WO2014165866A2

WO2014165866A2 - Methods for immune-based diagnosis, prevention and personalized treatment of narcolepsy

Info

Publication number: WO2014165866A2
Application number: PCT/US2014/039931
Authority: WO
Inventors: Birgitte K. KORNUM; Elizabeth D. Mellins; Emmanuel Mignot
Original assignee: The Board Of Trustees Of The Leland Stanford Junior University
Priority date: 2013-04-01
Filing date: 2014-05-29
Publication date: 2014-10-09
Also published as: WO2014165866A3

Abstract

Methods for diagnosis, prevention, and treatment of narcolepsy are disclosed. In particular, the invention relates to methods of detecting T cells reactive to narcolepsy-inducing antigens, such as hypocretin or influenza H1 peptides, displayed in complexes with human leukocyte antigen DQ0602. The invention further relates to methods of treating subjects for narcolepsy by blocking formation of DQ0602-hypocretin and DQ0602-influenza H1 peptide epitope complexes and their interaction with their cognate T cell receptor (TCR).

Description

METHODS FOR IMMUNE-BASED DIAGNOSIS, PREVENTION AND

PERSONALIZED TREATMENT OF NARCOLEPSY

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 1 19(e) of the U.S.

Provisional Application No. 61/807,307 filed April 1 , 2013 the contents of which are incorporated herein by reference in its entirety.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 27, 2014, is named S 13_026_ST25.txt and is 1 1 bytes in size.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with Government support under contract NS23724 awarded by the National Institutes of Health. The Government has certain rights in this invention.

Technical Field

[0004] The present invention pertains generally to methods for diagnosis, prevention, and predisposition to addiction in the contect of the treatment of narcolepsy. In particular, the invention relates to methods of detecting T cells reactive or binding to narcolepsy-inducing antigens, such as hypocretin or influenza virus hemagglutinin 1 (HI) peptides, displayed in complexes with human leukocyte antigen (HLA) DQ0602. The invention further relates to methods of treating subjects for narcolepsy, either therapeutically or prophylactically, by blocking formation of DQ0602-hypocretin and DQ0602 -influenza HI peptide epitope complexes and their interaction with the cognate T cell receptor (TCR). Methods of diagnosing increased or decreased predisposition to addiction caused by stimulant drugs and tailoring treatment with stimulants based on the increased or decreased predisposition to addition to stimulants are also included.

Background

[0005] Narcolepsy with hypocretin deficiency, also called Type 1 narcolepsy, is a life-long sleep disorder that affects approximately 1 in 3,000 people in the United States, Asia and Northern Europe (Longstreth et al. (2007) Sleep 30(1): 13-26). The disease is characterized by daytime sleepiness, cataplexy, and rapid sleep onset transitions to Rapid Eye Movement (REM) sleep. Onset is typically in childhood or early adolescence. The disorder is caused by a lack of wake -promoting hypocretin (hcrt, also called orexin) signaling in the brain, resulting from the loss of 70,000 hypothalamic neurons producing the peptide.

[0006] Since 1983, an autoimmune basis for narcolepsy with hypocretin deficiency has been suspected, based on an association with Human Leukocyte Antigen (HLA) DR2 (Juji et al. (1984) Tissue Antigens 24(5):316-319), a finding later shown to be due to linkage disequilibrium with a common HLA-DQ haplotype, DQA1 *01 :02/DQB1 *06:02, encoding the DQ0602 heterodimer (Mignot et al. (2001) Am. J. Hum. Genet. 68(3):686-699; Han et al. (2012) Tissue Antigens 80(4):328-35). This HLA association is one of the highest known: 98% of cases with demonstrated hypocretin deficiency carry DQ0602 versus 25% of the Caucasian population. Remarkably, even after the discovery of the putative autoimmune target, hypocretin-producing cells, attempts to demonstrate disease-associated autoimmune responses have been unsuccessful (Scammell (2006) Sleep 29(5): 601-602). Much of the investigation has focused on

autoantibodies, and although potential associations were found (Cvetkovic-Lopes et al. (2010) J. Clin. Invest. 120(3):713-719), these have not been consistently reproduced (Dauvilliers et al. (2010) Sleep 33(11): 1428-1430; Scammell, supra).

[0007] In the absence of a clear disease mechanism, further genetic studies, notably of the HLA region, and genome wide association studies were conducted (Faraco et al. (2013) PLoS Genetics 9(2):el 003270). These confirmed a primary effect of DQ0602 and also demonstrated modulating effects of other HLA alleles, as is typical in autoimmune disorders (Mignot et al., supra; Han et al., supra; (Hor et al. (2010) Nature Genetics 42(9):786-789). Additional loci in immune- related genes, such as the T cell receptor alpha (TCR-a), cathepsin-H (CTSH), the purinergic receptor P2RY11, and OX40L, a co-stimulatory molecule for T cells that is a tumor necrosis factor (ligand) superfamily member (TNFSF4) were identified, accounting for small effects, but sketching a pathway consistent with primary involvement of HLA-DQ presentation to CD4+ T cells in development of autoimmunity (Hallmayer et al. (2009) Nature Genetics 41(6):708-711 ; Faraco et al., supra; Kornum et al. (2011) Nature Genetics 43(1):66-71).

[0008] As with other autoimmune disorders, predisposition to developing narcolepsy also involves environmental or stochastic effects, as demonstrated by monozygotic twin concordance, derived from case reports, which is low, only 25-33%> (Dauvilliers et al. (2004) Neurology 62(11):2137-2138). In late 2000, childhood cases with narcoleptic onset following Streptococcus Pyogenes infections were reported, and increased levels of anti-streptolysin O antibodies (ASO) were found in sera of patients with recent onset (Aran et al. (2009) Sleep 32(8):979-983; Longstreth et al. (2009) Sleep 32(12): 1548). Monitoring the incidence of narcolepsy in China, Han et al. (Annals of Neurology (2011) 70(3):410-417) also found strong seasonal variation, with a trough during winter and a peak during spring and summer. These results suggested that winter infections could trigger the suspected autoimmune cascade that leads to hypocretin cell death and eventually narcolepsy, with only a few months delay.

[0009] In April 2009, the unexpected emergence of a new strain of H1N1 (often referred as the swine flu) with a potentially high mortality rate in Mexico resulted in significant international alarm and concern (Fraser et al. (2009) Science 324(5934): 1557-1561). The new strain spread rapidly, meeting criteria for a worldwide pandemic, although without the high mortality rate initially feared (Belongia et al. (2010) JAMA 304(10): 1091-1098; Girard et al. (2010) Vaccine 28(31):4895-4902). To face this threat, H1N1- pandemic specific vaccines were rapidly developed, using A/California/7/2009 (H1N1) pdm09-like reassortant virus. In Europe and some countries, vaccines were made both without and with adjuvants, the latter including MF-59, a squalene -based adjuvant, and AS03, a squalene-a-tocopherol mix adjuvant (Pandemrix), whereas in the United States only unadjuvanted vaccines were used (Girard et al., supra).

[00010] In the spring of 2010, sudden onset narcolepsy cases were reported following Pandemrix vaccination, notably in Finland, but also in other countries (Nohynek et al. (2012) PLoS One 7(3):e33536; Partinen et al. (2012) PLoS One 7(3):e33723). A large rise in childhood- onset cases in the spring and summer of 2010 in China, independent of vaccination, was also observed (Han et al. (2011) Annals of Neurology 70(3):410-417; Han et al. (2013) Annals of Neurology 73(4):560), and there are indications of a similar effect in the United States

(Dauvilliers et al., supra). Since then, the use of Pandemrix in children has been reported to increase the risk (Odds Ratio = 4-17) of developing narcolepsy in many countries, most strikingly in Scandinavia, where vaccine coverage was high (75% in Finnish children) (Dauvilliers et al., supra; Nohynek et al. (2012) PLoS One 7(3):e33536; Miller et al. (2013) BMJ 346:1794; Partinen et al. (2012) PLoS One 7(3):e33723; Szakacs et al. (2013) Neurology 80(14): 1315-1321 ; Wijnans et al. (2013) Vaccine 31(8): 1246-1254). Whether risk was also increased in adults varies across studies and countries; however, vaccination of different risk groups typically did not occur simultaneously. H1N1 pandemic infection unfolded in parallel with the vaccination campaign in most countries, complicating interpretation (Meeyai et al. (2013) BMJ Open. 3(3) pii:e002253; Nohynek et al. (2012) PLoS One 7(3):e33536). Even in Pandemrixvaccinated children however, only a minority, ~ 1/15,000 vaccines, developed narcolepsy (Partinen et al. (2012) PLoS One 7(3):e33723; Miller et al. (2013) BMJ 346:1794). [00011] In the United States alone, it is estimated that about 200,000 people suffer from narcolepsy, but the condition often remains undiagnosed or is misdiagnosed as other sleep disorders, such as sleep apnea or sleep deprivation, which are extremely common conditions (Chaudhary et al. (1993) J. Fam. Pract. 36(2):207-213). Approximately 1-2 million Americans are studied for sleep apnea each year in sleep clinics, many remaining sleepy after treatment for unknown reasons, possibly due to undiagnosed narcolepsy. Currently, narcolepsy is diagnosed with an expensive sleep test, the Multiple Sleep latency Test (MSLT), or a lumbar puncture test measuring hypocretin in cerebrospinal fluid (CSF) (Koziorynska et al. (2011) Rev. Neurol.

Dis.8(3-4):e97-106; Morrison et al. (2012) Eur. J. Intern. Med. 23(2):110-117; Mignot et al. (2002) Archives ofNeurology 59: 1553-1562; Carskadon et al. (1986) Sleep 9:519-524; Thorpy et al. (1992) Sleep; 15:268-276). The development of more convenient, inexpensive, and less painful diagnostic tests for narcolepsy, such as the blood test described in this invention is needed and will result in more recognition of the disease and improved care for narcoleptic patients.

[00012] In addition, there is a need for diagnostic tests that distinguish narcolepsy due to hypocretin autoimmune abnormalities from other forms of narcolepsy or from sleep disorders that can mimic narcolepsy, as it can be used to better tailor therapies. Indeed, first, in some cases, a positive test will allow earlier treatment of the disease, before the hypocretin cell loss is complete, possibly stopping the disease process in its track before the full blown symtoms have developped. Second, currently used treatments such as amphetamine, methylphenidate and sodium oxybate all have potential for abuse and addiction (Carter et al. (2009) Drug Alcohol Depend. 104(1 -2): 1-10), and there is clear evidence that hypocretin/orexin is involved in predisposition to addiction (Mahler et al. (2012) Prog Brain Res. 198:79-121, Matzeu et al. (2014) Front Behav Neurosci. 3;8:117), so that narcolepsy patients without hypocretin are less likely to become addicted to these medications.

Summary

[00013] The invention relates to methods for diagnosis, prevention, and treatment of narcolepsy and increased risk for addiction. In particular, the invention relates to methods of detecting T cells recognizing or reactive to narcolepsy-inducing antigens, such as hypocretin or influenza HI peptides, displayed in complexes with human leukocyte antigen (HLA) DQ0602. Additionally, the invention relates to methods of treating subjects for narcolepsy, either therapeutically or prophylactically, by blocking formation of DQ0602-hypocretin and DQ0602- influenza HI peptide epitope complexes or the cognate T cell receptor (TCR). It also relates to using this method to predict which patients are at lower risk of developing abuse when treated with stimulants (modafinil, methylphenidate, amphetamine) or sodium oxybate, the most commony used treatments currently used in narcolepsy.

[00014] In one aspect, the invention includes an isolated peptide consisting of 9 to 25 amino acids comprising the sequence of SEQ ID NO:4, wherein the peptide binds or induces a T cell immune response to human preprohypocretin, hypocretin-1, or hypocretin-2 when displayed in a complex with HLA DQ0602. In certain embodiments, the peptide is preprohypocretin, hypocretin-1, hypocretin-2, or an influenza HI peptide; or a variant or fragment thereof that is capable of inducing T cell reactivity in narcoleptic subjects. In certain embodiments, the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47. The peptide may be amidated at the C-terminus.

[00015] In one embodiment, the invention includes a composition comprising any narcolepsy- inducing peptide described herein and a physiologically acceptable excipient. The composition may further comprise HLA DQ0602, which may be present in any form (e.g., monomer or multimer) capable of binding the narcolepsy-inducing peptide and interacting with a T cell receptor. In one embodiment, the composition further comprises an antigen-presenting cell carrying HLA DQ0602, wherein the isolated peptide forms a complex with the HLA DQ0602 on the surface of the antigen-presenting cell. In another embodiment, the composition further comprises an artificial antigen-presenting cell (aAPC) carrying HLA DQ0602, wherein the isolated peptide forms a complex with the HLA DQ0602 on the surface of the aAPC. In one embodiment, the aAPC comprises an engineered cell expressing DQ0602 at its cell surface, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the engineered cell. In another embodiment, the aAPC comprises HLA DQ0602 attached to a solid support, wherein the isolated peptide forms a complex with the HLA DQ0602 attached to the solid support. In certain embodiments, the composition comprises a HLA DQ0602 multimer (e.g., a dimer, tetramer, pentamer, octamer, or dextramer), wherein the isolated peptide forms a complex with the HLA DQ0602 multimer; these multimers may be labeled, so that the T cell recognizing the complex can be detected and counted, for example using a fluorescence activated cell sorter (FACS). Additionally, the composition may comprise a T-cell that can be activated by interaction of its T cell receptor with a complex of a narcolepsy-inducing peptide and HLA DQ0602.

[00016] In another aspect, the invention includes a method for diagnosing narcolepsy in a subject, the method comprising: a) obtaining a T cell from the subject; b) contacting the T cell with a narcolepsy-inducing peptide displayed in a complex with HLA DQ0602, as described herein; and c) detecting T cell binding or a T cell response, wherein activation or binding of the T cell indicates that the subject has narcolepsy. Binding of the T cell to the DQ0602-narcolepsy inducing peptide complex can be detected by fluorescent or isotope labeled DQ0602-narcolepsy inducing peptide monomers, tetramers, or multimers, with sorting and counting of the cells having the coagnate T cell receptor using FACS. Activation of a T cell can be determined, for example, by detecting T cell proliferation or T cell secretion of cytokines. The T cell response can be evaluated by performing an immunoassay, such as, but not limited to an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry to detect, for example, changes in T cell surface or intracellular activation markers. Secretion of a cytokine may be detected by an ELISPOT assay, by detecting, for example, secretion of one or more cytokines selected from the group consisting of IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL- 4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β may be detected. The cytokine or combination of cytokines or surface markers (for example CD38, CD62L, CD25, CD69, CD71) chosen for detection depends on whether the T cell is a TH1, TH2, Thl7 or a T reg cell.

[00017] In another aspect, the invention includes a kit for detecting T cells that are binding or activated by narcolepsy-inducing antigens. The kit may comprise at least one peptide described herein, such as a peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: 1 -4, 26, 37-39, 43, and 45-47. The peptide may be amidated at the C-terminus. The kit may further include a container for holding a biological sample, isolated from a human subject suspected of having narcolepsy, and printed instructions for mixing the peptide with the biological sample or a portion of the biological sample to detect the presence of reactive T cells or T cell binding DQB0602-sequence complex in the biological sample. The agents may be packaged in separate containers. The kit may further comprise one or more antigen presenting cells, artificial antigen presenting cells, HLA DQ0602 (e.g., monomer or multimer, with our without peptide), control reference samples, or reagents for performing an immunoassay, such as an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry. The kit may further comprise information, in electronic or paper form, comprising instructions for diagnosing narcolepsy in a subject.

[00018] In another aspect, the invention includes an isolated antibody that specifically binds to a narcolepsy-inducing peptide described herein. In one embodiment, the antibody specifically binds to the peptide when it is displayed in a complex with HLA DQ0602. The HLA DQ0602 may be monomeric, tetrameric or multimeric and may be attached to the surface of an antigen presenting cell or an artificial antigen presenting cell. In another embodiment, the antibody specifically binds to the peptide when it is displayed in a complex with HLA DQ0602 in the presence of a T cell, wherein a T cell receptor on the surface of the T cell is bound to the peptide/DQB0602 complex. In certain embodiments, the antibody specifically binds to a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37-39, 43, and 45-47. The antibody may be a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an Fv fragment, or an scFv fragment. In one embodiment, the antibody is a humanized antibody. The antibody may further comprise a detectable label.

[00019] In another aspect, the invention includes a polynucleotide encoding a narcolepsy- inducing peptide described herein.

[00020] In another aspect, the invention includes a recombinant polynucleotide comprising a polynucleotide encoding a narcolepsy-inducing peptide operably linked to a promoter.

[00021] In another aspect, the invention includes a host cell comprising a recombinant polynucleotide encoding a narcolepsy-inducing peptide operably linked to a promoter.

[00022] In another aspect, the invention includes a method for producing a narcolepsy- inducing peptide, the method comprising the steps of: a) culturing a host cell comprising a recombinant polynucleotide encoding a narcolepsy-inducing peptide operably linked to a promoter under conditions suitable for the expression of the peptide; and b) recovering the peptide from the host cell culture.

[00023] In another aspect, the invention includes a method for detecting a T cell that is activated by a narcolepsy-inducing peptide, the method comprising: a) obtaining a biological sample comprising a T cell from a subject suspected of having narcolepsy; b) contacting the biological sample with a narcolepsy-inducing peptide displayed in a complex with HLA DQ0602, as described herein; and c) detecting T cell binding or a T cell response, wherein the detection of the T cell response indicates that the T cell binds or is activated by the narcolepsy-inducing peptide. In one embodiment, the biological sample is blood. In certain embodiments, detecting the T cell response comprises performing an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry. In one embodiment, secretion of a cytokine is detected by an ELISPOT assay. Exemplary cytokines that may be detected, include IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β. The cytokine or combination of cytokines or surface markers (for example CD38, CD62L, CD25, CD69, CD71) chosen for detection depends on whether the T cell is a THl, TH2, a Thl7 or A Treg cell.

[00024] In another aspect, the invention includes an isolated T cell receptor, or a fragment thereof (e.g., a TCR fragment comprising an antigen binding site, including the complementarity determining regions (CDRs) CDR1, CDR2, and CDR3), that specifically binds to a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l -4, 26, 37-39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602. In one embodiment, the peptide is bound to HLA DQ0602 on the surface of an antigen presenting cell. In another embodiment, the peptide is bound to HLA DQ0602 on the surface of an artificial antigen presenting cell. In another embodiment, the peptide is bound to HLA DQ0602 attached to a solid support. In yet another embodiment, the peptide is bound to HLA DQ0602 in the form of a multimer (e.g., dimer, tetramer, pentamer, octamer, or dextramer) that may be labeled and sorted by FACS.

[00025] In another aspect, the invention includes an isolated antibody that specifically binds to a T cell receptor that is activated by a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37-39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602. In certain embodiments, the antibody is a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an Fv fragment, or an scFv fragment. In one embodiment, the antibody is a humanized antibody. The antibody may further comprise a detectable label.

[00026] In another aspect, the invention includes a method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of an antibody that specifically binds to a T cell receptor on the surface of a T cell that can be activated by a narcolepsy-inducing peptide described herein, such that the antibody blocks binding of the T cell receptor to the narcolepsy-inducing peptide when the peptide is displayed in a complex with HLA DQ0602 on the surface of an antigen presenting cell. In one embodiment, the antibody is a humanized antibody. The antibody may be administered therapeutically or prophylactically, for example, to prevent or delay the onset of one or more symptoms of narcolepsy (e.g., to inhibit the autoimmune response to hypocretin and loss of hypocretin from the brain to prevent disease progression) or to ameliorate symptoms of narcolepsy. In certain embodiments, the antibody is administered prophylactically to a subject who has detectable T cells that are reactive to narcolepsy-inducing antigens, and/or a known genetic predisposition to developing narcolepsy, and/or who have been exposed to environmental triggers (e.g.,

Streptococcus pyogenes or influenza virus infection or vaccines). The method may further comprise treating the subject with one or more narcolepsy drugs. Exemplary narcolepsy drugs include methylphenidate, amphetamine, methamphetamine, modafmil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate. [00027] In another aspect, the invention includes a method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of an antibody that specifically binds to HLA DQ0602, such that the HLA DQ0602 cannot form a complex with a narcolepsy-inducing peptide or an antibody that binds to and blocks the HLA DQ0602-hypocretin complex, or an antibody that complexes with other peptides bound to the DQ0602 to block the T cell from binding the DQB0602-peptide complex associated with narcolepsy. In one embodiment, the antibody is a humanized antibody. The antibody may be administered therapeutically or prophylactically, for example, to prevent or delay the onset of one or more symptoms of narcolepsy (e.g., to inhibit the autoimmune response to hypocretin and loss of hypocretin from the brain to prevent disease progression) or to ameliorate symptoms of narcolepsy. In certain embodiments, the antibody is administered prophylactically to a subject who has detectable T cells that are reactive to narcolepsy-inducing antigens, and/or a known genetic predisposition to developing narcolepsy, and/or who have been exposed to environmental triggers (e.g., Streptococcus pyogenes or influenza virus infection or vaccines). The method may further comprise treating the subject with one or more narcolepsy drugs, such as, but not limited to methylphenidate, amphetamine, methamphetamine, modafmil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate.

[00028] In another aspect, the invention includes a method of inhibiting a T cell immune response to hypocretin, the method comprising: a) obtaining a biological sample comprising a T cell that is normally activated by a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4 when the peptide is displayed in a complex with HLA DQ0602; and b) contacting the biological sample with an antibody that specifically binds to a T cell receptor on the surface of the T cell, thereby blocking an antigen binding site of the T cell receptor, such that the T cell is no longer activated by the peptide.

[00029] In another aspect, the invention includes a method for treating a subject with a genetic predisposition to developing narcolepsy, the method comprising: a) obtaining a biological sample comprising a T cell from the subject; b) and treating the subject with an

immunosuppressive agent if the T cell is activated by a narcolepsy inducing peptide described herein. In one embodiment, the biological sample is blood.

[00030] In another aspect, the invention includes testing blood samples or blood sample extracts for T cells or T cell receptors recognizing DQ0602-hypocretin and DQ0602-influenza HI peptide epitope complexes, and using the result of this test to make a determination on whether or not this patient is suitable for treatment by addictive drugs such as modafinil, methylphenidate, sodium oxybate (also known as Gamma hydroxybutyric acid) and amphetamine.

[00031] These and other embodiments of the subject invention will readily occur to those of skill in the art in view of the disclosure herein.

Brief Description of the Figures

[00032] Figures 1A-1B show characterization of DQ0602-binding register and TCR contacts in narcolepsy-related hypocretin epitopes. Figure 1 A shows a schematics of the effects of various single amino acid substitutions on TCR recognition (top graphics) and DQ0602-binding (bottom graphics). Shown are anchor residues for HCRT56-68 and HCRT87-99 binding to DQ0602 (PI, P3, P4, P6, P9) and residues involved in subsequent TCR activation (P2, P5, P7, P8) and associated effects of various substitutions (details in Fig. S5). TCR data reflect assays of cells from 5 patients. Figure IB shows inhibition of DQ0602-binding of EBV490-503 by HCRT56-68 and HCRT87-99, including epitopes with N-amidated C-terminal end (from secreted hypocretin- 1 and 2). IC50s range from 1 to 10 μΜ.

[00033] Figures 2A-2C show that hypocretin peptides (HCRT56-68 and HCRT87-99) activate CD4+ T-cells in narcoleptic patients but not in healthy controls. Hypocretin peptides and EBV490-503 were presented by T2.DQ0602 cells to purified CD4+ T-cells and responding cells detected by IFN-γ ELISpot. Right panels display representative ELISpot images with SFU counts. Figure 2A shows ELISpot results (and median) from 24 hour in vitro stimulation of purified CD4+ T-cells (105 per well) from narcoleptic patients (n=23) and matched

DQBl *06:02-positive controls (n=24). Logarithmic scale. Figrue 2B shows ELISpot results from 4 discordant monozygotic twin pairs (pairs marked with lines). Figure 2C shows ELISpot results from Irish children who developed narcolepsy following Pandemrix vaccination (n=10) compared to vaccinated but healthy siblings (n=7). ***P<0.001.

[00034] Figures 3A-3B show in vivo and in vitro stimulation of CD4+ T-cells from narcolepsy patients with pHlNl vaccine antigens activates HCRT56-68 and HCRT87-99-reactive cells. CD4+ T-cell reactivity was tested by ELISpot before and after vaccination of patients and controls or after in vitro stimulation of PBMC with vaccine antigens. Figure 3 A shows ELISpot results from DQ0602-positive controls (blue, n=4) and narcoleptic patients (red, n=7) before and 5-9 days after non-adjuvanted influenza trivalent vaccination containing pHlNl (SFU/105 CD4+ T-cells, logarithmic scale). Figrue 3B shows ELISpot results from in vitro cross-culture stimulations. Individual results from control (n=3-5) and narcolepsy (n=13-14) samples. PBMC were cultured with pHlNl split vaccine antigen for 13 days and CD4+ T-cells were purified, rested and re-stimulated with HCRT56-68, HCRT87-99, pHAl 275-287, or EBV490-503. See Fig. S8 for representative ELISpot images. *P<0.05, **P<0.01, ***P<0.001.

