17-Z004-01 A-01 W-0746-08 LUAD c 1 a70a4b-2879-48e8-87e 1 -b02c57d58705

TCGA- 17-Z005-01 A-01 W-0746-08 LUAD 96b0bb86-6092-47ef-8088-fd0a4f261439

TCGA- 17-Z007-01 A-01 W-0746-08 LUAD cac5bcd 1 -f044-4275-89cd- 1110d0025537

TCGA- 17-Z008-01 A-01 W-0746-08 LUAD 6b6ddf99-f050-4dfa-85a2-d5a3e3ad56b0

TCGA- 17-Z009-01 A-01 W-0746-08 LUAD 8c5a3460-clfa-4b7b-9b31-l lf9c7b03255

TCGA- 17-ZO 10-01 A-01 W-0746-08 LUAD c9fb7916-74d0-4266-b5b8-705018e0e76b

TCGA- 17-ZO 11 -01 A-01 W-0746-08 LUAD d7495a00-b312-4502-9elb-9e5f3dbf4b5d TCGA- 17-ZO 12-01 A-01 W-0746-08 LUAD 861e9d45-df9a-41a6-9ddf-bc72f85aed80

TCGA- 17-ZO 13-01 A-01 W-0746-08 LUAD ee0cbaf2-a0bb-4e58-9e52-5986b5f4f25e

TCGA- 17-ZO 14-01 A-01 W-0746-08 LUAD ca24ac3d-4686-4f0c-a47d-0eff92a623bl

TCGA- 17-ZO 15-01 A-01 W-0746-08 LUAD 770c22ba-b759-433e-8478-b6cf0d685447

TCGA- 17-ZO 16-01 A-01 W-0746-08 LUAD 39bbd67b-52fd-46e5-98cf-b5632400216d

TCGA- 17-ZO 17-01 A-01 W-0746-08 LUAD 37049bfl-55cb-44d3-b673-le270ea835f7

TCGA- 17-ZO 18-01 A-01 W-0746-08 LUAD ddla61eb-8362-41a9-952d-b7e6887457ad

TCGA- 17-Z020-01 A-01 W-0746-08 LUAD 7ea20aa3-68cf-4389-9ace-99d6149dl6cl

TCGA- 17-Z021 -01 A-01 W-0746-08 LUAD 9394b536-cd08-414b-86a3-c6491f967709

TCGA- 17-Z022-01 A-01 W-0746-08 LUAD 7f07e5b3-bf70-4690-84ba-a9eace798a24

TCGA- 17-Z023-01 A-01 W-0746-08 LUAD bd72330a-463f-47 lb-9eba-2f 188524e74c

TCGA- 17-Z025-01 A-01 W-0746-08 LUAD 99eab29e-32d3-49d5-aa30-56de8be556e7

TCGA- 17-Z026-01 A-01 W-0746-08 LUAD bb048ffc-de00-4706-85bb-d052c0fb6496

TCGA- 17-Z027-01 A-01 W-0746-08 LUAD 880452fe-00ed-4732-bbcf-14b55c235e61

TCGA- 17-Z028-01 A-01 W-0746-08 LUAD If55fb6e-342a-41e0-9a8e-7c5156c95eaa

TCGA- 17-Z030-01 A-01 W-0746-08 LUAD e35e27e8-6cc5-495b-9ae8-89f65d94ebed

TCGA- 17-Z031 -01 A-01 W-0746-08 LUAD 6516244a-dfd8-4568-a2d2-7556cbea52b 1

TCGA- 17-Z032-01 A-01 W-0746-08 LUAD 92bc438b-02cl-4b81-a90a-4al302786a81

TCGA-17-Z033-01A-01W-0746-08 LUAD 639aea7c-5a38-4641-bf0d-90a9ce8e2980

TCGA- 17-Z035-01 A-01 W-0746-08 LUAD a4bcbb2e-594f-4a89-8b72-8c922a64cdef

TCGA- 17-Z036-01 A-01 W-0746-08 LUAD 374b881 a-dbe2-4b4b-bfc0-843 If 1 aec06c

TCGA- 17-Z037-01 A-01 W-0746-08 LUAD bffe237d-31b0-4950-a7ab-4ac7047aa3c0

TCGA- 17-Z038-01 A-01 W-0746-08 LUAD 8785c362- 1 c4d-41 da-a29e-5cf f21 dc2a2e

TCGA- 17-Z040-01 A-01 W-0746-08 LUAD 62d2ca54-b8e0-4907-b75e-cb9786069b52

TCGA- 17-Z041 -01 A-01 W-0746-08 LUAD c0ead7c7- 169e-4932-a987-5461611 c95e6

TCGA- 17-Z042-01 A-01 W-0746-08 LUAD 3c303c9d-6cda-490d-a64d-21bc40b064f3

TCGA- 17-Z043-01 A-01 W-0746-08 LUAD 577f7267-c568-4002-al53-26c09dleca97

TCGA- 17-Z044-01 A-01 W-0746-08 LUAD cblaaeb8-0c6f-4266-968c-38a3823d85f6

TCGA- 17-Z045-01 A-01 W-0746-08 LUAD ec7e65c5-7158-427f-8034-8616077da50b

TCGA- 17-Z046-01 A-01 W-0746-08 LUAD 7aac0e3f-39fe-4c9a-9482-50f02flb919d

TCGA- 17-Z047-01 A-01 W-0747-08 LUAD 2c04cfa8-6e99-46fa-82ad-36fb96e5ffef

TCGA- 17-Z048-01 A-01 W-0746-08 LUAD 8495el50-796b-4el5-9fa6-lfba558d7bl0

TCGA- 17-Z049-01 A-01 W-0746-08 LUAD ac31bcc6-6ccc-43b7-96f2-3ab47050be76

TCGA- 17-Z050-01 A-01 W-0747-08 LUAD d086dd38-a9e0-466c-ble5-9a4a879abd55

TCGA- 17-Z051 -01 A-01 W-0747-08 LUAD 5584878f-0608-45d9-8e28-29c277bf655f

TCGA- 17-Z052-01 A-01 W-0747-08 LUAD afdf7c82-2al7-4c73-980c-74ec822dc803

TCGA- 17-Z053-01 A-01 W-0747-08 LUAD 2d422986-6e91-4299-b6cf-4076f3706c83

TCGA- 17-Z054-01 A-01 W-0747-08 LUAD 409dd077-dab9-4f79-9c33-2c3b75b63125

TCGA- 17-Z055-01 A-01 W-0747-08 LUAD de78326d-3afc-4f29-af7f-1750da544826

TCGA- 17-Z056-01 A-01 W-0747-08 LUAD e6cb3d63-5a55-4eba-84d2-a25917c7bl 8e

TCGA- 17-Z057-01 A-01 W-0747-08 LUAD 4236905d-1549-4cbc-b3c6-e62db9ea598b TCGA- 17-Z058-01 A-01 W-0747-08 LUAD 6b0blfca-efce-49d6-9f7b-a2c34bb343e9

TCGA- 17-Z059-01 A-01 W-0747-08 LUAD 88ec6fb4- lb8 l-422e-8204-ef9e8dbf260c

TCGA- 17-Z060-01 A-01 W-0747-08 LUAD f834dfa4-8d9c-4e0b-861f-a3cc31245237

TCGA- 17-Z061 -01 A-01 W-0747-08 LUAD 1 eb07e6e-6cf 8-45e4-9b5c- 1 a9a5d38d 117

TCGA- 17-Z062-01 A-01 W-0747-08 LUAD f3280e5f-7d6e-4al8-a5a5-e84b805c9e66

TCGA-35-3615-01A LUAD 7407d705-6ec6-4143-93d2-eedcf5a22399

TCGA-35-3621-01A-01D-0969-08 LUAD 4a0cc41 a-562c-4aea-a7c3-b 1186d46cda8

TCGA-35-4122-01 A-01 D- 1105-08 LUAD 408elcb4-64a8-4801-bf58-3b8183ede851

TCGA-35-4123-01 A-01 D- 1105-08 LUAD 7ceccaee-df27-4f7f-bfcd-elc59b365711

TCGA-35-5375-01A-01D-1625-08 LUAD 63e76bef-3efl-445f-b591-649d774729cd

TCGA-38-4625-01A-01D-1553-08 LUAD 6f317d31-c9a4-4345-b5bl-b75776536402

TCGA-38-4626-01A-01D-1553-08 LUAD 85b56ce7-b420-433e-a77d-43ef628d685c

TCGA-38-4627-01A-01D-1553-08 LUAD abef97da-d7db-495f-b594-fa66577becd6

TCGA-38-4628-01A-01D-1265-08 LUAD 67bc44b7-92cf-4e8f-a7f6-c53bf34al7c6

TCGA-38-4629-01A-02D-1265-08 LUAD 4797f969-5f4d-4681-9fc5-68f25ba8f4d8

TCGA-38-4630-01A-01D-1265-08 LUAD 2b 139bb4-5a29-4684-901d-8d966ff79ac2

TCGA-38-4631-01A-01D-1753-08 LUAD b3ffc36d-b0b8-4ada-a00a-b48890c0162c

TCGA-38-4632-01A-01D-1753-08 LUAD 83519ed 1 -29e2-4f 1 b-922c-5779f 64178bc

TCGA-38-6178-01A-11D-1753-08 LUAD 7fa467fl-d928-4d81-bd0b-68d67a5cl8cf

TCGA-44-2655-01A LUAD 9fcabdal-ea79-4188-8b3f-7d0fd060a819

TCGA-44-2656-01A LUAD 5593f581-3d45-4a4a-a525-bfaelf4753a0

TCGA-44-2657-01 A-01 D- 1105-08 LUAD e3aa9b45-13b9-4b61-a30f-ae3f88466040

TCGA-44-2661 -01 A-01 D- 1105-08 LUAD 3c3a2e7c-9aa0-495e-95c7-87f661b9ed92

TCGA-44-2662-01A LUAD d2198941-e96f-40bd-9fbe-82886217d5db

TCGA-44-2665-01A LUAD a0863fa6-515c-44fa-825f-f9e243f945fl

TCGA-44-2666-01A LUAD 27a64f32-69c5-4c49-86b4-c8fc923cae08

TCGA-44-2668-01A LUAD dd9a6c68-b8b4-4168-9ff9-72a45f20c44f

TCGA-44-3396-01A-01D-1265-08 LUAD d68b216c-b304-4b30-9af7-eb3a9ala55ae

TCGA-44-3398-01 A-01 D- 1105-08 LUAD 82284bb3-2dfa-4016-a908-3b5994e00d31

TCGA-44-3918-01A-01D-1105-08 LUAD 7f456c3f-58e3-43fl-9f76-4422451528a5

TCGA-44-3919-01A LUAD 9de8d353-3442-41d8-8bfe-a08c4975eaca

TCGA-44-4112-01A LUAD 6c206676-e511-4281-91f5-bfe91b3279a4

TCGA-44-5643-01 A-01 D- 1625-08 LUAD 44286013-ae97-4890-86d3-1163285ac0cd

TCGA-44-5645-01 A-01 D- 1625-08 LUAD dac33765-0c88-4a51-8389-c042ccb78c83

TCGA-44-6144-01A-11D-1753-08 LUAD fl9575fd-eb9d-429f-96ce-c0e8f4bbc593

TCGA-44-6145-01A-11D-1753-08 LUAD 220dc947-4afc-4485-bcc7-cea046100b4b

TCGA-44-6146-01A-11D-1753-08 LUAD d5e90162-d7d2-4a7c-89f0-51c2b32c9ef0

TCGA-44-6147-01A-11D-1753-08 LUAD 7b6daa70-492e-4283-b3d2-b26f4e26a8d4

TCGA-44-6148-01A-11D-1753-08 LUAD 9c7b3ac8-1352-49cd-8a8c-df6bl9f6fd64

TCGA-44-6774-01 A-21 D- 1855-08 LUAD f9ccld71-bece-4693-b953-3e73dlb6cl lc

TCGA-44-6775-01 A- 11 D- 1855-08 LUAD 7a70a44f-84f3-440a-b898-dc3a0eff748e TCGA-44-6776-01 A- 11 D- 1855-08 LUAD 7d3c5101-fae2-4320-a8a2-a93753375368