[00035] Figures 4A-4F show molecular mimicry between pHlNl epitope pHA1275-287 and HCRT56-68/HCRT87-99, and activation of hypocretin-reactive CD4+ T-cells by pHAl 275-287. Our experiments identified pHAl 275-287, an epitope unique to pHAl, as a possible mimic of HCRT56-68 and HCRT87-99. Figreu 4A shows alignment of HCRT56-68, HCRT87-99, and pHAl 275-287 with sequences from other seasonal and pandemic flu strains. Single amino acid substitution scans of pHAl 275-287 (Fig. S5) established the binding register depicted here. Figeru 4B shows inhibition of DQ0602-binding of EBV490-503 by HA1 epitopes. IC50 for pHA1275-287 (and for homologous peptide from HA1 1998) is 0.5 μΜ. All other epitopes have 10-100 fold lower affinity for DQ0602. Figure 4C shows ELISpot results from epitope cross cultures. Individual results from control (n=3-5) and narcolepsy (n=13-14) samples. PBMC were cultured with pHAl 275-287 for 13 days and CD4+ T-cells were purified, rested and restimulated with HCRT56-68, HCRT87-99, pHAl 275-287, or EBV490-503. Figure 4D-4F show cross- culture stimulation experiments using T2.DQ0602 presentation of hypocretin, pHAl, or EBV epitopes (24 hr) to purified CD4+ T-cells, isolation of CD38+ (activated) CD4+ T-cells, and subsequent ELISpot testing for reactivity to the same epitopes. See Fig. S8 for representative ELISpot images. *P<0.05, **P<0.01, ***P<0.001

[00036] Figures 5A-5D show binding of HCRT and pHlNl peptides to DQ0602. Figure 5A shows that overlapping 15-mer peptides (11 amino acid overlap) covering the entire prepro- hypocretin protein were screened for their ability to compete with EBV490-503 for DQ0602 binding in vitro. Figures5B-5D show using the same assay, overlapping 15-mer peptides covering the entire pHAl, pNAl, and pPBl proteins present in A/California/7/2009 (pHlNl) were screened for their ability to displace EBV490-503 from DQ0602 in vitro. Binding was described based on the percentage of reference peptide (EBV490-503) out-competed; >75% decrease in signal is considered good binding, 50-75% moderate binding, and <50% poor binding. Note that in a few cases, signal increased in the presence of the competing peptide, indicating "peptide push off. All experiments were performed three times using technical duplicates.

[00037] Figures 6A-6B show representative examples of IFN-γ and TNF-a ELISpot results with DQ0602 binders. Figure 6A shows CD4+ T-cell IFN-γ responses to peptides binding strongly to DQ0602 in cells from narcolepsy patients and control subjects. Top: ELISpot results (and median) from 24 hour in vitro stimulation of purified CD4+ T-cells (105 per well) from narcoleptic patients and DQBl *06:02-positive controls. HCRT leader sequence (HCRTl-13), and peptides HCRT25-39, HCRT41-55, and HCRT113-127 were tested in 5 patients and 5 control subjects. Peptides HCRT53-67 and HCRT85-99 were tested in 7 patients and 7 controls.

Bottom: Representative ELISpot images with Spot Forming Units (SFU) counts for each peptide. Figure 6B shows HCRT peptides and EBV490-503 that were presented using T2.DQ0602 cells and responding CD4+ T-cells from 4 narcoleptic patients and 2 healthy controls were detected by TNF-a ELISpot by counting spot-forming units (SFUs). Right panel displays representative ELISpot images.

[00038] Figures 7A-7E show T-cell response to HCRT epitopes with different antigen presenting cells. Figure 7A shows IFN-γ ELISpot data from stimulations of 7 patient samples vs. 7 control samples with HCRT56-68 and HCRT87-99 peptides added to either total PBMCs (containing both CD4+ T-cells, CD8+ T-cells and autologous antigen presenting cells), autologous dendritic cells (DCs) with purified CD4+ T-cells, or T2.DQ0602 cells with purified CD4+ T-cells. Shown is number of Spot Forming Units (SFU) per 105 T-cells. *P<0.05, **P<0.01. Figure 7B-7E show correlations of results obtained with the different T-cell stimulation paradigms as performed on the same samples. Samples from 7 patients and 7 controls were used.

[00039] Figures 8A-8B show receiving operating characteristics (ROC) curves for ELISpot data. Using receiving operating characteristics curve analysis, a statistical method to optimize sensitivity and specificity, we found that a cut off for HCRT56-68 > 5 (Figure 8A) and HCRT87- 99 >1 (Figure 8B) Spot Forming Units (SFU) per 105 CD4+ T-cells, had sensitivities of 0.83 [0.67-1.0] and 0.92 [0.78-1.0] and specificities of 0.96 [0.88-1.0] and 0.88 [0.72-1.0], respectively. Combining both readings, HCRT56-68 > 3 and HCRT87-99 > 2 (C) SFU/105 cells had a sensitivity of 0.83 [0.63-0.96] (all but four patients positive) and a specificity of 1.0 [1.0- 1.0] (none of the controls met criteria); while HCRT56-68 > 5 or HCRT87-99 > 1 (D)

SFU/105cells had a sensitivity of 0.96 [0.88-1.0] and a specificity of 0.84 [0.70-0.96].

[00040] Figures 9A-9D show DQ0602 binding of HCRT and pHAl peptides with amino acid substitutions. Figure 9A shows peptides with amino acid substitutions at each residue position (1- 9) of HCRT56-68 were tested for their ability to bind DQ0602, as determined by EBV490-503 competition. Figures 9B-9C show peptides with phenylalanine substitutions at each residue position of (Fig. 9B) HCRT87-99 and (Fig. 9C) pHA1275-287 were tested for their ability to out- compete EBV490-503 binding to DQ0602. Figure 9D shows schematic overview of the substitutions tested in HCRT56-68, HCRT87-99, and pHAl 275-287, and their effect on DQ0602 binding. The asterisk denotes peptides difficult to dissolve in assay buffer. All experiments where performed 2-3 times in technical duplicates or triplicates. [00041] Figures 10A-10B show possible mimics of hypocretin epitopes in pHlNl stimulate T-cells from narcoleptic patients and controls. Figure 10A shows a dose-response curve for the effect of HCRT56-68, HCRT87-99, and pHAl 275-287 on CD4+ T-cell activation, as measured by IFN-γ ELISpot. IC50s is approximately ΙΟρΜ. The epitopes have high affinity for DQ0602 and are highly potent at stimulating CD4+T-cells. Data was generated using 5 narcolepsy patients. Figure 10B shows representative examples of IFN-γ ELISpot results of other DQ0602 binders from pHlNl . Data are obtained using NA13-11, NA181-90, HA174-83, and PB111-20, from 5 patients and 3 controls.

[00042] Figure 11 shows in vitro stimulation of CD4+ T-cells from narcolepsy patients and controls with HCRT56-68 and HCRT87-99 epitopes. ELISpot results from in vitro cross-culture stimulations. Individual results in narcolepsy (n=12-14) and controls (n=3-5) samples cultured with HCRT56-68 and HCRT87-99 (1 μΜ) for 13 days with IL-2 (10 IU/mL) and IL-7 (20 ng/niL) and restimulated with HCRT56-68, HCRT87-99, pHAl 275-287, or EBV490-503.

Statistical significance was calculated using the Wilcoxon Signed-Rank Test, *P<0.05,

***P<0.001.

[00043] Figures 12A-12B show representative ELISpot images corresponding to Fig. 3, Fig.4, and Fig. S7. Figure 12A shows ELISpot results from long-term epitope cross cultures. Cells from a total of 13-14 narcolepsy samples and 3-5 controls were cultured with either mixed HCRT56-68 plus HCRT87-99, pHAl 275-287, or whole vaccine and restimulated with HCRT56-68, HCRT87- 99, pHAl 275-287, or EBV490-503. Figure 12B shows cross-culture stimulation experiments using T2.DQ0602 presentation of HCRT56-68 plus HCRT87-99, pHAl 275-287, or EBV490-503 epitopes (24 hr), isolation of CD38+ positive activated cells, and subsequent ELISpot testing for reactivity to HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. In total 13-14 narcolepsy samples and 3-5 controls were tested. Numbers on the bottom right corner of each circle indicate SFU counts for each well.

Detailed Description

[00044] The practice of the present invention will employ, unless otherwise indicated, conventional methods of medicine, virology, chemistry, biochemistry, recombinant DNA techniques, and immunology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Narcolepsy: Pathophysiology, Diagnosis, and Treatment (C.R. Baumann, C.L. Bassetti, T.E. Scammell eds., Springer, 2011); Narcolepsy: A Clinical Guide (M. Goswami, S.R. Pandi-Perumal, M.J. Thorpy eds., Springer, 2010); T Cell Protocols (Methods in Molecular Biology, G. De Libero ed., Humana Press, 2nd edition, 2008); The Immunoassay Handbook: Theory and Applications of Ligand Binding, ELISA and Related Techniques (D.G. Wild ed., Elsevier Science; 4th edition, 2013); Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., Blackwell Scientific Publications); Fundamental Virology, 3rd Edition, vol. I & II (B. N. Fields and D. M. Knipe, eds.); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).

[00045] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entireties.

I. DEFINITIONS

[00046] In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

[00047] It must be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a T cell" includes a mixture of two or more T cells, and the like.

[00048] The term "about", particularly in reference to a given quantity, is meant to encompass deviations of plus or minus five percent.

[00049] The term "stimulant" is meant to include modafinil, methylphenidate and amphetamine, either as racemic mixtures or as pure isomers, with and without modifications for improved pharmacokinetcs (i.e. slow or extended release formulations)

[00050] The terms "peptide", "oligopeptide" and "polypeptide" refer to any compound comprising naturally occurring or synthetic amino acid polymers or amino acid-like molecules including but not limited to compounds comprising amino and/or imino molecules. No particular size is implied by use of the terms "peptide", "oligopeptide" or "polypeptide" and these terms are used interchangeably. Included within the definition are, for example, peptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), peptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring (e.g., synthetic). Thus, synthetic oligopeptides, dimers, multimers (e.g., tandem repeats, linearly-linked peptides), cyclized, branched molecules and the like, are included within the definition. The terms also include molecules comprising one or more peptoids (e.g., N-substituted glycine residues) and other synthetic amino acids or peptides. (See, e.g., U.S. Patent Nos. 5,831,005; 5,877,278; and 5,977,301 ; Nguyen et al. (2000) Chem. Biol. 7(7):463-473; and Simon et al. (1992) Proc. Natl. Acad. Sci. USA 89(20):9367-9371 for descriptions of peptoids). Non-limiting lengths of peptides suitable for use in the present invention includes peptides of 10 to 30 residues in length, e.g., 10 to 15 residues in length (or any integer therebetween), 16 to 20 residues in length (or any integer therebetween), 21 to 25 residues in length (or any integer therebetween), 26 to 30 (or any integer therebetween), or peptides of greater than 30 residues in length. Typically, peptides useful in this invention can have a maximum length suitable for the intended application. Preferably, the peptide is between about 10 and 25 residues in length. Generally, one skilled in art can easily select the maximum length in view of the teachings herein. Further, peptides and polypeptides, as described herein, for example synthetic peptides, may include additional molecules such as labels or other chemical moieties. Such moieties may further enhance interaction of the peptides or polypeptides with major histocompatibility complex (MHC) or the T cell receptor (TCR) and/or further detection of the peptides or polypeptides.

[00051] Thus, references to peptides or polypeptides also include derivatives of the amino acid sequences of the invention including one or more non-naturally occurring amino acids. A first peptide is "derived from" a second peptide if it is (i) encoded by a first polynucleotide derived from a second polynucleotide encoding the second peptide, or (ii) displays sequence identity to the second peptide as described herein. Sequence (or percent) identity can be determined as described below. Preferably, derivatives exhibit at least about 50% percent identity, more preferably at least about 80%, and even more preferably between about 85% and 99% (or any value therebetween) to the sequence from which they were derived. Such derivatives can include postexpression modifications of the peptide, for example, glycosylation, acetylation, phosphorylation, and the like.

[00052] Amino acid derivatives can also include modifications to the native sequence, such as deletions, additions and substitutions (generally conservative in nature), so long as the polypeptide or peptide maintains the desired activity (e.g., binds to MHC and TCR). These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts that produce the proteins or errors due to PCR amplification.

Furthermore, modifications may be made that have one or more of the following effects:

increasing affinity and/or specificity for HLA DQ0602 or its cognate TCR. Polypeptides and peptides described herein can be made recombinantly, synthetically, or in tissue culture.

[00053] A "narcolepsy-inducing peptide" or "narcolepsy-inducing antigen" refers to a peptide or protein antigen comprising the core DQ0602-binding epitope sequence of SEQ ID NO:4. Narcolepsy-inducing peptides can be derived from preprohypocretin, hypocretin-1, hypocretin-2, and influenza A virus hemagglutinin subtype 1 (HI); or a variant or fragment thereof that is capable of inducing narcolepsy in a subject. The molecule need not be physically derived from an organism or virus, but may be synthetically or recombinantly produced. A number of hypocretin and influenza HI nucleic acid, peptide, and protein sequences are known.

[00054] Representative hypocretin sequences are presented in SEQ ID NO: l and SEQ ID NO:2 and additional representative sequences are listed in the National Center for Biotechnology Information (NCBl) database. See, for example, NCBl entries: Accession Nos. XM 004282809, XM_004267773, XM_004266544, NM_010410, NM_013064, NM_001525, NM_001524, NM_001526, NG_01 1448, NM_001077392, NM_204185, NM_013179, NM_001 129951, NM_214156, M_001079868, NM_001 166520, NM_001043346, NM_001048182,

NM_001002933, NM_001024584, NM_013074, XM_002197738, XM 00219521 1 ,

NM_001 163027, NM_198959, NMJ 98962, XM_003279459, XM_003276352,

XM_003254127, XM_004041712, XM_004044226, XM_004025344, XM_004012921 , NG_012447, XM_003989799, XM_003986250, XM_001 166578, XM_524646, XM_518552, XM_003942765, XM_003937582, XM_003926378, XM_003897755, XM_003913092, XM_003891485, NM_001192677, NM_001246233, NM_001 194432, XM_003828934, XM_003828128, XM_003813875, XM_003786345, XM_003800745, XM_003789655, XM_002827520, XM_002817022, XM_00281 1 135, XM_003768205, XM_003769177, NM_001033994, XM_002750543, XM_002748650, XM_002746690, XM_003498389, XM_003495008, XM_001503207, XM_001917425, XM_002923975, XM_001099090, and XM 001 109616; all of which sequences (as entered by the date of filing of this application) are herein incorporated by reference. Any of these sequences or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, or a fragment thereof, can be used to construct a narcolepsy- inducing peptide, or a nucleic acid encoding a narcolepsy-inducing peptide, as described herein.

[00055] A representative influenza virus HI sequence is presented in SEQ ID NO: 3 and additional representative sequences are listed in the National Center for Biotechnology

Information (NCBl) database. See, for example, NCBl entries: Accession Nos. AEN75154, AEG77065, AEG77062, AEN75152, AEN75140, AEN75136, AEF33503, AEN80038,

AEF33561 , ADD71076, AEN75143, AEN75138, AEN75155, ADA70665, AEF33509, ADQ43766, AEN75150, AEN75148, AEN75144, AEN75151 , AEN75149, AEN75142, ACQ44558, AEN75141 , ADB66388, ACQ44557, AEG77092, AEN75132, ADA70661 , AEN75134, AEF33564, ACS75342, ADR70791 , AEF30705, AEF33516, AEF33523,

AEN75133, AEF33567, AEN75147, AEN75146, ACZ67873, AEN75137, AEN75135, AEF33525, AEF33522, AEF33517, ADA70663, ADA70662, ADA70660, AER46246,

AEF33552, AEF33521, ACT66226, AEN75153, ADA70664, ACX70052, AEF33520,

ACT66225, AEN75145, ADA70659, ADB66392, AEF33570, ADB66390, AEF30732,

ADB66382, AEF33539, AEF33506, AEF33507, AEF33531, AEF33540, AEF33544, AEF30672, ACX70048, AEN75139, ADB66384, AEF33558, AEF33566, AEF30723, AEF30743,

ACZ67881, AEF33511, ACS34673, ADW65793, ACX70067, AEF30755, AEF33519,

AEF30613, ADW65913, ADW65777, AEF30714, ADB66374, ACX70065, AEF33514, ADB66378, ACS34813, AEF30683, AEF30645, ADA70658, ADA70657, AEF30654,

AEA07344, ADA70656, ADB66345, and AEF30663; all of which sequences (as entered by the date of filing of this application) are herein incorporated by reference. Any of these sequences or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, or a fragment, can be used to construct a narcolepsy-inducing peptide, or a nucleic acid encoding a narcolepsy-inducing peptide, as described herein.

[00056] "Physiologically acceptable excipient or carrier" refers to an excipient that may optionally be included in the compositions of the invention and that causes no significant adverse toxicological effects to cells of the subject (e.g., T cells or antigen presenting cells used in assays of immunoreactivity). As used herein, and unless otherwise specified, the term "pharmaceutically acceptable carrier," "pharmaceutically acceptable excipient," "physiologically acceptable carrier," or "physiologically acceptable excipient" refers to a pharmaceutically-acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, buffer or encapsulating material. In one embodiment, each component is "pharmaceutically acceptable" in the sense of being compatible with the other ingredients of a pharmaceutical formulation, and suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit/risk ratio. In one embodiment, by "pharmaceutical" or "pharmaceutically acceptable" it is meant that any diluent(s), excipient(s) or carrier(s) in the composition, formulation, or dosage form are compatible with the other ingredient(s) and not deleterious to the recipient thereof. See, e.g., Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins: Philadelphia, Pa., 2005; Handbook of

Pharmaceutical Excipients, 5th Edition, Rowe et al., Eds., The Pharmaceutical Press and the American Pharmaceutical Association: 2005; and Handbook of Pharmaceutical Additives, 3rd Edition, Ash and Ash Eds., Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, 2nd Edition, Gibson Ed., CRC Press LLC: Boca Raton, Fla., 2009.

[00057] As used herein, the terms "T cell immune response" or "T cell response" refer to activation of antigen-specific T cells as measured by cell proliferation or expression of molecules on their cell surface or secretion of proteins such as cytokines. The term "T cell binding" refers to binding of antigen-specific T cells as measured by labeling of specific TCR molecules on their cell surface.

[00058] By "fragment" is intended a molecule consisting of only a part of the intact full- length sequence and structure. A fragment of a polypeptide can include a C-terminal deletion, an N-terminal deletion, and/or an internal deletion of the native polypeptide. A fragment of a polypeptide will generally include at least about 5-10 contiguous amino acid residues of the full- length molecule, preferably at least about 15-25 contiguous amino acid residues of the full-length molecule, and most preferably at least about 20-50 or more contiguous amino acid residues of the full-length molecule, or any integer between 5 amino acids and the number of amino acids in the full-length sequence, provided that the fragment in question retains the ability to elicit the desired biological response. A fragment of a nucleic acid can include a 5'-deletion, a 3'-deletion, and/or an internal deletion of a nucleic acid. Nucleic acid fragments will generally include at least about 5-1000 contiguous nucleotide bases of the full-length molecule and may include at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 75, 100, 150, 250 or at least 500 contiguous nucleotides of the full-length molecule, or any integer between 5 nucleotides and the number of nucleotides in the full-length sequence. Such fragments may be useful in hybridization, amplification, production of immunogenic fragments, or nucleic acid immunization.

[00059] As used herein, the term "epitope" generally refers to the site on an antigen which is recognized by a T-cell receptor and/or an antibody. It can be a short peptide derived from a protein antigen. Several different epitopes may be carried by a single antigenic molecule.

[00060] An "immunological response" to an antigen or composition is the development in a subject of a humoral and/or a cellular immune response to an antigen present in the composition of interest. For purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, while a "cellular immune response" is one mediated by T-lymphocytes and/or other white blood cells. One important aspect of cellular immunity involves an antigen-specific response by cytolytic T-cells ("CTL"s). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves an antigen-specific response by helper T-cells. Helper T-cells act to help stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A "cellular immune response" also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells.

[00061] A composition that elicits a cellular immune response may serve to sensitize a subject by the presentation of antigen in association with MHC molecules at the cell surface. The cell- mediated immune response is directed at, or near, cells presenting antigen at their surface. In addition, antigen-specific T-lymphocytes can be generated to allow for the future protection of an immunized host.

[00062] The ability of a particular antigen to stimulate a cell-mediated immunological response may be determined by a number of assays, such as by lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject. Such assays are well known in the art. See, e.g., Erickson et al., J. Immunol. (1993) 151 :4189-4199; Doe et al., Eur. J. Immunol. (1994) 24:2369-2376. Methods of measuring cell-mediated immune response include measurement of intracellular cytokines or cytokine secretion by T-cell populations, or by measurement of epitope specific T-cells (e.g., by the tetramer technique) (reviewed by McMichael, A. J., and O'Callaghan, C. A., J. Exp. Med. 187(9)1367-1371, 1998; Mcheyzer-Williams, M. G., et al, Immunol. Rev. 150:5-21, 1996;

Lalvani, A., et al, J. Exp. Med. 186:859-865, 1997).

[00063] The terms "immunogenic" protein, polypeptide, or peptide refer to an amino acid sequence which elicits an immunological response as described above. An "immunogenic" protein, polypeptide, or peptide, as used herein, includes the full-length sequence of the protein in question, including the precursor and mature forms, analogs thereof, or immunogenic fragments thereof.

[00064] An "antigen" refers to a molecule, such as a protein, polypeptide, peptide, or fragment thereof, containing one or more epitopes (either linear, conformational or both) that will stimulate a host's immune-system to make a humoral and/or cellular antigen-specific response. Normally, a B-cell epitope will include at least about 5 amino acids but can be as small as 3-4 amino acids. A T-cell epitope, such as a CTL epitope, will include at least about 7-9 amino acids, and a helper T-cell epitope at least about 11-20 amino acids. Normally, an epitope will include between about 7 and 15 amino acids, such as, 9, 10, 11, 12 or 15 amino acids. [00065] The term "MHC multimer" or "HLA DQ0602 multimer" refers to a complex comprising more than one MHC molecule held together by covalent or non-covalent bonds. The term includes, but is not limited to dimers, tetramers, pentamers, octamers, or polymers of MHC. In the multimer, MHC molecules may be attached to a multimerization domain, scaffold, or artificial antigen presenting cell (aAPC). These may be fluorescentlyor isotope labeled for detection of specific autorecative T cells.

[00066] The term "multimerization domain" refers to a molecule, a complex of molecules, or a solid support to which one or more MHC or MHC-peptide complexes can be attached. A multimerization domain may consist of one or more carriers and/or one or more scaffolds and may also contain one or more linkers connecting a carrier to a scaffold, a carrier to a carrier, or a scaffold to a scaffold. The multimerization domain may also contain one or more linkers that can be used for attachment of MHC complexes and/or other molecules to the multimerization domain. Multimerization domains may include, but are not limited to IgG, streptavidin, streptactin, dextran, liposomes, micelles, cells, polymers, beads and other types of solid support, and small organic molecules carrying reactive groups or carrying chemical motifs that can bind MHC complexes and other molecules.

[00067] "Substantially purified" generally refers to isolation of a substance (compound, polynucleotide, protein, peptide, peptide composition) such that the substance comprises the majority percent of the sample in which it resides. Typically in a sample, a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample.

Techniques for purifying polynucleotides and polypeptides or peptides of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.

[00068] By "isolated" is meant, when referring to a polypeptide or peptide, that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macro-molecules of the same type. The term "isolated" with respect to a polynucleotide is a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith; or a molecule disassociated from the chromosome.

[00069] "Homology" refers to the percent identity between two polynucleotide or two polypeptide moieties. Two nucleic acid, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% sequence identity, preferably at least about 75% sequence identity, more preferably at least about 80%-85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules. As used herein, substantially homologous also refers to sequences showing complete identity to the specified sequence.

[00070] In general, "identity" refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M.O. in Atlas of Protein Sequence and Structure M.O.

Dayhoff ed., 5 Suppl. 3:353-358, National biomedical Research Foundation, Washington, DC, which adapts the local homology algorithm of Smith and Waterman Advances in Appl. Math. 2:482-489, 1981 for peptide analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, WI) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.

[00071] Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of

Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. Details of these programs Error! Hyperlink reference not valid, are readily available.

[00072] Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system.

Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.

[00073] "Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation, is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term "recombinant" as used with respect to a protein, polypeptide, or peptide means a polypeptide or peptide produced by expression of a recombinant polynucleotide. In general, the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein or peptide under expression conditions.