TCGA-44-6777-01 A- 11 D- 1855-08 LUAD 32a0f0f3-3879-4b96-b9bb-eeab87827f6e

TCGA-44-6778-01 A- 11 D- 1855-08 LUAD 903182ad-3145-4fa3-869e-62774aedf86c

TCGA-44-6779-01 A- 11 D- 1855-08 LUAD d6990a90-6a99-490b-a476-5298f0c4e4f2

TCGA-49-4486-01 A-01 D- 1265-08 LUAD 3acl32c3-4889-4dc3-8b3d-0ef98065a858

TCGA-49-4487-01 A-21 D- 1855-08 LUAD 9bd8e303-a81e-4ff8-882b-d46a2f7c55d2

TCGA-49-4488-01A-01D-1753-08 LUAD 3635bb9c-a332-4445-ad81-83cec426dd02

TCGA-49-4490-01 A-21 D- 1855-08 LUAD 940455cf-aa91-432a-bc39-9dfba206e32b

TCGA-49-4494-01 A-01 D- 1265-08 LUAD 136bc973-1908-4767-9b22-d43d522b7c71

TCGA-49-4501 -01 A-01 D- 1265-08 LUAD 0c53bblb-5e6f-44a8-97a0-f89d43e0e789

TCGA-49-4505-01 A-01 D- 1265-08 LUAD e773a2fe-ld80-492d-bba8-105036al4a92

TCGA-49-4506-01 A-01 D- 1265-08 LUAD d707f 8ad-5ea5-493 a-a745-9b5dba64f213

TCGA-49-4507-01 A-01 D- 1265-08 LUAD 562a09al-b491-45c8-a87d-3c2471353c0d

TCGA-49-4510-01A-01D-1265-08 LUAD b2cl2bff-addd-45a2-ada4-c30ac935809c

TCGA-49-4512-01 A-21 D- 1855-08 LUAD fa6a60f5-8949-4e01-9435-d3117601627f

TCGA-49-4514-01 A-21 D- 1855-08 LUAD 7751af67-1415-475e-8ec5-66d76f515014

TCGA-49-6742-01 A- 11 D- 1855-08 LUAD 49dec0c2-8e75-4f44-a253-82b2ea605890

TCGA-49-6743-01 A- 11 D- 1855-08 LUAD 545c9d29-a8e0-4d2d-8552-d27b46f96070

TCGA-49-6744-01 A- 11 D- 1855-08 LUAD bf6ba698-7154-4d7f-b076-24ac2f768696

TCGA-49-6745-01 A- 11 D- 1855-08 LUAD bfb97048-977b-4722-be8f-3dd37370ba30

TCGA-49-6767-01A-11D-1855-08 LUAD 9f82f494-042a-4f00-954c-4761fa25b298

TCGA-50-5044-01 A-21 D- 1855-08 LUAD ec034986-4bf7-4554-b635-ca6d9c30da28

TCGA-50-5045-01 A-01 D- 1625-08 LUAD b0d734ad-1222-4bc0-b02b-ld2262b8ac35

TCGA-50-5049-01 A-01 D- 1625-08 LUAD 96358297-0735-4eab-a01c-a6be5d86a3de

TCGA-50-5051 -01 A-21 D- 1855-08 LUAD bb50bc27-fb 18-4eee-8785-b8e8b69bcbe6

TCGA-50-5055-01 A-01 D- 1625-08 LUAD 12fel53e-a8f7-49ec-9e0c-f680e2311cf6

TCGA-50-5066-01 A-01 D- 1625-08 LUAD f5a97315- 1906-4774-980e-0879c6ad368e

TCGA-50-5068-01 A-01 D- 1625-08 LUAD Clefdc48-6ea5-45f0-9fa3-94c42ecf3ab4

TCGA-50-5072-01 A-21 D- 1855-08 LUAD 3c6dcba5-1312-40ca-b589-07f7d88b3477

TCGA-50-5930-01A-11D-1753-08 LUAD bd3e88b3-b37c-4641-85fa-d8125ba324ca

TCGA-50-5931-01A-11D-1753-08 LUAD 290847c6-c9d4-4al 6-a70f-0488e3718f35

TCGA-50-5932-01A-11D-1753-08 LUAD 6726cl57-f688-491d-8b56-35628645df89

TCGA-50-5933-01A-11D-1753-08 LUAD Cc3a9cfe-8al4-4fb4-a60f-3ec795c5d7al

TCGA-50-5935-01A-11D-1753-08 LUAD 9570cd02-3339-4805-855a-74ebe429df96

TCGA-50-5936-01 A- 11 D- 1625-08 LUAD 82d380d5-4c07-4cf0-a6e9-7ca9e3fc9a08

TCGA-50-5939-01A-11D-1625-08 LUAD aa9108d7-5036-4059-ad82-dc64161 d5bc3

TCGA-50-5941-01A-11D-1753-08 LUAD 86efl2c0-d5fc-4852-9960-593366e717b4

TCGA-50-5942-01A-21D-1753-08 LUAD 95475clb-086d-4e09-a871-47d8f76cla07

TCGA-50-5944-01A-11D-1753-08 LUAD a314ee0c-694b-4ac8-b572-fflfbbda4765

TCGA-50-5946-01A-11D-1753-08 LUAD 142d43e8-10el-4945-a37c-f2824d53bl22

TCGA-50-6590-01 A- 12D- 1855-08 LUAD 85del82b-f4ae-41e6-b3fb-f60f46c072e4 TCGA-50-6591-01A-11D-1753-08 LUAD bf7462a2-394f-4838-bcb6-4d0126fa48bl

TCGA-50-6592-01A-11D-1753-08 LUAD d0303d05-a937-4a7d-9934-ffa93cclc5de

TCGA-50-6593-01A-11D-1753-08 LUAD 10e03053-f6e3-42b7-8638-ce58c6e7dfaa

TCGA-50-6594-01A-11D-1753-08 LUAD el365c7d-e93e-4478-a8e9-ae2d7ca30bc6

TCGA-50-6595-01 A- 12D- 1855-08 LUAD 9913e506-fc98-467d-8601-89595d0475e8

TCGA-50-6597-01A-11D-1855-08 LUAD cd0aeed5-93al-4287-8a88-fe6b7b5e3983

TCGA-55-1592-01A LUAD el90a9e4-10ae-4060-a071-4b8b73479023

TCGA-55-1594-01A LUAD 2885d4b3-34a6-421 d-b20c-eedad721 d 10a

TCGA-55- 1595-01 A-01 D-0969-08 LUAD flbe8e08-5201-49bb-abf7-cedc0eff06d6

TCGA-55-1596-01A LUAD 9a7alb22-9df6-438f-ad00-54755c7dbc7c

TCGA-55-5899-01A-11D-1625-08 LUAD ddaf36f7-7503-4ab4-b7f5-9777c0cl518c

TCGA-55-6543-01A-11D-1753-08 LUAD ac7ab3b3-eb76-4da9-bfb3-82b90c8d79d6

TCGA-55-6642-01 A- 11 D- 1855-08 LUAD 3c756f7c-d 1 f0-4ab 1 -9c9f-41 d2282af 3bf

TCGA-55-6712-01A-11D-1855-08 LUAD bc6eaf2b-9ccc-4ac7-9b 19-204b0ff420a3

TCGA-64-1676-01A LUAD 4bdf77d2-33cc-46e0-af34-le66a90a213a

TCGA-64-1677-01A-01W-0928-08 LUAD 559017d8-4b22-4313-abdd-d3526c889d7f

TCGA-64-1678-01A-01W-0928-08 LUAD 42e3b592-b57f-4b 18-8f 62-e7b0a9c0f 1 db

TCGA-64-1680-01A LUAD 0bdbe623-cf95-465a-917d-87dfb6a8618e

TCGA-64-5774-01 A-01 D- 1625-08 LUAD df5957d5-20d3-483e-990b-d6369fb990b8

TCGA-64-5775-01 A-01 D- 1625-08 LUAD C209d392-7d3a-481c-8cc7-398a6b90290a

TCGA-64-5778-01 A-01 D- 1625-08 LUAD 3c540f87-5981-4b7a-blab-30c2056c785e

TCGA-64-5779-01 A-01 D- 1625-08 LUAD 573471 Ib-52cd-46e6-9c2a-92c0612fee33

TCGA-64-5781 -01 A-01 D- 1625-08 LUAD fb9cfb49-99cf-4f49-8f3d-e25e762eb3ce

TCGA-64-5815-01 A-01 D- 1625-08 LUAD e800c8d4-786a-4a9d-ace2-2b779336e557

TCGA-67-3770-01A LUAD 74bcf2d5-fd42-423e-bd96-b2delb0cf778

TCGA-67-3771-01A LUAD b0410cd6-693d-41d6-9dad-dlblc30bf5cb

TCGA-67-3772-01A-01W-0928-08 LUAD 09226bc4-0202-4405-b3c9-208e8ffb7408

TCGA-67-3773-01A LUAD e4cb66f4-e847-40bf-afl4-20a3867alc35

TCGA-67-3774-01A LUAD b3585415-9ab9-4614-8bl5-8edb66efdldc

TCGA-67-4679-01B-01D-1753-08 LUAD 341bf21e-abd5-498e-8c49-111782af842c

TCGA-67-6215-01A-11D-1753-08 LUAD 68c2a355-862c-4657-b296-5776ed8447b0

TCGA-67-6216-01A-11D-1753-08 LUAD 6dc6da8c-2ecf-412f-b2c4-74529adb7c0f

TCGA-67-6217-01A-11D-1753-08 LUAD Cb98d825-668f-4bl6-a05e-501elc94f3fe

TCGA-71 -6725-01 A- 11 D- 1855-08 LUAD 3al46eb4-7b9b-4834-b3d0-eac80f9173ec

TCGA-73-4658-01A-01D-1753-08 LUAD b 11151 cf-6976-4812-a77e- 1 al 2f9d 1245c

TCGA-73-4659-01A-01D-1265-08 LUAD 13989aec-bla3-47c2-bc8e-ccf55f8e0cl l

TCGA-73-4662-01A-01D-1265-08 LUAD 48262c89-ecac-44c6-9a06-7170b7b41058

TCGA-73-4666-01A-01D-1265-08 LUAD f49fc77e-03cd-423c-b3el-18bbl9568650

TCGA-73-4668-01A-01D-1265-08 LUAD 0fdcb5e9-ada2-4755-ae02-491037ee9cl0

TCGA-73-4670-01A-01D-1265-08 LUAD 2aea0652-17ae-4dfa-9358-206d4f24f02f

TCGA-73-4675-01A-01D-1265-08 LUAD 59dad620-51f8-4cl2-8b09-e635fbdel26e TCGA-73-4676-01A-01D-1753-08 LUAD ff368c6d-fedb-49cc-b519-7726816aff8d

TCGA-73-4677-01A-01D-1265-08 LUAD a9c03165-d534-425e-8370-dlf557b82fa2

TCGA-75-5122-01A-01D-1753-08 LUAD e359b24f-7312-432f-b054-68dedc027df2

TCGA-75-5125-01A-01D-1753-08 LUAD 4cee9575-3040-4ffl-bf7e-ca8873860c59

TCGA-75-5126-01A-01D-1753-08 LUAD 1 c 1 ad 138-a59e-4f5d-8382-54c585c9298c

TCGA-75-5146-01 A-01 D- 1625-08 LUAD 965a2bb7-6cd4-4309-beba-51ae74b8a980

TCGA-75-5147-01 A-01 D- 1625-08 LUAD 5291 Oa60-bb 15-4ba5-9d09-50d8ee6a445b

TCGA-75-6203-01A-11D-1753-08 LUAD d9cd7f95-07d3-4b87-be83-87340b08d249

TCGA-75-6205-01A-11D-1753-08 LUAD 79cOel83-95aa-4c37-9bl5-8567aa87c93a

TCGA-75-6206-01A-11D-1753-08 LUAD 7a5ca29b-85d3-46bl-a710-6dcd3ce821c8

TCGA-75-6207-01A-11D-1753-08 LUAD 5a49e3fd-a47d-4b7d-9485-4238a88f4516

TCGA-75-6211-01A-11D-1753-08 LUAD d8c9abbe-bl l2-4019-a6a3-f582dfl379ed

TCGA-75-6212-01A-11D-1753-08 LUAD 0f2af4c9-05a8-4c97-ac2d-af9241b4ea64

TCGA-80-5611 -01 A-01 D- 1625-08 LUAD C9bab512-c5c3-4ad3-a9bf-f5258e405966

TCGA-86-6562-01A-11D-1753-08 LUAD e48ddl lb-89ae-4278-8de0-7956423c8609

TCGA-91-6828-01A-11D-1855-08 LUAD 99f819f2-4340-4303-8ffO-fdb03ef0151a

TCGA-91 -6829-01 A-21 D- 1855-08 LUAD 443f5b2d-832e-45cf-bca5-3f064ea3bc50

TCGA-91-6831-01A-11D-1855-08 LUAD 1624af6f-05a6-474c-ba49-9754938979c6

TCGA-91-6835-01A-11D-1855-08 LUAD 8120c5eb-2917-4053-a5e5-aad53ff45da9

TCGA-91-6836-01A-21D-1855-08 LUAD 87045814-366d-4e42-97f2-ad341 c620c47

TCGA-18-3406-01A-01D-0983-08 LUSC d3320989-71fd-425b-933e-6e8528a016ed

TCGA-18-3407-01A-01D-0983-08 LUSC c5b09119-0237-4804-a4f9-b67d676b8674

TCGA-18-3408-01A-01D-0983-08 LUSC Cab7a425-e081-4bae-b666-6cdf8ba4dd70

TCGA-18-3409-01A-01D-0983-08 LUSC aa733cbO-37a9-4fef-8d40-d57596ce9e51

TCGA-18-3410-01A-01D-0983-08 LUSC 7e6382c3-368a-43a5-9812-c58f54ceba3f

TCGA-18-3411-01A-01D-0983-08 LUSC 6a9cc303-c7fd-4f40-8933-1636dea99252

TCGA-18-3412-01A-01D-0983-08 LUSC 84aca315-8380-4625-887f-a8b3c704cOa9

TCGA-18-3414-01A-01D-0983-08 LUSC 239deee9-2791 -4163-b777-fdf 8c49c9e33

TCGA-18-3415-01A-01D-0983-08 LUSC ad0365d 1 - 1 Ob 1 -41 e6-b838-9c5794b9ad42

TCGA-18-3416-01A-01D-0983-08 LUSC e03577e7-37be-460b-96e8-5f6e0b49b3aa

TCGA- 18-3417-01 A-01 D- 1441 -08 LUSC 024d8a82-06c5-4b82-9a27-c52bc4fd450a

TCGA-18-3419-01A-01D-0983-08 LUSC c75ed357-d845-4443-8c9e-a2afa8ed30df

TCGA-18-3421-01A-01D-0983-08 LUSC 9f0e482e-e72d-4c57-b4f7-4580edabd390

TCGA- 18-4083-01 A-01 D- 1352-08 LUSC 0b87a82d-096c-4dd7-80c4-b4054fcleba2

TCGA- 18-4086-01 A-01 D- 1352-08 LUSC 9bbdf 36b-6804-416f-977d-fce772972bcc

TCGA- 18-4721 -01 A-01 D- 1441 -08 LUSC d2ab2555-7288-47a4-a80c-bf62d65b67b8

TCGA- 18-5592-01 A-01 D- 1632-08 LUSC 1 a6da454-8f af-4725-a702-55d29da461 a5

TCGA- 18-5595-01 A-01 D- 1632-08 LUSC 973b8ed8-2295-4fb0-b857-f4433dfc785a

TCGA-21 - 1070-01 A-01 D- 1521 -08 LUSC 9e300205-bl6d-4f40-bflb-f47410678f6d

TCGA-21-1071-01A-01D-1521-08 LUSC e01302f9-c5d6-4745-9c5d-d8bb8d278a77

TCGA-21 - 1076-01 A-02D- 1521 -08 LUSC 504d4cb0-d2dd-420d-82e6-9ecl4434a0fc TCGA-21 - 1077-01 A-01 D- 1521 -08 LUSC a71 d74cb-5b 10-4787-a654-7049cbb49a92

TCGA-21 - 1078-01 A-01 D- 1521 -08 LUSC 8cf9b32d-3d6f-4898-8c7a-89511b754021

TCGA-21-1081-01A-01D-1521-08 LUSC 811f7all-635c-4606-91fd-3729b97ffd8e

TCGA-21-5782-01A-01D-1632-08 LUSC 4c2ad4a0-5d57-4e27-9f35-058b2f205f50

TCGA-21-5784-01A-01D-1632-08 LUSC f79285af-c364-4ec3-97d3-70a7d9b5800b

TCGA-21-5786-01A-01D-1632-08 LUSC d7404e0f-d 171 -419b-97d3-807570aba 129

TCGA-21-5787-01A-01D-1632-08 LUSC 7cb79e4b-clfl-434d-bl3b-6c2eb7760ee8

TCGA-22-0944-01 A-01 D- 1521 -08 LUSC 818a6f09-a7fd-4cce-8373-adb4bcb5bc8c

TCGA-22- 1002-01 A-01 D- 1521 -08 LUSC 7c7604fe-8321-46cb-ac34-0e7994b8853b

TCGA-22- 1011 -01 A-01 D- 1521 -08 LUSC C9924f9f-fd86-434c-a83d-393d65272e64

TCGA-22-1012-01A-01D-1521-08 LUSC 3b75368a-d57f-4787-a0ef-3f478c7d22bc

TCGA-22- 1016-01 A-01 D- 1521 -08 LUSC 935bll3e-f5ed-4a07-8eld-1603daba7f40

TCGA-22-4591 -01 A-01 D- 1267-08 LUSC bcfb93d4-8653-477b-b5d2-c2832a0e3d92

TCGA-22-4593-01 A-21 D- 1817-08 LUSC b4a48075-92fd-43ab-95f3-476bcea88d7b

TCGA-22-4595-01 A-01 D- 1267-08 LUSC 7fcf5123-2dlb-4666-9d39-alaaf63cf954

TCGA-22-4599-01 A-01 D- 1441 -08 LUSC 08732b5 l-8ec8-4888-bOc8-aOcb8318 lcb9

TCGA-22-4601 -01 A-01 D- 1441 -08 LUSC 6c05b3f5-65e9-4e7d-9f99-a694006f2ed0

TCGA-22-4604-01 A-01 D- 1267-08 LUSC db2614fb-109c-4cel-af4c-f648a0d417fb

TCGA-22-4607-01 A-01 D- 1267-08 LUSC d8c6bb83-ebdd-4547-9077-3eba5c8bb9fO

TCGA-22-4613-01 A-01 D- 1441 -08 LUSC 5d 1 d538a-57d3-42ec-9f a3-0f ad 10b0f52f

TCGA-22-5471-01A-01D-1632-08 LUSC 665e98bf-6163-4dl 8-9665-ba93df9ecf6d

TCGA-22-5472-01A-01D-1632-08 LUSC be780766-483f-42f5-b0d0-l ld23a940156

TCGA-22-5473-01A-01D-1632-08 LUSC Cl07cald-5e35-470a-8c39-80dc7624e306

TCGA-22-5474-01A-01D-1632-08 LUSC 1 eda33fc-80e5-4c5f-8c61 -43976caO 106f

TCGA-22-5477-01 A-01 D- 1632-08 LUSC e7ebc6fb-0926-4c8a-a67b-0c6b9clffaba

TCGA-22-5478-01 A-01 D- 1632-08 LUSC 0ac704eb-d722-4c27-bfb4-fea6ca7af240

TCGA-22-5480-01 A-01 D- 1632-08 LUSC 24e426fb-219a-4a4d-a45c-c9b0896d0e88

TCGA-22-5482-01 A-01 D- 1632-08 LUSC b57c316e-lcae-4286-bdbb-8b65c020b3fa

TCGA-22-5485-01 A-01 D- 1632-08 LUSC 448af8b4-e071-48b0-a65b-b4adl7afdc0c

TCGA-22-5489-01 A-01 D- 1632-08 LUSC c4eb6681-7ec3-4688-b06a-c47a0043f3fb

TCGA-22-5491-01A-01D-1632-08 LUSC ed4b5a8c-ldae-41a3-8a2a-f54fa51be4b8

TCGA-22-5492-01A-01D-1632-08 LUSC abc94013-71f5-4ac6-88a4-01b4ef9f9d2f

TCGA-33-4532-01A-01D-1267-08 LUSC c8baeba2-2a73-41d7-9226-b89a8f42el8f

TCGA-33-4533-01A-01D-1267-08 LUSC 52b8c7cl-2cfe-410d-a738-ldec43109e24

TCGA-33-4538-01A-01D-1267-08 LUSC e04814f8-a5 If-4b6b-a4e9-bd8d2291817c

TCGA-33-4547-01 A-01 D- 1267-08 LUSC 7e622fc2-06c5-4686-a885-e407725c2f08

TCGA-33-4566-01 A-01 D- 1441 -08 LUSC ddd84ea3-dd5e-4f95-97c3-84cl07cl9cad

TCGA-33-4582-01 A-01 D- 1441 -08 LUSC 4cb06585-62f9-4aae-969a-2085b4d514c3

TCGA-33-4583-01A-01D- 1441-08 LUSC fb901997-6e46-436f-ad34-74aadc344245

TCGA-33-4586-01 A-01 D- 1441 -08 LUSC e6bf4288-9fdd-4c56-b6d2-fa2f5ee542b6

TCGA-33-6737-01A-11D-1817-08 LUSC 3b21ce38-16c6-4c68-9104-fal lflb619bl TCGA-34-2596-01 A-01 D- 1522-08 LUSC 66e35f68-f4db-46ee-876e-e770ea616ef3