[00074] The term "transformation" refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion. For example, direct uptake, transduction or f-mating are included. The exogenous polynucleotide may be maintained as a non-integrated vector, for example, a plasmid, or alternatively, may be integrated into the host genome.

[00075] "Recombinant host cells", "host cells," "cells", "cell lines," "cell cultures", and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vector or other transferred DNA, and include the original progeny of the original cell which has been transfected.

[00076] A "coding sequence" or a sequence which "encodes" a selected polypeptide or peptide, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide/peptide in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence can be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA, genomic DNA sequences from viral or prokaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3' to the coding sequence.

[00077] Typical "control elements," include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5' to the coding sequence), and translation termination sequences.

[00078] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.

[00079] "Encoded by" refers to a nucleic acid sequence which codes for a polypeptide sequence, wherein the polypeptide sequence or a portion thereof contains an amino acid sequence of at least 3 to 5 amino acids, and more preferably at least 8 to 25 amino acids from a polypeptide encoded by the nucleic acid sequence.

[00080] "Expression cassette" or "expression construct" refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest. An expression cassette generally includes control elements, as described above, such as a promoter which is operably linked to (so as to direct transcription of) the sequence(s) or gene(s) of interest, and often includes a polyadenylation sequence as well. Within certain embodiments of the invention, the expression cassette described herein may be contained within a plasmid construct. In addition to the components of the expression cassette, the plasmid construct may also include, one or more selectable markers, a signal which allows the plasmid construct to exist as single stranded DNA (e.g., a Ml 3 origin of replication), at least one multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).

[00081] The term "transfection" is used to refer to the uptake of foreign DNA by a cell. A cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (2001) Molecular Cloning, a laboratory manual, 3rd edition, Cold Spring Harbor Laboratories, New York, Davis et al. (1995) Basic Methods in Molecular Biology, 2nd edition, McGraw-Hill, and Chu et al. (1981) Gene 13: 197. Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells. The term refers to both stable and transient uptake of the genetic material, and includes uptake of peptide- or antibody-linked DNAs.

[00082] A "vector" is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, "vector construct," "expression vector, " and "gene transfer vector," mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.

[00083] "Gene transfer" or "gene delivery" refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of non- integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells. Gene delivery expression vectors include, but are not limited to, vectors derived from bacterial plasmid vectors, viral vectors, non- viral vectors, alphaviruses, pox viruses and vaccinia viruses.

[00084] The terms "variant," "analog" and "mutein" refer to biologically active derivatives of the reference molecule that retain desired activity, such as the ability a narcolepsy-inducing peptide to bind DQ0602 and activate a T cell response to a hypocretin peptide. In general, the terms "variant" and "analog" refer to compounds having a native polypeptide sequence and structure with one or more amino acid additions, substitutions (generally conservative in nature) and/or deletions, relative to the native molecule, so long as the modifications do not destroy biological activity and which are "substantially homologous" to the reference molecule as defined below. In general, the amino acid sequences of such analogs will have a high degree of sequence homology to the reference sequence, e.g., amino acid sequence homology of more than 50%, generally more than 60%-70%, even more particularly 80%-85% or more, such as at least 90%- 95% or more, when the two sequences are aligned. Often, the analogs will include the same number of amino acids but will include substitutions, as explained herein. The term "mutein" further includes polypeptides having one or more amino acid-like molecules including but not limited to compounds comprising only amino and/or imino molecules, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring (e.g., synthetic), cyclized, branched molecules and the like. The term also includes molecules comprising one or more N-substituted glycine residues (a "peptoid") and other synthetic amino acids or peptides. (See, e.g., U.S. Patent Nos. 5,831,005; 5,877,278; and 5,977,301; Nguyen et al., Chem. Biol. (2000) 7:463-473; and Simon et al., Proc. Natl. Acad. Sci. USA (1992) 89:9367-9371 for descriptions of peptoids). Methods for making polypeptide analogs and muteins are known in the art and are described further below.

[00085] As explained above, analogs generally include substitutions that are conservative in nature, i.e., those substitutions that take place within a family of amino acids that are related in their side chains. Specifically, amino acids are generally divided into four families: (1) acidic— aspartate and glutamate; (2) basic— lysine, arginine, histidine; (3) non-polar— alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar - glycine, asparagine, glutamine, cysteine, serine threonine, and tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid, will not have a major effect on the biological activity. For example, the polypeptide of interest may include up to about 5-10 conservative or non-conservative amino acid substitutions, or even up to about 15-25 conservative or non- conservative amino acid substitutions, or any integer between 5-25, so long as the desired function of the molecule remains intact. One of skill in the art may readily determine regions of the molecule of interest that can tolerate change by reference to Hopp/Woods and Kyte-Doolittle plots, well known in the art.

[00086] As used herein, a "solid support" refers to a solid surface such as a magnetic bead, latex bead, microtiter plate well, glass plate, nylon, agarose, acrylamide, and the like.

[00087] As used herein, a "biological sample" refers to a sample of a cell or cells, tissue, or fluid isolated from a subject, including but not limited to, for example, blood, plasma, serum, fecal matter, urine, bone marrow, bile, spinal fluid, lymph fluid, samples of the skin, external secretions of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, blood cells, organs, biopsies and also samples of in vitro cell culture constituents including but not limited to conditioned media resulting from the growth of cells and tissues in culture medium, e.g., recombinant cells, and cell components.

[00088] The terms "subject," "individual," and "patient," are used interchangeably herein and refer to any vertebrate subject, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. The term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.

[00089] The term "antibody" encompasses polyclonal and monoclonal antibody preparations, as well as preparations including hybrid antibodies, altered antibodies, chimeric antibodies and, humanized antibodies, as well as: hybrid (chimeric) antibody molecules (see, for example, Winter et al. (1991) Nature 349:293-299; and U.S. Pat. No. 4,816,567); F(ab')2 and F(ab) fragments; Fv molecules (noncovalent heterodimers, see, for example, Inbar et al. (1972) Proc Natl Acad Sci USA 69:2659-2662; and Ehrlich et al. (1980) Biochem 19:4091-4096); single-chain Fv molecules (sFv) (see, e.g., Huston et al. (1988) Proc Natl Acad Sci USA 85:5879-5883); dimeric and trimeric antibody fragment constructs; minibodies (see, e.g., Pack et al. (1992) Biochem 31 : 1579- 1584; Cumber et al. (1992) J Immunology 149B: 120-126); humanized antibody molecules (see, e.g., Riechmann et al. (1988) Nature 332:323-327; Verhoeyan et al. (1988) Science 239: 1534- 1536; and U.K. Patent Publication No. GB 2,276,169, published 21 Sep. 1994); and, any functional fragments obtained from such molecules, wherein such fragments retain specific- binding properties of the parent antibody molecule.

[00090] The phrase "specifically (or selectively) binds" to an antibody or TCR or

"specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies. Thus, under designated immunoassay conditions, the specified antibodies or TCRs bind to a particular protein or peptide at least two times the background and do not substantially bind in a significant amount to other proteins or peptides present in the sample. Specific binding to an antibody or TCR under such conditions may require an antibody or TCR that is selected for its specificity for a particular protein or peptide. Typically a specific or selective reaction will be at least twice background signal or noise and more typically more than 10 to 100 times background.

[00091] The terms "label" and "detectable label" refer to a molecule capable of detection, including, but not limited to, radioactive isotopes, stable (non-radioactive) heavy isotopes, fluorescers, chemiluminescers, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, chromophores, dyes, metal ions, metal sols, ligands (e.g., biotin or haptens) and the like. The term "fluorescer" refers to a substance or a portion thereof that is capable of exhibiting fluorescence in the detectable range. Particular examples of labels that may be used with the invention include, but are not limited to radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P), stable (non-radioactive) heavy isotopes (e.g., 13C or 15N), phycoerythrin, Alexa dyes, fluorescein, 7- nitrobenzo-2-oxa-l,3-diazole (NBD), YPet, CyPet, Cascade blue, allophycocyanin, Cy3, Cy5, Cy7, rhodamine, dansyl, umbelliferone, Texas red, luminol, acradimum esters, biotin or other streptavidin-binding proteins, magnetic beads, electron dense reagents, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), blue fluorescent protein (BFP), red fluorescent protein (RFP), Dronpa, Padron, mApple, mCherry, rsCherry, rsCherryRev, firefly luciferase, Renilla luciferase, NADPH, beta-galactosidase, horseradish peroxidase, glucose oxidase, alkaline phosphatase, chloramphenical acetyl transferase, and urease. Enzyme tags are used with their cognate substrate. The terms also include color-coded microspheres of known fluorescent light intensities (see e.g., microspheres with xMAP technology produced by Luminex (Austin, TX); microspheres containing quantum dot nanocrystals, for example, containing different ratios and combinations of quantum dot colors (e.g., Qdot nanocrystals produced by Life Technologies (Carlsbad, CA); glass coated metal nanoparticles (see e.g., SERS nanotags produced by Nanoplex Technologies, Inc. (Mountain View, CA); barcode materials (see e.g., sub-micron sized striped metallic rods such as Nanobarcodes produced by Nanoplex Technologies, Inc.), encoded microparticles with colored bar codes (see e.g., CellCard produced by Vitra Bioscience, vitrabio.com), and glass microparticles with digital holographic code images (see e.g., CyVera microbeads produced by Illumina (San Diego, CA). As with many of the standard procedures associated with the practice of the invention, skilled artisans will be aware of additional labels that can be used.

[00092] "Diagnosis" as used herein generally includes determination as to whether a subject is likely affected by a given disease, disorder or dysfunction. The skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, such as a biomarker (e.g., T cells reactive to narcolepsy-inducing peptide), the presence, absence, or amount of which is indicative of the presence or absence of the disease, disorder or dysfunction.

[00093] "Pharmaceutically acceptable excipient or carrier" refers to an excipient that may optionally be included in the compositions of the invention and that causes no significant adverse toxicological effects to the patient.

[00094] "Pharmaceutically acceptable salt" includes, but is not limited to, amino acid salts, salts prepared with inorganic acids, such as chloride, sulfate, phosphate, diphosphate, bromide, and nitrate salts, or salts prepared from the corresponding inorganic acid form of any of the preceding, e.g., hydrochloride, etc., or salts prepared with an organic acid, such as malate, maleate, fumarate, tartrate, succinate, ethylsuccinate, citrate, acetate, lactate, methanesulfonate, benzoate, ascorbate, para-toluenesulfonate, palmoate, salicylate and stearate, as well as estolate, gluceptate and lactobionate salts. Similarly salts containing pharmaceutically acceptable cations include, but are not limited to, sodium, potassium, calcium, aluminum, lithium, and ammonium (including substituted ammonium).

[00095] An "effective amount" of an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602 is an amount sufficient to effect beneficial or desired results, such as an amount that inhibits the autoimmune T cell response to hypocretin, and/or reduces or prevents destruction of neuronal cells producing hypocretin and loss of hypocretin from the brain of a subject. An effective amount can be administered in one or more administrations, applications or dosages.

[00096] By "therapeutically effective dose or amount" of an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602 is intended an amount that, when administered as described herein, brings about a positive therapeutic response, such as improved neurological recovery from narcolepsy.

Improved neurological recovery may include a reduction in sleepiness, cataplexy, or abnormal REM sleep. The therapeutically effective dose may be administered prophylactically to prevent or delay the onset of narcoleptic symptoms (e.g., to inhibit the autoimmune response to hypocretin and loss of hypocretin from the brain to prevent disease progression) or

therapeutically to ameliorate symptoms of narcolepsy. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, mode of administration, and the like. An appropriate "effective" amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation, based upon the information provided herein.

II. Modes of Carrying Out the Invention

[00097] Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.

[00098] Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.

[00099] The present invention is based on the discovery of hypocretin and influenza virus HI epitopes that trigger autoimmunity to hypocretin in subjects expressing HLA DQ0602

(heterodimer encoded by HLA alleles DQA1 *01 :02 and DQB 1 *06:02), who are susceptible to developing narcolepsy (see Examples). The autoimmune reaction results in destruction of hypocretin producing neurons in the brain causing deficiency of the hypocretin neurotransmitter, which normally regulates sleep-wake cycles. In particular, the inventors have identified the core epitope sequence that binds to DQ0602 and a specific T cell receptor responsible for inducing the autoimmune reaction.

[000100] The invention relates to methods of detecting T cells that are reactive to narcolepsy- inducing antigens, including hypocretin in its various forms (e.g., preprohypocretin, hypocretin-1, and hypocretin-2) and similar influenza HI peptides. The invention further relates to methods of protecting subjects susceptible to developing narcolepsy from exposure to dangerous narcolepsy- inducing antigens. The invention also includes methods of treating subjects for narcolepsy by blocking formation of DQ0602-hypocretin and DQ0602 -influenza HI peptide epitope complexes or interactions of such epitope complexes with their cognate T cell receptor.

[000101] In order to further an understanding of the invention, a more detailed discussion is provided below regarding the identified narcolepsy-inducing epitopes and methods of diagnosing, treating, and preventing narcolepsy.

A. Narcolepsy-Inducing Peptides

[000102] In one aspect, the invention provides narcolepsy-inducing peptides that binds T-cells or induce a T cell immune response to human preprohypocretin, hypocretin-1, or hypocretin-2 when displayed in a complex with human leukocyte antigen (HLA) DQ0602 by an antigen- presenting cell. Narcolepsy-inducing peptides comprise a 9-residue core epitope sequence (SEQ ID NO:4), wherein the amino acid at position 1 can be N, L, M, or an other amino acid but not A, C, F, G, H, or K, which disrupt DQ0602 binding; the amino acid at position 2 can be any amino acid; the amino acid at position 3 can be L, F, G, A, N, Y, S, or an other amino acid, but not K, W, or V, which disrupt DQ0602 binding; the amino acid at position 4 can be A, L, S, V, F, or any other amino acid, but not K, G, or D, which disrupt DQ0602 binding; the amino acid at position 5 can be any amino acid, but not F, which causes major disruption to the TCR interaction; the amino acid at position 6 can be I, L, M, V, or any other amino acid but not S, G, Y, or T, which disrupt DQ0602 binding; the amino acid at position 7 can be any amino acid but not F, which causes moderate disruption to the TCR interaction; the amino acid at position 8 can be K, T, I, or any other amino acid; and the amino acid at position 9 can be M, L or any other residue, but K is less preferred because it causes moderate disruption to DQ0602 binding (see Figure 2). In certain embodiments, the narcolepsy-inducing peptide consists of 9 to 25 amino acids comprising the sequence of SEQ ID NO:4, wherein the peptide binds or induces a T cell immune response to human preprohypocretin, hypocretin-1, or hypocretin-2 when displayed in a complex with HLA DQ0602. In certain embodiments, the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: 1 -3, 26, 37-39, 43, and 45-47. In addition, the peptide may be amidated at the C-terminus.

[000103] Narcolepsy-inducing peptides can be derived from preprohypocretin, hypocretin-1, hypocretin-2, and influenza A virus hemagglutinin subtype 1 (HI); or a variant or fragment thereof that is capable of inducing narcolepsy in a subject. The molecule need not be physically derived from an organism or virus, but may be synthetically or recombinantly produced. A number of hypocretin and influenza HI nucleic acid, peptide, and protein sequences are known.

[000104] Representative hypocretin sequences are presented in SEQ ID NO: l and SEQ ID NO:2 and additional representative sequences are listed in the National Center for Biotechnology Information (NCBl) database. See, for example, NCBl entries: Accession Nos. XM 004282809, XM_004267773, XM_004266544, NM_010410, NM_013064, NM_001525, NM_001524, NM_001526, NG_011448, NM_001077392, NM_204185, NM_013179, NM_001129951, NM_214156, M_001079868, NM_001166520, NM_001043346, NM_001048182,

NM_001002933, NM_001024584, NM_013074, XM_002197738, XM 002195211,

NM_001163027, NMJ98959, NMJ98962, XM_003279459, XM_003276352,

XM_003254127, XM_004041712, XM_004044226, XM_004025344, XM 004012921, NG_012447, XM_003989799, XM_003986250, XM_001166578, XM_524646, XM_518552, XM_003942765, XM_003937582, XM_003926378, XM_003897755, XM_003913092, XM_003891485, NM_001192677, NM_001246233, NM_001194432, XM_003828934, XM_003828128, XM_003813875, XM_003786345, XM_003800745, XM_003789655, XM_002827520, XM_002817022, XM_002811135, XM_003768205, XM_003769177, NM_001033994, XM_002750543, XM_002748650, XM_002746690, XM_003498389, XM_003495008, XM_001503207, XM_001917425, XM_002923975, XM_001099090, and XM 001109616; all of which sequences (as entered by the date of filing of this application) are herein incorporated by reference. Any of these sequences or a variant thereof comprising a sequence having at least about 80-100% sequence identity thereto, including any percent identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, or a fragment thereof, can be used to construct a narcolepsy- inducing peptide, or a nucleic acid encoding a narcolepsy-inducing peptide, as described herein.

[000105] A representative influenza virus HI sequence is presented in SEQ ID NO:3 and additional representative sequences are listed in the National Center for Biotechnology

AEF33561, ADD71076, AEN75143, AEN75138, AEN75155, ADA70665, AEF33509,

ADQ43766, AEN75150, AEN75148, AEN75144, AEN75151, AEN75149, AEN75142,

ACQ44558, AEN75141, ADB66388, ACQ44557, AEG77092, AEN75132, ADA70661, AEN75134, AEF33564, ACS75342, ADR70791, AEF30705, AEF33516, AEF33523,

AEN75133, AEF33567, AEN75147, AEN75146, ACZ67873, AEN75137, AEN75135,

AEF33525, AEF33522, AEF33517, ADA70663, ADA70662, ADA70660, AER46246,

AEF33552, AEF33521, ACT66226, AEN75153, ADA70664, ACX70052, AEF33520,

ACT66225, AEN75145, ADA70659, ADB66392, AEF33570, ADB66390, AEF30732,

ACZ67881, AEF33511, ACS34673, ADW65793, ACX70067, AEF30755, AEF33519,

[000106] In one embodiment, the invention includes a composition comprising any narcolepsy- inducing peptide described herein and a physiologically acceptable excipient. The composition may further comprise HLA DQ0602 (e.g., monomer or multimer), which may be attached to the surface of an antigen-presenting cell or an artificial antigen-presenting cell, wherein the peptide forms a complex with the HLA DQ0602. Additionally, the composition may comprise a T-cell that can be activated by interaction of its T cell receptor with the complex of the peptide with HLA DQ0602.

[000107] The narcolepsy-inducing peptide may further comprise a detectable label in order to facilitate detection of binding of the peptide to HLA DQ0602 and T cell receptors on T cells. Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means. Particular examples of labels that may be used with the invention include, but are not limited to radiolabels (e.g., 3H, 1251, 35S, 14C, or 32P), stable (non-radioactive) heavy isotopes (e.g., 13C or 15N), phycoerythrin, Alexa dyes, fluorescein, 7-nitrobenzo-2-oxa-l,3-diazole (NBD), YPet, CyPet, Cascade blue, allophycocyanin, Cy3, Cy5, Cy7, rhodamine, dansyl, umbelliferone, Texas red, luminol, acradimum esters, biotin or other streptavidin-binding proteins, magnetic beads, electron dense reagents, green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), blue fluorescent protein (BFP), red fluorescent protein (RFP), Dronpa, Padron, mApple, mCherry, rsCherry, rsCherryRev, firefly luciferase, Renilla luciferase, NADPH, beta- galactosidase, horseradish peroxidase, glucose oxidase, alkaline phosphatase, chloramphenical acetyl transferase, and urease. Enzyme tags are used with their cognate substrate. The terms also include color-coded microspheres of known fluorescent light intensities (see e.g., microspheres with xMAP technology produced by Luminex (Austin, TX); microspheres containing quantum dot nanocrystals, for example, containing different ratios and combinations of quantum dot colors (e.g., Qdot nanocrystals produced by Life Technologies (Carlsbad, CA); glass coated metal nanoparticles (see e.g., SERS nanotags produced by Nanoplex Technologies, Inc. (Mountain View, CA); barcode materials (see e.g., sub-micron sized striped metallic rods such as

Nanobarcodes produced by Nanoplex Technologies, Inc.), encoded microparticles with colored bar codes (see e.g., CellCard produced by Vitra Bioscience, vitrabio.com), and glass

microparticles with digital holographic code images (see e.g., CyVera microbeads produced by Illumina (San Diego, CA). As with many of the standard procedures associated with the practice of the invention, skilled artisans will be aware of additional labels that can be used.

[000108] The peptides disclosed throughout and, for example, in the tables presented in the specification are all contemplated alone or in various combinations to be useful in some aspects of the invention for assays, diagnostic methods, and for treatment as described. It is contemplated that the peptides can be, e.g., labeled, attached to tags or solid surfaces to provide useful tools for assays, kits and methods.

B. Production of Narcolepsy-Inducing Peptides

[000109] Narcolepsy-inducing peptides can be prepared in any suitable manner (e.g., recombinant expression, purification from cell culture, chemical synthesis, etc.) and in various forms (e.g. native, fusions, labeled, lipidated, etc.). Narcolepsy-inducing peptides include naturally-occurring peptides, recombinantly produced peptides, synthetically produced peptides, or peptides produced by a combination of these methods. Means for preparing peptides are well understood in the art. Peptides are preferably prepared in substantially pure form (i.e.

substantially free from other host cell or non-host cell proteins). [000110] In one embodiment, the peptides are generated using recombinant techniques. One of skill in the art can readily determine nucleotide sequences that encode the desired peptides using standard methodology and the teachings herein. Oligonucleotide probes can be devised based on the known sequences and used to probe genomic or cDNA libraries. The sequences can then be further isolated using standard techniques and, e.g., restriction enzymes employed to truncate the gene at desired portions of the full-length sequence. Similarly, sequences of interest can be isolated directly from cells and tissues containing the same, using known techniques, such as phenol extraction and the sequence further manipulated to produce the desired truncations. See, e.g., Sambrook et al., supra, for a description of techniques used to obtain and isolate DNA.

[000111] The sequences encoding peptides can also be produced synthetically, for example, based on the known sequences. The nucleotide sequence can be designed with the appropriate codons for the particular amino acid sequence desired. The complete sequence is generally assembled from overlapping oligonucleotides prepared by standard methods and assembled into a complete coding sequence. See, e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223: 1299; Jay et al. (1984) J. Biol. Chem. 259:6311 ; Stemmer et al. (1995) Gene 164:49-53.

[000112] Recombinant techniques are readily used to clone sequences encoding peptides that can then be mutagenized in vitro by the replacement of the appropriate base pair(s) to result in the codon for the desired amino acid. Such a change can include as little as one base pair, effecting a change in a single amino acid, or can encompass several base pair changes. Alternatively, the mutations can be effected using a mismatched primer that hybridizes to the parent nucleotide sequence (generally cDNA corresponding to the RNA sequence), at a temperature below the melting temperature of the mismatched duplex. The primer can be made specific by keeping primer length and base composition within relatively narrow limits and by keeping the mutant base centrally located. See, e.g., Innis et al, (1990) PCR Applications: Protocols for Functional Genomics; Zoller and Smith, Methods Enzymol. (1983) 100:468. Primer extension is effected using DNA polymerase, the product cloned and clones containing the mutated DNA, derived by segregation of the primer extended strand, selected. Selection can be accomplished using the mutant primer as a hybridization probe. The technique is also applicable for generating multiple point mutations. See, e.g., Dalbie-McFarland et al. Proc. Natl. Acad. Sci USA (1982) 79:6409.

[000113] Once coding sequences have been isolated and/or synthesized, they can be cloned into any suitable vector or replicon for expression. As will be apparent from the teachings herein, a wide variety of vectors encoding modified peptides can be generated by creating expression constructs which operably link, in various combinations, polynucleotides encoding peptides having deletions or mutations therein. [000114] Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. Examples of recombinant DNA vectors for cloning and host cells which they can transform include the bacteriophage λ (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pKT230 (gram-negative bacteria), pGVl 106 (gram-negative bacteria), pLAFRl (gram-negative bacteria), pME290 (non-E. coli gram-negative bacteria), pHV14 (E. coli and Bacillus subtilis), pBD9 (Bacillus), pIJ61 (Streptomyces), pUC6

(Streptomyces), YIp5 (Saccharomyces), YCpl9 (Saccharomyces) and bovine papilloma virus (mammalian cells). See, generally, DNA Cloning: Vols. I & II, supra; Sambrook et al., supra; B. Perbal, supra.

[000115] Insect cell expression systems, such as baculovirus systems, can also be used and are known to those of skill in the art and described in, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA ("MaxBac" kit).

[000116] Plant expression systems can also be used to produce the Narcolepsy-inducing peptides and polypeptides described herein. Generally, such systems use virus-based vectors to transfect plant cells with heterologous genes. For a description of such systems see, e.g., Porta et al., Mol. Biotech. (1996) 5:209-221 ; and Hackland et al., Arch. Virol. (1994) 139:1-22.

[000117] Viral systems, such as a vaccinia based infection/transfection system, as described in Tomei et al., J. Virol. (1993) 67:4017-4026 and Selby et al., J. Gen. Virol. (1993) 74: 1103-1113, will also find use with the present invention. In this system, cells are first transfected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase displays exquisite specificity in that it only transcribes templates bearing T7 promoters. Following infection, cells are transfected with the DNA of interest, driven by a T7 promoter. The polymerase expressed in the cytoplasm from the vaccinia virus recombinant transcribes the transfected DNA into RNA that is then translated into protein by the host translational machinery. The method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation product(s).

[000118] The gene can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator (collectively referred to herein as "control" elements), so that the DNA sequence encoding the desired polypeptide is transcribed into RNA in the host cell transformed by a vector containing this expression construction. The coding sequence may or may not contain a signal peptide or leader sequence. With the present invention, both the naturally occurring signal peptides or heterologous sequences can be used. Leader sequences can be removed by the host in post-translational processing. See, e.g., U.S. Patent Nos. 4,431,739; 4,425,437; 4,338,397. Such sequences include, but are not limited to, the TPA leader, as well as the honey bee mellitin signal sequence.

[000119] Other regulatory sequences may also be desirable which allow for regulation of expression of the protein sequences relative to the growth of the host cell. Such regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.

[000120] The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector. Alternatively, the coding sequence can be cloned directly into an expression vector that already contains the control sequences and an appropriate restriction site.

[000121] In some cases it may be necessary to modify the coding sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the proper reading frame. Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., Sambrook et al., supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra.

[000122] The expression vector is then used to transform an appropriate host cell. A number of mammalian cell lines are known in the art and include immortalized cell lines available from the American Type Culture Collection (ATCC), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), Vero293 cells, as well as others. Similarly, bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs. Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha,

Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris,

Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni.

[000123] Depending on the expression system and host selected, the fusion proteins of the present invention are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. The selection of the appropriate growth conditions is within the skill of the art.

[000124] In one embodiment, the transformed cells secrete the peptide or polypeptide product into the surrounding media. Certain regulatory sequences can be included in the vector to enhance secretion of the protein product, for example using a tissue plasminogen activator (TP A) leader sequence, an interferon (γ or a) signal sequence or other signal peptide sequences from known secretory proteins. The secreted peptide or polypeptide product can then be isolated by various techniques described herein, for example, using standard purification techniques such as but not limited to, hydroxyapatite resins, column chromatography, ion-exchange chromatography, size-exclusion chromatography, electrophoresis, HPLC, immunoadsorbent techniques, affinity chromatography, immunoprecipitation, and the like.

[000125] Alternatively, the transformed cells are disrupted, using chemical, physical or mechanical means, which lyse the cells yet keep the recombinant peptides substantially intact. Intracellular proteins can also be obtained by removing components from the cell wall or membrane, e.g., by the use of detergents or organic solvents, such that leakage of the

polypeptides occurs. Such methods are known to those of skill in the art and are described in, e.g., Protein Purification Applications: A Practical Approach, (Simon Roe, Ed., 2001).

[000126] For example, methods of disrupting cells for use with the present invention include but are not limited to: sonication or ultrasonication; agitation; liquid or solid extrusion; heat treatment; freeze-thaw; desiccation; explosive decompression; osmotic shock; treatment with lytic enzymes including proteases such as trypsin, neuraminidase and lysozyme; alkali treatment; and the use of detergents and solvents such as bile salts, sodium dodecylsulphate, Triton, NP40 and CHAPS. The particular technique used to disrupt the cells is largely a matter of choice and will depend on the cell type in which the polypeptide is expressed, culture conditions and any pre -treatment used.

[000127] Following disruption of the cells, cellular debris is removed, generally by centrifugation, and the intracellularly produced peptides are further purified, using standard purification techniques such as but not limited to, column chromatography, ion-exchange chromatography, size-exclusion chromatography, electrophoresis, HPLC, immunoadsorbent techniques, affinity chromatography, immunoprecipitation, and the like.

[000128] For example, one method for obtaining the intracellular peptides of the present invention involves affinity purification, such as by immunoaffinity chromatography using antibodies (e.g., previously generated antibodies), or by lectin affinity chromatography.

Particularly preferred lectin resins are those that recognize mannose moieties such as but not limited to resins derived from Galanthus nivalis agglutinin (GNA), Lens culinaris agglutinin (LCA or lentil lectin), Pisum sativum agglutinin (PSA or pea lectin), Narcissus pseudonarcissus agglutinin (NPA) and Allium ursinum agglutinin (AUA). The choice of a suitable affinity resin is within the skill in the art. After affinity purification, the peptides can be further purified using conventional techniques well known in the art, such as by any of the techniques described above.

[000129] Narcolepsy-inducing peptides and polypeptides can be conveniently synthesized chemically, for example by any of several techniques that are known to those skilled in the peptide art. See, e.g., Fmoc Solid Phase Peptide Synthesis: A Practical Approach (W. C. Chan and Peter D. White eds., Oxford University Press, 1st edition, 2000) ; N. Leo Benoiton,

Chemistry of Peptide Synthesis (CRC Press; 1st edition, 2005); Peptide Synthesis and

Applications (Methods in Molecular Biology, John Howl ed., Humana Press, 1st ed., 2005); and Pharmaceutical Formulation Development of Peptides and Proteins (The Taylor & Francis Series in Pharmaceutical Sciences, Lars Hovgaard, Sven Frokjaer, and Marco van de Weert eds., CRC Press; 1st edition, 1999; herein incorporated by reference).

[000130] In general, these methods employ the sequential addition of one or more amino acids to a growing peptide chain. Normally, either the amino or carboxyl group of the first amino acid is protected by a suitable protecting group. The protected or derivatized amino acid can then be either attached to an inert solid support or utilized in solution by adding the next amino acid in the sequence having the complementary (amino or carboxyl) group suitably protected, under conditions that allow for the formation of an amide linkage. The protecting group is then removed from the newly added amino acid residue and the next amino acid (suitably protected) is then added, and so forth. After the desired amino acids have been linked in the proper sequence, any remaining protecting groups (and any solid support, if solid phase synthesis techniques are used) are removed sequentially or concurrently, to render the final peptide or polypeptide. By simple modification of this general procedure, it is possible to add more than one amino acid at a time to a growing chain, for example, by coupling (under conditions which do not racemize chiral centers) a protected tripeptide with a properly protected dipeptide to form, after deprotection, a pentapeptide. See, e.g., J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis (Pierce Chemical Co., Rockford, IL 1984) and G. Barany and R. B. Merrifield, The Peptides: Analysis, Synthesis, Biology, editors E. Gross and J. Meienhofer, Vol. 2, (Academic Press, New York, 1980), pp. 3-254, for solid phase peptide synthesis techniques; and M. Bodansky, Principles of Peptide Synthesis, (Springer- Verlag, Berlin 1984) and E. Gross and J. Meienhofer, Eds., The Peptides: Analysis, Synthesis, Biology, Vol. 1, for classical solution synthesis. These methods are typically used for relatively small polypeptides, i.e., up to about 50-100 amino acids in length, but are also applicable to larger polypeptides.

[000131] Typical protecting groups include t-butyloxycarbonyl (Boc), 9- fluorenylmethoxycarbonyl (Fmoc) benzyloxycarbonyl (Cbz); p-toluenesulfonyl (Tx); 2,4- dinitrophenyl; benzyl (Bzl); biphenylisopropyloxycarboxy-carbonyl, t-amyloxycarbonyl, isobornyloxycarbonyl, o-bromobenzyloxycarbonyl, cyclohexyl, isopropyl, acetyl, o- nitrophenylsulfonyl and the like.

[000132] Typical solid supports are cross-linked polymeric supports. These can include divinylbenzene cross-linked-styrene -based polymers, for example, divinylbenzene- hydroxymethylstyrene copolymers, divinylbenzene-chloromethylstyrene copolymers and divinylbenzene-benzhydrylaminopolystyrene copolymers.

[000133] The polypeptide analogs of the present invention can also be chemically prepared by other methods such as by the method of simultaneous multiple peptide synthesis. See, e.g., Houghten Proc. Natl. Acad. Sci. USA (1985) 82:5131-5135; U.S. Patent No. 4,631,211.

C. Antibodies Specific for Narcolepsy-Inducing Antigens

[000134] Antibodies that specifically bind to a narcolepsy-inducing antigen or peptide fragment thereof can be prepared using any suitable methods known in the art. See, e.g., Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies: A Laboratory Manual (1988); Goding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986); and Kohler & Milstein, Nature 256:495-497 (1975). Antibodies can be generated that specifically bind to the free antigen or an antigenic peptide bound to HLA DQ0602 displayed on an antigen presenting cell or an artificial antigen presenting cell in the presence or absence of a T cell receptor. A narcolepsy-inducing antigen or peptide fragment thereof comprising the core epitope sequence of SEQ ID NO:4 (e.g., in the presence or absence of HLA DQ0602 and/or a T cell receptor) can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a narcolepsy-inducing antigen or peptide fragment thereof can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g.

lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful. [000135] Monoclonal antibodies which specifically bind to a narcolepsy-inducing antigen or peptide fragment thereof can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B cell hybridoma technique, and the EBV hybridoma technique (Kohler et al., Nature 256, 495-97, 1985; Kozbor et al., J. Immunol.

Methods 81, 31 42, 1985; Cote et al., Proc. Natl. Acad. Sci. 80, 2026-30, 1983; Cole et al., Mol. Cell Biol. 62, 109-20, 1984).

[000136] In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al., Proc. Natl. Acad. Sci. 81, 6851-55, 1984; Neuberger et al., Nature 312, 604-08, 1984; Takeda et al., Nature 314, 452-54, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.

[000137] Alternatively, humanized antibodies can be produced using recombinant methods, as described below. Antibodies which specifically bind to a particular antigen can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. Pat. No.

5,565,332. Human monoclonal antibodies can be prepared in vitro as described in Simmons et al., PLoS Medicine 4(5), 928-36, 2007.

[000138] Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to a particular antigen. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).

[000139] Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al., Eur. J. Cancer Prev. 5, 507-11, 1996). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, Nat. Biotechnol. 15, 159-63, 1997. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, J. Biol. Chem. 269, 199-206, 1994. [000140] A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al., Int. J Cancer 61, 497-501, 1995; Nicholls et al., J. Immunol. Meth. 165, 81-91, 1993).

[000141] Antibodies which specifically bind to a biomarker antigen also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al., Proc. Natl. Acad. Sci. 86, 3833 3837, 1989; Winter et al., Nature 349, 293 299, 1991).

[000142] Chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO 94/13804, also can be prepared.

[000143] Antibodies can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which the relevant antigen is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

[000144] In certain embodiments, the invention includes an isolated antibody selected from the group consisting of: a) an isolated antibody that specifically binds to a narcolepsy-inducing peptide, b) an isolated antibody that specifically binds to a narcolepsy-inducing peptide when it is displayed in a complex with HLA DQ0602 on the surface of an antigen-presenting cell, and c) an isolated antibody that specifically binds to a narcolepsy-inducing peptide when it is displayed in a complex with HLA DQ0602 on the surface of an antigen-presenting cell in the presence of a T cell, wherein a T cell receptor on the surface of the T cell is bound to the peptide. In certain embodiments, the antibody specifically binds to a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS : 1 -3. The antibody may further comprise a detectable label.

[000145] In another embodiment, the invention includes an isolated antibody that specifically binds to a T cell receptor that can be activated by interaction with narcolepsy-inducing peptides displayed by antigen presenting cells or artificial antigen presenting cells, wherein the antibody blocks binding of narcolepsy-inducing antigens to the antigen binding site of the T cell receptor. Such an antibody can be used to inhibit a T cell immune response to hypocretin (i.e., preprohypocretin, hypocretin- 1, or hypocretin-2). [000146] In one embodiment, the invention includes a method of inhibiting a T cell immune response with such an antibody, the method comprising: a) obtaining a biological sample comprising a T cell that is normally activated by a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l -4 when the peptide is displayed in a complex with HLA DQ0602; and b) contacting the biological sample with the antibody, such that the antibody binds to a T cell receptor on the surface of the T cell, thereby blocking an antigen binding site of the T cell receptor, such that the T cell is no longer activated by the peptide.

[000147] Such an antibody can also be used therapeutically to treat a subject for narcolepsy. In one embodiment, the invention includes a method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of such an antibody, such that the antibody blocks binding of T cell receptors to narcolepsy-inducing peptides displayed in complexes with HLA DQ0602 on the surface of antigen presenting cells. Preferably, the antibody is humanized to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.

[000148] In another embodiment, the invention includes an isolated antibody that specifically binds to HLA DQ0602, whereby the antibody blocks presentation of narcolepsy-inducing peptides by HLA DQ0602 to T cells. Such an antibody can also be used therapeutically to treat a subject for narcolepsy. In one embodiment, the invention includes a method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of an antibody that specifically binds to HLA DQ0602, such that the HLA DQ0602 cannot form a complex with a narcolepsy-inducing peptide. Preferably, the antibody is humanized to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.

D. Detecting T Cell Activation by Narcolepsy-Inducing Antigens

[000149] In another aspect, the invention includes a method for detecting a T cell that is binding or activated by a narcolepsy-inducing peptide displayed as a peptide -HLA DQ0602 complex. The method comprises contacting a biological sample comprising a T cell with a narcolepsy-inducing peptide displayed in a complex with HLA DQ0602 and detecting T cell binding or a T cell response to determine whether or not the T cell is binding or activated by the narcolepsy-inducing peptide.

[000150] The HLA DQ602 used in this method can be present in various forms, for example as a soluble monomer or multimer or immobilized on a solid support. For example, an antigen- presenting cell carrying HLA DQ0602 can be used, wherein the peptide forms a complex with the HLA DQ0602 on the surface of the antigen-presenting cell. Alternatively, artificial antigen- presenting cells (aAPCs) carrying HLA DQ0602 can be used to present peptides to T cells. Cell- based aAPCs can be used, which are derived from primary or transformed human, xenogeneic, or allogeneic cells that are engineered to express HLA DQ0602 at the cell surface, such cells are herein called an "engineered cell." Alternatively, synthetic acellular aAPCs can be used that contain HLA DQ602 attached to membranes of liposomes or micelles or immobilized on a solid support. Exemplary solid supports that can be used for attachment of HLA DQ602 include beads, slides, plates, gels, membranes, nylon, multi-well plates, tubes, microarray devices, flow cells, or micro-fluidic systems. See, e.g., Turtle et al. (2010) Cancer J. 16(4):374-381 ; Ye et al. (2011) J. Transl. Med. 9: 131; herein incorporated by reference in their entireties.

[000151] In certain embodiments, a HLA DQ0602 multimer comprising 2 or more HLA DQ0602 molecules is used to present narcolepsy-inducing peptides to T cells, wherein one or more peptides are bound to the HLA DQ0602 multimer. Multimeric forms of HLA DQ0602 that can be used include, but are not limited to dimers, trimers, tetramers, pentamers, hexamers, heptamers, octamers, decamers, dextramers and polymers. Multimerization of the HLA DQ0602 may occur on a scaffold associated with one or more HLA DQ0602-peptide complexes, or a carrier associated with one or more, preferably more than one, HLA DQ0602-peptide complex, or a carrier associated with a plurality of scaffolds each associated with one or more HLA DQ0602- peptide complexes, such as 2 HLA DQ0602-peptide complexes, 3 HLA DQ0602-peptide complexes, 4 HLA DQ0602-peptide complexes, 5 HLA DQ0602-peptide complexes, 6 HLA DQ0602-peptide complexes, 7 HLA DQ0602-peptide complexes, 8 HLA DQ0602-peptide complexes, or more than 8 HLA DQ0602-peptide complexes.

[000152] HLA DQ0602 complexes can be associated with a carrier and/or a scaffold either directly or indirectly through one or more binding entities. The association can be covalent or non-covalent. Multimerization may make use of antigen presenting cells or other cells, such as cells engineered to produce the HLA DQ0602 complex at the cell surface. Alternatively, micelles, liposomes, beads, or surfaces of, e.g., microtiter plates, tubes, slides, microarray devices, flow cells, or micro-fluidic systems may be used.

[000153] The HLA DQ0602-peptide complexes may be attached, covalently or non-covalently, to one or more multimerization domains, such as, but not limited to streptavidin, avidin, a dextran polymer, a self-assembling coiled-coil domain derived from an oligomer-forming coiled coil type protein (e.g., collagen, GCN4, cartilage oligomeric matrix protein, c-Fos, c-jun, myosin, tropomyosin, C-type lectins, Clq, p53, and bacteriophage P22 Mnt repressor), or any other self- assembling multimeric structure. Additionally, MHC complexes can be assembled on a scaffold, carrier, organic molecules, membranes, liposomes, micelles, polymers, polysaccharides, IgG domains, DNA duplexes, nucleic acid duplexes, PNA-PNA, PNA-DNA, DNA-RNA, antibodies, proteins, cells, cell-like structures, or a solid support.

[000154] Recombinant HLA DQ0602 molecules used for the production of monomeric or multimeric HLA DQ0602 reagents can be produced in either bacterial cells or eukaryotic cells, such as insect cells and mammalian cells. The HLA DQ0602 can be loaded with a narcolepsy- inducing peptide in various ways: Narcolepsy-inducing peptides can be added either during or after production of the HLA DQ0602 monomer or multimer. Alternatively, an antigenic peptide can be covalently linked to one of the HLA DQ0602 chains in a recombinant protein fusion construct.

[000155] The HLA DQ0602 molecules may be further conjugated to one or more detectable labels. Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means such as, but not limited to fluorophores, enzymes, radioisotopes,

chemiluminescent labels, dyes, bioluminescent labels, metal particles, magnetic beads, haptens, polymers, or antibodies.

[000156] For a discussion of various forms of MHC, including preparation of multimers, artificial antigen presenting cells, incorporation of antigenic peptides into MHC complexes, and the detection of target cells with such MHC complexes, see, e.g., Bakker and Schumacher (2005) Curr. Opin. Immunol. 17:428-433; Wooldridge et al. (2009) Immunology 126(2): 147-164; Nepom (2003) Clinical Immunology 106: 1-4; Ogg et al. (1999) AIDS 13: 1991-1993;

Luxembourg et al. (1998) Nat. Biotechnol. 16:281-285; Prakken et al. (2000) Nat. Med. 6: 1406- 1410; Mallet-Designe (2003) J. Immunol. 170: 123-131 ; Altman et al. (1996) Science 274:94-96; Turtle et al. (2010) Cancer J. 16(4):374-381 ; Ye et al. (2011) J. Transl. Med. 9:131 ; U.S. Patent Nos. 5,635,363 and 8,268,964; International Patent Applications WO 02/072631 and WO 99/42597; and U.S. Patent Application Publication Nos. 20100168390, 20050074848; and 2004209295; herein incorporated by reference in their entireties.

[000157] Any known method for evaluating T cell activation can be used to monitor the response of T cells to a narcolepsy-inducing antigen. Activation of T cells has an induction phase in which T cells proliferate and differentiate and an effector phase, in which T cells carryout their functions. Therefore, T cells that have responded to a specific displayed antigen can be detected by cell proliferation assays or assays of their effector function, such as assays detecting cytokine secretion or the effect of a T cell on appropriate target cells, for example, the ability of a CD4+ T cell to activate B cells or macrophages. [000158] For example, T cell activation may be detected with a cell proliferation assay.

Proliferating cells are commonly detected using radioactive thymidine incorporation. Increased DNA synthesis in proliferating cells results in uptake of the radioactive thymidine and the amount of radioactive thymidine used by cells is correlated with the level of cellular proliferation. Cells undergoing proliferation are also more metabolically active, which can be detected based on their increased level of dehydrogenase activity. The levels of NADH and NADPH can be measured by their ability to reduce yellow colored 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) to intracellular purple formazan. The resulting purple products can be solubilized and quantified spectrophotometrically. Alternatively, proliferating cells can be labeled with a fluorescent nucleic acid dye and detected by flow cytometry. See, e.g., Kruisbeek et al. (2004) Proliferative assays for T cell function. Curr. Protoc. Immunol., Chapter 3:Unit 3.12; Fulcher et al. (1999) Immunol. Cell Biol. 77(6):559-564; herein incorporated by reference in their entireties.

[000159] In another example, secretion of cytokines (or any other cell product of interest) by a T cell in response to activation may be detected by an enzyme-linked immunosorbent spot (ELISPOT) assay. Antibodies specific for a cytokine (or other cell secretory product) are immobilized on a polyvinylidene fluoride (PVDF) membrane coating a microplate well. Next, T cells, antigen, and antigen presenting cells are added to the well. The cytokine (or other cell product of interest) secreted by activated T cells is captured locally by the immobilized antibody in the well. The captured cytokine can then be detected, for example, with a labeled antibody that recognizes an epitope of the captured cytokine. Typically, ELISPOT assays are performed with a biotinylated antibody which binds specifically to the captured cytokine. The biotinylated antibody can then be detected with an avidin-conjugated enzyme, such as avidin-horseradish peroxidase or avidin-alkaline phosphatase using a substrate that produces a colored enzyme product. The Fluorospot assay is a variation of the ELISPOT assay that instead uses multiple fluorescently labeled antibodies against cytokines for detection of T cell activation. See, e.g., Czerkinsky et al. (1983) J. Immunol. Methods 65 (1-2): 109-121 ; Augustine et al. (2012) Clin. Chim. Acta. 413(17-18): 1359-1363; Anthony et al. (2012) Cells 1(2): 127-140; Ahlborg et al. (2012) Methods Mol. Biol. 792:77-85; Rebhahn et al. (2008) Comput. Methods Programs Biomed. 92(l):54-65; herein incorporated by reference in their entireties.

[000160] The cytokine or combination of cytokines chosen for detection depends on whether the T cell is a TH1 cell, a TH2 cell, or a Thl7 cell. For a TH1 cell, macrophage-activating effector molecules, including IFN-γ, GM-CSF, TNF-a, CD40 ligand, Fas ligand, as well as other TH1 secreted molecules, including but not limited to IL-3, TNF-β, and IL-2 may be detected to determine if a TH1 cell has been activated by a narcolepsy-inducing antigen. For a TH2 cell, B cell activating effector molecules, including IL-4, IL-5, CD40 ligand as well as other TH2 secreted molecules, including but not limited to IL-3, GM-CSF, IL-10, and TGF-β may be detected to determine if a TH2 cell has been activated by a narcolepsy-inducing antigen. For a Thl7 cell, IL-17 may be detected to determine if a Thl7 cell has been activated by a narcolepsy- inducing antigen.

[000161] In particular, these methods can be used to diagnose narcolepsy in a subject. In one embodiment, a subject suspected of having narcolepsy is diagnosed by obtaining an antigen- presenting cell carrying HLA DQ0602 and a T cell from the subject, contacting, in vitro or ex vivo, the antigen-presenting cell and the T cell with a narcolepsy-inducing peptide described herein; and detecting a T cell response, wherein activation of the T cell indicates that the subject has narcolepsy.

E. Detecting T cells binding Narcolepsy-Inducing antigens

[000162] In yet another aspect, T cells carrying the T-Cell receptor recognizing the HLA- DQ0602-narcolepsy associated peptide can be detected and quantified using labelled HLA- DQB0602-peptide multimers (typically tetramers) and Fluoresence activated cell sorting (FACS) (see Nepon (2012), J Immunol.188(6):2477-82 and Gojanovich et al. (2012), J Diabetes Sci Technol. 1 ;6(3):515-24). Example of tetramer sequences used are set forth in SEQ ID NOs: 50- 57. The method uses white blood cells of patients such as Peripheral Blood Mononuclear cells or CD4+ T cells and detects cells positive for the tetramer as a sign of narcolepsy. The DQB0602 labelled tetramers may be preloaded with the sequence of interest (e.g., SEQ ID NOS: l-3, 26, 37- 39, 43, and 45-47) linked with the linker or, if containing another sequence, loaded with peptides with SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47 thereafter using peptide exchange. The cells may also have been activated in the presence of the tetramer or the MHC-peptide T2-602 complex, resulting in the production of cytokines. These multimer/tetramer detected cells may also be characterized by the appearance of additional markers such as cytokines, e.g., IFN-γ, GM- CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β. The cytokine, intrcellular markers (FoxP3) or combination of cytokines or surface markers, for example CD38, CD62L, CD25, CD69, CD71, may be chosen for detection depending on whether the T cell is a TH1, TH2, a Thl7 or A Treg cell. F. Kits for Detecting T Cells Reactive to Narcolepsy-Inducing Antigens

[000163] In yet another aspect, the invention provides kits for detecting T cells that are activated by narcolepsy-inducing antigens. The kit may include at least one narcolepsy-inducing peptide described herein, a container for holding a biological sample isolated from a human subject suspected of having narcolepsy; and printed instructions for performing an immunoassay on the biological sample or a portion of the biological sample for detecting T cells that are activated by narcolepsy-inducing antigens in the biological sample. The kit may further comprise one or more antigen presenting cells, artificial antigen presenting cells, HLA DQ0602 (e.g., monomer or multimer), or reagents for performing an immunoassay, such as an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry.