TCGA-34-2600-01 A-01 D- 1522-08 LUSC 167e0f4e-e7d3-4942-885a-cf06419bbe6d

TCGA-34-2608-01A-02D-1522-08 LUSC 3c90209b-b6f6-40b2-a374-6cd37d6d3895

TCGA-34-5231 -01 A-21 D- 1817-08 LUSC c9862ed2-4ba6-434d-a205-b Ibda292d218

TCGA-34-5232-01 A-21 D- 1817-08 LUSC f32fff2f-0bbf-475f-b088-3fl699203c31

TCGA-34-5234-01 A-01 D- 1632-08 LUSC 7bl9ae84-2cab-47e7-87df-46c497dal7e0

TCGA-34-5236-01A-21D-1817-08 LUSC 46cb2de7-bbel-4444-bl7e-4c5677a05249

TCGA-34-5239-01 A-21 D- 1817-08 LUSC 6e596912-2146-4c4f-97b6-70b610f5d4b4

TCGA-34-5240-01 A-01 D- 1441 -08 LUSC 4c3840df-9824-40db-879e-6d24adc8cl55

TCGA-34-5241 -01 A-01 D- 1441 -08 LUSC 0bcdbc37-cde8-47df-9184-621b2b47da5b

TCGA-34-5927-01 A- 11 D- 1817-08 LUSC d717b 13 a-e487-4cad-9aae-4b0d649236c4

TCGA-34-5928-01 A- 11 D- 1817-08 LUSC 9e2d032e-f982-44fc-b6e0-3be82f029689

TCGA-34-5929-01 A- 11 D- 1817-08 LUSC a25de54e-cl3d-4973-864a-e307fbe7324a

TCGA-37-3783-01A-01D-1267-08 LUSC 711 e9b21 -bd8c-4058-a0ce-5ff4dc23b527

TCGA-37-3789-01A-01D-0983-08 LUSC d732196f-ef85-43ea-aac7-7c9060bfl9c5

TCGA-37-4133-01A-01D-1352-08 LUSC a678cc49-9009-4027-826f-el7f4533538d

TCGA-37-4135-01 A-01 D- 1352-08 LUSC 754dda66-fceb-4f63-bc99-c98aaa86bOc2

TCGA-37-4141-01A-02D-1352-08 LUSC 3d4f4555-d71 a-4c7d-8667-c42dcc20c076

TCGA-37-5819-01A-01D-1632-08 LUSC edf2a2c0-3829-4da2-8960-598fbd5c4c07

TCGA-39-5016-01 A-01 D- 1441 -08 LUSC d63aOa46-7676-40f5-8e03-b8317d243c73

TCGA-39-5019-01A-01D-1817-08 LUSC 6aecd71e-84fl-4b4d-bff6-ede33026f58b

TCGA-39-5021 -01 A-01 D- 1441 -08 LUSC 4d8b4c6f-e6eb-4799-b64d-119afc691e3d

TCGA-39-5022-01 A-21 D- 1817-08 LUSC f60928ab-0cbl-4483-8d61-48a5333defbf

TCGA-39-5024-01 A-21 D- 1817-08 LUSC 388478e9-8clf-43f8-88c4-811bf3cc2500

TCGA-39-5027-01 A-21 D- 1817-08 LUSC 32cl4926-b510-4714-90b2-b0bd68569cd4

TCGA-39-5028-01 A-01 D- 1441 -08 LUSC 015b9329-ecf2-4410-b7b6-f9313b5d2adb

TCGA-39-5029-01 A-01 D- 1441 -08 LUSC aa02c83c-7ef0-400d-bd8d-729dacda6352

TCGA-39-5030-01 A-01 D- 1441 -08 LUSC 9e7b63f2-6080-4bb0-b45d-a0d40dffcbe0

TCGA-39-5031 -01 A-01 D- 1441 -08 LUSC 3eab4096-8e8e-459d-a2bb-6ef03f414315

TCGA-39-5035-01A-01D- 1441-08 LUSC 035fe73e-56b4-4afe-b70e-dd3c34027f2d

TCGA-39-5036-01A-01D- 1441-08 LUSC alaa5fba-fl79-4777-8d49-345a366dl2fa

TCGA-39-5037-01A-01D- 1441-08 LUSC 825bd82c-f 8f 8-4776-a7f5-713b3 a574955

TCGA-39-5039-01A-01D- 1441-08 LUSC Oc 14e914-abd4-4406-be82-a81 Ob 1 Oa 1320

TCGA-43-2578-01A-01D-1522-08 LUSC 7ce90b30-d372-4edb-9807-b71cb5eb4cb7

TCGA-43-3394-01A-01D-0983-08 LUSC bb72e789-f8ad-4ab5-805b-a9ac21cef0e3

TCGA-43-3920-01A-01D-0983-08 LUSC a97333f4-d289-493f-8dff-88e52719fa86

TCGA-43-5668-01A-01D-1632-08 LUSC f01dfe80-aee9-44f6-b32d-3591fbc3c0f5

TCGA-43-6143-01A-11D-1817-08 LUSC 3874253f-7168-4cd6-b 1 d6-f426f a207313

TCGA-43-6647-01A-11D-1817-08 LUSC 90b97948-26f7-4431-be89-af8c432baae0

TCGA-43-6770-01A-11D-1817-08 LUSC 404ca8c2-flbb-4749-8abd-87f491a8111c

TCGA-43-6771-01A-11D-1817-08 LUSC 20735861-lf84-4141-a467-f598108ele41 TCGA-46-3765-01A-01D-0983-08 LUSC 6c4bb09f-46c8-4a42-bf4f-8bad5316603d

TCGA-46-3766-01A-01D-0983-08 LUSC Oa691892-2209-4f 3 c-ab 16-c2560e4928b4

TCGA-46-3767-01A-01D-0983-08 LUSC db4ea3ec-e926-4e75-a97b-a527cl01b3b9

TCGA-46-3768-01A-01D-0983-08 LUSC 30666313-cc29-4fce-8308-b04fb932083c

TCGA-46-3769-01A-01D-0983-08 LUSC 108al360-a545-4573-a775-49b3420814e2

TCGA-46-6025-01 A- 11 D- 1817-08 LUSC 767a9ae0-2aa4-467b-b9c3-fb3bf701b642

TCGA-46-6026-01 A- 11 D- 1817-08 LUSC 42a4a60c-257e-4bf6-a9ba-6fl62dbca94a

TCGA-51 -4079-01 A-01 D- 1458-08 LUSC 0a43aade-225c-4a29-bld8-6b930eb8aldb

TCGA-51 -4080-01 A-01 D- 1458-08 LUSC 2498ada2-b8d3-4220-8283-45af67a8119a

TCGA-51 -4081 -01 A-01 D- 1458-08 LUSC 1492c429-1041-4d86-9358-c9b9babdl401

TCGA-56- 1622-01 A-01 D- 1521 -08 LUSC 0bbc7ede-5022-4084-925c-d65baaf7abc2

TCGA-56-5897-01A-11D-1632-08 LUSC 056acb55-f3ba-4ceO-9735-3cfe6516df55

TCGA-56-5898-01A-11D-1632-08 LUSC aaf47efe-4a0a-40d 1 -b70f-9c9168cbdaeO

TCGA-56-6545-01A-11D-1817-08 LUSC 16756a08-8308-4ad3-9e21-2ceaOcd7028e

TCGA-56-6546-01A-11D-1817-08 LUSC 87e71949-5bd9-458c-95f7-4bl9882c2b4f

TCGA-60-2698-01A-01D-1522-08 LUSC 2045c788-9ea8-4ea5-a5e3-65fcl6a62adb

TCGA-60-2707-01 A-01 D- 1522-08 LUSC 5dlfa470-2789-4576-9743-0362af682cld

TCGA-60-2708-01 A-01 D- 1522-08 LUSC a371189b-5808-4408-824e-8dacec925cc5

TCGA-60-2709-01 A-21 D- 1817-08 LUSC 4f 321 c92-ae27-4253-bd8b-4505ba8c7dc4

TCGA-60-2710-01A-01D-1522-08 LUSC f aecb 1 fe-b4ef-434d-818c-81 ad2167dd25

TCGA-60-2711 -01 A-01 D- 1522-08 LUSC 2ed85cc9-3 lbc-4cea-9e54- 13b7cOe645fa

TCGA-60-2712-01A-01D-1522-08 LUSC 6662ddlb-3e4f-4b7a-b603-cfa7fd92fc30

TCGA-60-2713-01 A-01 D- 1522-08 LUSC 79eb7bba-f0d8-462c-add7-20a2fb7843el

TCGA-60-2715-01A-01D-1522-08 LUSC 8e05a30d-2177-45eO-90fd-8c5961268c39

TCGA-60-2719-01A-01D-1522-08 LUSC ee6cc68e-8d2a-41 ee-82c6-0fecdf7e6259

TCGA-60-2720-01 A-01 D- 1522-08 LUSC 3b435ddf-a496-40a2-82e8-6bl0391aae5d

TCGA-60-2721 -01 A-01 D- 1522-08 LUSC 8defff62-9395-47cb-bbl9-4b8487d9ea8e

TCGA-60-2722-01 A-01 D- 1522-08 LUSC eb955f72-83bf-4635-a7ed-89e4d66e08f4

TCGA-60-2723-01A-01D-1522-08 LUSC 8a6aa45a-ef6d-4005-b7c9-el5240dc6dd4

TCGA-60-2724-01 A-01 D- 1522-08 LUSC 387c6519-6529-4074-a5ab-00f8052a5732

TCGA-60-2725-01 A-01 D- 1267-08 LUSC f3ed705b-e5aa-4756-9794-e4b85303693a

TCGA-60-2726-01 A-01 D- 1522-08 LUSC a96eddfc-3afb-4bf8-a440-c91778113fbd

TCGA-63-5128-01 A-01 D- 1441 -08 LUSC d3b9b51e-eeea-4355-829d-ee35bdd2cf5b

TCGA-63-5131 -01 A-01 D- 1441 -08 LUSC b290a86e-22da-4fl0-a421-2616bb47bclb

TCGA-63-6202-01A-11D-1817-08 LUSC a3c568a6-0c43-47a7-a35a-3225fedeeb44

TCGA-66-2727-01A-01D-0983-08 LUSC c2b2c909-1461-42ce-8fd9-736147dcacd8

TCGA-66-2734-01A-01D-0983-08 LUSC 9f7a24a2-10e2-4039-ad27-13d7ec28ff36

TCGA-66-2742-01A-01D-0983-08 LUSC 07047a99-45bd-4df6-ad6f-934a48e8e213

TCGA-66-2744-01A-01D-0983-08 LUSC 43bela37-bl8e-4e96-89e6-ed6eeld8e65a

TCGA-66-2754-01A-01D-0983-08 LUSC c34a64c8-3746-44f8-a7ee-77f502b6256c

TCGA-66-2755-01A-01D-1522-08 LUSC 177d64a9-65dc-4aal-8774-bd8208e40f04 TCGA-66-2756-01A-01D-1522-08 LUSC 472c95e6-eccb-4988-be 16-fdace73b2ed8