[000164] The kit can comprise one or more containers for compositions contained in the kit. Compositions can be in liquid form or can be lyophilized. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. The kit can also comprise a package insert containing written instructions for methods of diagnosing narcolepsy.

[000165] In one embodiment, the kit comprises a narcolepsy-inducing peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: l -3, 26, 37-39, 43, and 45-47.

G. Pharmaceutical Compositions Comprising Therapeutic Antibodies

[000166] Therapeutic antibodies for treating or preventing narcolepsy (e.g., an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602 ) can be formulated into pharmaceutical compositions optionally comprising one or more pharmaceutically acceptable excipients. Exemplary excipients include, without limitation, carbohydrates, inorganic salts, antimicrobial agents, antioxidants, surfactants, buffers, acids, bases, and combinations thereof. Excipients suitable for injectable compositions include water, alcohols, polyols, glycerine, vegetable oils, phospholipids, and surfactants. A carbohydrate such as a sugar, a derivatized sugar such as an alditol, aldonic acid, an esterified sugar, and/or a sugar polymer may be present as an excipient. Specific carbohydrate excipients include, for example: monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol (glucitol), pyranosyl sorbitol, myoinositol, and the like. The excipient can also include an inorganic salt or buffer such as citric acid, sodium chloride, potassium chloride, sodium sulfate, potassium nitrate, sodium phosphate monobasic, sodium phosphate dibasic, and combinations thereof.

[000167] A composition of the invention can also include an antimicrobial agent for preventing or deterring microbial growth. Nonlimiting examples of antimicrobial agents suitable for the present invention include benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, thimersol, and combinations thereof.

[000168] An antioxidant can be present in the composition as well. Antioxidants are used to prevent oxidation, thereby preventing the deterioration of the therapeutic antibody, or other components of the preparation. Suitable antioxidants for use with therapeutic antibodies include, for example, ascorbyl palmitate, butylated

hydroxyanisole, butylated hydroxytoluene, hypophosphorous acid, monothioglycerol, propyl gallate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite, and combinations thereof.

[000169] A surfactant can be present as an excipient. Exemplary surfactants include: polysorbates, such as "Tween 20" and "Tween 80," and pluronics such as F68 and F88 (BASF, Mount Olive, New Jersey); sorbitan esters; lipids, such as phospholipids such as lecithin and other phosphatidylcholines, phosphatidylethanolamines (although preferably not in liposomal form), fatty acids and fatty esters; steroids, such as cholesterol; chelating agents, such as EDTA; and zinc and other such suitable cations.

[000170] Acids or bases can be present as an excipient in the composition. Nonlimiting examples of acids that can be used include those acids selected from the group consisting of hydrochloric acid, acetic acid, phosphoric acid, citric acid, malic acid, lactic acid, formic acid, trichloroacetic acid, nitric acid, perchloric acid, phosphoric acid, sulfuric acid, fumaric acid, and combinations thereof. Examples of suitable bases include, without limitation, bases selected from the group consisting of sodium hydroxide, sodium acetate, ammonium hydroxide, potassium hydroxide, ammonium acetate, potassium acetate, sodium phosphate, potassium phosphate, sodium citrate, sodium formate, sodium sulfate, potassium sulfate, potassium fumerate, and combinations thereof.

[000171] The amount of the therapeutic antibody (e.g., when contained in a drug delivery system) in the composition will vary depending on a number of factors, but will optimally be a therapeutically effective dose when the composition is in a unit dosage form or container (e.g., a vial). A therapeutically effective dose can be determined experimentally by repeated administration of increasing amounts of the composition in order to determine which amount produces a clinically desired endpoint.

[000172] The amount of any individual excipient in the composition will vary depending on the nature and function of the excipient and particular needs of the composition. Typically, the optimal amount of any individual excipient is determined through routine experimentation, i.e., by preparing compositions containing varying amounts of the excipient (ranging from low to high), examining the stability and other parameters, and then determining the range at which optimal performance is attained with no significant adverse effects. Generally, however, the excipient(s) will be present in the composition in an amount of about 1% to about 99% by weight, preferably from about 5% to about 98% by weight, more preferably from about 15 to about 95% by weight of the excipient, with concentrations less than 30% by weight most preferred. These foregoing pharmaceutical excipients along with other excipients are described in

"Remington: The Science & Practice of Pharmacy", 19th ed., Williams & Williams, (1995), the "Physician's Desk Reference", 52nd ed., Medical Economics, Montvale, NJ (1998), and Kibbe, A.H., Handbook of Pharmaceutical Excipients, 3rd Edition, American Pharmaceutical Association, Washington, D.C., 2000.

[000173] The compositions encompass all types of formulations and in particular those that are suited for injection, e.g., powders or lyophilates that can be reconstituted with a solvent prior to use, as well as ready for injection solutions or suspensions, dry insoluble compositions for combination with a vehicle prior to use, and emulsions and liquid concentrates for dilution prior to administration. Examples of suitable diluents for reconstituting solid compositions prior to injection include bacteriostatic water for injection, dextrose 5% in water, phosphate buffered saline, Ringer's solution, saline, sterile water, deionized water, and combinations thereof. With respect to liquid pharmaceutical compositions, solutions and suspensions are envisioned. Additional preferred compositions include those for oral, ocular, or localized delivery.

[000174] The pharmaceutical preparations herein can also be housed in a syringe, an implantation device, or the like, depending upon the intended mode of delivery and use. Preferably, the compositions comprising one or more therapeutic antibodies (e.g., antibodies that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or antibodies that specifically binds to HLA DQ0602) described herein are in unit dosage form, meaning an amount of a conjugate or composition of the invention appropriate for a single dose, in a premeasured or pre-packaged form.

[000175] The compositions herein may optionally include one or more additional agents, such as other drugs for treating narcolepsy, or other medications used to treat a subject for a condition or disease. Particularly preferred are compounded preparations including at least one therapeutic antibody (e.g., an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602) and one or more drugs for treating narcolepsy, such as methylphenidate, amphetamine, methamphetamine, modafmil, armodafinil, codeine, selegiline, atomoxetine, a non- stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate. Alternatively, such agents can be contained in a separate composition from the therapeutic antibody (e.g., an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602) and co-administered concurrently, before, or after the composition comprising a therapeutic antibody of the invention.

H. Administration

[000176] At least one therapeutically effective cycle of treatment with a therapeutic antibody (e.g., an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602) will be administered to a subject for treatment of narcolepsy. By "therapeutically effective cycle of treatment" is intended a cycle of treatment that when administered, brings about a positive therapeutic response with respect to treatment of an individual for narcolepsy. Of particular interest is a cycle of treatment with a therapeutic antibody that inhibits the autoimmune T cell response to hypocretin, including its various forms, such as preprohypo cretin, hypocretin- 1, and hypocretin-2. Additionally, a cycle of treatment may reduce or prevent destruction of neuronal cells producing hypocretin and loss of hypocretin from the brain of a subject. By "positive therapeutic response" is intended that the individual undergoing treatment according to the invention exhibits an improvement in one or more symptoms of narcolepsy, including such improvements as a reduction in sleepiness, cataplexy, or abnormal REM sleep.

[000177] In certain embodiments, multiple therapeutically effective doses of compositions comprising one or more therapeutic antibodies (e.g., antibodies that specifically bind to a T cell receptor reactive to narcolepsy-inducing peptides or antibodies that specifically bind to HLA DQ0602), and/or one or more other therapeutic agents, such as other drugs for treating narcolepsy, or other medications will be administered. The compositions of the present invention are typically, although not necessarily, administered orally, via injection (subcutaneously, intravenously, or intramuscularly), by infusion, or locally. Additional modes of administration are also contemplated, such as intracerebral, intraneural, intraspinal, intraparenchymatous, pulmonary, rectal, transdermal, transmucosal, intrathecal, pericardial, intra-arterial, intraocular, intraperitoneal, and so forth. In particular embodiments, compositions are administered into the brain or spinal cord of a subject.

[000178] The preparations according to the invention are also suitable for local treatment. In a particular embodiment, a composition of the invention is used for localized delivery of a therapeutic antibody, for example, for the treatment of narcolepsy. For example, compositions may be administered directly into a neuron or by stereotactic injection into the brain. The particular preparation and appropriate method of administration are chosen to target the site of hypocretin immune reaction.

[000179] In another embodiment, the pharmaceutical compositions comprising one or more therapeutic antibodies and/or other agents are administered prophylactically, e.g., to prevent the autoimmune reaction to hypocretin and development of narcolepsy. Such prophylactic uses will be of particular value for subjects who have detectable T cells reactive to narcolepsy-inducing antigens and/or a known genetic predisposition to developing narcolepsy, and/or who have been exposed to environmental triggers (e.g., Streptococcus pyogenes or influenza virus infection or vaccines).

[000180] The pharmaceutical preparation can be in the form of a liquid solution or suspension immediately prior to administration, but may also take another form such as a syrup, cream, ointment, tablet, capsule, powder, gel, matrix, suppository, or the like. The pharmaceutical compositions comprising one or more therapeutic antibodies and other agents may be administered using the same or different routes of administration in accordance with any medically acceptable method known in the art.

[000181] In another embodiment, the pharmaceutical compositions comprising one or more therapeutic antibodies and/or other agents are administered prophylactically, e.g., to prevent onset of narcolepsy. Such prophylactic uses will be of particular value for subjects with a genetic predisposition to narcolepsy, vaccine exposure to a narcolepsy- inducing antigen, or suffering from a sleep disorder.

[000182] In another embodiment of the invention, the pharmaceutical compositions comprising one or more therapeutic antibodies and/or other agents, are in a sustained- release formulation, or a formulation that is administered using a sustained-release device. Such devices are well known in the art, and include, for example, transdermal patches, and miniature implantable pumps that can provide for drug delivery over time in a continuous, steady-state fashion at a variety of doses to achieve a sustained-release effect with a non-sustained-release pharmaceutical composition.

[000183] The invention also provides a method for administering a conjugate comprising a therapeutic antibody as provided herein to a patient suffering from a condition that is responsive to treatment with a therapeutic antibody contained in the conjugate or composition. The method comprises administering, via any of the herein described modes, a therapeutically effective amount of the conjugate or drug delivery system, preferably provided as part of a pharmaceutical composition. The method of administering may be used to treat any condition that is responsive to treatment with a therapeutic antibody. More specifically, the compositions herein are effective in treating narcolepsy.

[000184] Those of ordinary skill in the art will appreciate which conditions a specific therapeutic antibody can effectively treat. The actual dose to be administered will vary depending upon the age, weight, and general condition of the subject as well as the severity of the condition being treated, the judgment of the health care professional, and conjugate being administered. Therapeutically effective amounts can be determined by those skilled in the art, and will be adjusted to the particular requirements of each particular case.

[000185] Generally, a therapeutically effective amount will range from about 0.1 mg to 5 grams of a therapeutic antibody daily, more preferably from about 5 mg to 2 grams daily, even more preferably from about 7 mg to 1.5 grams daily. Preferably, such doses are in the range of 10-600 mg four times a day (QID), 200-500 mg QID, 25 - 600 mg three times a day (TID), 25-50 mg TID, 50-100 mg TID, 50-200 mg TID, 300-600 mg TID, 200-400 mg TID, 200-600 mg TID, 100 to 700 mg twice daily (BID), 100-600 mg BID, 200-500 mg BID, or 200-300 mg BID. The amount of a therapeutic antibody administered will depend on the potency of the specific therapeutic antibody and the magnitude or effect on T cell inhibition desired and the route of administration.

[000186] A purified therapeutic antibody (again, preferably provided as part of a pharmaceutical preparation) can be administered alone or in combination with one or more other therapeutic agents, such as narcolepsy medications (e.g., methylphenidate, amphetamine, methamphetamine, modafmil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine reuptake inhibitor (NRI),

clomipramine, imipramine, protriptyline, venlafaxine, and Xyrem), or other medications used to treat a particular condition or disease according to a variety of dosing schedules depending on the judgment of the clinician, needs of the patient, and so forth. The specific dosing schedule will be known by those of ordinary skill in the art or can be determined experimentally using routine methods. Exemplary dosing schedules include, without limitation, administration five times a day, four times a day, three times a day, twice daily, once daily, three times weekly, twice weekly, once weekly, twice monthly, once monthly, and any combination thereof. Preferred compositions are those requiring dosing no more than once a day.

[000187] A therapeutic antibody can be administered prior to, concurrent with, or subsequent to other agents. If provided at the same time as other agents, one or more therapeutic antibodies can be provided in the same or in a different composition. Thus, one or more therapeutic antibodies and other agents can be presented to the individual by way of concurrent therapy. By "concurrent therapy" is intended administration to a subject such that the therapeutic effect of the combination of the substances is caused in the subject undergoing therapy. For example, concurrent therapy may be achieved by administering a dose of a pharmaceutical composition comprising a therapeutic antibody and a dose of a pharmaceutical composition comprising at least one other agent, such as another drug for treating narcolepsy, which in combination comprise a therapeutically effective dose, according to a particular dosing regimen. Similarly, one or more therapeutic antibodies and one or more other therapeutic agents can be administered in at least one therapeutic dose. Administration of the separate pharmaceutical compositions can be performed simultaneously or at different times (i.e., sequentially, in either order, on the same day, or on different days), as long as the therapeutic effect of the

combination of these substances is caused in the subject undergoing therapy.

I. Kits for Treating Narcolepsy

[000188] The invention also provides kits comprising one or more containers holding compositions comprising at least one therapeutic antibody (e.g., an antibody that specifically binds to a T cell receptor reactive to narcolepsy-inducing peptides or an antibody that specifically binds to HLA DQ0602), and optionally one or more other drugs for treating narcolepsy. Compositions can be in liquid form or can be lyophilized, as can individual antibodies. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. A container may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).

[000189] The kit can further comprise a second container comprising a

pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery devices. The delivery device may be pre-filled with the compositions.

[000190] The kit can also comprise a package insert containing written instructions for methods of treating narcolepsy. The package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.

1. An isolated peptide consisting of 9 to 25 amino acids comprising the sequence of SEQ ID NO:4, wherein the peptide induces a T cell immune response to human preprohypocretin, hypocretin-1, or hypocretin-2 when displayed in a complex with human leukocyte antigen (HLA) DQ0602.

2. The peptide of paragraph 1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

3. The peptide of paragraph 1, wherein the peptide is amidated at the C-terminus.

4. The peptide of paragraph 3, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

5. A composition comprising the isolated peptide of paragraph 1 and a

physiologically acceptable excipient.

6. The composition of paragraph 5, further comprising HLA DQ0602.

7. The composition of paragraph 6, further comprising an antigen-presenting cell carrying HLA DQ0602, wherein the peptide forms a complex with the HLA DQ0602 on the surface of the antigen-presenting cell.

8. The composition of paragraph 6, further comprising an artificial antigen- presenting cell (aAPC) carrying HLA DQ0602, wherein the peptide forms a complex with the HLA DQ0602 on the surface of the aAPC.

9. The composition of paragraph 8, wherein the aAPC comprises an engineered cell expressing DQ0602 at its cell surface, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the engineered cell.

10. The composition of paragraph 9, wherein the engineered cell is a T2 cell.

11. The composition of paragraph 9, wherein the aAPC comprises HLA DQ0602 attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

12. The composition of paragraph 6, comprising a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

13. The composition of paragraph 12, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer.

14. The composition of paragraph 6, further comprising a T-cell that can be activated by the complex of the peptide with HLA DQ0602.

15. A method for diagnosing narcolepsy in a subject, the method comprising: a) obtaining a T cell from the subject;

b) contacting the T cell with the isolated peptide of paragraph 1 displayed in a complex with HLA DQ0602; and

c) detecting a T cell response, wherein activation of the T cell indicates that the subject has narcolepsy.

16. The method of paragraph 15, wherein detecting the T cell response comprises performing an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry.

17. The method of paragraph 15, wherein secretion of a cytokine is detected by the ELISPOT assay.

18. The method of paragraph 17, wherein the cytokine is selected from the group consisting of IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β.

19. The method of paragraph 15, wherein the T cell is a TH1 cell, a TH2 cell, or a Thl7 cell.

20. The method of paragraph 15, wherein the peptide is selected from the group consisting of preprohypocretin, hypocretin-1, hypocretin-2, and an influenza HI peptide.

21. The method of paragraph 20, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

22. The method of paragraph 20, wherein the peptide is amidated at the C-terminus.

23. The peptide of paragraph 22, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

24. The method of paragraph 15, wherein the subject is a human being.

25. The method of paragraph 15, wherein the HLA DQ0602 is carried by an antigen presenting cell, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the antigen presenting cell.

26. The method of paragraph 15, wherein the HLA DQ0602 is carried by an artificial antigen-presenting cell (aAPC), wherein the peptide forms a complex with the HLA DQ0602 on the surface of the aAPC.

27. The method of paragraph 15, wherein the HLA DQ0602 is recombinant HLA DQ0602 expressed at the surface of an engineered cell, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the engineered cell.

28. The method of paragraph 27, wherein the engineered cell is a T2 cell. 29. The method of paragraph 15, wherein the HLA DQ0602 is attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

30. The method of paragraph 15, wherein the HLA DQ0602 is a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

31. The method of paragraph 30, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer.

32. A method for detecting a T cell that is activated by a narcolepsy-inducing peptide, the method comprising:

a) obtaining a biological sample comprising a T cell from a subject suspected of having narcolepsy;

b) contacting the biological sample with the isolated peptide of paragraph 1 displayed in a complex with HLA DQ0602; and

c) detecting a T cell response, wherein the T cell response indicates whether or not the T cell is activated by the narcolepsy-inducing peptide.

33. The method of paragraph 32, wherein the biological sample is blood.

34. The method of paragraph 32, wherein detecting the T cell response comprises performing an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry.

35. The method of paragraph 32, wherein secretion of a cytokine is detected by the ELISPOT assay.

36. The method of paragraph 35, wherein the cytokine is selected from the group consisting of IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β.

37. The method of paragraph 32, wherein the T cell is a TH1 cell, a TH2 cell, or a Thl7 cell.

38. The method of paragraph 32, wherein the peptide is selected from the group consisting of preprohypocretin, hypocretin-1, hypocretin-2, and an influenza HI peptide.

39. The method of paragraph 38, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: SEQ ID NOS: 1 -4, 26, 37-39, 43, and 45-47.

40. The method of paragraph 38, wherein the peptide is amidated at the C-terminus.

41. The peptide of paragraph 40, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47. 42. The method of paragraph 32, wherein the HLA DQ0602 is attached to the surface of an antigen presenting cell or an artificial antigen presenting cell.

43. The method of paragraph 32, wherein the HLA DQ0602 is attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

44. The method of paragraph 32, wherein the HLA DQ0602 is a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

45. The method of paragraph 44, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer..

46. A kit for detecting a T cell that is activated by a narcolepsy-inducing antigen, the kit comprising the peptide of paragraph 1.

47. The kit of paragraph 46, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

48. The kit of paragraph 46, wherein the peptide is amidated at the C-terminus.

49. The peptide of paragraph 48, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

50. The kit of paragraph 46, further comprising HLA DQ0602.

51. The kit of paragraph 50, comprising HLA DQ0602 attached to a solid support.

52. The kit of paragraph 50, comprising a HLA DQ0602 multimer.

53. The kit of paragraph 46, further comprising an antigen presenting cell.

54. The kit of paragraph 46, further comprising an artificial antigen presenting cell.

55. The kit of paragraph 46, further comprising one or more control reference samples.

56. The kit of paragraph 46, further comprising information, in electronic or paper form, comprising instructions for diagnosing narcolepsy in a subject.

57. The kit of paragraph 46, further comprising reagents for detecting a T cell response.

58. The kit of paragraph 57, comprising reagents for performing an ELISPOT assay, a T cell proliferation assay, or flow cytometry.

59. An isolated antibody that specifically binds to the peptide of paragraph 1.

60. The antibody of paragraph 59, wherein the antibody specifically binds to the peptide when it is displayed in a complex with HLA DQ0602.

61. The antibody of paragraph 60, wherein the HLA DQ0602 is attached to the surface of an antigen presenting cell or an artificial antigen presenting cell. 62. The antibody of paragraph 60, wherein a T cell receptor on the surface of a T cell is bound to the peptide.

63. The antibody of paragraph 59, wherein the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an Fv fragment, and an scFv fragment.

64. The antibody of paragraph 63, wherein the antibody is a humanized antibody.

65. The antibody of paragraph 59, wherein the antibody specifically binds to a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

66. The antibody of paragraph 59, further comprising a detectable label.

67. A polynucleotide encoding the peptide of paragraph 2.

68. A recombinant polynucleotide comprising the polynucleotide of paragraph 67 operably linked to a promoter.

69. A host cell comprising the recombinant polynucleotide of paragraph 68.

70. The host cell of paragraph 69, wherein the host cell secretes the peptide encoded by the recombinant polynucleotide.

71. The host cell of paragraph 69, further comprising HLA DQ0602 at the surface of the cell, wherein the peptide expressed by the recombinant polynucleotide forms a complex with the HLA DQ0602.

72. The host cell of paragraph 71, wherein the host cell is a T2 cell.

73. A method for producing a narcolepsy-inducing peptide, the method comprising the steps of:

a) culturing the host cell of paragraph 69 under conditions suitable for the expression of the peptide; and

b) recovering the peptide from the host cell culture.

74. A method for detecting a T cell that is activated by a narcolepsy-inducing peptide, the method comprising:

b) contacting the biological sample with the host cell of paragraph 71, wherein the narcolepsy-inducing peptide is displayed in a complex with HLA DQ0602; and

c) detecting a T cell response, wherein the T cell response indicates whether or not the T cell is activated by the narcolepsy-inducing peptide. 75. An isolated T cell receptor or a fragment thereof that specifically binds to a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37- 39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602.

76. An isolated antibody that specifically binds to the T cell receptor of paragraph

75.

77. The antibody of paragraph 76, wherein the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an Fv fragment, and an scFv fragment.

78. The antibody of paragraph 77, wherein the antibody is a humanized antibody.

79. A method of treating a subject for narcolepsy with the antibody of paragraph 76, the method comprising administering to the subject a therapeutically effective amount of the antibody, such that the antibody blocks binding of T cell receptors to narcolepsy-inducing peptides displayed in a complexes with HLA DQ0602 on the surfaces of antigen presenting cells in the subject.

80. The method of paragraph 79, wherein the antibody is administered

prophylactically.

81. The method of paragraph 79, wherein the antibody is a humanized antibody.

82. The method of paragraph 79, further comprising treating the subject with one or more narcolepsy drugs.

83. The method of paragraph 82, wherein one or more narcolepsy drugs are selected from the group consisting of methylphenidate, amphetamine, methamphetamine, modafinil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate.

84. A method of inhibiting a T cell immune response to hypocretin, the method comprising:

a) obtaining a biological sample comprising a T cell that is normally activated by a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37- 39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602 on the surface of an antigen presenting cell; and

b) contacting the biological sample with the antibody of paragraph 76, such that the antibody binds to a T cell receptor on the surface of the T cell and blocks an antigen binding site of the T cell receptor, whereby the T cell is no longer activated by the peptide. 85. A method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of an antibody that specifically binds to HLA DQ0602.

86. The method of paragraph 85, wherein the antibody is administered

prophylactically.

87. The method of paragraph 85, wherein the antibody is a humanized antibody.

88. The method of paragraph 85, further comprising treating the subject with one or more narcolepsy drugs.

89. The method of paragraph 88, wherein one or more narcolepsy drugs are selected from the group consisting of methylphenidate, amphetamine, methamphetamine, modafinil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate.

90. A method for treating a subject with a genetic predisposition to developing narcolepsy, the method comprising:

a) obtaining a biological sample comprising a T cell from the subject;

b) and treating the subject with an immunosuppressive agent if the T cell is activated by the narcolepsy inducing peptide of paragraph 1.

91. The method of paragraph 90, wherein the biological sample is blood.

92. An assay for diagnosing narcolepsy comprising the steps of

a. contacting a white blood cell obtained from a subject with an artificial antigen presentin cell, wherein the artificial antigen presenting cell is deficient for all HLAs and further engineered to express human leucocyte antigen DQ0602;

b. detecting cytokine expression of the white blood cells, wherein detection of cytokine expression indicates that the subject has Type I narcolepsy.

93. The assay of paragraph 92, wherein the cytokine is selected from interferon gamma, interleukin-2, interleukin-17 and tumor necrosis factor alpha.