TCGA-66-2757-01A-01D-1522-08 LUSC 1886dba0-4662-4342-84ac-96af0beb2393

TCGA-66-2758-01A-02D-1522-08 LUSC 71c4e854-a704-4787-a37a-fa6642ca5dac

TCGA-66-2759-01A-01D-1522-08 LUSC fecd0a2b-dl76-438a-be95-306f453fde40

TCGA-66-2763-01A-01D-1522-08 LUSC d6493c56-5322-4961-a693-8e8a62b0f7fl

TCGA-66-2765-01A-01D-1522-08 LUSC 85d7e094-ca96-4090-83aa-2f318ae6e954

TCGA-66-2766-01A-01D-1522-08 LUSC 452b75d0-1818-46aa-8804-9cfc0bd66449

TCGA-66-2767-01A-01D-1522-08 LUSC ca748128-272c-4fad-9alf-01328b93b3f4

TCGA-66-2768-01A-01D-1522-08 LUSC 5d458cef-965d-4d27-b754-31df67ed6eaa

TCGA-66-2770-01A-01D-1522-08 LUSC e417903d-ab76-44f0-aae9-3a91fa9a8d3c

TCGA-66-2771-01A-01D-0983-08 LUSC 58c73372-223f-400a-a2df-073a78c58b62

TCGA-66-2773-01A-01D-1267-08 LUSC fb0b515b-afc4-40c3-abe6-e90c442f0249

TCGA-66-2777-01A-01D-1267-08 LUSC 2ea52fb8-d7c9-48ce-9aef-50df7c42e5d5

TCGA-66-2778-01A-02D-1522-08 LUSC 5215060d-5ffd-49f3-a7a7-73167e7af74a

TCGA-66-2780-01A-01D-1522-08 LUSC d088bd 17-a 1 a0-4bd9-bfel -d57b5725c53b

TCGA-66-2781-01A-01D-1522-08 LUSC bfb33630-c8a8-4ec4-9eee-8bef349339ea

TCGA-66-2782-01A-01D-1522-08 LUSC 640ff507-203c-45aa-8bcl-030ee8639b5d

TCGA-66-2783-01A-01D-1267-08 LUSC f574d3b7-4ae4-49bc-9e05-f965fbc86119

TCGA-66-2785-01A-01D-1522-08 LUSC 57debe39-f57d-400a-a860-3de357d6becl

TCGA-66-2786-01A-01D-1522-08 LUSC 999a6582-33cf-47ca-b268-9b2dal02e99b

TCGA-66-2787-01A-01D-0983-08 LUSC C59e5971-e243-4b00-b5f0-f4bcal8530d6

TCGA-66-2788-01A-01D-0983-08 LUSC 2466d424-98bb-4380-9967-36abaa0e69d7

TCGA-66-2789-01A-01D-0983-08 LUSC fab8faeb-35b3-42f0-b0af-4dfbl325a21a

TCGA-66-2791-01A-01D-0983-08 LUSC dd468431 -2f a4-45ab-bel f-90671891 c5c4

TCGA-66-2792-01A-01D-0983-08 LUSC b704al7a-9ee9-4555-b2bb-250aclec5bed

TCGA-66-2793-01A-01D-1267-08 LUSC 7dc5f8ba-0080-43d3-8426-bd527a970761

TCGA-66-2794-01A-01D-1267-08 LUSC 2c58fa70-8fef-4a49-8cde-bfdc92e77919

TCGA-66-2795-01A-02D-0983-08 LUSC 73825564-8731-4137-972a-330490aceadc

TCGA-66-2800-01A-01D-1267-08 LUSC 803ec3a5-4347-41c3-a7b6-7eb00427a48c

TCGA-70-6722-01 A- 11 D- 1817-08 LUSC e8 If Ibb5-2d06-44b3-998a-e7a0b818467c

TCGA-70-6723-01A-11D-1817-08 LUSC 7483ea9f-8587-41e7-9ae5-d9223b76f33e

TCGA-85-6175-01A-11D-1817-08 LUSC 2ba53bf0-a4el-4b46-b258-610522aac7ee

TCGA-85-6560-01A-11D-1817-08 LUSC a5al56b8-2c8a-4ed0-8bae-b60cdc95698f

TCGA-85-6561-01A-11D-1817-08 LUSC f5aa0f 1 c-dal 9-4c04-b695-01 ed5b20e79e

TCGA-04- 1332-01 A-01 W-0488-09 ov b52e5d90-dc57-438c-9c38-e043308c24ac

TCGA-04-1336-01A-01W-0488-09 ov 586101df-93c9-4d0b-ba0e-58df7a2f9598

TCGA-04-1343-01A-01W-0488-09 ov fbbc3d80-aff2-463e-8eb3-c4361ad7cb98

TCGA-04-1346-01A-01W-0488-09 ov 9f494df7-f64f-4935-ae42-eeb0b94624dc

TCGA-04-1347-01A-01W-0488-09 ov 21b50b8c-781a-4el5-a4ad-715f416f0fa2

TCGA-04-1348-01A-01W-0494-09 ov lf4dee42-8f3d-4307-b6e5-3381d77d201c

TCGA-04-1349-01A-01W-0494-09 ov e456f707-f0a0-4624-98bc-e9dfe779182b TCG A-04- 1361 -01 A-01 W-0494-09 OV 0fc567bd-2201-4f3d-820e-2c0dbe58da6f

TCG A-04- 1362-01 A-01 W-0494-09 OV 830e207f-458e-4628-b7bc-287c2f2el2e5

TCGA-04-1542-01A-01W-0553-09 OV 317a63af-e862-43df-8ef5-7c555b2cb678

TCGA-09-0366-01A-01W-0372-09 OV 62269d21 -50dc-42b0-b 1 e4-75ed8010080a

TCGA-09-0369-01A-01W-0372-09 OV 633f5c4d-c224-404c-9f68-24daafdlfc84

TCG A- 10-0930-01 A-02W-0421 -09 OV ec98ed86-ld2f-4e54-b2d4-5976469bf0b8

TCGA-10-0933-01A-01W-0421-09 OV 3ec4215f-b57d-4ae7-b247-55ea If7e97d3

TCG A- 10-0935-01 A-03 W-0421 -09 OV af0edbf4-9d90-4373-a9ce-0875ebbeld04

TCGA-13-0723-01A-02W-0372-09 OV 6f9e5a76-5d2a-4bb0-babf-3f365al77236

TCGA-13-0724-01A-01W-0372-09 OV 2b6aalc8-5150-4d8f-af59-d5a826321308

TCGA-13-0726-01A-01W-0372-09 OV 201415c2-5b5a-4bb8-8005-bf2c78d4d88e

TCGA-13-0755-01A-01W-0372-09 OV 9bd227fa-e52a-4805-bd04-ad63df0930af

TCGA-13-0760-01A-01W-0372-09 OV 5181630f-246a-4cb4-88c2-1534b5fb8e37

TCGA-13-0765-01A-01W-0372-09 OV 5bcfe3ea-d95e-47ff-9718-6b 123d3acaef

TCGA-13-0791-01A-01W-0372-09 OV 70f63e2f-9bc6-4ed9-8d91-fl889287d7b7

TCGA-13-0795-01A-01W-0372-09 OV b266a007-694a-4580-ad67-48b0f709bc43

TCGA-13-0800-01A-01W-0372-09 OV 757862e3-0392-4e05-a242-25e3d2094ee8

TCGA-13-0804-01A-01W-0372-09 OV 7f39610d-45b8-45ae-806e-16b7acebafa6

TCG A- 13-0807-01 B-02W-0421 -09 OV f80466d9-6cc8-461b-acc2-addee22bd42a

TCGA-13-0884-01B-01W-0494-09 OV C5f0aa38-556b-401c-b4da-ac82cdc2e637

TCGA-13-0885-01A-02W-0421-09 OV a530d9a9-b21 e-47be-b4d8- 1707b71 f 360a

TCGA-13-0887-01A-01W-0421-09 OV e05146f2-688d-416b-a992-e2c7a2b7b244

TCGA-13-0890-01A-01W-0421-09 OV 15b867fb-7a7b-4158-9abd-91870ba77eb7

TCGA-13-0893-01B-01W-0494-09 OV 3335ab49-84b7-4d3b-a03d-9c3931904ca5

TCGA-13-0894-01B-01W-0494-09 OV eb57990e-702f-4fac-9ef5-7447ecb45cec

TCGA-13-0897-01A-01W-0421-09 OV f48ed68f-a833-4b78-971a-3c746c563d24

TCGA-13-0903-01A-01W-0421-09 OV 854167b5-03ab-4867-af34-9c92e385822e

TCGA-13-0910-01A-01W-0421-09 OV 26cebe0b-b7a7-431 e-bc 12-7fda22af72f 3

TCGA-13-0912-01A-01W-0421-09 OV 517f4d7f-c962-414f-8824-f2a7ael9cb6d

TCGA-13-0920-01A-01W-0421-09 OV 2e28969b-c9a9-41ec-80bf-f583197b7f92

TCGA-13-0924-01A-01W-0421-09 OV 510dda3c-6alf-4781-972f-c9c270608c72

TCGA-13-1403-01A-01W-0494-09 OV acbc77ba-7cc0-4af2-9ab6-0c835ce33998

TCGA-13-1404-01A-01W-0494-09 OV 692e4b24-daf0-4771 -b4a6-b0599f 122ad8

TCGA-13-1405-01A-01W-0494-09 OV C0dlde72-4cce-4d74-93f0-29c462dcl426

TCGA-13-1411-01A-01W-0494-09 OV e254d7f4-ledf-4054-9ca6-9fe058a05484

TCGA-13-1412-01A-01W-0494-09 OV f7edafe2-3eab-4bac-9d25-ed5c223b4aee

TCGA-13-1481-01A-01W-0549-09 OV f9eab025-5518-4240-bla8-19f8ff8354f0

TCGA-13-1482-01A-01W-0549-09 OV a68927d4-e827-49c9-9c3a-23ce0543261b

TCGA-13-1483-01A-01W-0549-09 OV 52280c07-44f5-4e9c-8601-7455b5b0de7a

TCGA-13-1488-01A-01W-0549-09 OV 886a8cl0-63cf-4cb2-83d2-5a99bbdal93d

TCGA-13-1489-01A-01W-0549-09 OV 395cld93-7216-4c9d-bfad-26ff95fb8afe TCGA-13-1491-01A-01W-0549-09 ov fb7dlc2b-3e87-4d05-a58b-92d0el016986