94. The assay of paragraph 92, wherein the detecting is performed using an ELISPOT assay.

95. The assay of paragraph 92 further comprising a step of administering to the subject a Type I narcoplepsy treatment when cytokine expression is detected. III. Experimental

[000191] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

[000192] Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

Example 1

T Cell Marker for Narcolepsy Diagnosis, Prevention, and Treatment

[000193] Narcolepsy is caused by the loss of neurons producing the wake -promoting neuropeptide hypocretin. Almost all cases carry Human Leukocyte Antigen (HLA)- DQA1 *01 :02/DQB1 *06:02(DQ0602). In 2010, the incidence of narcolepsy in children increased in Northern Europe, following AS03-adjuvanted 2009 H1N1 pandemic (pHlNl) influenza A vaccinations (Pandemrix), and in China, following the pHlNl pandemic. We report on DQ0602-binding hypocretin epitopes, HCRT56-68 and

HCRT87-99 that stimulate CD4+ T cells from narcoleptic subjects, including children with postPandemrix disease, but not from DQ0602-positive controls. Administration of a nonadjuvanted seasonal influenza vaccine (containing pHlNl) to narcoleptic patients increased the frequency of hypocretin epitope-reactive CD4+ T cells. In vitro stimulation of CD4+ T cells with Pandemrix antigens or a pHA1275-287 peptide with homology to hypocretin epitopes increased the frequency of hypocretin-reactive cells in narcolepsy, but not control cultures. Molecular mimicry between hypocretin and H1N1 , notably pHA1275-287, is a key factor in recent associations of narcolepsy with pHlNl vaccination and infection.

Material and methods

Human subjects

[000194] Patients with narcolepsy all had cataplexy and were DQB1 *06:02 positive, as documented by sequence specific primers (Longstreth et al. (2007) Sleep 30(1): 13-26) and follow up full HLA-DQ typing studies. DQB1 *06:02 controls were unrelated subjects in most cases, healthy twin for twin pairs and vaccinated siblings for Pandemrix probands. To collect peripheral blood mononuclear cells (PBMCs), three procedures were used, depending on the donor and situation (i) a simple blood draw; (ii) a blood donation (250 ml at the Stanford Blood Bank), (iii) pheresis (Stanford Blood Bank). Written consent was obtained in all cases in the context of an Institutional Review Board approved study, following guidelines for human subjects research under United States HHS human subjects regulations (45 CFR Part 46).

CD4⁺ T cell isolation

[000195] When extracted from fresh blood, PBMCs were prepared by washing once in medium containing RPMI-1640 (Sigma- Aldrich R8758) supplemented with 10% FBS and 1% PenStrep (100 U/mL Penicillin and 100 μg/mL Streptomycin). Samples were subsequently frozen in freezing media (medium plus DMSO) and stored in liquid nitrogen until needed. CD4+ T cells were isolated from PBMCs cells by negative selection using an "untouched" CD4+ cell isolation kit according to the manufacturer's instructions (1 1346D, Invitrogen). Purified CD4+ T cells were > 98% pure as assessed by FACS (not shown).

Generation of T2.DQ6 cell line

[000196] The a chain of DQ602 (DQAl *01 :02) was amplified by PCR from human cDNA made from PBMC of an HLA-DQA1 *01 :02 homozygote donor. The primers were:

[000197] 5 '-CGGGATCCATGATCCTAAACAAAGCTCTGCTGCTGGG-3 ' (SEQ ID NO:5) and

[000198] 5*-ACGCGTCGACTCACAATGGCCCTTGGTGTCTGGA-3* (SEQ ID NO:6). Restriction sites for BamHI and Sail are underlined. The□ D chain of DQ6 (DQB1 *06:02) was amplified by PCR from the bicistronic pLNCXPOX vector containing DQ6 cDNA (a kind gift from Dr. William Kwok from Benaroya Research Institute, Seattle, WA). The primers were: 5 '-

CCGGAATTCATGTCTTGGAAGAAGGCTT-3 ' (SEQ ID NO:7) and

[000199] 5'-ACGCGTCGACTCAGTGCAGAAGCCCTTT-3 ' (SEQ ID NO:8).

Restriction sites of EcoRI and Sail are underlined. Both chains were digested with restriction enzymes indicated above and then ligated into the retroviral vector, PBMN- ZINneo, which was cut with the same enzymes. Plasmids containing DQAl *01 :02 band DQB1 *06:02 cDNA, respectively, were sequentially introduced into T2 cells, a human T- B hybrid cell line (Juji et al. (1984) Tissue Antigens 24(5):316-319) using the Phoenix Retroviral System, as described (Doebele RC, Busch R, Scott HM, Pashine A, Mellins ED. Determination of the HLA-DM interaction site on HLA-DR molecules. Immunity. 2000 Oct;13(4):517-27.

[000200] PubMed PMID: 11070170.). Cells expressing the DQ6 dimer on the surface were enriched using PE-conjugated anti-DQ antibodies (Ia3, BD bioscience) and anti-PE MACS microbeads (Miltenyibiotec).

ELISPOT assay

[000201] CD4+ T cells (100,000 cells/well) and T2-DQ6 cells (100,000 cells/well) were added to the ELISPOT 96-well plate coated with the IFN-y-specific antibody (551849 BD Biosciences) in the presence of 1 μΜ of the indicated peptide (200 μΐ volume per well). After 24 hours of stimulation in an incubator (37°C, 5% C02, 92% RH), the cell suspension was aspirated and collected for further experiments (surface marker staining). Further antibody incubations and development of the ELISPOT plate were done according to the manufacturer's instructions (551849 BD Biosciences). Spots were counted with a fully automated computer-assisted CTL ELISPOT reader using the ImmunoSpot 4.0.17 software.

HLA-DQB0602 and HLA-DM production and isolation

[000202] For production of MHC-DQA1 *01 :02/DQB 1 *06: 02 (DQ0602) with β-chain N-terminally tethered thrombin-cleavable Class Il-associated invariant chain peptide (CLIP), we subcloned the gene sequences into a pAcGP67A Baculovirus transfer vector based construct. As template, we used cDNA from human PBMCs from an HLA- DQ A 1 * 01 : 02/DQB 1 * 06 : 02 homozygote donor. The primers for DQ A 1 * 01 : 02 were : 5 '-GAGGATCCGAAGGCATTGTGGCTGACCACG-3 ' (SEQ ID NO:9) and

5 ' -GATCT AGACTCTGTGAGCTCTGAC AT AGGGG-3 ' (SEQ ID NO: 10).

[000203] The primers for DQB 1 *06:02 were: 5'-

AGGTGGGTCCAGAGACTCTCCCGAGGATTT-3' (SEQ ID NO: 11) and 5'- CCTCTAGATTCAGACTGAGCCCGCCACTC-3' (SEQ ID NO: 12).

[000204] The tethered thrombin-cleavable CLIP sequence PVSKMRMATPLLMQA (SEQ ID NO: 13) was added at the N-terminal end of DQB by PCR stitching. For this we used the primers 5'-GAGGATCCCGTGTCCAAGATGC-3' (SEQ ID NO: 14) and 5'- CCTCTAGATTCAGACTGAGCCCGCCACTC-3' (SEQ ID NO: 15) and the CLIP oligo: 5'-

GAGGATCCCGTGTCCAAGATGCGCATGGCCACCCCCCTGCTGATGCAGGCCG GGAATTCGGGCGGTGGCTCACTAGTGCCACGGGGCTCTGGAGGAGGTGGGTC CAGAGACTCTCCC-3' (SEQ ID NO: 16).

[000205] Both DQA and DQB constructs contained the gp76 secretion signal, extracellular sequences of the respective DQ chain, an acid (DQA)-base (DQB) zipper region, a 6xhis tag on both chains and the DQA construct included a C-terminal birA site. For production of HLA-DM, a similar approach was used with sequences of HLA-DMA and DMB derived from the same cDNA source as the DQ genes. The DM construct contained the same additions as described above, except the CLIP and thrombin sequences. The primers used for HLA-DNA included: 5'- GAGGATCCTGAAGCTCCTACTCC AATGTGG-3 ' (SEQ ID NO: 17) and

5 ' -GATCT AGAATTCTCC AGC AGATCTGAGGGC AG-3 ' (SEQ ID NO: 18); and the primers used for HLA-DMB included: 5'-

GAGGATCCCACAGGAGCAGGTGGCTTCGTG-3' (SEQ ID NO: 19) and

5 ' -CCTCTAGAGGGGGACAGCCC AGGTGTCC A-3 ' (SEQ ID NO:20).

[000206] The vectors were co-transfected with BaculoGold (BD biosciences) into SF9 cells using Cellfectin II (Invitrogen). Briefly, the cells were incubated with the transfection mixture for 3 hours at 27°C. The transfection mixture was then replaced with SF9 complete media, and the cells were incubated at 27°C for 1 week. Following this, the supernatants containing virus were harvested and amplified. The resulting PI virus stock was stored at 4°C and used for protein production. For this PI virus was added to Hi5 cells and the cells were incubated for 5 days at 27°C. Supernatant from the infected Hi5cells were harvested and buffer (50 mM Tris-HCl, pH 8, 5 mM Calcium chloride and 1 mM Ni-sulfate) added (while stirring). The resulting mixture was spun and filtered; azide 0.01% and imidazole 5 mM added. A column was prepared using Ni- NTA Agarose (Qiagen) and Ni-sulfate and washed with HBS (20 mM HEPES pH 7.4, 150 mM NaCl) with 5 mM imidazole. The protein preparation was run through column, washed with HBS + 5 mM imidazole, and finally eluted using 300 mM imidazole in HBS. The eluate was further purified by S200 size-exclusion fast protein liquid chromatography, and finally stored in PBS with 50% glycerol at -20°C.

Peptide binding assay

[000207] Two slightly different protocols were used, but data were merged, as results were essentially identical. In the first protocol, 250 nM DQ6-CLIP cleaved overnight at room temperature (RT) was used. It was incubated overnight at 37°C with 200 nM HLA- DM, 25 μΜ biotinylated reference indicator peptide, EBV490-503 (biotin- GGGRALLARSHVERTTDEY, SEQ ID NO:21) (Demachi-Okamura et al. (2008) Cancer Science 99(8): 1633-1642), 40 mM citrate buffer (pH 5.2) and at different μΜ concentrations of competing peptide, as applicable (30-100 μΜ). In the second protocol, we used 30 nM DQ6-CLIP cleaved for 2 hours at room temperature in the presence of PMSF, incubated 4-21 hours at pH 4.6 with 100 nM HLA-DM, 1 μΜ biotinylated EBV490-503. A 96-well plate (Maxisorp, Nunc) was coated overnight at room temperature with anti-human-class II antibody (BD biosciences #555557) or, in the second protocol, with anti-DQ mAB, SPVL3 at room temperature for 2 hours (Scammell (2006) Sleep 29(5):601 -602; herein incorporated by reference). After washing (0.05% Tween-20, 0.1% NaN3 in PBS) the plates were blocked with 10% FBS or 2% BSA in PBS 2 hours at room temperature and washed again. The peptide exchange reaction was stopped by adding 1 volume 100 mM HEPES pH 7.4, with 10%> FBS or 2 volumes of neutralization buffer (100 mM Tris-CL, pH 8.3, 150 mM NaCl, 1% (w/v) BSA, 0.5% (v/v) NP40, 0.1%) (w/v) NaN3) to the protein-peptide mixture, and the mixture was transferred to the washed antibody-coated Nunc plate and incubated for 2 hours at room temperature. For detection of biotinylated peptide bound by the MHC protein, we used the DELFIA Eu-Nl Streptavidin system (PerkinElmer).

DQ0602 epitope identification

[000208] Screening for possible DQ6 binding peptides was performed with peptide libraries consisting of 15 amino acids (15-mer) with 1 1 overlapping. The

preprohypocretin library was purchased from JPT Peptides Technologies GmbH. The influenza peptide libraries (hemagglutinin, neuramidase, and polymerase PB1 proteins from HlNl/California/07/2009) were from BEI Resources (NIAID, NIH). HA and NA were screened in pools of 8 consecutive peptides. Pools that gave > 25% displacement of the reference peptide signal were divided into 2 pools of 4 consecutive peptides and screened again. Finally, all peptides from the 4-peptide pools with displacement exceeding 25% of the reference peptide signal were screened separately. For

preprohypocretin and PB1, we did not screen pools, but instead screened all individual peptides independently. All experiments were done in duplicate and replicated in three independent setups. The concentration of peptide was 400 μΜ in all screens. For further analysis, peptides that displaced > 75% of the reference peptide signal were considered strong binders and peptides displacing 50-75%) of the signal were considered weak binders. More detailed analysis of peptide binding was performed on selected peptides using concentrations ranging from 0.01 μΜ - 1 mM.

Peptide binding register and motif analysis

[000209] To determine the register of binding of identified DQ0602 epitopes, the binding of 13-mer peptide variants with single amino acid substitutions was measured using the binding assay, as described above. Selected amino acids were tested at each position across the 13-mer. Assays were done with 2-3 replicates and 2-3 independent repeats. Lack of binding of the test peptide, as indicated by binding of the reference peptide, was interpreted to indicate lack of tolerance to the substitution in the test peptide.

Database searches for epitopes

[000210] To identify possible mimics of HCRT56-68 and HCRT87-99, we used the entire library of 101 influenza peptides binding DQ0602 (Figure 4) and bioinformatics to identify the best possible 9-mer epitope of the 15-mer sequences using 3 Immune Epitope Database (IEDB) prediction algorithms (SMM align, N align and consensus) and similarity scores. The resulting registers (PI, 3, 4, 6 and 9) were next used to assess conservation of predicted TCR binding residues at P 5 (G), P7 (L or I), P8 (T, L,I, V, M) for all these peptides (critical residues in HCRT56-68 and HCRT87-99 for the activation of narcolepsy specific T cells) and ranked by conservation of the number and homology of residues with the HCRT56-68 and HCRT87-99 epitopes at these positions. This method correctly identified HCRT56-68 and HCRT87-99 epitopes as perfect matches at P5, 7 and 8 when the 20 preprohypocretin binders were analyzed. Using the 101 influenza binders, the program identified pHA1273-287 (match at P5, 7 and 8), followed by pNA1253-267 and pHA1549-563 (match at P5 and 7) within the strong binders, and pNA121-35 and pPBl 157-171 (match at P5 and 7) as weak or non-binders. For identifying epitopes similar to pHA1275-283, we used the Influenza Research Database (fludb.org) search tool for identifying short peptides in proteins, using ERNAGSGIIISD (SEQ ID NO:22) as input, fuzzy matching with a cut of value of 50% identity and the search was performed against all hemaglutinin proteins in the database. Finally, to identify if other possible influenza A strains before 2009 also contain potential mimics to HCRT56-68 and HCRT87-99, the same bioinformatic rules were applied to the entire Influenza Research Database, identifying new candidates with their frequency. This analysis identified 9 potential epitopes in a region of N2 segment 6, including a very frequent H3N2 epitope INSTIGNLIA (SEQ ID NO:23) (count 6192), and a moderately rare HI segment 4 variant of prior H1N1 strains NSGSGIIS (SEQ ID NO:24) (count: 355).

Stimulation and culture of peripheral blood mononuclear cells (PBMCs)

[000211] PBMC were thawed in 15 mL RPMI-1640 +10% FBS with 1% PenStrep (100 U/mL Penicillin and 100 μg/mL Streptomycin), washed twice, counted and suspended at a density of 2 l06/ml in RPMI-1640 with 10% FBS medium, IL2 (10 U/mL, BD

Pharmingen) and IL-7 (20 ng/niL, PeproTech). Aliquots of 100 μΐ (200,000 cells) were re-suspended in individual wells of 96 well round bottom plates. For stimulation, we added HCRT56-68 and HCRT87-99 or pHA1275-283 or the bulk Belgium vaccine antigen of the 2009 Pandemrix (AFLSIDA109, no adjuvant, mostly containing pHAl , minimal amounts of pNAl , pPBl and minimal amounts of matrix proteins from the PR8 strain, as characterized by Mass Spectrometric analysis) at final concentrations of 1 □ g/ml. Medium only was added as a negative control. Following stimulation or media, cells were incubated at 37°C, 5% C02 for 7 days. At day 7 and 1 1 , all cultures were split in half and fresh medium, peptide and IL-2, IL-7 (concentration as above) added. Day 13, cells were collected, counted, and CD4+ T cells were isolated using Dynabeads Untouched Human CD4 T cells (Invitrogen). The resulting CD4+ cells were allowed to rest overnight in media without peptide prior to ELISPOT.

Tetramer construction and use for detection of narcolepsy specific T cells [000212] DQ0602 tetramers were constructed by standard doing procedures to a tether a peptide to the N-terminal end of the DQ0602 β chain, using a linker containing an internal thrombin cleavage site. Clones were provided as purified plasmids to the NIH tetramer facility for tetramer construction (http://tetramer.yerkes.emory.edu/). Staining of CD4 T cells was carried out as described for figure 8.

Sequences of epitopes used

[000213] Epstein Barr Virus: EBV490-503 (15MER) RALLARSHVERTTDE (SEQ ID NO:25, Chain A, Epstein Barr Virus Nuclear Antigen- 1 Residues 470-607)

[000214] 2009 Pandemic Influenza: pHA1275-287 ERNAGSGIIISDT (SEQ ID NO:26, Hemagglutinin HAl , segment 4, Influenza A Virus A/California/07/2009, HlNl):

pHA1273-287 (15MER) AMERNAGSGIIISDT (SEQ ID NO:27, Hemagglutinin HAl , segment 4, Influenza A Virus A/California/07/2009, HlNl) pNA1253-267 (15MER) YKIFRIEKGKIVKSV (SEQ ID NO:28, Neuraminidase NA1 , segment 6, Influenza A Virus A/California/07/2009, HlNl)

[000215] pHA1549-563 (15MER) AISFWMCSNGSLQCR (SEQ ID NO:29,

Hemagglutinin HAl , segment 4, Influenza A Virus A/California/07/2009, HlNl) pNA121-35 (15MER) NLILQIGNIISIWIS (SEQ ID NO:30, Neuraminidase NA1 , segment 6, Influenza A Virus A/California/07/2009, HlNl) pPBl 157-171 (15MER) ANESGRLIDFLKDVM (SEQ ID NO:31 , PB1 Polymerase (basic) protein 1 , segment 2, Influenza A Virus A/California/07/2009, HlNl)

[000216] Other Influenza strains:

[000217] HA1274-285 MKRNSGSGIIIS (SEQ ID NO:32, Hemagglutinin HAl , segment 4, Influenza A Virus A/Wisconsin/10/1998; HAl swine virus transmitted to human): HA1273-284 LSRGFGSGlllS (SEQ ID NO:33, Hemagglutinin HAl , segment 4, Influenza A Virus A/New York/490/2003 HlNl)

[000218] HA1273-284 LSRGFGSGIITS (SEQ ID NO:34, Hemagglutinin HAl , segment 4, Influenza Virus AJ Puerto Rico/8/1934, HlNl also known as PR8 backbone of influenza vaccines)

[000219] HA1274-285 LNRGSGSGIITS (SEQ ID NO:35, Hemagglutinin HAl , segment 4, Influenza Virus A/Brevig Mission/1/1918, pandemic HlNl from 1918)

[000220] Hypocretin (orexin) epitopes [000221] HCRTl-13 MNLPSTKVSWAAV (SEQ ID NO:36, Hypocretin, leader peptide, Homo sapiens) HCRT56-68 AGNHAAGILTLGK (SEQ ID NO: l, Hypocretin, area processed as C-terminal end of hypocretin- 1, Homo sapiens)

[000222] HCRT53-67 (15MER) LHGAGNHAAGILTLG (SEQ ID NO:37, Hypocretin, area processed as C-terminal end of hypocretin- 1, Homo sapiens)

[000223] HCRT87-99 SGNHAAGILTMGR (SEQ ID NO:38, Hypocretin, area processed as C-terminal end of hypocretin-2, Homo sapiens)

[000224] HCRT85-99 (15MER) Q AS GNH AAGILTMGR (SEQ ID NO:39, Hypocretin, area processed as C-terminal end of hypocretin-2, Homo sapiens)

[000225] HCRT25-39 (15MER) ALLSSGAAAQPLPDC (SEQ ID NO:40, Hypocretin, Homo sapiens) HCRT113-127 (15MER) RRCSAPAAASVAPGG (SEQ ID NO:41, Hypocretin, Homo sapiens)

Statistics

[000226] Data are reported as mean ±SEM or %. To compare ELIPOT numbers across conditions, we used either paired or unpaired t test, or, when variance significantly differed, Mann- Whitney- Wilcoxon U tests or Wilcoxon's signed ranked non-parametric paired tests. To assess the best ELISPOT numbers diagnostic cut offs, we used Receiver Operating Characteristics (ROC) analyses

(stanford.edu/~hyatt4/software/softroc/software_softroc.html), and 100 bootstrap iterations to define 95% confidence intervals. To study the effects of onset time (pre versus post 2009), sample collection period (pre versus post 2009), or disease duration on ELISPOT numbers, linear regression models were used in narcolepsy subjects with these variables added as categorical or continuous covariates. Tests are two-tailed, except for the expected directional effects of H1N1 antigen administration on CD4+ reactivity to pHA1275-283, HCRT56-68 or HCRT87-99 in vivo and in vitro. Significance is reported when p < 0.05.

Results

[000227] Figures 1A-1B show characterization of DQ0602-binding register and TCR contacts in narcolepsy-related hypocretin epitopes. Figure 1 A shows a schematics of the effects of various single amino acid substitutions on TCR recognition (top graphics) and DQ0602-binding (bottom graphics). Shown are anchor residues for HCRT56-68 and HCRT87-99 binding to DQ0602 (PI, P3, P4, P6, P9) and residues involved in subsequent TCR activation (P2, P5, P7, P8) and associated effects of various substitutions (details in Fig. 9). TCR data reflect assays of cells from 5 patients. Figure IB shows inhibition of DQ0602-binding of EBV490-503 by HCRT56-68 and HCRT87-99, including epitopes with N-amidated C-terminal end (from secreted hypocretin-1 and 2). IC50s range from 1 to 10 μΜ.

[000228] Figures 2A-2C show that hypocretin peptides (HCRT56-68 and HCRT87-99) activate CD4+ T-cells in narcoleptic patients but not in healthy controls. Hypocretin peptides and EBV490-503 were presented by T2.DQ0602 cells to purified CD4+ T-cells and responding cells detected by IFN-γ ELISpot. Right panels display representative ELISpot images with SFU counts. Figure 2 A shows ELISpot results (and median) from 24 hour in vitro stimulation of purified CD4+ T-cells (105 per well) from narcoleptic patients (n=23) and matched DQBl *06:02-positive controls (n=24). Logarithmic scale. Figrue 2B shows ELISpot results from 4 discordant monozygotic twin pairs (pairs marked with lines). Figure 2C shows ELISpot results from Irish children who developed narcolepsy following Pandemrix vaccination (n=10) compared to vaccinated but healthy siblings (n=7). ***P<0.001.

[000229] Figures 3A-3B show in vivo and in vitro stimulation of CD4+ T-cells from narcolepsy patients with pHlNl vaccine antigens activates HCRT56-68 and HCRT87- 99-reactive cells. CD4+ T-cell reactivity was tested by ELISpot before and after vaccination of patients and controls or after in vitro stimulation of PBMC with vaccine antigens. Figure 3A shows ELISpot results from DQ0602-positive controls (n=4) and narcoleptic patients (n=7) before and 5-9 days after non-adjuvanted influenza trivalent vaccination containing pHlNl (SFU/105 CD4+ T-cells, logarithmic scale). Figrue 3B shows ELISpot results from in vitro cross-culture stimulations. Individual results from control (n=3-5) and narcolepsy (n=13-14) samples. PBMC were cultured with pHlNl split vaccine antigen for 13 days and CD4+ T-cells were purified, rested and re- stimulated with HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. See Fig. S8 for representative ELISpot images. *P<0.05, **P<0.01, ***P<0.001.

[000230] Figures 4A-4F show molecular mimicry between pHlNl epitope pHA1275- 287 and HCRT56-68/HCRT87-99, and activation of hypocretin-reactive CD4+ T-cells by pHA1275-287. Our experiments identified pHA1275-287, an epitope unique to pHAl, as a possible mimic of HCRT56-68 and HCRT87-99. Figreu 4A shows alignment of HCRT56-68, HCRT87-99, and pHA1275-287 with sequences from other seasonal and pandemic flu strains. Single amino acid substitution scans of pHA1275-287 (Fig. 9) established the binding register depicted here. Figeru 4B shows inhibition of DQ0602- binding of EBV490-503 by HAl epitopes. IC50 for pHA1275-287 (and for homologous peptide from HAl 1998) is 0.5 μΜ. All other epitopes have 10-100 fold lower affinity for DQ0602. Figure 4C shows ELISpot results from epitope cross cultures. Individual results from control (n=3-5) and narcolepsy (n=13-14) samples. PBMC were cultured with pHA1275-287 for 13 days and CD4+ T-cells were purified, rested and restimulated with HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. Figure 4D-4F show cross-culture stimulation experiments using T2.DQ0602 presentation of hypocretin, pHAl, or EBV epitopes (24 hr) to purified CD4+ T-cells, isolation of CD38+ (activated) CD4+ T-cells, and subsequent ELISpot testing for reactivity to the same epitopes. See Fig. S8 for representative ELISpot images. *P<0.05, **P<0.01, ***P<0.001

[000231] Figures 5A-5D show binding of HCRT and pHlNl peptides to DQ0602. Figure 5 A shows that overlapping 15-mer peptides (11 amino acid overlap) covering the entire prepro-hypocretin protein were screened for their ability to compete with EBV490- 503 for DQ0602 binding in vitro. Figures5B-5D show using the same assay, overlapping 15-mer peptides covering the entire pHAl, pNAl, and pPBl proteins present in

A/California/7/2009 (pHlNl) were screened for their ability to displace EBV490-503 from DQ0602 in vitro. Binding was described based on the percentage of reference peptide (EBV490-503) out-competed; >75% decrease in signal is considered good binding, 50-75% moderate binding, and <50% poor binding. Note that in a few cases, signal increased in the presence of the competing peptide, indicating "peptide push off. All experiments were performed three times using technical duplicates.