TCGA-13-1497-01A-01W-0549-09 ov 04e814c6-ea28-4ade-bc8f-a618552943da

TCGA-13-1498-01A-01W-0549-09 ov b00d9680-4099-43fe-87de-b3cc8b9e70c8

TCGA-13-1499-01A-01W-0549-09 ov b4ce07bl-677e-4a9c-8f8e-2b7762487692

TCGA- 13-1506-01 A-01 W-0549-09 ov 7534b542-88f8-445c-ae4a-9f44fb6798a8

TCGA- 13-1507-01 A-01 W-0549-09 ov 5423db 1 a-5b59-4a5b-a676-00a54570b04a

TCGA- 13-1509-01 A-01 W-0549-09 ov 4d3fab96-bc22-48d0-a3ef-1844ad894d0f

TCGA-23-1021-01B-01W-0488-09 ov 4fl4d366-4750-471f-98al-a01934365eel

TCGA-23-1022-01A-02W-0488-09 ov 160a0e7d-315e-4de3-a7d4-928412fd909c

TCGA-23-1117-01 A-02W-0488-09 ov 3a4b0c6a-lf43-437c-b715-fc50clc0303d

TCGA-23-1118-01 A-01W-0488-09 ov 00c41845-6b48-40f a-82e9- lb436e7d91 c3

TCGA-23-1123-01 A-01W-0488-09 ov 22cfe2c8-5elf-4b64-854d-2a7a02bfl0fe

TCGA-23-1124-01 A-01W-0488-09 ov 8a4061a0-77f2-4bb4-a3da-9b3d9f0314b9

TCGA-24-0966-01A-01W-0977-09 ov dc069342-661 a-4012-9bda-0c67469el 17d

TCGA-24-0980-01A-01W-0421-09 ov 87d32a92-a8d2-4656-al00-798328338486

TCGA-24-0982-01A-01W-0488-09 ov 7667c0e6-e44a-448f-b 118-6e2171 a99b6c

TCGA-24-1103-01 A-01W-0488-09 ov 47b7427c-a91 a-4872-bc08-50c07ba60512

TCGA-24- 1104-01 A-01 W-0488-09 ov 9cdb7821-fe43-46cd-94f3-b9d68b9ce21f

TCGA-24-1413-01A-01W-0494-09 ov lb2d2cde-4553-472e-82fl-8224745acleb

TCGA-24- 1416-01 A-01 W-0549-09 ov 21 f5e805-c0b4-487b-9ccd-02963e2369ff

TCGA-24-1417-01A-01W-0549-09 ov f6f43d04-a9e3-48c8-a276-3bebcaf416d7

TCGA-24- 1418-01 A-01 W-0549-09 ov 6093bcb5-4889-4cb9-9b01-e4e4278e72aa

TCGA-24-1424-01A-01W-0549-09 ov 2849f3e8-85d8-4d42-953b-3190b0ca98fc

TCGA-24-1425-01A-02W-0553-09 ov f8d4c37d-5b4d-4f5a-8022-7da2b32cclb0

TCGA-24-1426-01A-01W-0549-09 ov 063f8696-2c9d-4af4-a863-dfl0c42a5ea8

TCGA-24-1427-01A-01W-0549-09 ov 6511d3d4-722c-4702-a644-29bb98e5e5c3

TCGA-24-1428-01A-01W-0549-09 ov 52866517-eddf-4d63-al21-a296d6b2d264

TCGA-24-1435-01A-01W-0549-09 ov 28d236f6-dddc-48c2-be30-bl568a4d6055

TCGA-24-1436-01A-01W-0549-09 ov adeff0f5-d2a3-41c5-a509-298f702266bb

TCGA-24-1463-01A-01W-0549-09 ov c01ca9e7-ee9b-4698-8e4d-920ad7bfbe5f

TCGA-24-1464-01A-01W-0549-09 ov 01ec3cbb-c68a-4874-b396-f5e34876e04a

TCGA-24-1469-01A-01W-0553-09 ov 990c4b9d-608d-4b85-959c-5ccl2f4el0fc

TCGA-24-1470-01A-01W-0553-09 ov 1 d2bf 111 -910b-4ce9-8638-ab992b414e65

TCGA-24-1549-01A-01W-0553-09 ov b2e252bd-895f-4b28-9367-dd52733101 Of

TCGA-24-1562-01A-01W-0553-09 ov 5e49bcea-9cld-4cfd-a64c-4b84859bdda5

TCGA-24-1563-01A-01W-0553-09 ov b6c46b53-f94d-4936-9005-518c8f lcl449

TCGA-24-1616-01A-01W-0553-09 ov C464b2f6-9cfe-463a-b5e3-9a76cd4480c5

TCGA-25-1315-01A-01W-0494-09 ov 52f45b5e-af86-454c-be63-a56c6c21b730

TCGA-25- 1316-01 A-01W-0494-09 ov d75a0bl6-04e4-4ba3-a695-132c5ace698b

TCGA-25-1322-01A-01W-0494-09 ov 626fl798-fbl 5-4b01 -8d8f-db 19777d72e9 TCGA-AF-3913-01A-02W-1073-09 READ 4ebe7cf9-ce4f-485d-9332-ea9b536e38e2

TCGA-AG-3887-01A-01W-1073-09 READ 6d2de0f5-e812-4d3f-903b-7febdcfcd2f7

TCGA-AG-3890-01 A-01 W- 1073-09 READ 042e984f-cl06-4b23-9908-5abaf407e694

TCGA-AG-3892-01 A-01 W- 1073-09 READ 26acdae6-b01a-4dbd-b0b8-f6d97fe01808

TCGA-AG-3893-01A-01W-1073-09 READ 0faa6d28-c01c-4847-9552-912733485610

TCGA-AG-3894-01 A-01 W- 1073-09 READ e508d0c8-cdaf-463f-bb03-47aflbc41866

TCGA-AG-3896-01A-01W-1073-09 READ 22c7d09a-e69b-44be-8d8e-0a0cc9adf57c

TCGA-AG-3898-01A-01W-1073-09 READ cc3516ba-2941 -4ef a-80fc-7b5041194d52

TCGA-AG-3901-01A-01W-1073-09 READ 84859471-1136-4f42-ab75-b27a4ef27199

TCGA-AG-3902-01A-01W-1073-09 READ b679f02d-f48d-49eb-b245-65f341e4cl81

TCGA-AG-3909-01A-01W-1073-09 READ f5ece3cf-39eb-4277-8975-986e548bclea

TCGA-AG-3999-01A-01W-1073-09 READ 0445426d-b9c0-4ce5-b 1 cc-cb236d4381 cf

TCGA- AG-4001 -01 A-02W- 1073-09 READ 55075176-07a4-4183-9f8f-9f472bl5a6b4

TCGA- AG-4005-01 A-01 W- 1073-09 READ beld3bda-dela-4768-a2e4-22c07326ddc3

TCGA- AG-4007-01 A-01 W- 1073-09 READ 6fcfdc8f-22c0-4c3 a-9e46-58c0a68e818e

TCGA- AG-4008-01 A-01 W- 1073-09 READ 83cd3c 15-8eab-4d46-b9a2-36ee719f 6774

TCGA- AG-4015-01 A-01 W- 1073-09 READ Cf6f8e0f-04bf-4a0d-933e-8034ba6cl607

TCGA- AG- A008-01 A-01 W- A005- 10 READ 2221cfc4-b324-4329-ad37-3dd9a5adf36e

TCGA- AG- AOOC-01 A-01 W- A005- 10 READ la4f95be-32d3-4202-a0e7-507181b3fb86

TCGA- AG- AOOH-01 A-01 W- A00E-09 READ fdc4c8ac-fee2-4801-ae94-94c5d8058a9f

TCGA- AG- A00 Y-01 A-02W- A005- 10 READ b50aeldf-ee6f-4a5e-ba4b-c962d740ab22

TCGA- AG- AO 11 -01 A READ b5dd8f49-26fc-48d9-a964-d8ebdcca9el9

TCGA-AG-A014-01A READ fbf a61 fe-4fb7-4b2a-9bf0-33140fd41873

TCGA- AG- AO 15-01 A-01 W- A005- 10 READ abb751 f0-c4df-4556-ac9b-ad 1 el 971 cccf

TCGA- AG- AO 16-01 A-01 W- A005- 10 READ f20ae301 -b 10b-4df a-9169-04bc6c3d 103 a

TCGA-AG-A01L-01A READ b034c90b-d0bd-466a-88ba-b61efd36c6e4

TCGA- AG- A025-01 A-01 W- A00E-09 READ 7b5a3c33-cdl3-4e4d-alf8-3405dab5998f

TCGA- AG- A02G-01 A-01 W- A00E-09 READ 954527dc-8a7d-474d-b580-82199e86cb5a

TCGA- AG- A02X-01 A-01 W- A00E-09 READ 9ffb8919-a98c-40bd-bdad-146blcccl4ef

TCGA- AG- A032-01 A-01 W- A00E-09 READ 7522eb6b-797a-4964-8aca-6d70590b5f9f

Pipeline for prediction of peptides derived from gene mutations with binding to personal HLA alleles: MHC-binding affinity was predicted across all possible 9-mer and 10- mer peptides generated from each somatic mutation and the corresponding wildtype peptide using NetMHCpan (version 2.4). These tiled peptides were analyzed for their binding affinities (IC50 nM) to each class I alleles in the patients' HLA profile. An IC50 value of less than 150 nM was considered a predicted strong to intermediate binder, an IC50 of 150-500 nM was considered a predicted weak binder, while an IC50 > 500 nM was considered a non-binder. Experimental confirmation of predicted peptides binding to HLA molecules (IC50 < 500 nM) was performed using a competitive MHC class I allele-binding assay and has been described in detail elsewhere (Cai et al. 28 and Sidney et al. 2001). Sources of antigen: Peptides were synthesized to >95 purity (confirmed by high performance liquid chromatography) from New England Peptide (Gardner, MA); or RS

Synthesis, (Louisville, KY). Peptides were reconstituted in DMSO (10 mg/ml) and stored at - 80°C until use. Minigenes comprised of a sequence of 300 bp encompassing mut or wt FNDC3B were PCR-cloned from Pt 2's tumor into the expression vector pcDNA3.1 using the following primers: 5 'primer: GACGTCGGATCCCACCATGGGTCCCGGAATTAAGAAAACAGAG; 3' primer:

CCCGGGGCGGCCGCCTAATGGTGATGGTGATGGTGACATTCTAATTCTTCTCCACTG TAAA. Minigenes were expressed in antigen-presenting target cells by introducing 20 μg of the plasmid into 2 million K562 cells (ATCC) stably transfected with HLA-A2 by Amaxa nucleofection (Solution V, Program T16, Lonza Inc; WalkersviUe, MD). Cells were incubated in RPMI media (Cellgro; Manassas, VA), supplemented with 10% fetal bovine serum (Cellgro), 1% HEPES buffer (Cellgro), and 1% L-glutamine (Cellgro). The cells were harvested 2 days following nucleofection for immune assays.

Analysis of gene expression in CLL cases: previously reported microarray data (NCI Gene Expression Omnibus accession GSE37168) was reanalyzed. Affymetrix CEL files were processed using the affy package in R. The Robust Multichip Analysis (RMA) algorithm was used for background correction which models the observed intensities as a mixture of exponentially distributed signal and normally distributed noise. This was followed by quantile normalization across arrays to facilitate comparison of gene expression under different conditions. The individual probe-level was finally summarized using the median polish approach to get robust probeset-level values. Gene-level values were obtained by selecting the probe with the maximal average expression for each gene. Batch effects in the data were removed by using the Combat program.

Generation and detection of antigen specific T cells from patient PBMCs:

Autologous dendritic cells (DCs) were generated from immunomagnetically-isolated CD 14⁺ cells (Miltenyi, Auburn CA) that were cultured in RPMI (Cellgro) supplemented with 3% fetal bovine serum, 1% penicillin- streptomycin (Cellgro), 1% L-glutamine and 1% HEPES buffer in the presence of 120 ng/ml GM-CSF and 70 ng/ml IL-4 (R&D Systems, Minneapolis, MN). On days three and five, additional GM-CSF and IL-4 were added. On day six, cells were exposed to 30μg/ml Poly I:C (Sigma Aldrich, St Louis, MO) to undergo maturation (for 48 hours), in addition to adding IL-4 and GM-CSF. CD19⁺ B cells were isolated from patient PBMCs by immunomagnetic selection (CD19⁺ microbeads; Miltenyi, Auburn, CA), and seeded at IxlO⁶ cells/well in a 24-well plate. B cells were cultured in B cell media (Iscoves modified Dulbecco medium (IMDM; Life Technologies, Woburn, MA), supplemented with 10% human AB serum (GemCeli, Sacramento, CA), 5 ^πΛ insulin (Sigma Chemical, St Louis, MO), 15 μg/mL gentamicin, IL-4 (2ng/ml, R&D Systems, Minneapolis, MN) and CD40L-Tri ί ! μ«/ηιΙ ). CD40L- Tri was replenished every 3-4 days. For some experiments, CD40L-Tri activated and expanded CD19 ^" B cells were used as APCs. Generation of antigen-specific T cells from patient PBMCs: To generate peptide- reactive T cells from CLL patients, immunomagnetically selected CD8⁺ T cells (5xl0⁶/well) from pre- and post-transplant PBMCs (CD8+ Microbeads, Miltenyi, Auburn, CA) were cultured with autologous peptide pool-pulsed DCs (at 40: 1 ratio) or CD40L-Tri-activated irradiated B cells (at 4: 1 ratio) respectively, in complete medium supplemented with 10% FBS and 5-10 ng/niL IL-7, IL-12 and IL-15. APCs were pulsed for 3 hours with peptide pools (10 μΜ/ peptide/pool). CD8⁺ T cells were re-stimulated weekly (for 1-3 weeks, starting on day 7) with APCs.