[000232] Figures 6A-6B show representative examples of IFN-D and TNF-a ELISpot results with DQ0602 binders. Figure 6A shows CD4+ T-cell IFN-γ responses to peptides binding strongly to DQ0602 in cells from narcolepsy patients and control subjects. Top: ELISpot results (and median) from 24 hour in vitro stimulation of purified CD4+ T-cells (105 per well) from narcoleptic patients and DQBl *06:02-positive controls. HCRT leader sequence (HCRTl-13), and peptides HCRT25-39, HCRT41-55, and HCRT113- 127 were tested in 5 patients and 5 control subjects. Peptides HCRT53-67 and HCRT85- 99 were tested in 7 patients and 7 controls. Bottom: Representative ELISpot images with Spot Forming Units (SFU) counts for each peptide. Figure 6B shows HCRT peptides and EBV490-503 that were presented using T2.DQ0602 cells and responding CD4+ T-cells from 4 narcoleptic patients and 2 healthy controls were detected by TNF-a ELISpot by counting spot- forming units (SFUs). Right panel displays representative ELISpot images.

[000233] Figures 7A-7E show T-cell response to HCRT epitopes with different antigen presenting cells. Figure 7A shows IFN-γ ELISpot data from stimulations of 7 patient samples vs. 7 control samples with HCRT56-68 and HCRT87-99 peptides added to either total PBMCs (containing both CD4+ T-cells, CD8+ T-cells and autologous antigen presenting cells), autologous dendritic cells (DCs) with purified CD4+ T-cells, or T2.DQ0602 cells with purified CD4+ T-cells. Shown is number of Spot Forming Units (SFU) per 105 T-cells. *P<0.05, **P<0.01. Figure 7B-7E show correlations of results obtained with the different T-cell stimulation paradigms as performed on the same samples. Samples from 7 patients and 7 controls were used.

[000234] Figures 8A-8B show receiving operating characteristics (ROC) curves for ELISpot data. Using receiving operating characteristics curve analysis, a statistical method to optimize sensitivity and specificity, we found that a cut off for HCRT56-68 > 5 (Figure 8A) and HCRT87-99 >1 (Figure 8B) Spot Forming Units (SFU) per 105 CD4+ T-cells, had sensitivities of 0.83 [0.67-1.0] and 0.92 [0.78-1.0] and specificities of 0.96 [0.88-1.0] and 0.88 [0.72-1.0], respectively. Combining both readings, HCRT56-68 > 3 and HCRT87-99 > 2 (C) SFU/105 cells had a sensitivity of 0.83 [0.63-0.96] (all but four patients positive) and a specificity of 1.0 [1.0-1.0] (none of the controls met criteria); while HCRT56-68 > 5 or HCRT87-99 > 1 (D) SFU/105cells had a sensitivity of 0.96 [0.88-1.0] and a specificity of 0.84 [0.70-0.96].

[000235] Figures 9A-9D show DQ0602 binding of HCRT and pHAl peptides with amino acid substitutions. Figure 9A shows peptides with amino acid substitutions at each residue position (1-9) of HCRT56-68 were tested for their ability to bind DQ0602, as determined by EBV490-503 competition. Figures 9B-9C show peptides with

phenylalanine substitutions at each residue position of (Fig. 9B) HCRT87-99 and (Fig. 9C) pHA1275-287 were tested for their ability to out-compete EBV490-503 binding to DQ0602. Figure 9D shows schematic overview of the substitutions tested in HCRT56-68, HCRT87-99, and pHA1275-287, and their effect on DQ0602 binding. The asterisk denotes peptides difficult to dissolve in assay buffer. All experiments where performed 2- 3 times in technical duplicates or triplicates.

[000236] Figures 10A-10B show possible mimics of hypocretin epitopes in pHlNl stimulate T-cells from narcoleptic patients and controls. Figure 10A shows a dose- response curve for the effect of HCRT56-68, HCRT87-99, and pHA1275-287 on CD4+ T-cell activation, as measured by IFN-γ ELISpot. IC50s is approximately ΙΟρΜ. The epitopes have high affinity for DQ0602 and are highly potent at stimulating CD4+T-cells. Data was generated using 5 narcolepsy patients. Figure 10B shows representative examples of IFN-D ELISpot results of other DQ0602 binders from pHlNl . Data are obtained using NA13-11, NA181-90, HA174-83, and PB111-20, from 5 patients and 3 controls.

[000237] Figure 11 shows in vitro stimulation of CD4+ T-cells from narcolepsy patients and controls with HCRT56-68 and HCRT87-99 epitopes. ELISpot results from in vitro cross-culture stimulations. Individual results in narcolepsy (n=12-14) and controls (n=3- 5) samples cultured with HCRT56-68 and HCRT87-99 (1 μΜ) for 13 days with IL-2 (10 IU/mL) and IL-7 (20 ng/mL) and restimulated with HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. Statistical significance was calculated using the

Wilcoxon Signed-Rank Test, *P<0.05, ***P<0.001.

[000238] Figures 12A-12B show representative ELISpot images corresponding to Fig. 3, Fig.4, and Fig. S7. Figure 12A shows ELISpot results from long-term epitope cross cultures. Cells from a total of 13-14 narcolepsy samples and 3-5 controls were cultured with either mixed HCRT56-68 plus HCRT87-99, pHA1275-287, or whole vaccine and restimulated with HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. Figure 12B shows cross-culture stimulation experiments using T2.DQ0602 presentation of HCRT56-68 plus HCRT87-99, pHA1275-287, or EBV490-503 epitopes (24 hr), isolation of CD38+ positive activated cells, and subsequent ELISpot testing for reactivity to HCRT56-68, HCRT87-99, pHA1275-287, or EBV490-503. In total 13-14 narcolepsy samples and 3-5 controls were tested. Numbers on the bottom right corner of each circle indicate SFU counts for each well.

[000239] We also performed flow cytometry staining of T cells recognizing a DQ0602- hypocretin sequence (SEQ ID NO. 1) labeled tetramer in a narcolepsy patient. In this case, the tetramer is constituted by the sequence of DQB0602, a linker with a thrombin cleavage signal, and SEQ ID NOl but could as well have included of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47. CD4 T cells cultured with HCRT 87-99 peptide and T2.0602 cells provided every 12 days for 2 cycles, and with IL-2 and IL-7 at day 6 and every 3-4 days thereafter. Cells were stained with negative control tetramer (3 on Table) and HCRT(2) tetramer (Table) at 4°C for 30 min in the dark. Then antibodies to CD4 and CD 19 were added and incubated for 15 min RT in the dark. Before flow cytometry aquistion, Propridium iodide was added to identify dead cells. Cells were then analyzed by flow cytometry: CD 19+ cells were gated out, and CD4+ cells were analyzed for staining by tetramers.

Preliminary results

[000240] Considering that hypocretin is the only known protein specifically expressed in hypocretin neurons, we sought to identify preprohypocretin epitopes that bind to DQ0602. We screened overlapping 15-mer peptides covering the entire preprohypocretin sequence for their ability to displace a known, biotin-labeled Epstein-Barr virus

(EBV490-503) DQ0602-binding epitope in vitro. Using this approach, we found several weak and 6 strong binders to DQ0602 (Table 1), including a previously reported

DQ0602-binding peptide located in the N-terminal leader peptide of pre-prohypocretin (Siebold et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101(7): 1999-2004). Interestingly, binding was strong for the C-terminal ends of the two functional, secreted peptides of pre-prohypocretin: hypocretin- 1 and hypocretin-2.

[000241] The discovery of these strong DQ0602-binding epitopes led us to speculate that among these could be long-sought autoantigens in narcolepsy. Hypocretin has been suggested as the primary antigen before (Scammell et al., supra; Tanaka et al. (2006) Sleep 29(5):633-638), but T cell reactivity towards this protein has never been found (Siebold et al. (2004) Proc. Natl. Acad. Sci. U.S.A. 101(7): 1999-2004). To test whether narcolepsy patients had CD4+ T cells reactive towards these peptides, we selected samples from 23 patients and 19 DQB0602 controls. These samples represented a broad spectrum of patients, including recent (n=9 with onset with 2 years), versus distant (n=8 within 10 years plus n=6 with onset more than 14 years ago) disease onset and onset prior (n=14) and following (n=9) the 2009 H1N1 pandemic, but did not include individuals who developed disease following Pandemrix. Samples were donated both before (n = 4) and after (n = 19) the winter of 2009, and DQ0602 controls were also controlled for time of collection (n = 9 before 2009). CD4+ T cell reactivity to the hypocretin antigens was studied using INFy or TNFa enzyme-linked immunosorbent spot (ELISPOTs). Using autologous peripheral blood mononuclear cells (PBMCs) as antigen presenting cells, some CD4+ T cell reactivity to hypocretin peptides was observed in narcolepsy subjects, DQ0602 controls and nonDQ0602 controls, precluding interpretation.

[000242] To increase specificity, we created a transfectant that would allow antigen presentation by DQ0602 only. Full length DQA1 *01 :02 and DQB1 *06:02 cDNA were expressed in an MHC class II- and HLA-DM-deficient lymphoblastic T-B fusion cell line (T2) (Salter et al. (1985) Immuno genetics 21(3):235-246; Hou, T., et al. (2011) J.

Immunol. 187(5):2442-2452). The absence of HLA-DM enhances surface peptide loading (Busch et al. (2005) Immunological Reviews 207:242-260). When T2.DQ0602 cells were used as antigen presenting cells for the DQ0602-binding peptides in ELISPOT assays, three outcomes emerged: (1) no activation ever observed (HCRTl-13 leader sequence; (2) variable activation present in both controls and patients (HCRT25-39 or HCRT113-127); (3) strong T cell reactivity in subjects with narcolepsy, while controls had no or very few cytokine producing cells (preprohypocretin HCRT53-67 or HCRT85- 99, corresponding to the homologous C-terminal end region of the two functional peptides (p < 0.001). Using shorter peptides (13-mers), we next defined the binding epitopes as HCRT56-68 or HCRT87-99. These results were extended to all patients and controls and established these epitopes as specific markers of narcolepsy. Using receiving operating characteristics curve analysis, we found that a cut off HCRT56-68 > 5 and HCRT87-99 > 1 had respective sensitivities of 0.83 [0.65-0.96] and 0.91 [0.76-1.0] and specificities of 0.95 [0.82-1.0 and 0.84-1.0].

[000243] Using the individual cut offs, all but 5 patients (78%) reacted towards either HCRT56-68 or HCRT87-99. A significant correlation was found between duration and disease and hypocretin reactivity (number of HCRT56-68 +HCRT87-99 spots, r = -0.46, p = 0.03) versus disease duration. Of the 5 narcoleptic patients who did not react to either epitopes, 3 were cases with onset more than 19 years before blood collection, indicating the autoimmune process abates in some subjects over time. In two subjects with long lasting disease (> 18 years) however, anti-hypocretin immunity was still strong, suggesting it may remain active or could be reactivated by other cross-reacting antigens in the absence of remaining hypocretin cells.

[000244] We also found narcolepsy-specific T cell reactivity to the shorter peptides HCRT56-68, HCRT86-96 or the C-terminal amidated variants, as present in the naturally processed and secreted hypocretin-1 and 2, HCRT56-66-NH2 or HCRT86-96-NH2; these could be the naturally presented versions of these epitopes. DQB0602 binding data also supported this possibility, as IC50 was similar for all these hypocretin peptide variants. Data from phenylalanine and lysine substitution scans of these hypocretin epitopes implied the alignment that was favored. In this alignment, anchor residues of the hypocretin peptides are N for PI, A for the ledge P3, A for pocket P4, 1 for P6 and L or M for P9 of DQB602. Testing additional substitutions defined a motif tolerated by DQ0602 in these positions. In these epitopes, position 1, 4 and 6 seemed the most restrictive, preferring long side chains such as N, L, M for PI; short side chains such as A, S, V for P4 and medium hydrophobic side chains such as I, L, M, V for P6, in line with reported binding motifs for DQ0602 (Ettinger et al. (1998) J. Immunol.

160(5):2365-2373; Sidney et al. (2010) Immunol. 185(7):4189-4198). In contrast, we found P9 to be uniquely promiscuous, accommodating any residue.

[000245] Specificity of TCR binding residues was also examined. HCRT56-66 or HCRT86-96 epitopes with a phenylalanine substitution at P 2, 5, 7 and 8 bind normally to DQ0602. However, these peptides reduce T cell response as measured by ELISPOT analysis in 6 narcoleptic patients, both with onset prior and following 2009. Reduction of CD4+ T cell activation was strong at P5 and P7, moderate at P8, and very mild at P2. These data imply that residues P 5, 7, and 8 influence T cell receptor recognition of the HCRT56-66 or HCRT86-96 complexes, similar to some other TCRs whose binding sites have been mapped [Holland et al. (2012) Scientific Reports 2: 629; Calis et al. (2012) PLoS Computational Biology 8(3):el002412; Wucherpfennig et al. (2005) Current Topics in Microbiology and Immunology 296: 19-37). We also tested samples from 4 monozygotic twin pairs, all of whom were discordant for disease. HCRT56-66 or HCRT86-96 reactivity was observed only in the affected twin, further supporting the disease specificity of this CD4+ T cell response. Finally, expression of TNFD was also examined and found to be as positive as with INFD indicating a primary Thl response.

[000246] The discovery of autoreactive CD4+ T cells in narcoleptic patients raised the possibility that autoantibodies are generated. Several studies have already reported the absence of autoantibodies against hypocretin in narcoleptic patients (Scammell et al., supra; Tanaka et al. (2006) Sleep 29(5):633-638). We therefore decided to test a bigger panel of possible autoantibody targets. Using multiple techniques, over 40 proteins enriched in hypocretin cells have been identified (Dalai et al. (2013) Genes &

Development 27(5):565-578; Honda et al. (2009) PLoS One 4(1): p. e4254). To test 43 of these, including preprohypocretin, proteins were translated as radiolabeled products in reticulocytes, and the presence of autoantibodies was measured in human sera using previously described protocols (Tanaka et al. (2006) Sleep 29(5):633-638). Ninety-two recent onset cases (< 3 years since onset) versus 92 controls were tested in three successive replication sets, but no consistently positive result was observed. From this we conclude that autoantibodies most likely play no or only a minor role in the etiology of narcolepsy. This is also consistent with the autoreactive CD4+ cells being of the Thl subtype.

[000247] To better understand narcolepsy in the context of vaccination, we studied 10 Irish children who developed the disease following Pandemrix in comparison to 7 unaffected siblings. Siblings selected as controls were DQ0602 positive and had also been vaccinated with Pandemrix. Notably, reactivity to the HCRT56-68 and HCRT87-99 epitopes was increased after Pandemrix, but only in cases (p < 0.005), as expected from the disease specificity of autoreactivity towards hypocretin. We also studied 7 patients and 7 DQ0602 positive controls prior and 6-9 days after a 2012 seasonal unadjuvanted influenza vaccination (containing the HA1 antigen from pandemic influenza

A/California/07/2009). Although there has been no clinical exacerbation in the narcoleptic patients post-vaccination, we observed significant increases in CD4+ T cell responses to the disease-specific HCRT56-68 and HCRT87-99 epitopes. This strongly suggests molecular mimicry and also is consistent with recent data showing that vaccination with HlNl can activate cross-reactive T cells (Su et al. (2013) Immunity 38(2):373-383).

[000248] PBMCs of 6 narcoleptic patients and 3 DQ0602 controls were stimulated with the entire HlNl split antigen vaccine and expanded for 10 days using IL-2 and IL-7. CD4+ T cells were then isolated from the stimulated culture and tested by ELISPOT for the enrichment of CD4+ cells reactive to hypocretin. Stimulation of CD4+T cells with the HlNl antigens increased the frequency of cells reactive to the disease-related hypocretin epitopes in cultures of narcolepsy subjects, but not of controls.

[000249] Based on these results, combined with the unique spike in narcolepsy cases associated with the 2009 pandemic HlNlvirus and vaccine, we hypothesized that epitope(s) from variable regions of strain-specific proteins (e.g. the hemagglutinin HA1, neuraminidase NA1, and viral RNA polymerase subunit PB1) were involved in the stimulation and expansion of HCRT -reactive cells in vivo and in vitro. We screened overlapping 15-mer peptides covering the entire HA1, NA1 and PB1 proteins present in A/California/7/2009 (HlNl) for DQ0602 binding peptides. Among 31 strong binders and 70 weak binders, 7 and 8 binders, respectively, were pHlNl specific (Table 1).

[000250] Table 1 shows peptide displacement results with overlapping peptides scanning the HA1, NA1 and PB1 flu protein and the preprohypocretin. pHAl pNAl pPBl Hcrt

Total # peptides²¹ 139 115 187 30

Strong binders 7 (5%) 3 (3%) 21 (11%) 11 (37%) Unique epitopes 5 (3.6%) 2 (1.7%) 11 (5%) 6 (20%) Unique epitopes specific to pHlNl 2 (1.4%) 0 5 (2.7%)

Weak binders 16 (12%) 16 (14%) 38 (20%) 9 (30%) Unique epitopes 5 (3.6%) 10 (8.6%) 23 (12%) 4 (13%) Unique epitopes specific to pHlNl 0 4 (3.5%) 4 (2%)

Overlapping 15-mer peptides (with 11 amino acids overlapping) covering the entire HA1, NA1 and PB1 proteins present in A/California/7/2009 (HlNl) and the entire pre-prohypocretin sequence were screened for DQ0602 binding capability in a peptide displacement assay. Peptide binding was qualified based on the ability to displace a known DQ0602-binding epitope (EBV₄₉₀. 503) in vitro. Peptides that resulted in greater than 75%> displacement of EBV₄₉₀-503 were considered to be strong binders, and those with 50-75%> displacement were considered to be weak binders. Several weak and strong binders to DQ0602 were identified in the screen, including the C-terminal ends of pre-prohypocretin: HCRT₅₆.68 and HCRT₈₇_99. For details on the peptides, see Figures and Table 2. Strong binder: < 20%>, Weak binder: < 50%> of 100%) (no competitor) using a mean of 3 independent experiments in duplicate. Unique epitopes: if two overlapping peptides were suspected to contain the same epitope, they were counted as a single epitope.

[000251] To identify possible mimics of HCRT56-68 and HCRT87-99, we undertook a bioinformatics analysis of the entire library of 101 influenza peptides binding DQ0602 to identify 9-mer epitopes with conservation of at least 2 predicted TCR binding residues at P5, P7, and P8 (see material and methods). Five candidate peptides (two from HA1, two from NA1, one from PB1) were identified (see material and methods for list) and tested in narcolepsy and control samples, after presentation by T2.DQ602. Although the five peptides gave rise to some T cell reactivity, it was very variable among subjects, whether narcolepsy and controls, with the exception of one of the strong binding HA1 epitopes that produced consistent responses in most subjects. This epitope was particularly interesting, as it is specific to pandemic 2009 H1N1 (pHA1275-287), and has homology at P5, P7 and P8 to the hypocretin epitopes. A phenylalanine substitution scan was also performed (Figure 6) and implied the alignment were favored. In this alignment, anchor residues of the pHA1275-287 peptide are N for PI, G for P3, S for P4, 1 for P6 and S for P9 of DQB602. Residues likely to interact with the TCR receptor were A for P2, a critical G for P5 and I for P7 and P8, residues not dissimilar to those of hypocretin in the same location except for P2.

[000252] Table 2 shows DQ0602 binding peptides in the pHAl , pNAl , and pPB 1 flu proteins and prepro-hypocretin.Overlapping 15-mer peptides covering the entire pHAl, pNAl and pPBl proteins present in A/California/7/2009 (pHlNl) and the entire prepro- hypocretin sequence were screened for DQ0602 binding capability in a peptide competition assay. Peptide binding was qualified based on the ability to displace a known DQ0602-binding epitope (EBV490-503) in vitro. Peptides that out-competed EBV490- 503 by >75% were considered strong binders; those with 50-75% displacement weak binders. Data are from three independent experiments performed in duplicates. Several weak and strong binders to DQ0602 were identified in the screen, including the C- terminal ends of prepro-hypocretin: HCRT56-68 and HCRT87-99. Unique epitopes: if two overlapping peptides were suspected to contain the same epitope, they were counted as a single epitope. Table 2 pHAl pNAl pPBl Hcrt

Total # peptides 139 115 187 30

Strong binders 7 (5%) 3 (3%) 21 (11%) 11 (37%)

Unique epitopes 5 (3.6%) 2 (1.7%) 11 (5%) 6 (20%)

Unique epitopes specific

2 (1.4%) 0 5 (2.7%) - to pHlNl

Weak binders 16 (12%) 16 (14%) 38 (20%) 9 (30%)

Unique epitopes 5 (3.6%) 10 (8.6%) 23 (12%) 4 (13%)

Unique epitopes specific

0 4 (3.5%) 4 (2%) - to pHlNl

[000253] Table 3 shows prepro-hypocretin peptides showing binding to DQ0602. The table shows prepro-hypocretin peptides that out-competed a reference peptide by >90% (very strong binders, SB+), 75-90%) (strong binders, SB) or 50-75%) (weak binders, WB). The two very strong binders #15 and #22 are almost identical, a Shown is a possible binding motif as predicted by the a computer software

Prepro-hypocretin

Peptide # Sequence Predicted motifa Binding

1 MNLPSTKVSWAAVTL LPSTKVSWA SB+

6 LLPPALLSSGAAAQP LLSSGAAAQ WB

7 ALLSSGAAAQPLPDCSSGAAAQPL SB

8 SGAAAQPLPDCCRQK GAAAQPLPD WB

10 PDCCRQKTCSCRLYE QKTCSCRLY WB

11 RQKTCSCRLYELLHG TCSCRLYEL SB

12 CSCRLYELLHGAGNH CRLYELLHG SB

13 LYELLHGAGNHAAGI LHGAGNHAA SB

14 LHGAGNHAAGILTLG NHAAGILTL SB

15 GNHAAGILTLGKRRS NHAAGILTL SB+

18 RRSGPPGLQGRLQRLGLQGRLQRL WB

19 PPGLQGRLQRLLQAS GRLQRLLQA WB

20 QGRLQRLLQASGNHA GRLQRLLQA WB

21 QRLLQ AS GNHAAGIL LQASGNHAA SB

22 QASGNHAAGILTMGR NHAAGILTM SB+

23 NHAAGILTMGRRAGA NHAAGILTM SB

26 AGAEPAPRPCLGRRC EPAPRPCLG WB

27 PAPRPCLGRRCSAPA PCLGRRCSA WB

28 PCLGRRCSAPAAASV RRCSAPAAA WB

29 RRCSAPAAASVAPGG PAAASVAPG SB Table 4 shows pHAl peptides showing binding to DQ0602

[000254] The table shows pHAl peptides that out-competed a reference peptide by

>75% (SB) or 50-75% (WB). a Shown is a possible binding motif as predicted.

Sequences were compared to 7 vaccine strains, the A/PR/8/34 strain, and A/Brevig mission/1/1918 (see also Table S6).

Table 5 shows pNAl peptides showing binding to DQ0602

[000255] The table shows pNAl peptides that out-competed a reference peptide by

>75% (SB) or 50-75% (WB). aShown is a possible binding motif as predicted. Sequences were compared to 7 vaccine strains, the A/PR/8/34 strain, and A/Brevig mission/1/1918.

Table 6 shows pPBl peptides showing binding to DQ0602

[000256] The table shows pPBl peptides that out-competed a reference peptide by

>75%> (SB) or 50-75%) (WB). a Shown is a possible binding motif as predicted by the www.dtu.dk/cbs server. Sequences were compared to 7 vaccine strains, the A/PR/8/34 strain, and A/Brevig mission/1/1918.