Detection of antigen-specific T cells: T cell specificity against peptide pools was tested by IFN-γ ELISPOT assay, 10 days following 2^nd and 4^th stimulations. IFN-γ release was detected using test and control peptide-pulsed CD40L- activated B cells (50,000 cells/well) co-incubated with 50,000 CD8⁺ T cells/well (MiUipore, Billerica, MA) for 24 hours on ELISPOT plate. IFN-γ was detected using capture and detection antibodies, as directed (Mabtech AB, Mariemont, OH), and imaged (ImmunoSpot Series Analyzer; Cellular Technology, Cleveland, OH). To test T cell reactivity dependence on MHC class I, ELISPOT plates were first coated with APCs co- incubated with class I blocking antibody (W6/32) for 2 hours at 37°C, prior to introduction of T cells into the wells. MHC class I tetramer was used to test specificity of T cells where indicated (Emory University, Atlanta GA). For tetramer staining, 5xl0⁵ cells were incubated for 60 minutes at 4°C with ^g/mL PE-labeled tetramer, and then incubated with the addition of anti- CD3-FITC and anti-CD8-APC antibodies (BD Biosciences, San Diego CA) for another 30 minutes at 4 °C. A minimum of 100,000 events were acquired per sample. Secretion of GM-CSF and IL-2 from cultured CD8⁺ T cells was detected by analysis of culture supernatants using a Luminex multiplex bead-based technology, per the manufacturer' s recommendations (EMD Millipore, Billerica, MA). In brief, fluorescent-labeled microspheres were coated with specific cytokine capture antibodies. After incubation with the culture supernatant sample, captured cytokines were detected by a biotinylated detection antibody followed by a streptavidin-PE conjugate and median fluorescence intensity (MFI) was measured (Luminex 200 Bead Array instrument; Luminex Corporation, Austin TX). Based on a standard curve, cytokine levels were calculated in the Bead View Software program (Upstate, EMD Millipore, Billerica, MA). For detection and quantitation of TCR νβ clonotypes, mut-FNDC3B specific T cells were enriched from Pt 2's T cell lines using the IFN-γ secretion assay (Miltenyi, Auburn, CA) according to the manufacturer's instructions and as previously described. Statistical considerations: Two-way ANOVA models were constructed for T cells reactivity against mut vs wt peptide in the form of IFN-gamma, GM-CSF, and IL-2 release and included concentration and mutational status as fixed effects along with an interaction term as appropriate. P- values for these models were adjusted for multiple comparisons post-hoc using the Tukey method. For normalized comparisons of IFN-gamma, a i-test was performed to test the hypothesis that the normalized ratio equaled one. For other comparisons of continuous measures between groups, a Welch i-test was used. All P-values reported are two-sided and considered significant at the 0.05 level with appropriate adjustment for multiple comparisons. Analysis was performed in SAS v9.2.

Detection and quantitation of TCR νβ clonotypes: To detect mut-FNDC3B specific TCR νβ, a two-step nested PCR from peptide- specific IFN-γ enriched T cell populations was performed. In short, the dominant νβ subfamily was identified among the 24 known νβ subfamilies. First, 5 pools of Υβ forward primers (pool 1: Υβ 1-5.1; pool 2: Υβ 5.2-9; pool 3: νβ 10-13.2; pool 4: νβ 14-19; and pool 5: νβ 20, 22-25) were generated. RNA extracted from the T cell clones (QIAamp RNA Blood Mini-kit; Qiagen, Valencia, CA), was reverse transcribed into cDNA (Superscript, GIBCO BRL, Gaithersburg, MD) using random hexamers, and PCR- amplified in five separate 20 μΐ volume reactions. Second, T cell clone-derived cDNA was re- amplified, with each of the 5 individual primers contained within a positive pool together with a FAM-conjugated CP reverse (internal) primer. Subsequently, 4 μΐ of this PCR product was amplified with 1 μΐ of the clone CDR3 region- specific primer and probe, and 10 μΐ of Taqman Fast Universal PCR Master Mix (Applied Biosystems, Foster City, CA) in a total volume of 20 μΐ. The PCR amplification conditions were: 95°C for 20 minutes x 1 cycle, and 40 cycles of 95°C for 3 seconds followed by 60°C for 30 seconds (7500 Fast Real-time PCR cycler; Applied Biosystems, Foster City, CA). Test transcripts were quantified relative to SIS ribosomal RNA transcripts by calculating 2^A(S18 rRNA CT-target CT) as described previously.

Detection of molecular tumor burden: The clonotypic IgH sequence of Pt 2 was identified using a panel of VH-specific PCR primers, as previously described. Based on this sequence, a quantitative Taqman PCR assay was designed such that a sequence- specific probe was located in the region of junctional diversity (Applied Biosystems; Foster City, CA). This Taqman assay was applied to cDNA from tumor. All PCR reactions consisted of: 50°C for 1 minute xl cycle, 95°C for 10 minutes xl cycle, and 40 cycles of 95°C for 15 seconds followed by 60°C for 1 minute. All reactions were performed using a 7500 Fast Real-time PCR cycler (Applied Biosystems, Foster City, CA). Test transcripts were quantified relative to GAPDH. REFERENCES

Zhang GL, Ansari HR, Bradley P, et al. Machine learning competition in immunology -

Prediction of HLA class I binding peptides. J Immunol Methods. Nov 30 2011;374(1- 2): 1-4.

Kawai T, Akira S. TLR signaling. Seminars in immunology. Feb 2007;19(l):24-32.

Adams S. Toll-like receptor agonists in cancer therapy. Immunotherapy. Nov 2009; l(6):949-964.

Cheever MA. Twelve immunotherapy drugs that could cure cancers. Immunological reviews.

Apr 2008;222:357-368.

Bogunovic D, Manches O, Godefroy E, et al. TLR4 engagement during TLR3-induced

proinflammatory signaling in dendritic cells promotes IL-10-mediated suppression of antitumor immunity. Cancer Res. Aug 15 2011;71(16):5467-5476.

Stahl-Hennig C, Eisenblatter M, Jasny E, et al. Synthetic double- stranded RNAs are adjuvants for the induction of T helper 1 and humoral immune responses to human papillomavirus in rhesus macaques. PLoS pathogens. Apr 2009;5(4):el000373.

Boscardin SB, Hafalla JC, Masilamani RF, et al. Antigen targeting to dendritic cells elicits long- lived T cell help for antibody responses. The Journal of experimental medicine. Mar 20 2006;203(3):599-606.

Soares H, Waechter H, Glaichenhaus N, et al. A subset of dendritic cells induces CD4+ T cells to produce IFN-gamma by an IL-12-independent but CD70-dependent mechanism in vivo.

The Journal of experimental medicine. May 14 2007;204(5): 1095- 1106.

Trumpfheller C, Caskey M, Nchinda G, et al. The microbial mimic poly IC induces durable and protective CD4+ T cell immunity together with a dendritic cell targeted vaccine. Proc

Natl Acad Sci U S A. Feb 19 2008;105(7):2574-2579.

Trumpfheller C, Finke JS, Lopez CB, et al. Intensified and protective CD4+ T cell immunity in mice with anti-dendritic cell HIV gag fusion antibody vaccine. The Journal of

experimental medicine. Mar 20 2006;203(3):607-617.

Salem ML, Kadima AN, Cole DJ, Gillanders WE. Defining the antigen- specific T-cell response to vaccination and poly(I:C)/TLR3 signaling: evidence of enhanced primary and memory

CD8 T-cell responses and antitumor immunity. J Immunother. May-Jun 2005;28(3):220-

228. Tough DF, Borrow P, Sprent J. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science. Jun 28 1996;272(5270): 1947- 1950.

Zhu X, Nishimura F, Sasaki K, et al. Toll like receptor-3 ligand poly-ICLC promotes the efficacy of peripheral vaccinations with tumor antigen-derived peptide epitopes in murine CNS tumor models. Journal of translational medicine. 2007;5: 10.

Flynn BJ, Kastenmuller K, Wille-Reece U, et al. Immunization with HIV Gag targeted to

dendritic cells followed by recombinant New York vaccinia virus induces robust T-cell immunity in nonhuman primates. Proc Natl Acad Sci U S A. Apr 26 2011;108(17):7131-

7136.

Gaucher D, Therrien R, Kettaf N, et al. Yellow fever vaccine induces integrated multilineage and polyfunctional immune responses. The Journal of experimental medicine. Dec 22 2008;205(13):3119-3131.

Caskey M, Lefebvre F, Filali-Mouhim A, et al. Synthetic double- stranded RNA induces innate immune responses similar to a live viral vaccine in humans. The Journal of experimental medicine. Nov 21 2011;208(12):2357-2366.

Sabbatini P, Tsuji T, Ferran L, et al. Phase I trial of overlapping long peptides from a tumor self- antigen and poly-ICLC shows rapid induction of integrated immune response in ovarian cancer patients. Clinical cancer research : an official journal of the American Association for Cancer Research. Dec 1 2012;18(23):6497-6508.

Robinson RA, DeVita VT, Levy HB, Baron S, Hubbard SP, Levine AS. A phase I II trial of multiple-dose polyriboinosic-polyribocytidylic acid in patients with leukemia or solid tumors. Journal of the National Cancer Institute. Sep 1976;57(3):599-602.

Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA: a cancer journal for clinicians.

Jan 2013;63(l): l l-30.

Balch CM, Gershenwald JE, Soong SJ, et al. Final version of 2009 AJCC melanoma staging and classification. Journal of clinical oncology : official journal of the American Society of Clinical Oncology. Dec 20 2009;27(36):6199-6206.

Eggermont AM, Suciu S, Testori A, et al. Ulceration and stage are predictive of interferon

efficacy in melanoma: results of the phase III adjuvant trials EORTC 18952 and EORTC 18991. Eur J Cancer. Jan 2012;48(2):218-225. Sosman JA, Moon J, Tuthill RJ, et al. A phase 2 trial of complete resection for stage IV melanoma: results of Southwest Oncology Group Clinical Trial S9430. Cancer. Oct 15

2011;117(20):4740-4706.

Flaherty KT, Hodi FS, Fisher DE. From genes to drugs: targeted strategies for melanoma. Nat

Rev Cancer. May 2012;12(5):349-361.

Mocellin S, Pasquali S, Rossi CR, Nitti D. Interferon alpha adjuvant therapy in patients with high-risk melanoma: a systematic review and meta-analysis. Journal of the National

Cancer Institute. Apr 7 2010;102(7):493-501.

Pirard D, Heenen M, Melot C, Vereecken P. Interferon alpha as adjuvant postsurgical treatment of melanoma: a meta-analysis. Dermatology. 2004;208(l):43-48.

Wheatley K, Ives N, Hancock B, Gore M, Eggermont A, Suciu S. Does adjuvant interferon- alpha for high-risk melanoma provide a worthwhile benefit? A meta-analysis of the randomised trials. Cancer treatment reviews. Aug 2003;29(4):241-252.

Buckwalter MR, Srivastava PK. "It is the antigen(s), stupid" and other lessons from over a

decade of vaccitherapy of human cancer. Seminars in immunology. Oct 2008;20(5):296-

300.

Baurain JF, Colau D, van Baren N, et al. High frequency of autologous anti-melanoma CTL directed against an antigen generated by a point mutation in a new helicase gene. J Immunol. Jun 1 2000;164(l l):6057-6066.

Chiari R, Foury F, De Plaen E, Baurain JF, Thonnard J, Coulie PG. Two antigens recognized by autologous cytolytic T lymphocytes on a melanoma result from a single point mutation in an essential housekeeping gene. Cancer Res. Nov 15 1999;59(22):5785-5792.

Huang J, El-Gamil M, Dudley ME, Li YF, Rosenberg SA, Robbins PF. T cells associated with tumor regression recognize frameshifted products of the CDKN2A tumor suppressor gene locus and a mutated HLA class I gene product. J Immunol. May 15

2004;172(10):6057-6064.

Karanikas V, Colau D, Baurain JF, et al. High frequency of cytolytic T lymphocytes directed against a tumor- specific mutated antigen detectable with HLA tetramers in the blood of a lung carcinoma patient with long survival. Cancer Res. May 1 2001;61(9):3718-3724. Lennerz V, Fatho M, Gentilini C, et al. The response of autologous T cells to a human melanoma is dominated by mutated neoantigens. Proc Natl Acad Sci U S A. Nov 1

2005;102(44): 16013-16018.

Zorn E, Hercend T. A natural cytotoxic T cell response in a spontaneously regressing human melanoma targets a neoantigen resulting from a somatic point mutation. Eur J Immunol. Feb 1999;29(2):592-601.

Kannan S, Neelapu SS. Vaccination strategies in follicular lymphoma. Current hematologic malignancy reports. Oct 2009;4(4): 189-195.

Kenter GG, Welters MJ, Valentijn AR, et al. Phase I immunotherapeutic trial with long peptides spanning the E6 and E7 sequences of high-risk human papillomavirus 16 in end-stage cervical cancer patients shows low toxicity and robust immunogenicity. Clinical cancer research : an official journal of the American Association for Cancer Research. Jan 1 2008;14(1): 169-177.