GYAQTDCVLEAMAFL QTDCVLEAM SB No

TDCVLEAMAFLEESH LEAMAFLEE SB No

LEAMAFLEESHPGIF LEAMAFLEE WB No

GIFENSCLETMEWQ NSCLETMEV WB No

NSCLETMEWQQTRV LETMEWQQ WB No

LNRNQPAATALANTI NQPAATALA SB No

VFRSNGLTANESGRL SNGLTANES WB No

ANESGRLIDFLKDVM GRLIDFLKD WB No

EEIEITTHFQRKRRV IEITTHFQR WB Yes

IGKKKQRLNKRGYLI QRLNKRGYL WB Yes

KQRLNKRGYLIRALT KRGYLIRAL WB Yes

NKRGYLIRALTLNTM IRALTLNTM SB Yes

YLIRALTLNTMTKDA IRALTLNTM SB No

IATPGMQIRGFVYFV TPGMQIRGF WB No

RGFVYFVETLARSIC YFVETLARS WB No

TLARSICEKLEQSGL SICEKLEQS WB No

QPEWFRNILSMAPIM WFRNILSMA WB Yes

FRNILSMAPIMFSNK LSMAPIMFS WB Yes

PIMFSNKMARLGKGY NKMARLGKG SB No

SNKMARLGKGYMFES NKMARLGKG SB No

ARLGKGYMFESKRMK LGKGYMFES WB Yes

KGYMFESKRMKIRTQ SKRMKIRTQ SB Yes

FESKRMKIRTQIPAE SKRMKIRTQ SB Yes

RMKIRTQIPAEMLAS QIPAEMLAS SB No

RTQIPAEMLASIDLK QIPAEMLAS SB No

TKKKIEKIRPLLIDG IEKIRPLLI WB No

IEKIRPLLIDGTASL IEKIRPLLI WB No

PGMMMGMFNMLSTVL MGMFNMLST WB No

MGMFNMLSTVLGVSI NMLSTVLGV WB No

NMLSTVLGVSILNLG LGVSILNLG WB No

AGVDRFYRTCKLVGI YRTCKLVGI WB Yes

RFYRTCKLVGINMSK YRTCKLVGI WB Yes

TFEFT SFFYRYGFVA EFTSFFYRY WB No

YRYGFVANFSMELPS ANFSMELPS WB No

GVSGVNESADMSIGV VNESADMSI SB No

VNESADMSIGVTVIK NESADMSIG SB No

ADMSIGVTVIKNNMI IGVTVIKNN SB No

IGVTVIKNNMINNDL IKNNMINND SB No

NDLGPATAQMALQLF LGPATAQMA WB No

QLFIKDYRYTYRCHR QLFIKDYRY WB No

DTQIQTRRSFELKKL DTQIQTRRS WB No 150 NLYNIRNLHIPEVCL NLHIPEVCL SB No

153 VCLKWELMDDDYRGR LKWELMDDD WB Yes

156 RGRLCNPLNPFVSHK CNPLNPFVS WB Yes

159 SHKEID S VNNAVVMP SVNNAWMP SB Yes

160 ID S VNNAVVMPAHGP VNNAWMPA SB Yes

161 NNAVVMPAHGPAKSM NNAVVMPAH WB Yes

166 ATTHSWIPKRNRSIL TTHSWIPKR WB No

167 SWIPKRNRSILNTSQ RNRSILNTS WB No

168 KRNRSILNTSQRGIL NRSILNTSQ WB No

172 DEQMYQKCCNLFEKF QKCCNLFEK WB No

173 YQKCCNLFEKFFPS S QKCCNLFEK WB No

174 CNLFEKFFPSSSYRR NLFEKFFPS WB No

177 YRRPVGISSMVEAMV ISSMVEAMV WB No

178 VGIS SMVEAMVSRAR SSMVEAMVS SB No

185 KEEFSEIMKICSTIE EEFSEIMKI SB Yes

186 SEIMKICSTIEELRR SEIMKICST WB Yes

187 KIC STIEELRRQK KICSTIEEL SB No

[000257] Of avian origin, pHA1275-287 is located at the border of the globular head of the hemagglutinin HAl molecule and not within the 4 established antigenic sites typically targeted by neutralizing antibodies (Sa, Sb, Ca, and Cb)(Sriwilaijaroen and Suzuki (2012) Proceedings of the Japan Academy Series B, Physical and Biological Sciences,.

88(6):226-249; Igarashi et al. (2010) PLoS One 5(l):e8553; Zhang et al. (2010) Protein & Cell l(5):459-467). It is immediately upstream of a glycosylation site (N285AS) found in many seasonal H1N1 viruses, but not in the 2009 and 1918 pandemic strains (Sriwilaijaroen et al, supra). Adjacent glycosylation is known to limit proteolysis, epitope generation and T cell recognition (Prigozy et al. (2001) Science 291(5504):664- 667). The sequence is also near H290, a residue shared with the 1918 pandemic strain. This residue is part of a basic patch at the base of the HAl globular domain; larger basic patches in HAl are believed to enhance virus membrane fusion and subsequent infectivity (Sriwilaijaroen et al., supra).

[000258] Comparing other HAl variant sequences in the same region, such as A/Brevig Mission/1/1918 (Pandemic 1918 strain), A/Puerto Rico/8/1934 (PR8, 1918-like H1N1 seasonal strain also used as a backbone in recent vaccines), A/Wisconsin/10/1998 (a swine reassortant that has (rarely) infected humans (Lan et al. (2011) J. Public Health Epidemiol. 3(6):254-270) and A/Brisbane/59/2007, we found that the 1998 variant bound DQ0602 well, the 1918 epitope bound moderately and the others bound poorly (Figure 3B). Interestingly, IC50 for DQ0602 binding for pHA1273-287 (or pHA1275-287), HCRT56-68 and HCRT87-99 (or HCRT56-66-NH2 or HCRT86-96-NH2) were similar in vitro (Figure 3 A). Similarly, CD4+ reactivity to these peptides presented by DQB0602 occurred at a similar range of concentrations (Figure 3C).

[000259] In contrast to hypocretin, T cell reactivity to the pHA1275-287 epitope did not distinguish patients and controls (Figure 1 A). Surprisingly, reactivity to the pHA1275- 285 epitope was similar in samples collected before versus after 2009 (26 ± 5 vs. 26 ± 9 spots respectively, independently of narcolepsy), suggesting cross reactive T cells prior to 2009 may have been selected by exposure to another influenza strain or another unrelated, but homologous pathogen epitope (Su et al. (2013) Immunity 38(2):373-383).

[000260] To test whether pHA1275-287 could be involved in increasing HCRT56-68 and HCRT87-99 reactive CD4+T cells after pHlNl vaccination, peripheral blood mononuclear cells (PBMC) of 6 patients (all with onset after 2009, including 3 post pandemrix) and 3 DQ0602 controls (all with samples collected after 2009) were stimulated with the Pandemrix vaccine bulk peptide preparation (no adjuvant, 1 μΜ), pHA1275-287 (1 μΜ), or HCRT56-68 plus HCRT87-99 (1 μΜ) and expanded with IL2 and IL7 (see methods). CD4+ T cells were isolated from the stimulated populations and tested by ELISPOT for enrichment in cells reactive to HCRT56- 68, HCRT87-99, pHA1275-287 and EBV490-503. As shown in Figure 1, panel E, after stimulation of narcolepsy T cells with Pandemrix and pHA1275-287, the proportion of both pHA1275- 287, HCRT56-68 and HCRT87-99 epitope-specific T cells increased (versus media alone), implicating H1N1 as molecular mimic that can drive the autoreactive anti- hypocretin T cell response in narcoleptic patients. In contrast, the population of

EBV490-503 responsive T cells decreased in all conditions versus media, implying that other cells expand and dilute the EBV490-503 reactive cells (see also Figure 5E).

Results following expansion with the hypocretin epitopes were variable, possibly because peptide capture by other HLA subtypes may occur.

[000261] Because the loss of hypocretin causes narcolepsy, and the hypocretin- containing neurons apparently are the only cells lost, autoreactivity to hypocretin is likely causal to the disease. However, the sequence of events leading to neuronal death remains obscure. Neurons do not express MHC class II, even in the presence of cytokines like interferon γ, that induce class II on other cell types (Liblau et al. (2013) Trends Neurosci. 36(6):315-324). To date, there is no pathological evidence for involvement of microglia in narcolepsy, nor is there genetic, pathologic or immunologic evidence for auto- aggressive CD8+T cells in this disease (Scammell et al, supra; Liblau et al, supra).

[000262] Our data also suggest that molecular mimicry to influenza HA1 is an essential trigger in cases following Pandemrix and post 2009. Prior to 2009, other influenza strains or other organisms, notably Streptococcus Pyogenes, may have served as triggers, particularly in the period from 1957 to 1977 when influenza H1N1 was practically nonexistent in humans (Gill et al. (1991) Med. J. Aust. 155(6):362-367). Based on database mining for epitopes (fludb.org), no HI strain with known human-to-human transmission prior to 2009 has the culprit pHA1275-287 sequence, although other sequences in other strains, notably in H3N2, have the potential for DQB0602 binding and TCR activation (see material and methods). Whether or not these sequences are involved requires additional investigation. One possible culprit could have been a 1918-like strain, although affinity for DQB0602 in the region homologous to the HA1 epitope is 10-100 times lower for this strain (Figure 3B).

[000263] The 1918 Spanish influenza is nonetheless interesting in the context of our finding, as this H1N1 pandemic, of avian and not swine origin, may also have triggered autoimmune complications that shared some clinical features with narcolepsy. Indeed, this devastating epidemic that killed over 50 million people worldwide was concurrent with a smaller, delayed epidemic of encephalitis lethargica, a disease of extreme somnolence or insomnia, depending on which part of the hypothalamus is affected (Von Economo, Encephalitis Lethargica. Oxford Medical Publications 1931, London:

Humphrey Milford: Oxford University Press). Cataplexy, the hallmark of narcolepsy, was only rarely reported, suggesting that cells other than hypocretin neurons were affected in the hypothalamus. The disorder was also much a more clinically polymorphic and severe disorder than narcolepsy-cataplexy, with visible lymphocyte infiltration and necrosis of various brain regions occurring, often leading to death (Von Economo, supra). Severe sequelae such as Parkinson's disease and neuropsychiatric symptoms were common (Vilensky (2007) Pediatric Neurology 37(2):79-84). This disorder may share some pathophysiological autoimmune mechanisms with narcolepsy, although its relation with the H1N1 Spanish influenza is still debated and the auto antigens likely differ (Vilensky, supra). Candidate autoimmune disorders that could have similar

pathophysiology include subtypes among the Parkinson's disease spectrum or neuropsychiatric disorders, such as schizophrenia, known to be associated with HLA, autoimmune limbic encephalitis, and pediatric autoimmune neurological diseases associated with streptococcus infections (PANDAS) (Irish Schizophrenia Genomics Consortium and the Wellcome Trust Case Control Consortium 2 (2012) Biological Psychiatry 72(8):620-628; Nails et al. (2011) Lancet 377(9766):641-649), Singer et al. (2012) J. Pediatrics 160(5):725-731).

[000264] Although our findings strongly suggest that mimicry to ρΗΙΝΙ , notably the pHA1275-287 epitope, was involved in triggering narcolepsy after 2009, the special association with Pandemrix among vaccines remains to be explained. We propose that the strong effect of the AS03 adjuvant at stimulating CD4+ T cell responses (Moris et al. (2011) J. Clin. Immunol. 31(3):443-454), together with other circumstantial factors (such as vaccine coverage, timing of the pandemic in relation to the vaccination campaign), has played a synergistic role with pHA1275-287 in some countries. Similarly, co-infections known to occur in conjunction with influenza, such as Streptococcus Pyogenes could play an additive role in some cases (Chertow and Memoli (2013) JAMA 309(3):275- 282), with streptococcal superantigens acting as "natural" adjuvants (Fraser and Proft (2008) Immunological Reviews 225:226-243).

[000265] Our current hypothesis is that narcolepsy results from a sequence of unfortunate events, with genetic effects (Hallmayer et al, supra; Mignot et al, supra; Hor et al, supra; Han et al. (2012), supra; and Faraco et al, supra), stochastic effects

(generation of na^'ive putative pathogenic TCRs in some cases), lack of adequate self- tolerance, activation by mimics and/or non-specific immune-effects (other infections, adjuvants) and finally CNS penetration of pathogenic T cells, a phenomenon that could be facilitated by events such as fever or head trauma. The lack of reactivity of controls to HCRTl-13, HCRT56-68 and HCRT87-99, but not the other hypocretin epitopes, suggests that loss of tolerance is another important factor. The identification of the cognate pathogenic T cell receptors will likely shed light on the complex interplay of genetic and environmental factors that finally result in hypocretin cell loss. This, in turn may also enhance understanding of other autoimmune diseases where HLA association is more complex, more autoantigens are involved, and the T cell response likely more polyclonal. We hypothesize that antibody responses and epitope spreading are likely limited in diseases, like narcolepsy, that selectively implicate neurons, making autoimmunity more difficult to detect.

[000266] The results presented here likely will change how narcolepsy is diagnosed and treated. New diagnostic tests involving the monitoring of CD4+T cell response to hypocretin may be developed as new standards for narcolepsy diagnosis, replacing or adding to current sleep tests or more invasive CSF hypocretin measurements. The potential of these tests to detect mild cases with partial hypocretin cell loss or very slowly progressive disease, could change our understanding of the prevalence of the disease and its most common clinical presentation. In time, monitoring of at risk individuals may be possible, with immunosuppressive therapy or selected epitope vaccinations mitigating risk or reversing disease before hypocretin cell loss is complete.

[000267] While the preferred embodiments of the invention have been illustrated and described, it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention.

Claims

Claims What is claimed is:

2. The peptide of claim 1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

3. The peptide of claim 1, wherein the peptide is amidated at the C-terminus.

4. The peptide of claim 3, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

5. A composition comprising the isolated peptide of claim 1 and a physiologically acceptable excipient.

6. The composition of claim 5, further comprising HLA DQ0602.

7. The composition of claim 6, further comprising an antigen-presenting cell carrying HLA DQ0602, wherein the peptide forms a complex with the HLA DQ0602 on the surface of the antigen-presenting cell.

8. The composition of claim 6, further comprising an artificial antigen-presenting cell (aAPC) carrying HLA DQ0602, wherein the peptide forms a complex with the HLA DQ0602 on the surface of the aAPC.

9. The composition of claim 8, wherein the aAPC comprises an engineered cell expressing DQ0602 at its cell surface, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the engineered cell.

10. The composition of claim 9, wherein the engineered cell is a T2 cell.

11. The composition of claim 9, wherein the aAPC comprises HLA DQ0602 attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

12. The composition of claim 6, comprising a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

13. The composition of claim 12, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer.

14. The composition of claim 6, further comprising a T-cell that can be activated by the complex of the peptide with HLA DQ0602.

15. A method for diagnosing narcolepsy in a subject, the method comprising:

a) obtaining a T cell from the subj ect;

b) contacting the T cell with the isolated peptide of claim 1 displayed in a complex with HLA DQ0602; and

16. The method of claim 15, wherein detecting the T cell response comprises performing an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry.

17. The method of claim 15, wherein secretion of a cytokine is detected by the ELISPOT assay.

18. The method of claim 17, wherein the cytokine is selected from the group consisting of IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β.

19. The method of claim 15, wherein the T cell is a T_H1 cell, a T_H2 cell, or a Thl7 cell.

20. The method of claim 15, wherein the peptide is selected from the group consisting of preprohypocretin, hypocretin-1, hypocretin-2, and an influenza HI peptide.

21. The method of claim 20, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-3, 26, 37-39, 43, and 45-47.

22. The method of claim 20, wherein the peptide is amidated at the C-terminus.

23. The peptide of claim 22, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

24. The method of claim 15, wherein the subject is a human being.

25. The method of claim 15, wherein the HLA DQ0602 is carried by an antigen presenting cell, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the antigen presenting cell.

26. The method of claim 15, wherein the HLA DQ0602 is carried by an artificial antigen- presenting cell (aAPC), wherein the peptide forms a complex with the HLA DQ0602 on the surface of the aAPC.

27. The method of claim 15, wherein the HLA DQ0602 is recombinant HLA DQ0602 expressed at the surface of an engineered cell, wherein the peptide forms a complex with the HLA DQ0602 at the surface of the engineered cell.

28. The method of claim 27, wherein the engineered cell is a T2 cell.

29. The method of claim 15, wherein the HLA DQ0602 is attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

30. The method of claim 15, wherein the HLA DQ0602 is a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

31. The method of claim 30, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer.

32. A method for detecting a T cell that is activated by a narcolepsy-inducing peptide, the method comprising: a) obtaining a biological sample comprising a T cell from a subject suspected of having narcolepsy;

b) contacting the biological sample with the isolated peptide of claim 1 displayed in a complex with HLA DQ0602; and

33. The method of claim 32, wherein the biological sample is blood.

34. The method of claim 32, wherein detecting the T cell response comprises performing an enzyme-linked immunosorbent spot (ELISPOT) assay, a T cell proliferation assay, or flow cytometry.

35. The method of claim 32, wherein secretion of a cytokine is detected by the ELISPOT assay.

36. The method of claim 35, wherein the cytokine is selected from the group consisting of IFN-γ, GM-CSF, TNF-a, TNF-β, IL-2, IL-3, IL-4, IL-5, IL-10, IL-17, CD40 ligand, Fas ligand, and TGF-β.

37. The method of claim 32, wherein the T cell is a T_H1 cell, a T_H2 cell, or a Thl7 cell.

38. The method of claim 32, wherein the peptide is selected from the group consisting of preprohypocretin, hypocretin-1, hypocretin-2, and an influenza HI peptide.

39. The method of claim 38, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: SEQ ID NOS: 1-4, 26, 37-39, 43, and 45-47.

40. The method of claim 38, wherein the peptide is ami dated at the C-terminus.

41. The peptide of claim 40, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

42. The method of claim 32, wherein the HLA DQ0602 is attached to the surface of an antigen presenting cell or an artificial antigen presenting cell.

43. The method of claim 32, wherein the HLA DQ0602 is attached to a solid support, wherein the peptide forms a complex with the HLA DQ0602 attached to the solid support.

44. The method of claim 32, wherein the HLA DQ0602 is a HLA DQ0602 multimer, wherein the peptide forms a complex with the HLA DQ0602 multimer.

45. The method of claim 44, wherein the multimer is a HLA DQ0602 dimer, tetramer, pentamer, octamer, or dextramer..

46. A kit for detecting a T cell that is activated by a narcolepsy -inducing antigen, the kit comprising the peptide of claim 1.

47. The kit of claim 46, wherein the peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOS: l-3, 26, 37-39, 43, and 45-47.

48. The kit of claim 46, wherein the peptide is amidated at the C-terminus.

49. The peptide of claim 48, wherein the peptide consists of the amino acid sequence of SEQ ID NO:46 or SEQ ID NO:47.

50. The kit of claim 46, further comprising HLA DQ0602.

51. The kit of claim 50, comprising HLA DQ0602 attached to a solid support.

52. The kit of claim 50, comprising a HLA DQ0602 multimer.

53. The kit of claim 46, further comprising an antigen presenting cell.

54. The kit of claim 46, further comprising an artificial antigen presenting cell.

55. The kit of claim 46, further comprising one or more control reference samples.

56. The kit of claim 46, further comprising information, in electronic or paper form, comprising instructions for diagnosing narcolepsy in a subject.

57. The kit of claim 46, further comprising reagents for detecting a T cell response.

58. The kit of claim 57, comprising reagents for performing an ELISPOT assay, a T cell proliferation assay, or flow cytometry.

59. An isolated antibody that specifically binds to the peptide of claim 1.

60. The antibody of claim 59, wherein the antibody specifically binds to the peptide when it is displayed in a complex with HLA DQ0602.

61. The antibody of claim 60, wherein the HLA DQ0602 is attached to the surface of an antigen presenting cell or an artificial antigen presenting cell.

62. The antibody of claim 60, wherein a T cell receptor on the surface of a T cell is bound to the peptide.

63. The antibody of claim 59, wherein the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an F_v fragment, and an scF_v fragment.

64. The antibody of claim 63, wherein the antibody is a humanized antibody.

65. The antibody of claim 59, wherein the antibody specifically binds to a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOS:l-3, 26, 37-39, 43, and 45-47.

66. The antibody of claim 59, further comprising a detectable label.

67. A polynucleotide encoding the peptide of claim 2.

68. A recombinant polynucleotide comprising the polynucleotide of claim 67 operably linked to a promoter.

69. A host cell comprising the recombinant polynucleotide of claim 68.

70. The host cell of claim 69, wherein the host cell secretes the peptide encoded by the recombinant polynucleotide.

71. The host cell of claim 69, further comprising HLA DQ0602 at the surface of the cell, wherein the peptide expressed by the recombinant polynucleotide forms a complex with the HLA DQ0602.

72. The host cell of claim 71, wherein the host cell is a T2 cell.

a) culturing the host cell of claim 69 under conditions suitable for the expression of the peptide; and

b) recovering the peptide from the host cell culture.

b) contacting the biological sample with the host cell of claim 71, wherein the narcolepsy- inducing peptide is displayed in a complex with HLA DQ0602; and

75. An isolated T cell receptor or a fragment thereof that specifically binds to a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37-39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602.

76. An isolated antibody that specifically binds to the T cell receptor of claim 75.

77. The antibody of claim 76, wherein the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a recombinant fragment of an antibody, an Fab fragment, an Fab' fragment, an F(ab')2 fragment, an Fv fragment, and an scFv fragment.

78. The antibody of claim 77, wherein the antibody is a humanized antibody.

79. A method of treating a subject for narcolepsy with the antibody of claim 76, the method comprising administering to the subject a therapeutically effective amount of the antibody, such that the antibody blocks binding of T cell receptors to narcolepsy -inducing peptides displayed in a complexes with HLA DQ0602 on the surfaces of antigen presenting cells in the subject.

80. The method of claim 79, wherein the antibody is administered prophylactically.

81. The method of claim 79, wherein the antibody is a humanized antibody.

82. The method of claim 79, further comprising treating the subject with one or more narcolepsy drugs.

83. The method of claim 82, wherein one or more narcolepsy drugs are selected from the group consisting of methylphenidate, amphetamine, methamphetamine, modafinil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate.

84. A method of inhibiting a T cell immune response to hypocretin, the method comprising: a) obtaining a biological sample comprising a T cell that is normally activated by a peptide consisting of a sequence selected from the group consisting of SEQ ID NOS: l-4, 26, 37- 39, 43, and 45-47 when the peptide is displayed in a complex with HLA DQ0602 on the surface of an antigen presenting cell; and

b) contacting the biological sample with the antibody of claim 76, such that the antibody binds to a T cell receptor on the surface of the T cell and blocks an antigen binding site of the T cell receptor, whereby the T cell is no longer activated by the peptide.

85. A method of treating a subject for narcolepsy, the method comprising administering to the subject a therapeutically effective amount of an antibody that specifically binds to HLA DQ0602.

86. The method of claim 85, wherein the antibody is administered prophylactically.

87. The method of claim 85, wherein the antibody is a humanized antibody.

88. The method of claim 85, further comprising treating the subject with one or more narcolepsy drugs.

89. The method of claim 88, wherein one or more narcolepsy drugs are selected from the group consisting of methylphenidate, amphetamine, methamphetamine, modafinil, armodafinil, codeine, selegiline, atomoxetine, a non-stimulant and norepinephrine/serotonin reuptake inhibitor (SSRI, NRI, SNRI), clomipramine, imipramine, protriptyline, venlafaxine, and sodium oxybate.

a) obtaining a biological sample comprising a T cell from the subject;

b) and treating the subject with an immunosuppressive agent if the T cell is activated by the narcolepsy inducing peptide of claim 1.

91. The method of claim 90, wherein the biological sample is blood.

92. An assay for diagnosing narcolepsy comprising the steps of

93. The assay of claim 92, wherein the cytokine is selected from interferon gamma, interleukin-2, interleukin-17 and tumor necrosis factor alpha.

94. The assay of claim 92, wherein the detecting is performed using an ELISPOT assay.

95. The assay of claim 92 further comprising a step of administering to the subject a Type I narcoplepsy treatment when cytokine expression is detected.

96. An assay for screening for increased or decreased risk of developing addiction to a stimulant drug comprising

a. contacting a white blood cell obtained from a subject with an artificial antigen presentin cell, wherein the artificial antigen presenting cell is deficient for all HLAs and further engineered to express human leucocyte antigen DQ0602; b. detecting cytokine expression of the white blood cells, wherein detection of cytokine expression indicates that the subject is at low risk of developing addiction to the stimulant and absence of detection of cytokine expression indicates that the subject is at high risk of developing addiction to the stimulant.

97. The assay of claim 96, wherein the stimulant is selected from modafinil, methylphenidate and amphetamine, either as racemic mixtures or as pure isomers, with and without modifications for improved pharmacokinetics.

98. The assay of claim 96, wherein the cytokine is selected from interferon gamma, interleukin-2, interleukin-17 and tumor necrosis factor alpha.

99. The assay of claim 96, wherein the detecting is performed using an ELISPOT assay.