Kenter GG, Welters MJ, Valentijn AR, et al. Vaccination against HPV-16 oncoproteins for

vulvar intraepithelial neoplasia. The New England journal of medicine. Nov 5

2009;361(19): 1838-1847.

Welters MJ, Kenter GG, Piersma SJ, et al. Induction of tumor- specific CD4+ and CD8+ T-cell immunity in cervical cancer patients by a human papillomavirus type 16 E6 and E7 long peptides vaccine. Clinical cancer research : an official journal of the American

Association for Cancer Research. Jan 1 2008;14(1): 178-187.

Lundegaard C, Lund O, Nielsen M. Prediction of epitopes using neural network based methods. J

Immunol Methods. Nov 30 2011;374(l-2):26-34.

Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science. Mar 25 2011;331(6024): 1565-1570.

Berger, M. et al. Melanoma genome sequencing reveals frequent PREX2 mutations. Nature 485,

502-6 (2012).

Carter, SL. et al. Absolute quantification of somatic DNA alterations in human cancer. Nat

Biotechnol 30, 413-21 (2012).

Chapman, M.A. et al. Initial genome sequencing and analysis of multiple myeloma. Nature 471,

467-72 (2011). Cibulskis, K. et al. ContEst: estimating cross-contamination of human samples in next- generation sequencing data. Bioinformatics 27, 2601-2 (2011).

Cibulskis, K. et al. Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples. Nature Biotech (2013) Feb 10. doi: 10.1038/nbt.2514. [Epub ahead of print] .

DeLuca, DS. et al. RNA-SeQC: RNA-seq metrics for quality control and process optimization.

Bioinformatics 28, 1530-2 (2012).

DePristo, M. et al. A framework for variation discovery and genotyping using next-generation

DNA sequencing data. Nature Genetics 43, 491-498 (2011).

Landau, DA. et al. Evolution and impact of subclonal mutations in chronic lymphocytic

leukemia. Cell 152, 714-26 (2013).

Langmead, B. et al. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10, R25 (2009).

Li, B. et al. RSEM: accurate transcript quantification from RNA-Seq data with or without a

reference genome. BMC Bioinformatics 12, 323 (2011).

Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-9

(2009).

Li H. and Durbin R. Fast and accurate short read alignment with Burrows- Wheeler Transform.

Bioinformatics 25, 1754-60 (2009).

McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next- generation DNA sequencing data. Genome Res 20, 1297-303 (2010).

Robinson, JT. et al. Integrative genomics viewer. Nature Biotech 29, 24-26 (2011).

Stransky, N. et al. The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-60 (2011).

Garraway, L.A. and Lander, E. S, Lessons from the cancer genome. Cell. 153, 17-37 (2013). Lundegaard, C. et al. Prediction of epitopes using neural network based methods. J Immunol

Methods. 374, 26-34 (2011).

Sette, A. et al., The relationship between class I binding affinity and immunogenicity of potential cytotoxic T cell epitopes. J Immunol. 153, 5586-5592 (1994). Lu, Y. C. et al., Mutated regions of nucleophosmin 1PPP1R3B Is Recognized by T Cells Used

To Treat a Melanoma Patient Who Experienced a Durable Complete Tumor Regression.

J Immunol. 190, 6034-6042 (2013).

Sykulev, Y. et al., Evidence that a single peptide-MHC complex on a target cell can elicit a

cytolytic T cell response. Immunity. 4, 565-571 (1996).

Carter, S. L. et al., Absolute quantification of somatic DNA alterations in human cancer. Nat.

Biotechnology 30: 413-21 (2012).

Sidney, J. et al., HLA class I supertypes: a revised and updated classification. BMC Immunol. 9,

1 (2008).

Comprehensive genomic characterization of squamous cell lung cancers. Nature. 489, 519-525

(2012) .

Ding, L. et al., Somatic mutations affect key pathways in lung adenocarcinoma. Nature. 455, 1069-1075 (2008).

Stransky, N. et al., The mutational landscape of head and neck squamous cell carcinoma. Science 333, 1157-1160 (2011).

Comprehensive molecular characterization of human colon and rectal cancer. Nature. 487, 330- 337 (2012).

Comprehensive genomic characterization defines human glioblastoma genes and core pathways.

Nature. 455, 1061-1068 (2008).

Integrated genomic analyses of ovarian carcinoma. Nature. 474, 609-615 (Jun 30, 2011).

Comprehensive molecular characterization of clear cell renal cell carcinoma. Nature. 499, 43-49

(2013) .

Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med.

368, 2059-2074 (2013).

Comprehensive molecular portraits of human breast tumours. Nature. 490, 61-70 (2012).

Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims. The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or sub-combination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

Incorporation by Reference

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

Claims

What is claimed is:

1. A method of making a personalized neoplasia vaccine for a subject diagnosed as having a neoplasia, comprising:

identifying a plurality of mutations in the neoplasia;

analyzing the plurality of mutations to identify a subset of at least five neo-antigenic mutations predicted to encode neo-antigenic peptides, the neo-antigenic mutations selected from the group consisting of missense mutations, neoORF mutations, and any combination thereof; and

producing, based on the identified subset, a personalized neoplasia vaccine.

2. The method of claim 1, wherein identifying further comprises:

sequencing the genome, transcriptome, or proteome of the neoplasia.

3. The method of claim 1, wherein analyzing further comprises:

determining one or more characteristics associated with the subset of at least five neo- antigenic mutations predicted to encode neo-antigenic peptides, the characteristics selected from the group consisting of molecular weight, cysteine content, hydrophilicity, hydrophobicity, charge, and binding affinity; and

ranking, based on the determined characteristics, each of the neo-antigenic mutations within the identified subset of at least five neo-antigenic mutations.

4. The method of claim 3, wherein the top 5-30 ranked neo-antigenic mutations are included in the personalized neoplasia vaccine.

5. The method of claim 3, wherein the neo-antigenic mutations are ranked according to the order shown in FIG. 8.

6. The method of claim 4, wherein the personalized neoplasia vaccine comprises at least about 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

7. The method of claim 4, wherein the personalized neoplasia vaccine comprises one or more DNA molecules capable of expressing at least about 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

8. The method of claim 4, wherein the personalized neoplasia vaccine comprises one or more RNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

9. The method of claim 1, wherein the personalized neoplasia vaccine comprises neoORF mutations predicted to encode a neoORF polypeptide having a Kd of < 500 nM.

10. The method of claim 1, wherein the personalized neoplasia vaccine comprises missense mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein the native cognate protein has a Kd of > ΙΟΟΟηΜ or < 150 nM.

11. The method of claim 6, wherein the at least about 20 neo-antigenic peptides range from about 5 to about 50 amino acids in length.

12. The method of claim 6, wherein the at least about 20 neo-antigenic peptides range from about 15 to about 35 amino acids in length.

13. The method of claim 6, wherein the at least about 20 neo-antigenic peptides range from about 18 to about 30 amino acids in length.

14. The method of claim 6, wherein the at least about 20 neo-antigenic peptides range from about 6 to about 15 amino acids in length.

15. The method of claim 6, wherein the at least about 20 neo-antigenic peptides are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

16. The method of claim 1, wherein the personalized neoplasia vaccine further comprises an adjuvant.

17. The method of claim 1, wherein the adjuvant is selected from the group consisting of poly- ICLC, 1018 ISS, aluminum salts, Amplivax, AS15, BCG, CP-870,893, CpG7909, CyaA, dSLIM, GM-CSF, IC30, IC31, Imiquimod, ImuFact IMP321, IS Patch, ISS, ISCOMATRIX, Juvlmmune, LipoVac, MF59, monophosphoryl lipid A, Montanide IMS 1312, Montanide ISA 206, Montanide ISA 50V, Montanide ISA-51, OK-432, OM-174, OM-197-MP-EC, ONTAK, PepTel.RTM, vector system, PLGA microparticles, resiquimod, SRL172, Virosomes and other Virus-like particles, YF-17D, VEGF trap, R848, beta-glucan, Pam3Cys, Aquila's QS21 stimulon, vadimezan, and AsA404 (DMXAA).

18. The method of claim 17, wherein the adjuvant is poly- ICLC.

19. A method of treating a subject diagnosed as having a neoplasia with a personalized neoplasia vaccine, comprising:

identifying a plurality of mutations in the neoplasia;

analyzing the plurality of mutations to identify a subset of at least five neo-antigenic mutations predicted to encode expressed neo-antigenic peptides, the neo-antigenic mutations selected from the group consisting of missense mutations, neoORF mutations, and any combination thereof;

producing, based on the identified subset, a personalized neoplasia vaccine; and administering the personalized neoplasia vaccine to the subject, thereby treating the neoplasia.

20. The method of claim 19, wherein identifying further comprises:

sequencing the genome, transcriptome, or proteome of the neoplasia.

21. The method of claim 19, wherein analyzing further comprises:

determining one or more characteristics associated with the subset of at least five neo-antigenic mutations predicted to encode expressed neo-antigenic peptides, the characteristics selected from the group consisting of molecular weight, cysteine content, hydrophilicity, hydrophobicity charge, and binding affinity; and

ranking, based on the determined characteristics, each of the neo-antigenic mutations within the identified subset of at least five neo-antigenic mutations.

22. The method of claim 21, wherein the top 5-30 ranked neo-antigenic mutations are included in the personalized neoplasia vaccine.

23. The method of claim 21, wherein the neo-antigenic mutations are ranked according to the order shown in FIG. 8.

24. The method of claim 22, wherein the personalized neoplasia vaccine comprises at least 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

25. The method of claim 22, wherein the personalized neoplasia vaccine comprises one or more DNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

26. The method of claim 22, wherein the personalized neoplasia vaccine comprises one or more RNA molecules capable of expressing at least 20 neo-antigenic peptides corresponding to the neo-antigenic mutations.

27. The method of claim 19, wherein the personalized neoplasia vaccine comprises neoORF mutations predicted to encode a neoORF polypeptide having a Kd of < 500 nM.

28. The method of claim 19, wherein the personalized neoplasia vaccine comprises missense mutations predicted to encode a polypeptide having a Kd of < 150 nM, wherein the native cognate protein has a Kd of > ΙΟΟΟηΜ or < 150 nM.

29. The method of claim 24, wherein the at least 20 neo-antigenic peptides range from about 5 to about 50 amino acids in length.

30. The method of claim 24, wherein the at least 20 neo-antigenic peptides range from about 15 to about 35 amino acids in length.

31. The method of claim 24, wherein the at least 20 neo-antigenic peptides range from about 18 to about 30 amino acids in length.

32. The method of claim 24, wherein the at least 20 neo-antigenic peptides range from about 6 to about 15 amino acids in length.

33. The method of claim 24, wherein the at least 20 neo-antigenic peptides are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

34. The method of claim 16, wherein administering further comprises:

dividing the produced vaccine into two or more sub-pools; and

injecting each of the sub-pools into a different location of the patient.

35. The method of claim 34, wherein each of the sub-pools injected into a different location comprises neo-antigenic peptides such that a number of individual peptides in the sub-pool targeting any single patient HLA is one, or as few above one as possible.

36. The method of claim 31, wherein administering further comprises dividing the produced vaccine into two or more sub-pools, wherein each sub-pool comprises at least five neo-antigenic peptides selected to optimize intra-pool interactions; .

37. The method of claim 36, wherein optimizing comprises reducing negative interaction among the neo-antigenic peptides in the same pool.

38. The method of claim 19, wherein administering further comprises delivering a dendritic cell (DC) vaccine, wherein the DC is loaded with one or more of the at least five neo-antigenic mutations predicted to encode expressed neo-antigenic peptides.

9. A personalized neoplasia vaccine prepared according to the method of claim 1.